ES2373047T3 - STABILIZED APTAMERS FOR GROWTH FACTOR DERIVED FROM PLATES AND ITS USE AS ONCOLOGICAL THERAPEUTIC AGENTS. - Google Patents

Abstract

A PDGF specific aptamer comprising the following structure: wherein indicates a linker Aptamer = 5'dCdCdCdAdGdGdCdTdAdCmG (SEQ ID NO: 69) - PEG-dCdGdTdAmGdAmGdCdAmUmCmA (SEQ ID NO: 40) - PEG - dTdGdAdTmCdCdTmGmGmG-3T-3 '( SEQ ID NO: 70); in which d denotes a deoxy-nucleotide, m denotes a 2'-OMe-nucleotide, PEG denotes a PEG spacer and 3T denotes an inverted deoxy-thymidine cap.

Description

Stabilized aptamers for platelet-derived growth factor and its use as oncological therapeutic agents

FIELD OF THE INVENTION

[0001] The invention generally relates to the field of nucleic acids and more particularly to aptamers that can bind to platelet-derived growth factor ("PDGF") useful as therapeutic agents in oncology and / or other diseases or disorders in which PDGF participates. The invention further relates to materials and methods for the administration of aptamers that can bind to the platelet-derived growth factor.

BACKGROUND OF THE INVENTION

[0002] Aptamers are nucleic acid molecules that have specific binding affinity for molecules by interactions other than classical Watson-Crick base pairing.

[0003] Aptamers, like peptides generated by phage expression or monoclonal antibodies ("mAbs"), can specifically bind to selected targets and modulate target activity or binding interactions, for example, by binding Aptamers can block the functioning of your target's capacity. Discovered by an in vitro selection method of oligonucleotide sets of random sequences, aptamers have been generated for more than 130 proteins that include growth factors, transcription factors, enzymes, immunoglobulins and receptors. A typical aptamer is 10-15 kDa in size (20-45 nucleotides), binds to its target with nanomolar affinity to subnanomolar and discriminates against closely related targets (for example, aptamers will not normally bind to other proteins of the same family of genes). A series of structural studies have shown that aptamers can use the same types of binding interactions (e.g., hydrogen bonds, electrostatic complementarities, hydrophobic contacts, steric exclusion) that trigger affinity and specificity in immunocomplexes.

[0004] Aptamers have several desirable characteristics for use as therapeutic (and diagnostic) agents that include high specificity and affinity, biological efficacy and excellent pharmacokinetic properties. In addition, they offer specific competitive advantages over antibodies and other protein biological agents, for example:

[0005] 1) Speed and control. The aptamers are produced by a completely in vitro procedure that allows the rapid generation of initial serial heads, which include therapeutic serial heads. In vitro selection allows the specificity and affinity of the aptamer to be thoroughly controlled and allows the generation of serial heads against both toxic and non-immunogenic targets.

[0006] 2) Toxicity and immunogenicity. Aptamers as a class have demonstrated therapeutically acceptable toxicity and lack immunogenicity. While the efficacy of many monoclonal antibodies may be severely limited by the immune response to the antibodies themselves, it is extremely difficult to elicit antibodies directed against aptamers, most likely because aptamers cannot be presented by T lymphocytes using the MHC and Immune response is generally trained to not recognize nucleic acid fragments.

[0007] 3) Administration. While most of the currently approved antibody therapeutic agents are administered by intravenous infusion (usually for 2-4 hours), aptamers can be administered by subcutaneous injection (the bioavailability of the aptamer by subcutaneous administration is> 80% in mono studies ( Tucker et al., J. Chromatography B. 732: 203-212, 1999)). With good solubility (> 150 mg / ml) and comparatively low molecular weight (aptamer: 10-50 kDa; antibody: 150 kDa), a weekly dose of aptamer can be administered by injection in a volume of less than 0.5 ml. In addition, the small size of the aptamers allows them to penetrate the area of conformational limitations that does not allow antibodies or antibody fragments to penetrate, which still has another advantage of therapeutic agents based on aptamers or prophylaxis.

[0008] 4) Scalability and cost. Therapeutic aptamers are chemically synthesized and therefore can be easily scaled as needed to meet the production demand. While production scaling difficulties are currently limiting the availability of some biological agents and the capital cost of a large-scale protein production plant is enormous, a single large-scale oligonucleotide synthesizer can produce more than 100 kg / year and requires a relatively modest initial investment. The current cost of articles for the synthesis of aptamers at the kilogram scale is estimated at $ 500 / g, comparable to highly optimized antibodies. Continuous improvements are expected in the development of procedures to reduce the cost of the items to <$ 100 / g in five years.

[0009] 5) Stability. Therapeutic aptamers are chemically consistent. They are intrinsically adapted to recover activity after exposure to factors such as heat and denaturants and can be stored for prolonged periods (> 1 year) at room temperature as lyophilized powders.

Interstitial fluid pressure

[0010] The three most common types of cancer treatment are surgical removal of cancerous tissue, radiation therapy to destroy cancerous tissue, and chemotherapy. These treatments aim to remove cancer tissues or cells or destroy them in the body with therapeutic agents or other agents. Chemotherapy remains an important treatment modality for solid tumors. To possibly reduce toxic side effects and to achieve greater efficacy of chemotherapeutic drugs, strategies to improve drug distribution between normal tissues and tumors are highly desirable.

[0011] A major obstacle in the treatment of solid tumors is the limited uptake of therapeutic agents in tumor tissue. High interstitial fluid ("PLI") pressure is one of the physiologically characteristic properties of solid tumors that differ from healthy connective tissue and is considered to be the main obstacle that limits the free diffusion of therapeutic agents in solid tumors. PDGF receptors, particularly PDGF-�, participate in the regulation of PLI. When a tumor enters a hyperproliferative state, the oxygen that supplies the blood and other nutrients cannot continue with the demands of the tumor and results in a state of hypoxia. Hypoxia triggers an "angiogenic change" that regulates by increasing the expression of several factors, including VEGF and PDGF, which in turn serve to initiate angiogenesis. However, the resulting angiogenesis forms an abnormal tumor vasculature. The tumor vasculature is disturbed to the point that it cannot adequately drain excess fluid from the interstitium and the accumulation of fluid swells the elastic interstitial matrix causing an increase in pressure. If the pressure exceeds the resistance of the capillary wall, compression occurs and the resistance to blood circulation increases.

[0012] This property has been suggested for most solid tumors, tumor interstitial hypertension

or elevated PLI, as a possible target for an effort to increase drug uptake by the tumor (Jain et al., (1987) Cancer Res., 47: 3039-3051). Elevated PLI acts as a barrier to transvascular transport (Jain et al. (1997), Adv. Drug Deliv. Rev. 26: 71-90). It has been shown that the reduction of tumor PLI, or modulation of microvascular pressure, increases the transvascular transport of antibodies that choose tumor as a target or low molecular weight tracer compounds (Pietras et al., (2001), Cancer Res., 61 , 2929-2934). The etiology of interstitial hypertension in tumors is poorly understood. One proposed theory is that the lack of lymphatic vessels in tumors is a contributing factor to the increase in tumor PLI (Jain et al. (1987), Cancer Res., 47: 3039-3051). Another proposed theory is that microvasculature and the support stroma compartment are likely to be important determinants for tumor PLI (Pietras et al. (2002) Cancer Res., 62: 5476-5484). There is increasing evidence of PDGF transmembrane receptor tyrosine kinase as a possible target for pharmacological therapeutic agents to modulate tumor interstitial hypertension. Among other possible targets are the growth factors that bind to the PDGF receptor.

PDGF-mediated cancer

[0013] In addition to PLI and the difficulty of penetrating tumors with therapeutic agents, another obstacle in cancer treatment is mutations in certain forms of cancer mediated by PDGF that lead to constitutive expression of PDGF. These mutations trigger the proliferation of abnormal cells that produce the various forms of cancer as shown in Figure 1 (Pietras et al., (2001), Cancer Res., 61, 2929-2934). A genetic mutation causes the amplification of PDGF-a receptors in high-grade glioblastomas. In chronic myelomonocytic leukemia (CMLL), constitutive activation of PDGF-� receptors results from a mutation that causes fusion of � receptors with proteins other than PDGF (Golub et al. (1994) Cell 77, 30 7-316, Magnusson et al., (2001) Blood 100, 623-626). The constitutive activation of the PDGF-a receptor due to the activation of point mutations has also been identified in patients with gastrointestinal stromal tumors (GIST) (Heinreich et al. (2003) Science 299, 708-710). Protuberant dermatofibrosarcoma (DFSP) is associated with the constitutive production of fusion proteins that are processed in PDGF-BB (O'Brian et al., (1998) Gene Chrom. Cancer 23, 187-193; Shimiziu et al. (1999 ) Cancer Res. 59. 3719-3723; Simon et al. (1997) Nat. Genet., 15, 95-98). In addition to constitutive activation of the PDGF ligand and / or receptor due to mutations, regulation has been shown by increasing soft tissue sarcomas and gliomas (Ostman and Heldin, (2001), Adv. Cancer Res. 80, 1-38) .

PDGF

[0014] Growth factors are substances that have a proliferative effect of cells on cells or tissues. A given growth factor may have more than one receptor or induce cell proliferation in more than one cell line or tissue. PDGF belongs to the family of cysteine knot growth factors and was originally isolated from platelets to promote mitogenic and migratory cell activity. PDGF is a strong mitogen and has a fundamental function in the regulation of normal cell proliferation such as fibroblasts, smooth tissue cells, neuroglia cells and connective tissue cells. In addition, PDGF mediates pathological cell growth such as proliferative disorders, and also plays a role in angiogenesis. Another growth factor involved in tumor angiogenesis is vascular endothelial growth factor (VEGF).

[0015] Four PDGF polypeptide chains have been identified which are currently known to constitute five dimeric PDGF isoforms: PDGF-AA, -BB, -CC, -DD and -AB. The most abundant species are PDGF-AB and -BB. PDGF isoforms bind to a and tyrosine kinase receptors. PDGF receptors are expressed by many different types of cells within tumors. The binding of PDGF isoforms to their related receptors induces the dimerization and subsequent phosphorylation of specific residues in the intracellular tyrosine kinase domain of the receptors and the activation of the signaling pathway. The isoforms of PDGF -AA, -BB, -CC and -AB induce dimerization of PDGF a receptors. PDGF-BB and PDGF-DD activate the dimerization of PDGF receptors. All PDGF isoforms, except PDGF-AA, activate both a and cell receptors that express both types of receptors (Figure 2). Because they are potent mitogens, PDGF isoforms have been chosen as the target for the development of therapeutic agents for proliferative disease such as cancer, diabetic retinopathy, glomerulonephritis and restenosis.

[0016] PDGF, which is secreted by endothelial cells, acts as a direct mitogen for fibroblasts, recruits pericytes and stimulates vascular cells of smooth tissue. Many solid tumors show paracrine signaling of PDGF in the tumor stroma. It is known that PDGF regulates by increasing the synthesis of collagen and a half in interactions of anchor proteins such as integrins with extracellular matrix components (ECM). The PDGF interactions between connective tissue, ECM and intracellular actin filament systems produce an increase in tensile strength that contributes to high PLI. High PLI is located at the tumor site and is associated with a poor prognosis in human cancers as it increases with the size and severity of the tumor and the degree of malignancy. The function of PDGF signaling in the control of PLI and the expression regulated by increase in various solid tumors has promoted the investigation of whether inhibition of PDGF signaling can decrease PLI and thus increase drug uptake in solid tumors. Previous work has shown that inhibition of PDGF signaling with small molecule receptor antagonists and a specific PDGF aptamer decreases interstitial fluid pressure and increases the uptake of chemotherapeutic agents in solid tumors (Pietras et al., (2001 ), Cancer Res., 61: 2929-2934). WO 01/87351 A describes a method for treating solid tumors comprising administering a composition of a PDGF aptamer and a cytotoxic agent. The PDGF aptamer was identified using the SELEX procedure. A method for reducing the interstitial fluid pressure of a solid tumor is described, which comprises administering a PDGF aptamer. A method for increasing the uptake of cytotoxic agents in a tumor comprising administering a composition comprising a PDGF aptamer and a cytotoxic agent is also described.

US-B1-6 229 002 discloses a method for preparing a complex consisting of a PDGF nucleic acid ligand and a high-weight non-immunogenic molecular compound or lipophilic compound identifying a PDGF nucleic acid ligand by SELEX methodology and associating the PDGF nucleic acid ligand with a high-weight non-immunogenic molecular compound or lipophilic compound.

WO 2004/064760 discloses therapeutic compositions of nucleic acid that are reported to bind cytokines, growth factors and cell surface proteins, individually or in combinations of two or more, and methods for administering these therapeutic nucleic acid agents. in the treatment of glaucoma and other proliferative diseases of the eye. WO2004 / 050899 describes materials and methods for producing therapeutic agents of aptamers having modified triphosphate nucleotides incorporated into their sequence. It is established that the aptamers produced by the methods of the invention have a high stability and half-life.

Pietras et al. (Inhibition of PDGF receptor signaling in tumor stroma enhances antitumor effect of chemotherapy; Cancer Research, USA, vol 62, no. 19, October 1, 2002, pages 5476-5484) investigate the effects of PDGF antagonists on the response of chemotherapy in two tumor models that show expression of PDGF receptors limited to the tumor stroma, and in which PDGF antagonists relieve tumor hypertension. It was found that PDGF inhibitors and tyrosine kinase inhibitors of PDGF STI571 receptors potentiated the antitumor effect of taxol in KAT-4 s.c. in SCID mice. Treatment with only PDGF antagonists had no effect on tumor growth. Taxol uptake in tumors was increased by treatment with PDGF antagonists. Co-treatment with PDGF and taxol antagonists was not associated with antiangiogenic effects, and PDGF antagonists did not potentiate the effect of taxol on in vitro growth of KAT-4 cells. STI571 also increased the anti-tumor effects of 5-fluorouracil on tumors PROb s.c. in synthetic BDIX rats without increasing the effect of 5-fluorouracil on cultured PROb cells.

Green et al. (Inhibitory DNA ligands to platelet-derived growth factor B-chain. Biochemistry, vol 35, No. 45, 1996, pages 14413-14424) identified DNA molecules that bound PDGF-AB with subnanomolar affinity of a random DNA library using in vitro selection. It was found that the individual cloned ligands of the affinity-enriched pool bound PDGF-AB and PDGF-BB with comparablely high affinity (Kd "10-10 M) and PDGF-AA with lower affinity (> 10-8 M), indicating specific recognition of the PDGF B chain in the context of the hetero- or homodimer. Green et al. they establish that these DNA ligands represent a novel class of specific and potent antagonists of PDGF-BB and, by inference, PDGF-AB.

Fang et al. (Synthetic DNA aptamers to detect protein molecular variant in a high-throughput fluorescence quenching assay. Chembiochem- A European Journal of Chemical Biology. Vol 4, No. 9, September 5, 2003, pages 829834) describe the development of an assay based on fluorescence with synthetic DNA aptamers that can detect and distinguish molecular variants of proteins in biological samples in a high performance procedure. Fang et al. they used an aptamer with high affinity for the B-chain of PDGF, labeled with a fluorophore and a fluorescence quencher at both ends, and the fluorescence was measured by extinguishing it with PDGF. Fang et al. report that specific extinction can be used to detect PDGF at picomolar concentrations even in the presence of serum and other cell-derived proteins in cell culture media. The authors also establish that PDGF-AA, -AB and -BB dimers can be distinguished from each other.

[0017] Therefore, it would be beneficial to have novel materials and procedures in oncology therapy to reduce tumor PLI, decrease tumor angiogenesis and reduce the harmful effects of the mutation by constitutive expression of PDGF. This disclosure provides materials and procedures to meet these and other needs.

BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 is a scheme of gene mutations that give rise to constitutive signaling of PDGF receptors in cancer cells found in glioblastomas, chronic myelomonocytic leukemia (CMLL), protuberant dermatofibrosarcoma (DFSP), gastrointestinal stromal tumors (TEGI) and other soft tissue sarcomas.

[0019] Figure 2 is a schematic of AA, BB, CC, DD and AB isoforms of PDGF and related receptors.

[0020] Figure 3 is a schematic representation of the in vitro aptamer selection procedure (SELEX ™) from oligonucleotide sets of random sequences.

[0021] Figure 4 is a scheme of cytotoxin transport through the tumor vasculature with and without PDGF antagonists by the methods of the present disclosure.

[0022]

Figure 5 is an illustration of a branched PEG reagent for coupling to a biomolecule.

[0023]

Figure 6 is an illustration of a branched PEG conjugated to the 5 'end of an aptamer.

[0024]

Figure 7 is an illustration depicting various PEGylation strategies that represent

Conventional mono-PEGylation, multiple PEGylation and PEGylation dimerization.

[0025] Figure 8A is a graph of an ARC127 ion exchange HPLC analysis (5 '- [40 K PEG] - (SEQ ID NO: 1) -HEG- (SEQ ID NO: 2) -HEG- (SEQ ID NO: 3) -3'-dT-3 ') recently synthesized and stored at -20 ° C for two years; Figure 8B is a bar graph of the results of the 3T3 cell proliferation assay for ARC126 (5 '- (SEQ ID NO: 1) -HEG- (SEQ ID NO: 2) -HEG- (SEQ ID NO: 3 ) -3'-dT-3 ') and ARC127 recently synthesized (Archemix) and after storage at -20 ° C for 2 years (Proligo).

[0026] Figure 9A, left panel, is a schematic of the sequence and secondary structure of the PDGF aptamer composition containing 2'-fluorine of ARC126; Figure 9A, right panel, is a schematic of the sequence and secondary structure of the ARC126 variant ARC513 (5 '- (SEQ ID NO: 69) - PEG - (SEQ ID NO: 40) - PEG - (SEQ ID NO. 70) -3'-dT-3 '); Figure 9B is a schematic of the sequence and secondary structure of variants of ARC 126 ARC513 (5 '- (SEQ ID NO: 69) - PEG - (SEQ ID NO: 40) - PEG - (SEQ ID No. 70) -3 '-dT-3'), ARC514 (5 '- (SEQ ID NO: 69) - PEG - (SEQ ID NO: 40) - PEG - (SEQ ID NO: 71) -3'-dT-3'), ARC515 (5 '- (SEQ ID NO: 69) - PEG (SEQ ID NO: 40) - PEG - (SEQ ID NO: 72) -3'-dT-3') and ARC516 (5 '- (SEQ ID NO. : 69) - PEG - (SEQ ID NO: 40) - PEG - (SEQ ID NO: 73) -3'-dT-3 ').

[0027] Figure 10A is a graph of the results of the competition binding assay for ARC 126 and the ARC 128 composition variants (5 '- (SEQ ID NO: 4) -HEG- (SEQ ID NO: 5) - HEG- (SEQ ID NO: 6) -3 '), ARC513, ARC514, ARC515, ARC516; Figure 10B is a graph of proliferation assay data based on 3T3 cells in vitro showing the activity of some variants of ARC126 composition.

[0028] Figure 11A is a graph of a competition binding assay for ARC126 and two variants that are conjugated in 5 'with 30 kDa PEG groups (ARC308, 5' - [30 K PEG] - (SEQ ID NO. : 1) -HEG- (SEQ ID NO: 2) -HEG- (SEQ ID NO: 3) - 3'-dT-3 ') or 40 kDa (ARC127); Figure 11B is a graph of the in vitro 3T3 cell proliferation assay data for ARC126 as a function of conjugation with the PEG group at 5 '(ARC126 + 30 kDa = ARC308 and ARC126 + PEG 40 kDa = ARC127) .

[0029] Figure 12A is a graph of a pharmacokinetic profile of conjugates in 5 'of ARC126 after IV administration at 10 mg / kg in mice; Figure 12B is a graph of the in vivo pharmacokinetic profile of ARC127 (ARC 126 + PEG 40 kDa) after intravenous (IV), intraperitoneal (IP) and subcutaneous (SC) administration at a dose level of 10 mg / kg in mice; Figure 12C is a graph of the 40 kDa ARC126 + PEG bioactivity profile (i.e., ARC127) after intravenous (IV) administration at a dose level of 10 mg / kg in mice.

[0030] Figure 13A is a graph of a competition binding assay showing that ARC126 binds to PDGF-BB with a Kd of approximately 100 pM and PDGF-AB with a Kd of approximately 100 pM, but does not bind to PDGF-AA; Fig. 13B is a graph of a competition binding assay showing that ARC126 binds to human, rat and mouse PDGF-BB with an equal affinity of approximately 100 pM.

[0031] Figure 14A is a graph of the results of a 3T3 cell proliferation assay showing that ARC127 inhibits the proliferation of 3T3 cells better than the antibody directed against PDGF Neutralizer; Figure 14B is a graph of the results of a 3T3 cell proliferation assay that shows that ARC127 inhibits the proliferation of 3T3 cells better than the known tyrosine kinase inhibitors tested (AG1295 in the left panel and AG-1433 in the right panel ).

