ES2383990T3 - FEN endonucleases - Google Patents

Abstract

A composition comprising a purified FEN-1 endonuclease from Archaeaglobus veneficus, wherein said FEN-1 endonuclease comprises an amino acid sequence comprising SEQ ID No. 370.

Description

Fen endonucleases

Field of the Invention

The present invention is defined in the claims and provides new cleavage agents and polymerases for the cleavage and modification of nucleic acid. The cleavage agents and polymerases find utility for, for example, the detection and characterization of nucleic acid sequences and variations in the sequences of

nucleic acid. In some embodiments, the 5 ’nuclease activity of several enzymes is used to cleave a

target-dependent cleavage structure, so that it indicates the presence of specific nucleic acid sequences or specific variations thereof.

Background of the invention

The detection and characterization of specific nucleic acid sequences and variations of the sequences have been used to detect the presence of viral or bacterial nucleic acid sequences indicative of an infection, to detect the presence of variants or alleles of genes associated with disease and cancers These procedures also find application in the identification of nucleic acid sources, such as for forensic analysis or for paternity determinations.

Various methods are known in the art that can be used to detect and characterize specific nucleic acid sequences and sequence variants. However, with the completion of nucleic acid sequencing of the human genome, as well as the genomes of numerous pathogenic organisms, the demand for rapid, reliable, economical and user-friendly assays for the detection of specific nucleic acid sequences continues growing. Even more important, these assays have to be able to create a detectable signal from samples that contain very few copies of the sequence of interest. The following discussion examines two levels of nucleic acid detection assays that are currently used: I. Signal Amplification Technology for detection of rare sequences; and II. Direct Detection Technology for quantitative sequence detection.

I. Signal Amplification Technology Procedures for Amplification

The "Polymerase Chain Reaction" (PCR) comprises the first generation of procedures for the

nucleic acid amplification. However, several different procedures have been developed that employ the same basis of specificity, but that create a signal through different amplification mechanisms. These procedures include the  "Reaction  in Ligase Chain (CSF), "Self-Maintained Synthetic Reaction" (3SR / NASBA) and "Replicase Q" (Q).

Polymerase chain reaction (PCR)

The polymerase chain reaction (PCR), as described in US Pat. No. 4,683,195.

4,683,202. and 4,965,188 of Mullis and Mullis et al. describes a procedure to increase the concentration of a segment of target sequence in a mixture of genomic DNA without cloning or purification. This technology provides an approach to the problems of a low concentration of target sequence. PCR can be used to directly increase the concentration of the target to an easily detectable level. This procedure for amplifying the target sequence involves introducing a molar excess of the two oligonucleotide primers that are complementary to their respective strands of the double helix target sequence to the DNA mixture containing the desired target sequence. The mixture is denatured and then allowed to hybridize. After hybridization, the primers are extended with polymerase to form complementary chains. The stages of denaturation, hybridization and extension by polymerase can be repeated as often as necessary, to obtain relatively high concentrations of a segment of the desired target sequence.

The segment length of the desired target sequence is determined by the relative positions of the primers with each other and, therefore, this length is a controllable parameter. Because the desired segments of the target sequence become the dominant sequences (in terms of concentration) in the mixture,

He says they are "amplified by PCR."

Ligase Chain Reaction (CSF or LAR)

The ligase chain reaction (CSF; sometimes referred to as the "Ligase Amplification Reaction" (LAR) described by Barany, Proc. Natl. Acad. Sci., 88: 189 (1991); Barany, PCR Methods and Applic ., 1: 5 (1991); and Wu and Wallace, Genomics 4: 560 (1989) have developed until a well-recognized alternative method for amplifying nucleic acids.In the CSF, four oligonucleotides are mixed, two adjacent oligonucleotides that hybridize unique with a strand of target DNA and a complementary set of adjacent oligonucleotides, which hybridize with the opposite strand and DNA ligase is added to the mixture, provided that there is complete complementarity in the binding, the ligase will covalently bind each set of hybridized molecules.

which is even more important, in the CSF two probes are linked together only when they have base pairing with sequences in the target sample, without gaps or mismatches. Repeated cycles of denaturation, hybridization and ligation amplify a short segment of DNA. The CSF has also been used in combination with PCR to achieve enhanced detection of single base changes. Segev, PCT Public. No. W09001069 A1 (1990). However, because the four oligonucleotides used in this assay can be paired to form two short fragments that can be ligated, there is the potential for generating a target-independent background signal. The use of CSF for mutant selection is limited to the analysis of specific nucleic acid positions.

Synthetic Self-Maintained Reaction (3SR / NASBA)

The self-maintained sequence replication reaction (3SR) (Guatelli et al., Proc. Natl. Acad. Sci., 87: 1874-1878, [1990], with a typo in Proc. Natl. Acad. Sci., 87: 7797 [1990]) is a transcription-based in vitro amplification system (Kwok et al., Proc. Natl. Acad. Sci., 86: 1173-11177 [1989]) that can exponentially amplify RNA sequences to a uniform temperature The amplified RNA can then be used for detection of mutations (Fahy et al. PCR Meth. Appl., 1: 25-33 [1991]). In this procedure a primer is used

oligonucleotide to add a phage RNA polymerase promoter to the 5 ′ end of the sequence of interest. In

a combination of enzymes and substrates that includes a second primer, reverse transcriptase, RNAse H, RNA polymerase and ribo- and deoxyribonucleoside triphosphate, the target sequence undergoes repeated rounds of transcription, cDNA synthesis, second strand synthesis to amplify the area of interest. The use of 3SR to detect mutations is kinetically limited to scanning small segments of DNA (for example, 200-300 base pairs).

Replicase Q-Beta (QQ )

In this procedure, a probe that recognizes the sequence of interest binds to the replicable RNA template for replicase Q . A major problem that has been previously identified with false positives that are produced by the replication of non-hybridized probes has been addressed through the use of a sequence specific ligation stage. However, the available thermostable DNA ligases are not effective on this RNA substrate, so that ligation must be performed by T4 DNA ligase at low temperatures (37 ° C). This avoids the use of high temperature as a means to achieve specificity as in the CSF, the ligation event can be used to detect a mutation at the binding site, but not elsewhere.

The following table 1 lists some of the desirable characteristics for systems useful in sensitive nucleic acid diagnostics and summarizes the capabilities of each of the main amplification procedures (see also Landgren, Trends in Genetics 9: 199 [1993]).

A successful diagnostic procedure has to be very specific. A simple procedure to control the specificity of nucleic acid hybridization is by controlling the reaction temperature. Although the 3SR / NASBA and the Qß systems are all capable of generating a large amount of signal, one or more of the enzymes involved in each cannot be used at high temperature (i.e.,> 55 ° C). Therefore, reaction temperatures cannot be increased to avoid non-specific hybridization of the probes. If the probes are shortened to make them melt more easily at low temperatures, the likelihood of having more than perfect pairing in a complex genome increases. For these reasons, PCR and LCR currently dominate the field of research in detection technologies.

TABLE 1

Characteristic

Process

PCR

CSF PCR and CSF 3SR NASBA QQ

Amplify the target

+ + + +

Recognition is independent sequences required

+ + + + +

Made at high temperature

+ +

It works at a fixed temperature

+ +

Exponential amplification

+ + + + +

Generic signal generation

+

Characteristic

Process

PCR

CSF PCR and CSF 3SR NASBA QQ

Easily automatable

The basis of the PCR and LCR amplification procedure is the fact that the products of one cycle become molds that can be used in all subsequent cycles, thereby doubling the population with each cycle. The final performance of any such duplication system can be expressed as: (1 + X) n = y, where "X" is the average efficiency (percentage copied in each cycle), "n" is the number of cycles e " and "is the overall efficacy or reaction yield (Mullis, PCR Methods Applic., 1: 1 [1991]). If each copy of a target DNA is used as a template in each cycle of a polymerase chain reaction, the average efficiency is 100%. If 20 cycles of PCR are performed, then the yield will be 220 or 1,048,576 copies of the starting material. If the reaction conditions reduce the average efficiency to 85%, then the yield in those 20 cycles will be only 1.8520 or 220.513 copies of the starting material. In other words, a PCR that is processed at 85% efficiency will only produce up to 21% of the final product compared to a reaction that is processed at 100% efficiency. A reaction that is reduced to 50% average efficiency will produce less than 1% of the possible product.

In practice, routine polymerase chain reactions rarely achieve the maximum theoretical yield and the PCRs have usually been processed for more than 20 cycles to compensate for the lower yield. At 50% average efficiency, 34 cycles would be needed to achieve the theoretical one million times amplification possible in 20 and, at lower efficiencies, the number of cycles required becomes prohibitive. In addition, any background product that is amplified with a better average efficiency than the intended target will become the dominant products.

In addition, many variables can influence the average efficiency of the PCR, including the length and secondary structure of the target DNA, the length and design of the primer, the concentrations of primer and dNTP and the composition of the buffer, to name a few. The contamination of the reaction with exogenous DNA (for example, DNA spilled on laboratory surfaces) or cross contamination is also a major consideration. The reaction conditions have to be carefully optimized for each different primer pair and target sequence and the procedure may take days, even for an experienced researcher. The industriousness of this procedure, including numerous technical considerations and other factors, presents a significant disadvantage for using PCR in the clinical setting. In fact, PCR has yet to penetrate the clinical market in a meaningful way. The same aspects are presented with CSF, since CSF must also be optimized to use different oligonucleotide sequences for each target sequence. In addition, both procedures require expensive equipment, capable of precise temperature cycling.

Many applications of nucleic acid detection technologies, such as in allelic variation studies, not only involve the detection of a specific sequence in a complex background, but also discrimination between sequences with few, or only, nucleotide differences. A procedure for the detection of specific allele variants by PCR is based on the fact that it is difficult for Taq polymerase to synthesize a strand of DNA when there is a mismatch between the template chain and the 3 ′ end of the primer. A specific variant of allele can be detected by using a primer that is perfectly paired with only one of the possible alleles; the wrong pairing with the other allele acts avoiding the extension of the primer, thus avoiding the amplification of that sequence. This procedure has a substantial limitation because the base composition of the mismatch influences the ability to avoid extension along the mismatch and certain mismatches do not prevent extension or have only a minimal effect (Kwok et al., Nucl. Acids Res., 18: 999 [1990]).)

A similar mismatch 3 ’strategy is used with greater effect to prevent ligation in the CSF (Barany, PCR Meth. Applic., 1: 5 [1991]). Any mismatch effectively blocks the action of the thermostable ligase, but the CSF still has the disadvantage that target independent background ligation products initiate amplification. In addition, the combination of PCR with posterior CSF to identify nucleotides in individual positions is also a clearly uncomfortable proposition for the clinical laboratory.

II. Direct Detection Technology

When a sufficient amount of a nucleic acid to be detected is available, there are advantages in detecting that sequence directly, rather than preparing more copies of that target (for example, as in PCR and CSF). More particularly, a procedure that does not amplify the signal exponentially is more susceptible to quantitative analysis. Even if the signal is improved by binding multiple dyes to a single oligonucleotide, the correlation between the final signal intensity and the amount of target is direct. Such a system has an additional advantage that reaction products will not in themselves favor subsequent reaction, so that contamination of laboratory surfaces by products is not so much a problem. Traditional direct detection procedures, including Northern and Southern blotting and RNase protection assays, usually require the use of radioactivity and are not susceptible to automation. With the recently conceived techniques it has been tried to eliminate the use of radioactivity and / or improve the sensitivity in formats

automatable two examples the "Cycling Probe Reaction" (CPR) and "Branched DNA" (rDNA).

The cycling probe reaction (CPR) (Duck et al., Biotech., 9: 142 [1990]) uses a long chimeric oligonucleotide in which a central part is made of RNA while the two ends are made of DNA. Hybridization of the probe with a target DNA and exposure to ENASA H thermostable causes the RNA part to be digested. This destabilizes the remaining DNA parts of the duplex, releasing the rest of the target DNA probe and allowing another probe molecule to repeat the procedure. The signal, in the form of cleaved probe molecules, accumulates at a linear rate. Although the repetitive procedure increases the signal, the RNA part of the oligonucleotide is vulnerable to RNases that can be transported by the sample preparation.

Branched DNA (rDNA), described by Urdea et al., Gene 61: 253-264 (1987), involves oligonucleotides with branched structures that allow each individual oligonucleotide to carry 35 to 40 markers (for example alkaline phosphatase enzymes). Although this improves the signal of a hybridization event, the non-specific binding signal increases similarly.

Although these two procedures have the advantages of direct detection that have been discussed above, neither the CPR nor rDNA procedures can make use of the specificity allowed by the requirement of independent recognition by two or more probe sequences (oligonucleotides), as is common in the signal amplification procedures described above in section I. The requirement that two oligonucleotides have to hybridize with a target nucleic acid to generate a detectable signal confers an additional measure of rigor to any detection assay. . The requirement that two oligonucleotides bind to a target nucleic acid decreases the likelihood of results of

false "positives" due to the non-specific binding of a probe to the target. The additional requirement that the two

oligonucleotides must be bound in a specific orientation in relation to the target, as required in the PCR, where the oligonucleotides have to be oriented in an opposite but appropriate manner so that the DNA polymerase can overcome the gap between the two oligonucleotides in both directions, further improves the specificity of the detection reaction. However, those skilled in the art know well

that even though the PCR uses two oligonucleotide probes (called primers), "non-specific" amplification (ie, sequence amplification not directed by the two primers used) is a common artifact. This is partly because the DNA polymerase used in PCR can accommodate very large distances, measured in nucleotides, between oligonucleotides and, therefore, there is a large window in which non-specific binding of an oligonucleotide can lead to exponential amplification of inappropriate product. On the contrary, the PCR cannot advance unless the oligonucleotides used bind to the target adjacent to each other and thus the full benefit of double oligonucleotide hybridization is realized.

An ideal direct detection procedure would combine the advantages of direct detection assays (eg, simple quantification and minimal risk of contamination by handover) with the specificity provided by a double oligonucleotide hybridization assay.

Summary of the invention

The present invention is defined in the claims and provides new cleavage agents and polymerases for the cleavage and modification of nucleic acid. The cleavage agent and polymerases find utility for, for example, the detection and characterization of nucleic acid sequences and variations in nucleic acid sequences. In some embodiments, the 5 ′ nuclease activity of several enzymes is used to cleave a target-dependent cleavage structure, so that it indicates the presence of specific nucleic acid sequences or specific variations thereof. The present invention contemplates the use of new detection procedures for various uses, including, but not limited to, clinical diagnostic purposes.

The invention provides a composition comprising a purified FEN-1 endonuclease from Archaeaglobus veneficus, wherein said FEN-1 endonuclease comprises an amino acid sequence comprising SEQ ID No. 370.

The invention further provides a composition comprising an isolated nucleic acid, wherein said nucleic acid encodes the endonuclease of claim 1, wherein said isolated nucleic acid comprises SEQ ID NO: 369.

The invention further provides a method of detecting a target sequence, comprising:

a) provide:

i) a cleavage structure comprising a Diana sequence and oligonucleotides capable of forming an invasive cleavage structure in the presence of said target sequence; Y

ii) a purified FEN-1 endonuclease from Archaeaglobus veneficus, wherein said FEN-1 endonuclease comprises an amino acid sequence comprising SEQ ID NO: 370; Y

b) exposing said cleavage structure to said FEN-1 endonuclease; Y

c) detecting the cleavage of said cleavage structure.

The present invention provides a method of detecting a target sequence (eg, a mutation, polymorphism etc.), comprising a sample suspected of containing the target sequence; oligonucleotides capable of forming an invasive cleavage structure in the presence of the target sequence; and an agent to detect the presence of an invasive excision structure; and expose the sample to the oligonucleotides and the agent. In some embodiments, the method further comprises the step of detecting a complex comprising the agent and the invasive cleavage structure (directly or indirectly). In some embodiments, the agent comprises a cleavage agent. In some preferred embodiments, the exposure of the sample to the oligonucleotides and the agent comprises exposing the sample to the oligonucleotides and the agent under conditions in which an invasive cleavage structure is formed between the target sequence and the oligonucleotides if the target sequence is present. in the sample, in which the invasive cleavage structure is cleaved by the cleavage agent to form a cleavage product. In some embodiments, the method further comprises the step of detecting the cleavage product. In some embodiments, the target sequence comprises a first region and a second region, the second region downstream and contiguous to the first region, and wherein the oligonucleotides comprise the first and second oligonucleotides, in which at least a portion of the first oligonucleotide is completely complementary to the first portion of the target sequence and in which the second

oligonucleotide comprises a 3 'portion and a 5' portion, in which the 5 'portion is completely

complementary to the second portion of said target nucleic acid.

The present invention also provides a kit for detecting said target sequences, said kit comprising oligonucleotides capable of forming an invasive cleavage structure in the presence of the target sequence, as defined in the claims.

Specifically, the invention provides a nucleic acid treatment kit, comprising:

a) a composition comprising a purified FEN-1 endonuclease from Archaeaglobus veneficus, wherein said FEN-1 endonuclease comprises an amino acid sequence comprising SEQ ID NO: 370; Y

b) oligonucleotides capable of forming an invasive cleavage structure in the presence of a target nucleic acid.

The present invention also provides methods for detecting the presence of a target nucleic acid molecule by detecting non-target cleavage products, which comprises providing: A cleavage agent, a source of target nucleic acid, the target nucleic acid comprising a first region and a second region, the second region downstream and contiguous to the first region; a first oligonucleotide, in which at least a portion of the first oligonucleotide is completely complementary to the first portion of the target nucleic acid; Y

a second oligonucleotide comprising a 3 ’portion and a 5’ portion, in which the 5 ’portion is

completely complementary to the second portion of the target nucleic acid; mixing the cleavage agent, the target nucleic acid, the first oligonucleotide and the second oligonucleotide to create a reaction mixture under reaction conditions such that at least the portion of the first oligonucleotide hybridizes with the first region of

said target nucleic acid and wherein at least the 5 ’portion of the second oligonucleotide hybridizes with the second

region of the target nucleic acid to create a cleavage structure, and in which cleavage of the cleavage structure occurs to generate a non-target cleavage product; and detect the cleavage of the cleavage structure.

The detection of the cleavage of the cleavage structure can be carried out in any way. In some embodiments, the detection of cleavage of the cleavage structure comprises detecting the non-target cleavage product. In yet other embodiments, the detection of the cleavage of the cleavage structure comprises the detection of fluorescence, mass or transfer of fluorescence energy. Other detection procedures include, among others, detection of radioactivity, luminescence, phosphorescence, fluorescence polarization and charge. In some embodiments, detection is carried out by a method comprising providing the non-target cleavage product; a composition comprising two hybridized single stranded nucleic acids so that they define a single stranded portion of a protein binding region; and a protein; and exposing the non-target cleavage product to the single stranded portion of the protein binding region under conditions such that the protein binds to the protein binding region. In some embodiments, the protein comprises a nucleic acid producing protein, in which nucleic acid producing protein binds to the protein binding region and produces nucleic acid. In some embodiments, the protein binding region is a template-dependent RNA polymerase binding region (eg, the T7 RNA polymerase binding region). In other embodiments, the detection is carried out by a method that comprises providing the non-target cleavage product, a single contiguous strand of nucleic acid comprising a sequence defining a single strand of an RNA polymerase binding region; a mold dependent DNA polymerase; and a mold dependent RNA polymerase; exposing the non-target cleavage product to the RNA polymerase binding region under conditions such that the non-target cleavage product binds to a portion of the single strand of the RNA polymerase binding region to produce a non-target cleavage product United; exposing the non-target cleavage product bound to the template-dependent DNA polymerase under conditions such that a double-stranded RNA polymerase binding region is produced; and exposing the double-stranded RNA polymerase binding region to template-dependent RNA polymerase under conditions such that RNA transcripts occur. In some embodiments, the method further comprises the step of detecting RNA transcripts. In some embodiments, the template-dependent RNA polymerase is T7 RNA polymerase.

The present invention is not limited by the 3 ′ portion of the second oligonucleotide. In some preferred embodiments, the 3 ′ portion of this second oligonucleotide comprises a 3 ′ terminal nucleotide not complementary to the target nucleic acid. In some preferred embodiments, the 3 'portion of this second oligonucleotide consists of a single nucleotide not complementary to the target nucleic acid.

Any of the process components may be fixed to a solid support. For example, in some embodiments, the first oligonucleotide is fixed to a solid support. In other embodiments, the second oligonucleotide is fixed to a solid support.

The cleavage agent may be an agent that is capable of cleaving invasive cleavage structures as redefined in the claims. In some preferred embodiments, the cleavage agent comprises a structure-specific nuclease. In particularly preferred embodiments, the structure-specific nuclease comprises a specific nuclease of thermostable structure (eg, a 5 ’thermostable nuclease). Specific thermostable structure nucleases include, among others, those that have an amino acid sequence homologous to a portion of the amino acid sequence of a thermostable DNA polymerase derived from a thermophilic organism (e.g., Thermus aquaticus, Thermus flavus and Thermus thermophilus)

The process is not limited by the nature of the target nucleic acid. In some embodiments, the target nucleic acid is single stranded or double stranded DNA or RNA. In some embodiments, the double stranded nucleic acid is converted to single stranded (eg, by heat) before the formation of the cleavage structure. In some embodiment, the source of the target nucleic acid comprises a sample containing genomic DNA. Samples include, among others, blood, saliva, cerebrospinal fluid, pleural fluid, milk, lymph, sputum and semen.

In some embodiments, the reaction conditions for the process comprise providing a source of divalent cations. In some preferred embodiments, the divalent cation is selected from the group comprising Mn2 + and Mg2 + ions. In some embodiments, the reaction conditions for the process comprise providing the first and second oligonucleotides in excess concentration compared to the target nucleic acid.

In some embodiments, the method further comprises providing a third oligonucleotide complementary to a third portion of said target nucleic acid upstream of the first portion of the target nucleic acid, wherein the third oligonucleotide is mixed with the reaction mixture.

The invention provides a method of detecting a target sequence, comprising:

a) provide:

i) a cleavage structure comprising a Diana sequence and oligonucleotides capable of forming an invasive cleavage structure in the presence of said target sequence; Y

ii) a purified FEN-1 endonuclease from Archaeaglobus veneficus, wherein said FEN-1 endonuclease comprises an amino acid sequence comprising SEQ ID NO: 370; Y

b) exposing said cleavage structure to said FEN-1 endonuclease; Y

c) detecting the cleavage of said cleavage structure.

The present invention also relates to a method for detecting the presence of a target nucleic acid molecule by detecting non-target cleavage products, which comprises providing: A cleavage agent, a source of target nucleic acid, the target nucleic acid comprising a first region and a second region, the second region downstream and adjacent to the first region; a plurality of first oligonucleotides, in which at least a portion of the first oligonucleotide is completely complementary to the first portion of the acid

target nucleic; and a second oligonucleotide comprising a 3 'portion and a 5' portion, wherein said 5 'portion is completely complementary to the second portion of the target nucleic acid; the plurality of the first oligonucleotides and the second oligonucleotide to create a reaction mixture under reaction conditions such that at least the portion of the first oligonucleotide hybridizes with the first region of the target nucleic acid and in which at

minus the 5 ’portion of the second oligonucleotide hybridized with the second region of the target nucleic acid to create

a cleavage structure, and in which the cleavage of the cleavage structure occurs to generate a non-target cleavage product; wherein the conditions allow multiple cleavage structures to form and cleave the target nucleic acid and detect the cleavage of said cleavage structures. In some embodiments, the conditions comprise isothermal conditions that allow the plurality of said first oligonucleotides to dissociate from the target nucleic acid. Although the present invention is limited by the number of cleavage structures formed in a particular target nucleic acid, in some preferred embodiments, two or more (3, 4, 5, ..., 10, ..., 10000, .. .) of the plurality of the first oligonucleotides form cleavage structures with a Diana nucleic acid, in which the cleavage structures are cleaved to produce non-target cleavage products.

The present invention also relates to methods in which a cleavage product of the foregoing procedures is used in another region of invasive excision. For example, the present invention provides a method comprising providing a cleavage agent; a first target nucleic acid, in which the first nucleic acid comprises a first region and a second region, the second region downstream and contiguous to the first region; a first oligonucleotide, in which at least a portion of the first oligonucleotide is completely complementary to the first portion of the first target nucleic acid; a second oligonucleotide comprising a 3 'portion and a 5' portion, wherein the 5 'portion is completely complementary to the second portion of the first target nucleic acid; a second target nucleic acid, wherein said second target nucleic acid comprises a first region and a second region, the second region downstream and contiguous to the first region; and a third oligonucleotide, in which at least a portion of the third oligonucleotide is completely complementary to the first portion of the second target nucleic acid; generating a first cleavage structure in which at least said portion of the first oligonucleotide hybridizes with the first region

of the first target nucleic acid and in which at least the 5 ’portion of the second oligonucleotide hybridizes to the

second region of the first target nucleic acid and in which the cleavage of the first cleavage structure is produced by the cleavage agent, thereby cleaving the first oligonucleotide to generate a fourth oligonucleotide, wherein said fourth oligonucleotide comprises a portion 3 'and a 5' portion, wherein the 5 'portion is completely complementary to the second portion of the second target nucleic acid; generating

a second cleavage structure under conditions in which at least said portion of the third oligonucleotide hybridizes to the first region of the second target nucleic acid and in which at least the 5 'portion of the fourth oligonucleotide hybridizes to the second region of the second acid target nucleic and in which the cleavage of the second cleavage structure occurs to generate a fragment of cleavage; and detect the cleavage of the

Second split structure. In some preferred embodiments, the 3 ′ portion of the fourth oligonucleotide comprises a 3 ′ terminal nucleotide not complementary to the second target nucleic acid. In some embodiments, the 3 ′ portion of the third oligonucleotide is covalently linked to the second target nucleic acid. In some embodiments, the second target nucleic acid further comprises a 5 ’region, in which the 5’ region of the

Second target nucleic acid is the third oligonucleotide. The present invention also provides kits that

comprise: a cleavage agent; a first oligonucleotide comprising a 5 ′ portion complementary to a first region of a target nucleic acid; and a second oligonucleotide comprising a 3 ′ portion and a 5 ′ portion, said 5 ’portion complementary to a second region of the target nucleic acid downstream and contiguous to the first portion. In some embodiments, the 3 ′ portion of the second oligonucleotide comprises a 3 ′ terminal nucleotide not complementary to the target nucleic acid. In some preferred embodiments, the 3 ’portion of the

Second oligonucleotide consists of a single nucleotide not complementary to the target nucleic acid. In some embodiments, the kit further comprises a solid support. For example, in some embodiments, the first and / or second oligonucleotide is fixed to a solid support. In some embodiments, the kit further comprises a buffer solution. In some preferred embodiments, the buffer solution comprises a source of divalent cations (eg, Mn2 + and / or Mg2 +). In some specific embodiments, the kit further comprises a third oligonucleotide complementary to a third portion of said target nucleic acid upstream of the first portion of the first target nucleic acid. In yet other embodiments, the kit further comprises a target nucleic acid. In some embodiments, the kit comprises a second target nucleic acid. In yet other embodiments, the kit further comprises a third oligonucleotide comprising a 5 ′ portion complementary to a first region of the second target nucleic acid. In some specific embodiments, the 3rd portion of the third

oligonucleotide is covalently bound to the second target nucleic acid. In another specific embodiment, the

second target nucleic acid further comprises a 5 ’portion, in which the 5’ portion of the second nucleic acid

Target is the third oligonucleotide. In yet other embodiments, the kit further comprises an ARRESTOR molecule

(e.g., an ARRESTOR oligonucleotide).

The present invention further relates to a composition comprising a cleavage structure, in which the cleavage structure comprises: a) a target nucleic acid, in which the Diana nucleic acid has a first region, a second region, a third region and a fourth region, in which the first region is located adjacent and chain down from the second region, the second region is located adjacent and chain down from the third region and the third region is located adjacent and chain down to the fourth region ; b) a first oligonucleotide complementary to the fourth region of the target nucleic acid; c) a second oligonucleotide that has

a 5 ’portion and a 3’ portion in which the 5 ’portion of the Second oligonucleotide contains a sequence complementary to the second region of the Diana nucleic acid and in which the 3’ portion of the Second oligonucleotide

it contains a sequence complementary to the third region of the Diana nucleic acid; and (d) a third oligonucleotide

which has a 5 ’and a 3’ portion in which the 5 ’portion of the third oligonucleotide contains a sequence

complementary to the first region of the target nucleic acid and in which the 3 'portion of the third oligonucleotide contains a sequence complementary to the second region of the target nucleic acid.

The present invention is not limited by the length of the four regions of the target nucleic acid. In one embodiment, the first region of the target nucleic acid may be 11 to 50 nucleotides in length. In another embodiment, the second region of the target nucleic acid is one to three nucleotides in length. In another embodiment, the third region of the target nucleic acid may be six to nine nucleotides in length. In yet another embodiment, the fourth region of the target nucleic acid may be 6 to 50 nucleotides in length.

The invention is not limited by the nature or composition of the first, second, third and fourth oligonucleotides; these oligonucleotides can comprise DNA, RNA, ANP and combinations thereof as well as comprise modified nucleotides, universal bases, adducts, etc. In addition, one or more of the first, second, third and fourth oligonucleotides may contain a dideoxynucleotide at the 3 ′ end.

In a preferred embodiment, the target nucleic acid is not completely complementary to at least one of the first, second, third and fourth oligonucleotides. In a particularly preferred embodiment, the target nucleic acid is not completely complementary to the second oligonucleotide.

As noted above, the present invention contemplates the use of nucleases with structure specificity in detection procedures. In one embodiment, the present invention provides a method for detecting the presence of a target nucleic acid molecule by detecting non-target cleavage products, comprising: a) providing: i) a cleavage medium, ii) a source of target nucleic acid , in which the target nucleic acid has a first region, a second region, a third region and a fourth region, in which the first region is located adjacent and downstream of the second region, the second region is located adjacent and chain below the third region and the third region is located adjacent and chain down to the fourth region; iii) a first oligonucleotide complementary to the fourth region of the target nucleic acid; iv) a second oligonucleotide

which has a 5 ’and a 3’ portion in which the 5 ’portion of the second oligonucleotide contains a sequence complementary to the second region of the target nucleic acid and in which the 3’ portion of the second oligonucleotide

it contains a sequence complementary to the third region of the target nucleic acid; iv) a third oligonucleotide that

it has a 5 'portion and a 3' portion in which the 5 'portion of the third oligonucleotide contains a sequence complementary to the first region of the target nucleic acid and in which the 3' portion of the third oligonucleotide contains a sequence complementary to the second target nucleic acid region; b) mixing the cleavage medium, the target nucleic acid, the first oligonucleotide, the second oligonucleotide and the third oligonucleotide to create a reaction mixture under reaction conditions such that the first oligonucleotide hybridizes with the fourth region of the target nucleic acid and wherein at least the 3 'part of the second oligonucleotide hybridizes with the target nucleic acid and in which at least the 5' part of the third oligonucleotide hybridizes with the target nucleic acid

to create a cleavage structure and in which the cleavage of the cleavage structure takes place to generate non-target cleavage products, each non-target cleavage product having a 3 'hydroxyl group; and c) detect non-target cleavage products.

The invention is not limited by the nature of the target nucleic acid. In one embodiment, the target nucleic acid comprises a single stranded DNA. In another embodiment, the target nucleic acid comprises double helix DNA and prior to step c), the reaction mixture is treated such that the double helix DNA is substantially converted to single helix. In another embodiment, the target nucleic acid comprises an RNA and the first and second oligonucleotides comprise DNA.

The cleavage medium of the invention is an FEN-1 endonuclease, as defined in the claims. The cleavage medium of the invention may also be an FEN-1 endonuclease comprising the endonuclease of the claims.

In a preferred alternative embodiment, the detection of the non-target cleavage products comprises electrophoretic separation of the reaction products followed by visualization of the separate non-target cleavage products.

In another preferred embodiment, one or more of the first, second and third oligonucleotides contain a dideoxynucleotide at the 3 'end. When oligonucleotides containing dideoxynucleotides are used, the detection of non-target cleavage products preferably comprises: a) incubating non-target cleavage products with a template independent polymerase and at least one labeled nucleoside triphosphate under conditions such that at least

a labeled nucleotide is added to the 3 ’hydroxyl group of non-target cleavage products to generate products

of non-target cleavage marked; and b) detect the presence of labeled non-target cleavage products. The invention is not limited by the nature of the mold independent polymerase employed; In one embodiment, the template independent polymerase is selected from the group consisting of terminal deoxynucleotidyl transferase (TdT) and poly A polymerase. When TdT or poly A polymerase is employed in the detection step, the second

oligonucleotide may contain a 5 ’end marker, the 5’ end marker being a different marker

to the marker present in the nucleoside labeled triphosphate. The invention is not limited by the nature of the

5 ’end marker; a wide variety of suitable 5 ’end markers are known in the art and

they include biotin, fluorescein, tetrachlorofluorescein, hexachlorofluorescein, Cy3 amidite, Cy5 amidite and digoxigenin.

In another related embodiment, the detection of non-target cleavage products comprises: a) incubating the non-target cleavage products with a template independent polymerase and at least one nucleoside triphosphate under conditions such that at least one labeled nucleotide is added to the group 3 'hydroxyl of non-target cleavage products to generate non-target tail cleavage products; and b) detect the presence of non-target cleavage products with glue. The invention is not limited by the nature of the mold independent polymerase employed; In one embodiment, the template independent polymerase is selected from the group consisting of terminal deoxynucleotidyl transferase (TdT) and poly A polymerase. When TdT or poly A polymerase is used in the

detection stage, the second oligonucleotide may contain a 5 ’end marker. The invention is not limited by the nature of the 5 ’end marker; a wide variety of suitable 5 'end markers are known in the art and include biotin, fluorescein, tetrachlorofluorescein, hexachlorofluorescein, Cy3 amidite, Cy5 amidite and digoxigenin.

In a preferred embodiment, the reaction conditions comprise providing a source of divalent cations; Particularly preferred divalent cations are Mn2 + and Mg2 + ions.

The present invention also relates to a method for detecting the presence of a target nucleic acid molecule by detecting non-target cleavage products, comprising: a) providing: i) a cleavage medium, ii) a source of target nucleic acid, the target nucleic acid having a first region, a second region and a third region, in which the first region is located adjacent to and downstream of the second region and in which the second region is located adjacent to and chain below the third region , iii) a first oligonucleotide that

it has a 5 'and a 3' part, in which the 5 'part of the first oligonucleotide contains a sequence complementary to the second region of the target nucleic acid and in which the 3' part of the first oligonucleotide contains a sequence complementary to the third target nucleic acid region; iv) a second oligonucleotide having a length between eleven and fifteen nucleotides and also having a 5 'and a 3' part, in which the 5 'part of the second oligonucleotide contains a sequence complementary to the first region of the target nucleic acid and wherein the 3 'part of the second oligonucleotide contains a sequence complementary to the second region of the target nucleic acid; b) mixing the cleavage medium, the target nucleic acid, the first oligonucleotide and the second oligonucleotide to create a reaction mixture under reaction conditions such that at least the 3 'part of the first oligonucleotide hibride with the target nucleic acid and in which at least the 5 'part of the second

oligonucleotide hibride with the target nucleic acid to create a cleavage structure and in which the cleavage of the cleavage structure takes place to generate non-target cleavage products, each cleavage product having

does not target a 3 ’hydroxyl group; and c) detect non-target cleavage products. In a preferred embodiment, medium

The cleavage may be a nuclease with structure specificity, preferably a nuclease with thermostable structure specificity.

The invention is not limited by the length of the various regions of the target nucleic acid. In a preferred embodiment, the second region of the target nucleic acid is one to five nucleotides in length. In another preferred embodiment, one or more of the first and second oligonucleotides contain a dideoxynucleotide at the 3 'end. When oligonucleotides containing dideoxynucleotides are used, the detection of non-target cleavage products preferably comprises: a) incubating non-target cleavage products with a template independent polymerase and at least one labeled nucleoside triphosphate under conditions such that at least one

labeled nucleotide is added to the 3 'hydroxyl group of non-target cleavage products to generate products of

non-target cleavage marked; and b) detect the presence of labeled non-target cleavage products. The invention is not limited by the nature of the mold independent polymerase employed; In one embodiment, the template independent polymerase is selected from the group consisting of terminal deoxynucleotidyl transferase (TdT) and poly A polymerase. When TdT or poly A polymerase is employed in the detection step, the second

oligonucleotide may contain a 5 ’end marker, the 5’ end marker being a different marker

to the marker present in the nucleoside labeled triphosphate. The invention is not limited by the nature of the

5 ’end marker; a wide variety of suitable 5 ’end markers are known in the art and

they include biotin, fluorescein, tetrachlorofluorescein, hexachlorofluorescein, Cy3 amidite, Cy5 amidite and digoxigenin.

In another embodiment, the detection of non-target cleavage products comprises: a) incubating non-target cleavage products with a template independent polymerase and at least one nucleoside triphosphate under conditions such that at least one labeled nucleotide is added to the hydroxyl group 3 'of non-target cleavage products to generate non-target cleavage products with glue; and b) detect the presence of non-target cleavage products with glue. The invention is not limited by the nature of the mold independent polymerase employed; In one embodiment, the template independent polymerase is selected from the group consisting of terminal deoxynucleotidyl transferase (TdT) and poly A polymerase. When TdT or poly A polymerase is used in the detection step,

the second oligonucleotide may contain a 5 ’end marker. The invention is not limited by the nature of the 5 ’end marker; a wide variety of 5 ’end markers are known in the art

Suitable and include biotin, fluorescein, tetrachlorofluorescein, hexachlorofluorescein, Cy3 amidite, Cy5 amidite and digoxigenin.

The novel detection methods of the invention can be employed for the detection of DNA and target RNA including, but not limited to, DNA and target RNA comprising alleles of wild-type and mutant genes, including genes of humans or other animals that are or may be associated with disease

or cancer In addition, the methods of the invention can be used for the detection of and / or identification of strains of microorganisms, including bacteria, fungi, protozoa, ciliates and viruses (and, in particular, for the detection and identification of RNA viruses, such as HCV).

The present invention provides a purified FEN-1 endonuclease from Archaeaglobus veneficus, wherein said FEN1 endonuclease comprises an amino acid sequence comprising SEQ ID No. 370.

The invention further provides a composition comprising an isolated nucleic acid encoding the FEN-1 endonuclease comprising SEQ ID No. 370, wherein the isolated nucleic acid comprises SEQ ID NO.

369.

The invention further provides a composition comprising a chimeric FEN-1 endonuclease, wherein said chimeric FEN-1 endonuclease comprises the FEN-1 endonuclease comprises an amino acid sequence comprising SEQ ID No. 370.

The invention also provides recombinant DNA vectors comprising DNA having a nucleotide sequence encoding FEN-1 endonucleases, as defined in the claims. In a preferred embodiment, the host cell is an Escherichia coli cell.

Thus, the present invention provides multiple purified FEN-1 endonucleases, both purified native forms of the endonucleases and recombinant endonucleases. In preferred embodiments, purified FEN-1 endonucleases are obtained from archaebacterial organisms. FEN-1 endonucleases are obtained from Archaeaglobus veneficus. In a preferred embodiment, the purified FEN-1 endonucleases have molecular weights of approximately 39 kd (the molecular weight can be conveniently estimated using SDS-PAGE as described in Ex. 28).

In a preferred embodiment, the chimeric endonucleases comprise portions of amino acids derived from the FEN-1 endonucleases selected from the group of Pyrococcus furiosus, Methanococcus jannaschi, Pyrococcus woesei, Archaeoglobus fulgidus, Methanobacterium thermoautotrophicum, Sulfolobus solfataricumumugulumumorchaemoemoglobusummochaeummochaemoemoglobusummoeculumumus, pylorococummoecus, pylorusmoecus, Pylorococummoecus, Pyrococummoecus, Pyrococumusumumusumumus, Pyrococumusumumusumusus Archaeaglobus profundus, Acidianus brierlyi, Acidianus ambivalens, Desulfurococcus amylolyticus, Desulfurococcus mobilis, Pyrodictium brockii, Thermococcus gorgonarius, Thermococ-cus zilligii, Methanopyrus kandleri, Methanococconcus periuscus, Anecus pyroccusnnecumnum. In a more preferred embodiment, the chimeric FEN-1 endonucleases have molecular weights of approximately 39 kd (the molecular weight can be conveniently estimated using SDS-PAGE as described in Ex. 28). In another embodiment, the chimeric FEN endonucleases have amino acid sequences selected from the group of SEQ ID NO: 418, 426, 432, 436, 440, 444, 450, 452, 470, 472, 474, 476, 478, 480, 482 and

484

The present invention further provides isolated oligonucleotides encoding chimeric endonucleases. In one embodiment, the oligonucleotides encoding the chimeric endonucleases comprise nucleic acid sequences derived from the genes selected from the homologue group of FEN-1, XPG and RAD. In a preferred embodiment, the oligonucleotides encoding the chimeric endonucleases comprise nucleic acid sequences derived from the genes encoding the FEN-1 endonucleases selected from the group of derivatives of

Pyrococcus furiosus, Methanococcus jannaschi, Pyrococcus woesei, Archaeoglobus fulgidus, Methanobacterium thermoautotrophicum, Sulfolobus solfataricus, Pyrobaculum aerophilum, Thermococcus litoralis, Archaeaglobus Veneficus, Archaeaglobus profundus, Acidianus brierlyi, Acidianus ambivalens, Desulfurococcus amylolyticus, Desulfurococcus mobilis, Pyrodictium brockii, Thermococcus gorgonarius, Thermococ- cus zilligii, Methanopyrus kandleri, Methanococcus igneus, Pyrococcus horikoshii and Aeropyrum pernix. In another embodiment, the oligonucleotides encoding the chimeric endonucleases comprise a nucleic acid sequence selected from the group of SEQ ID NO: 417, 425, 431, 435, 439, 443, 449, 451, 469, 471, 473, 475, 477 , 479,481, and 483. In a particularly preferred embodiment, the chimeric endonuclease genes are operably linked to heterologous promoters. The present invention is not limited by the nature of the heterologous promoter employed. It is considered that the selected promoter will depend on the host cell selected for expression as is known in the art. In preferred embodiments, the heterologous promoter is an inducible promoter. The invention is not limited by the nature of the inducible promoter employed. Preferred inducible promoters include the -PL promoter, the tac promoter, the trp promoter and the trc promoter.

In another preferred embodiment, the invention provides recombinant DNA vectors comprising isolated oligonucleotides encoding the chimeric endonucleases described above and as defined in the claims.

In one embodiment, the recombinant DNA vectors comprise isolated oligonucleotides encoding nucleic acid sequences obtained from the genes selected from the homologue group of FEN-1, XPG and RAD.

In a preferred embodiment, the isolated oligonucleotide recombinant DNA vectors encoding the chimeric endonucleases comprising nucleic acid sequences derived from the genes encoding the FEN-1 endonucleases selected from the group of derivatives of Pyrococcus furiosus, Methanococcus jannaschi, Pyrococcus woesei, Archaeoglobus fulgidus, Methanobacterium thermoautotrophicum, Sulfolobus solfataricus, Pyrobaculum aerophilum, Thermococcus litoralis, Archaeaglobus Veneficus, Archaeaglobus profundus, Acidianus brierlyi, Acidianus ambivalens, Desulfurococcus amylolyticus, Desulfurococcus mobilis, Pyrodictium brockii, Thermococcus gorgonarius, Thermococcus zilligii, Methanopyrus kandleri, Methanococcus igneus, Pyrococcus Horikoshii and Aeropyrum pernix. In another embodiment, the recombinant DNA vectors comprise amino acid sequences selected from the group of SEQ ID NO: 417, 425, 431, 435, 439, 443, 449, 451, 469, 471, 473, 475, 477, 479, 481 and 483. These vectors may further comprise a heterologous promoter operably linked to the polynucleotides encoding the chimeric nuclease.

Host cells transformed with these recombinant vectors are also provided. The invention is not limited by the nature of the host cell employed. suitable expression vectors are well known for the expression of polynucleotides encoding FEN-1 that can be expressed in a variety of prokaryotic and eukaryotic host cells. In a preferred embodiment, the host cell is an Escherichia coli cell.

The invention provides a mixture comprising: i) a first nuclease with structure specificity comprising an FEN-1 endonuclease of Archaeaglobus veneficus; and ii) a second nuclease with structure specificity, wherein said nuclease with structure specificity comprises an amino acid sequence comprising SEQ ID NO: 370.

In preferred embodiments, second nuclease with specificity of structure of the mixture is selected from the group comprising Pyrococcus woesei FEN-1 endonuclease, Pyrococcus furiosus FEN-1 endonuclease; Methanococcus jannaschii endonuclease FEN-1, Methanobacterium thermoautotrophicum endonuclease FEN-1, Archaeoglobus fulgidus FEN-1, Sulfolobus solfataricus, Pyrobaculum aerophilum, Thermococcus litoralis, Archaeagloususususus, Acchaeaglous ambususususus, Acusagususususus, Acusagususus Pyrodictium brockii, Thermococcus gorgonarius, Thermococcus zilligii, Methanopyrus kandleri, Methanococcus igneus, Pyrococcus horikoshii, Aeropyrum pernix and chimeric FEN-1 endonucleases. In alternative embodiments, the purified FEN-1 endonuclease in the mixture is selected from the group consisting of Pyrococcus woesei FEN-1 endonuclease, Pyrococcus furiosus FEN-1 endonuclease; Methanococcus jannaschii endonuclease FEN-1, Methanobacterium thermoautotrophicum endonuclease FEN-1, Archaeoglobus fulgidus FEN-1, Sulfolobus solfataricus, Pyrobaculum aerophilum, Thermococcus litoralis, Archaeagloususususus, Acchaeaglous ambususususus, Acusagususususus, Acusagususus Pyrodictium brockii, Thermococcus gorgonarius, Thermococcus zilligii, Methanopyrus kandleri, Methanococcus igneus, Pyrococcus horikoshii, Aeropyrum pernix and chimeric FEN-1 endonucleases. In other preferred embodiments more than the mixture, the

second nuclease is a 5 ′ nuclease obtained from a thermostable DNA polymerase altered in the sequence of

amino acids in such a way that it shows reduced synthetic DNA activity with respect to that of wild-type DNA polymerase but retains substantially the same 5 ’nuclease activity of wild-type DNA polymerase. In some preferred embodiments of the mixture, the second nuclease is selected from the group consisting of the enzyme Cleavase® BN, Thermus aquaticus DNA polymerase, Thermus thermophilus DNA polymerase, Escherichia coli Exo III, Saccharomyces cerevisiae Rad1 / Rad10 complex.

The invention further provides a method of detecting a target sequence, comprising:

a) provide:

i) a cleavage structure comprising a Diana sequence and oligonucleotides capable of forming an invasive cleavage structure in the presence of said target sequence; Y

ii) a purified FEN-1 endonuclease from Archaeaglobus veneficus, wherein said FEN-1 endonuclease comprises an amino acid sequence comprising SEQ ID NO: 370; Y

b) exposing said cleavage structure to said FEN-1 endonuclease; Y

c) detecting the cleavage of said cleavage structure.

The invention further relates to a process for treating nucleic acid, comprising: a) providing a purified FEN-1 endonuclease; and a nucleic acid substrate; b) treating the nucleic acid substrate under conditions such that the substrate forms one or more cleavage structures; and c) reacting the endonuclease with the cleavage structures such that one or more cleavage products are produced. In some embodiments, the purified FEN-1 endonuclease is selected from the group consisting of Pyrococcus woesei FEN-1 endonuclease, Pyrococcus furiosus FN-1 endonuclease, Methanococcus jannaschii FEN-1 endonuclease, Methanobacterium thermoautotrophic-FEN-1 endonuclease Archaeoglobus fulgidus 1, Sulfolobus solfataricus, Pyrobaculum aerophilum, Thermococcus litoralis, Archaeaglobus Veneficus, Archaeaglobus profundus, Acidianus brierlyi, Acidianus ambivalens, Desulfurococcus amylolyticus, Desulfurococcus mo-bile, Pyrodictium brockii, Thermococcus gorgonarius, Thermococcus zilligii, Methanopyrus kandleri, Methanococcus igneus , Pyrococcus horikoshii, Aeropyrum pernix and chimeric FEN-1 endonucleases. In other embodiments, the method further comprises providing a nuclease with structure specificity obtained from a thermostable DNA polymerase altered in the amino acid sequence such that it shows reduced DNA synthetic activity relative to that of wild-type but conserved DNA polymerase substantially the same 5 'nuclease activity of wild-type DNA polymerase.

In related embodiments of the methods, a part of the amino acid sequence of the second nuclease is homologous to a part of the amino acid sequence of a thermostable DNA polymerase obtained from a Eubacterial thermophile of the genus Thermus. In further related embodiments, the thermophile is selected from the group consisting of Thermus aquaticus, Thermus flavus and Thermus thermophilus. In other related embodiments, the nuclease with specificity is selected from the group consisting of the enzyme Cleavase® BN, Thermus aquaticus DNA polymerase, Thermus thermophilus DNA polymerase, Escherichia coli Exo III, Saccharomyces cerevisiae Rad1 / Rad10 complex. In some related embodiments, the nuclease with structure specificity is the Cleaase® BN nuclease. In yet other embodiments, the nucleic acid of step (a) is substantially single stranded. In further embodiments, the nucleic acid is selected from the group consisting of RNA and DNA. In further embodiments, the stage nucleic acid

(a) is double stranded.

In other related embodiments of the procedures, the treatment of step (b) comprises:

converting the double helix nucleic acid substantially into a single helix; and exposing the single helix nucleic acid to conditions such that the single helix nucleic acid has a secondary structure. In some preferred embodiments, the double stranded nucleic acid is converted to substantially single stranded by the use of increased temperature. In alternative preferred embodiments, the method further comprises the step of detecting the one or more cleavage products.

The present invention also relates to methods for treating nucleic acid, comprising: a) providing: a first nuclease with structure specificity consisting of a purified FEN-1 endonuclease in a solution containing manganese and a nucleic acid substrate; b) treating the nucleic acid substrate with increased temperature such that the substrate is substantially single stranded; c) reduce the temperature under conditions such that the single stranded substrate forms one or more cleavage structures; d) reacting the cleavage medium with the cleavage structures such that one or more cleavage products are produced; and e) detect the one or more cleavage products. In some embodiments of the methods, the purified FEN-1 endonuclease is selected from the group consisting of Pyrococcus woesei FEN-1 endonuclease, Pyrococcus furiosus endonuclease FEN-1, Methanococcus jannaschii endonuclease, FEN-1 endonuclease from Methanobacteric therumautumumumumumumumumumumumumum , FEN-1 Archaeoglobus fulgidus of, Sulfolobus solfataricus, Pyrobaculum aerophilum, Thermococcus litoralis, Archaeaglobus Veneficus, Archaeaglobus profundus, Acidianus brierlyi, Acidianus ambivalens, Desulfurococcus amylolyticus, Desulfurococcus mo-bile, Pyrodictium brockii, Thermococcus gorgonarius, Thermococcus zilligii, Methanopyrus kandleri , Methanococcus igneus, Pyrococcus horikoshii, Aeropyrum pernix and chimeric FEN-1 endonucleases. In alternative embodiments, the methods further comprise providing a second nuclease with structure specificity. In some preferred embodiments, the second nuclease is selected from the group consisting of the enzyme Cleavase® BN, Thermus aquaticus DNA polymerase, Thermus thermophilus DNA polymerase, Escherichia coli Exo III, Saccharomyces cerevisiae Rad1 / Rad10 complex. In still other preferred embodiments, the second nuclease is a 5 ′ nuclease obtained from a thermostable DNA polymerase altered in the amino acid sequence such that it shows reduced DNA synthetic activity relative to that of wild-type but conserved DNA polymerase.

substantially the same 5 ’nuclease activity of wild-type DNA polymerase. In other embodiments,

The nucleic acid is selected from the group consisting of RNA and DNA. In further embodiments, the nucleic acid of step (a) is double stranded.

The invention also provides a nucleic acid treatment kit, comprising:

a) a composition comprising a purified FEN-1 endonuclease from Archaeaglobus veneficus, wherein said FEN-1 endonuclease comprises an amino acid sequence comprising SEQ ID NO: 370; Y

b) oligonucleotides capable of forming an invasive cleavage structure in the presence of a target nucleic acid.

The present invention also provides the nucleic acid treatment kits, as defined in the claims, which further comprise a solution containing manganese. In other embodiments, the kits further comprise at least a second nuclease with structure specificity. In some embodiments

preferred, the second nuclease is a 5 ′ nuclease obtained from a thermostable DNA polymerase altered in the

amino acid sequence in such a way that it shows reduced synthetic DNA activity with respect to that of the

Wild-type DNA polymerase but retains substantially the same 5 ’nuclease activity of DNA

wild type polymerase. In other embodiments of the kits, the amino acid sequence part of the second nuclease is homologous to a part of the amino acid sequence of a thermostable DNA polymerase obtained from a Eubacterial thermophile of the genus Thermus. In further embodiments, the thermophile is selected from the group consisting of Thermus aquaticus, Thermus flavus and Thermus thermophilus. In yet other embodiments, the kits further comprise reagents for detecting cleavage products.

The present invention further provides any of the compositions, mixtures, methods and kits described herein used in conjunction with endonucleases comprising Sulfolobus solfataricus endonucleases, Pyrobaculum aerophilum, Thermococcus litoralis, Archaeaglobus veneficus, Archaeaglobus profundus, Acidianus brierlyi, Acidianus ambivacivalecivalecivacivale, Acidianus ambivaulfide -cus amylolyticus, Desulfurococcus mobilis, Pyrodictium brockii, Thermococcus gorgonarius, Thermococcus zilligii, Methanopyrus kandleri, Methanococcus igneus, Pyrococcus horikoshii and Aeropyrum pernix. These include compositions comprising purified FEN-1 endonucleases from organisms (including specific endonucleases described by the sequences provided herein, as well as variants and homologues), kits comprising these compositions, composition comprising chimeric endonucleases comprising at least a part of the endonucleases of these organisms, kits comprising said compositions, compositions comprising nucleic acids encoding the endonucleases of these organisms (including vectors and host cells), kits comprising said compositions, antibodies generated against endonucleases, mixtures that they comprise endonucleases of these organisms, methods of using endonuclease in cleavage assays (eg, invasive cleavage assays, CFLP etc.) and kits containing components useful for such procedures. Examples 62-67 provide examples describing the generation, structure, use and characterization of these endonucleases.

The present invention is related to structure-specific nucleases from various sources, including, among others, mesophilic organisms, psychrophiles, thermophiles and hyperthermophiles. Preferred structure specific nucleases are thermostable. Specific thermostable structure nucleases are considered particularly useful in that they allow the INVASOR assay to be performed (see, for example, U.S. Patents 5,846,717, 5,985,557, 5,994,069, and 6,001,567 and PCT publications WO 97/27214 and WO 98/42873) near the melting temperature (Tf) of the oligonucleotide probe downstream, so that the cleaved and uncleaved probes can cycle and not cycle the target during the course of the reaction. In one embodiment, the specific thermostable structure enzymes are 5 'thermostable nucleated which are selected from the group comprising altered polymerases derived from the native polymerases of Thermus species, including, among others, Thermus aquaticus, Thermus flavus, Thermus thermophilus, Thermus filiformus , and Thermus scotoductus. Do not

However, the invention is not limited to the use of 5 ’thermoset nucleots. For example, certain embodiments of the

The present invention uses short oligonucleotide probes that can cycle and not cycle the target at low temperatures, which allows the use of non-thermostable enzymes.

In some preferred embodiments, the present invention provides a composition comprising an enzyme, in which the enzyme comprises a heterologous functional domain, in which the heterologous functional domain provides altered (eg, enhanced) functionality in a test of nucleic acid cleavage. The present invention is not limited by the nature of the nucleic acid cleavage assay. For example, nucleic acid cleavage assays include an assay in which a nucleic acid is cleaved, directly or indirectly, in the presence of the enzyme. In certain preferred embodiments, the nucleic acid cleavage assay is an invasive cleavage assay. In particularly preferred embodiments, the cleavage assay uses a cleavage structure that has at least one RNA component. In another particularly preferred embodiment, the cleavage assay uses a cleavage structure having at least one RNA component, in which a DNA member of the cleavage structure is cleaved.

The present invention is not limited by the nature of the altered functionality provided by the heterologous functional domain. Illustrative examples of alterations include, among others, enzymes in which the heterologous functional domain comprises an amino acid sequence (e.g., one or more amino acids) that provides improved nuclease activity, improved substrate binding activity and / or Specified background will improve in a nucleic acid cleavage test.

The present invention is not limited by the nature of the heterologous functional domain. For example, in some embodiments, the heterologous functional domain comprises two or more amino acids of a polymerase domain of a polymerase (eg, introduced into the enzyme by insertion of a chimeric functional domain or created by mutation). In a certain preferred embodiment, at least one of the two or more amino acids is from a palm region

or polymerase domain thumb. The present invention is not limited by the identity of the polymerase from which the two or more amino acids are selected. In certain preferred embodiments, the polymerase comprises Thermus thermophilus polymerase. In particularly preferred embodiments, the two or more amino acids are derived from amino acids 300-650 of SEQ ID NO: 267.

The novel enzymes of the invention can be used for the detection of DNA and target RNA including, but not limited to, DNA and target RNA comprising alleles of wild-type and mutant genes, including, among others, genes from humans, other animals. or plants that are or may be associated with disease or other alterations. In addition, the enzymes of the invention can be used for the detection of and / or identification of strains of microorganisms, including bacteria, fungi, protozoa, ciliates and viruses (and, in particular, for the detection and identification of viruses that have genomes of RNA, such as hepatitis C and human immunodeficiency viruses). For example, the present invention provides methods for cleaving nucleic acids comprising providing: an enzyme of the present invention and a substrate nucleic acid; and exposing the substrate nucleic acid to the enzyme (eg, to produce a detectable cleavage product).

DEFINITIONS

To facilitate the understanding of the present invention, a series of terms and phrases are defined below:

As used herein, the terms "complementary" or "complementarity" are used in

reference to polynucleotides (i.e., a nucleotide sequence such as an oligonucleotide or a target nucleic acid) according to the rules of base pairing. For example, the sequence 5'-AGT-3 '"is complementary to the sequence" 3'-TCA-5'. "Complementarity can be" partial ", in which only some of the nucleotide bases are paired according to the rules of base mating. Or you can

there is "complete" or "total" complementarity between nucleic acids. The degree of complementarity between

Nucleic acid strands have significant effects on the efficiency and strength of hybridization between nucleic acid strands. This is of particular importance in amplification reactions, as well as in detection procedures that depend on the binding between nucleic acids. Any term can be used in reference to individual nucleotides, especially within the context of polynucleotides. For example, a particular nucleotide within an oligonucleotide may be observed for its complementarity, or absence thereof, with a nucleotide within another nucleic acid strand, in contrast or comparison with the complementarity between the remainder of the oligonucleotide and the acid strand. nucleic.

The term "homology" and "homologue" refers to a degree of identity. There may be partial homology or complete homology. A partially identical sequence is one that has less than 100% identity with another sequence.

As used herein, the term "hybridization" is used with reference to acid pairing.

complementary nuclei. Hybridization and the strength of hybridization (ie, the strength of the association between nucleic acids) are influenced by factors such as the degree of complementarity between nucleic acids), the stringency of the conditions involved and the Tf of the hybrid formed . The "hybridization" procedures involve the hybridization of one nucleic acid with another, complementary nucleic acid, that is to say a nucleic acid having a complementary nucleotide sequence. The ability of two nucleic acid polymers containing complementary sequences to meet and hybridize by base pairing interaction is a good phenomenon.

recognized. Following initial observations of the "hybridization" procedure of Marmur and Lane, Proc. Natl Acad.

Sci. USA 46: 453 (1960) and Doty et al., Proc. Natl Acad. Sci. USA 46: 461 (1960) there has been the improvement of this process in an essential tool of modern biology.

With respect to complementarity, for some diagnostic applications it is important to determine whether hybridization represents complete or partial complementarity. For example, when it is desired to simply detect the presence or absence of pathogenic DNA (such as a virus, bacteria, fungus, mycoplasma, protozoan), it is only important that the hybridization procedure guarantees hybridization with the relevant sequence present; conditions can be selected so that they hybridize partially complementary and completely complementary probes. However, other diagnostic applications may require that the hybridization procedure distinguish between partial and complete complementarity. It may be of interest to detect genetic polymorphisms. For example, human hemoglobin is composed, in part, of four polypeptide chains. Two of these chains are identical chains of 141 amino acids (alpha chains) and two of these chains are identical chains of 146 amino acids (beta chains). It is known that the gene encoding the beta chain exhibiting polymorphism. The normal allele encodes a beta chain that has glutamic acid in the sixth position. The mutant allele encodes a beta chain that has valine in the sixth position. This difference in amino acids has a profound physiological impact (deeper when the individual is homozygous for the mutant allele) known clinically as sickle cell anemia. It is well known that the genetic basis of the amino acid change implies a difference in a single base between the DNA sequence of the normal allele and the DNA sequence of the mutant allele.

The complement of a nucleic acid sequence as used herein refers to a

oligonucleotide which, when aligned with the nucleic acid sequence so that the 5 'end of one sequence is paired with the 3' end of the other, is in "antiparallel association." Certain bases that are not usually found in acids Natural nucleic acids may be included in the nucleic acids of the present invention and include, for example, inopin and 7-deazaguanine.The complementarity does not have to be perfect, stable duplexes may contain mismatched base pairs or unpaired bases. The technique of nucleic acid technology can determine the stability of the duplex empirically by considering a series of variables including, for example, the length of the oligonucleotide, the composition in bases and the sequence of the oligonucleotide, the ionic strength and the incidence of pairs of bases paired incorrectly.

As used herein, the term "Tf" is used with reference to the "melting temperature." The

melting temperature is the temperature at which the population of double-stranded nucleic acid molecules dissociates in half into single helices. Several equations for calculating the Tf of nucleic acids are well known in the art. As indicated by conventional references, a simple estimate of the Tf value can be calculated with the equation: Tf = 81.5 + 0.41 (% G + C), when a nucleic acid is in aqueous solution at 1 M NaCl (see , for example, Anderson and Young, Quantitative Filter Hybridization, in Nucleic Acid Hybridization (1985).

(e.g., Allawi, HT & SantaLucia, J., Jr. Thermodynamics and NMR of internal GT mismatches in DNA. Biochemistry 36, 10581-94 (1997) include more sophisticated calculations that take into account structural and environmental characteristics, as well as sequence characteristics for the calculation of Tf.

As used herein, the term "stringency" is used with reference to the conditions of

temperature, ionic strength and presence of other compounds, in which nucleic acid hybridizations are performed. Under "high stringency" conditions, nucleic acid base pairing will take place only between nucleic acid fragments that have a high frequency of base sequences.

complementary. Therefore, "weak" or "low" stringency conditions are often required when it is desired that

nucleic acids that are not completely complementary to each other hybridize or associate with each other.

"Conditions of high stringency", when used in reference to hybridization of nucleic acids, comprise conditions equivalent to binding or hybridization at 42 ° C in a solution consisting of 5X SSPE (43.8 g / l NaCl, 6.9 g / l NaH 2PO4 H2O and 1.85 g / l EDTA, pH adjusted to 7.4 with NaOH), 0.5% SDS, 5X Denhardt reagent and 100

g / ml denatured salmon sperm DNA followed by washing in a solution comprising 0.1X SSPE, 1.0% SDS at 42 ° C when a probe approximately 500 nucleotides in length is used.

"Medium stringency conditions", when used in reference to nucleic acid hybridization, comprise

conditions equivalent to binding or hybridization at 42 ° C in a solution consisting of 5X SSPE (43.8 g / l NaCl, 6.9 g / l NaH 2PO4 H2O and 1.85 g / l EDTA, pH adjusted to 7.4 with NaOH), 0.5% SDS, 5X Denhardt reagent and 100

g / ml DNA of denatured salmon sperm, followed by washing in a solution comprising 1.0X SSPE, 1.0% SDS at 42 ° C when using a probe approximately 500 nucleotides in length.

"Low stringency conditions" comprise conditions equivalent to binding or hybridization at 42 ° C in a

solution consisting of 5X SSPE (43.8 g / l NaCl, 6.9 g / l NaH2PO4 H2O and 1.85 g / l EDTA, pH adjusted to 7.4 with NaOH), 0.1% SDS, 5X reagent of Denhardt [50X Denhardt reagent contains per 500 ml: 5 g of Ficoll (Type 400, Pharmacia), 5 g of BSA (Fraction V; Sigma) and 100 g / ml of denatured salmon sperm DNA, followed by washing in a solution comprising 5X SSPE, 0.1% SDS at 42 ° C when a probe is used approximately 500 nucleotides in length.

The term "gene" refers to a DNA sequence comprising control and coding sequences necessary for the production of an RNA that has a non-coding function (eg, a ribosomal or transfer RNA), a polypeptide or a precursor. The RNA or polypeptide can be encoded by a full length coding sequence or by any part of the coding sequence provided the desired enzymatic activity is preserved.

The term "wild type" refers to a gene or gene product that has the characteristics of that gene or gene product when it is isolated from a source of natural origin. A wild type gene is the one most observed

frequently in a population and, therefore, is arbitrarily termed the "normal" or "wild-type" form of the gene. On the contrary, the term "modified", "mutant" or "polymorphic" refers to a gene or gene product that shows sequence modifications and / or functional properties (ie, altered characteristics) when compared to the gene or product wild type gene. It should be noted that mutants of natural origin can be isolated; they are identified by the fact that they have altered characteristics when compared to the wild-type gene or gene product.

The term "recombinant DNA vector" as used herein refers to DNA sequences.

which contain a desired heterologous sequence. For example, although the term is not limited to the use of expressed sequences or sequences encoding an expression product, in some embodiments the heterologous sequence is a suitable coding sequence and DNA sequences necessary for the replication of the coding sequence in a host organism or the expression of the operably linked coding sequence in a particular host organism. DNA sequences necessary for prokaryotic expression include a promoter, optionally an operator sequence, a ribosome binding site and possibly other sequences. It is known that eukaryotic cells use promoters, polyadenylation signals and enhancers.

The term "LTR" as used herein refers to the long terminal repetition observed in each

end of a provirus (that is, the integrated form of a retrovirus). The LTR contains numerous regulatory signals that include transcription control elements, polyadenylation signals and sequences necessary for the replication and integration of the viral genome. The viral LTR is divided into three regions called U3, R and U5.

The U3 region contains the enhancer and promoter elements. The U5 region contains the polyadenylation signals. The R (repeat) region separates the U3 and U5 regions and transcribed sequences from the R region are presented at both the 5 ’and 3’ ends of the viral RNA.

The term "oligonucleotide" as used herein is defined as a molecule comprising two or

more deoxyribonucleotides or ribonucleotides, preferably at least 5 nucleotides, more preferably at least about 10-15 nucleotides and more preferably at least about 15 to 30 nucleotides. The exact size will depend on many factors that, in turn, depend on the ultimate function and use of the oligonucleotide. The oligonucleotide can be generated in any way. including chemical synthesis, DNA replication, reverse transcription or a combination thereof.

Since the mononucleotides are reacted to prepare oligonucleotides in such a way that the 5 'phosphate of a mononucleotide pentose ring binds to its neighbor's 3' oxygen in one direction via a phosphodiester bond, one end of an oligonucleotide is called the "5 'end" if its 5' phosphate does not bind to the 3 'oxygen of a mononucleotide pentose ring and the "3' end if its 3 'oxygen does not bind to a 5' phosphate ring of a pentose ring of posterior mononucleotide As used herein, it can be said that a nucleic acid sequence, even if it is internal to a larger oligonucleotide, also has 5 'and 3' ends. A first region along a nucleic acid chain is said to be upstream of another region if the 3 'end of the first region is in front of the 5' end of the second region when it moves along a chain of nucleic acid in a 5 'to 3' direction.

When two different, non-overlapping oligonucleotides hybridize with different regions of the same sequence of

linear complementary nucleic acid and the 3 ’end of one oligonucleotide is directed towards the 5’ end of the other, the first one can be called the “upstream” oligonucleotide and the last one, the “downstream” oligonucleotide. From

similarly, when two overlapping oligonucleotides hybridize with the same linear complementary nucleic acid sequence, with the first oligonucleotide positioned such that its 5 'end is upstream of the 5' end of the second oligonucleotide and the 3 'end of the first oligonucleotide is upstream of the 3 'end of the second oligonucleotide, the first oligonucleotide may be referred to as the "upstream" oligonucleotide and the

second oligonucleotide can be called the oligonucleotide "downstream".

The term "primer" refers to an oligonucleotide that is capable of acting as a starting point of synthesis when placed under conditions in which primer extension is initiated. An oligonucleotide "primer" can

appear naturally, as in a purified restriction digestion product or can be produced synthetically.

A primer is selected so that it is "substantially" complementary to a strand of a sequence

mold specific. A primer has to be sufficiently complementary to hybridize with a template chain for primer elongation to occur. A primer sequence does not have to reflect the exact sequence of the template. For example, a non-complementary nucleotide fragment may be attached to the 5 'end of the primer, the rest of the primer sequence being substantially complementary to the strand. Non-complementary bases or longer sequences may be entwined in the primer, as long as the primer sequence has sufficient complementarity with the template sequence to hybridize with it and, thus, form the template-primer complex for product synthesis. of primer extension.

The term "marker" as used herein refers to any atom or molecule that can be

use to provide a detectable signal (preferably quantifiable) and that can be attached to a nucleic acid

or to a protein. The markers can provide signals detectable by fluorescence, radioactivity, colorimetry, gravimetry, X-ray diffraction or absorption, magnetism, enzymatic activity and the like. A marker can be a charged remainder (positive or negative charge) or, alternatively, it can have a neutral charge. The markers may include or consist of a nucleic acid or protein sequence, provided that the sequence comprising the label is detectable.

The term "cleavage structure" as used herein refers to a structure that is

formed by the interaction of a probe oligonucleotide and a target nucleic acid to form a duplex, the resulting structure being cleavable by a cleavage means, including, but not limited to, an enzyme. The cleavage structure is a substrate for specific cleavage by the cleavage means compared to a nucleic acid molecule that is a substrate for non-specific cleavage by agents such as phosphodiesterases that cleave nucleic acid molecules regardless of the secondary structure ( that is, no formation of a duplex structure is required).

The term "folded cleavage structure" as used herein refers to a region of a single helix nucleic acid substrate that contains a secondary structure, the region being cleavable by an enzymatic cleavage means. The cleavage structure is a substrate for specific cleavage by the cleavage means compared to a nucleic acid molecule that is a substrate for non-specific cleavage by agents such as phosphodiesterases that cleave nucleic acid molecules regardless of the secondary structure ( that is, no folding of the substrate is required).

As used herein, the term "folded target" refers to a nucleic acid chain that

it contains at least one region of secondary structure (i.e., at least one double helix region and at least one single helix region within a single nucleic acid chain). A folded target can comprise regions of tertiary structure in addition to regions of secondary structure.

The term "cleavage media" or "cleavage agent", as used herein, refers to

any medium that is capable of cleaving a cleavage structure, including, among others, enzymes. The cleavage media may include native DNAPs that have 5 ’nuclease activity (e.g., Taq DNA polymerase, E. coli DNA polymerase I) and, more specifically, modified DNAPs that have 5’ nuclease but lack synthetic activity. "Nucleases with structure specificity" or "enzymes with structure specificity"

they are enzymes that recognize specific secondary structures in a nucleic acid molecule and cleave these structures. The cleavage medium of the invention cleaves a nucleic acid molecule in response to the formation of cleavage structures; It is not necessary that the cleavage means cleave the cleavage structure at any particular location within the cleavage structure.

The cleavage medium is not limited to enzymes that have only 5 ’nuclease activity. Excision media may include nuclease activity provided by a variety of sources including Cleavase® enzymes, FEN-1 endonucleases (including RAD2 and XPG proteins), Taq DNA polymerase and E. coli DNA polymerase I.

The term "thermostable" when used in reference to an enzyme, such as a 5 ’nuclease, indicates that the enzyme

it is functional or active (that is, it can perform catalysis) at an elevated temperature, that is, at about 55 ° C or more.

The term "cleavage products" as used herein refers to products generated by the

reaction of a cleavage medium with a cleavage structure (ie, treatment of a cleavage structure with a cleavage medium).

The term "target nucleic acid" refers to a nucleic acid molecule that contains a sequence that

It has at least partial complementarity with at least one probe oligonucleotide and can also have at least partial complementarity with an INVASOR oligonucleotide. The target nucleic acid may comprise single or double stranded DNA or RNA.

The term "probe oligonucleotide" refers to an oligonucleotide that interacts with a target nucleic acid.

to form a cleavage structure in the presence or absence of an INVASOR oligonucleotide. When hybridized with the target nucleic acid, the probe oligonucleotide and the target form a cleavage structure and the cleavage takes place within the probe oligonucleotide.

The term "non-target cleavage product" refers to a product of a cleavage reaction that is not obtained.

of the target nucleic acid. As discussed above, in the methods of the present invention, excision of the cleavage structure takes place within the probe oligonucleotide. Oligonucleotide fragments

Probes generated by this target nucleic acid-dependent cleavage are "non-target cleavage products."

The term "invasive oligonucleotide" refers to an oligonucleotide that hybridizes with a target nucleic acid at a location near the hybridization region between a probe and the target nucleic acid, wherein the INVASOR oligonucleotide comprises a portion (eg. , a chemical or nucleotide moiety, complementary or not to the target) that overlaps the hybridization region between the probe and the target. In some embodiments, the INVASOR oligonucleotide contains sequences at its 3 ′ end that are substantially the same as the sequences located at the 5 ′ end of a probe oligonucleotide.

The term "substantially single stranded" when used with reference to a nucleic acid substrate

It means that the substrate molecule exists primarily as a single nucleic acid helix compared to a double stranded substrate that exists as two nucleic acid chains when held together by intercatenary base pairing interactions.

The term "sequence variation" as used herein refers to differences in the nucleic acid sequence between two nucleic acids. For example, a wild-type structural gene and a mutant form of this wild-type structural gene may vary in sequence by the presence of substitutions of a single base and / or deletions or insertions of one or more nucleotides. He says that these two forms of the structural gene vary in sequence with each other. There may be a second mutant form of the structural gene. It is said that this second mutant form varies in sequence from both the wild type gene and the first mutant form of the gene.

The term "release" as used herein refers to the release of a nucleic acid fragment from a major nucleic acid fragment, such as an oligonucleotide, by the action of a 5 'nuclease such that the released fragment is no longer covalently bound to the rest of the oligonucleotide.

The term "Km" as used herein refers to the Michaelis-Menten constant for an enzyme

defined as the concentration of the specific substrate at which a given enzyme produces half its maximum speed in an enzyme catalyzed reaction.

The term "nucleotide analog" as used herein refers to modified or unnatural nucleotides such as 7-desaza purines (ie, 7-desaza-dATP and 7-desaza-dGTP). Nucleotide analogs include base analogs and comprise modified forms of deoxyribonucleotides as well as ribonucleotides.

The term "polymorphic locus" is a locus present in a population that shows variation among members of the population (that is, the most common allele has a frequency of less than 0.95). On the contrary, a "monomorphic locus"

It is a genetic locus with few or no variations observed among members of the population (it is generally assumed that it is a locus in which the most common allele exceeds a frequency of 0.95 in the population gene group).

The term "microorganism" as used herein refers to an organism too small to be observed with the naked eye and includes, but is not limited to, bacteria, viruses, protozoa, fungi and ciliates.

The term "microbial gene sequences" refers to gene sequences obtained from a microorganism.

The term "bacterium" refers to any bacterial species including eubacterial and

archaebacteria

The term "virus" refers to bound intracellular parasites, ultramicroscopic, unable to replicate

autonomous (that is, replication requires the use of host cell machinery).

The term "multi-drug resistant" or "with multiple drug resistance" refers to a microorganism

which is resistant to more than one of the antibiotics or antimicrobial agents used in the treatment of said microorganism.

The term "sample" in the present specification and the claims is used in its broadest sense. By

On the one hand, it is meant to include a specimen or culture (eg, microbiological cultures). On the other hand, it is meant to include both biological and environmental samples. A sample may include a specimen of synthetic origin.

Biological samples may be animals, including human, fluid, solid (eg, feces) or tissue, as well as liquid and solid foods and food products and ingredients such as dairy, vegetable, meat and meat by-products and wastes. Biological samples can be obtained from all the various families of domestic animals, as well as wild or wild animals, including, among others, animals such as ungulates, bears, fish, lagomorphs, rodents, etc.

Environmental samples include environmental material such as surface material, soil, water and industrial samples as well as samples obtained from food and dairy processing instruments, appliances, equipment, utensils, disposable and non-disposable items. These examples do not have to be considered as limiting the sample types applicable to the present invention.

The term "source of target nucleic acid" refers to any sample containing nucleic acids (RNA or

DNA) Particularly preferred sources of target nucleic acids are biological samples including, among others, blood, saliva, cerebrospinal fluid, pleural fluid, milk, lymph, sputum and semen.

It is said that an oligonucleotide is present in "excess" with respect to another oligonucleotide (or acid sequence

target nucleic) if that oligonucleotide is present in a higher molar concentration than the other oligonucleotide (or target nucleic acid sequence). When an oligonucleotide such as a probe oligonucleotide is present in an excess cleavage reaction with respect to the concentration of the complementary target nucleic acid sequence, the reaction can be used to indicate the amount of the target nucleic acid present. Typically, when present in excess, the probe oligonucleotide will be present in a molar excess of at least 100 times; Typically at least 1 pmol of each probe oligonucleotide would be used when the target nucleic acid sequence was present with approximately 10 fmol or less.

A sample that is "suspected of containing" a first and a second target nucleic acid may contain

any, both or no target nucleic acid molecule.

The term "load-balanced" oligonucleotide refers to an oligonucleotide (the input oligonucleotide in

a reaction) that has been modified such that the modified oligonucleotide carries a charge, such that when the modified oligonucleotide is cleaved (ie shortened) or prolonged, a resulting product carries a different charge than the input oligonucleotide (the "unbalanced load" oligonucleotide), thereby allowing separation of the input oligonucleotides and those that have reacted based on the charge. The term "load balanced" does not imply that the modified or balanced oligonucleotide has a net neutral charge (although this may be the case). Load balancing refers to the design and modification of an oligonucleotide so that a specific reaction product generated by this input oligonucleotide can be separated based on the charge of the input oligonucleotide.

For example, in an INVASOR-directed cleavage test in which the probe oligonucleotide carries the sequence: 5 'TTCTTTTCACCAGCGAGACGGG 3' (i.e., SEQ ID No. 61 without the modified bases) and the excision of the probe takes place between the second and third rest, a possible load balanced version of this oligonucleotide would be: 5 'Cy3-AminoT-Amino-TCTTTTCACCAGCGAGAC GGG 3'. This modified oligonucleotide carries a net negative charge. After cleavage the following oligonucleotides are generated: 5 'Cy3-AminoT-Amino-T 3' and 5 'CTTTTCAC-CAGCGAGACGGG 3' (residues 3-22 of SEQ ID NO: 61). The 5 'Cy3-AminoT-Amino-T 3' carries a detectable moiety (the positively charged Cy3 dye) and two amino-modified bases. The amino-modified bases and the Cy3 dye contribute with positive charges greater than the negative charges contributed by the phosphate groups and, therefore, the oligonucleotide 5’-Cy3-AminoT-Amino-T-3 ’has a positive net charge. The other longer excision fragment, such as the input probe, carries a negative net charge. Because the 5’-Cy3AminoT-Amino-T-3 ’fragment can be separated based on the charge of the input probe (the load-balanced oligonucleotide), it is called the unbalanced load oligonucleotide. The longer cleavage product cannot be separated based on the input oligonucleotide charge since both oligonucleotides carry a net negative charge; therefore, the longest cleavage product is not an unbalanced load oligonucleotide.

The term "net neutral charge" when used with reference to an oligonucleotide, including oligonucleotides

modified, indicates that the sum of the charges present (ie, R-NH3 + groups in thymidines, the cytosine N3 nitrogen, presence or absence of phosphate groups, etc.) under the desired reaction conditions is essentially zero. An oligonucleotide that has a net neutral charge would not migrate in an electric field.

The term "net positive charge" when used with reference to an oligonucleotide, including modified oligonucleotides, indicates that the sum of the charges present (ie, R-NH3 + groups in thymidines, the cytosine N3 nitrogen, presence or absence of groups phosphate, etc.) under the desired reaction conditions is essentially +1

or older. An oligonucleotide that has a positive neutral charge would migrate to the negative electrode in an electric field.

The term "net negative charge" when used with reference to an oligonucleotide, including modified oligonucleotides, indicates that the sum of the charges present (ie, R-NH3 + groups in thymidines, the cytosine N3 nitrogen, presence or absence of groups phosphate, etc.) under the desired reaction conditions is essentially -1

or older. An oligonucleotide that has a negative neutral charge would migrate to the positive electrode in an electric field.

The term "polymerization media" or "polymerization agent" refers to any agent capable of facilitating the addition of nucleoside triphosphate to an oligonucleotide. Preferred polymerization media comprise DNA and RNA polymerases.

The term "ligation medium" or "ligation agent" refers to any agent capable of facilitating ligation (ie, the formation of a phosphodiester bond between an OH 3 'and a P 5' located at the ends of two chains from

nucleic acid). Preferred ligation media comprise DNA ligases and RNA ligases.

The term "reactant" is used herein in its broadest sense. The reactant may comprise, for example, an enzymatic reactant, a chemical reactant or ultraviolet light (it is known that ultraviolet light, particularly short wavelength ultraviolet light breaks oligonucleotide chains). In the term

"Reactant" includes any agent capable of reacting with an oligonucleotide to shorten (ie,

cleave) or prolong the oligonucleotide.

The term "adduct" is used herein in its broadest sense to indicate any compound or element that may be added to an oligonucleotide. An adduct may be charged (positively or negatively) or it may have a neutral charge. An adduct can be added to the oligonucleotide by covalent or non-covalent bonds. Examples of adducts include, but are not limited to, amidites with an indodicarbocyanine dye, amino-substituted nucleotides, ethidium bromide, ethidium homodimer (1,3-propanediamine) propidium, (diethylenetriamine) propidium, triazole orange, (N-N 'orange -tetramethyl-1,3-propanediamino) propyl triazole, (N-N'-tetramethyl-1,2-ethanediamine) propyl triazole orange, triazole-orange triazole orange homodimer (TOTO), thiazole-orange orange heterodimer of thiazole (TOTAB), triazol-ethidium orange heterodimer 1 (TOED1), thiazol-ethidium orange heterodimer 2 (TOED2) and fluorescein-ethidium (FED) heterodimer, psoralen, biotin, streptavidin, avidin, etc.

When a first oligonucleotide is complementary to a region of a target nucleic acid and a second

oligonucleotide has complementarity with the same region (or a part of this region), there is an "overlapping region" along the target nucleic acid. The degree of overlap will vary depending on the nature of the complementarity (see, for example, region "X" in Figures 29 and 67 and the accompanying discussions).

As used herein, the term "purified" or "to purify" refers to the removal of contaminants from a sample. For example, Cleavase® recombinant nucleases are expressed in bacterial host cells and nucleases are purified by removing host cell proteins; in this way the percentage of these nucleases in the sample is increased.

The term "recombinant DNA molecule" as used herein refers to a DNA molecule.

comprising segments of DNA linked together by molecular biology techniques.

The term "recombinant protein" or "recombinant polypeptide" as used herein refers to a

Protein molecule that is expressed from a recombinant DNA molecule.

As used herein, the term "part" when referring to a protein (as in "a part of a given protein") refers to fragments of that protein. The fragments can vary in size from four amino acid residues to the entire amino acid sequence minus one amino acid (eg, 4, 5, 6, ..., n-1).

The term "nucleic acid sequence" as used herein refers to an oligonucleotide, nucleotide or polynucleotide and fragments or parts thereof and to DNA or RNA of genomic or synthetic origin that can be single or double stranded and represents the chain with sense or antisense. Similarly, "amino acid sequence" as used herein refers to peptide or protein sequence.

The term "peptide nucleic acid" ("PNA") as used herein refers to a molecule comprising bases or base analogs such as those that would be found in natural nucleic acid but bound to a peptide framework instead of to the sugar-phosphate framework typical of nucleic acids. The binding of the bases to the peptide is such that it allows the bases to be paired with complementary nucleic acid bases in a manner similar to that of an oligonucleotide. These small molecules, also called antigenic agents, stop the prolongation of the transcript by binding to its complementary nucleic acid chain [Nielsen et al. Anticancer Drug Des. 8:53 63 [1993]).

As used herein, the terms "purified" or "substantially purified" refer to molecules

either nucleic acid or amino acid sequences, which are removed from their natural environment, are isolated or separated and are at least 60% free, preferably 75% free and much more preferably 90% free from others.

components with which they are associated naturally. Therefore, an "isolated polynucleotide" or "isolated oligonucleotide" is a substantially purified polynucleotide.

An isolated oligonucleotide (or polynucleotide) encoding a Pyrococcus woesei (Pwo) FEN-1 endonuclease that has a region capable of hybridizing with SEQ ID NO: 116 is an oligonucleotide containing sequences encoding at least the amino-terminal part of Pwo FEN-1 endonuclease. An isolated oligonucleotide (or polynucleotide) encoding a Pwo FEN-1 endonuclease that has a region capable of hybridizing with SEQ ID NO: 117 is an oligonucleotide containing sequences encoding at least the carboxy-terminal part of the FEN-1 endonuclease from Pwo. An isolated oligonucleotide (or polynucleotide) encoding a Pwo FEN-1 endonuclease that has a region capable of hybridizing with SEQ ID NO: 118 and 119 is an oligonucleotide that contains sequences encoding at least parts of the FEN-1 endonuclease protein Internally located Pwo of the amino or carboxy terminus of a FEN-1 Pwo endonuclease protein.

As used herein, the term "fusion protein" refers to a chimeric protein that contains the protein of interest (ie, Cleaase® BN nuclease / thrombin and parts or fragments thereof) attached to an exogenous protein fragment. (the fusion partner consisting of a non-Cleavase® BN / thrombin nuclease protein). The fusion partner can improve the solubility of the recombinant chimeric protein (for example, the Cleaase® BN / thrombin nuclease) when expressed in a host cell, can provide an affinity marker (for example, a his marker) to allow Purification of the recombinant fusion protein from the host cell or culture supernatant or both. If desired, the fusion protein can be removed from the protein of interest (eg, Cleaase® BN nuclease / thrombin or fragments thereof) by a variety of enzymatic or chemical means known in the art.

As used herein, the terms "chimeric protein" and "chimeric protein" refer to

a single protein molecule comprising parts of amino acid sequences obtained from two or more precursor proteins. These precursor molecules can be of similar proteins of genetically distinct origins, different proteins of a single organism or different proteins of different organisms. By way of example but not by way of limitation, the chimeric structure-specific nuclease of the present invention may contain a mixture of amino acid sequences that have been obtained from FEN-1 genes of two or more of the organisms that have such genes, combined to form a nuclease of unnatural origin. The term "chimeric," as used herein, is not intended to convey any particular proportion of contribution from naturally occurring genes or limit the way in which the parts are combined. Any nuclease construct with specificity of chimeric structure that has cleavage activity as determined by the test procedures described herein is an improved cleavage agent that falls within the scope of the present invention.

The term "continuous nucleic acid strand", as used herein, means a strand of nucleic acid having a covalently bonded continuous framework structure, without notches or tears. The arrangement of the base part of each nucleotide, paired, single stranded or with mismatches, is not an element in the definition of a continuous strand. The framework of the continuous strand is not limited to the ribose-phosphate or deoxyribose-phosphate compositions found in nature, unmodified nucleic acids. A nucleic acid of the present invention may comprise modifications of the structure of the

framework, including but not limited to phosphorothioate residues, phosphonate residues, 2-substituted ribose residues (e.g., 2-O'-methyl ribose) and residues containing alternative sugar (e.g. arabinose) .

The term "continuous duplex," as used herein, refers to a region of nucleic acid.

double stranded in which there is no break in the progression of the base pairs in the duplex (i.e., the base pairs along the duplex are not distorted to accommodate a gap, protrusion or mismatch in the confines of the region of the continuous duplex). As used herein, the term refers only to the arrangement of the base pairs within the duplex, without implication of continuity in the shell portion of the nucleic acid strand. Duplex nucleic acids with uninterrupted base pairing, but notched in one or both strands are within the definition of a continuous duplex.

The term "duplex" refers to the state of nucleic acids in which the base parts of nucleotides in

A strand is joined through hydrogen bonds that join its complementary bases arranged in a second strand. The condition of being in a duplex form is reflected in the state of the bases of a nucleic acid. By virtue of base pairing, nucleic acid strands also generally assume the tertiary structure of a double helix having a larger and a smaller groove. The assumption of the helical form is implicit in the action of forming a duplex.

The term "duplex dependent protein binding" refers to the binding of proteins to nucleic acid.

dependent on the nucleic acid being in a duplex or helical shape.

The expression "duplex-dependent protein binding sites or regions", as used herein,

refers to regions or small sequences within a nucleic acid that are bound with a specific affinity by specific duplex-dependent nucleic acid binding proteins. This contrasts with the general duplex-dependent binding of proteins that are not site specific, such as histone proteins that bind to chromatin with little reference to specific sequences or sites.

The term "protein binding region", as used herein, refers to an acid region.

nucleic identified by the union of a sequence or structure to a specific protein or class of proteins. It is within the scope of this definition to include regions that contain sufficient genetic information to allow identification of the region by comparison with known sequences, but which may not have the structure required for real binding (e.g., a single strand of a nucleic acid binding protein site dependent on

duplex). As used herein, "" protein binding region "excludes regions of binding to

restriction endonucleases.

The term "complete double stranded protein binding region", as used herein, refers to

the minimum continuous duplex region required to allow binding or other activity of a duplex dependent protein. This definition is intended to cover the observation that some duplex-dependent nucleic acid binding proteins can interact with full activity with the duplex regions that may be shorter than a canonical protein binding region as observed in one or the other. of the two simple strands. In other words, one or more nucleotides in the region can be left unpaired without suppressing the

Union. As used herein, the term "complete double stranded binding region" refers to the

minimum sequence that will host the binding function. Since some of these regions can tolerate non-duplex sequences in multiple locations, although not necessarily simultaneously, a single protein-binding region could have several shorter subregions that, when in duplex, will be fully competent for protein binding.

The term "template" refers to a strand of nucleic acid on which a complementary copy is manufactured with

nucleoside triphosphate through the activity of a template-dependent nucleic acid polymerase. within a

Duplex, the template strand is represented and described, by consensus, as the "bottom" strand. Similarly, the non-mold strand is often depicted and described as the "superior" strand.

The term "template-dependent RNA polymerase" refers to a nucleic acid polymerase that creates new

strands of RNA by copying a template strand as described above and which does not synthesize RNA in the absence of a template. This contrasts with the activity of template independent nucleic acid polymerases that synthesize or extend nucleic acids without reference to a template, such as terminal deoxynucleotidyltransferase or PolyA polymerase.

The term "STOP molecule" refers to an agent added or included in an invasive excision reaction.

in order to stop the participation of one or more reaction components in a subsequent action or reaction. This can be done by sequestering or inactivating some component of the reaction (eg, by binding or base pairing of a nucleic acid component or by binding to a protein component). The term "STOP oligonucleotide" refers to an oligonucleotide included in an invasive cleavage reaction in order to stop or stop one or more aspects of any reaction (eg, the first reaction and / or any subsequent reaction or action; no it is intended that the STOP oligonucleotide be limited to no particular reaction or reaction step). This can be done by sequestering some component of the reaction (eg, by pairing bases with another nucleic acid or by binding to a protein component). However, it is not intended to limit the expression only to situations in which the reaction component is sequenced.

As used herein, the term "kit" refers to any release system to release

materials. In the context of the reaction assays, said release systems include systems that allow the storage, transport or release of reaction reagents (e.g., oligonucleotides, enzymes etc. in suitable containers) and / or support materials ( e.g., buffers, written instructions for testing etc.) from one place to another. For example, the kits include one or more containers (eg, boxes) containing the relevant reaction reagents and / or support materials. As used herein, the term "fragmented kit" refers to release systems comprising two or more separate containers, each of which

which contains a subportion of all kit components. The containers can be released in the intended container together or separately. For example, a first container can contain an enzyme to use

in one test, while a second container contains oligonucleotides. With the expression “fragmented kit” you

It is intended to cover kits that contain specific analyte reagents (OER) regulated in section 520 (e) of the Federal Food, Drug and Cosmetic Act, but are not limited to them. In fact, any release system comprising two or more separate containers, each of which contains a subportion of

All kit components are included in the expression “fragmented kit”. In contrast to this, a "combined kit" refers to a release system that contains all the components of a reaction test in a single container (eg, in a single box each of the desired components). The term "kit" includes the

kits both fragmented and combined.

As used herein, the term "functional domain" refers to a region, or a part of a region, of a protein (eg, an enzyme), which provides one or more functional characteristics of the protein. . For example, a functional domain of an enzyme can provide, directly or indirectly, one or more enzyme activities, including, but not limited to, the substrate binding capacity and catalytic activity. A functional domain can be characterized by the mutation of one or more amino acids within the functional domain, in which the mutation of the amino acid (s) alters the associated functionality (measured empirically in an assay), so that it indicates the presence of a functional domain.

As used herein, the term "heterologous functional domain" refers to a functional domain that is not in its natural environment. For example, a heterologous functional domain includes a functional domain of an enzyme introduced into another enzyme. A heterologous functional domain also includes a native functional domain of a protein that has been altered in some way (eg, mutated, added in multiple copies, etc.). A heterologous functional domain may comprise a plurality of contiguous amino acids or may include two or more distant amino acids amino acid fragments (eg, two or more amino acids or fragments with non-heterologous interposed sequence). The heterologous functional domains are distinguished from the endogenous functional domains in which the heterologous amino acid (s) are linked to amino acid sequences that are not naturally associated with nature's amino acid sequence or that are associated with a portion of a protein that is not in nature.

As used herein, the term "altered functionality in an amino acid cleavage assay" refers to a characteristic of an enzyme that has been altered in some way to differ from its

natural state (e.g., differ from how it is found in nature). Alterations include, among others, the addition of a heterologous functional domain (eg, by mutation or by the creation of chimeric proteins). In some embodiments, the altered enzyme characteristic may be one that improves the performance of an enzyme in a nucleic acid cleavage assay. Types of improvements include, among others, improvement of nuclease activity (e.g., improvement of reaction rate), improvement of substrate binding (e.g., increase or decrease in the binding of certain species of nucleic acid [eg, RNA or DNA] that produces a desired result [eg, greater specificity, improved substrate turnover etc.]) and improved background specificity (eg, less product is produced not wanted). The present invention is not limited by the nucleic acid cleavage assay to analyze the improvement of functionality. However, in some preferred embodiments of the present invention an invasive cleavage assay is used as the nucleic acid cleavage assay. In certain particularly preferred embodiments, an invasive cleavage assay using a target RNA is used as the nucleic acid cleavage assay.

As used herein, the terms "N-terminal" and "C-terminal" in reference to polypeptide sequences refer to regions of polypeptides that include portions of the -terminal and C-terminal regions of the polypeptide, respectively. A sequence that includes a portion of the N-terminal region of the polypeptide includes amino acids predominantly from the N-terminal half of the polypeptide chain, but is not limited to such sequences. For example, an N-terminal sequence may include an inner portion of the polypeptide sequence that includes both N-terminal and C-terminal half bases of the polypeptide. The same applies to regions in C-terminal. The N-terminal and C-terminal regions may include, but not necessarily, the amino acids that define the last N-terminal and C-terminal ends of the polypeptide, respectively.

As used herein, the term "detection panel" refers to a substrate or device that contains at least two unique candidate detection assays configured for target detection.

Description of the drawings

The invention is defined in the claims. Fig. 1 is a comparison of the nucleotide structure of DNAP genes isolated from Thermus aquaticus (SEC

ID No. 1), Thermus flavus (SEQ ID No. 2) and Thermus thermophilus (SEQ ID No. 3); the consensus sequence (SEQ ID NO. 7) is shown at the top of each row. Fig. 2 is a comparison of the amino acid sequence of DNAP isolated from Thermus aquaticus (SEQ ID NO.

4), Thermus flavus (SEQ ID No. 5) and Thermus thermophilus (SEQ ID No. 6); the consensus sequence (SEQ ID NO. 8) is shows at the top of each row. Figures 3A-G are a set of DNAPTaq gene diagrams of wild type and with poor synthesis. Fig. 4A depicts the wild-type Thermus flavus polymerase gene.

Fig. 4B depicts the Thermus flavus polymerase gene with poor synthesis. Figure 5 illustrates a structure that cannot be amplified using DNAP Taq; This figure shows SEQ ID NO. 17 (primer) and SEQ ID No. 15 (fork).

Figure 6 is a gel stained with ethidium bromide demonstrating attempts to amplify a bifurcated duplex using

either DNAPTaq or DNAPStf (that is, the Stoffel fragment of DNAPTaq). Figure 7 is an autoradiogram of a gel that analyzes the excision of a duplex branched by DNAPTaq and absence of excision by DNAPStf

Figures 8A-B are a set of autoradiograms of gels that analyze excision or absence of excision after addition of different reaction components and incubation temperature change during attempts to split a bifurcated duplex with DNAPTaq.

Figures 9A-B are an autoradiogram showing excision reactions synchronized with and without primer.

Figures 10 A-B are a set of autoradiograms of gels demonstrating attempts to split a duplex branched (with and without primer) with various DNAP. Figure 11A shows the substrates and oligonucleotides (19-12 [SEQ ID No. 18] and 30-12 [SEQ ID No. 19]) used for

assay the specific cleavage of substrate DNA directed by pilot oligonucleotides.

Figure 11B shows an autoradiogram of a gel showing the results of cleavage reactions using the substrates and oligonucleotides shown in Figure 12A. Figure 12A shows the substrates and oligonucleotides (30-0 [SEQ ID NO. 20] used to test the cleavage

RNA-specific substrate directed by a pilot oligonucleotide.

Figure 12B shows an autoradiogram of a gel showing the results of a cleavage reaction. using the substrate and oligonucleotide shown in Figure 13A. Figure 13 is a diagram of the vector pTTQ18. Figure 14 is a diagram of the vector pET-3c. Figures 15A-E illustrate a set of molecules that are suitable substrates for activity cleavage

DNAP nuclease 5 '(SEQ ID NOS 15 and 17 are represented in Figure 15E).

Figure 16 is an autoradiogram of a gel showing the results of a cleavage reaction performed with DNAP deficient in synthesis. Figure 17 is an autoradiogram of a PEI chromatogram that separates the products of an assay for

synthetic activity in DNAPTaq clones deficient in synthesis. Figure 18A illustrates the substrate molecule (SEQ ID NO. 15 and 17) used to test DNAP capacity.

deficient in synthesis to cleave short fork structures.

Figure 18B shows an autoradiogram of a gel that separates the products of a cleavage reaction performed using the substrate shown in Figure 19A.

Figure 19 provides the complete 206 unit oligomer duplex sequence (SEQ ID No. 27) employed

as a substrate for the 5 ’nucleases of the present invention.

Figures 20A and B show the cleavage of linear nucleic acid substrates (based on the 206 unit oligomers of Figure 21) by wild-type DNAP and 5 ’nucleases isolated from Thermus aquaticus and Thermus flavus.

Figure 21A shows the "clipping" phenomenon detected with the DNAPs of the present invention.

Figure 21B shows that the "clipping" of Figure 21A is 5 ’nucleolytic cleavage and not phosphatase cleavage.

Figure 22 demonstrates that the phenomenon of "clipping" depends on duplex.

Figure 23 is a scheme that shows how "clipping" can be used in a screening test.

Figures 24A and B demonstrate that "clipping" can be directed by target.

Figure 25 provides a schematic drawing of a target nucleic acid with an INVASOR oligonucleotide and a probe oligonucleotide hybridized with the target.

Figure 26 provides a scheme showing the fork oligonucleotide S-60 (SEQ ID No. 29) with the hybridized P-15 oligonucleotide (SEQ ID No. 30).

Figure 27 is an autoradiogram of a gel showing the results of a cleavage reaction performed using the S-60 hairpin in the presence or absence of the P-15 oligonucleotide.

Figure 28 provides a scheme showing three different arrangements of target specific oligonucleotides and their hybridization with a target nucleic acid that also hybridizes thereto with a probe oligonucleotide (SEQ ID NO: 31-35).

Figure 29 is the image generated by an apparatus for fluorescent imaging showing that the presence of an INVASOR oligonucleotide causes a displacement at the cleavage site in a probe / target duplex.

Figure 30 is the image generated by an fluorescent imaging apparatus showing the products of invasive-directed cleavage assays performed using the three target-specific oligonucleotides outlined in Figure 28.

Figure 31 is the image generated by an fluorescent imaging apparatus showing the products of INVASOR oligonucleotide-directed cleavage assays performed in the presence or absence of non-target nucleic acid molecules.

Figure 32 is the image generated by an fluorescent imaging apparatus showing the products of INVASOR oligonucleotide-directed cleavage assays performed in the presence of decreasing amounts of target nucleic acid.

Figure 33 is the image generated by an fluorescent imaging apparatus showing the products of INVASOR oligonucleotide-directed cleavage assays performed in the presence or absence of saliva extract using various thermostable 5 ’nucleases or DNA polymerases.

Figure 34 is the image generated by an apparatus for fluorescent imaging showing the

Invasive-directed cleavage assay products performed using various 5 ’nucleases.

Figure 35 is the image generated by an fluorescent imaging apparatus showing the products of invasive oligonucleotide-directed cleavage assays performed using two target nucleic acids that differ on a single base pair at two different reaction temperatures.

Figure 36A provides a scheme showing the effect of elevated temperature on hybridization and excision of a probe oligonucleotide along a target nucleic acid in which the probe contains a region of non-complementarity with the target.

Figure 36B provides a scheme showing the effect of adding an upstream oligonucleotide after hybridization and excision of a probe oligonucleotide along a target nucleic acid in which the probe contains a region of non-complementarity with the target .

Figure 37 provides a scheme showing an arrangement of a target specific INVASOR oligonucleotide (SEQ ID NO: 39) and a target specific probe oligonucleotide (SEQ ID NO: 38) bearing a 5 'Cy3 marker along an acid target nucleic (SEQ ID NO: 31).

Figure 38 is the image generated by an fluorescent imaging apparatus showing the products of INVASOR oligonucleotide-directed cleavage assays performed in the presence of increasing concentrations of KCl.

Figure 39 is the image generated by an fluorescent imaging apparatus showing the products of INVASOR oligonucleotide-directed cleavage assays performed in the presence of increasing concentrations of MnCl2 or MgCl2.

Figure 40 is the image generated by an fluorescent imaging apparatus showing the products of INVASOR oligonucleotide-directed cleavage assays performed in the presence of increasing amounts of genomic DNA or tRNA.

Figure 41 is the image generated by an fluorescent imaging apparatus showing the products of invasive-directed cleavage assays performed using an HCV RNA target.

Figure 42 is the image generated by an fluorescent imaging apparatus showing the products of INVASOR oligonucleotide-directed cleavage assays performed using an HCV RNA target and demonstrates the stability of RNA targets under cleavage assay conditions. directed by INVASOR oligonucleotide.

Figure 43 is the image generated by an fluorescent imaging apparatus showing the sensitivity of detection and stability of RNA in INVASOR oligonucleotide-directed cleavage assays performed using an HCV RNA target.

Figure 44 is the image generated by an apparatus for fluorescent imaging that shows thermal degradation of oligonucleotides containing or lacking a 3 'phosphate group.

Figure 45 illustrates the structure of amino-modified oligonucleotides 70 and 74.

Figure 46 illustrates the structure of amino-modified oligonucleotides 75.

Figure 47 illustrates the structure of amino-modified oligonucleotides 76.

Figure 48 is the image generated by an apparatus scan for fluorescent imaging of an IEF gel showing substrate migration 70, 70dp, 74, 74dp, 75, 75dp, 76 and 76dp.

Figure 49A provides a scheme showing an arrangement of an INVASOR oligonucleotide specific for

target (SEQ ID No. 50) and a target specific oligonucleotide probe (SEQ ID NO: 51) bearing a Cy3 5 ’marker

along a target nucleic acid (SEQ ID NO: 52).

Figure 49B is the image generated by an apparatus for fluorescent imaging that shows the detection of specific cleavage products generated in an invasive excision assay using load inversion (i.e., load-based separation of cleavage products).

Figure 50 is the image generated by an apparatus for fluorescent imaging that shows the sensitivity of detection of specific cleavage products generated in an invasive excision assay using charge inversion.

Figure 51 illustrates a first embodiment of a device for load-based separation of oligonucleotides.

Figure 52 illustrates a second embodiment of a device for load-based separation of oligonucleotides.

Figure 53 shows an autoradiogram of a gel showing the results of cleavage reactions performed in the presence or absence of a primer oligonucleotide; A sequencing scale is shown as a size marker.

Figures 54A-D illustrate four pairs of oligonucleotides; In each pair shown, the upper arrangement of a probe hybridized with a target nucleic acid lacks an upstream oligonucleotide and the lower arrangement contains an upstream oligonucleotide (SEQ ID NOS. 32 and 54-58 are shown in Figures 54A-D ).

Figure 55 shows the chemical structure of several positively charged heterodimeric DNA binding dyes.

Figure 56 is a scheme showing alternative procedures for the prolongation and detection of specific cleavage products in the context of the INVASOR-directed cleavage test.

Figure 57 provides a schematic drawing of a target nucleic acid with an INVASOR oligonucleotide, a minison and a stacking oligonucleotide hybridized with the target.

Figure 58 provides a space fill model of the 3-dimensional structure of the 5 ′ T5 exonuclease.

Figure 59 provides an alignment of the amino acid sequences of several FEN-1 nucleases including Methanococcus jannaschii FEN-1 protein (MJAFEN1.PRO), Pyrococcus furiosus FEN-1 protein (PFUFEN1.PRO), FEN- protein 1 human (HUMFEN1.PRO), mouse FEN-1 protein (MUSFEN1.PRO), YKL510 protein from Saccharomyces cerevisiae (YST510.PRO), RAD2 protein from Saccharomyces cerevisiae (YSTRAD2.PRO), RAD13 protein from Shizosaccharomyces Pombe (SPORAD13.PRO), human XPG protein (HUMXPG.PRO), mouse XPG protein (MUSXPG.PRO), Xenopus laevis XPG protein (XENXPG.PRO) and C. elegans RAD2 protein (CELRAD2. PRO); Parts of the amino acid sequence of some of these proteins were not shown to maximize protein alignment (specifically amino acids 122 to 765 of the YSTRAD2 sequence were deleted; amino acids 122 to 746 of the SPORAD13 sequence were deleted; amino acids 122 to 757 of the HUMXPG sequence were deleted, amino acids 122 to 770 of the MUSXPG sequence were deleted; and amino acids 122 to 790 of the XENXPG sequence were deleted). The numbers to the left of each sequence line refer to the amino acid residue number; dashed lines represent gaps introduced to maximize alignment.

Figure 60 is a scheme showing oligonucleotides S-33 (SEQ ID No. 84) and 11-8-0 (SEQ ID No. 85) in a folded configuration, the cleavage site is indicated by the arrowhead.

Figure 61 shows a Coomassie-stained SDS-PAGE gel showing digestion with Cleavase® BN thrombin / thrombin.

Figure 62 is the image generated by an fluorescent imaging apparatus showing the products produced by cleavage of the S-60 fork using Cleavase® BN / thrombin (before and after digestion with thrombin).

Figure 63 is the image generated by an fluorescent imaging apparatus showing the products produced by the cleavage of circular M13 DNA using Cleavase® BN / thrombin.

Figure 64 is an SDS-PAGE gel showing the migration of purified Cleavase® BN nuclease migration, FEN-1 from Pfu, FEN-1 from Pwo and FEN-1 from Mja.

Figure 65 is the image generated by an fluorescent imaging apparatus showing the products produced by the cleavage of oligonucleotides S-33 and 11-8-0 by Cleavase® BN and Mja FEN-1 nucleases.

Figure 66 is the image generated by an apparatus for fluorescent imaging that shows the products produced by the incubation of an oligonucleotide that has or lacks a 3'-OH group with TdT.

Figure 67 is the image generated by an apparatus for fluorescent imaging showing the products produced by incubation of cleavage products with TdT.

Figure 68 is a photograph of a GeneCombTM Universal card showing the capture and detection of cleavage products on a nitrocellulose support.

Figure 69 is the image generated by an apparatus for fluorescent imaging showing the products produced using Pfu Cleavase® A / G and FEN-1 nucleases and a fluorescein labeled probe.

Figure 70 is the image generated by an fluorescent imaging apparatus showing the products produced using Pfu Cleavase® A / G and FEN-1 nucleases and a Cy3 labeled probe.

Figure 71 is the image generated by an apparatus for fluorescent imaging showing products produced using Pfu Cleavase® A / G and FEN-1 nucleases and a TET labeled probe.

Figures 72A and 72B are images generated by an apparatus for the formation of fluorescent images showing the products produced using the Cleavase® A / G nucleases and the PEN FEN-1s and probes that have or lack a positive charge 5 ' ; the gel shown in Figure 83A was processed in the conventional direction and the gel shown in Figure 84B which was processed in the reverse direction.

Figure 73 shows the structure of 3-nitropyrrole and 5-nitroindole.

Figure 74 shows the sequence of oligonucleotides 109, 61 and 67 (SEQ ID No. 97, 50 and 51) hybridized in a cleavage structure as well as the sequence of oligonucleotide 67 (SEQ ID No. 51) and a compound of SEQ ID No. 98, 99, 101 and 102.

Figures 75A-C show images generated by an apparatus for fluorescent imaging that show the products produced in an INVASOR oligonucleotide-directed cleavage test conducted at various temperatures using a mini-wave that is completely complementary to the target or contains a single pairing. wrong with the target.

Figure 76 shows the sequence of oligonucleotides 166 (SEQ ID No. 103), 165 (SEQ ID No. 104), 161 (SEQ ID No. 106), 162 (SEQ ID No. 105) and 164 (SEQ ID No. 107) as well as a split structure.

Figure 77 is the image generated by an fluorescent imaging apparatus showing the products of INVASOR oligonucleotide-directed cleavage assays performed using ras gene sequences such as the target.

Figures 78A-C show the fork sequence S-60 (SEQ ID No. 29) (A) and oligonucleotide P-15 (SEQ ID No. 30) (shown hybridized with the fork S-60 in B) and the image generated by an apparatus for the formation of fluorescent images showing the products produced by the cleavage of the S-60 hairpin in the presence of various INVASOR oligonucleotides.

Figure 79 shows the structure of various 3 'end substituents.

Figure 80 is a composite graph showing the effect of probe concentration, temperature and a stacking oligonucleotide on minison wave cleavage.

