ES2378203A1 - Method for obtaining the genetic profile of an individual. (Machine-translation by Google Translate, not legally binding) - Google Patents

Abstract

The invention relates to a method for obtaining the genetic profile of an individual, for determining kinship relationships between individuals or for identifying human remains comprising the analysis of str loci in a dna extract of said individual by means of a multiplex amplification reaction using a set of pairs of primers specially designed for that purpose. Thus, the invention also relates to said set of primer pairs, the kit comprising them and the uses of said primers. (Machine-translation by Google Translate, not legally binding)

Description

METHOD FOR OBTAINING THE GENETIC PROFILE OF AN INDIVIDUAL

FIELD OF THE INVENTION

The invention relates to a method to obtain the genetic profile of an individual, to determine kinship relationships between individuals or to identify human remains comprising the analysis of STRs loci in a DNA extract of said individual by at least one reaction. of multiplex amplification. This method is applicable in the identification of individuals in the area of forensic genetics, as well as in population genetics, anthropology and biomedicine.

BACKGROUND OF THE INVENTION

Except for monozygotic twins, there are no two people whose nuclear genetic material (DNA) is identical. Certain regions of DNA known as STRs (Short Tandem Repeats) are characterized by their high variability among individuals and over the last two decades, they have been the material of choice for obtaining genetic profiles, which can be used both in the identification of people as in the determination of kinship relationships between individuals. In the same way, STRs are used in the elaboration of databases of genetic profiles in countries around the world, such as the CODIS database (Combined DNA Index System), which includes the STRs loci CSF1PO, FGA , TH01, TPOX, VWA, D3S1358, D5S818, D7S820, D8S1179, D13S317, D16S539, D18S51 and D21S11, also included in the United States national database for the search of DNA profiles during the investigation of criminal offenses. On the other hand, the European database and the United Kingdom database include some of the CODIS STR loci, such as FGA, TH01, VWA, D3S1358, D8S1179, D16S539, D18S51, D21S11 and the amelogenin sex locus ( AMEL), in addition to the locus STRs D2S1338.

There are currently numerous companies that sell kits for the elaboration of genetic profiles. Applied Biosystems® markets AmpFlSTR® Identifiler® PCR amplification kit (2004, Applied Biosystems®, Foster City, CA) and Promega manufactures PowerPlexTM 16 (2004, Promega® Corporation, USA). Through these kits, a probability of coincidence between the genetic profiles of two individuals of about one in a trillion can be achieved, after the analysis of 15 STRs regions. Both kits include the 13 CODIS loci; in the case of Identifiler® it also includes the autosomal loci D2S1338 and D19433, and PowerplexTM 16 includes the autosomal loci Penta E and Penta D.

Recently, the AmpFlSTR® NGMTM Amplification Kit (Applied Biosystems, Foster City, CA), PowerPlex® ES X and PowerPlex® ES Y (Promega® Corporation, USA) commercial kits have been developed to analyze some of the recommended loci for inclusion in the national databases.

One of the main drawbacks of these and other current analysis kits is their lack of ability to provide genetic profiles that include all of the loci currently collected in CODIS from highly degraded DNA extracts, which decreases their performance in as for comparison of the results obtained with the millions of genetic profiles available in this database. The degradation of DNA is characterized by a general fragmentation of the genetic material, where the DNA fragments can be around 240 bp while these kits need at least fragments of about 450 bp for the analysis of all the STRs loci they include. Highly degraded DNA is a characteristic of most samples that are analyzed in criminal genetic laboratories. In these cases there is the absence of results or even obtaining erroneous results, with the serious judicial and / or personal repercussions that this may entail.

In order to obtain genetic profiles of samples whose DNA is highly degraded, numerous efforts have been made to develop reactions that allow obtaining sufficiently discriminative genetic profiles in highly degraded DNA extracts, (Lygo et al., 1994 Int. J. Legal Med. 107: 77-89; Whitaker et al., 1995, BioTechniques 18 (4): 670-677).

Schilz, F. et al. 2004 (Anthrop. Anz., 4: 369-378) described a multiplex PCR reaction capable of simultaneously amplifying fragments of short length of 16 STRs loci and the amelogenin locus (from 84bp to 275bp). However, in this multiplex reaction, only alleles present in at least 1% of the caucasoides were considered, so their use may result in an erroneous genetic profile in 16% of the cases in which the analyzed biological sample comes from an individual of caucasoid origin, error that can even be increased in the analysis of individuals of other ethnic origins.

Okamoto, O. et al. 2003 (Acta Medica Okayama, 57 (2): 59-71) describes the use of the PowerPlex ™ 16 System commercial kit to estimate the genotypic and phenotypic frequencies of 15 STRs loci in the Japanese population.

In 2003, John Butler et al., Published the development of multiplex reactions that analyze between 3 and 6 STRs loci by amplifying small fragments, for application in degraded DNA extracts (Butler et al., J. Forensic Sci 48 (5): 1054-1064). In 2006 Applied Biosystems began marketing AmpFlSTR® MiniFiler ™ (Mulero et al., J Forensic Sci. 2008 Jul; 53 (4): 838-52, Luce et al., 2009. J Forensic Sci.Sep; 54 (5) : 1046-54), whereby results can be obtained with small sized DNA fragments. On the other hand, the genetic profile provided by AmpFlSTR®MiniFiler ™ consists of only 8 STR loci plus amelogenin, so although it has the advantage of making it possible to obtain results in degraded DNA samples that other kits do not allow, their results are insufficient for the determination of the majority of kinship relationships that are common in the identification of remains of missing persons or in cases of serious accidents or catastrophes.

In this context, numerous patent applications have arisen, related to obtaining genetic profiles through the simultaneous analysis of several STR loci, which describe new methods of obtaining increasingly discriminative genetic profiles based on the analysis of new STRs in addition to including some of the STR loci analyzed today, or methodologies capable of reporting results in the analysis of highly degraded DNA extracts.

US6090558 patent application describes the use of mass spectrometry to detect length variation in nucleotide sequence repeats, such as microsatellites and short tandem repeats, and DNA primers for the analysis of polymorphisms in tandem nucleotide repeats. in specific loci.

Both patent application US6479235 and patent ES2273367 describe the detection of genetic loci, more specifically, the simultaneous amplification of multiple different polymorphic genetic loci using the polymerase chain reaction or other amplification systems to determine in a reaction the alleles of Each locus contained within the multiplex system. The amplified genetic loci comprising HUMvWFA31, HUMLIPOL, HUMBFXIII, HUMF13A01, HUMFESFPS, HUMTH01, HUMTPOX, HUMCSF1PO, D22S683, D20S481, D19S253, D17S1299, D17S1298, D16S753, D16S539, D16S490, D14S562, D14S548, D14S118, D13S317, D10S1239, D9S930, D7S820 , D5S818, D4S2368, D3S1539. Although it analyzes a high number of STRs loci, it includes only 8 of the 13 loci object of the CODIS, and 3 of the 10 loci included in the European database, which decreases its performance in comparison to the results obtained with the millions of genetic profiles available in existing databases.

Patent application US6479235 describes methods and materials for the simultaneous amplification of at least 13 STRs of the CODIS in a simple multiplex reaction whose amplification sizes exceed 360 bp.

Patent application US2003 / 0186272 describes a rapid method for determining the length of fragments of alleles present in a plurality of loci in a sample containing DNA comprising (a) obtaining a sample containing DNA, b) amplifying by PCR multiplex a plurality of loci comprising FGA, vWA, TH01, TPOX, CSF1PO, D3S1358, D5S818, D7S820, D8S1179, D13S317, D16S539, D18S51 and D21S11, wherein said multiplex PCR reaction is carried out using a plurality of primer pairs, where at least one primer of each pair of primers is labeled with a detectable label, and the amplification produces a mixture of labeled amplicons, and (c) electrophoresis analyzing said mixture of amplicons loci, where said analysis step allows the determination of the length of the allele fragments in said plurality of loci of the sample containing DNA.

Currently obtaining genetic profiles through the analysis of STRs loci raises the technical problem of the low success of most reactions in the analysis of degraded DNA and the limited discriminating power of the reactions specifically designed for this type of samples, in special in the achievement of genetic profiles that include all the loci collected in the CODIS. Likewise, the limited amount of DNA present in highly degraded samples makes it difficult to carry out different multiplex reactions on the same sample or to make replicas that offer greater reliability of the results obtained, so it is vital to use reactions or combinations of reactions that allow obtaining genetic profiles composed of a large number of STRs loci, such as those contained in the main databases and through methods that guarantee high reliability of the genetic profiles obtained from highly degraded DNA extracts.

Therefore, there is a need in the state of the art to develop methods for obtaining genetic profiles, alternative to those already existing, that overcome the aforementioned drawbacks and that allow obtaining reliable genetic profiles even from highly degraded DNA extracts.

SUMMARY OF THE INVENTION

Obtaining reliable genetic profiles from highly degraded DNA extracts is difficult to achieve through the use of methods currently existing in the state of the art. However, the authors of the present invention have designed a set of primer pairs thanks to which they have developed a multiplex amplification reaction that allows, surprisingly, to obtain reliable genetic profiles, and even from highly degraded DNA extracts, thus overcoming the disadvantages of the rest of the methods of the prior art when obtaining said genetic profiles.

As shown in Example 1 of the present description, the design of the set of primer pairs of the invention was carried out by searching the flanking sequences at each STR locus and subsequently using the Perlprimer program (http: // perlprimer. sourceforge.net/). Once the primer pairs were obtained, an amplification reaction was carried out on a DNA extract using said primer pairs after which, the genetic profile of the individual to whom the DNA extract belonged was obtained with reliability, precision and Discrimination capacity superior to the genetic profiles obtained by other methods.

Thus, in a first aspect, the invention relates to a method for obtaining the genetic profile of an individual, to determine kinship relationships between individuals.

or to identify human moieties comprising the analysis of STRs loci in a DNA extract from said individual or said human moieties by at least one multiplex amplification reaction, wherein the primer pairs of said multiplex amplification reaction comprise the oligonucleotide pairs SEQ ID NO: 1 and SEQ ID NO: 2 (CSF1PO), SEQ ID NO: 3 and SEQ ID NO: 4 (FGA), SEQ ID NO: 5 and SEQ ID NO: 6 (TPOX), SEQ ID NO: 7 and SEQ ID NO: 8 (D18S51), SEQ ID NO: 9 and SEQ ID NO: 10 (VWA), SEQ ID NO: 11 and SEQ ID NO: 12 (TH01), SEQ ID NO: 13 and SEQ ID NO: 14 (D21S11), SEQ ID NO: 15 and SEQ ID NO: 16 (D7S820), SEQ ID NO: 17 and SEQ ID NO: 18 (D2S1338), SEQ ID NO: 19 and SEQ ID NO: 20 ( D13S317), SEQ ID NO: 21 and SEQ ID NO: 22 (Amelogenin), and SEQ ID NO: 23 and SEQ ID NO: 24 (D5S818).

In another aspect, the invention relates to a kit comprising primer pairs comprising oligonucleotide pairs SEQ ID NO: 1 and SEQ ID NO: 2 (CSF1PO), SEQ ID NO: 3 and SEQ ID NO: 4 ( FGA), SEQ ID NO: 5 and SEQ ID NO: 6 (TPOX), SEQ ID NO: 7 and SEQ ID NO: 8 (D18S51), SEQ ID NO: 9 and SEQ ID NO: 10 (VWA), SEQ ID NO: 11 and SEQ ID NO: 12 (TH01), SEQ ID NO: 13 and SEQ ID NO: 14 (D21S11), SEQ ID NO: 15 and SEQ ID NO: 16 (D7S820), SEQ ID NO: 17 and SEQ ID NO: 18 (D2S1338), SEQ ID NO: 19 and SEQ ID NO: 20 (D13S317), SEQ ID NO: 21 and SEQ ID NO: 22 (Amelogenin), and SEQ ID NO: 23 and SEQ ID NO: 24 (D5S818).

In another aspect, the invention relates to the use of a kit according to the present invention to obtain the genetic profile of an individual, to determine kinship relationships between individuals or to identify human remains.

In another aspect, the invention relates to a set of primer pairs comprising the following oligonucleotide pairs SEQ ID NO: 1 and SEQ ID NO: 2 (CSF1PO), SEQ ID NO: 3 and SEQ ID NO: 4 (FGA ), SEQ ID NO: 5 and SEQ ID NO: 6 (TPOX), SEQ ID NO: 7 and SEQ ID NO: 8 (D18S51), SEQ ID NO: 9 and SEQ ID NO: 10 (VWA), SEQ ID NO : 11 and SEQ ID NO: 12 (TH01), SEQ ID NO: 13 and SEQ ID NO: 14 (D21S11), SEQ ID NO: 15 and SEQ ID NO: 16 (D7S820), SEQ ID NO: 17 and SEQ ID NO: 18 (D2S1338), SEQ ID NO: 19 and SEQ ID NO: 20 (D13S317), SEQ ID NO: 21 and SEQ ID NO: 22 (Amelogenin), and SEQ ID NO: 23 and SEQ ID NO: 24 ( D5S818).

In another aspect, the invention relates to a pair of primers selected from oligonucleotide pairs consisting of SEQ ID NO: 1 and SEQ ID NO: 2 (CSF1PO), SEQ ID NO: 3 and SEQ ID NO: 4 ( FGA), SEQ ID NO: 5 and SEQ ID NO: 6 (TPOX), SEQ ID NO: 7 and SEQ ID NO: 8 (D18S51), SEQ ID NO: 9 and SEQ ID NO: 10 (VWA), SEQ ID NO: 11 and SEQ ID NO: 12 (TH01), SEQ ID NO: 13 and SEQ ID NO: 14 (D21S11), SEQ ID NO: 15 and SEQ ID NO: 16 (D7S820), SEQ ID NO: 17 and SEQ ID NO: 18 (D2S1338), SEQ ID NO: 19 and SEQ ID NO: 20 (D13S317), SEQ ID NO: 21 and SEQ ID NO: 22 (Amelogenin), SEQ ID NO: 23 and SEQ ID NO: 24 ( D5S818), SEQ ID NO: 25 and SEQ ID NO: 26 (CSF1PO), SEQ ID NO: 27 and SEQ ID NO: 28 (D5S818), SEQ ID NO: 15 and SEQ ID NO: 29 (D7S820), SEQ ID NO: 30 and SEQ ID NO: 31 (D21S11), SEQ ID NO: 32 and SEQ ID NO: 33 (VWA), SEQ ID NO: 34 and SEQ ID NO: 35 (D8S1179), SEQ ID NO: 36 and SEQ ID NO: 37 (D19S433), SEQ ID NO: 38 and SEQ ID NO: 39 (D16S539), SEQ ID NO: 40 and SEQ ID NO: 41 (D3S1358), SEQ ID NO: 42 and SEQ ID NO: 43 (D18S51), SEQ ID NO: 44 and SEQ ID NO: 45 (D13S317), SEQ ID NO: 46 and SEQ ID NO: 22 (Amelogenin), and SEQ ID NO: 3 and SEQ ID NO: 47 (FGA) .

The use, both of the set of primers and of the primers of the invention to obtain the genetic profile of an individual, to determine kinship relationships between individuals or to identify human remains, constitute additional aspects of the present invention.

DESCRIPTION OF THE FIGURES

Figure 1 corresponds to a graph called electropherogram showing the genetic profile of an individual for the STRs analyzed by the first set of primer pairs of the invention using an automatic AB3130 Genetic Analyzer (Applied Biosystems®) sequence analyzer. In the Figure 4 panels can be observed, each corresponding to those pairs of primers marked with the same fluorescent locus. Each panel shows the intensity of the signal detected in the Relative Fluorescence Units (RFU, relative fluorescence unit) on the Y axis; The X axis corresponds to the size in base pairs. Thus, the first panel corresponds to the results obtained for the products of STRs amplified with primers marked with 6-FAMTM (directed to the CSF1PO and FGA loci), the second panel to those marked with VICTM (loci TH01, D21S11 and D7S820), the third one to NEDTM (TPOX loci, D18S51 and VWA) and the fourth panel shows the results for the STR loci labeled with the PET® fluorochrome (D2S1338, D13S317, amelogenin, and D5S818). The bars at the top of each panel correspond to the name of the loci. The rectangles located under the electropherogram peaks show the name of the allele, indicated by a number, its size in base pairs and the signal strength in RFUs.

Figure 2 corresponds to a graph called electropherogram showing the genetic profile of an individual for the STRs analyzed by the second set of primers of the invention using an automatic AB3130 Genetic Analyzer (Applied Biosystems®) sequence analyzer. In the Figure 4 panels can be observed, each corresponding to those pairs of primers marked with the same fluorescent locus. Each panel shows the intensity of the signal detected in the Relative Fluorescence Units (RFU, relative fluorescence unit) on the Y axis; The X axis corresponds to the size in base pairs. Thus, the first panel corresponds to the results obtained for the products of STRs amplified with primers marked with 6-FAMTM (directed to the loci CSF1PO, D5S818, D7S820 and D21S11), the second panel to those marked with VICTM (loci TH01, D16S539 , D3S1358 and D18S51), the third to NEDTM (TPOX loci, VWA, D8S1179 and D19S433) and the results for the STRs loci labeled with the PET® fluorochrome (D13S317, amelogenin and FGA) are shown in the fourth panel. The bars at the top of each panel correspond to the name of the loci. The rectangles located under the electropherogram peaks show the name of the allele, indicated by a number, its size in base pairs and the signal strength in RFUs.

Figure 3 is a graphical representation showing the comparison of the first set of primer pairs (called I-DNA2) [Panel A] and the design of the second set of primer pairs (called I-DNA-1) [Panel B]. The boxes represent the amplified sizes for each locus. Loci marked with different color are presented in different gray scales. The respective markings are indicated on the right side of the Figure.