[0032] Figure 15 is a graph of the results of the cell viability test showing that ARC127 alone has no toxic effect on 3T3 cells after incubation for 24 or 48 hours.

[0033] Figure 16 is a data graph of the cell migration assay performed in a 96-well form using the 96-well migration assay QCM Chemotaxis (ECM No. 510) (Chemicon, Temecula, CA); Figure 16A shows that the observed migration signal increases as a function of the number of sown cells, and Figure 16B shows the migration signal as a function of the increase in the concentration of PDGF.

[0034] Figure 17 is a graph of the results of a PDGF-driven Elk luciferase assay showing that ARC127 shows an IC50 of 2 nM.

[0035] Figure 18A is a plot of tumor diameter versus time in Nu / Nu hairless mice under a dose optimization study of GLEEVEC ™ / irinotecan in the HT29 colon cancer xenograft model; Figure 18B is a plot of tumor diameter versus time in Nu / Nu hairless mice under the study of ARC 127 / irinotecan in the LS174T colon cancer xenograft model. Figure 18C is a graph of tumor volume versus time in Nu / Nu hairless mice under the study of ARC 127 / irinotecan in the LS174T colon cancer xenograft model.

[0036] Figure 19A is a plot of tumor diameter versus time in Nu / Nu hairless mice under dosing guidelines of ARC308 / irinotecan and ARC308 / GLEEVEC in an efficacy study in the LS174T colon cancer xenotransplantation model . Figure 19B is a graph of tumor volume versus time in Nu / Nu hairless mice under dosing guidelines of ARC308 / irinotecan in an efficacy study in the LS174T colon cancer xenotransplantation model.

[0037] Figure 20A is a schematic of the sequence and secondary structure of an aptamer that binds VEGF but not PDGF - referred to herein as ARC245 (SEQ ID NO: 7); Figure 20B is a schematic of the sequence and secondary structure of an aptamer that binds PDGF but not VEGF - referred to herein as ARC126 (5'-SEC ID No. 1-HEG-SEC ID No. 2-HEG-SEC ID No. 3 in which HEG represents hexaethylene glycol amidite.

[0038] Figure 21A is a schematic of the sequence and secondary structure of a bivalent aptamer that binds PDGF and VEGF (sequence TK.131.012.A, SEQ ID NO: 9); Figure 21B is a schematic of the sequence and secondary structure of a second bivalent aptamer that binds PDGF and VEGF (sequence TK.131.012B, SEQ ID NO: 10).

[0039] Figure 22 is a graph of binding data from the point transfer assay for constituent aptamers and multivalent aptamers for PDGF-BB (panel 1) and VEGF (panel 2).

[0040] Figure 23 is a schematic of the sequence and secondary structures (absent an indication of phosphorothioate linkages) of PDGF aptamers having CpG islands or motifs incorporated or inserted therein.

[0041] Figure 24A is a graph of the results of an IL-6 ELISA assay that measures the release of IL-6 in TIB cells using ODN immunostimulants known as positive controls and aptamers that do not contain CpG islands as negative controls. in the trial; Figure 24B is a graph of the results of an IL-6 ELISA assay that measures the release of IL-6 in TIB cells using the ISS-ODN and shortened versions of ISS-ODN; Figure 24C is a graph of the results of an IL-6 ELISA assay that measures the release of IL-6 in TIB cells using PDGF aptamers in which CpG motifs have been incorporated; Figure 24D is a graph of the results of an IL-6 ELISA assay that measures the release of IL-6 in TIB cells using additional PDGF aptamers in which CpG motifs have been incorporated. Figure 24E is a graph of the results of a TNFa ELISA assay that measures the release of TNFa in TIB cells using the same PDGF aptamers as in Figure 24D in which CpG motifs have been incorporated.

[0042] Figures 25A-25B are graphs depicting point transfer binding analyzes for clone RNA transcripts.

[0043] Figure 26 is a graph depicting the inhibitory effect of various PDGF-AA aptamers of the disclosure (ARX33P1.D2 (SEQ ID NO: 78), ARX33P1.E5 (SEQ ID NO: 79) and ARX33P1.E10 (SEQ ID NO: 80)) on the proliferation of 3T3 cells induced by PDGF-AA.

[0044] Figure 27 is a graph depicting the effect of PDGF-AA aptamers (ARX33P1.D2 (SEQ ID NO: 78), ARX33P1.E5 (SEQ ID NO: 79) and ARX33P1.E10 (SEQ ID NO: 80)) on the proliferation of 3T3 cells induced by PDGF-BB.

[0045] Figure 28 is a graph of tumor volume versus time (post-dosing period) in Nu / Nu hairless mice under the study of ARC127 / irinotecan in LS174T colon cancer xenograft model.

[0046] Figure 29 is a Kaplan-Meier representation of the data shown in Figure 28 in which the percentage of mice in a treatment group presenting tumors less than 500 mm3 is presented [as calculated from measurements with compass digital caliper of the length and width of the tumors, using the following formula: volume = (length x width2) / 2].

[0047] Figure 30 is a graph showing the mean volume of the tumor per group (vertical axis) versus days after tumor implantation (horizontal axis) for LS174T tumors that have been treated with vehicle or ARC593.

[0048] Figure 31 is a graph showing the mean values for the area density for blood vessels stained with CD31 and a-SMA immunoreactive pericytes of a mouse Lewis lung carcinoma model in which the mice had been treated with vehicle, the ARC308 aptamer or the ARC594 aptamer.

[0049] Figure 32 is a graph showing the area density (expressed as a percentage of vehicle control) of Lewis lung carcinoma tissue stained with antibody directed against CD31 and stained with antibody directed against type IV collagen that had been treated with vehicle, ARC308 or ARC594. In the graph: * = P <0.05 versus vehicle, † = P <0.05 versus aptamer 308.

[0050] Figure 33 is a graph showing the area density (expressed as a percentage of vehicle control) of Lewis lung carcinoma tissue stained with antibody directed against CD31, stained with antibody directed against PDGFR-beta, stained with antibody directed against -SMA, stained with antibody directed against NG2 or stained with antibody directed against desmin of mice that have been treated with vehicle, ARC308 (indicated as AX101) or ARC594 (indicated as AX102). In the graph: * = P <0.05 versus vehicle, † = P <0.05 versus aptamer 308.

[0051] Figure 34 is a graph showing the percentage colocalization of CD31 and marker of PDGFR-beta, CD31 and marker of a-SMA, CD31 and marker of NG2 and CD31 and marker of demining in Lewis lung carcinoma that had treated with vehicle or ARC594 (indicated as AX102). In the graph: * = <0.05 versus vehicle.

[0052] Figure 35 is a graph showing the number of individual vessels (vertical axis) in Lewis lung carcinoma that had been treated with vehicle or ARC594 versus the colocalization range of CD31 and NG2 (horizontal axis) in the vessels.

[0053] Figure 36 is a graph showing the area density (expressed as a percentage of vehicle control) of Lewis lung carcinoma tissue stained with antibody directed against CD31 (left bar) and stained with antibody directed against type collagen IV (right bar) that had been treated with vehicle, 2 mg / kg, 10 mg / kg or 50 mg / kg of ARC594 in which * = P <0.05 versus vehicle, † = P <0.05 versus at 2 mg / kg of ARC594,

‡ = P <0.05 versus 10 mg / kg of ARC594 and § = P <0.05 versus 50 mg / kg of ARC594.

[0054] Figure 37 is a graph showing the area density (expressed as a percentage of vehicle control) of Lewis lung carcinoma tissue stained with antibody directed against CD31 and stained with antibody directed against a-SMA that had been treated with vehicle, 2 mg / kg, 10 mg / kg or 50 mg / kg of ARC594 in which * = P <0.05 versus vehicle, † = P <0.05 versus 2 mg / kg of ARC594, ‡ = P <0.05 versus 10 mg / kg of ARC594 and § = P <0.05 versus 50 mg / kg of ARC594.

[0055] Figure 38 is a graph showing the percentage colocalization of Lewis lung carcinoma tissue stained with antibody directed against CD31 and stained with antibody directed against a-SMA or stained with antibody directed against CD32 and stained with antibody directed against NG2 that had been treated with vehicle, 2 mg / kg, 10 mg / kg or 50 mg / kg of ARC594 in which * = P <0.05 vs. vehicle and $ = P <0.05 versus 50 mg / kg of ARC594.

[0056] Figure 39 is a graph showing the area density (expressed as a percentage of vehicle control) of Lewis lung carcinoma tissue stained with antibody directed against CD31, stained with antibody directed against a-SMA and stained with antibody directed against NG2 that had been treated with ARC594 for 1, 2, 4 or 7 days in which * = P <0.05 versus vehicle, † = P <0.05 versus 1 day of treatment, ‡ = P <0.05 versus 2 days of treatment and § = P <0.05 versus 4 days of treatment.

[0057] Figure 40 is a graph showing the area density (expressed as a percentage of vehicle control) of Lewis lung carcinoma tissue stained with antibody directed against -SMA, NG2, PDGFRbeta and demin that had been treated with vehicle or ARC594 for one or seven days.

[0058] Figure 41 is a graph representing the volume of the tumor as a function of the day of treatment with both vehicle and ARC594 (indicated as AX102).

[0059] Figure 42 is a graph showing the weight of the tumor weight as a function of the treatment time with both vehicle and ARC594 (indicated as AX102).

[0060] Figure 43 is a graph showing mouse body weight as a function of treatment time with both vehicle and ARC594 (indicated as AX 102).

[0061] Figure 44 is a graph showing the area density (expressed as a percentage of vehicle control) of Lewis lung carcinoma tissue stained with antibody directed against CD31 (left bar) and stained with antibody directed against NG2 ( right bar) that had been treated with vehicle or ARC594 (indicated as AX102) for up to 28 days in which * = P <0.05 against vehicle, † = P <0.05 against CD31.

[0062] Figure 45 is a graph showing the area density (expressed as a percentage of vehicle control) on the vertical axis of Lewis lung carcinoma tissue stained with antibody directed against CD31 and stained with antibody directed against PDGFR- beta that had been treated with vehicle or ARC594 several times, up to 28 days.

[0063] Figure 46 is a graph showing the percentage colocalization (vertical axis) of Lewis lung carcinoma tissue stained with antibody directed against CD31 and stained with antibody directed against PDGFR-�that had been treated with vehicle (first bar on the left), with ARC594 for 7 days (second bar) or with ARC594 for 28 days (third bar).

[0064] Figure 47 is a set of three bar graphs showing the percentage of vessels (vertical axis) versus the percentage of pericyte coverage (horizontal axis) for Lewis lung carcinoma that had been treated with vehicle (upper panel) , ARC594 (indicated as AX102) for 7 days (center panel) or ARC594 (indicated as AX102) for 28 days (lower panel).

[0065] Figure 48 is a graph showing the diameter of the vessel in μm (vertical axis) versus the treatment of Lewis lung carcinoma with vehicle or ARC594 for 4, 7, 14, 21 or 28 days (duration of treatment in the horizontal axis).

[0066] Figure 49 is a graph showing the area density (expressed as a percentage of vehicle control) on the vertical axis of Lewis lung carcinoma tissue stained with antibody directed against type IV collagen (indicated as Col IV) , CD31 or PDGFR-beta that had been treated with vehicle or ARC594 for 1, 2, 4, 7, 14, 21 or 28 days (duration of treatment on the horizontal axis).

[0067] Figure 50 is a graph showing the area density (expressed as a percentage of vehicle control) on the vertical axis of Lewis lung carcinoma tissue stained with antibody directed against type IV collagen (indicated as Col IV) , laminin or nidogen that had been treated with vehicle or ARC594 for 7 or 28 days (duration of treatment on the horizontal axis).

[0068] Figure 51 is a graph showing the area density (expressed as a percentage of vehicle control) of Lewis lung carcinoma tissue stained with antibody directed against a-SMA that had been treated with vehicle, control aptamer negative (AX104) or 2 mg / kg, 10 mg / kg or 50 mg / kg of ARC594 in which * = P <0.05 versus vehicle.

[0069] Figure 52 is a graph showing the area density (expressed as a percentage of vehicle control) of Lewis lung carcinoma tissue stained with antibody directed against -SMA that had been

a treated with vehicle or ARC594 for 1, 2, 4 or 7 days in which * = P <0.05 against vehicle.

[0070] Figure 53 is a graph showing the area density (expressed as a percentage of vehicle control) of Rip-Tag2 tumor tissue stained with antibody directed against CD31 (left bar) and stained with antibody directed against NG2 (bar right) treated with vehicle, 2 mg / kg, 10 mg / kg or 50 mg / kg of ARC594

5 (indicated as AX102) in which * = P <0.05 versus vehicle, † = P <0.05 versus 2 mg / kg of ARC594.

[0071] Figure 54 is a graph showing the area density (expressed as a percentage of vehicle control) on the vertical axis of Rip-Tag2 tumor tissue stained with antibody directed against -SMA and stained with antibody directed against CD31 that it had been treated with vehicle or ARC594 for 7, 14 or 28 days (duration of treatment on the horizontal axis). [0072] Figure 55 is a graph of a competition binding assay showing that ARC594 binds PDGF-BB with a Kd of approximately 100 pM and PDGF-AB with a Kd of approximately 100 pM, but does not bind to PDGF AA.

[0073] Figure 56A is a graph depicting the plasma concentration of ARC594 in mice as a function of time; Figure 56B is a table listing pharmacokinetic properties of ARC594 (indicated as AX102) in mice.

[0074] Figure 57 is a bioactivity profile of ARC594 (indicated as AX 102) after intravenous (IV) administration at a dose level of 10 mg / kg in mice showing that the pharmacodynamic profile of the aptamer is according to its Pharmacokinetic data

SUMMARY OF THE INVENTION

[0075] The present invention provides a PDGF specific aptamer according to claim 1.

The present invention also provides a composition comprising a therapeutically effective amount of an aptamer according to claim 8.

The present invention also provides a specific PDGF. The present disclosure provides materials and methods for the treatment of cancer, particularly solid tumor cancers, by the administration to patients of therapeutically effective amounts of aptamers or aptamer compositions that can bind with high affinity and specificity to platelet-derived growth factor, vascular endothelial growth factor, its isoforms, its receptors, or any combination thereof, thereby altering, for example,

35 inhibiting the biological function of the bound ligand in the etiology of cancer. The aptamers of the present disclosure can be used in combination with known chemotherapeutic cytotoxic agents and / or other cancer treatments. In addition, the aptamers of the disclosure may include one or more CpG motifs incorporated therein or attached thereto.

[0076] The present disclosure provides aptamers that bind PDGF. In one embodiment, PDGF-binding aptamers include a nucleic acid sequence selected from SEQ ID NO: 1 to SEQ ID NO: 3, SEQ ID NO: 9 to SEQ ID NO: 35, SEQ ID NO: 36 to SEQ ID NO: 73, SEQ ID NO: 85, SEQ ID NO: 77 to SEQ ID NO: 81 and SEQ ID No. 86-89, 91, 93-95 and 102. In one embodiment, the oligonucleotide sequence of the aptamer contains less of seven nucleotides that have a 2'-fluorine substituent.

[0077] In another embodiment, the aptamers of the disclosure comprise at least one additional chemical modification. In one embodiment, the modification is selected from the group consisting of a chemical substitution in a sugar position; a chemical substitution in a phosphate position; and a chemical substitution at a base position, of the nucleic acid. In a particular embodiment, the modification is selected from the group consisting of: incorporation of a modified nucleotide, plugging of the 3 'end, conjugation with a non-immunogenic compound of high molecular weight and conjugation with a lipophilic compound. In a particular embodiment, the high molecular weight non-immunogenic compound is polyalkylene glycol, particularly polyethylene glycol. For example, the high molecular weight nonimmunogenic compound is hexaethylene glycol (HEG) amidite.

[0078] In a particular embodiment, the PDGF specific aptamer of the disclosure comprises the following structure:

in which

indicates a linker

Atamer = 5'dCdCdCdAdGdGdCTdAdCmG (SEQ ID NO: 69) - PEG - dCdGTdAmGdAmGdCdAmUmCmA (SEQ ID NO: 40) - PEG - TdGdATmCdCTmGmGmG-3T-3 '; SEQ ID NO: 70); in which d denotes a deoxy-nucleotide, m denotes a 2'-OMe-nucleotide, PEG denotes a PEG spacer and 3T denotes an inverted deoxy-thymidine cap.

[0079] In another embodiment, the PDGF specific aptamer of the disclosure comprises the following structure:

in which

15 indicates a linker

Atamer = 5'dCdCdCdAdGdGdCdTdAdCmG (SEQ ID NO: 69) - PEG - dCdGdTdAmGdAmGdCdAmUmCmA (SEQ ID NO: 40) - PEG - dTdGdAdTmCdCdTmGmGmG (SEC # 3: 70 in which d denotes a deoxy-nucleotide, m denotes a 2'-OMe-nucleotide, PEG denotes a PEG spacer and 3T denotes an inverted deoxy-thymidine cap.

[0080] In another embodiment, the PDGF specific aptamer of the disclosure comprises the following structure:

25 in which

 indicates a linker

Atamer = 5'dCdCdCdAdGdGdCdTdAdCmG (SEQ ID NO: 69) - PEG - dCdGdTdAmGdAmGdCdAmUmCmA (SEQ ID NO: 40) - PEG - dTdGdAdTmCdCdTmGmGmG -3T-ID: 70 in which d denotes a deoxy-nucleotide, m denotes a 2'-OMe-nucleotide, PEG denotes a PEG spacer and 3T denotes an inverted deoxy-thymidine cap.

[0081] In another embodiment, the PDGF specific aptamer of the disclosure comprises the following structure:

in which

 indicates a linker

Atamer = 5'dCdCdCdAdGdGdCdTdAdCmG (SEQ ID NO: 69) - PEG - dCdGdTdAmGdAmGdCdAmUmCmA (SEQ ID NO: 40) - PEG - dTdGdAdTmCdCdTmGmGmG (SEC # 3: 70 where d denotes a deoxy-nucleotide, m 45 denotes a 2'-OMe-nucleotide, PEG denotes a PEG spacer and 3T denotes an inverted deoxy-thymidine cap.

[0082] In another particular embodiment, the PDGF specific aptamer of the disclosure comprises the following structure:

in which

 indicates a linker

Atamer = 5'dCdAdGdGdCfUdAfCmG (SEQ ID NO: 1)) - HEG - dCdGTdAmGdAmGdCdAfUfCmA (SEQ ID NO: 2) - HEG - TdGdATfCfCfUmG-3T-3 '(SEQ ID NO: 3); in which d denotes a deoxy-nucleotide, m denotes a 2'-OMe5 nucleotide, HEG denotes a hexaethylene glycol (HEG) amidite spacer and 3T denotes an inverted deoxy-thymidine.

[0083] In another embodiment, the PDGF specific aptamer of the disclosure comprises one of the following two structures:

in which

15 indicates a linker

Atamer = 5'dCdCdCdAdGdGdCdTdAdCmG (SEQ ID NO: 69) - PEG - dCdGdTdAmGdAmGdCdAmUmCmA (SEQ ID NO: 40) - PEG - dTdGdAdTmCdCdTmGmGmG 3 '; SEC: wherein d denotes a deoxy-nucleotide, m denotes a 2'-OMe-nucleotide and PEG denotes a PEG spacer; or

in which

 indicates a linker

Atamer = 5'dCdCdCdAdGdGdCdTdAdCmG (SEQ ID NO: 69) - PEG - dCdGdTdAmGdAmGdCdAmUmCmA (SEQ ID NO: 40) - PEG - dTdGdAdTmCdCdTmGmGmG No. 3 '; SEC: in which d denotes a deoxy-nucleotide, m denotes a 2'-OMe-nucleotide and PEG denotes a PEG spacer.

[0084] In some embodiments of this aspect of the disclosure, the linker is an alkyl linker. In particular embodiments, the alkyl linker comprises 2 to 18 consecutive CH2 groups. In preferred embodiments, the alkyl linker comprises 2 to 12 consecutive CH2 groups. In particularly preferred embodiments, the alkyl linker comprises 3 to 6 consecutive CH2 groups.