Figure 81 shows the sequence of the IT-2 oligonucleotide (SEQ ID No. 115; shown in a folded configuration) as well as the sequence of the IT-1 (SEQ ID No. 116) and IT-A (SEQ ID No. 117) oligonucleotides. .

Figure 82 is the image generated by an apparatus for fluorescent imaging showing the products produced by the oligonucleotides shown in Figure 92 by nuclease Cleavase® A / G.

Figure 83 is the image generated by an apparatus for fluorescent imaging that provides a comparison of cleavage rates by Pfu and Mja FEN-1 nucleases.

Figure 84 shows the image generated by an apparatus for fluorescent imaging that illustrates the detection of RNA targets using a mini-wave and stacking oligonucleotides.

Figures 85A-C provide schemes showing concrete embodiments of the present invention, in which a T7 promoter region and the template copy hybridized with no oligonucleotide (A), an oligonucleotide

complete promoter (B) or a complete promoter oligonucleotide with a 3 'tail (C); a strand of the region

T7 promoter is indicated with the dashed line.

Figures 86A-D provide schemes showing concrete embodiments of the present invention, in which a T7 promoter region and the template copy hybridized with a cutting probe (A), a partial promoter oligonucleotide (B), an oligonucleotide without cut (C) or an uncut probe and a partial promoter oligonucleotide (D).

Figure 87 provides a scheme illustrating an embodiment of the present invention in which a template-dependent DNA polymerase is used to extend a cut probe to complete a T7 promoter region and thereby allow transcription.

Figure 88 provides a scheme illustrating that an uncut probe combined with a partial promoter oligonucleotide does not allow transcription, while a cut probe combined with a partial promoter oligonucleotide generates a complete (but notched) promoter that supports transcription.

Figure 89 shows the image generated by an apparatus for fluorescent imaging that shows that the primer extension can be used to complete a partial promoter formed by a cut probe (lanes 1-5) and that hybridize a cut probe generated in An invasive excision assay can complete a partial T7 promoter to allow transcription (lanes 6-9).

Figures 90A-C provide schemes showing concrete embodiments of the present invention that

illustrate that the use of a partial promoter oligonucleotide with a paired tail 5 ’can be used to block

transcription of a compound promoter formed by hybridization of an uncut probe.

Figure 91 shows the image generated by an apparatus for fluorescent imaging that shows that transcription from a "leaking" branched T7 compound promoter can be turned off by the use of a downstream partial promoter oligonucleotide having a paired tail in 5'-

Figure 92 shows the image generated by an apparatus for fluorescent imaging that shows that the location of the notch site in a T7 promoter composed of notches can effect transcription efficiently.

Figure 93 shows the image generated by an apparatus for fluorescent imaging that shows that the presence of a 2 ’unpaired tail on a full length promoter oligonucleotide decreases, but does not cancel the transcription. Schemes showing the nucleic acids analyzed in reactions 1-4 are presented below the image; These schemes show SEQ ID NO 123-125.

Figure 94 is a schematic illustrating an embodiment of the present invention in which a T7 promoter region is created composed by binding the probe oligonucleotide cut down the partial promoter oligonucleotide.

Figures 95A-D provide schematics showing concrete embodiments of the present invention showing various ways by which a composite promoter can be formed in which the cut is located in the template (or lower) strand.

Figure 96 is a scheme illustrating an embodiment of the present invention in which the probe cut from an initial invasive excision reaction is employed as the INVASOR oligonucleotide in a second invasive excision reaction.

Figure 97 is a scheme illustrating an embodiment of the present invention in which the probe cut from an initial invasive excision reaction is employed as an INVASOR-target complex integrated in a second invasive excision reaction.

Figure 98 shows the nucleotide sequence of the PR1 probe (SEQ ID No. 119), the oligonucleotide INVASOR-Diana TT3 (SEQ ID No. 118), the oligonucleotides IT3-8, IT3-6, TT3-4, IT3-3 and IT3-0 (SEQ ID No. 147-151, respectively).

Figure 99 depicts structures that can be used to determine the ability of an enzyme to cleave a probe in the presence and absence of an upstream oligonucleotide. Figure 99 shows the sequence of oligonucleotide 89-15-1 (SEQ ID No. 152), oligonucleotide 81-69-5 (SEQ ID No. 156), oligonucleotide 81-69-4 (SEQ ID No. 155), the oligonucleotide 81-69-3 (SEQ ID No. 154), oligonucleotide 81-69-2 (SEQ ID No. 153) and a part of M13mp18 (SEQ ID No. 163).

Figure 100 shows the image generated by an apparatus for fluorescent imaging showing the dependence of Pfu FEN-1 on the presence of an upstream overlapping oligonucleotide for specific excision of the probe.

Figure 101a shows the image generated by an apparatus for fluorescent imaging that compares the amount of product generated in a standard reaction (i.e., a non-sequential invasive excision reaction) and a sequential invasive excision reaction.

Figure 101b is a graph comparing the amount of product generated in a standard or basic reaction (ie, a non-sequential invasive excision reaction) and a sequential invasive excision reaction ("INVASOR sqrd") (y axis = units of fluorescence; x axis = target atoms).

Figure 102 shows the image generated by an apparatus for fluorescent imaging that shows that the products of a sequential invasive excision reaction completed cannot produce cross contamination in a similar subsequent reaction.

Figure 103 shows the oligonucleotide sequence employed in an invasive cleavage reaction for the detection of viral DNA from HCMV; Figure 103 shows the sequence of oligonucleotides 89-76 (SEQ ID No. 161), oligonucleotides 89-44 (SEQ ID No. 160) and nucleotides 3057-3110 of the HCMV genome (SEQ ID No. 162).

Figure 104 shows the image generated by an apparatus for fluorescent imaging that shows the sensitive detection of HCMV viral DNA in samples containing human genomic DNA using an invasive excision reaction.

Figure 105 is a scheme illustrating an embodiment of the present invention in which the probe cut from an initial invasive excision reaction is employed as the INVASOR oligonucleotide in a second invasive excision reaction and in which a STOP oligonucleotide prevents the participation of the first probe without cutting remaining in the excision of the second probe.

Figure 106 is a scheme illustrating an embodiment of the present invention in which the probe cut from an initial invasive excision reaction is employed as an INVASOR-target complex integrated in a second invasive excision reaction and in which an oligonucleotide of STOP prevents the participation of the first probe without cutting remaining in the excision of the second probe.

Figure 107 shows three images generated by an apparatus for fluorescent imaging showing that the two different lengths of 2'-O-methyl, aminomodified STOP oligonucleotide at the 3 'end reduce nonspecific base cleavage of the secondary probe when included in the second stage

of a reaction in which the probe cut from an initial invasive excision reaction is employed as an INVASOR-target complex integrated in a second invasive excision reaction.

Figure 108A shows two images generated by an apparatus for fluorescent imaging showing the effects on the nonspecific and specific cleavage signal of increasing concentrations of the primary probe in the first stage of a reaction in which the probe cut from a Initial invasive excision reaction is employed as the INVASOR oligonucleotide in a second invasive excision reaction.

Figure 108B shows two images generated by an apparatus for fluorescent imaging showing the effects on the nonspecific and specific cleavage signal of increasing concentrations of the primary probe in the first stage of a reaction and the inclusion of a 2'- O-methyl oligonucleotide STOP aminomodified at the 3 'end in which the second stage of a reaction in which the probe cut from a

Initial invasive excision reaction is employed as the INVASOR oligonucleotide in a second invasive excision reaction.

Figure 108C shows a graph generated using the Microsoft Excel drop-down sheet software that compares the effects on the nonspecific and specific cleavage signal of increasing concentrations of the primary probe in the first stage of a reaction in the presence or absence of a 2'- O-methyl oligonucleotide STOP aminomodified at the 3 'end in which the second stage of a reaction in which the probe cut from a

Initial invasive excision reaction is employed as the INVASOR oligonucleotide in a second invasive excision reaction.

Figure 109A shows two images generated by an apparatus for the formation of fluorescent images showing the effects on the nonspecific and specific cleavage signal of the inclusion of an aminomodified STOP oligonucleotide in the second stage of a reaction in which the probe cut from An initial invasive excision reaction is used as the INVASOR oligonucleotide in a second invasive excision reaction.

Figure 109B shows two images generated by an apparatus for fluorescent imaging showing the effects on the nonspecific and specific cleavage signal of the inclusion of an aminomodified STOP oligonucleotide at the 3 'end, a 2'-O-methyl oligonucleotide of aminomodified STOP at the 3 'end or a 2'-O-methyl oligonucleotide STOP completely aminomodified at the 3' end in the second stage of a reaction in which the probe cut from an initial invasive excision reaction is used as the INVASOR oligonucleotide in a second invasive excision reaction.

Figure 110A shows two images generated by an apparatus for fluorescent imaging that compares the effects on the nonspecific and specific cleavage signal of the inclusion of a DETENTION oligonucleotide of different lengths in the second stage of a reaction in which the probe cut from an initial invasive excision reaction is used as the INVASOR oligonucleotide in a second invasive excision reaction.

Figure 110B shows two images generated by an apparatus for fluorescent imaging that compares the effects on the nonspecific and specific cleavage signal of the inclusion of a DETENTION oligonucleotide of different lengths in the second stage of a reaction in which the probe cut from an initial invasive excision reaction is used as the INVASOR oligonucleotide in a second invasive excision reaction and in which a longer variant of the secondary probe used in the reactions of Figure 110A is analyzed.

Figure 110C shows a schematic diagram of a primary probe aligned with several different length oligonucleotides. The region of the primary probe that is complementary to the HBV target sequence is underlined. STOP oligonucleotides are aligned with the probe by complementarity.

Figure 111 shows two images generated by an apparatus for fluorescent imaging that compares the effects on the nonspecific and specific cleavage signal of the inclusion of a DETENTION oligonucleotide of different lengths in the second stage of a reaction in which the probe cut from an initial invasive excision reaction is used as the INVASOR oligonucleotide in a second invasive excision reaction using secondary probes of two different lengths.

Figure 112A provides a schematic diagram illustrating an embodiment of the present invention in which the probe cut from an initial invasive excision reaction is employed as the INVASOR oligonucleotide in a second invasive excision reaction using a FRET cassette. The region indicated as "N" is the overlap required for cleavage in this embodiment. Figure 112B is a diagram of how a

Mismatching between the probe and the target strand in the "N" position breaks the overlap and thus

suppresses the excision of the probe.

Figure 113A shows a schematic diagram of an provides an INVASOR oligonucleotide (SEQ ID No. 195), probe oligonucleotide (SEQ ID No. 197) and a FRET cassette (SEQ ID No. 201) for the detection of the Apo E 112 arg allele.

Figure 113B shows a schematic diagram of an INVASOR oligonucleotide (SEQ ID No. 195), probe oligonucleotide (SEQ ID No. 198) and a FRET cassette (SEQ ID No. 201) for the detection of the Apo E 112 cys allele.

Figure 113C shows a schematic diagram of an INVASOR oligonucleotide (SEQ ID No. 196), probe oligonucleotide (SEQ ID No. 199) and a FRET cassette (SEQ ID No. 201) for the detection of the Apo E 158 arg allele.

Figure 113D shows a schematic diagram of an INVASOR oligonucleotide (SEQ ID No. 196), probe oligonucleotide (SEQ ID No. 200) and a FRET cassette (SEQ ID No. 201) for the detection of the Apo E 158 cys allele.

Figure 114A provides a bar graph showing the detection of the arg and cys alleles in the Apo E 112 locus in 2 synthetic controls and 5 samples of human genomic DNA.

Figure 114B provides a bar graph showing the detection of the arg and cys alleles in the Apo E 158 locus in 2 synthetic controls and 5 samples of human genomic DNA.

Figure 115A shows a schematic diagram of an INVASOR oligonucleotide (SEQ ID No. 202), probe oligonucleotide (SEQ ID No. 208) and the FRET cassette (SEQ ID No. 201) for the detection of the wild type C282 allele of the human HFE gene.

Figure 115B shows a schematic diagram of an INVASOR oligonucleotide (SEQ ID No. 202), probe oligonucleotide (SEQ ID No. 209) and the FRET cassette (SEQ ID No. 210) for the detection of the C282Y mutant allele of the human HFE gene.

Figure 115C shows a schematic diagram of an INVASOR oligonucleotide (SEQ ID No. 203), probe oligonucleotide (SEQ ID No. 211) and the FRET cassette (SEQ ID No. 206) for the detection of the mutant H63 allele of the human HFE gene.

Figure 115D shows a schematic diagram of an INVASOR oligonucleotide (SEQ ID No. 203), probe oligonucleotide (SEQ ID No. 212) and the FRET cassette (SEQ ID No. 213) for the detection of the H63D mutant allele of the human HFE gene.

Figure 116 provides a bar graph showing the analysis of the C282Y mutations (first set of eight assays, from left to right) and H63D (second set of eight assays, from left to right) in the human HFE gene, each analyzed in 2 synthetic controls and 5 samples of human genomic DNA.

Figure 117A shows a schematic diagram of an INVASOR oligonucleotide (SEQ ID No. 216), probe oligonucleotide (SEQ ID No. 217) and the FRET cassette (SEQ ID No. 225) for the detection of the wild type allele at position 677 of the gene Human MTHFR.

Figure 117B shows a schematic diagram of an INVASOR oligonucleotide (SEQ ID No. 216), probe oligonucleotide (SEQ ID No. 218) and the FRET cassette (SEQ ID No. 225) for the detection of the mutant allele at position 677 of the human MTHFR gene .

Figure 118 provides a bar graph showing the analysis of the C677T mutation in the human MTHFR gene in 3 synthetic control samples and 3 human genomic DNA samples.

Figure 119A shows a schematic diagram of an INVASOR oligonucleotide (SEQ ID No. 222), probe oligonucleotide (SEQ ID No. 223) and the FRET cassette (SEQ ID No. 225) for the detection of the wild type allele at position 20210 of the gene of human prothrombin.

Figure 119B shows a schematic diagram of an INVASOR oligonucleotide (SEQ ID No. 222), probe oligonucleotide (SEQ ID No. 224) and the FRET cassette (SEQ ID No. 225) for the detection of the mutant allele at position 20210 of the gene of the human prothrombin

Figure 120 provides a bar graph showing the analysis of the A20210G mutation in the human prothrombin gene in 2 synthetic control samples and 3 human genomic DNA samples.

Figure 121A shows a schematic diagram of an INVASOR oligonucleotide (SEQ ID No. 228), probe oligonucleotide (SEQ ID No. 229) and the FRET cassette (SEQ ID No. 230) for the detection of the R-2 mutant allele of the factor V gene human.

Figure 121B shows a schematic diagram of an INVASOR oligonucleotide (SEQ ID No. 231), oligonucleotide probe (SEQ ID No. 232) and the FRET cassette (SEQ ID No. 230) for the detection of the human -actin gene. Figure 122 provides a bar graph showing the detection of the R-2 mutant (HR-2) of the factor V gene human compared to internal control (IC) detection, the -actin gene, 3 synthetic control samples and 2 human genomic DNA samples.

Figure 123A shows a schematic diagram of an INVASOR oligonucleotide (SEQ ID No. 235), probe oligonucleotide (SEQ ID No. 236) and the FRET cassette (SEQ ID No. 225) for the detection of the wild type allele in position -308 in the promoter of the TNF-human gene. Figure 123B shows a schematic diagram of an INVASOR oligonucleotide (SEQ ID No. 235), probe oligonucleotide (SEQ ID No. 237) and the FRET cassette (SEQ ID No. 225) for the detection of the mutant allele at position -308 in the promoter of the human TNF-gene.

Figure 124 provides a bar graph showing the analysis of the -308 mutation in the gene promoter of human TNF-in 3 synthetic control samples and 3 samples of human genomic DNA. Figure 125A shows a schematic diagram of an INVASOR oligonucleotide (SEQ ID No. 240), probe oligonucleotide (SEQ ID No. 241) and the FRET cassette (SEQ ID No. 225) for the detection of the wild type allele at the position of codon 506 of the human factor V gene.

Figure 125B shows a schematic diagram of an INVASOR oligonucleotide (SEQ ID No. 240), probe oligonucleotide (SEQ ID No. 242) and the FRET cassette (SEQ ID No. 225) for the detection of the mutant allele A506G of the human factor V gene.

Figure 126 provides a bar graph showing the analysis of the A506G mutation in the human factor V gene in 3 synthetic control samples and 6 human genomic DNA samples.

Figure 127A shows a schematic diagram of an INVASOR oligonucleotide (SEQ ID No. 243), probe oligonucleotide (SEQ ID No. 244) and the FRET cassette (SEQ ID No. 245) for the detection of the mecA gene associated with methicillin resistance in S. aureus

Figure 127B shows a schematic diagram of an INVASOR oligonucleotide (SEQ ID No. 246), probe oligonucleotide (SEQ ID No. 247) and the FRET cassette (SEQ ID No. 245) for the detection of the nuc gene, a species-specific gene that distinguishes S. aureus of S. haemolyticus.

Figure 128 provides a bar graph showing the detection of the mecA gene compared to the detection of the specific S. aureus nuc gene in methicillin-sensitive S. aureus DNA (MSSA), methicillin-resistant S. aureus (MRSA) , S. haemolyticus and amplified control targets for the mecA and nuc target sequences.

Figure 129A shows the image generated by an apparatus for fluorescent imaging that compares the products produced by cleavage of a mixture of the oligonucleotides shown in Figure 60 by FEN-1 of Pfu (1) or FEN-1 of Mja ( 2).

Figure 129B shows the image generated by an apparatus for fluorescent imaging that compares the products produced by cleavage of the oligonucleotides shown in Figure 26 by FEN-1 of Pfu (1) or FEN-1 of Mja (2).

Figure 130 shows a schematic diagram of the parts of the FEN-1 proteins of Pfu and FEN-1 of Mja combined to create chimeric nuclei.

Figure 131A shows the image generated by an apparatus for fluorescent imaging that compares the products produced by cleavage of a mixture of the oligonucleotides shown in Figure 60 by FEN-1 of Pfu (1) or FEN-1 of Mja ( 2) or the chimeric nuclei shown in the diagrams in Figure

130.

Figure 131B shows the image generated by an apparatus for fluorescent imaging that compares the products produced by cleavage of the oligonucleotides shown in Figure 26 by FEN-1 of Pfu (1) or FEN-1 of Mja (2) or the chimeric nuclei shown in the diagrams of Figure 130.

Figure 132 shows the image generated by an apparatus for fluorescent imaging that compares the products produced by cleavage of the excision structures folded by FEN-1 of Pfu (1) or FEN-1 of Mja (2) or nucleated chimerics shown in the diagrams of Figure 130.

Figures 133A-J show the results of several tests used to determine the activity of Cleavase BN under various conditions.

Figures 134A-B, D-F and H-J show the results of several tests used to determine the activity of TaqDN under various conditions.

Figures 135A-B, D-F, H-J show the results of several tests used to determine the activity of TthDN under various conditions.

Figures 136A-B, D-F and H-J show the results of several tests used to determine Pfu FEN-1 activity under various conditions.

Figures 137A-J show the results of several tests used to determine the activity of Mja FEN-1 under various conditions.

Figures 138A-B, D-F and H-J show the results of several tests used to determine Afu FEN-1 activity under various conditions.

Figures 139A-E and G-I show the results of several tests used to determine the activity of Mth FEN-1 under various conditions.

Figure 140 shows the two substrates. Panel A shows the structure and sequence of the fork substrate (25-65-1) (SEQ ID No. 293), while Panel B shows the structure and sequence of the INVASOR (IT) substrate (25-184-5 ) (SEQ ID No. 294).

Figure 141A shows the structure and sequence of oligonucleotides that form an invasive cleavage structure (203-91-01, SEQ ID No. 403, and the target oligonucleotide-INVASOR 203-91-04 (SEQ ID No. 404).

Figure 141B shows the structure and sequence of oligonucleotides that form an X-structure substrate (203-81-02, SEQ ID No. -405 and 594-09-01, SEQ ID No. 406).

Figure 142 shows the activities of the FEN proteins indicated in the invasive cleavage structure of the diagram of Figure 141A.

Figure 143 shows the activities of the FEN proteins indicated in the X structure of the diagram of Figure 141B.

Figure 144 shows a schematic diagram of an INVASOR oligonucleotide (SEQ ID No. 407), probe oligonucleotide (SEQ ID No. 408) and the FRET cassette (SEQ ID No. 409) for the detection of the human cytomegalovirus polymerase gene.

Figure 145 provides a bar graph showing the detection of different copy numbers of the human cytomegalovirus genomic DNA.

Figures 146A-J show the nucleic acid and amino acid sequences for certain FEN-1 endonucleases of the present invention.

Figure 147 shows a schematic diagram of an embodiment of a high performance enzyme detection system.

Figure 148 graphic samples comparing the cleavage rates observed using modified enzymes and

INVASOR oligonucleotides that have different 3 ’ends.

Description of the invention

Introduction

The present invention is defined in the claims and relates to methods and compositions for treating nucleic acid and, in particular, to methods and compositions for the detection and characterization of nucleic acid sequences and sequence changes.

In preferred embodiments, the present invention relates to means for cleaving a nucleic acid cleavage structure in a site-specific manner. Although the present invention provides various cleavage agents, in some embodiments the present invention relates to a cleavage enzyme that has 5 ′ nuclease activity without synthetic interference nucleic acid capacity. In other embodiments, the present invention provides novel polymerases (eg, thermostable polymerases) that possess altered polymerase and / or nuclease activities.

The invention provides a composition comprising a purified FEN-1 endonuclease from Archaeaglobus veneficus, wherein said FEN-1 endonuclease comprises an amino acid sequence comprising SEQ ID No. 370.

The invention further provides a composition comprising an isolated nucleic acid, wherein said nucleic acid encodes the endonuclease of claim 1, wherein said isolated nucleic acid comprises SEQ ID NO: 369.

For example, in some embodiments, the present invention provides 5 'nucleases obtained from thermostable DNA polymerases that show altered DNA synthetic activity with respect to that of native thermostable DNA polymerases. The 5 ’nuclease activity of the polymerase is retained while the synthetic activity is diminished or absent. Such 5 ’nucleases are capable of catalyzing cleavage with specificity of nucleic acid structure in the absence of synthetic interference activity. The absence of synthetic activity during a cleavage reaction results in nucleic acid cleavage products of uniform size.

The novel properties of the nucleases of the invention form the basis of a procedure for detecting specific nucleic acid sequences. This procedure depends on the amplification of the detection molecule rather than the amplification of the target sequence itself as do the existing procedures for detecting specific target sequences.

DNA polymerases (DNAP), such as isolates of E. coli or thermophilic bacteria of the Thermus genus, are enzymes that synthesize new DNA strands. Several of the known DNAPs contain associated nuclease activities in addition to the synthetic activity of the enzyme.

It is known that some DNAPs remove nucleotides from the 5 ’and 3’ ends of DNA strands (Kornberg, ADN

Replication, W. H. Freeman and Co., San Francisco, p. 127-139 [1980]). These nuclease activities are commonly referred to as exonuclease 5 'and exonuclease 3' activities, respectively. For example, the 5 ’exonuclease activity located in the N-terminal domain of several DNAPs participates in the elimination of RNA primers during lagged chain synthesis during DNA replication and the removal of damaged nucleotides during repair. Some DNAPs, such as E. coli DNA polymerase (DNAPEcl), also have 3 ′ exonuclease activity responsible for reading correction during DNA synthesis (Kornberg, above).

A DNAP isolated from Thermus aquaticus, called Taq DNA polymerase (DNAPTaq), has an activity

5 ’exonuclease, but lacks a functional 3’ exonucleolytic domain (Tindall and Kunkell, Biochem., 27: 6008

[1988]). The derivatives of DNAPEc1 and DNAPTaq, called respectively the Klenow and Stoffel fragments,

they lack 5 ’exonuclease domains as a result of enzymatic or genetic manipulations (Brutlag et al.,

Biochem Biophys Res. Commun., 37: 982 [1969]; Erlich et al., Science 252: 1643 [1991]; Setlow and Kornberg, J. Biol. Chem., 247: 232 [1972]).

DNAPTaq 5 'exonuclease activity was described as requiring concurrent synthesis (Gelfand, PCR Technology

-

Principles and Applications for ADN Amplification, H. A. Erlich, [Ed.], Stockton Press, New York, p.19 [1989]).

Although mononucleotides predominate among the digestion products of DNAPTaq 5 ’exonucleases and

DNAPEc1, you can also see short oligonucleotides (12 nucleotides) that imply that these

so-called 5 'exonucleases can function endonucleolytically (Setlow, above; Holland et al., Proc.

Natl Acad. Sci. USA 88: 7276 [1991]).

In WO 92/06200, Gelfand et al. show that the preferred substrate of the 5 ′ exonuclease activity of thermostable DNA polymerases is single stranded displaced DNA. Hydrolysis of the phosphodiester bond takes place between the displaced single stranded DNA and the double helix DNA, the preferred exonuclease cleavage site being a phosphodiester bond in the double helix region. Thus, the 5 ’exonuclease activity usually associated with DNAP is a unique structure-dependent helix endonuclease and is more appropriately referred to as a 5’ nuclease. Exonucleases are enzymes that cleave nucleotide molecules from the ends of the nucleic acid molecule. On the other hand, endonucleases are enzymes that cleave the nucleic acid molecule at an internal site rather than at terminal sites. The nuclease activity associated with some DNA

Thermostable polymerases cleave endonucleolytically but this cleavage requires contact with the 5 ′ end of the molecule being cleaved. Therefore, these nucleases are called 5 ’nucleases.

When a 5 'nuclease activity is associated with a eubacterial Type A DNA polymerase, it is observed in the third of the N-terminal region of the protein as an independent functional domain. The two thirds C-terminals of the molecule constitute the polymerization domain that is responsible for DNA synthesis. Some Type A DNA polymerases also have a 3 ′ exonuclease activity associated with the two-thirds C-terminal region of the molecule.

The 5 ’exonuclease activity and DNAP polymerization activity have been separated by proteolytic cleavage or genetic manipulation of the polymerase molecule. The Klenow or large proteolytic cleavage fragment of DNAPEc1 contains the polymerase and exonuclease 3 ’activity, but lacks the 5’ nuclease activity. The Stoffel fragment of DNAPTaq (DNAPStf) lacks the 5 ’nuclease activity due to genetic manipulation that

deleted the 289 N-terminal amino acids of the polymerase molecule (Erlich et al., Science 252: 1643 [1991]). WO 92/06200 describes a thermostable DNAP with an altered level of exonuclease from 5 'to 3'. U.S. Patent No. 5,108,892 describes a Thermus aquaticus DNAP without a 5 ’to 3’ exonuclease.

There are thermostable DNA polymerases with less synthetic activity ((Third Wave Technologies, Madison, WI) and are described in U.S. Patent Nos. 5,541,311. 5,614,402. 5,795,763,5,691,142. And 5,837,450 ). The present invention relates to 5 ’nucleases obtained from thermostable Type A DNA polymerases that retain 5’ nuclease activity but have reduced or absent synthetic activity. The ability to decouple the synthetic activity of the enzyme from nuclease 5 ’activity proves that nuclease 5’ activity does not require synthesis

of concurrent DNA as previously described (Gelfand, PCR Technology, above).

In addition to the 5 ′ exonuclease domains of the DNA polymerase I proteins of eubacteria described above, 5 ’nucleases associated with bacteriophages, eukaryotes and archaebacteria have been found. In general, all enzymes in this family show very similar substrate specificities, despite their limited level of sequence similarity. Accordingly, enzymes suitable for use in the methods of the present invention can be isolated or obtained from a wide range of sources.

Almost 30 years ago a mammalian enzyme with a functional similarity to the 5'-exonuclease domain of E. coli Pol I (Lindahl, et al., Proc Natl Acad Sci USA 62 (2): 597-603 was isolated [1969]). Later, it was shown that additional members of this group of enzymes called wing endonucleases (FEN1) of Eukarya and Archaea possessed a specific activity of almost identical structure (Harrington and Lieber. Embo J 13 (5), 1235-46 [1994] ; Murante et al., J Biol Chem 269 (2), 1191-6 [1994]; Robins, et al., J Biol Chem 269 (46), 28535-8 [1994]; Hosfield, et al., J Biol Chem 273 (42), 27154-61 [1998]), despite the limited sequence similarity. The substrate specificities of the FEN1 enzymes and related eubacterial and bacteriophage enzymes have been studied and found to be similar for all enzymes (Lyamichev, et al., Science 260 (5109), 778-83 [1993], Harrington and Lieber, formerly, Murante, et al., Formerly, Hosfield, et al, formerly, Rao, et al., J Bacteriol 180 (20), 5406-12 [1998], Bhagwat, et al., J. Biol Chem 272 (45), 28523-30 [1997], Garforth and Sayers, Nucleic Acids Res 25 (19), 3801-7 [1997]).

Using preformed substrates, many of the studies cited above determined that these nucleates leave a gap after cleavage, which leads the authors to speculate that DNA polymerase must act to fill that gap and generate a linkable cut. It has been shown that a number of other 5’-nucleases leave a hole

or overlap after cleavage of the same or similar wing substrates. From then on it has been determined that all 5 'specific structure exonucleases leave a cut after cleavage if the substrate has an overlap between the upstream and downstream duplexes (Kaiser et al., J. Biol Chem. 274 (30): 21387-21394 [1999]). Although duplexes that have several overlapping sequence bases can assume several different conformations by branch migration, it was determined that cleavage occurs in the conformation in which the

last nucleotide at the 3 ’end of the strand chain above is unpaired, the cleavage rate being

essentially the same is the end of the upstream primer A, C, G or T. An overlap was determined

positional between the 3 ’end of the upstream primer and the downstream duplex, instead of overlapping the

sequence, required for optimal cleavage. In addition to allowing these enzymes to leave a cut after cleavage, the sole basis of the overlap causes enzymes to cleave several orders of magnitude faster than when a substrate lacks overlap (Kaiser et al., Above).

Any of the 5 'nuclei described above may find application in one or more embodiments of the procedures described herein. FEN1 nucleates of concrete utility in the methods of the present invention include, among others, those of Methanococcus jannaschii and Methanobacterium thermoautotrophicum; enzymes FEN1 Particularly preferred are Archaeoglobus fulgidus, Pyrococcus furiosus, Archaeoglobus Veneficus, Sulfolobus solfataricus, Pyrobaculum aerophilum, Thermococcus litoralis, Archaeaglobus Veneficus, Archaeaglobus profundus, Acidianus brierlyi, Acidianus ambivalens, Desulfurococcus amylolyticus, Desulfurococcus mobilis, Pyrodictium brockii, Thermococcus gorgonarius, Thermococcus zilligii , Methanopyrus kandleri, Methanococcus igneus, Pyrococcus horikoshii and Aeropyrum pernix.

The invention is defined in the claims.

The detailed description of the invention is presented in the following sections:

I. Detection of Specific Nucleic Acid Sequences Using 5 ’Nucleases in an INVASOR-directed cleavage test;

II. Effect of STOP oligonucleotides on the signal and background in sequential invasive excision reactions.

III. Signal Improvement by incorporating the products of an invasive excision reaction into a subsequent invasive excision reaction;

IV.

 Fractionation of specific nucleic acids by selective charge inversion;

V.

 Signal Improvement by Prolongation of Reaction Products in the INVASOR oligonucleotide-directed Excision Assay;

VI Signal improvement by termination of an activated protein binding site

VII. Generation of 5 ’Nucleases Obtained from Thermostable DNA Polymerases;

VIII. Enhanced enzymes for use in cleavage reactions directed by INVASOR oligonucleotide;

IX.

 INVASOR test for direct detection and measurement of specific analytes.

X.

Kits

I. Detection of Specific Nucleic Acid Sequences Using 5 ’Nucleases in a cleavage test directed by INVASOR

1. Design of the INVASOR test reaction

The present invention provides means for forming a nucleic acid cleavage structure that depends on the presence of a target nucleic acid and the cleavage of the nucleic acid cleavage structure to release different cleavage products. The 5 ’nuclease activity is used to cleave the target-dependent cleavage structure and the resulting cleavage products are indicative of the presence of target nucleic acid sequences in the sample. When nucleic acid wastes, or oligonucleotides, hybridize with a target nucleic acid strand in such a way that they form an overlapping invasive excision structure, as redescribed below, an invasive excision can occur. Through the interaction of a cleavage agent (e.g., a

nuclease 5 ’) and the upstream oligonucleotide, the cleavage agent can be made to cleave the

oligonucleotides downstream at an internal site in such a way that a distinctive fragment is produced. Such embodiments have been referred to as the INVASOR test (Third Wave Technologies) and are described in patent applications No. 5,846,717. 5,985,557. 5,994,069. 6,001,567 and 6,090,543 and PCT publications WO 97/27214 and WO 98/42873.

The present invention further provides assays in which the target nucleic acid is reused or recycled during multiple rounds of hybridization with oligonucleotide probes and excision without the need to use temperature cycling (i.e., for periodic denaturation of target nucleic acid chains) or synthesis. of nucleic acid (ie, for polymerization-based displacement of probe nucleic acid strands). When a cleavage reaction is performed under conditions in which the probes are continuously replaced in the target strand (e.g., by probe-probe displacement or by a balance between probe / target association and dissociation or by a combination comprising these mechanisms [The kinetics of oligonucleotide replacement. Luis P. Reynaldo, Alexander V. Vologodskii, Bruce P. Neri and Victor I. Lyamichev. J. Mol. Biol. 97: 511-520 (2000)], multiple probes can hybridize with the same target, which allows multiple cleavages, and the generation of multiple cleavage products.

By extension of its complementarity with a strand of target nucleic acid, it can be said that an oligonucleotide defines a specific region of said target. In an invasive cleavage structure, the two oligonucleotides define and hybridize with two regions of the target that are adjacent to each other (i.e. regions without any additional region of the target between them). Either or both oligonucleotides may comprise additional parts that are not complementary to the target strand. In addition to hybridizing adjacently, in order to form an invasive cleavage structure, the 3 ′ end of the upstream oligonucleotides must comprise an additional moiety. When both oligonucleotides hybridize with a target strand to form a structure and said 3 'challenge is present in the oligonucleotides upstream within the structure, it can be said that the oligonucleotides overlap and the structure can be described as an overlapping or invasive cleavage structure. .

In one embodiment, the 3 'remainder of the invasive cleavage structure is a single nucleotide. In this embodiment, the rest in 3 ’can be any nucleotide (that is, it can be, but does not have to be complementary to the target strand). In a preferred embodiment, the 3 'moiety is a single nucleotide that is not complementary to the target strand. In another embodiment, the 3 'moiety is a nucleotide-like compound (i.e., a moiety having chemical characteristics similar to a nucleotide, such as a nucleotide analog or an organic ring compound; see, for example, the patent for U.S. 5,985,557). In yet another embodiment, the 3 'moiety is one or more nucleotides that sequentially beg for one or more nucleotides present at the 5' end of the hybridized region of the downstream oligonucleotide. In a further embodiment, the duplicated nucleotide sequence of the 3 ’moiety is followed by a single nucleotide that is no longer duplicated from the oligonucleotide sequence downstream and that can be any other nucleotide. In yet another embodiment, the nucleotide duplicate sequence of the 3 'moiety is followed by a nucleotide-like compound, as described above.

The downstream oligonucleotide may have, but is not necessary, additional moieties attached to any end of the region that hybridizes with the target nucleic acid strand. In a preferred embodiment, the downstream oligonucleotide comprises a moiety at its 5 ′ end (ie, a 5 ’moiety). In a particularly preferred embodiment, said 5 ’moiety is a 5’ wing or arm comprising a nucleotide sequence that is not complementary to

the target nucleic acid strand.

When an overlapping cleavage structure is formed, it can be recognized and cleaved by a nuclease that is specific to this structure (i.e., a nuclease that will cleave one or more of the nucleic acids in the overlapping structure based on the recognition of this structure, instead of recognizing a nucleotide sequence of any of the nucleic acids that make up the structure). Said nuclease can be called "structure specific nuclease." In some embodiments, the specific structure nuclease is a 5 'nuclease. In a preferred embodiment, the structure-specific nuclease is the 5 'nuclease of a DNA polymerase. In another preferred embodiment, the DNA polymerase having the 5 ′ nuclease has a poor synthesis. In another preferred embodiment, nuclease 5 ’is an FEN-1 endonuclease. In a particularly preferred embodiment, nuclease 5 ’is thermostable.

In some embodiments, said nuclease with structure specificity cleaves, preferably, the oligonucleotide downstream. In a preferred embodiment, the downstream oligonucleotide is cleaved a nucleotide at the 5 ′ end of the region that hybridizes with the target within the overlapping structure. Excision of the overlapping structure at any location by a nuclease with structure specificity produces one or more parts or fragments released from nucleic acid, called "cleavage products."

In some embodiments, the cleavage of an overlapping structure is performed under conditions in which one or more of the nucleic acids in the structure can be dissociated (ie, de-inhibited or fused) from the structure. In one embodiment, complete or partial dissociation of a first cleavage structure allows the target nucleic acid to participate in the formation of one or more additional overlapping cleavage structures. In a preferred embodiment, the first cleavage structure is partially dissociated. In a particularly preferred embodiment, only the oligonucleotides that are cleaved dissociate from the first cleavage structure so that it can be replaced by another copy of the same oligonucleotides. In some embodiments, said dissociation is induced by an increase in temperature, so that one or more oligonucleotides can no longer hybridize with the target strand. In other embodiments, said dissociation occurs because the cleavage of an oligonucleotide produces only cleavage products that cannot bind to the target strand under the reaction conditions. In a preferred embodiment, conditions under which an oligonucleotide can be associated with (i.e. hybridize) and dissociate from a target strand are independent of cleavage and under which the oligonucleotide can be cleaved when hybridized with the target as part of an overlapping excision structure. In a particularly preferred embodiment, conditions are selected in which the number of copies of the oligonucleotide that can be cleaved when part of an overlapping structure exceeds the number of copies of the target nucleic acid strand by an amount sufficient that when the first structure of cleavage is dissociated, the probability that the target strand is associated with an intact copy of the oligonucleotide is greater than the probability that it is associated with a cleaved copy of the oligonucleotide.

In some embodiments, the cleavage is performed by a specific nuclease of structure that can recognize and cleave structures that have an overlap. In a preferred embodiment, the cleavage is performed by a specific structure nuclease that has a cleavage rate of nucleic acid structures that do not comprise an overlap less than the cleavage rate of structures comprising an overlap. In a particularly preferred embodiment, the cleavage is performed by a specific nuclease of structure having a cleavage rate of nucleic acid structures that do not comprise an overlap less than 1% of the cleavage rate of structures comprising an overlap.

In some embodiments, it is desirable to detect cleavage of the overlapping cleavage structure. Detection can be performed by analysis of the cleavage products or by analysis of one or more remaining uncleaved nucleic acids. For convenience, the following discussion will refer to the analysis of cleavage products, but those skilled in the art will appreciate that these procedures can be applied so easily to the analysis of nucleic acids without cleaving in an invasive excision reaction. Any method known in the art for the analysis of nucleic acids, nucleic acid fragments or oligonucleotides can be applied to the detection of cleavage products.

In one embodiment, the cleavage products can be identified by the chemical content, for example the relative amounts of each atom, each specific type of reactive group or each nucleotide base (Chargaff et al.,

J. Biol. Chem. 177: 405 [1949]) containing. In this way, a cleavage product can be distinguished from a longer nucleic acid than was released by cleavage or other nucleic acids.

In another embodiment, the cleavage products can be distinguished by a specific physical characteristic, including, among others, length, mass, load or load-to-mass ratio. In yet another embodiment, the cleavage product can be distinguished by a behavior that is related to a physical characteristic, including, among others, the speed of rotation in solution, the speed of migration during electrophoresis, the coefficient of sedimentation in centrifugation, the flight time in MALDI-TOFF mass spectrometry, migration speed or other behavior in chromatography, the melting temperature of a complementary nucleic acid

or the ability to precipitate in solution.

The detection of cleavage products can be performed by releasing a marker. Said markers may include, among others, one or more of any pigment, radiomarkers such as 32P or 35S, binding moieties such as biotin, mass marks, such as metal ions or chemical groups, filler tags, such as polyamines or pigments. charged, haptens such as digoxgenin, light, phosphorescent or fluorogenic moieties, and fluorescent pigments, either alone or in combination with moieties that can suppress or shift the emission spectrum, such as energy transfer fluorescence resonance (FRET) or fluorescence fluorescence collision with energy transfer.

In some embodiments, the analysis of the cleavage products may include resolution or physical separation, for example by electrophoresis, hybridization or selective attachment to a support, or by mass spectrometry procedures such as MALDI-TOFF. In embodiments, the analysis can be performed without any resolution or physical separation, such as by detection of changes induced by fluorescence excision, such as in FRET-based analysis or by changes induced by excision in the rotation speed of a nucleic acid in solution as in fluorescence polarization analysis.

The cleavage products can then be used in any reaction or reading procedure that can use oligonucleotides. Such reactions include, among others, modification reactions, such as ligation, prolongation with a template-independent nucleic acid polymerase and primer extension with a template-dependent nucleic acid polymerase. The modification of the cleavage products can be carried out for the purposes of, including, but not limited to, adding one or more markers or binding moieties, altering the mass, adding specific sequences or for any other purpose that would facilitate the analysis of the cleavage products or the analysis of any other by-product, result or consequence of the cleavage reaction.

The analysis of the cleavage products may involve subsequent steps or reactions that do not modify the cleavage products themselves. For example, cleavage products can be used to complete a functional structure, such as a competent promoter for in vitro transcription or other protein binding site. The analysis may include the step of using the structure completed by or to perform its function. You can also use one

or more cleavage products to complete an overlapping cleavage structure, so as to allow a subsequent cleavage reaction whose products can be detected or used by any of the procedures described herein, including participation in subsequent cleavage reactions.

Certain preferred embodiments of invasive cleavage reactions are provided in the following descriptions. As illustrated in the diagram of Figure 29, the methods of the present invention employ at least one pair of oligonucleotides that interact with a target nucleic acid to form a cleavage structure for a specific nuclease structure. In some embodiments, the cleavage structure comprises i) a target nucleic acid that can be single stranded or double stranded (when a double stranded target nucleic acid is used, it can be converted into single stranded, for example, by heating); ii) a first

oligonucleotide, called the "probe", which defines a first region of the target nucleic acid sequence

being the complement of that region (regions X and Z of the target as shown in Fig. 29); iii) a second oligonucleotide, called the "INVASOR", whose part 5 'defines a second region of the same target nucleic acid sequence (regions Y and X in Fig. 29), adjacent to and downstream of the first target region ( regions X and Z) and whose second part overlaps in the region defined by the first oligonucleotide (region X represents the region of overlap). The resulting structure is depicted in Fig. 29.

Although it does not limit the invention or the present discussion to any particular mechanism of action, the diagram in Fig. 29 represents the effect of the cleavage site caused by this type of arrangement of an oligonucleotide pair. The design of such an oligonucleotide pair is described in more detail below. In Fig. 29, the 3 'ends of the nucleic acids (ie, the target and the oligonucleotides) are indicated by the use of the arrowheads at the ends of the lines representing the chains of the nucleic acids (and , where space permits, these extremes are also marked with “3 '”). It is readily understood that the two oligonucleotides (the INVASOR and the probe) are arranged in a relative parallel orientation to each other, while the target nucleic acid chain is arranged in an antiparallel orientation with respect to the two oligonucleotides. Furthermore, it is evident that the INVASOR oligonucleotide is located upstream of the probe oligonucleotide and that, with respect to the target nucleic acid chain, the Z region is upstream of the X region and the X region is upstream of the Y (it is that is, region Y is downstream of region X and region X is chain down of region Z). Complementarity regions between opposite chains are indicated by short vertical lines. Although it is not intended to indicate the precise location of the site or cleavage sites, the area to which the cleavage site within the probe oligonucleotide is displaced by the presence of the invading oligonucleotide is indicated by the filled vertical arrowhead. An alternative representation of the target cleavage / INVASOR / probe structure is shown in Fig. 32C. No diagram (i.e., Fig. 29 or Fig. 32C) is intended to represent the actual mechanism of action or physical arrangement of the cleavage structure and, furthermore, it is not intended that the process of the present invention be limited to any mechanism. of particular action.

The binding of these oligonucleotides in this embodiment can be considered to divide the target nucleic acid into three distinct regions: a region that has complementarity only with the probe (shown as "Z"); a region that has complementarity only with the INVASOR (shown as "Y"); and a region that has complementarity with both nucleotides (shown as "X"). As discussed above, in some preferred embodiments of the present invention, the overlap may comprise residues other than the overlapping complementary bases. Thus, in some embodiments, the region shown as "X" may represent a region in which there is a physical overlap, but not a sequence, between the INVASOR and probe oligonucleotides, that is, in these latter embodiments there is no region of the target nucleic acid between the "Z" and "Y" regions that have complementarity with both nucleotides.

a) Oligonucleotide design

The design of these oligonucleotides (ie, the INVASOR and the probe) is achieved using practices that are conventional in the art. For example, sequences that have self-complementarity are generally avoided, such that the resulting oligonucleotides would fold over themselves or hybridize to each other at the cost of binding to the target nucleic acid.

A consideration for the selection of a length for these oligonucleotides is the complexity of the sample containing the target nucleic acid. For example, the human genome is approximately 3 x 109 base pairs in length. Any sequence of 10 nucleotides will be presented with a frequency of 1: 410 or 1: 1048,576 in a random series of nucleotides, which would be approximately 2,861 times in 3 billion base pairs. Clearly, an oligonucleotide of this length would have a worse chance of uniquely binding to a region of 10 nucleotides within a target that has a sequence with the size of the human genome. If the target sequence were within a 3 kb plasmid, however, such an oligonucleotide could have a very reasonable chance of binding uniquely. By this same calculation it can be seen that a 16 nucleotide oligonucleotide (i.e., a 16 unit oligomer) is the minimum length of a sequence that will likely appear mathematically once in 3 x 109 base pairs. Also, this level of specificity can be provided by two or more shorter oligonucleotides if they are configured to bind in a cooperative manner (i.e., in such a way that they can only produce the expected complex if both or all are linked to their target sequences provided), in which the combination of the short oligonucleotides provides the desired specificity. In one of these embodiments, the cooperativity between the shorter oligonucleotides is by coaxial stacking effect that can occur when the oligonucleotides hybridize at adjacent sites on a target nucleic acid. In another embodiment, the shorter oligonucleotides are connected to each other, either directly or through one or more spacer regions. The shorter oligonucleotides connected in this way can be attached to distal regions of the target and can be used to cross the regions of the secondary structure on a target. Examples of such bridge oligonucleotides are described in PCR publication WO 98/50403, incorporated herein by reference in its entirety.

A second consideration for the selection of the oligonucleotide length is the temperature range in which the oligonucleotides are expected to function. An oligomer of 16 units with an average base content (50% GC base pairs) will have a calculated Tf (the temperature at which 50% of the sequence dissociates) of approximately 41 ° C, depending on, among other things, the concentration of the oligonucleotide and its target, the salt content of the reaction and the precise order of the nucleotides. As a practical aspect, longer oligonucleotides are usually selected to improve hybridization specificity. Oligonucleotides 20 to 25 nucleotides in length are often used since they have a high probability of being specific if they are used in reactions performed at temperatures that are close to their Tf (within approximately 5 ° of Tf). In addition, with Tf calculated in the range of 50 ° to 70 ° C, such oligonucleotides (i.e., oligomers of 20 to 25 units) are appropriately used in reactions catalyzed by thermostable enzymes, which often show optimal activity near this temperature range. .

The maximum length of the selected oligonucleotide is also based on the desired specificity. It is necessary to avoid selecting sequences that are so long that they present a high risk of stably binding to partial complements or that cannot be easily dislodged when desired. (for example, failure to dissociate the target once the cleavage has occurred or failure to dissociate at a reaction temperature suitable for enzymes and other materials in the reaction).

The first stage of design and selection of oligonucleotides for cleavage directed by INVASOR is in accordance with these general sample principles. Considered as sequence specific probes individually, each oligonucleotide can be selected according to the guidelines indicated above. That is, each oligonucleotide will generally be long enough to reasonably expect that it will hybridize only with the intended target sequence within a complex sample, usually in the range of 20 to 40 nucleotides. Alternatively, since the INVASOR-directed cleavage test depends on the concerted action of these oligonucleotides, the length composed of the 2 oligonucleotides will span / bind to regions X, Y, Z can be selected to enter within this range. , each of the individual oligonucleotides being in the range of approximately 13 to 17 nucleotides. Such a design can be used if non-thermostable cleavage means were employed in the reaction, requiring that the reactions be carried out at a temperature lower than that used when thermostable cleavage means are employed. In some cases, it may be desirable to have these oligonucleotides linked multiple times within a target nucleic acid (for example, that bind to multiple variants or multiple similar sequences within a target). It is not intended that the process of the present invention be limited to any particular size of the INVASOR oligonucleotide or probe.

The second stage to design a pair of oligonucleotides for this assay is to select the degree to which the

oligonucleotide sequence "INVASOR" upstream will overlap in the oligonucleotide sequence "probe"

chain down and, consequently, the sizes to which the probe will be excised. A key feature of this

Assay is that the oligonucleotide probe can be prepared to "renew", that is, the cleaved probe can be

Prepare to set aside to allow binding and excision of other copies of the probe molecule, without the requirements of thermal denaturation or polymerization displacement. Although in one embodiment of this assay the renewal of the probe can be facilitated by an exonucleolytic digestion by the cleavage agent, it is essential for the present invention that the renewal does not require this exonucleolytic activity. For example, in some embodiments, a reaction temperature and reaction conditions are selected to create a balance in which the probe hybridizes and dissociates from the target. In other embodiments, the reaction temperature and reaction conditions are selected so that the unbound probe can initiate binding to the target strand and physically displace the bound probe. In yet other embodiments, the temperature and reaction conditions are selected so that either or both mechanisms of probe replacement can occur in any proportion. The process of the present invention is not limited to any specific probe replacement mechanism. By any mechanism, when the probe is attached to the target to form a cleavage structure, excision can occur. Continuous cycling of the probe intermittently to the target allows multiple probes to bind and cleave for each copy of a target nucleic acid.

i) Selection of the amount of sequence overlap

One way of achieving such a renewal, in which the INVASOR oligonucleotide and the probe oligonucleotide share a region of complementarity, can be envisaged considering the diagram in Fig. 29. It can be seen that the Tf of each oligonucleotide will be a function of the full length of that oligonucleotide: that is, the Tf of the INVASOR = Tf (Y + X) and the Tf of the probe = Tf (X + Y) for the probe. When the probe is cleaved, the X region is released, leaving section Z. If the Tf of Z is less than the reaction temperature and the reaction temperature is less than Tf (X + Z), then the excision of the probe it will lead to the removal of Z, thus allowing it to hybridize a new one (X + Z). It can be seen from this example that the region X has to be long enough for the release of X to drop the Tf of the remaining probe section below the reaction temperature: a GC-rich section X can be much shorter than an X section rich in AT and still get this stability change.

In other embodiments described herein, the renewal of the probe is not related to a change in the Tf caused by the excision of the probe, but is related to the association and dissociation behavior of the probe under the selected conditions, regardless of the split. Therefore, it is not intended that the present invention be limited to the use of probes that, after cleavage, give products having Tf below the reaction temperature, as described above.

ii) Non-sequence overlaps

It has been determined that the relationship between the 3 ’end of the upstream oligonucleotide and the cleavage site

desired in the probe must be carefully designed. It is known that the preferred cleavage site for the types of structure-specific endonucleases employed herein is a base pair in a duplex (Lyamichev et al., Above). Previously, it was believed that the presence of an upstream oligonucleotide or primer allowed the cleavage site to move from this preferred site, to the single stranded region of the 5 'arm (Lyamichev et al., Above and US Patent No. 5,422. 253). In contrast to this previously proposed mechanism and while not limiting the present invention to any particular mechanism, it is believed

that the nucleotide immediately 5 ’or upstream of the probe cleavage site (including minison and

intermediate length probes) must be able to have base pairing with the target for effective cleavage to take place. In the case of the present invention, this would be the nucleotide in the probe sequence immediately upstream of the intended cleavage site. In addition, as described herein, it has been observed that to direct cleavage to the same site in the probe, the upstream oligonucleotide

it has to have its 3 ’base (i.e. nucleotide) immediately upstream of the intended cleavage site of the

probe. In embodiments in which the INVASOR oligonucleotides and probe share an overlap of

sequence, this places the 3 ′ terminal nucleotide of the upstream oligonucleotide and the base of the 5 ′ probe oligonucleotide of the cleavage site competing for pairing with the corresponding nucleotide of the target chain.

To examine the result of this competition (i.e., which base is matched during a successful cleavage event), substitutions were made in the probe and INVASOR oligonucleotides so that either the probe oligonucleotide or the INVASOR erroneously paired with the target sequence in this position. The effects of both provisions on excision rates were examined. When the INVASOR oligonucleotide is unpaired at the 3 'end, the cleavage rate was not reduced. However, if this base was removed, the cleavage site moved upstream of the intended site. In contrast, if the probe oligonucleotide had no base pairing with the target just upstream of the site to which the INVASOR oligonucleotide was directing the cleavage, the cleavage rate decreased dramatically, suggesting that when there is competition, the probe oligonucleotide was the molecule to have base pairing in that position.

It appears that the 3 ′ end of the upstream INVASOR oligonucleotide is unpaired during cleavage and is still required for precise excision placement. To examine which part or parts of the 3 ’terminal nucleotide are required for excision placement, INVASOR oligonucleotides were designed that terminated at this end with nucleotides that were altered in a variety of ways. The sugars examined included 2 ’deoxyribose with a phosphate 3’ group, a dideoxyribose, 3 ’deoxyribose, 2’ O-methylribose, arabinose and arabinose with a 3 ’phosphate. Abbasic ribose, with and without 3 'phosphate, were tested. "Universal" bases were tested

synthetics such as 3-nitropyrrole and 5-3-nitroindole in ribose sugars. Finally, a similar aromatic ring structure based on acridine, attached to the 3 'end of the previous nucleotide without a sugar group was tested. The results obtained reinforced the conclusion that the aromatic ring of the base (at the 3 ’end of the INVASOR oligonucleotide) is the remainder required to achieve the direction of cleavage at the desired site within the downstream probe. The remainder at the 3 'end of the INVASOR oligonucleotide does not have to be a complementary base to the target nucleic acid.

iii) Minies and Intermediate Length Probes;

As discussed above, the INVASOR oligonucleotide-directed cleavage assay can be performed using INVASOR and probe oligonucleotides that are approximately 13-25 nucleotides in length (typically 20-25 nucleotides). It is also considered that oligonucleotides can be composed of themselves by shorter oligonucleotide sequences that align along a target chain but are not covalently bound. This means that there is a cut in the main phosphate-sugar structure of the compound oligonucleotide, but that there is no alteration in the progress of nucleotides with paired bases in the resulting duplex. When short nucleic acid chains are aligned contiguously along a longer chain, hybridization of each is stabilized by hybridization of adjacent fragments because base pairs can be stacked along the helix. since, in fact, the main structure was not interrupted. This binding cooperativity can give each segment a greater interaction stability than would be expected for the segment that hybridizes with the longest nucleic acid alone. One application of this observation has been to assemble primers for DNA sequencing, typically approximately 18 nucleotides in length, from oligonucleotide assemblies of three hexamers that are designed to hybridize in this way (Kotler et al., Proc. Natl. Acad. Sci USA 90: 4241 [1993]). The resulting double-cut primer can be enzymatically extended in reactions performed at temperatures that can be expected to alter the hybridization of hexamers, but not oligomers of 18 units.

The use of compound or discontinuous oligonucleotides is successfully applied in the INVASOR-directed cleavage test. For example, the probe oligonucleotide can be divided into two oligonucleotides that hybridize contiguously and adjacently along a target oligonucleotide as illustrated in Fig. 57. In this figure, the downstream oligonucleotide (analogous to the probe Fig. 25) is composed of two smaller pieces: a short segment of 6-10 nucleotides (called the "minison"), which has to be cleaved throughout the detection reaction and an oligonucleotide that hybridizes immediately underneath of the mini-wave (called the “stacker”), which serves to stabilize the hybridization of the probe. To form the cleavage structure, an upstream oligonucleotide (the INVASOR oligonucleotide) is provided to direct the cleavage activity to the desired region of the mini-wave. The assembly of the probe by unbound parts of nucleic acid (i.e., the mini-wave and the stacker) allows regions of sequences to change without requiring the re-synthesis of the entire probed sequence, thereby improving the cost and flexibility of the detection system In addition, the use of unbound compound oligonucleotides makes the system more rigorous in its perfectly matching hybridization requirement to achieve signal generation, allowing this to be used as a sensitive means to detect mutations or changes in target nucleic acid sequences. .

As illustrated in Figure 57, in one embodiment, the methods of the present invention employ at least one pair of oligonucleotides that interact with a target nucleic acid to form a cleavage structure for a specific nuclease of structure. More specifically, the cleavage structure comprises i) a target nucleic acid that can be single stranded or double stranded (when a double stranded target nucleic acid is used, it can be converted into single stranded, for example, by heating); ii) a first oligonucleotide,

called the "stacker", which defines a first region of the target nucleic acid sequence being the

complement of that region (W region of the target as shown in Fig. 57); iii) a second oligonucleotide,

called the "minison", which defines a second region of the target nucleic acid sequence being the

complement of said region (regions X and Z of the target as shown in Fig. 57); iv) a third

oligonucleotide, called the "INVASOR", whose part 5 ’defines a third region of the same acid sequence

target nucleic (regions Y and X in Fig. 57) adjacent to and chain below the second target region (regions X and Z) and the second whose 3 'part overlaps in the region defined by the second oligonucleotide (region X represents overlap region). The resulting structure is illustrated in Fig. 57. As described above for embodiments that do not employ an applicator, the region shown as "X" may represent a region in which there is a physical, but not a sequence, overlap between the oligonucleotides INVASOR and probe.

Although it does not limit the invention or the present discussion to any particular mechanism of action, the diagram in Fig. 57 represents the effect of the cleavage site caused by this type of arrangement of three oligonucleotides. The design of these three oligonucleotides is described in more detail below. In Fig. 57, the 3 'ends of the nucleic acids (ie, the target and the oligonucleotides) are indicated by the use of the arrowheads at the ends of the lines representing the chains of the nucleic acids (and , where space permits, these extremes are also marked with “3 '”). It is easily understood that the three oligonucleotides (the INVASOR, the minison and the stacker) are arranged in a relative parallel orientation to each other, while the target nucleic acid chain is arranged in an antiparallel orientation with respect to the three oligonucleotides. In addition, it is evident that the INVASOR oligonucleotide is located upstream of the minidose oligonucleotide and that the minidonized oligonucleotide is located upstream of the stacking oligonucleotide and that, with respect to the target nucleic acid chain, region W is upstream of region Z , the Z region is upstream of the X region and the X region is upstream of the Y region (i.e., the Y region is downstream of the X region, the X region is downstream of the Z region and the region Z is chain below region W). Complementarity regions between opposite chains are indicated by short vertical lines. Although it is not intended to indicate the precise location of the site or cleavage sites, the area to which the cleavage site is displaced within the oligonucleotide mined by the presence of the INVASOR oligonucleotide is indicated by the filled vertical arrowhead. Fig. 57 is not intended to represent the actual mechanism of action or physical arrangement of the cleavage structure and, furthermore, it is not intended that the method of the present invention be limited to any particular mechanism of action.

The binding of these oligonucleotides can be considered to divide the target nucleic acid into four distinct regions: a region that has complementarity only with the stacker (shown as "W"); a region that has complementarity only with the mini-wave (shown as "Z"); a region that has complementarity only with the oligonucleotide INVASOR (shown as "Y") and a region that has complementarity with both oligonucleotides, the INVASOR and the mini-wave, (shown as "X"). As discussed above, the INVASOR oligonucleotide can also be used in a way that provides physical overlap instead of sequence overlap with the probe.

In addition to the benefits mentioned above, the use of a composite design for the oligonucleotides that form the cleavage structure allows greater freedom in the design of reaction conditions to perform the INVASOR-directed cleavage test. When a longer probe (for example, 16-25 nucleotides) is used, as described above for detection in reactions that are performed at temperatures below that probe's Tf, excision of the probe may play a role. significant in destabilizing the duplex of which it is a part, thus allowing the renewal and reuse of the recognition site in the target nucleic acid. In contrast, reaction temperatures that are at or above the Tf of the probe refer to the probe molecules hybridizing and releasing from the target quite rapidly even without excision of the probe. When an upstream INVASOR oligonucleotide and a cleavage medium are provided, the probe will be specifically cleaved, but excision will not be necessary for probe renewal. If a long probe (for example, 16-25 nucleotides) is used in this way, the temperatures required to achieve this state would be quite high, approximately 65 to 70 ° C for an oligomer of 25 units of average base composition. The need for the use of such elevated temperatures limits the selection of cleavage agents to those that are very thermostable and can contribute thoroughly to the reactions, depending on the detection means, by thermal degradation of the probe oligonucleotides. With the mini-waves, this last probe replacement mechanism can be achieved at a lower temperature. Therefore, short probes are preferred for embodiments using lower reaction temperatures.

The mini-wave of the present invention may vary in size depending on the desired application. In one embodiment, the probe can be relatively short compared to a conventional probe (for example, 16-25 nucleotides), in the range of 6 to 10 nucleotides. When such a short probe is used, reaction conditions can be chosen that prevent hybridization of the mini-wave in the absence of the stacking oligonucleotide. In this way a short probe can be prepared to assume the specificity and statistical selectivity of a longer sequence. In the event of a disturbance in the cooperative junction of the minison and stacking nucleic acids, as can be caused by an erroneous mating within the short sequence (ie, region "Z" which is the region of the minisonda that does not overlaps with the invader) or at the junction between adjoining duplexes, this cooperativity can be lost, dramatically decreasing the stability of the shorter oligonucleotide (i.e., the mini-wave) and thereby decreasing the level of product cleaved in the test of The present invention.

It is also contemplated that intermediate size probes can be used. Such probes, in the range of 1 to 15 nucleotides, may combine some of the characteristics associated with the longer probes as originally described, including these characteristics the ability to hybridize and cleave in the absence of a stacking oligonucleotide. At temperatures below the expected Tf of such probes, the renewal mechanisms may be as discussed above for probes in the range of 20 nucleotides and may

depend on the elimination of the sequence in the "X" region for destabilization and cycling.

Intermediate length probes can also be used at elevated temperatures, at or above their expected Tf, to allow fusion instead of excision to promote probe renewal. In contrast to the longer probes described above, however, the temperatures required to allow the use of such a thermally directed renewal are much lower (approximately 40 to 60 ° C), thereby protecting both the means of excision as nucleic acids in the reaction against thermal degradation. In this way, intermediate length probes can function in some cases as the mini-waves described above. In an additional similarity with the mini-waves, the accumulation of the cleavage signal of an intermediate length probe can be aided in some reaction conditions by the presence of a stacker.

To summarize, a conventional length probe usually does not benefit from the presence of a downstream stacking oligonucleotide (the exception being cases in which such an oligonucleotide can also alter structures in the target nucleic acid that interfere with the binding of probe) and is commonly used under conditions that require several nucleotides to be removed to allow the oligonucleotide to be released from the target efficiently. If the reaction temperature is used to direct the exchange of the probes, standard probes may require the use of a temperature at which nucleic acids and enzymes have a higher risk of thermal degradation.

The mini-wave is very short and works optimally in the presence of a down-chain stacking oligonucleotide. The mini-waves are very suitable for reaction conditions that use the reaction temperature to direct a rapid exchange of the probes on the target regardless of how many bases have been cleaved. In reactions with sufficient amount of the cleavage media, the probes that bind will be rapidly cleaved before they melt.

The intermediate or mid-length probe combines characteristics of these probes and can be used in

reactions such as so-called long probes, with longer overlapping regions ("X" regions) to

direct probe renewal at lower temperature. In a preferred embodiment, the intermediate length probes are used at sufficiently high temperatures such that the probes hybridize with the target and are rapidly released regardless of cleavage. The intermediate length probe may have improved performance in the presence of a stacker in some circumstances.

The distinctions between minison, midison (ie intermediate length) and long are not considered inflexible and are only based on length. The operation of any given probe may vary with its specific sequence, the selection of solution conditions, the temperature selection and the cleavage media selected.

Example 17 shows that the assembly of oligonucleotides comprising the cleavage structure of the present invention is sensitive to mismatches between the probe and the target. The mismatch site used in Example 17 provides an example and is not intended to be a limitation on the location of a mismatch that affects cleavage. It is also considered that a mismatch between the INVASOR oligonucleotide and the target can be used to distinguish related target sequences. In the 3 oligonucleotide system, which comprises an invasive oligonucleotide, a probe and a stacker, it is considered that the mismatches can be located within any of the duplex regions formed between these oligonucleotides and the target sequence. In a preferred embodiment, a mismatch to be detected is located in the probe. In a particularly preferred embodiment, the mismatch is in the probe, in the pair of

bases immediately upstream (i.e., 5 ’) of the site that is cleaved when the probe does not mate

wrongly with the target.

In another preferred embodiment, a mismatch to be detected is located within the "Z" region defined by the hybridization of a mini-wave. In a particularly preferred embodiment, the mismatch is in the minison, in the base pair immediately upstream (i.e., 5 ’) of the site that is cleaved when the minison does not pair with the target.

b) Design of reaction conditions

Target nucleic acids that can be analyzed using the methods of the present invention that employ a 5 ′ nuclease as the cleavage medium include many types of both RNA and DNA. Such nucleic acids can be obtained using conventional molecular biology techniques. For example, nucleic acids (RNA or DNA) can be isolated from a tissue sample (for example, a biopsy sample), tissue culture cells, samples containing bacteria and / or viruses (including cultures of bacteria and / or viruses) , etc. The target nucleic acid can also be transcribed in vitro from a DNA template or it can be chemically synthesized or amplified by the polymerase chain reaction. In addition, nucleic acids can be isolated from an organism, as a genomic material or as a similar extrachromosomal plasmid or DNA or they can be a fragment of such material generated by treatment with a restriction endonuclease or other cleavage agents,

or shear force, or they can be synthetic.

The assembly of the target nucleic acids, probe and the INVASOR oligonucleotide in the cleavage reaction of the present invention uses principles commonly used in the design of oligonucleotide-based enzyme assays, such as dideoxynucleotide sequencing and polymerase chain reaction (PCR). ). As performed in these assays, the oligonucleotides are provided in an excess sufficient so that the rate of hybridization with the target nucleic acid is very rapid. These tests are usually performed with 50 fmol to 2 pmol of each oligonucleotide per µl of reaction mixture, although they are not necessarily limited to this range. In the Examples described herein, amounts of oligonucleotides ranging from 250 fmol to 5 pmol per µl of reaction volume were used. These values were selected for the purpose of facilitating the demonstration and are not intended to limit the realization of the present invention to these concentrations. Other concentrations of oligonucleotides (eg, lower ones) commonly used in other molecular biology reactions are also considered.

It is desirable that an invading oligonucleotide be immediately available to direct cleavage of each probe oligonucleotide that hybridizes with a target nucleic acid. In some embodiments described herein, the INVASOR oligonucleotide is provided in excess with respect to the probe oligonucleotide. Although this is an effective means of manufacturing the INVASOR oligonucleotide immediately available in said embodiments, it is not intended that the practice of the present invention be limited to conditions where the INVASOR oligonucleotide is in excess of the probe or any particular proportion of the INVASOR and the probe (eg, in some preferred embodiments described herein, the probe is provided in excess with respect to the INVASOR oligonucleotide). Another means of ensuring the presence of an INVASOR oligonucleotide whenever a probe binds to a target nucleic acid is to design the INVASOR oligonucleotide to hybridize more stably with the target, that is, to have a Tf greater than that of the target. probe. This can be achieved by any means of increasing the stability of the nucleic acid duplex discussed herein (eg, increasing the amount of complementarity with the target nucleic acid).

Buffer conditions have to be selected that will be compatible with both oligonucleotide / target hybridization and with the activity of the cleavage agent. Optimum buffer conditions for nucleic acid modification enzymes and, particularly, DNA modification enzymes, generally include sufficient mono- and divalent salts to allow the association of nucleic acid chains by base pairing. If the process of the present invention is performed using an enzyme cleavage agent other than those specifically described herein, the reactions can generally be performed in any buffer of this type that has been described as being optimal for the nuclease function of the agent. cleavage. In general, to test the usefulness of any cleavage agent in this procedure, test reactions are performed in which the cleavage agent of interest is tested in MOPS / MnCl2 / KCl buffer or Mg-containing buffers described in the present document and in any buffer that has been described that is suitable for use with that agent, in a manufacturer data sheet, a magazine article or in a personal communication.

The products of the invasive-directed cleavage reaction are fragments generated by cleavage with structure specificity of the input oligonucleotides. The resulting cleaved and / or non-cleaved oligonucleotides can be analyzed and separated by various methods including, among others, electrophoresis (on a variety of supports including acrylamide or agarose gels, paper, etc.), chromatography, fluorescence polarization, spectrometry of masses and chip hybridization. In some examples, the invention is illustrated using electrophoretic separation for the analysis of the products of the cleavage reactions. However, it is noted that the separation of the cleavage products is not limited to electrophoresis. Electrophoresis is selected to illustrate the process of the invention because electrophoresis is widely practiced in the art and easily accessible to the average practitioner. In other examples, the invention is illustrated without electrophoresis or any other resolution of the cleavage products.

The probe and INVASOR oligonucleotides may contain a marker to aid its detection after the cleavage reaction. The label can be a radioisotope (for example, a nucleotide labeled with 32P or 35S)

placed at the 5 ’or 3’ end of the oligonucleotide or, alternatively, the marker can be distributed along the

oligonucleotide (ie, a uniformly labeled oligonucleotide). The label can be a non-isotopic detectable moiety, such as a fluorophore, that can be detected directly or a reactive group that allows specific recognition by a secondary agent. For example, biotinylated oligonucleotides can be detected by probing with a streptavidin molecule that is coupled to an indicator (eg, alkaline phosphatase or a fluorophore) or a hapten such as dioxigenin that can be detected using a specific antibody coupled to a similar indicator. The reactive group may also be a specific configuration or nucleotide sequence that can bind or otherwise interact with a secondary agent, such as another nucleic acid, an enzyme or an antibody.

c) Optimization of reaction conditions

The INVASOR-directed cleavage reaction is useful for detecting the presence of specific nucleic acids In addition to the considerations indicated above for the selection and design of the INVASOR oligonucleotides and probe, the conditions under which the reaction has to be performed they can be optimized for detection of a specific target sequence.

An objective to optimize the INVASOR-directed cleavage test is to allow specific detection of the smallest number of copies of a target nucleic acid. To achieve this, it is desirable that the combined elements of the reaction interact with maximum efficiency, such that the reaction rate (for example, the number of cleavage events per minute) is maximized. Elements that contribute to the overall effectiveness of the reaction include the speed of hybridization, the rate of cleavage and the effectiveness of the release of the cleaved probe.

The cleavage rate will be a function of the selected cleavage medium and can be made optimal according to the manufacturer's instructions when commercial enzyme preparations are used or as described herein in the examples herein. The other elements (hybridization rate, release efficiency) depend on the execution of the reaction and the optimization of these elements is discussed below.

Three elements of the cleavage reaction that significantly affect the rate of nucleic acid hybridization are the concentration of the nucleic acids, the temperature at which the cleavage reaction is performed and the concentration of salts and / or other ions of load protection in the reaction solution.

The concentrations at which oligonucleotide probes are used in assays of this type are well known in the art and have been discussed above. An example of a common strategy to optimize an oligonucleotide concentration is to select an oligonucleotide starting amount for pilot assays; 0.01 to 2 μM is a range of concentrations used in many oligonucleotide-based assays. When initial cleavage reactions are performed, the following questions about the data can be raised: Is the reaction performed in the absence of the target nucleic acid substantially free of cleavage product ?; Is the cleavage site specifically displaced according to the design of the INVASOR oligonucleotide ?; Is the specific cleavage product detected easily in the presence of the uncleaved probe (or does the amount of uncut material exceed the selected display procedure)?

A negative response to any of these questions would suggest that the concentration of the probe is too high and that a set of reactions should be performed using serial dilutions of the probe until the appropriate amount was identified. Once identified for a given target nucleic acid in a given type of sample (for example, purified genomic DNA, body fluid extract, lysed bacterial extract), re-optimization should not be necessary. The type of sample is important because the complexity of the material present can influence the optimum of the probe.

On the contrary, if the initial probe concentration selected is too low, the reaction may be slow, due to inefficient hybridization. Tests with increasing amounts of the probe will identify the point at which the concentration exceeds the optimum (eg, at which an undesirable effect occurs, such as background cleavage not dependent on the target sequence or interference with detection of split products). Since hybridization will be facilitated by excess probe, it is desirable, but not required, that the reaction be performed using probe concentrations just below this point.

The INVASOR oligonucleotide concentration can be selected based on the design considerations discussed above. In some embodiments, the INVASOR oligonucleotide is in excess with respect to the probe oligonucleotide. In a preferred embodiment, the probe oligonucleotide is in excess with respect to the INVASOR oligonucleotide.

Temperature is also an important factor in oligonucleotide hybridization. The temperature range analyzed will depend largely on the design of the oligonucleotides, as discussed above. When it is desired to carry out a reaction at a specific temperature (e.g., for an enzymatic requirement, for convenience, for compatibility with assay or detection apparatus etc.), the oligonucleotides that function in the reaction can be designed to function optimally at the desired reaction temperature. Each INVASOR reaction includes at least two oligonucleotides specific to the target sequence for the primary reaction: an upstream INVASOR oligonucleotide and a downstream probe oligonucleotide. In some preferred embodiments, the INVASOR oligonucleotide is designed to bind stably at the reaction temperature, while the probe is designed to freely associate and dissociate with the target strand, excision occurring only when an uncut probe hybridizes adjacent to a overlapping INVASOR oligonucleotide. In preferred embodiments, the probe includes a 5 'fin that is not complementary to the target and this fin is released from the probe when excision occurs. The released fin can be detected directly or indirectly. In some preferred embodiments, as discussed in detail below, the released fin participates with INVASOR oligonucleotide in a secondary reaction.

In general, the optimal conditions for the INVASOR assay are those that allow specific detection of the least amount of a target nucleic acid. Such conditions can be characterized as those that give the highest target dependent signal in a given time frame or for a given amount of target nucleic acid, or that allow the highest probe cleavage rate (i.e. probes cleaved by minute). In order to select a probe sequence that works optimally at a preselected reaction temperature, the melting temperature (Tf) of its specific analyte region (ASR, the region that is complementary to the target nucleic acid) is calculated using the nearest neighbor model near and published parameters for DNA duplex formation (SantaLucia, J., Proc Natl Acad Sci USA 95, 1460-5 (1998), Allawi, HT & SantaLucia, J., Jr. Biochemistry 36, 10581-94 ( 1997) However, there are several differences between the conditions under which the published parameters were measured and the conditions under which the published parameters were measured and the conditions under which the INVASOR test is performed in preferred embodiments. they are often different from the conditions of the solution in which the nearest neighboring parameters were obtained (1M NaCl and without divalent metals). This factor can be compensated by modifying the value provided for the concentration of salts within the melting temperature calculations. In addition to the salt concentration, the presence and concentration of the enzyme influences the optimal reaction temperature and an additional adjustment must be made in the calculated Tf to determine the optimum temperature at which to carry out a reaction. Observing the optimum temperature for a series of INVASOR reactions (that is, the temperature at which the rate of accumulation of the signal is higher), it has been possible to further alter the value of the salt concentration within these calculations to allow that the algorithm be modified for the calculation of the Tf instead of providing an optimal cleavage reaction temperature for a given probe sequence. This setting

additional is called a "salt correction." As used herein, the term "salt correction" refers to a variation made in the value provided for a concentration of salts in order to reflect the effect on a calculation of the Tf for a nucleic acid duplex of a parameter or condition without salts that affects said duplex. The variation of the values provided for the strand concentrations will also affect the result of these calculations. Using a 0.5M NaCl value [SantaLucia, J., Proc Natl Acad Sci U S A 95, 1460-5 (1998)] strand concentrations of approximately 1 M of the probe and 1fM of the target, the algorithm used to calculate the melting temperature of the target probe has been adapted for use in predicting the temperature of optimal reaction of the INVASOR test. For a set of approximately 30 probes, the average deviation between the optimum test temperatures calculated by this procedure and those determined experimentally was approximately 1.5 ° C.

As indicated above, the concentration of the cleavage agent may affect the actual optimum temperature for a cleavage reaction. Additionally, different cleavage agents, even if used at identical concentrations, can affect the optimal reaction temperature in a different way (e.g., the difference between the calculated Tf of the probe and the optimum temperature of the observed reaction can be greater for one enzyme than for another). The determination of suitable salt concentrations for reactions using different enzymes or enzyme concentrations, or for any other variation made under the conditions of the reaction, involves a two-stage procedure of a) measuring the optimum reaction temperature in the new reaction conditions and varying the concentration of salts within the Tf algorithm to produce a calculated temperature that matches or closely approximates the observed optimum. The measurement of an optimal reaction temperature generally involves carrying out reactions at a selected temperature range in such a way that the interval allows the observation of an increase in performance as it approaches an optimum temperature (increasing or decreasing temperatures) and a decrease in performance when an optimum temperature has been exceeded, so that the identification of the optimum temperature or temperature range is allowed [see, for example, VI Lyamichev, et al., Biochemistry 39, No.

31: 9523-9532 (2000)].

The length of the specific analyte region (ASR) of the downstream probe is defined with the temperature selected to carry out the reaction, for example at 63 ° C, in the experiments described in examples 54 to 60. To select a probe sequence Based on a desired reaction temperature, the probe sequence is selected as follows (as illustrated for the design of a probe for the detection of a difference in the sequence at a desired location). Starting from the position of the variant nucleotide on the target DNA (position N, Figure 112); the target base that is paired with the probe nucleotide at 5 'from the intended cleavage site), a repetitive procedure is used by which the length of the ASR is increased by a couple of bases until an optimum calculated reaction temperature is reached (Tf more salt correction to compensate for the enzyme and any other effect of the reaction conditions) that matches the desired reaction temperature. Preferably, the non-complementary arm of the probe is selected (by a similar retiterative procedure) to allow the secondary reaction to cycle at the same temperature of

reaction and design of the entire probe (ASR and non-complementary branch in 5 ’) is selected using programs

such as mfold [Zuker, M. Science 244, 48-52 (1989)] or Oligo 5.0 [Rychlik, W. & Rhoads, R.E. Nucleic Acids Res 17, 8543-51 (1989)] for the possible formation of dimeric complexes or secondary structures that could interfere with the reaction. The same principles are also followed for the design of the INVASOR oligonucleotide. TO

A design of an INVASOR test embodiment in which the 3 ’end of the

INVASOR oligonucleotide, at position N in the target DNA, is designed to have a non-complementary nucleotide for any allele suspected to be contained in the sample to be analyzed. Lack of mating does not adversely affect excision [Lyamichev, V. et al. Nature Biotechnology 17, 292-296 (1999)], and can potentiate probe cycling, probably minimizing the effects of coaxial stabilization between the two probes. Briefly, starting at the N position, additional residues complementary to the target DNA starting from the N-1 residue are then added upstream until the stability of the INVASOR-target hybrid exceeds that of the probe (and, therefore, the temperature of the programmed test reaction). In preferred embodiments, the stability of the INVASOR-target hybrid exceeds that of the probe by 15-20 ° C.

In some embodiments, when the cleavage fragment released from a primary reaction is to be used in a secondary reaction, the reaction conditions of the secondary reaction should also be considered when designing oligonucleotides for the primary reaction (e.g. ., the sequence of the 5 'non-complementary fin released from the probe in the primary reaction can be designed to function optimally in a secondary reaction). For example, as described in detail below, in some embodiments a secondary reaction is used when the cleavage fragment released from a primary reaction hybridizes with a synthetic cassette to form a secondary cleavage reaction. In some preferred embodiments, the cassette comprises a fluorescent moiety and an inactivation moiety, in which the cleavage of the secondary cleavage structure separates the fluorescent moiety from the inactivation moiety, which results in a detectable signal (eg. , FRET detection). The secondary reaction can be configured in several different ways. For example, in some embodiments, the synthetic cassette comprises two oligonucleotides: An oligonucleotide that contains the FRET challenges and a FRET / INVASOR oligonucleotide bridged with an oligonucleotide that allows the INVASOR oligonucleotide (ie, the aletaliberate of the primary reaction) and the FRET oligonucleotide to hybridize, so that a cleavage structure is formed. In some embodiments, the synthetic cassette is provided as a single oligonucleotide, which comprises a hairpin structure (ie, the FRET oligonucleotide is connected at its 3 'end with the bridge oligonucleotide by a loop). The loop may be nucleic acid (eg, a nucleotide chain, such as the four T residues represented in various Figures, including 113A) or a spacer or linker that is not nucleic acid. Bound molecules can be described together as a FRET cassette. In the secondary reaction using a FRET cassette, the fin released from the primary reaction, which acts as an INVASOR oligonucleotide, should be able to associate and disassociate with the FRET cassette freely, so that a released fin can direct the excision of multiple cassettes FRET. It is an aspect of the assay design that all probe sequences can be selected to allow primary and secondary reactions to occur at the same optimum temperature, so that the reaction steps can be run simultaneously. In an alternative embodiment, the probes can be designed to operate at different optimum temperatures, so that the reaction steps are not simultaneous at their optimum temperature. As indicated above, the same repetitive process used to select the ASR of the probe can be used in the design of the part of the primary probe that participates in a secondary reaction.

Another determinant of hybridization efficiency is the salt concentration of the reaction. In large part, the selection of the solution conditions will depend on the cleavage agent requirements and, for commercially available reagents, the manufacturer's instructions are a resource for this information. When an assay is developed that uses any particular cleavage agent, the oligonucleotide and temperature optimizations described above should be performed under the buffer conditions most appropriate to that cleavage agent.

An "enzyme-free" control allows the evaluation of the stability of the labeled oligonucleotides under specific reaction conditions or in the presence of the sample to be tested (ie, evaluating the sample for contaminated nuclei). In this way, the substrate and oligonucleotides are introduced into a tube containing all the reaction components, except the enzyme and are treated the same as the reactions containing enzyme. Other controls may also be included. For example, a reaction with all components except the target nucleic acid will serve to confirm the dependence of cleavage on the presence of the target sequence.

d) Selection of a cleavage agent

As demonstrated in a series of the Examples, some 5 'nuclei do not require an oligonucleotide chain

above that is active in a cleavage reaction. Although cleavage may be slower without the upstream oligonucleotide, it can occur (Lyamichev et al., Science 260: 778 [1993], Kaiser et al., J. Biol. Chem., 274: 21387 [1999]). When a DNA strand is the template or target strand with which the probe oligonucleotides hybridize, the

5 ’nucleated derivatives of DNA polymerases and some FLAP endonucleases (FEN), such as those derived

of Methanococcus jannaschii, can be cleaved quite well without an upstream oligonucleotide that provides an overlap (Lyamichev et al., Science 260: 778 [1993], Kaiser et al., J. Biol. Chem., 274: 21387 [1999], and U.S. Patent No. 5,843,669). These mucleases can be selected for use in some embodiments of the INVASOR assay, for example in embodiments where excision of the probe in the absence of an INVASOR oligonucleotide gives a different cleavage product that does not interfere with the intended analysis, or in which Both types of cleavage, directed by INVASOR oligonucleotide and independent of INVASOR oligonucleotide, will occur.

In other embodiments it is preferred that the excision of the probe depends on the presence of an upstream INVASOR oligonucleotide and that an enzyme having this requirement be used. Other FENs, such as those from Archeaoglobus fulgidus (Afu) and Pyrococcus furiosus (Pfu), cleave an overlapping structure on a target DNA at such a higher velocity than with a non-overlapping structure (i.e., after losing the upstream oligonucleotide or of having a non-overlapping upstream oligonucleotide) that can be seen as having an essentially absolute requirement for overlap (Lyamichev et al., Nat. Biotechnol., 17: 292 [1999], Kaiser et al., J. Biol. Chem., 274: 21387 [1999]). When a target RNA hybridizes with oligonucleotide DNA probes to form a cleavage structure, many FEN cleaves the DNA probe down the chain poorly, regardless of the presence of an overlap. In these RNA-containing structures, 5 ’nucleases derived from DNA polymerases have a strong overlap requirement and are essentially inactive in their absence.

e) Polling for Multiple Alleles

The INVASOR-directed cleavage reaction is also useful in the detection and quantification of individual variants or alleles in a mixed sample population. By way of example, such a need exists in the analysis of tumor material for mutations in genes associated with cancers. The biopsy material of a tumor may have a significant complement of normal cells, so that it is desirable to detect mutations even when they are present in less than 5% of the copies of the target nucleic acid in a sample. In this case, it is also desirable to measure what fraction of the population carries the mutation. Similar analyzes can also be performed to examine allelic variation in other gene systems and it is not intended that the method of the present invention be limited to tumor analysis.

As demonstrated below, the reactions can be performed under conditions that prevent excision of probes that even lead to a mismatch of difference of a single nucleotide within the region of the target nucleic acid called "Z" in Fig. 29, but which allow the excision of a similar probe that is completely complementary to the target in this region. In a preferred embodiment, the mismatch is in the probe that is 5 'from the site where the cleavage occurs in the absence of the mismatch.

In other embodiments, the INVASOR assay can be performed under conditions of an important overlapping requirement (e.g., using Afu FEN for the detection of the target DNA or the 5 'nuclease of the DNA polymerase for the detection of RNA. target, as described above), which provides an alternative means of detecting a single nucleotide or other sequence variations. In one embodiment, the probe is selected from

so that the target base that is suspected to vary is placed at the 5 ’end of the region complementary to the

target of this probe. The upstream INVASOR oligonucleotide is positioned to provide a single overlapping base. If the target and the probe oligonucleotide are complementary at the base in question, overlap is formed and excision can occur. This embodiment is illustrated in Figure 112. However, if the target is not complementary to the probe in this position, said base in the probe becomes part of a non-branch

Complementary to 5 ’, there is no overlap between the INVASOR oligonucleotide and the probe oligonucleotide and it

suppresses splitting

It is also contemplated that different sequences can be detected in a single reaction. The specific probes for the different sequences can be marked differently. For example, the probes may have different dyes or other detectable moieties, different lengths or they may have differences in net loads of the products after cleavage. When they are marked differently in one of these ways, the contribution of each specific target sequence to the final product can be adjusted. This has the application in the detection of the quantities of different versions of a gene within a mixture. Different genes in a mixture to be detected and quantified can be wild-type and mutant genes, for example, (as can be seen in a tumor sample, such as a biopsy). In this embodiment, the probes can be designed to bind to the same site precisely, but one to match the wild type sequence and one to match the mutant. Quantitative detection of the cleavage products of a reaction performed for an adjusted amount of time will show the proportion of the two genes in the mixture. Such analysis can also be performed on unrelated genes in a mixture. This type of analysis is not intended to be limited to two genes. Many variants can be measured similarly within a mixture.

Alternatively, different sites in a single gene can be controlled and quantified to verify the measurement of that gene. In this embodiment, the signal from each probe would be expected to be the same.

The use of multiple probes that are not marked differently is also considered, so that the aggregate signal is measured. This may be desirable when many probes designed to detect a single gene are used to strengthen the signal of that gene. This configuration can also be used to detect unrelated sequences within a mixture. For example, in blood banks it is desirable to know if any one of a host of infectious agents is present in a blood sample. Because blood is discarded regardless of which agent is present, different signals from the probes would not be required in such an application of the present invention and, in fact, may be undesirable for reasons of confidentiality.

As described above for the two oligonucleotide system, above, the specificity of the reaction As described above for the two oligonucleotide system, above, the specificity of hybridization of the complete set of the detection oligonucleotides. For example, there may be applications where it is desirable to detect a single region within a complex genome. In such a case, the oligonucleotide set can be chosen to require precise recognition by hybridization of a longer segment of a target nucleic acid, often in the range of 20 to 40 nucleotides. In other cases it may be desirable to have the oligonucleotide set interacting with multiple sites within a target sample. In these cases, a strategy would be to use a set of oligonucleotides that recognize a smaller and, therefore, statistically more common segment of a target nucleic acid sequence.

In a preferred embodiment, the INVASOR oligonucleotides and stacker can be designed to be maximally stable, such that they will remain attached to the target sequence for prolonged periods during the reaction. This can be achieved by any one of several measures well known to those skilled in the art, such as adding additional hybridization sequences to the length of the nucleotide (up to about 50 nucleotides in total length) or using residues with decreased negative charge, such as phosphorothioate or peptide nucleic acid moieties, such that complementary chains do not repel each other to the extent that natural chains do. Such modifications can also serve to make these flanking oligonucleotides resistant to contaminating nuclei, thereby further guaranteeing their continued presence on the target chain during the course of the reaction. In addition, the INVASOR and stacker oligonucleotides can be covalently bound to the target (for example, by the use of cross-linking with psoralen).

II. Effect of STOP molecules on the signal and background in sequential invasive excision reactions

As described above, and demonstrated in example 36, the concentration of the probe that is cleaved can be used to increase the signal accumulation, with the highest concentrations of the probe giving the highest final signal. Do not impede, the presence of large quantities of probe without residual cleavage can pose problems for the subsequent use of the cleaved products for detection or for further amplification. If the next step is a simple detection (e.g., by gel resolution), excess uncut material can produce background by dissemination or dispersion of the signal, or by overcoming a detector (e.g., by overexposing a film in the case of radioactivity or exceeding the limits of quantitative detection of an apparatus for fluorescent imaging). This can be overcome by distributing the product of the uncut probe (eg, using the load inversion procedure described in Example 22 and discussed in detail below). In more complex detection procedures, the cleaved product can be intended to interact with another entity to indicate cleavage. As indicated above, the cleaved product can be used in any reaction that uses oligonucleotides, such as hybridization, primer extension, ligation or the direction of invasive excision. In each of these cases, the fate of the residual uncut probe should be considered in the reaction design. In a primer extension reaction, the uncut probe can hybridize with a template for prolongation. If the excision is required to reveal the correct 3 ′ end for prolongation, the hybrid uncut probe will not be extended. However, it can compete with the cleaved product for the mold. If the mold is in excess of the excised and uncleaved probe combination, the last two must find a copy of the mold to join. However, if the mold is limiting, any competition can reduce the part of the excised probe that can be successfully attached to the available mold. If a large excess of probe was used to direct the initial reaction, the remainder may also be in large excess over the cleavage product and, therefore, can provide a very effective competitor, so that the amount of the product of final reaction (e.g., prolongation) for its ultimate detection.

The involvement of the uncut probe material in a secondary reaction can also contribute to the background in these reactions. Although the presentation of a cleaved probe for a subsequent reaction may represent an ideal substrate for the enzyme to be used in the next step, some enzymes can also act, although inefficiently, also on the uncut probe. In Example 43, it was shown that transcription can be stimulated from a cut promoter even when one side of the cut has additional unmatched nucleotides (called "branched promoter" in said Example). Similarly, when the subsequent reaction is going to be an invasive excision, the uncleaved probe can be attached to the elements intended to form the second excision structure with the excised probe. Two of the possible configurations are shown schematically in Figures 105 and 106. The structure on the right in the second stage in each Figure shows a possible configuration formed by the elements of the secondary reaction (eg, targets and / or probes secondary) and the primary probe without cleavage. In each of these cases, it was found that some of the 5 'nuclei described in this document can catalyze some measure of cleavage of these defective structures. Even at a low level, this aberrant cleavage can be misinterpreted as a signal of specific positive cleavage of the target.

With these negative effects of the excess of uncut probe considered, there is clearly a need for some procedure to prevent these interactions. As indicated above, it is possible to distribute the cleaved product of the snda without cutting after the primary reaction by traditional procedures. However, these procedures often take time, can be expensive (eg, columns, disposable gels etc.) and can increase the risk of improper handling or contamination of the sample. It is very preferable to configure the sequential reactions so that the original sample does not have to be removed to a new vessel for subsequent reaction.

The present invention provides a method for reducing interactions between the primary probe and other reactants. This procedure provides a means of specifically diverting the probes without splitting off the participation in subsequent reactions. The deviation is achieved by the inclusion in the next reaction stage an agent designed to interact specifically with the primary probe without cleaving. Although the primary probe in an invasive excision reaction is treated for reasons of comfort, it is contemplated that the STOP molecules can be used at any stage of reaction within a chain of invasive excision stages, as needed or desired for the design. of an essay. It is not intended that the DETENTION molecules of the present invention be limited to any particular stage.

The process of diverting residual uncut probes from a primary reaction uses agents that can be specifically designed or selected to bind to the probe molecules without cleaving with greater affinity than the cleaved probes, so that the species of cleaved probe competes effectively by the elements of the subsequent reaction, even when the uncut probe is present in a large excess. These

agents have been called “STOP molecules” due to their function of stopping or stopping the probe

Primary participation in the last reaction. In various Examples below, a oligonucleotide is provided as a STOP oligonucleotide in an invasive excision assay. It can be appreciated that any molecule or chemical substance that can discriminate between the uncut probe of full length and the excised probe, and that can be attached or otherwise inactivate the probe without cleavage can preferably be configured to act as DETENTION molecules within the meaning of the present invention. By

For example, antibodies with such specificity can be obtained, such as "aptamers" that can be selected

through multiple stages of in vitro amplification (eg, SELEX, "US Patent Nos. 5,270,163 and 5,567,588) and specific capture rounds or other selection means.

In one embodiment, the STOP molecule is an oligonucleotide. In another embodiment, the DETENTION oligonucleotide is a compound oligonucleotide, comprising two or more short oligonucleotides that are not covalently bound but that are cooperatively bound and stabilized by coaxial stacking. In a preferred embodiment, the oligonucleotide is modified to reduce interactions with the cleavage agents of the present invention. When an oligonucleotide is used as a STOP oligonucleotide, it is intended not to participate in the subsequent reaction stage. Considering the schematic diagrams in Figures 105 and 106, particularly the rightmost figure of step 2b of each Figure, it will show that the binding of the STOP oligonucleotide to the primary probe can, with the participation of the secondary target or without such participation , creating a bifurcated structure that is a substrate of cleavage by the 5 'nucleases used in some embodiments of the methods of the present invention. The formation of such structures would lead to some level of unintended cleavage that could contribute to the fonodi, reduce the specific signal or compete for the enzyme. It is preferable to provide STOP oligonucleotides that do not create such cleavage structures. One procedure to do this is to add these modifications to the DETENTION oligonucleotides, since they have been found to reduce the activity of the INVASOR olugonucleorides, since the INVASOR olugonucleorides

they occupy a similar position within a cleavage structure (that is, the 3 ′ end of the ONVASOR oligonucleotide places the cleavage site of an unpaired 5 ’arm). Modification of the 3 ′ end of the INVASOR oligonucleotides was analyzed to determine the effects on cleavage in Example 35, it was found that a series of modifications were significantly debilitating for the function of the INVASOR oligonucleotide. Other modifications not described herein can be easily characterized by performing said assay using the cleavage enzyme to be used in the reaction for which the STOP oligonucleotide is intended.

In a preferred embodiment the structure of a STOP oligonucleotide is modified. This can be done to increase the resistance to degradation by nucleating or temperature, or to provide a duplex structure that is a less favorable substrate for the enzyme to be used (e.g., duplex of form A versus duplex of form B). In a particularly preferred embodiment, the modified structure oligonucleotide further comprises a modification at the 3 'end. In a preferred embodiment, the modifications comprise a 2'-0-methyl substitution of the nucleic acid structure, while in a particularly preferred embodiment, the modified 2'-O-methyl oligonucleotide further comprises an amine group at the 3-terminus. '.

The purpose of the STOP oligonucleotide is to allow the minority population of the cleaved probe to compete effectively with the cleaved probe for the binding of any element to be used in the next step. Although a STOP oligonucleotide that can discriminate between the two probe species absolutely (i.e., only joining the uncut probe and never cutting) can give the greatest benefits in some embodiments, it is envisioned that in many applications, including INVASOR sequential assays described herein, the STOP oligonucleotide of the present invention can perform the intended function only with partial discrimination. When the STOP oligonucleotide has some interaction with the cleaved probe, it can prevent the detection of some part of these cleavage products, so that the absolute level of signal generated from a given amount of target material is reduced. If this same oligonucleotide STOP has the simultaneous effect of reducing the background of the reaction (that is, from the specific non-target cleavage) by a factor that is greater than the reduction factor in the specific signal, the meaning of the signal (i.e. the signal: background ratio) increases, even with the smallest amount of absolute signal. Any potential STOP molecule design can be analyzed in a simple way by comparing the levels of the background and specific signals of the reactions that lack STOP molecules with the levels of the background and specific signals of similar reactions that include oligonucleotides from DETENTION. Each of the reactions described in Examples 49-53 demonstrate the use of such comparisons and those skilled in the art can easily adapt them to other DETENTION molecules and target embodiments. What constitutes an acceptable level of exchange of the absolute signal for that effectiveness will vary for different applications (eg, target levels, sensitivity of texture etc.) and any individual user can determine it using the methods of the present invention.

III. Signal improvement by incorporating the products of an invasive excision reaction into a subsequent invasive excision reaction

As indicated above, the oligonucleotide product released by invasive cleavage can then be used in any reaction or reading procedure that uses oligonucleotides in the size range of a cleavage product. In addition to the reactions that involve primer extension and transcription, described herein, another enzymatic reaction using oligonucleotides is the invasive cleavage reaction. The present invention provides means of using the oligonucleotide released in a primary invasive cleavage reaction as a component to complete a cleavage structure to allow a secondary invasive cleavage reaction. A possible configuration of an invasive excision reaction that supplies a component for a secondary excision structure is depicted in Figure 96. It is not intended that the sequential use of the invasive excision product be limited to a single additional stage. It is contemplated that many different invasive excision reactions can be performed in sequence.

The polymerase chain reaction uses a DNA replication procedure to create copies of a targeted segment of nucleic acid at a logarithmic accumulation rate. This is made possible by the fact that when DNA strands are separated, each individual strand contains enough information to allow the assembly of a new complementary strand. When new strands are synthesized, the number of identical molecules has doubled. In 20 repetitions of this procedure, the original can be copied 1 million times, making very rare sequences easily detectable. The mathematical power of a duplication reaction has been incorporated into a series of amplification tests, several of which are cited in Table 1.

By performing multiple sequential invasive cleavage reactions, the method of the present invention captures an exponential mathematical advantage without producing additional copies of the target analyte. In a simple invasive cleavage reaction, the yield, Y, is simply the turnover rate, K, multiplied by the reaction time, t (i.e., Y = (K) (t)). If Y is used to represent the performance of a single reaction, the performance of a compound (i.e., a sequential multiple reaction), assuming that each of the stages of individual invasive excision has the same turnover rate, it can simply be represented as Yn, in which n is the number of invasive excision reactions that have been performed in the series. If the yields of each stage differ, the ultimate yield can be represented as the product of the multiplication of the yields of each individual reaction in the series. For example, if a primary invasive excision reaction can produce a thousand products in 30 minutes and each of these products can participate in 1000 additional reactions, there will be 10002 copies (1000 x 1000) of the last product in a second reaction. If a third reaction is added to the series, the theoretical yield will be 10003 (1000 x 1000 x 1000). In the methods of the present invention, the exponent is derived from the number of invasive cleavage reactions in the cascade. This can be contrasted with the amplification procedures described above (e.g., PCR) in which Y is limited to 2 by the number of strands in the duplex DNA and the exponent n is the number of realization cycles, so that Many repetitions are necessary to accumulate large quantities of product.

To distinguish the exponential amplifications described above from those of the present invention, the former can be considered reciprocal reactions because the reaction products are reintroduced into the same reaction (e.g., event one leads to a number of events 2 and each event 2 leads back to some number of events 1). In contrast, the events of the present invention are sequential (e.g., event 1 conducts some number of events 2; each event 2 again donates to a number of events 3 etc., and no event can contribute to an earlier event in the chain).

The sensitivity of reciprocity procedures is also one of the greatest weaknesses when these assays are used to determine if a target nucleic acid sequence is present or absent in a sample. Since the product of these reactions is a detectable copy of the starting material, contamination of a reaction with the products of a previous reaction can lead to false positive results (i.e., the obvious reaction of the target nucleic acid in samples that do not actually contain none of these target analytes). In addition, since the concentration of the product in each positive reaction is so high, sufficient amounts of DNA to create a strong false positive signal can be communicated to new reactions very easily, either by contact with contaminated instruments or by aerosol. In contrast to the reciprocity procedures, the most concentrated product of the sequential reaction (i.e., the product released in the last event of invsive excision) is not capable of initiating a similar reaction or disgust if performed with a sample of fresh ensato . This is a marked advantage over the exponential amplification procedures described above because the reactions of the present invention can be carried out without the costly containment provisions (e.g., by specialized instruments or by a separate laboratory space) required by any reaction. of reciprocity Although the products of a penultimate event can be inadvertently transferred to produce a bottom of the final product in the absence of a target analyte, the contamination would have to be of a much larger volume to give an equivalent risk of a false positive result.

When the sequential term is used, it is not intended to limit the invention to condifugrations in which an invasive excision reaction or assay must be completed before the start of a subsequent reaction for invasive excision of a different probe. Instead, the term refers to the order of events as they would occur if only single copies of each of the oligonucleotide species were used in an assay. The primary invasive cleavage reaction refers to the one that occurs first, in response to the formation of the cleavage structure on the target nucleic acid. Subsequent reactions may be called secondary, tertiary reactions etc., and may involve artificial "target" strands that only serve as support for the

assembly of a cleavage structure and that are not related to ”the nucleic acid analyte of interest.

Although the entire test can be configured, if desired, with each invasive excision stage separated in space (e.g., in different reaction vessels) or in time (e.g., using a shift in the conditions of reaction, such as temperature, enzyme identity or solution conditions, to allow for the latest cleavage events), it is also contemplated that all reaction components can be mixed so that side reactions can be initiated as soon as the Product of a primary split is available. In such a format, primary, secondary and subsequent excision events involving different copies of the excision structures can take place simultaneously.

Several levels of this type of linear amplification can be conceived, in which each successive round of the excision produces an oligonucleotide that can participate in the excision of a different probe in subsequent rounds. The primary reaction would be specific to the analyte of interest, using the secondary (and tertiary, etc.) reactions to generate a signal while remaining dependent on the primary reaction for its onset.

The released product can work in various capacities in subsequent reactions. One of the possible variations is shown in Figure 96, in which the product of an invasive excision reaction is converted to the INVASOR oligonucleotide to direct the specific excision of another probe in a second reaction. In Figure 96,

The first invasive excision structure is formed by the association of the INVASOR oligonucleotide ("Invader") and the probe oligonucleotide ("Probe 1") with the pyrmer target nucleic acid ("Diana 1"). The target nucleic acid is divided into three regions based on what parts of the INVASOR and probe oligonucleotides are capable of hybridizing with the target (as discussed above and as shown in Figure 25.) Region 1 (region Y in Figure 25) of the target has complementarity with only the INVASOR oligonucleotide; region 3 (Region Z in Figure 25) of the target has complementarity with only the oligonucleotide; and region 2 (region X in Figure 25) of the target has complementarity with both INVASOR oligonucleotides and probe It is noted that the sequential invasive cleavage reaction is depicted in Figure 96 employs an INVASOR oligonucleotide and one probe; the sequential cleavage reaction is not limited to the use of and such first escosión structure. The first cleavage structure in the sequential reaction can also employ an INVASOR oligonucleotide, a minidrill and an applicator oligonucleotide as discussed above. In addition, as discussed above, overlap in any or all cleavage structures in sequential reactions may comprise residues other than overlapping complementary bases, so that the region shown as

"X" represents a region in which there is a physical overlap rather than a sequence between the oligonucleotides

INVASOR and probe.

In Figure 96, excision of Probe 1 releases "Probe Cut 1" (indicated by the dashed line in Probe 1

both cleaved and uncleaved in Figure 96). Then, the released Probe 1 is used as the INVASOR oligonucleotide in the second cleavage. The second cleavage structure is formed by the association of the Probe

Cut 1, a second oligonucleotide probe ("Probe 2") and a second target nucleic acid ("Diana 2"). In

Some embodiments, Probe 2 and the second target nucleic acid are covalently linked, preferably at their 3 'and 5' ends, respectively, thereby forming a foot and a hairpin loop which is herein referred to as a "cassette." . The loop may be nucleic acid (eg, a nucleotide chain, such as the four T residues represented in various Figures, including 113A) or a spacer or linker that is not nucleic acid. The inclusion of an excess of the cassette molecule allows each Cut Probe 1 to serve as an INVASOR to direct the excision of multiple copies of the cassette.

Probe 2 may be marked (eg, as indicated by the star in Figure 96) and the detection of the excision of the second cleavage structure can be achieved by detecting the labeled Probe 2 cut; the label can be a radioisotope (e.g., 32P or 35S), a fluorophore (fluorescein), a reactive group capable of detecting a secondary agent (e.g., biotin / streptavidin), a positively charged adduct that allows the detection by selective load inversion (as discussed in Section IV above) etc. Alternatively, the Cut Probe 2 can be used in an extension reaction or to complete or activate a protein binding site or can be detected and used by any means to detect or use an oligonucleotide described herein.

Another possible configuration for performing a sequential invasive cleavage reaction is depicted in Figure 97. In this embodiment, probe oligonucleotides that are cleaved in the primary reaction can be designed to fold over themselves (i.e., they contain a region of autocomplementarity) to create a molecule that can serve as an INVASOR oligonucleotide and target (herein called the "IT" complex). The IT complex then allows excision of a different probe present in the secondary reaction. The inclusion of an excess of the secondary probe molecule ("Probe 2") allows each IT molecule to serve as

platform for the generation of multiple copies of the excised secondary probe. In Figure 97, the regions of

autocomplementarity contained within the 5 ’part of the INVASOR oligonucleotide are indicated by the

Striped ovals, the flehca between these two ovals indicates that these two regions can self-appear (as shown in “Cut Probe 1”). The target nucleic acid is divided into three regions based on which parts of the INVASOR and probe oligonucleotides are capable of hybridizing with the target (as discussed above and it is noted that the target can be divided into four regions if a stacking oligonucleotide is used ). The second

Excision structure is formed by associating the second probe ("Probe 2") with the fragment of Probe 1 ("Cut Probe 1") that was released by excision of the first excision structure. The Cut Probe 1 forms a fork or foot / loop structure near its 3 ’end by virtue of the association of the

regions of autocomplementarity contained within the Cut Probe 1 (this self-associated Cut Probe 1 forms the IT complex). The IT complex (Probe 1 Cut) is divided into three regions. Region 1 of the IT complex has

complementarity with part 3 ’of Probe 2; region 2 has complementarity with the 3 ’end of the Cut Probe 1 and with the 5’ part of the Probe 2 (analogous to the overlap region “X” shown in Figure 25); and region 3 contains the region of self-complementarity (that is, region 3 is complementary to part 3 ’of

Probe 1 Cut). Note that, with respect to the IT complex (i.e., the Probe Cut 1), region 2 is located upstream of region 2 and region 2 is located upstream of region 3. As for other embodiments of invasive cleavage, the region shown as "2" may represent a region in which there is a physical, but not sequence, overlap between the INVASOR part of the Cut Probe 1 and the oligonucleotide Probe 2.

The cleavage products of the secondary invasive excision reaction (i.e., Cut Probe 2) can be detected or, in turn, designed to constitute yet another integrated INVASOR-target complex for use with a third probe molecule, again without relate c and the preceding targets.

The present invention is not limited to the configurations depicted in Figures 96 and 97. It has been conceived that the oligonucleotide product of a primary cleavage reaction can play the role of any of the oligonucleotides described herein (e.g., it can serve as a target strand without a sequence similar to the INVASOR oligonucleotide or it can serve as a stacking oligonucleotide, as described above), to enhance the rate of renewal in the secondary reaction by stabilizing the hybridization of the probe through coaxial stacking.

Secondary cleavage reactions in some preferred embodiments of the present invention include the use of FRET cassettes such as those described in Examples 54 to 62. Such molecules provide a secondary target and a FRET-labeled cleavable sequence, which allows for the homogeneous reaction ( that is, without product separation or other manipulation after the reaction) of the sequential invasive cleavage reaction. Other preferred embodiments use a secondary reaction system in which the FRET probe and the synthetic target are provided as separate oligonucleotides.

In a preferred embodiment, each subsequent reaction is facilitated (i.e., depends on) by the product of the previous cleavage, so that the presence of the latter product can serve as an indicator of the presence of the target analyte. However, the cleavage in the second reaction does not have to depend on the presence of the product of the primary cleavage reaction; The product of the primary cleavage reaction can simply measurably boost the speed of the second cleavage reaction.

In summary, the cascade of the INVASOR assay (ie, sequential invasive cleavage reactions) of the present invention is a combination of two or more linear assays that allows the accumulation of the ultimate product at an exponential rate, but without a significant risk of transfer contamination. It is important to note that the fines that do not arise from sequential excision, such as thermal rhythm of the secondary probe, generally increase linearly over time. In contrast to this, the signal generation of a two-stage sequential reaction follows a quadratic kinetics. Therefore, data collection as a course of time, either taking temporary points or using an instrument that allows real-time detection during incubations of the reaction in the INVASOR test, provides the attractive ability to discriminate between the signal true and any background solely on the basis of linear versus quadratic increments in the signal over time. For example, when viewed graphically, the actual signal will appear as a quadratic cross, while any accumulated background will be linear and therefore easy to distinguish, even if the absolute level of the background signal (e.g., fluorescence in a FRET detection format) is substantial.

The amplification of the sequential invasive excision of the present invention can be used as an in-between reinforcement of any of the detection procedures (e.g., conventional gel-based analysis or by load inversion), polymerase extension and incorporation into a region d eunion to protein, described herein. When used in such combinations, the increased production of a specific cleavage product in the invasive cleavage test reduces the sensitivity and specificity loads in reading systems, thereby facilitating its use.

In addition to allowing several detection platforms, the cascade strategy is suitable for multiplex analysis of individual analytes (i.e. individual target nucleic acids) in a single reaction. The multiplez format can be classified into two types. In one case, it is desirable to know the identity (and quantity) of each of the analytes that may be in a clinical sample or the identity of each of the analytes as well as internal control. To identify the presence of multiple individual analytes in a single sample, several secondary amplification systems can be included. Each probe cleaved in response to the presence of a specific target sequence (or internal control) can be designed to trigger a different cascade coupled to different detectable moieties, such as different sequences that will be extended by different DNA polymerase or pigments in a format. FRET. The contribution of each specific target sequence to the final product can thus be extended, allowing quantitative detection of different genes or alleles in a sample containing a mixture of genes or alleles.