DETAILED DESCRIPTION OF THE INVENTION

The authors of the present invention have designed a set of primer pairs thanks to which they have developed a multiplex amplification reaction that allows obtaining genetic profiles with a high discrimination power from highly degraded DNA extracts, thus overcoming the inconveniences they present. the rest of the prior art methods to obtain said genetic profiles

The primer pairs of the invention have been designed in such a way that it is possible to obtain the simultaneous analysis of 11 STRs (Short Tandem Repeats) loci plus the amelogenin locus for sex determination, when a DNA extract is subjected to a reaction of multiplex amplification using said primer pairs, and even from highly degraded DNA extracts, wherein the size of the extracted fragments does not exceed 230 bp. Additionally, the inventors have designed a second set of primer pairs that used in another amplification reaction on the same DNA extract, provide on the one hand the confirmation of the genetic profile obtained with the first set of primer pairs, since it comprises targeted primers to the same STRs loci of the first set of primers, and on the other extend the genetic profile to 15 STRs loci plus the amelogenin locus. These two characteristics allow obtaining a genetic profile with a high discrimination power. In addition, by combining both sets of primer pairs, 10 loci are analyzed in duplicate: (i) 8 of which are genotyped with different primer pairs, thus reducing allelic losses caused when a particular primer does not bind to the target DNA sequence due to some polymorphism; (ii) and the remaining two with identical primers, which provides additional internal control, since the genotypes of both loci must be identical in each of the reactions. It should be mentioned that both sets of primer pairs also present primers aimed at identifying the amelogenin locus for sex determination.

Thus, based on these sets of primer pairs, the various inventive aspects that are part of the present invention and which will be described in detail below have been developed. Prior to the description of said inventive aspects, a list of definitions is included explaining the meaning of the terms used in the context of the present invention to aid in the understanding thereof.

Definitions

"One" / "one"

The use of the word "a" or "a" when used in conjunction with the term "understand" or "comprises" in the claims and / or the description may mean "one," but is also consistent with the meaning of "one. or more ”,“ at least one ”and“ one or more than one ”.

Genetic Profile

In the context of the present invention, the terms "genetic profile" and "genetic fingerprint" have the same meaning, so they can be used interchangeably throughout the description. The "genetic profile" is a set of sequences of characteristic bases of the genetic material that allow differentiating an individual from another.

STR loci

In the present invention, the genetic profile is obtained from the analysis of sequences of short bases repeated in tandem or STRs (of the English Short Tandem Repeats) that are characterized by their high variability among individuals. Thus, "STRs sequences" or "STRs loci" means those DNA sequences, also called microsatellites, that contain 4 bp repeats (Butler JM, Biotechniques. 2007 Oct; 43 (4): ii-v .).

The analysis of the STRs loci in the genome presents multiple applications that include, but are not limited to, obtaining genetic profiles, kinship diagnoses, determining the origin of a sample or tissue, identification of cadavers, population genetics studies, tests of zygosity in twins, monitoring of bone marrow transplants, evaluation of the traceability of biological samples of human origin, identification of mixtures present in a sample and determination of the number of contributors of human origin to a mixture and their contribution relative to the mixture.

PCR

PCR corresponds to the polymerase chain reaction acronym whereby millions of copies of the desired DNA regions can be obtained. It is characterized by the use of pairs of primers that delimit the region from which millions of copies will be made, which is also known as "amplifying DNA" during PCR. The PCR is composed of a certain number of cycles, in turn composed of three phases in which the DNA strands are separated, the primers are joined and the new DNA strands are elongated. In each cycle, if the reaction efficiency is 100%, exponential growth of the DNA fragments subject to amplification occurs.

Multiplex amplification reaction

In the present invention, "multiplex amplification reaction" is understood as the PCR reaction in which more than one DNA sequence is amplified in the same reaction, by using two or more pairs of primers in a single tube together with the rest. of the reaction reagents in order to simultaneously amplify multiple DNA sequences.

Oligonucleotide

The term "oligonucleotide" refers to the sequence of nucleotide bases linked by phospho-diester bonds, usually not greater than 50 nucleotides.

Primer

In the present invention, "primer" or "first" or "oligonucleotide" ("oligo") is understood as the nucleotide sequence from which DNA polymerase initiates the synthesis of a new DNA molecule. The primers are short nucleotide sequences, approximately 15-24 nucleotides in length that can be aligned with a strand of target DNA thanks to the complementarity of bases to form a hybrid between the primer and the target strand of DNA. Then, the DNA polymerase enzyme can extend the primer along the DNA strand. Methods for preparing and using primers are described, for example in Sambrook et al. (2001) and Ausubel et al. (1999).

Pair of primers

In the context of the present invention, "primer pair" or "first pair" is understood as the set of two primers which, when used in the same amplification or PCR reaction, allow multiple copies of a DNA target sequence to be obtained. Each of the primers hybridizes with the target sequence, so that the bounded nucleotide sequence is amplified by each pair of primers. The extent of the primers during the PCR cycles determines the 2N exponential multiplication of the nucleotide sequence bounded by the primers, N being the number of cycles of the PCR reaction.

Biological sample

In the context of the present invention, "biological sample" means any matter that contains DNA.

DNA Extract

In the context of the present invention, "DNA extract" is understood when, after subjecting the biological sample to a method of extraction, separation, purification or cloning of DNA, among others, it is obtained as a result either dry, in solution, bound or not to other molecules, adhered or not to various substances or beds, matter in which the DNA is in a greater relative proportion with respect to the rest of the molecules present, compared to the biological starting sample.

Thus "DNA extract" refers to DNA extracted from any biological sample that contains human DNA, whether from a living or dead individual, fetus, organs, tissues or cells.

In the context of the present invention, "highly degraded DNA" is understood to be DNA whose fragments are small in size, preferably smaller than 300 bp, 290 bp, 280 bp, 270 bp, 260 bp, 250 bp, 240 bp, 230 bp, 220 bp, 210 bp or 200 bp.

Individual

The term "individual" refers to a human being of any age or race, who in the context of the present invention may be alive or dead.

Primers of the invention

The inventors have designed a set of primer pairs, hereafter, "first set of primer pairs of the invention" or "I-DNA2", which allows obtaining the genetic profile of an individual from highly extracted DNA extracts degraded The primer pairs have been designed so that when used together in a multiplex amplification reaction it is possible to obtain the simultaneous analysis of 11 STR loci plus the amelogenin locus that determines sex. The STR loci analyzed in the present invention as well as the primer pairs designed for identification are shown in Table 1 (next page). The procedure followed in the design of the first set of primer pairs of the invention is detailed in Example 1.

Table 1. Summary of the sequences of the primers in the 5´a to 3´ direction designed for the amplification of each STR locus. It also details the minor to major allele of the STR that will be considered by this analysis (column: alleles) as well as the maximum and minimum possible amplification size for each STR.

LOCUS

ALELOS Amplified size (bp) SEQ ID NO: SEQUENCE (5-3´)

CSF1PO

5 88-132 one GAAGATATTAACAGTAACTGCCTT

16

2 ACCCTGTTCTAAGTACTTCC

FGA

12 140-298 3 CTCACAGATTAAACTGTAACCA

51.2

4 GTGATTTGTCTGTAATTGCCA

TPOX

4 53-101 5 CTTAGGGAACCCTCACTG

16

6 GCAGCGTTTATTTGCCCAA

D18S51

7 109-196 7 CTTAGGGAACCCTCACTG

28.3

 8 GTACAATAACAGTTGCTACTATTTCT

VWA

10 204-264 9 ACTCCTCAGACTGATCCTATA

25

10 AGATGATAAATACATAGGATGGATG

TH01

3 49-93 eleven AACACAGACTCCATGGTG

14

12 GTTCCTCCCTTATTTCCCT

D21S11

12 94-212 13 CCCAAGTGAATTGCCTTC

41.2

14 ATAGGAGGTAGATAGACTGGA

D7S820

5 220-260 fifteen GAATTATAACGATTCCACATTTATCC

fifteen

16 GTTGGTCAGGCTGACTATG

D2S1338

eleven 88-156 17 GGAAACAGAAATGGCTTGG

28

18 GTAAGTTAAAGGATTGCAGGAG

D13S317

5 164-212 19 GTTCATTTCTTTAGTGGGCA

17

twenty GTCCTTCAACTTGGGTTGAG

Amelogenin

X 220-226 twenty-one AAAGCTACCACCTCATCCT

Y

22 GGCTTGAGGCCAACCAT

D5S818

6 234-282 2. 3 TAGCAAGTATGTGACAAGGG

18

24 GTCAGATGCTAATAGGCTGTT

Thus, in one aspect, the invention relates to a set of primer pairs comprising the following oligonucleotide pairs SEQ ID NO: 1 and SEQ ID NO: 2 10 (CSF1PO), SEQ ID NO: 3 and SEQ ID NO: 4 (FGA), SEQ ID NO: 5 and SEQ ID NO: 6 (TPOX), SEQ ID NO: 7 and SEQ ID NO: 8 (D18S51), SEQ ID NO: 9 and SEQ ID NO: 10 (VWA), SEQ ID NO: 11 and SEQ ID NO: 12 (TH01), SEQ ID NO: 13 and SEQ ID NO: 14 (D21S11), SEQ ID NO: 15 and SEQ ID NO: 16 (D7S820), SEQ ID NO: 17 and SEQ ID NO: 18 (D2S1338), SEQ ID NO: 19 and SEQ ID NO: 20 (D13S317), SEQ ID NO: 21 and SEQ ID

15 NO: 22 (Amelogenin), and SEQ ID NO: 23 and SEQ ID NO: 24 (D5S818).

On the other hand, the authors of the present invention have designed a second set of primer pairs, hereafter, "second set of primer pairs of the

invention "or" I-DNA1 ", characterized in that it comprises at least one pair of primers characterized in that:

-

 amplifies one of the locus amplified by the first set of primer pairs of the invention and

5 - one of the primers of the couple has a nucleotide sequence different from the nucleotide sequence of the couple of primers that amplifies the same locus in the first set of primers.

The second set of primer pairs of the invention allows obtaining the genetic profile 10 of 14 STR loci plus the amelogenin locus. The second primer primers, as well as the STRs loci that it amplifies, are listed in Table 2 (next page).

An additional value of the present invention is that by performing two amplification reactions on the same DNA extract, that is, dividing a single DNA extract

In two aliquots and on each aliquot, carrying out an amplification reaction using, respectively, I-DNA2 and I-DNA1, firstly, confirmation of the genetic profile obtained with the first set of primer pairs (I-DNA2) is achieved. ) and secondly, the genetic profile obtained from 11 and 14 STRs respectively is extended to 15 STRs plus amelogenin.

Table 2: Summary of the sequence of primers in the 5´a to 3´ direction designed for the amplification of each STR in the combination called I-DNA1 (column: sequence 5´3´). This same table details the minor to major allele of the STR that will be considered by this analysis (column: alleles) as well as the maximum and minimum possible size for each STR.

LOCUS

ALELOS Size of the amplified (bp) SEQ ID NO: SEQUENCE (5-3´)

CSF1PO

6 71-115 25 ACTGCCTTCATAGATAGAAGAT

fifteen

26 GCCCTGTTCTAAGTACTTCCT

D5S818

7 123-171 27 TTAATAGCAAGTATGTGACAAGG

17

28 GACATTTGTATCTTTATCTGTATCCTT

D7S820

6 179-219 fifteen GAATTATAACGATTCCACATTTATCC

fifteen

29 ATAAAGGGTATGATAGAACACTTG

D21S11

24 227-297 30 CCCTGATTCTTCAGCTTGTA

38

31 GCAGAGACAGACTAATAGGAGG

TPOX

6 53-101 5 CTTAGGGAACCCTCACTG

16

6 GCAGCGTTTATTTGCCCAA

VWA

eleven 109-169 32 TCAGTATGTGACTTGGATTGA

24

33 GTAGGTTAGATAGAGATAGGACAGA

D8S1179

8 177-229 3. 4 TTGTATTTCATGTGTACATTCGT

twenty

35 TTGTGTTCATGAGTATAGTTTCAC

D19S433

5.2 237-295 36 CATGTTGGCACATTCCTG

18.2

37 AGTTCTTTAGCAGTGATTTCTG

TH01

5 49-93 eleven AACACAGACTCCATGGTG

14

12 GTTCCTCCCTTATTTCCCT

D16S539

5 101-149 38 CCTCTTCCCTAGATCAATACA

16

39 ATCTGTAAGCATGTATCTATCATC

D3S1358

9 157-205 40 TGTAGTGAGCTATGATTCCC

twenty

41 GTATTCCCTGTGCCTTTG

D18S51

7 213-300 42 GTCTCAGCTACTTGCAGG

27

43 GGAGATGTCTTACAATAACAGTTG

D13S317

5 72-120 44 CGCCTATCTGTATTTACAAATACAT

17

Four. Five GGACAGAAAGATAGATAGATGATTGAT

Amelogenin

X 121-127 46 CCCTGGGCTCTGTAAAGA

Y

22 GGGCTTGAGGCCAACCAT

FGA

16 135-293 3 CTCACAGATTAAACTGTAACCA

51.2

47 TTGTCTGTAATTGCCAGC

Use of the primers of the invention

The different uses that the primers of the invention have, constitute additional inventive aspects of the present invention.

Thus, the uses of the first set of primer pairs of the invention include, but are not limited to, obtaining genetic profiles, kinship diagnoses, determining the origin of a sample or tissue, identification of cadavers, population genetics studies, tests. of zygosity in twins, monitoring of bone marrow transplants, evaluation of the traceability of biological samples of human origin, identification of mixtures present in a sample and determination of the number of contributors of human origin to a mixture and their contribution relative to the mixture.

In another aspect, the invention relates to the use of the first set of primer pairs of the invention (Table 1) to obtain the genetic profile of an individual, to determine kinship relationships between individuals or to identify human remains.

Invention Method

As explained above, by an amplification reaction using the first set of primer pairs of the invention (Table 1) it is possible to carry out the simultaneous analysis of 11 STRs loci plus the amelogenin locus in a highly degraded DNA extract to obtain a genetic profile of an individual.

Thus, in a first aspect, the invention relates to a method, hereafter "method of the invention", to obtain the genetic profile of an individual, to determine kinship relationships between individuals or to identify human remains comprising the analysis of STRs loci in a DNA extract from said individual or said human residues by at least one multiplex amplification reaction, wherein the primer pairs of said multiplex amplification reaction comprise the oligonucleotide pairs SEQ ID NO: 1 and SEQ ID NO: 2 (CSF1PO), SEQ ID NO: 3 and SEQ ID NO: 4 (FGA), SEQ ID NO: 5 and SEQ ID NO: 6 (TPOX), SEQ ID NO: 7 and SEQ ID NO: 8 (D18S51), SEQ ID NO: 9 and SEQ ID NO: 10 (VWA), SEQ ID NO: 11 and SEQ ID NO: 12 (TH01), SEQ ID NO: 13 and SEQ ID NO: 14 (D21S11), SEQ ID NO: 15 and SEQ ID NO: 16 (D7S820), SEQ ID NO: 17 and SEQ ID NO: 18 (D2S1338), SEQ ID NO: 19 and SEQ ID NO: 20 (D13S317), SEQ ID NO: 21 and SEQ ID NO: 22 (Amelogenin), and SEQ ID NO: 23 and SEQ ID NO: 24 (D5S818).

The implementation of the method of the invention requires obtaining a DNA extract that will ultimately come from a biological sample that will be adequately treated to obtain said DNA extract.

As the person skilled in the art understands, if the method of the invention is directed to obtain the genetic profile of an individual or the relationship between individuals, the DNA extract will come from the individual whose genetic profile is to be obtained, or from the individuals whose kinship relationship wants to be determined. However, if the method of the invention is directed to the identification of human remains, the DNA extract will come from the human remains that are to be identified. In the present invention, the term "human remains" includes any biological sample from a dead or living human being, said human residue may be preserved in formol, frozen, dried, fixed in paraffin, in a state of decomposition, degradation and / or rot, among others.

Examples of biological samples from which DNA can be obtained include, but is not limited to, biological fluids (blood, saliva, urine, sperm, etc.); epidermis, dandruff, hair, feces, a vaginal sample, a tissue sample, burned tissues, etc. The biological samples most suitable for obtaining DNA extracts useful in the identification of human remains include, among others, hairs with roots, compact bones, teeth, soft tissues and blood.

In a particular embodiment, the DNA extract comes from a sample of blood, hair, saliva, epidermis, sperm, dandruff, a vaginal sample and a tissue sample,

Obtaining the biological sample must be done under the conditions and with the appropriate material, such as swabs, tweezers, etc. and each sample must be stored independently in separate and sterile plastic jars or bags, without any preservative, in freezing and properly labeled, avoiding contamination by foreign biological material.

Once the sample of the individual (s) or of the human rest has been obtained, it must be processed to obtain the DNA extract. The fraction of DNA suitable for the implementation of the method of the invention is nuclear DNA. DNA extraction can be carried out using any method known to those skilled in the art (Sambrock et al., 2001. "Molecular cloning: a Laboratory Manual", 3rd ed., Cold Spring Harbor Laboratory Press, NY, Vol. 1-3) including, but not limited to, density gradient centrifugations, two-phase extraction using aqueous phenol or chloroform with ethanol, column chromatography, methods based on the ability of DNA to bind on glass surfaces and / or silicates , such as diatomaceous earth preparations or glass beds, using commercial kits, for example, "Q-Biogene fast DNA kit" or "QIAamp (R) DNA Blood Mini Kit" (Qiagen, Hilden, Germany) "G -Spin IIp ”(Intron Biotechnology, Korea) or the“ Fast Prep System Bio 101 ”(Qbiogene, Madrid, Spain) or the methods described in patent applications US5,057,426, US4,923,978 and European patent application EP0512767A1.