[0085] In particular embodiments, the disclosure aptamer comprises one of the following structures:

40 in which Atamer = 5'dCdCdCdAdGdGdCTdAdCmG (SEQ ID NO: 69) - PEG - dCdGTdAmGdAmGdCdAmUmCmA (SEQ ID NO: 40) - PEG - TdGdATmCdCTmGmGmG-3T-3 '(SEC): SEC in which d denotes a deoxy-nucleotide, m denotes a 2'-OMe-nucleotide, PEG denotes a spacer of PEG and 3T denotes an inverted deoxy-thymidine cap (in this document, the above structure is hereinafter referred to as ARC594 or AX102);

in which Atamer = 5'dCdCdCdAdGdGdCTdAdCmG (SEQ ID NO: 69) - PEG - dCdGTdAmGdAmGdCdAmUmCmA

(SEQ ID NO: 40) - PEG-TdGdATmCdCTmGmGmG-3T-3 '(SEQ ID NO: 70); in which d denotes a deoxy-nucleotide, m denotes a 2'-OMe-nucleotide, PEG denotes a spacer of PEG and 3T denotes an inverted deoxy-thymidine cap (in this document, the above structure is hereinafter referred to as ARC 1472);

in which Atamer = 5'dCdCdCdAdGdGdCTdAdCmG (SEQ ID NO: 69) - PEG - dCdGTdAmGdAmGdCdAmUmCmA (SEQ ID NO: 40) - PEG - TdGdATmCdCTmGmGmG-3T-3 '; SEQ ID NO: 70'; where d denotes a deoxy-nucleotide, m denotes a 2'-OMe-nucleotide, PEG denotes a PEG spacer and 3T denotes a deoxy-thymidine cap

10 inverted (in this document, the above structure is hereinafter referred to as ARC593);

in which Atamer = 5'dCdCdCdAdGdGdCTdAdCmG (SEQ ID NO: 69) - PEG - dCdGTdAmGdAmGdCdAmUmCmA

15 (SEQ ID NO: 40) - PEG-TdGdATmCdCTmGmGmG-3T-3 '(SEQ ID NO: 70); in which d denotes a deoxy-nucleotide, m denotes a 2'-OMe-nucleotide, PEG denotes a spacer of PEG and 3T denotes an inverted deoxy-thymidine cap (in this document, the above structure is referred to hereafter ( ARC592).

[0086] In another particular embodiment, the disclosure aptamer comprises the following structure:

in which Atamer = 5'dCdAdGdGdCfUdAfCmG (SEQ ID NO: 1) - HEG - dCdGTdAmGdAmGdCdArUfCmA (SEQ ID NO: 2) –HEG - TdGdATfCfCtUmG-3T-3 '; SEQ ID NO: 3); in which d denotes a deoxy-nucleotide, m denotes a 2 '

25 OMe-nucleotide, HEG denotes a hexaethylene glycol (HEG) amidite spacer and 3T denotes an inverted deoxy-thymidine (here, the structure above is hereinafter referred to as ARC308). [0087] In some embodiments, the disclosure aptamer comprises one of the structures set forth below:

in which Atamer = 5'dCdCdCdAdGdGdCdTdAdCmG (SEQ ID NO: 69) - PEG dCdGdTdAmGdAmGdCdAmUmCmA (SEQ ID NO: 40) - PEG - dTdGdAdTmCdCdTmGmG ID No. 3 '; SEC: 70; in which d denotes a deoxy-nucleotide, m denotes a 2'-OMe-nucleotide and PEG denotes a PEG spacer (in this

35, the previous structure is hereinafter referred to as ARC1473); or

in which Atamer = 5'dCdCdCdAdGdGdCdTdAdCmG (SEQ ID NO: 69) -PEG

40 dCdGdTdAmGdAmGdCdAmUmCmA (SEQ ID NO: 40) - PEG-dTdGdAdTmCdCdTmGmGmG 3 '(SEQ ID NO: 70); in which d denotes a deoxy-nucleotide, m denotes a 2'-OMe-nucleotide and PEG denotes a PEG spacer (in this document, the above structure is hereinafter referred to as ARC1474).

[0088] The disclosure also provides aptamers that include a first sequence that binds to a first target and a second sequence that binds to a second target. In one embodiment, the first target is PDGF, isoforms of PDGF or a PDGF receptor, and the second target is VEGF or a VEGF receptor. The isoforms of PDGF are, for example, PDGF-BB, PDGF-AB, PDGF-CC and PDGF-DD. The aptamers bind, for example, to one or more of PDGF-BB, PDGF-AB, PDGF-CC, PDGF-DD, PDGF-AA, the five isoforms, four isoforms, three isoforms or two isoforms. In one embodiment, PDGF-binding aptamers include a nucleic acid sequence selected from SEQ ID NO: 1 to SEQ ID NO: 3, SEQ ID NO: 9 to SEQ ID NO: 35, SEQ ID NO: 36 to SEQ ID NO: 73, SEQ ID NO: 85 and SEQ ID NO: 77 to SEQ ID NO: 81 and SEQ ID NO: 86-90, 91, 93-95 and 102.

[0089] In one embodiment, the first target does not stimulate, after the attachment of the aptamer, an immune response, and in addition, the second target stimulates, after the attachment of the aptamer, an immune response. In one embodiment, the second target is a toll-like receptor. In another embodiment, the second sequence is an immunostimulatory sequence. In one embodiment, the immunostimulatory sequence is a CpG motif.

[0090] In one embodiment, the first sequence may be linked to one of the following targets: PDGF, IgE, IgE FcE R1, PSMA, CD22, TNF-a, CTLA4, PD-1, PD-L1, PD-L2, FcRIIB , BTLA, TIM-3, CD11c, BAFF, B7-X, CD19, CD20, CD25 or CD33. In one embodiment, the first sequence can be linked to PDGF.

[0091] The present disclosure also provides compositions containing a PDGF binding aptamer of the disclosure and a pharmaceutically acceptable carrier. In particular embodiments of this aspect of the disclosure, the composition comprises a PDGF binding aptamer selected from ARC308, ARC404, ARC513, ARC592, ARC593, ARC594, ARC1472, ARC1473 and ARC1474.

[0092] In one embodiment, the compositions of the disclosure include a PDGF binding aptamer of the disclosure, a cytotoxic agent and a pharmaceutically acceptable carrier. In one embodiment, the cytotoxic agent belongs to a class of cytotoxic agents such as tubulin stabilizers, tubulin destabilizers, antimetabolites, purine synthesis inhibitors, nucleoside analogs, DNA alkylating agents, DNA modifying agents and agents. vascular disruptors In one embodiment, the cytotoxic agent is used alone or in combinations with one or more cytotoxic agents selected from the group consisting of calicheamycin, doxorubicin, taxol, methotrexate, gemcitabine, cytarabine, vinblastine, daunorubicin, docetaxel, irinotecan, epothilone B, epothilone D , cisplatin, carboplatin and 5-fluoro-U. [0093] The disclosure also provides compositions that include a PDGF binding aptamer of the disclosure, a VEGF binding aptamer and a pharmaceutically acceptable carrier. In one embodiment, these compositions also include a cytotoxic agent. Suitable cytotoxic agents include agents belonging to a class of cytotoxic agents selected from the group consisting of tubulin stabilizers, tubulin destabilizers, antimetabolites, purine synthesis inhibitors, nucleoside analogs, DNA alkylating agents, modifying agents DNA and vascular disrupting agents. In one embodiment, the cytotoxic agent is used alone or in combinations of one or more cytotoxic agents selected from the group consisting of calicheamycin, doxorubicin, taxol, methotrexate, gemcitabine, cytarabine, vinblastine, daunorubicin, docetaxel, irinotecan, epothilone B, epothilone D , cisplatin, carboplatin and 5-fluoro-U.

[0094] The disclosure also provides methods for treating cancer by administering a therapeutically effective amount of a PDGF binding aptamer of the disclosure. The disclosure also provides methods for treating cancer by administering a therapeutically effective amount of a composition of the disclosure.

[0095] In one embodiment, the cancer or tumor is a PDGF-mediated cancer or tumor. In one embodiment, the PDGF-mediated cancer or tumor is a glioblastoma, chronic myelomonocytic leukemia, a protruding dermatofibrosarcoma, a gastrointestinal stromal tumor or a soft tissue sarcoma.

[0096] In one embodiment, the composition includes a cytotoxic agent belonging to a class of cytotoxic agents selected from the group consisting of tubulin stabilizers, tubulin destabilizers, antimetabolites, purine synthesis inhibitors, nucleoside analogs, DNA alkylating agents, DNA modifying agents and vascular disrupting agents. In one embodiment, the cytotoxic agent is used alone or in combinations of one or more cytotoxic agents such as calicheamycin, doxorubicin, taxol, methotrexate, gemcitabine, cytarabine, vinblastine, daunorubicin, docetaxel, irinotecan, epothilone B, epothilone D, cisplatin, carboplatin and 5-fluoro-U.

[0097] The disclosure also provides methods for inhibiting the growth of a solid tumor by administering a therapeutically effective amount of a PDGF binding aptamer of the disclosure. The disclosure also provides methods for inhibiting the growth of a solid tumor by administering a therapeutically effective amount of a composition of the disclosure.

[0098] In another aspect, the disclosure provides a method of reducing the number of pericytes in a tumor that comprises treating the tumor with an aptamer or composition of the disclosure. In a particular embodiment, the aptamer is selected from ARC308, ARC404, ARC513, ARC592, ARC593, ARC594 and ARC1472 to ARC1474.

[0099] In one embodiment, the cancer or tumor is a PDGF-mediated cancer or tumor. In one embodiment, the PDGF-mediated cancer or tumor is a glioblastoma, chronic myelomonocytic leukemia, a protruding dermatofibrosarcoma, a gastrointestinal stromal tumor or a soft tissue sarcoma.

[0100] In one embodiment, the disclosure provides a method for treating a patient who has a tumor, in which the tumor does not express a high level of VEGF, the method comprising administering a therapeutically effective amount of a PDGF aptamer or composition of patient disclosure. Tumors that express low levels of VEGF are known in the literature and are similarly described as weakly powered by VEGF. One of the tumor models used in the present disclosure, the Lewis lung carcinoma tumor model, is weakly powered by VEGF. Tumors strongly activated by VEGF, such as the RipTag2 model used to evaluate the PDGF aptamer of the present disclosure, express higher levels of VEGF. Human tumor cell lines used in mouse xenograft studies to profile the activity of anti-VEGF agents or other antiangiogenic agents are known in the literature. Such cell lines are derived from human tumors of the brain, colon, lung, breast, prostate and kidney, and are described as more or less dependent on VEGF according to VEGF expression level. LS174T is an example of a VEGF-strongly driven xenograft tumor. In a particular embodiment, the PDGF antagonist is an anti-PDGF aptamer, particularly an aptamer selected from the group consisting of ARC308, ARC404, ARC513, ARC592, ARC593, ARC594 and ARC 1472 to ARC1474.

[0101] In one embodiment, the composition includes a cytotoxic agent belonging to a class of cytotoxic agents selected from tubulin stabilizers, tubulin destabilizers, antimetabolites, purine synthesis inhibitors, nucleoside analogs, DNA alkylating agents , DNA modifying agents and vascular disrupting agents. In one embodiment, the cytotoxic agent is used alone or in combinations of one or more cytotoxic agents such as calicheamycin, doxorubicin, taxol, methotrexate, gemcitabine, cytarabine, vinblastine, daunorubicin, docetaxel, irinotecan, epothilone B, epothilone D, cisplatin, carboplatin and 5-fluoro-U.

[0102] The disclosure also provides methods of reducing PLI in a solid tumor by administering a therapeutically effective amount of a PDGF binding aptamer of the disclosure. The disclosure also provides methods of reducing PLI in a solid tumor by administering a therapeutically effective amount of a composition of the disclosure.

[0103] In one embodiment, the cancer or tumor is a PDGF-mediated cancer or tumor. In one embodiment, the PDGF-mediated cancer or tumor is a glioblastoma, chronic myelomonocytic leukemia, a protruding dermatofibrosarcoma, a gastrointestinal stromal tumor or a soft tissue sarcoma.

[0104] In one embodiment, the composition includes a cytotoxic agent belonging to a class of cytotoxic agents selected from the group consisting of tubulin stabilizers, tubulin destabilizers, antimetabolites, purine synthesis inhibitors, nucleoside analogs, DNA alkylating agents, DNA modifying agents and vascular disrupting agents. In one embodiment, the cytotoxic agent is used alone or in combinations of one or more cytotoxic agents such as calicheamycin, doxorubicin, taxol, methotrexate, gemcitabine, cytarabine, vinblastine, daunorubicin, docetaxel, irinotecan, epothilone B, epothilone D, cisplatin, carboplatin and 5-fluoro-U.

[0105] The disclosure also provides methods for increasing the permeability of a solid tumor to cytotoxic agents by administering a therapeutically effective amount of a PDGF binding aptamer of the disclosure. The disclosure also provides methods for increasing the permeability of a solid tumor to cytotoxic agents by administering a therapeutically effective amount of a composition of the disclosure.

[0106] In one embodiment, the cancer or tumor is a PDGF-mediated cancer or tumor. In one embodiment, the PDGF-mediated cancer or tumor is a glioblastoma, chronic myelomonocytic leukemia, a protruding dermatofibrosarcoma, a gastrointestinal stromal tumor or a soft tissue sarcoma.

[0107] In one embodiment, the composition includes a cytotoxic agent belonging to a class of cytotoxic agents selected from the group consisting of tubulin stabilizers, tubulin destabilizers, antimetabolites, purine synthesis inhibitors, nucleoside analogs, DNA alkylating agents, DNA modifying agents and vascular disrupting agents. In one embodiment, the cytotoxic agent is used alone or in combinations of one or more cytotoxic agents such as calicheamycin, doxorubicin, taxol, methotrexate, gemcitabine, cytarabine, vinblastine, daunorubicin, docetaxel, irinotecan, epothilone B, epothilone D, cisplatin, carboplatin and 5-fluoro-U. In one embodiment of the invention, the composition includes an antivascular agent or an antiangiogenic agent belonging to the class of anti-VEGF agents selected from anti-sense RI and RII receptor anti-VEGF or anti-VEGF drugs, RI receptor siRNA drugs and anti-VEGF or anti-VEGF RII, anti-VEGF or anti-VEGF RI and RII receptor aptamer drugs, anti-VEGF or anti-VEGF RI and RII receptor antibodies, monobody or adnectin-based drugs RI and RII receptors anti-VEGF or anti-VEGF, or drugs based on chimeric proteins of RI and RII receptors anti-VEGF or anti-VEGF, anti-Ang2, anti-Angl or anti-Tie 1 or anti-antisense derived drugs Tie 2, siRNA, aptamer, antibody, monobody, adnectin or protein chimera.

[0108] The disclosure also provides methods of reducing the constitutive expression of platelet-derived growth factor in a tumor by administering a therapeutically effective amount of a PDGF-binding aptamer of the disclosure. The disclosure also provides methods of reducing the constitutive expression of platelet-derived growth factor in a tumor by administering a therapeutically effective amount of a composition of the disclosure.

[0109] In one embodiment, the cancer or tumor is a PDGF-mediated cancer or tumor. In one embodiment, the PDGF-mediated cancer or tumor is a glioblastoma, chronic myelomonocytic leukemia, a protruding dermatofibrosarcoma, a gastrointestinal stromal tumor or a soft tissue sarcoma.

[0110] In one embodiment, the composition includes a cytotoxic agent belonging to a class of cytotoxic agents selected from the group consisting of tubulin stabilizers, tubulin destabilizers, antimetabolites, purine synthesis inhibitors, nucleoside analogs, DNA alkylating agents, DNA modifying agents and vascular disrupting agents. In one embodiment, the cytotoxic agent is used alone or in combinations of one or more cytotoxic agents such as calicheamycin, doxorubicin, taxol, methotrexate, gemcitabine, cytarabine, vinblastine, daunorubicin, docetaxel, irinotecan, epothilone B, epothilone D, cisplatin, carboplatin and 5-fluoro-U.

[0111] The disclosure also provides angiogenesis reduction procedures, neovascularization

or both angiogenesis and neovascularization in a tumor by administering a therapeutically effective amount of a PDGF binding aptamer of the disclosure. The disclosure also provides methods of reducing angiogenesis, neovascularization or both angiogenesis and neovascularization in a tumor by administering a therapeutically effective amount of a composition of the disclosure. In a particular embodiment of the disclosure, the aptamer is administered 1 to 28 days before administration of a targeted anti-VEGF agent or other antivascular agent. In another embodiment of the disclosure, the aptamer is administered simultaneously with an anti-VEGF agent or other anti-angiogenic antivascular agent. In another embodiment of the disclosure, the PDGF aptamer is administered 1 to 14 days before administration of the antiangiogenic agent or other antivascular agent, other known cancer therapeutic agents, before surgical treatment or any other therapeutic or diagnostic procedure. (for example, radiation therapy). In a particular embodiment of the disclosure, the anti-PDGF agent is administered for up to 14 days and then suspended while anti-VEGF therapy is continued.

or antiangiogenic. In another embodiment of the disclosure, the PDGF agent is administered from 1 to 28 days and the size of the tumor neovasculature, and the degree of tumor vascular growth, is monitored by intravital microscopy to guide a doctor or nurse at the appropriate time. of the administration of the anti-VEGF, anti-angiogenic agent

or antivascular. In another embodiment of the disclosure, the PDGF aptamer is administered 1-28 days to remove pericyte cells and VEGF-producing murals from the tumor microenvironment as a means of altering the VEGF level of a solid tumor.

[0112] In one embodiment, the cancer or tumor is a PDGF-mediated cancer or tumor. In one embodiment, the PDGF-mediated cancer or tumor is a glioblastoma, chronic myelomonocytic leukemia, a protruding dermatofibrosarcoma, a gastrointestinal stromal tumor or a soft tissue sarcoma.

[0113] In one embodiment, the composition includes a cytotoxic agent belonging to a class of cytotoxic agents selected from the group consisting of tubulin stabilizers, tubulin destabilizers, antimetabolites, purine synthesis inhibitors, nucleoside analogs, DNA alkylating agents, DNA modifying agents and vascular disrupting agents. In one embodiment, the cytotoxic agent is used alone or in combinations of one or more cytotoxic agents such as calicheamycin, doxorubicin, taxol, methotrexate, gemcitabine, cytarabine, vinblastine, daunorubicin, docetaxel, irinotecan, epothilone B, epothilone D, cisplatin, carboplatin and 5-fluoro-U.

[0114] The disclosure also provides methods for treating a PDGF-mediated tumor, for example, a solid tumor, in a subject comprising administering a PDGF-binding aptamer of the disclosure to the subject and treating the subject with radiotherapy. In some embodiments, the PDGF binding aptamer of the disclosure increases the edematous fluid content of the tumor, relative to an untreated tumor, before and / or during radiotherapy. In some embodiments, the PDGF binding aptamer of the disclosure increases the oxygen content of the tumor with respect to an untreated tumor, before and / or during radiotherapy. In a particular embodiment, the PDGF specific aptamer for use in radiotherapy is selected from the group consisting of: ARC308, ARC404, ARC513, 592, 593, ARC594 and ARC1472 to ARC1474, particularly from the group consisting of ARC308, ARC593 and ARC594 . In one embodiment, the tumor to be treated with the disclosure aptamer and radiotherapy is a colorectal tumor.

[0115] The disclosure also provides methods of enhancing imaging of tumors comprising administering a PDGF binding aptamer and a photosensitizer to a subject having a PDGF mediated tumor, activating the photosensitizer and detecting the tumor. In some embodiments, the PDGF binding aptamer of the disclosure increases the amount of photosensitizer contained in the tumor, relative to a similar tumor untreated with the PDGF binding aptamer of the disclosure. In some embodiments, the PDGF binding aptamer and / or photosensitizer are administered by perfusing the tumor with, or allowing the tumor to be perfused with, an edematous fluid comprising the PDGF binding aptamer and / or photosensitizer. In a particular embodiment, the PDGF specific aptamer for use in tumor imaging is selected from the group consisting of: ARC308, ARC404, ARC513, ARC592, ARC593, ARC594 and ARC1472 to ARC1474, particularly from the group consisting of ARC308, ARC593 and ARC594. In one embodiment, the tumor to be detected with the aptamer of the invention and the photosensitizer is a colorectal tumor.

DETAILED DESCRIPTION OF THE INVENTION

[0116] The details of one or more embodiments of the disclosure are set forth in the description attached below. The preferred procedures and materials are now described. Other features, objects, and advantages of the disclosure will be apparent from the description. In the specification, singular forms also include the plural, unless the context clearly dictates otherwise. Unless otherwise defined, all technical and scientific terms used in this document have the same meaning that is commonly understood by an expert in the field to which this disclosure belongs. In the case of conflict, the present specification will dominate.

THE SELEX ™ PROCEDURE

[0117] A suitable procedure for generating an aptamer is with the procedure entitled "Systematic Evolution of Exponential Enrichment Ligands" ("SELEX ™") generally represented in Figure 3. The procedure SELEX ™ is a procedure for in vitro evolution of nucleic acid molecules with highly specific binding to target molecules and is described, for example, in US Pat. Serial No. 07 / 536,428 filed June 11, 1990, now abandoned, U.S. Pat. No. 5,475,096 entitled "Nucleic Acid Ligands" and US Pat. No. 5,270,163 (see also WO 91/19813) entitled "Nucleic acid ligands". Each nucleic acid ligand identified by SELEX ™, that is, each aptamer, is a specific ligand of a given target compound or molecule. The SELEX ™ procedure is based on the sole knowledge that nucleic acids have sufficient capacity to form a variety of bi and three-dimensional structures and sufficient chemical versatility available within their monomers to act as ligands (i.e., form specific binding pairs) with virtually any chemical compound, both monomeric and polymeric. Molecules of any size or composition can serve as targets.