In the second configuration, it is desirable to determine if any of the various analytes are present in a sample, but the exact identity of each one does not have to be known. For example, in blood banks it is desirable to know if any one of a host of infectious agents is present in a blood sample. Because blood is discarded regardless of which agent is present, different signals from the probes would not be required in such an application of the present invention and, in fact, may be undesirable for reasons of confidentiality. In this case, the 5 ’arms (that is, the 5’ part that will be released after excision) of the different analyte-specific probes would be identical and, therefore, would trigger the same secondary signal cascade. A similar configuration would allow multiple complementary probes of a single gene to be used to reinforce the signal of said gene or to guarantee incuslivity when there are numerous fins of a gene to be detected.

In the primary INVASOR reaction there are two possible sources of substance. The first comes from excision of the INVASOR independent probe associated with the target, with itself or with one of the other oligonucleotides present in the reaction. It can be seen considering Figures 96 and 97 that the probes of the primary cleavage reactions depicted are designed to have regions of complementarity with the other oligonucleotides involved in subsequent reactions and, as depicted in Figure 97, with other regions of The same molecule. For this reason, the use of an enzyme that cannot effectively cleave a structure that lacks a primer is preferred (eg, which cannot cleave the structures depicted in Figures 16A

or 16 D). As shown in Figures 99 and 100, the Pfu FEN-1 enzyme does not give detectable cleavage in the absence of the upstream oligonucleotide or even in the presence of an upstream oligonucleotide that does not invade the target probe complex. This indicates that Pfu FEN-1 endonuclease is an enzyme suitable for use in the methods of the present invention.

Other specific structure numbered may also be suitable. As commented in the first

For example, some 5 'nuclei can be used under conditions that significantly reduce this independent cleavage of the primer. For example, it has been shown that when the 5 'nuclease of DNAPTaq is used to cleave the forks, the idependent primer cleavage is markedly reduced by the inclusion of a monovalent salt in the reaction (Lyamichev, et al., [1993], previously).

INVASOR oligonucleotide independent cleavage test

A simple assay can be performed for any enzyme in combination with any reaction buffer to calculate the amount of INVASOR oligonucleotide-independent cleavage that can be expected from said combination. A small fork-like test molecule that can be used with or without a 3 'arm hybridized primer, the S-60 molecule, is depicted in Figure 30. The S-60 and oligonucleotide P15 are a set suitable for molecules to analyze the suitability of an enzyme to apply in the present invention and the conditions of use of these molecules are described in Example 11. Other similar forks can be used. A cleavage structure can be assembled from different oligonucleotides as depicted in Figures 99a-e. The reactions using these structures to analyze the activity of the Pfu FEN-1 enzyme in the presence or absence of an overlapping oligonucleotide upstream are described in Example 45 and the results are shown in Figure 100. To analyze any specific combination of enzyme and cleavage conditions similar reactions can be mounted. Outside of the variables of the reaction conditions to be analyzed for any particular enzyme (e.g., salt sensitization requirements, divalent cations), the test reactions should be adapted to any known limitations of this test enzyme. . For example, the test reactions will be performed at a temperature that is within the operating temperature range of the candidate enzyme, if known.

It is not necessary to demonstrate multiple overlap lengths for each candidate enzyme, but the enzyme activity should be evaluated in the absence of an upstream oligonucleotide (sequence or physical overlap) (as shown in Figure 99th and in the presence of an oligonucleotide that does not overlap (Fig. 99b) It is preferable that structures lacking upstream oligonucleotide are cleaved at less than half the rate observed in the presence of an upstream overlapping oligonucleotide. It is more preferable that these structures are cleaved at less than about one tenth of the velocity of the invasive excision structure It is most preferable that these structures are excised at less than a percentage of the velocity of the invasive excision structure.

If the cleaved product is to serve as an upstream oligonucleotide in a subsequent cleavage reaction, as depicted in Figure 96, the fastest reaction will be achieved if the other components of the second cleavage structure (ie Diana 2 and Probe 2 in Figure 96) are provided in excess with respect to the amount of the first cleavage product, so that cleavage can proceed immediately after the upstream oligonucleotide is available (ie, Probe 1 Cut in Figure 96 ). To provide an abundance of the second strand or target cassette (Diana 2 in Figure 96), an isolated natural nucleic acid, such as bacteriophage M13 DNA, can be used, or a synthetic oligonucleotide can be used. If a synthetic oligonucleotide is chosen as the second target sequence, the sequence used will be analyzed for regions of unintended autocomplementarity (similar considerations will apply to isolated natural nucleic acids such as restriction enzyme fragments or PCR products; acid targets natural nucleic whose 3 'ends are located 100 nucleotide chain abadjo of the probe binding site on the target strand are, in general, long enough to obviate the design considerations discussed below).

Specifically, it should be determined that the 3 ’end of the synthetic oligonucleotide may not hybridize with the strand

target (i.e., intracatenary hybridization) upstream of the probe, which triggers an unforeseen excision. Simple analysis of the synthetic oligonucleotide sequence should reveal whether the 3 'end has sufficient complementarity with the region of the target upstream of the soda site to pose a problem (i.e., it would reveal whether the synthetic oligonucleotide can form a fork at its 3 'end that could act as an invasive oligonucleotide to produce excision of the second probe in the absence of hybridization of the expected INVASOR oligonucleotide (i.e., the excision product of the first invasive excision reaction)). Yes

3 or more of the last 4 to 7 nucleotides (the 3 ’terminal region) of the synthetic target can pair the bases

chain above the probe so that there is an overlap with the probe-target duplex or delay that the duplexes

formed by the synthetic target strand with its own 3 ′ terminal region and with the probe but without a gap and the 3 ’terminal region has 1 or 2 additional nucleotides without pairing at the 3’ end of the synthetic target, the sequence of the

synthetic target oligonucleotide should be modified. The sequence can be modified to break the intertaction of

the 3 ’terminal region or to increase the distance between the probe binding site and the regions to which the 3 ′ end joins. Alternatively, the 3 'end can be modified to reduce its ability to direct cleavage (e.g., by adding a 3' phosphate during synthesis) (see Example 35, Table 3) or by adding several additional nucleotides whose bases they will not mate in a self-complementary way (that is, they will not participate in the formation of a hairpin structure).

When the product of a first invasive excision reaction is designed to form a target that can be folded over itself to direct the excision of a second probe, the IT complex as depicted in Figure 97, the sequence design will be considered. used to form the piebucle of the IT complex. Factors to be introduced in the design of said probe are 1) the length of the autocomplementarity region, 2) the type of overlap (is

say what remainder in 3 ’) and, if an overlap is selected in the sequence, the length of the overlap region

(region "X" in Figure 25) and 3) the stability of the fork / foot / loop skeleton as predicted by Watson-Crick base pairing and the presence or absence of a particularly stable loop sequence (eg, a tetrabucle [Tinoco et al., above], or a tribecle [Hirao et al., above]). It is desirable that this sequence has nucleotides whose bases can be paired (intracatenary) so that the second round of invasive excision can occur, but that the structure is not so strong that its presence prevents excision of the probe in the primary reaction ( that is, Probe 1 in Figure 96). As shown in this document, the presence

of a secondary structure in the 5 ’arm of a cleavage structure cleaved by a specific nuclease of

structure can inhibit cleavage by some specific nuclease structure (Ex. 1).

The length of the autocomplementarity region within Probe 1 determines the length of the duplex region upstream of Probe 2 in the second cleavage structure (see Fig. 97). Different enzymes have different length demands for this duplex to effect invasive excision in an effective way. For example, the FEN-1 enzymes of Pfu and FEN-2 of Mja have been analyzed to determine the effect of this duplex length using the set of target oligonucleotide molecules / INVASOR depicted in Figure 98 (ie, SEQ ID NO. 118, 119, 147-151). Invasive excision reactions were performed as described in the Example 38, using 1 pM IT3 (SEC IN No. 118), 2M PR1 probe (SEQ ID No. 119) for 5 minutes and the cleavage rates are shown in Table 2.

TABLE 2

Duplex Length

Pfu FEN-1 renewal per minute Mja FEN-1 renewal per minute

0

0

0

3

one 29

4

10 57

6

44 51

8

Four. Five 46

The data shown in Table 2 demonstrates that the Pfu FEN-2 enzyme can be used with 3 or 4 base feet, but that the cleavage speed is maximized when the foot is longer than 4 base pairs. Table 2 shows that Mja's FEN-1 enzyme can be effectively cleaved using shorter feet; however, since this enzyme can also cleave a probe in the absence of an upstream oligonucleotide, the use of Mja FEN-1 is not preferred in the sequential invsive excision procedures of the present invention.

A similar assay can be performed using any candidate enzyme to determine how much autocomplementarity can be designed in Probe 1. The use of a shorter foot means that the overall probe can be shorter. This is beneficial because shorter probes are less expensive to synthesize and because shorter probes will have fewer sequences that could form unforeseen intracatenary structures. When evaluating the activity of a candidate enzyme in structures such as those shown in Figure 98, it is not required that the length of the chosen foot allows the maximum rate of excision to occur. For example, when considering the case of Pfu FEN-1, the advantages of using a 4 base pair foot (e.g., cost or sequence constraints) with a spin-off rate of 10 splits per minute can exceed the speed advantage of using a foot longer than 6 base pairs (44 splits / minute) in the context of a particular experiment. It is within the scope of the present invention that some elements chosen for use in the assay are suboptimal for the performance of said particular element, if the use of the suboptimal design is beneficial to the objectives of said particular experiment as a whole.

In designing the oligonucleotides to be used as a probe that, once cleaved, forms a foot-loop structure as depicted in Figure 97 (i.e., Probe 1 in Figure 97), it has been found that stability of the loop is not a factor in the efficiency of the cleavage of Probe 1 or Probe 2. The analyzed loops have included stable tribes, sde 3 and 4 nucleotide loops that I had not predicted to be particularly stable (i.e., stability it is determined by the duplex sequence and not by additional stabilizing interactions within the loop) and large loops of up to about 25 nucleotides.

IV. Fractionation of specific nucleic acids by selective charge inversion

Some detection assays based on nucleic acid involve prolongation and / or shortening of oligonucleotide probes. For example, as described herein, primer-directed, primer-independent and INVASOR-directed cleavage assays, as well as the "clipping" assay all involve excision (ie, shortening) of oligonucleotides as a means to detect the presence of a target nucleic acid sequence. Examples of other screening assays that involve shortening a probe

Oligonucleotide include the "TaqMan" or PCR cut-off assay described in the US Pat.

No. 5,210,015 to Gelfand et al., The tests described in US Pat. Nos. 4,775,619 and

5,118,605 of Urdea, the catalytic hybridization amplification assay described in US Patent No. 5,403,711 to Walder and Walder and the cyclic probe assay described in United States Patents No.

4,876,187 and 5,011,769) of Duck et al. Examples of detection assays that involve prolongation of an oligonucleotide probe (or primer) include the polymerase chain reaction (PCR) described in U.S. Patent Nos. 4,683,195 and 4,683,202 to Mullis and Mullis et al. . and the ligase chain reaction (CSF) described in U.S. Patent Nos. 5,427,930 and 5,494,810 to Birkenmeyer et al. and Barany et al. . The above examples are intended to be illustrative of nucleic acid-based detection assays that involve prolongation and / or shortening of oligonucleotide probes and do not provide any exhaustive list.

Typically, nucleic acid-based detection assays involve prolongation and / or shortening of oligonucleotide probes require post-reaction analysis to detect the products of the reaction. It is common for the specific product or reaction products to be separated from the other reaction components, including the input or unreacted oligonucleotide probe. A detection technique involves electrophoretic separation of the reacted and unreacted oligonucleotide probe. When the assay involves excision or shortening of the probe, the unreacted product will be longer than the reacted or cleaved product. When the assay involves prolongation of the probe (or primer), the reaction products will be longer than the inlet. . Gel-based electrophoresis of a sample containing nucleic acid molecules of different lengths separates these fragments mainly based on size. This is due to the fact that in solutions that have a neutral or alkaline pH, nucleic acids that have widely different sizes (i.e. molecular weights) have very similar mass loading ratios and do not separate (Andrews, Elctrophoresis, 2nd Edition, Oxford University Press [1986], pp. 153-154.] The gel matrix acts as a molecular sieve and allows nucleic acids to separate based on size and shape (eg, linear, relaxed circular circles or supercoiled covalently closed).

Unmodified nucleic acids have a negative net charge due to the presence of negatively charged phosphate groups contained within the main sugar phosphate structure of the nucleic acid. Typically, the sample is applied to the gel near the negative pole and the nucleic acid fragments migrate within the gel towards the positive pole by moving the smaller fragments more rapidly through the gel.

The present invention provides a novel means for fractionating nucleic acid fragments based on the charge. This novel separation technique is related to the observation that positively charged adducts can affect the electrophoretic behavior of small oligonucleotides because the adduct charge is significantly relative to the charge of the entire complex. In addition to the use of positively charged adducts (for example, Cy3 and Cy5 amidite fluorescent dyes, the positively charged heterodimeric DNA binding dyes shown in Fig. 66, etc.), the oligonucleotide may contain amino acids (particularly useful amino acids are charged amino acids: lysine, arginine, aspartate, glutamate), modified bases, such as amino-modified bases and / or a main phosphonate structure (in all or a subset of the positions). In other embodiments, as discussed in more detail below, a neutral dye or detection moiety (eg, biotin, streptavidin, etc.) may be used instead of a positively charged adduct together with the use of amino-modified bases. and / or a complete or partial phosphonate main structure.

This observed effect is of particular utility in assays based on the cleavage of DNA molecules. Using the assays described herein as an example, when an oligonucleotide is shortened by the action of a CLEAVASE® enzyme or other cleavage agent, the positive charge can be prepared so as not to

only to significantly reduce the net negative charge, but to actually cancel it out, "investing" in a way

effective net charge of the marked entity. This load inversion allows target specific cleavage products to be divided from the uncleaved probe by extremely simple means. For example, cleavage products can be prepared to migrate to a negative electrode placed at any point in a reaction vessel, for focused detection without gel-based electrophoresis; Example 24 provides examples of suitable devices for focused detection without gel-based electrophoresis. When a plate gel is used, the sample wells can be placed in the center of the gel, so that it can be seen that the cleaved and non-cleaved probes migrate in opposite directions. Alternatively, a traditional vertical gel can be used, but with the electrodes inverted with respect to the usual DNA gels (i.e., the positive electrode at the top and the negative electrode at the bottom) in such a way that the cleaved molecules they enter the gel, while the non-cleaved ones are dispersed to the upper electrophoresis buffer reservoir.

An important benefit of this type of reading is the absolute nature of the division of substrate products (i.e., the separation is practically 100%.) This means that an abundance of uncleaved probe can be supplied to direct the hybridization stage. of the probe-based test, although the unconsumed (i.e. unreacted) probe can be subtracted, in essence from the result to decrease the background due to the fact that the unreacted probe will not migrate to the same pole as the specific reaction product .

By using multiple positively charged adducts, synthetic molecules can be constructed with sufficient modification so that the normally negatively charged chain becomes practically neutral. When constructed in this way, the presence or absence of a single phosphate group can mean the difference between a net negative charge or a net positive charge. This observation has particular utility when an objective is

differentiate between enzymatically generated DNA fragments, which lack a 3 ′ phosphate and thermal degradation products, which generally retain a 3 ′ phosphate (and therefore two additional negative charges). Examples 22 and 23 demonstrate the ability to separate positively charged reaction products from a negatively charged substrate oligonucleotide. As discussed in these examples, oligonucleotides can be transformed from net negative charged compounds to net positive ones. At

Ex. 23, the Cy3 positively charged dye was incorporated into the 5 ′ end of a 22 unit oligomer (SEQ ID NO: 50) which also contained two amino-substituted moieties at the 5 ′ end of the oligonucleotide; This oligonucleotide probe carries a negative net charge. After cleavage, which took place 2 nucleotides within the probe, the following labeled oligonucleotide was released: 5'-Cy3-AminoT-AminoT-3 '(in addition to unlabeled fragments comprising the remaining 20 nucleotides of SEQ ID No. 50). This short fragment carries a net positive charge while the rest of the cleaved oligonucleotide and the unreacted or inlet oligonucleotide carry negative net charges.

The present invention considers embodiments in which the specific reaction product produced by any cleavage of any oligonucleotide can be designed to carry a net positive charge while the unreacted probe is neutral in charge or carries a negative net charge. The present invention also considers embodiments in which the released product can be designed to carry a net negative charge while the input nucleic acid carries a net positive charge. Depending on the length of the released product to be detected, positively charged dyes may be incorporated at one end of the probe and modified bases may be placed along the oligonucleotide such that after cleavage, the released fragment containing the charged dye positively carries a positive net charge. Aminomodified bases can be used to balance the charge of the released fragment in cases where the presence of the positively charged adduct (eg, dye) alone is not sufficient to impart a positive net charge to the released fragment. In addition, the phosphate main structure can be substituted with a phosphonate main structure at a level sufficient to impart a positive net charge (this is particularly useful when the oligonucleotide sequence is not susceptible to the use of aminosubstituted bases). Figures 45 and 46 show the structure of short oligonucleotides containing a phosphonate group in the second residue T). An oligonucleotide containing a main structure completely substituted by phosphonate would have a neutral charge (without the presence of modified charged residues carrying a charge or presence of a charged adduct) due to the absence of negatively charged phosphate groups. Nucleotides containing phosphonate (for example, nucleotides containing methyl phosphonate are readily available and can be incorporated into any position of an oligonucleotide during synthesis using techniques that are well known in the art.

In essence, the invention contemplates the use of charge-based separation to allow the separation of specific reaction products from the input oligonucleotides in nucleic acid-based detection assays. The foundation of this novel separation technique is the design and use of oligonucleotide probes

(typically referred to as "primers" in the case of PCR) that are "load balanced" such that after each excision or extension of the probe, it becomes "unbalanced in charge" and specific reaction products can be separate from the input reactants based on the net charge.

In the context of assays that involve prolongation of an oligonucleotide probe (ie, a primer), as is the case in PCR, the input primers are designed to carry a net positive charge. The prolongation of the short oligonucleotide primer during polymerization will generate PCR products that now carry a net negative charge. The specific reaction products can then be easily separated and removed by concentration of the input primers using the charge-based separation technique described herein (the electrodes will be inverted with respect to the description in Ex. 23 , since the product to be separated and concentrated after a PCR will carry a negative charge).

V. Signal improvement by prolonging the reaction products in the oligonucleotide-directed cleavage assay INVASOR

It has been determined that when oligonucleotide probes are used in high temperature cleavage detection assays, a certain fraction of the truncated probes will have been shortened by non-specific thermal degradation and that such decomposition products can cause the analysis of specific cleavage data Diana's harder. The thermal degradation that creates a ladder of bottom bands when the probes of the present invention are treated at an elevated temperature for more than a few minutes occurs as a two-stage process. In the first stage the N-glycosyl linkage is broken, leaving an abasic site in the DNA strand. At the abbasic site, the DNA chain is weakened and undergoes spontaneous excision through a beta elimination process. Purine bases have been determined to be approximately 20 times more susceptible to breakage than pyrimidine bases (Lindahl, Nature 362: 709 [1993]). This suggests that one way to reduce the background in procedures using oligonucleotides at elevated temperatures is to select target sequences that allow the use of probes rich in pyrimidine. It is preferable, when possible, to use oligonucleotides completely composed of pyrimidine residues. If only one or a few purines are used, the background rupture will appear mainly at the corresponding sites and these bands (due to thermal degradation) can be confused with the expected cleavage products if precautions are not taken in the data analysis ( that is, the appropriate controls must be executed).

Background cleavage due to thermal degradation of probe oligonucleotides can, when not resolved from specific cleavage products, reduce the accuracy of quantification of the target nucleic acids based on the amount of product accumulated within a framework of fixed time A means to distinguish specific from non-specific products has been described above and is based on the division of the products of these reactions by differences in the net charges carried by the different molecular species in the reaction. As noted in that discussion, thermal decomposition products usually retain 3 'phosphates after decomposition, while enzyme cleaved products do not. The two negative charges on phosphate facilitate the load-based division of products.

The absence of a 3 ′ phosphate in the desired subset of the probe fragments can also be used advantageously in enzymatic assays. Nucleic acid polymerases, both without template (for example, terminal deoxynucleotidyl transferase, poly A polymerase) and template-dependent (for example, Pol 1 type DNA polymerases) require an available 3 'hydroxyl to which to attach additional nucleotides. This enzymatic selection of terminal structure 3 ’can be used as an effective means for specific non-product division

specific.

In addition to the benefits of the division described above, the addition of nucleotides to the end of the specific product of a specific invader cleavage offers an opportunity to add a marker to the products, to add captureable tails to facilitate support-based reading systems. solid or to do these two things at the same time. Some possible embodiments of this concept are illustrated in Fig. 56.

In Fig. 56, an INVASOR cleavage structure is shown comprising an INVASOR oligonucleotide that

it contains a 3 'blocked or non-extensible end (for example, a 3' dideoxy nucleotide) and a probe oligonucleotide containing a 3 'blocked or non-extensible end (the open circle at the 3' end of the oligonucleotides represents a non-extendable nucleotide ) and a target nucleic acid; the oligonucleotide probe may contain a

5 'end marker such as a biotin or fluorescein marker (indicated by stars) (cleavage structures that employ a 5' biotin labeled probe or a 5 'fluorescein labeled probe are shown below the large structure diagram left and right cleavage, respectively). After excision of the probe (the cleavage site is indicated by the large arrowhead), the probe labeled with cleaved biotin is extended using a template independent polymerase (e.g., TdT) and fluorescein triphosphate nucleotides. The prolonged cleaved probe molecule with fluorescein is then captured by binding by its 5 ′ biotin marker to streptavidin and then fluorescence is measured. Alternatively, after excision of a 5 ’fluorescein labeled probe, the cleaved probe is extended using a polymerase

independent of mold (for example, TdT) and d ATP. The polyadenylated cleaved probe molecule (prolonged with A) is then captured by binding by the poly A tail to the dT oligonucleotide attached to a solid support.

The examples described in Fig. 56 are based on the use of TdT to prolong specific products of INVASOR-directed cleavage. The description of the use of this specific enzyme is presented by way of example and is not intended to be a limitation (in fact, when probe oligonucleotides comprising RNA are used, the cleaved RNA probes can be extended using poly A polymerase). It is considered that such an assay could be configured to use a mold-dependent polymerase, as described above. Although this would require the presence of a suitable copy template other than the target nucleic acid, on which the truncated oligonucleotide could prime the synthesis, it can be anticipated that a probe that prior to excision would be non-extensible, due to any mismatch or modification of the 3 'end, could be activated as a primer when cleaved by an INVASOR directed cleavage. A mold-directed prolongation reaction also has the advantage of allowing greater selection and control of the incorporated nucleotides.

The use of extension without mold does not require the presence of any additional nucleic acid in the detection reaction, avoiding a stage of trial development and problem solving. In addition, the use of moldless synthesis eliminated the hybridization stage, potentially accelerating the assay. In addition, the TdT enzyme is rapid, capable of adding at least> 700 nucleotides to substrate oligonucleotides in a 15 minute reaction.

As mentioned above, the added queues can be used in several ways. They can be used as a direct mode of debris marked to the cleavage product to increase the signal of each cleavage event. Such a reaction is illustrated on the left side of Fig. 66. The labeled residues can be anything that, when added to a nucleotide, is added by the extension enzyme, such as dye molecules, haptens such as Digoxigenin or other binding groups such as biotin.

In a preferred embodiment, the assay includes a means for specifically capturing or dividing INVASOR-directed cleavage products in the mixture. It can be seen that target nucleic acids in the mixture can be prolonged during the reaction. If a marker is added, it is desirable to divide the prolonged INVSOR-directed cleavage products of these other labeled molecules to avoid funds in these results. This is done easily if only the cleavage product is capable of being captured. For example, you have to consider a

cleavage assay of the present invention in which the probe used has a biotin at the 5 ′ end and is blocked against extension at the 3 ′ end and in which a dye is added during prolongation. It should also be considered that the products have to be captured on a support by means of the remaining biotin and the captured dye is measured to assess the presence of the target nucleic acid. When the marker is added by extension, only the specifically cleaved probes will be labeled. Residual uncut probes can still be joined at the final capture stage, but will not contribute to the signal. In the same reaction, the nicks and cuts in the target nucleic acid can be prolonged by the enzyme and, therefore, labeled with dye. In the final capture, these marked targets will not join the support and, therefore, although marked, will not contribute to the signal. If it is considered that the final specific product is constituted by two parts, the part obtained from the probe and the part from the tail, it can be seen from this discussion that it is particularly preferred that when the part obtained from the probe is used for the specific capture , by hybridization, biotin / streptavidin or other procedure, that the marker is associated with the tail part. On the contrary, if a marker is attached to the probe part obtained, then the tail part can be adapted for capture, as illustrated on the right side of Fig. 66. The tails can be captured in several ways, including hybridization, incorporation of biotin with streptavidin capture or by the fact that longer molecules bind more predictably and more effectively to various nucleic acid binding matrices, such as nitrocellulose, nylon or glass, in membrane , paper, resin or other form. Although not required for this assay, this separation of functions allows the effective exclusion of signal from both unreacted probe and prolonged target nucleic acid.

In addition to the carriers described above, the extended products can be captured on any solid support that contains a suitable capture residue. For example, biotinylated products are generally captured with avidin treated surfaces. These avidin surfaces may be in microtiter plate wells, on beads, on rods, to name just a few of the possibilities. Such surfaces can also be modified to contain specific oligonucleotides, allowing product capture by hybridization. Generally, those skilled in the art know the capture surfaces as described herein and include nitrocellulose rods (eg, GENECOMB, BioRad, Hercules, CA).

SAW. Signal enhancement by termination of an activated protein binding site

In addition to the prolongation reaction with DNA polymerase described above, the present invention also contemplates the use of the products of the invasive cleavage reaction to form activated protein binding sites, such as RNA polymerase promoter duplexes, so that interaction of the completed site is allowed to use as an indicator of the presence of the nucleic acid that is the target of the invasive excision reaction. By way of example, when a duplex of RNA polymerase promoter is activated causing it to be completed (i.e., it is double-stranded on said part of the promoter region required for the binding of the polymeters) through the hybridization of the oligonucleotide porduct of In the invasive cleavage reaction, RNA synthesis can be used as such indicator.

It is not intended that the transcription reaction of the present invention be limited to the use of a particular RNA polymerase or RNA polymerase promoter region. Promoter sequences are well characterized for several bacteriophages, including bacteriophages SP6, T7 and T3. In addition, promoter sequences have been well characterized for a series of both eukaryotic and prokaryotic RNA polymerases. In a preferred embodiment, the promoter used allows transcription from one of the bacteriophage RNA polymerases. In a particularly preferred embodiment, the promoter used allows transcription by T7 RNA polymerase. Means for performing in vitro transcription are known in the art and commercial kits are available for transcription with eukaryotic, prokaryotic or bacteriophage RNA polymerases (eg, from Promega Corp., Madison, WI).

The protein binding regions of the present invention are not limited to the bacteriophage RNA polymerase promoters described above. Other promoter sequences that are contemplated are those of prokaryotes and eukaryotes. For example, many strains of bacteria and fungi are used for the expression of heterologous proteins. The minimum promoters required for transcription by RNA polymerases of organisms such as yeasts and other fungi, eubacteria, nematodes and cultured mammalian cells are well described in the literature and in the catalogs of commercial suppliers of DNA vectors for the expression of foreign proteins. in these organisms.

Binding sites for other types of nucleic acid binding protrins (eg, DNA) are contemplated for use in the present invention. For example, the proteins involved in the regulation of genes exert their effects by binding to DNA in the vicinity of the promoter from which the RNA of that gene is transcribed. The E. coli lac operator is an example of a particularly well characterized and commonly used gene regulation system in which the lac repressor protein binds to specific sequences that overlap, and therefore block, the promoter for the genes under the repressor control (Jacob and and Monod, Cold Spring Harbor Symposium on Quantitative Biol. XXVI: 193-211 [1961]). Many similar systems have been described in bacteria, including the trp and AraC regulatory systems. Given the large amount of information available on bacterial promoters, the steps described below for the design of partial promoters suitable for bacteriophage RNA polymerases can easily be adapted to the design of detection systems based on these other promoters.

As indicated above, many of the bacterial promoters are under the control of a repressor or other regulatory protein. It is considered within the scope of the present invention to include the creation of compound binding sites for these regulatory proteins through the provision of a nucleic acid fragment (e.g., a non-target cleavage product generated in a cleavage reaction invasive). The binding of the regulatory protein to the completed protein binding region (e.g., the composite binding region) can be assessed by one of numerous means, including delayed electrophoretic migration of the protein or DNA fragment or by a conformational change in protein or DNA after binding. In addition, transcription of a downstream promoter can be monitored to determine regulation by increase or decrease as a result of the binding of the regulatory protein to the completed protein binding region.

In addition to the bacterial systems described above, it has also been discovered that many genes in eukaryotic systems are under the control of specific proteins that bind to specific regions of the duplex DNA. Examples include, among others, OCT-1, OCT-2 and AP-4 proteins in mammals and GAL4 and GCN4 proteins in yeasts. Such regulatory proteins normally have a structural motif associated with the binding of duplex nucleic acid, such as helix-spin-helix, a zinc finger or a leucine zipper [for a review, see, Molecular and Cellular Biology, Wolfe (Ed. ), Wadsworth Publishing Co., Belmont, CA, p. 694-715 [1993]).

To simplify the test reaction described herein, reference will be made to T7 RNA polymerase, and its promoter. This is not intended to limit the invention to the use of this RNA polymerase and those skilled in the art of molecular biology will be able to easily adapt the described assay to the analysis of any of the DNA-binding proteins, RNA polymerases and their binding or the promoter sites discussed above.

It is known in the art that active T7 promoters can be formed by hybridization of two oligonucleotides, each comprising the upper or lower strand of the promoter sequence, so that a full-duplex promoter is formed without dent and complete (Milligan et al. , Nucl. Acids Res., 15:21, 8783-8798 (1987).] The present invention shows that one way of making the initiation of transcription dependent on the products of an invasive excision reaction is to design the probe for cleavage reaction in such a way that a part of an RNA polymerase promoter is released as a product.The remaining part or parts of DNA that have to assemble a promoter duplex can be provided as elements in the reaction mixture or can be produced by other invasive excision events If the oligonucleotide pieces are designed to comprise suitable regions of complementarity, the bases can be paired to form a duplex pr Complete omotor composed of three or more nucleic acid fragments, as depicted in Figure 88B. A promoter assembled in this way will have nicks in the structure of one or both strands. In one embodiment, these nicks can be covalently closed by the use of a DNA ligase enzyme. In a preferred embodiment, the indentations are placed in such a way that the transcription can proceed without ligation. When selecting the site of a dent created by assembling the partial fragment of the promoter, at least one dent must be within the recognized promoter region to use RNA polymerase. When a bacteriophage promoter is used, a dent should be between nucleotides -17 and -1, measured from the site of the start of transcription to +1. In a preferred embodiment, a dent will be between nucleotides -13 and -8. In a particularly preferred embodiment, a dent will be between nucleotides -12 and -10 on the non-template strand of the bacteriophage promoter.

When the nicks are not going to be repaired (that is, they are not going to be covalently closed with a DNA ligase), it is important to evaluate the effect of the nipple location on the level of transcription from the assembled promoter. A simple test is to combine the oligonucleotides that comprise the distinct parts of the promoter with an oligonucleotide comprising an entire strand of the promoter to be assembled, so that a duplex promoter is formed with a dent in a strand. If the dent is in the upper or non-template strand of the promoter, the oligonucleotide comprising the complete promoter is included to include additional non-promoter sequences at its 5 ′ end to serve as a template to be copied in the transcript. These arrangements are represented in Figure 88B. Alternatively, if the dent is going to be in the lower strand or template of the promoter, the partial promoter oligonucleotide that covers the +1 position, the transcription start site, will include the additional template sequence. This arrangement is depicted in Figures 95A-D (in this Figure several different embodiments are shown in which a cut probe or non-target cleavage product is used to form a composite promoter containing one or more nicks in the template strand). In any case, the separated oligonucleotides combine to form the complete promoter and the assembly is used in a transcription reaction to create RNA.

To measure the effect of the dent, a substantially identical promoter fragment is created by hybridization of two oligonucleotides each consisting of a strand of the full length promoter, to create a dent-free version of the same promoter. These two molecular assemblies are analyzed in parallel transcription reactions and the expected amount of RNA produced in each reaction is measured for both size and performance. A preferred method of assessing RNA size is by electrophoresis with posterior visualization. If a labeled nucleotide (e.g., 32P-GTP or fluorescein-UTP) is used in transcription, the RNA can be detected and quantified by autoradiography, fluorescent imaging or by transfer to the support membrane with subsequent detection (e.g., by antibodies or probe hybridization). Alternatively, if unlabeled RNA is produced, the amounts can be determined by other methods known in the art, such as by spectrophotometry or by electrophoresis with subsequent staining and comparison with known standards.

If the size of the RNA is as predicted with the template sequence or if it matches that produced from the control promoter, it can be assumed that transcription has been initiated at the same site of the complex and that essentially the same product has been produced of RNA. If the product is much shorter, the transcript has been initiated at an internal site or terminated prematurely (Schenborn and Mierendorf, Nucl. Acids Res., 13:17, 6223 [1985]; and Milligan et al., Previously ). Although this does not indicate that the analyzed assembly is completely unsuitable for the assay, partial transcripts will reduce the gross amount of RNA created, perhaps compromising the assay signal, and such products would require subsequent characterization (e.g., imprint printing or sequencing ) to identify the nucleotide content of the product. It is preferred that the size of the RNA produced matches the RNA produced in the control reaction.

The reaction yield is also analyzed. It is not necessary that the level of transcription matches that of the control reaction. In some cases (see Example 41 below), the nick promoter may have a higher transcription rate, while in other arrangements the transcription can be reduced (with respect to the promoter assembly rate without nicking). Only the quantity of product is required to be within the detection limits of the procedure to be used with the test promoter.

It is indicated that transcription from a bacteriophage promoter can produce 200 to 1000 copies of each transcription template (template plus active promoter) in one reaction. These levels of transcription are not necessary in the present invention. The reactions in which an RNA is produced for each template are also contemplated.

The test described above will allow to evaluate the usefulness in this test of a promoter with a dent in any position. It is an objective of the invention to provide one or more of the oligonucleotides comprising a partial promoter region through invasive excision event (s). In this embodiment, the partial promoter sequences are linked to the probe oligonucleotide in the invasive cleavage assay and are released by cleavage at a specific site, directed by the INVASOR oligonucleotide. It is also intended that transcription will be very little or non-existent in the absence of the correctly excised probe. To evaluate the success of any oligonucleotide design with respect to meeting these objectives, several transcription reaction assays can be performed.

For a promoter assembly that has a dent in the non-mold strand, several partial assemblies to be analyzed are shown in Figures 86A-D. As an example, but without limitations, this Figure represents the

trials for a promoter with it in which the upstream or 5 ’part of the non-template strand is to be provided

by the invasive excision test. This fragment is seen in Figure 86A marked as "cut probe." The transcription reactions incubated in the presence of the duplex shown in Fig. 86A will analyze the ability of the upstream partial promoter to allow transcription to begin when hybridized with a lower strand, called a "copy template." Similarly, a reaction performed in the presence of the duplex depicted in Fig. 86B will be analyzed to determine the capacity of the partial promoter fragment closest to the initiation site (stio +1, as indicated in Figure 85B) to support the Mold transcription copy. It is an important feature of the present invention that none of these partial promoter duplexes can support transcription at the same level as would be seen in transcription from an intact promoter as depicted in Figure 85B. It is preferred that none of these partial promoters will be sufficient to initiate detectable transcription within the same time course of a medium transcription reaction (ie, in approximately one hour of incubation).

Figures 86C and 86D represent two other duplex arrangements designed to analyze the effect of the uncut probe within the transcription reaction. Figure 86C represents the duplex formed between only the uncut probe and the copy mold, while Figure 86D includes the other part of the promoter. The 3 'region of the probe is not complementary to the promoter sequence and therefore produces an unpaired branch in the middle of the promoter. It is an important feature of the present invention that none of these branched promoter duplexes can support transcription at the same level as would be seen in transcription from an intact promoter as depicted in Figure 85B. It is preferred that none of these branched promoters will be sufficient to initiate detectable transcription in the same time course of a medium transcription reaction (ie, in approximately one hour of incubation).

In one embodiment of the transcription system of the present invention, the initiation of transcription from the copy template in the absence of a full promoter or in the presence of a branched promoter is avoided by judiciously placing the dent or nicks in the composite promoter. . For example, as shown in the following examples, the placement of a dent between nucleotides -12 and -11 of the non-template strand of the T7 bacteriophage promoter allows transcription to occur only when the probe has been successfully cut. , as in an invasive excision reaction. However, in some cases where the invasive cleavage reaction is to provide the upstream part of the non-template strand of the promoter (e.g., as depicted in Figure 88B), it may be necessary or desirable to place the dent in said strand in a specific position for reasons other than providing an optimal composite promoter (i.e., one that is inactive in the absence of any of the promoter parts). It may be necessary or desirable to place the dent in such a way that the creation of a complete branched promoter (Fig. 86D) has an undesirable level of transcription, reducing the dependence of RNA production on the success of the invasive cleavage stage. The following examples show that transcription from said branched promoter can be suppressed by a modification of the non-template promoter part below, shown as the "partial promoter oligonucleotide" in Figures 86, 88, 90 and 95D. As depicted in Figure 90, the partial promoter oligonucleotide can be provided with a "tail" of 5 'nucleotides that are not complementary to the template strand of the promoter but which are complementary to the 3' part of the probe oligonucleotide that is would eliminate in the invasive excision reaction. When the uncut probe hybridizes to the template with the 5 'tail partial oligonucleotide, the 5' tail can be paired with the 3 'region of the probe, forming a three-way junction as depicted in Figure 90A This can turn off transcription effectively, as shown below. When a hybridized cut probe, as shown in Figure 90B, a promoter with a small arm is formed and, herein, it is shown that said branched promoter can initiate transcription. In addition, care is taken when selecting the tail sequence at 5 '(that is, if the first unpaired base is the same nucleotide in nucleotide 3' of the cut probe, so that it competes' to hybridize with the same base of the template strand), the resulting branched structure can also be cleaved by the specific structure nucleated of the present invention, so that the unbranched promoter of Figure 90C is created, in some cases enhancing transcription on that observed with the promoter of Figure 90B.

The promoter duplex that is intended to be created in this embodiment by successfully executing the INVASOR-directed cleavage assay will include the "cut probe" and the partial promoter oligonucleotide depicted in Figures 86A and B, aligned on a single copy template nucleic acid. The analysis of the transcription efficiency of said promoter segment with a dent in comparison with the intact promoter is described above. All oligonucleotides described for these test molecules can be created using conventional synthetic chemistries.

The set of test molecules represented in Figure 86 is designed to assess the capabilities

of transcription of the various structures that may be present in the reactions in which the 5 ’part of

The non-template strand of the promoter is supplied by the INVASOR-directed division. It has also been conceived that the invasive cleavage reaction can deliver a different part of the partial promoter (eg, the abjo chain segment of the non-template strand of the promoter), as shown in Figure 94. The strand portions The promoter mold can also be supplied by the cut probe, as shown in Figures 95A-D. Can be created

an analogous set of test molecules, including the “cut” and uncut versions of the probe to be

use in the invasive excision test to analyze any alternative design, the dent is located in the template strand or in the promoter non-template strand.

The transcription based display procedures of the present invention can be used in a multiplex manner. The reactions can be constructed in such a way that the presence of a specific target leads to transcription from one type of promoter, while the presence of a different target sequence (e.g., a mutant or variant) or other A target that is suspected to be present may lead to transcription from a different type of promoter (i.e., a second). In said embodiment, the identity of the promoter from which the transcription was initiated could be deduced from the type or size of the RNA produced.

By way of example, without limitations, bacteriophage promoters can be compared with said application in sight. The promoters for phage T7, T3 and SP6 are quite similar, each having a length of approximately 15 to 20 base pairs and sharing an identity of approximately 45% between nucleotides -17 and -1, relative to the start of transcription. Despite these similarities, the RNA polymerases of these phages are highly specific to their known promoters, so that the other promoters may be present in a reaction but will not be transcribed (Chamberlin and Ryan, Enzymes XV: 87-108 [1982] ). Since these promoters are of a size and a way of being recognized for their similar polymerases (Li et al., Biochem. 35: 3722 * [1996]), indented versions of similar promoters can be designed for use in the methods of the present invention by analogy with the examples described herein that employ the T7 promoter. Given the high degree of specificity of RNA polymerases, these nicked promoters can be used together to detect multiple targets in a single reaction. There are many cases in which it would be highly desirable to detect multiple nucleic acid doanas in a single sample, including cases in which multiple infectious ones may be present or in which variants of a single type of target may have to be identified. Alternatively, it is often desirable to use a combination of probes to detect a target sequence and an internal control sequence to calculate the effects of contaminants in the sample on the test result. The use of multiple promoters allows the reaction to be evaluated according to the effectiveness of the invasive excision and the solidity of the transcription.

As indicated above, phage promoters were described in detail as an example of suitable protein binding regions (eg, that can be used to generate a composite promoter) for use in the methods of the present invention. The invention is not limited to the use of phage RNA polymerase promoter regions, in particular, and RNA polymerase promoter regions in general. Properly well characterized specific promoters have also been found in both prokaryotic and eukaryotic systems.

RNA that is produced in a manner dependent on the success of the detection of the target nucleic acid in the invasive excision reaction can be detected in several ways. If a labeled nucleotide is incorporated into the RNA during transcription, the RNA can be detected directly after fractionation (eg, by electrophoresis or chromatography). The labeled RNA can also be captured on a solid support, such as a microtiter plate, a bead or a test strip (e.g., by hybridization, antibody capture or through an affinity interaction such as that produced between biotin and avidin The capture may facilitate the measurement of the incorporated marker or it may be an intermediate stage before hybridization of the probe or a similar detection medium.If it is desired to incorporate the maximum amount of label in each transcript, it is preferred that the copy template is very long, approximately 3 to 10 kilobases, so that each RNA molecule carries many markers, alternatively, it may be desired to specifically mark a single site or a limited number of sites within the transcript. In this case, it may be desirable to have a short copy mold with only one or a few residues that would allow the incorporation of the labeled nucleotide.

The copy template can also be selected to produce RNA that perform specific functions. In a simple case, if a duplex dependent intercalating fluorophore is to be used to detect the RNA product, it may be desirable to transcribe an RNA that is known to form secondary duplex structures, such as a ribosomal RNA or an tRNA. In another embodiment, the RNA can be designed to interact specifically, or with a specific affinity, with a different substance. It has been shown that a method of alternating selection steps (e.g., by binding to a target substance) and in vitro amplification (e.g., by PCR) can be used to identify nucleic acid ligands with new properties and useful (Tuerk and Gold, Science 249: 505 [1990]). This system has been used to identify RNA, called ligands or aptameths, that bind closely and specifically to proteins and other types of molecules, such as antibiotics (Wang et al., Biochem. 35: 12338 [1996]) and hormones. RNAs can even be selected to bind to other RNAs through non-Watson-Crick interactions (Schmidt et al., Ann. N.Y. Acad. Sci. 782: 526 [1996]). An RNA ligand can be used to inactivate or enhance the activity of a molecule to which it binds. Any segment of RNA identified through said method can also be produced by the methods of the present invention so that observation of the activity of the RNA ligand can be used as a specific sign of the presence of the target material in the cleavage reaction. invasive The ligand binding to its specific partner can also be used as another way to capture a reading signal on a solid support.

The product RNA could also be designed to have a catalytic function (e.g., act as ribozyme), which allows the cleavage of another molecule to be indicative of the success of the primary invasive esicisón reaction (Uhlenbeck, Nature

328: 596 [1987]). In another embodiment, the RNA can be manufactured to encode a peptide sequence. When coupled to an in vitro translation system (eg, the S-30 system obtained from E. coli [Lesley, Methods Mol. Biol.,

37: 265 (1985)], or a rabbit reticulocyte lysate system [Dasso and Jackson, Nucleic Acids Res. 17: 3129 (1989)], available at Promega), the production of the appropriate protein can be detected. In a preferred embodiment, the proteins produced include those that allow colorimetric or luminescent detection, such as beta-galactosidase (lac-Z) or luciferase.

The previous discussion focused on the use of the present transcription visualization procedures in the context of the INVASOR-directed cleavage assay (i.e., non-target cleavage products produced in the INVASOR assay were used to complete and activate the region protein binding, such as a promoter region). However, the procedures for viewing the transcript are not limited to this context. An assay that produces an oligonucleotide product that has relatively small ends can be used in conjunction with the present transcription visualization procedures. For example, the homogeneous test described in US Pat. . 5,210,015, particularly when performed under conditions where polymerization cannot occur, produces short oligonucleotide fragments as a result of excision of a probe. If this test is performed under conditions where polymerization occurs, the probe cleavage site can be centered through the use of nucleotide analogs that have non-cleavable bonds at specific positions within the probe. These short oligonucleotides can be employed analogously to the cut probe or non-target cleavage products produced in the invasive cleavage reactions of the present invention. Further tests are known in the art that generalize suitable oligonucleotide products. For example, non-target cleavage products produced in assays such as "Probe Cycle Reaction" (Duck et al., BioTech., 9: 142 [1990] and US Pat. Nos. 4,876,187 and 5,011,769), in which shorter oligonucleotides are released from longer oligonucleotides after hybridization with a target sequence, such as short restriction fragments released in reeds in which a probe is designed for excision when hybridized with success with an appropriate restriction recognition sequence (US Patent No. 4,683,194).

Assays that generate short oligonucleotides having 3 '"Indented" (ie, non-discontinuous) ends can also be used successfully in the transcription reactions of the present invention when the oligonucleotide provided by this non-transcription reaction is used for providing a portion of the promoter region located downstream of the other oligonucleotide (s) that are required to complete the promoter region (i.e., a 3 'tail or unpaired extension can be tolerated when the oligonucleotide is use as the "Cut Probe" is in Figures 94 and 95A).

VII. Generation of 5 ’Nucleases Obtained from Thermostable DNA Polymerases

The 5 'nuclei of the invention form the basis of a new detection assay for the identification of

specific nucleic acid sequences. Figure 1A provides a schematic of an embodiment of the detection method of the present invention. The target sequence is recognized by two different oligonucleotides in the trigger or trigger reaction. In a preferred embodiment one of these oligonucleotides is provided on a solid support. The other can be provided free in solution. In the figure

1A, the free oligonucleotide is indicated as a "primer" and the other oligonucleotide is shown attached to a bead called type 1. The target nucleic acid aligns the two oligonucleotides for specific excision of the 5 'arm (of the oligonucleotide in pearl 1) through the 5 'nuclei of the present invention (not shown in Fig. 1A). The cleavage site (indicated by a large filled arrowhead) is controlled by the position of the 3 'end of the "primer" with respect to the downstream branch of the oligonucleotide in the bead 1.

The cleavage successfully releases a single copy of what is called the alpha signal oligonucleotide. This oligonucleotide may contain a detectable moiety (for example, fluorescein). On the other hand, it may be unmarked.

In one embodiment of the detection method, two or more oligonucleotides are provided on solid supports. The oligonucleotide shown in Fig. 1A in pearl 2 has a region that is complementary to the signal oligonucleotide (indicated as alpha raw), which allows hybridization. This structure can be cleaved by the 5 'nucelases of the present invention to release the beta signal oligonucleotide. The beta signal oligonucleotide can then hybridize with type 3 beads that have an oligonucleotide with a complementary region (indicated as raw beta). Again, this structure can be cleaved by the 5 ’nucelases of the present invention to release a new alpha oligonucleotide.

At this point, the amplification has been linear. To increase the power of the process, it is desired that the alpha signal oligonucleotide hybridize with the type 2 bead to be released after the release of the beta oligonucleotide so that it can continue to hybridize with other oligonucleotides on type 2 beads. Similarly, After the release of an alpha oligonucleotide from type 3 beads, it is desired that the beta oligonucleotide be released.

With the release of signal oligonucleotides by such techniques, each cleavage results in a doubling of the number of signal oligonucleotides. In this way, a detectable signal can be quickly achieved.

Fig. 1B provides a scheme of a second embodiment of the detection method of the present invention. Again, the target sequence is recognized by two distinct oligonucleotides in the trigger or trigger reaction and the target nucleic acid aligns the two oligonucleotides for specific 5 'arm cleavage by the DNAPs of the present invention (not shown in Fig. 1B ). In this specific example, the first oligonucleotide is completely complementary to a part of the target sequence. He

second oligonucleotide is partially complementary to the target sequence; the 3 ’end of the second oligonucleotide is completely complementary to the target sequence while the 5’ end is not

Complementary and forms a single chain arm. The non-complementary end of the second oligonucleotide can be a generic sequence that can be used with a set of conventional hairpin structures (described below). Detection of different target sequences would require unique parts of two oligonucleotides: the entire first oligonucleotide and the 3 ′ end of the second oligonucleotide. The 5 ’arm of the second oligonucleotide can be of invariable or generic sequence.

The second part of the detection procedure allows hybridization of the fragment of the second oligonucleotide released by the cleavage of the first cleavage structure formed in the triggering reaction (called the third oligonucleotide or trigger) with a first hairpin structure. The first fork structure has a 5 ′ single chain arm and a 3 ′ single chain arm. The third oligonucleotide triggers the cleavage of this first hairpin structure by hybridizing with the 3 ’arm of the hairpin thereby forming a substrate for 5 ′ nuclease cleavage of the present invention. The cleavage of this first fork structure generates two reaction products: 1) the 5 'split arm of the fork called the fourth oligonucleotide and 2) the split fork structure that now lacks the 5' arm and is smaller in size than the fork not split. This first cleaved fork can be used as a detection molecule to indicate that cleavage directed by the trigger oligonucleotide or third oligonucleotide has taken place. Therefore, this indicates that the first two oligonucleotides found and hybridized with the target sequence, thereby indicating the presence of the target sequence in the sample.

Detection products are amplified by having to hybridize the fourth oligonucleotide with a second hairpin structure. This fork structure has a 5 ′ single chain arm and a 3 ′ single chain arm. The fourth oligonucleotide generated by cleavage of the first fork structure hybridized with the 3 ’arm of the second fork structure thus creating a third cleavage structure recognized by nuclease 5’. The cleavage of this second fork structure also generates two reaction products: 1) the 5 'split arm of the fork called the fifth oligonucleotide and 2) the second split fork structure that now lacks the 5' arm and is smaller in size. that the fork not split. In one embodiment, the fifth oligonucleotide has a similar sequence identical to that of the third nucleotide. This second cleaved fork can be like a detection molecule and amplifies the signal generated by the cleavage of the first fork structure. Simultaneously with the hybridization of the fourth oligonucleotide, the third oligonucleotide dissociates from the first cleaved hairpin molecule so that it is free to hybridize with a new copy of the first hairpin structure. Dissociation of the oligonucleotides from the hairpin structures can be achieved by heating or other suitable means to break down the base pairing interactions. As described above, conditions that allow the association and dissociation of hybridized oligonucleotides are cycled at temperatures can be selected.

If the fifth oligonucleotide has a sequence similar or identical to that of the third nucleotide, further amplification of the detection signal is achieved by hybridizing the fifth oligonucleotide with another molecule of the first hairpin structure. The cleavage is then performed and the oligonucleotide that is then hybridized with another molecule of the second hairpin structure. Successive rounds of hybridization and excision of the first and second fork structure, provided in excess, are performed to generate a sufficient amount of cleave products cleaved to detect.

As discussed above for other embodiments of detection using structure specific nuclease cleavage, any method known in the art for the analysis of nucleic acids, nucleic acid fragments or oligonucleotides can be applied to the detection of cleavage products.

The fork structures can be attached to a solid support, such as an agarose, styrene or magnetic bead,

through the 3 ’end of the fork. A spacer molecule can be placed between the 3 ’end of the

hairpin and pearl, if desired. The advantage of joining the fork-type structures to a solid support that avoids hybridization of the two fork-type structures with each other over regions that are complementary. Thus the fork-like structures hybridize to each other, the amount of hairpins available to hybridize with the primers released during the cleavage reactions will be reduced. If the fork structures are attached to a solid support, then additional detection procedures of the cleavage reaction products can be employed.

These procedures include, among others, the measurement of the 5 ′ single chain arm released when the 5 ’arm contains a marker at the 5’ end. This marker can be radioactive, fluorescent, biotinylated, etc. If the fork structure has not been split, the 5 ’marker will remain attached to the solid support. If excision occurs, the 5 ’marker will be released from the solid support.

The 3 ′ end of the hairpin molecule can be blocked by the use of dideoxynucleotides. A 3 ′ end containing a dideoxynucleotide is not available to participate in reactions with certain enzymes that modify DNA, such as terminal transferase. Cleavage excision that has a terminal dideoxynucleotide

3 ’generates a new 3’ end not locked at the cleavage site. This new 3 ’end has a hydroxyl group

free that can interact with terminal transferase thus providing other means for the detection of cleavage products.

The fork structures are designed in such a way that their self-complementary regions are very short (generally in the range of 3-8 base pairs). Therefore, the fork structures are not stable at the high temperatures at which this reaction is performed (generally in the range of 50-75 ° C) unless the fork is stabilized by the presence of the hybridized oligonucleotide in the 3 'arm of The fork. This instability prevents the polymerase from cleaving the hairpin structure in the absence of an associated primer thus avoiding false positive results due to non-oligonucleotide-directed cleavage.

VIII. Enhanced enzymes for use in oligonucleotide-directed cleavage reactions INVASOR

In the present document, a cleavage structure is defined as a structure that is formed by the interaction of a probe oligonucleotide and a target nucleic acid to form a duplex, the resulting structure being cleavable by a cleavage agent, including, but not limited to, a enzyme. The cleavage structure is further defined as a substrate for specific cleavage by the cleavage medium unlike a nucleic acid molecule that is a substrate for non-specific cleavage by agents such as phosphodiesterases. Examples of some possible cleavage structures are shown in Figure 15. Considering improvements of enzymatic cleavage agents, the action of said enzymes on any of these structures and not on any other structure that falls within the definition of a cleavage structure can be considered. The cleavage sites indicated in the structures in Figure 15 are presented by way of example. Specific cleavage at any site within such a structure is considered.

Improvements in an enzyme may be an increased or decreased rate of cleavage of one or more types of structures. The improvements may also result in more or less cleavage sites in one or more of said cleavage structures. During the development of a new nucleate library with structure specificity for use in nucleic acid cleavage assays, the improvements may have many different embodiments, each related to the specific substrate structure used in a particular assay.

As an example, an embodiment of the INVASOR-directed cleavage test of the present invention can be considered. In the INVASOR-directed cleavage test, the accumulation of cleaved material is influenced by several characteristics of the enzyme's behavior. Not surprisingly, the rate of renewal or the number of structures that can be cleaved by a single enzyme molecule in a fixed amount of time is very important in determining the amount of material processed during the course of an assay reaction.

If an enzyme needs a prolonged time to recognize a substrate (for example, if it is presented with a less than optimal structure) or needs a prolonged time to perform the cleavage, the rate of product accumulation is lower than if these stages advanced rapidly. If these stages are rapid, the enzyme is still "attached" to the cleaved structure and does not immediately advance to another uncut structure, the speed will be adversely affected.

Enzyme renewal is not the only way in which the behavior of the enzyme can adversely affect the rate of product accumulation. When the medium used to visualize or measure product is specific to a precisely defined product, products that deviate from that definition may escape detection and, therefore, the rate of product accumulation may appear to be less than is. For example, if there is a sensitive detector for trinucleotides that could not see di- or tetranucleotides or any oligonucleotide sized different from 3 residues, in the INVASOR-directed excision test of the present invention, any wandering excision would reduce the detectable signal in a way proportional. e it can be seen from the cleavage data presented herein that, although there is usually a site within a probe favorable to excision, there are often products that arise from the cleavage one or more nucleotides away from the primary cleavage site . These are products that are target dependent and, therefore, not non-specific fund. However, if a subsequent display system can detect only the primary product, this represents a loss of signal. An example of such a selective display system is the load inversion reading presented in this document, in which the balance of positive and negative charges determines the behavior of the products. In such a system, the presence of an additional nucleotide or the absence of an expected nucleotide can exclude a valid final detection cleavage product leaving that product with the wrong load balance. It can be easily observed that any assay that can distinguish sensitively the nucleotide content of an oligonucleotide, such as conventional stringency hybridization, suffers with respect to sensitivity when any fraction of the valid product is not desirable for successful detection by that assay. .

These discussions suggest two highly desirable traits in any enzyme to be used in the process of the present invention. First, the faster the enzyme executes a complete cleavage reaction, including recognition, cleavage and release, the more signal can potentially be created in the INVASOR-directed cleavage assay. Secondly, the more successful an enzyme is in its targeting at a single cleavage site within a structure, the more effectively the cleavage product can be successfully detected in a selective reading.

The foundations that have been cited above to make improvements in enzymes to be used in the INVASOR-directed cleavage test refer to serving as an example of a direction in which improvements can be sought, but not as a limit or nature nor of the applications of improved enzyme activities.

As another direction of activity change that would be considered as an appropriate improvement, the 5 ’nucleases associated with DNAP could be used as an example. During the creation of some of the 5 'polymerase deficient nucleases described herein, it was observed that those created by deletion of substantial parts of the polymerase domain, as illustrated in Fig. 4, assumed activities that were weak or They were absent in the precursor proteins. These activities included the ability to cleave the unbifurcated structure shown in Fig. 15D, a greatly improved ability to exonucleolytically remove nucleotides from the 5 'ends of duplex chains and a nascent ability to cleave circular molecules without taking advantage of an end 5 ' free.

In addition to the 5 ′ nucleases derived from DNA polymerases, the present invention also contemplates the use of structure specific nucleases that are not derived from DNA polymerases. For example, a class has been identified

of eukaryotic endonucleases and archaebacteria having substrate specificity similar to 5 ’nucleases

DNA polymerases of the Pol 1 type. These are the proteins FEN-1 (Flap EndoNuclease), RAD2 and XPG (complementation group G of Xeroderma Pigmentosa). These proteins are involved in DNA repair and it has been

shown to favor the excision of structures that resemble a 5 ’arm that has been displaced by a

extension primer during polymerization, similar to the model illustrated in Fig. 15B. Similar DNA repair enzymes have been isolated from single and upper eukaryotic cells and from archaebacteria and there are related DNA repair proteins in eubacteria. Similar 5 ’endonucleases have also been associated with bacteriophage such as T5 and T7.

Recently, the 3-dimensional structures of DNAPTaq and 5 'phage T5 exonuclease (Fig. 58) were determined by X-ray diffraction (Kim et al., Nature 376: 612 [1995] and Ceska et al., Nature 382: 90 [1995]). The two enzymes have very similar 3-dimensional structures despite the limited amino acid sequence similarity. The most striking feature of the 5 ’exonuclease structure of T5 is the existence of a triangular orifice formed by the active site of the protein and two alpha helices (Fig. 58). This same region of DNAPTaq is disordered in the crystal structure, indicating that this region is flexible and, therefore, is not shown in the published 3-dimensional structure. However, the 5 'nuclease domain of DNAPTaq probably has the same structure, based on its overall 3-dimensional similarity with the 5' exonuclease of T5 since the amino acids in the disordered region of the DNAPTaq protein are those associated with the formation of alpha helix

The existence of such a hole or groove in the nuclease 5 ’domain of DNAPTaq was predicted based on its

substrate specificity (Lyamichev et al., above).

It has been suggested that the 5 ’arm of a cleavage structure has to be threaded through the helical arc described above to position said structure correctly for excision (Ceska et al., Above). One of the 5 'nuclease modifications described herein opened the helical arc portion of the protein at the top to allow improved cleavage of poorly cut or non-cut structures (e.g., circular DNA target structures that they would avoid such threading of an arm 5 '). The gene construct that was selected as a model to test this strategy was called CLEAVASE BN, which was obtained from DNAPTaq but does not contain the polymerase domain (Ex. 2). It comprises the entire 5 ’domain of DNAPTaq, and therefore must be very close in structure to the 5’ exonuclease of T5. This 5 ’nuclease was selected to demonstrate the principle of such a physical modification in proteins of this type. The arc opening modification of the present invention is not intended to be limited to the 5 'nuclease domains of DNA polymerases and is considered for use in any nuclease with structure specificity that includes such an opening as a limitation of cleavage activity. The present invention considers the insertion of a thrombin cleavage site in the helical arc of DNAP obtained from the Thermus genus as well as 5 ’nucleases obtained from DNAP obtained from the Thermus genus. The specific example shown herein that uses the CLEAVASE® BN / thrombin nuclease merely illustrates the concept of opening the helical arc located within a nuclease domain. Since the DNAP amino acid sequence obtained from the Thermus genus is highly conserved, the descriptions of the present invention allow the insertion of a thrombin site into the

Helical arc present in these DNAP and 5 ’nucleases obtained from these DNAP.

The opening of the helical arch was achieved by inserting a protease site in the arch. This allowed post-translational digestion of the expressed protein with the appropriate protease to open the arc at its apex. Proteases of this type recognize short extensions of specific amino acid sequence. Such proteases include thrombin and factor Xa. The cleavage of a protein with such a protease depends on both the presence of that site in the amino acid sequence of the protein and the accessibility of that site in the intact folded protein. Even with a crystal structure it can be difficult to predict the susceptibility of any particular region of a protein to protease cleavage. In the absence of a crystal structure it has to be determined empirically.

To select a protease for a site-specific cleavage of a protein that has been modified to contain a protease cleavage site, a first step is to test the unmodified protein for cleavage at alternative sites. For example, DNAPTaq and Cleavase® BN were both incubated under protease cleavage conditions with factor Xa and thrombin proteases.

Both nuclease proteins were cut with factor Xa within the 5 ’nuclease domain, but no nuclease was

digested with large amounts of thrombin. Therefore, thrombin was selected for initial tests to open the CLEAVASE BN enzyme arc.

In the protease / CLEAVAS modifications described herein, the factor Xa protease was severely cleaved at an unacceptable position in the unmodified nuclease protein, in a region that probably compromises the activity of the final product. Other unmodified nucleases considered herein may not be sensitive to factor Xa, but may be sensitive to thrombin or other proteases of this type. Alternatively, they may be sensitive to these or other proteases of this type at sites that are irrelevant to the nuclease function that is intended to be modified. Addressing any protein for modification by adding a protease cleavage site, the unmodified protein should be tested with proteases taking into consideration determining which proteases give acceptable levels of cleavage in other regions.

During the work with the cloned segment of DNAPTaq by which the CLEAVASE® BN protein is expressed, nucleotides were introduced that encode a thrombin cleavage site in phase near the sequence encoding amino acid 90 of the nuclease gene. This position was determined to be at or near the helical arc vertex by reference to both the 3-dimensional structure of DNAPTaq and the 5 ′ exonuclease structure of T5. The encoded amino acid sequence, LVPRGS, was inserted into the apex of the helical arch by directed mutagenesis of the nuclease gene. The proline (P) at the thrombin cleavage site was placed to replace a proline that is normally in this position in CLEAVASE BN because the proline is an alpha helix decomposition amino acid and may be important for the 3-dimensional structure of this arch. This construct was expressed, purified and then digested with thrombin. The digested enzyme was tested for its ability to cleave a target nucleic acid, genomic DNA from bacteriophage M13, which does not provide free 5 'ends to facilitate cleavage by the threaded model.

Although the helical arc in this nuclease was opened by protease cleavage, it is considered that several additional techniques could be used to achieve the same purpose. For example, the nucleotide sequence could be redisposed so that, after expression, the resulting protein would be configured such that the upper part of the helical arc (amino acid 90) would be at the amino end of the protein, the ends Natural carboxyl and amino of the protein sequence would bind and the new carboxyl end would be located at the natural amino acid 89. This strategy has the benefit that no foreign sequences are introduced and the enzyme is a

Unique amino acid chain and therefore, may be more stable than the 5 ′ cleaved nuclease. In the DNAPTaq crystal structure, the amino and carboxyl ends of the 5 ’exonuclease domain are located in close proximity

each other, suggesting that the ends can be attached directly without the use of a flexible linker peptide sequence as is sometimes necessary. Such a redisposition of the gene, with subsequent cloning and expression, could be achieved by conventional PCR recombination and cloning techniques known to those skilled in the art.

The present invention also considers the use of nucleases isolated from an organism that develops in a variety of conditions. The genes for the FEN-1 / XPG class of enzymes are found in organisms that range from bacteriophages to humans to the extreme thermophiles of the Archaea Kingdom. For tests in which high temperature has to be used, it is considered that enzymes isolated from extreme thermophiles may show the thermostability required for such an assay. For assays in which it may be desirable to have maximum enzymatic activity at moderate temperature or in which it may be desirable to destroy the enzyme at elevated temperature, the enzymes of organisms that favor moderate temperatures for development may be of particular value.

An alignment of a collection of FEN-1 proteins sequenced by others is shown in Figures 59A-E (SEQ ID No. 135-145). It can be seen in this alignment that there are some conservation regions in this class of proteins, suggesting that they are related in function and possibly in structure. Similarity regions at the amino acid sequence level can be used to design primers for in vitro amplification (PCR) by a reverse translation procedure of the amino acid sequence to the possible nucleic acid sequences, then selecting primers with the least possible number of variations within the sequences. They can be used in low stringency PCR to search for related DNA sequences. This strategy allows the amplification of DNA encoding a FEN-1 nuclease without prior knowledge of the actual DNA sequence.

It can also be seen from this alignment that there are regions in the sequences that are not fully conserved. The degree of difference observed suggests that proteins may have subtle or different differences in substrate specificity. In other words, they may have different levels of cleavage activity in the cleavage structures of the present invention. When a particular structure is cleaved at a faster rate than the others, this is called a preferred substrate, while a structure that is slowly cleaved is considered a less preferred substrate. The denomination of preferred or less preferred substrates in this context is not intended to be a limitation of the present invention. It is considered that some embodiments of the present invention will use the interactions of an enzyme with a less preferred substrate. Candidate enzymes are tested for suitability in the cleavage assays of the present invention using the tests described below.

1. Structure specific nuclease assay

The candidate nuclease assay for activities with structure specificity in these assays is performed in a manner very similar to that described for the DNA polymerase assay modified in Ex. 2, but with the use of a different library of model structures. In addition to assessing the yield of the enzyme in primer-independent and primer-directed cleavage, a set of synthetic forks is used to examine the length of duplex downstream of the cleavage site preferred by the enzyme.

The FEN-1 and XPG 5 'nucleases used in the present invention must be tested for activity in assays in which they are intended to be used, including, but not limited to, the INVASOR-directed cleavage detection assay of the present invention. invention and the CFLP nucleic acid characterization process (the CFLP procedure is described in U.S. Patent Nos. 5,843,654. 5,843,669. 5,719,028. and 5,888,780 and PCT Publication WO 96/15267) . The INVASOR assay uses a mode of cleavage that has been termed "primer driven" or "primer dependent" to reflect the influence of the oligonucleotide hybridized with the nucleic acid

target chain above the cleavage site. In contrast, the CFLP reaction is based on the cleavage of the folded structure, or hairpins, within the target nucleic acid in the absence of any hybridized oligonucleotide. The assays described herein are not intended to be limited to nuclease analysis with no particular cleavage site or mode of recognition of substrate structures. It is considered that enzymes can be described as 3 'nucleases, using the 3' end as a reference point to recognize structures, or they may have a different mode of recognition. In addition, the use of the 5 ’nuclease expression is not intended to limit consideration to enzymes that cleave the cleavage structures at any particular site. It refers a

general class of enzymes that require some reference or access to a 5 ’end to excision of a

structure.

A set of model cleavage structures has been created to allow evaluation of the cleavage capacity of unknown enzymes in such structures. Each of the model structures is constructed from one or more synthetic oligonucleotides prepared by conventional DNA synthesis chemistry. Examples of such synthetic model substrate structures are shown in Figures 26 and 60. They are intended only to represent the desirable general folded configuration in such test structures. Although a sequence that would assume such a structure is indicated in the figures, there are numerous additional nucleotide sequence arrangements that would be expected to fold in such ways. The essential characteristics to be designed in a set of oligonucleotides to perform the assays described herein are the presence or absence of

an arm 3 'long enough to allow hybridization of an additional nucleic acid to test cleavage in a "primer-directed" manner and the length of the duplex region. In the assembly illustrated in Figure 60, the duplex lengths of structures S-33 and 11-8-0 are the base pairs 12 and 8, respectively. Difference in the length of the test molecules facilitates the detection of candidate nuclease discrimination between longer and shorter duplexes. Additions to this series that expands the range of duplex molecules presented in enzymes, both shorter and longer, can be used. The use of a stabilizing DNA tetrabucle (Antao et al., Nucl. Acids Res., 19: 5901 [1991]) or tribucle (Hiraro et al., Nuc. Acids Res., 22: 576 [1994]) in The closed end of the duplex helps ensure the formation of the structure expected by the oligonucleotide.

The model substrate for testing primer-directed cleavage, the "S-60 hairpin" (SEQ ID No. 40) is described in Ex. 11. In the absence of a primer, this hairpin is typically cleaved to release fragments of the arm 5 ' 18 and 19 nucleotides in length. An oligonucleotide, called P-14 (5'-CGAGAGACCACGCT-3 ') (SEQ ID No. 108), which extends to the base of the duplex when hybridized with the 3' arm of the S-60 fork provides cleavage products thereof size, but at a faster spin rate.

To test the invasive excision, a different primer, called P-15 (5’-CGAGAGACCACGCTG-3 ’; SEQ ID No. 30) is used. In a successful invasive excision, the presence of this primer displaces the S-60 cleavage site to the duplex region, usually releasing products of 21 and 22 nucleotides in length.

The S-60 fork can also be used to test the effects of modifications of the cleavage structure in primer-directed or invasive cleavage. Such modifications include, but are not limited to, the use of erroneous pairings or base analogs in the fork duplex in one, a few or all positions, similar alterations or modifications in the duplex between the primer and the 3 'arm of the S -60, chemical or other modifications at one or both ends of the primer sequence, or binding of moieties or other modifications to the 5 'arm of the structure. In all analyzes using the S-60 or a similar fork described herein, the activity with and without a primer can be compared using the same fork structure.

The assembly of these test reactions, including appropriate amounts of hairpin, primer and candidate nuclease are described in Ex. 2. As cited therein, the presence of cleavage products is indicated by the presence of molecules that migrate to a lower molecular weight than the uncleaved test structure does. When a marker load inversion is used, the products will carry a different net charge than the uncleaved material. Any of these cleavage products indicates that the candidate nuclease has the nuclease activity with specificity of desired structure. By "nuclease activity with specificity of desired structure" it is meant only that the candidate nuclease cleaves one or more test molecules.

It is not necessary for the candidate nuclease to be cleaved at any particular rate or site of cleavage to be considered a successful cleavage.

2. Enzyme chimeras and variants

The present invention further provides structure specific chimeric nucleases, as defined in the claims. Structure specific chimeric nucleases comprise one or more parts of any enzyme described herein in combination with another sequence. In preferred embodiments, the structure-specific chimeric nucleases comprise a functional domain (eg, an enzyme region

containing an arc region or sequence physically associated with it) of a 5 ’nuclease in combination with domains of other enzymes (e.g., of other 5’ nucleases). In some preferred embodiments, a given functional domain comprises the sequence of two or more enzymes. For example, the amino acid sequence of a functional domain of a first structure-specific nuclease can be altered at one or more amino acid positions to convert the functional domain, or a part thereof, into the sequence of a second structure-specific nuclease. , so that it imparts characteristics of the second nuclease on the first. Such features include, among others, catalytic activity, specificity and stability (eg, thermostability).

In one embodiment, the present invention provides chimeric enzymes comprising parts of amino acids obtained from the enzymes selected from the group of DNA polymerases and endonucleases FEN-1, XPG and RAD. In a preferred embodiment, the chimeric enzymes comprise portions of amino acids derived from the FEN-1 endonucleases selected from the group of Pyrococcus furiosus, Methanococcus jannaschi, Pyrococcus woesei, Archaeoglobus fulgidus, Methanobacterium thermoautotrophicum, Sulfolobus solfataricmoustrousmoustrousmochaemoebus, Pyrococumuscoecus, Pyrococumusbusus, Pyrococumuscoecus, Pyrococumuscoecus, Pyrococumuscoecus, Pyrococcuscobususus Archaeaglobus profundus, Acidianus brierlyi, Acidianus ambivalens, Desulfurococcus amylolyticus, Desulfurococcus mobilis, Pyrodictium brockii, Thermococcus gorgonarius, Thermococ-cus zilligii, Methanopyrus kandleri, Methanococconcus periuscus, Anecus pyroccusnnecumnum.

Some embodiments of the present invention provide mutant forms or variants of enzymes described herein. It is possible to modify the structure of a peptide having an activity of the enzymes described herein for purposes such as enhancing the cleavage rate, substrate specificity, stability and the like. For example, a modified peptide can be produced in which the amino acid sequence has been altered, such as by substitution, deletion or addition of amino acids. For example, an isolated substitution of leucine with isoleucine or valine, an aspartate with a glutamate, a threonine with a serine or a similar conservative substitution of an amino acid with a structurally related amino acid (i.e. conservative mutations) will not have a important effect on the biological activity of the resulting molecule. Accordingly, some embodiments of the present invention provide enzyme variants described herein that contain conservative substitutions. Conservative substitutions are those that take place within a family of amino acids that are related by their side chains. Generically encoded amino acids can be divided into four families: (1) acids (aspartate, glutamate; (2) basic (lysine, arginine, histidine); (3) non-polar (alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan); and (4) polar unloaded (glycine, asparagine, glutamine, cysteine, serine, threonine, tyrosine) Sometimes, the amino acids phenylalanine, tryptophan and tyrosine are collectively classified as aromatic amino acids. , the amino acid repertoire can be grouped as (1) acids (aspartate, glutamate), (2) basic (lysine, arginine, histidine), (3) aliphatic (glycine, alanine, valine, leucine, isoleucine, serine, threonine) , the serine and threonine being optionally grouped separately as aliphatic hydroxyl; (4) aromatic (phenylalanine, tyrosine, tryptophan); (5) amide (asparagine, glutamine); and (6) containing sulfur (cysteine and methionine) (see , for example, Stryer (ed.), Biochemis try, 2nd ed, WH Freeman and Co. [1981]). If a change in the amino acid sequence of a peptide results in a functional homologue or not, it can be easily determined by evaluating the ability of the variant peptide to produce a response similar to wild-type protein using the assays described herein. document. Peptides in which more than one substitution has occurred can easily be tested in the same way.

It is contemplated that the nucleic acids encoding the enzymes can be used as starting nucleic acids for directed evolution. These techniques can be used to develop enzymatic variants that have desirable properties. In some embodiments, artificial evolution is performed by random mutagenesis.

(e.g., using error-prone PCR to introduce random mutations in a given coding sequence). This procedure requires a fine adjustment of the mutation frequency. As a general rule, beneficial mutations are rare, while harmful mutations are uncommon. This is because the combination of a harmful mutation and a beneficial mutation often results in an inactive enzyme. The ideal number of base substitutions for target genes is usually between 1.5 and 5 (Moore and Arnold, Nat. Biotech., 14, 458-67 [1996]; Leung et al., Technique, 1: 11-15 [ 1989]; Eckert and Kunkel, PCR Methods Appl., 1: 17-24 [1991]; Caldwell and Joyce, PCR Methods Appl., 2: 28-33 (1992); and Zhao and Arnold, Nuc. Acids. Res. , 25: 1307-08 [1997]). After mutagenesis, the resulting clones are selected according to the desirable activity (eg, ability to cleave a cleavage structure such as those described in Example 66). Successive rounds of mutagenesis and selection are often necessary to develop enzymes with desirable properties. It should be noted that only useful mutations are passed to the next round of mutagenesis.

In other embodiments of the present invention, the polynucleotides of the present invention are used in generic transposition or sexual PCR procedures (eg, Smith, Nature, 370: 324-25 [1994]; U.S. Pat. Nos. 5,837,458; 5,830,721; 5,811: 238; 5,733,731). Genetic transposition involves random fragmentation of several mutant DNAs, followed by reassembly by PCR in full-length molecules. Examples of several genetic transposition procedures include, among others, assembly after DNase treatment, the stepwise extension procedure (STEP) and random priming in in vitro recombination. In the DNase mediated procedure, the isolated DNA segments from a set of positive mutants are cleaved into random fragments with DNase I and subjected to multiple PCR rounds without added primer. The lengths of random fragments approach those of the segment without cleavage as the PCR cycles progress, resulting in the mixing of mutations in different clones and accumulation in some of the resulting sequences. Multiple cycles of selection and SHIFFLING have led to the functional enhancement of a series of enzymes (Stemmer, Nature, 370: 398-91 [1994]; Stemmer, Proc. Natl. Acad. Sci. USA, 91, 10747-51 [1994 ]; Crameri et al., Nat. Biotech., 14: 315-19 [1996]; Zhang et al., Proc. Natl. Acad. Sci. USA, 94: 4504-09 [1997]; and Crameri et al. , Nat. Biotech., 15: 436-38 [1997]).

The present invention provides a means for rapid selective detection of enzymes by their enhanced activity. In some embodiments, the rapid selective detection method of the present invention comprises an instrument system comprising a liquid handling function (e.g., BIOMEK 2000 Laboratory Automated work station, Beckman Coulter, Fullerton CA, or TECAN Automated workstation , Tecan US, Durham NC), a heating blocking function, an incubator function (eg, a Liconic Instruments Automated Incubator, Liconic Instruments, Fusrentum, Liechtenstein or an HERAEUS automatic incubator) a microplate carousel function ( eg, a BIOMEK Carousel, Beckman Coulter, Fullerton, CA), a fluorescence reader function (eg, a CYTOFLUOR Series 4000 multi-well plate reader or a Sapphire automatic plate reader (Tecan, US ) and a Robotic function (eg, a BIOMEK ORCA robot arm, Beckman Coulter) An example of the selective detection system diagram of the present invention is provided in Figur to 147. In one embodiment of the selective detection method of the present invention, the robot function moves the tips of the pipettes, the plates with lysate (e.g. 96 wells), culture plates (e.g.

e.g. deep well growth plate with mutated culture) with the ORCA arm of the Carousel to BIOMEK. Next, the BOMEK dispenses a mixture of lysozymes in each well of the lysate plates. Then, the cell culture is transferred from each well of the culture plate to each corresponding well of the lysate plate. The lysate plates are then transferred by the ORCA arm to the incubator for a period of time (e.g., at room temperature for 15 minutes), then transferred to the heating block and heated for a period of time (p e.g. at 83 ° C for 3 minutes). The lysate plates, together with the medium-deep substrate blocks, the reaction plates (e.g., 384-well Griener plates) and the tips move from the Carousel or the thermal block to the BIOMEK and the test substrate (e.g., 10 ul) is dispensed in each well of the reaction plate. An aliquot of lysate (e.g., 5 ul) is transferred from each well of a lysate plate to a corresponding well of the reaction plate. Each well is coated with mineral oil (e.g., 6.5 ul). The reaction plate is moved by the robot arm to the incubator and incubated (eg, at 63 ° C) for one hour. Then, the plate was moved to the fluorescence plate reader, the fluorescence is measured for each well and the robot arm returns the completed test plate, all other plates and tip components to the carousel. These steps are repeated until all the desired tests are completed. When a primary selection indicates a desired change in activity, clones grown to produce additional enzyme (e.g., under induction conditions), the enzyme can be purified and used both to verify the initial result and to use in characterization. additional. Clones expressing the enzymes of interest can also be sequenced to identify or verify mutations. In certain embodiments, 48 culture plates are grown every day. In some embodiments, 12 to 16 lysis plates are processed by detection tests in a day of 8 to 10 hours. In other embodiments, 18 to 21 lysis plates are processed by screening tests in a day from 12 to 15 hours. Other details of the embodiments of this system are provided in example 67.

IX. INVASOR test for direct detection and measurement of specific analytes.

The following description provides illustrative examples of detection of the target sequence by using the compositions and methods of the present invention. These examples include the detection of human cytomegalovirus viral DNA, single nucleotide polymorphisms in the human apolipoprotein E gene, mutations in the hemochromatosis gene, mutations in human MTHFR, prothrombin 20210GA polymorphism, HR-2 mutation in the human factor V gene, single nucleotide polymorphisms in the human TNF-gene and Leiden mutation in the human factor V gene. These descriptions include new nucleic acid compositions for use in detecting said sequence. Examples 54-61 below provide details about the design and execution of these illustrative embodiments. It is understood that these detection tests can be performed alone, for example in individual detection tests or they can be performed in combinations. The combinations may comprise multiplex analysis, for example in which a plurality of different target sequences is detected in a single reaction (e.g., using a different inactive dye in a FRET probe for each sequence suspected to be present in a sample or mixture). The combinations may comprise panels, in which a plurality of detection reactions are performed simultaneously, for example a test plate.

A. Detection of human cytomegalovirus viral DNA by invasive excision

Human cytomegalovirus (HCMV) produces, or is associated with, a wide variety of diseases in humans (Table 3). More than 90% of bone marrow or kidney transplant recipients (immunocompromised hosts) develop HCMV infections, most of which are due to reactivation of latent virus by immunosuppressive drugs, as well as virus transmission by donor tissue or blood latent infected (Ackerman et al., Transplant. Proc., 20 (S1): 468 [1988]; and Peterson et al., Medicine 59: 283 [1980]).

TABLE 3

Diseases caused by human cytomegalovirus

Cytomegalic inclusion Negative heterophile disease in neonates mononucleosis Interstitial pneumonia Pneumonitis retinitis Hepatitis pancreatitis meningoencephalitis Gastrointestinal disease Spread infection

There are cases in which a rapid, sensitive and specific diagnosis of HCMV disease is necessary. In recent years, the number of patients undergoing organ and tissue transplants has increased considerably. HCMV is the most frequent cause of death in immunocompromised transplant recipients, so the need for a fast and reliable laboratory diagnosis is confirmed. Lymphocytes, monocytes and possibly arterial smooth muscle or endothelial cells are sites of HCMV latency. Therefore, the prevention of HCMV infections in immunocompromised individuals (eg, transplant recipients) includes the use of blood products and HCMV negative organs. Additionally, HCMV can be transmitted through the placenta and to infants by contact with infected cervical secretions during birth. Therefore, a rapid, sensitive and specific assay to detect HCMV in body fluids or secretions may be desirable as a means of monitoring the infection and, consequently, determining the need for a C-section.

The diagnosis of HCMV infection can be made by conventional cell culture using human fibrblasts; centrifugal culture of covered vial using monoclonal antibodies and immunofluorescent staining techniques; serological procedures; the HCMV antigenemia assay that uses a monoclonal antibody to detect the HCMV antigen in peripheral blood leukocytes (PBL) or by nucleic acid hybridization assays. These various procedures have their advantages and limitations. Conventional cell culture is sensitive but slow, since the cytopathic effect (ECP) may require 30 or more days to develop. Covered vial centrifugation is faster but still requires 24-48 hours to get the initial results. Both culture procedures are affected by antiviral therapy. In immunocompromised patients, the ability to mount IgG and / or IgM antibody responses against HCMV infection is impaired and, therefore, serological procedures are not reliable in this context. Alternatively, IgM antibodies may persist for months after the infection is resolved and, therefore, their presence may not be indicative of active infection. The HCMV antigenemia test requires intense work and is not applicable to samples other than PBL.

Recent advances in molecular biology have stimulated the use of DNA probes in an attempt to provide a faster, more sensitive and specific assay to detect HCMV in clinical samples. For example, radiolabelled DNA probes have been used to hybridize with tissue cultures infected with or by HCMV or in clinical samples suspected of containing HCMV ("hybridization assays"). However, the use of probes in tissue cultures requires at least 18-24 hours of growth to amplify the antigen (HCMV) to be detected, if present, an additional time to develop autoradiographic detection systems. Using hybridization assays to analyze clinical samples for HCMV may lack sensitivity, depending on the virus titer and the clinical sample analyzed. The detection of HCMV in clinical samples has been reported using polymerase chain reaction (PCR) to enzymatically amplify HCMV DNA. Procedures using PCR compare favorably with virus isolation, in situ hybridization assays and southern blotting; see, for example, Bamborschke et al. J. Neurol., 239: 205 [1992]; Drouet et al., J. Virol. Meth., 45: 259 [1993]; Einsele et al., Blood 77: 1104-1110 [1991]; Einsele et al., Lancet 338: 1170 [1991]; Lee et al., Aust. NZ J. Med., 22: 249 [1992]; Miller et al., J. Clin. Microbiol., 32: 5 [1994]; Rowley et al., Transplant. 51: 1028 [1991]; Spector et al. J. Clin. Microbiol., 30: 2359 [1992]; and Stanier et al., Mol. Cell Probes 8:51 [1992]). Other authors, comparing the HCMV antigenemia assay with PCR procedures, have discovered PCR procedures as efficient or slightly more efficient in detecting HCMV (van Dorp et al. (1992) Transplant. 54: 661; Gema et al. (1991) J. Infect. Dis. 164: 488; Vleiger et al. (1992) Bone Marrow Transplant. 9: 247; Zipeto et al. (1992) J. Clin. Microbiol. 30: 527]. of PCR have exhibited great sensitivity when other samples other than PBL have been analyzed (Natori et al., Kansenshogaku Zasshi 67: 1011 [1993]; Peterson et al., Medicine 59: 283 [1980]; Prosch et al., J Med. Virol., 38: 246 [1992]; Ratnamohan et al., J. Med. Virol. 38: 252 [1992]) However, due to the dangers of false positive reactions, these PCR-based procedures require rigid controls to prevent contamination and transfer (Ehrlich et al., in PCR-Based Diagnostics in Infectious Diseases, Ehrlich and Greenberg (eds), Blackwell Scientific P ublications, [1994], p. 3-18). Therefore, there is a need for a rapid, sensitive and specific test for HCMV that has a lower risk of false positive results due to contamination by the reaction product from other samples.

As shown herein, the INVASOR-directed cleavage test is fast, sensitive and specific. Since the accumulated products do not contribute to the subsequent accumulation of the sela, the reaction products carried from a standard cleavage directed by INVASOR (ie, non-sequential) to another cannot stimulate false positive results. The use of multiple sequential INVASOR-directed cleavage assays will further enhance the sensitivity of HCMV detection without sacrificing these advantages.

B. Detection of single nucleotide polymorphisms in the human apolipoprotein E gene

Apolipoprotein E (ApoE) performs several functions as a constituent of plasma lipoproteins, including its role in cholesterol metabolism. It was first identified as a constituent of very low density lipoproteins synthesized in the liver that function in the transport of triglycerides from the liver to peripheral tissues. There are three main isoforms of ApoE, called ApoE2, ApoE3 and ApoE4, which are products of three alleles in a single gene locus. Three homozygous phenotypes (Apo-E2 / 2, E3 / 3 and E4 / 4) and three heterozygous phenotypes (ApoE3 / 2, E4 / 3 and E4 / 2) arise from the expression of any two of the three alleles. The most common phenotype is ApoE3 / 3 and the most common allele is E3. See Mahley, R. W., Science 240: 622-630 (1988).

The amino acid sequences of the three types differ only slightly. ApoE4 differs from ApoE3 in that ApoE4 arginine is replaced by normal cysteine in amino acid residue 112. The most common form of ApoE2 differs from ApoE3 in residue 158, in which cysteine is substituted by normal arginine. . See Mahley, Science, supra. -

It has been shown that apoE4 allele frequency is markedly increased in sporadic Alzheimer's disease (AD) (Poirier, J. et al., 1993, Apolipoprotein E phenotype and Alzheimer's Disease, Lancet, 342: 697-699; Noguchi, S. et al., 1993, Lancet (letter), 342: 737) and late-onset familial Alzheimer's disease (AD) (Corder,

E. H. et al., 1993, Science, 261: 921-923; Payami, H. et al., 1993, Lancet (letter), 342: 738). This dose effect on the gene was observed in both sporadic and family cases (that is, as the age of onset increases, the number of copies of the E4 allele decreases). Women, who generally have a higher risk of developing Alzheimer's disease, show a higher frequency of the E4 allele when compared to men of the same age.

C. Detection of mutations in the human hemochromatosis gene

Hereditary hemochromatosis (HH) is an inherited disorder of iron metabolism in which excess iron accumulates in the body. In symptomatic individuals, this excess iron leads to harmful effects when deposited in various organs that leads to its failure and results in cirrhosis, diabetes, infertility and other serious diseases.

HH is inherited as a recessive trait; Heterozygotes are asymptomatic and only homozygotes are affected by the disease. It has been estimated that approximately 10% of individuals descended from Western Europe carry a mutation in the HH gene and that there are approximately one million homozygotes in the US. Although ultimately HH produces debilitating symptoms, most homozygotes have not been diagnosed. In fact, it has been estimated that in the US I have not diagnosed this condition to more than 10,000 people. The symptoms are often confused with those of other conditions and the serious effects of the disease do not usually appear immediately. It would be desirable to provide a procedure to identify people who are ultimately destined to be symptomatic in order to intervene on time and prevent excessive tissue damage. One reason for the lack of early diagnosis is the inadequacy of the diagnostic procedures currently available to determine which individuals are at risk.

Although blood iron parameters can be used as a selective screening tool, a confirmed diagnosis often uses HLA typing, which is tedious, nonspecific and expensive, and / or liver biopsy that is undesirably invasive and expensive. Accordingly, other authors have tried to develop cheap and non-invasive diagnoses for the detection of homozygotes that have the existing disease, in that presymptomatic detection would guide the intervention to prevent damage to the organs and for the identification of carriers. . The need for such diagnoses is documented in, for example, Firich, C. A. West J Med (1990) 153: 323-325; McCusick, V. et al. Mendelian Inheritance in Man 11th ed., Johns Hopkins University Press (Baltimore, 1994) p. 1882-1887; Joint report of the World Health Organization / HH Foundation / Meeting of the French HH Association, 1993.

D. Detection of mutations in human MTHFR

Folic acid derivatives are coenzymes of several critical reactions of single carbon transfer, including purine, thymidylate and methionine biosynthesis reactions. Methylene tetrahydrofolate reductase (MTHFR; EC 1.5.1.20) catalyzes the NADPH-linked reduction of 5,10-methylenetetrahydrofolate into 5-methyltetrahydrofolate, a cosustrate for methionine homocysteine methylation. The porcine liver enzyme, a flavoprotein, has been purified to homogeneity; It is a homodimer of 77 kDa subunits. Partial proteolysis of the peptide portions has revealed two spatially distinct domains: a 40 kDa N-terminal domain and a 37 kDa C-terminal domain. The last domain contains the binding site for the allosteric regulator S-adenosylmethionine.

Hereditary deficiency of MTHFR, an autosomal recessive disorder, is the most common congenital error of folic acid metabolism. A blockage in the production of methyltetrahydrofolate conditions high homocysteine levels with low to normal levels of methionine. Patients with severe MTHFR deficiencies (0-20% activity in fibroblasts) may have variable phenotypes. In this group, developmental delays, mental retardation, motor and gait abnormalities, peripheral neuropathy, seizures and psychiatric disorders have been reported, although at least one patient with severe MTHFR definitivity was asymptomatic. The ptological changes in the severe form include vascular changes that have been found in other conditions with elevated homocysteine levels, as well as reduced levels of neurotransmitter and methionine in the CNS. A milder definition of MTHFR (activity 35-50%) has been described in patients with coronary artery disease. Genetic heterogeneicity is likely, considering the various clinical characteristics, varying levels of enzyme activity and differential thermal inactivation profiles of reductase in patient cells. Procedures for detecting the mutation in MTHFR include: AS-PCR (Hessner et al., Br J Haematol 106, 237-9 (1999)) and PCR-RFLP (Nature Genetics, Frosst et al. 1995: 10; 111-113 ).

E. Detection of prothrombin 20210GA polymorphism and Leiden factor V polymorphism

The coagulation cascade is a complex series of loops of cymogen activations, inactivations and feedback in which numerous enzymes and their cofactors participate. The entire waterfall, from the tissue injury

or venous trauma until coagulation has been well described (ref.). The cascade culminates in the conversion of prothrombin (Factor II) to thrombin. This is catalyzed by the actuated form of factor X, factor Xa and its cofactor, activated factor V, factor Va. Next, thrombin converts fibrinogen into fibrin and stimulates fibrin crosslinking and clot formation by activating factor XIII. In addition to the functions indicated above, thrombin, a serine protease, can also activate factor V in a positive feedback loop. Factor Va is a procoagulant cofactor in the coagulation cascade and when clot formation is sufficient, it is inactivated by activated protein C (APC).

Venous thrombosis is the obstruction of the circulation by clots that have formed in the veins or that have been released from a thrombus formed elsewhere. The most frequent sites of clot formation are the deep veins of the legs, but they can also occur in the veins of the brain, retina, liver and mesentery. Factors other than inherited defects that may play a role in the development of thrombosis include recent surgery, malignant disorders, pregnancy and childbirth, and prolonged immobilization.

Studies of hereditary thrombophilia, defined as an increase in the tendency to venous thrombotic disease in relatively young adults, have provided insight into the genetic factors that regulate thrombosis. In 1993, Dahlback et al. (Proc Natl Acad Sci USA 1993; 90: 1004-1008) described an insensitivity to APC, a critical anticoagulant in the coagulation cascade, in three families unrelated to hereditary thrombophilia. The anticoagulant property of APC resides in its ability to inactivate activated cofactors Va and VIIIa by limited proteolysis (Ref. 3). This inactivation of cofactors Va and VIIIa results in the reduction of the thrombin formation rate, the final product of the cascade. This observation was confirmed by other researchers (Ref.) And the expression "APC resistance" was coined to describe this specific phenotype in thrombophilic patients. In a subsequent study of 20 families with thrombophilia and resistance to APC, an autosomal dominant pattern of inheritance was observed (17). Bertina et al. (Nature, 1994, May 5; 369 (6475): 64-7) demonstrated that the PAC resistance phenotype was associated with heterozygosity or homozygosity for a single punctual mutation in nucleotide 1691 at the 10th point of the factor V gene This change from a single base, a substitution of guanine in adenine, gives a mutant factor V molecule in which arginine at position 506 is substituted with glutamine. This form of the factor V molecule, which was characterized at the University of Leiden (Bertenia et al), is known as FV Q506 or FV mutation of Leiden, or is inactivated less efficiently by the APC than with the Wild protein. It has been postulated that the prolonged circulation of activated factor V stimulates a hypercoagulation state and increases the risk of thrombosis. Subsequent analysis of several groups of patients exhibiting symptoms of venous thrombosis indicates that the Leiden factor V mutation is the most common single inherited factor that contributes to an increased risk of venous thrombosis.

In 1996, studies by Poort et al. (Blood. 1996: 88; 3698-703) revealed the second most common hereditary factor contributing to increase thrombotic risk. When studying the prothrombin gene sequence in selected patients with a documented family history of venous thrombophilia, Poort's group identified a single strut mutation in the 3 ’untranslated region. This transition from G to A at position 20210 correlates strongly with elevated plasma prothrombin levels and was also shown to be associated with an almost threshold increase in the risk of venous thrombosis (summary, Howard)

The first reported case of a patient with genetically homozygous thrombophilia for polymorphism from G to A in the 3 'region without translation was made by Howard, et al. (Blood Coagulation Fibrinolysis 1997 Jul; 8 (5): 316-9). The patient, a young and healthy Mexican male, presented with myocardial infarction, venous thrombosis and embolism. It was found that the patient was homozygous for the prothrombin mutation and heterozygous for the Leiden factor v mutation, which supports the double theory of thrombophilia in young patients.

The studies conducted by Hessner et al. They show that the genotype of prothrombin 20210GA was almost 5 times as prevalent in symptomatic FVL carriers than in a random Caucasian control group (British Journal of Haematology, 1999, 106), and that allele frequencies for prothrombin mutants and Factor V vary between different ethnic backgrounds (Thromb Haemostat 1999; 81: 733-8). The previous discussion confirms that the early detection of the Leidn factor V mutation and the prothrombin factor II mutation is crucial in the evaluation of hereditary thrombotic risk. The nature of these two mutations, that is, a change in a single base in the nucleic acid sequence, makes them sensitive to various nucleic acid detection procedures known in the art, although the demand for faster, more reliable tests, More economical and comfortable for the user to detect nucleic acid sequences continues to grow. The most frequent procedures to analyze these mutations include PCR / RFLP, AS-PCR and functional coagulation assays.

F. Detection of the HR-2 mutation in the human factor V gene

The R-2 polymorphism is located in exon 13 of the factor V gene and is the result of a transition from A to G at base 4070, replacing the wild amino acid histidine with the arginine mutant in the mature protein. The R-2 polymorphism is one of a set of mutations called together HR-2. The HR-2 haplotype is defined by substitutions of 6 nucleotide bases in exons 13 and 16 of the factor V gene. The haplotype is associated with an increase in functional resistance to activated protein C, both in normal subjects and in thrombophilic patients. . When present as a compound heterozygous together with the Leiden factor V mutation, the clinical symptoms are comparable to those observed in patients homozygous for the Leiden factor V mutation and include an increased risk of deep vein thrombosis.

G. Detection of single nucleotide polymorphisms in the TNF- gene  human

It has been shown that human cytokine tumor necrosis factor alpha (TNF-alpha) is a major factor in the rejection of grafts; When more TNF-alpha is present in the system, the greater the rejection response to the transplanted tissue. Mutations in TNF-alpha have also been correlated with cerebral malaria (Nature 1994; 371: 508-510), fulminant purpura (J Infect Dis. 1996; 174: 878-880) and mucocutaneous leishmaniaisis (J Exp Med. 1995 ; 182: 1259-1264). The mutation detected in this example is located in the promoter region of the TNFalfa gene at position minus 308. Wild guanine (G) is substituted with a mutant adenine (A). This result of this mutation in the promoter is the multiplication of TNF-alpha transcription by 6-7. Procedures for detecting mutations in TNF-alpha include sequencing, denaturing gradient gel electrophoresis, PCR procedures and procedures involving PCR and hybridization after PCR with specific oligos.

H. Detection of methicillin-resistant Staphylococcus aureus

Staphylococcus aureus is recognized as one of the main causes of infections in humans that occur in the hospital and in the community in general. One of the most serious problems that concern the treatment of any bacterial infection is the increase in antibiotic resistance. The increasing incidence of methicillin-resistant S. aureus (MRSA) infections worldwide has underlined the importance of early detection of the infectious agent and defining a resistance profile so that appropriate treatment can be administered. The main mechanism of methicillin resistance involves the production of a protein called PBP2a, conditioned by the mecA gene. The mecA gene is not specific to Staphalococcus aureus, but is of origin in other species. However, the mecA gene is indicative of methicillin resistance and is used as a marker for the detection of resistant bacteria. Therefore, to identify methicillin-resistant S. aureus by nucleic acid techniques, both the mecA gene and at least one species-specific gene must be targeted. A specific species specific gene, the nuclease or nuc gene, is used in the following example: The procedures used to detect MRSA include culture and laborious and time-consuming, and coagulation assays and growth assays with antibiotic means. Molecular strategies include a Cycling Probe ™ assay, the Alexon-Trend Cycling Probe ™ kit (Ramsey, MN Cat. No. 818-48), antibody assay that binds to PBP2a protein, bDNA assay (Chiron, Emeryville , All of them analyze only the presence of the mecA gene and are not specific to Staph. Aureus.

X. Kits

In some embodiments, the present invention provides kits comprising one or more of the components necessary to practice the present invention, as defined in the claims. For example, the present invention provides kits for storing or releasing enzymes of the present invention and / or the reaction components necessary to carry out a cleavage assay (eg, the INVASOR assay). The kiut may include each and every one of the necessary or desired components for enzymes or assays, including, but not limited to, the reagents, buffers, control reagents (eg, tissue samples, positive and negative target control oligonucleotides etc.). ), solid media, markers, written and / or image instructions and product information, inhibitors, labeling and / or detection reagents, environmental controls for packaging (eg, ice, desiccants etc.) and the like. In some embodiments, the kits provide a subset of the required components, in which the user can be expected to supply the remaining components. In some embodiments, the kits comprise two or more separate containers in which each container houses a subset of the components to be released. For example, a first container (e.g., a box) may contain an enzyme (e.g., structure-specific cleavage enzyme in a suitable storage buffer and container), while a second box may contain oligonucleotides ( e.g., INVASOR oligonucleotides, probe oligonucleotides, control target oligonucleotides etc.).

EXAMPLES

The invention is defined in the claims.

The following examples serve to illustrate certain preferred embodiments and aspects of the present invention and should not be construed as limiting its scope.

In the following disclosure, the following abbreviations apply to: Afu (Archaeoglobus fulgidus); Mth (Methanobacterium thermoautotrophicum); Mja (Methanococcus jannaschii); Pfu (Pyrococcus furiosus); Sso (Sulfolobus solfataricus); Pae (Pyrobaculum aerophilumI); Tli (Thermococcus litoralis); Ave (Archaeaglobus veneficus); Apr (Ar-chaeaglobus profundus); Apr (Acidianus brierlyi); Aam (Acidianus ambivalens); Dam (Desulfurococcus amylolyticus); Dmo (Desulfurococcus mobilis); Pbr (Pyrodictium brockii); Tgo (Thermococcus gorgonarius); Tzi (Thermococcus zilligii); Mke (Methanopyrus kandleri); Mig (Methanococcus igneus); Pho (Pyrococcus horikoshii); Ape (Aeropyrum pernix); Pwo (Pyrococcus woesei); Taq (Thermus aquaticus); DNAP of Taq, DNAPTaq and Taq Pol I (DNA polymerase I from T. aquaticus); DNAPStf (the Stoffel fragment of DNAPTaq); DNAPEcl (E. coli DNA polymerase I); Tth (Thermus thermophilus); Ex. Example); Fig. (Fig.); ºC (degrees Celsius); g (gravitational field); h (hour); min (minute), oligo (oligonucleotide), rxn (reaction), vol (volume); w / v (weight to volume); v / v (volume to volume); BSA (bovine serum albumin); CTAB (bromide of

cetyltrimethylammonium); HPLC (high pressure liquid chromatography); DNA (deoxyribonucleic acid); p (plasmid); μl (microliters); ml (milliliters); μg (micrograms); mg (milligrams); M (molar); mM (milliMolar); μM (microMolar); pmol

(picomol); amol (atomol), zmol (zeptomol); nm (nanometers); kdal (kilodalton); OD (optical density); EDTA (ethylene diamino tetraacetic acid); FITC (fluorescein isothiocyanate); SDS (sodium dodecyl sulfate); NaPO4 (sodium phosphate); NP-40 (Nonidet P-40); Tris (tris (hydroxymethyl) -aminomethane); PMSF (phenylmethylsulfonylfluoride); TBE (Tris-Borate-EDTA, that is, Tris buffer titrated with boric acid instead of HCl and containing EDTA); PBS (phosphate buffered saline); PPBS (phosphate buffered saline having 1 mM PMSF); PAGE (polyacrylamide gel electrophoresis); Tween (polyoxyethylene sorbitan); ATCC (American Type Culture Collection, Rockville, MD); Coriell (Coriell Cell Re-positories, Camden, NJ); DSMZ (Deutsche Sammlung von Mikroorganismen und Zellculturen, Braunschweig, Germany), red pigment (REDMOND RED dye, Synthetic Genetics, San Diego, CA); Z28 (ECLIPSE Quencher, Synthetic Genetics, San Diego, CA); Ambion (Ambion, Inc., Austin, TX); Boehringer (Boehringer Mannheim Biochemical, Indianapolis, IN); MJ. Research (MJ Research, Watertown, MA; Sigma (Sigma Chemical Company, St. Louis, MO); Dynal (Dynal AS, Oslo, Norway); Gull (Gull Laboratories, Salt Lake City, UT); Epicenter (Epicenter Technologies, Madison , WI); Lampire (Biological Labs., Inc., Coopersberg, PA); MJ Research (MJ Research, Watertown, MA); National Biosciences (National Biosciences, Plymouth, MN); NEB (New England Biolabs, Beverly, MA) ; Novagen (Novagen, Inc., Madison, WI) ;; Promega (Promega, Corp., Madison, WI); Stratagene (Stratagene Cloning Systems, La Jolla, CA); Clonetech (Clonetech, Palo Alto, CA) Pharmacia (Pharmacia , Piscataway, NJ); Milton Roy (Milton Roy, Rochester, NY); Amersham (Amersham International, Chicago, IL); and USB (US Biochemical, Cleveland, OH). Glen Research (Glen Research, Sterling, VA); Coriell (Coriell Cell Repositories, Camden, NJ); Gentra (Gentra, Minneapolis, MN); Third Wave Technologies (Third Wave Technologies, Madison, WI); PerSeptive Biosystems (PerSeptive Biosystems, Framington, MA); M icrosoft (Mi-crosoft, Redmond, WA); Qiagen (Qiagen, Valencia, CA); Molecular Probes (Molecular Probes, Eugene, OR); VWR (VWR Scientific,); Advanced Biotechnologies (Advanced Biotechnologies, INC., Columbia, MD); Invitrogen (Invitrogen, Carlsbad, CA) and Perkin Elmer (also known as PE Biosytems and Applied Biosystems, Foster City, CA).

EXAMPLE 1 - Reference

Characteristics of native thermostable DNA polymerases

A. Activity 5 ’nuclease of DNAPTaq

During the polymerase chain reaction (PCR) (Saiki et al., Science 239: 487 [1988]; Mullis and Faloona, Meth. Enzymol., 155: 335 [1987]), DNAPTaq is capable of amplifying many, but not all of the DNA sequences. A sequence that cannot be amplified using DNAPTaq is shown in Fig. 5 (the Fork Structure is SEQ ID No. 15 also shows a primer: SEQ ID No. 17). This DNA sequence has the distinctive feature of being able to fold over itself to form a fork with two single stranded arms, which correspond to the primers used in PCR.

To test whether this inability to amplify is due to the 5 ’nuclease activity of the enzyme, they were compared

DNAPTaq and DNAPStf capabilities to amplify this DNA sequence for 30 cycles of PCR. Synthetic oligonucleotides were obtained at the Biotechnology Center at the University of Wisconsin-Madison. DNAPTaq and DNAPStf were obtained from Perkin Elmer (i.e., AMPLITAQ DNA polymerase and AMPLITAQ DNA polymerase Stoffel fragment). The substrate DNA comprised the hairpin structure shown in Fig. 6 cloned in a double helix shape in pUC19. Primers used in amplification are indicated as SEQ ID NOS 16-17. The primer of SEQ ID No. 17 is shown hybridized with the 3 'arm of the hairpin structure in Fig. 5. The primer of SEQ ID No. 16 is shown as the first 20 nucleotides in bold type

5 ’arm of the fork in Fig. 5.

Polymerase chain reactions comprised 1 ng of supercoiled plasmid target DNA, 5 pmol of each primer, 40 μM of each dNTP and 2.5 units of DNAPTaq or DNAPStf, in a 50 μl solution of 10 mM Tris · Cl pH 8.3. DNAPTaq reactions included 50 mM KCl and 1.5 mM MgCl2. The temperature profile was 95 ° C for 30 s, 55 ° C for 1 min and 72 ° C for 1 min, over 30 cycles. Ten percent of each reaction was analyzed by gel electrophoresis through 6% polyacrylamide (crosslinked 29: 1) in a 45 mM Tris · Borate buffer, pH 8.3, 1.4 mM EDTA.

The results are shown in Fig. 6. The expected product was prepared by DNAPStf (indicated simply as "S") but not DNAPTaq (indicated as "T"). It was concluded that the 5 ’nuclease activity of DNAPTaq is responsible for the absence of amplification of this DNA sequence.

To test whether unpaired 5 ’nucleotides in the substrate region of this structured DNA are removed by DNAPTaq, the fate of the 5 ′ terminal arm labeled during four PCR cycles was compared using the same two polymerases (Fig. 7). Fork molds, such as the one described in Fig. 6, were prepared using DNAPStf and a 5 ′ labeled end primer with 32P. The 5 'end of the DNA was released as a few large fragments by DNAPTaq but not by DNAPStf. The sizes of these fragments (based on their

mobilities) show that they contain most or all of the 5 ’unpaired arm of the DNA. Therefore, the excision takes place at or near the base of the bifurcated duplex. These released fragments terminate with OH 3 'groups, as evidenced by direct sequence analysis and the capabilities of the fragments to be extended by terminal deoxynucleotidyl transferase.

Figures 8-10 show the results of experiments designed to characterize the DNAPTaq catalyzed cleavage reaction. Unless otherwise specified, the cleavage reactions comprise 0.01 pmol of heat-denatured, terminal-labeled hairpin DNA (the unlabeled complementary chain is also present), 1 primer pmol (complementary to the 3 'arm) and 0.5 units of DNAPTaq (estimated to be 0.026 pmol) in a total volume of 10 μl of 10 mM Tris-Cl, pH 8.5, 50 mM KCl and 1.5 mM MgCl2 As indicated, some reactions had different concentrations of KCl and the precise times and temperatures used in each experiment are indicated in the Individual figures. Reactions that included a primer used the one shown in Fig. 5 (SEQ ID NO: 17). In some cases, the primer was extended to the binding site providing selected polymerase and nucleotides.

The reactions were started at the final reaction temperature by the addition of MgCl2 or the enzyme. The reactions

they were stopped at their incubation temperatures by adding 8 µl of 95% formamide with 20 mM EDTA

and 0.05% marker dyes. The Tf calculations listed were performed using the OligoTM primer analysis software from National Biosciences, Inc. They were determined using 0.25 μM as the DNA concentration, at 15 or 65 mM total salt (at MgCl2 1.5 mM in all reactions the value of 15 mM salt was given for these calculations).

Fig. 8 is an autoradiogram that contains the results of a set of experiments and site conditions. Fig. 8A is a determination of the reaction components that allow cleavage. The incubation of the labeled hairpin DNA at the 5 'end was carried out for 30 minutes at 55 ° C, with the indicated components. The products were separated by electrophoresis in denaturing polyacrylamide gel and the lengths of the products are indicated, in nucleotides. Fig. 8B describes the effect of temperature on the cleavage site in the absence of added primer. The reactions were incubated in the absence of KCl for 10 minutes at the indicated temperatures. The lengths of the products are indicated, in nucleotides.

Surprisingly, DNAPTaq cleavage does not require any primer or dNTP (see Fig. 8A). Therefore, the

5 ’nuclease activity can be decoupled from polymerization. Nuclease activity requires magnesium ions,

although manganese ions can be substituted, although with potential changes in specificity and activity. Neither zinc nor calcium ions support the cleavage reaction. The reaction takes place over a wide range of temperatures, from 25 ° C to 85 ° C, increasing the rate of cleavage at higher temperatures.