The DNA extract is quantified and normalized to obtain equal amounts of DNA in each sample in case the amount of DNA is sufficient for it. In the case of highly degraded samples with poor and / or degraded DNA, it is usual to add as much DNA as possible in the subsequent multiplex PCR reaction.

After obtaining the DNA extract from the biological sample, it is subjected, at least, to a multiplex amplification reaction using the first set of primer pairs of the invention. The amplification of the different STRs loci requires specific reaction conditions and procedures for each of the pairs of primers used, which can be achieved by systematic variation of each parameter. The number of cycles and the alignment temperature used in the PCR reaction must be suitable for obtaining reliable results by using each of the primer pairs of the first set of primers of the invention. Parameters such as the concentration of primers are specific to each primer and have been adjusted in the validation of the primer set. The primers offer results in a wide range of concentrations, although the optimal concentrations for each pair of primers are shown in Table 3 (next page).

Table 3. Summary of the concentrations at which each of the primers is used and the fluorochrome with which the 5'end of the direct or forward primer (numbers in bold) of each pair of primers in the set called I has been marked -DNA2.

LOCUS

SEQ ID NO: Interval Concentration of primers (μM) Optimum concentration of deprecators (μM) Fluorescent marking

CSF1PO

one 0.12-0.03 0.06 6-FAM

2

FGA

3 0.14-0.03 0.08

4

TPOX

5 0.16-0.04 0.10 NED

6

D18S51

7 0.36-0.24 0.30

8

VWA

9 2.4-0.12 0.18

10

TH01

eleven 0.11-0.03 0.05 VIC

12

D21S11

13 0.17-0.03 0.11

14

D7S820

fifteen 0.20-0.08 0.14

16

D2S1338

17 0.21-0.09 0.15 PET

18

D13S317

19 0.21-0.09 0.15

twenty

Amelogenin

twenty-one 0.17-0.03 0.11

22

D5S818

2. 3 0.14-0.03 0.08

24

As indicated at the beginning of the present description, the method of the invention comprises the analysis of STRs loci in a DNA extract by means of a multiplex amplification reaction which, additionally, can comprise a second amplification reaction of said extract of DNA Thus, in a particular embodiment of the method of the invention, STRs loci analysis further comprises a second multiplex amplification reaction of the DNA extract from said individual or said human remains, wherein the primer pairs of said second multiplex amplification reaction comprises at least one pair of primers characterized in that: - it amplifies one of the amplified locus in the first amplification reaction multiplex 15 and

-

one of the couple's primers has a different nucleotide sequence

of the nucleotide sequence of the primer pair than in the first

Multiplex amplification reaction amplifies the same locus.

As previously indicated, with two amplification reactions on the same DNA extract, that is, divide a single DNA extract into two aliquots and on each aliquot carry out an amplification reaction using, respectively, I-DNA2 and I -DNA1, on the one hand, the confirmation of the genetic profile obtained with the first set of primer pairs of the invention (I-DNA2) is achieved and on the other, if desired, expand the number of STRs loci that are part of the genetic profile

In another particular embodiment of the invention, the primer pairs of the second multiplex amplification reaction comprise 2, 3, 4, 5, 6, 7, 8 or 9 primer pairs, each primer pair characterized in that:

-

amplify one of the amplified locus in the first amplification reaction

multiplex and

-

one of the couple's primers has a different nucleotide sequence

of the nucleotide sequence of the primer pair than in the first

Amplification reaction amplifies the same locus.

In another even more particular embodiment, the primer pairs of the second multiplex amplification reaction are selected from the oligonucleotide pairs SEQ ID NO: 25 and SEQ ID NO: 26 (CSF1PO), SEQ ID NO: 3 and SEQ ID NO : 47 (FGA), SEQ ID NO: 42 and SEQ ID NO: 43 (D18S51), SEQ ID NO: 32 and SEQ ID NO: 33 (VWA), SEQ ID NO: 30 and SEQ ID NO: 31 (D21S11) , SEQ ID NO: 15 and SEQ ID NO: 29 (D7S820), SEQ ID NO: 44 and SEQ ID NO: 45 (D13S317), SEQ ID NO: 46 and SEQ ID NO: 22 (Amelogenin) and SEQ ID NO: 27 and SEQ ID NO: 28 (D5S818).

In another even more particular embodiment, the second multiplex amplification reaction additionally comprises at least 1, 2, 3, 4, 5 or 6 of the primer pairs selected from the oligonucleotide pairs SEQ ID NO: 5 and SEQ ID NO : 6 (TPOX), SEQ ID NO: 11 and SEQ ID NO: 12 (TH01), SEQ ID NO: 34 and SEQ ID NO: 35 (D8S1179), SEQ ID NO: 36 and SEQ ID NO: 37 (D19S433) , SEQ ID NO: 38 and SEQ ID NO: 39 (D16S539) and, SEQ ID NO: 40 and SEQ ID NO: 41 (D3S1358).

The primer pairs used in the second multiplex amplification reaction 5 of the particular embodiment of the method of the invention, as well as the amplifying loci, are collected in Table 2, and the optimum concentration for each primer (adjusted in the validation of the second set of primer pairs) is shown in Table 4.

Table 4. Summary of the concentrations at which each of the primers is used and the fluorochrome with which the 5'end of the direct or forward primer (numbers in 10 bold) of each pair of primers in the set called I-DNA1.

LOCUS

SEQ ID NO Interval Concentration of primers (μM) Optimal concentration of primers (μM) Fluorescent marking

CSF1PO

25 0.14-0.03 0.08 6-FAM

26

D5S818

27 0.25-0.13 0.19

28

D7S820

fifteen 0.19-0.07 0.13

29

D21S11

30 0.16-0.04 0.1

31

TPOX

5 0.14-0.03 0.08 NED

6

VWA

32 0.15-0.03 0.07

33

D8S1179

3. 4 0.15-0.03 0.09

35

D19S433

36 0.25-0.13 0.19

37

TH01

eleven 0.1-0.03 0.04 VIC

12

D16S539

38 0.17-0.05 0.11

39

D3S1358

40 0.15-0.03 0.09

41

D18S51

42 0.44-0.32 0.38

43

D13S317

44 0.12-0.03 0.06 PET

Four. Five

Amelogenin

46 0.17-0.05 0.11

22

FGA

3 0.37-0.25 0.31

47

As the person skilled in the art understands, a multiplex amplification reaction requires a series of reagents, including, but not limited to, the template DNA, the enzyme DNA polymerase, at least two pairs of primers (each primer being each pair complementary to one of the two strands of the DNA), deoxynucleotide triphosphates (dNTPs), magnesium chloride (MgCl2), reaction buffer and optional additives, which can be added separately by mixing in the laboratory or purchased previously mixed, as is the case of Qiagen Multiplex PCR Kit (Qiagen, Valencia, CA), to which the primer pairs are added in the appropriate concentrations and the template DNA.

The PCR is carried out in a thermocycler that performs the cycles in the exact times and temperatures programmed, such as the hybridization temperature, which depends on the melting temperature of each of the primers used in the reaction

or the extension temperature.

The melting temperature of the primers SEQ ID NO: 1 to SEQ ID NO: 24 (Table 1) is between 58 and 60 ° C, and that of the set of primer pairs shown in Table 2, is between 57 and 63 ° C, as calculated using the Perlprimer software (http://perlprimer.sourceforge.net/).

Thus, in a particular embodiment of the method of the invention, the hybridization temperature of the multiplex amplification reaction comprising oligonucleotides SEQ ID NO: 1 to SEQ ID NO: 24 (Table 1) is comprised between 58 and 60 ° C, and / or in case the second multiplex amplification reaction is carried out with all or part of the set of oligonucleotide pairs shown in Table 2, the hybridization temperature of the second multiplex amplification reaction is between 57 and 63 ° C.

Multiplex amplification, either the first set of primer pairs or I-DNA2 (Table 1) as the second set of primer pairs or I-DNA1 (Table 2), offers satisfactory results over a wide range of hybridization temperatures, between 57-63ºC, although the best results in both cases, is 60.5ºC. Similarly, the primers offer results in a wide range of concentrations, although optimal concentrations for each pair of primers are shown in Tables 3 and 4. Regarding the number of cycles used in the PCR reaction, satisfactory results are obtained between 28 -32 cycles, although the optimal number of cycles is 30 in both multiplex amplification reactions.

Optionally, if desired, prior to the multiplex amplification reaction, the labeling of the primers participating in said multiplex amplification reaction can be carried out in order to be able to subsequently detect the amplified fragments. The labeling of the amplification products can be done by conventional methods. Said labeling can be direct, for which fluorophores can be used, for example, Cy3, Cy5, fluorescein, alexa, etc., enzymes, for example, alkaline phosphatase, peroxidase, etc., radioactive isotopes, for example, 33P, 125I, etc., or any other marker known to the person skilled in the art. Alternatively, said labeling may be indirect through the use of chemical, enzymatic, etc .; by way of illustration, the amplification product may incorporate a member of a specific binding pair, for example, avidin or streptavidin conjugated with a fluorochrome (locus), and the probe binds to the other member of the specific binding pair, for example, biotin (indicator), the reading being carried out by fluorimetry, etc., or the amplification product may incorporate a member of a specific binding pair, for example, an anti-digoxigenin antibody conjugated to an enzyme (locus), and the The probe binds to the other member of the specific binding pair, for example, digoxigenin (indicator), etc., the enzyme substrate is transformed into a luminescent or fluorescent product and the reading is carried out by chemo-luminescence, fluorimetry, etc.

Thus, in a particular embodiment, the labeling of the amplification product is carried out by labeling, at one of its ends, one of the oligonucleotides of each pair of primers which, in another even more particular embodiment, the compound employed in oligonucleotide labeling is selected from the group consisting of a radioisotope, a fluorescent material, digoxigenin and biotin. Examples of fluorescent materials that can be employed in oligonucleotide labeling include, but are not limited to, 5-carboxyfluorescein (5-FAM), 6-FAM, tetrachlorinated t-FAM analog (TET), 6-FAM hexachlorinated analog (HEX) ), 6-carboxytetramethylrodamine (TAMRA), 6-carboxy-X-rhodamine (ROX), 6-carboxy-4 ', 5'-dichloro-2', 7'-dimethoxyfluorescein (JOE), NED, Cy-3, Cy -5, Cy-5.5, fluorescein-6-isothiocinate (FITC) and tetramethylrodamine-5isothiocinate (TRITC).

After completing the multiplex amplification reaction, if desired, the amplification products or amplicons can be separated. Virtually any conventional method can be used within the scope of the invention to separate the amplification products. Techniques for separating amplification products are widely described in the state of the art, such as in Sambrook et al., 2001 (cited ad supra). Techniques for separating amplification products are, for example, submerged electrophoresis with Methafor gels, polyacrylamide gels electrophoresis, capillary electrophoresis, etc.

Following the separation of the amplification products, the size of the separated fragments is identified, for which any of the methods of identification of amplification fragments known in the state of the art can be used, such as hybridization with labeled probes ( for example with a fluorophore) which will be detected by a detector and processed by a computer system, staining, for example, with ethidium bromide, silver staining, etc. As the person skilled in the art understands, if this whole process is integrated into a computer system, a graph called electropherogram can be generated where the size of the amplified fragments can be identified.

Invention kit

On the other hand, the invention relates to a kit useful for the implementation of the method of the invention, which comprises the first set of primer pairs of the invention or I-DNA2.

Thus, in another aspect, the invention relates to a kit, hereinafter "kit of the invention", comprising primer pairs SEQ ID NO: 1 and SEQ ID NO: 2 (CSF1PO), SEQ ID NO: 3 and SEQ ID NO: 4 (FGA), SEQ ID NO: 5 and SEQ ID NO: 6 (TPOX), SEQ ID NO: 7 and SEQ ID NO: 8 (D18S51), SEQ ID NO: 9 and SEQ ID NO : 10 (VWA), SEQ ID NO: 11 and SEQ ID NO: 12 (TH01), SEQ ID NO: 13 and SEQ ID NO: 14 (D21S11), SEQ ID NO: 15 and SEQ ID NO: 16 (D7S820) , SEQ ID NO: 17 and SEQ ID NO: 18 (D2S1338), SEQ ID NO: 19 and SEQ ID NO: 20 (D13S317), SEQ ID NO: 21 and SEQ ID NO: 22 (Amelogenin), and SEQ ID NO : 23 and SEQ ID NO: 24 (D5S818).

As the person skilled in the art understands, the kit of the invention, in addition to comprising the first set of primer pairs of the invention, may optionally include the reagents necessary to carry out the multiplex amplification reaction, including , without limiting to, deoxynucleotides triphosphate (dNTPs), divalent and / or monovalent ions, a buffer solution (buffer) that maintains the proper pH for the functioning of DNA polymerase, DNA polymerase or mixture of different polymerases, etc. However, if the kit of the invention does not comprise the reagents necessary to practice the method of the invention, these are commercially available and can be found as part of a kit. Any commercially available kit containing the reagents necessary to carry out an amplification reaction can be used successfully in the practice of the method of the invention. As shown in the examples, in the case of the present invention these reagents are previously mixed in the Qiagen Multiplex PCR Kit reagent (Qiagen, Valencia, CA), which is used at one fifth of the volume recommended by the manufacturers for PCR reactions in general in combination with the first or second combination of primers at the concentrations previously described, in a final volume of 10 microliters.

However, as previously mentioned, the method of the invention may further comprise a second multiplex amplification reaction to amplify another aliquot of the DNA extract, wherein said second multiplex reaction comprises a set of primer pairs in the that, at least, one pair of primers is characterized in that (i) amplifies one of the amplified locus in the first amplification reaction and (ii) one of the primers of the couple has a nucleotide sequence other than the nucleotide sequence of the pair of primers that amplify the same locus in the first amplification reaction.

Therefore, in a particular embodiment, the kit of the invention additionally comprises the first set of primer pairs of the invention, at least one primer pair characterized in that:

-

amplifies one of the locus amplified by the first set of primer pairs of the invention and

-

one of the primers of the pair has a nucleotide sequence different from the nucleotide sequence of the primer pair that amplifies the same locus in the first set of primer pairs.

In another more particular embodiment, the kit of the invention comprises, in addition to the first set of primer pairs of the invention, 2, 3, 4, 5, 6, 7, 8 or 9 primer pairs, each primer pair characterized in that :

-

amplifies one of the locus amplified by the first set of primer pairs of the invention, and

-

one of the primers of the pair has a nucleotide sequence different from the nucleotide sequence of the primer pair that amplifies the same locus in the first set of primer pairs.

In another even more particular embodiment, said primer pair characterized in that (i) amplifies one of the locus amplified by the first set of primer pairs of the invention, and (ii) one of the primers of the pair has a nucleotide sequence other than the nucleotide sequence of the primer pair that amplifies the same locus in the first set of primer pairs of the invention, it is selected from the oligonucleotide pairs SEQ ID NO: 25 and SEQ ID NO: 26 (CSF1PO) , SEQ ID NO: 3 and SEQ ID NO: 47 (FGA), SEQ ID NO: 42 and SEQ ID NO: 43 (D18S51), SEQ ID NO: 32 and SEQ ID NO: 33 (VWA), SEQ ID NO: 30 and SEQ ID NO: 31 (D21S11), SEQ ID NO: 15 and SEQ ID NO: 29 (D7S820), SEQ ID NO: 44 and SEQ ID NO: 45 (D13S317), SEQ ID NO: 46 and SEQ ID NO : 22 (Amelogenin) and SEQ ID NO: 27 and SEQ ID NO: 28 (D5S818).

In another particular embodiment, the kit of the invention additionally comprises at least 1, 2, 3, 4, 5 or 6 of the primer pairs selected from the oligonucleotide pairs SEQ ID NO: 5 and SEQ ID NO: 6 (TPOX), SEQ ID NO: 11 and SEQ ID NO: 12 (TH01), SEQ ID NO: 34 and SEQ ID NO: 35 (D8S1179), SEQ ID NO: 36 and SEQ ID NO: 37 (D19S433), SEQ ID NO: 38 and SEQ ID NO: 39 (D16S539) and, SEQ ID NO: 40 and SEQ ID NO: 41 (D3S1358).

On the other hand, as the person skilled in the art understands, the kit of the invention may comprise pairs of primers already marked or the reagents necessary to carry out the labeling thereof. The different methods that exist in the state of the art to perform the labeling of the primers, as well as the types of compounds that can be used in said labeling have been previously explained herein.

Thus, in a particular embodiment, the kit of the invention comprises pairs of primers wherein one of the oligonucleotides of each pair is labeled at one of its ends,

or the reagents necessary to label the primer pairs.

In an even more particular embodiment of the kit of the invention, the compounds employed in the labeling of the oligonucleotides select from the group consisting of a radioisotope, a fluorescent material, digoxigenin and biotin, which in another even more particular embodiment, the fluorescent material is selects from the group consisting of 5-carboxyfluorescein (5-FAM), 6-FAM, tetrachlorinated t-FAM analog (TET), 6-FAM hexachlorinated analog (HEX), 6-carboxytetramethylrodamine (TAMRA), 6-carboxy-Xrodamine ( ROX), 6-carboxy-4 ', 5'-dichloro-2', 7'-dimethoxyfluorescein (JOE), NED (ABI), Cy-3, Cy-5, Cy-5.5, fluorescein-6-isothiocinate (FITC ) and tetramethylrodamine-5-isothiocinate (TRITC).

As previously mentioned, the kit of the invention is useful in the implementation of the method of invention. Therefore, in another aspect, the invention relates to the use of the kit of the invention to obtain the genetic profile of an individual, to determine kinship relationships between individuals or to identify human remains.