[0118] SELEX ™ is based on a large library or set of single stranded oligonucleotides comprising random sequences. The oligonucleotides can be DNA, RNA, or DNA / RNA hybrids, modified or unmodified. In some examples, the set comprises 100% random or partially random oligonucleotides. In other examples, the set comprises random or partially random oligonucleotides containing at least one fixed sequence and / or conserved sequence incorporated within the random sequence. In other examples, the set comprises random or partially random oligonucleotides containing at least one fixed and / or conserved sequence at its 5 'and / or 3' end that may comprise a sequence shared by all molecules of the oligonucleotide set. Fixed sequences are sequences common to oligonucleotides in the set that is incorporated for a preselected purpose, such as CpG motifs described further below, hybridization sites for PCR primers, promoter sequences for RNA polymerases (eg, T3, T4, T7 and SP6), restriction sites, or homopolymeric sequences such as poly A or poly T tracts, catalytic nuclei, sites for selective binding to affinity columns, and other sequences to facilitate cloning and / or sequencing of an oligonucleotide of interest . The conserved sequences are sequences, different from the previously described fixed sequences, shared by several aptamers that bind to the same target.

[0119] The oligonucleotides in the set preferably include a random sequence portion, in addition to fixed sequences necessary for efficient amplification. Normally, the oligonucleotides of the starting set contain sequences of the fixed 5 'and 3' ends flanking an internal region of random 30-50 nucleotides. Random nucleotides can be produced in several ways that include chemical synthesis and size selection from randomly cleaved cell nucleic acids. The sequence variation in test nucleic acids can also be introduced or increased by mutagenesis before or during the selection / amplification iterations.

[0120] The random sequence portion of the oligonucleotide may be of any length and may comprise ribonucleotides and / or deoxyribonucleotides and may include modified or unnatural nucleotides or nucleotide analogs. See, for example, US Pat. No. 5,958,691; U.S. Patent No. 5,660,985; U.S. Patent No. 5,958,691; U.S. Patent No. 5,698,687; U.S. Patent No. 5,817,635; U.S. Patent No. 5,672,695 and PCT publication WO 92/07065. Random oligonucleotides can be synthesized from phosphodiester-linked nucleotides using solid phase oligonucleotide synthesis techniques well known in the art. See, for example, Froehler et al., Nucl. Acid Res. 14: 5399-5467 (1986) and Froehler et al., Tet. Lett. 27: 5575-5578 (1986). Random oligonucleotides can also be synthesized using dissolution-free procedures such as the synthesis of tri-esters. See, for example, Sood et al., Nucl. Acid Res. 4: 2557 (1977) and Hirose et al., Tet. Lett., 28: 2449 (1978). Typical syntheses carried out in automated DNA synthesis equipment give 1014-1016 individual molecules, a sufficient number for most SELEX ™ experiments. Sufficiently large regions of the random sequence in the sequence design increase the probability that each synthesized molecule probably represents a single sequence.

[0121] The oligonucleotide starting library can be generated by automated chemical synthesis in a DNA synthesizer. To synthesize random sequences, mixtures of four nucleotides are added to each stage of nucleotide addition during the synthesis procedure, allowing the random incorporation of the nucleotides. As stated above, in one embodiment, the random oligonucleotides comprise the complete random sequences; however, in other embodiments, the random oligonucleotides may comprise extensions of non-random or partially random sequences. Partially random sequences can be created by adding the four nucleotides in different molar ratios at each stage of addition.

[0122] The oligonucleotide starting library can be both RNA and DNA, or substituted RNA or DNA. In those cases where an RNA library is to be used as a starting library, it is normally generated by synthesizing a DNA library, optionally amplifying by PCR, then transcribing the DNA library in vitro using T7 RNA polymerase or modified T7 RNA polymerases, and purifying the transcribed library. Then, the RNA or DNA library is mixed with the target under favorable conditions for binding and subjected to staggered iterations of binding, separation and amplification, using the same general selection scheme, to achieve virtually any desired affinity and selectivity criteria. of Union. More specifically, starting with a mixture containing the nucleic acid starting set, the SELEX ™ process includes the steps of: (a) contacting the mixture with the target under favorable conditions for binding; (b) separating unbound nucleic acids from those nucleic acids that have specifically bound to target molecules;

(c) dissociate the nucleic acid-target complexes; (d) amplifying the dissociated nucleic acids of the nucleic acid-target complexes to give a mixture enriched in nucleic acid ligands; and (e) reiterate the stages of binding, separation, dissociation and amplification over as many cycles as desired to give highly specific nucleic acid ligands of high affinity for the target molecule. In those cases in which the RNA aptamers are being selected, the SELEX ™ method further comprises the steps of: (i) reverse transcribing the dissociated nucleic acids from the nucleic acid-target complexes before amplification in the stage ( d); and (ii) transcribe the amplified nucleic acids from step (d) before starting the procedure again.

[0123] Within a mixture of nucleic acids containing a large number of possible sequences and structures there is a wide range of binding affinities for a given target. A mixture of nucleic acids comprising, for example, a segment of 20 random nucleotides may have 420 candidate possibilities. Those that have the highest affinity (lowest dissociation constants) for the target are the most likely to bind to the target. After separation, dissociation and amplification a second mixture of nucleic acids is generated, enriched in the candidates with the highest binding affinity. Additional rounds of selection progressively favor the best ligands until the resulting nucleic acid mixture is predominantly composed of only one or some sequences. Then, it can be cloned, sequenced and tested individually for binding affinity as pure ligands or aptamers.

[0124] The selection and amplification cycles are repeated until a desired objective is achieved. In the most general case, the selection / amplification continues until no significant improvement in the bond strength is achieved with the repetition of the cycle. The procedure is normally used to sample approximately 1014 different nucleic acid species, but can be used to sample no less than approximately 1018 different nucleic acid species. Generally, nucleic acid aptamer molecules are selected in a 5 to 20 cycle procedure. In one embodiment, heterogeneity is only introduced in the initial selection stages and does not occur throughout the replication process.

[0125] In one embodiment of SELEX ™, the selection procedure is so efficient in isolating those nucleic acid ligands that bind more strongly to the selected target that only one selection and amplification cycle is required. Such efficient selection can occur, for example, in a chromatographic type procedure in which the ability of nucleic acids to associate with targets bound on a column operates such that the column can sufficiently allow separation and isolation of ligands. of higher affinity nucleic acid.

[0126] In many cases it is not necessarily desirable to perform the iterative steps of SELEX ™ until a single nucleic acid ligand is identified. The dissolution of target specific nucleic acid ligands may include a family of nucleic acid structures or motifs that have several conserved sequences and several sequences that can be substituted or added without significantly affecting the affinity of the nucleic acid ligands for the target. Ending the SELEX ™ procedure before completing it is possible to determine the sequence of several members of the nucleic acid ligand dissolution family.

[0127] It is known that there are a variety of primary, secondary and tertiary nucleic acid structures. The structures or motifs that have been shown to be most commonly involved in non-Watson-Crick-type interactions are hereinafter referred to as hairpin loops, symmetric and asymmetric protuberances, pseudo-nouns and myriad combinations thereof. Almost all known cases of such motives suggest that they can be formed in a nucleic acid sequence of no more than 30 nucleotides. For this reason, it is often preferred that SELEX ™ procedures with adjacent random segments be initiated with nucleic acid sequences containing a random segment of between about 20 and about 50 nucleotides, and about 30 to about 40 nucleotides in some embodiments. . In one example, the 5 'fixed sequence: random: 3' fixed sequence comprises a random sequence of about 30 to about 50 nucleotides.

[0128] The central SELEX ™ procedure has been modified to achieve several specific objectives. For example, US Pat. No. 5,707,796 describes the use of SELEX ™ in conjunction with gel electrophoresis to select nucleic acid molecules with specific structural characteristics such as curved DNA. U.S. Pat. No. 5,763,177 describes SELEX ™ based procedures for selecting nucleic acid ligands that contain photoreactive groups that can bind and / or photoreticulate with and / or photoinactivate a target molecule. U.S. Pat. No. 5,567,588 and U.S. Pat. No. 5,861,254 describe SELEX ™ based procedures that achieve a highly efficient separation between oligonucleotides that have high and low affinity for a target molecule. U.S. Pat. No. 5,496,938 describes procedures for obtaining improved nucleic acid ligands after the SELEX ™ procedure is performed. U.S. Pat. nº

5,705,337 describes procedures for covalently binding a ligand to its target.

[0129] SELEX ™ can also be used to obtain nucleic acid ligands that bind to more than one site in the target molecule, and to obtain nucleic acid ligands that include non-nucleic acid species that bind to specific sites on the target. . SELEX ™ provides means to isolate and identify nucleic acid ligands that bind to any intended target, including large and small biomolecules such as nucleic acid binding proteins and proteins that do not bind nucleic acids as part of their biological function. , in addition to cofactors and other small molecules. For example, US Pat. No. 5,580,737 discloses nucleic acid sequences identified by SELEX ™ that can bind with high affinity to caffeine and the closely related analogue, theophylline.

[0130] Counter-SELEX ™ is a procedure to improve the specificity of nucleic acid ligands by a target molecule by eliminating nucleic acid ligand sequences with cross reactivity by one or more non-target molecules. Counter-SELEX ™ comprises the steps of: (a) preparing a candidate mixture of nucleic acids; (b) contacting the candidate mixture with the target, in which nucleic acids having a high affinity for the target with respect to the candidate mixture can be separated from the rest of the candidate mixture; (c) separating nucleic acids with high affinity from the rest of the candidate mixture; (d) dissociate nucleic acids with high affinity of the target; (e) contacting nucleic acids with high affinity with one or more non-target molecules so that nucleic acid ligands with specific specificity are removed by the non-target molecule (s); and (f) amplifying nucleic acids with specific specificity only by the target molecule to give a mixture of nucleic acids enriched in nucleic acid sequences with a relatively higher affinity and specificity for binding to the target molecule. As described above for SELEX ™, the selection and amplification cycles are repeated as necessary until a desired objective is achieved.

[0131] A possible problem encountered in the use of nucleic acids as therapeutic agents and vaccines is that oligonucleotides in their phosphodiester form can be rapidly degraded in body fluids by intracellular and extracellular enzymes such as endonucleases and exonucleases before the desired effect is manifested. . Therefore, the SELEX ™ method encompasses the identification of high affinity nucleic acid ligands containing modified nucleotides that confer improved ligand characteristics such as improved in vivo stability or improved administration characteristics. Examples of such modifications include chemical substitutions at the sugar and / or phosphate and / or base positions. Nucleic acid ligands identified by SELEX ™ containing modified nucleotides are described, for example, in US Pat. No. 5,660,985, which describes oligonucleotides containing chemically modified nucleotide derivatives at the 2 'position of ribose, position 5 of pyrimidines and position 8 of purines, US Pat. nº

5,756,703 describing oligonucleotides containing various 2 'modified pyrimidines, and US Pat. No. 5,580,737 describing highly specific nucleic acid ligands containing one or more nucleotides modified with 2'-amino (2'-NH2), 2'-fluorine (2'-F) and / or 2'-OMe substituents.

[0132] Modifications of the nucleic acid ligands contemplated in this disclosure include, but are not limited to, those that provide other chemical groups that incorporate additional charge, polarizability, hydrophobia, hydrogen bonds, electrostatic interaction and fluxionality with the bases of the nucleic acid ligands or with the nucleic acid ligand as a whole. Modifications to generate oligonucleotide populations that are resistant to nucleases may also include one or more substitute internucleotide linkages, altered sugars, altered bases, or combinations thereof. Such modifications include, but are not limited to, modifications in the sugar in the 2 'position, modifications in the pyrimidine in the 5 position, modifications in the purine in the 8 position, modifications in exocyclic amines, 4-thiouridine substitution, substitution of 5-bromo or 5-iodo-uracil, modifications in the skeleton, modifications in phosphorothioate or alkyl phosphate, methylations, and combinations of unusual base pairings such as isocytididine and isoguanidine isobases. Modifications may also include 3 'and 5' modifications such as plugging.

[0133] In one embodiment, oligonucleotides are provided in which the group P (O) O is substituted by P (O) S ("thioate"), P (S) S ("dithioate"), P (O) NR2 ( "Amidite"), P (O) R, P (O) OR ', CO or CH2 ("formacetal") or 3'-amine (-NH-CH2-CH2-) in which each R or R' is independently H or substituted or unsubstituted alkyl. The linking groups can be linked to adjacent nucleotides by a -O-, -N- or -S- bond. It is not required that all the bonds in the oligonucleotide be identical. As used herein, the term phosphorothioate encompasses one or more oxygen atoms that do not form bridges in a phosphodiester bond substituted by one or more sulfur atoms.

[0134] In other embodiments, the oligonucleotides comprise modified sugar groups, for example, one

or more of the hydroxyl groups is replaced by halogen, aliphatic groups, or functionalized as ethers or amines. In one embodiment, the 2 'position of the furanose residue is substituted by any of an O-methyl, Oalkyl, O-allyl, S-alkyl, S-allyl or halo group. The 2 'modified sugar synthesis procedures are described, for example, in Sproat et al., Nucl. Acid Res. 19: 733-738 (1991); Cotten et al., Nucl. Acid Res. 19: 2629-2635 (1991); and Hobbs et al., Biochemistry 12: 5138-5145 (1973). Other modifications are known to a person skilled in the art. Such modifications may be modifications of the pre-SELEX ™ procedure or modifications of the post-SELEX ™ procedure (modification of unmodified ligands previously identified), or may be made by incorporation into the SELEX ™ procedure.

[0135] Modifications of the pre-SELEX ™ procedure or those made by incorporation into the SELEX procedure give nucleic acid ligands with both specificity for their SELEX ™ target and improved stability, for example, in vivo stability. Modifications of the post-SELEX ™ procedure made to nucleic acid ligands can produce improved stability, for example, stability in vivo without adversely affecting the binding capacity of the nucleic acid ligand.

[0136] The SELEX ™ method encompasses combining selected oligonucleotides with other selected oligonucleotides and non-oligonucleotide functional units as described in US Pat. No. 5,637,459 and U.S. Pat. No. 5,683,867. The SELEX ™ method further encompasses combining selected nucleic acid ligands with high molecular weight lipophilic or non-immunogenic compounds in a diagnostic or therapeutic complex as described, for example, in US Pat. No. 6,011,020, U.S. Pat. No. 6,051,698 and PCT Publication No. WO 98/18480. These patents and applications teach the combination of a broad array of forms and other properties, with the efficient amplification and replication properties of oligonucleotides, and with the desirable properties of other molecules.

[0137] The identification of nucleic acid ligands for small flexible peptides has also been explored by the SELEX ™ method. Small peptides have flexible structures and normally exist in solution in a multi-conformer equilibrium, and therefore, it was initially thought that binding affinities could be limited by the conformational entropy lost after binding to the flexible peptide. However, the feasibility of identification of nucleic acid ligands for small peptides in solution was demonstrated in US Pat. No. 5,648,214 in which high affinity RNA nucleic acid ligands were identified by substance P, an 11 amino acid peptide.

[0138] The aptamer with specificity and binding affinity for the target (s) of the present disclosure is normally selected by the SELEX ™ procedure as described herein. Then, as part of the SELEX ™ procedure, the selected sequences to be bound to the target are optionally minimized to determine the minimum sequence that has the desired binding affinity. Selected aptamer sequences and / or minimized aptamer sequences are optionally optimized by random or directed mutagenesis of the sequence to increase binding affinity or alternatively to determine which positions in the sequence are essential for binding activity. For example, a "doped reselection" can be used to explore the sequence requirements within an aptamer. During doped reselection, selections are made with a synthetic degenerate set that is designed based on a single sequence. The level of degeneration normally varies from 70% to 85% of natural nucleotide. In general, neutral mutations are observed after doped reselection, but in some cases sequence changes can produce improvements in affinity. Additionally, selections can be made with sequences incorporating modified sequences to stabilize the aptamer molecules against degradation in vivo.

SELEX ™ MODIFIED IN 2 '

[0139] For an aptamer to be suitable for use as a therapeutic agent, it is preferably cheap to synthesize, safe and stable in vivo. Natural RNA and DNA aptamers are normally not stable in vivo due to their susceptibility to nuclease degradation. Resistance to degradation by nucleases can be greatly increased, if desired, by incorporation of modifying groups at the 2 'position.

[0140] The 2'-fluorine and 2'-amino groups have been successfully incorporated into oligonucleotide libraries from which aptamers have subsequently been selected. However, these modifications greatly increase the synthesis cost of the resulting aptamer and may introduce safety issues in some cases due to the possibility that the modified nucleotides could be recirculated into host DNA by degradation of the modified oligonucleotides and subsequent use of the nucleotides as substrates for DNA synthesis.

[0141] Aptamers containing 2'-O-methyl-nucleotides ("2'-OMe"), as provided in some embodiments herein, overcome many of these disadvantages. Oligonucleotides containing 2'OMe-nucleotides are nuclease resistant and inexpensive to synthesize. Although 2'-OMe-nucleotides are ubiquitous in biological systems, natural polymerases do not accept 2'-OMe-NTP as substrates under physiological conditions, therefore, there are no safety concerns regarding the recirculation of 2'-OMe- nucleotides in host DNA. The SELEX ™ procedures used to generate 2 'modified aptamers are described, for example, in the US provisional patent application. Serial No. 60 / 430,761 filed on December 3, 2002, the provisional US patent application. Serial No. 60 / 487,474 filed July 15, 2003, U.S. provisional patent application Serial No. 60/517,039 filed on November 4, 2003, U.S. Patent Application. No. 10 / 729,581 filed on December 3, 2003, US Pat. No. 10 / 873,856 filed on June 21, 2004 entitled "Procedure for in vitro selection of 2'-OMe substituted nucleic acids" and the provisional US patent application. Serial No. 60 / 696,295 filed on June 30, 2005 entitled "Improved materials and procedures for the generation of nucleic acid transcripts containing completely modified in 2 '".

[0142] The present disclosure includes aptamers that bind to and modulate the function of PDGF containing modified nucleotides (eg, nucleotides having a 2 'position modification) to make the oligonucleotide more stable than the unmodified oligonucleotide to degradation enzymatic and chemical, in addition to thermal and physical degradation. Although there are several examples of aptamers containing 2'-OMe in the literature (see, for example, Ruckman et al., J.Biol.Chem, (1998) 273, 20556-20567-695), these were generated by selection in vitro of modified transcript libraries in which residues C and U were substituted with 2'-fluorine (2'-F) and residues A and G with 2'-OH. Then, once functional sequences were identified, each residue A and G was tested for tolerance to substitution with 2'-OMe, and the aptamer was re-synthesized having all residues A and G that tolerated substitution with 2'- OMe as waste 2'-OMe. Most of the A and G residues of aptamers generated in this two-stage mode tolerate substitution with 2'-OMe residues although, on average, approximately 20% did not tolerate it. Therefore, aptamers generated using this procedure tend to contain two to four 2'-OH residues, and as a result there is a balance between stability and synthesis cost. Incorporating modified nucleotides into the transcription reaction that generates stabilized oligonucleotides used in oligonucleotide libraries from which aptamers are selected and enriched by SELEX ™ (and / or any of its variations and improvements, which include those described herein), The methods of the present disclosure eliminate the need to stabilize the oligonucleotides of selected aptamers (eg, re-synthesizing the oligonucleotides of aptamers with modified nucleotides).

[0143] In one embodiment, the present disclosure provides aptamers comprising combinations of modifications with 2'-OH, 2'-F, 2'-deoxy and 2'-OMe of the nucleotides ATP, GTP, CTP, TTP and UTP. In another embodiment, the present disclosure provides aptamers comprising combinations of modifications with 2'-OH, 2'-F, 2'-deoxy, 2'-OMe, 2'-NH2 and 2'-methoxyethyl nucleotides ATP, GTP , CTP, TTP and UTP. In another embodiment, the present disclosure provides aptamers comprising 56 combinations of modifications with 2'-OH, 2'-F, 2'-deoxy, 2'-OMe, 2'-NH2 and 2'-methoxyethyl of the ATP nucleotides, GTP, CTP, TTP and UTP.