Still with reference to Fig. 8, the primer is not prolonged in the absence of added dNTP. However, the primer influences the site and the speed of excision of the fork. The change in the cleavage site (Fig. 8A) apparently occurs by the alteration of a short duplex formed between the arms of the DNA substrate. In the absence of a primer, the sequences indicated by the underline in Fig. 5 could be paired, forming an extended duplex. Excision at the end of the extended duplex would release the 11 nucleotide fragment observed in the rails of Fig. 9A without added primer. The addition of excess primer (Fig. 8A, lanes 3 and 4) or incubation at an elevated temperature (Fig. 8B) alters the short extension of the duplex and results in a longer 5 'arm and, therefore, products of longer split.

The location of the 3 ’end of the primer can influence the precise site of cleavage. Electrophoretic analysis

showed that in the absence of a primer (Fig. 8B), the cleavage takes place at the end of the substrate duplex (the extended or shortened form, depending on the temperature) between the first and second base pair. When the primer extends to the base of the duplex, the excision also takes place a nucleotide within the duplex. Without

However, when there is a gap of four or six nucleotides between the 3 'end of the primer and the substrate duplex, the cleavage site moves from four to six nucleotides in the 5' direction.

Fig. 10 describes the kinetics of cleavage in the presence (Fig. 9A) or absence (Fig. 9B) of a oligonucleotide primer. The reactions were performed at 55 ° C with 50 mM KCl (Fig. 9A) or 20 mM KCl (Fig. 9B). The reaction products were separated by electrophoresis in denaturing polyacrylamide gel and the lengths of the

products, in nucleotides. "M", which indicates a marker, is a 19-nucleotide oligonucleotide labeled at the 5 'end. Under these salinity conditions, Figs. 9A and 9B indicate that the reaction appears to be approximately twenty times faster in the presence of a primer than in the absence of a primer. This effect on efficacy can be attributed to proper alignment and stabilization of the enzyme in the substrate.

The relative influence of primer on cleavage rates is much greater when both reactions are performed in 50 mM KCl. In the presence of a primer, the cleavage rate increases with the concentration of KCl, up to about 50 mM. However, inhibition of this reaction in the presence of primer is evident at 100 mM and is complete at 150 mM KCl. On the contrary, in the absence of a primer the speed improves by the concentration of KCl up to 20 mM, but is reduced to concentrations above 30 mM. At 50 mM KCl, the reaction is virtually completely inhibited. Inhibition of cleavage by KCl in the absence of primer is affected by temperature, being more pronounced at lower temperatures.

The recognition of the 5 ’end of the arm to be cut seems to be an important substrate recognition feature. The substrate that lacks a free 5 ’end, such as circular M13 DNA, cannot be cleaved in any analyzed condition. Even with substrates that have defined 5 ’arms, the cleavage rate by

DNAPTaq is influenced by the length of the arm. In the presence of primer and 50 mM KCl, excision of an extension

5 ’which is 27 nucleotides in length is essentially complete in the 2 minute interval at 55 ° C. On the contrary, the cleavage of molecules with 5 'arms of 84 and 188 nucleotides is only approximately 90% and 40% complete after 20 minutes. Incubation at higher temperatures decreases the inhibitory effects of long extensions indicating that the secondary structure in the 5 ’arm or a thermolabile structure in the enzyme can inhibit the reaction. A mixing experiment, performed under conditions of excess substrate, shows that long-arm molecules do not preferentially immobilize the enzyme available in complexes.

not productive These results may indicate that the nuclease 5 ’domain gains access to the cleavage site at the end of the bifurcated duplex by moving arm 5 down from one end to the other. 5 ’arms would be expected

the longer they had more adventitious secondary structures (particularly when KCl concentrations are high), which would probably prevent this movement.

The cleavage does not appear to be inhibited by 3 'long arms of any of the target nucleic acid substrate chain target molecule, at least up to 2 kilobases. At the other end, the 3 ’arms of the pilot nucleic acid so short

as a nucleotide they can withstand cleavage in an independent primer reaction, albeit inefficiently. Fully paired oligonucleotides do not elicit excision of DNA templates during primer extension.

DNAPTaq's ability to cleave molecules even when the complementary chain contains only an unpaired 3 ′ nucleotide may be useful for optimizing allele-specific PCR. PCR primers having unpaired 3 'ends could act as pilot oligonucleotides to direct the selective cleavage of unwanted templates during preincubation of potential template-primer complexes with DNAPTaq in the absence of nucleoside triphosphates.

B. Activity 5 ’Nuclease from other DNAPs

To determine whether other 5 ’nucleases in other DNAPs would be suitable for the present invention, a series of enzymes were examined, in the literature it was described that several of them were free of apparent 5 ′ nuclease activity. The ability of these other enzymes to cleave nucleic acids in a specific way of structure was tested using the hairpin substrate shown in Fig. 5 under conditions that were described as being optimal for synthesis by each enzyme.

DNAPEcl and DNAP Klenow were obtained from Promega Corporation; the DNAP of Pyrococcus furiosus ("Pfu", Bargseid et al., Strategies 4: 34 [1991]) was from Strategene; the DNAP of Thermococcus litoralis ("Tli", VentTM (exo-), Perler et al., Proc. Natl. Acad. Sci., USA 89: 5577 [1992]) was from New England Biolabs; the DNAP of Thermus flavus ("Tfl", Kaledin et al., Biokhimiya 46: 1576 [1981]) was from Epicenter Technologies; and the DNAP of Thermus thermophilus

("Tth", Carballeira et al., Biotechniques 9: 276 [1990]; Myers et al., Biochem., 30: 7661 [1991]) was from U. S.

Biochemicals

In this Example, 0.5 units of each DNA polymerase were tested in a 20 µl reaction, using the

buffers supplied by the manufacturers for the primer-dependent reactions or 10 mM Tris Cl, pH 8.5, 1.5 mM MgCl 2 and 20 mM KCl. The reaction mixtures were maintained at 72 ° C before enzyme addition.

Fig. 10 is an autoradiogram that records the results of these tests. Fig. 10A demonstrates DNAP endonuclease reactions of several thermophilic bacteria. The reactions were incubated at 55 ° C for 10 minutes in the presence of primer or at 72 ° C for 30 minutes in the absence of primer and the products were separated by electrophoresis in denaturing polyacrylamide gel. The lengths of the products are indicated, in nucleotides.

Fig. 10B demonstrates endonucleolytic cleavage by nuclease 5 'of DNAPEcl. DNAPEcl reactions and

DNAP Klenow were incubated for 5 minutes at 37 ° C. Note the light band of cleavage products of 25 and 11 nucleotides in the DNAPEcl lanes (performed in the presence and absence of primer, respectively). Fig. 8A also shows DNAPTaq reactions in the presence (+) or absence (-) of primer. These reactions were performed in 50 mM and 20 mM KCl, respectively and incubated at 55 ° C for 10 minutes.

With reference to Fig. 10A, the DNAPs of the Thermus thermophilus and Thermus flavus eubacteria cleave the substrate at the same site as DNAPTaq, both in the presence and absence of a primer. In contrast, the DNAPs of the Pyrococcus furiosus and Thermococcus litoralis archaea are unable to cleave the substrates endonucleolytically. The DNAPs of Pyrococcus furiosus and Thermococcus litoralis share little sequence homology with eubacterial enzymes (Ito et al., Nucl. Acids Res. 19: 4045 (1991); Mathur et al., Nucl. Acids. Res. 19: 6952 ( 1991); see also Perler et al.). With reference to Fig. 10B, DNAPEcl also cleaves the substrate,

but the resulting cleavage products are difficult to detect unless exonuclease 3 is inhibited. The amino acid sequences of the 5 'nuclease domains of DNAPEcl and DNAPTaq have a homology of approximately 38% (Gelfand, above).

The 5 'nuclease domain of DNAPTaq also shares approximately 19% homology with the 5' exonuclease encoded by gene 6 of bacteriophage T7 (Dunn et al., J. Mol. Biol. 166: 477 [1983]). This nuclease, which does not covalently bind to a DNAP polymerization domain, is also capable of cleaving DNA.

endonucleolytically, at a site similar or identical to the site that is cut by the 5 ’nucleases that have been described

previously, in the absence of added primers.

C. Transcision

The ability of a 5 ’nuclease to be directed to cleave efficiently in any specific sequence is

He demonstrated in the following experiment. A partially complementary oligonucleotide called a

"Pilot oligonucleotide" hybridized with sequences at the desired cleavage point. The non-complementary part of the pilot oligonucleotide provided a structure analogous to the 3 ’arm of the template (See Fig. 6), while the 5’ region of the substrate chain became the 5 ’arm. A primer was provided by designing the pilot's 3 ’region so that it would fold over itself creating a short fork with a stabilization tetra-loop (Antao et al., Nucl. Acids Res. 19: 5901 [1991). Two pilot oligonucleotides are shown in Fig. 11A. Oligonucleotides 19-12 (SEQ ID No. 18), 30-12 (SEQ ID No. 19) and 30-0 (SEQ ID No. 20) are 31, 42 or 30 nucleotides in length, respectively. However, oligonucleotides 19-12 (SEQ ID No. 18) and 34-19 (SEQ ID No. 19) have only 19 and 30 nucleotides, respectively, which are complementary to different sequences in the substrate strand. Pilot oligonucleotides are calculated to melt away from their complements at approximately 50 ° C (19-12) and at approximately 75 ° C (30-12). Both pilots have 12 nucleotides in their

3 ’ends, acting as 3’ arms with primers with paired base pairings.

To demonstrate that cleavage could be directed by a pilot oligonucleotide, a single helix target DNA was incubated with DNAPTaq in the presence of two potential pilot oligonucleotides. Transescision reactions, where the target and pilot nucleic acids are non-covalently bound, include 0.01 pmol of substrate labeled DNA.

single end, 1 unit of DNAPTaq and 5 pmol of pilot oligonucleotide in a volume of 20 μl thereof

tampons These components were combined during one minute of incubation at 95 ° C to denature the double helix substrate DNA generated by PCR and the reaction temperatures were then reduced to their final incubation temperatures. Oligonucleotides 30-12 and 19-12 can hybridize with regions of the substrate DNAs that are 85 and 27 nucleotides from the 5 ′ end of the targeted chain.

Fig. 19 shows the complete sequence of the 206 unit oligomer (SEQ ID No. 27). The 206 unit oligomer was generated by PCR. The 24-unit oligomer sequencing primer (-48) of M13 / pUC units and the M13 / pUC sequencing primer (-47) of NEB (catalog no. 1233 and 1224, respectively) were used (50 pmol each ) with the plasmid vector pGEM3z (f +) (Promega) as a template (10 ng) containing the target sequences. The conditions for PCR were as follows: 50 μM of each dNTP and 2.5 units of Taq DNA polymerase in 100 μl of 20 mM Tris-Cl, pH 8.3, 1.5 mM MgCl2, 50 mM KCl with Tween- 0.05% 20 and 0.05% NP-40. The reactions were cycled 35 times over 95 ° C for 45 seconds, 63 ° C for 45 seconds, then 72 ° C for 75 seconds. After cycling, the reactions were terminated with an incubation at 72 ° C for 5 minutes. The resulting fragment was purified by electrophoresis through a 6% polyacrylamide gel

(29: 1 cross-linking) in a 45 mM Tris-Borate buffer, pH 8.3, 1.4 mM EDTA, visualized by staining with ethidium bromide or autoradiography, excised from the gel, eluted by passive diffusion and concentrated by precipitation with ethanol.

The cleavage of the substrate DNA took place in the presence of the pilot oligonucleotide 19-12 at 50 ° C (Fig. 11B, lanes 1 and 7) but not at 75 ° C (lanes 4 and 10). In the presence of oligonucleotide 30-12, excision was observed at both temperatures. No cleavage took place in the absence of added oligonucleotides (lanes 3, 6 and 12) or at approximately 80 ° C even though at 50 ° C, adventitious structures in the substrate allowed independent primer cleavage in the absence of KCl (Fig. 11B, lane 9). A non-specific oligonucleotide without complementarity with the substrate DNA did not direct cleavage at 50 ° C, either in the absence or in the presence of 50 mM KCl (lanes 13 and 14). Therefore, the specificity of the cleavage reactions can be controlled by the extent of complementarity with the substrate and by the incubation conditions.

D. RNA Excision

A shortened RNA version of the sequence used in the transescision experiments discussed above was tested for its ability to serve as a substrate in the reaction. The RNA is cleaved at the expected site, in a reaction that depends on the presence of the pilot oligonucleotide. The RNA substrate, prepared by T7 RNA polymerase in the presence of [-32P] UTP, corresponds to a truncated version of the DNA substrate used in Fig. 11B. The reaction conditions were similar to those used for the DNA substrates described above, with 50 mM KCl; the incubation was for 40 minutes for 55 ° C. The pilot oligonucleotide used is called 30-0 (SEQ ID No. 20) and is shown in Fig. 12A.

The results of the cleavage reaction are shown in Fig. 13B. The reaction was performed in the presence or absence of DNAPTaq or pilot oligonucleotide as indicated in Fig. 12B.

Surprisingly, in the case of RNA cleavage, a 3 'arm is not required for the pilot oligonucleotide. It is very unlikely that this cleavage is due to RNasaH that has been previously described, which would be expected to cut the RNA at several sites along the 30-base-length RNA-DNA duplex. The 5 ’nuclease of DNAPTaq is RNasaH with structure specificity that cleaves the RNA at a single site near the 5’ end of

the region in heteroduplex.

It is surprising that an oligonucleotide lacking a 3 'arm is able to act as a pilot to direct the efficient cleavage of an RNA target because such oligonucleotides are unable to direct the efficient cleavage of DNA targets using native DNAP. However, some 5 ’nucleases (for example, clones E, F and G of Fig. 4) can cleave DNA in the absence of a 3’ arm. In other words, no non-extensible cleavage structure is required for specific cleavage with some 5 'nucleases of the present invention obtained from DNA.

thermostable polymerases.

It was tested whether excision of an RNA template by DNAPTaq in the presence of a completely complementary primer could help explain why DNAPTaq is unable to extend a DNA oligonucleotide into an RNA template, in a reaction that resembles that of reverse transcriptase Another thermophilic DNAP, DNAPTth, is capable of using RNA as a template, but only in the presence of Mn ++, so it was predicted that this enzyme would not cleave RNA in the presence of this cation. Accordingly, an RNA molecule was incubated with an appropriate pilot oligonucleotide in the presence of DNAPTaq or DNAPTth, in a buffer containing Mg ++ or Mn ++. As expected, both enzymes cleaved the RNA in the presence of Mg ++. However, DNAPTaq, but not

DNAPTth, degraded the RNA in the presence of Mn ++. It was concluded that the 5 ’nuclease activities of many DNAPs

They can contribute to your inability to use RNA as templates.

EXAMPLE 2 - Reference

Generation of 5 ’Nucleases obtained from thermostable DNA polymerases

Thermostable DNA polymerases were generated that had reduced synthetic activity, an activity that is an undesirable side reaction during DNA cleavage in the detection assay of the invention, although it has maintained thermostable nuclease activity. The result is a thermostable polymerase that cleaves nucleic acid DNA with extreme specificity.

Type A DNA polymerases from eubacteria of the Thermus genus share broad protein sequence identity (90% in the polymerization domain, using the Lipman-Pearson method in the DNA analysis software of DNAStar, WI) and behave similarly, both in polymerization and nuclease assays. Therefore, the genes for Thermus aquaticus DNA polymerase (DNAPTaq) and Thermus flavus (DNAPTf1) were used as representatives of this class. The polymerase genes of other eubacterial organisms, such as Thermus thermophilus, Thermus sp., Thermotoga maritima, Thermosipho africanus and Bacillus stearothermophilus are also equally suitable. The DNA polymerases of these thermophilic organisms are capable of surviving and functioning at elevated temperatures and, therefore, can be used in reactions where temperature is used as a selection against non-specific hybridization of nucleic acid chains.

Restriction sites used for deletion mutagenesis, described below, were selected for convenience. Different sites located with similar convenience are available in the Thermus thermophilus gene and can be used to prepare similar constructs with other Type A polymerase genes from related organisms.

A. Creation of 5 ’nuclease constructs

1. Modified DNAPTaq genes

The first stage was to place a modified gene for Taq DNA polymerase in a plasmid under the control of an inducible promoter. The modified Taq polymerase gene was isolated as follows: the Taq DNA polymerase gene was amplified by polymerase chain reaction from genomic DNA from Thermus aquaticus, strain YT-1 (Lawyer et al., Above ), using the oligonucleotides described in SEQ ID NOS 13-14 as primers. The resulting DNA fragment has an EcoRI restriction endonuclease recognition sequence at the 5 ′ end of the coding sequence and a BgIII sequence at the 3 ′ end. The cleavage with BgIII leaves a 5 'or "adhesive end" protrusion that is compatible with the end generated by BamHI. The PCR amplified DNA was digested with EcoRI and BamHI. The 2512 bp fragment containing the coding region for the polymerase gene was gel purified and then ligated into a plasmid containing an inducible promoter.

In one embodiment of the invention, vector pTTQ18 was used, which contains the hybrid trp-lac (tac) promoter [M. J. R. Stark, Gene 5: 255 (1987)] and is shown in Fig. 13. The tac promoter is under the control of the E. coli lac repressor. Repression allows the synthesis of the gene product to be suppressed until the desired level has been achieved. of bacterial development, at which point repression is eliminated by the addition of a specific inducer, isopropyl-Dthiogalactopyranoside (IPTG). Such a system allows the expression of foreign proteins that can slow or prevent the growth of transformants.

Bacterial promoters, such as tac, may not be suitably suppressed when they are present in a multi-copy plasmid. If a highly toxic protein is placed under the control of such a promoter, the small amount of expression that is produced can be harmful to bacteria. In another embodiment of the invention another option was used to repress the synthesis of a cloned gene product. The non-bacterial promoter, from bacteriophage T7, found in the pET-3 series plasmid vector was used to express the cloned mutant Taq polymerase genes [Fig. fifteen; Studier and Moffatt, J. Mol. Biol. 189: 113 (1986)]. This promoter initiates transcription only by T7-RNA polymerase. In a suitable strain, such as BL21 (DE3) pLYS, the gene for this RNA polymerase is carried in the bacterial genome under the control of a lac operator. This arrangement has the advantage that the expression of the multi-copy gene (in the plasmid) is completely dependent on the expression of T7 RNA polymerase, which is easily suppressed because it is present in a single copy.

For ligation in the pTTQ18 vector (Fig. 13), the PCR product DNA containing the Taq polymerase coding region (mutTaq, clone 4B, SEQ ID No. 21) was digested with EcoRI and BgIII and this fragment was ligated in

Conventional "adhesive end" conditions [Sambrook et al. Molecular Cloning, Cold Spring Harbor

Laboratory Press, Cold Spring Harbor, pp. 1.63-1.69 [1989]) at the EcoRI and BamHI sites of the plasmid vector pTTQ18. The expression of this construct provides a translation fusion product in which the first two residues of the native protein (Met-Arg) are replaced by three of the vector (Met-Asn-Ser), but the rest of the natural protein is not would change. The construction was introduced by transformation in E. coli strain JM109 and the transformants were seeded under repression conditions that do not allow the development of bacteria that express the native protein. These seeding conditions allow the isolation of genes that contain pre-existing mutations, such as those produced by the infidelity of Taq polymerase during the amplification procedure

Using this amplification / selection protocol, a clone (illustrated in Fig. 3B) containing a mutated Taq polymerase gene (mutTaq, clone 3B) was isolated. The mutant was first detected by its phenotype, in which the

5 'stable nuclease activity at temperature in a crude cell extract was normal, but the activity of

Polymerization was virtually absent (approximately less than 1% of wild-type Taq polymerase activity).

DNA sequence analysis of the recombinant gene showed that it had changes in the polymerase domain resulting in two amino acid substitutions: or a change from A to G at the position of nucleotide 1394 causes a change from Glu to Gly at the amino acid position 465 (numbered according to the natural nucleic acid and amino acid sequences, SEQ ID NO: 1 and 4) and another change from A to G at nucleotide position 2260 causes a change from Gln to Arg at amino acid position 754. Because the Gln to Gly mutation is in an unconserved position and because the Glu to Arg mutation alters an amino acid that is conserved in virtually all known Type A polymerases, the latter mutation is most likely responsible for Restrict the synthesis activity of this protein. The nucleotide sequence for the construction of Fig. 3B is provided in SEQ ID NO: 21. The enzyme encoded by this sequence is called Cleavase® A / G.

Subsequent derivatives of DNAPTaq constructs were prepared from the mutTaq gene, therefore, all carry these amino acid substitutions in addition to their other alterations, unless these particular regions have been deleted. These mutated sites are indicated by black boxes in these locations in the diagrams in the

Fig. 3. In Fig. 3, the name “Exo 3’ ”is used to indicate the location of exonuclease 3’ activity

associated Type A polymerases that are not present in DNAPTaq. All constructs except the genes shown in Figs. 3E, F and G were performed on the pTTQ18 vector.

The cloning vector used for the genes in Figs. 3E and F was of the commercially available pET-3 series described above. Although this vector series has only one BamHI site for downstream cloning of the T7 promoter, the series contains variants that allow cloning in any of the three reading phases. For the cloning of the PCR product described above, the variant called pET-3c was used (Fig. 14). The vector was digested with BamHI, dephosphorylated with calf intestinal phosphatase and the adhesive ends were introduced using the Klenow fragment of DNAPEc1 and dNTP. The mutant Taq DNAP gene shown in Fig. 3B (mutTaq, clone 3B) was released from pTTQ18 by digestion with EcoRI and SaII and the "adhesive ends" were introduced as was done with the vector. The fragment was ligated to the vector under extreme conditions

Conventional blunts (Sambrook et al., Molecular Cloning, above), the construction was introduced by transformation into E. coli strain BL21 (DE3) ply and isolates were screened to identify those that were ligated with the gene in the appropriate orientation with respect to the promoter. This construction provides another translation fusion product, in which the first two amino acids of DNAPTaq (Met-Arg) are replaced by 13 of the vector plus two of the PCR primer (Met-Ala-Ser-Met-Thr-Gly-Gly -Gln-Gln-Met-Gly-Arg-Ile-Asn-Ser) (SEQ ID No. 24).

In these experiments, the objective was to generate enzymes that lack the ability to synthesize DNA, but that

they retain the ability to cleave nucleic acids with a 5 ’nuclease activity. The barley synthesis act, with

DNA template is in fact a series of coordinated events, so that it is possible to disable DNA synthesis by altering an event as long as it does not affect others. These steps include, but are not limited to, recognition and primer binding, dNTP binding and inter-nucleotide phosphodiester bond catalysis. Some of the amino acids in the polymerization domain of DNAPEcl have been linked to these functions, but the precise mechanisms are still poorly defined.

One way to destroy the polymerization capacity of a DNA polymerase is to delete all or part of the gene segment encoding that domain for the protein or otherwise convert the gene unable to prepare a complete polymerization domain. Individual mutant enzymes may differ from each other in stability and

solubility both inside and outside cells. For example, compared to the nuclease 5 ’domain of

DNAPEcl, which can be released in an active form from the polymerization domain by careful proteolysis (Setlow and Kornberg, J. Biol. Chem., 247: 232 [1972]), the Thermus nuclease domain, when treated similarly, It becomes less soluble and the cleavage activity is often lost.

Using the mutant gene shown in Fig. 3B as a starting material, several deletion constructs were created. All cloning technologies were conventional (Sambrook et al., Above) and are briefly summarized as follows:

Fig. 3C: The mutTaq construct was digested with PstI, which cuts once within the polymerase coding region, as indicated and immediately cuts downstream of the gene at the multiple cloning site of the vector. After release of the fragment between these two sites, the vector was re-ligated, creating a deletion of 894 nucleotides and carrying out a termination codon 40 nucleotides chain below the junction. The

Nucleotide sequence of this 5 ’nuclease (clone 4C) is provided in SEQ ID NO: 9.

Fig. 3D: The mutTaq construct was digested with NheI, which cuts once in the gene at position 2047. The

5 ’protruding ends of four resulting nucleotides were introduced, as described above and the

blunt ends were ligated again. The resulting insertion of four nucleotides changes the reading phase and causes the translation termination ten amino acids chain below the mutation. The sequence of

Nucleotides of this nuclease 5 '(3D clone) is provided in SEQ ID NO. 10.

Fig. 3E: The entire mutTaq gene was cut from pTTQ18 using EcoRI and SalI and cloned into pET-3c, as described above. This clone was digested with BstXI and XcmI, in unique sites that are positioned as shown in Fig. 3E. The DNA was treated with the Klenow fragment of DNAPEc1 and dNTP, which resulted in the 3 'protrusions of both sites being cut to blunt ends. These blunt ends were ligated together, resulting in an out-of-phase deletion of 1540 nucleotides. A phase termination codon takes place 18 triplets beyond the binding site. The nucleotide sequence of this 5 ’nuclease (clone 3E) is given in SEQ ID No. 11, giving the appropriate leader sequence in SEQ ID No. 25. It is also called Cleavase® BX.

Fig. 3F: The entire mutTaq gene was cut from pTTQ18 using EcoRI and SalI and cloned into pET-3c, as described above. This clone was digested with BstXI and BamHI, in unique sites that are positioned as shown in the diagram. The DNA was treated with the Klenow fragment of DNAPEc1 and dNTP, which resulted in the protrusion

3 ’of the BstXI site will be cut to a blunt end, while the 5’ projection of the BamHI site was introduced to

prepare a blunt end. These ends were linked together, resulting in a phase deletion of 903 nucleotides. The nucleotide sequence of this 5 ’nuclease (clone 3F) is given in SEQ ID NO. 12. It is also called Cleavase® BB.

Fig. 3G: This polymerase is a variant of that shown in Fig. 4E .. It was cloned into the plasmid vector pET-21 (Novagen). The bacteriophage T7 non-bacterial promoter, observed in this vector, initiates transcription only by T7 RNA polymerase. See Studier and Moffatt, above. In a suitable strain, such as (DES) pLYS, the gene for this RNA polymerase is carried in the bacterial genome under the control of the lac operator. This arrangement has the advantage that the expression of the multi-copy gene (in the plasmid) is completely dependent on the expression of T7 RNA polymerase, which is easily suppressed because it is present in a single copy. Because the expression of these mutant genes is under this tightly controlled promoter, the potential toxicity problems of the proteins expressed for the host cells are a minor cause for concern.

The pET-21 vector also carries a "His * Marker", an extension of six consecutive histidine residues that are added to the carboxy terminus of the expressed proteins. The resulting proteins can then be purified in a single step by metal chelation chromatography, using a commercially available column resin (Novagen) with immobilized Ni ++ ions. The 2.5 ml columns are reusable and can bind up to 20 mg of the target protein under native or denaturing conditions (guanidine * HCl or urea).

E. coli (DES) pLYS cells are transformed with the constructs described above using conventional transformation techniques and used to inoculate a conventional culture medium (eg, Luria-Bertani broth). The production of T7 RNA polymerase is induced during logarithmic phase growth by the addition of IPTG and incubated for an additional 12 to 17 hours. Aliquots of culture are removed both before and after induction and the proteins are examined by SDS-PAGE. Staining with Coomassie Blue allows the visualization of foreign proteins if they represent approximately 3-5% of the cellular protein and do not combine with any of the major protein bands. Proteins that co-migrate with the main host protein must be expressed as more than 10% of the total protein to be observed at this stage of analysis.

Some mutant proteins are sequestered by cells in inclusion bodies. These are granules that form in the cytoplasm when bacteria are prepared to express high levels of a foreign protein and can be purified from a crude lysate and analyzed by SDS-PAGE to determine its protein content. If the cloned protein is observed in the inclusion bodies, it must be released to test the cleavage and polymerase activities. Different solubilization procedures may be appropriate for different proteins and various procedures are known. (See, for example, Builder & Ogez, U.S. Patent No.

4,511,502 (1985); Olson, U.S. Patent No. 4,518,526 (1985); Olson & Pai, U.S. Patent No. 4,511,503 (1985); Jones et al., U.S. Patent No. 4,512,922 (1985)).

Then, the solubilized protein is purified on the Ni ++ column as described above, following the manufacturer's instructions (Novagen). The washed proteins are eluted from the column by a combination of imidazole competitor (1 M) and high salt content (0.5 M NaCl) and dialyzed to change the buffer and to allow denatured proteins to fold back. Typical recoveries result in

approximately 20 μg of specific protein per ml of starting culture. The DNAP mutant is called the

CLEAVASE BN nuclease and the sequence is given in SEQ ID No. 26 (the amino acid sequence of the CLEAVASE BN nuclease is obtained by translating the DNA sequence of SEQ ID No. 26).

2. Modified DNATfl gene

The Thermus flavus DNA polymerase gene was isolated from the strain of "T. flavus ”AT-62 obtained from the ATCC (ATCC 33923). This strain has a different restriction map than the T. flavus strain used to generate the sequence published by Akhmetzjanov and Vakhitov, previously. The published sequence is indicated as SEQ ID NO. 2. No sequence data has been published for the DNA polymerase gene of the AT-62 strain of T. flavus.

T. flavus genomic DNA was amplified using the same primers used to amplify the T. aquaticus DNA polymerase gene (SEQ ID NO: 13-14). The approximately 2,500 base pair PCR fragment was digested with EcoRI and BamHI. The protruding ends became blunt with the Klenow fragment of DNAPEc1 and dNTP. The resulting approximately 1800 base pair fragment containing the coding region for the N-terminus was ligated into pET-3c, as described above. This construction, clone 4B, is illustrated in Fig. 4B. The wild-type T. flavus DNA polymerase gene is illustrated in Fig. 4A. Clone 4B has the same leading amino acids as the DNAPTaq 4E and F clones that were cloned into pET-3c; It is not known precisely where translation termination occurs, but the vector has a strong transcription termination signal immediately downstream of the cloning site.

B. Growth and induction of transformed cells

Bacterial cells were transformed with the constructs described above using conventional transformation techniques and used to inoculate 2 ml of a conventional culture medium (for example, Luria-Bertani broth). The resulting cultures were incubated appropriately for the particular strain used and induced if a specific expression system was required. For all the constructions represented in Figs. 3 and 4, cultures were grown to an optical density (at 600 nm wavelength) OD of 0.5.

To induce expression of the cloned genes, cultures were brought to a final concentration of 0.4mM IPTG and incubations were continued for 12 to 17 hours. Then, 50 μl aliquots of each culture were removed both before and after induction and combined with 20 μl of a conventional gel loading buffer

for electrophoresis in sodium dodecyl sulfate-polyacrylamide gel (SDS-PAGE). Subsequent staining with Coomassie blue (Sambrook et al., Above) allows the visualization of foreign proteins if they represent approximately 3-5% of the cellular protein and do not co-migrate with any of the major E protein bands. coli Proteins that do co-migrate with the main host protein must be expressed as more than 10% of the total protein to be observed at this stage of analysis.

C. Heat lysis and fractionation

Expressed thermostable proteins, i.e. 5 ’nucleases, were isolated, heating crude bacterial cell extracts to cause denaturing and precipitation of less stable E. coli proteins. Then, the precipitated E. coli proteins were removed by centrifugation together with other cell debris. Next, 1.7 ml of the culture was pelleted by microcentrifugation at 12,000 at 14,000 rpm for 30 to 60 seconds. After removal of the supernatant, the cells were resuspended in 400 μl of buffer A ((50 mM Tris-HCl, pH 7.9, 50 mM dextrose, 1 mM EDTA), re-centrifuged, then resuspended in 80 μl of buffer A with 4 mg / ml lysozyme.The cells were incubated at room temperature for 15 minutes, then combined with 80 µl of buffer B (10 mM Tris-HCl, pH 7.9, 50 mM KCl, 1 mM EDTA , 1 mM PMSF, 0.5% Tween-20, 0.5% Nonidet-P40).

This mixture was incubated at 75 ° C for 1 hour to denature and precipitate host proteins. This cell extract was centrifuged at 14,000 rpm for 15 minutes at 4 ° C and the supernatant was transferred to a new tube.

An aliquot of 0.5 to 1 μl of this supernatant was used directly in each test reaction and the protein content of the extract was determined by subjecting 7 μl to electrophoretic analysis, as before. The native recombinant Taq DNA polymerase [Englke, Anal. Biochem., 191: 396 [1990]), and the double point mutation protein shown in Fig. 3B are both soluble and active at this point.

The foreign protein may not be detected after heat treatments due to the sequestration of the foreign protein by cells in inclusion bodies. These are granules that form in the cytoplasm when bacteria are prepared to express high levels of a foreign protein and can be purified from a crude lysate and analyzed by SDS-PAGE to determine its protein content. Many procedures have been described in the literature and a strategy is described below.

D. Isolation and solubilization of inclusion bodies

A small culture was developed and induced as described above. A 1.7 ml aliquot was pelleted by brief centrifugation and the bacterial cells were resuspended in 100 µl of Lisis buffer (Tris -50 mM HCl, pH 8.0, 1 mM EDTA, 100 mM NaCl). Then 2.5 l of 20 mM PMSF was added to a final concentration of 0.5 mM and lysozyme was added to a concentration of 1.0 mg / ml. The cells were incubated at temperature At room temperature for 20 minutes, deoxycholic acid was added up to 1 mg / ml (1 L of 10 mg / ml solution) and the mixture was further incubated at 37 ° C for approximately 15 minutes or until viscous. Was added

DNase I up to 10 μg / ml and the mixture was incubated at room temperature for approximately 30 minutes or

until it was not viscous.

From this mixture the inclusion bodies were collected by centrifugation at 14,000 rpm for 15 minutes at 4 ° C and

the supernatant was discarded. The sediment was resuspended in 100 μl lysis buffer with 10 mM EDTA (pH 8.0) and

0.5% Triton X-100. After 5 minutes at room temperature, the inclusion bodies were sedimented as before and the supernatant was stored for further analysis. Inclusion bodies are

resuspended in 50 μl of distilled water and combined 5 μl with SDS gel loading buffer (which dissolves the

inclusion bodies) and were analyzed electrophoretically, together with an aliquot of the supernatant.

If the cloned protein is found in the inclusion bodies, it can be released to test the cleavage and polymerase activities and the solubilization procedure has to be compatible with the specific activity. Different solubilization procedures may be appropriate for different proteins and a variety of procedures are discussed in Molecular Cloning (Sambrook et al., Above). The following is an adaptation that was used for several of the isolates used in the development of the present invention.

Twenty μl of the inclusion-water body suspension was pelleted by centrifugation at 14,000 rpm for 4 minutes at room temperature and the supernatant was discarded. To further wash the inclusion bodies, the pellet was resuspended in 20 μl of lysis buffer with 2 M urea and incubated at room temperature for one hour. The washed inclusion bodies were then resuspended in 2 µl of lysis buffer with 8 M urea; the

solution was visibly cleared when the inclusion bodies dissolved. The undissolved residues were removed by centrifugation at 14,000 rpm for 4 minutes at room temperature and the extract supernatant was transferred to a new tube.

To decrease the urea concentration, the extract was diluted in KH2PO4. A new tube containing 180 μl of 50 mM KH2PO4, pH 9.5, 1 mM EDTA and 50 mM NaCl was prepared. A 2 μl aliquot of the extract was added and vortexed briefly for mixing. This step was repeated until the entire extract had been added for a total of 10 additions. The mixture was allowed to stand at room temperature for 15 minutes, during which time some precipitate often forms. The precipitates were removed by centrifugation at

14,000 rpm for 15 minutes at room temperature and the supernatant was transferred to a new tube. At 200 μl of protein in the KH2PO4 solution 140-200 μl of saturated (NH4) 2SO4 was added, such that the resulting mixture was (NH4) 2SO4 of approximately 41% to 50% saturation. The mixture was cooled on ice for 30 minutes to allow the protein to precipitate and then the protein was collected by centrifugation at 14,000 rpm, for 4 minutes at room temperature. The supernatant was discarded and the pellet was dissolved in 20 μl of Buffer C (20 mM HEPES, pH 7.9, 1 mM EDTA, 0.5% PMSF, 25 mM KCl and 0.5% each of Tween -20 and Nonidet P 40). The protein solution was centrifuged again for 4 minutes to sediment insoluble materials and the supernatant was transferred to a new tube. The protein contents of the extracts prepared in this way were visualized by separating 1-4 μl by SDS-PAGE; 0.5 to 1 µl of extract were tested in the cleavage and polymerization assays as described.

E. Protein analysis for the presence of nuclease and synthetic activity

The 5 ’nucleases that have been described above and are shown in Figs. 3 and 4 analyzed by

following procedures.

1. Structure specific nuclease assay

A modified candidate polymerase is tested for 5 ’nuclease activity examining its ability to catalyze cleavages with structure specificity. With the expression "cleavage structure" as used in this

document means a nucleic acid structure that is a substrate for activity cleavage

5 ’nuclease of a DNAP.

The polymerase is exposed to test complexes having the structures shown in Fig. 15. The 5 'nuclease activity assay involves three reactions: 1) a primer-directed cleavage (Fig. 15B) is performed because it is relatively insensitive at variations in the salt concentration of the reaction and, therefore, can be performed in any solute condition that requires the enzyme modified for the activity; this is generally the same preferred conditions for unmodified polymerases; 2) a similar primer-directed cleavage is performed in a buffer that allows independent primer cleavage, that is, a low salt buffer, to demonstrate that the enzyme is viable under these conditions; and 3) an independent primer cleavage (Fig. 15A) is performed in the same low salt buffer.

The bifurcated duplex is formed between a substrate chain and a mold chain as shown in Fig. 15. With the

The term "substrate chain" as used herein means the nucleic acid chain in which the cleavage mediated by the 5 ’nuclease activity takes place. The substrate chain is always illustrated as the upper chain in the bifurcated complex that serves as a substrate for 5 ’nuclease cleavage (Fig. 15). By the term "template chain" as used herein is meant the nucleic acid chain that

It is at least partially complementary to the substrate chain and hybridizes with the substrate chain to form the cleavage structure. The mold chain is always illustrated as the lower chain of the bifurcated excision structure (Fig. 15). If a primer (a short oligonucleotide 19 to 30 nucleotides in length) is added to the complex,

as when primer-dependent excision has to be tested, it is designed to hybridize with the 3 ’arm of the

mold chain (Fig. 15B). Such a primer would extend along the template chain if the polymerase used in the reaction has synthetic activity.

The cleavage structure can be prepared as a single hairpin molecule, with the 3 ′ end of the target and the 5 ′ end of the pilot attached as a loop as shown in Fig. 15E. A primer oligonucleotide complementary to the 3 ’arm is also required for these assays so that the sensitivity of the

enzyme in the presence of a primer.

The nucleic acids to be used to form assay cleavage structures can be chemically synthesized or generated by conventional recombinant DNA techniques. By the last procedure, the hairpin part of the molecule can be created by inserting duplicate copies of a short segment of DNA into a cloning vector, adjacent to each other but in opposite orientation. The double stranded fragment that includes this inverted repeat and that includes sufficient flanking sequences to give short arms (of approximately 20 nucleotides) 5 'and 3' unpaired can then be released by the vector by restriction enzyme digestion or by PCR performed with a enzyme lacking a 5 'exonuclease (for example, the Stoffel fragment of

AMPLITAQ DNA polymerase, VentTM DNA polymerase).

The test DNA can be labeled at each end, or internally, with a radioisotope or with a non-isotopic marker. When the hairpin DNA is a synthetic single helix or a cloned double helix, the DNA is heated before use to melt all the duplexes. When cooling on ice, the structure illustrated in Fig. 16E is formed and is stable for sufficient time to perform these tests.

To analyze primer-directed cleavage (Reaction 1), a detectable amount of the test molecule (typically 1-100 fmol of 32P-labeled hairpin molecule) and a 10 to 100-fold molar excess of primer are placed in a buffer It is known to be compatible with the test enzyme. For Reaction 2, when primer-directed cleavage is performed in a condition that allows independent primer cleavage, the same amounts of molecule are placed in a solution that is the same as the buffer used in Reaction 1 with respect to pH stabilizers. enzyme (for example, bovine serum albumin, non-ionic detergents, gelatin) and reducing agents (for example, dithiothreitol, 2-mercaptoethanol) but replacing any monovalent cation salt with 20 mM KCl; 20 mM KCl is the optimum demonstrated for independent primer cleavage. Enzyme buffers, such as DNAPEc1, which usually work in the absence of salt, are not supplemented to achieve this concentration. To test for independent cleavage of primer (Reaction 3), the same amount of the test molecule is combined, but not as a primer, under the same buffer conditions used for Reaction 2.

The three test reactions are then exposed to sufficient amount of the enzyme so that the molar ratio of enzyme to test complex is approximately 1: 1. The reactions are incubated at a variety of temperatures up to, but not exceeding, the temperature allowed by enzyme stability or complex stability, whichever is less, up to 80 ° C for thermophilic enzymes for a time sufficient to allow cleavage ( 10 to 60 minutes). The products of Reactions 1, 2 and 3 are separated by denaturing polyacrylamide gel electrophoresis and visualized by autoradiography or by a comparable procedure appropriate for the labeling system used. Additional marking systems include chemiluminescent detection, staining with silver or others, transfer and probing and the like. The presence of cleavage products is indicated by the presence of molecules that migrate at a lower molecular weight than the test structure does.

split. These cleavage products indicate that the candidate polymerase has 5 ’nuclease activity with

structure specificity.

To determine whether a modified DNA polymerase has substantially the same 5 ’nuclease activity as that of the native DNA polymerase, the results of the tests described above are compared with the results obtained from these tests with the native DNA polymerase. With "substantially the same 5 'nuclease activity" it is meant that modified polymerase and native polymerase will cleave both molecules of

Rehearsal in the same way. It is not necessary for the modified polymerase to cleave at the same rate as the native DNA polymerase.

Some enzymes or enzyme preparations may have other associated activities or contaminants that may be functional under the cleavage conditions described above and that may interfere with 5 'nuclease detection. Reaction conditions may be modified taking these other activities into consideration. , to avoid destruction of substrate or other masking of 5 'nuclease cleavage and its products. For example, E. coli DNA polymerase I (Pol I), in addition to its 5 ’polymerase and nuclease activities, has a 3’ exonuclease that can degrade DNA in a 3 ’to 5 ′ direction. . Consequently, when the

molecule in Fig. 15E is exposed to this polymerase under the conditions described above, the

exonuclease 3 ’quickly removes unpaired arm 3’, destroying the required bifurcated structure of a substrate for excision with a 5 ’exonuclease and no cleavage is detected. The actual ability of Pol I to cleave the structure can be revealed if exonuclease 3 ’is inhibited by a change in conditions (for example,

pH), mutation or by adding a competitor to the activity. The addition of 500 pmol of a single stranded competitor oligonucleotide, unrelated to the structure of Fig. 15E, to the cleavage reaction with Pol I inhibits

effectively digestion of arm 3 ’of the structure of Fig. 15E without interfering with the release of exonuclease 5’ from arm 5 ’. The competitor's concentration is not critical, but it must be high enough to occupy exonuclease 3 ’for the duration of the reaction.

Similar destruction of the test molecule can be caused by contaminants in the preparation of the candidate polymerase. Several sets of nuclease reactions with structure specificity can be performed to determine the purity of the candidate nuclease and to find the window between the sub and over exposure of the test molecule to the polymerase preparation being investigated.

The modified polymerases described above were tested for 5 ’nuclease activity.

as follows: Reaction 1 was performed in a 10 mM Tris-Cl buffer, pH 8.5 at 20 ° C, 1.5 mM MgCl 2 and 50 mM KCl and in Reaction 2 the concentration of KCl was reduced to 20 mM. In Reactions 1 and 2, 10 fmol of the molecule

Test substrate shown in Fig. 15E were combined with 1 pmol of the indicated primer and 0.5 to 1.0 µl of

extract containing the modified polymerase (prepared as described above). This mixture was then incubated for 10 minutes at 55 ° C. For all mutant polymerases tested, these conditions were sufficient to give complete cleavage. When the molecule shown in Fig. 15E was labeled at the 5 ′ end, the 5 ’released fragment, 25 nucleotides in length, was conveniently separated on a polyacrylamide gel

20% (crosslinked 19: 1) with 7 M urea in a buffer containing 45 mM Tris-borate, pH 8.3, 1.4 mM EDTA. Clones 3C-F and 4B showed cleavage with structure specificity comparable to unmodified DNA polymerase Additionally, clones 3E, 3F and 3G have the added ability to cleave DNA in the absence of a 3 'arm as discussed above. Representative cleavage reactions are shown in Fig. 16.

For the reactions shown in Fig. 16, the 3E mutant polymerase clones (Taq mutant) and 4B (Tfl mutant) were examined for their ability to cleave the hairpin substrate molecule shown in Fig. 15E. The substrate molecule was labeled at the 5 ’end with 32P. 10 fmol of heat-denatured substrate DNA, labeled at the end and 0.5 units of DNAPTaq (lane 1) or 0.5 μl of 3E or 4B extract (Fig. 16, lanes 2-7, were mixed, the extract was prepared as described above) with each other in a buffer containing 10 mM Tris-Cl, pH 8.5, 50 mM KCl and 1.5 mM MgCl 2. The final reaction volume was 10 μl. The reactions shown in lanes 4 and 7 also contain 50 μM of each dNTP. The reactions shown in lanes 3, 4, 6 and 7 contain 0.2 μM of the oligonucleotide primer (complementary to the 3 'arm of the substrate and illustrated in Fig. 15E). The reactions were incubated at 55 ° C for 4 minutes. The reactions were stopped by the addition of 8 µl of 95% formamide containing 20 mM EDTA and 0.05% marker dyes per 10 µl of the reaction volume. Then they were applied

samples to 12% denaturing acrylamide gels. After electrophoresis, the gels were autoradiographed. Fig. 16 shows that clones 3E and 4B show cleavage activity similar to the native DNAPTaq. Note that some excision occurs in these reactions in the absence of the primer. When a long fork structure is used, such as that used herein (Fig. 15E) in cleavage reactions performed in buffers containing 50 mM KCl, a low level of independent primer cleavage is observed. Higher concentrations of KCl repress, but do not eliminate, this independent cleavage of primer under these conditions.

2. Test for synthetic activity

The ability of the modified enzyme or proteolytic fragments is analyzed by adding the modified enzyme to an assay system in which a primer hybridizes with a template and DNA synthesis is catalyzed by the added enzyme. Many conventional laboratory techniques employ such an assay. For example, nick transfer and enzymatic sequencing involve the extension of a primer along a DNA template by a polymerase molecule.

In a preferred assay to determine the synthetic activity of a modified enzyme, an oligonucleotide primer is hybridized with a single stranded DNA template (e.g., M13 bacteriophage DNA) and the primer / template duplex is incubated in the presence of the modified polymerase in question. , deoxynucleoside triphosphate (dNTP) and buffer and salts known to be appropriate for the unmodified or native enzyme. The detection of primer extension (by denaturing gel electrophoresis) or incorporation of dNTP (by acid precipitation or chromatography) is indicative of an active polymerase. Preferably, an isotopic or non-isotopic label is included in the primer or as a dNTP to facilitate the detection of polymerization products. Synthetic activity is quantified as the amount of free nucleotide incorporated into the growing DNA chain and is expressed as the amount incorporated per unit of time under specific reaction conditions.

Representative results of an assay for synthetic activity are shown in Fig. 17. The synthetic activity of the 3B-F mutant DNAPTaq clones was tested as follows: A stock mixture of the following buffer was prepared: 1.2X PCR buffer (1X PCR buffer contains 50 mM KCl, 1.5 mM MgCl2, 10 mM Tris-Cl, pH 8.5 and 0.05% each of Tween-20 and Nonidet P- 40), 50 μM each of dGTP, dATP and dTTP, 5 μM dCTP and 0.125 μM -32PdCTP at 600 Ci / mmol. Before adjusting this mixture to its final volume it was divided into two equal aliquots. One received distilled water to a volume of 50 μl to give the previous concentrations. The other received 5 μg of single-propelled M13mp18 DNA (approximately 2.5 pmol or 0.05 μM of final concentration) and 250 pmol of M13 sequencing primer (5 μM final concentration) and distilled water to a final volume of 50 μl Each combination was heated at 75 ° C for 5 minutes and then cooled to room temperature.

This allowed the primers to hybridize with the DNA in the mixtures containing DNA.

For each assay, 4 µl of the combination was combined with the DNA with 1 µl of mutant polymerase, prepared as described, or 1 unit of DNAPTaq (Perkin Elmer) in 1 µl of dH2O. A “no DNA” control was performed in the presence of DNAPTaq (Fig. 17, lane 1) and a “no enzyme” control was performed using water instead of the enzyme

(lane 2). Each reaction was mixed, then incubated at room temperature (approximately 22 ° C) for 5 minutes, then at 55 ° C for 2 minutes, then at 72 ° C for 2 minutes. This incubation step was performed to detect polymerization in any mutant that could have optimal temperatures below 72 ° C. After the final incubation, the tubes were centrifuged briefly to collect any condensation and were

They put on ice. One μl of each reaction was applied promptly at an origin 1.5 cm from the lower edge of a

Thin layer chromatography plate of polyethyleneimine cellulose (PEI) and allowed to dry. The chromatography plate was processed in 0.75 M NaH2PO4, pH 3.5, until the front of the buffer had advanced approximately 9 cm from the origin. The plate was dried, wrapped in plastic cloth, marked with luminescent ink and It was exposed to an X-ray film. The incorporation was detected as counts that adhered where it was originally applied in a timely manner, while the unincorporated nucleotides moved away from the source's saline solution.

The comparison of the locations of the counts with the two control lanes confirmed the absence of polymerization activity in the mutant preparations. Among the modified DNAPTaq clones, only clone 3B retains some residual synthetic activity as shown in Fig. 17.

EXAMPLE 3 - Reference

5 ’nucleases obtained from thermostable DNA polymerases can cleave hairpin structures

short with specificity

The ability of nucleases 5 ’to cleave hairpin structures to generate a suitable cleaved hairpin structure as a detection molecule was examined. The structure and sequence of the hairpin test molecule is shown in Fig. 18A (SEQ ID NO: 15). The oligonucleotide ("primer" labeled in Fig. 18A, SEQ ID NO. 22) is shown hybridized with its complementary sequence in the 3 'arm of the hairpin test molecule.

The hairpin test molecule was labeled at a single end with 32P using a T7 promoter primer labeled in a polymerase chain reaction. The marker is present on the 5 ’arm of the hairpin test molecule and is represented by the star in Fig. 18A.

The cleavage reaction was performed by adding 10 fmol of heat denatured hairpin test molecule,

marked at the end, 0.2 μM of the oligonucleotide primer (complementary to the 3 'arm of the hairpin), 50 μM of each dNTP and 0.5 units of DNAPTaq (Perkin Elmer) or 0.5 μl of extract containing a nuclease 5 '(prepared as described above) in a total volume of 10 μl in a buffer containing 10 mM Tris-Cl, pH 8.5, 50 mM KCl and 1.5 mM MgCl 2. The reactions shown in lanes 3, 5 and 7 were performed in the absence of dNTP.

The reactions were incubated at 55 ° C for 4 minutes. The reactions were stopped at 55 ° C by the addition

8 μl of 95% formamide with 20 mM EDTA and 0.05% marker dyes per 10 μl of the reaction volume.

The samples were not heated before loading in denaturing polyacrylamide gels (10% polyacrylamide, 19: 1 crosslinking, 7 M urea, 89 mM Tris-borate, pH 8.3, 2.8 mM EDTA). The samples were not heated to allow the separation of cleaved single-stranded fork molecules and with new duplex formation.

Fig. 18B shows that altered polymerases that lack any detectable synthetic activity cleave

a fork structure when an oligonucleotide hybridizes with the 3 ’single helix arm of the fork to produce a unique species of cleaved product (Fig. 18B, lanes 3 and 4). 5 ’nucleases, such as the 3D clone, shown on lanes 3 and 4, produce a unique cleaved product even in the presence of dNTP. 5 ’nucleases that retain a residual amount of synthetic activity (less than 1% of wild-type activity) produce multiple cleavage products, since polymerase can extend the hybridized oligonucleotide with the 3’ arm

the fork thus moving the cleavage site (clone 3B, lanes 5 and 6). The native DNAPTaq produces even more species of cleavage products than do mutant polymerases that retain residual synthetic activity and, additionally, converts the hairpin structure into a double helix form in the presence of dNTP due to the high level of synthetic activity. in native polymerase (Fig. 18B, lane 8).

EXAMPLE 4 - Reference

Excision of linear nucleic acid substrates

From the above, it should be clear that native thermostable DNA polymerases (ie, "wild type") are capable of cleaving hairpin structures in a specific manner and that this discovery can be successfully applied to a detection assay. . In this example, the mutant DNAPs of the present invention are tested against three different cleavage structures shown in Fig. 20A. Structure 1 in Fig. 20A is simply an oligomer of 206 single stranded units (whose preparation and sequence information are discussed in Example 1C). Structures 2 and 3 are duplex; structure 2 is the same fork structure as shown in Fig. 11A (lower part), while structure 3 has the fork part of structure 2 removed.

The cleavage reactions comprised 0.01 pmol of the resulting substrate DNA and 1 pmol of pilot oligonucleotide in a total volume of 10 µl of 10 mM Tris-Cl, pH 8.3, 100 mM KCl, 1 mM MgCl 2. The reactions were incubated for 30 minutes at 55 ° C and stopped by the addition of 8 µl of 95% formamide with 20 mM EDTA and 0.05% marker dyes. The samples were heated at 75 ° C for 2 minutes immediately before electrophoresis through a 10% polyacrylamide gel (19: 1 cross-linking), with 7 M urea, in a 45 mM Tris-Borate buffer, pH 8.3, 1.4 mM EDTA.

The results were visualized by autoradiography and are shown in Fig. 20B with the enzymes indicated as follows: I is native Taq DNAP; II is DNAP of native Tfl; III is CLEAVASE BX shown in Fig. 3E; IV is CLEAVASE BB shown in Fig. 3F; V is the mutant shown in Fig. 4B; and VI is CLEAVASE BN shown in Fig. 3G.

Structure 2 was used to "normalize" the comparison. For example, it was noted that 50 ng of

DNAP of Taq and 300 ng of CLEAVASE BN to give similar amounts of cleavage of Structure 2 in thirty

(30 minutes. Under these conditions, the native Taq DNAP is unable to split Structure 3 to any significant degree. The Tfl DNAP cleaves Structure 3 in a way that creates multiple products.

In contrast, all mutants tested cleave the linear duplex of Structure 3. This observation indicates that this characteristic of mutant DNA polymerases is uniform in thermostable polymerases among thermophilic species.

EXAMPLE 5 - Reference

Exonucleolytic excision 5 ’(“ trimming ”) by thermostable DNAP

It has been observed that thermostable DNAP, including those of the present invention, have a true 5 ’exonuclease capable of trimming the 5 ′ end of a linear duplex nucleic acid structure. In this example, the 206 base pair DNA duplex substrate is reused (see Example 1C). In this case, it was produced by using a 32P-labeled primer and an unlabeled primer in a polymerase chain reaction. The cleavage reactions comprised 0.01 pmol of heat-denatured substrate DNA, labeled at the end (the unlabeled chain also being present), 5 pmol of pilot oligonucleotide (see pilot oligonucleotides in Fig. 11A) and 0.5 units DNAPTaq or 0.5 μl CLEAVASE BB in the E. coli extract (see above), in a total volume of 10 μl of 10 mM TrisCl, pH 8.5, 50 mM KCl, 1.5 mM MgCl2 .

The reactions were started at 65 ° C by the addition of pre-heated enzyme, then changed at the temperature for 30 minutes. The results are shown in Fig. 21A. The samples in lanes 1-4 are the results with native Taq DNAP, while lanes 5-8 show the results with CLEAVASE BB. The reactions for lanes 1, 2, 5 and 6 were performed at 65 ° C and the reactions for lanes 3, 4, 7 and 8 were performed at 50 ° C and all stopped at temperature by the addition of 8 μl of 95% formamide with 20 mM EDTA and 0.05% marker dyes. The samples were heated at 75 ° C for 2 minutes immediately before electrophoresis through a 10% polyacrylamide gel (19: 1 cross-linking), with 7 M urea, in a 45 mM Tris · Borate buffer, pH 8.3 , 1.4 mM EDTA. The expected product in reactions 1, 2, 5 and 6 is 85 nucleotides in length; in reactions 3 and 7, the expected product is 27 nucleotides in length. Reactions 4 and 8 were performed without a pilot and should remain at 206 nucleotides. The weak band observed at 24 nucleotides is the primer labeled at the residual end of the PCR.

The surprising result is that CLEAVASE BB under these conditions causes the entire marker to appear in a very small species, suggesting the possibility that the enzyme completely hydrolyzes the substrate. To determine the composition of the fastest migration band observed in lanes 5-8 (reactions performed with the deletion mutant), samples of the 206 base pair duplexes were treated with T7 gene 6 (USB) exonuclease or with calf intestinal alkaline phosphatase (Promega), according to the manufacturer's instructions, to produce labeled mononucleotide (lane of Fig. 21B) or free inorganic phosphate labeled with 32P (lane b of Fig. 21B), respectively. These products, together with the products observed in lane 7 of panel A, were separated by brief electrophoresis through a 20% acrylamide gel (19: 1 cross-linking), with 7 M urea, in a Tris · Borate 45 buffer mM, pH 8.3, 1.4 mM EDTA. Therefore, CLEAVASE BB is able to convert the substrate into mononucleotides.

EXAMPLE 6 - Reference

Clipping Depends on Duplex

Clipping by CLEAVASE BB depends on duplex. In this internally labeled example, unique helices of the 206 unit oligomer were produced by 15 extension cycles per primer incorporating labeled dCTP with -32P combined with the four unlabeled dNTPs, using an unlabeled fragment of 206 bp as a template. Single and double helix products were separated by electrophoresis by a non-denaturing 6% polyacrylamide gel (29: 1 cross-linking) in a 45 mM Tris · Borate buffer, pH 8.3, 1.4 mM EDTA, visualized by autoradiography, they were excised from the gel, eluted by passive diffusion and concentrated by ethanol precipitation.

The cleavage reactions comprised 0.04 pmol of substrate DNA and 2 µl of Cleavase® BB (in an E. coli extract as described above) in a total volume of 40 µl of 10 mM Tris · Cl Tris-Cl, pH 8.5, 50 mM KCl, 1.5 mM MgCl2. The reactions were initiated by the addition of pre-heated enzyme; 10 μl aliquots were removed at 5, 10, 20 and 30 minutes and transferred to prepared tubes containing 8 μl of 95% formamide with 30 mM EDTA and 0.05% marker dyes. The samples were heated at 75 ° C for 2 minutes immediately before electrophoresis through a 10% polyacrylamide gel (19: 1 cross-linking), with 7 M urea, in a 45 mM Tris · Borate buffer, pH 8, 3, 1.4 mM EDTA. The results were visualized by autoradiography as shown in Fig. 22. Clearly, cleavage by BB BB is dependent on a duplex structure; no single helix structure cleavage is detected while the 206 unit oligomer duplex cleavage is complete.

EXAMPLE 7 - Reference

The clipping can be directed by target

The DNAP clipping activity can be used successfully in a screening test. An embodiment of such an assay is shown in Fig. 23. In this assay a labeled oligonucleotide that is specific for a target sequence is employed. The oligonucleotide is in excess of the target in such a way that hybridization is rapid. In this embodiment, the oligonucleotide contains two fluorescein markers whose proximity in the oligonucleotide causes its emission to be inactivated. When DNAP is allowed to trim the oligonucleotide, the markers are separated and detectable. The shortened duplex destabilizes and dissociates. Even more important, the target is now free to react with an intact labeled oligonucleotide. . The reaction can continue until the desired detection level is achieved. A type of analogous, although different, cycling assay has been described using lambda exonuclease. See C. G. Copley and C. Boot, Bio Techniques

13: 888 (1992).

The success of an essay of such an essay depends on the specificity. In other words, the oligonucleotide has to hybridize with the specific target. It is also preferred that the assay be sensitive; The oligonucleotide should ideally be able to detect small amounts of target. Fig. 24A shows a primer labeled with

32P at the 5 ’end attached to a plasmid target sequence. In this case, the plasmid was pUC19 (available in

the market) that was heat denatured by boiling for two (2) minutes and then cooling rapidly. The primer is an oligomer of 21 units (SEQ ID NO: 28). The enzyme used was CLEAVASE BX (a dilution equivalent to 5 x 10-3 μl of extract) in 100 mM KCl, 10 mM Tris-Cl, pH 8.3, 2 mM MnCl2. The reaction was performed at 55 ° C for sixteen (16) hours with or without genomic background DNA (from chicken blood). The reaction stopped for

the addition of 8 μl of 95% formamide with 20 mM EDTA and marker dyes.

The reaction products were separated by PAGE (10% polyacrylamide, 19: 1 crosslinking, 1 x TBE) as seen in Fig. 24B. Lane "M" contains the labeled 21 unit oligomer. Lanes 1-3 do not contain a specific target, although Lanes 2 and 3 contain 100 ng and 200 ng of genomic DNA, respectively. Lanes 4, 5 and 6 all contain specific target with 0 ng, 100 ng or 200 ng of genomic DNA, respectively. It is obvious that conversion to mononucleotides takes place in Lanes 4, 5 and 6 without taking into account the presence or amount of background DNA. Therefore, clipping can be targeted and specific.

EXAMPLE 8 - Reference

Cleavase Purification

As noted above, expressed thermostable proteins (i.e., 5 ’nucleases) were isolated by

Extracts of crude bacterial cells. Then, the precipitated E. coli proteins were removed by centrifugation together with other cell debris. In this example, cells expressing the BN clone (500 grams) were cultured and collected. For each gram (wet weight) of E. coli 3 ml of lysis buffer (Tris-HCl 50) was added

mM, pH 8.0, 1 mM EDTA, 100 μM NaCl). The cells were lysed with 200 μg / ml lysozyme at room temperature

during 20 minutes. After this, deoxycholic acid was added to prepare a final concentration of 0.2% and the mixture was incubated for 15 minutes at room temperature.

The lysate was sonicated for approximately 6-8 minutes at 0 ° C. The precipitate was removed by centrifugation (39,000 g for 20 minutes). Polyethyleneimine (0.5%) was added to the supernatant and the mixture was incubated on ice for 15 minutes. The mixture was centrifuged (5,000 g for 15 minutes) and the supernatant was retained. This was heated for 30 minutes at 60 ° C and then centrifuged again (5,000 g for 15 minutes) and the supernatant was retained again.

The supernatant was precipitated with 35% ammonium sulfate at 4 ° C for 15 minutes. Then, the mixture was centrifuged (5,000 g for 15 minutes) and the supernatant was removed. The precipitate was then dissolved in 0.25 M KCl, Tris 20, pH 7.6, 0.2% Tween and 0.1 EDTA) and then dialyzed against Binding Buffer (8x Binding Buffer comprises: imidazole 40 mM, 4M NaCl, 160 mM Tris-HCl, pH 7.9).

Then, the solubilized protein is purified on the Ni ++ column (Novagen). The Binding Buffer is allowed to drain to the top of the column bed and the column is loaded with the prepared extract. A flow rate of approximately 10 column volumes per hour is optimal for effective purification. If the flow rate is too fast, more impurities will contaminate the eluted fraction.

The column is washed with 25 ml (10 volumes) of 1X Binding Buffer and then washed with 15 ml (6 volumes) of 1X Wash Buffer (8X Wash Buffer comprises: 480 mM imidazole, 4M NaCl, Tris-HCl 160 mM, pH 7.9). The bound protein was eluted with 15 ml (6 volumes) of 1X Elution Buffer (4X Elution Buffer comprises: 4 mM imidazole, 2 M NaCl, 80 mM Tris-HCl, pH 7.9). Then, the protein is repressed with 35% Ammonium Sulfate as before. , the precipitate dissolves and dialyzes against: 20 mM Tris, 100 mM KCl, 1 mM EDTA). The solution is brought to 0.1% of each of Tween 20 and NP-40 and stored at 4 ° C.

EXAMPLE 9 - Reference

The use of various divalent cations in the cleavage reaction influences the nature of the resulting cleavage products.

When comparing the 5 ’nucleases generated by the modification and / or deletion of the C-terminal polymerization domain of

Thermus aquaticus DNA polymerase (DNAPTaq), as illustrated in Figs. 3B-G, differences were observed

significant in the intensity of the interactions of these proteins with the 3 ’end of localized primers

chain above the cleavage site (as illustrated in Fig. 5). In writing the cleavage of these structures by DNA polymerases of the Pol I type (see Example 1 and Lyamichev et al., Science 260: 778 [1993]), it was observed that in the absence of a primer, the location of the junction between the double helix region and the 5 'and 3' single helix arms determined the cleavage site, but in the presence of a primer, the location of the 3 'end of the primer became the determining factor for the cleavage site. It was postulated that this affinity for the 3 ’end agreed with the DNA polymerase synthesis function.

Structure 2, shown in Fig. 20A, was used to analyze the effects of a 3 ’end near the site of

cleavage in cleavage reactions comprising several different solutions (for example, solutions containing different salts [KCl or NaCl], different divalent cations [Mn2 + or Mg2 +], etc.) as well as the use of different temperatures for the cleavage reaction. When the reaction conditions were such that the enzyme binding (for example, a DNAP comprising a 5 'nuclease, a modified DNAP or a 5' nuclease) to the 3 'end (of the pilot oligonucleotide) near the cleavage site was strong, the structure shown is cleaved at the site indicated in Fig. 20A. This cleavage releases the unpaired 5 ’arm and leaves a dent between the remaining part of the target nucleic acid and the 3 ′ folded end of the pilot oligonucleotide. On the contrary, when the reaction conditions are such that the binding of DNAP (comprising a 5 'nuclease) to the 3' end was weak, the initial cleavage was as described above, but after the release of arm 5 ', the duplex

Remaining is digested by the exonuclease function of DNAP.

One way to weaken the union of DNAP to the 3 ’end is to remove all or part of the domain to which at least some of this function has been attributed. Some of the 5 ’nucleases created by deletion of the polymerization domain of

DNAPTaq have enhanced true exonuclease function, as demonstrated in Ex.5.

The affinity of these types of enzymes (i.e. 5 ’nucleases associated or obtained from DNAP) by 3’ ends with

Gaps can also be affected by the identity of the divalent cation present in the cleavage reaction. Longley et al. (Nucl. Acids Res., 18: 7317 [1990]) demonstrated that the use of MnCl2 in a reaction with DNAPTaq

allowed the polymerase to remove nucleotides from the 5 ’end of a primer hybridized with a template, although of

inefficient way. . Similarly, by assaying the cleavage products generated using Structure 2 of Fig. 20A, as described above, in a reaction containing DNAPTaq or CLEAVASE BB nuclease, it was observed that the replacement of MgCl2 by MnCl2 in the cleavage reaction resulted in

Exonucleolytic "clipping" of the duplex downstream of the initial cleavage site. Although it does not limit the invention to any

Particular mechanism, replacing MgCl2 with MnCl2 in the cleavage reaction decreases the

affinity of these enzymes for 3 ’ends with gaps.

In all cases, the use of MnCl2 improves the 5 ’nuclease function, and in the case of CLEAVASE BB nuclease a 50 to 100-fold stimulation of the 5’ nuclease function is observed. Therefore, although the exonuclease activity of these enzymes was previously demonstrated in the presence of MgCl2, the assays described below show a comparable amount of exonuclease activity using 50 to 100 times less enzyme when MnCl2 is used instead of MgCl2. When these reduced amounts of enzyme are used in a reaction mixture containing MgCl2, the clipping activity or exonuclease is much less obvious than that observed in Examples 5-7.

Similar effects are observed in performing the nucleic acid detection assay described in the following Examples 10-39 when comparing reactions performed in the presence of MgCl2 or MnCl2. In the presence of divalent cation, the presence of the INVASOR oligonucleotide (described below) forces the cleavage site inside the probe duplex, but in the presence of MnCl2, the probe duplex can be further trimmed producing a scale of products that are visible when it is visible. present a 3 'end marker in the probe oligonucleotide.

When the INVASOR oligonucleotide is omitted from a reaction containing Mn2 +, the probe is trimmed from the 5 ′ end. Mg2 + based reactions show minimal clipping of the probe oligonucleotide. In any of these cases, the digestion of the probe depends on the presence of the target nucleic acid. In the following examples, the scale produced by the enhanced clipping activity observed in the presence of Mn2 + is used as a positive indicator that the probe oligonucleotide has hybridized with the target sequence.

EXAMPLE 10 - Reference

Endonucleolytic 5 ’invasive excision by 5’ thermostable nucleases in the absence of polymerization

As described in the previous Examples, the 5 ’nucleases split near the junction between regions of single helix and base pairing in a bifurcated duplex, usually approximately a couple of

bases in the region with base pairing. In this example, it is shown that 5 ’thermostable nucleases,

including those of the present invention (eg, CLEAVASE BN nuclease, CLEAVASE A / G nuclease), have the ability to cleave a greater distance within the region with base pairing when

provided with an upstream oligonucleotide carrying a 3 ’region that is homologous to a 5’ region

subject duplex, as shown in Fig. 26.

Fig. 26 shows a synthetic oligonucleotide that was designed to fold on itself that is constituted by the following sequence: 5’-GTTCTCTGCTCTCTGGTCGCTG TCTCGCTTGTGAAACAAGCGAGACAGCGTGGTCTCTCG-3 ’(SEQ ID NO: 29). This oligonucleotide is called the "S-60 hairpin". The 15 base pair fork formed by this oligonucleotide is further stabilized by the "tri loop" sequence at the end of the loop (ie, three nucleotides form the loop part of the fork) (Hiraro et al., Nucleic Acids Res., 22 (4): 576 [1994]). Fig. 26 also shows the sequence of oligonucleotide P-15 and the location of the region of complementarity shared by hairpin oligonucleotides P-15 and S-60. The oligonucleotide sequence P-15 is 5’-CGAGAGACCACGCTG-3 ’(SEQ ID NO: 30). As discussed in detail below, the filled black arrowheads shown in Fig. 26 indicate the cleavage sites of the S-60 hairpin in the absence of the oligonucleotide P-15 and the empty arrowheads indicate the cleavage sites at presence of oligonucleotide P-15. The size of the arrowhead indicates the relative use of a particular site.

The S-60 fork molecule was labeled at its 5 ’end with biotin for later detection. The S-60 fork was incubated in the presence of a thermostable 5 ’nuclease in the presence or absence of the P-15 oligonucleotide. The presence of the full duplex that can be formed by the S-60 fork is demonstrated by cleavage with the 5 ’Cleaase® BN nuclease, in a primer independent manner (that is, in the absence of oligonucleotide P-15). The release of 18 and 19 nucleotide fragments from the 5 ’end of the S-60 hairpin molecule showed that excision occurred near the junction between the single and double helix regions when nothing hybridized with the 3’ arm

of the S-60 fork (Fig. 27, lane 2).

The reactions shown in Fig. 27 were performed as follows. Twenty fmol of the marked fork DNA

with 5 'biotin (SEQ ID NO. 29) they were combined with 0.1 ng of CLEAVASE BN enzyme and 1 µl of 100 mM MOPS (pH 7.5) containing 0.5% of each of Tween-20 and NP -40 in a total volume of 9 μl. In the reaction shown in lane 1, the enzyme was omitted and the volume was prepared by the addition of distilled water (this served as the uncut control or without enzyme). The reaction shown in lane 3 of Fig. 27 also included 0.5 pmol of oligonucleotide P-15 (SEQ ID No. 30), which can hybridize with the 3 'unpaired arm of fork S-60 (SEQ ID No. 29), as illustrated in Fig. 26.

The reactions were covered with a drop of mineral oil, heated at 95 ° C for 15 seconds, then cooled to 37 ° C and the reaction was initiated by the addition of 1 µl of 10 mM MnCl2 to each tube. After 5 minutes, the reactions were stopped by the addition of 6 µl of 95% formamide containing 20 mM EDTA and dyes

0.05% markers. The samples were heated at 75 ° C for 2 minutes immediately before electrophoresis through a 15% polyacrylamide gel (19: 1 cross-linking), with 7 M urea, in a 45 mM Tris · Borate buffer, pH 8.3 , 1.4 mM EDTA.

After electrophoresis, the gel plates separated allowing the gel to remain flat on a plate. A positively charged nylon membrane with 0.2 mm pores (NYTRAN, Schleicher and Schuell, Keene, NH), pre-humidified in H2O, was placed on top of the exposed gel. All air bubbles were removed. After two pieces of 3MM filter paper (Whatman) were placed on top of the membrane, the other glass plate was replaced and the sandwich was secured with joining tongs. The transfer was allowed to be carried out overnight. After transfer, the membrane was carefully removed from the gel and allowed to air dry. After complete drying, the membrane was washed in 1.2X Sequenase Images Blocking Buffer (USB) using 0.3 ml of membrane buffer / cm2. The washing was carried out for 30 minutes at room temperature. An alkaline streptavidin phosphatase conjugate (SAAP, United States Biochemical) was added at a 1: 4000 dilution directly to the blocking solution and stirred for 15 minutes. The membrane was rinsed briefly with H2O and then washed three times for 5 minutes by washing using 0.5 ml / cm2 of 1X SAAP buffer (100 mM Tris-HCl, pH 10, 50 mM NaCl) with 0-sodium dodecyl sulfate, 1% (SDS). The membrane was rinsed briefly with H2O between each wash. The membrane was then washed once in 1X SAAP buffer containing 1 mM MgCl2 without SDS, drained thoroughly and put in a heat sealable plastic bag. Using a sterile pipette, 5 ml of chemiluminescent CDP-StarTM substrate (Tropix, Bedford, MA) for alkaline phosphatase was added to the bag and distributed throughout the entire membrane for 2-3 minutes. The membrane treated with CDP-StarTM was exposed to XRP (Kodak) X-ray film for an initial exposure of 10 minutes.

The resulting autoradiography is shown in Fig. 27. In Fig. 27, the lane marked “M” contains the

biotinylated P-15 oligonucleotide that served as a marker. The sizes (in nucleotides) of the uncleaved S-60 fork (60 nucleotides; lane 1), the marker (15 nucleotides; "M" lane) and the cleavage products generated by cleavage of the S-60 fork in the presence ( lane 3) or absence (lane 2) of oligonucleotide P-15 are indicated.

Because the complementary regions of the S-60 hairpin are located in the same molecule, essentially no delay in time should be needed to allow hybridization (i.e., to form the fork's duplex region). It is expected that this hairpin structure is formed long before the enzyme could locate and cleave the molecule. As expected, the cleavage in the absence of the oligonucleotide primer was at or near the junction between the duplex and single stranded regions, releasing the 5 ’unpaired arm (Fig. 27, lane 2). The resulting cleavage products were 18 and 19 nucleotides in length.

It was hoped that the stability of the S-60 fork with the tri-loop would prevent the P-15 oligonucleotide from promoting

excision of the "primer driven" mode described in the above Example 1, because the 3 "end of the" primer "would remain unpaired. Surprisingly, it was observed that the enzyme seemed to mediate an "invasion" by the

P-15 primer in the duplex region of the S-60 fork, as evidenced by the displacement of the cleavage site from 3 to 4 base pairs beyond the interior of the duplex region, releasing the larger products (22 and 21 nucleotides) observed in lane 3 of Fig. 27.

The precise cleavage sites of the S-60 fork are illustrated in the structure in Fig. 26, indicating the black arrowheads filled in the cleavage sites in the absence of the oligonucleotide P-15 and indicating the empty arrowheads the sites of excision in the presence of P-15.

These data show that the presence in the 3 'arm of an oligonucleotide having some sequence homology with the first several bases of the similarly oriented chain of the downstream duplex may be a dominant factor in determining the nuclease cleavage site. '. Because the oligonucleotide that shares a certain sequence homology with the first several bases of the similarly oriented chain of the downstream duplex seems to invade the duplex region of the hairpin, it is called an "INVASOR" oligonucleotide. As shown in the following Examples, an INVASOR oligonucleotide appears to invade (or displace) a region of duplex nucleic acid regardless of whether the duplex region is present in the same molecule (i.e., a hairpin) or if the duplex is formed between two separate chains of nucleic acid.

EXAMPLE 11 - Reference

The INVASOR oligonucleotide displaces the cleavage site in a preformed probe / target duplex

In Example 10 it was demonstrated that an INVASOR oligonucleotide could displace the site where a 5 ’nuclease cleaves a duplex region present in a hairpin molecule. In this example, the ability of an INVASOR oligonucleotide to displace the cleavage site within a duplex region formed between two separate chains of nucleic acid molecules was examined.

A single helix target DNA comprising the single helix circular M13mp19 molecule and a labeled probe oligonucleotide (fluorescein) were mixed in the presence of the salt-containing reaction buffer (KCl) and divalent cations (Mg2 + or Mn2 +) to promote formation of duplex. The probe oligonucleotide refers to a labeled oligonucleotide that is complementary to a region along the target molecule (eg, M13mp19). A second (unlabeled) oligonucleotide was added to the reaction after the probe and target had been allowed to hybridize. The second oligonucleotide binds to a region of the target that is located downstream of the region to which the probe oligonucleotide binds. This second oligonucleotide contains sequences that are complementary to a second region of the target molecule. If the second oligonucleotide contains a region that is complementary to a part of the sequences along the target to which the probe oligonucleotide also binds, this second oligonucleotide is called an INVASOR oligonucleotide (see Fig. 28c).

Fig. 32 illustrates the hybridization of two oligonucleotides with regions along the M13mg19 target molecule (lower chain in all three structures shown). In Fig. 28 only a 52 nucleotide part of the M13mp19 molecule is shown; this 52 nucleotide sequence is listed in SEQ ID No. 31. The probe oligonucleotide contains a fluorescein marker at the 3 ′ end; the sequence of the probe is 5’-AGAAAGGAAGGGAAGAAAGCGAAAGG-3 ’(SEQ ID No. 32). In Fig. 28, the sequences comprising the second oligonucleotide, including the INVASOR oligonucleotide, are underlined. In Fig. 28a, the second oligonucleotide, which has the sequence 5'-GACGGGGAAAGCCGGCGAACG-3 '(SEQ ID No. 33), is complementary to a different region and downstream of the target molecule than is the probe oligonucleotide (labeled with

fluorescein or "fluorine"); there is a gap between the second oligonucleotide upstream and the probe for the structure shown in Fig. 28a. In Fig. 28b, the second upstream oligonucleotide, which has the sequence 5'-GAAAGCCGGCGAACGTGGCG-3 '(SEQ ID No. 34) is complementary to a different region of the target molecule than is the probe oligonucleotide, but in this In this case, the second oligonucleotide and the probe oligonucleotide contact each other (i.e., the 3 'end of the second upstream oligonucleotide is immediately adjacent to the 5' end of the probe so that there is no gap between these two oligonucleotides ). In Fig. 28c, the second upstream oligonucleotide (5’-GGCGAACGTGGCGAGAAAGGA-3 ’) [SEQ ID No. 35]) and the probe oligonucleotide share a region of complementarity with the target molecule. Therefore the

Upstream oligonucleotide has a 3 'arm that has an identical sequence to the first several bases of the downstream probe. In this situation, the upstream oligonucleotide is called an "INVASOR" oligonucleotide.

The effect of the presence of an INVSOR oligonucleotide on the cleavage pattern in a probe / target duplex formed before the addition of INVASOR was examined. The INVASOR oligonucleotide and enzyme were added after the probe had been allowed to hybridize with the target and the position and extent of excision of the probe were examined to determine a) if the INVASOR was able to displace the cleavage site to a specific internal region of the probe and b) if the reaction could accumulate specific cleavage products over time, even in the absence of thermocycling, polymerization or exonuclease removal of the probe sequence.

The reactions were carried out as follows: Twenty µl of each of the two enzyme mixtures were prepared, containing 2 µl of CLEAVASE A / G nuclease extract (prepared as described in Example 2), with or without 50 pmol of the INVASOR oligonucleotide (SEQ ID No. 35), as indicated, per 4 µl of the mixture. For each of the eight reactions shown in Fig. 29, 150 fmol of M13mp19 single helix DNA (available from Life Technologies, Inc.) were combined with 5 pmol of fluorescein-labeled probe (SEQ ID No. 32), to create the structure shown in Fig. 28c, but without the INVASOR oligonucleotide present (the mixture

probe / target). Half (4 tubes) of the probe / target mixtures were combined with 1 μl of 100 mM MOPS, pH 7.5 with 0.5% each of Tween-20 and NP-40, 0.5 μl of 1 M KCl and 0.25 μl of 80 mM MnCl 2 and distilled water to a volume of 6 μl. The second set of probe / target mixtures was combined with 1 μl of 100 mM MOPS, pH 7.5 with 0.5% each of Tween-20 and NP-40, 0.5 μl of 1 M KCl and 0.25 μl of 80 mM MgCl2. . The second set of mixtures, therefore, contained MgCl2 instead of the MnCl2 present in the first set of mixtures.

The mixtures (containing the probe / target with buffer, KCl and divalent cation) were covered with a drop of CHILLOUT evaporation barrier and brought to 60 ° C for 5 minutes to allow hybridization. Four μl of the above enzyme mixtures without the INVASOR oligonucleotide were added to reactions whose products are shown in lanes 1, 3, 5 and 7 of Fig. 29. The reactions whose products are shown in lanes 2, 4, 6 and 8 of Fig. 29 received the same amount of enzyme mixed with the invading oligonucleotide (SEQ ID No. 35). Reactions 1, 2, 5 and 6 were incubated for 5 minutes at 60 ° C and reactions 3, 4, 7 and 8 were incubated for 15 minutes at 60 ° C.

All reactions were stopped by the addition of 8 μl of 95% formamide with 20 mM EDTA and dyes

0.05% markers. The samples were heated at 90 ° C for 1 minute immediately before electrophoresis through a 20% acrylamide gel (crosslinked 19: 1), containing 7 M urea, in a 45 mM Tris-Borate buffer, pH 8, 3, 1.4 mM EDTA. After electrophoresis, the reaction products were visualized by the use of an apparatus for the formation of Hitachi FMBIO fluorescent images, the output of which is observed in Fig. 29. The very low molecular weight fluorescent material observed in all lanes in or near the salt front of Fig. 29 and other device figures for fluorescent imaging are observed when fluorescently labeled oligonucleotides are electrophoresed and represented in an apparatus for fluorescent imaging. This material is not a product of the cleavage reaction.

The use of MnCl2 in these reactions (lanes 1-4) stimulates the true exonuclease or "clipping" activity of the CLEAVASE enzyme, as described in Example 6, as clearly observed in lanes 1 and 3 of Fig. 29. This clipping of the probe oligonucleotide (SEQ ID No. 32) in the absence of INVASOR oligonucleotide (SEQ ID No. 35) confirms that the probe oligonucleotide is forming a duplex with the target sequence. The scale-type products produced by this clipping reaction may be difficult to differentiate from degradation of the probe by nucleating which may be present in a clinical sample. On the contrary, the introduction of the INVASOR oligonucleotide (SEQ ID No. 35) caused a clear displacement in the excision of the probe, advancing the cleavage site from 6 to 7 bases inside the probe, confirming the hybridization of both oligonucleotides. In the presence of MnCl2, the "clipping" of exonuclease can take place after the INVASOR-directed cleavage event, until the residual duplex is destabilized and undone.

In a magnesium-based cleavage reaction (lanes 5-8), the true clipping or exonuclease function of CLEAVASE A / G is suppressed by enzyme (but the enzyme's endonucleolytic function is essentially unchanged), so that the Probe oligonucleotide does not degrade in the absence of INVASOR (Fig. 29, lanes 5 and 7). When INVASOR is added, it is clear that the INVASOR oligonucleotide can promote a displacement at the endonucleolytic cleavage site of the hybridized probe. The comparison of the products of the 5 and 15 minute reaction by INVASOR (lanes 6 and 8 in Fig. 29) shows that the additional probe hybridizes with the target and is cleaved. The calculated melting temperature (TF) of the non-invading probe part (i.e. nucleotides 9-26 of SEQ ID NO: 32) is 56 ° C, so that the renewal observed (as evidenced by the accumulation of cleavage products with increasing reaction time) suggests that the full length of the probe molecule, with a calculated Tf of 76 ° C, has to be involved in subsequent probe hybridization events in this reaction of 60 ° C.

EXAMPLE 12 - Reference

The overlap of the sequence of the oligonucleotide INVASOR 3 ’with the 5’ region of the probe causes a

displacement at the site of cleavage

In Example 11, the ability of an INVASOR oligonucleotide to cause a displacement in the cleavage site of a probe hybridized with a target molecule was demonstrated. In this example, experiments were conducted to examine whether the presence of an oligonucleotide upstream of the probe was sufficient to cause a displacement at the site or cleavage sites along the probe or if the presence of nucleotides at the 3-terminus. 'of the invading oligonucleotide having the same sequence as the first several nucleotides at the 5' end of the probe oligonucleotide was required to promote displacement cleavage.

To examine this point, the cleavage products obtained from three different arrangements of target specific oligonucleotides are compared. A diagram of these oligonucleotides and how they hybridize with a test nucleic acid, M13mp19, is shown in Fig. 28. In Fig. 28a, the 3 'end of the upstream oligonucleotide (SEQ ID NO: 33) is place chain up the 5 'end of the oligonucleotide "probe" chain down (SEC

ID No. 32) such that a region of the M13 target is present that is not paired with any oligonucleotide. In Fig. 28b, the upstream oligonucleotide sequence (SEQ ID NO. 34) is immediately upstream of the probe (SEQ ID NO. 32), with no gap or overlap between the sequences. Fig. 28c illustrates the arrangement of the substrates used in the assay of the present invention, showing that the

“INVASOR” oligonucleotide upstream (SEQ ID No. 35) has the same sequence in a part of its 3 ’region as present in the 5’ region of the downstream probe (SEQ ID No. 32). This means that these regions will compete to hybridize with the same segment in the M13 target nucleic acid.

In these experiments, four enzyme mixtures were prepared as follows (planning 5 μl per digestion product): mixture 1 contained 2.25 μl of CLEAVASE A / G nuclease extract (prepared as described in Example 2) for 5 µl of mixture, in 20 mM MOPS, pH 7.5 with 0.1% each of Tween 20 and NP-40, 4 mM MnCl2 and 100 mM KCl. Mixture 2 contained 2.25 μl of CLEAVASE A / G nuclease extract per 5 μl of mixture in 20 mM Tris-HCl, pH 8.5, 4 mM MgCl 2 and 100 mM KCl. Mixture 3 contained 2.25 μl of CLEAVASE A / G nuclease extract per 5 μl of mixture in 20 mM Tris-HCl, pH 8.5, 4 mM MgCl 2 and 100 mM KCl. Mixture 4 contained 11.25 units of Taq DNA polymerase per 5 µl of the mixture in 20 mM Tris-HCl, pH 8.5, 4 mM MgCl 2 and 100 mM KCl.

For each reaction, 50 fmol of M13mp19 single stranded DNA (the target nucleic acid) were combined with 5

pmol of the probe oligonucleotide (SEQ ID No. 32 containing a fluorescein marker at the 3 ′ end) and 50 pmol

of one of the three chain oligonucleotides illustrated in Fig. 28 (ie, one of SEQ ID N: 33-35) in

a total volume of 5 μl of distilled water. The reactions were covered with a drop of ChillOutTM evaporation barrier and heated to 62 ° C. The cleavage reactions were initiated by the addition of 5 µl of an enzyme mixture to each tube and the reactions were incubated at 62 ° C for 30 min. The reactions shown in lanes 1-3 of Fig. 34 received Mix 1; reactions 4-6 received Mix 2; reactions 7-9 received Mix 3 and reactions 10-12 received Mix 4.

After 30 minutes at 62 ° C, the reactions were stopped by adding 8 µl of 95% formamide with

20 mM EDTA and 0.05% marker dyes. The samples were heated at 75 ° C for 2 minutes immediately before electrophoresis through a 20% polyacrylamide gel (19: 1 cross-linking), with 7 M urea, in a 45 mM Tris · Borate buffer, pH 8.3 , 1.4 mM EDTA.

After electrophoresis, the products of the reactions were visualized by using an apparatus for the formation of Hitachi FMBIO fluorescent images, the output of which is shown in Fig. 30. The reaction products shown in lanes 1, 4, 7 and 10 of Fig. 30 were of the reactions containing SEQ ID No. 33 as the upstream oligonucleotide (see Fig. 28a). The reaction products shown in lanes 2, 5, 8 and 11 of Fig. 30 were from reactions containing SEQ ID No. 34 as the oligonucleotide upstream (see Fig. 28b). The reaction products shown in lanes 3, 6, 9 and 12 of Fig. 30 were from reactions containing SEQ ID No. 35, the oligonucleotide INVASOR, as an upstream oligonucleotide (see Fig. 28c).

Examination of Mn2 + based reactions using CLEAVASE A / G or DNAPTaq nuclease as the cleavage agent (lanes 1 to 3 and 4 to 6, respectively) shows that both enzymes have active exonuclease function under these buffer conditions. The use of a 3 ’marker in the probe oligonucleotide allows the products of the clipping activity to remain labeled and, therefore, visible in this assay. The scales observed in lanes 1, 2, 4 and 5 confirm that the probe hybridizes with the target DNA as intended. These lanes also show that the location of non-invasive oligonucleotides has little effect on the products generated. The uniform scale created by these digestion products would be difficult to distinguish from a scale caused by a contaminating nuclease, as can be found in a clinical sample. In contrast, the products shown in lanes 3 and 6, where an INVASOR oligonucleotide was provided to direct the cleavage, show a very different displacement, such that the primary cleavage product is smaller than those observed in non-invasive excision. . This product is then subjected to additional trimming under these conditions, as indicated by the shorter products on these rails. These INVASOR-directed cleavage products would be easily distinguished from a non-specific degradation background of the probe oligonucleotide.

When Mg2 + is used as the divalent cation, the results are even more distinctive. In lanes 7, 8, 10 and 11 of Fig. 30, where the upstream oligonucleotides were non-invasive, minimal clipping is observed. The products in DNAPTaq reactions show some probe accumulation that has been shortened at the 5 ’end by one

or two nucleotides in a manner consistent with prior examination of the action of this enzyme on dented substrates (Longley et al., above). However, when the upstream oligonucleotide is invasive, the appearance of the clearly displaced probe band is observed. These data clearly indicated that it is the invasive part 3 ’of the upstream oligonucleotide that is responsible for fixing the cleavage site in the downstream probe.

Therefore, the previous results show that it is the presence of free nucleotides or initially not

hybridized at the 3 ’end of the INVASOR oligonucleotide which mediates the displacement at the site of

excision, not just the presence of a hybridized oligonucleotide upstream of the probe. Nucleic acid detection assays that employ the use of an INVASOR oligonucleotide are called assays of

"Split directed by INVASOR".

EXAMPLE 13 - Reference

INVASOR-directed cleavage recognizes single-stranded and double-stranded target molecules in a background of non-target DNA molecules

For a nucleic acid detection procedure to be widely useful, it must be able to detect a specific target in a sample that may contain large amounts of other DNA (eg, bacterial or human chromosomal DNA). The ability of the INVASOR-directed cleavage assay to recognize and cleave each single-stranded or double-stranded target molecule in the presence of large amounts of non-target DNA was examined. In these experiments, a model target nucleic acid, M13, in single stranded or double stranded form (single stranded M13mp18 is available from Life Technologies, Inc. and double stranded M13mp19 is available in NEB), was combined with human genomic DNA (Novagen) and then used in excision reactions directed by INVASOR. Prior to the start of the cleavage reaction, the DNAs were heated at 95 ° C for 15 minutes to completely denature the samples, as is conventional practice in assays, such as polymerase chain reaction or enzymatic DNA sequencing, which involve solution hybridization. of oligonucleotides with double stranded target molecules.

For each of the reactions shown in lanes 2-5 of Fig. 31, the target DNA (25 fmol of the mc DNA or one pmol of the bc DNA) was combined with 50 pmol of the INVASOR oligonucleotide (SEQ ID NO: 35); for the reaction shown in lane 1 the target DNA was omitted. Reactions 1, 3 and 5 also contained 470 ng of human genomic DNA. These mixtures were brought to a volume of 10 µl with distilled water, covered with a drop of ChillOut® evaporation barrier and brought to 95 ° C for 15 minutes. After this incubation period, and

still at 95 ° C, each tube received 10 μl of a mixture comprising

2.25 μl of CLEAVASE A / G nuclease extract (prepared as described in Example 2) and 5 pmol of the probe oligonucleotide (SEQ ID No. 32), in 20 mM MOPS, pH 7.5 with 0.1% each of Tween-20 and NP-40, 4 mm MnCl2 and 100 mM KCl. The reactions were carried at 62 ° C for 15 minutes and stopped by the addition of

12 μl of 95% formamide with 20 mM EDTA and 0.05% marker dyes. The samples were heated to 75 ° C

for 2 minutes immediately before electrophoresis through a 20% polyacrylamide gel (19: 1 cross-linking), with 7 M urea, in a 45 mM Tris · Borate buffer, pH 8.3, 1.4 mM EDTA . The products of the reactions were visualized by the use of an apparatus for the formation of Hitachi FMBIO fluorescent images. The results are shown in Figure 31.

In Fig. 31, lane 1 contains the reaction products containing the probe (SEQ ID NO. 32), the oligonucleotide INVASOR (SEQ ID NO. 35) and human genomic DNA. Lane 1 examination shows that the probe and INVASOR oligonucleotides are specific for the target sequence and that the presence of genomic DNA does not cause any significant background cleavage.

In Fig. 31, lanes 2 and 3 contain reaction products of reactions containing the single helix target DNA (M13mp18), the probe oligonucleotide (SEQ ID No. 32) and the INVASOR (SEQ ID No. 35) in the absence or presence of human genomic DNA, respectively. Examination of lanes 2 and 3 demonstrates that the INVASOR detection assay can be used to detect the presence of a specific sequence in a single-stranded target molecule in the presence or absence of a large excess of competing DNA (human genomic DNA).

In Fig. 31, lanes 4 and 5 contain reaction products of reactions containing the double stranded target DNA (M13mp19), the probe oligonucleotide (SEQ ID No. 32) and the INVASOR (SEQ ID No. 35) in the absence or presence of Human genomic DNA, respectively. Examination of lanes 4 and 5 shows that single stranded target molecules are eminently suitable for detection reactions directed by INVASOR. The success of this reaction using a short duplex molecule, M13mp19, as the target on a background of a large excess of genomic DNA is especially notable since it would be expected that shorter and less complex M13 DNA strands would be expected to find its complementary chain in a simpler way than the more complex human genomic DNA chains would. If the M13 DNA was rehybridized before the probe and / or INVASOR oligonucleotides could bind to the target sequences along the M13 DNA, the cleavage reaction would be avoided. In addition, because the denatured genomic DNA would potentially contain complementary regions with the probe and / or INVASOR oligonucleotides it was possible that the presence of the genomic DNA would inhibit the reaction by binding these oligonucleotides thereby preventing hybridization with the M13 target. The previous results demonstrate that these theoretical aspects are not a problem in the reaction conditions that have been previously used.

In addition to demonstrating that the INVASOR detection assay can be used to detect sequences present in a double helix target, these data also show that the presence of a large amount of non-target DNA

(470 ng / 20 μl reaction) does not decrease the specificity of cleavage. Although this amount of DNA shows

Some impact on the rate of product accumulation, probably by joining a part of the enzyme, the nature of the target sequence, either single or double helix nucleic acid, does not limit the application of this assay.

EXAMPLE 14 - Reference

Signal accumulation in the INVASOR-directed cleavage test as a function of target concentration

To investigate whether the INVASOR-directed cleavage test could be used to indicate the amount of target nucleic acid in a sample, the following experiment was performed. Excision reactions containing an INVASOR oligonucleotide (SEQ ID No. 35), a labeled probe (SEQ ID No. 32) and a target nucleic acid, M13mp19, were assembled. A series of reactions, containing minor and minor amounts of the M13 target DNA, was used to examine whether the cleavage products would accumulate in a manner that reflects the amount of target DNA present in the reaction.

The reactions were performed as follows. A stock mixture containing enzyme and buffer was assembled. Each 5 μl of the stock mixture contained 25 ng of Cleaase® A / G nuclease in 20 mM MOPS (pH 7.5) with 0.1%

of each of Tween 20 and NP-40, 4mM MnCl2 and 100mM KCl. For each of the cleavage reactions shown in lanes 4-13 of Fig. 36, a DNA mixture containing 5 pmol of the fluorescein-labeled probe oligonucleotide (SEQ ID NO: 43), 50 pmol of the invading oligonucleotide was generated ( SEQ ID NO. 35) and 100, 50, 10, 5, 1, 0.5, 0.1, 0.05, 0.01 or 0.005 fmol of single stranded M13mp19, respectively, for each 5 µl of the DNA mixture. The DNA solutions were covered with a drop of CHILLOUT evaporation barrier and carried

up to 61 ° C. The cleavage reactions were initiated by the addition of 5 μl of the enzyme mixture to each of the tubes (final reaction volume was 10 μl). After 30 minutes at 61 ° C, the reactions were stopped by adding 8 µl of 95% formamide with 20 mM EDTA and 0.05% marker dyes. The samples are

heated at 90 ° C for 1 minute immediately before electrophoresis through a denaturing 20% polyacrylamide gel (19: 1 cross-linking), with 7 M urea, in a buffer containing 45 mM Tris · Borate (pH 8.3) , 1.4 mM EDTA. To provide reference (i.e., standards), 1.0, 0.1 and 0.01 pmol of fluorescein-labeled probe oligonucleotide aliquots (SEQ ID No. 32) were diluted with the above formamide solution to a final volume of 18 μl. These reference markers were loaded on lanes 1-3, respectively, of the gel. The products of the cleavage reactions (as well as the reference standards) were visualized after electrophoresis by using a device for the formation of Hitachi FMBIO fluorescent images. The results are shown in Figure 32.

In Fig. 32 there are boxes around nucleic acid containing fluorescein (i.e., the uncleaved and cleaved probe molecules) and the amount of fluorescein contained within each cell is indicated below

the box The background fluorescence of the gel (see box called "background") was subtracted by the apparatus for

fluorescent imaging to generate each value presented under a box containing excised or uncleaved probe products (the boxes are numbered 1-14 in the upper left with a V followed by a number below the box). The lane labeled "M" contains fluorescein oligonucleotides that serve as markers.

The results shown in Fig. 32 demonstrate that the accumulation of excised probe molecules in a fixed length incubation period reflects the amount of target DNA present in the reaction. The results also demonstrate that the cleaved probe products accumulate excessively with respect to the number of copies of the target. This is clearly demonstrated by comparing the results in lane 3, in which 10 fmol (0.01 pmol) of uncut probe is shown, with the results shown in 5, where the products that accumulated in response to the presence are shown of 10 fmol of target DNA. These results show that the reaction can cleave hundreds of probe oligonucleotide molecules for each target molecule present, dramatically amplifying the specific target signal generated in the INVASOR-directed cleavage reaction.

EXAMPLE 15 - Reference

Effect of saliva extract on the cleavage test conducted by INVASOR

For a nucleic acid detection procedure to be useful in a medical environment (i.e. a diagnostic one), it does not have to be inhibited by materials and contaminants that are likely to be found in a typical clinical sample. To analyze the susceptibility of the INVASOR-directed cleavage test to various materials, including, among others, nucleic acids, glycoproteins and carbohydrates, probably found in a clinical sample, a sample of human saliva was prepared in a manner consistent with the practices in clinical laboratory and the resulting saliva extract was added to the INVASOR-directed excision test. The effect of saliva extract on excision inhibition and on the specificity of the excision reaction was examined.

One and a half milliliters of human saliva were collected and extracted once with an equal volume of a mixture containing phenol: chloroform: isoamyl alcohol (25: 24: 1). The resulting mixture was centrifuged in a microcentrifuge to separate the aqueous and organic phases. The aqueous upper phase was transferred to a new tube. A tenth of 3M NaOAc volumes were added and the contents of the tube were mixed. Two volumes of 100% ethyl alcohol were added to the mixture and the sample was mixed and incubated at room temperature for 15 minutes to allow a precipitate to form. The sample was centrifuged in a microcentrifuge at 13,000 rpm for 5 minutes and the supernatant was removed and discarded. A whitish sediment could be seen easily. The sediment was rinsed once with 70% ethanol, dried under vacuum and dissolved in 200 µl of 10 mM Tris-HCl, pH 8.0, 0.1 mM EDTA (this constitutes the saliva extract). Each µl of saliva extract was equivalent to 7.5 µl of

saliva. The analysis of saliva extract by ultraviolet scanning spectrophotometry showed an absorbance

maximum at 260 nm and indicated the presence of approximately 45 ng of total nucleic acid per μl

of extract.

The effect of the presence of saliva extract in the following enzymes was examined: CLEAVASE BN nuclease, CLEAVASE A / G nuclease and three different batches of DNAPTaq: AmpliTaq® (Perkin Elmer; a recombinant form of DNAPTaq), AmpliTaq® LD (Perkin -Elmer: a preparation of recombinant DNAPTaq that contains very low levels of DNA) and Taq DNA polymerase (Fisher). For each enzyme tested, an enzyme / probe mixture was prepared comprising the selected amount of enzyme with 5 pmol of the probe oligonucleotide (SEQ ID No. 32) in 10 µl of 20 mM MOPS (pH 7.5) containing 0 , 1% each of Tween 20 and NP-40, 4 mM MnCl2, 100 mM KCl and 100 μg / ml BSA. The following amounts of enzyme were used: 25 ng of CLEAVASE BN prepared as described in Example 8; 2 µl of CLEAVASE A / G nuclease extract prepared as described in Example 2; 2.25 μl (11.25 polymerase units) of the following DNA polymerases: AmpliTaq® DNA polymerase

(Perkin Elmer); LD AmpliTaq® DNA polymerase (low in DNA; from Perkin Elmer); Taq DNA polymerase (Fisher Scientific).

For each of the reactions shown in Fig. 33, except for the one shown in lane 1, the target DNA (50 fmol of single stranded M13mp19 DNA) was combined with 50 pmol of the INVASOR oligonucleotide (SEQ ID NO: 35) and 5 pmol of the probe oligonucleotide (SEQ ID No. 32); the target DNA was omitted in reaction 1 (lane 1). Reactions 1, 3, 5, 7, 9 and 11 included 1.5 µl of saliva extract. These mixtures were brought to a volume of 5 μl with distilled water, covered with a drop of CHILLOUT evaporation barrier and brought to 95 ° C for 10

minutes The cleavage reactions were then initiated by the addition of 5 μl of the desired mixture of

enzyme / probe; reactions 1, 4 and 5 received CLEAVASE A / G nuclease. Reactions 2 and 3 received CLEAVASE BN; reactions 6 and 7 received AmpliTaq®, reactions 8 and 9 received AmpliTaq® LD and reactions 10 and 11 received Taq DNA polymerase from Fisher Scientific

The reactions were incubated at 63 ° C for 30 minutes and stopped by the addition of 6 µl of 95% formamide

with 20 mM EDTA and 0.05% marker dyes. The samples were heated at 75 ° C for 2 minutes immediately before electrophoresis through a 20% polyacrylamide gel (19: 1 cross-linking), with 7 M urea, in a 45 mM Tris · Borate buffer, pH 8.3 , 1.4 mM EDTA. The products of the reactions were visualized by the use of an apparatus for the formation of Hitachi FMBIO fluorescent images and the results are shown in Fig. 33.

A paired comparison of the rails shown in Fig. 33 without and with the saliva extract, treated with each of the enzymes, shows that the saliva extract has different effects on each of the enzymes. While the CLEAVASE BN nuclease and AmpliTaq® were significantly inhibited in terms of cleavage under these conditions, the CLEAVASE A / G and AmpliTaq® LD nuclease show little difference in the performance of the cleaved probe. Fisher Scientific Taq DNA polymerase preparation shows an intermediate response, with a partial reduction in the yield of the cleaved product. From the point of view of polymerization, the three variants of DNAPTaq must be equivalent; they must be the same protein with the same amount of synthetic activity. It is possible that the differences observed may be due to variations in the amount of nuclease activity present in each preparation caused by different handling during purification or by different purification protocols. In any case, quality control assays designed to evaluate polymerization activity in commercial DNAP preparations will probably not show variation in the amount of nuclease activity present. If DNAPTaq preparations are explored

for complete 5 ’nuclease activity (that is, if 5’ nuclease activity is specifically quantified), it is

The preparations were likely to show sensitivities (to saliva extract) more in line with those observed using CLEAVASE A / G nuclease, from which DNAPTaq differs by very little amino acids.

It should be noted that even in the slowed reactions of CLEAVASE BN and DNAPTaq variants there is no apparent increase in nonspecific cleavage of the probe oligonucleotide due to inappropriate hybridization or nucleases included in saliva.

EXAMPLE 16 - Reference

Comparison of additional 5 ’nucleases in the INVASOR-directed cleavage test

It has been shown that several eubacterial Type A DNA polymerases (i.e., Pol I type DNA polymerases) function as endonucleases with structure specificity (see Example 1 and Lyamichev et al., Above). In this example it was shown that enzymes of this class can also be prepared to catalyze the invasive-directed cleavage of the present invention, although not as efficiently as CLEAVASE enzymes.

The CLEAVASE BN nuclease and the CLEAVASE A / G nuclease were tested together with three different thermostable DNA polymerases: Thermus aquaticus DNA polymerase (Promega), Thermus thermophilus and Thermus flavus DNA polymerases (Epicenter). The enzyme mixtures used in the reactions shown in lanes 1-11 of Fig. 34 contained the following, each in a volume of 5 μl: Lane 1: 20 mM MOPS (pH 7.5) with 0.1 % of each of Tween 20 and NP-40, 4 mM MnCl2, 100 mM KCl; Lane 2: 25 ng of CLEAVASE BN nuclease in the same solution described for lane 1; Lane 3: 2.25 μl of CLEAVASE A / G nuclease extract (prepared as described in Example 2), in the same solution described for lane 1; Lane 4: 2.25 μl of nuclease extract

CLEAVASE A / G in 20 mM Tris-Cl, (pH 8.5), 4 mM MgCl2 and 100 mM KCl; Lane 5: 11.25 Taq DNA polymerase polymerase units in the same buffer described for lane 4; Lane 6: 11.25 units of Tth DNA polymerase polymerase in the same buffer described for lane 1; Lane 7: 11.25 units of Tth DNA polymerase polymerase in a 2X concentration of the buffer supplied by the manufacturer, supplemented with 4 mM MnCl2; Lane 8: 11.25 units of Tth DNA polymerase polymerase in a 2X concentration of the buffer supplied by the manufacturer, supplemented with 4 mM MgCl2; Lane 9: 2.25 units of Tfl DNA polymerase polymerase in the same buffer described for lane 1; Lane 10: 2.25 units of Tfl polymerase polymerase in a 2X concentration of the buffer supplied by the manufacturer, supplemented with 4 mM MnCl2; Lane 11: 2.25 units of Tfl DNA polymerase polymerase in a 2X concentration of the buffer supplied by the manufacturer, supplemented with 4 mM MgCl2.

Sufficient target DNA, probe and INVASOR were combined for all 11 reactions in a stock mixture. This mixture contained 550 fmol of single stranded M13mp19 target DNA, 550 pmol of the INVASOR oligonucleotide (SEQ ID No. 35) and 55 pmol of the probe oligonucleotide (SEQ ID No. 32), each as illustrated in Fig. 28c, in 55 μl of distilled water. Five μl of the DNA mixture was dispensed into each of the 11 labeled tubes and covered

with a drop of evaporation barrier CHILLOUT. The reactions were brought to 63 ° C and cleavage was initiated by the addition of 5 µl of the appropriate enzyme mixture. Then, the reaction mixtures were incubated at a temperature of 63 ° C for 15 minutes. The reactions were stopped by the addition of 8 μl of 95% formamide with EDTA 20

mM and 0.05% marker dyes. The samples were heated at 90 ° C for 1 minute immediately before electrophoresis through a 20% polyacrylamide gel (19: 1 cross-linking), with 7 M urea, in a 45 mM Tris · Borate buffer, (pH 8, 3), 1.4 mM EDTA. After electrophoresis, the products of the reactions were visualized by the use of an apparatus for the formation of Hitachi FMBIO fluorescent images and the results are shown in Fig. 34. The examination of the results shown in Fig. 34 demonstrates that all

5 ’nucleases analyzed have the ability to catalyze cleavage directed by INVASOR in at least one of the

buffer systems analyzed. Although not optimized herein, these cleavage agents are suitable for use in the methods of the present invention.

EXAMPLE 17 - Reference

The INVASOR-directed cleavage assay can detect single-base differences in target nucleic acid sequences.

The ability of the invasive-directed cleavage assay to detect single-base mating mutations was examined. Two target nucleic acid sequences were chemically synthesized containing CLEAVASE enzyme resistant main phosphorothioate structures and purified by polyacrylamide gel electrophoresis. Targets comprising major phosphorothioate structures were used to prevent exonucleolytic clipping of the duplex target with an oligonucleotide. The target oligonucleotide, which provides the target sequence that is completely complementary to the INVASOR oligonucleotide (SEQ ID No. 35) and the probe oligonucleotide (SEQ ID No. 32), contained the following sequence: 5'-CCTTTCGCTTTCTTCCCTTC-CTTTCTCGCCACGTTCGCCGGC-3 '(SEQ ID No. 36). A second target sequence was synthesized that contained a single base change with respect to SEQ ID No. 36: 5'-CCTTTCGCTCTCTTCCCT TCCTTTCTCGCC ACGTTCGCCGGC-3 (SEQ ID No. 37; single base change with respect to SEQ ID No. 36 se sample using bold and underlined). The subsequent mismatch occurs within the "Z" region of the target as depicted in Fig. 25.

To distinguish two target sequences that differ by the presence of a single mismatch, INVASOR-directed cleavage reactions were performed using two different reaction temperatures (55 ° C and 60 ° C). Mixtures containing 200 fmol of SEQ ID No. 36 or SEQ ID No. 37, 3 pmol of the fluorescein-labeled probe oligonucleotide (SEQ ID No. 32), 7.7 pmol of oligonucleotide INVASOR (SEQ ID No. 35) and 2 were assembled µl of CLEAVASE A / G nuclease extract (prepared as described in Example 2) in 9 µl of 10mM MOPS (pH

7.4) with 50 mM KCl, they were covered with a drop of CHILLOUT evaporation barrier and brought to the appropriate reaction temperature. The cleavage reactions were initiated by the addition of 1 µl of 20 mM MgCl2. After 30 minutes at 55 ° C or 60 ° C, the reactions were stopped by adding 10 µl of

95% formamide with 20 mM EDTA and 0.05% marker dyes. The reaction mixtures are then

heated at 90 ° C for one minute before loading 4 μl in 20% denaturing polyacrylamide gels. The

Separated reaction products were visualized using an Hitachi FMBIO fluorescent imaging apparatus. The resulting image is shown in Fig. 35.