In another aspect, the invention relates to a pair of primers selected from oligonucleotide pairs consisting of SEQ ID NO: 1 and SEQ ID NO: 2 (CSF1PO), SEQ ID NO: 3 and SEQ ID NO: 4 ( FGA), SEQ ID NO: 5 and SEQ ID NO: 6 (TPOX), SEQ ID NO: 7 and SEQ ID NO: 8 (D18S51), SEQ ID NO: 9 and SEQ ID NO: 10 (VWA), SEQ ID NO: 11 and SEQ ID NO: 12 (TH01), SEQ ID NO: 13 and SEQ ID NO: 14 (D21S11), SEQ ID NO: 15 and SEQ ID NO: 16 (D7S820), SEQ ID NO: 17 and SEQ ID NO: 18 (D2S1338), SEQ ID NO: 19 and SEQ ID NO: 20 (D13S317), SEQ ID NO: 21 and SEQ ID NO: 22 (Amelogenin), SEQ ID NO: 23 and SEQ ID NO: 24 ( D5S818), SEQ ID NO: 25 and SEQ ID NO: 26 (CSF1PO), SEQ ID NO: 27 and SEQ ID NO: 28 (D5S818), SEQ ID NO: 15 and SEQ ID NO: 29 (D7S820), SEQ ID NO: 30 and SEQ ID NO: 31 (D21S11), SEQ ID NO: 32 and SEQ ID NO: 33 (VWA), SEQ ID NO: 34 and SEQ ID NO: 35 (D8S1179), SEQ ID NO: 36 and SEQ ID NO: 37 (D19S433), SEQ ID NO: 38 and SEQ ID NO: 39 (D16S539), SEQ ID NO: 40 and SEQ ID NO: 41 (D3S1358), SEQ ID NO: 42 and SEQ ID NO: 43 (D18S51), SEQ ID NO: 44 and SEQ ID NO: 45 (D13S317), SEQ ID NO: 46 and SEQ ID NO: 22 (Amelogenin), and SEQ ID NO: 3 and SEQ ID NO: 47 (FGA) .

The following examples are illustrative of the invention and are not intended to be limiting thereof.

EXAMPLES

In the following examples the validation of I-DNA1, I-DNA2 and the combination of both systems according to Scientific Working Group on DNA Analysis Methods (SGWDAM) [Ellegren, H., 2004. Nat Rev Genet., 5 ( 6): 435-45], for use in human identification (Example 1) and in the analysis of highly degraded DNA samples (Example 2). The first example details the optimization of the sets of primers and the parameters of the PCR reactions, concordance studies, precision and accuracy, with the aim of demonstrating that the invention is suitable for use in human identification. In the second example, the comparison of the invention and other methods of the state of the art is made, in terms of the main parameters in the analysis of highly degraded DNA samples such as the analysis of mixtures, sensitivity and design strategies . Likewise, a direct comparison of performance is made in the analysis of a set of highly degraded DNA samples, between the method of the invention and the method of higher performance of the prior art. The results obtained demonstrate that the method of the invention constitutes an improvement over the methods of the prior art, in the performance and

the reliability of analysis of STRs loci included in the CODIS from highly degraded DNA samples.

EXAMPLE 1 Validation of the method of the invention comprising two reactions of multiplex amplification using sets of pairs of primers I-DNA1 and I-DNA2 for use in human identification

The following describes the validation of I-DNA1, I-DNA2 and the combination of both systems according to Scientific Working Group on DNA Analysis Methods (SGWDAM) [Ellegren, H., 2004. Nat Rev Genet., 5 (6) : 435-45]. This validation has consisted of trials of optimization of primer sets, optimization of PCR parameters, concordance studies, precision and accuracy. The results obtained showed that both I-DNA1, I-DNA2 separately and the combination of both are suitable tools for obtaining human genetic profiles.

MATERIALS AND METHODS

Control samples of human DNA

9947A control DNAs from the AmpFlSTR® YFiler kit (Applied Biosystems, Foster City, CA), Control DNA 007 (Applied Biosystems, Foster City, CA) and K562 (Promega® Corporation, USA) were used to tune the PCR conditions and perform sensitivity tests. These three samples were quantified using Quantifiler® Human DNA Quantification Kit (Applied Biosystems, Foster City, CA) in an ABI PRISM® 7000 Sequence Detection System (Applied Biosystems, Foster City, CA), according to the manufacturer's specifications and were diluted at 1 ng / µl.

Population samples

Peripheral blood samples were taken from 600 healthy individuals: 318 European Caucasians (Basque Country, Spain) and 282 individuals from Colombia (133 Negroids and 149 Hispanics).

DNA extraction and quantification

DNA extracts from individuals of caucasoid origin were obtained by proteolytic lysis with proteinase K and organic extraction. DNA extracts from biological samples of individuals of black and Hispanic origin were obtained by extraction by QiAamp DNA Micro Kit (Qiagen, CA). All DNA extracts were quantified with PicoGreen® (Invitrogen).

Primer set optimization

The Perlprimer program (http://perlprimer.sourceforge.net/) was used to design new primers that amplify in the case of I-DNA1 14 loci STRs (D3S1358, D5S818, D7S820, D8S1179, D13S317, D16S539, D18S51, D19S433, D21S11, CSF1PO, FGA, TH01, TPOX and vWA) plus amelogenin, and in the case of I-DNA2 11 STRs (CSF1PO, FGA, TPOX, D18S51, vWA, TH01, D21S11, D7S820, D2S1338, D13S317, D5S818) plus Dmelogen , based on the reference sequences whose Genbank access numbers are collected in Table 5 and Table 5A for the first and second set of primer pairs, respectively.

The flanking regions to the STRs analyzed were studied using SNPblast (www.ncbi.nlm.nih.gov/SNP/snpblastByChr.html) in order to avoid variable positions in the junction region of all designed primers. The amplifiers range from 49 to 297 bp and 298 bp, in the case of I-DNA1 and I-DNA2 respectively, to cover a large number of alleles contained in the STRBase website [Ruitberg, C.M.,

DJ. Reeder, and J.M. Butler, 2001. Nucleic Acids Res, 29 (1): 320-2] (Tables 5 and 5A, respectively).

The intensity of the amplicons and the absence of nonspecific of each locus was evaluated by analyzing the PCR products by DHPLC with a DNAsep Cartridge (Transgenomic® WAVE® System 4500, Glasgow, UK). 10 μl of amplified were migrated at 40 ° C in a linear gradient from 38.6 to 61.1% buffer B (25% acetonitrile and 0.1 M TEAA) for 10 minutes.

In order to avoid incomplete adenylation, the addition of both a guanine to the 5'-end of the reverse primer and "pig-tailing" [nucleotide tail (5'-GTTTCTT3 ') that is added to the 5' end of a primer was used to avoid incomplete adenylation], (Brownstein, MJ, JD Carpten, and JR Smith, 1996. Biotechniques, 20 (6): 1004-6, 1008-10; Hill CR, BJ, Valone PM, 2009. J Forensic Sci, 54 ( 5): 7; Butler, JM, Y. Shen, and BR McCord, 2003. J Forensic Sci, 48 (5): 1054-64).

PCR amplification, electrophoresis and data analysis

5 μl of Qiagen® Master Mix of Qiagen® Multiplex PCR Kit (Qiagen, Valencia, CA), 4 μl of the primer mix and 1 μl of template DNA (1ng / μl) were used. The concentrations of each pair of primers are detailed in Tables 3 and 4. The amplification performance in different thermal cyclers was analyzed: BioradTM ICycler, C1000TM and MycyclerTM (BioRad, Hercules, CA) and GeneAmp® 9700 PCR System (Applied Biosystems, Foster City, CA), as well as in different conditions of hybridization temperatures (“annealing temperature”): 57 ºC, 58.9 ºC, 60.5 ºC, 61.8 ºC and 63 ºC, at different numbers of cycles: 28 , 29, 30, 31 and 32 cycles and at final extension times of 30, 45, 60 and 90 minutes. 2 μl of each amplifier product was analyzed mixed with 9 μl of Hi-Di ™ Formamide (Applied Biosystems®, Foster City, CA) and 0.5 μl of GeneScan ™ 500 LIZ® Size Standard (Applied Biosystems®, Foster City, AC). After denaturation of the amplified (6 minutes at 95 ° C), they were cooled (4 minutes at 4 ° C) and separated in an ABI PRISM 3130 Genetic Analyzer (Applied Biosystems®, Foster City, CA). The electrophoresis results were analyzed using the Genmapper version software

4.0 (Applied Biosystems®, Foster City, CA).

Concordance studies

Genetic profiles analyzed with I-DNA1, I-DNA2 and Identifiler® (Applied Biosystems, Foster City, CA) were compared. For analysis by I-DNA1 and I-DNA2, 1 ng of template DNA from each individual was used. The analysis using Identifiler® (Applied Biosystems, Foster City, CA) was performed according to the optimal conditions suggested by the manufacturer.

Precision and accuracy

The precision of the allelic stairs of I-DNA1 and I-DNA2 was calculated by analyzing 48 replicas of each allele ladder in an ABI PRISM 3130 Genetic Analyzer (Applied Biosystems®, Foster City, CA). The accuracy of genotyping of I-DNA1 and I-DNA2 was assessed by analyzing 162 amplified DNA samples under standard conditions,

5 of which the standard deviation in base pairs of each of the alleles with respect to the allele size of the corresponding allele ladder was calculated by the Genmapper program (Applied Biosystems, Foster City, CA).

10 RESULTS

Optimization of primer sets

Tables 5 and 5A (following pages) collect a wide range of alleles for each locus included in I-DNA1 and I-DNA2, respectively. The alleles have been considered

15 described in the main population groups according to the information collected in STRbase [Ruitberg, C.M., D.J. Reeder, and J.M. Butler, 2001. Nucleic Acids Res, 29 (1): 3202].

Table 5

Locus

Genbank access number Allele Interval PCR fragment (bp) Primer concentration (μM) Fluorescent marker

CSF1PO

X14720 AC008512 AC004848 M84567 M68651 M25858 AF216671 G08036 D00269 AC024591 NT_005997 AP001534 AL353628 Sullivan et al. * M64982 6 -15 7 -17 6 -15 24 -38 6 -16 11 -24 8 -20 5.2 -18.2 5 -14 5 -16 9 -20 7 -27 5 -17 X, Y 16 -51, 2 75 - 111 127 -167 183 - 219 240 - 296 61 - 89 121 - 173 181 - 229 245 - 297 57 - 93 105 - 149 161 - 205 213 - 293 72 - 120 121,127 151 - 293 0.08 0.19 0.13 0.1 0.08 0.07 0.09 0.19 0.04 0.11 0.09 0.38 0.06 0.11 0.31 6-FAMTM

D5S818

D7S820

D21S11

TPOX

NEDTM

VWA

D8S1179

D19S433

TH01

VICTM

D16S539

D3S1358

D18S51

D13S317

PET®

amelogenin

FGA

*

Sullivan KM, et.al. 1993. Biotechniques, 15 (4): 636-8,640-1.

*

Sullivan KM, et.al. 1993. Biotechniques, 15 (4): 636-8,640-1.

Table 5A

Locus

GenBank access number Allele Interval PCR fragment size (bp) ΜM primer concentration Fluorescent marker

CSF1PO

X14720 M64982 M68651 AP001534 M25858 D00269 M84567 AC004848 AC010136 AL353628 Sullivan et al. * AC008512 5 - 16 12 - 51.2 4 - 16 7 -28.3 10 - 25 3 - 14 12 - 39 6 - 15 11 - 28 5 - 17 X, Y 6 - 18 88 -132 140 -298 53 -101 109 -196 212 -272 49 -93 107 -215 224 -260 88 -156 164 -212 220, 226 234-282 0.06 0.08 0.1 0.3 0.18 0.05 0.11 0.14 0.15 0.15 0.11 0.08 6-FAMTM

FGA

TPOX

NEDTM

D18S51

vWA

TH01

VICTM

D21S11

D7S820

D2S1338

PET ©

D13S317

amelogenin

D5S818

In the case of I-DNA1 96 primers were designed from which those were chosen

5 capable of producing amplifiers of the smallest possible size, which in no case exceeded 300 bp, whose melting temperatures were between 57.5 and 62.5 ° C and that hybridized in regions lacking SNPs (Single Nucleotide Polymorphism) and INDELS (Insertions / deletions) described to date in NCBI (http://www.ncbi.nlm.nih.gov/snp/). In the first phase of optimization,

10 performed singleplex PCR amplifications of each locus. The PCR products were analyzed by DHPLC to assess the specificity of the primers and the amplification intensity. All primer pairs of this invention are different from those used in any of the currently validated kits. In the second optimization phase, various sets of multiplex primers were tested. They spaced

15 the ranges of alleles of adjacent loci in size in order to avoid overlaps between alleles corresponding to different loci to ensure proper genotyping. He

DHPLC analysis allowed to evaluate the absence of nonspecific and the efficiency of amplification for each of the loci tested in multiplex format. Finally, 3 quadruplex PCR reactions (quadruplex A: CSF1PO, D5S818, D7S820 and D21S11; quadruplex B: TH01, D16S539, D3S1358 and D18S51; quaduplex C: TPOX, vWA, D8S1179 and D19S433) and a triplex PCR reaction were selected ( triplex D: D13S317, amelogenin and FGA). The direct primers of the 3 quadruplex reactions A, B and C were labeled with 6-FAMTM, VICTM and NEDTM, respectively and the direct primers of the triplex D reaction were labeled with PET® (Applied Biosystems, Foster City, CA) ( Table 5). Finally, the different sets of primers were grouped in a single multiplex PCR reaction that allows obtaining a genetic profile by amplifying 14 STRs and amelogenin loci. Figure 3 shows the final result of the strategy in the design of primers for I-DNA1.

In the case of I-DNA2, 78 primers were designed capable of producing amplicons that in no case exceeded 300 bp and whose melting temperatures were between 57.5 and 62.5 ° C. Additionally, the design of the I-DNA2 primers allows their analysis with the combination of I-DNA1 to allow analysis of the largest possible number of miniSTRs. Therefore, 9 of the 11 loci shared by I-DNA2 and I-DNA1 (CSF1PO, FGA, D18S51, VWA, D21S11, D7S820, D13S317, D5S818 and amelogenin) have amplicons of clearly different sizes in both systems (Tables 5 and 5A ). Likewise, primers designed to produce amplifiers of the smallest possible size for D2S1138 were designed as this locus was not included in I-DNA1. On the other hand, primers of the same sequence were used to those used in I-DNA1 for TH01 and TPOX due to their small size of 49 and 51 bp, respectively. In the first phase of the optimization, singleplex PCR amplifications of each locus were performed, with the exception of TH01 and TPOX, previously tested. The PCR products were analyzed by DHPLC to assess the specificity of the primers and the amplification intensity. It should be noted that all the pairs of primers selected in this work are different from those used in any of the prior art methods, except for the pairs of primers used for the amplification of TH01 and TPOX, also used in I-DNA1 . In the second optimization phase, several sets of multiplex primers were tested, so that the allele ranges of the adjacent loci in size were spaced, in order to avoid overlaps between alleles corresponding to different loci. The analysis by DHPLC of the PCR products of each of the loci tested in multiplex format, allowed to evaluate the effectiveness of the amplification and the absence of nonspecific in each case.

Finally, 2 triplex PCR reactions were selected (Triplex A: TPOX, D18S51 and vWA; Triplex B: TH01, D21S11 and D7S820), a quadruplex (quadruplex) PCR reaction

C: D2S1338, D13S317, amelogenin and D5S818) and a duplex PCR reaction (duplex D: CSF1PO and FGA). The direct primers of the 2 triplex A and B reactions were labeled with NEDTM and VICTM, respectively, the direct primers of the quadruplex C reaction were labeled with PET® (Applied Biosystems, Foster City, CA) and the direct reaction primers duplex D, were marked with 6-FAMTM (Table 5A). Finally, the different sets of primers were grouped in a single multiplex PCR reaction that allows amplifying 11 STR loci plus amelogenin, by means of amplicons from 49 to 298 bp, in order to cover a large number of alleles (Table 5A).

In conclusion, both I-DNA1 and I-DNA2 allow obtaining a genetic profile by analyzing 14 and 11 STRs respectively. On the other hand, the design of primers of I-DNA1 and I-DNA2 makes it possible that, by combination, a total of 15 STRs loci can be analyzed as an option: (CSF1PO, FGA, TPOX, D18S51, vWA, TH01, D21S11, D7S820, D2S1338, D13S317, D5S818, D8S1179, D19S433, D16S539, D3S1358) plus amelogenin. The first multiplex reaction, which uses the set of primers called I-DNA1, allows obtaining the genetic profile of 14 STRs (CSF1PO, D5S818, D7S820, D21S11, TPOX, VWA, D8S1179, D19S433, TH01, D16S539, D3S1358, D18S51, D13S317 , FGA) plus amelogenin. The second multiplex reaction, which uses the set of primers called I-DNA2, allows obtaining the genetic profile of 11 STRs (CSF1PO, FGA, TPOX, D18S51, vWA, TH01, D21S11, D7S820, D2S1338, D13S317, D5S818) plus amelogenin.

The final result of the strategy in the design of primers for I-DNA2 (A) and I-DNA1 (B) is represented in Figure 3.

PCR parameter optimization

The optimization of the amplification parameters such as the optimal concentration of primers, hybridization temperature, number of cycles and extension time, was performed by studying the electropherograms in which the height of the peaks was evaluated, the balance in heterozygosis of them and incomplete adenylation.

First, the concentration of each pair of primers was tested between 0.0375 μM and 0.75 μM, so that in each case, below the optimum concentration an increase in the height of the peaks was observed as that the concentration of primers was increased. While at the same time, in concentrations higher than the one considered optimal, an increase in both imbalance in heterozygosis and incomplete adenylation was detected, as well as in the intensity of the artifacts in I-DNA1 (FAM87, FAM96, FAM158, VIC53, VIC105, VIC121 and VIC180) and in I-DNA2 (FAM91, FAM155, VIC51, VIC179, NED100, NED165, NED179, PET95 and PET97).