[0144] The 2 'modified aptamers of some embodiments of the disclosure are created using modified polymerases, for example, a modified T7 polymerase having a rate of incorporation of modified nucleotides having bulky substituents at the 2' position of furanose which is superior to that of natural polymerases. For example, a mutant T7 polymerase (Y639F) in which the tyrosine residue at position 639 has been changed to phenylalanine easily uses 2'-deoxy-, 2'-amino- and 2'-fluoro-nucleotide triphosphate (NTP) as substrates and has been widely used to synthesize modified RNA for a variety of applications. However, this mutant T7 polymerase reportedly cannot easily use (i.e. incorporate) NTP with 2'-bulky substituents such as 2'-OMe or 2'-azido (2'-N3) substituents. For the incorporation of bulky 2 'substituents, a T7 polymerase mutant (Y639F / H784A) that has histidine at position 784 was changed to an alanine residue, in addition to the Y639F mutation that has been described and used under limited circumstances to incorporate modified pyrimidine NTP. See Padilla, R. and Sousa, R., Nucleic Acids Re., 2002, 30 (24): 138. A mutant T7 RNA polymerase Y639F / H784A / K378R has been used under limited circumstances to incorporate modified purine and pyrimidine NTP, for example, 2'-OMe-NPT, but requires an addition of 2'-OH-GTP for transcription. See Burmeister et al., Chemistry and Biology, 2005, 12: 25-33. A mutant T7 polymerase (H784A) having histidine at position 784 that was changed to an alanine residue has also been described. Padilla et al., Nucleic Acids Research, 2002, 30: 138. In both the Y639F / H784A mutant polymerases and the H784A mutant T7, the change to a smaller amino acid residue such as alanine allows the incorporation of more bulky nucleotide substrates, for example, nucleotides substituted with 2'-O-methyl. See Chelliserry, K. and Ellington, A.D., Nature Biotech, 2004, 9: 1155-60. Additional T7 RNA polymerases have been described with mutations in the active site of T7 RNA polymerase that more readily incorporate the 2 'bulky modified substrates, for example, a T7 mutant RNA polymerase having the tyrosine residue at position 639 changed by a leucine (Y639L). However, activity is frequently sacrificed to increase substrate specificity conferred by such mutations, leading to low yields of transcripts. See Padilla R and Sousa, R., Nucleic Acids Re., 1999, 27 (6): 15G1.

[0145] It has generally been found that under the conditions disclosed herein the mutant Y693F can be used for the incorporation of all NTP substituted with 2'-OMe, except GTP, and the mutant T7 RNA polymerases Y639F / H784A, Y639F / H784A / K378R, Y639L / H784A and Y639L / H784A / K378R can be used for the incorporation of all NTPs substituted with 2'-OMe including GTP. The H784A mutant is expected to possess properties similar to those of the Y639F and Y639F / H784A mutants when used under the conditions disclosed herein.

[0146] The 2 'modified oligonucleotides can be synthesized completely by modified nucleotides, or with a subset of modified nucleotides. All nucleotides can be modified, and all can contain the same modification. All nucleotides can be modified, but they contain different modifications, for example, all nucleotides that contain the same base can have one type of modification, while nucleotides that contain other bases may have different types of modification. All purine nucleotides may have one type of modification (or are unmodified), while all pyrimidine nucleotides have a different type of modification (or are unmodified). Thus, transcripts, or transcript libraries, are generated using any combination of modifications that includes, for example, ribonucleotides (2'-OH), deoxyribonucleotides (2'-deoxy), nucleotides 2'-F and 2'- OMe. A transcription mixture containing 2'-OMe-C and -U and 2'-OH-A and -G is hereinafter referred to as a mixture "rRmY" and aptamers selected therefrom are hereinafter referred to as aptamers "rRmY" . A transcription mixture containing deoxy-A and -G and 2'-OMe-U and -C is hereinafter referred to as a "dRmY" mixture and the aptamers selected therefrom are hereinafter referred to as "dRmY" aptamers. A transcription mixture containing 2'-OMe-A, -C and -U and 2'-OH-G is hereinafter referred to as a mixture "rGmH" and the aptamers selected therefrom are hereinafter referred to as aptamers "rGmH " A transcription mixture that alternatively contains 2'-OMe-A, -C, -U and -G and 2'-OMe-A, -U and -C and 2'-FG is hereinafter referred to as an "alternating mixture" and the aptamers selected therefrom are hereinafter referred to as "alternating mixture" aptamers. A transcription mixture containing 2'-OMe-A, -U, -C and -G in which up to 10% of the G are ribonucleotides is hereinafter referred to as a mixture "r / mGmH" and the aptamers selected from it is hereinafter referred to as aptamers "r / mGmH". A transcription mixture containing 2'-OMe-A, -U and -C and 2'-F-G is hereinafter referred to as a mixture "fGmH" and the aptamers selected therefrom are hereinafter referred to as aptamers "fGmH". A transcription mixture containing 2'-OH-A and -G and 2'-F-C and -U is hereinafter referred to as a mixture "rRfY" and the aptamers selected therefrom are hereinafter referred to as aptamers "rRfY". A transcription mixture containing 2'-OMe-A, -U and -C and deoxy-G is hereinafter referred to as a mixture "dGmH" and the aptamers selected therefrom are hereinafter referred to as "dGmH" aptamers. A transcription mixture containing deoxy-A and 2'-OMe-C, -G and -U is hereinafter referred to as a mixture "dAmB" and the aptamers selected therefrom are hereinafter referred to as aptamers "dAmB", and A transcription mixture containing all 2'-OH-nucleotides is hereinafter referred to as a "rN" mixture and the aptamers selected therefrom are hereinafter referred to as "rN", "rRrY" or "RNA" aptamers. A transcription mixture containing 2'-OH-adenosine triphosphate and guanosine triphosphate and deoxy-citidine triphosphate and thymidine triphosphate is hereinafter referred to as a mixture rRdY and the aptamers selected hereinafter are referred to as aptamers "rRdY". An "mRmY" aptamer is one that only contains 2'-OMe-nucleotides, except the starting nucleotide that is 2'-hydroxy.

[0147] A preferred embodiment includes any combination of 2'-OH-, 2'-deoxy- and 2'-OMe-nucleotides. Another embodiment includes any combination of 2'-deoxy-and 2'-OMe-nucleotides. Yet another embodiment includes any combination of 2'-deoxy- and 2'-OMe-nucleotides in which the pyrimidines are 2'-OMe (such as dRmY, mRmY or dGmH).

[0148] The incorporation of modified nucleotides into the aptamers of the disclosure can be carried out before (pre) the selection procedure (eg, a modification of the pre-SELEX ™ procedure). Optionally, the aptamers of the disclosure in which the modified nucleotides have been incorporated by the modification of the pre-SELEX ™ procedure can be further modified by a post-SELEX ™ modification procedure (i.e., a modification of the post-SELEX ™ procedure afterwards of a pre-SELEX ™ modification). Modifications of the pre-SELEX ™ procedure give specifically modified nucleic acid ligands for the SELEX ™ target and also improves stability in vivo. Modifications of the post-SELEX ™ procedure, that is, modification (eg, truncation, deletion, substitution or modifications of additional nucleotides of previously identified ligands having nucleotides incorporated by modification of the pre-SELEX ™ procedure) may result in further improvement. of stability in vivo without adversely affecting the binding capacity of the nucleic acid ligand having nucleotides incorporated by modification of the pre-SELEX ™ procedure.

[0149] To generate sets of 2 'modified RNA transcripts (eg, 2'-OMe) under conditions where a polymerase accepts 2' modified NTPs, mutant T7 RNA polymerases Y693F, Y693F / K378R can be used, Y693F / H784A, Y693F / H784A / K378R, Y693L / H784A, Y693L / H784A / K378R, Y639L or Y639L / K378R. A preferred polymerase is mutant T7 RNA polymerase Y639L / H784A. Another preferred polymerase is the mutant T7 RNA polymerase Y639L / H784A / K378R. Other T7 RNA polymerases can also be used in the present disclosure, particularly those that have a high tolerance for bulky 2 'substituents. If used in a mold-directed polymerization using the conditions disclosed herein, the mutant T7 RNA polymerase Y639L / H784A or Y639L / H784A / K378R can be used for the incorporation of all 2'-OMe-NTP, including GTP, with higher yields of transcripts than those obtained using the mutant T7 RNA polymerase Y639F, Y639F / K378R, Y639F / H784A, Y639F / H784A / K378R, Y639L or Y639L / K378R. If used under the 2 'modified SELEX ™ transcription conditions disclosed herein, the Y639L / H784A and Y639L / H784A / K378R mutant T7 RNA polymerases do not require 2'-OH-GTP to achieve high yields of modified oligonucleotides in 2 ', for example, containing 2'-OMe.

[0150] Several factors have been determined to be important for the transcription conditions useful in the procedures disclosed in this document. For example, increases in modified transcript yields are observed when a conductive sequence is incorporated at the 5 'end of the DNA transcription template. The conductive sequence is normally 6-15 nucleotides in length, and may be composed of all purines, or a mixture of purine and pyrimidine nucleotides.

[0151] Transcription can be divided into two phases: the first phase is initiation, during which an NTP is added to the 3 'hydroxyl end of GTP (or another substituted guanosine) to give a dinucleotide that then extends approximately 10- 12 nucleotides; the second phase is elongation, during which transcription advances beyond the addition of the first approximately 10-12 nucleotides. It has been found that small amounts of 2'-OH-GTP added to a transcription mixture containing an excess of 2'-OMe-GTP are sufficient to allow polymerase to initiate transcription using 2'-OH-GTP, but a Once the transcription enters the elongation phase, the reduced discrimination between 2'-OMe- and 2'-OH-GTP, and the excess of 2'-OMe-GTP with respect to 2'-OH-GTP, allows the incorporation of mainly 2'-OMe-GTP.

[0152] Another important factor in the incorporation of 2'-OMe substituted nucleotides in transcripts is the use of both magnesium and divalent manganese in the transcription mixture. It has been found that different combinations of magnesium chloride and manganese chloride concentrations affect the performance of 2'-O-methylated transcripts, the optimal concentration of magnesium chloride and manganese depending on the concentration in the transcription reaction mixture. of NTP that complex divalent metal ions. To obtain the highest yield of maximally 2'-O-methylated transcripts (ie, all 2'-OMe-A, -C and -U and approximately 90% of G nucleotides) concentrations of approximately magnesium chloride are preferred. 5 mM and 1.5 mM manganese chloride when each NTP is present at a concentration of 0.5 mM. If the concentration of each NTP is 1.0 mM, concentrations of approximately 6.5 mM magnesium chloride and 2.0 mM manganese chloride are preferred. If the concentration of each NTP is 2.0 mM, concentrations of approximately 9.5 mM magnesium chloride and 3.0 mM manganese chloride are preferred. In any case, deviations from these concentrations of up to two times still give significant amounts of modified transcripts.

[0153] Transcription by priming with GMP or guanosine, or other non-2'-OMe-no triphosphate is also important. This effect results from the specificity of the polymerase by the initiation nucleotide. As a result, the nucleotide of the 5 'end of any transcript generated in this way is likely to be 2'-OH-G. The preferred concentration of GMP (or guanosine) is 0.5 mM and even more preferably 1 mM. It has also been found that including PEG, preferably PEG-8000, in the transcription reaction is useful for maximizing the incorporation of modified nucleotides.

[0154] For maximum incorporation of 2'-OMe-ATP (100%), -UTP (100%), -CTP (100%) and -GTP (~ 90%) ("r / mGmH") in transcripts Prefer the following conditions: 200 mM HEPES buffer, 40 mM DTT, 2 mM spermidine, 10% PEG-8000 (weight / volume), 0.01% Triton X-100 (weight / volume), 5 mM MgCl2 (6.5 mM if the concentration of each 2'-OMe-NTP is 1.0 mM), 1.5 mM MnCl2 (2.0 mM if the concentration of each 2'-OMe-NTP is 1.0 mM), 2'- OMe-NTP (each) 500 μM (more preferably 1.0 mM), 2'-OH-GTP 30 μM, 2'-OH-GMP 500 μM, pH 7.5, RNA polymerase T7 Y639F / H784A 200 nM, inorganic pyrophosphatase units / ml and a conductive sequence of all purines at least 8 nucleotides in length. As used herein, a unit of the mutant T7 RNA polymerase Y639F / H784A (or any other mutant T7 RNA polymerase specified herein) is defined as the amount of enzyme required to incorporate 1 nmol of 2'-OMe-NTP in transcripts under the conditions of r / mGmH. As used herein, an inorganic pyrophosphatase unit is defined as the amount of enzyme that will release 1.0 mol of inorganic orthophosphate per minute at pH 7.2 and 25 ° C.

[0155] For the maximum incorporation (100%) of 2'-OMe-ATP, -UTP and -CTP ("rGmH") in transcripts the following conditions are preferred: 200 mM HEPES buffer, 40 mM DTT, 2 mM spermidine, PEG-8000 10% (weight / volume), Triton X-100 0.01% (weight / volume), 5 mM MgCl2 (9.5 mM if the concentration of each 2'-OMe-NTP is 2.0 mM) , 1.5 mM MnCl2 (3.0 mM if the concentration of each 2'-OMe-NTP is 2.0 mM), 2'-OMe-NTP (each) 500 µM (more preferably 2.0 mM), pH 7.5, T7 Y639F 200 nM RNA polymerase, 5 units / ml inorganic pyrophosphatase, and a conductive sequence of all purines at least 8 nucleotides in length.

[0156] For the maximum incorporation of 2'-OMe-ATP (100%), 2'-OMe-UTP (100%), 2'-OMe-CTP (100%) and 2'-OMe-GTP (100% ) ("MRmY") in transcripts the following conditions are preferred: 200 mM HEPES buffer, 40 mM DTT, 2 mM spermidine, 10% PEG-8000 (weight / volume), Triton X-100 0.01% (weight / volume ), 8 mM MgCl2, 2.5 mM MnCl2, 1.5 mM 2'-OMe-NTP, 1 mM 2'-OH-GMP, pH 7.5, mutant T7 RNA polymerase Y639L / H784A / K378R 200 nM, inorganic pyrophosphatase 5 units / ml and a conductive sequence that increases the transcription yield under the derived transcription conditions. In one embodiment, the conductive sequence is a conductive sequence of all purines. In another embodiment, the conductive sequence is a mixture of purines and pyrimidines. As used herein, an inorganic pyrophosphatase unit is defined as the amount of enzyme that will release 1.0 mol of inorganic orthophosphate per minute at pH 7.2 and 25 ° C.

[0157] For the maximum incorporation (100%) of 2'-OMe-UTP and -CTP ("rRmY") in transcripts the following conditions are preferred: 200 mM HEPES buffer, 40 mM DTT, 2 mM spermidine, PEG-8000 10% (weight / volume), Triton X-100 0.01% (weight / volume), 5 mM MgCl2 (9.5 mM if the concentration of each 2'-OMe-NTP is 2.0 mM), MnCl2 1 , 5 mM (3.0 mM if the concentration of each 2'-OMe-NTP is 2.0 mM), 2'-OMe-NTP (each) 500 µM (more preferably 2.0 mM), pH 7, 5, T7 Y639F / H784A 200 nM RNA polymerase, 5 units / ml inorganic pyrophosphatase and a conductive sequence of all purines at least 8 nucleotides in length.

[0158] For the maximum incorporation (100%) of deoxy-ATP and -GTP and 2'-OMe-UTP and -CTP ("dRmY") in transcripts the following conditions are preferred: 200 mM HEPES buffer, 40 mM DTT, 2 mM spermine, 2 mM spermidine, 10% PEG-8000 (weight / volume), Triton X-100 0.01% (weight / volume), 9.5 mM MgCl2, 3.0 mM MnCl2, 2'-OMe- 2.0 mM NTP (each), pH 7.5, 200 nM T7 Y639F RNA polymerase, 5 units / ml inorganic pyrophosphatase and a conductive sequence of all purines at least 8 nucleotides in length.

[0159] For the maximum incorporation (100%) of 2'-OMe-ATP, -UTP and -CTP and 2'-F-GTP ("fGmH") in transcripts the following conditions are preferred: 200 mM HEPES buffer, DTT 40 mM, 2 mM spermidine, 10% PEG-8000 (weight / volume), Triton X-100 0.01% (weight / volume), 9.5 mM MgCl2, 3.0 mM MnCl2, 2'-OMe-NTP (each) 2.0 mM, pH 7.5, RNA polymerase T7 Y639F 200 nM, inorganic pyrophosphatase 5 units / ml and a conductive sequence of all purines at least 8 nucleotides in length.

[0160] For the maximum incorporation (100%) of deoxy-ATP and 2'-OMe-UTP, -GTP and -CTP ("dAmB") in transcripts the following conditions are preferred: 200 mM HEPES buffer, 40 mM DTT, 2 mM spermidine, 10% PEG8000 (weight / volume), Triton X-100 0.01% (weight / volume), 9.5 mM MgCl2, 3.0 mM MnCl2, 2'-OMe-NTP (each) 2 , 0 mM, pH 7.5, 200 nM T7Y69F RNA polymerase, 5 units / ml inorganic pyrophosphatase and a conductive sequence of all purines at least 8 nucleotides in length.

[0161] For each of the above (a) transcription is preferably performed at a temperature of about 20 ° C to about 50 ° C, preferably about 30 ° C to 45 ° C, and more preferably at about 37 ° C for a period of at least two hours and ( b) 50-300 nM of a double-stranded DNA transcription template is used (200 nM template is used in round 1 to increase diversity (300 nM template is used in dRmY transcripts)), and for subsequent rounds it is used approximately 50 nM, at 1/10 dilution of an optimized PCR reaction using conditions described herein). Preferred DNA transcription templates are described below (when ARC254 and ARC256 transcribe under all conditions of 2'-OMe and ARC255 transcribe under rRmY conditions).

[0162] Under rN transcription conditions of the present disclosure, the transcription reaction mixture comprises 2'-OH-adenosine triphosphates (ATP), 2'-OH-guanosine triphosphates (GTP), 2'-OH-citidine triphosphates ( CTP) and 2'-OH-uridine triphosphates (UTP). The modified oligonucleotides produced using the rN transcription mixtures of the present disclosure comprise substantially all 2'-OH-adenosine, 2'-OH-guanosine, 2'-OH-cytidine and 2'-OH-uridine. In a preferred embodiment of rN transcription, the resulting modified oligonucleotides comprise a sequence in which at least 80% of all adenosine nucleotides are 2'-OH-adenosine, at least 80% of all guanosine nucleotides are 2'-OH-guanosine, at least 80% of all cytidine nucleotides are 2'-OH-citidine and at least 80% of all uridine nucleotides are 2'-OH-uridine. In a more preferred embodiment of rN transcription, the modified oligonucleotides resulting from the present disclosure comprise a sequence in which at least 90% of all adenosine nucleotides are 2'-OH adenosine, at least 90% of all Guanosine nucleotides are 2'-OH-guanosine, at least 90% of all cytidine nucleotides are 2'-OH-cytidine and at least 90% of all uridine nucleotides are 2'-OHuridine. In a more preferred embodiment of rN transcription, the modified oligonucleotides of the present disclosure comprise a sequence in which 100% of all adenosine nucleotides are 2'-OHadenosine, 100% of all guanosine nucleotides are 2 ' -OH-guanosine, 100% of all cytidine nucleotides are 2'-OH-cytidine and 100% of all uridine nucleotides are 2'-OH-uridine.

[0163] Under rRmY transcription conditions of the present disclosure, the transcription reaction mixture comprises 2'-OH-adenosine triphosphates, 2'-OH-guanosine triphosphates, 2'-OMe-cytidine triphosphates and 2'OMe-uridine triphosphates . The modified oligonucleotides produced using the rRmY transcription mixtures of the present disclosure comprise substantially all 2'-OH-adenosine, 2'-OH-guanosine, 2'-OMe-cytidine and 2'OMe-uridine. In a preferred embodiment, the resulting modified oligonucleotides comprise a sequence in which at least 80% of all adenosine nucleotides are 2'-OH-adenosine, at least 80% of all guanosine nucleotides are 2'-OH -guanosine, at least 80% of all cytidine nucleotides are 2'OMe-cytidine and at least 80% of all uridine nucleotides are 2'-OMe-uridine. In a more preferred embodiment, the resulting modified oligonucleotides comprise a sequence in which at least 90% of all adenosine nucleotides are 2'-OH-adenosine, at least 90% of all guanosine nucleotides are 2'- OH-guanosine, at least 90% of all cytidine nucleotides are 2'-OMe-cytidine and at least 90% of all uridine nucleotides are 2'-OMe-uridine. In a more preferred embodiment, the resulting modified oligonucleotides comprise a sequence in which 100% of all adenosine nucleotides are 2'OH-adenosine, 100% of all guanosine nucleotides are 2'-OH-guanosine, the 100% of all cytidine nucleotides are 2'-OMe-cytidine and 100% of all uridine nucleotides are 2'-OMe-uridine.

[0164] Under dRmY transcription conditions of the present disclosure, the transcription reaction mixture comprises 2'-deoxy-adenosine triphosphates, 2'-deoxy-guanosine triphosphates, 2'-O-methyl-citidine triphosphates and 2'-O -methyl-uridine triphosphates. The modified oligonucleotides produced using the dRmY transcription conditions of the present disclosure comprise substantially all 2'-deoxy-adenosine, 2'-deoxy-guanosine, 2'O-methyl-cytidine and 2'-O-methyl-uridine. In a preferred embodiment, the modified oligonucleotides resulting from the present disclosure comprise a sequence in which at least 80% of all adenosine nucleotides are 2'-deoxy-adenosine, at least 80% of all guanosine nucleotides are 2'-deoxy-guanosine, at least 80% of all cytidine nucleotides are 2'-O-methyl-cytidine and at least 80% of all uridine nucleotides are 2'-O-methyl-uridine. In a more preferred embodiment, the modified oligonucleotides resulting from the present disclosure comprise a sequence in which at least 90% of all adenosine nucleotides are 2'-deoxy-adenosine, at least 90% of all guanosine nucleotides are 2'-deoxy-guanosine, at least 90% of all cytidine nucleotides are 2'-O-methyl-cytidine and at least 90% of all uridine nucleotides are 2'-O-methyl-uridine. In a more preferred embodiment, the modified oligonucleotides resulting from the present disclosure comprise a sequence in which 100% of all adenosine nucleotides are 2'deoxy-adenosine, 100% of all guanosine nucleotides are 2'-deoxy -guanosine, 100% of all cytidine nucleotides are 2'-O-methyl-cytidine and 100% of all uridine nucleotides are 2'-O-methyl-uridine.