In Fig. 35, lanes 1 and 2 show the products of reactions performed at 55 ° C; lanes 3 and 4 show the products of reactions carried out at 60 ° C. Lanes 1 and 3 contained reaction products containing SEQ ID No. 36 (perfect coupling with the probe) as the target. Lanes 2 and 4 contained reaction products containing SEQ ID No. 37 (single base mismatch with the probe) as the target. The target that does not have a perfect hybridization correspondence (i.e. complete complementarity) with the probe will not bond so strongly (i.e., the Tf value of that duplex will be less than the Tf value of the same region if it is coupled perfectly). The results presented in this document demonstrate that the reaction conditions can be varied to accommodate erroneous pairing (for example, reducing the reaction temperature) or to exclude the binding of the sequence with erroneous mating (for example, raising the reaction temperature ).

The results shown in Fig. 35 demonstrate that the specific cleavage event that occurs in INVASOR-directed cleavage reactions can be eliminated by the presence of a single base mismatch between the probe oligonucleotide and the target sequence. In this way, reaction conditions can be chosen to exclude the hybridization of INVASOR-directed cleavage probes poorly paired by decreasing in this way or even eliminating probe excision. In an extension of this test system, multiple cleavage probes could also be used, each having a separate indicator molecule (i.e., a single marker) in a single cleavage reaction, to simultaneously probe two or more variants in the same target region . The products of this reaction would allow not only the detection of mutations that exist within a target molecule, but also allow a determination of the relative concentrations of each sequence (i.e. mutant and wild type or multiple different mutants) present within samples which contain a mixture of target sequences. When provided in equal amounts, but a large excess (for example, at least a 100-fold molar excess; typically at least 1 pmol of each probe oligonucleotide would be used when the target sequence was present at a concentration of about 10 fmol or less ) with respect to the target and would be used under optimized conditions. As described above, no difference in the relative amounts of the target variants will affect hybridization kinetics, so that the cleavage amounts of each probe will reflect the relative amounts of each variant present in the reaction.

The results shown in the example clearly demonstrate that the INVASOR-directed cleavage reaction can be used to detect single base differences between target nucleic acids.

Example 18- Reference

The INVASOR-directed cleavage reaction is insensitive to large changes in reaction conditions.

The results shown above demonstrated that the INVASOR-directed cleavage reaction can be used for the detection of target nucleic acid sequences and that this assay can be used to detect single-base differences between target nucleic acids. These results demonstrated that 5 ’nucleases could be used (for example, CLEAVASE BN, CLEAVASE A / G, DNAPTaq, DNAPTth, DNAPTfl) together with a pair of overlapping oligonucleotides as an effective way to recognize nucleic acid targets. The experiments presented below show that the invasive excision reaction is relatively insensitive to large changes in conditions, which makes the procedure more suitable for clinical laboratory practice.

The effects of varying the conditions of the cleavage reaction on the specificity of the invasive cleavage and on the amount of signal accumulated over the course of the reaction were examined. To compare

variations in the cleavage reaction, a "conventional" INVASOR cleavage reaction was first defined.

In any case, unless specifically indicated otherwise, the indicated parameter of the reaction was varied, while the invariable aspects of a particular test were those of this conventional reaction. The results of these tests are shown in Figs. 38-40 or the results described below.

a) The conventional INVASOR directed cleavage reaction

The conventional reaction was defined as a reaction comprising 1 fmol of M13mp18 single stranded target DNA (NEB), 5 pmol of the labeled probe oligonucleotide (SEQ ID No. 38), 10 pmol of the INVASOR oligonucleotide

upstream chain (SEQ ID No. 39) and 2 units of CLEAVASE A / G in 10 μl of 10 mM MOPS, pH 7.5 with 100 mM KCl,

4 mM MnCl2 and 0.05% Tween-20 and Nonidet-P40. For each reaction, the buffers, salts and enzyme were combined in a volume of 5 µl; DNAs (target and two oligonucleotides) were combined in 5 µl of dH2O and covered with a drop of CHILLOUT evaporation barrier. When multiple reactions were performed with the same reaction constituents, these formulations expanded proportionally.

Unless otherwise indicated, the sample tubes with the DNA samples were heated to 61 ° C and the

reactions were initiated by the addition of 5 μl of the enzyme mixture. After 20 minutes at this temperature, the reactions were stopped by adding 8 µl of 95% formamide with 20 mM EDTA and

0.05% marker dyes. The samples were heated at 75 ° C for 2 minutes immediately before electrophoresis through a 20% polyacrylamide gel (19: 1 cross-linking), with 7 M urea, in a 45 mM Tris · Borate buffer, pH 8.3 , 1.4 mM EDTA. The products of the reactions were visualized by the use of an apparatus for the formation of Hitachi FMBIO fluorescent images. In all cases, the uncut probe material was visible as an intense black band or spot, usually in the upper half of the panel, while the desired products of INVASOR specific cleavage were visible as one or two narrower black bands , usually in the lower half of the panel. Under some reaction conditions, particularly under conditions with high salt concentrations, a secondary cleavage product is also visible (thus generating a doublet). The lighter gray band scales generally indicate exonuclease clipping of the probe oligonucleotide or non-specific heat-induced fragmentation of the probe.

Fig. 37 illustrates the hybridization of the probe and INVASOR oligonucleotides with regions along the M13mg18 target molecule (lower chain). In Fig. 37 only a 52 nucleotide part of the M13mp18 molecule is shown; This 52 nucleotide sequence is indicated in SEQ ID No. 31 (this sequence is identical in both M13mp18 and M13mp19). The oligonucleotide probe (upper chain) contains a Cy3 amidite marker at the 5 ’end; The sequence of the probe is 5'-AGAAAGGAAGGGAA-GAAAGCGAAAGGT-3 '(SEQ ID No. 38. Bold characters indicate the presence of a modified base (2'-O-CH3). Amidite Cy3 (Pharmacia) is a coloring amidite of indodicarbocyanin that can be incorporated in any position during oligonucleotide synthesis; Cy3 emits fluorescence in the yellow region (maximum excitation and emission of 554 and 568 nm, respectively). The invading oligonucleotide (intermediate chain) has the following sequence: 5 ' -GCCGGCGAACGTGGCGAGAAAGGA-3 '(SEQ ID No. 39).

b) Titration with KCl

Fig. 38 shows the results of the variation in the concentration of KCl in combination with the use of 2 mM MnCl2, in an otherwise conventional reaction. The reactions were performed in duplicate to confirm the observations; the reactions shown in lanes 1 and 2 did not contain added KCl, lanes 3 and 4 contained 5 mM KCl, lanes 5 and 6 contained 25 mM KCl, lanes 7 and 8 contained 50 mM KCl, lanes 9 and 10 contained 100 mM KCl and lanes 11 and 12 contained 200 mM KCl. These results demonstrate that the inclusion of KCl allows the generation of a specific cleavage product. Although the strongest signal is observed at the concentration of 100 mM KCl, the specificity in the other reactions with KCl at a concentration of 25 mM or higher indicates that concentrations in the entire range (i.e. 25-200 mM) can be chosen if desired for any specific reaction condition.

As shown in Fig. 38, the INVASOR-directed cleavage reaction requires the presence of a salt (eg, KCl) for efficient cleavage to occur. In other reactions, it has been discovered that KCl can inhibit the activity of certain CLEAVASE enzymes when they are present at concentrations above about 25 mm. For example, in cleavage reactions using oligonucleotide S-60 shown in Fig. 26, in the absence of a primer, the CLEAVASE BN enzyme loses approximately 50% of its activity in 50 mM KCl. Therefore, the use of alternative salts in the cleavage reaction directed by INVASOR was examined. In these experiments, the potassium ion was replaced by Na + or Li + or the chloride ion was replaced by glutamic acid. The replacement of KCl with alternative salts is described later in sections c-e.

c) Titration with NaCl

NaCl was used instead of Kcl at 75, 100, 150 or 200 mM, in combination with the use of 2 mM MnCl2, in an otherwise conventional reaction. These results demonstrate that NaCl can be used as a substitute for KCl in the INVASOR-directed cleavage reaction, giving similar concentration similar results (i.e., the presence of NaCl, like KCl, increases product accumulation).

d) Titration with LiCl

LiCl was used instead of Kcl in otherwise conventional reactions. The concentrations analyzed were 25, 50, 75, 100,150 and 200 mm of LiCl. The results demonstrated that LiCl can be used as a suitable substitute for KCl in the INVASOR-directed cleavage reaction (i.e., the presence of LiCl, like KCl, increases product accumulation) at concentrations of approximately 100 mM or higher.

e) Titration with KGlu

The results of the use of a potassium glutamate salt (KGlu) were examined instead of the most frequently used chloride salt (KCl) in reactions performed in a temperature range. KGlu has been shown to be a very effective salt source for some enzymatic reactions, showing a wider range of concentrations that allow for maximum enzymatic activity (Leirmo et al., Biochem. 26: 2095 [1987]). The ability of KGlu to facilitate hybridization of the probe and INVASOR oligonucleotides with the target nucleic acid was compared with that of LiCl. In these experiments, the reactions were performed for 15 minutes, instead of the conventional 20 minutes in conventional reactions that replaced 200 mM, 300 mM or 400 mM KGlu KCl. The reactions were performed at 65 ° C, 67 ° C, 69 ° C or 71 ° C. The results shown showed that KGlu was very effective as a salt in invasive excision reactions, with complete evident activity even at 400 mM KGlu, although at the lowest temperature the excision was reduced by approximately 30% at 300 mM KGlu and in approximately 90% at 400 mM KGlu.

f) Titration with MnCl2 and MgCl2 and ability to replace MnCl2 with MgCl2

In some cases it may be desirable to perform the invasive cleavage reaction in the presence of Mg2 +, in addition to or instead of Mn2 + as the necessary divalent cation required for the activity of the enzyme employed. For example, some common procedures for preparing DNA from bacterial cultures or tissues use MgCl2 in solutions that are used to facilitate the collection of DNA by precipitation. In addition, high concentrations (i.e., greater than 5 mM) of divalent cation can be used to facilitate hybridization of nucleic acids, in the same way that the monovalent salts were used above, thereby improving the invasive cleavage reaction. In this experiment, the tolerance of the invasive cleavage reaction for 1) the substitution of MnCl2 by MgCl2 and for the ability to produce a specific product in the presence of increasing concentrations of MgCl2 and MnCl2 was examined.

Fig. 39 shows the results of varying the concentration of MnCl2 from 2 mM to 8 mM, replacing the MnCl2 with MgCl2 from 2 to 4 mM or using these components in combination in an otherwise conventional reaction The reactions analyzed in the lanes 1 and 2 contained 2 mM of MnCl2 and MgCl2, lanes 3-4 contained only MnCl2, lanes 5 and 6 contained 3 mM MnCl2, lanes 7 and 8 contained 4 mM MnCl2 and lanes 9 and 10 contained 8 mM MnCl2. The reactions analyzed in lanes 11 and 12 contained 2 mM MgCl2 and lanes 13 and 14 contained 4 mM MgCl2. These results demonstrate that both MnCl2 and MgCl2 can be used as a divalent cation necessary to allow cleavage activity of the CLEAVASE A / G enzyme. in these reactions and that the invasive cleavage reaction can tolerate a wide range of concentrations of these components.

In addition to examining the effects of salt environment on the rate of product accumulation in the invasive cleavage reaction, the use of reaction constituents that had proven effective in increasing nucleic acid hybridization in conventional hybridization assays was examined ( for example, transfer hybridization) or in ligation reactions. These components can act as volume excluders, increasing the effective concentration of the nucleic acids of interest and thus, increasing hybridization,

or they can act as charge protection agents to minimize repulsion between the highly charged main structures of the nucleic acid chains. The results of these experiments are described in sections g and h shown below.

g) Effect of CTAB Addition

Cetyltriethylammonium bromide polycationic detergent (CTAB) has been shown to dramatically increase hybridization of nucleic acids (Pontius and Berg, Proc. Natl. Acad. Sci. USA 88: 8237 [1991]). The effect of adding CTAB detergent in concentrations of 100 mM to 1 mM to invasive cleavage reactions in which 150 mM LiCl was used instead of KCl in otherwise conventional reactions was also investigated. These results showed that 200 mM CTAB can have a very moderate enhancing effect in these conditions. reaction and the presence of CTAB above about 500 M was inhibitory with respect to the accumulation of the specific cleavage product.

h) Effect of the addition of PEG

The effect of the addition of polyethylene glycol (PEG) at concentrations 4.8 or 12% (w / v) to otherwise conventional reactions was also examined. The effects of the increase in the reaction temperature of the PEG-containing reactions were also examined by duplicate series of titration reactions with PEG at 61 ° C and 65 ° C. The results showed that all the percentages analyzed and at both temperatures analyzed, the inclusion of PEG substantially eliminated the production of specific cleavage product.

In addition, it was found that the presence of Denhardt 1X solution in the reaction mixture had no adverse effect after the cleavage reaction (Denhardt 50X solution contains per 500 ml: 5 g of Ficoll, 5 g of polyvinylpyrrolidone, 5 g of BSA) In addition, the presence of each component of Denhardt's solution (ie Ficoll alone, polyvinylpyrrolidone alone and BSA alone) was examined individually with respect to the effect on the cleavage reaction directed by INVASOR; no adverse effects were observed.

I) Effect of the addition of stabilizing agents

Another strategy to increase the performance of the invasive cleavage reaction is to increase the activity of the enzyme employed, increasing its stability in the reaction medium or increasing its turnover rate. Without taking into account the precise mechanism by which various agents act in the invasive cleavage reaction, the ability to increase the accumulation of specific cleavage product in the invasive cleavage reaction of various agents frequently used to stabilize enzymes was analyzed. Prolonged storage

The effects of the addition of 15% glycerol and the addition of 1.5% Tween 20 and Nonidet-P40 detergents, alone or in combination, in otherwise conventional reactions were also examined. The results showed that under these conditions these adducts had a small or no effect on the accumulation of specific cleavage product.

The effects of the addition of gelatin to reactions in which the identity and salt concentration were varied with respect to the conventional reaction were also investigated. The results showed that in the absence of salt, gelatin had a moderately potentiating effect on the accumulation of specific cleavage product, but when any salt (KCl or LiCl) was added to reactions performed under these conditions, increasing amounts of gelatin reduced the product accumulation.

j) Effect of the addition of large amounts of non-target nucleic acid

To detect specific nucleic acid sequences within samples, it is important to determine whether the presence of additional genetic material (i.e. non-target nucleic acids) will have a negative effect on the specificity of the assay. In this experiment, the effect of including large amounts of non-target nucleic acid, DNA or RNA, on the specificity of the invasive cleavage reaction was examined. Data were examined for an alteration at the expected site of cleavage or an increase in non-specific degradation of the probe oligonucleotide.

Fig. 40 shows the effects of the addition of non-target nucleic acid (eg, genomic DNA or tRNA) to an invasive cleavage reaction performed at 65 °, with 150 mM LiCl instead of the KCl in the conventional reaction. The reactions analyzed in lanes 1 and 2 contained 235 and 470 ng of genomic DNA, respectively. The

Reactions analyzed in lanes 3, 4, 5 and 6 contained 100 ng, 200 ng, 500 ng and 1 μg of tRNA, respectively.

Lane 7 represents a control reaction that did not contain added nucleic acid above the amounts used in the conventional reaction. The results shown in Fig. 40 demonstrate that the inclusion of non-target nucleic acid in large quantities could visibly slow down the accumulation of specific cleavage product (although without limiting the invention to any particular mechanism, it is believed that the additional nucleic acid competes for the binding of the enzyme with the specific reaction components). In other experiments it was discovered that the effect of adding large amounts of non-target nucleic acid can be compensated by increasing the enzyme in the reaction. The data shown in Fig. 40 also demonstrates that a key feature of the invasive excision reaction, the specificity of detection, was not compromised by the presence of large amounts of non-target nucleic acid.

In addition to the data presented above, invasive excision reactions were performed with buffer

succinate at pH 5.9 instead of the MOPS buffer used in the "conventional" reaction; no effects were observed

Adverse

The data shown in Figs. 38-40 and described above demonstrate that the invasive cleavage reaction can be performed using a wide variety of reaction conditions and is therefore suitable for practice in clinical laboratories.

EXAMPLE 19 - Reference

Detection of RNA targets by cleavage directed by INVASOR

In addition to the clinical need to detect specific DNA sequences for infectious and genetic diseases, there is a need for technologies that can quantitatively detect target nucleic acids that are composed of RNA. For example, several viral agents, such as hepatitis C virus (HCV) and human immunodeficiency virus (HIV) have RNA genomic material, whose quantitative detection can be used as a measure of viral load in the sample of a patient. This information may have a critical diagnostic or prognostic value.

Hepatitis C virus (HCV) infection is the leading cause of hepatitis A, not B (NANB) after a worldwide transfusion. In addition, HCV is the main etiologic agent of hepatocellular carcinoma (HCC) and chronic liver disease worldwide. The HCV genome is a small RNA molecule (9.4 kb). In studies of HCV transmission by blood transfusion it has been found that the presence of HCV antibody, measured in conventional immunological assays, does not always correlate with the infectivity of the sample, while the presence of HCV RNA in a sample of Blood correlates strongly with infectivity. In contrast, serological assays can remain negative in infected immunosuppressed individuals, while HCV RNA can be easily detected (Cuthbert, Clin. Microbiol. Rev. 7: 505 [1994]).

The need and value of developing a probe based assay for HCV RNA detection are clear. The polymerase chain reaction has been used to detect HCV is clinical samples, but problems associated with contamination by handover of samples have been a concern. Direct detection of viral RNA without the need for reverse transcription or amplification would allow the elimination of several of the points where existing assays may fail.

The genome of the positive chain RNA hepatitis C virus comprises several regions that include 5 'and 3' non-coding regions (i.e., 5 'and 3' non-translated regions) and a polyprotein coding region encoding the nuclear protein (C), two shell glycoproteins (E1 and E2 / NS1) and six non-structural glycoproteins (NS2-NS5b). The molecular biology analysis of the HCV genome has shown that some regions of the genome are very popular among isolates, while other regions may change quite quickly.

The 5 ’non-coding region (NCR) is the most conserved region in HCV. These analyzes have allowed to divide these

virus into six basic genotypic groups and then classify them into more than a dozen subtypes (the nomenclature and division of HCV genotypes is under development; see a recent classification scheme in Altamirano et al., J. Infect. Dis. 171: 1034 (1995)).

To develop a rapid and accurate procedure to detect HCV present in infected individuals, the ability of the invasive-directed excision reaction to detect HCV RNA was examined. Plasmids containing DNA from the 5 ’untranslated region conserved from six different HCV RNA isolates were used to generate templates for in vitro transcription. The HCV sequences contained within these six plasmids represent genotypes 1 (four subtypes represented; 1a, 1b, 1c and 1c), 2 and 3. The nomenclature of the HCV genotypes used herein is that of Simmonds et al., (as described in Altamirano et al., Above). Subtype 1c was used in the model detection reaction described below.

a) Generation of plasmids containing HCV sequences

Six DNA fragments obtained from HCV were generated by RT-PCR using RNA extracted from blood donor serum samples; these PCR fragments were a donation from Dr. M. Altamirano (University of British Columbia. Vancouver). These PCR fragments represent HCV sequences obtained from HCV genotypes 1a, 1b, 1c, 1c, 2c and 3a. RNA extraction, reverse transcription and PCR were used using conventional techniques (Altamirano et al., Above). In summary, 100 µl RNA of serum was extracted using guanidine isothiocyanate, sodium lauryl sarcosate and phenol-chloroform (Inchauspe et al., Hepatol. 14: 594 (1991)). Reverse transcription was performed according to the manufacturer's instructions using a GeneAmp rTth reverse transcriptase RNA PCR kit (Perkin-Elmer) in the presence of an external antisense primer, HCV342. The HCV342 primer sequence is 5’-GGTTTTTCTTTGAGGTTTAG-3 ’(SEQ ID No. 40). After finishing the reaction at RT, the HCV7 (5’-GCGACACTCCACCATAGAT-3 ’[SEQ ID 41]) and magnesium sense primer were added and a first PCR was performed. Aliquots of the products of the first PCR were used in a second (nested) PCR in the presence of primers HCV46 [5'-CTGTCTTCACGCAGAAAGC-3 '(SEQ ID No. 42]) and HCV308 [5'-GCACGGT CTACGAGACCTC-3' [SEC ID No. 43]). The PCR produced a 281 bp product that corresponds to a 5 ’non-coding region (NCR)

HCV conserved between positions -284 and -4 of the HCV genome (Altamirano et al., above).

The six 281 bp PCR fragments were used directly for cloning or subjected to a step of

further amplification using a 50 μl PCR comprising approximately 100 fmol of DNA, primers of HCV46 and HCV308 at 0.1 μM, 100 μM of the four dNTPs and 2.5 units of Taq DNA polymerase in a buffer containing Tris -10 mM HCl, pH 8.3, 50 mM KCl, 1.5 mM MgCl2 and 0.1% Tween-20. The PCRs were subjected to cycles 25 times at 96 ° C for 45 s, 55 ° C for 45 s and 72 ° C for 1 min. Two microliters of the original DNA samples or the amplified PCR products were used for cloning into the linear pT7Blue T vector (Novagen) according to the manufacturer's protocol. After ligating the PCR products to the pT7blue T vector, the ligation reaction mixture was used to transform competent JM109 cells (Promega). Clones containing the pT7blue T vector with an insert were selected for the presence of colonies that had a white color on LB plates containing 40 μg / ml of X-Gal, 40 μg / ml of IPTG and 50 μg / ml of ampicillin. Four colonies were selected for each PCR sample and grown overnight in 2 ml of LB medium containing 50 μg / ml carbenicillin. Plasmid DNA was isolated using the following alkaline mini-preparation protocol. 1.5 mm cells were collected from the overnight culture by centrifugation for 2 min.

in a microcentrifuge (14K rpm); The supernatant was discarded and the cell pellet was resuspended in 50 μl of TE buffer with 10 μg / ml of ENASA A (Pharmacia). One hundred microliters of a solution containing NaOH, 1% SDS was added and the cells lysed for 2 min. The lysate was mixed gently with 100 μl of acetate

1.32 M potassium pH 4.8 and the mixture was centrifuged for 4 min in a microcentrifuge (14K rpm); the

sediment comprising cell debris. Plasmid DNA was precipitated in the supernatant with 200 µl ethanol

and sedimented by centrifugation in a microcentrifuge (14K rpm). The DNA pellet was air dried for 15 min and then redissolved in 50 µl of TE buffer (10 mM Tris-HCl, pH 7.8, 1 mM EDTA).

b) Reamplification of HCV clones to add phage T7 promoter for subsequent in vitro transcription

To ensure that the transcription RNA product had a discrete 3 ′ end, it was necessary to create linear transcription templates that stopped at the end of the HCV sequence. These fragments were conveniently produced using PCR to reamplify the segment of the plasmid containing the phage promoter sequence and the HCV insert. For these studies, the HCV clone of type _1C was reamplified using a primer that hybridizes with the T7 promoter sequence: 5'-TAATACGACTCACTATAGGG-3 '(SEQ ID No. 44; "T7 promoter primer") (Novagen ) in combination with the HCV308 3 'terminal specific HCV primer (SEQ ID No. 43). For these reactions, 1 µl of plasmid DNA (approximately 10 to 100 ng) was reactivated in a 200 µl PCR using T7 and HCV308 primers as described above with the exception that 30 amplification cycles were employed. The resulting amplicon was 345 bp in length. After amplification, the PCR mixture was transferred to a new 1.5 ml microcentrifuge tube, the mixture was brought to a final concentration of 2M NH4OAc and the products were precipitated by the addition of a volume of 100% isopropanol . After a 10 min incubation at room temperature, the precipitates were collected by

centrifugation, washed once with 80% ethanol and dried in vacuo. The collected material was dissolved in 100 μl

of distilled water without nuclease (Promega).

RNA segments were produced from this amplicon by in vitro transcription using the RiboMAX Large Scale RNA Production System TM (Promega) according to the manufacturer's instructions using 5.3 g of the amplicon described above in a 100 μl reaction. The transcription reaction was incubated for 3.75 hours, after which the DNA template was destroyed by the addition of 5-6 µl DNase without RNase RQ1 (1 unit / µl) according to the instructions of the RiboMAXTM kit. The reaction was extracted twice with phenol / chloroform / isoamyl alcohol (50: 48: 2) and the aqueous phase was transferred to a tube of

new microcentrifuge. Then, the RNA was collected by adding 10 µl of 3M NH4OAc, pH 5.2 and 110 µl of

100% isopropanol. After an incubation at 4 ° C, for 5 min at room temperature, the precipitate was collected by centrifugation, washed once with 80% ethanol and dried under vacuum. The sequence of the resulting RNA transcript (HCV1.1 transcript) is indicated in SEQ ID NO: 45.

c) Detection of the HCV1.1 transcript in the INVASOR-directed cleavage test

The detection of the HCV1.1 transcript was tested in the INVASOR-directed cleavage assay using an HCV-specific probe oligonucleotide (5’-CCGGTCGTCCTGGCAATXCC-3 ’[SEQ ID NO. 46]); X indicates the presence of a fluorescein dye in an abbasic bond) and an HCV-specific INVASOR oligonucleotide (5’-GTTTATCCAAGAAAGGACCCGGTC-3 ’[SEQ ID No. 47] that produces an invasive 6 nucleotide excision of the probe.

Each 10 μl of reaction mixture comprised 5 pmol of the probe oligonucleotide (SEQ ID No. 46) and 10 pmol of the INVASOR oligonucleotide (SEQ ID No. 47) in a 10 mM MOPS buffer, pH 7.5 with 50 mM KCl, MnCl2 4 mM, 0.05% Tween-20 and Nonidet-P40 and 7.8 RNasin® ribonuclease inhibitor units (Promega). The cleavage agents used were CLEAVASE A / G (used at 5.3 ng / 10 μl reaction) or DNAPTth (used at 5 polymerase units / 10 μl reaction). The amount of RNA target was varied as indicated below. When RNase treatment is indicated, the target RNAs were pre-treated with 10 μg of RNase A (Sigma) at 37 ° C for 30 min to demonstrate that the detection was specific for the RNA in the reaction and was not due to the presence of no residual RNA template from the transcription reaction. Aliquots treated with RNase from HCV RNA were used directly without intermediate purification.

For each reaction, the target RNAs were suspended in the reaction solutions described above, but lacking the cleavage agent and the MnCl2 for a final volume of 10 μl, with the INVASOR and the probe at the concentrations indicated above. The reactions were heated to 46 ° C and the reactions were initiated by the addition of a mixture of the appropriate enzyme with MnCl2. After incubation during

30 min at 46 ° C, the reactions were stopped by the addition of 8 µl of 85% formamide, 10 mM EDTA and violet of

0.02% methyl (methyl violet loading buffer). The samples were then separated by electrophoresis through a 15% denaturing polyacrylamide gel (crosslinked 19: 1), containing 7 M urea, in a 45 mM Tris-Borate buffer, pH 8.3, EDTA 1, 4 mM . After electrophoresis, the labeled reaction products were visualized using the FMBIO-100 Image Analyzer (Hitachi), with the scanning of the resulting imaging apparatus shown in Fig. 41.

In Fig. 41, the samples analyzed in lanes 1-4 contained 1 pmol of RNA target, the reactions shown in lanes 5-8 contained 100 fmol of the RNA target and the reactions shown in lanes 9-12 contained 10 fmol of RNA target. All lanes with odd numbers represent reactions performed using CLEAVASE A / G enzyme and all lanes with even numbers represent reactions performed using DNAPTth. The reactions analyzed in lanes 1, 2, 5, 6, 9 and 10 contained RNA that had been predigested with RNase A. These data demonstrate that the invasive cleavage reaction effectively detects RNA targets and also, the absence of any signal from Specific cleavage in samples treated with RNase confirms that the specific cleavage product observed in the other lanes depends on the presence of input RNA.

EXAMPLE 20 - Reference

The fate of the target RNA in the cleavage reaction directed by INVASOR

In this example, the fate of the RNA target in the cleavage reaction directed by INVASOR was examined. As shown above in Ex. 1D, when RNA is hybridized with DNA oligonucleotides, the 5 ′ nucleases associated with DNA polymerases can be used to cleave the RNAs; this split can be suppressed when the

arm 5 ’is long or when it is very structured [Lyamichev et al., Science 260: 778 [1993] and the Patent of

United States No. 5,422,253]. In this experiment, the extent to which the RNA target would be cleaved by cleavage agents when hybridized with the detection oligonucleotides (i.e., the probe and INVASOR oligonucleotides) was examined using reactions similar to those described in Example 20 , performed using fluorescein-labeled RNA as a target.

Transcription reactions were performed as described in Example 19 with the exception that 2% of the UTP in the reaction was replaced by fluorescein-12-UTP (Boehringer Mannheim) and 5.3 μg of the amplicon was used in a reaction of 100 μl. The transcription reaction was incubated for 2.5 hours and, after that, the DNA template was destroyed by the addition of 5-6 µl DNase without RNase RQ1 (1 unit / µl) according to the instructions of the RiboMAXTM kit . The organic extraction was omitted and the RNA was collected by the addition of 10 µl of 3M NaOAc, pH 5.2 and 110 µl of 100% isopropanol. . After an incubation at 4 ° C, for 5 min at room temperature, the precipitate was collected by centrifugation, washed once with 80% ethanol and dried under vacuum. The resulting RNA

it was dissolved in 100 µl of water without nuclease. 50% of the sample was purified by electrophoresis through a gel

8% denaturing polyacrylamide (crosslinked 19: 1), containing 7 M urea, in a 45 mM Tris-Borate buffer, pH 8.3, 1.4 mM EDTA. The gel cut containing the full length material was cleaved and the RNA eluted by moistening the cut overnight at 4 ° C in 200 µl of 10 mM Tris-Cl, pH 8.0, 0.1 mM EDTA and 0 NaOAc, 3 M. The RNA was then precipitated by the addition of 2.5 volumes of 100% ethanol. After incubation at 20 ° C for 30 min, the precipitates were recovered by centrifugation, washed once with 80% ethanol and

dried under vacuum. The RNA was dissolved in 25 µl of water without nuclease and then quantified by UV absorbance at

260 nm

Samples of the purified RNA target were incubated for 5 or 30 min in reactions that doubled the invasive reactions with CLEAVASE A / G and DNAPTth described in Example 20 with the exception that the reactions lacked the probe and INVASOR oligonucleotides. Subsequent analysis of the products showed that the RNA was very stable, with a very light background of non-specific degradation, which appeared as a gray background in the gel lane. The background did not depend on the presence of enzyme in the reaction.

INVASOR detection reactions were performed using the purified RNA target using the probe / INVASOR pair described in Example 19 (SEQ ID NO: 46 and 47). Each reaction included 500 fmol of the target RNA, 5 pmol of the fluorescein-labeled probe and 10 pmol of the invading oligonucleotide in a 10 mM MOPS buffer, pH 7.5 with 150 mM LiCl, 4 mM MnCl2, 0.05% of Tween-20 and Nonidet-P40 and 39 units of RNAsin® (Promega). These components were combined and heated at 50 ° C and the reactions were initiated by the addition of 53 ng of CLEAVASE A / G or 5 units of DNAPTth polymerase. The final reaction volume was 10 μl. After 5 min at 50 ° C, 5 µl aliquots of each reaction were removed to tubes containing 4 µl of 95% formamide,

10 mM EDTA and 0.02% methyl violet. The remaining aliquot received a drop of evaporation barrier

CHILLOUT and incubated for an additional 25 min. These reactions were then stopped by the addition of 4 μl of

the former formamide solution. The products of these reactions were separated by electrophoresis through separate 20% denaturing polyacrylamide gels (crosslinked 19: 1), containing 7 M urea, in a 45 mM Tris-Borate buffer, pH 8.3, EDTA 1 , 4 mM. After electrophoresis, the labeled reaction products were visualized using the FMBIO-100 Image Analyzer (Hitachi), with the scans of the resulting imaging apparatus shown in Figs 42A (5 min reactions) and 42B (reaction reactions). 30 min).

In Fig. 53, the target RNA is observed very close to the top of each lane, while the labeled probe and its cleavage products are seen just below the middle of each panel. The FMBIO-100 Image Analyzer was used to quantify the fluorescence signal in the probe bands. In each panel, lane 1 contains products of reactions performed in the absence of a cleavage agent, lane 2 contains products of reactions performed using CLEAVASE A / G and lane 3 contains products of reactions performed using DNAPTth.

Quantification of the fluorescence signal in the probe bands revealed that after a 5 min incubation, 12% or 300 fmol of the probe was cleaved by the CLEAVASE A / G and 29% or 700 fmol was cleaved by the DNAPTth. After a 30 min incubation, CLEAVASE A / G had cleaved 32% of the probe molecules and DNAPTth had cleaved 70% of the probe molecules. (The images shown in Figs. 42A and 42B were printed with the intensity adjusted to show the small background amount of RNA degradation, so that bands containing strong signals become saturated and therefore, these images do not reflect precisely the differences in the measured fluorescence.)

The data shown in Fig. 42 clearly demonstrates that, under conditions of invasive excision, RNA molecules are stable enough to be detected as a target and that each RNA molecule can withstand many rounds of probe excision.

EXAMPLE 21 - Reference

Titration of target RNA in the cleavage test conducted by INVASOR

One of the main advantages of the INVASOR-directed cleavage test as a means to detect the presence of specific target nucleic acids is the correlation between the amount of cleavage product generated in a set amount of time and the amount of nucleic acid of interest present. in the reaction. The advantages of quantitative detection of RNA sequences were described in Example19. In this example, the quantitative nature of the detection assay is demonstrated through the use of various amounts of target starting material. In addition to demonstrating the correlation between the amounts of input target and output cleavage product, these data graphically demonstrate the extent to which the RNA target can be recycled in this assay.

The RNA target used in these reactions was the fluorescein labeled material described in Example 20 (ie, SEQ ID NO: 45). Since the efficacy of fluorescein-12-UTP incorporation by T7 RNA polymerase was unknown, the concentration of the RNA was determined by measuring absorbance at 260 nm, not by fluorescence intensity. Each reaction comprised 5 pmol of the fluorescein labeled probe (SEQ ID No. 46) and 10 pmol of the INVASOR oligonucleotide (SEQ ID No. 47) in a 10 mM MOPS buffer, pH 7.5 with 150 mM LiCl, 4 mM MnCl2, 0.05% Tween-20 and Nonidet-P40 and 39 units of RNAsin® (Promega). The amount of target RNA varied from 1 to 100 fmol, as indicated below. These components were combined, covered with CHILLOUT evaporation barrier and heated to 50 ° C; The reactions were initiated by the addition of 53 ng of Cleavase® A / G or 5 units of DNAPTth polymerase, to a final reaction volume of 10 μl. After 30 minutes at 50 ° C, the reactions were stopped by adding 8 µl of 95% formamide with 10 mM EDTA and violet of

0.02% methyl. Markers that had not reacted on lanes 1 and 2 were diluted in the same volume

total (18 μl). The samples were heated at 90 ° C for 1 minute and 2.5 µl of each of these reactions were

separated by electrophoresis through a 20% denaturing polyacrylamide gel (19: 1 cross-linking) with 7 M urea in a 45 mM Tris-Borate buffer, pH 8.3, 1.4 mM EDTA and the labeled reaction products they were visualized using the FMBIO-100 Image Analyzer (Hitachi), with the scans of the resulting imaging apparatus shown in Fig. 43.

In Fig. 43, lanes 1 and 2 show 5 pmol of uncut probe and 500 fmol of untreated RNA, respectively. The probe is the very dark signal near the middle part of the panel, while the RNA is the thin line near the top of the panel. These RNAs were transcribed with a 2% substitution of natural UTP with fluorescein-12-UTP in the transcription reaction. The resulting transcript contains 74 U residues, which would give an average of 1.5 fluorescein markers per molecule. With one tenth of the molar amount of RNA loaded in lane 2, the lane 2 signal should be approximately one seventh (0.15X) of the fluorescence intensity of the probe in lane 1. The measurements indicated that the intensity was closer to a fortieth, indicating a marker incorporation efficiency of approximately 17%. Since the RNA concentration was verified by the A260 measurement, this does not alter the experimental observations indicated below, but it should be noted that the RNA signal and the probes do not accurately reflect the relative amounts in the reactions.

The reactions analyzed in lanes 3 to 7 contained 1, 5, 10, 50 and 100 fmol of target, respectively, with the excision of the probe being performed by Cleavase® A / G. The reactions analyzed in lanes 8 to 12 repeated the same series of target amounts, with the excision of the probe performed by DNAPTth. The boxes that are observed surrounding the product bands show the area of the scan in which the fluorescence was measured for each reaction. The number of fluorescence units detected within each box is indicated below each box; background fluorescence was also measured.

Comparing the fluorescence detected in each lane, it can be seen that the amount of product formed in these 30-minute reactions can be correlated with the amount of target material. The accumulation of product under these conditions increases slightly when DNAPTth is used as the cleavage agent, but the correlation with the amount of target present remains. This demonstrates that the INVASOR assay can be used as a means to measure the amount of target RNA within a sample.

Comparison of the fluorescence intensity of the input RNA with that of the cleaved product shows that the INVASOR-directed cleavage test creates an excess signal with respect to the amount of target, so that the visible signal as a cleaved probe is much more intense than that represented by the target RNA. This further confirms the results described in Example 20, in which it was demonstrated that each RNA molecule could be used many times.

EXAMPLE 22 - Reference

DNA detection by load inversion

The detection of specific targets is achieved in the INVASOR-directed cleavage test by means of excision of the probe oligonucleotide. In addition to the procedures described in the previous examples, the cleaved probe can be separated from the uncleaved probe using the load inversion technique described below. This novel separation technique is related to the observation that positively charged adducts can affect the electrophoretic behavior of small oligonucleotides because the adduct charge is significantly relative to the charge of the entire complex. Observations of aberrant mobility due to charged adducts have been presented in the literature, but in all cases found, applications followed by other scientists have involved obtaining larger nucleotides by enzymatic extension. As negatively charged nucleotides are added, the positive influence of the adduct is reduced to an insignificant level. As a result, the effects of positively charged adducts have been reduced and have received infinitesimal attention in the existing literature.

This observed effect is of particular utility in assays based on the cleavage of DNA molecules. When an oligonucleotide is shortened by the action of a CLEAVASE® or other cleavage agent, the positive charge can be prepared to not only significantly decrease the negative net charge, but to actually cancel it out, effectively "reversing" the charge net of the marked entity. This load inversion allows target specific cleavage products to be divided from the uncleaved probe by extremely simple means. For example, cleavage products can be prepared to migrate to a negative electrode placed at any point in a reaction vessel, for focused detection without gel-based electrophoresis. When a plate gel is used, the sample wells can be placed in the center of the gel, so that it can be seen that the cleaved and non-cleaved probes migrate in opposite directions. Alternatively, a traditional vertical gel can be used, but with the electrodes inverted with respect to the usual DNA gels (i.e., the positive electrode at the top and the negative electrode at the bottom) in such a way that the cleaved molecules they enter the gel, while the non-cleaved ones are dispersed to the upper electrophoresis buffer reservoir.

An additional advantage of this type of reading is that the absolute nature of the division of substrate products means that an abundance of uncleaved probe can be supplied to direct the hybridization stage of the probe-based assay, but the unconsumed probe can be subtracted from the result to reduce the background.

By using multiple positively charged adducts, synthetic molecules can be constructed with sufficient modification so that the normally negatively charged chain becomes practically neutral. When constructed in this way, the presence or absence of a single phosphate group can mean the difference between a net negative charge or a net positive charge. This observation has particular utility when an objective is to differentiate between enzymatically generated DNA fragments, which lack a 3 ′ phosphate and thermal degradation products, which retain a 3 ′ phosphate (and, therefore, two additional negative charges).

a) Characterization of DNA oligonucleotide thermal decomposition products

The thermal degradation of DNA probes produces a high background that can obscure the signals generated by specific enzymatic cleavage, reducing the relationship between signal and noise. To better understand the nature of the DNA thermal degradation products, the 5'78 tetrachlorofluorescein-labeled oligonucleotides (TET) (SEQ ID NO: 59) and 79 (SEQ ID NO: 60) (100 pmol each) were incubated in 50 μl of 10 mM NaCO3 (pH 10.6), 50 mM NaCl at 90 ° C for 4 hours. To prevent evaporation of the samples, the reaction mixture was covered with 50 µl of CHILLOUT liquid wax. The reactions were then divided into two equal aliquots (A and B). Aliquot A was mixed with 25 μl of loading buffer with methyl violet and Aliquot B was dephosphorylated by the addition of 2.5 μl of 100 mM MgCl2 and 1 μl of 1 unit / μl of Calf Alkaline Alkaline Phosphatase (CIAP ) (Promega), with incubation at 37 ° C for 30 min, after which 25 µl of loading buffer with methyl violet was added.

One microliter of each sample was separated by electrophoresis through a 12% polyacrylamide denaturing gel and images were obtained as described in Example 21; a 585 nm filter was used with the FMBIO Image Analyzer. The scan of the resulting imaging apparatus is shown in Fig. 44.

In Fig. 44, lanes 1-3 contain the TET-labeled oligonucleotide 78 and lanes 4-6 contain the TET-labeled oligonucleotide 79. Lanes 1 and 4 contain reaction products that were not heat treated. Lanes 2 and 5 contain reaction products that were heat treated and lanes 3 and 6 contain reaction products that were heat treated and subjected to phosphatase treatment.

As shown in Fig. 44, the heat treatment produces a significant decomposition of DNA labeled with TET 5 ’, generating a scale of degradation products (Fig. 44, lanes 2, 3, 5 and 6). The intensities of the bands correlate with the placement of the purine and pyrimidine bases in the oligonucleotide sequences, indicating that hydrolysis of the main structure can occur through the formation of abrasive intermediates that have faster speeds for purines than for pyrimidines ( Lindahl and Karlström, Biochem, 12: 5151 [1973]).

Dephosphorylation reduces the mobility of all products generated by the thermal degradation process, observing the most pronounced effect on smaller products (Fig. 44, lanes 3 and 6). This demonstrates that thermally degraded products have a terminal 3 ’phosphoryl group that can be removed by dephosphorylation with CIAP. The removal of the phosphoryl group reduces the total negative charge by 2. Therefore, shorter products that have a small number of negative charges are influenced to a greater extent after the elimination of two charges. This leads to a greater change in mobility in shorter products than that observed in larger species.

The fact that most thermally degraded DNA products contain phosphate groups in the

Extreme 3 ’and products generated by the CLEAVASE enzyme did not allow the development of

Simple insulation for products generated in the INVASOR-directed cleavage test. The two additional charges found in thermal decomposition products do not exist in specific cleavage products. Therefore, if tests are designed that produce specific products that contain a positive net charge of one or two, then similar thermal decomposition products will be negative or neutral. The difference can be used to isolate specific products by reverse loading procedures as shown below.

b) Dephosphorylation of short amino-modified oligonucleotides can reverse the net charge of the labeled product

To demonstrate how oligonucleotides can be transformed from compounds with a negative net charge to compounds with a positive net charge, the four short amino-modified oligonucleotides indicated 70, 74, 75 and 76 and shown in Figs. 45-47 (Fig. 45 shows both oligonucleotide 70 and 74). The four modified oligonucleotides have Cy-3 dyes located at the 5 ′ end that are positively charged individually under the reaction and isolation conditions described in this example. Compounds 70 and 74 contain two modified amino thymidines which, under reaction conditions, have positively charged R-NH3 + groups attached to the C5 position through a C10 or C6 linker, respectively. Since compounds 70 and 74 are phosphorylated at the 3 ′ end, they consist of four negative charges and three positive charges. Compound 75 differs from 74 in that the internal C6 amino-modified thymidine phosphate of 74 is replaced by a thymidine methyl phosphonate. The main phosphonate structure is not charged and therefore there are a total of three negative charges in compound 75. This gives compound 75 a net negative charge. Compound 76 differs from 70 in that the internal amino-modified thymidine is replaced by an internal cytosine phosphonate. The pKa of the cytosine N3 nitrogen can be from 4 to 7. In this way, the net charges of this compound can be from -1 to 0 depending on the pH of the solution. For simplicity of the analysis, each group is assigned an integer number of charges, although it is observed that, depending on the pKa of each chemical group and the environmental pH, a real charge may differ from the assigned whole number. It is assumed that this difference is not significant in the pH range used in the enzymatic reactions studied herein.

The dephosphorylation of these compounds or the elimination of the terminal phosphoryl group at the 3 ′ end results in the elimination of two negative charges and generates products that have a positive net charge of one. In this experiment, the isoelectric focusing method (IEF) was used to demonstrate a change from a negative to a positive net charge for the substrates described during dephosphorylation.

Substrates 70, 74, 75 and 76 were synthesized by conventional phosphoramidite chemicals and deprotected for 24 hours at 22 ° C in 14 M aqueous ammonium hydroxide solution, after which the solvent was removed in vacuo. The dried powders were resuspended in 200 µl of H2O and filtered through 0.2 µm filters. The concentration of the stock solutions was estimated by UV absorbance at 261 nm of samples diluted 200 times in H2O using a spectrophotometer (Spectronic Genesys 2, Milton Roy, Rochester, NY).

Dephosphorylation of compounds 70 and 74, 75 and 76 was performed by treating 10 μl of crude stock solutions (varying in concentration of approximately 0.5 to 2 mM) with 2 CIAP units in 100 μl of CIAP buffer

(Promise) at 37 ° C for 1 hour. The reactions were then heated at 75 ° C for 15 min to inactivate the

CIAP. To provide greater clarity, dephosphorylated compounds are called "dp." For example,

after dephosphorylation, the substrate 70 becomes 70dp.

To prepare samples for IEF experiments, the concentration of the substrate stock solutions and dephosphorylated product were adjusted to a uniform absorbance of 8.5 x 10-3 at 532 nm by dilution with water. Two microliters of each sample were analyzed by IEF using a PhastSystem electrophoresis unit (Pharmacia) and PhastGel IEF 3-9 medium (Pharmacia) according to the manufacturer's protocol. The separation was carried out at 15 ° C with the following program: pre-separation; 2,000 V, 2.5 mA, 3.5 W, 75 Vh; load; 200 V, 2.5 mA, 3.5 W, 15 Vh; separation;

2,000 V; 2.5 mA; 3.5 W, 130 Vh. After separation, the samples were visualized using the FMBIO Image Analyzer (Hitachi) equipped with a 585 nm filter. The scan of the resulting imaging apparatus is shown in Fig. 48.

Fig. 48 shows results of separation by IEF of substrates 70, 74, 75 and 76 and their dephosphorylated products. The arrow where it says "Sample Charge Position" indicates a charge line, the "+" sign shows the position of the positive electrode and the "-" sign indicates the position of the negative electrode.

The results shown in Fig. 48 demonstrate that substrates 70, 74, 75 and 76 migrated to the positive electrode, while dephosphorylated products 70dp, 74dp, 75dp and 76dp migrated to the negative electrode. The differences observed in the direction of mobility were in accordance with the predicted net load of the strata (minus one) and the products (plus one). Small disturbances in the mobility of phosphorylated compounds indicate that global pIs vary. . This also happened in the case of dephosphorylated compounds. The presence of cytosine in 76dp, for example, displaced this compound further towards the negative electrode, which indicated a greater overall pI with respect to the other dephosphorylated compounds. It is important to note that additional positive charges can be obtained using a combination of natural aminomodified bases (70dp and 74dp) together with unloaded methylphosphonate bridges (products 75dp and 76dp).

The results shown above demonstrate that the elimination of a single phosphate group can change the net charge of an oligonucleotide to produce an inversion in the electric field, allowing easy separation of the products and that the precise base composition of the oligonucleotides affects the absolute mobility but not for the purpose of load inversion.

EXAMPLE 23 - Reference

Detection of specific cleavage products in the INVASOR-directed cleavage reaction by load inversion

In this example, the ability to isolate products generated in the invasive-directed cleavage test of all other nucleic acids present in the reaction combination using charge inversion was demonstrated. This experiment used the following oligonucleotide labeled with Cy3: 5’-Cy3-AminoT-AminoT-CTTTTCACCAGCGAGACGGG-3 ’(SEQ ID No. 50 called" oligo 61 "). Oligonucleotide 61 was designed to release a product labeled with a positive net charge after cleavage. To test whether a product labeled at the 5 'end with a net positive charge would be recognized or not by Cleavase® enzymes in the INVASOR-directed cleavage assay format, probe 61 oligonucleotide (SEQ ID No. 50) and chemically synthesized Invasive oligonucleotide 67 (SEQ ID No. 51) in a DNA synthesizer (ABI 391) using conventional phosphoramidite chemistry and reagents obtained from Glen Research (Sterling, VA).

Each test reaction comprised 100 fmol of M13mp18 single helix DNA, 10 pmol of the probe oligonucleotides (SEQ ID No. 50) and INVASOR (SEQ ID No. 51) and 20 units of CLEAVASE A / G in 10 µl of MOPS 10 solution mM, pH 7.4 with 100 mM KCl. The samples were covered with mineral oil to prevent

evaporation. Samples were taken at 50 ° C, 55 ° C, 60 ° C or 65 ° C and the cleavage was initiated by the addition of 1 µl of

40 mM MClCl. The reactions were allowed to continue for 25 minutes and then terminated by the addition of

10 μl of 95% formamide containing 20 mM EDTA and 0.02% methyl violet. Control experiment

negative lacked the target M13mp18 and was performed at 60 ° C. Five microliters of each reaction was loaded into separate wells of a 20% denaturing polyacrylamide gel (crosslinked 29: 1) with 8 M urea in a buffer containing 45 mM Tris-Borate (pH 8.3) and EDTA 1.4 mM. A 20-watt electric field was applied for 30 minutes, with the electrodes oriented as indicated in Fig. 49B (ie, in reverse orientation). The products of these reactions were visualized using the FMBIO fluorescent imaging apparatus and the scanning of the resulting imaging apparatus is shown in Fig. 49B.

Fig. 49A provides a schematic illustration showing an alignment of the INVASOR (SEQ ID No. 50) and the probe (SEQ ID No. 51) along the M13mp 18 DNA; Only 53 bases of the sequence of M13mp18 (SEQ ID No. 52) are shown. The INVASOR oligonucleotide sequence is presented below the M13mp18 target and an arrow is used above the M13mp18 sequence to indicate the position of the INVASOR with respect to the probe and the target. As shown in Fig. 49A, the INVASOR and probe oligonucleotides share a 2 base overlap region.

In Fig. 49B, lanes 1-6 contain reactions performed at 50 ° C, 55 ° C, 60 ° C and 65 ° C, respectively; lane 5 contained the control reaction (which lacked a target). In Fig. 49B, the cleavage products are seen as dark bands in the upper half of the panel; The weak observed lower band appears in proportion to the amount of primary product produced and, although it does not limit the invention to any particular mechanism, it may represent the cleavage of a nucleotide into the duplex. The uncleaved probe does not enter the gel and therefore is not visible. The control lane showed no detectable signal on the bottom (lane 5). As expected in an invasive cleavage reaction, the rate of accumulation of specific cleavage product was temperature dependent. Using these particular oligonucleotides and target, the maximum product accumulation rate was observed at 55 ° C (lane 2) and very little product was observed at 65 ° C (lane 4).

When incubated for prolonged periods at high temperature, the DNA probes can decompose in a non-specific way (that is, they can undergo thermal degradation) and the resulting fragments provide a background of interference to the analysis. The products of this thermal decomposition are distributed from individual nucleotides to the full length probe. In this experiment it was examined whether the separation capacity based on the loading of cleavage products (i.e., load inversion) would allow sensitive separation of specific target-dependent cleavage products from probe fragments generated by thermal degradation.

To test the sensitivity limit of this detection procedure, the target M13mp18 DNA was serially diluted tenfold with respect to the range of 1 fmol to 1 amol. The INVASOR and probe oligonucleotides were those described above (ie, SEQ ID NO: 50 and 51). Invasive excision reactions were performed as described above with the following modifications: the reactions were performed at 55 ° C, 250 mM KGlu was used

or 100 mM instead of 100 mM KCl and only 1 pmol of the INVASOR oligonucleotide was added. The reactions were started as described above and allowed to continue for 12.5 hours. A negative control reaction was also performed that lacked added M13m18 target DNA. The reactions were terminated by the

addition of 10 μl of 95% formamide containing 20 mM EDTA and 0.02% methyl violet and 5 μl of these

mixtures were subjected to electrophoresis and visualized as described above. The scan of the resulting imaging apparatus is shown in Fig. 50.

In Fig. 50, lane 1 contains the negative control; lanes 2-5 contain reactions performed using 100 mM KGlu; and lanes 6-9 contain reactions performed using 250 mM KGlu. The separate reactions in lanes 2 and 6 contained 1 fmol of target DNA; those on lanes 3 and 7 contained 100 amol of target; those of lanes 4 and 8 contained 10 amol of target and those of lanes 5 and 9 contained 1 amol of target. The results shown in Fig. 50 demonstrate that the limit of detection using load inversion to detect the production of specific cleavage products in an invasive cleavage reaction is 1 atomol or less or about 6.02 x 105 target molecules. No detectable signal was observed in the control lane, indicating that non-specific hydrolysis products or other degradation products do not migrate in the same direction as enzyme specific cleavage products. The maximum excitation and emission for Cy3 are 554 and 568, respectively, while the FMBIO Image Analyzer has an excitation at 532 and detection at 585. Therefore, the detection limit of specific cleavage products can be improved by means of use of a source of excitation and more matching detection filters.

EXAMPLE 24 - Reference

Devices and procedures for the separation and detection of charged reaction products

This example refers to procedures and devices for isolating and concentrating specific reaction products produced by enzymatic reactions carried out in solution, whereby the reactions generate products loaded from a neutral charge substrate or a substrate that carries the opposite charge to the product. of specific reaction. The procedures and devices of this example make it possible to isolate, for example, the products generated by the INVASOR-directed cleavage test.

The procedures and devices of this example are based on the principle that when an electric field is applied to a solution of charged molecules, the migration of the molecules to the electrode of the opposite charge occurs very quickly. If a matrix or other inhibitor material is introduced between the charged molecules and the opposite charge electrode in such a way that this rapid migration is dramatically slowed down, the first molecules to reach the matrix will almost stop, thus allowing the recovery of the molecules lagging behind In this way, a dispersed population of molecules loaded in solution can effectively concentrate on a smaller volume. By marking the molecules with a detectable moiety (for example, a fluorescent dye), the detection is facilitated both by the concentration and by the location of the analytes. This example illustrates two embodiments of devices contemplated by the present invention; Of course, variations of these devices will be apparent to those skilled in the art and fall within the spirit and scope of the present invention.

Fig. 51 represents an embodiment of a device for concentrating positively charged products generated using the methods of the present invention. As shown in Fig. 51, the device comprises a reaction tube (10) containing the reaction solution (11). One end of each of two thin capillaries (or other tubes with a hollow central part) (13A and 13B) are immersed in the reaction solution (11). The capillaries (13A and 13B) can be suspended in the reaction solution (11) so that they are not in contact with the reaction tube itself; An appropriate procedure to suspend the capillaries is to hold them in place with clamps (not shown). Alternatively, the capillaries can be suspended in the reaction solution (11) so that they are in contact with the reaction tube itself. Suitable capillaries include glass capillary tubes commonly available from companies that provide scientific material (for example, Fisher Scientific or VWR Scientific) or from medical product suppliers that have materials for blood collection and analysis. Although the present invention is not limited to capillaries of any particular internal diameter, tubes with internal diameters of up to about 1/8 inches (about 3 mm) are particularly preferred for use with the present invention; for example, Kimble tubes No. 73811-99 (VWR Scientific) have an internal diameter of 1.1 mm and are a suitable type of capillary type. Although the capillaries of the device are normally composed of glass, any rigid, flexible or non-conductive tubular material that may contain a conductive material or a capture material is suitable for use in the present invention. An example of a suitable flexible tube is the Tygon® transparent plastic tube (Part No. R3603; internal diameter = 0.16 centimeters; external diameter = 0.32 centimeters).

As illustrated in Fig. 51, the capillary 13A is connected to the positive electrode of a power source (20) (for example, a controllable energy source available at the laboratory equipment suppliers indicated above or at the material suppliers such as Radio Shack) and capillary 13B is connected to the negative electrode of the power source (20).

Capillary 13B is filled with a capture material (14) that can capture positively charged reaction products allowing minimal migration of products that have entered the capture material (14). Suitable capture materials include, but are not limited to, high percentage acrylamide (eg, about 20%) polymerized in a high salt buffer (0.5 M sodium acetate or higher

or a similar salt); such a high percentage of polyacrylamide matrix dramatically slows down the migration of positively charged reaction products. Alternatively, the capture material may comprise a negatively charged solid matrix, such as negatively charged latex beads, which can be attached to the incoming positively charged products. It should be noted that any amount of capture material (14) capable of inhibiting any concentration of positively charged reaction products can be used. Thus, although the capillary 13B of Fig. 51 only contains capture material in the submerged bottom of the tube, the capture material (14) may be present in the entire capillary (13B); similarly, less capture material (14) could be present than shown in Fig. 51, because positively charged reaction products generally accumulate within a very small part of the lower part of the capillary (13B). The amount of capture material only needs to be sufficient to come into contact with the reaction solution (11) and have the ability to collect the reaction products. When capillary 13B is not completely filled with capture material, the remaining space is filled with any conductive material (15); Suitable conductive materials are those described below.

By comparison, the capillary (13A) connected to the positive electrode of the power source 20 can be filled with any conductive material (15; indicated by the shaded lines in Fig. 51). This may be the reaction buffer of the sample (for example, 10 mM MOPS, pH 7.5 with 150 mM LiCl, 4 mM MnCl2), a conventional electrophoresis buffer (for example, 45 mM Tris-Borate, pH 8, 3, 1.4 mM EDTA), or the reaction solution itself (11). The conductive material (15) is often a liquid, but it could be easier to use a semi-solid material (for example, a gel) or other suitable material and is within the scope of the present invention. In addition, the capture material used in the other capillary (i.e. 13B) can also be used as the conductive material. On the contrary, it should be borne in mind that in the capillary 13B the same conductive material used in the capillary (13A) attached to the positive electrode can also be used to fill the space above the region containing the capture material (14) ( see Fig. 51).

The upper end of each of the capillaries (13A and 13B) is connected to the appropriate electrode of the power source (20) by an electrode cable (18) or other suitable material. . As a conductor cable, a thin platinum cable (for example, 0.1 to 0.4 mm, Aesar Johnson Matthey, Ward Hill, MA) is commonly used because it does not corrode under electrophoresis conditions. The electrode cable (18) can be attached to the capillaries (13A and 13B) by means of a non-conductive adhesive (not shown) such as silicone adhesives that are commonly sold in hardware stores to seal pipe fittings. capillaries are constructed of a flexible material, the electrode cable (18) can be fixed with a small hose clamp or constriction cable (not shown) to compress the opening of the capillaries around the electrode cable. If the conductive material (15) is a gel, a gel electrode cable (18) can be inserted directly into the capillary.

The cleavage reaction is mounted in the reaction tube (10) and allowed to continue as described in the previous examples (for example, Examples 22-23). Although there is no limitation to any particular reaction solution volume (11), the preferred volume is less than 10 ml and more preferably less than 0.1 ml. The volume only needs to be enough to allow contact with the two capillaries. After completion of the cleavage reaction, an electric field is applied to the capillaries by turning on the power source (20). As a result, positively charged products generated in the course of the INVASOR-directed cleavage reaction that employs an oligonucleotide, which when cleaved, generates a positively charged fragment (described in Example 23) but when not cleaved carries a net charge negative, they migrate to the negative capillary, where their migration is slowed or stopped by the capture material (14) and the thermally degraded and uncut negatively charged probe molecules migrate to the positive electrode. Through the use of this device or a similar device, the positively charged products of the invasive cleavage reaction are separated from the other material (i.e. the thermally degraded and uncut probe) and concentrated from a large volume. The concentration of the product in a small amount of capture material (14) simplifies the detection, with a ratio between signal and interference much greater than possible with the detection in the original reaction volume. Since the concentrated product is labeled with a detectable moiety as a fluorescent dye, a commercially available fluorescent plate reader (not shown) can be used to find out the amount of product. Suitable plate readers include both top and bottom laser readers. Capillary 13B can be placed with the reaction tube (10) in any desired position to accommodate use with an upper or lower plate reading device.

In the alternative embodiment of the present invention depicted in Fig. 52, the procedure described above is performed using only a single capillary (13B). The capillary (13B) contains the capture material

(14) described above and is connected to an electrode cable (18) which in turn is connected to the negative electrode of a power source (20). The reaction tube (10) has an electrode (25) inserted in its surface such that one surface of the electrode is exposed inside the reaction tube (10) and another surface is exposed outside the reaction tube. The surface of the electrode (25) outside the reaction tube is in contact with a conductive surface (26) connected to the positive electrode of the supply (20) by means of an electrode cable (18). Variations of the arrangement shown in Fig. 52 are also contemplated in the present invention. For example, the electrode (25) may be in contact with the reaction solution (11) through the use of a small hole in the reaction tube (10); furthermore, the electrode cable (18) can be attached directly to the electrode cable (18), thus eliminating the conductive surface (26).

As indicated in Fig. 52, the electrode (25) is embedded in the lower part of a reaction tube (10) such that one or more reaction tubes can be placed on the conductive surface (26). This conductive surface could serve as a negative electrode for multiple reaction tubes; Such a surface with appropriate contacts could be applied through the use of metal foils (for example, copper or platinum, Aesar Johnson Matthey, Ward Hill, MA) in much the same way that contacts are applied to circuits printed. Since such a surface contact would not be directly exposed to the reaction sample, less expensive metals, such as copper, could be used to make the electrical connections.

The above devices and procedures are not limited to the separation and concentration of positively charged oligonucleotides.

As will be apparent to those skilled in the art, negatively charged reaction products can be separated from positively charged or neutral reactants using the device and the above procedures with the exception that capillary 13B is attached to the positive electrode of the energy source (20 ) and capillary 13A or, alternatively, electrode 25, is attached to the negative electrode of the power source (20).

EXAMPLE 25

Primer-directed and primer-independent cleavage occurs at the same site when the primer extends to the 3 ’side of a“ bubble ”with mismatch in the downstream duplex

As described above in Example 1, the presence of a primer upstream of a duplex

bifurcated may influence the cleavage site and the existence of a gap between the 3 'end of the primer and the base of the duplex can cause a displacement site displacement to the 5' unpaired arm of the structure (see also Lyamichev et al. ., above and United States Patent No. 5,422,253). The resulting non-invasive displacement of the cleavage site in response to a primer is demonstrated in Figs. 8, 9 and 10, in which the primer used leaves a 4-nucleotide gap (with respect to the duplex base). In figures 8-10 all

"primer-directed" cleavage reactions produced a product of 21 nucleotides, while the reactions

Independent primer cleavage produced a 25 nucleotide product. The cleavage site obtained when the primer was extended to the base of the duplex was examined, leaving no gaps. The results are shown in Fig. 53 (Fig. 53 is a reproduction of Fig. 2C in Lyamichev et al.). These data were obtained from the cleavage of the structure shown in Fig. 5, as described in Example 1. Unless otherwise specified, the cleavage reactions comprised 0.01 pmol of terminal-labeled hairpin DNA. , denatured with heat (the complementary unlabeled chain also being present), 1 pmol of primer [complementary to the 3 'arm shown in Fig. 5 and having the sequence: 5'-GAATTCGATTTAGGTGACAC TATAGAATACA [SEQ ID NO: 53]) and 0.5 units of DNAPTaq (an estimated amount of 0.026 pmol) in a total volume of 10 μl of 10 mM Tris-Cl, pH 8.5 and 1.5 mM MgCl2 and 50 mM KCl. The primer was omitted from the reaction shown in the first lane of Fig. 53 was included in lane 2. These reactions were incubated at 55 ° C for 10 minutes. The reactions were started at the final reaction temperature by the addition of MgCl2 or the enzyme. The reactions were stopped at their incubation temperatures by the addition of 8 µl of 95% formamide with 20 mM EDTA and 0.05% marker dyes.

Fig. 53 is an autoradiogram indicating the effects of the cleavage site of a bifurcated duplex structure in the presence of a primer that extends to the base of the fork duplex. The size of the cleavage product released shows on the left (i.e., 25 nucleotides). On the right, a dideoxynucleotide sequencing scale of the cleavage substrate is shown as a marker (lanes 36).

These data show that the presence of a primer that is adjacent to a downstream duplex (lane 2) produces cleavage at the same site as seen in reactions performed in the absence of the primer (lane 1). (See other comparisons in Figs. 8A and B, 9B and 10A). When the 3 ′ terminal nucleotides of the upstream oligonucleotide can form base pairs with the template chain but are not homologous to the chain displaced in the region immediately upstream of the cleavage site (i.e., when the upstream oligonucleotide is

opening a “bubble” in the duplex), the site where the cleavage apparently moves does not depend entirely

of the presence of an upstream oligonucleotide.

As described above in the Background section and in Table 1, the requirement that two independent sequences be recognized in one assay provides a highly desirable level of specificity. In the invasive cleavage reactions of the present invention, the INVASOR oligonucleotides and probe should hybridize with the target nucleic acid with the correct orientation and separation to allow the production of the correct cleavage product. When the characteristic cleavage pattern does not depend on the satisfactory alignment of the two oligonucleotides in the detection system, these advantages of independent recognition are lost.

EXAMPLE 26

Invasive excision and primer-directed excision when there is only partial homology in the region of

“X” overlap

Although without limiting the present invention to any particular mechanism, invasive excision occurs when the cleavage site is changed to a site within the duplex formed between the probe and the target nucleic acid in a manner that is dependent on the presence of an oligonucleotide. chain up that shares a region of

overlap with the probe oligonucleotide down the chain. In some cases, the 5 ’region of the oligonucleotide chain

Low may not be completely complementary to the target nucleic acid. In these cases, excision of the probe can occur at an internal site within the probe even in the absence of an upstream oligonucleotide (as opposed to the base-by-base cutout observed when a fully paired probe is used without an INVASOR). Invasive excision is characterized by an apparent change of excision to a site within a downstream duplex that is dependent on the presence of INVASOR oligonucleotide.

A comparison between invasive excision and primer-directed excision can be illustrated by comparing the expected cleavage sites of a series of probe oligonucleotides having decreasing degrees of

complementarity with the target chain in the 5 ’region of the probe (that is, the region that overlaps with

INVADER). A simple test, similar to that performed on the anterior hairpin substrate (Ex. 25) can be performed to compare invasive excision with non-invasive primer-directed excision described above. This series of test oligonucleotides is represented in Fig. 54. The structures shown in Fig. 65 are grouped into

pairs, called "a", "b", "c" and "d". Each pair has the same probe sequence hybridized with the target chain

(SEQ ID No. 54), but the upper structure of each pair is drawn without an upstream oligonucleotide, while the lower structure includes this oligonucleotide (SEQ ID No. 55). The sequences of the probes shown in Figs. 54a-54d are indicated in SEQ ID NOS 32, 56, 57 and 58, respectively. Probable cleavage sites are indicated by the black arrowheads. (It should be noted that the precise cleavage site in each of these structures may vary depending on the choice of cleavage agent and other experimental variables. These particular sites are provided for illustrative purposes only.)

To perform this test, the cleavage site of each probe is determined both in the presence and absence of the upstream oligonucleotide, under reaction conditions such as those described in Example 18. Then

they compare the products of each pair of reactions to determine if the fragment released from the 5 ’end of the

probe increases in size when the upstream oligonucleotide is included in the reaction.

The arrangement shown in Fig. 54a, in which the probe molecule is completely complementary to the

target chain, is similar to that shown in Fig. 28. Treatment of the upper structure with nuclease 5 ’of

a DNA polymerase would produce exonucleolytic clipping of the probe (that is, in the absence of the upstream oligonucleotide). On the contrary, the inclusion of an INVASOR oligonucleotide would produce a distinctive excision change similar to those observed in Fig. 29.

The arrangements shown in Figs. 54b and 54c have some amount of unpaired sequence in the

5 ’end of the probe (3 and 5 bases, respectively). These small 5 ’arms are a suitable cleavage substrate for 5’ nucleases and would be cleaved within a 2 nucleotide distance of the junction between the single helix region and the duplex. In these arrangements, the 3 'end of the upstream oligonucleotide shares identity with a part of the 5' region of the probe that is complementary to the target sequence (i.e., the 3 'end of the INVASOR has to compete for binding to the target with a part of the 5 'end of the probe). Thus,

when the upstream oligonucleotide is included, it is believed that mediates a change in the cleavage site to the downstream duplex (although the present invention is not limited to any particular mechanism of action) and, therefore,

This would constitute an invasive excision. the 5 ’end nucleotides of the unpaired region of the probe

could hybridize with the target chain, the cleavage site in the absence of INVASOR could change, but the addition of the invading oligonucleotide would still change the cleavage site to the appropriate position.

Finally, in the arrangement shown in Fig. 54d, the probe and the upstream oligonucleotides do not share significant regions of homology and the presence of upstream oligonucleotide would not compete for target binding with the probe. Excision of the structures shown in Fig. 5 4d would occur at the same site with or without upstream oligonucleotide and, therefore, would not constitute invasive excision.

By examining any pair of upstream oligonucleotide / probe in this manner, it can be readily determined whether the resulting cleavage is invasive or simply directed by primer. This analysis is particularly useful when the probe is not completely complementary to the target nucleic acid, so that the expected result may not be obvious by simple inspection of the sequences.

EXAMPLE 27 - Reference

Modified CLEAVASE enzymes

To develop nucleases that have useful activities for nucleic acid cleavage, the following modified nucleases were produced.

a) Nuclease CLEAVASE BN / thrombin

i) Cloning and expression of CLEAVASE BN / thrombin nuclease

Targeted mutagenesis was used to introduce a protein sequence recognized by the thrombin protease into the CLEAVASE BN nuclease region that is believed to form the helical arc of the protein through which the single helix DNA that is cleaved should supposedly pass. performed mutagenesis using the TransformerTM mutagenesis kit (Clonetech, Palo Alto, CA) according to the manufacturer's protocol using the 5'-GGGAAAGTC-CTCGCAGCCGCGCG GGACGAGCGTGGGGGCCCG (SEQ ID No. 59) mutagenic oligonucleotide. After mutagenesis, the DNA was sequenced to verify the insertion of the thrombin cleavage site. The DNA sequence encoding Cleaase® BN / thrombin nuclease is provided in SEQ ID NO: 60; The amino acid sequence of the CLEAVASE BN / thrombin nuclease is provided in SEQ ID NO: 61.

A large-scale preparation of the thrombin mutant (ie CLEAVASE BN / thrombin) was performed using E. coli cells that overexpressed the CLEAVASE BN / thrombin nuclease as described in Example 28.

ii) CLEAVASE BN / thrombin thrombin cleavage

Six coma four (6.4) mg of the CLEAVASE BN / purified thrombin nucleus with 0.4 U of thrombin (Novagen) was digested for 4 hours at 23 ° C or 37 ° C. Complete digestion was verified by electrophoresis on a 15% polyacrylamide SDS gel followed by staining with Coomassie R Bright Blue. As a control, wild-type CLEAVASE BN nuclease with thrombin was also digested. The resulting gel is shown in Fig. 61.

In Fig. 61, lane 1 contains molecular weight markers (Low-Range Protein Molecular Weight Markers; Promega), lane 2 contains CLEAVASE BN nuclease / undigested thrombin, lanes 3 and 4 contain CLEAVASE BN nuclease / digested thrombin with thrombin at 23 ° C for 2 and 4 hours, respectively and lanes 5 and 6 contain CLEAVASE BN nuclease / thrombin digested with thrombin at 37 ° C for 2 and 4 hours, respectively. These results show that the CLEAVAGE BN / thrombin nuclease has an apparent molecular weight of 36.5 kilodalton and demonstrates that the CLEAVAGE BN / thrombin nuclease is effectively cleaved by thrombin. In addition, thrombin cleavage products have approximate molecular weights of 27 kilodalton and 9 kilodalton, the expected size based on the position of the thrombin site inserted into the CLEAVASE BN / thrombin nuclease.

To determine the level of fork cleavage activity in the CLEAVASE BN / digested and undigested thrombin nuclease, dilutions were made and used to cleave a test fork containing a marker of

5 ’fluorescein. Variable amounts of CLEAVASE BN nuclease / digested and undigested thrombin were incubated with 5 μM oligonucleotide fork (SEQ ID No. 29; see Fig. 26) in 10 mM MOPS (pH 7.5), Tween-20 at 0.05%, 0.05% NP-40 and 1 mM MnCl2 for 5 minutes at 60 ° C. The digested mixture was electrophoresed on a 20% acrylamide gel and visualized on a Hitachi FMBIO 100 fluorescent imaging apparatus. The resulting image is shown in Fig. 62.

In Fig. 62, lane 1 contains the enzyme-free control, lane 2 contains reaction products produced using 0.01 ng of CLEAVASE BN / thrombin nuclease, lanes 3, 4 and 5 contain reaction products produced using 0, 01 ng, 0.04 ng and 4 ng of CLEAVASE BN nuclease / undigested thrombin, respectively and lanes 6, 7 and 8 contain reaction products produced using 0.01 ng, 0.04 ng and 4 ng of CLEAVASE BN nuclease / thrombin digested with thrombin, respectively. The results shown in Fig. 62 showed that insertion of the thrombin cleavage site reduced the cleavage activity approximately 200 times (with respect to the activity of the CLEAVASE BN / thrombin nuclease activity), but that digestion with thrombin did not reduce the activity significantly.

M13 single helix DNA was used as a substrate for cleavage by CLEAVASE BN nuclease and CLEAVASE BN nuclease / digested and undigested thrombin. Seventy nanograms of single-propelled M13 DNA (NEB) were incubated in 10 mM MOPS, pH 7.5, 0.05% Tween-20, 0.05% NP-40, 1 mM MgCl2 or 1 mM MnCl2, with 8 ng CLEAVASE BN nuclease, CLEAVASEBN nuclease / undigested thrombin or CLEAVASE BN nuclease / digested thrombin for 10 minutes at 50 ° C. The reaction mixtures were electrophoresed on an agarose gel at

0.8% and then stained with a solution containing 0.5 μg / ml ethidium bromide (EtBr) to visualize the

DNA bands. A negative image of the gel stained with EtBr is shown in Fig. 63.

In Fig. 63, lane 1 contains the enzyme-free control, lane 2 contains reaction products produced using CLEAVASE BN nuclease and 1 mM MgCl2, lane 3 contains reaction products produced using CLEAVASE BN nuclease and 1 mM MnCl2, the lane 4 contains reaction products produced using CLEAVASE BN nuclease / undigested thrombin and 1 mM MgCl2, lane 5 contains reaction products produced using CLEAVASE BN nuclease / undigested thrombin and 1 mM MnCl2, lane 6 contains reaction products produced using CLEAVASE BN nuclease / thrombin digested with thrombin and 1 mM MgCl2 and lane 7 contains reaction products produced using CLEAVASE BN nuclease / thrombin digested with thrombin and 1 mM MnCl2. The results shown in Fig. 63 showed that the CLEAVASE BN / thrombin nuclease had a greater ability to

cleaving circular DNA (and therefore, a reduced need for the presence of a free 5 ’end) in comparison

with the nuclease CLEAVASE BN.

From these data it can be seen that the helical arc of these proteins can be opened without destroying the enzyme or its ability to specifically recognize cleavage structures. The CLEAVASE BN / thrombin mutant has a greater ability to cleave without reference to a 5 ′ end, as described above. The ability to cleave these structures will allow the excision of long molecules, such as genomic DNA that, although often not circular, may have many desirable cleavage sites that are quite removed from

any 5 ’end available. Excision structures can be made at these sites by folding the

chains (ie CFLP® cleavage) or by the inclusion of structure-forming oligonucleotides (Patent for

United States No. 5,422,253). It is also possible that the 5 ’ends of nucleic acids are not available

due to the union of a substance too large to be threaded through the helical arc. These binding moieties may include proteins such as streptavidin or antibodies or solid supports such as beads or the walls of a reaction vessel. A cleavage enzyme with an opening in the loop in the helical arc can cleave DNA that is configured in this way, expanding the number of ways in which reactions using enzymes can be formatted.

b) Nuclease CLEAVASE DN

i) CLEAVASE DN nuclease expression and cloning

A mutant deficient in the polymerization of Taq DNA polymerase, called CLEAVASE DN nuclease, was constructed. The CLEAVASE DN nuclease contains an asparagine residue instead of the wild-type aspartic acid residue at position 785 (D785N).

DNA encoding the CLEAVASE DN nuclease was constructed from the gene encoding CLEAVASE A / G (mutTaq, Ex. 2) in two rounds of directed mutagenesis. First, the G at position 1397 and the G at position 2264 of the CLEAVASE A / G gene (SEQ ID No. 21) were changed to A in both positions to recreate a wild-type DNAPTaq gene. As a second round of mutagenesis, the wild-type DNAPTaq gene became the CLEAVASE DN gene by changing the G position 2356 to A. These manipulations were performed as indicated below.

DNA encoding the CLEAVASE A / G nuclease was re-cloned from plasmid pTTQ18 (Ex. 2) into plasmid pTrc99A (Pharmacia) in a two step procedure. First, the pTrc99A vector was modified by removing the G at position 270 of the pTrc99A map, creating the cloning vector pTrc99G. To this end, the plasmid pTrc99A DNA was cut with NcoI and the recessive 3 'ends introduced using the E. coli Klenow fragment of polymerase I in the presence of the four dNTP at 37 ° C for 15 min. After inactivation of the Klenow fragment by incubation at 65 ° C for 10 min, the plasmid DNA was cut with EcoRI, the ends were reintroduced using the Klenow fragment in the presence of the four dNTP at 37 ° C for 15 min. The Klenow fragment after inactivation by incubation at 65 ° C for 10 min. Plasmid DNA was precipitated with ethanol, recirculated by ligation and used to transform E. coli cells JM109 (Promega). Plasmid DNA was isolated from individual colonies and the deletion of the G at position 270 of the pTrc99A map was confirmed by DNA sequencing.

As a second stage, DNA encoding the CLEAVASE A / G nuclease of plasmid pTTQ18 was removed using EcoRI and SalI and the DNA fragment carrying the CLEAVASE A / G nuclease gene was separated on a 1% agarose gel and isolated with the Geneclean II kit (Bio 101, Vista, CA). The purified fragment was ligated to the pTrc99G se vector that had been cut with EcoRI and SalI. The ligation mixture was used to transform competent E. coli JM109 (Promega) cells. Plasmid DNA was isolated from individual colonies and the insertion of the CLEAVASE A / G nuclease gene was confirmed by restriction analysis using EcoRI and SalI.

The plasmid DNA of pTrcAG carrying the Cleaase® A / G nuclease gene cloned into the pTrc99A vector was purified from 200 ml of a overnight culture of JM109 using the QIAGEN Plasmid Maxi kit (QIAGEN, Chatsworth, CA) according to the manufacturer's protocol. Plasmid pTrAGAG DNA was mutagenized using two mutagenic primers, E465 (SEQ ID No. 62) (Integrated DNA Technologies, Iowa) and R754Q (SEQ ID No. 63) (Integrated DNA Technologies) and the Trans Oligonucleotide AlwNI / SpeI selection primer ( Clontech, Palo Alto, CA, Catalog No. 6488-1) in accordance with the Transformer Directed Mutagenesis kit protocol (Clontech, Palo Alto, CA) to produce a restored wild-type DNAPTaq (pTrcWT) gene.

Plasmid pTrcWT DNA carrying the wild-type DNAPTaq gene cloned into the pTrc99A vector was purified from 200 ml overnight culture of JM109 using the QIAGEN Plasmid Maxi kit (QIAGEN, Chatsworth, CA) according to the protocol manufacturer. Then pTrcWT was mutagenized using the D785N mutagenic primer (SEQ ID No. 64) (Integrated DNA Technologies) and the Switch Oligonucleotide SpeI / AlwNI selection primer (Clontech, Catalog No. 6373-1) according to the protocol of the Directed Mutagenesis kit TransformerTM (Clontech) to create a plasmid containing DNA encoding the CLEAVASE DN nuclease. The DNA sequence encoding the CLEAVASE DN nuclease is provided in SEQ ID NO: 65; The amino acid sequence of the CLEAVASE DN nuclease is provided in SEQ ID No. 66.

A large-scale preparation of the Cleavase® DN nuclease was performed using E. coli cells that overexpressed the CLEAVASE DN nuclease as described in Example 28.

c) Nucleasa CLEAVASE DA and Nucleasa CLEAVASE DV

Two mutants deficient in the polymerization of Taq DNA polymerase, called CLEAVASE DA and CLEAVASE DV nuclease, were constructed. The CLEAVASE DA nuclease contains an alanine residue instead of the wild-type aspartic acid residue at position 610 (D785A). The CLEAVASE DV nuclease contains a valine residue instead of the wild-type aspartic acid residue at position 610 (D610V).

i) Construction and expression of CLEAVASE DA and CLEAVASE DV nucleases

To construct vectors encoding the CLEAVASE DA and DV nucleases, the CLEAVASE A / G nuclease gene contained within pTrcAG was mutagenized with two mutagenic primers, R754Q (SEQ ID No. 63) and D610AV (SEQ ID No. 67) and the primer Trans Oligonucleotide AlwNI / SpeI selection (Clontech, Catalog No. 6488-1) according to the TransformerTM Directed Mutagenesis Kit (Clontech) protocol to create a plasmid containing DNA encoding the CLEAVASE DA nuclease or the CLEAVASE DV nuclease. Oligonucleotide D610AV was synthesized to have a purine, A or G, at position 10 from the 5 ′ end of the oligonucleotide. After mutagenesis, plasmid DNA was isolated from individual colonies and the type of mutation present, DA or DV, was determined by DNA sequencing. The DNA sequence encoding the CLEAVASE DA nuclease is provided in SEQ ID NO: 68; the amino acid sequence of the CLEAVASE DA nuclease is provided in SEQ ID No. 69. The DNA sequence encoding the CLEAVASE DV nuclease is provided in SEQ ID No. 70; The amino acid sequence of the CLEAVASE DV nuclease is provided in SEQ ID No. 71.

d) Nuclease CLEAVASE Tth DN

i) Construction and expression of CLEAVASE Tth DN nuclease

The DNA polymerase enzyme of the bacterial species Thermus thermophilus (Tth) was produced by cloning the gene of this protein into an expression vector and overproducing it in E. coli cells. Genomic DNA was prepared from 1 vial of Thermus thermophilus of dried strain HB-8 from the ATCC (ATCC No. 27634) as described in Ex. 28a. The DNA polymerase gene was amplified by PCR as described in Ex. 27b using the following primers: 5'-CACGAATTCCGAGGCGAT-GCTTCCGCTC-3 '(SEQ ID No. 254) and 5'-TCGACGTCGACTAACCCTTGGCGGAAAGCC-3' (SEQ ID No. 255) , as described in Ex. 28a.

The resulting PCR product was digested with the restriction endonucleases EcoR I and SalI and inserted into the plasmid vector pTrc99g (described in Example 27b) digested with EcoRI / SalI by ligation, as described in Example 27b, to create the plasmid pTrcTth-1. This Tth polymerase construct lacks a single nucleotide

which was inadvertently omitted from oligonucleotide 5 ’, resulting in the polymerase gene

I was out of phase. This error was corrected by pTrcTth-1 mutagenesis as described in Example 27b using the following oligonucleotide: 5’-GCATCGCCTCGGAAT-TCATGGTC-3 ’(SEQ ID NO. 256), to create plasmid pTrcTth-2. The Tth DN construct was created by mutation of the sequence encoding an aspartic acid from position 787 to a sequence encoding asparagine. Performed mutagenesis of pTrcTth-2 with the following oligonucleotide: 5’-CAGGAGGAGCTCGTTGTGGACCTGGA-3 ’(SEQ ID No. 257) as described in Example 27b, to create plasmid pTrcTth-DN. The resulting polymerase deficient nuclease, Cleavase® TthDN, was expressed and purified as described in Ex. 28.

A large-scale preparation of the CLEAVASE DA and CLEAVASE DV nucleases was performed using E. coli cells overexpressing the CLEAVASE DA nuclease or CLEAVASE DV nuclease as described in Example

28.

EXAMPLE 28

Cloning and expression of thermostable FEN-1 endonucleases

Sequences encoding thermostable FEN-1 proteins from three species of Archaebacteria were cloned and over-expressed in E. coli. This example involved: a) cloning and expression of an FEN-1 endonuclease from Methanococcus jannaschii; b) cloning and expression of an FEN-1 endonuclease from Pyrococcus furiosus; c) cloning and expression of an FEN-1 endonuclease from Pyrococcus woesei; d) cloning and expression of an FEN-1 endonuclease from Archaeoglobus fulgidus; e) large-scale preparation of recombinant thermostable FEN-1 proteins; and f) activity assays using FEN-1 endonucleases.

a) Cloning and expression of an FEN-1 endonuclease from Methanococcus jannaschii

The DNA encoding the Methanococcus jannaschii FEN-1 endonuclease (M. jannaschii) was isolated from M. jannaschii cells and inserted into a plasmid under the transcriptional control of an inducible promoter as follows. Genomic DNA was prepared from 1 vial of the M. jannaschii viva bacteria (DSMZ, Sammlung von Mikroorganismen und Zellkulturen, Braunschweig, Germany, No. 2661) the XTRAX DNA kit (Gull Laboratories, Salt

Lake City, UT), according to the manufacturer's protocol. The final DNA pellet was resuspended in 100 μl of

TE (10 mM Tris HCl, pH 8.0, 1 mM EDTA). One microliter of the DNA solution was used in a PCR using the AdvantageTM cDNA PCR kit (Clonetech); PCR was performed according to the manufacturer's recommendations. The 5 'end primer (SEQ ID NO: 72) is complementary to the 5' end of the open reading phase of Mja FEN-1 with a substitution of a base to create an NcoI restriction site (a genome fragment of M. jannaschii that contains the gene encoding FEN-1 of M. jannaschii (Mja) is available in GenBank with accession number U67585). The 3 'end primer (SEQ ID No. 73) is complementary to a sequence approximately 15 base pairs downstream of the 3' end of the open reading phase of Mja FEN-1 with 2 base substitutions to create a site of restriction enzyme SalI. The sequences of the 5 ’and 3’ end primers are: 5’-GGGATACCA TGGGAGTGCAGTTTGG-3 ’(SEQ ID No. 72) and 5’-GGTAAATTTTTCTCGTCGA CATCCCAC-3’ (SEQ ID No. 73), respectively. The PCR reaction resulted in the amplification (ie, production) of a single main band with a length of approximately 1 kilobase. The open reading frame (ORF) encoding Mja FEN-1 endonuclease is provided in SEQ ID NO: 74; The amino acid sequence encoded by this ORF is provided in SEQ ID No. 75.

After PCR amplification, the entire reaction was electrophoresed on a 1.0% agarose gel and the main band was cleaved from the gel and purified using the Geneclean II kit (Bio101, Vista, CA) according to The manufacturer's instructions. Approximately 1 μg of the gel purified Mja FEN-1 PCR product was digested with NcoI and SalI. After digestion, the DNA was purified using the Geneclean II kit according to the manufacturer's instructions. A microgram of the pTrc99a vector (Pharmacia) was digested with NcoI and SalI in preparation for ligation with the digested PCR product. One hundred nanograms of the digested pTrc99a vector and 250 ng of the Mja FEN-1 PCR product were combined and ligated to create pTrc99-MJFEN-1. pTrc99-MJFEN-1 was used to transform competent E. coli JM109 cells (Promega) using conventional techniques.

b) Cloning and expression of an FEN-1 endonuclease from Pyrococcus furiosus

DNA encoding Pyrococcus furiosus FEN-1 endonuclease (P. furiosus) was obtained by PCR amplification using a plasmid containing DNA encoding P. furiosus FEN-1 endonuclease (Pfu) (obtained from Dr. Frank Robb, Center of Marine Biotechnology, Baltimore, MD). DNA sequences encoding a portion of Pfu FEN-1 endonuclease can be obtained in GenBank (Accession No. AA113505 and W36094. The amplified Pfu FEN-1 gene was inserted into the expression vector pTrc99a (Pharmacia) to place the Pfu FEN-1 gene under the transcriptional control of the inducible trc promoter. PCR amplification was performed as follows. One hundred microliter reactions contained 50 mM Tris HCl, pH 9.0, (NH4) 2SO4. mM, 2 mM MgCl2, 50 mM dNTP, 50 pmol of each primer, 1 U of Tfl polymerase (Epicenter Technologies, Madison, WI) 1 ng of plasmid DNA containing the FEN-1 gene. The 5 'end primer (SEQ ID No. 76) is complementary to the 5 'end of the Pfu FEN-1 open reading frame with two substitutions to create an NcoI restriction site and the 3' end primer (SEQ ID No. 77) is complementary to a region located approximately 30 base pairs downstream of the open reading frame FEN-1 ta with two substitutions to create a PstI site. The sequences of the 5 ′ and 3 ’end primers are: 5’-GAGGTGATACCATG GGTGTCC-3’ (SEQ ID No. 76) and 5’-GAAACTCTGCAGCGCGTCAG-3 ’(SEQ ID No. 77), respectively. The PCR reaction resulted in the amplification of a single main band with a length of approximately 1 kilobase. The open reading frame (ORF) encoding Pfu FEN-1 endonuclease is provided in SEQ ID NO: 78; the amino acid sequence encoded by this. The ORF is provided in SEQ ID No. 79.

After PCR amplification, the entire reaction was electrophoresed on a 1.0% agarose gel and the main band was cleaved from the gel and purified using the Geneclean II kit (Bio101) according to the manufacturer's instructions . Approximately 1 μg of the gel purified Pfu FEN-1 PCR product was digested with NcoI and PstI. After digestion, the DNA was purified using the Geneclean II kit according to the manufacturer's instructions. A microgram of the pTrc99a vector was digested with Pstl before ligation with the digested PCR product. One hundred nanograms of digested pTrc99a and 250 ng of the Pfu FEN-1 PCR product were combined and ligated to create pTrc99-PFFEN1. pTrc99-PFFEN1 was used to transform competent E. coli JM109 cells (Promega) using conventional techniques.

c) Cloning and expression of an FEN-1 endonuclease from Pyrococcus woesei

For the cloning of DNA encoding Pyrococcus woesei (Pwo) FEN-1 endonuclease, DNA was prepared from lyophilized P. woesei bacteria (DSMZ No. 3773) as described (Zwickl et al., J. Bact., 172 : 4329 [1990]) with several changes. In summary, a vial of P. woesei bacteria was rehydrated and resuspended in 0.5 ml of LB (Luria broth). The cells were centrifuged at 14,000 x g for 1 min and the cell pellet was resuspended in 0.45 ml of TE. 50 microliters of 10% SDS were added and the mixture was incubated at RT for 5 min. The cell lysate was then extracted three times with 1: 1 phenol: chloroform and three times with chloroform. Five hundred microliters of isopropanol was added to the extracted lysate and the DNA was pelleted by centrifugation at 14,000 x g for 10 min. The DNA pellet was washed in 0.5 ml of 70% ethanol and the DNA was pelleted again by centrifugation at

14,000 x g for 5 min. The DNA pellet was dried and resuspended in 100 µl of tE and used for

PCR reactions without further purification.

To generate a FEN-1 gene fragment of P. woesei for cloning in an expression vector, a low-severity PCR was attempted with primers complementary to the ends of the open reading phase of the FEN-1 gene of P. furiosus. The sequences of the 5 ’and 3’ end primers are 5’-GATACCATGGGTGTCCCAATTGGTG-3 ’(SEQ ID No. 80) and 5’-TCGACGTCGACTTATCTCTTGAACCAACTTTCAAGGG (SEQ ID No. 81) respectively. The high level of sequence similarity of protein homologs (ie, proteins other than FEN-1) of P. furiosus and P. woesei suggested that there was a high probability that the FEN-1 gene of P. woesei was amplified using primers containing sequences complementary to the FEN-1 gene of P. furiosus. However, this strategy was not satisfactory in several different PCR conditions.

The DNA sequence of FEN-1 genes from P. furiosus and M. jannaschii were aligned and sequence identity blocks were identified between the two genes. These blocks were used to design internal primers (i.e., complementary to sequences located internally at the 5 'and 3' ends of the ORF) for the FEN-1 gene that are complementary to the P. furiosus FEN-1 gene in those conserved regions. The sequences of the 5 ’and 3’ internal primers are 5’-AGCGAG-GGAGAGGCCCAAGC-3 ’(SEQ ID No. 82) and 5’-GCCTATGCCCTTTATTCCTCC-3’ (SEQ ID No. 83) respectively. PCR was performed using these internal primers using the AdvantageTM PCR kit and resulted in the production of a ~ 300 bp main band

Since PCR with the internal primers was successful, reactions containing mixtures of the internal (SEQ ID No. 82 and 83) and external (SEQ ID No. 80 and 81) attempts were attempted. A reaction that contained the primer

external of the 5 'end (SEQ ID No. 80) and the internal primer of the 3' end (SEQ ID No. 83) resulted in the production of a 600 bp band and a reaction containing the internal primer of the 5 'end (SEC ID No. 82) and the external primer of the 3 'end (SEQ ID No. 81) resulted in the production resulted in the production of a 750 bp band. These overlapping DNA fragments were gel purified and combined with the external primers (SEQ ID NO. 80 and 81) in a PCR reaction. This reaction generated a 1 kb DNA fragment that contained the entire open reading frame of the Pwo FEN-1 gene. The resulting PCR product was gel purified, digested and ligated exactly as described above for the PCR product of the Mja FEN1 gene. The resulting plasmid was named pTrc99-PWFEN1. pTrc99-PWFEN1 was used to transform cells of

E. coli JM109 (Promega) competent using conventional techniques.

d) Cloning and expression of an FEN-1 endonuclease from Archueoglobus fulgidus

The preliminary sequence of the 2.2 million base Archaeoglobus fulgidus (Afu) chromosome was downloaded from the global TIGR (The Institute for Genomic Research) global network page and imported into a software program (MacD-NAsis) , used to analyze and manipulate DNA and protein sequences. The sequence without commenting was translated into the 6 possible reading frames, each comprising approximately 726,000

amino acids. In each frame, the individual presence of the amino acid sequence “VFDG” (valine,

phenylalanine, aspartic acid, glycine), a sequence that is conserved in the FEN-1 family. The amino acid sequence was found in an open reading frame that contained other amino acid sequences conserved in the FEN-1 genes and that was approximately the same size as the other FEN-1 genes. The DNA sequence of the ORF is shown in SEQ ID No. 164, while the protein sequence of the ORF is shown in SEQ ID No. 165. Based on the position of this amino acid sequence in the reading phase, the sequence was identified. DNA sequence encoding a supposed FEN-1 gene.

Sequence information was used to design oligonucleotide primers that were used for PCR amplification of the genomic DNA FEN-1 type sequence of A. fulgidus. Genomic DNA was prepared from A. fulgidus as described in Ex. 29a in relation to M jannaschii, with the exception that a vial (approximately 5 ml culture) of A. fulgidus viva bacteria from DSMZ ( DSMZ No. 4304). For the PCR reaction

one microliter of genomic DNA was used as described in Ex. 29a. The 5 'end primer is complementary to the 5' end of the Afu FEN-1 gene with the exception that it has a substitution of 1 base pair to create an Nco I site. The 3 'end primer is complementary to end 3 'of the Afu FEN-1 gene chain below the FEN-1 ORF with the exception that it contains a 2 base substitution to create a SalI site. The sequences of the 5 ’and 3’ primers are 5’-CCGTCAACATTTACCATGGGTGCGGA-3 ’(SEQ ID No. 166) and 5’-CCGCCACCTCGTAGTCGACATCCTTTTCGTG-3’ (SEQ ID No. 167) respectively.

Cloning of the resulting fragment was as described for the PfuFEN1 gene, above, to create plasmid pTrc99-AFFEN1. Plasmid pTrcAfuHis was constructed by modifying pTrc99-AFFEN1, by adding a histidine tail to facilitate purification. To add this histidine tail, primer-directed mutagenesis procedures were used by standard PCR in order to insert the coding sequence for six histidine residues between the last amino acid codon of the pTrc99-AFFEN1 coding region and the termination codon . The resulting plasmid was called pTrcAfuHis. The protein was then expressed as described in example 28f) and purified by binding to a Ni ++ affinity column as described in Example 8.

d) Cloning and expression of an FEN-1 endonuclease from Methanobacterium thermoautotrophicum

In a provisional list of all open reading phases of the genome of Methanobacterium thermoautotrophicum (Mth) on the page of the global global network of Genome Therapeutics, amino acid sequences conserved in the FEN-1 genes were searched. In an open reading frame that also contained other conserved FEN-1 sequences, the amino acid sequence "VFDG" (valine, phenylalanine, aspartic acid, glycine) was found. SEQ ID No. 260 provides the Mth FEN-1 ORF DNA sequence indicated by Genome Therapeutics, while SEQ ID No. 261 provides the Mth FEN-1 ORF protein sequence as indicated by Genome Therapeutics. However, this open reading phase was 259 amino acids in length, compared to the other archaebacterial FEN-1 genes, which are approximately 325 amino acids in length. To determine the cause of this discrepancy, the DNA sequence for Mth FEN1 was obtained in an identical manner to that described above in the case of Afu FEN-1.

After examining the sequence, it was evident that the open reading frame could be extended to 328 amino acids by deletion of a single base approximately at position 750 of the open reading frame. The additional amino acid sequence added by deleting a base has an identity of 39% with the same region of the P. furiosus FEN-1 gene. The DNA sequence of the supposed Mth FEN-1 gene was used to design oligonucleotide primers complementary to the 5 ’and 3’ ends of the gene. This 5 ’oligonucleotide is complementary to the 5’ end of the Mth FEN-1 gene with the exception that it contains 2 substitutions that create an NcoI site. Oligonucleotide 3 ’is complementary to the 3’ end of the gene approximately 100 base pairs downstream from where the true open reading frame is believed to end. This region contains a natural PstI site. The 5 ’and 3’ oligonucleotide sequences are 5’-GGGTGTTCCCATGGGAGTTAAACTCAGG-3 ’(SEQ ID No. 262) and 5’-CTGAATTCTGCAGAAAAAGGGG-3’ (SEQ ID No. 263) respectively.

Genomic DNA was prepared from 1 vial of frozen M. thermoautotrophicum bacteria from the ATCC (ATCC No. 29096) as described in Ex. 28a. PCR, cloning, expression and purification of Mth FEN-1 were performed as described in Examples 28a and 28f, with the exception that PstI was used instead of SalI. The resulting plasmid was named pTrc99-MTFEN1. Sequencing of the cloned Mth FEN-1 gene revealed the

presence of an additional "T" nucleotide compared to the genomic sequence published in the global global network. This remainder of "T" in position 775 of the FEN-1 open reading frame produces a frame change, creating the larger open reading frame that was originally thought based on comparison with the FEN genes of other organisms. SEQ ID No. 264 provides the DNA sequence of the Mth ORF the present invention, while SEQ ID No. 265 provides the sequence sequence of the Mth FEN-1 protein sequence of the present invention.

f) Large-scale production of recombinant thermostable FEN-1 proteins

The FEN-1 proteins of Mja, Pwo and Pfu were purified by the following technique obtained from a Taq DNA polymerase preparation protocol (Engelke et al., Anal. Biochem., 191: 396 [1990]) as indicated a continuation. E. coli cells (strain JM109) containing pTrc99-PFFEN1, pTrc99-PWFEN1 or pTrc99-MJFEN1 in 3 ml of LB (Luria Broth) containing 100 μg / ml ampicillin were inoculated and cultured for 16 hours

at 37 ° C. The overnight culture was inoculated in 200 ml or 350 ml of LB containing 100 μg / ml of ampicillin and

It was grown at 37 ° C with vigorous stirring to an A600 of 0.8. IPTG (1 M stock solution) was added to a final concentration of 1 mM and the culture was continued for 16 h at 37 ° C.

The induced cells settled and the cell pellet was weighed. An equal volume of DG 2X buffer (100 mM Tris-HCl, pH 7.6, 0.1 mM EDTA) was added and the pellet was resuspended by stirring. Fifty mg / ml lysozyme (Sigma) was added at a final concentration of 1 mg / ml and the cells were incubated at room temperature for 15 min. Deoxycholic acid (10% solution) was added dropwise at a final concentration of 0.2% while vortexing. A volume of H2O and 1 volume of DG 2X buffer was added and the resulting mixture was sonicated for 2 minutes on ice to reduce the viscosity of the mixture. After sonication, 3M (NH4) 2SO4 was added to a final concentration of 0.2M and the lysate was centrifuged at 14,000 x g for 20 min at 4 ° C. The supernatant was removed and incubated at 70 ° C for 60 min, after which 10% polyethylimine (PEI) was added to 0.25%. After incubation on ice for 30 min, the mixture was centrifuged at 14,000 x g for 20 min at 4 ° C. At this point, the supernatant was removed and the FEN-1 proteins were precipitated by the addition of (NH4) 2SO4 as indicated below.

For the Pwo and Pfu FEN-1 preparations, the FEN-1 protein was precipitated by the addition of 2 volumes of 3M (NH4) 2SO4. The mixture was incubated overnight at room temperature for 16 h and the protein was centrifuged at 14,000 x g for 20 min at 4 ° C. The protein pellet was resuspended in 0.5 ml of buffer Q (50 mM Tris-HCl, pH 8.0, 0.1 mM EDTA, 0.1% Tween 20). For the preparation of Mja FEN-1, solid (NH4) 2SO4 was added to a final concentration of 3 M (saturated ~ 75%), the mixture was incubated on ice for 30 min and the protein was centrifuged and resuspended as has been previously described.

Resuspended protein preparations were quantified by the determination of A279 and electrophoresis was subjected to a 10% polyacrylamide SDS gel (29: 1 acrylamide: bis-acrylamide) in standard Laemmli buffer [Laemmli, Nature 277: 680 [ 1970]) aliquots containing 2-4 μg of total protein and stained with Coomassie R Bright Blue. The results are shown in Figure 64.

In Fig. 64, lane 1 contains molecular weight markers ((Mid-Range Protein Molecular Weight Markers Promega); the size of the marker proteins is indicated to the left of the gel. Lane 2 contains purified CLEAVASE BN nuclease; Lanes 3-5 contain extracts prepared from E. coli expressing the FEN-1 nuclei of Pfu, Pwo and Mja, respectively. The calculated molecular weight (ie, using a translation of the DNA sequence encoding the nuclease) of the Pfu FEN-1 nuclease is 38,714 dalton and the calculated molecular weight for the Mja FEN-1 nuclease is 37,503 Daltons. The Pwo and Pfu FEN-1 proteins combined in the SDS-PAGE gel and so therefore, it was estimated that the molecular weight of the Pwo FEN-1 nuclease was 38.7 kDa

g) Activity Assays using FEN-1 Endonucleases

i) Mixed Fork Test

The CLEAVASE BN nuclease has an affinity approximately 60 times greater for a 12-base pair stem-loop structure than for an 8 base pair stem-loop DNA structure As an assay for differences in activity between the CLEAVASEBN nuclease and FEN-1 nucleases, a mixture of oligonucleotides that had an 8 or 12 bp stem-loop (see Fig. 60 presenting oligonucleotides S-33 and 11-8-0) was incubated with an extract prepared from E. coli cells that overexpressed the Mja FEN-1 nuclease (prepared as described above). The reactions contained 0.05 µM of oligonucleotides S-33 (SEQ ID No. 84) and 11-8-0 (SEQ ID No. 85) (both oligonucleotides contained 5 'fluorescein markers), 10 mM MOPS, pH 7, 5, 0.05% Tween-20, 0.05% NP-40, 1 mM MnCl2. The reactions were heated at 90 ° C for 10 seconds, cooled to 55 ° C, then 1 µl of crude extract (Mja FEN-1) or purified enzyme (CLEAVASE BN nuclease) was added and the mixtures were incubated at 55 ° C for 10 minutes; a control without enzyme was also performed. The reactions were stopped by the addition of formamide / EDTA, the samples were electrophoresed in a denaturing 20% acrylamide gel and visualized in a Hitachi FMBIO 100 fluorescent imaging apparatus. The resulting image is shown in Fig. 65.

In Fig. 65, lane 1 contains the reaction products generated by the Nuclease CLEAVASE BN N, lane 2 contains the reaction products of the control reaction without enzyme and lane 3 contains the reaction products generated by the nuclease FEN-1 of Mja. The data shown in Fig. 76 demonstrate that the CLEAVASE BN nuclease strongly prefers the S33 structure (12 bp stem-loop), while the Mja FEN-1 nuclease cleaves structures that have an 8 or 12 bp stem-loop structure. with about the same efficiency. This shows that Mja's FEN-1 nuclease has a different substrate specificity than CLEAVASE BN nuclease, a useful feature for INVASOR assays or CFLP® analysis as described in the Description of the Invention.

EXAMPLE 29

Terminal deoxynucleotidyl transferase selectively extends the cleavage products directed by INVASOR

Most thermal degradation products of DNA probes will have a 3 'end phosphate. To investigate whether the template-independent DNA polymerase, terminal deoxynucleotidyl transferase (TdT) can extend polymerization of the aforementioned 3 ′ phosphates (i.e., add nucleotide triphosphate to the 3 ′ end), the following experiment was performed.

To create a sample containing a large percentage of thermal degradation products, the 5'34-078-01 fluorescein-labeled oligonucleotide (SEQ ID No. 86) (200 pmol) was incubated in 100 µl of 10 mM NaCO3 (pH 10, 6), 50 mM NaCl at 95 ° C for 13 hours. To prevent evaporation of the samples, the reaction mixture was covered with 60 µl of ChillOut ™ liquid wax. The reaction mixture was then divided into two equal aliquots (A and B). Aliquot A was mixed with a volume of one tenth of 3M NaOAc followed by three volumes of ethanol and stored at -20 ° C. Aliquot B was dephosphorylated by the addition of 0.5 μl of 1 M MgCl 2 and 1 μl of 1 unit / μl Calf Alkaline Intestinal Phosphata (CIAP) (Promega) with incubation at 37 ° C for 30 minutes. An equal volume of phenol: chloroform: isoamyl alcohol (24: 24: 1) was added to the sample followed by vortexing for one minute and then centrifuging for 5 minutes at maximum speed in a microcentrifuge to separate the phases. The aqueous phase was removed to a new tube to which a volume of one tenth of 3M NaOAc and three volumes of ethanol were added, followed by storage at -20 ° C for 30 minutes. Then, the two aliquots (A and B) were centrifuged for 10 minutes at maximum speed in a microcentrifuge to sediment the DNA. The sediments were then washed twice with 80% ethanol each time and then dried to dryness. The dried sediments were then dissolved in 70 μl of ddH2O each.

TdT reactions were performed as indicated below. Six mixtures were mounted, all mixtures contained 10 mM TrisOAc (pH 7.5), 10 mM MgOAc, 50 mM KCl and 2 mM dATP Mixtures 1 and 2 contained a pmol of 34-078-01 (SEQ ID NO: 86) untreated, mixtures 3 and 4 contained 2 μl of aliquots A (above) and mixtures 5 and 6 contained 2 μl of aliquot B (above). To each 9 μl of mixtures 1, 3 and 5 1 μl of ddH2O was added, to each 9 μl of mixtures 2, 4 and 6, 1 μl of 20 units / μl of TdT (Promega) was added. The mixtures were incubated at 37 ° C for 1 hour and then the reaction was terminated by the addition of 5 µl of 95% formamide with 10 mM EDTA and dyes

0.05% markers. Five microliters of each mixture was separated by electrophoresis through a 20% denaturing acrylamide gel (crosslinked 19: 1) with 7 M urea, in a buffer containing 45 mM Tris-Borate (pH 8.3), EDTA 1 , 4 mM and images were obtained with a 505 nm filter with the FMBIO Image Analyzer. The scan of the resulting imaging apparatus is shown in Fig. 66.

In Fig. 66, lanes 1, 3 and 5 contain 34-078-01 (SEQ ID No. 86) untreated, 34-078-01 heat degraded and dephosphorylated 34-078-01, respectively incubated in the absence of TdT . Lanes 2, 4 and 6 contain 34 078-01 heat degraded, 34-078-01 dephosphorylated and heat degraded, respectively incubated in the presence of TdT.

As shown in Fig. 66, lane 4, TdT was unable to extend the thermal degradation products containing

a phosphate group at the 3 'end and selectively extends molecules that have a hydroxyl group at the 3' end. -

EXAMPLE 30

Specific TdT extension of INVASOR-directed cleavage products with subsequent capture and detection on nitrocellulose supports

When TdT is used to extend specific cleavage products, one way to detect prolonged products is the selective capture of extension products on a solid support before visualization. This example demonstrates that cleavage products can be selectively prolonged by use of TdT and deoxynucleotide triphosphate and that prolonged products can be visualized by capture using a complementary oligonucleotide attached to a nitrocellulose support.

To extend the cleavage product produced in an INVASOR-directed cleavage reaction, the following experiment was performed. Three reaction mixtures were mounted, each in a 10 mM MES buffer (pH 6.5), 0.5% Tween-20 and 0.5% NP-40. The first mixture contained 5 fmol of M13mp18 target DNA, 10 pmol of probe oligonucleotide 32-161-2 (SEQ ID No. 87; this probe oligonucleotide contains 3 'ddC and a Cy3 amidite group near the 3' end) and 5 pmol of the oligonucleotide INVASOR TM 32-161-1 (SEQ ID No. 88; this oligonucleotide contains a 3 'ddC). The second mixture contained the probe and INVASOR oligonucleotides without target DNA. The third mixture was the same as the first mixture and contained the same probe sequence, but with a 5 'fluorescein label (oligonucleotide 32-161-4 [SEQ ID NO. 89; this oligonucleotide contains a 3' ddC, fluorescein marker 5 'and an amidite group Cy3 near the 3'] end), so that the cleavage products directed by

INVASOR could be detected before and after excision by means of fluorescent imaging. The probe-only control sample contained 10 pmol of oligonucleotide 32 161-2 (SEQ ID No. 87). Each 3 μl of enzyme mixture contained 5 ng of CLEAVASE DN nuclease in 7.5 mM MgCl2. The mixture of TdT (per 4 μl) contained: 10 U of TdT (Promega), 1 M CoCl2, 50 mM KCl and 100 μM dTTP. The cleavage reaction mixtures

with INVASOR described above, they were mounted in thin-walled tubes and the reactions were

initiated by the addition of 3 μl of CLEAVASE DN enzyme mixture. The reactions were incubated at 65 ° C for 20 min. After cooling to 37 ° C, 4 µl of the TdT mixture was added and the samples were incubated for 4 min at 37 ° C, then Biotin-16-dUTP was added at 100 µM and the samples were incubated for 50 min at 37 ° C. The reactions were terminated by the addition of 1 μl of 0.5 M EDTA.