In this sense, the intensities of the loci analyzed by I-DNA1 and I-DNA2 were balanced around 2,500 RFUs in the analysis of 1 ng of DNA, to achieve a balance between the intensity of the signal and the absence of overlap between signals corresponding to different fluorochromes.

The hybridization temperature of the multiplex PCR reaction was then optimized. The increase in hybridization temperature produced a gradual decrease in both incomplete adenylation and peak height. The best results were obtained at the hybridization temperature of 60.5 ° C, in the case of I-DNA1, and 58.9 ° C and 60.5 ° C in the case of I-DNA2. The temperature of 60.5 ° C was chosen because it is the most restrictive for I-DNA2 and for coinciding for both systems.

On the other hand, the increase in the number of cycles generally increased the height of the peaks and incomplete adenylation. In this sense, the most balanced results corresponded to 30 cycles. Likewise, the increase in extension time did not produce significant changes in incomplete adenylation; however, the addition of a guanine to the 5 'end of the first reverse eliminated the effect of adenylation

incomplete, even better than the addition of pig-tailing. The addition of said guanine is represented as a G in Tables 1 and 2.

It should also be noted that the use of BioradTM ICycler, C1000TM and MycyclerTM (BioRad, Hercules, CA) and GeneAmp® 9700 PCR System (Applied Biosystems, Foster City, CA) thermal cyclists did not reveal significant variations in the quality of the results obtained.

After the evaluation of all the aforementioned parameters, the optimal concentration of primers was determined, so that the following average intensities for each color were obtained in the analysis of 1 ng of DNA of I-DNA1 [6-FAMTM ( 2243 ± 764 RFUs), VICTM (2742 ± 748 RFUs), NEDTM (2313 ± 426 RFUs) and PET® (2417 ± 247 RFUs)] and I-DNA2 [6-FAMTM (1933 ± 424 RFUs), VICTM (2659 ± 428 RFUs), NEDTM (2276 ± 100 RFUs) and PET® (1869 ± 416 RFUs)].

Thus, I-DNA1 and I-DNA2 have proven to be balanced and specific multiplex reactions, capable of obtaining genetic profiles independently by amplifying 14 STRs loci and 11 STRs loci, respectively, in addition to the amelogenin locus, from 1 ng of DNA mold (Figures 1 and 2), by the following amplification conditions: an initial denaturation cycle for 15 minutes at 95 ° C, 30 cycles of 30 s at 95 ° C, 90 s at 60.5 ° C and 1 minute at 72 ° C, followed by 1 final extension cycle of 30 minutes at 60 ° C. In addition, the fact that the primers used in both systems have similar melting temperature characteristics (I-DNA1: 58.8 ± 0.91 ° C and I-DNA2: 58.9 ± 0.87 ° C) and length (I- DNA1: 21.3 ± 2.88 bp and I-DNA2: 20.4 ± 2.3 bp), allows them to offer optimal results under the same PCR conditions.

Concordance studies

Concordance studies were carried out by comparing 2430 allele calls obtained by I-DNA1 and Identifiler® (Applied Biosystems, Foster City, CA), of 1944 allele calls obtained by I-DNA2 and Identifiler® (Applied Biosystems, Foster City, CA) and the comparison of 6600 allele calls obtained by I-DNA2 and I-DNA1. Identifiler® (Applied Biosystems, Foster City, CA) was chosen as this is a widely used system.

used [Hill, CR, et al., 2007. J Forensic Sci, 52 (4): 870-3] and validated [Collins, PJ, et al., 2004. J Forensic Sci, 49 (6): 1265-77 ]. Among the results obtained by I-DNA1 and Identifiler®, a single disagreement was found, which implies a 99.9% concordance between these systems. This disagreement corresponded to an individual genotyped as homozygous (15/15) for D3S1358 by Identifiler® and as heterozygous (12/15) by I-DNA1. The sample was analyzed in triplicate by both systems with identical results. In the comparison of I-DNA2 and Identifiler® (Applied Biosystems, Foster City, CA) no disagreements were found, which means 100% concordance between both systems. Whereas, the comparison of the genetic profiles obtained by I-DNA1 and I-DNA2 revealed 6 disagreements, which implies a 99.9% concordance between these systems.

Of these disagreements 2 corresponded to allelic losses recorded in the vWA locus of I-DNA2, while 3 mismatches consisted of differences between both systems of 2 bp in the size of 1 D18S51 locus and 4 bp in 2 alleles of D13S317 locus .

Precision and accuracy

The accuracy of the allelic stairs of I-DNA1 and I-DNA2 was calculated from the study of allelic stairs analyzed in independent injections. The standard deviation in base pair size was equal to or less than 0.07 bp for both I-DNA1 and I-DNA2. Accuracy was measured by the analysis of 162 caucasoid individuals to calculate the deviation of the allele size of each sample with respect to the allele size of the corresponding allelic ladders. No alleles outside the range of ± 0.40 bp corresponding to each allele of allelic stairs were detected.

DISCUSSION

The results related to the validation of I-DNA1 in the trials of primer set optimization, PCR parameter optimization, and concordance studies are discussed below.

The optimization of the set of primers has been to analyze the amplified products both separately and in multiplex. The usual procedure consists of

analysis of labeled amplicons using a DNA sequencer [Tagliaro, F., et al., 2010. Electrophoresis, 31 (1): 251-9]. However, DHPLC (Denaturing High-Performance Liquid Chromatography) technology has been used for the first time in this invention to evaluate the intensity of the amplified and determine the absence of nonspecific amplifications. The advantage of using DHPLC analysis is that it avoids the need for prior labeling of primers. This methodology has been used both in the first phase of optimization of PCR products separately, and in the second phase of optimization with the additional purpose of assessing the absence of overlapping of PCR products. Once the best set of primers for the multiplex amplification of the 14 STRs and amelogenin loci, the 11 STRs plus amelogenin loci was determined, as appropriate, the primers were labeled by fluorochromes. In this way, only those primers that have finally been included in the reactions called I-DNA1 and I-DNA2 have been labeled. Therefore, the use of DHPLC technology in the optimization of amplification of multiplex reactions is a rapid alternative [Shinka, T., et al., 2001. J Hum Genet, 46 (5): 263-6] and of reduced cost to the analysis of amplicons by means of DNA sequencer, since it avoids the need to use primers marked in the early stages of optimization [Devaney, JM, JE Girard, and M.A. Marino, 2000. Anal Chem, 72 (4): 858-64].

I-DNA1 and I-DNA2 have proven to be balanced and specific multiplex reactions, capable of obtaining genetic profiles independently by amplifying 14 STRs loci and 11 STRs loci, respectively, in addition to the amelogenin locus. In addition, the fact that the primers used in both systems have similar melting temperature and length characteristics, allows them to offer optimal results under the same PCR conditions.

The reliability of I-DNA1 and I-DNA2 has been proven by concordance studies between the genetic profiles determined by these systems and those obtained by widely used pre-existing systems. In this sense, in the first place, a 99.9% agreement was found between I-DNA1 and Identifiler® (Applied Biosystems, Foster City, CA), where the only exception was detected in an individual, genotyped as homozygous by Identifiler® (Applied Biosystems, Foster City, CA) and as heterozygous for I-DNA1. Likewise, the concordance of 100% of I-DNA2 with respect to

Identifiler (Applied Biosystems, Foster City, CA) and 99.9% compared to I-DNA1. The mismatches detected between I-DNA1 and I-DNA2 consist of allelic losses and variations of 2-4 bp in the size of the alleles detected in both systems. These types of disagreements are the usual ones after the analysis of identical STRs with systems that use different primer pairs (Hill, C.R. et al., 2007. J Forensic Sci, 2007. 52 (4): 870-3). Similar disagreements reported in other studies were due to the presence of mutations that probably coincided with the junction region of the 3 'end of one of the primers, while variations in allele size were probably due to the presence of insertions and / or deletions in the region flanking the repetition STR [Budowle, B., et al., 2008. Int J Legal Med, 122 (5): 421-7; Zhai, X.D., et al., 2009. Oct 30, Int J Legal Med]. These mutations prevent the amplification of one of the alleles and consequently cause allelic losses. In this sense, the genetic profiles obtained by I-DNA1 and I-DNA2 showed high reliability, since the combined use of several multiplex STRs using different pairs of primers for the amplification of common STR loci such as I-DNA1 and I- DNA2, offers considerable advantages in human identification, allowing both the detection of insertions / deletions that may affect the genetic profile obtained, and the decrease in the effect of these silent alleles.

In conclusion, the present validation has shown that both I-DNA1 and I-DNA2 independently, as well as the combination of both reactions, constitute systems of high robustness and reliability in obtaining genetic profiles, which makes them useful tools for use in human identification. Likewise, the small size of its amplified, added to having been designed for optimum complementarity, suggests that the present invention has a high capacity for analysis of loci included in CODIS from small DNA fragments.

EXAMPLE 2 Validation of the method of the invention comprising two reactions of multiplex amplification using sets of primer pairs I-DNA1 and I- DNA2 for use in the analysis of highly degraded DNA samples

The following describes the validation of I-DNA1, I-DNA2 and the combination of both reactions according to Scientific Working Group on DNA Analysis Methods (SGWDAM) [Ellegren, H., 2004. Nat Rev Genet., 5 (6) : 435-45] in the analysis of highly degraded DNA samples. This validation has consisted of tests to determine the percentage of stuttering alleles, relative intensity between peaks, mixtures and sensitivity. Likewise, two comparative studies are carried out: 1) between the design strategies of the method object of the invention and those of the prior art methods and 2) between the capacity of loci analysis included in CODIS from samples of Highly degraded DNA of the method of the invention and that of MinifilerTM Kit PCR, Identifiler® and the combination of both (Applied Biosystems, Foster City, CA), being the state-of-the-art methods that have shown the highest performance in this regard.

The results obtained indicate that the present invention surpasses the rest of the methods of the technique capable of analyzing loci included in the CODIS from highly degraded DNA samples.

MATERIALS AND METHODS

Control samples of human DNA

9947A control DNAs from the AmpFlSTR® YFiler kit (Applied Biosystems, Foster City, CA), Control DNA 007 (Applied Biosystems, Foster City, CA) and K562 (Promega® Corporation, USA) were used to tune the PCR conditions and perform sensitivity tests. These three samples were quantified using Quantifiler® Human DNA Quantification Kit (Applied Biosystems, Foster City, CA) in an ABI PRISM® 7000 Sequence Detection System (Applied Biosystems, Foster City, CA), according to the manufacturer's specifications and were diluted at 1 ng / μl. Population samples

Peripheral blood samples were taken from 600 healthy individuals: 318 European Caucasians (Basque Country, Spain) and 282 individuals from Colombia (133 Negroids and 149 Hispanics).

Highly degraded DNA samples.

Ten DNA samples were taken from tissues included in 80-year paraffin, originating from autopsies in which the tissue remained 72-96 hours in formalin before inclusion in paraffin.

DNA extraction and quantification

DNA extracts from individuals of caucasoid origin and paraffin samples were obtained by proteolytic lysis with proteinase K and organic extraction. DNA extracts from biological samples of individuals of black and Hispanic origin were obtained by extraction by QiAamp DNA Micro Kit (Qiagen, CA). The amounts of DNA recommended by the manufacturer were used for the PCR amplification of each type of sample in each case. For analysis by the system object of the present invention, 1 ng was used in the amplification of DNA from population samples and 1.6 ng of DNA from paraffin samples. All DNA extracts were quantified with PicoGreen® (Invitrogen).

PCR amplification, electrophoresis and data analysis

5 µl of Qiagen® Master Mix of Qiagen® Multiplex PCR Kit (Qiagen, Valencia, CA), 4 µl of the primer mix and 1 µl of template DNA were used. The concentrations of each pair of primers are detailed in Tables 3 and 4. The PCR amplification reactions were performed in a MycyclerTM thermal cycler (BioRad, Hercules, CA) under the following conditions: an initial denaturation cycle for 15 minutes at 95 ° C , 30 cycles of 30 s at 95 ºC, 90 s at 60.5 ºC and 1 minute at 72 ºC, followed by 1 final extension cycle of 30 minutes at 60 ºC. 2 μl of each amplifier product was analyzed mixed with 9 μl of Hi-Di ™ Formamide (Applied Biosystems®, Foster City, CA) and 0.5 μl of GeneScan ™ 500 LIZ® Size Standard (Applied Biosystems®, Foster City, AC). After denaturation of the amplified (6 minutes at 95 ° C), they were cooled (4 minutes at 4 ° C) and separated in an ABI PRISM 3130 Genetic Analyzer (Applied Biosystems®, Foster City, CA). The electrophoresis results were analyzed using Genmapper software version 4.0 (Applied Biosystems®, Foster City, CA).

Determination of the percentage of stuttering alleles, relative intensity of heterozygous peaks and mixtures

The determination of stuttering alleles in both homozygous and heterozygous individuals that differed in size by more than 4 bp was made by calculating the percentage of the stutter allele's height relative to the actual peak's height. The calculation of the relative intensity of heterozygous peaks ("Peak Height Ratio" or PHR) was done by dividing the height of the smallest of the peaks by the height of the largest of the heterozygotes of each locus.

The studies of mixtures consisted of establishing a threshold based on the percentage of stuttering allele for the distinction between the stuttering and “minor contributor” allele (in a mixture composed of the DNAs of two individuals, the “minor contributor” refers to the profile that to a lesser extent it contributes to the mixture). To check the effectiveness of this threshold, two DNA samples were mixed at the following proportions (1: 1, 1: 3, 1: 5, 1: 7, 1:10, 1:15, 1:20, 3: 1 , 5: 1, 7: 1, 10: 1, 15: 1 and 20: 1), keeping the amount of final template DNA at 1 ng.

Sensitivity

In order to determine the sensitivity of I-DNA1, I-DNA2 and that of both in combination, 9947A control DNAs from the AmpFlSTR® YFiler kit (Applied Biosystems, Foster City, CA), Control DNA 007 (Applied) were analyzed in triplicate Biosystems, Foster City, CA) and K562 (Promega® Corporation, USA). DNA concentrations of 30 ng, 20 ng, 10 ng, 1.6 ng, 1 ng, 400 pg, 200 pg, 100 pg, 50 pg and 25 pg were used.

RESULTS

Determination of the percentage of stuttering alleles, relative intensity of heterozygous peaks and mixtures

The peaks corresponding to stuttering alleles, the result of polymerase slippage (in English, “strand slippage”), usually result in a peak 4 bp less than the real allele. The results for each locus after the analysis of 162 individuals of caucasoid origin corresponding to I-DNA1 and I-DNA2, are shown in Tables 6 and 7, respectively (next page). The lowest average value was observed in TH01 in both cases (4.0 ± 2.1 and 4.3 ± 1.6, respectively), while the highest was also observed in both cases in D21S11 (11.4 ± 2, 2 and 12.9 ± 2.9, respectively). In all loci it is observed that the greater the number of repetitions of their alleles, the greater the percentage of stuttered alleles.

Table 6: Percentage of stuttering alleles (%) of STR loci analyzed with I-DNA1

I-DNA1

Sample size Half Median Standard deviation Minimum Maximum

CSF1PO

209 6.3 5.4 2.6 2.7 13.0

D13S317

276 6.2 6.1 2.3 2.0 13.2

D16S539

202 9.4 9.3 1.3 6.6 12.6

D18S59

270 8.6 8.5 2.0 5.2 12.7

D19S433

272 8.5 8.4 1.4 5.9 12.5

D21S11

240 11.4 11.2 2.2 7.7 16.9

D3S1358

258 10.1 10.2 1.9 6.1 14.1

D5S818

200 5.7 6.7 3.4 5.0 10.9

D7S820

279 7.2 7.0 2.1 2.8 12.4

D8S1179

233 9.2 8.9 2.2 5.2 15.0

FGA

269 8.4 8.4 2.0 3.9 12.9

TH01

254 4.0 3.8 2.1 0.8 11.2

TPOX

228 4.2 3.9 1.6 1.0 9.3

vWA

275 8.7 9.2 3.1 1.0 14.6

Table 7. Percentage of stuttering alleles of STRs analyzed by I-DNA2.

I-DNA2

Sample size Half Median Standard deviation Minimum Maximum

CSF1PO

262 10.6 10.3 2.2 6.9 16.6

D13S317

264 5.6 5.7 1.8 2.2 9.4

D18S59

272 8.5 8.3 2.1 4.9 12.7

D21S11

172 12.9 12.6 2.9 7.8 18.2

D2S1338

270 10.8 10.7 2.1 6.6 14.8

D5S818

247 6.8 6.9 1.7 3.4 10.8

D7S820

255 7.6 7.6 2.4 3.2 13.7

FGA

243 12.1 12.0 3.0 6.9 17.8

TH01

264 4.3 4,5 1.6 1.3 7.4

TPOX

263 5.4 4.9 1.7 3.2 10.4

Vwa

240 9.4 9.7 2.8 3.0 14.8

The calculation of the Relative Height between Peaks (PHR) offered low standard deviation values as well as median values very close to the average in each of the loci 15 analyzed in 600 individuals, both in I-DNA1 and in I-DNA2 ( Tables 8 and 9, respectively). In the specific case of I-DNA1, all means exceed 80% with

standard deviations between 7.2 and 11.4. In general, I-DNA1 has a good balance of alleles in heterozygosis. The only exception is the locus D13S317 an average of 75.8% is observed with a standard deviation of 14.8. I-DNA2 also presents a good balance of alleles in heterozygosis, since it shows low standard deviation values (8.6 - 11.6), as well as median values very close to the corresponding means (82.7 - 90.5 %).