[0165] Under rGmH transcription conditions of the present disclosure, the transcription reaction mixture comprises 2'-OH-guanosine triphosphates, 2'-O-methyl-citidine triphosphates, 2'-O-methyl-uridine triphosphates and 2 ' O-methyl adenosine triphosphates. The modified oligonucleotides produced using the rGmH transcription mixtures of the present disclosure comprise substantially all 2'-OH-guanosine, 2'-O-methyl-cytidine, 2'-O-methyluridine and 2'-O-methyl-adenosine. In a preferred embodiment, the resulting modified oligonucleotides comprise a sequence in which at least 80% of all guanosine nucleotides are 2'-OH-guanosine, at least 80% of all cytidine nucleotides are 2'-O -methyl-citidine, at least 80% of all uridine nucleotides are 2'-O-methyl-uridine and at least 80% of all adenosine nucleotides are 2'-Omethyl-adenosine. In a more preferred embodiment, the resulting modified oligonucleotides comprise a sequence in which at least 90% of all guanosine nucleotides are 2'-OH-guanosine, at least 90% of all cytidine nucleotides are 2'- O-methyl-cytidine, at least 90% of all uridine nucleotides are 2'-O-methyl-uridine and at least 90% of all adenosine nucleotides are 2'-O-methyl-adenosine. In a more preferred embodiment, the resulting modified oligonucleotides comprise a sequence in which 100% of all guanosine nucleotides are 2'-OH-guanosine, 100% of all cytidine nucleotides are 2'-O-ethyl- Citidine, 100% of all uridine nucleotides are 2'-O-methyl-uridine and 100% of all adenosine nucleotides are 2'-O-ethyl-adenosine.

[0166] Under r / mGmH transcription conditions of the present disclosure, the transcription reaction mixture comprises 2'-O-methyl-adenosine triphosphate, 2'-O-methyl-cytidine triphosphate, 2'-O-methyl guanosine triphosphate , 2'-O-methyl-uridine triphosphate and 2'-OH-guanosine triphosphate. The resulting modified oligonucleotides produced using the r / mGmH transcription mixtures of the present disclosure comprise substantially all 2'-Omethyl-adenosine, 2'-O-methyl-cytidine, 2'-O-methyl guanosine and 2'-O-methyl -uridine, in which the guanosine nucleotide population has a maximum of approximately 10% 2'-OH-guanosine. In a preferred embodiment, the r / mGmH modified oligonucleotides resulting from the present disclosure comprise a sequence in which at least 80% of all adenosine nucleotides are 2'-O-methyl-adenosine, at least 80% of all cytidine nucleotides are 2'-O-methyl-cytidine, at least 80% of all guanosine nucleotides are 2'-O-methylguanosine, at least 80% of all uridine nucleotides are 2'-O -methyl-uridine, and no more than about 10% of all guanosine nucleotides are 2'-OH-guanosine. In a more preferred embodiment, the resulting modified oligonucleotides comprise a sequence in which at least 90% of all adenosine nucleotides are 2'-O-methyl-adenosine, at least 90% of all cytidine nucleotides are 2 '-O-methyl-cytidine, at least 90% of all guanosine nucleotides are 2'-O-methyl guanosine, at least 90% of all uridine nucleotides are 2'-O-methyl-uridine, and no more than about 10% of all guanosine nucleotides are 2'-OH-guanosine. In a more preferred embodiment, the resulting modified oligonucleotides comprise a sequence in which 100% of all adenosine nucleotides are 2'-O-methyladenosine, 100% of all cytidine nucleotides are 2'-O-methyl- Citidine, 90% of all guanosine nucleotides are 2'-O-methyl-guanosine and 100% of all uridine nucleotides are 2'-O-methyl-uridine, and no more than about 10% of all The guanosine nucleotides are 2'-OH-guanosine.

[0167] Under mRmY transcription conditions of the present disclosure, the transcription mixture only comprises 2'-O-methyl-adenosine triphosphate, 2'-O-methyl-cytidine triphosphate, 2'-O-methyl-guanosine triphosphate, 2 '-O-methyluridine triphosphate. The resulting modified oligonucleotides produced using the mRmY transcription mixture of the present invention comprise a sequence in which 100% of all adenosine nucleotides are 2'-O-methyl-adenosine, 100% of all cytidine nucleotides are 2'-O-methyl-cytidine, 100% of all guanosine nucleotides are 2'-O-methyl-guanosine and 100% of all uridine nucleotides are 2'-O-methyluridine.

[0168] Under the fGmH transcription conditions of the present disclosure, the transcription reaction mixture comprises 2'-O-methyl-adenosine triphosphates, 2'-O-methyl-uridine triphosphates, 2'-O-methyl-citidine triphosphates and 2'-F-guanosine triphosphates. The modified oligonucleotides produced using the fGmH transcription conditions of the present disclosure comprise substantially all 2'-O-methyl-adenosine, 2'-O-methyl-uridine, 2'-Omethyl-cytidine and 2'-F-guanosine. In a preferred embodiment, the resulting modified oligonucleotides comprise a sequence in which at least 80% of all adenosine nucleotides are 2'-O-methyladenosine, at least 80% of all uridine nucleotides are 2'-O -methyl-uridine, at least 80% of all cytidine nucleotides are 2'-O-methyl-cytidine and at least 80% of all guanosine nucleotides are 2'-Fguanosine. In a more preferred embodiment, the resulting modified oligonucleotides comprise a sequence in which at least 90% of all adenosine nucleotides are 2'-O-methyl-adenosine, at least 90% of all uridine nucleotides are 2 '-O-methyl-uridine, at least 90% of all cytidine nucleotides are 2'-O-methyl-cytidine and at least 90% of all guanosine nucleotides are 2'-F-guanosine. In a more preferred embodiment, the resulting modified oligonucleotides comprise a sequence in which 100% of all adenosine nucleotides are 2'-O-methyl-adenosine, 100% of all uridine nucleotides are 2'-O- methyl-uridine, 100% of all cytidine nucleotides are 2'-O-methyl-cytidine and 100% of all guanosine nucleotides are 2'-F-guanosine.

[0169] Under dAmB transcription conditions of the present disclosure, the transcription reaction mixture comprises 2'-deoxy-adenosine triphosphates, 2'-O-methyl-cytidine triphosphates, 2'-O-methyl-guanosine triphosphates and 2 ' -O-methyl-uridine triphosphates. The modified oligonucleotides produced using the dAmB transcription mixtures of the present disclosure comprise substantially all 2'-deoxy-adenosine, 2'-O-methylcytidine, 2'-O-methyl-guanosine and 2'-O-methyl-uridine. In a preferred embodiment, the resulting modified oligonucleotides comprise a sequence in which at least 80% of all adenosine nucleotides are 2'-deoxy-adenosine, at least 80% of all cytidine nucleotides are 2'-O- methyl-citidine, at least 80% of all guanosine nucleotides are 2'-O-methyl-guanosine and at least 80% of all uridine nucleotides are 2'-O-methyl-uridine. In a more preferred embodiment, the resulting modified oligonucleotides comprise a sequence in which at least 90% of all adenosine nucleotides are 2'-deoxy-adenosine, at least 90% of all cytidine nucleotides are 2'- O-methyl-cytidine, at least 90% of all guanosine nucleotides are 2'-O-methyl-guanosine and at least 90% of all uridine nucleotides are 2'-O-methyl-uridine. In a more preferred embodiment, the modified oligonucleotides resulting from the present disclosure comprise a sequence in which 100% of all adenosine nucleotides are 2'-deoxy-adenosine, 100% of all cytidine nucleotides are 2'- O-methyl-cytidine, 100% of all guanosine nucleotides are 2'-O-methylguanosine and 100% of all uridine nucleotides are 2'-O-methyl-uridine.

[0170] In each case, the transcription products can then be used for entry into the SELEX ™ procedure to identify aptamers and / or to determine a conserved sequence that has binding specificity for a given target. The resulting sequences are already partially stabilized, this step being removed from the post-SELEX ™ procedure to arrive at an optimized aptamer sequence and resulting in a more highly stabilized aptamer. Another advantage of the 2'-OMe SELEX ™ procedure is that the resulting sequences are likely to have less 2'-OH-nucleotides required in the sequence, possibly none. To the point that the remaining 2'OH-nucleotides can be eliminated by making post-SELEX ™ modifications.

[0171] As described below, lower but still useful yields of transcripts incorporating completely 2 'substituted nucleotides can be obtained under conditions other than the optimized conditions described above. For example, variations to the above transcription conditions include:

[0172] The concentration of HEPES buffer may range from 0 to 1 M. The present disclosure also contemplates the use of other buffering agents having a pKa between 5 and 10 that include, for example, tris-hydroxymethyl-aminomethane.

[0173] The concentration of DTT can range from 0 to 400 mM. The methods of the present disclosure also provide the use of other reducing agents that include, for example, mercaptoethanol.

[0174] The concentration of spermidine and / or spermine can range from 0 to 20 mM.

[0175] The concentration of PEG-8000 can range from 0 to 50% (weight / volume). The methods of the present disclosure also provide the use of another hydrophilic polymer that includes, for example, PEG of another molecular weight or other polyalkylene glycols.

[0176] The concentration of Triton X-100 can range from 0 to 0.1% (weight / volume). The methods of the present disclosure also provide the use of other non-ionic detergents that include, for example, other detergents that include other Triton-X detergents.

[0177] The concentration of MgCl2 can range from 0.5 mM to 50 mM. The concentration of MnCl2 can range from 0.15 mM to 15 mM. Both MgCl2 and MnCl2 must be present within the ranges described and in a preferred embodiment they are present in about a ratio of 10 to about 3 MgCl2: MnCl2, preferably, the ratio is about 3-5: 1, more preferably, the ratio It is approximately 3-4: 1.

[0178]

The concentration of 2'-OMe-NTP (each NTP) can range from 5 μM to 5 mM.

[0179]

The concentration of 2'-OH-GTP can range from 0 μM to 300 μM.

[0180]

The concentration of 2'-OH-GMP can range from 0 to 5 mM.

[0181]

The pH may range from pH 6 to pH 9. The methods of the present disclosure can be set in

practice within the pH range of the activity of most polymerases that incorporate modified nucleotides. In addition, the methods of the present disclosure provide the optimal use of chelating agents in the transcription reaction condition that include, for example, EDTA, EGTA and DTT.

MEDICINAL CHEMISTRY OF APTÁMEROS

[0182] The medicinal chemistry of aptamers is an aptamer improvement technique in which sets of variant aptamers are chemically synthesized. These sets of variants normally differ from the parental aptamer by the introduction of a single substituent, and are differentiated from each other by the location of this substituent. Then, these variants are compared with each other and with the parent. The improvements in the characteristics can be deep enough so that the inclusion of a single substituent may be all that is necessary to achieve a particular therapeutic criterion.

[0183] Alternatively, the information collected from the set of individual variants can be used to further design sets of variants in which more than one substituent is introduced simultaneously. In a design strategy all the variants of a single substituent are classified, the first 4 are chosen and synthesized and all possible double (6), triple (4) and quadruple (I) combinations of these 4 variants of a 4 substituent only. In a second design strategy, the best variant of a single substituent is considered to be the new parent and all possible double substituent variants that include this variant with the highest classification of a single substituent are synthesized and tested. Other strategies can be used, and these strategies can be applied repeatedly so that the number of substituents increases gradually while further improved variants continue to be identified.

[0184] The medicinal chemistry of aptamers can be used particularly as a procedure to explore the local, rather than global, introduction of substituents. Because aptamers are discovered within libraries that are generated by transcription, any substituent that is introduced during the SELEX ™ procedure must be introduced globally. For example, if it is desired to introduce phosphorothioate bonds between nucleotides, then they can only be introduced into each A (or each G, C, T, U, etc.) (globally substituted). Aptamers that require phosphorothioates in some A (or some G, C, T, U, etc.) (locally substituted), but cannot tolerate them in other A, cannot be easily discovered by this procedure.

[0185] The types of substituent that can be used by the medicinal chemistry process of aptamers are only limited by the ability to generate them as solid phase synthesis reagents and introduce them into an oligomer synthesis scheme. The procedure is certainly not limited to nucleotides alone. Medicinal chemistry schemes of aptamers may include substituents that introduce steric volume, hydrophobia, hydrophilicity, lipophilicity, lipophobia, positive charge, negative charge, neutral charge, bipolar ions, polarizability, nuclease resistance, conformational rigidity, conformational flexibility, characteristics of protein binding, mass, etc. Schemes of medicinal chemistry of aptamers may include modifications of bases, modifications of sugars or modifications of phosphodiester bonds.

[0186] If the types of substituents that are likely to be beneficial within the context of an aptamer therapeutic agent are considered, it may be desirable to introduce substitutions that fall into one or more of the following categories:

(one)

 Substituents already present in the body, for example, 2'-deoxy-, 2'-ribo-, 2'-O-methyl-purines or pyrimidines

or 5-methyl-cytosine.

(2)

 Substituents and part of an approved therapeutic agent, for example, phosphorothioate-linked oligonucleotides.

(3)

 Substituents that hydrolyse or degrade one of the two previous categories, for example, oligonucleotides linked to methyl phosphonate.

[0187] The PDGF aptamers of the disclosure include aptamers developed by medicinal chemistry of aptamers as described herein.

SPECIFIC UNION APTAMERS TO PDGF AND PDGF-VEGF AS ONCOLOGICAL THERAPEUTIC AGENTS

[0188] Aptamers that can specifically bind and inhibit different PDGF isoforms are set forth herein. These aptamers, which include aptamers that only bind PDGF, aptamers that bind both PDGF and VEGF, and any of the above aptamers that have a CpG motif incorporated therein, provide a low toxicity mode, safe and effective to inhibit most of the PDGF-mediated tumor progression that includes, without limitation, glioblastomas, chronic myelomonocytic leukemia (CML), protuberant dermatofibrosarcoma (DFSP), gastrointestinal stromal tumors, (GIST) and other soft tissue sarcomas.

[0189] Examples of PDGF and PDGF-VEGF specific binding aptamers for use as therapeutic agents in oncology include the following sequences:

PDGF binding aptamers:

[0190] ARC126: 5 '- (5'-NH2-dC-dA-dG-dG-dC-fU-dA-fC-mG-3', SEQ ID No. 1) -HEG- (5'-dC-dG -T-dA-mG-dAmG-dC-dA-fU-fC-mA-3 ', SEQ ID NO: 2) -HEG- (5'-T-dG-dA-T-fC-fC-fU-mG- 3'dT-3 ', SEQ ID NO. 3) -3' in which HEG = hexaethylene glycol amidite.

[0191] ARC127: 5 '- [40 K PEG] - (5'-NH2-dC-dA-dG-dG-dC-fU-dA-fC-mG-3', SEQ ID No. 1) -HEG- (5'-dC-dG-TdA-mG-dA-mG-dC-dA-fU-fC-mA-3 ', SEQ ID No. 2) -HEG- (5'-T-dG-dA-T-fC -fC-fU-mG-3'dT-3 ', SEQ ID NO. 3) -3' in which HEG = hexaethylene glycol amidite.

[0192] ARC240: 5 '- [20 K PEG] - (5'-NH2-dC-dA-dG-dG-dC-fU-dA-fC-mG-3', SEQ ID No. 1) -HEG- (5'-dC-dG-TdA-mG-dA-mG-dC-dA-fU-fC-mA-3 ', SEQ ID No. 2) -HEG- (5'-T-dG-dA-T-fC -fC-fU-mG-3'dT-3 ', SEQ ID NO. 3) -3' in which HEG = hexaethylene glycol amidite.

[0193] ARC308: 5 '- [30 K PEG] - (5'-NH2-dC-dA-dG-dG-dC-fU-dA-fC-mG-3', SEQ ID No. 1) -HEG- (5'-dC-dG-TdA-mG-dA-mG-dC-dA-fU-fC-mA-3 ', SEQ ID No. 2) -HEG- (5'-T-dG-dA-T-fC -fC-fU-mG-3'dT-3 ', SEQ ID NO. 3) -3' in which HEG = hexaethylene glycol amidite.

[0194] DeoxyARC126: 5'-dCdAdGdGdCdTdAdCdGdCdGdTdAdGdAdGdCdAdTdCdAdTdGdAdTdCdCdTdG [3T] -3 '(SEQ ID NO: 8) in which "d is linked to unrelated nucleot of d-3" 3 'end of the oligonucleotide.

[0195] ARC124: 5 'CACAGGCTACGGCACGTAGAGCATCACCATGATCCTGTG-3'InvdT (SEQ ID NO: 11) in which 3'InvdT refers to an inverted thymine nucleotide attached to the 3' end of the oligonucleotide.

Negative control aptamer:

[0196] ARC128: (ARC126 negative control): 5 '- (5'-NH2-dC-dA-dG-fC-mG-fU-dA-fC-mG-3', SEQ ID No. 4) HEG- ( 5'- dC-dG-dT-dA-dC-dC-mG-dA-dT-fU-fC-mA-3 ', SEQ ID No. 5) -HEG- (5'- dT-dG-dA-dA- dG-fC-fU-mG-3'dT-3 ', SEQ ID NO. 6) -3' in which HEG = hexaethylene glycol amidite.

[0197] VEGF binding aptamer:

[0198] ARC245: 5'-mAmUmGmCmAmGmUmUmUmGmAmGmAmAmGmUmCmGmCmGmCmAmU- [3T] -3 '(SEQ ID NO: 7) in which "m" indicates 2'-OMe-nucleotides and "[3T]" refers to a nucleotide which is attached to the 3 'end of the oligonucleotide in the 3' position on the ribose sugar; therefore, the oligonucleotide has two 5 'ends and, therefore, is resistant to nucleases that act on the 3' hydroxyl end.

Multivalent PDGF / VEGF binding aptamers:

[0199] TK.131.012.A: (SEQ ID NO: 9):

5'dCdAdGdGdCdTdAdCdGmAmUmGmCmAmGmUmUmUmGmAmGmAmAmGmUm CmGmCmGmCmAmUdCdGdTdAdGdAdGdCdAdTdCdAdGdAdAdAdTdGdAddTd mt-3 "

[0200] TK.131.012.B: (SEQ ID NO: 10):

5'dCdAdGdGdCdTdAdCdGmUmGmCmAmGmUmUmUmGmAmGmAmAmGmUmCm GmCmGmCmAdCdGdTdAdGdAdGdCdAdTdCdAdGdAdAdAdTddd [3] which are defined as m-3]

[0201] Other aptamers that bind PDGF and / or VEGF are described below, for example, in Table 2 and in Example 12.

[0202] The inhibition of PDGF signaling with small molecule receptor antagonists has been shown to decrease interstitial fluid pressure and increase the uptake of chemotherapeutic agents in solid tumors. Pietras et al. They validated the hypothesis that PDGF-B participates in PLI and that blocking the function of PDGF-B could lead to an increased uptake of chemotherapeutic agents in tumors (Pietras et al. (2003), Cancer Cell vol. 3 p. 439-443). Using the KAT-4 thyroid carcinoma model, which has paracrine signaling properties of PDGF, Pietras et al. demonstrated that KAT-4 tumors expressed PDGF receptors in the stoma and that PDGF-B bound KAT-4 cells in vitro. Next, Pietras et al. they used the tyrosine kinase inhibitor drug STI571 (GLEEVEC ™) to block PDGF-B signaling in KAT-4 tumors and showed that this treatment significantly decreased the tumor PLI in vivo leading to an increase in taxol uptake. However, since STI571 chooses both the a and PDGF receptors as a target, in addition to the osina kinase Kit, Abl and Arg, it was impossible to know if the effect of STI571 was due to PDGF-B blockade alone. This ambiguity was resolved using a highly specific aptamer to block PDGF-B in similar experiments. The aptamer has an affinity of 100 pM for PDGF-B and has no appreciable affinity for the PDGF-A sequence. As with STI571, treatment of mice with KAT-4 xenograft with PDGF-B aptamer conjugated to PEG reduced PLI and dramatically increased taxol uptake by the tumor. And, more importantly, treatment with aptamers strongly enhanced the ability of taxol to inhibit tumor growth. In addition, it has been shown that a currently marketed therapeutic therapeutic agent, the PDGF receptor antagonist GLEEVEC ™, is effective in reducing tumor PLI and in increasing cytotoxin uptake by the tumor when used in combination. with a cytotoxin such as taxol. The methods and materials herein are used to inhibit the biological activity of PDGF-B and its etiology in the development and growth of the tumor by enhancing the uptake and efficacy of chemotherapeutic agents.