To analyze the efficacy of prolongation, the products were processed on an acrylamide gel. Four were mixed

microliters of each reaction mixture with 2.6 μl of 95% formamide, 10 M EDTA and 0.05% methyl violet and heated to 90 ° C for 1 min and 3 μl were loaded on a denaturing acrylamide gel at 20 % (crosslinked 19: 1) with 7 M urea, in buffer containing 45 mM Tris-Borate (pH 8.3) and 1.4 mM EDTA. A marker was also added (FX174-HinfI [fluorescein labeled]). After electrophoresis, the gel was analyzed using an FMBIO-100 Image Analyzer (Hitachi) equipped with a 505 nm filter. The resulting scan is shown in Fig. 67.

In Fig. 67, lane 1 contained only probe 32-161-2, without any treatment. Lanes 2 and 3 contained the products of reactions performed without target DNA, without or with prolongation by TdT, respectively. Lanes 4 and 5 contained the products of reactions performed with target DNA, probe oligonucleotide 32-161-4 (SEQ ID No. 87) and oligonucleotide INVASOR 32-161-1 (SEQ ID No. 88), with or without prolongation with subsequent TdT respectively. Lanes 6 and 7 show the reaction products containing target DNA, probe oligonucleotide 32-161-4 (SEQ ID No. 89) and oligonucleotide INVASOR 32-161-1 (SEQ ID No. 88), with or without prolongation by TdT later, respectively. Lane "M" contains the X174-HinfI marker. The reaction products of lanes 4 and 5 were the same as those observed in lanes 6 and 7, with the

except that the absence of a 5 'fluorescein in the probe prevents the detection of the 5' product released (indicated as "A" near the bottom of the gel) or the 5 'product extended by TdT (indicated as "B" near from the top of the gel). The 3 ′ part labeled with Cy3 of the cleaved probe is visible in all these reactions (indicated as "C", just below the center of the gel).

To demonstrate the detection of target-dependent INVASOR cleavage products on a solid support, the reactions of lanes 3 and 5 were tested in the Universal GENECOMB (Bio-Rad) which is a conventional nitrocellulose matrix on a rigid support of Nylon designed in a comb format, as shown in Fig. 68. The manufacturer's protocol was followed with a modification: 10 µl of the cleavage reactions directed by INVASOR were used instead of the recommended 10% of a PCR. To capture the cleavage products, 2.5 pmol of capture oligonucleotide 59-28-1 (SEQ ID No. 90) was punctually applied to each tooth. The capture and display stages were performed according to the manufacturer's instructions. The results are shown in Figure 68.

In Fig. 68, teeth with numbers 6 and 7 show the results of capturing reactions performed without and with target DNA present. Tooth 8 shows the positive control of the kit.

The darkness of the stain observed in tooth 7, compared to tooth 6, clearly indicates that products of INVASOR-directed cleavage tests can be specifically detected on solid supports. Although Universal GENECOMB was used to demonstrate solid support capture in this case, other support capture procedures known to those skilled in the art would be equally suitable. For example, beads or reaction vessel surfaces can be easily coated with capture oligonucleotides so that they can be used at this stage. Alternatively, similar solid supports can be easily coated with streptavidin or antibodies for the capture of biotin-labeled or hapten-labeled products of the cleavage / prolongation reaction. In any of these embodiments, the products can be appropriately visualized by detecting fluorescence, chemiluminescence, colorimetric changes, radioactive emissions, resulting optical density changes or any other distinguishable product characteristics.

EXAMPLE 31

Comparison of the effects of invasion length and 5 ’marker of the probe on cleavage directed by INVASOR by the PA CLEAVASE A / G and FEN-1 nucleases

To investigate the effect of invasion length as well as the effect of the type of dye on the ability of Pfu FEN-1 and CLEAVASE A / G nuclease to cleave 5 'arms, the following experiment was performed. Three similar sequence probes labeled with fluorescein, TET or Cy3, were mounted in reactions with three INVASOR oligonucleotides that created hybridization regions with eight, five and three base overlapping targets along the target nucleic acid, M13mp18

The reactions were performed as follows. All conditions were performed in duplicate. Enzyme mixtures were assembled for Pfu FEN-1 and CLEAVASE A / G nuclease. Each 2 µl of the Pfu FEN-1 mixture contained 100 ng of Pfu FEN-1 (prepared as described in Ex. 28) and 7.5 mM MgCl2. Each 2 μl of the CLEAVASE A / G mixture contained 5.3 ng of the CLEAVASE A / G nuclease and 4.0 mM MnCl2. Six master mixtures containing buffer, M13mp18 and INVASOR oligonucleotides were mounted. Each 7 μl of mixtures 1-3 contained 1 fmol of M13mp18, d 10 pmol of oligonucleotide INVASOR (34-078-4 [SEQ ID No. 39], 24-181-2 [SEQ ID No. 91] or 24-181-1 [SEQ ID NO. 92] in 10 mM MOPS (pH 7.5), 150 mM LiCl Each 7 μl of mixtures 4-6 contained 1 fmol of M13mp18, d 10 pmol of oligonucleotide INVASOR (34-078-4 [SEQ ID No. 39], 24-181-2 [SEQ ID No. 91] or 24181-1 [SEQ ID No. 92] in 10 mM Tris (pH 8.0) Mixtures 1-6 were then divided into three mixtures each, to which the fluorescein-labeled probe (oligonucleotide 34-078-01; SEQ ID No. 86), the probe labeled with Cy3 (oligonucleotide 43-20; SEQ ID No. 93) or the probe labeled with TET (oligonucleotide 90; SEQ ID No. 32 containing a 5 'TET marker) Each 7 µl of all mixtures contained 10 pmol of corresponding probe.The DNA solutions described above were covered with 10 µl evaporation barrier

CHILLOUT and were taken at 68 ° C.

The reactions obtained from mixtures 1-3 were started with 2 μl of the CLEAVASE A / G nuclease mixture and the reactions obtained from mixtures 4-6 were started with 2 μl of the FEN-1 mixture. Pfu. After 30 minutes at 68 ° C, the reactions were stopped by adding 8 µl of 95% formamide with 10 mM EDTA and 0.05% marker dyes. The samples were heated at 90 ° C for 1 minute immediately before electrophoresis through a denaturing 20% polyacrylamide gel (19: 1 cross-linking), with 7 M urea, in a buffer containing 45 mM Tris · Borate (pH 8 , 3), 1.4 mM EDTA. The products of the cleavage reactions were visualized after electrophoresis by the use of an apparatus for the formation of Hitachi FMBIO fluorescent images. The results of the fluorescein labeled probe are shown in Fig. 69, the results of the Cy3 labeled probe in Fig. 70 and the results of the TET labeled probe in Fig. 71. In each of these figures , CLEAVASE A / G cleavage products are shown on lanes 1-6 and Pfu FEN-1 cleavage products are shown on lanes 7-12. In all cases, the uncut material appears as a very dark band near the top of the gel, indicated by a "U" on the left. The cleavage products directed by INVASOR oligonucleotides with 8, 5 or 3 overlapping bases (ie, the "X" region had a length of 8, 5 or 3 nucleotides) are shown in the first, second and third pair of lanes in each series, respectively and the 5 'marked ends released from these reactions are indicated by the numbers 8,

5 and 3 on the left. It should be noted that in the cleavage reactions shown in Fig. 70, the presence of the positively charged Cy3 dye causes shorter products to migrate more slowly than larger products. These products do not contain any additional positive charge (for example, amino modifications such as those used in Ex. 23) and therefore, still carry a net negative charge and migrate to the positive electrode in a conventional electrophoresis separation.

From these data it can be seen that the nucleases with specificity of structure FEN-1 of Pfu and CLEAVASE A / G respond differently to both the identity of the dye and the size of the piece to be excised from the probe. Pfu FEN-1 nuclease showed much less variability in the response to the identity of the dye than the CLEAVASE A / G nuclease, demonstrating that any dye would be suitable for use with this enzyme. On the contrary, the amount of catalyzed cleavage for the CLEAVASE A / G nuclease it varied substantially with the identity of the dye. The use of the fluorescein dye gave results very similar to those observed with Pfu FEN-1 nuclease, while the use of Cy3 or TET provided a dramatically reduced signal compared to Pfu FEN-1 reactions. The only exception to this was in the cleavage of the 3 nucleotide product carrying a TET dye (lanes 5 and 6, Fig. 71), in which the CLEAVASE A / G nuclease provided cleavage at the same rate as the FEN nuclease. 1 of Pfu. These data indicate that, although CLEAVASE A / G can be used to cleave probes labeled with these other dyes, Pfu FEN-1 nuclease is a preferred nuclease for cleaving probes labeled with Cy3 and TET.

EXAMPLE 32

Examination of the effects of a positive 5 ’charge on the rate of invasive excision using nucleases

CLEAVASE A / G FEN-1 from Pfu

To investigate whether positive charges at the 5 ’end of probe oligonucleotides containing one or more adducts

positively charged (i.e., load inversion technology or CRT probes as described in Ex. 23 and 24 have an effect on the ability of Pfu CLEAVASE A / G or FEN-1 nucleases to cleave the 5 'arm of the probe, the following experiment was performed.

In the reactions with INVASOR two probe oligonucleotides were used that had the following sequences: Probe 34-180-1: (N-Cy3) TNH2TNH2CCAGAGCCTAATTTGCC AGT (N-fluorescein) A, in which N represents a spacer containing Cy3 or a group fluorescein (SEQ ID No. 94) and probe 34-180-2: 5 '- (N-TET) TTCCAGAGCC TAATTT-GCCAGT- (N-fluorescein) A, in which N represents a spacer containing the TET or fluorescein group (SEQ ID No. 95). Probe 34-180-1 has amino modifiers at the two T residues at the 5 ’end and a Cy3 marker at the 5’ end, creating additional positive charges at the 5 ’end. Probe 34180-2 has a TET marker at the 5 ’end, with no additional positive charges. The fluorescein marker at the 3 'end of the 34-180-1 probe allows visualization of the 3' cleaved products and probes not cleaved together in an acrylamide gel processed in the conventional direction (i.e., migrating the DNA to the positive electrode). The 5 'cleaved product of the 34-180-1 probe has a positive net charge and will not migrate in the same direction as the uncleaved probe and, therefore, is displayed by separation in a gel processed in the opposite direction (it is say, migrating this DNA towards the negative electrode).

The reactions were performed as follows. All conditions were performed in duplicate. Enzyme mixtures were assembled for Pfu and CLEAVASE A / G nucleases. Each 2 µl of the Pfu FEN-1 mixture contained 100 ng of Pfu FEN-1 (prepared as described in Ex. 28) and 7.5 mM MgCl2. Each 2 μl of the CLEAVASE A / G nuclease mixture contained 26.5 ng of the CLEAVASE A / G nuclease and 4.0 mM MnCl2. Six master mixtures containing buffer, M13mp18 and INVASOR oligonucleotides were mounted. Every 7 μl of

mixture 1 contained 5 fmol of M13mp18, 10 pmol of oligonucleotide INVASOR 123 (SEQ ID No. 96) in 10 mM HEPES (pH 7.2). Each 7 μl of mixture 2 contained 1 fmol of M13mp18, 10 pmol of oligonucleotide INVASOR 123 in 10 mM HEPES (pH 7.2). Each 7 µl of mixture 3 contained 5 fmol of M13mp18, 10 pmol of oligonucleotide INVASOR 123 in 10 mM HEPES (pH 7.2), 250 mM KGlu. Each 7 μl of mixture 4 contained 1 fmol of M13mp18, 10 pmol of oligonucleotide INVASOR 123 in 10 mM HEPES (pH 7.2), 250 mM KGlu. For every 7 μl of each mixture,

added 10 pmol of probe 34-180-1 (SEQ ID No. 94) or probe 34-180-2 (SEQ ID No. 95). The DNA solutions described above were covered with 10 µl of CHILLOUT evaporation barrier and brought to 65 ° C. The reactions prepared from mixtures 1-2 were initiated by the addition of 2 μl of the Pfu FEN-1 mixture and the reactions prepared from mixtures 3-4 were initiated by the addition of 2 μl of the mixture of CLEAVASE A / G nuclease. After 30 minutes at 65 ° C, the reactions were stopped by adding 8 µl of 95% formamide with 10 mM EDTA. The samples were heated at 90 ° C for 1 minute immediately before electrophoresis through a denaturing 20% polyacrylamide gel (19: 1 cross-linking), with 7 M urea, in a buffer containing 45 mM Tris · Borate (pH 8 , 3), 1.4 mM EDTA and a 20% native acrylamide gel (crosslinked at 29: 1) in a buffer containing 45 mM Tris-Borate (pH 8.3) and 1.4 mM EDTA.

The products of the cleavage reactions were visualized after electrophoresis by the use of an apparatus for the formation of Hitachi FMBIO fluorescent images. The resulting images are shown in Figs. 72. Fig. 72A shows the denaturing gel that was processed in the conventional electrophoresis direction and Fig. 72B shows the native gel that was processed in the reverse direction. The reaction products produced by the Pfu and CLEAVASE A / G nucleases FEN-1 are shown in lanes 1-8 and 9-16, respectively. The products of the 5 fmol reactions of M13mp18 and 1 fmol of M13mp18 are shown in lanes 1-4, 9-12 (6 fmol) and 5-8, 13-16 (1 fmol). Probe 24-180-1 is on lanes 1-2, 5-6, 9-10, 13-14 and probe 34-180-2 is on lanes 3-4, 7-8, 11-12, 15-16.

The fluorescein-labeled 3 'end fragments of all cleavage reactions are shown in Fig. 72A and are indicated by a "3" mark on the left. Products marked with TET 5 'of 3 nucleotides are not visible in this figure, while products marked with Cy3 5' are shown in Fig. 72B.

The 3 ′ end bands of Fig. 72A can be used to compare cleavage rates by enzyme differences in the presence of the different 5 ’end markers. By this band it can be seen that

Regardless of the amount of target nucleic acid present, both Pfu FEN-1 nuclease and CLEAVASE A / G nuclease show more product from the TET 5 ′ labeled probe. With Pfu FEN-1 nuclease this preference is modest, with an increase in the signal of only 25 to 40%. However, in the case of the CLEAVASE A / G nuclease there is a strong preference for the TET 5 ’marker. Therefore, although when the charge inversion procedure is used to separate the products, a substantial amount of product is observed in the CLEAVAGE A / G nuclease catalyzed reactions, the Pfu FEN-1 nuclease is a preferred enzyme for excision of probes marked with Cy3.

EXAMPLE 33

The use of universal bases in the detection of erroneous pairings by split directed by INVASOR

The term "degenerate base" refers to a base in a nucleotide that does not form hydrogen bonds in a conventional form of "Watson-Crick" with a specific complementary base (ie, A with T and G with C). For example, the inosine base can be made to pair by means of one or two hydrogen bonds with all

the natural bases (the effect of "wobble") and therefore is called degenerate. Alternatively, a degenerate base may not form base pairs; This type of base has been called a “universal” base because

it can be placed in the opposite position to any nucleotide in a duplex and although it cannot contribute to stability by the formation of base pairs, it does not actively destabilize pushing the opposite base. The duplexes that use these universal bases are stabilized only by stacking interactions. Two examples of universal bases, 3-nitropyrrole and 5-nitroindole, are shown in Fig. 73. In hybridization, the placement of a 3 nitropyrrole at three bases in a wrong pairing position improves the differential recognition of mismatches of a base. The best discrimination seems to be due to the destabilization effect of the unnatural base (that is, an altered Tf very close to the wrong mating). To test this same principle as a way to detect substantially mismatches using the INVASORTM-directed cleavage test, INVASOR oligonucleotides were designed using the universal bases shown in Fig. 73, in the presence or absence of a natural mating mismatch. In these experiments, the use of a single nitropyrrole base or nitroindole base pairs that flank the mating site was examined.

The target, probe and INVASOR oligonucleotides used in these assays are shown in Fig. 74. A 43 nucleotide oligonucleotide (oligonucleotide 109; SEQ ID No. 97) was used as the target. The probe oligonucleotide (oligonucleotide 61; SEQ ID No. 50) releases a product marked with a net positive charge after cleavage. In Fig. 74, the INVASOR oligonucleotide is schematically shown above the target oligonucleotide as an arrow; The large arrowhead indicates the location of the mismatch between the INVASOR oligonucleotides and the target. Below the target oligonucleotide is the completely natural INVASOR oligonucleotide (ie, without universal bases) and completely complementary (oligonucleotide 67; SEQ ID No. 51) and an INVASOR oligonucleotide compound containing universal bases ("X") on either side of the mismatch ("M"). The following INVASOR oligonucleotides were used: oligonucleotide 114 (SEQ ID No. 98) which

contains a single nucleotide mismatch; oligonucleotide 115 (SEQ ID No. 99) containing two bases of 5-nitroindole and no mismatch; oligonucleotide 116 (SEQ ID No. 100) containing two bases of 5-nitroindole and a single nucleotide mismatch; oligonucleotide 112 (SEQ ID No. 101) containing a 3-nitropyrrole base and no mismatch; oligonucleotide 113 (SEQ ID No. 102) containing a 5-nitropyrrole base and a single nucleotide mismatch; and oligonucleotide 67 (SEQ ID No. 51) which is completely complementary to the target.

IINVASOR-directed cleavage reactions were performed in 10 µl of 10 mM MOPS (pH 7.2), 100 mM KCl containing 1 µM of the appropriate invasive oligonucleotide (oligonucleotide 67, 112-116), synthetic target 109 10 nM, probe 61 marked with 1 μM Cy3 and 2 CLEAVASE DV units (prepared as described in Ex. 27). The reactions were covered with Chill-Out® liquid wax, brought to the appropriate reaction temperature, 52 ° C, 55 ° C

or 58 ° C and started with the addition of 1 µl of 40 mM MnCl2. The reactions were allowed to continue for 1 hour and stopped by the addition of 10 µl of formamide. A quarter of the total volume of each reaction was loaded on gels

20% non-denaturing polyacrylamide that underwent electrophoresis in the reverse direction. The products were visualized using a Hitachi FMBIO-100 fluorescent scanner using a 585 nm filter. . The resulting images are shown in Figs. 75A-C. In each panel, lanes 1-6 contain reaction products of reactions using oligonucleotide INVASOR 67, 114, 115, 116, 112 and 113, respectively. The reactions performed at 52 ° C, 55 ° C and 58 ° C are shown in Panels A, B and C, respectively.

These data show that two flanking 5-nitroindoles have a significantly greater differentiation than a 3-nitropyrrole system or hybridization of all natural bases and this increase in sensitivity does not depend on temperature. This demonstrates that the use of universal bases is a useful way to detect substantially single base mismatches between the target nucleic acid and the detection oligonucleotide complex of the present invention.

EXAMPLE 34 - Reference

Detection of point mutations in the human oncogene using a mini-wave

This document demonstrates that very short probes can be used for sensitive detection of target nucleic acid sequences (Ex. 37). In this example it is shown that short probes work very poorly when they mismatch with the target and therefore can be used to distinguish a given nucleic acid sequence from a closely related one with a difference in only a single base. To analyze this system, synthetic target sequences of the human oncogene were created that varied among themselves in one position. Oligonucleotide 166 (SEQ ID No. 103) provided the wild type ras target sequence. Oligonucleotide 165 (SEQ ID No. 104) provided the mutant ras target sequence. The sequence of these oligonucleotides is shown in Fig. 76 and the sequence variation site at the site corresponding to codon 13 of the ras gene is indicated. The oligonucleotide INVASOR (oligo 162) has the following sequence: 5'-GSCSTSCSASASGSGSCSACTCTTGCC TACGA-3 '(SEQ ID No. 105), in which "S" indicates thiol bonds - (ie, these are 2'-deoxynucleotides-5' -O- (1thromophosphate)). The mini-wave (oligonucleotide 161) has the sequence: 5 '- (N-Cy3) TNH2TNH2CACCAG-3' (SEQ ID No. 106) is designed to detect the mutant ras target sequence (i.e., it is completely complementary to oligonucleotide 165). The stacking oligonucleotide (oligonucleotide 164) has the sequence: 5’-CSTSCSCSASASCS TSASCCACAAGTTTATATTCAG-3 ’(SEQ ID No. 107). A scheme showing the assembly of these oligonucleotides in a cleavage structure is shown in Fig. 76.

Each cleavage reaction contained 100 nM of both the invading oligonucleotide (oligonucleotide 162) and the stacking oligonucleotide (oligonucleotide 164), 10 µM Cy3 labeled probe (oligonucleotide 161) and 100 pM of oligonucleotide 165 or oligonucleotide 166 (target DNA) at 10 μl of 10mM HEPES (pH 7.2), 250 mM KGlu, MnCl2

4 mM The DNA mixtures were covered with mineral oil, heated at 90 ° C for 15 s and then brought to a reaction temperature of 47 ° C, 50 ° C, 53 ° C or 56 ° C. The reactions were initiated by the addition of 1 μl of 100 ng / μl of PEN FEN-1. The reactions were allowed to continue for 3 hours and stopped by the addition of 10 µl of formamide. A quarter of the total volume of each reaction was charged to 20% non-denaturing polyacrylamide gel that was electrophoresed in the reverse direction. The gel was scanned using a Hitachi FMBIO-100 fluorescent scanner equipped with a 585 nm filter and the resulting image is shown in Fig. 77.

In Fig. 77, for each reaction temperature tested, reaction products containing the target sequence of mutant ras (oligonucleotide 165) or wild type (oligonucleotide 166) are shown.

These data demonstrate that the mini-wave can be used to discriminate sensitively between sequences that differ in a single nucleotide. The minison was cleaved producing a strong signal in the presence of the mutant target sequence, but a small or zero amount of minison was cleaved in the presence of the wild type target sequence. In addition, discrimination between closely related targets is effective in a temperature range of at least 10 ° C, which is a much wider range of temperatures than can normally be tolerated when the selection is based solely on hybridization (eg, hybridization with ASO ). This suggests that the enzyme may be a factor in discrimination, the minison being perfectly coupled to the preferred substrate compared to the decoupled minison. In this way, this system provides a sensitive and specific detection of target nucleic acid sequences.

EXAMPLE 35

Identity effects of the 3 ’end on the cleavage site of a model oligonucleotide structure

As described in the previous Examples, structure-specific nucleases cleave near the junction between regions of single helix and with base pairing in a bifurcated duplex, usually approximately one base pair in the region with base pairing. In Example 10 it was shown that

5 ’thermostable nucleases, including those of the present invention (eg, CLEAVASE BN nuclease, nuclease

CLEAVASE A / G), have the ability to split a greater distance inside the region with pairing of

bases when provided with an upstream oligonucleotide carrying a 3 ’region that is homologous to a 5’ region of the subject duplex, as shown in Fig. 26. It has also been determined that the 3 ′ terminal nucleotide

of the INVASOR oligonucleotide may be unpaired with the target nucleic acid and still shift the cleavage the same distance within the downstream duplex as when paired. This example demonstrates that this is the base component of the nucleotide, not sugar or phosphate, which is necessary to displace cleavage.

Figures 78A and B show a synthetic oligonucleotide that was designed to fold on itself that is constituted by the following sequence: 5’-GTTCTCTGCTCTCTGGTC GCTGTCTCGCTTGTGAAACAAGCGAGACAGCGT- GGTCTCTCG-3 ’(SEQ ID NO. 29). This oligonucleotide is called the "S-60 hairpin". The 15 base pair fork formed by this oligonucleotide is further stabilized by the "tri loop" sequence at the end of the loop (ie, three nucleotides form the

fork loop part) (Hiraro et al., Nucleic Acids Res., 22 (4): 576 [1994]). Fig. 78B also shows the sequence of oligonucleotide P-15 (SEQ ID No. 30) and the location of the region of complementarity shared by hairpin oligonucleotides P-15 and S60. In addition to the P-15 oligonucleotide shown, the cleavage was also analyzed in the presence of oligonucleotide P-14 (SEQ ID No. 108) (P-14 has a base less at the 3 'end than P15), the P-14 with a sugar abasic (P-14d; SEQ ID No. 109) and P14 with an abasic sugar with a 3 'phosphate (P14dp; SEQ ID No. 110). A P-15 oligonucleotide with a 3 ′ phosphate was also examined (SEQ ID No. 111). The black arrows shown in Fig. 78 indicate the cleavage sites of the S-60 fork in the absence (upper structure; A)

or in the presence (lower structure; B) of oligonucleotide P-15.

The S-60 hairpin molecule was labeled at its 5 ’end with fluorescein for later detection. The S60 hairpin was incubated in the presence of a thermostable 5 ’nuclease in the presence or absence of the P-15 oligonucleotide. The presence of the full duplex that can be formed by the S-60 fork is demonstrated by cleavage with the 5 ’Cleaase® BN nuclease, in a primer independent manner (that is, in the absence of oligonucleotide P-15). The release of 18 and 19 nucleotide fragments from the 5 ’end of the S-60 hairpin molecule showed that excision occurred near the junction between the single and double helix regions when nothing hybridized with the 3’ arm

of the S-60 fork (Fig. 27, lane 2).

The reactions shown in Fig. 78C were performed in 10 μl of 1X CFLP buffer with 1 mM MnCl2 and 50 mM K-Glutamate, in the presence of 0.02 μM S-60, 0.5 μM INVASORTM oligonucleotide and 0.01 ng per μl of CLEAVASE BN nucleases. The reactions were incubated for 5 minutes at 40 ° C and stopped by the addition of 8 µl

of stop buffer (95% formamide, 20 mM EDTA, 0.02% methyl violet). The samples were heated at 75 ° C for 2 minutes immediately before electrophoresis through a 15% polyacrylamide gel (19: 1 cross-linking), with 7 M urea, in a 45 mM Tris · Borate buffer, pH 8.3 , 1.4 mM EDTA. The gels were then analyzed with an FMBIO-100 Image Analyzer (Hitachi) equipped with a 505 nm filter. The resulting image is shown in Fig. 78C.

In Fig. 78C, lane 1 contains control products without enzyme; lane 2 contains products of a reaction performed in the absence of an INVASOR oligonucleotide; lanes 3-6 contain products of reactions carried out in the presence of the oligonucleotides INVASOR P-14d, P-14dp, P-15 and P-15p respectively.

From the data shown in Fig. 78C, it can be seen that the use of the INVASOR P-15 oligonucleotide causes a change in the cleavage site, while the INVASOR P-14 oligonucleotide with a ribose (P14d) or a phosphorylated ribose (P14dp) I did not. This indicates that the 15th remainder of the INVASOR oligonucleotide must have the base group attached to promote the change in cleavage. Interestingly, the addition of phosphate to the 3 ′ end of oligonucleotide P15 apparently reversed the change of the cleavage site. The cleavage in this lane may, in fact, be an excision in the absence of an INVASOR oligonucleotide as seen in lane 2. In experiments with INVASOR oligonucleotides labeled with 5 'dye with 3' phosphate groups, these oligonucleotides have been severely delayed by gel migration, suggesting that the enzyme or other

constituent of the reaction (for example, BSA) can bind to phosphate 3 ’regardless of the rest of the

split structure. If the INVASOR oligonucleotides are indeed being sequestered from the 5-cleavage structure, the resulting cleavage of the S-60 hairpin would occur in a "primer independent" manner and therefore, would not shift.

In addition to the study cited above, the effects of other substituents on the

3 'ends of the INVASOR oligonucleotides in the presence of several different enzymes and in the presence of Mn ++ or Mg ++. The effects of these modifications at the 3 ’end on the generation of the cleaved product are summarized

10 in the following table. All modifications were made during conventional oligonucleotide synthesis through the use of synthesis columns with controlled pore glass (CPG) with the indicated chemical moiety provided on the support as the synthesis start residue. All of these CPG materials were obtained from Glen Research Corp. (Sterling, VA).

Fig. 79 provides the structures for the 3 ′ substituents used in these experiments.

15 TABLE 4

Modification studies at the 3 ’end of INVASOR oligonucleotide

Modification at the 3 ’end

Terminal Transferase Extension Effect on reaction with INVASOR (as INVASOR) Enzyme Effect: Condition

3 ’phosphate Part Glen No. 20-2900-42

Do not A: 5 - inhibits the reaction, with no detectable activity

3 ’acridine Part Glen No. 20-2973-42

Yes, a little A: 5 - decrease in activity, <10% B: 5 - decrease in activity, <10% B: 4 - decrease in activity, <10% C: 1 - decrease in activity, <10% C: 2 - decrease in activity, ~ 20% C: 4 - decrease in activity, ~ 50% C: 3 - decrease in activity, <5%

3 ’carboxylate Part Glen No. 20-4090-42

Do not A: 1 - decrease in activity, ~ 50% change in activity at the cleavage site C: 3 - reduce activity, <10%

3 ’nitropyrrole Part Glen No. 20-2143-42

Yes A: 5 - decreased activity, ~ 2X

3 ’nitroindole Part Glen No. 20-2144-42

Yes A: 5 - decrease in activity, ~ 33%

3 ’arabinosa Part Glen No. 10-4010-90

Yes A: 5 - decrease in activity, ~ 50% activity

Modification studies at the 3 ’end of INVASOR oligonucleotide

Modification at the 3 ’end

Terminal Transferase Extension Effect on reaction with INVASOR (as INVASOR) Enzyme Effect: Condition

3’dideoxyUTP-fluorescein

Do not A: 5 - decrease in activity, ~ 40% activity

Link 3’-3 ’Part Glen No. 20-0002-01

Do not A: 1 - change of equivalent cleavage activity at the cleavage site C: 3 - decrease in activity, ~ 25% of activity

3 ’glyceryl Part Glen No. 20-2902-42

Yes, a little C: 3 - decreased activity, ~ 30% loss of excision activity (2 sites)

Amino modifier 3 ’C7 Part Glen No. 20-2957-42

Yes C: 3 - decreased activity, ~ 30% loss of excision activity, multiple sites

3 ’phosphate Part Glen No. 20-2900-42

Do not A: 5 - inhibits the reaction, with no detectable activity

3’ desoxi, 2’OH Glen Part No. 20-2104-42

Yes, a little A: 5 - decrease in activity, <20% of activity B: 5 - decrease in activity, <20% of activity B: 3 - decrease in activity, <20% of activity C: 1 - activity equivalent C: 2 - activity equivalent C: 4 - increase in activity C: 3 - decrease in activity, ~ 40% of activity

Enzymes: b) Nuclease CLEAVASE DV B) Nuclease CLEAVASE BN

5 C) PEN FEN-1

Conditions: 1) 4mM MnCl2, 150mM LiCl 2) 4mM MnCl2, 50mM KCl

10 3) 7.5mM MgCl2, non-monovalent 4) 4mM MgCl2, 50mM KCl 5) 10mM MgOAc, 50mM KCl

From this data it can be seen that many different modifications can be used at the 3 ’end of the

INVASOR oligonucleotide without this being harmful. In various embodiments of the present invention, said modifications of the 3 'end can be used to block, facilitate or otherwise alter the hybridization characteristics of the INVASOR oligonucleotide (for example, to increase discrimination against mismatches or to increase mating tolerance erroneous or to strengthen the association between the oligonucleotide INVASORTM and the target nucleic acid). Some substituents can be used to alter the behavior of the enzyme in recognition and cleavage within the assembled complex.

Altered 3 'ends may also be used to prevent the extension of the INVASOR oligonucleotide by

Mold-dependent or mold-independent nucleic acid polymerases. The use of otherwise unmodified dideoxy oligonucleotides (i.e., without dyes or other bound moieties) is a particularly preferred way to block the extension of INVASOR oligonucleotides because they do not reduce cleavage activity and are completely inextensible.

EXAMPLE 36

Effect of probe concentration, temperature, and a stacking oligonucleotide on cleavage of minison by excision directed by INVASOR

Stacking oligonucleotides used to form cleavage structures can have two purposes in the detection of a nucleic acid target using a mini-wave. The stacking oligonucleotide can help stabilize the interaction of the minison with the target nucleic acid, leading to a greater accumulation of cleaved probe. In addition, the presence of this oligonucleotide in the complex lengthens the duplex downstream of the cleavage site, which can improve the cleavage activity of some of the enzymes of the present invention. An example of different preferences for length of this duplex for different nucleases with structure specificity is seen in the comparison of cleavage by CLEAVASE BN nuclease and excision by Mja FEN1 nuclease of duplex regions of 8 bp and 12 bp in the Fig. 65. The higher affinity of the enzyme for the cleavage structure also results in a greater accumulation of excised probe during reactions performed over a set period of time.

The amount of minison that binds to the target is also affected by the concentration of the minison in the reaction mixture. Although a mini-wave only has a marginal probability of hybridizing (for example, when the reaction is carried out at temperatures above the expected melting temperature of the probe / target duplex), the amount of probe in the target at any given time can be increased using high minisonda concentrations.

The need for a stacking oligonucleotide to improve cleavage of the mini-wave was examined at both low and high probe concentrations. The reactions were performed in 10 µl of 10 mM HEPES (pH 7.2), 250 mM KGlu, 4 mM MnCl2, containing 100 nM of both the invading oligonucleotide (oligonucleotide 135; SEQ ID No. 112) and the stacker (oligonucleotide 147; SEQ ID NO. 113) and ssM13 100 pM DNA. The reactions were covered with mineral oil, heated at 90 ° C for 15 s and then brought to the reaction temperature. The reactions are

performed at 35º, 40º, 50º, 55º, 60º and 65º. The cleavage reactions were initiated by the addition of 1 µl of 100 ng / µl of Pfu FEN-1 and 1 µl of varying concentrations of Cy3-labeled minison oligonucleotide 142 (SEQ ID NO: 114). The reactions were allowed to continue for 1 hour and stopped by the addition of 10 µl of formamide. A

fourth of the total volume of each reaction was charged to 20% non-denaturing polyacrylamide gels that were electrophoresed in the reverse direction. The gels were visualized using a Hitachi FMBIO-100 fluorescent scanner using a 585 nm filter. . Fluorescence was measured in each product band and the graph shown in Fig. 80 was created using a Microsoft Excel spreadsheet.

The data summarized in Fig. 80 showed that the concentration of the mini-wave had a significant effect on the final product measurement, showing spectacular increases when the concentration was increased. Increases in the concentration of the minison also displaced the optimum reaction temperature. It is known in the art that the concentration of complementary chains in a hybridization will affect the apparent Tf of the duplex formed between them. It is more significant for the methods and compositions of the present invention that the presence of the stacking oligonucleotide has a profound influence on the rate of cleavage of the mini-wave at all probe concentrations. At each of the probe concentrations, the presence of the stacker can double the signal of the cleaved product. This demonstrated the utility of the use of the stacking oligonucleotide in combination with the mini-waves described herein.

EXAMPLE 37

The presence of a mismatch in the INVASOR oligonucleotide decreases the cleavage activity of the CLEAVASE A / G nuclease

In any nucleic acid detection assay there is an additional advantage if the assay can be performed to detect substantially small differences between related nucleic acids. In the following experiment, model cleavage substrates were used that were identical except for the presence or absence of a pairing

wrong near the 3 ’end of the INVASOR oligonucleotide when it hybridized with the model target nucleic acid.

Then the effect of an erroneous mating in this region on the accumulation of excised probe was evaluated.

To demonstrate the effect of the presence of a mismatch in the INVASOR oligonucleotide on the ability of the CLEAVASE A / G nuclease to cleave the probe oligonucleotide in an INVASOR assay, the following experiment was performed. Excision of the IT-2 test oligonucleotide (SEQ ID No. 115) in the presence of INVASOR IT-1 oligonucleotides (SEQ ID No. 116) and IT-1A4 (SEQ ID No. 117). The IT-1 oligonucleotide is completely complementary to the 3 'arm of IT-2, while the IT-1A4 oligonucleotide has a T> A substitution at position 4 from the 3' end that results in A / A mismatch in the duplex

INVASOR -Diana. It would be expected that the INVASOR oligonucleotides both paired and mismatched would hybridize at the temperature at which the next reaction was performed. Fig. 91 provides a scheme showing IT-1 hybridized with the IT-2 structure folded and showing IT-1A4 hybridized with the IT-2 structure folded

The reactions were performed as follows. IT-2 assay oligonucleotide (0.1 μM) labeled at the 5 'end with fluorescein (Integrated DNA Technologies) was incubated with 0.26 ng / l CLEAVASE AG in 10 μl of CFLP® buffer with 4 mM MgCl2, in presence of 1 μM IT-1 or IT-1A4 at 40 ° C for 10 min; A control without enzyme was also processed. The samples were covered with 15 µl of Chill-Out® liquid wax to prevent evaporation. The reactions were stopped by the addition of 4 µl of termination buffer (95% formamide, 20 mM EDTA, 0.02% methyl violet). The cleavage products were separated on a 20% denaturing polyacrylamide gel and analyzed with the FMBIO-100 Image Analyzer (Hitachi) equipped with a 505 nm filter. The resulting image is shown in Fig. 82.

In Fig. 82, lane 1 contains reaction products of the enzyme-free control and shows the migration of the uncut IT-2 oligonucleotide, lanes 2-4 contain reaction products that do not contain INVASOR oligonucleotide, the INVASOR IT-1 oligonucleotide and the oligonucleotide INVASOR IT-1A4, respectively.

These data show that the cleavage is markedly reduced by the presence of the mismatch, even in conditions where it would not be expected that the mismatch would alter the hybridization. This demonstrates that the INVASOR oligonucleotide binding region is one of the regions within the complex in which it can be used for detection of mismatch, as shown by a decrease in the cleavage rate.

EXAMPLE 38

Comparison of the activity of the PEN and FEN-1 of Mja nucleases in the reaction with INVASOR

To compare the activity of the PEN and FEN-1 of Mja nucleases in the reaction with INVASOR, the following experiment was performed. In the INVASOR tests, an IT3 test oligonucleotide (SEQ ID No. 118) was used which forms an INVASOR-Diana hairpin structure and the probe oligonucleotide PR1 (SEQ ID No. 119) labeled at the 5 'end with fluorescein (Integrated DNA Technologies) using the PEN or FEN-1 of Mja nucleases.

The tests were performed as indicated below. PEN FEN-1 (13 ng / μl) and Mja FEN-1 (10 ng / μl) (prepared as described in Ex. 28) were incubated with the oligonucleotides IT3 (0.1 nM) and PR1 (2 and 5 μM) in 10 μl of CFLP® buffer, 4 mM MgCl2, 20 mg / ml tRNA at 55 ° C for 41 min. The samples were covered with 15 μl of Chill-Out® evaporation barrier to prevent evaporation. The reactions were stopped by the addition of 70

μl of termination buffer (95% formamide, 20 mM EDTA, 0.02% methyl violet). The reaction products (1 μl) were separated on a 20% denaturing polyacrylamide gel, visualized using an apparatus

of fluorescent imaging and the bands corresponding to the probe and the product were quantified. The resulting image is shown in Fig. 83. In Fig. 83, the renewal rate per target and per minute is shown below the image for each nuclease at each probe concentration and target analyzed.

In Example 32 it was demonstrated that the use of the nuclease with specificity of Pfu FEN-1 structure in the INVASOR-directed cleavage reaction produced a faster product accumulation rate than the use of CLEAVASE A / G. The data presented herein demonstrate that the use of Mja FEN-1 nuclease with the fluorescein-labeled probe further increases the amount of product generated by an average of approximately 50%, demonstrating that, in addition to the FEN-1 nuclease of Pfu, the Mja FEN-1 nuclease is a nuclease with preferred structure specificity for the detection of nucleic acid targets by the process of the present invention.

EXAMPLE 39

Detection of RNA target nucleic acids using mini-oligonucleotide and stacker

In addition to the detection of the M13 DNA target material described above, a minison / stacker system was designed to detect the RNA sequences obtained from HCV described in Ex. 19. A probe was also tested. intermediate length, a medium length probe or a conventional cut. The minison (oligonucleotide 42-168-1) has the sequence: 5'-TET-CCGGTCGTCCTGG-3 '(SEQ ID No. 120), used stacking oligonucleotide (oligonucleotide 32-085) with this minison has the sequence: 5'-CAATTCCGGTGTACTACCGGTTCC -3 '(SEQ ID No. 121). The slightly longer probe, used without stacking oligonucleotide (oligonucleotide 42-088), has the sequence: 5’-TET-CCGGTCGTCCTGGCAA-3 ’(SEQ ID No. 122). The INVASOR oligonucleotide used with both probes has the following sequence: 5’-GTTTATCCAAGAAAGGACCCGGTC-3 ’(SEQ ID No. 47). The reactions included 50 fmol of target RNA, 10 pmol of the oligonucleotide INVASOR and 5 pmol of the oligonucleotide mined in 10 µl of buffer containing 10 mM MES, pH 6.5 with 150 mM LiCL, 4 mM MnCl2, 0.05% of Tween-20 and 0.05% NP-40 and 39 units of RNAs (Promega). When used, 10 pmol of the stacking oligonucleotide was added. These components were combined, covered with CHILLOUT evaporation barrier and heated to 50 ° C; The reactions were initiated by the addition of 5 units of DNAPTth polymerase, to a final reaction volume of 10 μl. After 30 minutes at 50 ° C, the reactions were stopped by the addition of 8 µl of 95% formamide, 10mM EDTA and 0.02% methyl violet. The samples were heated to 90 ° C for 1 minute and 2.5 μl of each of these

reactions were separated by electrophoresis through 20% denaturing polyacrylamide (19: 1 cross-linking) with 7 M urea in a 45 mM Tris-Borate buffer, pH 9.4, 1.4 mM EDTA and the labeled reaction products were visualized using the FMBIO-100 Image Analyzer (Hitachi). The resulting image is shown in Fig. 84.

In Fig. 84, lanes 1 and 2 show the reaction products containing the HCV INVASOR oligonucleotide and the longest probe (oligonucleotide 42-088), with and without the target RNA present, respectively. Lanes 3, 4 and 5 show the reaction products containing the INVASOR oligonucleotide and the shorter probe (oligonucleotide 42-168-1). Lane 3 is a control reaction without target RNA present, while lanes 4 and 5 have the target but lack or have the stacking oligonucleotide, respectively.

Under these conditions, the slightly longer probe oligonucleotide (16 nucleotides) was cleaved quite easily without the aid of a stacking oligonucleotide. In contrast, the shorter probe (13 nucleotides) required the presence of the stacking oligonucleotide to produce detectable cleavage levels. These data demonstrate that the INVASOR-directed cleavage target detection mini-wave system is equally applicable to the detection of RNA and DNA targets. In addition, comparing the cleavage behavior of longer and shorter probes in the absence of a stacking oligonucleotide provides an example of the distinction between the behavior of the stacking minison / oligonucleotide system and the behavior of the intermediate and long length probes in the detection of nucleic acid targets.

EXAMPLE 40

Effect of a 3 'queue not paired on the transcription of a complete promoter (without dent)

When designing the visualization procedure based on the transcription of the products of the cleavage directed by INVASOR, it was first necessary to evaluate the effect of a 3 'tail on the effectiveness of transcription from a full length promoter. The duplexes analyzed in this example are shown in the lower part of Fig. 93 and are presented schematically in Fig. 85A-C.

Transcription reactions were performed using the MEGAshortscriptTM system of Ambion, Inc. (Austin, TX), according to the manufacturer's instructions except for the addition of a fluorescein-labeled ribonucleotide. Each DNA sample was prepared in 4 µl of RNase-free H2Od. Reactions 1-3 each contained 10 pmol of the 150 copy template oligo (SEQ ID NO: 123); reaction 2 contained 10 pmol of oligo promoter 151 (SEQ ID NO: 124); Sample 3 contained 10 pmol of the promoter oligo prolonged at 3 '073-065 (SEQ ID NO. 125); Sample 4 had no added DNA. 6 µl of a solution containing 1 µl of 10 x transcription buffer, 7.5 mM of each rNTP was added to each sample; 0.125 mM fluorescein-12-UTP (Boehringer) and 1 μl of MEGAshortscriptTM enzyme mixture of T7. Then, the plates were incubated for 1 hour at 37 ° C. One microliter of RNase-free DNase 1 (2 U / μl) was added to each sample and the samples were incubated for an additional 15 minutes at 37 ° C. The reactions were stopped by adding 10 µl of a 95% formamide solution, 5 mM Na2EDTA with filler dyes. All samples were heated to 95 ° C for 2 minutes and 4 µl of each sample was resolved by electrophoresis through 20% denaturing acrylamide gel (19: 1 cross-linking), with 7 M urea, in a buffer containing Tris-Borate 7 M (pH 8.3) and 1.4 mM EDTA. The gel was analyzed using an FMBIO II fluorescent image analyzer and the resulting image is shown in Fig. 93. RNA produced by correct transcription appears near the middle of the panel, as indicated ("RNA").

Examination of the transcription products shown in lanes 2 and 3 shows that the presence of the 3 'tail on the full length promoter has a negative effect on the effectiveness of the transcription, but does not deactivate it completely. Since the objective of the transcription-based visualization analyzes of the present invention is to differentiate between the uncleaved probe and the shorter products of the invasive excision analysis (cut probe), these data indicate that the production of a length promoter Complete in the cleavage reaction would be difficult to resolve from the background created by transcription from promoters containing the probe without cleavage if other oligonucleotides were not included in the analysis. The means for suppressing transcription from such a branched promoter are discussed in the Description section of the invention and in Ex. 43.

EXAMPLE 41

Examination of the influence of the position of the dent on the efficiency of transcription from promoters of the bacteriophage T7 partial and complete compounds

In the Description of the invention section, the procedure for analyzing possible promoter pieces for suitability in an analysis related to invasive excision is described. One aspect of the analysis is to examine the effect that a given dent site has on the effectiveness of transcription from the final compound promoter. In addition, the individual pieces of the nicked promoter are analyzed for transcription activity in the presence of the full-length non-nicked chain. In this experiment, a comparison is made on these points between a compound promoter that has a dent in the non-template chain between nucleotides -11 and -10 with respect to the initiation site (+1), and a promoter that has a dent on the same chain, but placed between nucleotides -8 and -7. Figure numbers for schematic representations of the contents of each reaction are indicated under each lane (eg, 85A = Fig. 85A). The site where the dent would be in a fully assembled composite promoter using the oligonucleotides of the reaction is also indicated under each lane ("-11 / -10" and "-8 / -7").

Transcription reactions were performed using the MEGAshortscriptTM system according to the manufacturer's instructions except for the addition of a fluorescein-labeled ribonucleotide. Each DNA sample was prepared in 4 µl of RNase-free H2Od. Reaction 1 had no DNA added. Reactions 2-9 each contained 10 pmol of the oligo copy template 150 (SEQ ID NO. 123). Reactions 3 and 4 contained 10 pmol of the "cut" probe oligo -11 (oligonucleotide 073-061-01; SEQ ID No. 127) or 20 pmol of the partial promoter oligo -10 073-061-02 (SEQ ID No. 130), respectively; and reaction 5 contained both. Reactions 6 and 7 contained 10 pmol of the "cut" probe oligo -8 (oligonucleotide 073-062-01; SEQ ID No. 126) or 20 pmol of the partial promoter oligo -7 073062-02 (SEQ ID No. 129), respectively; and reaction 8 contained both. Reaction 9 contained 10 pmol of the intact promoter oligo 151 (SEQ ID NO: 124).

Transcription reactions were initiated, incubated and terminated, and the reaction products were resolved and images were created as described in Ex. 40. In Fig. 92, the resulting image is shown. The reaction numbers correspond to the lane numbers on the image. RNA created by correct transcription appears in the upper third of the image. The comparison with the positive control reaction (rxn. 9) shows that the full-length RNA produced by each of the compound promoters is the same size as that produced in the control reaction, indicating that transcription was initiated at the same site in each reaction.

In Fig. 92, lanes 3, 4 and 5 compare the transcription from the two partially assembled promoter species (see the schemes in Figs. 86A and B) and the fully assembled composite promoter (Fig. 88B) having a dent between nucleotides -11 and -10 with respect to the start of transcription. It can be seen from these data that no partial promoter (lanes 3 and 4) is capable of maintaining transcription of the copy template, but that the composite promoter (lane 5) with this nick site is potently transcribed. The surprising thing is that the comparison with the control reaction (lane 9) shows that the presence of a dent in this site (-11 / -10) actually increases transcription. Although without limiting the present invention to a particular mechanism, it is believed that the increase in transcription is a result of both suppressing the formation of shorter abortive transcripts and allowing greater accumulation of the full length product. This result is highly reproducible.

In Fig. 92, lanes 6, 7 and 8 compare the transcription of a similar set of partial and complete promoters in which the dent is displaced 3 residues closer to the transcription initiation site. Examination of lane 6 shows that the presence of 3 more bases on the "cut" -8 probes (compared to the "cut" -11 probe of lane 3) allows this partial promoter to initiate transcription. This indicates that the -8 / -7 site would be a bad choice for use in this embodiment of the present invention.

This experiment demonstrates the procedure to determine the proper placement of a dent within a promoter assembly to achieve the desired result. Similar analyzes can easily be designed to analyze other indentations of the T7 bacteriophage promoter analyzed in this example, or to analyze the proper placement of the dent in any desired phage, prokaryotic or eukaryotic promoter.

EXAMPLE 42

Detection of the products of INVASOR-directed cleavage through transcription from a compound promoter

The examples described above indicate that it is possible to use a small oligonucleotide to complete the assembly of a compound T7 promoter, thus allowing transcription from that promoter. The above examples demonstrate that the invasive cleavage reaction can be used to release specific small oligonucleotide products from longer probe oligonucleotides. In this example, it is demonstrated that these two observations can be combined, and that the products of the invasive cleavage reaction can be used to complete a promoter and allow subsequent transcription. In Fig. 88, the schematic representations of the compound promoters analyzed in this example are shown.

Two invasive excision reactions were prepared, one without (rxn 1) and one with (rxn. 2) input target DNA. Reactions (1 and 2) comprised 10 mM MOPS (pH 7.5), 0.05% Tween-20, 0.05% NP-40, and 20 pmol of oligo probe 073-067-01 (SEQ ID No. 132) and 10 pmol of oligo INVASOR 073-073-02 (SEQ ID No. 134) in a volume of 14

μl. Reaction 2 also included 100 fmol of M13mp18 mDNA. Samples were placed at 60 ° C and 6 µl of a solution containing 20 ng of Mja FEN-1 and 40 mM Mg2Cl was added to each sample to initiate the reactions. Samples were incubated at 60 ° C for 30 minutes and stopped by adding 3 µl

2.5 M NaOAc and 83 mM Na2EDTA (pH 8.0). Each sample was transferred to a 1.5 ml microcentrifuge tube and then the DNA was precipitated by the addition of 60 µl of 100% cooled ethanol, and stored at -20 ° C for 20 minutes. The sediments were collected by microcentrifugation, washed once with 80% ethanol to remove excess salt and then dried under vacuum. The product of this invasive cleavage reaction is a 12-nucleotide oligonucleotide that has the sequence: 5'-CGAAATTAATAC-3 '(SEQ ID No. 128), called a cut probe -12 (the same sequence as oligo 073-073-03 ).

For transcription, each of the dried samples was dissolved in 4 µl of a solution containing 1 pmol of the 150 copy oligo template and 2 pmol of the partial promoter oligo -11 073-073-012 (SEQ ID No. 131). Control samples 3 and 4 each contained 1 pmol of the oligo copy template 150; Sample 3 contained 1 pmol of the oligo probe 073-067-01 (SEQ ID No. 132) and 2 pmol of the partial promoter oligo -11 073-073-012 (see structure 88A); Sample 4 contained 1 pmol of the "cut" probe oligo -12 073-073-03 (SEQ ID No. 128) and 2 pmol of the partial promoter oligo -11 073-073-012 (see structure 88B). These are the structures that would be expected to exist in the transcription reactions from the two invasive excision reactions described above.

Transcription reactions were initiated, incubated and terminated, and the products were resolved and images were created as described in Ex. 40. The resulting image is shown in the right half of Fig. 89 (lanes 6-9 ). Samples 3 and 4 appear on lanes 6 and 7, respectively, and reactions 1 and 2 from the invasive cleavage reaction products (indicated by the use of the lowercase "i") appear on lanes 8 and 9, respectively. The number of Fig. Showing the schematic representation of the expected promoter structure in each reaction is indicated on each lane, also indicating the placement of the dent. The capital letters indicate which structure of the particular figure to examine for each reaction. The lowercase "i" on lanes 8 and 9 indicates that these transcripts were obtained from true invasive excision reactions. These products are compared with the RNA produced in the control reaction in lane 5, the procedure of which is described in Ex. 44. The RNA created by the correct transcription appears in the upper third of the image (indicated as "RNA") .

The reaction shown in lane 6 does not show transcription. This demonstrates that a dent between nucleotides 12 and -11 of the non-template chain of the T7 promoter eliminates transcription if the promoter is assembled from the uncut probe such that the 3 'end of the probe forms a branch within the sequence. promotion girl. This contrasts with the results observed with the nick -11 / -10 examined below. In addition, the apparent transcript of lane 7 shows that an unbranched promoter with a dent in the same site (-12 / -11) produces the correct RNA with few abortive initiation products (see lanes 2 and 5 of Fig. 89 , described in Ex. 44). The reactions of lanes 8 and 9 demonstrate that the same effect is observed when the invasive cleavage reaction is the only origin of the upstream piece (probe cut -12) of the T7 promoter. It should be noted that the promoter that is transcribed in lane 8 is completed by the presence of 1 pmol of a synthetic "cut" oligo probe, without any uncut probe in the mixture, while the promoter that is transcribed in lane 9 is complete by the product of an invasive excision reaction that only has 100 fmol of target DNA in it. This reaction also included the residual uncut probe (up to approx. 10 pmol) that can compete for binding at the same site. However, the effectiveness of the transcripts from the products of the invasive cleavage reaction is only slightly reduced and the transcripts are just as free as the "no target" sample (lane 8). This example clearly demonstrates that cleavage products from the invasive cleavage reaction can be used in combination with a partial promoter oligo to promote RNA production, without the background transcription generated by the presence of the uncut probe. This RNA product clearly depends on the presence of the target material in the invasive excision reaction.

EXAMPLE 43

Deactivation of transcription from a branched "bored" T7 compound promoter through the use of a downstream partial promoter oligonucleotide having a 5 'tail

The previous example showed that the placement of a dent in the non-template chain of a T7 bacteriophage promoter between nucleotides -12 and -11 with respect to the transcription initiation site prevents transcription of the branched promoter, while when the promoter Compound is assembled using the cut probe transcription is allowed. When the dent is placed in other areas of the T7 promoter, it is possible to initiate transcription from any promoter, although it is usually less effective to do so from the branched promoter. This example demonstrates that the addition of a 5 'tail that can be paired to the uncut probe (Fig. 90A) to the piece of partial promoter downstream effectively blocks transcription from that promoter, but does not prevent transcription when there is a probe cut by completing the promoter (Fig. 90B).

Two invasive excision reactions were prepared, one without (rxn 7) and one with (rxn. 8) input target DNA. Reactions (7 and 8) comprised 10 mM MOPS (pH 7.5), 0.05% Tween-20, 0.05% NP-40, and 20 pmol of oligo probe 073-067-01 (SEQ ID No. 132) and 10 pmol of oligo INVASOR 073-067-02 (SEQ ID No. 133) in a volume of 14

μl. Reaction 8 also included 100 fmol of M13mp18 mDNA. Samples were placed at 60 ° C and 6 µl of a solution containing 20 ng of Mja FEN-1 and 40 mM Mg2Cl was added to each sample to initiate the reactions. Samples were incubated at 60 ° C for 30 minutes and stopped by the addition of 3 µl 2.5 M NaOAc and 83 mM Na2EDTA (pH 8.0). Each sample was transferred to a 1.5 m microcentrifuge tube, and then the DNA was precipitated, washed and dried as described in Ex 42. The product of this invasive excision reaction is the oligonucleotide sequence of 13 nucleotides 5'-CGAAATTAATACG-3 '(SEQ ID No. 127), called probe cut -11 (the same sequence as oligo 073-061-03, which is called probe "cut" -11 to indicate that it was not generated in an invasive excision reaction)

In transcription reactions, all DNAs were dissolved in 4 µl of RNase-free H2Od. Sample 1 had no added DNA; Samples 2-8 contained 1 pmol of the oligo 150 copy template (SEQ ID No. 123). In addition, sample 3 contained 1 pmol of the "cut" probe oligo -11 073-061-01 (SEQ ID No. 127) and 2 pmol of the partial promoter oligo -10 073-061-02 (SEQ ID No. 130); Sample 4 contained 1 pmol of the oligo probe 073-067-01 and 2 pmol of the oligo partial promoter -10 073-061-02. Control sample 5 contained 1 pmol of the oligo probe 073-067-01 and 2 pmol of the partial promoter oligo with 5'073-074 tail (5'-TACTGACTCACTATAGGGTCTTCTATGGAGGTC-3 '; SEQ ID No. 146) (see the structure of Fig 90A) and sample 6 contained 1 pmol of the "cut" probe oligo -11 073-061-01 and 2 pmol of the 5'073-074 partial promoter oligo with tail (see the structure of Fig. 90B). These are the structures (i.e., 90A and 90B) that would be expected to exist in the transcription reactions from the two invasive excision reactions described above.

Each of the dried samples 7 and 8 from the invasive (anterior) excision were dissolved in 4 μl of H2Od containing 1 pmol of the 150 template copy oligo and 2 pmol of the 5'073-074 partial promoter oligo with tail. Transcription reactions were initiated, incubated, and terminated, the reaction products resolved and images created as described in Ex. 40. The resulting image is shown in Fig. 91.

In Fig. 91, the lane numbers correspond to the sample numbers; the number of the figure that shows the schematic representation of the expected promoter structure in each reaction is indicated on each lane ("88" and "90"), also indicating the placement of the dent ("-11 / -10") . The capital letters indicate which structure of the particular figure to examine for each reaction. The lowercase "i" on lanes 7 and 8 indicates that these transcripts were obtained from true invasive excision reactions. RNA created by the correct transcription appears in the upper third of the image ("RNA").

Control reactions of lanes 1 and 2, either without DNA or with the copy template alone, did not produce RNA as expected. The product of lane 4 demonstrates that the branched T7 promoter with a dent in the non-template chain between nucleotides -11 and -10 can maintain transcription, although not as effectively as the unbranched promoter with the nick in the same site ( lane 3). Lane 5 examination shows that the use of a partial promoter oligonucleotide with a short 5 'tail that can be paired to the uncut probe as depicted in Fig. 90A effectively suppresses this transcription, but allows transcription when the probe does not it has a 3 'tail (lane

6: Fig. 90B schematic). The reactions of lanes 7 and 8 demonstrate that the same effect is observed when the invasive cleavage reaction is the only origin of the upstream piece (probe cut -11, SEQ ID No. 127) of the T7 promoter. It should be noted that the promoter that is transcribed in sample 8 is completed by the presence of 1 pmol of a synthetic "cut" oligo probe, without any uncut probe in the mixture, while the promoter that is transcribed in lane 9 is complete by the product of an invasive excision reaction that only has 100 fmol of target DNA in it. This reaction also included the residual uncut probe (up to approx. 19 pmol) that can compete for binding at the same site. However, the transcripts from the products of the invasive cleavage reaction are just as potent and are just as background free in the "non-target" samples.

This example clearly demonstrates that cleavage products from the invasive cleavage reaction can be used in combination with a partial promoter oligo having a 5 'tail to promote RNA production without the background transcription generated by the uncut probe. This RNA product clearly depends on the presence of the target material in the invasive excision reaction.

EXAMPLE 44

Creation of a complete T7 bacteriophage promoter by prolongation mediated by a DNA polymerase of a cut probe comprising a partial T7 promoter

As demonstrated in the previous examples, transcription cannot take place from the T7 promoter unless a complete promoter is present. In the previous examples, a complete promoter containing a dent in a chain was created by mating a cut probe generated in an invasive excision reaction with a copy template that was paired to a partial promoter oligo. An alternative method for creating a complete promoter in a manner dependent on the detection of a target sequence in an invasive cleavage reaction is to couple the cut probe to a copy template lacking a partial promoter oligo. The 3 'OH present at the end of the paired cut probe is then extended by a DNA polymerase to create a complete, non-nicked promoter that is competent in transcription.

In this Example, the promoter was completed through the use of a primer extension, rather than by the co-hybridization of another oligonucleotide. In Figure 87, the reaction steps are schematically represented. Two invasive excision reactions were prepared, one without (rxn. 1) and one with (rxn. 2) input target DNA. Reactions (1 and 2) comprised 10 mM MOPS (pH 7.5), 0.05% Tween-20, 0.05% NP-40, and 20 pmol of oligo probe 073-067-01 (SEQ ID No. 132) and 10 pmol of oligo INVASORTM 073-073-02 (SEQ ID No. 134) in

a volume of 14 μl. Reaction 2 also included 100 fmol of M13mp18 mDNA. Samples were placed at 60 ° C and 6 µl of a solution containing 20 ng of Mja FEN-1 and 40 mM Mg2Cl was added to each sample to initiate the reactions. Samples were incubated at 60 ° C for 30 minutes and stopped by the addition of 3 µl 2.5 M NaOAc and 83 mM Na2EDTA (pH 8.0). Each sample was transferred to a 1.5 m microcentrifuge tube, and then the DNA was precipitated, washed and dried as described in Ex.

42. The product of this invasive cleavage reaction is a 12 nucleotide oligonucleotide sequence: 5'-CGAAATTAATAC-3 '(SEQ ID No. 128), called probe cut -12 (the same sequence as oligo 073-073-03 , which is called a "cut" probe -12 to indicate that it was not generated in an invasive excision reaction).

To allow the prolongation of these products using a mold-dependent DNA polymerase, a 20 μl solution containing 20 mM Tris-HCl (pH 8.5), 1.5 mM Mg2Cl was added to each of the dried cleavage samples , 50 mM KCl, 0.05% Tween-20, 0.05% NP-40, 25 μM of each dNTP, 0.25 units of Taq DNA polymerase (Boehringer) and oligo 150 2 μM copy template ( SEQ ID No. 123). The samples were incubated at 30 ° C for 1 hour. All primer extension reactions were stopped by the addition of 3 µl of 2.5 M NaOAc

with 83 mM Na2EDTA (pH 8.0). Each sample was transferred to a 1.5 m microcentrifuge tube, and then the DNA was precipitated, washed and dried as described in Ex. 42.

Samples 1 and 2 were dissolved in 4 µl of RNase-free H2Od. Samples 3, 4 and 5 are control reactions; Sample 3 was 4 µl of RNase-free H2Od without added DNA; Sample 4 contained 1 pmol of oligo copy template 150 (SEQ ID No. 123) in 4 μl of H2Od free of ENASA, and sample 5 contained 1 pmol of the same copy template and 1 pmol of oligo complete promoter 151 (SEQ ID No. 124) in RNase free H2Od.

Transcription reactions were performed using the MEGAshortscriptTM system according to the instructions of the

manufacturer but with the addition of a fluorescein-labeled ribonucleotide. 6 µl of a solution containing 1 µl of 10 x transcription buffer, 7.5 mM of each rNTP was added to each sample; 0.125 mM fluorescein-12-UTP (Boehringer) and 1 μl of MEGAshortscriptTM enzyme mixture of T7. The samples were incubated for 1 hour at 37 ° C. One microliter of RNase-free DNase 1 (2 U / μl) was added to each sample and the samples were incubated for an additional 15 minutes at 37 ° C. The reactions were stopped by adding 10 μl of a solution of

95% formamide, 5 mM Na2EDTA with fillers. All samples were heated to 95 ° C for

2 minutes and four µl of each sample was resolved by electrophoresis through acrylamide gel

20% denaturing (19: 1 crosslinking), with 7 M urea, in a buffer containing 45 mM Tris-Borate (pH 8.3) and 1.4 mM EDTA. Images of the results were generated using Molecular Dynamics 595 fluorescent imager, with excitation at 488 nm and emission detected at 530 nm.

The resulting image is shown on lanes 1 to 5 of Fig. 89; Lane numbers correspond to sample numbers. The figure numbers correspond to the schematic representations of the promoters transcribed in each reaction as indicated on the rails. The RNA product by correct transcription appears in the upper third of the image ("RNA"). The unincorporated labeled nucleotide appears as a dense signal near the bottom ("NTP"). Short transcription products generated by aborted initiations (Milligan and Uhlenbeck (1989) Methods Enzymol. 180: 51 [1989]) appear as bands just above the free nucleotide in the lanes that show an active transcription (i.e. lanes 2 and 5).

It can be clearly seen from the data in lanes 1 and 2 that transcription depends on the presence of the target material in the invasive excision reaction. It is shown elsewhere (see lane 3, Fig. 92) that the product of the cleavage reaction is not sufficient in itself to allow transcription from the copy template. Thus, the action of DNA polymerase prolonging the cut probe hybridized through the promoter is a necessary step to allow transcription in this embodiment. These data clearly demonstrate that both the mold-dependent prolongation performed by a DNA polymerase and the prolongation followed by transcription are suitable visualization procedures for the products of the invasive excision analysis. As discussed in the Description of the invention section, thermal degradation products that possess phosphates in the 3 'terminal would not be prolonged, and therefore could not contribute to background transcription.

EXAMPLE 45

Assay for the dependence of an enzyme on the presence of an upstream oligonucleotide

When choosing a specific nuclease of structure to use in an invasive cleavage reaction, it is preferable that the enzyme has poor ability to cleave a probe 1) in the absence of an upstream oligonucleotide and 2) in the absence of overlap between the upstream oligonucleotide and the probe oligonucleotide labeled downstream. Figs. 99a-e represent the various structures that can be used to examine the activity of an enzyme confronted with each of these types of structures. The structure (Fig. 99a) shows the alignment of a probe oligonucleotide with a target site on the bacteriophage M13 DNA (the M13 sequences shown in Fig. 99 are provided in SEQ ID NO: 163) in the absence of an oligonucleotide chain above. Structure b (Fig. 99b) is provided with an upstream oligonucleotide that does not contain an overlapping region with the labeled probe (the marker is indicated with a star). In structures c, d and e (Figs. 99c-e), the upstream oligonucleotides have 1, 3 or 5 nucleotide overlaps, respectively, and each downstream probe oligonucleotide and each of these structures represents a suitable invasive cleavage structure. Pfu FEN-1 was tested to determine the activity on each of these structures and all reactions were performed in duplicate.

Each reaction comprised the probe oligonucleotide labeled 5'TET 89-15-1 1 μM (SEQ ID No. 152), oligonucleotide upstream 50 Mm (oligo 81-69-2 [SEQ ID No. 153], oligo 81-69-3 [ SEQ ID No. 154], oligo 81-69-4 [SEQ ID No. 155], oligo 81-69-5 [SEQ ID No. 156], or without oligonucleotide upstream), 1 fmol of target M13 DNA, 10 mg / ml of tRNA and 10 ng of Pfu FEN-1 in 10 μl of 10 mM MOPS (pH 7.5), 7.5 mM MgCl2 with 0.05% each of Tween 20 and Nonidet P-40.

All components except the enzyme and MgCl2 were mounted in a final volume of 8 μl and covered with 10 μl of Chill-Out ™ liquid wax. The samples were heated to the reaction temperature of 69 ° C. The reactions were initiated by the addition of PEN FEN-1 and MgCl2 in a volume of 2 µl. After incubation for 30 min at 69 ° C, the reactions were stopped by the addition of 10 µl of 95% formamide, 10 mM EDTA and

0.02% methyl violet. The samples were heated at 90 ° C for 1 minute immediately before electrophoresis through a 20% denaturing polyacrylamide gel (19: 1 cross-linking), with 7 M urea, in a 45 mM Tris · Borate buffer, pH 8 , 3, 1.4 mM EDTA. The gels were then analyzed with an FMBIO-100 Image Analyzer. The resulting image is shown in Fig. 100.

In Fig. 100, the lanes marked "a" contain the products generated from reactions performed without an upstream oligonucleotide (structure a), the lanes marked "b" contain the upstream oligonucleotide (which does not invade the probe / duplex duplex). target (structure b) Lanes marked "c", "d" and "e" contain the products generated from the reactions performed using an upstream oligonucleotide that invades the duplex / probe at 1, 3 or 5 bases, respectively The size (in nucleotides) of the uncleaved probe and the cleavage products is indicated to the left of the image in Figure 100.

As shown in Fig. 100, probe excision could not be detected when structures a and b were used. In contrast, cleavage products were generated when invasive excision structures (c-e structures) were used. These data show that the Pfu FEN-1 enzyme requires an overlapping upstream oligonucleotide for specific excision of the probe.

All enzymes can be examined to check their suitability for use in a sequential invasive cleavage reaction by examining the ability of the test enzyme to cleave the ae structures (those skilled in the art understand that the specific oligonucleotide sequences shown in Figs. 99a-e do not have to be used in test reactions, these structures are simply illustrative of suitable test structures). Desirable enzymes show little or no cleavage of structures a and b, and show specific cleavage structures ce (i.e., generate cleavage products of the expected size from the degree of overlap between the two oligonucleotides used to form the invasive cleavage structure) .

EXAMPLE 46

Use of the products of a first invasive excision reaction to allow a second invasive excision reaction with a net gain in sensitivity

As discussed in the Description section of the previous invention, the sensitivity of the detection of the invasive excision reaction can be increased by performing a second round of invasive excision using the products of the first reaction to complete the excision structure in the second reaction (shown schematically in Fig. 96). This Example illustrates the use of a probe that when cleaved in a first invasive excision reaction forms an INVASOR oligo and target molecule for use in a second invasive excision reaction (shown schematically in Fig. 97).

A first probe was designed to contain some internal complementarity so that, when it is cleaved in

a first invasive excision reaction, the product ("Cut Probe 1") could form a target strand that

it comprises an integral INVASOR oligonucleotide, as depicted in Fig. 97. A second probe was provided in the reaction that would be cleaved at the indicated site when hybridized with the newly formed target / INVASOR (Fig. 97). To demonstrate the signal gain due to the performance of invasive excision sequences, in parallel a standard invasive excision assay was performed, as described above.

All reactions were performed in duplicate. Each standard invasive excision reaction (i.e. non-sequential) comprised 5 'labeled oligonucleotide with 1 μM fluorescein 073-182 (5' F1-AGAAAGGAAGGGAAGAAAGCGAA-3 '; SEQ ID No. 157), oligo upstream 10 nM 81- 69-4 (5'-CTTGACGGGGAAAGCCGGCGAACGTGGCGA-3 '; SEQ ID No. 155), 10 to 100 M13 AND Diana atom, 10 mg / ml tRNA and 10 ng Pfu FEN-1 in 10 μl of MOPS 10 mM (pH 7.5), 8 mM MgCl2 with 0.05% each of Tween 20 and Nonidet P-40. All components except the enzyme and MgCl2 were mounted in a final volume of 7 μl and covered with 10 μl of Chill-Out ™ liquid wax. The samples were heated to the reaction temperature of 62 ° C. The reactions were initiated by the addition of PEN FEN-1 and MgCl2 in a volume of 2 µl. After incubation for 30 min at 62 ° C, the reactions were stopped by the addition of 10 µl of 95% formamide, 10 mM EDTA and 0.02% methyl violet.

Each sequential invasive excision reaction comprised fluorescein-labeled oligonucleotide in 5'1 μM 073-191 (the first probe or "Probe 1" 5 'Fl-TGGAGGTCAAAACATCG ATAAGTCGAAGAAAGGAAGGGAAGAAAT3'; SEQ ID No. 158), 10 nM oligonucleotide upstream 81-69 -4 (5'-CTTGACGGGGAAA GCCGGCGAACGTGGCGA-3 '; SEQ ID No. 155), fluorescein-labeled oligonucleotide at 5' 1 μM 106-32 (the second probe or "Probe 2" 5 'F1-TGTTTTGACCT CCA-3'; SEC ID No. 159), from 1 to 100 M13 AND Diana atom, 10 mg / ml of tRNA and 1 ng of Pfu FEN-1 in 10 μl of 10 mM MOPS (pH 7.5), 8 mM MgCl2 with 0 , 05% of each of Tween 20 and Nonidet P-40. All components except the enzyme and MgCl2 were mounted in a final volume of 8 μl and covered with 10 μl of Chill-Out ™ liquid wax. The samples were heated to the reaction temperature of 62 ° C (this temperature is the optimum temperature to hybridize the Probe 1 to the first target). The reactions were initiated by the addition of PEN FEN-1 and MgCl2 in a volume of 2 µl. After incubation at 62 ° C for 15 months, the temperature was lowered to 58 ° C (this temperature is the optimum temperature to hybridize Probe 2 to the second target) and the samples were incubated for another 15 minutes. The

reactions were stopped by the addition of 10 µl of 95% formamide, 20 mM EDTA and methyl violet at

0.02%). Samples of both conventional and sequential invasive excision reactions were heated at 90 ° C for 1 minute immediately before electrophoresis through a 20% denaturing polyacrylamide gel (19: 1 cross-linking), with 7 M urea, in a Tris buffer · 45 mM Borate, pH 8.3, 1.4 mM EDTA. The gel was then analyzed with a Molecular Dynamics FluorImager 595 apparatus. The resulting image is shown in Fig. 101a. A graph measuring fluorescence intensity for each of the product bands is shown in Fig. 101b.

In Fig. 101a, lanes 1-5 contain the products generated in conventional invasive cleavage reactions containing or absence of target (Lane 1), 10 target atomol (lanes 2 and 3) or 100 target atomol (lanes 4 and 5). The uncleaved probe looks like a dark band in each lane halfway to the panel and the cleavage products appear as a smaller black band near the bottom of the panel, the position of the cleavage product is indicated as the tip of an arrow to the left of Fig. 101a. The gray scale of bands observed in lanes 1-5 is due to thermal degradation of the probe as discussed above and is not related to the presence or absence of the target DNA. The remaining lanes show products generated in the sequential invasive cleavage reactions containing 1 target atomol (lanes 6 and 7), 10 target atomol (lanes 8 and 9) and 100 target atmol (lanes 10 and 11) . The first uncleaved probe

(Probe 1, “1 uncut” marked) is seen near the top of the panel, while the first excised probe is indicated as “1: cut.” Similarly, the second uncleaved and excised probe is indicated as "2: uncut" and 2: cut ", respectively.

The graph shown in Fig. 101b compares the amount of product generated from the conventional reaction

("Series 1) with the amount of product generated from the second stage of the sequential reaction (" Series 2 "). He

Background fluorescence level measured in a reaction without target DNA was subtracted from each measurement. From the table below the graph it can be seen that the signal of the conventional invasive excision test containing 100 atomol of the target DNA was almost identical to the signal of the sequential invasive excision test in which there was 1 atom of the target, which indicates that the inclusion of a second cleavage structure multiplies the sensitivity of the assay by 100 or 200. This signal reinforcement allows simple detection of target nucleic acids at the subatomole level using the sequential invasive cleavage test, while the conventional test, when performed using this enzyme for only 30 minutes, does not generate detectable product in the presence of 10 Diana's atomol.

When the target amount decreased by 10 or 100 in the sequential invasive excision test, the signal intensity decreased in the same proportion. This indicates that the quantitative capacity of the invasive excision assay is preserved even when the reactions are performed in series, so that it provides a sensitive and quantitative nucleic acid detection procedure.

Although in this Example the two probes used had different optimal hybridization temperatures (i.e., the empirically determined temperature to give the highest renewal rate under the given reaction conditions), the probes can also be selected (designed) so that they have the same optimal hybridization temperature so that a temperature change is not necessary during incubation.

EXAMPLE 47

The products of a completed sequential invasive excision reaction cannot produce cross contamination following similar reactions.

As discussed in the Description of the invention section, the serial nature of multiple invasive excision events that occur in the sequential invasive excision reaction, in contrast to the reciprocal nature of the polymerase chain reaction and assays Similar duplication means that the sequential invasive cleavage reaction is not subject to contamination by the products of similar reactions because the products of the first cleavage reaction do not participate in the generation of new signal in the second cleavage reaction. If a large amount of a completed reaction has to be added to a newly mounted reaction, the background it would produce would come from the amount of target that was also introduced, combined with the amount of probe already excised that had been introduced. In this Example, it is demonstrated that in the secondary reaction a very large part of a primary reaction must be introduced to create a significant signal.

A first sequential or primary invasive excision reaction was performed as described above using 100 target DNA atomol. A second set of 5 reactions was mounted as described in Ex. 46 with the exception that parts of the first reaction were introduced and no additional target DNA was included. These side reactions were initiated and incubated as described above and included 0, 0.01, 0.1, 1, or 10% of the first reaction material. A control reaction with 100 atomol of the target was also included in the second set. The reactions were stopped, separated by electrophoresis and visualized as described above and the resulting image is shown in Fig. 102. The primary probe, second uncut probe and second cut probe are indicated on the left as "1: cut" , 2: uncut ”and 2: cut”, respectively.

In Fig. 102, lane 1 shows the results of the first reaction with the product accumulated at the bottom of the panel and lane 2 shows a 1:10 dilution of the same reaction, to demonstrate the signal level that would fit expect from the level of contamination, without additional amplification. Lanes 3 to 7 show the results of secondary cleavage reactions containing 0, 10, 1, 0.1 or 0.01% of the first reaction material added as a contaminant, respectively, and lane 8 shows a control reaction that I had 100 Diana DNA atomol added to verify system activity in the secondary reaction. The signal level in lane 4 is as expected when 10% of the pre-cleaved material is transferred (as in lane 2) and 10% of the target material transferred from the lane 1 reaction is further purified. At all levels of additional dilution, the signal is not easily distinguished from the background. These data show that although a large-scale transfer from one reaction to another can be detectable, cross contamination by minimal amounts that would be expected by aerosol or equipment contamination would not be easily confused with a false positive result. These data also demonstrate that when the products of a reaction are deliberately passed to a fresh sample, these products do not participate in the new reaction and, therefore, do not affect the level of the target dependent signal that can be generated in said reaction.

EXAMPLE 48

Detection of human cytomegalovirus viral DNA by invasive excision

The above Example demonstrates the ability of the invasive cleavage reaction to detect minimal amounts of viral DNA in the presence of human genomic DNA. In this Example, the probe and INVASOR oligonucleotides were designed to target region 3104-3061 of the main immediate early human cytomegalovirus (HCMV) gene as shown in Fig. 103. In Fig. 103, the oligonucleotide INVASOR (89 -44; SEQ ID No. 160) and the fluorescein-labeled probe oligonucleotide (Fl) (89-76; SEQ ID No. 161) are shown hybridized along a region of the HCMV genome corresponding to nucleotides 3057-3110 of DNA viral (SEQ ID No. 162). The probe used in this Example is a polypyrimidine probe and, as shown herein, the use of a polypyrimidine probe reduces the background signal generated by thermal degradation of the probe oligonucleotides.

The viral genomic DNA was purchased from Advanced Biotechnologies, Incorporated (Columbia, MD). Advanced Biotechnologies staff estimated (but did not certify) a DNA concentration of 170 atomol (1 x 108 copies) per microliter. The reactions were performed in quadruplicate. Each reaction comprised fluorescentin-labeled probe oligonucleotide in 5'1 μM 89-76 (SEQ ID No. 161), 100 nM INVASOR oligonucleotide 89-44 (SEQ ID No. 160), 1 ng / ml human genomic DNA and one of five concentrations of HCMV target DNA in the amounts indicated on each lane in Fig. 104 and 10 ng of Pfu FEN-1 in 10 µl of 10 mM MOPS (pH 7.5), 6 mM MgCl2 with 0.05% of each one of Tween 20 and Nonidet P-40. All components except the enzyme and MgCl2 were mounted in a final volume of 7 μl and covered with 10 μl of Chill-Out ™ liquid wax. The samples are

heated to 95 ° C for 5 minutes, then reduced to 62 ° C. The reactions were initiated by the addition of probe, Pfu FEN-1 and MgCl2 in a volume of 3 µl. After incubation for 60 min at 62 ° C, the reactions were stopped by the addition of 10 µl of 95% formamide, 10 mM EDTA and 0.02% methyl violet.

The samples were heated at 90 ° C for 1 minute immediately before electrophoresis through a 20% acrylamide gel (19 :(: 1), containing 7 M urea, in a 45 mM Tris-Borate buffer, pH 8 , 3, 1.4 mM EDTA The gels were then analyzed with a Molecular Dynamics FluorImager 595 apparatus.

The resulting image is shown in Fig. 104. Duplicate reactions were performed in groups on four lanes with the HCMV target DNA content of the indicated reactions on each set of lanes (0170 amol). The uncleaved probe is seen in the upper third of the panel ("89-76 uncut"), while the cleavage products are seen in the lower two thirds of the panel ("89-76 cut"). It can be seen that the intensity of the accumulated cleavage product is proportional to the amount of the target DNA in the reaction. In addition, you can see

clearly in reactions that did not contain target DNA ("no target") that the probe is not cleaved, even in a

Human genomic DNA background. Although 10 ng of human genomic DNA was included in each of the reactions shown in Fig. 104, the inclusion of genomic DNA up to 200 ng has little impact on

quantity of product accumulated. The data did not suggest that 200 ng per 10 μl of the reaction mixture

they represented the maximum amount of genomic DNA that could be tolerated without a significant reduction in signal accumulation. By reference, this amount of DNA exceeds what could be found in 0.2 ml of urine (an amount usually tested for HCMV in neonates) and is equivalent to the amount that would be found

in about 5 μl of whole blood.

These results demonstrate that the conventional invasive excision reaction (i.e., non-sequential) is a sensitive, specific and reproducible means of detecting viral DNA. From this data it can also be seen that the use of a polypyrimidine probe reduces the thermal degradation background of the probe, as discussed in the Example

22. The detection of 1.7 amol of target is approximately equivalent to the detection of 106 copies of the virus. This is equivalent to the number of viral genomes that could be found in 0.2 ml of urine from a newborn with congenital infection (102 to 106 genome equivalents per 0.2 ml; Stagno et al., J. Infect. Dis., 132: 568 [1975]). The use of the sequential invasive excision assay would allow the detection of even fewer viral DNA molecules, which facilitates the detection in blood (101 to 105 of viral particles per ml; Pector et al., J. Clin. Microbiol., 30: 2359 [1992]), which has a much greater amount of heterologous DNA.

From the foregoing it is clear that the invention provides reagents and methods for allowing the detection and characterization of nucleic acid sequences and variations in nucleic acid sequences. The INVASOR-directed cleavage reaction and the sequential INVASOR-directed cleavage reaction of the present invention provide ideal direct detection procedures that combine the advantages of direct detection assays (e.g., simple quantification and minimal risk of contamination by handover) with the specificity provided by a double oligonucleotide hybridization assay.

As indicated in the Description of the Invention, the use of sequential invasive excision reactions can be a problem of the first, or primary, uncut residual probe that interacts with the second target, and compete with the cut probe to join, or create bottom through low level cleavage of the resulting structure. This is shown in diagram in Figs. 105 and 106. In Fig. 105, the reaction depicted uses the cleavage product of the first cleavage structure to form an INVASOR oligonucleotide for a second cleavage reaction. The structure formed between the secondary target, the secondary probe and the uncut primary probe is depicted in Fig. 105, as the structure on the right shown in step 2a. This structure is recognized and cleaved by 5 ’nucleases, but inefficiently (that is, at less than about 1% in most reaction conditions). However, the resulting product is indistinguishable from the specific product and, therefore, can lead to a false positive result. The same effect can occur when the cleaved primary probe creates an integrated target molecule / INVASOR (IT) as described in Example 46; The formation of the undesirable complex is schematically depicted in Fig. 106, as the structure on the right shown in step 2a.

The improvements provided by the inclusion of STOP oligonucleotides of various compositions in each of these types of sequential INVASOR assays are demonstrated in the following Examples. These STOP oligonucleotides are configured to bind to the residual uncut probe of the first cleavage reaction in the series, so that efficiency is increased and the nonspecific background is reduced in the subsequent reaction (s).

EXAMPLE 49

"DETENTION" oligonucleotides improve the sensitivity of multiple invasive excision assays

sequential

This Example demonstrates the effect of including a STOP oligonucleotide on signal generation using the IT probe system depicted in Figs. 97 and 106. The DETENTION oligonucleotide hybridizes with the primary probe, mainly in the part that recognizes the target nucleic acid during the first cleavage reaction. In addition to examining the effects of adding a STOP oligonucleotide, we also investigated the effects of using STOP oligonucleotide that complement different distances in the region of the primary probe that makes up the secondary IT structure. These effects were compared in reactions that included the target DNA in a series of concentrations or that lacked target DNA, in order to demonstrate the unspecific background level (i.e. not related to the target nucleic acid) in each set of conditions of reaction.

The target DNA for these reactions was a fragment that comprised the full length of the hepatitis B genome of the adw serotype strain. This material was created using the polyamide chain reaction of plasmid pAM6 (ATCC No. 45020D). PCRs were performed using a direct primer based on the vector, oligo No. 156-022-001 (5'-ggcgaccacacccgtc-ctgt-3 '; SEQ ID No. 168) and a reverse primer, oligo No. 156-022-02 (5'ccacgatgcgtccggcgtag-3 '; SEQ ID No. 169) to amplify the full length of the HBV insert, an amplicon of approximately 3.2 kb. Cycling conditions included a denaturation of the plasmid at 95 ° C for 5 minutes, followed by 30 cycles of 95 ° C, 30 seconds; 60 ° C. 40 seconds and 72 ° C, 4 minutes. This was followed by a final extension at 72 ° C for 10 minutes. The resulting amplicon, designated pAM6 # 2, was adjusted to 2M NH4OAc and collected by precipitation with isopropanol. After drying under vacuum, the DNA was dissolved in 10 mM Tris, pH, 0, 0.1 mM EDTA. The concentration was determined by DO200 measurement and by INVASOR assay compared with a known concentration standard.

INVASOR reactions were performed as follows. Six master mixtures called "A," "B, '" C, "" D, "and" E, "were mounted; all mixtures contained 12.5mM MOPS, pH 7.5, 500 fmol of the primary INVASOR oligo No. 218 -55-05 (SEQ ID NO. 171), 10 ng of human genomic DNA (Novagen) and 30 ng of Afu FEN1 enzyme for every 8 µl of the mixture.The mixture A did not contain HBV genomic amplicon DNA; the mixture B contained 600 HBV genomic amplicon DNA molecules pAM6 # 2; mixture C contained 6000 molecules of pAM6 # 2; mixture C contained

60,000 molecules of pAM6 # 2 and the mixture E contained 600,000 molecules of pAM6 # 2. The mixtures were aliquotted in the reaction tubes, 8 μl / tube. The mixture A to tubes 1, 2, 11, 12, 21 and 22; mixture B to tubes 3, 4, 13, 14, 23 and 24; the mixture C to the tubes 5, 6.15, 16, 25 and 26; the mixture D to the tubes 7, 8, 17, 18, 27 and 28; and mixture E to tubes 9, 10, 19, 20, 29 and 30. The samples were incubated at 95 ° C for 4 minutes to denature the DNA of the

HBV genomic amplicon. The reactions were then cooled to 67 ° C and 2 µl of a mixture containing 37.5 mM MgCl 2 and 2.5 pmol of 218-95-06 (SEQ ID NO. 183) was added to each sample for every 2 µl. The samples were incubated at 67 ° C for 60 minutes. Three secondary reaction master mixtures were prepared, all mixtures contained 10 pmol of the secondary probe oligonucleotide No. 228-48-04 (SEQ ID No. 173) for every 2 µl of the mixture. Mix 2A did not contain additional oligonucleotide, mixture 2 B contained 5 pmol of oligonucleotide "DETENTION" No. 218-95-03 (SEQ ID No. 184) and mixture 2C contained 5 pmol of oligonucleotide "STOP" # 218-95- 01 (SEQ ID No. 174). After a 60 minute incubation at 67 ° C (the primary reaction described

above), 2 µl of the secondary reaction mixture was added to each sample: The 2A mixture was added to

samples No. 1-10; mixture 2B was added to samples 11-20 and mixture 2C was added to samples 21-30. The temperature was adjusted to 52 ° C and the samples were incubated at 52 ° C for 30 minutes. Then, the reactions were stopped by the addition of 10 µl of a solution of 95% formamide, 5 mM EDTA and 0.02% crystal violet. All samples were heated to 95 ° C for 2 minutes and four µl of each was resolved.

sample by electrophoresis through 20% denaturing acrylamide gel (19: 1 cross-linking), with 7 M urea, in a buffer containing 45 mM Tris-Borate (pH 1.4) and 1.4 mM EDTA. Images of the results were generated using Molecular Dynamics 595 fluorescent imager, with excitation at 488 nm and emission detected at 530 nm. The resulting images are shown in Fig. 107

In Fig. 107, Panel A shows the results of the titration of the target when oligonucleotide DEDETENTION was not included in the secondary reaction; Panel B shows the results of the same titration of the target using a STOP oligonucleotide that extended 2 nucleotides in the non-target complementary region of the primary probe; and Panel C shows the results of the same titration of the target using an oligonucleotide DEDETENTION that extended 4 nucleotides in the non-target complementary region of the primary probe. The product of the secondary cleavage reaction looks like a band near the bottom of each panel. The first two lanes of each panel (i.e. 1 and 2, 11 and 12, 21 and 22) lacked target DNA and the signal that matches the band of the product represents the non-specific background under each set of conditions.

By visual inspection of these panels it can be seen that the background signal is reduced and made more predictable, by the inclusion of any species of DETENTION oligonucleotide. In addition to reducing the background in the non-target control lanes, the background reduction in reactions that had the most dilute amounts of the target included is reduced, which leads to a signal that is a more accurate reflection of the target contained within the reaction, so that the quantitative range of the multiple sequential invasive excision reaction is improved.

To quantify the impact of including the STOP oligonucleotide in the secondary cleavage reaction under these conditions, the average signal of the product band of the reactions that have the highest amount of target (i.e., the means of the lane signals 9 and 10, lanes 19 and 20 and lanes 29 and 30) were compared with the

mean signal of the control lanes without target for each panel, the “amount on the bottom”, the factor of

signal amplification on the background, in each set of conditions. For reactions without DETENTION oligonucleotide, Panel A, the amount on the background was 5.3; for Panel B, the amount on the fund was 12.7; and for Panel C, the amount on the background was 13.4, indicating that in this system, the inclusion of any STOP oligonucleotide at least doubled the specificity of the signal on reactions without STOP oligonucleotide and that the oligonucleotide OF DETENTION that extended slightly beyond the complementary non-target region may be slightly more effective, at least in this embodiment of the system. This clearly shows the benefits of using a DETENTION oligonucleotide to enhance the specificity of these reactions, an advantage that is of particular benefit at low levels of the target nucleic acid.

EXAMPLE 50

"DETENTION" oligonucleotides allow the use of higher concentrations of primary probe

without increasing the background signal

In Example 36 it was shown that increasing the concentration of the probe in the invasive excision reaction can dramatically increase the amount of signal generated for a given amount of target DNA. Although not intended to limit the explanation to any specific mechanism, it is believed to be due to the fact that a higher concentration of the probe increases the speed at which the cleaved probe is supplanted by an uncleaved copy, so that the speed is increased of renewal of the cleavage reaction. Unfortunately, this effect could not be applied later to the primary cleavage reaction of a multiple sequential INVASOR assay because the primary probe without residual cleavage can hybridize with the secondary target, in competition with the cleaved molecules, so that the efficiency is reduced of the secondary reaction. High concentrations of the primary probe exacerbate this problem. In addition, the resulting complexes, as described above, can be cleaved at a low level, which contributes to the background. Therefore, increasing the primary probe may have a double negative effect of slowing the secondary reaction and increasing the level of non-target specific background form. The use of a DETENTION oligonucleotide to sequester or neutralize the residual primary probe allows this concentration enhancement effect to be applied to these sequential reactions.

To demonstrate this effect, two sets of reactions were performed. In the first set of reactions, the reactions were performed using a series of concentrations of the primary probe, for no oligonucleotide DEDETENTION was delivered in the secondary reaction. In the second set of reactions the same probe concentrations were used, but a STOP oligonucleotide was added for side reactions.

All reactions were performed in duplicate. The primary INVASOR reactions were performed in a final volume of 10 µl and contained: 10 mM MOPS, pH 7.5, 7.5 mM MgCl2, 500 fm of the primary INVASOR (218-55-05; SEQ ID NO. 171); 30 ng of the FEN1 enzyme from Afu and 10 ng of human genomic DNA. 100 zeptomoles of HBV pAM6 # 2 amplicon were included in all even number reactions (by reference to Figs. 108A and B). Reactions included 10 pmol, 20 pmol, 50 pmol, 100 pmol or 150 pmol of the primary probe (218-55-02; SEQ ID No. 170). MOPS, target oligonucleotides and INVASOR were combined to a final volume of 7 μl. The samples were denatured with heat at 95 ° C for 5 minutes, then cooled to 67 ° C. MgCl2, the probe and the enzyme were combined during the 5-minute denaturation. Primary INVASOR reactions were initiated by the addition of 3 µl of MgCl2, the probe and the enzyme mixture at the final concentrations indicated above. The reactions were incubated for 30 minutes at 67 ° C. The reactions were then cooled to 52 ° C and each primary INVASOR reaction received the following secondary reaction components in a total volume of 4 µl: 2.5 pmol of secondary target (oligonucleotide number 218-95-04; SEQ ID No. 172 ); 10 pmol of secondary probe (oligonucleotide number 228-48-04; SEQ ID No. 173). The reactions that included the DETENTION oligonucleotide had 40 pmol, 80 pmol, 200 pmol, 400 pmol or 600 pmol of the oligonucleotide DETENTION (oligonucleotide number 218-95-01; SEQ ID No. 174), added with a 4-fold molar excess over the amount of the primary probe for each reaction, with this mixture. The reactions were incubated at 52 ° C for 30 minutes. The reactions were stopped by adding 10 µl of a 95% formamide solution with 10 mM EDTA and 0.02% violet crystal. All samples were heated to 95 ° C for 1 minute and were

resolved four µl of each sample by electrophoresis through 20% denaturing acrylamide gel

(19: 1 cross-linking), with 7 M urea, in a buffer containing 45 mM Tris-Borate (pH 1.4) and 1.4 mM EDTA. Images of the results were generated using the Molecular Dynamics 595 fluorescent imager, with the excitation at 488 and the emission detected at 530. The resulting images for reactions with or without a STOP oligonucleotide are shown in Figs. 108A and 108B, respectively. The cleavage products of the secondary probe looks like a band near the bottom of each panel.

In Fig. 108A, lane assemblies 1 and 2 show the results with 10 pmol of primary probe; 3 and 4 had 20 pmol; 5 and 6 had 50 pmol; 7 and 8 had 100 pmol; and 9 and 10 had 150 pmol. By visual examination it can be seen that the increases in the amount of primary probe have the combined effect of slightly increasing the background in the lanes without target (odd numbers) and reduce the specific signal in the presence of target (lanes with even numbers) and, in this way the specificity of the reaction is reduced if it is seen as the measure of the “amount on the background”, which demonstrates that the approach of increasing the signal by increasing the probe cannot be applied

in these sequential reactions.

In Fig. 108B, lane assemblies 1 and 2 show the results with 10 pmol of primary probe; while 3 and 4 had 20 pmol; 5 and 6 had 50 pmol; 7 and 8 had 100 pmol; and 9 and 10 had 150 pmol. In addition, each reaction included a molar excess of 4 of the STOP oligonucleotide added before the secondary cleavage reaction. By visual examination it can be seen that the background in the lanes without target (odd numbers) is lower in all cases, while the specific signal in the presence of target (lanes with even numbers) increases with increasing amounts of the primary probe, which leads to a greater sensitivity of “amount on the background at this level of the target.

To quantitatively compare these effects, the fluorescence signal of the nonspecific and specific cleavage products was measured. The results are plotted in Fig. 108C, as a measure of the percentage of the secondary probe cleaved during the reaction, compared to the amount of primary probe used. Examination of the graphs of the target-free reactions confirms that the background in the absence of the DETENTION oligonucleotide is, in general, approximately twice as large, and that both increase slightly with increasing amounts of the probe. However, the specific signals diverge between the two reaction sets dramatically. Although the signal in reactions without oligonucleotide DETENTION decreases steadily as the primary probe increases, the signal in reactions with oligonucleotide DETENTION continued to increase. At the highest concentrations of the primary probe analyzed, the reactions without oligonucleotide DETENTION had a specific signal that was only 1.7 times in the background, while reactions with oligonucleotide DETENTION detected the 100 zmol (60,000 copies) of target with a signal 6.5 on the background, so that the improvement of the sequential invasive cleavage reaction is demonstrated when the STOP oligonucleotide is included.

EXAMPLE 51

Modified structures improve the performance of natural oligonucleotides DETENTION Oligos “DE DETENCIÓN” without 3’-amine

The reactions described in the two previous Examples used STOP oligonucleotides constructed using a 2 ′ O-methyl ribose structure and that included a positively charged amino group in the 3 ′ nucleotide. Modifications were made specifically to reduce enzymatic interaction with the probe complex.

Primary / oligonucleotide DETENTION. During the development of the present invention it was determined that modified 2'-O-methyl oligonucleotides are somewhat resistant to cleavage by 5 'nucleases, to the extent that they are slowly degraded by nucleases when used in antisense applications ( see, for example, Kawasaki et al., J. Med. Chem., 36: 831 [1993]).

In addition, as demonstrated in example 35, the presence of an amino group at the 3 ′ end of a

oligonucleotide reduces its ability to direct invasive excision. To reduce the possibility that the oligonucleotide DETENTION forms a cleavage structure in this way an amino group was included in the design of the experiments described in this and in other Examples.

Initial designs of the DETENTION oligonucleotides (sometimes referred to as "blockers") did not include these modifications and it was found that these molecules did not provide benefits in reducing background cleavage in the sequential invasive excision assay and, in fact, in Sometimes it contributed to the fund by inducing splitting at an unforeseen site, probably providing some element to an alternative splitting structure. The effects of the natural and modified STOP oligonucleotide on background noise in these reactions are investigated in this Example.

The efficacy of a "natural STOP oligonucleotide" (ie, a STOP oligonucleotide that does not

contained no base analogue or base modification) was examined by comparison with an identical reaction that lacked STOP oligonucleotide. All reactions were performed in duplicate and were carried out as follows. Two master mixtures were mounted, each containing 12.5 mM MOPS, pH 7.5, 500 fmol of primary INVASOR oligonucleotide No. 218-55-05 (SEQ ID No. 171), 10 ng of human genomic DNA (Novagen ) and 30 ng of the enzyme FEN1 of Afu. Mix A did not contain HBV genomic amplicon DNA added, mixture B contained 600,000 HBV genomic amplicon DNA molecules, pAM6 # 2. The mixtures were distributed to the reaction tubes, in 8 μl aliquots / tube as follows: The mixture A to tubes 1, 2, 5 and 6; and mixture B to tubes 3, 4, 7 and 8. The samples were incubated at 95 ° C for 4 minutes to denature the HBV genomic amplicon DNA. The reactions were cooled to 67 ° C and 2 µl of a mixture containing 37.5 mM MgCl 2 and 10 pmol of 218-55-02B (SEQ ID No. 185) was added to each sample for every 2 µl. Then, the samples were incubated at 67 ° C for 30 minutes. Two secondary reaction master mixtures were prepared, each containing 10 pmol of the secondary probe oligonucleotide No. 228-48-04 (SEQ ID No. 178) and 2.5 pmol of the secondary target oligonucleotide No. 218-95-04 (SEC ID No. 172) for every 3 μl of mixture. Mixture 2A did not contain additional oligonucleotide, while mixture 2B contained 50 pmol of the natural "DETENTION" oligonucleotide No. 241-62-02 (SEQ ID NO. 186). After an initial 30 minute incubation at 67 ° C, the temperature it was adjusted to 52 ° C and 3 µl of the secondary reaction mixture was added to each sample, as follows: Mix 2A was added to samples 1-4, and mixture 2B was added to samples 5-8. the samples were incubated at 52 ° C for 30 minutes, then the reactions were stopped by the addition

10 μl of 95% formamide with 10 mM EDTA and 0.02% violet crystal.

All samples were heated to 95 ° C for 2 minutes and four µl of each sample was resolved by

electrophoresis through 20% denaturing acrylamide gel (19: 1 cross-linking), with 7 M urea, in a buffer containing 45 mM Tris-Borate (pH 1.4) and 1.4 mM EDTA. Images of the results were generated using Molecular Dynamics 595 fluorescent imager, with excitation at 488 nm and emission detected at 530 nm. The resulting images are shown in Fig. 109A.

To compare the effects of the various modifications made to the DETENTION oligonucleotides, the reactions were performed using the DETENTION oligonucleotides that have natural bases but that include an amine at the 3 'end: the DETENTION oligonucleotide that has the 3' part composed of 2 -O'-methyl nucleotides, plus the amine at the 3 'end, and the STOP oligonucleotide completely composed of 2O'-methyl nucleotides plus the amine at the 3' end. These were compared with reactions performed without a STOP unoligonucleotide. The reactions were performed as follows. Two master mixtures were mounted, each containing 14.3 mM MOPS, pH 7.5, 500 fmol of primary INVASOR oligonucleotide No. 218-55-05 (SEQ ID No. 171) and 10 ng of human genomic DNA (Novagen ) for every 7 μl of mixture. Mix A did not contain genomic amplicon DNA from added HBV, mix B contained 600,000 DNA molecules from

HBV genomic amplicon, pAM6 # 2. The mixtures were distributed to the reaction tubes, at 7 μl / tube: The mixture

A to tubes 1,, 2, 5, 6, 9, 10, 13 and 14; and mixture B to tubes 33, 4, 7, 8, 11, 12, 15 and 16. The samples were heated to 95 ° C for 4 minutes to denature the HBV DNA. The reactions were then cooled to 67 ° C and 3 µl of a mixture containing 25 mM MgCl2, 25 pmol of 218-55-02B (SEQ ID No. 185) and 30 ng of Afu FEN1 enzyme were added to each sample for every 3 μl. Then, the samples were incubated at 67 ° C for 30 minutes. Four secondary reaction master mixtures were prepared, each containing 10 pmol of the secondary probe oligonucleotide No. 228-48-04 (SEQ ID No. 190) and 2.5 pmol of the secondary target oligonucleotide No. 218-95-04 (SEC ID No. 172) for every 3 μl of mixture. Mixture 2A did not contain additional oligonucleotide, while mixture 2B contained 100 pmol of the natural STOP oligonucleotide + amine No. 24162-01 (SEQ ID No. 187), mixture 2C contained 100 pmol of the partially O-methyl oligonucleotide + amine No. 241- 6203 (SEQ ID No. 188) and the 2D mixture contained 100 pmol of the completely O-methyl + amine oligonucleotide No. 241-6401 (SEQ ID No. 189). After an initial incubation of 30 minutes at 67 ° C, the temperature was adjusted to 52 ° C and at

each sample was added 3 μl of the secondary reaction mixture, as follows: The 2A mixture was added to

samples 1-4; mixture 2B was added to samples 5-8; the 2C mixture was added to samples 9-12 and the 2D mixture was added to samples 13-17. The samples were incubated at 52 ° C for 30 minutes, then stopped by the addition of 10 µl of 95% formamide with 10 mM EDTA and 0.2% violet crystal.

All samples were heated to 95 ° C for 2 minutes and four µl of each sample was resolved by

electrophoresis through 20% denaturing acrylamide gel (19: 1 cross-linking), with 7 M urea, in a buffer containing 45 mM Tris-Borate (pH 1.4) and 1.4 mM EDTA. Images of the results were generated using Molecular Dynamics 595 fluorescent imager, with excitation at 488 nm and emission detected at 530 nm. The resulting images are shown in Fig. 109B.

In Fig. 109A, the left panel shows the reactions lacking the STOP oligonucleotide, while the right panel shows the data of the reactions that included natural STOP oligonucleotide. The first two lanes of each panel come from controls without a target, the second set of lanes contained the target. The cleavage products are visible in the lower room of each panel. The position at which the specific reaction products should be performed are indicated by arrows to the left and to the right.

By examining these data, it can be seen that the reactions carried out without DETENTION oligonucleotide show a reproducible quality among the duplicates and show a significant cleavage only when a target is present. On the contrary, the addition of another unmodified oligonucleotide in the reactions produces a large variation between the duplicated lanes (eg, lanes 5 and 6 were provided with the same reactants, but produced markedly different results). The introduction of the natural DETENTION oligonucleotide produced, instead of reducing, background in these non-target lanes and increased cleavage at other sites (i.e., bands other than those indicated by the arrows flanking the panels). For these reasons the modifications described above were incorporated, the effects of which are shown in Fig. 109B.

The first 4 lanes of Fig. 109B show the products of duplicate reactions without an oligonucleotide DEDETENTION, more or less the HBV target (lanes 1, 2 and lanes 3, 4, respectively); the next 4 lanes, 5, 6, and 7, 8 used a natural STOP oligonucleotide with a 3 'amine; lanes 9, 10 and 11, 12 used the DETENTION oligonucleotide with a 3 ′ portion composed of 2’-O-methyl nucleotides and having a 3 ′ amine; lanes 13, 14 and 15, 15 used the DETENTION oligonucleotide composed entirely of 2'-O-methyl nucleotides and having a 3 'amine. The products of excision of the secondary probe are visible in the lower third of each panel.

Visual inspection of these data shows that the addition of the 3 ’amine to the DETENTION oligonucleotide

Natural suppresses the aberrant cleavage observed in Fig. 109A, but this STOP oligonucleotide does not improve reaction performance compared to controls without STOP oligonucleotide. In contrast, the use of 2’-O-methyl nucleotides in the body of the DETENTION oligonucleotide does reduce the background, partially or completely substituted. To quantify the relative effects of these modifications, the fluorescence of each of the product bands they ate was measured, the average of the duplicate lane signals was obtained, and the amount on the bottom was calculated for each acid-containing reaction. target nucleic

When the STOP oligonucleotide was omitted, the specific target signal (lanes 3, 4) was 27 times greater than the target background; the STOP + amine oligonucleotide gave a signal of 17 on the background; 2’-Ometil + amine gave a signal of 47 on the bottom; and the 2’-O-methyl + complete amine gave a signal of 33 on the bottom.

These Figures show that both modifications can have a beneficial effect on the specificity of the multiple sequential invasive excision assay. They also show that the use of the 2′-O-methyl substituted, partial or complete structure markedly improves the specificity of these reactions. It is intended that in several embodiments of the present invention that any number of modifications that form the STOP oligonucleotide or complex that forms with the nuclease resistant primary target provide similar potentiation.

EXAMPLE 52

Effect of STOP oligonucleotide length on signal enhancement in multiple sequential invasive excision assays

As indicated in the Description of the Invention, the optimal length of a STOP oligonucleotide depends on the design of other nucleic acid elements of the INVASOR reaction, particularly on the design of the primary probe. In this Example, the effects of varying the length of the oligonucleotide DEDETENTION in systems using two different secondary probes were explored. A schematic diagram showing these aligned STOP oligonucleotides as they would hybridize with the primary probe oligonucleotide is provided in Fig. 110C. In this Figure, the region of the primary probe that recognizes the target nucleic acid is underlined; the portion without underlining, plus the first base without underlining is the portion that is released by the first split and goes on to participate in the second or subsequent split structure.

All reactions were performed in duplicate. The INVASOR reactions were performed in a final volume of 10 μl, containing 10 mM MOPS, pH 7.5, 2 mM MgCl2; 500 fmol of primary INVASOR 241-95-01, (SEQ ID No. 176), 25 pmol of primary probe 241-95-02 (SEQ ID No. 175), 30 ng of the FEN1 enzyme of Afu and 10 ng of human genomic DNA and, not included, 1 amol of HBV amplicon pAM 6 # 2. MOPS, the AND Diana and the INVASOR oligonucleotides were combined to a final volume of 7 μl. Samples were denatured with heat at 95 ° C for 5 minutes, then cooled to 67 ° C. During the 5 minute denaturation, MgCl2, the probe and the enzyme were combined. Primary INVASOR reactions were initiated by the addition of 3 µl of MgCl2, the probe and the enzyme mixture at the final concentrations indicated above. The reactions were incubated for 30 minutes at 67 ° C. The reactions were then cooled to 52 ° C and each primary INVASOR reaction received the following secondary reaction components in a total volume of 3 μl: 2.5 pmol of secondary target 241-95-07 (SEQ ID No. 177), 10 pmol of secondary probe 228-48-04 (SEQ ID No. 173), or 228-48-04N (SEQ ID No. 178) and 100 pmol of a STOP oligonucleotide, either 241-95-03 (SEQ ID No. 179), 241 -95-04 (SEQ ID No. 180), 241-95-05 (SEQ ID No. 181) or 241-95-06 (SEQ ID No. 182). The STOP oligonucleotide was omitted in some reactions as controls for the effects of the STOP oligonucleotide.

The reactions were incubated at 52 ° C for 34 minutes and then stopped by the addition of 10 µl of 95% formamide with 10 mM EDTA and 0.02% violet crystal. All samples were heated to 95 ° C for 1 minute and four µl of each sample was resolved by electrophoresis through 20% denaturing acrylamide gel (19: 1 cross-linking), with 7 M urea, in a buffer containing Tris-Borate 45 mM (pH 1.4) and 1.4 mM EDTA. Images of the results were generated using Molecular Dynamics 595 fluorescent imager, with excitation at 488 nm and emission detected at 530 nm. The resulting images for reactions with the shorter and longer secondary probes are shown in Figs. 110A and 110B, respectively.

In each Figure, the cleavage products are visible as bands in the lower half of each lane. The first 4 lanes of each Figure show the products of duplicate reactions without an oligonucleotide DETENTION plus or minus the HBV target (sets of lanes 1 and 2, respectively), in the next 4 lanes, sets 3 and 4 used the STOP DETENTION more short 241-95-03 (SEQ ID No. 179); lanes 5 and 6 used 241-95-04 (SEQ ID No. 180); lanes 7 and 8 used 241-95-05 (SEQ ID No. 181); and lanes 9 and 10 used 241-95-06 (SEQ ID NO. 182).

The main focus of attention is the band that appears on the “no target” control lanes (odd numbers; this

band would eat with the specific signal of the target near the bottom of each gel panel). The visual inspection shows that the shorter STOP oligonucleotide was the least effective in suppressing this background and that the efficacy increased when the STOP oligonucleotide extended beyond the part that participates in the subsequent cleavage reaction. Even with this difference in effect, it can be seen from these data that there is a lot of difference in the design of the DETENTION oligonucleotide. The choice of lengths will be influenced by the temperature at which the reaction using the STOP oligonucleotide is performed, the lengths of the duplexes formed between the primary probe and the target, the primary probe and the secondary target, and the relative concentrations of the different nucleic acid species in the reactions.

EXAMPLE 53

Effect of STOP oligonucleotide concentration on signal improvement in multiple sequential invasive excision assays

When examining the effects of including STOP oligonucleotides in these cleavage reactions, it was of interest to determine whether the concentration of the STOP oligonucleotide in excess of the concentration of the primary probe would have an effect on the unspecific or specific signal yields, and if the length of the oligonucleotide STOP was a factor. These two variables were investigated in the following Example.