Table 8: Relative intensity between peaks for each STR locus analyzed with I-DNA1

Size

IDNA1 Medium Medium SD * Minimum Maximum

sample

CSF1PO D13S317 D16S539 D18S59 D19S433 D21S11 D3S1358

390 437 429 473 430 445 424 84.2 75.8 92.1 84.0 81.7 85.7 89.1 86.3 77.2 94.1 85.6 83.7 87.4 90.3 11.4 14.8 7.2 8.5 8.9 9.9 7.5 49.0 40.7 63.7 55.9 51.7 49.1 58.8 100.0 99.8 100.0 100.0 99.6 99.6 100.0

D5S818 D7S820 D8S1179 FGA TH01

399 430 421 475 436 84.2 89.2 81.9 88.0 90.9 85.7 91.0 84.1 89.7 94.6 10.4 9.2 11.2 8.0 9.7 52.7 58.0 50.5 59.8 57.2 100.0 100.0 99.7 99.8 100.0

TPOX

359 88.2 90.6 10.1 54.3 99.9

vWA 457 SD: standard deviation

87.1 88.1 8.3 60.2 99.9

10

Table 9. Relative peak intensity for each STR locus analyzed with I-DNA2.

I-DNA2

Sample size Half Median Standard deviation Minimum Maximum

CSF1PO

397 88.9 90.7 9.2 57.7 100.0

D13S317

420 83.9 86.2 9.9 54.2 100.0

D18S51

462 87.1 88.6 9.0 52.4 99.8

D21S11

443 85.8 88.2 10.9 52.8 100.0

D2S1338

473 84.6 86.7 10.2 53.2 99.8

D5S818

389 85.9 87.8 8.9 54.8 100.0

D7S820

409 88.7 91.0 8.6 60.1 99.9

FGA

461 90.0 94.0 10.0 59.2 100.0

THO1

424 90.5 95.3 10.5 56.7 100.0

TPOX

348 88.2 91.8 11.6 46.0 100.0

vWA

429 82.7 83.3 10.8 51.0 100.0

The DNAs selected for the mixture test were chosen because of their high heterozygosity, although some of the alleles of the “minor contributor” resided in the

stammering allele positions of the "major contributor" alleles (in a mixture composed of the DNAs of two individuals, the "largest contributor" refers to the profile that is in the highest proportion in the mix). The threshold for the distinction between the “minor contributor” and the stutterer allele of the “largest contributor” of each locus analyzed was set at an intensity equal to the average percentage of stuttered allele plus 3 times its standard deviation.

Taking into account this threshold, in the case of I-DNA1, the “minor contributor” was genotyped at a 1:10 ratio in all of the loci included in this reaction, with the exception of loci D19S433 and D7S820 that were genotyped. at a proportion

1: 7 The “minor contributor” was genotyped up to proportions of 1:15 in the CSF1PO, D5S818 and D8S1179 loci, and even at 1:20 in TH01 and TPOX.

In the case of I-DNA2, the minor contributor was genotyped at a 1: 7 ratio in all loci included in this reaction, with the exception of locus D21S11, which was genotyped at a ratio of 1: 5, due to to its high percentage of stutter and the presence of the VIC179 artifact. The minor contributor was able to genotype up to a 1:10 ratio in D18S51 and D7S820, 1:15 in CSF1PO, FGA and D13S317, and even a 1:20 ratio in TPOX and TH01.

Sensitivity

The least amount of DNA that allowed amplifying all of the STRs included in both the case of I-DNA1 and I-DNA2 was 100 pg. Using I-DNA1, quantities greater than 25 pg of DNA allowed the analysis of 11 STR loci and amelogenin, while the remaining 3 STR loci (D5S818, D3S1358 and D18S51) presented allelic losses due to stochastic effects.

Using I-DNA2, amounts greater than 50 pg of DNA allowed the analysis of 8 STR loci and amelogenin, while the remaining 3 STR loci (FGA, D21S11 and D2S1338) presented allelic losses due to stochastic effects. Likewise, amounts greater than 25pg of DNA allowed the analysis of 5 STR loci (VWA, TH01, D7S820, D13S317 and D5S818) and amelogenin, while the rest of STR loci presented

allelic losses due to stochastic effects, with the exception of FGA that did not offer results at more than 50 RFUs.

On the other hand, the combination of I-DNA1 and I-DNA2 from amounts of 100 pg of total DNA, using equally 50 pg in each system, allowed the analysis of 14 STRs and amelogenin loci, 5 of them in duplicate (CSF1PO, vWA, D13S317, TPOX and D7S820). In turn, amounts of 50 pg of total DNA, using 25 pg in each system equally, allowed the analysis of 13 STRs and amelogenin loci, 2 of them plus amelogenin in duplicate (D13S317 and vWA).

Comparative study of the design strategies of the primer sets of the present invention with respect to prior art methods

As explained in the section dedicated to the background of the invention, the size of the amplicons of a multiplex STR system is critical for obtaining genetic profiles from highly degraded biological samples [Butler, JM, Y. Shen , and BR McCord, 2003. J Forensic Sci, 48 (5): 1054-64; Coble, M.D. and J.M. Butler, 2005. J Forensic Sci, 50 (1): 43-53].

The primer pairs of the present invention are characterized by allowing a high number of STR loci to be analyzed by small amplified amplifiers. In Table 11 (next page), the loci analyzed are detailed both in the STR multiplexes of the prior art and in the method object of the invention, by means of amplifications that do not exceed 200 bp (miniSTRs) or 300 bp (midiSTRs) , as well as those over 300 bp (maxiSTRS). In order to evaluate the design strategies followed by the different multiplex STRs, regarding the analysis of loci included in the CODIS from highly degraded DNA samples, the STR loci included in the different databases are detailed.

Table 11. miniSTRs (<200 pbs), midiSTRs (<300 pbs) and maxiSTRs (> 300 pbs), in black, gray and white respectively, analyzed by the main state-of-the-art STRsmultiplexes as well as by the combinations of reactions and those object of the present invention. In this calculation, high molecular weight alleles of FGA are not considered, as they are highly infrequent, as demonstrated by their absence in the 600 individuals analyzed in examples 1 and 2. Left to right: Identifiler®, MinifilerTM, Powerplex 16 , Q8, Bioplex-11, NGMTM, Powerplex ESX-17, Powerplex ESI-17, I-DNA2, I-DNA1 and the Powerplex ESX-17 + Powerplex ESX-17, MinifilerTM + Identifiler®, MinifilerTM + NGMTM and I- combinations DNA1 + I-DNA2. The amplified sizes for MinifilerTM and Identifiler® are approximate, because the exact data has not been published. STR loci included in the CODIS, ECL, in both or in other databases are detailed.

I-DNA1 ESX + ESI MINI + NGM I-DNA1 + I-DNA2 MIINI + IDENT IDENTIFILER * MINIFILER * PP 16 BIOPLEX-11 NGM PP ESX-17 I-DNA2PP ESI-17Q8LOCUS

D16S539 D18S51 D21S11 D3S1358 D8S1179 FGA TH01 vWA CSF1PO D13S317 D5S818 D7S820 TPOX D19S433 D2S1338

D16S539

D18S51 D21S11 D3S1358 D8S1179 FGA TH01 vWA CSF1PO D13S317 D7S820 D19S433 D2S1338 D10S1248 D12S391 D1S1656 D22S1045 D2S441

D16S539

D18S51 D21S11 D3S1358 D8S1179 FGA TH01 vWA CSF1PO D13S317 D5S818 D7S820 TPOX D19S433 D2S1338

D16S539

D18S51 D21S11 D3S1358 D8S1179 FGA TH01 vWA D19S433 D2S1338 D10S1248 D12S391 D1S1656 D22S1045 D2S441 SE33

D16S539

D18S59 D21S11 D3S1358 D8S1179 FGA TH01 vWA CSF1PO D13S317 D5S818 D7S820 TPOX D19S433

D18S51

D21S11 FGA THO1 vWA CSF1PO D13S317 D5S818 D7S820 TPOX D2S1338

D16S539

D18S51 D21S11 D3S1358 D8S1179 FGA TH01 vWA D19S433 D2S1338 D10S1248 D12S391 D1S1656 D22S1045 D2S441 SE33

D16S539

D18S51 D21S11 D3S1358 D8S1179 FGA TH01 vWA D19S433 D2S1338 D10S1248 D12S391 D1S1656 D22S1045 D2S441 SE33

D16S539

D18S51 D21S11 D3S1358 D8S1179 FGA TH01 vWA D19S433 D2S1338 D10S1248 D12S391 D1S1656 D22S1045 D2S441

D21S11

D3S1358 D8S1179 FGA THO1 vWA D5S818 TPOX D2S1338 D12S391

D18S51

D21S11 D3S1358 D8S1179 FGA THO1 vWA SE33

D16S539

D18S51 D21S11 D3S1358 D8S1179 FGA TH01 vWA CSF1PO D13S317 D5S818 D7S820 TPOX Penta-D Penta-E

D16S539

D18S51 D21S11 FGA CSF1PO D13S317 D7S820 D2S1338

D16S539

D18S51 D21S11 D3S1358 D8S1179 FGA THO1 vWA CSF1PO D13S317 D5S818 D7S820 TPOX D19S433 D2S1338

D16S539

D18S51 D21S11 D3S1358 D8S1179 FGA TH01 vWA CSF1PO D13S317 D5S818 D7S820 TPOX D19S433 D2S1338 D10S1248 D12S391 D1S1656 D22S1045 D2S441 Penta-D Penta-E SE33

CODIS + ECL

CODIS ECL OTHERS

I-DNA1 analyzes all the STRs included in the CODIS and 9 of 10 of the ECL, as well as amelogenin, from DNA fragments that do not exceed 300 bp. I-DNA1 stands out as the only system currently available that allows analyzing all the loci included in the CODIS by means of amplicons that do not exceed 300 bp and, like Bioplex-11, analyzes 10 loci included in the CODIS by means of amplicons not exceeding 200 bps. I-DNA2 analyzes 10 and 7 of the STRs included in the CODIS, as well as amelogenin, from DNA fragments that do not exceed 300 and 200 bps, respectively.

The combinations of STRs multiplexes of the prior art have the following performance from fragments that do not exceed 300 bp: MinifilerTM + Identifiler®, analyzes the entire CODIS [Luce, C., et al., 2009. J Forensic Sci , 54 (5): 1046-54; Mulero, J.J., et al., 2008. J Forensic Sci, 53 (4): 838-52]; MinifilerTM + NGM ™, analyzes 11 loci included in the CODIS [AmpFlSTR® NGM ™ PCR Amplification Kit User’s Guide. Applied Biosystems. 2009]; and PowerPlex® ESX + PowerPlex® ESY, analyzes 8 loci included in the CODIS [Hill, C.R., et al. 2010. April 22, Forensic Sci Int Genet]. In this sense, the combination of I-DNA1 with I-DNA2, allows to analyze 15 STR loci plus amelogenin from fragments that do not exceed 300 bp, and includes all the markers / loci of CODIS. This combination has a small size of amplicons, so that it has been specifically designed to enable the amplification of 13 STR loci, 12 of them included in the CODIS in DNA fragments that do not exceed 200 bp. It should be noted that the combination of I-DNA1 with I-DNA2, allows to analyze all the loci included in the CODIS by means of amplicons that do not exceed 229 bps.

Also, the reaction combinations have been designed so that they can allow duplicate genotyping of a certain number of loci. MinifilerTM combined with NGMTM allows duplicate amplification of 2 loci in the midiSTR format, while combined with Identifiler® it expands to 4 the number of loci analyzed in duplicate in the midiSTR format. Both combinations allow only genotyping in duplicate of amelogenin in fragments that do not exceed 200 bp. On the other hand, the combination of PowerPlex® ESX and ESY, allows duplicate analysis of 9 loci, 6 included in the CODIS, from fragments that do not exceed 300 bp and 4 loci, included in the CODIS and the ECL, from fragments that do not exceed 200 bp [Hill, CR, et al. 2010. April 22, Forensic Sci Int Genet]. The combination of I-DNA2 with I-DNA1, allows to analyze 10 STR loci plus amelogenin in duplicate, all of them included in the CODIS, by means of amplicons that do not exceed 300 bp and 5 STRs loci in

5 fragments that do not exceed 200 bp.

Comparative study of the ability to analyze highly degraded DNA samples of the primer sets of the present invention with respect to prior art methods.

10 The joint analysis of Identifiler® and Minifiler® is the state-of-the-art identification system with the highest performance in the analysis of STR loci included in CODIS, based on highly degraded extracts; (Mulero, JJ, et.al. 2008. J Forensic Sci, 53 (4): 838-852 and Luce et al., 2009. J Forensic Sci. 54 (5): 104654), considering the STR loci included in the CODIS Identifiler® * corresponds to power

15 of combined discrimination of the loci STRs D3S1358, D5S818, D8S1179, D19S433, TH01, TPOX and VWA, those of smaller size of amplified in that identification system and therefore those most likely to offer results in the analysis of extracts of Highly degraded DNA Minifiler® includes the analysis of the remaining 8 STR loci present in Identifiler® plus amelogenin.

20 Table 15 represents both separately and in combination, the combined probability of coincidence in different population groups of Identifiler® and Minifiler®, as well as of I-DNA1 and I-DNA2.

25 Table 15. Combined match probability of Identifiler® * (not including loci analyzed by Minifiler), Minifiler®, I-DNA1, I-DNA2 and Identifiler® (Id) or the combination between I-DNA1 + I-DNA2 ( since they include identical STRs loci).

Identifiler® Systems *

African Americans 2,01E-08 Caucasus 6,10E-08 Native Americans 7,32E-08 Hispanic 1.75E-07

Minifiler®

6.52E-11 8.21E-11 1.05E-10 2,08E-10

I-DNA2

5.64E-14 1.22E-13 1.74E-13 6.11E-13

I-DNA1

5.69E-17 1.86E-16 2.01E-16 8.43E-16

Id / I-DNA1 + 2

1.31E-18 5,01E-18 7.65E-18 3.62E-17

As can be seen in Table 15, the systems compared according to their probability of coincidence, from highest to lowest are: Identifiler® *, Minifiler®, I-DNA2, I-DNA1. The combination of I-DNA1 + I-DNA2 offers the same probability of coincidence as Identifiler®, and that the combination of this with MinifilerTM because

5 in both cases identical STRs loci are analyzed.

The comparison of the capacity of analysis of highly degraded samples of the system object of the invention with respect to the system of greater performance of the state of the art, was performed by the analysis by the 4 multiplex reactions of 10 samples of

10 DNA from tissues included in autopsy paraffin of the year 80. The results regarding the probability of coincidence and the number of STR loci of the profiles obtained by each system are detailed respectively in Tables 12 and 13. The alleles have been considered. exceeded 40RFUs (Relative Units of Fluorescence). In the absence of reference samples, it has been taken as a complete analysis of a STR

15 those cases in which it has been possible to obtain two alleles for the same sample or when in all the results obtained a single allele has been detected. In the case of D19S433, because no results have been achieved other than through Identifiler®, those cases in which a single allele has been detected have been taken as complete results, so it may be that the results for Identifiler®, like those who

20 combine the results obtained by combining Identifiler® and Minifiler® have been slightly overestimated compared to the rest of the systems compared.

Table 12. Probability of average coincidence after the analysis by different identification systems of DNA samples from 80 year paraffin. I-DNA1 + I-DNA2 DC, refers to the probability of coincidence of those loci analyzed in duplicate at combine I-

DNA1 and I-DNA2.

Systems

African Americans Caucasus American natives Hispanic

Identifiler® Minifiler®

0.018606312 3.50657E-09 0.025840157 3.19672E-09 0.021707915 4.04664E-09 0.025506154 5.8364E-09

I-DNA2 Identifiler® + Minifiler® I-DNA1

2.48349E-10 3.46271E-11 5.37458E-11 8.20714E-10 6.55755E-11 9.90932E-11 1.30969E-09 8.1612E-11 1.18376E-10 3.82184E-09 1.4143E-10 1.71206E-10

I-DNA1 + I-DNA2

1.11032E-15 3.11562E-15 4.73925E-15 1.93533E-14

I-DNA1 + I-DNA2 DC 0.003101053 0.004306698 0.003617991 0.004251035

As seen in Table 12, Identifiler® offers the highest probability of matching the systems compared. Minifiler® in turn, presents similar results to I-DNA2. The combination Identifiler® and Minifiler® offers a probability of coincidence similar to that obtained by I-DNA1. On the other hand, the combination I-DNA1 and I-DNA2 offer a probability of coincidence between 4 and 7 orders of magnitude less than that obtained by the combination Identifiler® and Minifiler®, and between 4 and 5 orders of magnitude less than that obtained by I-DNA1.

Similarly, regarding the number of STRs loci analyzed (Table 13, next page) Identifiler® offers the worst results among the systems compared, allowing only the complete analysis of an average of 2.9 STR loci plus amelogenin. Both Minifiler®, whereby an average of 8.4 loci (7.4 STR loci plus amelogenin) is obtained, as well as I-DNA2, whereby an average of 8.9 loci is obtained, (8 STR loci plus amelogenin , which could be completely genotyped in 6 and partially in 3 of the 10 samples analyzed) offer similar results in terms of the number of loci analyzed.

Through I-DNA1, an average of 11 complete loci (10 STR loci plus amelogenin) is obtained, which constitutes a superior performance to the rest of the systems compared, similar to that obtained by combining Identifiler® and Minifiler® on the same samples. Finally, the combination I-DNA1 and I-DNA2 offers the most complete genetic profiles, since it manages to genotypt an average of 14 loci (13 STR loci plus amelogenin). In addition, while the Identifiler® and Minifiler® combination allows genotyping in duplicate only the amelogenin sex locus, the combination of I-DNA1 and I-DNA2 results in duplicate genotyping of 5.8 complete loci (5.4 STR loci plus amelogenin in 6 cases of the 10 cases analyzed).