[0203] The combination therapy methods of the present disclosure include combining PDGF specific aptamers of the present disclosure with cytotoxic agents. Without wishing to adhere to any theory, combining PDGF-specific aptamers with other known cytotoxins can provide an effective method of drug delivery specifically at the tumor site, for example, by the selective reduction of PLI in tumor vessels. In turn, it allows the increase of cytotoxin uptake in tumors by the tumor vasculature. Figure 4 shows a scheme of cytotoxin transport through the tumor vasculature with and without PDGF antagonists by the methods of the present invention (Pietras et al. (2003), Cancer Cell vol. 3 p. 439-443) .

[0204] The PDGF aptamers of the present disclosure can be used in combination with a variety of known cytotoxic or cytostatic agents (collectively "cytotoxic") to reduce tumor PLI and thus increase tumor administration and uptake by cytotoxic agents to All solid tumors. Suitable cytotoxic or cytostatic agents include tubulin stabilizers / destabilizers, antimetabolites, purine synthesis inhibitors, nucleoside analogs and DNA alkylating agents or other DNA modifying agents that include, but are not limited to, paclitaxel (TAXOL ™) , docetaxel, irinotecan, topotecan, gemcitabine, epothilone, cisplatin, carboplatin, 5-fluoro-U, calicheamycin, doxorubicin, methotrexate, AraC (cytarabine), vinblastine, daunorubicin, oxaliplatin, cyclophosphamide, iflosamine, oblycinimine, dipulinimidium, diphtheriamine, epicamine, epicamine, epicamine, epicamine, epicamine, epicamine, epicamine, epicamine, epicamine, epicamine, epicamine, pyrimidium, diphtheriamine, epicamine, epicamine, epicamine, diphysinimine, dipulinidin, dichloroimine, epicamine, dichlorine, dichloroimine, dichloroimine, dichloric acid , permetrexed, kinase inhibitors that include, but are not limited to, EGF receptor kinase, VEGF receptor kinase, aurora kinase, both alone and in any combination thereof. The PDGF aptamers of the present disclosure can be used in combination with a variety of known vascular target agents in which the "vascular target agent of choice" means a small molecule therapeutic agent (eg, irinotecan), a protein therapeutic agent (for example, bevicizumab) and / or an oligonucleotide therapeutic agent (for example, antisense molecules, siRNA molecules) that modifies the existing vasculature and neovasculature network that supplies blood and lymph flow to the tumor. The PDGF aptamers of the present disclosure may be used in combination with a therapeutic conjugate comprising a binding or target selection moiety and a cytotoxic moiety, wherein the binding or target moiety is, but is not limited to. a, an aptamer, antibody that includes, but is not limited to, trastuzumab, rituximab, cetuximab, panitumumab, gemtuzumab, bevicizumab and tositumomab, peptide, an agent of choice of vascular target or folate compound, and in which the cytotoxic moiety belongs to a class of compounds that includes, but is not limited to, tubulin stabilizers / destabilizers, antimetabolites, purine synthesis inhibitors, nucleoside analogs and DNA alkylating agents, other DNA modifying agents, or vascular disrupting agents (for example, flavonoids) alone or in any combination thereof.

[0205] The materials and methods of the present disclosure provide a more effective way of administering known chemotherapeutic agents to inhibit the formation of solid tumors that produces a variety of cancers that include, but are not limited to, colorectal, pancreatic, breast cancer. , lung, prostate and ovarian.

[0206] In addition, the PDGF aptamer compositions of the present disclosure can be used as antiangiogenic agents to inhibit the formation of tumor vasculature that choose pericytes as target. In one example, a PDGF aptamer composition of the present disclosure can be used in combination with a VEGF / VEGFR antagonist such as a VEGF specific aptamer. Such combinations may provide a more effective way to inhibit tumor angiogenesis than both a PDGF aptamer therapeutic agent and a VEGF / VEGFR antagonist therapeutic agent alone. An advantage of the agents that choose PDGF-B and VEGF as the target of the present disclosure is that the therapeutic compositions of the present disclosure are highly specific for their target ligand and hence do not appear to exhibit nonspecific tyrosine kinase activity; and they are not designed to enter cells to cause their biological function.

[0207] The currently commercialized small molecule kinase inhibitor therapeutic agents, for example GLEEVEC ™, exhibit high nonspecific activity. GLEEVEC ™ selects both a and tyrosine kinase receptors, as well as BCR-Abl, C-kit and Arg.

More than nonspecific tyrosine kinases is in general a major impediment to the development of small molecule kinase inhibitors. Additionally, small molecule kinase inhibitors such as GLEEVEC ™ are administered at or near their maximum tolerated doses when used in the treatment of solid tumors. The toxicity of GLEEVEC ™ and other tyrosine kinase inhibitors (TKI) is probably limited by both side effects related to the mechanism and side effects not related to the mechanism (nonspecific). Based on in vivo experiments with ARC127 (5 '- [40 K PEG] - (SEQ ID NO. 1) -HEG- (SEQ ID NO: 2) -HEG- (SEQ ID NO: 3) -3'-dT- 3 ') and ARC308 (5' - [30 K PEG] - (SEQ ID NO. 1) -HEG- (SEQ ID NO: 2) -HEG- (SEQ ID NO: 3) -3'-dT-3 ' ) No dose-limiting side effects were evident. Additional advantages are that the aptamer therapeutic compositions of the present disclosure can be administered intravenously, subcutaneously or intraperitoneally. Unlike therapeutic agents against monoclonal antibody cancer that are immunogenic, aptamers are not immunogenic; therefore, reaction with the drug and / or drug resistance is not a problem.

APTAMERS FOR PDGF AND PDGF ISOFORMS

[0208] The materials of the present disclosure comprise a series of nucleic acid aptamers 31-35 nucleotides in length (SEQ ID NO: 1 to SEQ ID NO: 3, SEQ ID NO: 9 to SEQ ID NO: 35, SEQ ID NO: 36 to SEQ ID NO: 73, SEQ ID NO: 85, and SEQ ID NO: 77 to SEQ ID NO: 81, and SEQ ID NO: 86-89, 91, 93-95 and 102) which are joined specifically to the PDGF-B protein in vitro and that functionally block the activity of PDGF-BB in in vivo and cell-based assays. The sequences of anti-PDGF-B aptamers of the present disclosure are derived from a parental molecule (ARC126 (5 '- (SEQ ID NO. 1) -HEG- (SEQ ID NO: 2) -HEG- (SEQ ID NO: 3 ) -3'-dT-3 ') containing seven individual residues containing 2'F (Figure 9A). The residues containing 2'F were incorporated into ARC126 to increase serum stability in vitro and in vivo of the therapeutic agent of aptamer blocking its degradation by serum endonucleases and / or exonucleases In an effort to replace possibly toxic 2'F nucleotide residues in the anti-PDGF-B aptamer ARC126 a new series of completely free aptamers of 2'F. The new aptamers of the present disclosure retain potent binding and antiproliferative activity in vitro and contain naturally occurring 2'-deoxy or 2'-OMe nucleotides that occur, these new aptamers of the present disclosure also retain a substantial stability in serum as determined by resistance to degradation by nucleases in an in vitro stability test, with no degradation detected for up to 48 hours.

[0209] The aptamer therapeutic agents of the present disclosure have a high affinity and specificity for PDGF, PDGF isoforms and / or PDGF receptor, while reducing the harmful side effects of nucleotide substitutions that occur not naturally. when the therapeutic agents of aptamer are broken in the body of patients or subjects. The therapeutic compositions containing the aptamer therapeutic agents of the present disclosure are free or have a reduced amount of fluorinated nucleotides.

MATERIALS AND PROCEDURES TO INCREASE THE EFFECTIVENESS OF ANTITUMURAL AGENTS

[0210] The materials and procedures of the present disclosure further comprise methods for increasing the efficacy of tumor agents by dual therapy with the aptamers of the present disclosure, such as ARC127 and ARC308. In addition, the experiments described herein have shown that the specific aptamers for PDGF-B, ARC 127 (i.e., ARC126 + PEG 40K) and ARC308 (i.e. ARC 126 + PEG 30K), are tumor agents active when co-administered with irinotecan hairless mice that carry the colorectal tumor xenograft LS174T. The therapeutic anti-cancer compounds of the present disclosure (for example, both ARC 127 and ARC308) are safe non-cytotoxic agents when administered alone, but in combination with other cytotoxic agents, ARC 127 and ARC308 enhance their antitumor effects by a novel mechanism. of action. In addition, the serum-derived ARC 127 aptamer, when administered to mice parenterally, that is, intravenously, subcutaneously or by intraperitoneal injection, retains complete biological activity.

CHAMBER OF APTAMEROS SPECIFIC FOR PDGF-B AND VEGF

[0211] The disclosure also provides a bifunctional aptamer chimera that both PDGF-B and VEGF choose as target. The chimera of aptamers of PDGF-B-VEGF TK.131.12.A (SEQ ID NO: 9) and TK.131.12.B (SEQ ID NO: 10) of the present disclosure allow simultaneous selection as target of PDGF-B and VEGF, for example, for the treatment of cancer. The PDGF-B aptamer used in the chimeric molecule is derived from the sequence of the ARC127 aptamer. The VEGF aptamer that was used in the chimeric molecule is derived from the sequence of the ARC245 aptamer (SEQ ID NO: 7). The chimer of aptamers of the present disclosure can be constructed from any set of PDGF-B and VEGF binding aptamers. The PDGF-B-VEGF chimera of the present disclosure is useful in the treatment of VEGF-dependent solid tumors that also show a high degree of neovascularization, in addition to the recruitment of pericytes to deliver the nascent vasculature.

[0212] Recent anti-tumor data from the RipTag pancreatic mouse tumor model suggest that there is a greater inhibition in the growth of the conferred tumor when anti-VEGF and anti-PDGFR therapy are performed simultaneously than when both the anti-VEGF agent and the agent anti-PDGFR are added alone (Bergers et al., (2003), J. Clin. Invest., 111: 9, p. 1287-1295). Since anti-PDGFR therapy blocks all receptor-mediated signaling events, the effects of this therapy can be expected to be non-specific and, therefore, suffer from side effects associated with non-specific treatments. In contrast, the PDGF-B-VEGF chimera in this disclosure provides the precise choice of PDGF-B and VEGF as a target in tumors.

[0213] The aptamer therapeutic agents of the present disclosure have a high affinity and specificity for VEGF and / or the VEGF receptor, while reducing the harmful side effects of unnaturally occurring nucleotide substitutions that may result. when the therapeutic agents of aptamer are broken in the body of a patient or subject. The therapeutic compositions of the aptamer therapeutic agents of the present disclosure are free of or have a reduced amount of fluorinated nucleotides.

APTÁMEROS THAT HAVE IMMUNO STIMULATING REASONS

[0214] The recognition of bacterial DNA by the vertebrate immune system is based on the recognition of unmethylated CG dinucleotides, in particular sequence contexts ("CpG motifs"). A receptor that recognizes such a motive is the toll-like receptor ("TLR 9"), a member of a family of toll-like receptors (~ 10 members) that participates in the innate immune response by recognizing distinct microbial components. TLR 9 binds to oligodeoxy-nucleotide (ODN) CpG sequences without methylation in a sequence-specific manner. The recognition of CpG motives triggers defense mechanisms that lead to innate immune responses and ultimately to acquired ones. For example, the activation of TLR 9 in mice induces the activation of antigen presenting cells, the regulation by increase of MHC class I and II molecules and the expression of important costimulatory molecules and cytokines that include IL-12 and IL-23. . This activation potentiates both directly and indirectly B and T lymphocyte responses that include consistent expression by increased TH1 IFN-gamma cytokine. Together, the response to CpG sequences leads to: protection against infectious diseases, improved immune response to vaccines, an effective response against asthma and enhanced cytotoxicity mediated by antibody-dependent cells. Therefore, CpG ODNs can provide protection against infectious diseases, they work as immunoadjuvants.

or therapeutic agents against cancer (monotherapy or in combination with mAb or other therapies), and may decrease asthma and allergic response.

[0215] Aptamers comprising one or more CpG motifs can be identified or generated by a variety of strategies using, for example, the SELEX ™ procedure described herein. In general, the strategies can be divided into two groups. In the first group, the strategies are aimed at identifying or generating aptamers that comprise both a binding site for targets other than those that recognize CpG motifs as a CpG motif. These strategies are as follows: (a) perform SELEX ™ to obtain an aptamer for a specific target (other than a target that is known to bind CpG motifs and after binding stimulate an immune response), preferably a target in the that a suppressed immune response is relevant to the development of disease, using a set of oligonucleotides in which a CpG motif has been incorporated into each member of the set as, or as part of, a fixed region, for example, in the region at random of the members of the set; (b) perform SELEX to obtain an aptamer for a specific target (other than a target known to bind CpG motifs and after binding stimulate an immune response), preferably a target in which a suppressed immune response is relevant to the development of disease, and then joining a CpG motif to the 5 'and / or 3' end or manipulating a CpG motif in a region, preferably a non-essential region, of the aptamer; (c) perform SELEX ™ to obtain an aptamer for a specific target (other than a target known to bind CpG motifs and after binding stimulate an immune response), preferably a target in which a suppressed immune response is relevant for the development of disease, in which during the synthesis of the set the molar ratio of the various nucleotides is favored in one or more stages of nucleotide addition so that the random region of each member of the set is enriched in CpG motifs; and (d) perform SELEX ™ to obtain an aptamer for a specific target (other than a target known to bind CpG motifs and after binding stimulate an immune response), preferably a target in which a suppressed immune response is relevant to the development of disease, and identify those aptamers that comprise a CpG motif.

[0216] In the second group, the strategies are aimed at identifying or generating aptamers comprising a CpG motif and / or other sequences that bind to the receptors for the CpG motifs (eg TLR9 or the other toll-like receptors) and after binding they stimulate an immune response. These strategies are as follows: (i) perform SELEX ™ to obtain an aptamer for a target that is known to bind CpG motifs and after binding stimulate an immune response using an oligonucleotide set in which a CpG motif has been incorporated into each set member as, or as part of, a fixed region, for example, in the random region of the set members; (ii) perform SELEX to obtain an aptamer for a target that is known to bind CpG motifs and after binding stimulate an immune response and then attach a CpG motif to the 5 'and / or 3' end or manipulate a CpG motif in a region, preferably a non-essential region, of the aptamer;

(iii) perform SELEX to obtain an aptamer for a target that is known to bind CpG motifs and after binding stimulate an immune response in which during the synthesis of the whole, the molar ratio of the various nucleotides is favored in one or more nucleotide addition steps so that the random region of each member of the set is enriched in CpG motifs; (iv) perform SELEX to obtain an aptamer for a target that is known to bind CpG motifs and after binding stimulate an immune response and identify those aptamers comprising a CpG motif; and (v) perform SELEX to obtain an aptamer for a target that is known to bind CpG motifs and identify those aptamers that, after binding, stimulate an immune response that does not comprise a CpG motif.

[0217] A variety of different kinds of CpG motifs have been identified, each producing after recognition a different cascade of events, release of cytokines and other molecules, and activation of certain cell types. See, for example, CpG Motifs in Bacterial DNA and Their Immune Effects, Annu. Rev. Immunol. 2002, 20: 709-760. Additional immunostimulatory motives are disclosed in the following US patents: 6,207,646; 6,239,116; 6,429,199; 6,214,806; 6,653,292; 6,426,434; 6,514,948 and 6,498,148. Any of these CpG or other immunostimulatory motifs can be incorporated into an aptamer. The choice of aptamers depends on the disease or disorder to be treated. Preferred immunostimulatory motifs are the following (shown from 5 'to 3' from left to right) in which "r" designates a purine, "y" designates a pyrimidine and "X" designates any nucleotide:

AACGTTCGAG (SEQ ID NO: 85); AACGTT (SEQ ID NO: 90); ACGT (SEQ ID NO: 92), rCGy (SEQ ID NO: 96); rrCGyy (SEQ ID NO: 98), XCGX (SEQ ID NO: 99),

XXCGXX (SEQ ID NO: 100) and X1X2CGY1Y2 (SEQ ID NO: 101) in which X1 is G or A, X2 is not C, Y1 is not G and Y2 is preferably T.

[0218] In those cases in which a CpG motif is incorporated into an aptamer that binds to a specific target other than a target that is known to bind CpG motifs and after binding stimulates an immune response (a “target not CpG ”), CpG is preferably located in a non-essential region of the aptamer. Non-essential regions of aptamers can be identified by site-directed mutagenesis, deletion analysis and / or substitution analysis. However, any location that does not significantly interfere with the aptamer's ability to bind to the non-CpG target can be used. In addition to being incorporated into the aptamer sequence, the CpG motif can be attached to either one or both of the 5 'and 3' ends or otherwise attached to the aptamer. Any location or means of attachment can be used as long as the aptamer's ability to bind to the non-CpG target does not significantly interfere.

[0219] As used herein, "stimulation of an immune response" may mean either (1) the induction of a specific response (eg, induction of a Th1 response) or the production of certain molecules such as (2) the inhibition or suppression of a specific response (for example, inhibition or suppression of the Th2 response) or of certain molecules.

[0220] CpG motifs may be incorporated or attached to an aptamer against any target that includes, but is not limited to: PDGF, IgE, IgE FcE RI, TNFa, PSMA, CTLA4, PD-1, PD-L1, PD-L2 , FcRIIB, BTLA, TIM-3, CD11b, CD-11c, BAFF, B7-X, CD19, CD20, CD25 and / or CD33.

[0221] By incorporating CpG motifs into aptamers that specifically choose solid tumors such as target, these aptamers can be used to activate the immune system by recruiting antigen presenting cells that have absorbed tumor-derived material, enhance their maturation and migration to local lymph nodes. and increase the priming of tumor-specific T lymphocytes. This is especially relevant when aptamers release cytotoxic payload and cause cell death (such as a PSMA aptamer containing a CpG motif). Such aptamers containing CpG motifs can also induce tumor-specific memory response (for example, prophylactic use). In addition, the reduction of PLI and the effects of blocking the recruitment of pericytes from a PDGF-B aptamer, combined with the increase in the immune response observed after administration of CpG, represents a potent therapeutic agent for cancer. Thus, aptamers with incorporated, attached or inserted CpG motifs represent a novel class of anticancer compounds. When these compounds are administered they can lead to a significant surgical cytoreduction of the tumor by two mechanisms: first, by activation of T-lymphocytes specific for tumors within the tumor bed and second by the action based on the intended mechanism of the aptamer pharmacophore.

PHARMACEUTICAL COMPOSITIONS

[0222] The disclosure also includes pharmaceutical compositions containing aptamer molecules. In some embodiments, the compositions are suitable for internal use and include an effective amount of a pharmacologically active compound of the disclosure, alone or in combination, with one or more pharmaceutically acceptable carriers. The compounds are especially useful because they have very low toxicity, if they have one.

[0223] The compositions of the disclosure can be used to treat or prevent a pathology such as a disease or disorder, or to alleviate the symptoms of such disease or disorder in a patient. The compositions of the disclosure are useful for administration to a subject who suffers, or is predisposed to, a disease or disorder that is related to or derived from a target to which the aptamers of the disclosure specifically bind. For example, the target is a protein involved in a pathology, for example, the target protein produces the pathology. For example, the target is the involvement of PDGF in the development and progression of solid tumors.

[0224] The compositions of the disclosure can be used in a procedure to treat a patient or subject having a pathology. The method involves administering to the patient or subject a composition comprising aptamers that bind to a target (for example, a protein) involved in the pathology, such that the binding of the composition to the target alters the biological function of the target, thus treating the pathology.

[0225] The patient or subject having a pathology, for example, the patient or subject treated by the methods of this disclosure, may be a mammal, or more particularly a human being.

[0226] In practice, aptamers or their pharmaceutically acceptable salts are administered in amounts that will be sufficient to exert their desired biological activity, for example, inhibiting the binding of a cytokine to its receptor.

[0227] One aspect of the disclosure comprises an aptamer composition of the disclosure in combination with other treatments for cancer or cancer-related disorders. The aptamer composition of the disclosure may contain, for example, more than one aptamer. In some examples, an aptamer composition of the disclosure, which contains one or more compounds of the disclosure, is administered in combination with another useful composition such as an anti-inflammatory agent, an immunosuppressant, an antiviral agent.

or similar. In addition, the compounds of the disclosure can be administered in combination with a cytotoxic, cytostatic or chemotherapeutic agent such as an alkylating agent, antimetabolite, mitotic inhibitor or cytotoxic antibiotic, as described above. In general, the currently available dosage forms of the known therapeutic agents for use in such combinations will be suitable.

[0228] "Combination therapy" (or "co-therapy") includes the administration of an aptamer composition of the disclosure and at least a second agent as part of a specific treatment schedule intended to provide the beneficial effect of co -action of these therapeutic agents. The beneficial effect of the combination includes, but is not limited to, pharmacokinetic or pharmacodynamic co-action resulting from the combination of therapeutic agents. The administration of these therapeutic agents in combination is usually carried out for a defined period of time (usually minutes, hours, days or weeks depending on the selected combination).