All reactions were performed in duplicate. Reactions with primary INVASOR were performed in a final volume of 10 μl and contained 10 mM MOPS, pH 7.5; 7.5 mM MgCl2, 500 fmol of primary INVASOR 241-95-01 (SEQ ID No. 176), 25 pmol of primary probe 241-95-02 (SEQ ID No. 175), 30 ng of Afu FEN-1 enzyme and 10 ng of human genomic DNA. When included, the target DNA was 1 atom of HBV amplicon pAM 6 # 2, as

It has been described above. MOPS, the target and the INVASOR were combined to a final volume of 7 μl. The

Samples were denatured with heat at 95 ° C for 5 minutes, then cooled to 67 ° C. MgCl2, the probe and the enzyme were combined during the 5-minute denaturation. Primary INVASOR reactions were initiated by the addition of 3 µl of MgCl2, the probe and the enzyme mixture. The reactions were incubated for 30 minutes at 67 ° C. The reactions were then cooled to 52 ° C and each primary INVASOR reaction received the following secondary reaction components: 2.5 pmol of secondary Diana 241-95-07 (SEQ ID No. 177), 10 pmol of secondary probe 228-48- 04 (SEQ ID No. 173); and, if included, 50, 100 or 200 pmol of the oligonucleotide DETENTION 241-95-03 (SEQ ID No. 179) or 241-95 or 1813 (SEQ ID No. 181) in a total volume

of 3 μl. The reactions were incubated at 52 ° C for 35 minutes. The reactions were stopped by adding 10 µl of a 95% formamide solution with 10 mM EDTA and 0.02% violet crystal. All samples were heated to 95 ° C for 1 minute and four µl of each sample was resolved by electrophoresis through

of 20% denaturing acrylamide gel (19: 1 cross-linking), with 7 M urea, in a buffer containing 45 mM Tris-Borate (pH 8.3) and 1.4 mM EDTA. Images of the results were generated using Molecular Dynamics 595 fluorescent imager, with excitation at 488 nm and emission detected at 530 nm. The resulting images are shown as a composite image in Fig. 111.

Each of the duplicate reactions were loaded into the gene in adjacent lanes and marked with a unique lane number. All odd number lanes were controls without a target. Lanes 1 and 2 had no oligonucleotide DETENTION added; lanes 3-8 show the results of the reactions containing the shortest STOP oligonucleotide, 241-95-03 (SEQ ID NO: 179); lanes 9-14 show the results of reactions containing the longest STOP oligonucleotide, 241-95-05 (SEQ ID NO. 181). The cleavage products of the secondary reaction are visible in the lower third of each panel. Visual inspection of these data (ie, the comparison of specific products with the background bands) shows that both STOP oligonucleotides have some beneficial effects throughout the concentration.

To quantify the relative effects of the length and concentration of the DETENTION oligonucleotide, the fluorescence of each of the product bands they ate was measured, the average of the duplicate lane signals was obtained and the amount on the bottom was calculated. "for each reaction containing target nucleic acid. The reaction lacking a STOP oligonucleotide gave a signal of approximately 27 on the background. Inclusion of the shorter STOP oligonucleotide at 50, 100 or 200 pmol produced products at 42, 51 and 60 on the bottom, respectively. This shows that while the short stop oligo at the lowest concentration appears to be less effective than the longer STOP oligonucleotides (see previous Example), this can be compensated by increasing the concentration of the STOP oligonucleotide and, thus, The oligonucleotide proportion OF DETENTION: primary probe.

In contrast to this, the inclusion of the shorter STOP oligonucleotide at 50, 100 or 200 pmol produced products at 60, 32 and 24 on the bottom, respectively. At the lowest concentration, the efficacy of this longer STOP oligonucleotide with respect to the shorter STOP oligonucleotide is consistent with the previous Example. However, increasing the concentration decreased the yield of the specific product, which suggests a competition effect with some element of the secondary cleavage reaction.

These data show that STOP oligonucleotides can be used to excel in a number of specific reaction designs. The choice of concentration will be influenced by the temperature at which the reaction using the DETENTION oligonucleotide, the lengths of the duplexes formed between the primary probe and the target, the primary probe and the secondary target, and between the probe is performed. Primary and oligonucleotide DEDETENTION.

The selection of oligonucleotides for target nucleic acids other than HBV shown here (e.g., the composition and length of the oligonucleotide) and the optimization of the cleavage reaction conditions according to the models provided herein follow routine procedures. and common practice well known to experts in molecular biology.

Example 45 demonstrated that some enzymes require an overlap between an upstream INVASOR oligonucleotide and a downstream probe oligonucleotide to create a cleavage structure (Figure 100). It has also been determined that the 3 'nucleotide of an INVASOR oligonucleotide does not have to be complementary to the target strand, although it is the only overlapping base in the INVASOR oligonucleotide (e.g., as with the HCMV probes shown in the Figure 103). The overlap requirement may serve as a convenient basis for detecting single base polymorphisms (SNPs) or mutations in a nucleic acid sample.

For the detection of variations of a base, at least two oligonucleotides (e.g., a probe and an INVASOR oligonucleotide) hybridize in tandem with the target nucleic acid to form the overlapping structure recognized by the

CLEAVASE enzyme to be used in the reaction. An "unpaired" fin is included at the 5 'end of the probe.

The enzyme recognizes the overlap and cleaves the flap without pairing, releasing it as a specific target product. Enzymes that have a strong preference for an overlapping structure, that is to say that they cleave the overlapping structure at a much faster rate than those that cleave a non-overlapping structure include the FEN-1 enzymes of Archaeoglobus fulgidus and Pyrococcus furiosus and such enzymes are particularly preferred. in the detection of mutations and SNPs. In the secondary reaction, the released fin serves as an INVASOR oligonucleotide to create another overlapping cleavage structure (eg, as shown in Figure 96). In the following examples, the free fin creates this overlapping structure together with a FRET cassette, a single oligonucleotide that has a region of autocomplementarity to form a hairpin (Figure 112A). When the FRET cassette is

cleaved to release the 5 ’nucleotide, the fluorescent dye (F) and the inactivator (Q) in the cassette are

separated and a detectable fluorescence signal is produced. If the probe and the target sequence do not coincide perfectly at the cleavage site (e.g., as in Figure 112B), the overlapping structure is not formed, the cleavage is suppressed and fluorescence will not occur.

The reactions can be carried out under conditions where FRET probes and cassettes are renewed continuously without temperature cycling or excision. When an uncut probe hybridizes to the target next to an overlapping INVASOR oligonucleotide, the probe can be cleaved to produce a specific target product that, in turn, allows the excision of many FRET cassettes.

The following eight examples demonstrate the design and application of the sequential INVASOR assay with detection of the FRET cassette to SNP analysis and mutations in various nucleic acid samples.

EXAMPLE 54

Detection of single nucleotide polymorphisms in the human apolipoprotein E gene

This Example describes an assay for the detection of SNPs in the human apolipoprotein E gene. Probe and INVASOR oligonucleotides were designed for single nucleotide polymorphisms (SNPs) at two positions in the human apolipoprotein E (apoE) gene. There are three different alleles for the apoE gene, epsilon 2, epsilon 3 and epsilon 4, which encode 3 different isoforms of the apoE protein, designated E2, E3 and E4. The different isoforms vary in amino acid positions 112 or 158 (see Table A) and each variation is due to a single base change in the corresponding codon.

Table A

ISOFORM

112 158

Codon

amino acid  Codon amino acid

E2 E3 E4

TGC TGC CGC cys cys arg TGC CGC CGC cys arg arg

The INVASOR oligonucleotides and probe were designed using the algorithm described above (Detailed description of the invention), setting the selected probe at 63 ° C. As shown in Figures 113 A-D, for each codon an INVASOR oligonucleotide and two unlabeled probe oligonucleotides were designed, one for each variant in a given locus. For codon 112, the probes were designed to detect nucleotide C (to encode arginine; SEQ ID No. 197) or nucleotide T (to encode cysteine; SEQ ID No. 198). For codon 158, the probes were designed to detect nucleotide C (to encode arginine; SEQ ID No. 199) or a nucleotide T (to encode cysteine; SEQ ID No. 200). A FRET cassette to be used with all probe sets was also synthesized (SEQ ID No. 201, Figure 113). In this Example, and in the following Examples, all oligonucleotides were synthesized using conventional phosphoramidite chemistry. The primary probe oligonucleotides were not labeled. FRET cassettes were labeled by incorporating Cy3 phosphoramidite and phosphoramidite (Glen

Research). Although designed for use at the 5 ’end, Cy3 phosphoramidite has a monomethoxytrityl group

(MMT) additional in the dye that can be removed to allow further extension of the synthetic chain, which results in an internal marker with the dye attached in a hole in the sugar-phosphate structure of the oligonucleotide (according to the diagram in the panels of Figure 113). Although a nucleotide can be omitted in this position to adapt the dye, the inventors have determined that it is not necessary and no nucleotide was omitted from the FRET cassettes used in these examples. The amine or phosphate modifications, when indicated,

3 'ends of the primary probes and FRET cassettes were used to prevent their use as invasive oligonucleotides. The 2’-O-methyl bases in the secondary target oligonucleotides are induced by underlining and were also used to minimize enzymatic recognition of the 3 ′ ends. In addition, reactions that have synthetic target DNA were used as positive controls to verify the activity of the reaction components. Control targets are illustrated in Figures 113 A-D. Control oligonucleotides 112 arg, 112 cys, 158 arg and 158 cys are SEQ ID NOS 191-194, respectively.

The AG09714 genomic DNA sample was purchased from Coriell. This sample was quantified by Pico Green and diluted with Tris with 0.1 mM EDTA to a concentration of approximately 100 ng / μl. This sample (9714 in Figure 114A) was used to analyze the 112 mutation. Samples 39634, 32435 and 31071 were purchased as whole blood from Lampire Biological Labs., Inc. Samples 511, 537, 538 and 539 were whole blood samples donated by the Blood Center of Southeast Wisconsin (Milwaukee, WI). Genomic DNA was prepared with the PUREGENE Blood Kit (Gentra) according to the manufacturer's instructions. Samples 39634 and 32435 were used to analyze mutation 112 and samples 31071, 511, 537, 38 and 539 were used to analyze mutation 158. One µl of genomic DNA was used by reaction with 9 µl of water for a final volume of 10 μl. Although the determination of

Complete genotype for any one sample usually requires the analysis of both loci, the samples listed above were selected to show representative signals and, therefore, the operation of each set of probes. Complete genotyping requires analyzing each sample with the probe sets.

The experiment included analyzing each genomic DNA the alleles indicated together with the reactions that do not have target DNA to allow the measurement of any background signal not attributable to the presence of a target sequence. The reactions that analyze locus 112 were performed in quadruplicate, the reactions that analyzed locus 158 were performed in triplicate.

The reaction components were prepared as batch mixtures to be dispensed to the individual test reactions. Batches of the mixture were prepared with INVASOR for each allele comprising for each

planned reaction: 4 μl of PEG 8000 at 16% / MOPS 50mM at pH 7.5 and 1 μl of oligonucleotide INVASOR 1 μM (el

112 or 158). Batches of the mixture were prepared on CLEAVASE / Mg2 + / probe for each allele comprising for

each planned reaction: 2 μl of 75mM MgCl2, 1 μl of the 10 μM FRET cassette, 1 μl of 10μM probe oligonucleotide (any one of the 112 or 158 T or C probe oligonucleotides) and 1 μl of the Afu 200ng FEN-1 enzyme / μl.

For each reaction, 5 µl of the INVASOR reaction was aliquoted into each well of a 96-well low profile polypropylene microplate (MJ Research). Ten μl of each control AND genomic sample

(approximately 100 ng-190 ng) were added and mixed by pipetting up and down. The controls without target They received 1 g of yeast tRNA instead of the target DNA. Reactions comprising synthetic targets as positive controls included  150 or 100 zeptomoles (zmol) of synthetic targets 112 or 158, respectively, and 1 g of yeast tRNA. Each reaction was covered with 20μl liquid CHILLOUT wax or incubated at 95 ° C for 5 minutes. Then, the reaction temperature was reduced to 63 ° C, 5μl of the CLEAVASE / Mg2 + / Probe enzyme reaction mixture was added to each reaction and mixed by pipetting up and down 35 times and the reactions were then incubated for 4 hours at 63 ° C and were read directly on a CYTOFLUOR Series 4000 (PerSeptive Biosystems) fluorescence multiwell plate reader, using the following parameters: Excitation (wavelength / bandwidth): 485/20 nm; Emission (wavelength / bandwidth): 530/25 nm; Gain: 37. The net mean fluorescence signal was calculated by subtracting the mean non-target signal (background) from the corresponding mean target DNA reaction signal and the data was plotted using Excel spreadsheet software (Microsoft).

The results for the ApoE 112 and ApoE 158 loci are shown graphically in Figures 114A and 114B, respectively, with Diana DNA indicated on the horizontal axis and the fluorescence units indicated on the

vertical axis. The white bars represent the average net signal of the "C" probe, while the dark bars represent the net average signal of the "T" probe. Reactions that have synthetic targets are indicated as Syn C and Syn T for controls C and T, respectively. In both loci, samples that are homozygous for the C or T allele are easily identified by having a strong signal from only one probe or the other, while heterozygous samples are easily identified by having strong signals from probes C and T.

EXAMPLE 55 Detection of mutations in the human hemochromatosis (HFE) gene

The human hemochromatosis (HFE) gene is located in the MHC region of chromosome 6 and was initially named HLA-H, later to be called the HFE gene, according to the WHO committee for HLA System Nomenclature. Two different variations of a single base in the HFE gene are responsible for the vast majority of cases of hereditary hemochromatosis, or disease of iron overload. The most common variant, called C282Y, is due to a change from adenine (A) of the Wild type (WT) to the mutant guanine (G) (MT) at codon 282 that produces an amino acid change of a cysteine residue To a tyrosine. The second variation usually detected in individuals suffering from iron overload disorder is called H63D and is due to a change of a cytosine (C) WT for a guanine (G) MT in codon 63 that produces an amino acid change of histidine to a residue of aspartic acid in the expressed protein.

The INVASOR oligonucleotide and probe assemblies were designed as described above to detect the WT and MT alleles at sites C282Y and H63D are shown in Figures 115 A-D. The C282 polymorphism detection used an INVASOR oligonucleotide (SEQ ID No. 202), a specific probe for each variant of the allele (WT and MT, SEQ ID No. 208 and 209, respectively) and a first FRET cassette (SEQ ID No. 210). The oligonucleotides for the H63 locus included an INVASOR oligonucleotide (SEQ ID No. 203), a specific probe for each variant of the allele (WT and MT, SEQ ID No. 211 and 212, respectively) and a second FRET cassette (SEQ ID No. 213) . In addition, reactions that have synthetic target DNA were used as positive controls to verify the activity of the reaction components. The control targets are illustrated in Figures 115 A-D. Control oligonucleotides C282 WT, C282 MT, H63 WT and H63 MT are SEQ ID NOS 204-207, respectively. Samples of human genomic DNA 14640,14641,14646, 14690, and 14691 were purchased from Coriell Cell Deposits (catalog no. NA14640, NA14641, NA1446, NA14690, and NA14691). The reactions were performed and analyzed as described in Example 54. The reactions comprising Synthetic targets as positive controls included 100 zeptomol of the synthetic target and 1 g of yeast tRNA. The results are shown graphically in Figure 116, with the target DNAs indicated on the horizontal axis and the fluorescence units indicated on the vertical axis. The white bars represent the net signal of the wild catheter, while the dark bars represent the net signal of the mutant catheter. The left half of the graph indicates the samples analyzed for the C282Y polymorphism, while the right half of the graph indicates the samples analyzed for the H63D polymorphism. Target-free controls are indicated as "NT" and synthetic targets are indicated as SynWT and SynMT for wild type and mutant controls, respectively. In both loci, samples that are homozygous WT or MT are easily identified by having a strong signal from only one probe or the other, while heterozygous samples are easily identified by having strong signals from the WT and MT probes.

EXAMPLE 56

Mutation detection in human MTHFR

5,10-Methylenetetrahydrofolate reductase (MTHFR) is a major enzyme in folate-dependent regulation of methionine and homocysteine concentrations. Wild-type protein plays a crucial role in the conversion of homocysteine to methionine. A specific variation in the MTHFR protein, called C677T, and caused by a transition from C to T in the MTHFR gene, has been correlated with a myriad of diseases and defects, including cardiovascular and neurological disorders. This Example describes an assay for the detection of WT and MT alleles for SNP MTHFR 677.

The INVASOR oligonucleotide and probe assemblies were designed as described above to detect the WT and MT allele for the MTHFR 677 site (INVASOR, WT probe, MT probe and FRET cassette are SEQ ID Nos. 216, 217, 218 and 225) , respectively). The positive control targets were synthesized for the WT and MT alleles at site 677 (SEQ ID NO. 214 and 215, respectively); oligonucleotides are shown in Figures 117A and 117B.

Samples of human genomic DNA 01532 and 01560 were purchased from Coriell. These samples had been

characterized by "PCR" in Coriell for the MTHFR genotype. They were also characterized internally

by PCR / RFLP analysis for genotype confirmation. The human genomic sample 32435 was purchased as whole blood from Lampire Bio-logical Labs., Inc. (Coopersberg, PA) and the genomic DNA was prepared using the Gentra PUREGENE Blood kit (Minneapolis, MN) according to the manufacturer's instructions. The samples were quantified by Pico Green (Molecular Probes, Eugene OR) and diluted with TE to a concentration

of approximately 10 ng / μl. In each reaction 100 ng (10 μl) of each sample was used.

Triplicate reactions were performed and analyzed as described in Example 54, except that

mixtures with INVASOR contained 1 µl of the 0.5 µM INVASOR oligonucleotide for each reaction. The reactions that

Synthetic targets comprising positive controls included 50 zeptomol of the synthetic target and 1 yeast tRNA. Reactions that simulate a heterozygous sample included 50 zmol of each control target.

The results are shown graphically in Figure 118, with the target DNAs indicated on the horizontal axis and the fluorescence units indicated on the vertical axis. The white bars represent the average net signal of the wild catheter, while the dark bars represent the net average signal of the mutant probe. Synthetic targets are indicated as SynWT and SynMT for wild-type and mutant controls, respectively, and SynHET for a mixture of the two to simulate a heterozygous sample. In both loci, samples that are homozygous WT or MT are easily identified by having a strong signal from only one probe or the other, while heterozygous samples are easily identified by having strong signals from the WT and MT probes.

EXAMPLE 57

Detection of mutations in the human prothrombin gene (Factor II)

It has been determined that the prothrombin A20210G mutation is a risk factor for thromboembolism. The

mutation occurs in the 2 ’untranslated region of the prothrombin gene, replacing the adenine (A) WT in the

position 20210 with the guanine (G) MT. This Example describes an assay for the detection of the WT and MT alleles of the prothrombin A20210G mutation.

The INVASOR oligonucleotide and probe assemblies were designed as described above to detect the WT and MT alleles at the 20210 site of the prothrombin (INVASOR, WT probe, MT probe and FRET cassette are SEQ ID NO: 222-225, respectively) . The positive control targets were synthesized for the WT and MT alleles at site 20210 (SEQ ID No. 220 and 221, respectively); oligonucleotides are shown in Figures 119A and 119B.

Three samples of patients in the human genomic DNA were donated by the Blood Center of Southeast Wisconsin and identified as 2196, 2263 and 2265. These samples were peurified at the Blood Center via QIAGEN BioRobot 9600 (QIAGEN # 900200), quantified using Pico Green (Molecular Probes) and were found to be at a concentration of 30-50 ng / ul.

Duplicate reactions were performed and analyzed as described in Example 54, except that

the INVASOR mixtures contained 1 μl of the 0.5 μM INVASOR oligonucleotide for each reaction and the mixture was diluted with 1 volume of dH2O (i.e. 5 μl per reaction) so that the INVASOR mixture was dispensed in 10 μl aliquots , while the DNA was dispensed in 5 μl aliquots, adding 150 -250 ng of genomic DNA by reaction. Each control reaction without target received 1 g of yeast tRNA and reactions comprising synthetic targets as positive controls included 300 zmol of WT control or 50 zmol of MT control and 1 g of yeast tRNA.

The results are shown graphically in Figure 120, with the target DNAs indicated on the horizontal axis and the fluorescence units indicated on the vertical axis. The white bars represent the average net signal of the wild catheter, while the dark bars represent the net average signal of the mutant probe. Synthetic targets are indicated as SynWT and SynMT for wild type and mutant controls, respectively. Samples that are homozygous for WT are easily identified by having a strong signal from only the WT probe, while the heterozygous sample is easily identified by having strong signals from the WT and MT probes.

EXAMPLE 58

Detection of the HR-2 mutation in the human factor V gene

This Example describes an assay for the detection of R-2 polymorphism in the human factor V gene. The R-2 polymorphism in the human factor V genl is located in exon 13 of the factor V gene and is the result of a transition from A to G at base 4070, replacing the wild histidine amino acid with the arginine mutant in the mature protein The R-2 polymorphism is one of a set of mutations called together HR-2. The HR-2 haplotype is defined by substitutions of 6 nucleotide bases in exons 13 and 16 of the factor V gene and is associated with an increase in functional resistance to activated protein C in both normal subjects and thrombophilic patients. When present as a compound heterozygote together with the mutation in the Leiden factor (see Example 60, below), the clinical symptoms are comparable with those observed in patients homozygous for the Leiden mutation.

In a region of approximately 600 base pairs surrounding the R2 allele, four DNA subregions, each of which encompasses the sequence of the INVASOR WT probe set (length of approximately 22 bases) contains the sequence similar to that immediately adjacent to the allele R2. These repeated sequences can be detected by an array of INVASOR oligonucleotide and probe designed for the wild-type R-2 sequence. By repeated sequence, reactions with the INVASOR oligonucleotide and probe set give a very high signal, even with genomic samples containing R-2 mutants, so that the risk of misinterpreting the data is greatly increased. In the example of a heterozygous R-2, the signal generated by the mutant R-2 would be extremely low compared to the wild-type signal. Therefore, it is possible that the data can be erred and interpreted as wild-type, not as heterozygous. The same would apply even for a homozygous mutant R-2 sample. Therefore, instead of having an INVASOR / probe set to detect the R-2 WT allele, an INVASOR / probe set was developed to detect sequences in the gene of the - single copy actin, so that internal control of the reaction is provided, as well as an internal control of the signal strength. Since the -actin gene is a single copy, the signal levels generated in the detection of this sequence will be comparable to those generated in the detection of the R-2 mutant allele and the probability of incorrect interpretation of the data due to Overcoming by the WT signal of the one generated by the MT is no longer a problem.

In the previous examples each sample was analyzed in two different reactions, one reaction analyzed the presence of wild type sequence and one reaction was analyzed by the presence of mutant sequence. In this example, Each sample is analyzed with the internal control of the -actin and the MT R-2 INVASOR / probe assemblies. The INVASOR oligonucleotide and probe assemblies were designed as described above to detect the control sequence of MT R-2 and -actin (INVASOR MT R-2 and probe, and the FRET cassette are SEQ ID NOS. 228, 229 and 230, respectively; INVASOR -actin and the probe are SEQ ID NOS. 231 and 232 , respectively). Positive control targets were synthesized for the mutant allele of R-2 and the -actin gene (SEQ ID NO: 226 and 227, respectively); oligonucleotides are shown in Figures 121A and B.

The 39021 genomic DNA sample was obtained in Sigma (catalog no. D6537) and the uncharacterized human genomic sample 15506 was obtained in Coriell (catalog no. NA15506, Camden, NJ 08103). The samples were diluted to 10 ng / μl with Tris-EDTA, pH 8.0. Ten μl (100 ng) was used per reaction. Target-free controls received 1 yeast tRNA instead of human genomic DNA. The reactions were performed and analyzed as has been

described in Example 54, except that the mixtures with INVASOR contained 0.5 μl of the oligonucleotide INVASOR 2 μM and oligonucleotide INVASOR DE -actin 2 μM. The probe master mixtures contained 1 μl of the 10 μM R-2 probe or 1 μl of the probe - 10 μM actin, 2 μl of 75 mM MgCl2, 1 μl of 10 μM FRET cassette and 1 μl of the enzyme FEN- 1 of Afu 200 ng / μl per reaction. The reactions that comprise synthetic targets  as positive controls included 100 zeptomol of the synthetic target and 1 g of yeast tRNA. The SynHET and SynMT reactions contained mixtures of synthetic targets at 2: 1 and 1: 1 of the -actin: R-2 mutant targets, respectively.

The reactions were read directly on a CYTOFLUOR Series 4000 multi-well plate reader (PerSeptive Biosystems) using the following parameters: Wavelength / excitation bandwidth 485 nm / 20 nm, Wavelength / emission bandwidth 530nm / 25 nm, gain 36.

The results are shown graphically in Figure 122, with the target DNAs indicated on the horizontal axis and the fluorescence units indicated on the vertical axis. The white bars represent the net signal of the internal control probe, while the dark bars represent the net signal of the R-2 mutant probe. Synthetic targets are indicated as SynIC and SynMT for internal control and mutant R-2 controls, respectively, and SynHET for a mixture of the two to simulate a heterozygous sample in the R-2 allele. The sample that does not have the R-2 MT allele is easily identified by having a strong signal from only the IC probe, while the one that is heroic in the R-2 allele is identified by having signals from the IC and R-2 probes MT, but at a ratio close to 2: 1. A homozygous sample for mutation in the R-2 allele (not shown) would show an almost equal signal from each probe, as shown with the SynMT control.

EXAMPLE 59

Detection of single nucleotide polymorphisms in the TNF- gene  human

It has been shown that human cytokine tumor necrosis factor alpha (TNF-alpha) is a major factor in graft rejection; When more TNF-alpha is present in the system, the greater the rejection response to the transplanted tissue. The mutation detected in this example is located in the promoter region of the TNF-alpha gene at position -308 (minus 308). Guanine (G) WT is replaced by an adenine (A) MT. This result of this mutation in the promoter is the multiplication of TNF-alpha transcription by 6 to 7. This Example describes a assay for the detection of mutation in -308 in the promoter of the TNF-human gene. The INVASOR oligonucleotide and probe assemblies were designed as described above to detect the WT and MT alleles at the -308 site (INVASOR, WT probe, MT probe are SEQ ID Nos. 235, 236 and 237 respectively; FRET cassette (SEC ID No. 225) The positive control targets were synthesized for the WT and MT alleles at the -308 site (SEQ ID NO: 233 and 234, respectively); the oligonucleotides are shown in Figures 123A and 123B.

Samples of purified genomic DNA (M2, M3 and M4) were donated by the Mayo Clinic (Rochester MN). Triplicate reactions were performed and analyzed as described in Example 54, except that

human. 100 μl of each stopped reaction was transferred to a 96-well Nunc Maxisorb plate (VWR Scientific) and read on a CYTOFLUOR Series 4000 multi-well plate reader (PerSeptive Biosystems) using the following parameters: Wavelength / bandwidth excitation 485 nm / 20 nm, Wavelength / emission bandwidth 530nm / 65 nm, gain 65.

The results are shown graphically in Figure 124, with the target DNAs indicated on the horizontal axis and the fluorescence units indicated on the vertical axis. The white bars represent the average net signal of the wild catheter, while the dark bars represent the net average signal of the mutant probe. Synthetic targets are indicated as SynWT and SynMT for wild-type and mutant controls, respectively, and SynHET for a mixture of the two to simulate a heterozygous sample. Samples that are homozygous WT or MT are easily identified by having a strong signal from only one probe or the other, while heterozygous samples are easily identified by having strong signals from the WT and MT probes.

EXAMPLE 60

Detection of the Factor V Leiden mutation

The mutation of "Leiden" in blood coagulation factor V is the result of a change of base in cytosine "C" in a thymidine "Y" in exon 1 of the factor V gene. The mutant protein has a glutamine in the amino acid at position 506, instead of the wild type arginine. This substitution prevents activated protein C from cleaving and inactivating factor V. Therefore, the active form of the protein remains abundant in the bloodstream and continues to stimulate coagulation. This Example describes an assay for the detection of the Leiden mutation in the human factor V gene.

The INVASOR oligonucleotide and probe assemblies were designed as described above to detect the WT and MT alleles at site 506 (INVASOR, WT probe, MT probe are SEQ ID Nos. 240, 241 and 242 respectively; the FRET cassette is the SEQ ID No. 225). The positive control targets were synthesized for the WT and MT alleles at site 506 (SEQ ID NO. 238 and 239, respectively); oligonucleotides are shown in Figures 125A and 125B.

Whole blood samples were obtained from the Midwest Hemostasis Center (Muncie, Indiana). The samples were characterized by the Leiden Factor V genotype by Midwest Hemostasis Center by procedures involving PCR. Leukocyte layers were isolated as described above and the genomic DNA was purified using the QIAamp 96 DNA Blood Kit (Qiagen, Valencia) according to the manufacturer's instructions, to

except that the samples eluted in 200 μl of the elution buffer. The purified DNA samples are

quantified by Pico Green (Molecular Probes) and then diluted with TE to a concentration of 15-60 ng per μl. Simple reactions were performed as described in Example 54. The control reaction without target received 1 g of yeast tRNA instead of DNA and reactions comprising synthetic targets as positive controls included 200 zmol of the synthetic target and 1 g of yeast tRNA.

After a 4-hour incubation at 63 ° C, the reactions were read directly in a CYTOFLUOR Series 4000 multi-well plate reader (PerSeptive Biosystems) using the following parameters: Wavelength / excitation bandwidth 485 nm / 20 nm, Wavelength / emission bandwidth 530nm / 65 nm, gain 65.

The results are shown graphically in Figure 126, with the target DNAs indicated on the horizontal axis and the fluorescence units indicated on the vertical axis. The white bars represent the average net signal of the wild catheter, while the dark bars represent the net average signal of the mutant probe. Synthetic targets are indicated as SynWT and SynMT for wild-type and mutant controls, respectively, and SynHET for a mixture of the two to simulate a heterozygous sample. Samples that are homozygous WT or MT are easily identified by having a strong signal from only one probe or the other, while heterozygous samples are easily identified by having strong signals from the WT and MT probes.

EXAMPLE 61

Methicillin-resistant Staphylococcus aureus detection

Staphylococcus aureus is recognized as one of the main causes of infections in humans that occur in the hospital and in the community in general. One of the most serious problems concerning the treatment of any bacterial infection is the increase in antibiotic resistance. The increasing incidence of methicillin-resistant S. aureus (MRSA) infections worldwide has underlined the importance of early detection of the infectious agent and defining a resistance profile so that appropriate treatment can be administered. The main mechanism of methicillin resistance involves the production of a protein called PBP2a, conditioned by the mecA gene. The mecA gene is not native to Staphalococcus aureus, but is of origin in other species. However, the mecA gene is indicative of methicillin resistance and is used as a marker for the detection of resistant bacteria. To identify methicillin-resistant S. aureus by nucleic acid techniques, both the mecA gene and at least one species-specific gene must be targeted. A specific species specific gene, the nuclease or nuc gene is used in the following example: This Example describes an assay for the detection of MRSA.

The INVASOR oligonucleotide and probe assemblies were designed as described above to detect the mecA gene and the nuc gene (INVASOR meA and probe are SEQ ID No. 243 and 244, respectively; INVASOR nuc and the probe are SEQ ID No. 246 and 247, respectively; the FRET cassette for INVASOR / probe assemblies is SEQ ID NO: 245); oligonucleotides are shown in Figures 127A and 127B. The mecA and nuc target sequences shown are SEQ ID Nos. 252 and 253, respectively. Samples of methicillin-resistant Staphalococcus aureus were purchased from the American Type Culture Collection (ATCC, Catalog No. 33591). Methicillin-sensitive Staphalococcus aureus (MSSA) samples were obtained from Gene Trak, Inc. (GT # 2431), and staphalococcus haemolyticus samples were obtained from the ATCC (ATCC No. 29970). Bacterial samples were seeded on standard blood agar plates and cultured at 37 ° C for 14-18 hours. The DNA samples from MRSA, MSSA and S. haemolyticus were prepared as follows. A single colony was suspended in 50 μl of 10 mM TRIS pH 7.5 in a 1.5 ml microfuge tube. The sample was incubated at 65 ° C for 5 minutes and then

Microwave with the highest parameter for 4 minutes. In each reaction ten μl of this was used

preparation.

Positive controls were created by polymerase chain reaction. A 533 base pair DNA fragment of the mecA sequence and a 467 base pair DNA fragment of the nuc gene sequence were amplified and isolated as follows. The PCR primer sequences used for the amplification of the mecA gene were 5'-AAA ATC GAT GGT AAA GGT TGG C-3 "(SEQ ID No. 248) and 5'-AGT TCT GCA GTA CCG GAT TTG C-3 '( SEQ ID No. 249) The PCR primer sequences used for the nuc gene amplification were 5'-TCGCTACTAGTTGCTTAGTG-3 '(SEQ ID No. 250 and 5'-GTAAACATAAGCAACTT-TAG-3' (SEQ ID No. 251). MRSA and MSSA DNA was isolated as described above The PCR reactions were performed using the AMPLITAQ DNA Polymerase Kit with GENEAMP (PE Corporation Catalog No. N8080152) Separate reactions were performed for the mecA sequences and nun and were made in a final volume

100 μl containing the following components: 10 μl of 10X buffer for PCR, 2.5 μl of the primer chain arrila and priming chain 10μM, 2 μl of 10mM dNTP mixture, 1.0 μl of AMPLITAQ DNA polymerase, 2 μl (10-50 ng) of bacterial DNA (MRSA or MSSA) and 80 μl of water for a final volume of 100 μl. The reactions were covered with approximately 50 µl of liquid wax CHILLOUT (MJ Research) and cycled as follows. The mecA reactions were denatured at 97 ° C for 3 minutes. Then, the reactions were cycled at 97 ° C for 1 minute, 52 ° C for 30 seconds, 72 ° C for 1 minute. This was repeated 5 times. After the final incubation of 1 minute at 72 ° C, the reactions were heated again to 94 ° C for 30 seconds, 52 ° C for 30 seconds and 72 ° C for 1 minutes, for 30 cycles. The reactions with mecA were then incubated at and 72 ° C for 7 minutes, then kept at 4 ° C until purification.

Nuc amplification reactions were denatured at 97 ° C for 3 minutes. Then, the reactions were cycled at 97 ° C for 1 minute, 48 ° C for 30 seconds, 72 ° C for 1 minute. This was repeated for 5 cycles. After the last incubation of 72 ° C for 1 minute, the reactions were heated to 94 ° C for 30 seconds, 48 ° C for 30 seconds and 72 ° C for 1 minute. This was repeated for 30 cycles. The reactions were then incubated at 72 ° C for 7 minutes and, finally, cooled to 4 ° C and maintained until purification.

After amplification, the reactions were performed on a 1% agarose gel in 1% TBE buffer with 50-2000 base pair markers (Novagen, decat no. 69278-3); the bands were visualized with ethidium bromide staining followed by ultraviolet illumination. The bands of suitable size were cleaved from the gel and the QlAquick Gel extraction kit from Qiagen (Qiagen catalog No. 28704) was purified according to the

manufacturer's instructions Each column was eluted twice with 50μl of elution buffer. The concentration of

Synthetic target DNA by purified PCR was determined by OD260 and diluted to a stock concentration of 50 fmol per microliter. Positive controls were used at a concentration of 10 amol per reaction with the addition

of 10 μl. Control reactions without a target were also performed using human genomic DNA at 10 ng / μl instead of a bacterial sample. All samples were added in a volume of 10 μl.

The INVASOR reactions were performed in 96-well low profile polypropylene microplates of MJ (MJ Research MLL-9601) in duplicate in a final volume of 15 μl. A master mixture of the INVASOR reaction was prepared and contained (per reaction) 1.5 μl of water, 2.5 μl of 100 mM MOPS, 5 μl of 20% PEG (8000MW), 0.5 μl of INVASOR nuc 1μM oligonucleotide and 0.5 μl of oligonucleotide INVASOR mecA. Five µl of the INVASOR master mix was added to each well with sample and control. To each well was added 10 µl of the samples of target bacterial AD, prepared as described above, or 10 µl (10 amoles) of the positive control target

or 10 μl (100ng of human genomic DNA) of the control sample without target. The samples were covered with 15 μl of

Chill-out wax transparent wax (MJ Research,) and incubated at 95 ° C for 5 minutes in an MJ Research Thermocycler with Hot Bonnet. Two different probe master mixtures were prepared, one containing the mecA probe oligonucleotide, one containing the nunc probe oligonucleotide. The master mixes probe

contained (per reaction) 2μl of MgCl2 93.75mM, 1μl of the 10μM FRET oligonucleotide, 1μl of the 10μM mecA probe oligonucleotide or the 10μM nuc probe oligonucleotide, 1μl of the Afu 100 ng / μl FEN-1 enzyme (Third Wave Technologies, catalog number 96004D). The temperature was cooled to 64 ° C and 5 µl of the appropriate probe master mix was added to each well (so that each control or sample reaction is analyzed with the mecA and nuc probe) under the Chill- wax layer. out and mixed by pipetting up and down 5 times. The plate was covered with MICROSEAL ’A’ Film (MJ Research) and incubated at 64 ºC for 30 minutes. After the 30-minute incubation, the reactions were cooled, placed on a Perkin Elmer MICROAMP base (Catalog No. N801-0531) and read in a multi-well plate reader CYTOFLUOR Series 4000 (PerSeptiveBiosystems) using the following parameters : Wavelength / excitation bandwidth 485 nm / 20 nm, Wavelength / emission bandwidth 530nm / 40 nm, gain 40, 30 readings per well, temperature 25 ° C.

The results are shown graphically in Figure 128, with the target DNAs indicated on the horizontal axis and the fluorescence units indicated on the vertical axis. The white bars represent the net mean signal of the mecA probe, while the dark bars represent the net average signal of the nuc probe.

EXAMPLE 62

Construction of specific chimeric structure nucleases

Fig. 59 provides an alignment of the amino acid sequences of several nucleases with structure specificity including several of the FEN-1, XPG and RAD type nucleases. The numbers to the left of each sequence line refer to the number of amino acid residues; no parts of the amino acid sequence of some of these proteins were shown to maximize protein alignment. The dashes represent gaps introduced to maximize alignment. In this alignment, it can be seen that proteins can be broadly divided into conservation blocks, which can also represent functional regions of the proteins. Although they are not intended for any limitation for the chimeric nucleases of the present invention, these preservation blocks can be used to select binding sites for the creation of said chimeric proteins.

Methanococcus jannaschii FEN-1 protein (MJAFEN1.PRO), Pyrococcus furiosus FEN-1 protein (PFUFEN1.PRO) are shown in the alignment in Fig. 59. These two natural genes were used to demonstrate nuclease creation chimeric that had different activities than any of the precursor nucleases. As those skilled in the art know, restriction endonuclease cleavage at appropriate sites and ligation would also be a suitable means for creating the nucleases of the present invention. The data shown in Figures 129A and 129B show, respectively, the activities of precursor nucleases on two types of cleavage structures, particularly folded structures (See, for example, Fig. 60) and invasive structures (See, for example, Fig. 26). These test molecules were digested as described in Ex. 29g. The lanes marked "1" show the Ffu-1 cleavage of Pfu, while the lanes marked "2" indicate the Mja FEN-1 cleavage.

In this example, PCR was used to construct complete coding sequences for the chimeric proteins. This is a small subset of the possible combinations. It would also be common practice in the art to design primers that allow the combination of any fragment of a gene for a nuclease with one or more other nuclease gene fragments, to create additional chimeric nucleases. The specification provides procedures, including an activity assay, so that the activity of any of these chimeric nucleases not explicitly described herein can be determined and characterized. Thus, any chimeric nuclease that meets the requirements of the chimeric nucleases, determined by procedures such as the test procedures described herein, can be used.

To prepare chimeric nucleases from 5 'nuclease genes of M. jannaschii and P. furiosus, homologous parts were amplified by PCR using external and internal primer series as shown in Fig. 130. In the next step, they were joined 5 'parts of one gene and 3' parts of another gene in pairs by means of recombinant PCF, so that each combination created a different full-size chimeric gene. The resulting coding regions were cloned into the pTrc99A vector and expressed to produce chimeric nucleases. The specific construction details of each of the chimeric genes shown in Fig. 130 are described below.

a) Construction of 5 'chimeric nuclease with N-terminal part of M. jannaschii and C-terminal part of P. furiosus with a junction point on codon 84 (Figure 130g).

A fragment of the pTrc99A vector carrying the 5 'nuclease gene of M. jannaschii was amplified by PCR with TrcFwd primers (SEQ ID No. 266) and 025-141-02 (SEQ ID No. 267) (5 pmol of each) in a 50 μl reaction using the AdvantageTM cDNA PCR kit (Clonetech), for 30 cycles (92 ° C, 30 s; 55 ° C, 1 min; 72 ° C 1 min) to obtain an N-end coding gene fragment (SEQ ID NO: 268) . Primers TrcRev (SEQ ID No. 269) and 025-141-01 (SEQ ID No. 270) were used to amplify a fragment of the pTrc99A vector carrying the P. furiosus gene to produce a gene fragment encoding the C-terminus (SEQ ID No. 271). The PCR products were cleaned with the High Pure PCR Product Purification Kit (Boehringer Mannheim, Germany) as described in the manufacturer's protocol and eluted in 100 µl of water. Primer 025-141-02 (SEQ ID No. 267) and primer 025-141-01 (SEQ ID No. 270) are complementary to each other, so that the PCR fragments created above had the corresponding regions of complementarity at one end. . When these fragments are combined in an amplification reaction, the complementarity region allows the parts to hybridize with each other, be introduced with the DNA polymerase and then amplified using the pair of external primers, TrcFwd (SEQ ID No. 266) and TrcRev ( SEQ ID No. 269) in this case, to form a fragment (SEQ ID No. 272). Five pmol of each external primer was then placed in 50 µl of PCR reaction using the AdvantageTM cDNA PCR kit (Clonetech) as described above. The full length PCR product (SEQ ID No. 272) that included the chimeric coding region (positions 45-1067 of SEQ ID No. 272) was separated on a 1% agarose gel by conventional procedures and isolated using the Kit Geneclean II (Bio 101, Vista, CA). The isolated fragment was then cut with restriction enzymes NcoI and PstI and cloned into the vector pTrc99A.

b) Chimeric 5 'nuclease construction with the N-terminal part of P. furiosus and the C-terminal part of M. jannaschii with a junction point on codon 84 (Fig 130f).

A fragment of the pTrc99A vector carrying the 5 'nuclease gene of P. furiosus was amplified by PCR with the TrcFwd primers (SEQ ID No. 266) and 025-141-02 (SEQ ID No. 267) (5 pmol of each) as described above to obtain a gene fragment encoding the N-terminus (SEQ ID NO: 273). Primers TrcRev (SEQ ID No. 269) and 025-141-01 (SEQ ID No. 270) used to amplify a fragment of the pTrc99A vector carrying the M. jannaschii gene to produce a gene fragment encoding the C-terminus (SEQ ID NO. 274). The fragments were purified and combined in a PCR as described above to form a fragment (SEQ ID No. 275), which contained the entire chimeric gene (positions 45-1025 of SEQ ID No. 275). This chimeric gene was cut with NcoI and PstI and cloned into the pTrc99A vector as described in a) above.

c) 5 'chimeric nuclease construction with the N-terminal part of P. furiosus and the C-terminal part of M. jannaschii with a junction point on codon 114 (Fig. 130e).

A fragment of plasmid pTrcPfuHis was amplified with PCR with primers TrcFwd (SEQ ID No. 266) and 025-16404 (SEQ ID No. 277) (5 pmol each), as described above to obtain a gene fragment encoding the N-terminus (SEQ ID No. 276). Plasmid pTrcPfuHis was constructed by modifying Trc99-PFFFEN1 (described in Ex. 28), adding a histidine tail to facilitate purification. To add this histidine tail, methods of mutagenesis directed to conventional primers were used to insert the coding sequence of six histidine residues between the last amino acid codon of the coding region of pTrc99-PFFFEN1 and the termination codon. The resulting plasmid was called pTrcPfuHis. Primers 159-006-01 (SEQ ID No. 279) and 025-164-07 (SEQ ID No. 280) were used as described in section a) above, to amplify a fragment of plasmid pTrcMjaHis to produce a coding gene fragment of end C (SEQ ID No. 278). Plasmid pTrcMjasHis was constructed by modifying pTrc99-MJFEN1 (described in Ex. 28), adding a histidine tail to facilitate purification. To add this histidine tail, conventional PCR mutagenesis procedures were used to insert this sequence of six histidine residues between the last amino acid codon of the coding region of pTrc99-MJFEN1 and the termination codon. The resulting plasmid was called pTrcMjaHis. The fragments were purified and combined by PCR amplification with TrcFwd primers (SEQ ID No. 266) and 150-006-01 (SEQ ID No. 279) into a fragment (SEQ ID No. 281) containing the chimeric gene (positions 45- 1043). This chimeric gene was cut with NcoI and PstI and cloned into the pTrc99A vector as described in a), above.

d) 5 'chimeric nuclease construction with the N-terminal part of M. jannaschii and the C-terminal part of P. furiosus with a junction point on codon 148 (Fig. 130d).

A fragment of the pTrc99A vector carrying the 5 'nuclease gene of M. jannaschii was amplified by PCR with TrcFwd primers (SEQ ID No. 266) and 025-119-05 (SEQ ID No. 283), as described above to obtain a gene fragment encoding the N-terminus (SEQ ID No. 282). Primers TrcRev (SEQ ID NO: 269) and 025-119-04 (SEQ ID NO: 285) were used to amplify a fragment of the pTrc99A vector carrying the P. furiosus gene to produce a gene fragment encoding the C-terminus (SEC ID No. 284). The fragments were purified as described above and combined by PCR amplification with the primers TrcFwd (SEQ ID No. 266) and TrcRev (SEQ ID No. 269) into a fragment (SEQ ID No. 286) containing the chimeric gene (positions 45-1067). This chimeric gene was cut with NcoI and PstI and cloned into the pTrc99A vector as described in a), above.

e) 5 'chimeric nuclease construction with the N-terminal part of P. furiosus and the C-terminal part of M. jannaschii with a junction point on codon 148 (Fig. 130c).

A fragment of plasmid pTrcPfuHis was amplified by PCR with primers TrcFwd (SEQ ID No. 266) and 025119-05 (SEQ ID No. 283) as described above to obtain a gene fragment encoding the N-terminus (SEQ ID No. 287). Primers TrcRev (SEQ ID No. 269) and 025-119-04 (SEQ ID No. 285) were used to amplify a fragment of plasmid pTrcMjaHis to produce a gene fragment encoding the C-terminus (SEQ ID No. 288). The fragments were purified as described above and combined by PCR amplification with TrcFwd primers (SEQ ID No. 266) and and TrcRev (SEQ ID No. 269) into a fragment (SEQ ID No. 289) containing the chimeric gene (positions 45 -1025). This chimeric gene was cut with NcoI and PstI and cloned into the pTrc99A vector as described in a), above.

f) Expression and purification of chimeras

All chimeric enzymes described above except the construction of P. furiosus -M. Jannaschii containing a junction point on codon 114 (ie, Example 62c) were purified as described for the Taq DN. The chimera of codon 114 of P. furiosus - M. jannaschii with a His marker was purified as described for the 5 'BN nuclease domain of Pol I of Taq.

g) Characterization of Nuclease Activity with Specificity of Natural and Chimeric Structure.

All chimeric enzymes produced as described above were characterized. In one test, enzymes were tested using a mixture of long and short hairpin substrates in the test system described in Example 28g.

In these tests, the reactions were performed using 50 ng of each enzyme for 2 min, at 50 ° C. The results of the analysis are shown in Fig. 131A. In this Figure, the lanes marked "1" and "2" in Figure 131A indicate reactions with the precursor enzymes of Pfu and Maj respectively. The remaining uncut fork molecules are visible as two bands at the top of each lane. Each chimeric enzyme tested is represented with reference to Figure 130. For example, the lane labeled "130f" shows the cleavage of these test molecules by the chimeric 5 'nuclease with the N-terminus of P. furiosus and the C-terminus of M. jannaschii attached at codon 84. The various cleavage products are seen at the bottom of each lane. These data show that chimeric nucleases can exhibit cleavage activities (i.e. substrate specificities) the same as any precursor molecule (e.g., 130c and Pfu precursor FEN-1 show little cleavage in this assay) or different from any molecule precursor (i.e. different product profiles).

Similarly, chimeric enzymes were examined for invasive cleavage activity using structure S60 and oligonucleotide P15 depicted in Fig. 26, as described in Example 11. The results are shown in Fig. 131B. The uncleaved labeled P15 oligonucleotide appears at the top of each lane, while the labeled cleavage product appears at the bottom.

These results indicate that the chimeric enzymes are different in activity and specificity of the original 5 '(wild-type) nucleases of M. jannaschii and P. furiosus.

EXAMPLE 63

Digestion comparison of folded cleavage structures with chimeric nucleases

A CFLP analysis was applied to a segment amplified by PCR obtained from E. coli 16S rRNA genes. Although bacterial 16S rRNA genes vary throughout the phylogenetic tree, these genes contain segments that are conserved at the species, genus or kingdom level. These characteristics have been used to generate primers that contain consensus sequences that flank regions of variability. In prokaryotes, ribosomal RNA genes are present in 2 to 10 copies, with an average of 7 copies in Escherichia strains. Any PCR amplification produces a mixed population of these genes and is essentially a "multiplex" PCR of that strain. The CFLPTM analysis represents a pattern composed of slightly varied rRNA genes within that organism, so that no particular rRNA sequence is directly responsible for the entire "barcode". As a representative example of an amplicon as described below 16s of E. coli is provided the E. coli rrsE gene (SEQ ID NO. 290). Despite the variable nature of these genes, PCR amplification between conserved regions of the rRNA genes can be performed, so that prior knowledge of the entire collection of rRNA sequences for any microbe of interest is not necessary (See, for example, Brow et al., J. Clin. Microbiol., 34: 3129 [1996]).

In this Example, primer pair 1638 (5'-AGAGTTTGATCCTGGCTCAG-3 ') (SEQ ID NO: 174) / TET-1659 (5'-CTGCTGCCTCCCGTAGGAGT-3') (SEQ ID No. 292) was used to amplify a fragment of approximately 350 bp of rrsE from genomic DNA obtained from E. coli O157: H7 (ATCC No. 43895). The PCR reactions contained 10 mM Tris-HCl (pH 8.3 at 25 ° C), 50 mM KCl, 1.5 mM MgCl 2, 0.001% w / v gelatin, 60 μM each of dGTP, dATP, dTTP and dCTP , 1 μM of each primer, 25 ng of genomic DNA and 2.5 units of Ampli Taq LD DNA polymerase in a volume of 100 μl. Control reactions that did not contain bacterial genomic input DNA were also processed to examine the amount of 16S rRNA product produced due to contaminants in DNA polymerase preparations. The reactions were subjected to 30 cycles of 95 ° C for 30 s; 60 ° C for 1 min; 72 ° C for 30 s; after the last cycle the tubes were cooled to 4 ° C.

After the thermal cycles, the PCR mixtures were treated with E. coli exonuclease I (Exo I, Amersham) to remove partial amplicons and single helix primers. An ExoI unit was added directly to each PCR mixture and the samples were incubated at 37 ° C for 20 minutes. Then, the nuclease was inactivated by heating at 70 ° C for 15 min. The reaction mixtures were taken to 2M NH4OAc and the DNAs were precipitated by the addition of 1 volume of 100% ethanol.

Excision reactions were then carried out comprising a 1 μl of TET-labeled PCR product (approximately 100 fmol) in a total volume of 10 μl containing 1X CFLPTM buffer (10 mM MOPS, pH 7.5; 0.5% Tween-20 and 0.5% NP-40) and 0.2 mM MnCl2. All components except the enzyme are

gathered in a volume of 9 μl. The reactions were heated at 95 ° C for 15 s, cooled to 55 ° C and the

cleavage reactions were initiated by the addition of 50 ng of enzyme. After 2 minutes at 55 ° C, the reactions

they were stopped by the addition of 6 μl of a solution containing 95% formamide, 10 mM EDTA and violet of

0.02% methyl.

The reaction mixtures were heated at 85 ° C for 2 min and then separated by electrophoresis through a 10% denaturing polyacrylamide gel (19: 1 cross-linking) with 7 M urea in a 45 mM Tris-Borate buffer, pH 8 , 3, 1.4 mM EDTA and were visualized using the FMBIO-100 Image Analyzer (Hitachi). The resulting scanned image is shown in Fig. 132. In this Figure, the enzymes used in each digestion are indicated at the top of each lane. Cleavase® BN is described in Ex. 2. Lane 2 shows the results of digestion with the Mja FEN-1 precursor nuclease, while digestions with the chimeric nucleases are indicated by reference to the diagrams in Fig. 130 These data demonstrate that the use of each of these nucleases under identical reaction conditions (ie, conditions in which DNA assumes similar folded structures) can produce differences of different patterns, which indicate differences in the specificities of enzymes. In this way, each enzyme can provide additional information on the folded structure assumed by a nucleic acid of interest, thus allowing more precise comparisons of molecules for identification, genotyping and / or mutation detection.

These data show that the activities of these enzymes can vary substantially in similar reaction situations. The realization of an optimization panel for an unknown enzyme can help in the selection of the enzyme and the optimal conditions for a given application. For example, in invasive excision reactions it is often desirable to choose a combination of nuclease and conditions that perform invasive excision, but that do not exhibit activity in the absence of the invading oligonucleotide (i.e., do not cut a hairpin type substrate). The optimization panel allows the selection of conditions that do not favor hairpin cleavage, such as the use of Pfu FEN-1 enzyme in a solution containing MgCl2. On the contrary, fork excision is desirable for excision of the CFLP type, so that it is contemplated that the reaction conditions will be selected according to the intensity of this activity.

EXAMPLE 64

Characterization of nuclease behavior with structure specificity

Two substrates were used to determine the optimal conditions for seven enzymes, FEN-1 of Afu, Pfu, Mth and Mja, CLEAVASE BN, DN of Taq and DN of Tth. As shown in Figure 140 Panel A, Substrate 25-65-1 (5'-Fluorescein -TTT-TCGCTGTCTCGCTGAAAGCGAGACAGCGTTT-3; SEQ ID No. 293) is a tallobucle structure with a 5 'arm marked at its 5' end with fluorescein. As shown in Figure 140 Panel B, Substrate 25-184-5 (invasive type "IT" test substrate) (5'-Fluorescein -TTTTCGCTGTCTCGCTGAAAGCGAGACAGCGAAAGACGCTCGTGAAACGAGC GTCTTTG-3; SEQ ID No. 294) an upstream primer adjacent to the 5 'fluorescein labeled arm; This mimics an invasive oligonucleotide and the target ("IT"). Conventional reactions contained 2 μM labeled substrate, 10 mM MOPS, pH 7.5, 0.05% TWEEN 20, 0.05% NP-40, 20 μg / ml tRNA (Sigma No. R-5636) and MgCl2 2 mM or 2 mM MnCl2. Reactions of ten 10 µl were heated at 90 ° C for 15 seconds in the absence of enzyme and divalent cation, after which the reactions were cooled to room temperature and enzyme was added. The reactions were heated at 50 ° C for 20 seconds and then divalent cation was added to start the reaction. The incubation time varied from 1 minute to 1 hour depending on the particular enzyme / substrate combination. Reaction times were adjusted so that less than 25% of the substrate was cleaved during incubation. The reactions were stopped by the addition of 10 µl of a 95% formamide solution with 20 mM EDTA and methyl violet. One µl of each reaction was electrophoresed in a 20% denaturing acrylamide gel and then scanned in an FMBIO-100 scanner (Hitachi).

The divalent cation titers varied from 0.25mM MgCl2 or MnCl2 to 7mM under otherwise conventional conditions. Salt titers varied from 0 mM KCl to 200 mM or 400 mM for salt tolerant enzymes under otherwise conventional conditions. For temperature titers, the reactions with the Cleavase® BN and FEN-1 enzymes contained 50 mM KCl and 4 mM MgCl2 or MnCl2. The temperature titers of DN of Taq and DN of Tth contained 200 mM KCl and 4 mM MgCl2 or MnCl2. The temperature varied from 40 ° C to 85 ° C in increments of 5 or 10 degrees depending on the particular enzyme used.

The results are shown in Figures 133-139. Figure 133 shows the results for CLEAVASE BN, while Figure 134 shows the results for Taq DN, Figure 135 shows the results for Tth DN, Figure 136 shows the results for Pfu FEN-1, Figure 137 shows the results for MEN FEN-1, Figure 138 shows the results for Afu FEN-1 and Figure 139 shows the results for Mth FEN-1. In each of the Panels within these Figures, enzyme activity is defined as cleavages by enzyme molecules per minute. Panels marked with "IT" refer to the cleavage of structure 25-184-5 (SEQ ID No. 294; Fig. 140B), which mimics an invading oligonucleotide / target DNA structure, while Panels marked with "hairpin "refer to the cleavage of structure 25-65-1 (SEQ ID No. 293; Fig. 140A), which indicates the activity on folded cleavage structures.

In each of these Figures, Panel A shows the results of reactions containing 2 mM MgCl2 and the IT substrate described in the text, varying the KCl as indicated; Panel B shows the results of reactions containing 2 mM MnCl2 and the IT substrate as described in the text, varying the KCl as indicated; Panel C shows the results of reactions containing 2 mM MgCl2 and the hairpin substrate as described in the text, varying the KCl as indicated; Panel D shows the results of reactions containing 2 mM MnCl2 and the hairpin substrate as described in the text, varying the KCl as indicated; Panel E shows the results of reactions containing the IT substrate as described in the text, varying the MgCl2 as indicated; Panel F shows the results of reactions containing the IT substrate as described in the text, varying the MnCl2 as indicated; Panel G shows the results of reactions containing the hairpin substrate as described in the text, varying the MgCl2 as indicated; Panel H shows the results of reactions containing the hairpin substrate as described in the text, varying the MnCl2 as indicated; Panel I shows the results of reactions containing the IT substrate, 4 mM MgCl2 and 50 mM KCl (FEN-1 from Afu, FEN-1 from Pfu, FEN-1 from Mja, FEN-1 from Mth and Cleavase® FN) or 200 mM KCl (Taq DN and Tth DN) as described in the text, varying the temperature as indicated; and Panel J shows the results of reactions containing the IT substrate, 4 mM MnCl2 and 50 mM KCl (FEN-1 from Afu, FEN-1 from Pfu, FEN-1 from Mja, FEN-1 from Mth and CLEAVASE® BN ) or 200 mM KCl (Taq DN and Tth DN) as described in the text, varying the temperature as indicated. It should be noted that some of these Figures (e.g., 134, 135, 136, and138) do not show each of the A-J panels indicated above.

From the foregoing, it is clear that the invention provides reagents and methods for allowing the detection and characterization of nucleic acid sequences and variations in nucleic acid sequences. The INVASOR-directed cleavage reaction of the present invention provides an ideal direct detection procedure that combines the advantages of direct detection assays (eg, easy quantification and minimal risk of contamination by handover) with the specificity provided by a test of hybridization of two or three oligonucleotides.

EXAMPLE 65

Cloning and expression of unknown FEN1 nucleases

The invention is defined in the claims.

A common procedure for cloning new members of a family of genes is to perform PCR reactions using degenerate oligonucleotides complementary to the amino acid sequences conserved in said family and then clone and sequence the gene-specific PCR fragments. This sequence information can then be used to design specific sense and antisense gene primers that can be used in circulating PCR reactions (Nucleic Acids Res. 1,995a. 23 (6) 1087-1088) to obtain the rest of the gene sequence . The sequences obtained from the sense and antisense PCR paths can then be combined to generate the DNA sequence for the entire open reading frame (ORF) of the gene of interest. One time

that all ORF is known, specific primers for the 5 ’and 3’ ends of the gene can be designed and

They can perform PCR reactions on genomic DNA to amplify the gene as a whole. This organism-specific amplified fragment can then be cloned into an expression vector and by methods known in the art, and detailed below, the protein of interest can be expressed and purified.

The following examples use this series of steps in the cloning and expression of 14 new FEN-1 nucleases. The steps and reagents (such as cloning vectors, expression vectors, PCR kit or circulating PCR kit etc.) are intended to be examples and not limitations to the present invention; Those skilled in the art would know that different cloning vectors, expression vectors, PCR kit or circulating PCR kit can be replaced by those in the examples.

The following example is divided into 2 main sections:

A. Degenerated PCR and circulating PCR to obtain the sequence of 14 new FEN-1 nucleases

B. Cloning and expression of 16 FEN-1 nucleases

A. Degenerated PCR and circulating PCR to obtain the sequence of 14 new FEN-1 nucleases

The protein sequences of the FEN1 genes of Pyrococcus juriosus (SEQ ID No. 79) Methanococcus jannaschii (SEQ ID No. 75), Methanobacterium thermoautotrophicum (SEQ ID No. 265) and Archaeoglobus fulgidus (SEQ ID No. 165) were aligned and the blocks of conserved amino acids The conserved sequence blocks (valine, phenylalanine, aspartic acid, glycine), EGEAQ (glutamic acid, glycine, glutamic acid, alanine, glutamine), SQDYD (serine, glutamine, aspartic acid, tyrosine, aspartic acid), and GTDYN / GTDFN (glycine, threonine, aspartic acid, tyrosine or phenylalanine, asparagine) were chosen as the sequences that would probably be present in the archaebacteria FEN1 genes.

Degenerated oligonucleotides were designed for each of these blocks of conserved sequence. In addition to

the specific part of the oligonucleotide FEN1 gene was added a 15 nucleotide tail at the 5 ′ end of

oligonucleotides to allow nested PCR. A different tail sequence was used depending on whether the degenerate oligonucleotide was directed to the sense or antisense strand of the FEN1 gene.

Direct and / or reverse versions of the oligonucleotides were prepared and directed to the sense and antisense strands of the FEN1 gene, respectively. The oligonucleotides are VFDG-Fwd (SEQ ID No. 295), EGEAQ-Fwd (SEQ ID No. 296) QDYD-Fwd (SEQ ID No. 297), EGEAQ-Rev (SEQ ID No. 298), SQDYD-Rev1 (SEQ ID No. 299 ), SQDYD-Rev2 (SEQ ID No. 300), and GTDYN-Rev (SEQ ID No. 301). Two oligonucleotides were prepared for the SQDYD-Rev sequence because the serine is encoded by 6 different codons. For use in PCR, the oligonucleotides SQDYD-Rev1 and SQDYD-Rev2 were mixed in a ratio of 1: 2. For oligonucleotide QDYD-Fwd the requirement of mixing was pointed out by targeting only the last four amino acids of the conserved SQDYD sequence. The GTDYN-Rev oligonucleotide also recognizes the GTDFN sequence, given that the codons for tyrosine and phenylalanine share 2 of 3 nucleotides.

First, genomic DNA was prepared from 1 vial of the live bacterial strain as described below. All bacterial strains were obtained from DSMZ (Deutsche Sammlung von Mikroorganismen und Zellkulturen, Acidianus ambivalens-DSM # 3772). When the cells were lyophilized, they were resuspended in 200 µl of TNE (10 mM TrisHCL, pH 8.0, 1mM EDTA, 100 mM NaCl). When the cells were in liquid suspension, they were centrifuged at 20,000 x G for 2 minutes and the cell precipitates were resuspended in 200 µl of TNE. 20 μl of 20% SDS (sodium doccyl sulfate) and 2 μl of proteinase K 1 mg / ml were added and the suspension was incubated at 65

ºC for 30 minutes. The lysed cell suspension was extracted sequentially with buffered phenol, 1: 1 phenol: chloroform and chloroform. The nucleic acid was precipitated by the addition of an equal volume of 100% cold ethanol. The nucleic acid was precipitated by centrifuging at 20,000 x G for 5 minutes. The nucleic acid pellet was washed with 70% ethanol, air dried and resuspended in 50 µl of TE (10 mM Tris HCl, pH 8.0, 1 mM EDTA). The final DNA pellet was resuspended in 50 μl of TE (10 mM Tris HCl, pH 8.0, 1 mM EDTA).

Both nested PCR reactions were performed using the Advantage cDNA PCR kit (Clontech) PCR kit from

according to the manufacturer's instructions using a final concentration of 1 μM for all oligonucleotides. The first reaction is carried out in a volume of 20 μl with one of the 6 possible combinations of direct and inverse degenerate oligonucleotides and includes 1 μl of the genomic DNA preparation described above or in the case of Tgo and Tzi, 1 μl (4 ng / μL of Madrek and 6 ng / μL of Mother, respectively) of DNA acquired from the ATCC

(ATCC # s 700654D and 700529D, respectively). The cycling conditions were 20 cycles of 95 ° C for 15 seconds, 50 ° C or 55 ° C for 15 seconds, and 68 ° C for 30 seconds. The second reactions use primers that have the same sequence as the 5 'tail sequence of the degenerate oligonucleotides described above. The two primers are 203-01-01 (SEQ ID No. 302) and 203-01-02 (SEQ ID No. 303). The second reaction is carried out exactly as described for the first reaction, except that

they perform 30 cycles instead of 20 and the reaction volume is 25 μl. After the second PCR, 5 μl of the

reaction in a 2% or 4% agarose gel and the DNA was visualized by staining with ethidium bromide. The expected product sizes based on the FEN1 sequences identified above for all primer pairs were the following: VFDG-Fwd and EGEAQ-Rev; 275 pairs of baes, VFDG-Fwd and SQDYD-Rev; 325 base pairs, VFDG Fwd and GTDYN-Rev; 510 base pairs, EGEAQ-Fwd and SQDYD-Rev; 100 base pairs, EGEAQ-Fwd and GTDYN-Rev; 290 base pairs, QDYD-Fwd and GTDYN-Rev; 230 base pairs. The pair of primers VFDG-Fwd and EGEAQ-Rev could generate a DNA product of the correct size for all the samples that were attempted. The pair of primers VFDG-Fwd and GTDYN-Rev could generate a DNA product of the correct size for most of the samples that were attempted.

When a DNA product of the intended size was manufactured by degenerate PCR, said DNA fragment was isolated and cloned into pGEM-T Easy (Promega) using the pGEM-T Easy ligation kit according to the manufacturer's instructions. The DNA sequence was determined and the sequence was used to generate the sense and antisense genome of the circulating oligonucleotides to clone the rest of the FEN1 genes. The oligonucleotides were designed according to the parameters of the GenomeWalker kit (Clontech), which was used to prepare the diverase genomic DNA samples for circulating genome PCR reactions.

Since many of the organisms of interest cannot be easily grown in a conventional laboratory situation (due to the requirements of temperature, pressure and very specialized environment conditions), the amounts of genomic DNA were limiting. Thus, the DNA was randomly amplified using a 12-unit random oligonucleotide. One hundred-μl PCR reactions were fixed with the Advantage cDNA PCR kit (Clontech) and contained 10 μl of genomic DNA and random oligonucleotide of 12 15 μM units. 50 cycles were carried out with the following parameters: 95 ° C for 30 seconds, 50 ° C for 30 seconds, 68 ° C for 5 minutes. Once the PCR reactions were completed, the amplified DNA was purified with the product purification kit for high purity PCR (Boehringer Mannheim). The purified DNA was eluted in a total of

200 μl of 10 mM TrisHCL, pH 8.5.

The circulating genome protocol consists of 3 stages: First, a genomic DNA sample is cut with 5 blunt end restriction enzymes in 5 different reactions. Second, the cut DNA is ligated into an adapter that serves as a labeling sequence and is also designed to prevent background amplification. Third, the ligated DNA is amplified with a gene specific primer and a primer with the same sequence as a portion of the adapter sequence.

50 μl of restriction enzymes contained 30 μl of randomly amplified genomic DNA and one of the enzymes

following. Dra I, Eco RV, Pvu II, Sca I or Stu L After four hours at 37 ° C, the cut DNA was purified with GENECLEANII (Bio 101) or QIAEX II (Qiagen) according to the manufacturer's instructions. DNA eluted in

10 μl 10 mM TrisHCl, pH 8.5 in any case. 5.6μl of this cut DNA was used in the 10μl ligation reactions containing the 6μM GenomeWalker adapter. The reactions were carried out at room temperature overnight, followed by heating at 70 ° C for 10 minutes to inactivate the T4 DNA ligase. The ligation reactions were then diluted with 70 µl of TE (10 mM Tris HCl, pH 8.0, 1 mM EDTA).

One μl of the diluted ligation mixture was used in 25 μl PCR reactions with 0.2 μM gene specific primer and 0.2 μM P-1 primer (Clontech), which has the same sequence as the 5 part 'of the Genome Walker adapter. Ten reactions were performed for each DNA sample. Five circulating antisense PCR reactions (for the five different restriction enzymes used to cut the genomic sample) were performed using the sense gene specific primer and five sense circulating PCR reactions were performed using the antisense gene specific primer for each sample of DNA The cycling parameters were as recommended in the Universal Genome Walking kit (Clontech) and were as follows: 7 cycles of 94 ° C for 25 seconds and 72 ° C for 3 minutes; 32 cycles of 94 ° C for 25 seconds and 67 ° C for 3 minutes; followed by 67 ° C for 7 minutes. The source of the DNA for the genome circulating PCR reactions was, in most cases, genomic DNA that had been randomly amplified with a 12-unit random oligonucleotide, as described above. The exceptions were Sulfolobus solfataricus (Sso), Thermococcus gorgonarius (Tgo), and Thermococcus zilligii (Tzi). Since Sso could be cullivated, there was a large amount of Sso genomic DNA and the DNA was used directly. A 500 ml culture of Sulfolobus solfataricus (ATCC No. 35091) was grown in DSM 182 medium at 75 ° C for 48 hours. After cultivation, the cells were centrifuged for 10 minutes at 20,000 xG at 4 ° C. The cell precipitate was resuspended in 10 ml of TE (10 mM Tris HCL, 1 mM EDTA) and frozen in 1 ml aliquots at -70 ° C. The DNA was prepared by the procedure described above using 1 ml aliquots, but all volumes increased 10 times. As indicated above, Tgo and Tzi genomic DNAs were acquired at the ATCC

Once the PCR reactions were completed, 5 μl of each reaction was loaded on a 1% agarose gel and the DNA was visualized by ethidium bromide staining. The presence of a main product was used as an indication of a successful reaction. When a main product was prepared, it was gel purified with GENECLEAN II (Bio101) or QIAEX II (Qiagen) and ligated into pGEM-T Easy (Promega) according to the manufacturer's instructions. The plasmids were sequenced with flanking primers of the insert and the sequence obtained was compared with the sequence of the fragment generated by PCR with the degenerate oligonucleotides of the same species. The sequences obtained for the degenerated PCR and the sense and antisense trajectories were combined to generate the DNA sequence for the entire open reading frame of FEN1. Specific information on the circulating genome and cloning for each of the 14 new FEN1 nuclei is detailed below.

1. Acidianus ambivalens (Aam)

The genome trajectories of Acidianus ambivalens (Aam) were performed as follows. The antisense primer was Aam 39AS (SEQ ID No. 304) and the felt primer was Aam 44S (SEQ ID No. 305). The antisense PCR pathway in the Aam genomic sample digested with ScaI generated a 1 kilobase DNA product that was cloned into pGEM-T Easy (Promega) following the manufacturer's instructions and sequenced. The PCR path felt in the Aam genomic sample digested with Dra I generated a 600 base pair fragment that was cloned into pGEM-T Easy (Promega) following the manufacturer's instructions and sequenced.

2. Acidianus brierlyi (Apr)

The genome trajectories of Acidianus brierlyi (Apr) were performed as follows. The antisense primer was in Apr 39AS (SEQ ID No. 306) and the felt primer was Apr 40S (SEQ ID No. 307). The antisense PCR pathway in the genomic sample of Abr digested with Eco RV generated a 1.5 kilobase DNA product that was cloned into pGEM-T Easy (Promega) following the manufacturer's instructions and sequenced. The PCR path felt in the genomic sample of Abr digested with Dra I generated a 600 base pair fragment that was cloned into pGEM-T Easy (Promega) following the manufacturer's instructions and sequenced.

3. Archaeoglobus profundus (Apr)

The genome trajectories of Acidianus brierlyi (Apr) were performed as follows. The antisense primer was in Apr 35AS (SEQ ID No. 308) and the felt primer was Apr 63S (SEQ ID No. 309). The antisense PCR pathway in the genomic sample of Apr digested with Dra I generated a 1.8 kilobase DNA product that was cloned into pGEM-T Easy (Promega) following the manufacturer's instructions and sequenced. The antisense PCR pathway in the genomic sample of Apr digested with Pvu II generated a 2 kilobase DNA product that was cloned into pGEM-T Easy (Promega) following the manufacturer's instructions and sequenced. The PCR path felt in the genomic sample of Apr digested with Dra I generated a 1 kilobase fragment that was cloned into pGEM-T Easy (Promega) following the manufacturer's instructions and sequenced.

4. Archaeoglobus veneficus (Ave)

The genome trajectories of Archaeoglobus veneficus (Ave) were performed as follows. The primary antisense primer was at Ave 34AS (SEQ ID No. 310) and the primary sense primer was at Ave 65S (SEQ ID No. 311). For Ave, the circulating PCR reactions of the primary genome generated a strong product for only the path felt in the Ave DNA sample cut with Dra I. Therefore, nested PCR reactions were performed by suctioning the nested primer AP-2 and the nested antisense barley Ave 32AS (SEQ ID No. 312) and the nested sense primer was on Ave 67S (SEQ ID No. 313). Nested reactions were performed with 25 µl as described above for the primary circulating PCR reactions. The primary reactions were diluted to 1: 50 in H2O and 0.5 µl of said dilutions were added to the nested PCR reactions. The cycling parameters for the nested PCR reactions were as recommended in the Universal Genome Walking kit (Clontech) and were as follows: 5 cycles of 94 ° C for 25 seconds and 72 ° C for 3 minutes, 20 cycles of 94 ° C for 25 seconds and 67 ° C for 3 minutes, followed by 7 minutes at 67 ° C. The nested antisense PCR reaction in a sample of Ave cut with Stu I generated a 1 kilobase DNA product that was cloned into pGEM-T Easy (Promega) following the manufacturer's instructions and sequenced. The sense PCR reaction nested in the genomic sample of Ave digested with Eco RV generated a 1.1 kilobase DNA product that was cloned into pGEM-T Easy (Promega) following the manufacturer's instructions and sequenced.

5. Desulfurococcus amylolyticus (Dam)

The genome trajectories of Desulfurococcus amylolyticus (Dam) were performed as follows. The antisense primer was Dam 3 1 AS (SEQ ID No. 314) and the felt primer was Dam 65S (SEQ ID No. 315). The antisense PCR pathway in the genomic sample of Dam digested with Stu I generated a 1 kilobase DNA product that was cloned into pGEM-T Easy (Promega) following the manufacturer's instructions and sequenced. The PCR path felt in the genomic sample of Dan digested with Pvu II generated an 800 base pair DNA product that was cloned into pGEM-T Easy (Promega) following the manufacturer's instructions and sequenced. The PCR path felt in the genomic sample of Dam digested with Stu I generated a 400 base pair fragment that was cloned into pGEM-T Easy (Promega) following the manufacturer's instructions and sequenced.

6. Desulfurococcus mobilis (Dmo)

The trajectories of the Desulfurococcus mobilis (Dmo) genome were performed as follows. The antisense primer was Dmo 31 AS (SEQ ID No. 316) and the felt primer was Dmo 66S (SEQ ID No. 317). The antisense PCR pathway in the genomic sample of Dmo digested with Eco RV generated a 450 base pair DNA product that was cloned into pGEM-T Easy (Promega) following the manufacturer's instructions and sequenced. The PCR path felt in the genomic sample of Dmo digested with Pvu II generated a 1 kilobase fragment that was cloned into pGEM-T Easy (Promega) following the manufacturer's instructions and sequenced.

7. Methanococcus igneus (Mig)

Methanococcus igneus (Mig) genome trajectories were performed as follows. The antisense primer was in Mig 36AS (SEQ ID No. 318) and the felt primer was Mig 39S (SEQ ID No. 319). The antisense PCR pathway in the genomic sample of Mig digested with Dra I generated a 900 base pair DNA product that was cloned into pGEM-T Easy (Promega) following the manufacturer's instructions and sequenced. The PCR path felt in the Mig genomic sample digested with Eco RV generated a 2.5 kilobase fragment that was cloned into pGEM-T Easy (Promega) following the manufacturer's instructions and sequenced.

8. Methanopyrus kandleri (Mka)

Methanopyrus kandleri (Mka) genome trajectories were performed as follows. The antisense primer was Mka 31AS (SEQ ID No. 320) and the felt primer was Mka 41 S (SEQ ID No. 321). The antisense PCR pathway in the genomic sample of Mka digested with Eco RV generated a 500 base pair DNA product that was cloned into pGEM-T Easy (Promega) following the manufacturer's instructions and sequenced. The PCR path felt in the genomic sample of Mka digested with Eco RV generated a 1.6 kilobase fragment that was cloned into pGEM-T Easy (Promega) following the manufacturer's instructions and sequenced.

9. Pyrobaculum aerophilum (Pae)

The genome trajectories of Pyrobaculum aerophilum (Pae) were performed as follows. The antisense primer was in Pae 28AS (SEQ ID No. 322) and the felt primer was Pae 45S (SEQ ID No. 323). The antisense PCR path in the Pae genomic sample digested with Eco RV generated a 400 base pair DNA product that was cloned into pGEM-T Easy (Promega) following the manufacturer's instructions and sequenced. The PCR path felt in the genomic sample of Pae digested with Pvu II generated a 700 base pair fragment that was cloned into pGEM-T Easy (Promega) following the manufacturer's instructions and sequenced.

10. Pyrodictium brockii (Pbr)

The genome trajectories of Pyrodictium brockii (Pbr) were performed as follows. The antisense primer was at Pbr 42AS (SEQ ID No. 324) and the felt primer was Pbr 56S (SEQ ID No. 325). The antisense PCR path in the genomic sample of Pbr digested with Eco RV generated a 650 base pair DNA product that was cloned into pGEM-T Easy (Promega) following the manufacturer's instructions and sequenced. The PCR path felt in the genomic sample of Pbr digested with Pvu II generated an 800 base pair fragment that was cloned into pGEM-T Easy (Promega) following the manufacturer's instructions and sequenced.

11. Sulfolobus solfataricus (Sso)

Sulfolobus solfataricus (Sso) genome trajectories were performed as follows. The antisense primer was in Sso 27AS (SEQ ID No. 326) and the felt primer was Sso 27S (SEQ ID No. 327). The antisense PCR pathway in the genomic sample of Sso digested with Pvu II generated a 1 kilobase DNA product that was cloned into pGEM-T Easy (Promega) following the manufacturer's instructions and sequenced. The PCR path felt in the genomic sample of Sso digested with Dra I generated a 750 base pair fragment that was cloned into pGEM-T Easy (Promega) following the manufacturer's instructions and sequenced.

12. Thermococcus gorgonarius (Tgo)

The genome trajectories of Thermococcus gorgonarius (Tgo) were performed as follows. The antisense primer was in Tgo 55AS (SEQ ID No. 330) and the felt primer was Tgo 67S (SEQ ID No. 331). The antisense PCR pathway in the genomic sample of Tgo digested with Dra I generated a 1 kilobase DNA product that was cloned into pGEM-T Easy (Promega) following the manufacturer's instructions and sequenced. The PCR path felt in the genomic sample of Tgo digested with Stu I generated a 850 base pair fragment that was cloned into pGEM-T Easy (Promega) following the manufacturer's instructions and sequenced.

13. Thermococcus litoralis (Tli)

The genome trajectories of Thermococcus litoralis (Tli) were performed as follows. The antisense primer was in Tli 28AS (SEQ ID No. 328) and the felt primer was Tli 48S (SEQ ID No. 329). The antisense PCR pathway in the genomic sample of Tli digested with Eco RV generated a 1 kilobase DNA product that was cloned into pGEM-T Easy (Promega) following the manufacturer's instructions and sequenced. The PCR path felt in the genomic sample of Tli digested with Eco RV generated a 1.9 kilobase fragment that was cloned into pGEM-T Easy (Promega) following the manufacturer's instructions and sequenced.

14. Thermococcus zilligii (Tzi)

The genome trajectories of Thermococcus zilligii (Tzi) were performed as follows. The antisense primer was in Tzi 55AS (SEQ ID No. 332) and the felt primer was Tzi 67S (SEQ ID No. 333). The antisense PCR pathway in the genomic sample of Tzi digested with Dra I generated a 1 kilobase DNA product that was cloned into pGEM-T Easy (Promega) following the manufacturer's instructions and sequenced. The PCR path felt in the Tzi genomic sample digested with Stu I generated an 850 base pair fragment that was cloned into pGEM-T Easy (Promega) following the manufacturer's instructions and sequenced.

B. Cloning of 16 FEN-1 nucleases

The previous section detailed the cloning and sequencing of new FEN1 nuclei. This section will describe the cloning of these new FEN-1s into an expression vector, as well as the cloning of two additional previously known FEN-1 Aeropyrnum pernix (Ape) and Pyrococcus horikoshii (Pho). The procedure comprises 4 or 5 stages and is explained broadly below.

The first stage involves the design of gene specific PCR primers in 5 ’and 3’. Since the complete sequence of the 16 FEN-1 genes has been determined, specific primers were designed to direct and amplify the FEN-1 gene of interest as a whole. For each FEN1 endonuclease to be cloned, the 5 ′ and 3 ′ end primers are mostly complementary to the 5 ’and 3’ end of the FEN1 open reading frame. The first few nucleotides of the primer constitute a spacer and sequences necessary to introduce a restriction endonuclease to facilitate cloning. The choice of restriction endonuclease sequence to incorporate into the primer depends on the sequence of the FEN-1 enzyme. Ideally, the sites of

Unique constraints are created at the 5 ’and 3’ ends of the PCR product (they are not the same as any site of

internal restriction in the sequence of FEN-1). Also, the sites incorporated in the primers correspond to restriction enzyme sites usually found in the expression vectors used in the art. Examples of such enzymes are EcoRI, SalI, NcoI, XbaI and PstI.

Second, the PCR reactions were performed using the primers designed above and the genomic DNA of the organism of interest. Third, the PCR products were gel purified and then cut with restriction endonucleases corresponding to the sites incorporated in the PCR primers. The products of the cut PCR were then purified from the smaller digestion fragments and, fourthly, the cut products were cloned into an expression vector. In some cases, this was the final stage of the cloning process, before the transformation and expression / purification of proteins. In some cases a fifth stage was necessary. In some cases, a mutagenesis step had to be performed to remove any nucleotide incorporated into the ORF as a result of the primer sequences required for cloning.

Finally, a bacterial host (e.g., E. coli JM109) was transformed with the expression vector containing the cloned FEN-1 and expression and purification were performed as detailed in Experimental Example 28f. Four of the isolated FEN gene constructs (Pae FEN-1, Pbr FEN-1, Mig FEN-1 and Mka FEN-1) produced little or no detectable protein in the host was transformed.

The following section details the PCR, restriction digests, cloning and mutagenesis reactions (if required) and transformation for each FEN-1 nuclease. The description is subdivided in order to group the FEN-1 nucleases according to the restriction endonucleases used in cloning. The subdivisions are as follows:

I. FEN-1 endonucleases cloned on NcoI / SalI restriction endonuclease

II. FEN-1 endonucleases cloned on the restriction endonuclease EcoRI / SalI

III. FEN-1 endonucleases cloned with other restriction endonucleases

I. Cloning of FEN-1 endonucleases using NcoI and SalI restriction endonucleases

In this example, the DNA encoding the FEN-1 endonuclease of Acidianus ambivalens (Aam), Acidianus brierlyi (Abr), Aeropyrum pernix (Ape), Archaeaglobus profundus (Apr), Methanococcus igneus (Mig), Pyrococcus horikoshii (Pho), Sulfolobus solfataricus (Sso), Thermococcus gorgonarius (Tgo), was isolated and inserted into a plasmid under the transcriptional control of an inducible promoter as follows.

1. Cloning of FEN-1 from Acidianus ambivalens (Aam)

One microliter of the genomic DNA solution described above (in section 65A) was used in a PCR using the ADVANTAGE cDNA PCR kit (Clonetech); PCR was performed according to the manufacturer's recommendations. For each FEN1 endonuclease to be cloned, the 5 ′ end primer is mostly complementary to the 5 ′ end of the FEN1 open reading frame. The first 6 nucleotides of the primer constitute a spacer and 2 bases of an Nco I site to facilitate cloning. An "A" in position 3 of the Aam ORF sequence (SEQ ID No. 336) was mutilated to a "G" in primer 5 "to create an ATP initiation codon. Likewise, the 3 ′ end primer is mostly complementary to the 3 ′ end of the FEN1 open reading frame. The first 10 oligonucleotides constitute a spacer and a Salt I site to facilitate cloning. The PCR primers used for Aam are: Aam5’-5 ’GCAACCATG GGAGTAGACCTTGCTGATTTGG (SEQ ID No. 334) and Aam 3’ -5 ’CCATGTCGACTAAAAC CACT-GATCTAAACCGC (SEQ ID No. 335). The PCR reaction for each FEN1 resulted in the amplification (ie, production) of a single main band with a length of approximately 1 kilobase. The open reading frame (ORF) encoding Aam FEN-1 endonuclease is provided in SEQ ID NO. 336; The amino acid sequence encoded by the Aam ORF is provided in SEQ ID NO 337.

After PCR amplification, the entire reaction was electrophoresed on a 1.0% agarose gel and the main band was cleaved from the gel and purified using the GENECLEAN II kit (Bio 101, Vista CA) according with the manufacturer's instructions. Approximately 1 μg of the gel purified FEN-1 PCR product was digested with NcoI and SalI. After digestion, the DNA was purified using the Geneclean II kit according to the manufacturer's instructions. A microgram of the pTrc99a vector (Pharmacia) was digested with NcoI and SalI in preparation for ligation with the digested PCR product. One hundred nanograms of the digested pTrc99a vector and 250 ng of the Mja FEN-1 PCR product were combined and ligated to create FEN 1 pTrc99-MJFEN-1 (TLA enzyme). pTrc99- (TLA enzyme) was used to transform competent E. coli JM109 cells (Promega) using conventional techniques.

2. Cloning of an FEN-1 edonuclease from Acidianus brierlyi

The cloning of an Acidianus brierlyi (Apr) FEN-1 was performed as indicated above with the exception of DSM 1651, the PCR primers used are Apr 5 '-5' CATACCATGGGAGTAGATTTATCTGACTTAG (SEQ ID No. 338) and Apr 3 '- 5 'CTTGGTCGACTTAAAACCATTGGTCAAGTCCAG (SEQ ID No. 339). A ’C’ in position 3 of the Apr ORF sequence (SEQ ID No. 338) was mutilated to a “G” in the 5 ’primer to create an ATP initiation codon. The open reading frame (ORF) encoding the Apr FEN-1 endonuclease is provided in SEQ ID NO. 340; The amino acid sequence encoded by this ORF is provided in SEQ ID No. 341.

3. Cloning of an FEN-1 edonuclease from Aeropyrum pernix

The cloning of an Aeropyrum pernix (Ape) FEN-1 was performed as indicated above except that the enzyme sequence was obtained from GENBANK (registration number H72765), DSM 11879, the PCR primers used are Ape 5 '-5' TTAGCCATGGGAGTCAACCTTAGGGAG (SEQ ID No. 342) and Ape 3'-5 'GTAAGTCGACTATCCGAAC-CACATGTCGAG (SEQ ID No. 343). A 'T' in position 1 of the Ape ORF sequence (SEQ ID No. 344) was mutilated to an 'A' in primer 5 'to create an ATP initiation codon. The open reading frame (ORF) encoding Ape's FEN-1 endonuclease is provided in SEQ ID NO. 344; The amino acid sequence encoded by this ORF is provided in SEQ ID No. 345.

4. Cloning of an FEN-1 edonuclease from Archaeaglobus profundus

The cloning of an FEN-1 from Archaeaglobus profundus (Apr) was performed as indicated except for DSM 5631, the PCR primers used are Apr 5'-5 'CTTACCATGGGCGCTGATATAGGAGAGC (SEQ ID No. 346) and Apr 3'- 5 'TGGAGTCGACTTAAAACCACCTGTCCAGAG (SEQ ID No. 347). The open reading frame (ORF) encoding Apr's FEN-1 endonuclease is provided in SEQ ID NO. 348; The amino acid sequence encoded by this ORF is provided in SEQ ID No. 349.

5. Cloning of an FEN-1 edonuclease from Methanococcus igneus

The cloning of a Methanococcus igneus (Mig) FEN-1 was performed as indicated above with the exception of DSM 5666, the PCR primers used are Mig 5 '-5' CATTCCATGGGAGTGCAGTTTAATG (SEQ ID No. 350) and Mig 3 '- 5 'CGGAGTCGACTCATCTCCCAAACCATGC (SEQ ID No. 351). The open reading frame (ORF) encoding Mig FEN-1 endonuclease is provided in SEQ ID NO. 352; The amino acid sequence encoded by this ORF is provided in SEQ ID No. 353.

6. Cloning of an FEN-1 edonuclease from Pyrococcus horikoshii

The cloning of a Pyrococcus horikoshii (Pho) FEN-1 was performed as indicated above except that the enzyme sequence was obtained from GENBANK (registration number A71015), the DSM is 12428, the PCR primers used they are Pho 5 '-5' GATACCATGGGTGTTCCTATCGGTGAC (SEQ ID No. 354) Pho 3 '- 5' CTTGGTC-GACTTAGGGTTTCTTTTTAACGAACC (SEQ ID No. 355). The open reading frame (ORF) encoding Pho's FEN-1 endonuclease is provided in SEQ ID NO. 356; The amino acid sequence encoded by this ORF is provided in SEQ ID No. 357.

7. Cloning of an FEN-1 edonuclease from Sulfolobus solfataricus

The cloning of a Sulfolobus solfataricus (Sso) FEN-1 was performed as indicated above except that bacterial reserves were obtained from the American Type Culture Collection (Manassas, VA) (ATCC, No. 5091) and the primers of PCR used are Sso 5'-5 'TAAGCCATGGGTGTAGATTTAGGCGAAATAG (SEQ ID No. 358) Sso 3'-5' ACTAGTCGACTTAAAACCACTGATCAAGACCTGTC (SEQ ID No. 359). An "A" in position 3 of the Sso ORF sequence (SEQ ID No. 360) was mutilated to a "G" in primer 5 "to create an ATP initiation codon. The open reading frame (ORF) encoding Sso FEN-1 endonuclease is provided in SEQ ID NO. 360; The amino acid sequence encoded by this ORF is provided in SEQ ID No. 361.

8. Cloning of an FEN-1 edonuclease from Thermococcus gorgonarius

The cloning and expression of Thermococcus gorgonarius (Tgo) was performed as indicated above except that the ATCC number is 700653D and the PCR primers used are Tgo 5 '-5' CTAGCCATGGGAGTTCAGATAGGTGAGC (SEQ ID No. 362) and Tgo 3 '-5' TGGAGTCGACTACCGTGTGAACCAGCTTTC (SEQ ID No. 363). The open reading frame (ORF) encoding Tgo's FEN-1 endonuclease is provided in SEQ ID NO. 364; The amino acid sequence encoded by this ORF is provided in SEQ ID No. 365.

II. Cloning of FEN-1 endonucleases with EcoRI / SalI

The FEN-1s in this group were cloned as indicated above, except that the restriction endonucleases used for the cloning stage are EcoRI and SalI. This is due to the presence of an internal NcoI site in these FEN-1 sequences. EcoRI is a good choice since it is common in the cloning technique, it is found in many expression vectors and the following FEN-2 do not contain internal sites for EcoRI. Interestingly, the cloning of these PCR fragments into the pTRC99a vector gives an ORF containing two amino acids not present in the native sequence. To correct this and obtain a native ORF, mutagenesis reactions were performed with the Transformer ™ Site-Directed Mutagenesis Kit (Palo Alto CA, catalog number K1600-1) following the manufacturer's instructions, using the mutagenic oligonucleotide specified for each endonuclease FEN1. After the mutagenesis reaction, it was selected by cutting the products with Ncori. Since mutant constructs have no EcoRI site, they will not be cut. No construction not adequately mutageneized will contain an EcoRI restriction site and will be cut with the digestion reaction. Bacterial cells were transformed and cultured in selective medium (ampicillin) according to the instructions of the Transformer ™ Site-Directed Mutagenesis kit. The mutagenic plasmid was isolated according to the manufacturer's instructions, the resulting DNA was cut again with EcoRI and the products of this reaction were used to transform JM 109 cells from E. coli (Promega) using standard techniques.

9. Cloning of an FEN-1 edonuclease from Archaeaglobus veneficus

The cloning of an FEN-1 from Archaeaglobus veneficus (Ave) was performed as indicated above with the exception of DSM 11195, the PCR primers used are Ave 5'-5 'TAACGAATTCGGTGCAGACATAGGCGAACTAC (SEQ ID No. 366) and Ave 3'- 5 'CGGTGTCGACTCAGGAAAACCACCTCTCAAGCG (SEQ ID No. 367), and the mutagenic oligonucleotide used was Ave.R1-5' CACAGGAAACAGACCATGGGTGCAGACATAGGCGAAC (SEQ ID No. 368). The open reading frame (ORF) encoding Ave's FEN-1 endonuclease is provided in SEQ ID NO. 369; The amino acid sequence encoded by this ORF is provided in SEQ ID No. 370.

10. Cloning of an FEN-1 edonuclease from Desulfurococcus amylolyticus

The cloning of a Desulfurococcus amylolyticus (Dam) FEN-1 was performed as indicated except for the DSM 3822, the PCR primers used are Dam 5'-5 'CTAAGAATTCGGAGTAGACTTAAAAGACATTATACC (SEQ ID No. 371) and Dam 3'- 5 'AGTTGTCGACTACTTCGGCTTACTGAACC (SEQ ID No. 372), and the mutagenic oligonucleotide used was Dam .R1 5' CAGGAAACAGACCATGGGAGTAGACTTAAAAGAC (SEQ ID No. 373). The open reading frame (ORF) encoding Dam FEN-1 endonuclease is provided in SEQ ID NO. 374; The amino acid sequence encoded by this ORF is provided in SEQ ID No. 375.

11. Cloning of an FEN-1 edonuclease from Pyrobaculum aerophilum

The cloning of a Pyrobaculum aerophilum (Pae) FEN-1 was performed as indicated except for DSM 7523, the PCR primers used were cloned using EcoR I and Salt I Pae 5 '-5' CGTTGAATTCGGAGTTACTGAGTT-GGGTAAG (SEC ID No. 376) and Pae 3 '-5' TACTGTCGACAGAAAAAGGAGTCGAGAGAGGAAG (SEQ ID No. 377). A’G ’in position 1 of the Pae ORF sequence (SEQ ID No. 378) was an’ A ’in primer 5’ to create an ATP initiation codon. The mutagenesis reaction for this enzyme has not yet been performed. There are two non-native amino acids at the 5 ’end of this protein. The open reading frame (ORF) encoding Pae's FEN-1 endonuclease is provided in SEQ ID NO: 378; The amino acid sequence encoded by this ORF is provided in SEQ ID No. 379.

12. Cloning of an FEN-1 edonuclease from Thermococcus litoralis

The cloning of a Thermococcus litoralis (Tli) FEN-1 was performed as indicated except with the exception of DSM 5473, the PCR primers used were Tli 5'-5 'TCATGAATTCGGAGTCCAGATTGGTGAGCTT (SEQ ID No. 380) and Tli 3' - 5 'GATTGTCGACTCACTTTTTAAACCAGCTGTCC (SEQ ID No. 381); the mutagenic primer was Tli .R1-5 AAGCTCACCAATCTGGACTCCCATGGTCTGTTTCCTGTG (SEQ ID No. 382). The open reading frame (ORF) encoding Tli FEN-1 endonuclease is provided in SEQ ID NO. 383; The amino acid sequence encoded by this ORF is provided in SEQ ID No. 384.

13. Cloning of an FEN-1 edonuclease from Desulfurococcus mobilis

The cloning of a Desulfurococcus mobilis (Dmo) FEN-1 was performed as indicated above with the exception of DSM 2161, the PCR primers used were Dmo 5'-5 'CTTGGAATTCGGCGTCGACCTAAGGGAACTC (SEQ ID No. 385) and Dmo 3'- 5 'AGGTCTGCAGTTAACCCTGCTTACCGGGCTTAGC (SEQ ID No. 386), and the mutagenic primer used was Dmo .R1-5' CAGGAAACAGACCATGGGCGTCGACCTAAGG (SEQ ID No. 387). The open reading frame (ORF) encoding Dmo's FEN-1 endonuclease is provided in SEQ ID NO. 388; The amino acid sequence encoded by this ORF is provided in SEQ ID No. 389.

14. Cloning of an FEN-1 edonuclease from Pyrodictium brockii

The cloning of a Pyrodictium brockii (Pbr) FEN-1 was performed as indicated above except for DSM 2708, the PCR primers used were Pbr 5'-5 'TAGCGAATTCGGCGTCAACCTCCGCGAG (SEQ ID No. 390) and Pbr 3'- 5 'CATTCTGCAGCTAGCGGCGCAGCCACGC (SEQ ID No. 391); the mutagenic primer was Pbr .R1-5 'CAG-GAAACAGACCATGGGCGTCAACCTCCGC (SEQ ID NO: 392). A’G ’at position 1 of the Pbr ORF sequence (SEQ ID NO: 393) was mutilated to an ’A’ on primer 5 ’to create an ATP initiation codon. The open reading frame (ORF) encoding Pbr FEN-1 endonuclease is provided in SEQ ID NO. 393; The amino acid sequence encoded by this ORF is provided in SEQ ID NO: 394.

III. Cloning of FEN-1 endonucleases with other enzymes

The following FEN-1 endonucleases were cloned using restriction endonucleases other than those already described. These specific FEN-1 sequences contain internal sites for EcoRI or internal sites for SalI and, therefore, require different restriction enzymes at the cloning stage. None of the primers used in this section give cloned products containing an ORF with aberrant (unnatural) nucleotides, therefore there is no need for an additional mutagenesis stage. All reactions described in this section were performed as in section I, with all exceptions indicated below.

15. Cloning of an FEN-1 edonuclease from Methanopyrus kandleri

The cloning of a Methanopyrus kandleri (Mka) FEN-1 was performed as indicated above with the exception of DSM 6324, the PCR primers used were Mka 5'-5 'CATACCATGGGACTAGCTGAACTCCGAG (SEQ ID No. 395) and Mka 3'- 5 'TGGATCTAGATCAGAAGAACGCGTCCAGGG (SEQ ID No. 396). A’G ’in position 1 of the Mka ORF sequence (SEQ ID NO: 397) was an ’A’ in primer 5 ’to create an ATP initiation codon. The restriction enzymes used in the cloning reaction were NcoI and XbaI. The open reading frame (ORF) encoding the Mka FEN-1 endonuclease is provided in SEQ ID NO. 397; The amino acid sequence encoded by this ORF is provided in SEQ ID NO: 398.

16. Cloning of an FEN-1 edonuclease from Thermococcus zilligii

The cloning of a Thermococcus zilligii (Tzi) FEN-1 was performed as indicated above except that the genomic DNA obtained was obtained from the American Type Culture Collection (ATCC, No. 700529D) and the PCR primers used were Tzi 5 '-5' CGATCCATGGGAGTTCAGATCGGTGAGC (SEQ ID No. 399) and Tzi 3'-5 'CAGGCTGCAGTCACCT-TCCGAACCAGCTCTC (SEQ ID No. 400). The restriction enzymes used in the cloning reaction were NcoI and PstI. The open reading frame (ORF) encoding Tzi FEN-1 endonuclease is provided in SEQ ID NO: 401; The amino acid sequence encoded by this ORF is provided in SEQ ID No. 402.

IV. Site-directed and recombinant mutants of the FEN1 enzymes.

Chimeras of change of arc

The arc region of the FEN1 enzymes comprises approximately 58 amino acids from amino acid 78 (beginning with the VFDG sequence conserved) to amino acids 135. The FEN1 enzymes of Archaeoglobus fulgidus (Afu), Pyrococcus furiosus (Pfu), and Methanococcus jannaschii (Mja) they have different specificities, the

Arc regions were "changed" between enzymes and the effects on the specificity of the enzyme were examined.

Amino acids 78 to 84 (starting in the arc region) are identical in the enzymes FEN1 Afu, Pfu and Mja, amino acids 85 to 135 of Mja, Pfu and Afu were changed to create new chimeric enzymes. The four enzymes created are MPM, PMP, MAM, and PAP.

MPM consists of amino acids 1-84 of Mja FEN1 enzyme, amino acids 85-135 of Pfu FEN1 enzyme and amino acids 136-326 of Mja FEN1 enzyme. PMP consists of amino acids 1-84 of the FEN1 enzyme of pFU, amino acids 85-135 of the MEN FEN1 enzyme and amino acids 136-340 of the Pfu FEN1 enzyme. MAM consists of amino acids 1-84 of the enzyme FEN1 of Mja, amino acids 85-134 of the enzyme FEN1 of Afu and amino acids 136-326 of the enzyme FEN1 of Mja (the discrepancy in numbering is due to the fact that the arc is a shorter amino acid in the FEN1 of Afu than in the FEN1 of Pfu and Mja). PAP consists of amino acids 1-84 of Pfu FEN1 enzyme, amino acids 85-134 of Afu FEN1 enzyme and amino acids 136-340 of Pfu FEN1 enzyme.

The MPM chimera was constructed as follows. Three PCR reactions were performed, one for each chimera fragment. PCR reactions were carried out as described. Reaction 1 used primers Mja5 ’(5’-GGGATAC-CATGGGAGTGCAGTTTGG, SEQ ID No. 411) and MPM84AS 5’ (GAGCTCTTTCTTTTTGAATTCTGGTGGCTCAC-CATCAAAAAC, SEQ ID No. 412) and 1 nd of 1mn in line F1 to 1 ng of PL1 nd. Reaction 2 used primers P84S (5’-GAATTCAAAAAGAAAGAGCTC, SEQ ID No. 413) and P135AS (5’-TGCATCCTCGATGAGCATTTC, SEQ ID No. 414) and 1 ng of the plasmid containing the PEN FEN1 FEN1. Reaction 3 used primers P84S MPM135S the (5'-GAAATGCTCATCGAGGAT-GCAAAATATTTGTTAAGTTTGATGGG, SEQ ID NO 415) and Mja3 '(5'-GGTAAATTTTTCTCGTCGACATCCCAC, SEQ ID NO 416) and 1 ng of plasmid containing the Mja FEN1 of FEN1. After the first reaction, the fragments were gel purified and eluted in 50 µl of the elution buffer. The DNA fragments were diluted from 1 to 10 in water and to the final PCR, which was performed as described above for primers Mja5 'and Mja3', 1 µl of each diluted fragment was added. After the final PCR, the DNA was gel purified and cloned into the pTrc99a vector as described. º The open reading frame of MPM is SEQ ID No. 417; The amino acid sequence of MPM is SEQ ID No. 418.

The PMP chimera was constructed as follows. Three PCR reactions were performed, one for each chimera fragment. PCR reactions were carried out as described. Reaction 1 used primers Pfu5 ’(5’-GATTCCAT-GGGTGTCCCAATTGGTGAG, SEQ ID No. 419) and Pmp84AS (5’-CCTTGTTTTCTCCTTTAACTTTGGAGGTTCTC-CATCAAAAAC, SEQ ID No. 420) and 1 ng of the plasmid of the P1 plasmid. Reaction 2 used primers M84S (5’-AAGTTAAAGGAGAAAACAAGG, SEQ ID No. 421) and M135AS (5’-GCAGTTTTCAACCATTTTCGG, SEQ ID NO: 422) and 1 ng of the plasmid containing the MEN FEN1 FEN1. Reaction 3 used primers Pmp135S (5’-CCGAAAATGGTTGAAAACT-GCAAAAAACTCTTAGAGCTTATG, SEQ ID No. 423) and Pfu3 ’(5’-CGGAGTCGACTTATCTCTTGAACCAACTT-TCAAG, SEQ ID No. 424) and 1 nd of 1 pn. After the first reaction, the fragments were gel purified and eluted in 50 µl of the elution buffer. The DNA fragments were diluted from 1 to 10 in water and to the final PCR, which was performed as described above for primers Pfu5 'and Pfu3', 1 µl of each diluted fragment was added. After the final PCR, the DNA was gel purified and cloned into the pTrc99a vector as described. The sequence of the open reading frame of PMP is SEQ ID No. 425, the amino acid sequence of PMP is SEQ ID No. 426.

The MAM chimera was constructed as follows. Three PCR reactions were performed, one for each chimera fragment. PCR reactions were carried out as described. Reaction 1 used primers Mja5 ’and MAM84AS (5’-CAATTTCAGCCTTCTTGAACTCTGGTGGCTCACCATCAAAAAC, SEQ ID No. 427) and 1 ng of the plasmid containing MEN FEN1 FEN1. Reaction 2 used primers A84S (5’-GAGTTCAAGAAGGCTGAAATTG, SEQ ID No. 428) and A135AS (5’-TGCGGAGTCAACAATGTACTC, SEQ ID NO: 429) and 1 ng of the plasmid containing the FEN1 of Afu. Reaction 3 used primers MAM135S (5’-GAGTACATTGTTGACTCCGCAAAATATTTGTTAAGTTTGATGGGC, SEQ ID No. 430) and Mja3 ’and 1 ng of the plasmid containing Mja FEN1. After the first reaction, the fragments were gel purified and eluted in 50 µl of the elution buffer. The DNA fragments were diluted from 1 to 10 in water and to the final PCR, which was performed as described above for primers Pfu5 'and Pfu3', 1 µl of each diluted fragment was added. After the final PCR, the DNA was gel purified and cloned into the pTrc99a vector as described. The sequence of the MAM open reading frame is SEQ ID No. 431, the amino acid sequence of MAM is SEQ ID No. 432.

The PAP chimera was constructed as follows. Three PCR reactions were performed, one for each chimera fragment. PCR reactions were carried out as described. Reaction 1 used primers Pfu5 'and PAP84AS (5’-CAATTTCAGCCTTCTTGAACTCTGGAGGTTCTCCATCAAAAAC, SEQ ID No. 433) and 1 ng of the plasmid containing the PEN FEN1 FEN1. Reaction 2 used primers A84S and A135AS and 1 ng of the plasmid containing the Afu FEN1 gene. Reaction 3 used primers PAP135S (5’-GAGTACATTGTTGACTCCGCAAAAAAACTCTTAGAGCTTATGGG, SEQ ID No. 434) and Pfu3 ’and 1 ng of the plasmid containing the Mja FEN1 gene. After the first reaction, the fragments were gel purified and eluted in 50 µl of the elution buffer. The DNA fragments were diluted from 1 to 10 in water and to the final PCR, which was performed as described above for primers Pfu5 'and Pfu3', 1 µl of each diluted fragment was added. After the final PCR, the DNA was gel purified and cloned into the pTrc99a vector as described. The sequence of the PAP open reading frame is SEQ ID No. 435: the amino acid sequence of PAP is SEQ ID No. 436.

Chimeras loop change

When the sequence of the FEN1 enzymes is compared, most of the archaebacterial FEN1 enzymes, with the exception of the Mja FEN1 and Mth FEN1, have an additional 10 amino acids in which they are compared with the equatorial FEN1 enzymes. This amino acid sequence forms a loop in the form of a β loop that protrudes from the enzyme surface. Since both Mja FEN1 and Mth FEN1 have a high activity on the substrates of the fork and structure X and lack this sequence of the loop, tests were performed to determine the effect of the presence of the loop on the specificity of the enzyme.

Two chimeric enzymes were constructed: Mja + Pfu16, which is the FEN1 enzyme of Mja FEN1 with the Pfu loop sequence inserted in the appropriate location; and Pfu + Mja4, which is the PEN FEN1 enzyme with the loop sequence removed and the 4 amino acids of the Mja FEN1 stored in place. Both enzymes were created by recombinant PCR.

Twelve PCR were performed for the creation of Mja + Pfu16. The first reaction contained the primers of Mja5 ’and Mja + Pfu16AS (5’-CGTAGACATTTTTCCCAGGCAACTTTCTTTTTCCTGTAGTTGTTAAATTTCTAA C, SEQ ID No. 437) and 1 ng of the plasmid containing the MEN FEN1 FEN1. The second reaction contained the primers of Mja5 ’and Mja + Pfu16S (5’-CCTGGGAAAAATGTCTACGTCGAGATAAAGCCCGAACTTATTGAATTAAATG, SEQ ID No. 438) and 1 ng of the plasmid containing the FEN1 of MjaFEN1. After the first reaction, the fragments were gel purified and eluted in 50 µl of the elution buffer. The DNA fragments were diluted from 1 to 10 in water and to the final PCR, which was performed as described above for primers Mja5 'and Mja3', 1 µl of each diluted fragment was added. After the final PCR, the DNA was gel purified and cloned into the pTrc99a vector as described. The sequence of the open reading frame Mja + Pfu16 is SEQ ID No. 439; The amino acid sequence Mja + Pfu16 is SEQ ID No. 440.

For the creation of Pfu + Mja4, two PCRs were performed. The pirmera reaction contained the primers of Pfu5 ’and Pfu + Mja4AS (5’-CTCTGGCATCTCCTTTGTTATTGTTAAGTTTCTAAC, SEQ ID No. 441) and 1 ng of the plasmid containing the PEN FEN1. The second reaction contained the primers of Pfu + Mja4S (5’-ACAAAGGAGATGCCAGAGTTGATAATTTTGGAGGAAG, SEQ ID No. 442) and Pfu3 ’and 1 ng of the plasmid containing the PEN FEN1. After the first reaction, the fragments were gel purified and eluted in 50 µl of the elution buffer. The DNA fragments were diluted from 1 to 10 in water and to the final PCR, which was performed as described above for primers Pfu5 'and Pfu3', 1 µl of each diluted fragment was added. After the final PCR, the DNA was gel purified and cloned into the pTrc99a vector as described. º Enzymes have been purified as described. The sequence of the Pfu + Mja4 open reading frame is SEQ ID No. 443; The amino acid sequence of Pfu + Mja4 is SEQ ID No. 444.

Mutations in conserved tyrosine

In modeling studies of FEN1 enzymes with DNA substrates it was observed that the 3 ′ end of the INVASOR oligonucleotide is close to a tyrosine conserved at position 33 of the Pfu FEN1 protein sequence. Said amino acid is a tyrosine in all FEn1 sequences of known archaebacteria and is phenylalanine or tyrosine in the homologs of bacterial DNA polymerase 1. The tyrosine at position 33 of the Pfu FEN1 enzyme was mutilated into an alanine or a phenylalanine to determine the effect on the recognition of the 3 ′ end of the INVASOR oligonucleotide. The constructs were performed individually using the site-directed mutagenesis technique using the QuikChange (Stratagene) technique. The oligonucleotides used in Y33A mutagenesis were PfuY33A-S (5’-CTCTTAATGCAATCGCCCAATTTTTGTCCAC, SEQ ID No. 445) and Pfu Y33A-AS (5’-GTGGACAAAAATTGGGCGATTGCATTAAGAG, SEQ ID No. 446). The oligonucleotides used in Y33F mutagenesis were PfuY33F-S (5’-CTCTTAATGCAATCTTCCAATTTTTGTCCAC, SEQ ID No. 447) and PfuY33F-AS (5’-GTGGACAAAAATTGGAAGATTGCATTAAGAG, SEQ ID No. 448). The sequence of the PfuY33F open reading frame is SEQ ID No. 449; the amino acid sequence of PfuY33 is SEQ ID No. 450. The sequence of the open reading frame of PfuY33A F is SEQ ID No. 451; The amino acid sequence of PfuY33A is SEQ ID No. 452. After mutagenesis and selective detection of the presence of mutations, the enzymes are purified as described.