Table 13. Summary of results obtained after the analysis of 10 paraffin samples from the year 80, using I-DNA1, I-DNA2, I-DNA1 + I-DNA2, Minifiler®, Identifiler® and Minifiler® + Identifiler®. The figures under each identification system correspond to the number of loci (between STRs and amelogenin) C: completely analyzed, P: partially, N: no result, DC (double check, genotyped by both systems).

Sample

I-DNA2 I-DNA1 I-DNA1 + I-DNA2 Minifiler Identifiler Minifiler + Identifiler

C

P N C P N  C P N DC C P N C P N C P N DC

C

P  C P

1 71410 2314 1132 8 013013 10 1 5 10 2 91211 1314 1161 9 002113 10 1 5 10 3 90311 1314 1160 8 102113 9 2 5 10 4 72311 1314 1142 8 104012 11 1 4 10 5 91212 0315 0161 9 005011 13 0 3 10 6 10021203150170 9 005011 13 0 1210 7 10111203150171 7 203112 9 3 4 10 8 10111014131271 9 004210 12 2 2 10 9 91212 1215 0162 8 104012 11 1 4 1 10 92112 0315 0162 9 0070915 0 1 10

AVERAGE 8.9 1 2.1 11 0.7 3 14 0.5 1.1 5.8 1.2 8.4 0.5 0 3.9 0.5 12 11 1.1 4.5 10

DISCUSSION

The results related to the validation of I-DNA1, I-DNA2 and the combination of both are discussed in the tests for determining the percentage of stuttering alleles, relative intensity of heterozygous peaks (PHR), mixtures and sensitivity. Likewise, the results obtained in the comparative studies of the method of the invention and the methods of the prior art are discussed, both with respect to the design strategy and with respect to the capacity of analysis of loci included in the CODIS from samples of highly degraded DNA.

The estimation of the analytical capacity of a multiplex system requires assessing its sensitivity in the analysis of mixtures. Before proceeding to the test of mixtures it is necessary to evaluate the results obtained for percentage of stuttered alleles and PHR [Budowle, B., Onorato, AJ, Callaghan, TF, Della Manna, A., Gross, AM, Guerrieri, RA, Luttman, JC, & McClure, DL 2009b. J Forensic Sci, 54 (4): 810-821]. A high percentage of stuttering alleles can lead to misunderstandings in the interpretation of mixtures when confused with the “minor contributor” [Walsh PS, F.N., Reynolds R., 1996. Nucleic Acids Res, 24 (14): 2807-12]. In the same way, the inter-sample variability in the percentage of stuttering alleles can affect the performance in the resolution of mixtures. The percentage values of stuttering alleles of mean, median, standard deviation, minimum and maximum values of the method of the invention, conform to those obtained by other research groups in the validation of identification systems such as Minifiler® [Mulero, JJ, et al., 2008. J Forensic Sci, 53 (4): 838-52] and genRESMPX-3 [Schlenk, J., et al., 2004. Int J Legal Med, 118 (1): 55-61]. Together, the low percentages of stuttering alleles obtained for I-DNA1 and I-DNA2 help the correct genotyping of the samples, as well as the interpretation of mixtures.

On the other hand, the PHR values define the balance in the heterozygous amplification. For I-DNA1 and I-DNA2, an average PHR similar to that reported for MinifilerTM and Identifiler® (Applied Biosystems, Foster City, CA) is observed (85.86%, 87%, 87.87% and 86.87%, respectively). Regarding the homogeneity of PHR in the different loci, I-DNA1 and I-DNA2 show similar values and a lower standard mean deviation than that reported for MinifilerTM Kit PCR (Applied Biosystems, Foster

City, CA) (9.65 and 9.95, versus 33.47, respectively) [Mulero, J.J., et al., 2008. J Forensic Sci, 53 (4): 838-52]. I-DNA1 and I-DNA2 have not been compared with Identifiler® (Applied Biosystems, Foster City, CA) because no standard deviation data has been reported.

In the analysis of mixtures, the detection threshold depends on the number of contributors, their genetic profile and the amount of total DNA [Schlenk, J., et al., 2004. Int J Legal Med, 118 (1) : 55-61]. The low percentage of stuttering alleles, high PHR value and low standard deviation value thereof, determine that in mixtures of two contributors, both I-DNA1 and I-DNA2 allow the detection of a “minor contributor” at 1:20. I-DNA2 presents in the FGA loci, D13S317 and D7S820, a greater ability to analyze mixtures than I-DNA1, while this is lower in the vWA, D21S11 and D5S818 loci.

Therefore, the use of both systems on the same mixture of two-component DNA increases the ability to determine individual profiles with respect to that obtained by using a single system. Thus, it can be considered that, both I-DNA1 and I-DNA2 and especially the combination of both, have adequate characteristics both for the determination of the genotypes that make up a mixture, and to estimate the proportion in which they are found.

The sensitivity of a multiplex STR is decisive in obtaining STR profiles with a sufficient probability of coincidence [Budowle, B., A.J. Eisenberg, and A. van Daal, 2009. Croat Med J, 50 (3): 207-17]. Therefore, in the present invention, those experimental conditions in which I-DNA1 and I-DNA2 offer high sensitivity have been pursued. Both allow the amplification of all the STRs they contain from amounts of DNA of 100 pg, I-DNA1 of 14 STR loci plus amelogenin and I-DNA2 11 loci STR plus amelogenin. I-DNA1 even enables the analysis of 12 loci in samples with amounts of DNA in the range of 25 to 100 pg.

The sensitivity of I-DNA1 and I-DNA2 has been compared with that of other multiplex systems that include at least 13 CODIS STR loci, such as PowerPlex16 system (Promega® Corporation, USA) and Identifiler® (Applied Biosystems, Foster City ,

AC). Both systems require larger amounts of template DNA than I-DNA1 (250 pg) [Collins, P.J., et al., 2004. J Forensic Sci, 49 (6): 1265-77; Krenke, B.E., et al., 2002. J Forensic Sci, 47 (4): 773-85]. PowerPlex® 16 HS system (Promega® Corporation, USA), has a sensitivity superior to I-DNA1 and I-DNA2 by being able to amplify all of the STRs it includes from amounts of DNA greater than 62.5 pg, although on the contrary it requires larger amplifications for this, which reduces its performance in the analysis of highly degraded samples, as detailed in the comparative study of design strategies (PowerPlex® 16 HS system and PowerPlex® 16 contain identical primer sets).

Other widely used multiplex systems are genRESMPX-3 (Serac, Homburg, Germany), AmpFISTR Profiler Plus and AmpFISTR Cofiler multiplex Systems (Applied Biosystems, Foster City, CA), which also require larger amounts of template DNA than I-DNA1 ( 120 pg the first [Schlenk, J., et al., 2004. Int J Legal Med, 118 (1): 55-61] and 160 pg the second and third [LaFountain MJ, SM, Svete PA, Walkinshaw MA and Buel E, 2001. J Forensic Sci, 46: 9]).

DNA extracts analyzed in forensic laboratories are often characterized by containing very small amounts of DNA, which makes it difficult to obtain genetic profiles with a high probability of coincidence after analysis using a multiplex STR system. In this sense, the combination of I-DNA1 and I-DNA2 has been shown to be more effective in the analysis of scarce amounts of DNA, than the use of a single STR multiplex.

Thus, the combined analysis of I-DNA1 and I-DNA2 from 50 pg of DNA distributed in two 25 pg reactions, allows obtaining genetic profiles of 13 STRs loci and amelogenin, of which D13S317, vWA and amelogenin They are genotyped in duplicate. While the use of a single reaction, either I-DNA1 or I-DNA2, from amounts of 50 pg of DNA, allows the amplification of 11 or 8 STRs loci plus amelogenin, respectively.

The progressive improvement in sensitivity in extremely low DNA analysis has been mainly due to the high performance of the LCN genotyping (Low Copy

Number) It is important to note that LCN genotyping does not show the same reliability as conventional genotyping and that its application carries a greater risk of error and contamination [Budowle, B., A.J. Eisenberg, and A. van Daal, 2009. Croat Med J, 50 (3): 207-17], so the reliability of the LCN genotyping is based on the realization of several replicas so that the allele that has been registered at less twice, be incorporated into the results table [Taberlet, P., et al., 1996. Nucleic Acids Res, 24 (16): 3189-94].

In this sense, the main drawback of the combinations of reactions of the prior art is the small number of loci they share, both in midiSTR (<300 bp) and miniSTR (<200 bp) format. Thus, MinifilerTM combined with NGMTM allows duplicate amplification of 3 loci in midiSTR format, while combined with Identifiler® expands to 6 the number of loci analyzed in duplicate in midiSTR format. Both combinations allow only genotyping in duplicate of amelogenin in fragments that do not exceed 200 bp. The combination of PowerPlex® ESX and ESY, allows duplicate analysis of 10 loci, 7 included in the CODIS and in the ECL, in midiSTR format, and 3 loci, all of them included in the CODIS and in the ECL, in format miniSTR [Hill, CR, et al. 2010. April 22, Forensic Sci Int Genet].

The combination of I-DNA1 with I-DNA2, allows 10 STRs plus amelogenin loci to be analyzed in duplicate, all of them included in the CODIS, thus confirming the genetic profile obtained from DNA fragments that do not exceed 300 bp. This quality is of special interest in the analysis of highly degraded DNA samples and in the LCN genotyping, where profiles may have reduced reliability due to the low height of the peaks obtained. Likewise, both I-DNA1 and I-DNA2, as well as the combination of both reactions, have a reduced size of amplicons, in such a way that when combined, they allow the amplification in duplicate of 5 STRs loci, all included in the CODIS, from DNA fragments not larger than 200 bp.

Therefore, based on the sensitivity and the midiSTRs and miniSTRs loci analyzed both I-DNA1 and I-DNA2 and especially their combination constitute a highly effective tool for the confirmation of genetic profiles obtained by LCN genotyping, and especially from highly degraded samples whose DNA fragments do not exceed

the 300 bp and even the 200 bp, which suggests in this section a greater overall yield of the method of the invention than that of the other combinations of reactions of the state of the art.

The size of the amplicons of a STR multiplex system is critical for obtaining genetic profiles from highly degraded biological samples [Budowle, B.,

A.J. Eisenberg, and A. van Daal, 2009. Croat Med J, 50 (3): 207-17]. As observed in the comparative study of design strategies I-DNA1, I-DNA2 and the combination of both, have been specifically designed to obtain genomic profiles from small DNA fragments.

The STR multiplexes of the state of the art are characterized by their inability to analyze the set of loci that constitute the CODIS, from DNA fragments that do not exceed 300 bp. I-DNA1 stands out for being the only STR multiplex that allows analyzing all the loci included in the CODIS by means of amplicons that do not exceed 300 bp and 10 of them by means of amplicons that do not exceed 200 bp.

It should be noted that Bioplex-11 analyzes 8 CODIS loci by means of amplifications below 200 bp, although for this purpose it marks part of its primers with biotin which makes it possible to separate the amplified into two portions that are analyzed in independent electrophoresis and therefore allows to include a higher number of loci per PCR reaction. Therefore, it can be affirmed that, I-DNA1 increases the number of total loci and those included in the CODIS analyzed from DNA extracts that do not exceed 300 bp and even 200 bp, by means of a single reaction of PCR and a single capillary electrophoresis.

MinifilerTM (Applied Biosystems, Foster City, CA) is the highest performing system in the analysis of CODIS STRs from highly degraded DNA samples. In total, it amplifies 8 STRs plus amelogenin, 7 of them included in the CODIS, from DNA fragments that do not exceed 283 bp and amounts of DNA of 125 pg, while below 100 pg it usually offers partial results [Mulero, JJ, et al., 2008. J Forensic Sci, 53 (4): 838-52]. In comparison, I-DNA1 amplifies 15 loci including all of the CODIS and I-DNA2 12 loci including 10 STRs of the CODIS, both reactions with a 25 pg template DNA requirement lower than MinifilerTM. Even from fragments that do not exceed 229 bp, I-DNA2 is able to analyze as many STRs as all of those included in MinifilerTM and I-DNA1 analyzes 5 STRs more than these two reactions. In summary, the small size of the I-DNA1 and I-DNA2 amplicons added to their high sensitivity, suggest that the usefulness of these systems in analyzing STR loci included in the CODIS, from samples of highly degraded DNA samples and / or scarce, it is superior to the prior art methods.

Likewise, with the exception of the combination MinifilerTM and Identifiler®, the combinations of STRs multiplexes of the prior art, do not allow the analysis of all the loci included in the CODIS by means of amplicons that do not exceed 300 bp, so that the profiles of STRs that provide from highly degraded DNA extracts do not include the 13 STRs of the CODIS and therefore do not allow their comparison with that of all the STRs loci genotyped in the millions of genetic profiles stored in said base of data. In this way, MinifilerTM and Identifiler® constitute the most widely used combination of reactions currently used in the analysis of degraded samples and the one that shows the highest performance among the combinations of the state of the art in terms of loci analysis capability included in the CODIS from this type of samples. However, it is not possible to determine exactly the minimum required size of DNA fragments to analyze all the loci included in the CODIS through the combined use of MinifilerTM and Identifiler®, because they have not been published since the primers of these reactions use peptide connectors that alter the electrophoretic mobility of the amplified. According to the published graphic information, this minimum size is approximately 255 bp.

The combination of I-DNA1 and I-DNA2 has a small size of amplicons, so that it has been specifically designed to analyze the totality of loci included in the CODIS in fragments that do not exceed 229 bp, and even 13 STRs loci between those that include 12 of the 13 of the CODIS (5 of them in duplicate) in DNA fragments that do not exceed 200 bp. In total, this combination analyzes 15 STR loci plus amelogenin, 10 of them plus amelogenin in duplicate, from fragments that do not exceed 300 bp. Therefore, the design strategy of the present invention, in the absence of being able to be compared with the design of the combination MinifilerTM and Identifiler®, is a

improvement compared to other combinations of reactions developed to date, in performance and reliability, in the analysis of loci included in the CODIS from small DNA fragments.

The comparative analysis of the ability to analyze highly degraded DNA samples consisted of the analysis of paraffin samples characterized by the high fragmentation of their DNA, through: I-DNA1, I-DNA2, the combination of both, Identifiler® and MinifilerTM, as well as the combination of the latter two.

Identifiler®, due to the large size of its amplified ones, presents the worst results among all the systems compared, when analyzing 2.9 STR loci, with a probability of coincidence of approximately 10-2, which results in an insufficient reaction for its use as an identifying tool from highly degraded DNA. I-DNA2 and Minifiler®, show similar performance, both in the number of loci analyzed (8 STRs and 7.4 STRs, respectively), and in terms of probability of coincidence, in both cases of approximately 10-9.

I-DNA1, allows the analysis of 10 STR loci plus amelogenin with a probability of coincidence of 10-10 and therefore, through the use of I-DNA1 and from identical samples, the genetic profiles with the lowest probability of coincidence are obtained between the systems compared. I-DNA1 even provides genetic profiles of a lower probability of coincidence (10-10-10-11) than those provided by the combination of Identifiler® and Minifiler® (10-8-10-11) in 3 of the 4 population groups, Therefore, it can be affirmed that I-DNA1 achieves a higher yield than the rest of the methods compared, in terms of ability to analyze loci included in CODIS from highly degraded DNA samples.

Likewise, the combination I-DNA1 and I-DNA2 offers genetic profiles of greater reliability than the combination of Identifiler® and Minifiler®, both in number of loci, when analyzing 13 STR loci plus amelogenin (12 included in the CODIS), regarding the 10 STRs plus amelogenin (8 included in the CODIS), as in the probability of coincidence that reaches values of 10-14-10-15, compared to 10-8-10-11 of the combination of Identifiler® and Minifiler ®.

Similarly, as for duplicate genotyping of a series of STRs loci to the I-DNA1 + I-DNA2 combination, it offers greater performance than the MinifilerTM + Identifiler® combination, since while the latter allows duplicate genotyping

5 only the amelogenin sex locus, the combination I-DNA1 and I-DNA2 allows genotyping in duplicate of 5.4 STR loci that provide in themselves a probability of coincidence of 10-3, lower than that obtained in the analysis of Paraffin samples using Identifiler®.

10 In conclusion, the results obtained in the present validation both in the mixtures and sensitivity tests, as in the comparative studies of design strategies and analysis of highly degraded DNA samples, demonstrate that the present invention constitutes a substantial improvement over to the state of the art in terms of performance and reliability in analysis of STR loci included in the CODIS from DNA samples

15 highly degraded.

Claims (24)

one.

A method to obtain the genetic profile of an individual, to determine kinship relationships between individuals or to identify human remains comprising the analysis of STR loci in a DNA extract from said individual or said human remains by at least one reaction. of multiplex amplification, wherein the primer pairs of said multiplex amplification reaction comprise the oligonucleotide pairs SEQ ID NO: 1 and SEQ ID NO: 2 (CSF1PO), SEQ ID NO: 3 and SEQ ID NO: 4 (FGA) , SEQ ID NO: 5 and SEQ ID NO: 6 (TPOX), SEQ ID NO: 7 and SEQ ID NO: 8 (D18S51), SEQ ID NO: 9 and SEQ ID NO: 10 (VWA), SEQ ID NO: 11 and SEQ ID NO: 12 (TH01), SEQ ID NO: 13 and SEQ ID NO: 14 (D21S11), SEQ ID NO: 15 and SEQ ID NO: 16 (D7S820), SEQ ID NO: 17 and SEQ ID NO : 18 (D2S1338), SEQ ID NO: 19 and SEQ ID NO: 20 (D13S317), SEQ ID NO: 21 and SEQ ID NO: 22 (Amelogenin), and SEQ ID NO: 23 and SEQ ID NO: 24 (D5S818 ).

2.