Mutants arch. from Pho and Pfu

Pho's FEN1 enzyme has a cleavage rate on the hairpin substrates and structure X that is 1 to 2 orders of magnitude greater than the same speeds measured using Pfu's FEN1 enzyme. When the amino acid sequences of the two enzymes were compared, it was observed that there were 4 changes between the two enzymes in the arq region. (at amino acid positions 82, 103, 110, and 113). In each of the positions where differences occur between the two enzymes, Pfu FEN1 has a negatively charged glutamic acid residue, while Pho Fen1 has a neutral or positively charged amino acid in said positions. The tests were performed to examine the effects of these residues on the specificities of these enzymes. The inventors made mutants of the PEN and Pho FEN1 enzymes to sweep the amino acids in the arc region and determine the effects of the mutations on specificity. The following constructs were performed using the QuikChange (Stratagene) mutagenesis technique. For sequencing with multiple mutations sequential mutagenesis reactions were performed. Pfu1M has the E82K mutation made using the oligonucleotides PfuE82K-S (5’-GTGTATGTTTTTGATGGAAAACCTCCAGAATTC, SEQ ID No. 453) and PfuE82K-AS (5’-GAATTCTGGAGGTTTTCCATCAAAAACATACACAC, SEQ ID 45ATACAC), SEQ ID NO. Pfu1M has the E82K mutation and the E103L mutation carried out using the oligonucleotides PfuE103L-S (5’-GAGAGAGGAAGCTGAACTAAAGT-GGAGAGAAGC, SEQ ID No. 455) and PfuE103L-AS (5’-GCTTCTCTCCACTTTAGTTCAGCTT IDTCTC6CTCTT. Pfu1M has the E82K and E103L mutations and the E110A mutation made with PfuE110A-S (5’-GAGAGAAG-CACTTGCAAAAGGAGAGATAGAGG, SEQ ID No. 457) and PfuE110A-AS (5’-CCTCTATCTCTCCTTTTGCAAGT-SEC. Pfu1M has the E82K, E103L and E110A mutations and the E113N mutation made with PfuE113N-S (5’-GAAGCACTTGCAAAAGGAAACATAGAGGAAGCAAGAA, SEQ ID No. 459) and PfuE113N-AS (5’-TTCTTGCTTCCTCTGTTTTCTCGTGTTTTTCTCTGTCTCCTCTGTCTCCTC Pho1M has the K82E mutation made with PhoK82E-S (5’-CCTACGTCTTTGATGGAGAGCCTCCGGAATTCAAAAGG, SEQ ID No. 461) and PhoK82E-AS (5’-CCTTTTGAATTCCGGAGGCTCTCCATCAAAGACG, SEQ ID No. 462). Pho1M has the K82E mutation and the L103E mutation made with PhoL103E-S (5’-GAGAAGAGGCAGAAGAAAATGGAAAGAAGC, SEQ ID No. 463) and PhoL103E-AS (5’-GCTTCTTTCCATTTTTCTTCTGCCTCTTCTC), SEQ ID No. 46 Pho1M has the K82E and L103E mutations and the A110E mutation carried out with PhoA110E-S (5’-GGAAAGAAGCTCCAGAGAAGGGAAACCTGGAGG, SEQ ID No. 465) and PhoA110E-AS (5’-CCTCCAGGTTTCCCTTCTCTAGAGCTTCTTCT 46TTC. Pho4M has the K82E, L103E and A110E mutations and the N113E mutation made with PhoN113E-S (5’-GCTCTAGAGAAGGGAGAACT-GGAGGAAGCTAGG, SEQ ID No. 467) and PhoN1 13E-AS (5’-CCTAGCTTCCTCCAGTTCTCCTCCTTCTAGTTCTAGTTCT.

The sequence of the Pfu1M open reading frame is SEQ ID No. 469; the amino acid sequence of Pfu1M is SEQ ID No. 470. The sequence of the open reading frame of Pfu2M is SEQ ID No. 471; the amino acid sequence of Pfu2M is SEQ ID No. 472. The sequence of the open reading frame of Pfu3M is SEQ ID No. 473; the amino acid sequence of Pfu3M is SEQ ID No. 474. The sequence of the open reading frame of Pfu4M is SEQ ID No. 475; The amino acid sequence of Pfu4M is SEQ ID No. 476. The sequence of the open reading frame of Pho1M is SEQ ID No. 477; the amino acid sequence of Pho1M is SEQ ID No. 478. The sequence of the open reading frame of Pho2M is SEQ ID No. 479; the amino acid sequence of Pho2M is SEQ ID No. 480. The sequence of the open reading frame of Pho3M is SEQ ID No. 481; the amino acid sequence of Pho3M is SEQ ID No. 482. The sequence of the open reading frame of Pho4M is SEQ ID No. 483; The amino acid sequence of Pho4M is SEQ ID No. 484.

Mutation that affects the interaction of the 3 ’end

Mutations at the Y33 position of the Pfu FEN1 were made because the amino acid was thought to interact with the 3 ′ end of the INVASOR oligonucleotide. To test this hypothesis, the FEN 1 Pfu, PfuY33F, and PfuY33A enzymes on the INVASOR oligonucleotides with different 3 'ends were analyzed to determine the effect of mutations on the cleavage of said substrates. The combined 203-15-2 target oligonucleotide-probe (5’-TET-AAAACGCTGTCTCGCTGAAAGCGA-GACAGCGAAAGACGCTCGT, SEQ ID NO. 485) was used with INVASOR oligonucleotides that differ only at their 3 ′ end. The different INVASOR oligonucleotides are 203-15-3 (5'-ACGAGCGTCTTT, SEQ ID No. 486), 203-15-4 (5'-AC-GAGCGTCTTTA, SEQ ID No. 487), 203-15-5 (5'- ACGAGCGTCTTTT, SEQ ID No. 488), 203-15-6 (5'-AC-GAGCGTCTTTG, SEQ ID No. 489), 203-15-7 (5'-ACGAGCGTCTTTC, SEQ ID No. 490), 203-15-8 ( 5'-AC-GAGCGTCTTT-dideoxyC, SEQ ID No. 491) 203-15-9 (5'-ACGAGCGTCTTTC-PO4, SEQ ID No. 492), and 203-15-10 (5'-ACGAGCGTCTTT-dribose, SEQ ID NO. 493). The 10 μl reactions contained 203-15-2 2 μM and 2 μM of one of INVASOR oligonucleotides (above), 10 mM MOPS, pH 7.5, 0.05% TWEEN 20, 0.05% NP-40 , 4 mM MgCl2 and 0.35 nM enzyme (Pfu FEN1 and PfuY33F FEN1) or 3.5 nM enzyme (PfuY33A FEN1) enzyme. The reactions were performed at 50 ° C for 10 to 30 minutes. The

reactions were stopped by the addition of 10 µl of 95% formamide and 0.02% methyl violet. 1 μl of the

The mixture was loaded on a denaturing 20% acrylamide gel and electrophoresed for 15 minutes or until a good separation between the excised and uncleaved probe. The gels are scanned using an FMBIO fluorescence gel scanning apparatus and the bands are quantified with FMBIO analysis software. The cleavage rates were determined from the percentage of excised probe. The cleavage rate is defined as the number of probe-target oligonucleotides cleaved per minute per enzyme. Although the cleavage rate is reduced for Y33F of Pfu and more for Y33A for Pfu, no specificity change is observed.

The cleavage rate versus the 3 ’end is represented for the 3 enzymes (Figure 148).

EXAMPLE 66

Activity test for cloned FEN1 nucleases

The INVASOR test was performed using a combination of target and upstream oligonucleotide (INVASOR) and a large excessomolar labeled probe oligonucleotide (as depicted in Figure 141A). The ten μl reactions contained 10 mM MOPS, (pH 7.5), 0.05% TWEEN 20, 0.05% NP-40, 20 ng / μl tRNA (Sigma), 4 mM MgCl2, 100 ng of enzyme, probe oligonucleotide labeled 203-91-01 (5 '(Tet) TTTTCAACTGCCGTGA, SEQ ID No. 403) and 0.2 mM INVASOR-target oligonucleotide 203-91-04 (5'-TCACG-GCAGTTGGTGCGCCTCGGAACGAGGCGCACA, SEQ ID No. 404) . The reactions were fixed by adding all components to the individual wells of a 96-well plate in an ice-water bath. The reactions were initiated by placing the 96-well plate in a preheated gradient thermal cycler (Eppendorf Mastercycler) and incubated at the set temperature for 20 minutes. Then, the 96-well plate was reintroduced into the water bath to stop the reactions and 10 µl of termination mixture (95% formamide, 20 mM EDTA, 0.05% methyl violet) was added. 1 μl of each reaction was loaded on a denaturing 20% acrylamide gel. After electrophoresis, the gels were visualized using an FMBIO image tank (Hitachi) and quantified with the FMBIO analysis software. The results are shown graphically in Figure 142.

The cleavage of an "X structure" depicted in Figure 141B can provide a signal source of

Background in the sequential invasive cleavage reactions of the present invention, therefore, it is desirable to determine the level of activity that enzymes have in the cleavage of such a structure. Ten μl reactions on the substrate of structure X contained 10 mM MOPS, (pH 7.5), 0.05% TWEEN 20, 0.05% NP-40, 20 ng / μl tRNA (Sigma), MgCl2 4 mM, 100 ng of enzyme and 203-81-02 labeled 2 μM (5 '(Tet) TTTTCAACTGCTTAGAGAATCTAAGCAGTTGGTGCGCCTCGTTAA-NH2, SEQ ID No. 405) and target 594-09-01 2 μM (5'-AACGAGGCGCACATTTTTTTT 40TT IDTTTTTT 40TT IDTTTTTTTTTT 40TT IDTTTTTTTTTTTTTTTTTTTTT No 40 ). The reactions were performed as described above except that the incubation at the reaction temperature was carried out for 60 minutes. The samples were subjected to electrophoresis and analyzed as described above. The results are shown graphically in Figure 143.

Together, these assays allow the characterization of the cleavage activities of FEN and other enzymes

5 ’nucleate and any new enzyme suspected of being able to cleave a cleavage structure

invasive

Evaluation of chimeric and mutant FEN1 enzymes

For the evaluation of chimeric enzymes, conventional tests were performed to measure the yield and specificity of enzymes. The INVASOR test assay contains 10 mM MOPS, pH 7.5, 0.05% TWEEN 20, 0.05% NP-40, 4 mM MgCl2, target oligonucleotide-INVASOR 0.5nM 594-12-1 (5'-Biotin-TTTTTCACGGCAGTTGGTGC-GCCTCG-GAACGAGGCGCACA, SEQ ID No. 517), the probe oligonucleotide 203-911 1 μM (5'-Tet-TTTTCAACTGCCGTGA, SEQ ID No. 518), streptavidin 2 nM and enzymes 256 nM. The 10 μl reactions are reacted at 59 ° C for between 5 to 60 minutes depending on the enzyme. The reactions were stopped by the addition of 10 µl of 95% formamide and 0.02% methyl violet. 1 μl of the mixture is loaded on a denaturing 20% acrylamide gel and electrophoresed for 15 minutes or until a good separation between the excised and uncleaved probe is achieved. The gels are scanned using an FMBIO fluorescence gel scanning apparatus and the bands are quantified with FMBIO analysis software. Excision rates are determined from the percentage of excised probe. The cleavage rate for the INVASOR substrate is defined as the number of probe molecules cleaved per target molecule per minute. In Table 5, below, the cleavage rates for the mutant enzymes are compared with the cleavage rates for the unmodified Pfu FEN1 enzyme in the INVASOR assay and substrates of structure X.

The substrate of structure X is used to determine the amount of background cleavage that an enzyme will carry out in a reaction with INVASOR. It mimics the structure created by the primary uncut probe and the secondary FRET cassette in the INVASOR square reaction. Structure X reactions contain 10 mM MOPS, pH 7.5, 0.05% TWEEN 20, 0.05% NP-40, 4 mM MgCl2, 2 μM target oligonucleotide-probe 203-81-2 (5 ' -TET-TTTTCAACTGCTTAGAGAA-TCTAAGCAGTTGGT-GCGCCTCGTTAA-NH2, SEQ ID No. 494), probe oligonucleotide 203-91-2 2 μM (5'-AACGAGGCGCACATT, SEQ ID No. 495), and enzyme 4 to 256 nM. The 10 μl reactions are reacted at 59 ° C for between 3 to 30 minutes depending on the enzyme. The reactions were stopped by

addition of 10 μl of 95% formamide and 0.02% methyl violet. 1 μl of the mixture is loaded on a gel

20% denaturing acrylamide and electrophoresis for 15 minutes or until a good separation between the excised and uncleaved probe is achieved. The gels are scanned using an FMBIO fluorescence gel scanning apparatus and the bands are quantified with FMBIO analysis software. Excision rates are determined from the percentage of excised probe. The cleavage rate for the substrate structure X is defined as the number of probe-target molecules cleaved per enzyme molecule.

TABLE 5

Excision rates of modified FEN1 enzymes on INVASOR substrates and structure X (with respect to rates for unmodified Pfu FEN1)

Enzyme

Relative INVASOR test Excision rate Relative cleavage rate of structure Xb

Pfu FEN1

one one

Pho FEN1

1.6 120

Pfu1M FEN1

0.83 0.85

Pfu2M FEN1

1.4 3

Pfu3M FEN1

1.8 4.9

Pfu4M FEN1

2.2 62

Pho1M FEN1

1.1 18

Pho2M FEN1

1.6 31

Pho3M FEN1

0.95 6.6

Pho4M FEN1

1.3 2.2

Mja FEN1

1.9 203

Afu FEN1

0.52 0.5

MPM FEN1

0.14 0.1

PMP FEN1

2.4 1.37

MAM FEN1

0.03 0.07

PAP FEN1

0.56 0.52

Pfu + M4 FEN1

0.05 0.28

Mja + P16 FEN1

1.2 59

Pfu Y33F FEN1

0.96 N.D.

Pfu Y33A FEN1

0.05 N.D.

a The cleavage rate of the INVASOR assay is relative to the cleavage rate of the Pfu FEN1 enzyme that has been given a value of 1. bThe cleavage rate of structure X is relative to the cleavage rate of the PEN FEN1 enzyme which has been given a value of 1. ND -not determined.

EXAMPLE 67 High-performance selective detection for the selection of candidate enzymes

For individual high-performance detection, individual colonies are chosen and inoculated in 1 ml of broth. Luria-Bertani (LB) supplemented with 100 g / ml ampicillin and 1 mM isopropyl-β-D-thiogalactopyranoside (IPTG) in deep-bottom 96-well plates. The cultures are grown for approximately 20 hours with vigorous shaking at 37 ° C. The culture plates are then cut in the automatic robot (eg, as shown in Figure 147) for selective detection.

The test plates are established as follows. Test wells are created for each overnight culture, two without target and 1 with target (described below). Thus, each 96-well plate for overnight culture generates a 96-well plate of lysates and a 384-well assay plate. Lysates can be subjected to selective detection under additional conditions, for example in the presence of salts, or denaturing agents such as guanidine hydrochloride, both known because they inhibit the cleavage enzymes of the present invention. In this case, each 96-well plate of lysates could give 2 or more test plates.

The following steps are usually performed with a robot in a 96-well plate (cell lysis) or 384-well plate (activity test) (eg, as shown in Figure 147).

Cell lysis

75 μl of the overnight culture was mixed 100 μl of 0.02% TWEEN 20, 1 mg / ml lysozyme and incubated at

room temperature for 15 minutes. The lysis plates are then heated at 83 C for 3 minutes and the plates are centrifuged 1100 x G for 5 minutes at room temperature to obtain the cell debris.

Assay on DNA targets

Plasmids containing mutant Factor II and wild type Factor V were created for use in high performance assays. The factor II mutant target plasmid contains a 345 base pair insert of a mutant factor II (human prothrombin gene; SEQ ID No. 510) inserted into pCR Topo2.1 (Invitrogen). The wild-type target plasmid factor V contains a 220 base pair insert (SEQ ID No. 509) of the wild-type human factor VI gene inserted into pCR-Topo2.1 (Invitrogen). To analyze the cell assays, 5 μl of the cell lysate was added to 10 μl of the buffer, the probe oligonucleotides, the SEQUENCING oligonucleotides, the FRET oligonucleotides in a target mixture. The final concentration of the buffer components is 3.5% PEG, 10 mM MOPS, pH 7.5, 14 mM MgCl2. The 15 μl reactions contain 0.33 mM of each of the Factor II Fre probe ((5 '-F1-TCT-Z28-AGCCGGTTTTCCGGCTGAGACGTCCGTGGCCT-Hex, SEQ ID No. 516) Factor Fret probe ((5'-F1-TCT-Z28-AGCCGGTTTTCCGGCTGAGACGTCCGTGGCCT-Hex, SEC D of each 613 of each 6 SEC of m 6,6 of each 6 m of one 6 m of each 6 m of one 6 m of each 6 m of one 6 m of each 6 m of one 6 m of each 6 m of one 6 m of each 6 m of one 6 m of each 6 m of each one wild type factor V probe 23-445 (5'-F1-TCT-Z28-AGCCGGTTTTCCGGCTGAGACGTCCGTGGCCT-Hex, SEQ ID No. 511) and the mutant probe of factor II 23-215 (5'-AGGCCACGGACGAAGCCTCAATGCTCC-Hex, SEQ ID NO. 514) and INVASOR oligonucleotide of Fcator V 66 nM 23-200 (5'-TCTAATCTGTAAGAGCAGATCCCTGGACAGACC, SEQ ID No. 512) and an INVASOR oligonucleotiod of factor II 23-415 (5'-AGGCCACGGACGAAGCCTCAATGCTCC-Hex, SEQ ID No. 515). reaction between 20 and 100 pg of each target plasmid (described above) are used.

After mixing the reagents, the 384 well plates are incubated at 63 ° C for 1 hour, after which the signal in a CYTOFLUOR fluorescence plate reader disappears. The wavelength parameters without 485 nm excitation and 530 nm emission for the probe containing fluorescein and excitation at 560 nm t emission at 620 nm for the probe containing REDMOND RED dye. Fluorescence measurements are compared with measurements using unmodified enzymes under the same reaction conditions. Enzymes that show an increase in the signal in a specific set of reaction conditions (ie more fluorescence) and are considered for further analysis. In general, mutant enzymes show increases of at least 20 to 50% that are then purified for further analysis.

Essay on RNA targets

To analyze the activities of enzymes on RNA targets, sets of INVASOR test probes are used for the detection of mRNA of human ubiquitin and for human interleukin 8 (IL-8). To analyze

cell assays, 5 µl of the cell lysate were added to 10 µl of the buffer, the probe oligonucleotides, the

INVASOR oligonucleotides, FRET oligonucleotides in a target mixture. The final concentration of the tamoon components in the primary reaction are 4% PEG, 12.5mM MgSO4, 10mM MOPS, pH 7.5, 100mM KCl, 0.05% Tween 20 and 0.05% NP-40. The primary reactions are incubated at 60 ° C for 1 hour. Then, the secondary reactions are initiated by the addition of the secondary reaction mixture comprising the stop oligonucleotides and the secondary probe and target oligonucleotide assemblies. The final concentrations of the buffer components in the secondary reaction are 2.67% PEG, 6.5mM MgSO4, 6.67mM MOPS, pH 7.5, 6.67mM KCl, 0.033% Tween 20 and 0.033% NP-40. The side reactions are incubated at 60 ° C for 1 hour, after which the signal is sealed in a CYTOFLUOR fluorescence plate reader. The wavelength parameters without 485 nm excitation and 530 nm emission for the probe containing fluorescein and excitation at 560 nm t emission at 620 nm for the probe containing REDMOND RED dye. Fluorescence measurements are compared with measurements using unmodified enzymes under the same reaction conditions. Enzymes that show an increase in the signal in a specific set of reaction conditions (ie more fluorescence) and are considered for further analysis. In general, mutant enzymes that show increases of at least 20 to 50% are then purified for further analysis.

Primary reactions include the oligonucleotide INVASOR of ubiquitin Hu (514) 0.5 μM, 5 'CCTTCCTTATCCTGGATCTT-GGCA, SEQ ID No. 496), the oligonucleotide probe of ubiquitin Hu (1 μM, 5' CGCCGAGATCACCTTTACATTTTCTATCG-ID2G, SEC No. 497), the probe of the Hu IL-8 (1 μM, 5 'CCGTCACGCCTCCTCTCAGTTCT-NH2, SEQ ID No. 502), the stacker probe of the Hu IL-8 (1 μM, all bases 2'O-methyl, 5 'TTGATAAATTTGGGGTGGAAAGGTTTGGA, SEQ ID No. 503), the INVASOR oligonucleotide of Hu IL-8 (0.5 μM, 5' GTGTGGTCCACTCTCAATCAA, SEQ ID No. 504). The 5 ′ cleaved fins of the primary reaction are the 5 ’Hu ubiquitin fin (5’ CCGCCGAGATCACC, SEQ ID No. 500) and the 5 ’Hu IL-8 fin (5’-CCGTCACGCCTCT, SEQ ID No. 507). At the end of the primary reaction, the secondary reaction mixture comprising the Hu ubiquitin stop oligonucleotide (2.67 μM, all 2'-O-methyl bases, 5 'ACGATAGAAAATGTAAAGGTGATC, SEQ ID No. 498), the Secondary probe of ubiquitin Hu (0.67 μM, red dye CTC-Z28-TTCTCAGTGCG, SEQ ID No. 499), the secondary probe of Hu ubiquitin (0.1 μM, the last 3 nt at the 3 'end are 2'-O -methyl; 5 'CGCAGTGAGAATGAGGTGATCTCG-GCGGU, SEQ ID No. 501), Hu-IL-8 stop oligonucleotide (2.67 μM, all 2'-O-methyl, 5' AGAACTGAGAGGAGGC, SEQ ID No. 505), the secondary probe of Hu-IL8 (0.67 μM, F1-CAC-Z28-TGCTTCGTGG, SEQ ID No. 506), the secondary target of Hu IL-8 (0.1 μM, the last 3 nt at the 3 'end are 2'-O-methyl bases; 5 'CCAGGAAGCAAGTGGAGGCGT-GACGGU, SEQ ID No. 508).

EXAMPLE 68

Detection of the human cytomegalovirus pol gene

Example 48 demonstrated the use of the invasive cleavage assay to detect human cytomegalovirus sequences in a background of human genomic DNA. In this example, another embodiment of the invasive multiple cleavage reaction for the detection of human cytomegalovirus sequences will be demonstrated. Example 48 used an INVASOR oligonucleotide and labeled primary probe directed to region 3104-3061 of HCMV. In this example, we aimed at bases 2302-2248 of the HCMV genome. As in the previous examples, a FRET cassette was used to generate signal in the presence of the target DNA.

The INVASOR oligonucleotides and probe were designed as described above to detect the HCMV polymerase gene (SEQ ID No. 407 and 408 respectively; the FRET cassette is SEQ ID No. 409. The oligonucleotides are depicted in Figure 144. The HCMV / target sequence detected by this set of probes is SEQ ID No. 410.

The viral genomic DNA was purchased from Advanced Biotechnologies, Inc. (Columbia, MD). Advanced Biotechnologies staff estimated (but did not certify) a DNA concentration of 170 atomol (1 x 108 copies) per microliter. The viral mother was diluted in 10ng / μl human genomic DNA to final concentrations of 45.7, 137.2, 411.5 and 1234.6 copies of virus per microliter. The reactions were performed in 96-well MJ 96 well MULTIPLATE (MJ Research MLL-9601) in triplicate in a final volume of 15 μl. Each reaction comprised 12 mM MOPS (pH 7.5), MgCl212 mM, 0.5 pmol of the INVASOR oligonucleotide, 10 pmol of unlabeled primary probe, 5 pmol of One-Piece FRET cassette, 0, 457, 1372, 4115 or 12346 copies of the CMV virus DNA, 100 ng of human genomic DNA and 60ng of Bird FEN1 and water to a final volume of 2 μl MOPS, INVASOR oligonucleotide, water, CMV virus DNA and human genomic DNA were combined, covered with CHILLOUT liquid wax and denatured for 5 minutes at 95 ° C. The reactions were then cooled to 20 ° C and MgCl2, unlabeled primary probe, FRET cassette and AveFEN1 enzyme were added under the Chill-out layer. The reaction was mixed by pipetting up and down 5-10 times, taking care to make the CHILLOUT layer transparent. The reactions were then incubated for 4 hours at 65 ° C and the plates were read directly on a Cytoflour plate reader using the following parameters: Excitation = 485/20, Emission = 530/25, Gain = 40 to 10 readings / well.

The results are shown graphically in Figure 145, with the number of copies of the target DNA indicated on the horizontal axis and the fluorescence units indicated on the vertical axis. These results indicate sensitive detection of HCMV using the FRET format of sequential invasive excision.

The selection of oligonucleotides for target nucleic acids other than the analytes shown here (e.g., the composition and length of the oligonucleotide) and optimization of the cleavage reaction conditions according to the models provided herein follow routine procedures. and common practice well known to experts in molecular biology.

SEQUENCE LIST

<110> KAISER, Michael LYAMICHEV, Victor I. LYAMICHEVA, Natasha

<120> FEN endonucleases

<130> FORS-06647

<140> Pending assignment

<141> 2001-11-15

<160> 518

<170> Patent In Ver. 2.0

<210> 1

<211> 2506

<212> DNA

<213> Thermus aquaticus

<400> 1

<210> 2

<211> 2496

<212> DNA

<213> thermus flavus

<400> 2

<210> 3

<211> 2504

<212> DNA

<213> Thermus thermophilus

<400> 3

<210> 4 5 <211> 832

<212> PRT

<213> Thermus aquaticus

10 <400> 4

<210> 5

<211> 831

<212> PRT

<213> thermus flavus

<400> 5

<210> 6

<211> 834

<212> PRT

<213> Thermus thermophilus

<400> 6

5 <210> 7

<211> 2502

<212> PRT

<213> Artificial sequence

10 <220>

<223> Description of the Artificial Sequence: Synthetic

<400> 7

<210> 8

<211> 833 5 <212> PRT

<213> Artificial sequence

<220> 10 <223> Description of the Artificial Sequence: Synthetic

<400> 8

<210> 9

<211> 1647

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 9

<210> 10

<211> 2088 5 <212> DNA

<213> Artificial sequence

<220> 10 <223> Description of the Artificial Sequence: Synthetic

<400> 10

<210> 11

<211> 962 5 <212> DNA

<213> Artificial sequence

<220>

<223> Description of the Artificial Sequence: Synthetic 10

<400> 11 <212> DNA

<213> Artificial sequence

<220> 10 <223> Description of the Artificial Sequence: Synthetic

<400> 12

<210> 13

<211> 36

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 13 acgaattcg gggatgctgc ccctctttga gcccaa 36

<210> 14

<211> 34

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 14 gtgagatcta tcactccttg gcggagagcc agtc 34

<210> 15

<211> 91

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 15

<210> 16 <211> 20 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 16 taatacgact cactataggg

twenty

<210> 17 <211> 27 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 17 gaattcgatt taggtgacac tatagaa

27

<210> 18 <211> 31 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 18 gtaatcatgg tcatagctgg tagcttgcta c

31

<210> 19 <211> 42 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 19 ggatcctcta gagtcgacct gcaggcatgc ctaccttggt ag

42

<210> 20 <211> 30 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 20 ggatcctcta gagtcgacct gcaggcatgc

30

<210> 21 <211> 2502 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 21

<210> 22 <211> 19 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 22 gatttaggtg acactatag

19

<210> 23 <211> 50 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 23 acacaggtac cacatggtac aagaggcaag agagacgaca cagcagaaac

fifty

<210> 24 <211> 15 <212> PRT <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 24

<210> 25

<211> 969

<212> DNA

<213> Artificial sequence 5

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 25 10

<210> 26

<211> 948

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 26

<210> 27

<211> 206

<212> DNA

<213> Artificial sequence 15

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 27 <220> <400> 33 <210> 37

<210> 28 <211> 21 <212> DNA <213> Artificial sequence ‘

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 28 aacagctatg accatgatta c

twenty-one

<210> 29 <211> 60 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 29 gttctctgct ctctggtcgc tgtctcgctt gtgaaacaag cgagacagcg tggtctctcg

60

<210> 30 <211> 15 <212> DNA <213> Artificial sequence

<223> Description of the Artificial Sequence: Synthetic

<400> 30 cgagagacca cgctg

fifteen

<210> 31 <211> 52 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 31 cctttcgctt tcttcccttc ctttctcgcc acgttcgccg gctttccccg tc

52

<210> 32 <211> 26 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 32 agaaaggaag ggaagaaagc gaaagg

26

<210> 33 <211> 21 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

 gacggggaaa gccggcgaac g

twenty-one

<210> 34 <211> 20 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 34 gaaagccggc gaacgtggcg

twenty

<210> 35 <211> 21 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 36 ggcgaacgtg gcgagaaagg a

twenty-one

<210> 36 <211> 4.2 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 36 cctttcgctt tcttcccttc ctttctcgcc acgttcgccg gc

42

<211> 42 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 37 cctttcgctc tcttcccttc ctttctcgcc acgttcgccg gc

42

<210> 38 <211> 27 <212> DNA <213> Artificial sequence

<220> <221> modified base <222> (8) <223> The A residue at this position is 2’-O-methyladenosine.

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 38 agaaaggaag ggaagaaagc gaaaggt

27

<210> 39 <211> 24 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 39

gccggcgaac gtggcgagaa agga

24

<210> 40 <211> 20 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 40 g gtttttctt tgaggtttag

twenty

<210> 41 <211> 19 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 41 gcgacactcc accatagat

19

<210> 42 <211> 19 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 42 ctgtcttcac gcagaaagc

19

<210> 43

<211> 19

<212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 43 gcacggtcta cgagacctc

19

<210> 44 <211> 20 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 44 taatacgact cactataggg

twenty

<210> 45 <211> 337 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 45

<210> 46

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<221> modified base

<222> (18)

<223> The N at this position indicates the presence of a fluorescein dye on an abasic linker.

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 46 ccggtcgtcc tggcaatncc 20

<210> 47

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 47 gtttatccaa gaaaggaccc ggtc 24

<210> 48

<211> 30 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 48 cagggtgaag ggaagaagaa agcgaaaggt

30

<210> 49 <211> 30 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic <400> 49 cagggggaag ggaagaagaa agcgaaaggt

30

<210> 50 <211> 22 <212> DNA <213> Artificial sequence

<220> <221> modified base <222> (1) .. (2) <223> The T residues at positions 1 and 2 are amino modified T residues.

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 50 ttcttttcac cagcgagacg gg

22

<210> 51 <211> 22 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 51 attgggcgcc agggtggttt tt

22

<210> 52 <211> 53 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 52 cccgtctcgc tggtgaaaag aaaaaccacc ctggcgccca atacgcaaac cgc

53

<210> 53 <211> 31 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 53 gaattcgatt taggtgacac tatagaatac a

31

<210> 54 <211> 42

<212> DNA

<213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 54 cctttcgctt tcttcccttc ctttctcgcc acgttcgccg gc

42

<210> 55 <211> 24 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 55 gccggcgaac gtggcgagaa agga

24

<210> 56 <211> 26 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 56 cagaaggaag ggaagaaagc gaaagg

26

<210> 57 <211> 26 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 57 cagggggaag ggaagaaagc gaaagg

26

<210> 58 <211> 26 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 58 cagggtacag ggaagaaagc gaaagg

26

<210> 59 <211> 42 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 59 gggaaagtcc tcggagccgc gcgggacgag cgtgggggcc cg

42

<210> 60 <211> 963 <212> DNA <213> Artificial sequence

<220> <221> CDS <222> (1) .. (960)

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 60

<210> 61

<211> 320

<212> PRT

<213> Artificial sequence

<400> 61

5

<210> 62 <211> 20 <212> DNA <213> Artificial sequence

10

<220> <223> Description of the Artificial Sequence: Synthetic <400> 62 cgatctcctc ggccacctcc twenty

fifteen

<210> 63 <211> 20 <212> DNA <213> Artificial sequence

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 63 ggcggtgccc tggacgggca

twenty

<210> 64 <211> 20 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 64 ccagctcgtt gtggacctga

twenty

<210> 65 <211> 2505 <212> DNA <213> Artificial sequence

<220> <221> CDS <222> (1) .. (2499)

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 65

<210> 66

<211> 833

<212> PRT

<213> Artificial sequence

<400> 66

<210> 67

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 67 tggctatagr ccagggccac

<210> 68

<211> 2505

<212> DNA

<213> Artificial sequence

<220>

<221> CDS

<222> (1) .. (2499)

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 68

<210> 69

<211> 833

<212> PRT

<213> Artificial sequence

<400> 69

<210> 70

<211> 2505 5 <212> DNA

<213> Artificial sequence

<220>

<221> CDS 10 <222> (1) .. (2499)

<220>

<223> Description of the Artificial Sequence: Synthetic

15 <400> 70

<210> 71

<211> 833

<212> PRT

<213> Artificial sequence

<400> 71

<210> 72

<211> 25

<212> DNA 263

<213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 72 gggataccat gggagtgcag tttgg

25

<210> 73 <211> 27 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 73 ggtaaatttt tctcgtcgac atcccac

27

<210> 74 <211> 981 <212> DNA <213> Artificial sequence

<220> <221> CDS <222> (1) .. (978)

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 74

<210> 75

<211> 326

<212> PRT

<213> Artificial sequence

<400> 75

<210> 76 <211> 21 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 76 gaggtgatac catgggtgtc c

twenty-one

<210> 77 <211> 20 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 77 gaaactctgc agcgcgtcag

twenty

<210> 78 <211> 1023

<212> DNA

<213> Pyrococcus furiosus

<220>

<221> CDS

<222> (1) .. (1020)

<400> 78

<210> 79

<211> 340

<212> PRT

<213> Pyrococcus furiosus

<400> 79

<210> 80 <211> 25 <212> DNA <213> Pyrococcus wosei

<400> 80 gataccatgg gtgtcccaat tggtg

25

<210> 81 <211> 37 <212> DNA <213> Pyrococcus wosei

<400> 81 tcgacgtcga cttatctctt gaaccaactt tcaaggg

37

<210> 82 <211> 20 <212> DNA <213> Pyrococcus wosei

<400> 82 agcgagggag aggcccaagc

twenty

<210> 83 <211> 21 <212> DNA <213> Pyrococcus wosei

<400> 83 gcctatgccc tttattcctc c

twenty-one

<210> 84 <211> 33 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 84 tggtcgctgt ctcgctgaaa gcgagacagc gtg

33

<210> 85 <211> 30 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 85 tgctctctgg tcgctgtctg aaagacagcg

30

<210> 86 <211> 27 <212> DNA <213> Artificial sequence

<220>

<221> misc_difference

<222> (1)

<223> The residue in this position is a spacer that contains a fluorescein marker.

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 86 nagaaaggaa gggaagaaag cgaaagg 27

<210> 87

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<221> misc difference

<222> (27)

<223> The residue in this position is a spacer carrying a Cy3 dye.

<220>

<221> modified base

<222> (28)

<223> The residue in this position is dideoxycytidine.

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 87 agaaaggaag ggaagaaagc gaaaggnc 28

<210> 88

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<221> modified base

<222> (24)

<223> The residue in this position is dideoxycytidine.

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 88 gccggcgaac gtggcgagaa aggc 24

<210> 89

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<221> misc_difference

<222> (1)

<223> The residue in this position is a spacer that contains a fluorescein marker.

<220>

<221> misc_difference

<222> (28)

<223> The residue in this position is a spacer carrying a Cy3 dye.

<220> <221> modified base <222> (29) <223> The residue in this position is dideoxycytidine.

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 89 nagaaaggaa gggaagaaag cgaaaggnc

29

<210> 90 <211> 30 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 90 aaaattcctt tctctttgcc ctttgcttcc

30

<210> 91 <211> 26 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 91 ggaaagccgg cgaacgtggc gagaaa 26

<210> 92

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 92 ggaaagccgg cgaacgtggc gaga 24

<210> 93

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<221> misc_difference

<222> (1)

<223> The residue in this position is a spacer carrying a Cy3 dye.

<220>

<221> misc_difference

<222> (28)

<223> The residue in this position is a spacer carrying a biotin group.

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 93 nagaaaggaa gggaagaaag cgaaaggnt 29

<210> 94

<211> 25

<212> DNA

<213> Artificial sequence

<220>

<221> misc_difference

<222> (1)

<223> The residue in this position is a spacer carrying a Cy3 dye.

<220>

<221> modified base

<222> (2) .. (3)

<223> The residues in these positions have an added amino group.

<220>

<221> misc_difference

<222> (24)

<223> The residue in this position is a spacer that contains a fluorescein marker.

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 94 nttccagagc ctaatttgcc agtna 25

<210> 95

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<221> modified base

<222> (1)

<223> The residue at this position has a 5 ’TET-label.

<220>

<221> misc difference

<222> (23)

<223> The residue in this position is a spacer that contains a fluorescein marker.

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 95 ttccagagcc taatttgcca gtna 24

<210> 96

<211> 25

<212> DNA

<213> Artificial sequence,

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 96 cttaccaacg ctaacgagcg tcttg 25

<210> 97 <211> 43 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 97 cccgtctcgc tggtgaaaag aaaaaccacc ctggcgccca ata

43

<210> 98 <211> 23 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 98 tattgggcgc catggtggtt ttt

2. 3

<210> 99 <211> 23 <212> DNA <213> Artificial sequence

<220> <221> misc_difference <222> (10) <223> The residue in this position is that 5-nitroindole.

<220> <221> misc_difference <222> (16) <223> The residue in this position is that 5-nitroindole.

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 99 tattgggcgn cagggnggtt ttt

2. 3

<210> 100 <211> 23 <212> DNA <213> Artificial sequence

<220> <221> misc_difference <222> (10) <223> "The residue in this position is a 5-nitroindole.

<220> <221> misc_difference <222> (16) <223> The residue in this position is that 5-nitroindole.

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 100 tattgggcgn catggnggtt ttt

2. 3

<210> 101 <211> 23 <212> DNA <213> Artificial sequence

<220> <221> misc_difference <222> (16) <223> The residue in this position is 3-nitropyrrole.

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 101 tattgggcgc cagggnggtt ttt

2. 3

<210> 102 <211> 23 <212> DNA <213> Artificial sequence

<220> <221> misc_difference <222> (16) <223> The residue in this position is a group of 3-nitropyrrole.

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 102 tattgggcgc catggnggtt ttt

2. 3

<210> 103

<211> 56

<212> DNA

<213> Artificial sequence

<220>

<221> misc_difference

<222> (1)

<223> The residue in this position is 2′-deoxycytosine 5’-O- (1-Thiomonophosphate).

<220>

<221> misc_difference

<222> (2)

<223> The residue in this position is 2’-deoxythymidine 5’-O- (1-Thiomonophosphate).

<220>

<221> misc_difference

<222> (3)

<223> The residue in this position is 2’s deoxyguanosine 5’-O- (1-Thiomonophosphate).

<220>

<221> misc_difference

<222> (4) .. (5)

<223> The residues in these positions are 2’-deoxiadenosine 5’-O- (1-Thiomonophosphate).

<220> <221> misc_difference

<222> (6)

<223> The residue in this position is 2’-deoxythymidine 5’-O- (1-Thiomonophosphate).

<220>

<221> misc_difference

<222> (7)

<223> The residue in this position is that 2’-deoxiadenosine 5’-O- (1-Thiomonophosphate).

<220>

<221> misc_difference

<222> (8)

<223> The residue in this position is 2′-deoxythymidine 5 ’-O- (1-Thiomonophosphate).

<220>

<221> misc difference

<222> (9) .. (10)

<223> The residues in these positions are 2’-deoxiadenosine 5’-O- (1-Thiomonophosphate).

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 103 ctgaatataa acttgtggta gttggagctg gtgccgtagg caagagtgcc ttgacg 56

<210> 104

<211> 56

<212> DNA

<213> Artificial sequence

<220>

<221> misc_difference

<222> (1)

<223> The residue in this position is 2′-deoxycytosine 5’-O- (1-Thiomonophosphate).

<220>

<221> misc_difference

<222> (2)

<223> The residue in this position is 2′-deoxythymidine 5 ’-O- (1-Thiomonophosphate).

<220>

<221> misc_difference

<222> (3)

<223> The residue in this position is 2’s deoxyguanosine 5’-O- (1-Thiomonophosphate).

<220>

<221> misc_difference

<222> (4) .. (5)

<223> The residues in these positions are 2’-deoxiadenosine 5’-O- (1-Thiomonophosphate).

<220>

<221> misc_difference

<222> (6)

<223> The residue in this position is 2′-deoxythymidine 5 ’-O- (1-Thiomonophosphate).

<220>

<221> misc_difference

<222> (7)

<223> The residue in this position is 2'-deoxiadenosine 5 ′ -O- (1-Thiomonophosphate).

<220>

<221> misc_difference

<222> (8)

<223> The residue in this position is 2’-deoxythymidine 5’-O- (1-Thiomonophosphate).

<220>

<221> misc_difference

<222> (9) .. (10)

<223> The residues at these positions are a 2’ deoxiadenosine 5 ’-O- (1-Thiomonophosphate).

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 104 ctgaatataa acttgtggta gttggagctg gtgacgtagg caagagtgcc ttgacg 56

<210> 105

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<221> misc_difference

<222> (1)

<223> The residue in this position is 2’s deoxyguanosine 5’-O- (1-Thiomonophosphate).

<220>

<221> misc_difference

<222> (2)

<223> The residue in this position is 2′-deoxycytosine 5’-O- (1-Thiomonophosphate).

<220>

<221> misc_difference

<222> (3)

<223> The residue in this position is 2’-deoxythymidine 5’-O- (1-Thiomonophosphate).

<220>

<221> misc_difference

<222> (4)

<223> The residue in this position is 2′-deoxycytosine 5’-O- (1-Thiomonophosphate).

<220>

<221> misc_difference

<222> (5) .. (6)

<223> The residues at these positions are 2 ’deoxyadenosine 5’-O- (1-Thiomonophosphate).

<220>

<221> misc_difference

<222> (7) .. (8)

<223> The residues at these positions are 2 ’deoxyguanosine 5’-O- (1-Thyromophosphate).

<220>

<221> misc_difference

<222> (9)

<223> The residue in this position is 2'-deoxycytosine 5 ′ -O- (1-Thiomonophosphate).

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 105 gctcaaggca ctcttgccta cga 23

<210> 106

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<221> misc_difference

<222> (1)

<223> The residue in this position is a spacer bearing a Cy3 amidite marker.

<220>

<221> misc_difference

<222> (2) .. (3)

<223> The residues in these positions have an added amino group.

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 106 nttcaccag 9

<210> 107

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<221> misc_difference

<222> (1)

<223> The residue in this position is 2′-deoxycytosine 5’-O- (1-Thiomonophosphate).

<220>

<221> misc_difference

<222> (2)

<223> The residue in this position is 2’-deoxythymidine 5’-O- (1-Thiomonophosphate).

<220>

<221> misc difference

<222> (3) .. (4)

<223> The residues at these positions are a 2’ deoxycytosine 5’-O- (1-Thiomonophosphate).

<220>

<221> misc_difference

<222> (5) .. (6)

<223> The residues in these positions are 2’-deoxiadenosine 5’-O- (1-Thiomonophosphate).

<220>

<221> misc_difference

<222> (7)

<223> The residue in this position is 2'-deoxycytosine 5 ′ -O- (1-Thiomonophosphate).

<220> <221> misc_difference

<222> (8)

<223> The residue in this position is 2′-deoxythymidine 5 ’-O- (1-Thiomonophosphate).

<220>

<221> misc_difference

<222> (9)

<223> The residue in this position is that 2’-deoxiadenosine 5’-O- (1-Thiomonophosphate).

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 107 ctccaactac cacaagttta tattcag 27

<210> 108

<211> 14

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 108 cgagagacca cgct 14

<210> 109

<211> 14

<212> DNA

<213> Artificial sequence

<220>

<221> misc_difference

<222> (14)

<223> The residue in this position contains an abbasic ribose.

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 109 cgagagacca cgct 14

<210> 110

<211> 14

<212> DNA

<213> Artificial sequence

<220>

<221> misc_difference

<222> (14)

<223> The residue in this position contains an abbasic ribose with a 3’ phosphate group.

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 110 cgagagacca cgct 14

<210> 111

<211> 15

<212> DNA

<213> Artificial sequence

<220>

<221> misc_difference

<222> (15)

<223> The residue in this position contains a 3 ’phosphate group.

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 111

 cgagagacca cgctg

<210> 112

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<221> misc_difference

<222> (1)

<223> The residue in this position is 2’s deoxyguanosine 5’-O- (1-Thiomonophosphate).

<220>

<221> misc_difference

<222> (2)

<223> The residue in this position is 2’-deoxythymidine 5’-O- (1-Thiomonophosphate).

<220>

<221> misc_difference

<222> (3) .. (4)

<223> The residues in these positions are 2’-deoxiadenosine 5’-O- (1-Thiomonophosphate).

<220>

<221> misc_difference

<222> (5)

<223> The residue in this position is 2’-deoxythymidine 5’-O- (1-Thiomonophosphate).

<220>

<221> misc_difference

<222> (6)

<223> The residue in this position is 2′-deoxycytosine 5’-O- (1-Thiomonophosphate).

<220>

<221> misc_difference

<222> (7) .. (8)

<223> The residues at these positions are a 2’ deoxythymidine 5’-O- (1-Thiomonophosphate).

<220>

<221> misc_difference

<222> (9)

<223> The residue in this position is that 2’-deoxiadenosine 5’-O- (1-Thiomonophosphate).

<220>

<221> misc_difference

<222> (10)

<223> The residue in this position is 2′-deoxycytosine 5’-O- (1-Thiomonophosphate).

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 112 gtaatcttac caacgctaac gagcgtcttg 30

<210> 113

<211> 31

<212> DNA

<213> Artificial sequence

<220>

<221> misc_difference

<222> (1) .. (2)

<223> The residues at these positions are a 2’ deoxycytosine 5’-O- (1-Thiomonophosphate).

<220>

<221> misc difference

<222> (3)

<223> The residue in this position is 2’-deoxythymidine 5’-O- (1-Thiomonophosphate).

<220>

<221> misc_difference

<222> (4) .. (5)

<223> The residues in these positions are 2’-deoxiadenosine 5’-O- (1-Thiomonophosphate).

<220>

<221> misc_difference

<222> (6) .. (8)

<223> The residues at these positions are a 2’ deoxythymidine 5’-O- (1-Thiomonophosphate).

<220>

<221> misc_difference

<222> (9)

<223> The residue in this position is 2’s deoxyguanosine 5’-O- (1-Thiomonophosphate).

<220>

<221> misc_difference

<222> (10)

<223> The residue in this position is 2′-deoxycytosine 5’-O- (1-Thiomonophosphate).

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 113 cctaatttgc cagttacaaa ataaacagcc c 31

<210> 114

<211> 9

<212> DNA

<213> Artificial sequence

<220>

<221> misc_difference

<222> (1)

<223> The residue in this position is a spacer carrying a Cy3 dye.

<220>

<221> misc_difference

<222> (2) .. (3)

<223> The residues in these positions have an added amino group.

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 114 nttccagag

9

<210> 115 <211> 44 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 115 ttttccagag cctaatgaaa ttaggctctg gaaagacgct cgtg

44

<210> 116 <211> 14 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 116 aacgagcgtc tttg

14

<210> 117 <211> 14 <212> DNA <213> Artificial sequence

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 117 aacgagcgtc attg

14

<210> 118 <211> 50 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 118 ttttttttta attaggctct ggaaagacgc tcgtgaaacg agcgtctttg

fifty

<210> 119 <211> 17 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 119 ttttccagag cctaatg

17

<210> 120 <211> 13 <212> DNA <213> Artificial sequence

<220> <221> misc_difference <222> (1) <223> The residue at this position has a TET label.

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 120 ccggtcgtcc tgg

13

<210> 121 <211> 25 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 121 caattccggt gtactcaccg gttcc

25

<210> 122 <211> 16 <212> DNA <213> Artificial sequence

<220> <221> misc_difference <222> (1) <223> The residue at this position has a TET label.

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 122 ccggtcgtcc tggcaa

16

<210> 123 <211> 47

<212> DNA

<213> Artificial sequence <220> <223> Description of the Artificial Sequence: Synthetic

<400> 123 tgttttgacc tccatagaag accctatagt gagtcgtatt aatttcg

47

<210> 124 <211> 23 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 124 cgaaattaat acgactcact ata

2. 3

<210> 125 <211> 30 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 125 cgaaattaat acgactcact atacccagaa

30

<210> 126 <211> 16 <212> DNA <213> Artificial sequence

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 126 cgaaattaat acgact

16

<210> 127 <211> 13 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 127 cgaaattaat acg

13

<210> 128 <211> 12 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic <400> 128 cgaaattaat ac

12

<210> 129 <211> 25 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 129 cactataggg tcttctatgg aggtc

25

<210> 130 <211> 28 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 130 actcactata gggtcttcta tggaggtc

28

<210> 131 <211> 29 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 131 gactcactat agggtcttct atggaggtc

29

<210> 132 <211> 30 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 132 cgaaattaat acgcagtatg ttagcaaacg

30

<210> 133 <211> 30

<212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 133 gaactggcat gattaagact ccttattacc

30

<210> 134 <211> 29 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 134 gaactggcat gattaagact ccttattaa

29

<210> 135 <211> 326 <212> PRT <213> Methanococcus jannaschii

<400> 135

<210> 136

<211> 340

<212> PRT

<213> Pyrococcus furiosus

<400> 136 305

<210> 137

<211> 380

<212> PRT

<213> Homo sapiens

<400> 137

<210> 138

<211> 378

<212> PRT

<213> Mus musculus

<400> 138

<210> 139

<211> 382

<212> PRT

<213> Saccharomyces cerevisiae

<400> 139

<210> 140

<211> 387

<212> PRT

<213> Saccharomyces cerevisiae

<400> 140

<210> 141

<211> 488

<212> PRT

<213> Shizosaccharomyces pombe

<400> 141

<210> 142

<211> 550

<212> PRT

<213> Homo sapiens

<400> 142

<210> 143

<211> 543

<212> PRT

<213> Mus musculus

<400> 143

<210> 144

<211> 527

<212> PRT

<213> Xenopus laevis

<400> 144

<210> 145

<211> 434

<212> PRT

<213> Cunninghamella elegans

<400>

 145

<400>

 164

<210> 146 <211> 33 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 146 tactgactca ctatagggtc ttctatggag gtc

33

<210> 147 <211> 42 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 147 ttttttttta attaggctct ggaagacgct gaaagcgtct tg

42

<210> 148 <211> 38 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 148 ttttttttta attaggctct ggaagacgga acgtcttg

38

<210> 149 <211> 34 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 149 ttttttttta attaggctct ggaagagaat cttg

3. 4

<210> 150 <211> 32 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 150 ttttttttta attaggctct ggaaggaact tg

32

<210> 151 <211> 25 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 151 ttttttttta attaggctct ggaag

25

<210> 152 <211> 26 <212> DNA <213> Artificial sequence

<220> <221> misc_difference <222> (1) <223> The residue at this position contains a TET-label.

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 152 attagaaagg aagggaagaa agcgaa

26

<210> 153 <211> 30 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 153 acggggaaag ccggcgaacg tggcgagaaa

30

<210> 154 <211> 30 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 154 tgacggggaa agccggcgaa cgtggcgaga

30

<210> 155 <211> 30 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 155 cttgacgggg aaagccggcg aacgtggcga

30

<210> 156 <211> 30 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 156 gcttgacggg gaaagccggc gaacgtggcg

30

<210> 157, <211> 18 <212> DNA <213> Artificial sequence

<220> <221> misc_difference <222> (1) <223> The residue in this position contains a fluorescein marker.

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 157 agaaaggaag ggaagaaa

18

<210> 158 <211> 45 <212> DNA <213> Artificial sequence

<220> <221> misc_difference <222> (1) <223> The residue in this position contains a fluorescein marker.

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 158 tggaggtcaa aacatcgata agtcgaagaa aggaagggaa gaaat

Four. Five

<210> 159 <211> 14 <212> DNA <213> Artificial sequence

<220> <221> misc_difference <222> (1) <223> The residue in this position contains a fluorescein marker.

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 159 tgttttgacc tcca

14

<210> 160 <211> 30 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 160 acacagtgtc ctcccgctcc tcctgagcaa

30

<210> 161 <211> 18 <212> DNA <213> Artificial sequence <220> <221> misc_difference <222> (1) <223> The residue in this position contains a fluorescein marker.

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 161 tttccctcct cctcttcc

18

<210> 162 <211> 54 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 162 atgaggaaga ggaggagggt gctcaggagg agcgggagga cactgtgtct gtca

154

<210> 163 <211> 53 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 163 ttcgctttct tcccttcctt tctcgccacg ttcgccggct ttccccgtca agc

53

<210> 164 <211> 1011 <212> DNA <213> Archaeoglobus fulgidus

<210> 165

<211> 336

<212> PRT

<213> Archaeoglobus fulgidus

<400> 165

<210> 166 <211> 26 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 166 ccgtcaacat ttaccatggg tgcgga

26

<210> 167 <211> 31 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 167 ccgccacctc gtagtcgaca tccttttcgt g

31

<210> 168 <211> 20 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 168 ggcgaccaca cccgtcctgt

twenty

<210> 169 <211> 20 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 169 ccacgatgcg tccggcgtag

twenty

<210> 170 <211> 29 <212> DNA <213> Artificial sequence

<220> <221> misc_difference <222> (29) <223> The residue in this position is a 3’amina

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 170 aacgaggcgc acccacccaa ggcacagcn

29

<210> 171 <211> 26 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 171 acgggtcaat gtccatgccc caaaga

26

<210> 172 <211> 28 <212> DNA <213> Artificial sequence

<220> <221> misc_difference <222> (23) .. (27) <223> The residues in these positions are 2’-O-methyl

<220> <221> misc_difference <222> (28) <223> The residue in this position is a 3’amina

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 172 gtctgagatg aaagtgcgcc tcgttaan

28

<210> 173

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<221> misc_difference

<222> (1)

<223> The residue in this position is a spacer that contains a fluorescein marker

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 173 ntcttcgcac atttcatctc agacgga 27

<210> 174

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<221> misc_difference

<222> (1) .. (21)

<223> The residues in these positions are 2’-O-methyl

<220>

<221> misc_difference

<222> (22)

<223> The residue in this position is a 3’amine

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 174 gctgtgcctt gggtgggtgc gn

22

<210> 175 <211> 29 <212> DNA <213> Artificial sequence

<220> <221> misc_difference <222> (29) <223> The residue in this position is a 3’amina

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 175 aacgaggcgc acccacccaa ggcacagcn

29

<210> 176 <211> 26 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 176 acgggtcaat gtccatgccc caaaga

26

<210> 177

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<221> misc_feature

<222> (23) .. (27)

<223> The residues in these positions are 2’-O-methyl

<220>

<221> misc_difference

<222> (28)

<223> The residue in this position is a 3’amine

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 177 gtctgagatg aaagtgcgcc tcgttaan 28

<210> 178

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<221> misc_difference

<222> (1)

<223> The residue in this position is a spacer that contains a fluorescein marker

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 178 ntcttcgcac atttcatctc agac

24

<210> 179 <211> 18 <212> DNA <213> Artificial sequence

<220> <221> misc_difference <222> (1) .. (17) <223> The residues in these positions are 2’-O-methyl

<220> <221> misc_difference <222> (18) <223> The residue in this position is a 3’amina

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 179 gctgtgcctt gggtgggn

18

<210> 180 <211> 20 <212> DNA <213> Artificial sequence

<220>

<221> misc_difference

<222> (1) .. (19)

<223> The residues in these positions are 2’-O-methyl

<220>

<221> misc_difference

<222> (20)

<223> The residue in this position is a 3’amine

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 180 gctgtgcctt gggtgggtgn

<210> 181

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<221> misc_difference

<222> (1) .. (21)

<223> The residues in these positions are 2’-O-methyl

<220>

<221> misc_difference

<222> (22)

<223> The residue in this position is a 3’amine

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 181 gctgtgcctt gggtgggtgc gn 22

<210> 182

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<221> misc_difference

<222> (1) .. (22)

<223> The residues in these positions are 2’-O-methyl

<220>

<221> misc_difference

<222> (23)

<223> The residue in this position is a 3’amine

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 182 gctgtgcctt gggtgggtgc gcn 23

<210> 183

<211> 43

<212> DNA

<213> Artificial sequence

<220>

<221> misc_difference

<222> (1)

<223> The residue in this position is a spacer that contains a fluorescein marker <220>

<221> misc_difference

<222> (23)

<223> The residue in this position indicates a 2’-O-methyl sugar

<220>

<221> misc_difference

<222> (43)

<223> The residue in this position is a 3’amine

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 183 ngtctgagat gaaagtgctc ccgcacccac ccaaggcaca gcn

<210> 184

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<221> misc_difference

<222> (1) .. (17)

<223> The residues in these positions are 2’-O-metilazúcares

<220>

<221> misc_difference

<222> (18)

<223> The residue in this position is a 3’amine

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 184 gctgtgcctt gggtgggn

18

<210> 185 <211> 29 <212> DNA <213> Artificial sequence

<220> <221> misc_difference <222> (29) <223> The residue in this position is a 3 ’primer

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 185 aacgaggcgc acccacccaa ggcacagcn

29

<210> 186 <211> 21 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 186 gctgtgcctt gggtgggtgc g

twenty-one

<210> 187

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<221> misc_difference

<222> (21)

<223> The residue in this position is a 3’amine

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 187 gctgtgcctt gggtgggtgc n

<210> 188

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<221> misc_difference

<222> (15) .. (20)

<223> The residues in these positions are 2’-O-metilazúcares

<220>

<221> misc_difference

<222> (21)

<223> The residue in this position is a 3’amine

<220>

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 188 gctgtgcctt gggtgggtgc n

twenty-one

<210> 189 <211> 21 <212> DNA <213> Artificial sequence

<220> <221> misc_difference <222> (1) .. (20) <223> The residues in these positions are 2’-O-metilazúcares

<220> <221> misc_difference <222> (21) <223> The residue in this position is a 3’amina

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 189 gctgtgcctt gggtgggtgc n

twenty-one

<210> 190 <211> 27 <212> DNA <213> Artificial sequence

<221> misc_difference

<222> (1)

<223> The residue in this position is a spacer that contains a fluorescein marker

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 190 ntcttcgcac atttcatctc agacgga 27

<210> 191

<211> 54

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 191 ctgggcgcgg acatggagga cgtgcgcggc cgcctggtgc agtaccgcgg cgag 54

<210> 192

<211> 54

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 192 ctgggcgcgg acatggagga cgtgtgcggc cgcctggtgc agtaccgcgg cgag 54

<210> 193

<211> 56

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 193 cgcgatgccg atgacctgca gaagcgcctg gcagtgtacc aggccggggc ccgcga 56

<210> 194

<211> 56

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 194 cgcgatgccg atgacctgca gaagtgcctg gcagtgtacc aggccggggc ccgcga 56

<210> 195

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 195 23 cggtactgca ccaggcggcc gct

2. 3

<210> 196 <211> 25 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 196 ccccggcctg gtacactgcc aggct

25

<210> 197 <211> 27 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 197 aacgaggcgc acgcacgtcc tccatgt

27

<210> 198 <211> 28 <212> DNA <213> Artificial sequence

<220> <221> misc_feature <222> (25) <223> The residue in this position is that 2-amino deoxyadenosine.

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 198 gaacgaggcg cacacacgtc ctccntgt

28

<210> 199 <211> 28 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 199 aacgaggcgc acgcttctgc aggtcatc

28

<210> 200 <211> 28 <212> DNA <213> Artificial sequence

<220> <221> misc_feature <222> (21) <223> The residue in this position is that 2-amino deoxyadenosine.

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 200 aacgaggcgc acacttctgc nggtcatc

28

<210> 201 <211> 40 <212> DNA <213> Artificial sequence

<220> <221> misc_feature <222> (5) <223> The residue in this position is an abbasic linker (CY3).

<220> <221> misc_feature <222> (38) .. (40) <223> The residues in these positions are 2’-O-methyl.

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 201 cctcngtctc ggttttccga gacgagggtg cgcctcgttc

40

<210> 202 <211> 28 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 202 cccctgggga agagcagaga tatacgtc

28

<210> 203 <211> 24 <212> DNA <213> Artificial sequence

<220> <223> Description.of Artificial sequence: Synthetic

<400> 203 gggctccaca cggcgactct catt

24

<210> 204 <211> 39 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 204 ggtgctccac ctggcacgta tatctctgct cttccccag

39

<210> 205 <211> 39 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 205 ggtgctccac ctggtacgta tatctctgct cttccccag

39

<210> 206 <211> 46 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 206 agctgttcgt gttctatgat catgagagtc gccgtgtgga gccccg

46

<210> 207 <211> 46 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 207 agctgttcgt gttctatgat gatgagagtc gccgtgtgga gccccg

46

<210> 208 <211> 29 <212> DNA

<213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 208 aacgaacgcg caggccaggt ggagcattt

29

<210> 209 <211> 27 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 209 aacgaacgcg cagaccaggt ggagcac

27

<210> 210 <211> 41 <212> DNA <213> Artificial sequence

<220> <221> misc_feature <222> (5) <223> The residue in this position is an abbasic linker (CY3).

<220> <221> misc_feature <222> (39) .. (41) <223> The residues in these positions are 2’-O-methyl.

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 210 ctccngtctc ggttttccga gacggagctg cgcgttcguu u

41

<210> 211 <211> 35 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 211 aagcacgcag cacgatcata gaacacgaac agttt

35

<210> 212 <211> 35 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 212 aagcacgcag caccatcata gaacacgaac agttt

35

<210> 213 <211> 41 <212> DNA <213> Artificial sequence

<220> <221> misc_feature <222> (5) <223> The residue in this position is an abbasic linker (CY3).

<220> <221> misc_feature <222> (39) .. (41) <223> The residues in these positions are 2’-O-methyl.

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 213 acgcngtctc ggttttccga gacgcgtgtg ctgcgtgcuu u

41

<210> 214 <211> 50 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 214 gaaggtgtct gcgggagccg atttcatcat cacgcagctt ttctttgagg

fifty

<210> 215 <211> 50 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 215 gaaggtgtct gcgggagtcg atttcatcat cacgcagctt ttctttgagg

fifty

<210> 216 <211> 30 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 216 caaagaaaag ctgcgtgatg atgaaatcgc

30

<210> 217 <211> 26 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 217 aacgaggcgc acgctcccgc agacac

26

<210> 218 <211> 27 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 218 aacgaggcgc acactcccgc agacacc

27

<210> 219 <211> 40 <212> DNA <213> Artificial sequence

<220> <221> misc_feature <222> (5) <223> The residue in this position is an abbasic linker (CY3).

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 219 cctcngtctc ggttttccga gacgagggtg cgcctcgttt

40

<210> 220 <211> 51 <232> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 220 actgggagca ttgaggctcg ctgagagtca cttttattgg gaaccatagt t

51

<210> 221 <211> 51 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 221 actgggagca ttgaggcttg ctgagagtca cttttattgg gaaccatagt t

51

<210> 222 <211> 30 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 222 tatggttccc aataaaagtg actctcagct

30

<210> 223 <211> 28 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 223 aacgaggcgc acgagcctca atgctccc

28

<210> 224 <211> 28 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 224 aacgaggcgc acaagcctca atgctccc

28

<210> 225 <211> 40 <212> DNA <213> Artificial sequence

<220> <221> misc_feature <222> (5) <223> The residue in this position is an abbasic linker (CY3).

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 225 cctcngtctc ggttttccga gacgagggtg cgcctcgttt

40

<210> 226 <211> 52 <212> DNA <213> Artificial sequence

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 226 tgaagtctag agaaagggtt gtacggctga ggtctggaga aatgggcatc tg 52

<210> 227

<211> 46

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 227 tttgaaatgt cacagggttc ctaacagcca ctcttccctg gatggg 46

<210> 228

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 228 agatgcccat ttctccagac ctcagccc 28

<210> 229

<211> 36

<212> DNA

<213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 229 aagcacgcag cacgtacaac cctttctcta gacaaa

36

<210> 230 <211> 41 <212> DNA <213> Artificial sequence

<220> <221> misc_feature <222> (5) <223> The residue in this position is an abbasic linker (CY3).

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 230 ctccngtctc ggttttccga gacggaggtg ctgcgtgcuu u

41

<210> 231 <211> 25 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 231 ccatccaggg aagagtggcc tgttt

25

<210> 232 <211> 29 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 232 aagcacgcag cacaggaacc ctgtgacat

29

<210> 233 <211> 46 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 233 taggttttga ggggcatggg gacggggttc agcctccagg gtccta

46

<210> 234 <211> 46 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 234 taggttttga ggggcatgag gacggggttc agcctccagg gtccta

46

<210> 235 <211> 25 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 235 gaccctggag gctgaacccc gtcca

25

<210> 236 <211> 28 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 236 aacgaggcgc acccatcggg gtcaaaac

28

<210> 237 <211> 28 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 237 aacgaggcgc actcatgccc ctcaaaac

28

<210> 238 <211> 56 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 238 aaggacaaaa tacctgtatt cctcgcctgt ccagggatct gctcttacag attaga

56

<210> 239 <211> 56 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 239 aaggacaaaa tacctgtatt ccttgcctgt ccagggatct gctcttacag attaga

56

<210> 240 <211> 31 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 240 taatctgtaa gagcagatcc ctggacagrc c

31

<210> 241 <211> 33 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 241 aacgaggcgc acgaggaata caggtatttt gtc

33

<210> 242 <211> 33 <212> DNA

<213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 242 aacgaggcgc acaaggaata caggtatttt gtc

33

<210> 243 <211> 24 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 243 ggtaaaggtt ggcaaaaaga taac

24

<210> 244 <210> 244 <211> 27 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 244 gcgccgaggt cttggggtgg ttacaag

27

<210> 245 <211> 38 <212> DNA <213> Artificial sequence

<220> <221> misc_feature <222> (5) <223> The residue in this position is an abbasic linker (CY3).

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 245 tctcngtctc ggttttccga gactgagacc tcggcgcg

38

<210> 246 <211> 29 <212> DNA <213> Artificial sequence

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 246 cacttgcttc aggaccatat ttctctctc 29

<210> 247

<211> 33

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 247 cgcgccgagg acaccttttt tagggtgctt tgt 33

<210> 248

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 248 aaaatcgatg gtaaaggttg gc 22

<210> 249

<211> 22

<212> DNA

<213> Artificial sequence <220>

<223> Description of the Artificial Sequence: Synthetic

<400> 249 agttctgcag taccggattt gc 22

<210> 250

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 250 tcgctactag ttgcttagtg 20

<210> 251

<211> 20

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 251 gtaaacataa gcaactttag 20

<210> 252

<211> 41

<212> DNA

<213> Artificial sequence <220>

<223> Description of the Artificial Sequence: Synthetic

<400> 252 cttgtaacca ccccaagatt atctttttgc caacctttac c 41

<210> 253

<211> 51

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 253 acaaagcacc ctaaaaaagg tgtagagaga aatatggtcc tgaagcaagt g 51

<210> 254

<211> 28

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 254 cacgaattcc gaggcgatgc ttccgctc 28

<210> 255

<211> 30

<212> DNA

<213> Artificial sequence <220>

<223> Description of the Artificial Sequence: Synthetic

<400> 255 tcgacgtcga ctaacccttg gcggaaagcc 30

<210> 256

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 256 gcatcgcctc ggaattcatg gtc 23

<210> 257

<211> 26

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 257 caggaggagc tcgttgtgga cctgga 26

<210> 258

<211> 2511

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 258

<210> 259

<211> 836

<212> PRT

<213> Artificial sequence

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 259

<210> 260

<211> 777

<212> DNA

<213> Methanobacterium thermoautotrophicum

<400> 260 <210> 261

<211> 258

<212> PRT

<213> Methanobacterium thermoautotrophicum

<400> 261

5

<210> 262 <211> 28 <212> DNA <213> Artificial sequence

10

<220> <223> Description of the Artificial Sequence: Synthetic <400> 262 gggtgttccc atgggagtta aactcagg 28

<210> 263

<211> 22

<212> DNA

<213> Artificial sequence

5 <220>

<223> Description of the Artificial Sequence: Synthetic

<400> 263 ctgaattctg cagaaaaagg gg 22 10

<210> 264

<211> 987

<212> DNA

<213> Methanobacterium thermoautotrophicum 15

<400> 264 <210> 265

<211> 328

<212> PRT

<213> Methanobacterium thermoautotrophicum

<400> 265

<210> 266

<211> 17

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 266 tgtggaattg tgagcgg 17

<210> 267

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 267 tggaggctct ccatcaaaaa c 21

<210> 268

<211> 296

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 268

<210> 269 <211> 17 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 269 taatctgtat caggctg

17

<210> 270 <211> 21 <212> DNA <213> Artificial sequence

<220> <223> Description of the Artificial Sequence: Synthetic

<400> 270 gtttttgatg gagagcctcc a

twenty-one

<210> 271 <211> 889 <212> DNA <213> Artificial sequence

<220>

<223> Description of the Artificial Sequence: Synthetic

<400> 271

<210> 272

<211> 1164

<212> DNA 10 <213> Artificial sequence

<220>

<223> Description of the Artificial Sequence: Synthetic

15 <400> 272 <210> 273

<211> 296 5 <212> DNA

<213> Artificial sequence

<220>

<223> Description of the Artificial Sequence: Synthetic 10

<400> 273 5 <210> 274

<211> 840

<212> DNA

<213> Artificial sequence

10 <220>

<223> Description of the artificial sequence: Synthetic

<400> 274

<210> 275

<211> 1115 5 <212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: Synthetic 10

<400> 275

<210> 276

<211> 386

<212> DNA 5 <213> Artificial sequence

<220>

<223> Description of the artificial sequence: Synthetic

10 <400> 276

5

<210> 277 <211> 33 <212> DNA <213> Artificial sequence

10

<220> <223> Description of the artificial sequence: Synthetic

<400> 277 tacttagcag cttcttctat ctctcctttt tca

33

fifteen

<210> 278 <211> 668 <212> DNA <213> Artificial sequence

twenty

<220> <223> Description of the artificial sequence: Synthetic

<400> 278

5

<210> 279 <211> 53 <212> DNA <213> Artificial sequence

10

<220> <223> Description of the artificial sequence: Synthetic <400> 279 taccgctgca gttagtggtg gtggtggtgg tgtttaaacc atgcatctaa tgt 53

fifteen

<210> 280 <211> 17 <212> DNA <213> Artificial sequence

twenty

<220> <223> Description of the artificial sequence: Synthetic

<400> 280

 gaagaagctg ctaagta

17

5

<210> 281 <211> 1054 <212> DNA <213> Artificial sequence

10

<220> <223> Description of the artificial sequence: Synthetic <400> 281

<210> 282

<211> 514

<212> DNA

<213> Artificial sequence 5

<220>

<223> Description of the artificial sequence: Synthetic

<400> 282 10

fifteen

<210> 283 <211> 17 <212> DNA <213> Artificial sequence

twenty

<220> <223> Description of the artificial sequence: Synthetic <400> 283 gcttgggcct ctccctc 17

25

<210> 284 <211> 667 <212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: Synthetic

<400> 284

10

<210> 285 <211> 17 <212> DNA <213> Artificial sequence

fifteen

<220> <223> Description of the artificial sequence: Synthetic

twenty

<400> 285 gagggagagg cccaagc <210> 286 <211> 1164 17

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: Synthetic

<400> 286

<210> 287

<211> 514 <212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: Synthetic

<400> 287

<210> 288

<211> 618

<212> DNA

<213> Artificial sequence 15

<220>

<223> Description of the artificial sequence: Synthetic

<400> 288 20

<210> 289

<211> 1115 5 <212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: Synthetic 10

<400> 289

<210> 290

<211> 350

<212> DNA

<213> Escherichia coli

<400> 290

<210> 291

<211> 20

<212> DNA

<213> Artificial sequence

<220> <400> 294 <210> 298

<223> Description of the artificial sequence: Synthetic

<400> 291 agagtttgat cctggctcag

twenty

<210> 292 <211> 20 <212> DNA <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

<400> 292 ctgctgcctc ccgtaggagt

twenty

<210> 293 <211> 34 <212> DNA <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

<400> 293 ttttcgctgt ctcgctgaaa gcgagacagc gttt

3. 4

<210> 294 <211> 59 <212> DNA <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

ttttcgctgt ctcgctgaaa gcgagacagc gaaagacgct cgtgaaacga gcgtctttg

59

<210> 295 <211> 27 <212> DNA <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

<400> 295 atctctagca ctgctgtntt ygayggn

27

<210> 296 <211> 31 <212> DNA <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

<400> 296 gatctctagc actgctgarg gngargcnca r

31

<210> 297 <211> 28 <212> DNA <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

<400> 297 gatctctagc actgctcarg aytaygay

28

<211> 31 <212> DNA <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

<400> 298 cttaaggtag gactacytgn gcytcnccyt c

31

<210> 299 <211> 30 <212> DNA <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

<400> 299 ttaaggtagg actacytcrt aytcytgrct

30

<210> 300 <211> 30 <212> DNA <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

<400> 300 ttaaggtagg actacytcrt aytcytgnga

30

<210> 301 <211> 30 <212> DNA

<213>

 Artificial sequence

<213>

 Homo sapiens

<213>

Acidianus ambivalens

<220> <223> Description of the artificial sequence: Synthetic

<400> 301 ttaaggtagg actacrttrw artcngtncc

30

<210> 302 <211> 16 <212> DNA <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

<400> 302 gatctctagg actgct

16

<210> 303 <211> 16 <212> DNA <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

<400> 303 cttaaggtag gactac 16

<210> 304 <211> 27 <212> DNA <213> Acidianus ambivalens

<400> 304 gccatgtcat tagttaacct agttgcc

27

<210> 305 <211> 27 <212> DNA <213> Acidianus ambivalens

<400> 305 ggcaatggga attccagtag tgcaagc

27

<210> 306 <211> 27 <212> DNA <213> Acidianus brierleyi

<400> 306 gccatctcgt ttgtaagtct ggttgcc

27

<210> 307 <211> 26 <212> DNA <213> Acidianus brierleyi

<400> 307 cttacaaacg agatggcaga cgaagg

26

<210> 308 <211> 27 <212> DNA <213> Homo sapiens

<400> 308 ttgctgtgca tacttcctcg cttcagc

27

<210> 309 <211> 27 <212> DNA

<400> 309 ccgaggtgat agacttagaa tacaacc

27

<210> 310 <211> 27 <212> DNA <213> Archaeoglobus veneficus

<400> 310 tatcgcagcg atccacttct cctctgc

27

<210> 311 <211> 27 <212> DNA <213> Archaeoglobus veneficus

<400> 311 cttaaacggc aacctgagaa ggcttgg

27

<210> 312 <211> 28 <212> DNA <213> Archaeoglobus veneficus

<400> 312 ctatctcctt ctgcttgaaa acaggagg

28

<210> 313 <211> 27 <212> DNA <213> Archaeoglobus veneficus

<400> 313 acaagggaac agctcgtcga tatcgcg

27

<210> 314 <211> 26 <212> DNA <213> Desulfurococcus amylolyticus

<400> 314 tgctgcctcc tccttaacgg ctttcc

26

<210> 315 <211> 27 <212> DNA <213> Desulfurococcus amylolyticus

<400> 315 ccggagctca tagagctcga caaactc

27

<210> 316 <211> 26 <212> DNA <213> Desulfurococcus mobilis

<400> 316 tctcgcagcc tcctccctga caaccc

26

<210> 317 <211> 27 <212> DNA <213> Desulfurococcus mobilis

<400> 317 ctcgataaac tgctttcaaa gctgggc

27

<210> 318 <211> 27 <212> DNA

<213> Methanococcus igneus

<400> 318 cctctttgcg tatttttgca tctcatc

27

<210> 319 <211> 27 <212> DNA <213> Methanococcus igneus

<400> 319 cttaacaaag gacatcgtag agaactc

27

<210> 320 <211> 26 <212> DNA <213> Methanopyrus kandleri

<400> 320 cagtttctcc atcgcctcct ccttcc

27

<210> 321 <211> 27 <212> DNA <213> Methanopyrus kandleri

<400> 321 ttggtggaag acgcgaagag gctgttg

27

<210> 322 <211> 26 <212> DNA <213> Pyrobaculum aerophilum

<400> 322 catggccttc tcacgcgtct tcctcc

26

<210> 323 <211> 26 <212> DNA <213> Pyrobaculum aerophilum

<400> 323 ctgagctata tgggcgtacc ctgggt

26

<210> 324 <211> 26 <212> DNA <213> Methanopyrus kandleri

<400> 324 cccatggcct ccagcagctt cttagc

26

<210> 325 <211> 27 <212> DNA <213> Pyrodictium brockii

<400> 325 aacctcgcta taacgggtaa gaggaag

27

<210> 326 <211> 27 <212> DNA <213> Sulfolobus solfataricus

<400> 326 agcttgaact acaggtatac ccatagc

27

<210> 327 <211> 27 <212> DNA <213> Sulfolobus solfataricus

<400> 327 gctatgggta tacctgtagt tcaagct

27

<210> 328 <211> 26 <212> DNA <213> Thermococcus litoralis

<400> 328 ctgcgcttcc tccctagcct cagctc

26

<210> 329 <211> 26 <212> DNA <213> Thermococcus litoralis

<400> 329 atgggcatcc catgggtgca ggctcc

26

<210> 330 <211> 26 <212> DNA <213> Thermococcus gorgonarius

<400> 330 aggttcctta caagtctcgg cgcgcc

26

<210> 331

<211> 26 <212> DNA <213> Thermococcus gorgonarius

<400> 331 agctcggcat agacagggaa aagctg

26

<210> 332 <211> 26 <212> DNA <213> Thermococcus zilligii

<400> 332 aggtttctca cgagtttcgg cgcgcc

 26

<210> 333 <211> 26 <212> DNA <213> Thermococcus zilligii

<400> 333 agcttggcat agaccgggag aaactc

 26

<210> 334 <211> 31 <212> DNA <213> Acidianus ambivalens

<400> 334 gcaaccatgg gagtagacct tgctgatttg g

31

<210> 335 <211> 32 <212> DNA <213> Acidianus ambivalens

<400> 335 ccatgtcgac taaaaccact gatctaaacc gc

32

<210> 336 <211> 1056 <212> DNA

<400> 336

<210> 337

<211> 351

<212> PRT

<213> Acidianus ambivalens

<400> 337

<210> 338

<211> 31

5

<212> DNA

<213> Acidianus brierleyi

<400> 338

cataccatgg gagtagattt atctgactta g

31

10

<210> 339

<211> 33

<212> DNA

<213> Acidianus brierleyi

fifteen

<400> 339

cttggtcgac ttaaaaccat tggtcaagtc cag

33

<210> 340

<211> 1056

<212> DNA

<213> Acidianus brierleyi

<400>

 340

<400>

 341

10

<210> 341

<211> 351

<212> PRT

<213> Acidianus brierleyi

fifteen

<210> 342

<211> 27

<212> DNA

<213> Aeropyrum pernix

<400> 342 ttagccatgg gagtcaacct tagggag 27

5 <210> 343

<211> 30

<212> DNA

<213> Aeropyrum pernix

10 <400> 343 gtaagtcgac tatccgaacc acatgtcgag 30

<210> 344

<211> 1053 15 <212> DNA

<213> Aeropyrum pernix

<400> 344

<210> 345

<211> 350

<212> PRT

<213> Aeropyrum pernix

<400> 345

<210> 346 <211> 28 <212> DNA <213> Homo sapiens

<400> 346 28 cttaccatgg gcgctgatat aggagagc

28

<210> 347 <211> 30 <212> DNA <213> Homo sapiens

<400> 347 30 tggagtcgac ttaaaaccac ctgtccagag

30

<210> 348 <211> 1008 <212> DNA <213> Homo sapiens

<400> 348

<212> PRT

<213> Homo sapiens

<400> 349 10

5

<210> 350 <211> 25 <212> DNA <213> Methanococcus igneus

10 15

<400> 350 cattccatgg gagtgcagtt taatg <210> 351 <211> 28 <212> DNA <213> Methanococcus igneus <400> 351 cggagtcgac tcatctccca aaccatgc 25 28

<210> 352

<211> 981

<212> DNA

<213> Methanococcus igneus

<400> 352

10 <210> 353

<211> 326

<212> PRT

<213> Methanococcus igneus

15 <400> 353

5

<210> 354 <211> 27 <212> DNA <213> Pyrococcus horikoshii

10

<400> 354 gataccatgg gtgttcctat cggtgac 27

<210> 355

<211> 33

<212> DNA

<213> Pyrococcus horikoshii 5

<400> 355 cttggtcgac ttagggtttc tttttaacga acc 33

<210> 356 10 <211> 1032

<212> DNA

<213> Pyrococcus horikoshii

<400> 356 15

<210> 357

<211> 343

<212> PRT

<213> Pyrococcus horikoshii

<400> 357

5

<210> 358 <211> 31 <212> DNA <213> Sulfolobus solfataricus

<400> 358 taagccatgg gtgtagattt aggcgaaata g

31

10

<210> 359 <211> 35 <212> DNA <213> Sulfolobus solfataricus

fifteen

<400> 359 actagtcgac ttaaaaccac tgatcaagac ctgtc 35

twenty

<210> 360 <211> 1056 <212> DNA <213> Sulfolobus solfataricus

<400> 360

5 <210> 361

<211> 351

<212> PRT

<213> Sulfolobus solfataricus

10 <400> 361

<210> 362

<211> 28

5

<212> DNA

<213> Thermococcus gorgonarius

<400> 362

ctagccatgg gagttcagat aggtgagc

10

<210> 363

<211> 30

<212> DNA

<213> Thermococcus gorgonarius

fifteen

<400> 363

tggagtcgac taccgtgtga accagctttc

<210> 364

twenty

<211> 1023

<212> DNA

 <213> Thermococcus gorgonarius

<400> 364

<210> 365

<211> 340

<212> PRT

<213> Thermococcus gorgonarius

<400> 365

<210> 366

<211> 32

<212> DNA

<213> Archaeoglobus veneficus

<400> 366 taacgaattc ggtgcagaca taggcgaact ac 32

5

<210> 367 <211> 33 <212> DNA <213> Archaeoglobus veneficus

<400> 367 cggtgtcgac tcaggaaaac cacctctcaa gcg

33

10

<210> 368 <211> 37 <212> DNA <213> Archaeoglobus veneficus

fifteen

<400> 368 cacaggaaac agaccatggg tgcagacata ggcgaac 37

twenty

<210> 369 <211> 1017 <212> DNA <213> Archaeoglobus veneficus

<400> 369

<210> 370

<211> 338

<212> PRT

<213> Archaeoglobus veneficus

<400> 370

<210> 371 <211> 36 <212> DNA <213> Desulfurococcus amylolyticus

<400> 371 ctaagaattc ggagtagact taaaagacat tatacc

36

<210> 372 <211> 29 <212> DNA <213> Desulfurococcus amylolyticus

<400> 372 agttgtcgac tacttcggct tactgaacc

29

<210> 373 <211> 34 <212> DNA <213> Desulfurococcus amylolyticus

<400> 373 caggaaacag accatgggag tagacttaaa agac

3. 4

<210> 374

<211> 1062

<212> DNA

<213> Desulfurococcus amylolyticus

<400>

 374

<400>

 375

10

<210> 375

<211> 353

<212> PRT

<213> Desulfurococcus amylolyticus

fifteen

<210> 376

<211> 31

<212> DNA

<213> Pyrobaculum aerophilum

<400> 376

cgttgaattc ggagttactg agttgggtaa g

31

5

<210> 377 <211> 34 <212> DNA <213> Pyrobaculum aerophilum

10

<400> 377 tactgtcgac agaaaaagga gtcgagagag gaag 3. 4

fifteen

<210> 378 <211> 1041 <212> DNA <213> Pyrobaculum aerophilum

<400> 378

<210> 379

<211> 346

<212> PRT

<213> Pyrobaculum aerophilum

<400> 379

<210> 380 <211> 31 <212> DNA <213> Thermococcus litoralis

<400> 380 tcatgaattc ggagtccaga ttggtgagct t

31

<210> 381 <211> 32 <212> DNA <213> Thermococcus litoralis

<400> 381 gattgtcgac tcacttttta aaccagctgt cc

32

<210> 382 <211> 39 <212> DNA <213> Thermococcus litoralis

<400> 382 aagctcacca atctggactc ccatggtctg tttcctgtg

39

<210> 383 <211> 1023 <212> DNA

<213> Thermococcus litoralis

<400> 383

<210> 384

<211> 340

<212> PRT

<213> Thermococcus litoralis

<400> 384

<210> 385

<211> 31

5

<212> DNA

<213> Desulfurococcus mobilis

<400> 385 31

cttggaattc ggcgtcgacc taagggaact c

31

10

<210> 386

<211> 34

459

<212> DNA

<213> Desulfurococcus mobilis

<400> 386 34 5 aggtctgcag ttaaccctgc ttaccgggct tagc 34

<210> 387

<211> 31

<212> DNA 10 <213> Desulfurococcus mobilis

<400> 387 31 caggaaacag accatgggcg tcgacctaag g 31

15 <210> 388

<211> 1071

<212> DNA

<213> Desulfurococcus mobilis

20 <400> 388

<210> 389

<211> 356

<212> PRT

<213> Desulfurococcus mobilis

<400> 389

<210> 390 <211> 28 <212> DNA <213> Pyrodictium brockii

<400> 390 tagcgaattc ggcgtcaacc tccgcgag

28

<210> 391 <211> 28 <212> DNA <213> Pyrodictium brockii

<400> 391 cattctgcag ctagcggcgc agccacgc

28

<210> 392 <211> 31 <212> DNA <213> Pyrodictium brockii

<400> 392 caggaaacag accatgggcg tcaacctccg c

31

<210> 393

<211> 1053

<212> DNA

<213> Pyrodictium brockii

<400>

 393

<400>

 394

10

<210> 394

<211> 350

<212> PRT

<213> Pyrodictium brockii

fifteen

5

<210> 395 <211> 28 <212> DNA <213> Methanopyrus kandleri

10

<400> 395 cataccatgg gactagctga actccgag 28

<210>

 396

<210>

 398

5

<211> 30 <212> DNA <213> Methanopyrus kandleri <400> 396 tggatctaga tcagaagaac gcgtccaggg 30

10

<210> 397 <211> 985 <212> DNA <213> Methanopyrus kandleri

fifteen

<400> 397

<211> 328

<212> PRT

<213> Methanopyrus kandleri

<400> 398

<210> 399 <211> 28 <212> DNA <213> Thermococcus zilligii

<400> 399 cgatccatgg gagttcagat cggtgagc

28

<210> 400 <211> 31 <212> DNA <213> Thermococcus zilligii

<400> 400 caggctgcag tcaccttccg aaccagctct c

31

<210> 401 <211> 1023 <212> DNA <213> Thermococcus zilligii

<400> 401

<212> PRT

<213> Thermococcus zilligii

<400> 402 10

5

<210> 403 <211> 16 <212> DNA <213> Artificial sequence

10

<220> <223> Description of the artificial sequence: Synthetic <400> 403 ttttcaactg ccgtga 16

fifteen

<210> 404 <211> 36 <212> DNA <213> Artificial sequence

twenty

<220> <223> Description of the artificial sequence: Synthetic

<400> 404

 tcacggcagt tggtgcgcct cggaacgagg cgcaca

36

<210> 405 <211> 45 <212> DNA <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

<400> 405 ttttcaactg cttagagaat ctaagcagtt ggtgcgcctc gttaa

Four. Five

<210> 406 <211> 21 <212> DNA <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

<400> 406 aacgaggcgc acattttttt t

twenty-one

<210> 407 <211> 30 <212> DNA <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

<400> 407 ccgaagcacg cacaaagcgg tgtgtcacga

30

<210> 408

<211> 25 <212> DNA <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

<400> 408 gcgccgaggc cgttctctag cgtga

25

<210> 409 <211> 36 <212> DNA <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

<400> 409 tcnctgccgg ttttccggca gagacctcgg cgcact

36

<210> 410 <211> 55 <212> DNA <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

<400> 410 gtatacagcg tcacgctaga gaacggcgtg acccaccgct ttgtgcgtgc ttcgg

55

<210> 411 <211> 25 <212> DNA <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

<400> 411 gggataccat gggagtgcag tttgg

25

<210> 412 <211> 42 <212> DNA <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

<400> 412 gagctctttc tttttgaatt ctggtggctc accatcaaaa ac

42

<210> 413 <211> 21 <212> DA1A <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

<400> 413 gaattcaaaa agaaagagct c

twenty-one

<210> 414 <211> 21 <212> DNA <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

<400> 414 tgcatcctcg atgagcattt c 21

<210> 415

<211> 44

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: Synthetic

<400> 415 gaaatgctca tcgaggatgc aaaatatttg ttaagtttga tggg 44

<210> 416

<211> 27

<212> DNA

<213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

<400> 416 ggtaaatttt tctcgtcgac atcccac 27

<210> 417

<211> 981

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: Synthetic

<400> 417 <210> 418

<211> 326 5 <212> PRT

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: Synthetic 10

<400>

 418

<400>

 420

5

<210> 419 <211> 27 <212> DNA <213> Artificial sequence

10

<220> <223 Description of the artificial sequence: Synthetic

<400> 419 gattccatgg gtgtcccaat tggtgag

27

fifteen

<210> 420 <211> 42 <212> DNA <213> Artificial sequence

twenty

<220> <223> Description of the artificial sequence: Synthetic

ccttgttttc tcctttaact ttggaggttc tccatcaaaa ac

42

<210> 421 <211> 21 <212> DNA <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

<400> 421 aagttaaagg agaaaacaag g

twenty-one

<210> 422 <211> 21 <212> DNA <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

<400> 422 gcagttttca accattttca g

twenty-one

<210> 423 <211> 42 <212> DNA <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

<400> 423 ccgaaaatgg ttgaaaactg caaaaaactc ttagagctta tg

42

<210> 424

<211> 34

<212> DNA 5 <213> Artificial sequence

<220>

<223> Description of the artificial sequence: Synthetic

10 <400> 424 cggagtcgac ttatctcttg aaccaacttt caag 34

<210> 425

<211> 1014 15 <212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: Synthetic 20

<400> 425

<210> 426

<211> 338

<212> PRT

<213> Artificial sequence 10

<220>

<223> Description of the artificial sequence: Synthetic

<400> 426 15

<210> 427

<211> 43 5 <212> ADNP

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: Synthetic 10

<400> 427

caatttcagc cttcttgaac tctggtggct caccatcaaa aac 43

<210> 428

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: Synthetic

<400> 428 gagttcaaga aggctgaaat tg 22

<210> 429

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: Synthetic

<400> 429 tgcggagtca acaatgtact c 21

<210> 430

<211> 45

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: Synthetic

5

<400> 430 gagtacattg ttgactccgc aaaatatttg ttaagtttga tgggc Four. Five

10

<210> 431 <211> 978 <212> DNA, <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

fifteen

<400> 431

<210> 432

<211> 325 5 <212> PRT

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: Synthetic 10

<400> 432

<210> 433

<211> 43

5

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: Synthetic

10

<400> 433

caatttcagc cttcttgaac tctggaggtt ctccatcaaa aac

43

<210> 434

<211> 44

<212> DNA

<213> Artificial sequence 5

<220>

<223> Description of the artificial sequence: Synthetic

<400> 434 10 gagtacattg ttgactccgc aaaaaaactc ttagagctta tggg 44

<210> 435

<211> 1020

<212> DNA 15 <213> Artificial sequence

<220>

<223> Description of the artificial sequence: Synthetic

20 <400> 435

<210> 436

<211> 339

<212> PRT

<213> Artificial sequence 5

<220>

<223> Description of the artificial sequence: Synthetic

<400> 436 10

<210> 437 <211> 55 <212> DNA <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

<400> 437 cgtagacatt tttcccaggc aactttcttt ttcctgtagt tgttaaattt ctaac

55

<210> 438 <211> 52 <212> DNA <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

<400> 438 cctgggaaaa atgtctacgt cgagataaag cccgaactta ttgaattaaa tg

52

<210> 439 <211> 1017 <212> DNA <213> Artificial sequence

<220>

<223> Description of the artificial sequence: Synthetic

<400> 439

<210> 440

<211> 338 10 <212> PRT

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: Synthetic 15

<400> 440

<210> 441

<211> 36

5

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: Synthetic

10

<400> 441

ctctggcatc tcctttgtta ttgttaagtt tctaac

36

<210> 442

<211> 37

<212> DNA 5 <213> Artificial sequence

<220>

<223> Description of the artificial sequence: Synthetic

10 <400> 442 acaaaggaga tgccagagtt gataattttg gaggaag 37

<210> 443

<211> 987 15 <212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: Synthetic 20

<400> 443 <210> 444

<211> 328 5 <212> PRT

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: Synthetic 10

<400> 444

<210> 445 <211> 31 <212> DNA <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

<400> 445 ctcttaatgc aatcgcccaa tttttgtcca c

31

<210> 446 <211> 31 <212> DNA <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

<400> 446 gtggacaaaa attgggcgat tgcattaaga g

31

<210> 447 <211> 31 <212> DNA <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

<400> 447 ctcttaatgc aatcttccaa tttttgtcca c

31

<210> 448 <211> 31 <212> DNA <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

<400> 448 31 gtggacaaaa attggaagat tgcattaaga g

31

<210> 449 <211> 1023 <212> DNA <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

<400> 449

<210> 450

<211> 340 5 <212> PRT

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: Synthetic 10

<400> 450

<210> 451

<211> 1023 5 <212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: Synthetic 10

<400> 451 <210> 452

<211> 340 5 <212> PRT

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: Synthetic 10

<400> 452

<210> 453 <211> 33 <212> DNA <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

<400> 453 gtgtatgttt ttgatggaaa acctccagaa ttc

33

<210> 454 <211> 33 <212> DNA <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

<400> 454 gaattctgga ggttttccat caaaaacata cac

33

<210> 455 <211> 33

<212> DNA <220> <400> 461

<213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

<400> 455 gagagaggaa gctgaactaa agtggagaga agc

33

<210> 456 <211> 33 <212> DNA <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic.

<400> 456 gcttctctcc actttagttc agcttcctct ctc

33

<210> 457 <211> 32 <212> DNA <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

<400> 457 gagagaagca cttgcaaaag gagagataga gg

32

<210> 458 <211> 32 <212> DNA <213> Artificial sequence

<223> Description of the artificial sequence: Synthetic

<400> 458 cctctatctc tccttttgca agtgcttctc tc

32

<210> 459 <211> 37 <212> DNA <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

<400> 459 gaagcacttg caaaaggaaa catagaggaa gcaagaa

37

<210> 460 <211> 37 <212> DNA <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

<400> 460 ttcttgcttc ctctatgttt ccttttgcaa gtgcttc

37

<210> 461 <211> 38 <212> DNA <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

cctacgtctt tgatggagag cctccggaat tcaaaagg

38

<210> 462 <211> 34 <212> DNA <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

<400> 462 ccttttgaat tccggaggct ctccatcaaa gacg

3. 4

<210> 463 <211> 31 <212> DNA <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

<400> 463 gagaagaggc agaagaaaaa tggaaagaag c

31

<210> 464 <211> 31 <212> DNA <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

<400> 464 gcttctttcc atttttcttc tgcctcttct c

31

<210>

 465

<210>

 470

<211> 33 <212> DNA <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

<400> 465 ggaaagaagc tctagagaag ggaaacctgg agg

33

<210> 466 <211> 33 <212> DNA <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

<400> 466 cctccaggtt tcccttctct agagcttctt tcc

33

<210> 467 <211> 33 <212> DNA <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

<400> 467 gctctagaga agggagaact ggaggaagct agg

33

<210> 468 <211> 33 <212> DNA

<213> Artificial sequence

5

<220> <223> Description of the artificial sequence: Synthetic <400> 468 cctagcttcc tccagttctc ccttctctag age 33

10

<210> 469 <211> 1023 <212> DNA <213> Artificial sequence

fifteen

<220> <223> Description of the artificial sequence: Synthetic

<400> 469

<211> 340 5 <212> PRT

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: Synthetic 10

<400> 470

<210> 471

<211> 1023

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: Synthetic

<400> 471

5 <210> 472

<211> 340

<212> PRT

<213> Artificial sequence

10 <220>

<223> Description of the artificial sequence: Synthetic

<400> 472

<210> 473

<211> 1023

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: Synthetic

<400> 473 <220>

10

<210> 474

<211> 340

<212> PRT

<213> Artificial sequence

fifteen

<223> Description of the artificial sequence: Synthetic

<400> 474

<210> 475

<211> 1023 5 <212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: Synthetic 10

<400> 475 <210> 476

<211> 340 5 <212> PRT

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: Synthetic 10

<400> 476.

<210> 477

<211> 1024 5 <212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: Synthetic 10

<400> 477 <212> PRT

<213> Artificial sequence

<220> 10 <223> Description of the artificial sequence: Synthetic

<400> 478

<210> 479

<211> 1024 5 <212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: Synthetic 10

<400> 479 <212> PRT

<213> Artificial sequence

<220> 10 <223> Description of the artificial sequence: Synthetic

<400> 480

<210> 481

<211> 1024 5 <212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: Synthetic 10

<400> 481 <212> PRT

<213> Artificial sequence

<220> 10 <223> Description of the artificial sequence: Synthetic

<400> 482

<210> 483

<211> 1024 5 <212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: Synthetic 10

<400> 483 <212> PRT

<213> Artificial sequence

<220> 10 <223> Description of the artificial sequence: Synthetic

<400> 484

<210> 485

<211> 43

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: Synthetic

<400> 485 aaaacgctgt ctcgctgaaa gcgagacagc gaaagacgct cgt

43

<210> 486 <211> 12 <212> DNA <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

<400> 486 acgagcgtct tt

12

<210> 487 <211> 13 <212> DNA <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

<400> 487 acgagcgtct tta

13

<210> 488 <211> 13 <212> DNA <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

<400> 488 acgagcgtct ttt

13

<210> 489 <211> 13 <212> DNA <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

<400> 489 acgagcgtct ttg

13

<210> 490 <211> 13 <212> DNA <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

<400> 490 acgagcgtct ttc

13

<210> 491 <211> 13 <212> DNA <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

<220> <221> modified base <222> (13) <223> The nucleotide in this position is dideoxycytosine

<400> 491 <223> Description of the artificial sequence: Synthetic

 acgagcgtct ttn

13

<210> 492 <211> 13 <212> DNA <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

<220> <221> modified base <222> (14) <223> The nucleotide in this position is dideoxycytosine,

<400> 492 acgagcgtct ttc

13

<210> 493 <211> 12 <212> DNA <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

<400> 493 acgagcgtct tt

12

<210> 494 <211> 45 <212> DNA <213> Artificial sequence

<220>

<400> 494 ttttcaactg cttagagaat ctaagcagtt ggtgcgcctc gttaa

Four. Five

<210> 495 <211> 15 <212> DNA <213> Artificial sequence

<220> <223> Description of Artificial sequence: Synthetic <400> 495 aacgaggcgc acatt

fifteen

<210> 496 <211> 24 <212> DNA <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

<400> 496 ccttccttat cctggatctt ggca

24

<210> 497 <211> 30 <212> DNA <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

<400> 497 cgccgagatc acctttacat tttctatcgt

30

<210> 498

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: Synthetic

<220>

<221> modified base

<222> (1) .. (24)

<223> The nucleotides at these positions are 2 ’O-methyl

<400> 498 acgatagaaa atgtaaaggt gatc 24

<210> 499

<211> 14

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: Synthetic

<220>

<221> modified base

<222> (3)

<223> The nucleotide in this position is a cirosine attached to an inactivating moiety Z28

<400> 499 ctnttctcag tgcg 14

<210> 500

<211> 14

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: Synthetic

<400> 500 ccgccgagat cacc

<210> 501

<211> 29

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: Synthetic

<220>

<221> modified base

<222> (5)

<223> The nucleotide in this position is a guanosine to a 2 ’O-methyl

<220>

<221> modified base

<222> (27)

<223> The nucleotide in this position is a guanosine at a 2 ′ O-methyl

<220>

<221> modified base

<222> (28)

<223> The nucleotide in this position is a guanosine at a 2 ′ O-methyl

<220>

<221> modified base

<222> (29)

<223> The nucleotide in this position is deoxyuridine

<400> 501

 cgcantgaga atgaggtgat ctcggcnnn

29

<210> 502 <211> 24 <212> DNA <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

<220> <221> modified base <222> (24) <223> The nucleotide in this position is a T amine

<400> 502 ccgtcacgcc tcctctcagt tctn

24

<210> 503 <211> 29 <212> DNA <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

<400> 503 ttgataaatt tggggtggaa aggtttgga

29

<210> 504 <211> 21 <212> DNA <213> Artificial sequence

<220>

<223> Description of the artificial sequence: Synthetic

<400> 504 gtgtggtcca ctctcaatca at 21

<210> 505

<211> 16

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: Synthetic

<400> 505 agaactgaga ggaggc 16

<210> 506

<211> 13

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: Synthetic

<220>

<221> modified base

<222> (3)

<223> The nucleotide in this position is a cytosine bound to an inactivating moiety Z28

<400> 506 cantgcttcg tgg 13

<210> 507

<211> 13

<212> DNA

<213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

<400> 507 ccgtcacgcc tct

13

<210> 508 <211> 27 <212> DNA <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

<220> <221> modified base <222> (27) <223> The nucleotide in this position is deoxyuridine

<400> 508 ccaggaagca agtggaggcg tgacggn

27

<210> 509 <211> 220 <212> DNA <213> Artificial sequence

<220> <223> Description of the artificial sequence: Synthetic

<400> 509

<210> 510

<211> 339 5 <212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: Synthetic 10

<400> 510

fifteen

<210> 511 <211> 32 <212> DNA <213> Artificial sequence

twenty

<220> <223> Description of the artificial sequence: Synthetic

<400> 511 cgcgaggccg gaggaataca ggtattttgt cc

32

<210> 512

<211> 33

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: Synthetic

<400> 512 tctaatctgt aagagcagat ccctggacag acc 33

<210> 513

<211> 33

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: Synthetic

<220>

<221> modified base

<222> (3)

<223> The nucleotide in this position is a thymidine attached to an inactivating moiety Z28

<400> 513 tcnagccggt tttccggctg agacggcctc gcg 33

<210> 514

<211> 27

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: Synthetic

<400> 514

 aggccacgga cgaagcctca atgctcc 27

<210> 515

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: Synthetic

<400> 515 tatggttccc aataaaagtg actctcagct 30

<210> 516

<211> 35

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: Synthetic

<220>

<221> modified base

<222> (3)

<223> The nucleotide in this position is a thymidine attached to an inactivating moiety Z28

<400> 516 tcnagccggt tttccggctg agacgtccgt ggcct 35

<210> 517

<211> 40

<212> DNA

<213> Artificial sequence

<220>

<223> Description of the artificial sequence: Synthetic

5

<400> 517 tttttcacgg cagttggtgc gcctcggaac gaggcgcaca 40

10

<210> 518 <211> 16 <212> DNA <213> Artificial sequence

fifteen

<220> <223> Description of the artificial sequence: Synthetic <400> 518 ttttcaactg ccgtga 16

Claims (41)

one.

A composition comprising a purified FEN-1 endonuclease from Archaeaglobus veneficus, wherein said FEN-1 endonuclease comprises an amino acid sequence comprising SEQ ID No. 370.

2.

A composition comprising an isolated nucleic acid, wherein said nucleic acid encodes the endonuclease of claim 1, wherein said isolated nucleic acid comprises SEQ ID NO: 369.

3.

A composition comprising a chimeric FEN-1 endonuclease, said chimeric FEN-1 endonuclease comprising the endonuclease of claim 1.

Four.

A vector comprising the nucleic acid of claim 2.

5.

A composition comprising a host cell, said host cell comprising the vector of claim 4.

6.

The composition of claim 3, wherein said chimeric FEN-1 endonuclease comprises a functional domain.

7.

The composition of claim 6, wherein said chimeric FEN-1 endonuclease comprises SEQ ID NO.

370.

8.

A mixture comprising: i) a first nuclease with structure specificity comprising an FEN-1 endonuclease of Archaeaglobus veneficus; and ii) a second nuclease with structure specificity, wherein said nuclease with structure specificity comprises an amino acid sequence comprising SEQ ID NO: 370.

9.

The mixture of claim 8, wherein said purified structure specific nuclease comprises a specific structure nuclease from an organism selected from the group consisting of Sulfolobus solfataricus, Pyrobaculum aerophilum, Thermococcus litoralis, Archaeaglobus veneficus, Archaeaglobus profundus, Acidianus brierlyi, Acidianus ambivalens, Desulfurococcus amylolyticus, Desulfurococcus mobilis, Pyrodictium brockii, Thermococcus gorgonarius, Thermococcus zilligii, Methanopyrus kandleri, Methanococcus igneus, Pyrococcus horikoshii and Aeropyrum pernix.

10.

The mixture of claim 8, wherein said purified structure specific nuclease comprises a sequence selected from the group consisting of SEQ ID Nos. 337, 341, 345, 349, 353, 357, 361, 365, 375, 379, 384 , 389, 394, 398, 402, 418, 426, 432, 436, 440, 444, 450, 452, 470, 472, 474, 476, 478, 480, 482, and

484

eleven.

The mixture of claim 8, wherein said second structure-specific nuclease comprises a polymerase.

12.

The mixture of claim 11, wherein said polymerase comprises a DNA polymerase.

13.

The mixture of claim 12, wherein said DNA polymerase comprises a thermostable DNA polymerase.

14.

In The mixture of claim 8, wherein said second structure-specific nuclease comprises a

5 ’nuclease derived from an altered DNA polymerase in the amino acid sequence so that shows synthetic activity of reduced DNA with respect to that of wild-type DNA polymerase but conserves substantially the same 5 ’nuclease activity of wild-type DNA polymerase.

fifteen.

The mixture of claim 14, wherein said 5 ′ nuclease comprises a thermostable 5 ′ nuclease.

16.

The mixture of claim 8, wherein said second structure-specific nuclease is selected from the group consisting of the CLEAVASE BN enzyme, the CLEAVASE DA enzyme, the CLEAVASE DN enzyme, the CLEAVASE DV enzyme, the CLEAVASE BN / thrombin enzyme, CLEAVASE TThDN enzyme, Thermus aquaticus DNA polymerase, Thermus thermophilus DNA polymerase, Escherichia coli Exo III and Rad1 / Rad10 complex of Saccharomyces cerevisiae.

17.

A nucleic acid treatment kit, comprising:

a) a composition comprising a purified FEN-1 endonuclease from Archaeaglobus veneficus, wherein said FEN1 endonuclease comprises an amino acid sequence comprising SEQ ID NO: 370; Y b) oligonucleotides capable of forming an invasive cleavage structure in the presence of a target nucleic acid. 18. The kit of claim 17, wherein said oligonucleotides comprise: a) a first oligonucleotide comprising a complementary 5 ’portion of a first portion of a target nucleic acid; Y b) a second oligonucleotide comprising: a 5 'portion complementary to a second portion of said target nucleic acid chain below and adjacent to said first portion; and a 3 ’portion.

19.

The kit of claim 18, wherein said 3 ′ portion of said second oligonucleotide comprises a 3 ′ terminal nucleotide not complementary to said target nucleic acid.

twenty.

The kit of claim 19, wherein said 3 'portion of said second oligonucleotide consists of a single nucleotide not complementary to said target nucleic acid.

twenty-one.

The kit of claim 18, comprising a solid support.

22

The kit of claim 21, wherein said first oligonucleotide is attached to said solid support.

2. 3.

The kit of claim 21, wherein said second oligonucleotide is attached to said solid support.

24.

The kit of claim 18, further comprising a buffer solution.

25.

The kit of claim 24, wherein said buffer solution comprises a source of divalent cations.

26.

The kit of claim 25, wherein said divalent cation comprises Mn2 +.

27.

The kit of claim 25, wherein said divalent cation comprises Mg2 +.

28.

The kit of claim 18, further comprising a third oligonucleotide complementary to a third portion of said target nucleic acid upstream of the first portion of the first target nucleic acid.

29.

The kit of claim 28, further comprising one or more target nucleic acids.

30

A method of detecting a target sequence, comprising: a) providing:

i) a cleavage structure comprising a Diana sequence and oligonucleotides capable of forming an invasive cleavage structure in the presence of said target sequence; and ii) a purified FEN-1 endonuclease from Archaeaglobus veneficus, wherein said FEN-1 endonuclease comprises an amino acid sequence comprising SEQ ID No. 370; Y b) exposing said cleavage structure to said FEN-1 endonuclease; Y c) detecting the cleavage of said cleavage structure.

31.

The method of claim 30, wherein said target sequence comprises a first region and a second region, said second region downstream and contiguous to said first region, and wherein said oligonucleotides comprise the first and second oligonucleotides, wherein said at least a portion of said first oligonucleotide is completely complementary to said first portion of said target sequence and wherein said second oligonucleotide comprises a 3 'portion and a 5' portion, wherein said 5 'portion is completely complementary to said second portion of said target nucleic acid.

32

The method of claim 31, wherein said 3 ′ portion of said second oligonucleotide comprises a 3 ′ terminal nucleotide not complementary to said target nucleic acid.

33.

The method of claim 31, wherein said 3 ′ portion of said second oligonucleotide consists of a single nucleotide not complementary to said target nucleic acid.

3. 4.

The method of claim 31, wherein said first oligonucleotide is attached to a solid support.

35

The method of claim 31, wherein said second oligonucleotide is attached to a solid support.

36.

The method of claim 30, wherein exposing said cleavage structure to said FEN-1 endonuclease comprises exposing in the presence of a buffer solution comprising a source of divalent cations.

554

37.

The method of claim 36, wherein said divalent cation comprises Mn2 +.

38.

The method of claim 36, wherein said divalent cation comprises Mg2 +.

39.

The method of claim 31, further comprising a third oligonucleotide complementary to a third portion of said target nucleic acid upstream of the first portion of said target nucleic acid.