A method according to claim 1, wherein the analysis of STRs loci further comprises a second multiplex amplification reaction of the DNA extract from said individual or said human moieties, wherein the primer pairs of said second multiplex amplification reaction comprise a pair of primers characterized by:

- amplify one of the amplified locus in the first amplification reaction and -one of the primers of the couple has a nucleotide sequence different from the nucleotide sequence of the couple of primers that amplifies the same locus in the first amplification reaction.

3.

Method according to claim 2, wherein the primer pairs of the second multiplex amplification reaction are selected from the oligonucleotide pairs SEQ ID NO: 25 and SEQ ID NO: 26 (CSF1PO), SEQ ID NO: 3 and SEQ ID NO: 47 (FGA), SEQ ID NO: 42 and SEQ ID NO: 43 (D18S51), SEQ ID NO: 32 and SEQ ID NO: 33 (VWA), SEQ ID NO: 30 and SEQ ID NO: 31 (D21S11 ), SEQ ID NO: 15 and SEQ ID NO: 29 (D7S820), SEQ ID NO: 44 and SEQ ID NO: 45 (D13S317), SEQ

ID NO: 46 and SEQ ID NO: 22 (Amelogenin) and SEQ ID NO: 27 and SEQ ID NO: 28 (D5S818).

Four.

Method according to claim 2 or 3, wherein the second multiplex amplification reaction additionally comprises at least 1, 2, 3, 4 or 5 of the primer pairs selected from the oligonucleotide pairs SEQ ID NO: 5 and SEQ ID NO: 6 (TPOX), SEQ ID NO: 11 and SEQ ID NO: 12 (TH01), SEQ ID NO: 34 and SEQ ID NO: 35 (D8S1179), SEQ ID NO: 36 and SEQ ID NO: 37 (D19S433) and SEQ ID NO: 38 and SEQ ID NO: 39 (D16S539).

5.

 Method according to any one of claims 1 to 4, wherein the melting temperature of the multiplex amplification reaction comprising oligonucleotides SEQ ID NO: 1 to SEQ ID NO: 24 is between 58 and 60 ° C.

6. Method according to claim 3 or 4, wherein

(i)

 the hybridization temperature of the multiplex amplification reaction comprising oligonucleotides SEQ ID NO: 1 to SEQ ID NO: 24 is between 58 and 60 ° C, and

(ii)

 the hybridization temperature of the multiplex amplification reaction comprising the second multiplex amplification reaction is between 57 and 63 ° C.

7.

Method according to any one of claims 1 to 6, wherein one of the oligonucleotides of each pair of primers is labeled at one of its ends.

8.

Method according to claim 7, wherein the compounds used in the labeling of the oligonucleotides select from the group consisting of a radioisotope, a fluorescent material, digoxigenin and biotin.

9.

Method according to claim 8, wherein the fluorescent material is selected from the group consisting of 5-carboxyfluorescein (5-FAM), 6-FAM, t-FAM tetrachlorinated analog (TET), 6-FAM hexachlorinated analog (HEX) , 6-carboxytetramethylrodamine (TAMRA), 6-carboxy-X-rhodamine (ROX), 6-carboxy-4 ', 5'

dichloro-2 ’, 7’-dimethoxyfluorescein (JOE), NED (ABI), Cy-3, Cy-5, Cy-5.5, fluorescein-6-isothiocinate (FITC) and tetramethylrodamine-5-isothiocinate (TRITC).

10.

 Method according to any one of claims 1 to 9, wherein the DNA extract comes from a sample of blood, hair, saliva, epidermis, sperm, dandruff, ashes, a vaginal sample and a tissue sample.

eleven.

 Kit comprising primer pairs comprising oligonucleotide pairs SEQ ID NO: 1 and SEQ ID NO: 2 (CSF1PO), SEQ ID NO: 3 and SEQ ID NO: 4 (FGA), SEQ ID NO: 5 and SEQ ID NO: 6 (TPOX), SEQ ID NO: 7 and SEQ ID NO: 8 (D18S51), SEQ ID NO: 9 and SEQ ID NO: 10 (VWA), SEQ ID NO: 11 and SEQ ID NO: 12 ( TH01), SEQ ID NO: 13 and SEQ ID NO: 14 (D21S11), SEQ ID NO: 15 and SEQ ID NO: 16 (D7S820), SEQ ID NO: 17 and SEQ ID NO: 18 (D2S1338), SEQ ID NO: 19 and SEQ ID NO: 20 (D13S317), SEQ ID NO: 21 and SEQ ID NO: 22 (Amelogenin), and SEQ ID NO: 23 and SEQ ID NO: 24 (D5S818).

12.

Kit according to claim 11, further comprising a pair of primers characterized in that:

- amplifies one of the locus amplified by the primer pairs of claim 11 and -one of the primers of the couple has a nucleotide sequence other than the nucleotide sequence of the primer pairs of claim 11 which amplifies the same locus.

13.

 Kit according to claim 13, wherein the primer pairs are selected from the group consisting of the oligonucleotide pairs SEQ ID NO: 25 and SEQ ID NO: 26 (CSF1PO), SEQ ID NO: 3 and SEQ ID NO: 47 ( FGA), SEQ ID NO: 42 and SEQ ID NO: 43 (D18S51), SEQ ID NO: 32 and SEQ ID NO: 33 (VWA), SEQ ID NO: 30 and SEQ ID NO: 31 (D21S11), SEQ ID NO: 15 and SEQ ID NO: 29 (D7S820), SEQ ID NO: 44 and SEQ ID NO: 45 (D13S317), SEQ ID NO: 46 and SEQ ID NO: 22 (Amelogenin) and SEQ ID NO: 27 and SEQ ID NO: 28 (D5S818).

14.

 Kit according to claim 12 or 13 further comprising at least 1, 2, 3, 4, 5 or 6 of the primer pairs selected from the oligonucleotide pairs SEQ ID NO: 5 and SEQ ID NO: 6 (TPOX ), SEQ ID NO: 11 and SEQ ID NO: 12 (TH01), SEQ ID NO: 34 and SEQ ID NO: 35 (D8S1179), SEQ ID NO: 36 and SEQ ID NO: 37 (D19S433), SEQ ID NO : 38 and SEQ ID NO: 39 (D16S539) and, SEQ ID NO: 40 and SEQ ID NO: 41 (D3S1358).

fifteen.

Kit according to any of claims 11 to 14, which further comprises the reagents necessary to label the primer pairs.

16.

 Kit according to any of claims 11 to 15, wherein one of the oligonucleotides of each pair of primers is labeled at one of its ends.

17.

 Kit according to claim 15 or 16, wherein the compounds employed in the labeling of the oligonucleotides select from the group consisting of a radioisotope, a fluorescent material, digoxigenin and biotin.

18.

 Kit according to claim 17, wherein the fluorescent material is selected from the group consisting of 5-carboxyfluorescein (5-FAM), 6-FAM, t-FAM tetrachlorinated analog (TET), 6-FAM hexachlorinated analog (HEX) , 6-carboxytetramethylrodamine (TAMRA), 6-carboxy-X-rhodamine (ROX), 6-carboxy-4 ', 5'-dichloro-2', 7'-dimethoxyfluorescein (JOE), NED (ABI), Cy-3, Cy- 5, Cy-5.5, fluorescein-6-isothiocinate (FITC) and tetramethylrodamine-5-isothiocinate (TRITC).

19.

 Use of a kit according to any of claims 11 to 18 to obtain the genetic profile of an individual, to determine kinship relationships between individuals or to identify human remains.

twenty.

 A set of primer pairs comprising the following oligonucleotide pairs SEQ ID NO: 1 and SEQ ID NO: 2 (CSF1PO), SEQ ID NO: 3 and SEQ ID NO: 4 (FGA), SEQ ID NO: 5 and SEQ ID NO: 6 (TPOX), SEQ ID NO: 7 and SEQ ID NO: 8 (D18S51), SEQ ID NO: 9 and SEQ ID NO: 10 (VWA), SEQ ID NO: 11 and SEQ ID NO: 12 ( TH01), SEQ ID NO: 13 and SEQ ID NO: 14 (D21S11), SEQ ID NO: 15 and SEQ

ID NO: 16 (D7S820), SEQ ID NO: 17 and SEQ ID NO: 18 (D2S1338), SEQ ID NO: 19 and SEQ ID NO: 20 (D13S317), SEQ ID NO: 21 and SEQ ID NO: 22 ( Amelogenin), and SEQ ID NO: 23 and SEQ ID NO: 24 (D5S818).

twenty-one.

 Use of a set of primer pairs according to claim 20 to obtain the genetic profile of an individual, to determine kinship relationships between individuals or to identify human remains.

22

 A pair of primers selected from oligonucleotide pairs consisting of SEQ ID NO: 1 and SEQ ID NO: 2 (CSF1PO), SEQ ID NO: 3 and SEQ ID NO: 4 (FGA), SEQ ID NO: 5 and SEQ ID NO: 6 (TPOX), SEQ ID NO: 7 and SEQ ID NO: 8 (D18S51), SEQ ID NO: 9 and SEQ ID NO: 10 (VWA), SEQ ID NO: 11 and SEQ ID NO: 12 (TH01), SEQ ID NO: 13 and SEQ ID NO: 14 (D21S11), SEQ ID NO: 15 and SEQ ID NO: 16 (D7S820), SEQ ID NO: 17 and SEQ ID NO: 18 (D2S1338), SEQ ID NO: 19 and SEQ ID NO: 20 (D13S317), SEQ ID NO: 21 and SEQ ID NO: 22 (Amelogenin), SEQ ID NO: 23 and SEQ ID NO: 24 (D5S818), SEQ ID NO: 25 and SEQ ID NO: 26 (CSF1PO), SEQ ID NO: 27 and SEQ ID NO: 28 (D5S818), SEQ ID NO: 15 and SEQ ID NO: 29 (D7S820), SEQ ID NO: 30 and SEQ ID NO: 31 (D21S11), SEQ ID NO: 32 and SEQ ID NO: 33 (VWA), SEQ ID NO: 34 and SEQ ID NO: 35 (D8S1179), SEQ ID NO: 36 and SEQ ID NO: 37 (D19S433), SEQ ID NO: 38 and SEQ ID NO: 39 (D16S539), SEQ ID NO: 40 and SEQ ID NO: 41 (D3S1358), SEQ ID NO: 42 and SEQ ID NO: 43 (D18S51), SEQ ID NO: 44 and SEQ ID NO: 45 (D13S 317), SEQ ID NO: 46 and SEQ ID NO: 22 (Amelogenin), and SEQ ID NO: 3 and SEQ ID NO: 47 (FGA).

2. 3.

 Use of a pair of primers according to claim 22 to obtain the genetic profile of an individual, to determine kinship relationships between individuals or to identify human remains.

SPANISH OFFICE OF THE PATENTS AND BRAND Application no .: 201031270 SPAIN Date of submission of the application: 19.08.2010 Priority Date: REPORT ON THE STATE OF THE TECHNIQUE 51 Int. Cl.: C12Q1 / 68 (2006.01) RELEVANT DOCUMENTS

Category

56 Documents cited Claims Affected

X

WO 2009059049 A1 (APLLIED BIOSYSTEM INC) 07.05.2009, the whole document. 1-23

X

WO 0192575 A1 (OLIGOTRAIL LLC) 06.12.2001, the whole document. 1-23

X

WO 0031306 A2 (PROMEGA CORP.) 02.06.2000, the whole document. 1-23

X

ZUÑIGA J. et al. “Allele frequencies for 15 autosomal STR loci and admixture estimates in Puerto 1-23

Rican Americans. " FORENSIC SCIENCE INTERNATIONAL. 12.12.2006. Vol. 164, No. 2-3, pages 266-270. ISSN 0379-0738.

X

COBLE M. D. et al. “Characterization and performance of new MiniSTR loci for typing degraded samples”. INTERNATIONAL CONGRESS SERIES. 04.01.2006. Vol. 1288, pages 504-506. ISSN 0531-5131. 1-23

Category of the documents cited X: of particular relevance Y: of particular relevance combined with other / s of the same category A: reflects the state of the art O: refers to unwritten disclosure P: published between the priority date and the date of priority submission of the application E: previous document, but published after the date of submission of the application

This report has been prepared • for all claims • for claims no:

Date of realization of the report 26.03.2012

Examiner J. Manso Tomico Page 1/4

REPORT OF THE STATE OF THE TECHNIQUE Application number: 201031270 Minimum documentation sought (classification system followed by classification symbols) C12Q Electronic databases consulted during the search (name of the database and, if possible, terms of search used) INVENES, EPODOC, WPI, EMBASE, BIOSIS, MEDLINE, NPL State of the Art Report Page 2/4  WRITTEN OPINION Application number: 201031270 Date of Written Opinion: 26.03.2012 Statement

Novelty (Art. 6.1 LP 11/1986)

Claims Claims 1-23 IF NOT

Inventive activity (Art. 8.1 LP11 / 1986)

Claims Claims 1-23 IF NOT

The application is considered to comply with the industrial application requirement. This requirement was evaluated during the formal and technical examination phase of the application (Article 31.2 Law 11/1986).  Opinion Base.- This opinion has been made on the basis of the patent application as published. State of the Art Report Page 3/4  WRITTEN OPINION Application number: 201031270 1. Documents considered.- The documents belonging to the state of the art taken into consideration for the realization of this opinion are listed below.

Document

Publication or Identification Number publication date

D01

WO 2009059049 A1 (APLLIED BIOSYSTEM INC) 05.07.2009

D02

WO 0192575 A1 (OLIGOTRAIL LLC) 06.12.2001

D03

WO 0031306 A2 (PROMEGA CORP.) 02.06.2000

D04

ZUÑIGA J. et al. "Allele frequencies for 15 autosomal STR loci and admixture estimates in Puerto Rican Americans." FORENSIC SCIENCE INTERNATIONAL. 12.12.2006. Vol. 164, No. 2-3, pages 266-270. ISSN 0379-0738.

D05

COBLE M. D. et al. “Characterization and performance of new MiniSTR loci for typing degraded samples”. INTERNATIONAL CONGRESS SERIES. 04.01.2006. Vol. 1288, pages 504-506. ISSN 0531-5131.

2. Statement motivated according to articles 29.6 and 29.7 of the Regulations for the execution of Law 11/1986, of March 20, on Patents on novelty and inventive activity; quotes and explanations in support of this statement The present application discloses a combination of primer pairs for the identification of a STR marker profile, which, used in a multiplex amplification reaction on a DNA extract from an individual, allows obtaining genetic profiles with a high discrimination power from of highly degraded DNA extracts. D01 discloses a method comprising: (a) the co-amplification of a locis set of a DNA sample by a multiplex amplification reaction, where the locis set comprises 10 STR loci D16S539, D18S51, D19S433, D21S11, D2S1338, D3S1358, D8S1179, FGA, TH01, VWA; and one more among the following STR loci: D10S1248, D12S391, D1S1656, D22S1045, and D2S441; and (b) the evaluation of the amplified alleles to determine the genetic profile present in the analyzed sample. D02 describes methods and materials for simultaneous amplification of at least 13 STR markers, included in CODIS, in a simple multiplex reaction, whose amplicon sizes exceed 360 bp. In D03 a rapid method is described for determining the length of the allele fragments present in a plurality of loci in a sample containing DNA comprising (a) obtaining a sample containing DNA, b) amplifying by multiplex PCR a plurality of loci comprising FGA, vWA, TH01, TPOX, CSF1PO, D3S1358, D5S818, D7S820, D8S1179, D13S317, D16S539, D18S51 and D21S11, where said multiplex PCR reaction is carried out using a plurality of primer pairs, where at least, one primer of each pair of primers is labeled with a detectable label, and the amplification produces a mixture of labeled amplicons, and (c) electrophoresis analyzing said mixture of amplicons loci, where said stage of analysis allows the determination of the length of the fragments of the alleles in said plurality of loci of the sample containing DNA. D04 describes a work where the allele frequency of 15 STR markers was determined, specifically: CSF1PO, FGA, THO1, TPOX, VWA, D3S11358, D5S818, D7S820, D8S1179, D13S317, D16S539, D18S51, D21S11, D19S383 and D2S133, making use of the AmpFlSTR Kit Kit, verifying the usefulness of the method in comparative ethnic studies, as well as in paternity studies, and identification in the forensic field. Finally, D05 discloses a study describing 10 mini STR markers not included in the CODIS for the amplification of small DNA samples in degraded samples such as blood spots or hair pieces. The difference between D01 and the object of the present application. it would be the different combination of the STR markers analyzed. The technical effect resulting from the difference would be the increase in the reliability of the results on degraded DNA samples, or where the initial starting quantity was low. Therefore, the technical problem that the invention intends to solve would be the provision of a methodology for obtaining genetic profiles where the analysis of a high number of STR markers is carried out. The proposed solution would be the combination of the pairs of claimed oligos that allow the identification of the STR loci grouped in the sets identified as I-DNA1, I-DNA2, of the present application None of the documents of the prior art discloses a combination STR markers identical to those claimed, so claims 1-23 would meet the requirement of novelty as mentioned in art. 6 of law 11/1986. However, such claims do not appear to be inventive. Since different databases are known that contain different loci for obtaining genetic profiles such as CODIS (Combined DNA Index System), or the European and United Kingdom databases (description page 1), it would be obvious the addition and combination of different loci that appear in these databases as alternatives to existing STR loci sets when faced with the problem of improving the identification of genetic profiles in degraded DNA samples. Once selected the STR loci to analyze both the design of the oligonucleotides used to amplify each loci, and the optimization of the conditions to carry out the appropriate methodology, they would lack inventive activity, since it is something that is routine matter within the scope of experimentation of this type of amplification methods, as can be seen in the different documents of the prior art cited. Likewise, Kit's claims would not be inventive since the inclusion of a combination of non-inventive STR amplifying oligonucleotides does not make the Kits inventive. Therefore, claims 1-23 would not meet the requirement of inventive activity as mentioned in art. 8 of law 11/1986. State of the Art Report Page 4/4