[0229] "Combination therapy" may claim to encompass, but generally not, the administration of two

or more of these therapeutic agents as part of separate monotherapy guidelines that casually and arbitrarily produce the combinations of the present disclosure. "Combination therapy" is intended to encompass the administration of these therapeutic agents in a sequential manner, that is, in which each therapeutic agent is administered at a different time, in addition to the administration of these therapeutic agents, or at least two of the agents. therapeutic, in a substantially simultaneous way. Substantially simultaneous administration can be carried out, for example, by administering to the subject a single capsule having a fixed ratio of each therapeutic agent or in multiple individual capsules for each of the therapeutic agents.

[0230] The sequential or substantially simultaneous administration of each therapeutic agent may be effected by any appropriate route that includes, but is not limited to, topical routes, oral routes, intravenous routes, intramuscular routes and direct absorption through the tissues of the mucous membrane The therapeutic agents can be administered by the same route or by different routes. For example, a first therapeutic agent of the selected combination may be administered by injection, while the other therapeutic agents of the combination may be administered topically.

[0231] Alternatively, for example, all therapeutic agents can be administered topically or all therapeutic agents can be administered by injection. The sequence in which therapeutic agents are administered is not exhaustively critical. "Combination therapy" may also encompass the administration of therapeutic agents as described above in additional combination with other biologically active principles. If the combination therapy further comprises a drug-free treatment, the drug-free treatment can be performed at any suitable time, while a beneficial effect of coercion of the combination of therapeutic agents and drug-free treatment is achieved. For example, in appropriate cases, the beneficial effect is still achieved when the non-drug treatment is temporarily eliminated from the administration of therapeutic agents, perhaps for days or even weeks.

[0232] The compounds of the disclosure and the other pharmacologically active agent can be administered to a patient simultaneously, sequentially or in combination. It will be appreciated that if a combination of the disclosure is used, the disclosure compound and the other pharmacologically active agent may be in the same pharmaceutically acceptable carrier and, therefore, administered simultaneously. They can be in separate pharmaceutical vehicles such as conventional oral dosage forms that are taken simultaneously. The term "combination" further refers to the case in which the compounds are provided in separate dosage forms and administered sequentially.

[0233] The therapeutic or pharmacological compositions of the present disclosure will generally comprise an effective amount of the active component (s) of the therapy, dissolved (s) or dispersed (s) in a pharmaceutically acceptable medium. Pharmaceutically acceptable media or vehicles include each and every solvent, dispersion media, coatings, antibacterial and antifungal agents, isotonic agents and absorption retardants and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Complementary active ingredients can also be incorporated into the therapeutic compositions of the present disclosure.

[0234] The preparation of pharmaceutical or pharmacological compositions will be known to those skilled in the art in view of the present disclosure. Normally, such compositions can be prepared as injectables, both as liquid solutions and suspensions; solid forms suitable for dissolution in, or suspension in, liquid before injection; as tablets or other solids for oral administration; as release capsules over time; or in any other form currently used that includes eye drops, creams, lotions, balms, inhalants and the like. The use of sterile formulations, such as saline based washes, can also be particularly useful by surgeons, doctors or healthcare workers to treat a particular area in the field of operation. The compositions can also be administered by a microdevice, microparticle or sponge.

[0235] After formulation, therapeutic agents will be administered in a manner compatible with the dosage form, and in an amount such that it is pharmacologically effective. The formulations are easily administered in a variety of dosage forms. In a preferred embodiment, the aptamer of the disclosure is formulated as an injectable solution described above, but drug release capsules and the like can also be employed.

[0236] In this context, the amount of active ingredient and volume of composition to be administered depends on the host animal to be treated. The precise amounts of active compound required for administration depend on the judgment of the physician and are characteristic for each individual.

[0237] Normally a minimum volume of a required composition is used to disperse the active compounds. Appropriate guidelines for administration are also viable, but would be typified by the initial administration of the compound and monitoring the results and then additionally administering controlled doses at more intervals.

[0238] For example, for oral administration in the form of a tablet or capsule (for example, a gelatin capsule), the active drug component may be combined with a pharmaceutically acceptable non-toxic oral inert carrier such as ethanol, glycerol, water and the like In addition, when desired or necessary, suitable binders, lubricants, disintegrating agents and coloring agents may also be incorporated into the mixture. Suitable binders include starch, magnesium aluminum silicate, starch paste, gelatin, methylcellulose, sodium carboxymethylcellulose and / or polyvinylpyrrolidone, natural sugars such as glucose or betalactose, corn sweeteners, natural and synthetic gums such as gum arabic, tragacanth or alginate of sodium, polyethylene glycol, waxes and the like. The lubricants used in these dosage forms include sodium oleate, sodium stearate, magnesium stearate, sodium benzoate, sodium acetate, sodium chloride, silica, talc, stearic acid, its magnesium or calcium salt and / or polyethylene glycol and the like. . Disintegrants include, without limitation, starch, methylcellulose, agar, bentonite, xanthan gum starches, agar, alginic acid or its sodium salt, or effervescent mixtures and the like. Diluents include, for example, lactose, dextrose, sucrose, mannitol, sorbitol, cellulose and / or glycine.

[0239] Injectable compositions are preferably aqueous isotonic solutions or suspensions and suppositories are advantageously prepared from fatty emulsions or suspensions. The compositions may be sterilized and / or contain adjuvants such as preservatives, stabilizers, humectants or emulsifiers, solution promoters, salts to regulate osmotic pressure and / or buffers. In addition, they may also contain other therapeutically valuable substances. The compositions are prepared according to conventional mixing, granulation or coating procedures, respectively, and contain about 0.1 to 75%, preferably about 1 to 50%, of the active ingredient.

[0240] The compounds of the disclosure can also be administered in such oral dosage forms as controlled release and sustained release tablets or capsules, pills, powders, granules, elixirs, tinctures, suspensions, syrups and emulsions.

[0241] Liquid compositions, particularly injectable, can be prepared, for example, by dissolving, dispersing, etc. The active compound is dissolved in or mixed with a pharmaceutically pure solvent such as, for example, water, saline, aqueous dextrose, glycerol, ethanol and the like, to thereby form the solution or suspension for injection. Additionally, solid forms suitable for dissolving in liquid before injection can be formulated. Injectable compositions are preferably isotonic aqueous solutions or suspensions. The compositions may be sterilized and / or contain adjuvants such as preservatives, stabilizers, humectants or emulsifiers, solution promoters, salts to regulate osmotic pressure and / or buffers. In addition, they may also contain other therapeutically valuable substances.

[0242] The compounds of the present disclosure can be administered intravenously (both bolus and infusion), intraperitoneal, subcutaneous or intramuscular using all forms well known to those skilled in the pharmaceutical techniques. Injectables can be prepared in conventional forms, both as liquid solutions and suspensions.

[0243] The administration of parenteral injectables is generally used for subcutaneous, intramuscular or intravenous injections and infusions. Additionally, an approach to parenteral administration employs the implementation of slow-release or sustained-release systems that ensure that a constant level of dosage is maintained, according to US Pat. No. 3,710,795.

[0244] In addition, the preferred compounds for the present disclosure can be administered intranasally by topical use of suitable intranasal vehicles, or by transdermal routes, using those forms of transdermal skin patches well known to those skilled in the art. To be administered in the form of a transdermal administration system, the administration of dosing will, of course, be continuous rather than intermittent throughout the entire dosing schedule. Other preferred topical preparations include creams, ointments, lotions, aerosol sprays and gels, in which the concentration of active ingredient would range from 0.01% to 15%, weight / weight or weight / volume.

[0245] For solid compositions excipients may be used that include pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, talc, cellulose, glucose, sucrose, magnesium carbonate and the like. The active compound defined above can also be formulated as suppositories using, for example, polyalkylene glycols, for example, propylene glycol, as a carrier. In some embodiments, suppositories are advantageously prepared from fatty emulsions or suspensions.

[0246] The compounds of the present disclosure can also be administered in the form of liposome delivery systems such as small unilamellar vesicles, large unilamellar vesicles and multilamellar vesicles. Liposomes can be formed from a variety of phospholipids that contain cholesterol, stearylamine or phosphatidylcholines. In some embodiments, a film of lipid components is hydrated with an aqueous drug solution to form a lipid layer that encapsulates the drug, as described in US Pat. No. 5,262,564. For example, the aptamer molecules described herein can be provided as a complex with a lipophilic compound or non-immunogenic high molecular weight compound constructed using methods known in the art. An example of nucleic acid associated complexes is provided in US Pat. No. 6,011,020.

[0247] The compounds of the present disclosure can also be coupled to soluble polymers as drug carriers that can be chosen as targets. Such polymers may include polyvinylpyrrolidone, pyran copolymer, polyhydroxypropyl methacrylamide-phenol, polyhydroxyethylaspanamidaphenol or poly (ethylene oxide) polylysine substituted with palmitoyl residues. In addition, the compounds of the present disclosure can be coupled to a class of biodegradable polymers useful in achieving controlled release of a drug, for example, polylactic acid, polyepsilon-caprolactone, polyhydroxybutyric acid, polyortoesters, polyacetals, polyhydropyran, polycyanoacrylates and block copolymers crosslinked or amphipathic hydrogels.

[0248] If desired, the pharmaceutical composition to be administered may also contain minor amounts of non-toxic auxiliary substances such as wetting or emulsifying agents, pH buffering agents and other substances such as, for example, sodium acetate and oleate. triethanolamine

[0249] The dosage schedule used by aptamers is selected according to a variety of factors including type, species, age, weight, sex and medical condition of the patient; the severity of the condition to be treated; the route of administration; the renal and hepatic function of the patient; and the particular aptamer or salt of the same employee. A generally skilled doctor or veterinarian can easily determine and prescribe the effective amount of the drug required to prevent, counteract or stop the progress of the condition.

[0250] The oral dosages of the present disclosure, when used for the indicated effects, will range between approximately 0.05 and 7500 mg / day orally. The compositions are preferably provided in the form of slotted tablets containing 0.5, 1.0, 2.5, 5.0, 10.0, 15.0, 25.0, 50.0, 100.0, 250, 0, 500.0 and 1000.0 mg of active substance. The infused dosages, intranasal dosages and transdermal dosages will range between 0.05 and 7500 mg / day. Subcutaneous, intravenous and intraperitoneal dosages will range between 0.05 and 3800 mg / day.

[0251] The compounds of the present disclosure may be administered in a single daily dose, or the total daily dosage may be administered in divided doses two, three or four times a day.

[0252] Effective plasma levels of the compounds of the present disclosure range from 0.002 mg / ml to 50 mg / ml. In the dosages of the present disclosure, mass refers only to the molecular weight of the oligonucleotide portion of the aptamer, regardless of the mass conferred by conjugation with PEG.

MODULATION OF PHARMACOCINETICS AND BIODISTRIBUTION OF THERAPEUTIC AGENTS OF

APTÁMERO

[0253] It is important that the pharmacokinetic properties for all oligonucleotide-based therapeutic agents, including aptamers, be made to match the desired pharmaceutical application. While aptamers directed against extracellular targets do not suffer from the difficulties associated with intracellular administration (as is the case with antisense and RNAi-based therapeutic agents), such aptamers must still be able to be distributed to target organs and tissues, and remain in the body ( unmodified) for a period of time according to the desired dosage schedule.

[0254] Therefore, the present disclosure provides materials and methods for affecting the pharmacokinetics of aptamer compositions and, in particular, the ability to adjust the pharmacokinetics of aptamers. The ability to adjust (i.e., the ability to modulate) the pharmacokinetics of aptamers is achieved by the conjugation of modifying moieties (e.g., PEG polymers) with the aptamer and / or the incorporation of modified nucleotides (e.g., 2 ' -fluor or 2'-O-methyl) to alter the chemical composition of the nucleic acid. The ability to adjust the pharmacokinetics of aptamers is used in the improvement of existing therapeutic applications, or alternatively in the development of new therapeutic applications. For example, in some therapeutic applications, for example, in the antineoplastic or acute context in which rapid elimination or exit of the drug may be desired, it is desired to decrease residence times of aptamers in the circulation. Alternatively, in other therapeutic applications, for example, maintenance therapies in which the systemic circulation of a therapeutic agent is desired, it may be desired to increase the residence times of aptamers in the circulation.

[0255] In addition, the ability to adjust the pharmacokinetics of aptamers is used to modify the biodistribution of an aptamer therapeutic agent in a subject. For example, in some therapeutic applications it may be desired to alter the biodistribution of an aptamer therapeutic agent in an effort to select a particular type of tissue or a specific organ (or set of organs) as the target. In these applications, the aptamer therapeutic agent preferentially accumulates in a specific tissue or organ (s). In other therapeutic applications, it may be desired to choose tissues that show a cell marker or a symptom associated with a disease, cell injury or other abnormal pathology, so that the therapeutic agent of the aptamer preferentially accumulates in the affected tissue. For example, as described in the provisional US request serial number 60/550790 filed on March 5, 2004 and entitled "Controlled modulation of the pharmacokinetics and biodistribution of aptamer therapeutic agents", the PEGylation of a therapeutic agent of Aptamer (for example, PEGylation with a 20 kDa PEG polymer) is used to select inflamed tissues as a target, so that the therapeutic agent of PEGylated aptamer preferentially accumulates in inflamed tissue.

[0256] To determine the pharmacokinetic and biodistribution profiles of aptamer therapeutic agents (eg, conjugates of aptamers or aptamers having altered chemicals such as modified nucleotides), a variety of parameters are such parameters that include, for example, half-life. (t1 / 2), plasma removal (CL), volume of distribution (Vss), area under the concentration-time curve (ABC), maximum observed serum or plasma concentration (Cmax) and time of Medium residence (MRT) of an aptamer composition. As used herein, the term "ABC" refers to the area under the representation of the plasma concentration of an aptamer therapeutic agent versus time after aptamer administration. The value of ABC is used to estimate the bioavailability (i.e., the percentage of aptamer therapeutic agent administered in the circulation after aptamer administration) and / or total elimination (CL) (i.e., the rate at which the aptamer therapeutic agent is removed from the circulation) of a given aptamer therapeutic agent. The volume of distribution refers to the plasma concentration of an aptamer therapeutic agent with respect to the amount of aptamer present in the body. The higher Vss, the more aptamer is outside the plasma (ie, more extravasation).

[0257] The present disclosure provides materials and methods for modulating, in a controlled manner, the pharmacokinetics and biodistribution of stabilized aptamer compositions in vivo by conjugating an aptamer with a modulating moiety such as a small molecule, peptide or polymer terminal group, or incorporating modified nucleotides into an aptamer. As described herein, the conjugation of a chemical composition of modifying moiety and / or alteration nucleotide (s) alters fundamental aspects of the residence time of circulating aptamers and distribution to tissues.

[0258] In addition to nuclease removal, oligonucleotide therapeutic agents are subject to renal filtration removal. As such, an intravenously administered nuclease resistant oligonucleotide normally has a half-life in vivo of <10 min, unless filtration can be blocked. This can be done both by facilitating the rapid distribution outside the bloodstream in tissues and increasing the apparent molecular weight of the oligonucleotide above the size cut effective for the glomerulus. The conjugation of small therapeutic agents with a PEG (PEGylation) polymer, described below, can dramatically lengthen the residence times of circulating aptamers, thus decreasing the dosing frequency and enhancing efficacy against vascular targets.

[0259] Aptamers can be conjugated to a variety of modifying moieties such as high molecular weight polymers, for example, PEG; peptides, for example, Tat (a 13 amino acid fragment of the HIV Tat protein (Vives et al., (1997), J. Biol. Chem. 272 (25): 16010-7)), Ant (a sequence of 16 amino acids derived from the third helix of the homeotic protein of Drosophila antennapedia (Pietersz et al. (2001), Vaccine 19 (11-12): 1397-405)) and Arg7 (a positively charged short peptide that permeates cells composed of polyarginine (Arg7) (Rothbard et al. (2000), Nat. Med. 6 (11): 1253-7; Rothbard, J et al. (2002), J. Med. Chem. 45 (17): 3612 -8)); and small molecules, for example, lipophilic compounds such as cholesterol. Among the various conjugates described herein, the properties of aptamers in vivo are those that are most profoundly altered by complexation with PEG groups. For example, complexing a mixed 2'F and 2'-OMe modified aptamer therapeutic agent with a 20 kDa PEG polymer hinders renal filtration and promotes the distribution of aptamers to both healthy and inflamed tissues. In addition, the 20 kDa-aptamer PEG polymer conjugate proves to be almost as effective as a 40 kDa PEG polymer in preventing renal filtration of aptamers. While a PEGylation effect is in the elimination of aptamers, the prolonged systemic exposure provided by the presence of the rest of 20 kDa also facilitates the distribution of aptamer to tissues, particularly those of highly perfused organs and those at the site of inflammation. The 20 kDa PEG aptamer-polymer conjugate directs the distribution of aptamers to the site of inflammation, so that the PEGylated aptamer preferentially accumulates in inflamed tissue. In some cases, the PEGylated 20 kDa aptamer conjugate can access the interior of cells such as, for example, kidney cells. Modified nucleotides can also be used to modulate the removal of aptamers from plasma. For example, an unconjugated aptamer incorporating chemical stabilizers of both 2'-F and 2'-OMe, which are typical of aptamers of the current generation, since it has a high degree of nuclease stability in vitro and in vivo, shows rapid plasma loss (i.e. rapid plasma removal) and rapid tissue distribution, mainly in the kidney, when compared to the unmodified aptamer.

NUCLEIC ACIDS DERIVATIZED WITH PEG

[0260] As described above, the derivatization of nucleic acids with non-immunogenic polymers of high molecular weight has the possibility of altering the pharmacokinetic and pharmacodynamic properties of nucleic acids making them more effective therapeutic agents. Favorable changes in activity may include decreased resistance to degradation by nucleases, decreased filtration by the kidneys, decreased exposure to the immune system and altered distribution of the therapeutic agent by the body.

[0261] The aptamer compositions of the disclosure can be derivatized with polyalkylene glycol (PAG) moieties. Examples of nucleic acids derivatized by PAG are found in US Pat. Serial No. 10 / 718,833 filed November 21, 2003. Typical polymers used in the disclosure include poly (ethylene glycol) (PEG), also known as poly (ethylene oxide) (PEO) and polypropylene glycol (including polyisopropylene glycol). Additionally, in many applications random or block copolymers of different alkylene oxides (eg, ethylene oxide and propylene oxide) can be used. In its most common form, a polyalkylene glycol such as PEG is a linear polymer terminated at each end with hydroxyl groups: HOCH2CH2O- (CH2CH2O) n-CH2CH2-OH. This polymer, alpha-, omega-dihydroxypoly (ethylene glycol), can also be represented as HO-PEG-OH in which it is understood that the symbol -PEG- represents the following structural unit: -CH2CH2O- (CH2CH2O) n-CH2CH2- en which normally ranges from about 4 to about 10,000.

[0262] As shown, the PEG molecule is di-functional and is sometimes referred to as "PEG-diol". The terminal portions of the PEG molecule are relatively non-reactive hydroxyl moieties, the -OH groups, which can be activated, or become functional moieties, for the binding of PEG to other compounds at reactive sites in the compound. Such activated PEG-diols are referred to herein as bi-activated PEG. For example, the terminal residues of PEG-diol have been functionalized as an active carbonate ester for selective reaction with amino moieties by substitution of the relatively non-reactive hydroxyl moieties, -OH, with N-hydroxy succinimide succinimidyl active ester moieties.

[0263] In many applications it is desired to cover the PEG molecule at one end with an essentially non-reactive moiety so that the PEG molecule is mono-functional (or mono-activated). In the case of protein therapeutic agents that generally show multiple reaction sites for activated PEGs, bi-functional activated PEGs lead to broad crosslinking, giving poorly functional aggregates. To generate mono-activated PEG, a hydroxyl moiety at the end of the PEG-diol molecule is normally substituted with a moiety of the non-reactive methoxy end, -OCH3. The other uncovered end of the PEG molecule normally becomes a remainder of the reactive end that can be activated for binding to a reactive site on a surface or a molecule such as a protein.

[0264] PAGs are polymers that normally have solubility properties in water and in many organic solvents, lack toxicity and lack immunogenicity. One use of PAG is to covalently bind the polymer to insoluble molecules to make the "conjugate" of the resulting PAG-molecule soluble. For example, it has been shown that the water insoluble drug paclitaxel, when coupled to PEG, becomes water soluble. Greenwald et al., J. Org. Chem., 60: 331-336 (1995). PAG conjugates are often used not only to enhance solubility and stability, but also to prolong the half-life in the blood circulation of molecules.

[0265] The polyalkylated compounds of the disclosure are normally between 5 and 80 kDa in size; however, any size can be used, depending on the choice of the aptamer and the application. Other PAG compounds of the disclosure are between 10 and 80 kDa in size. Still other PAG compounds of the disclosure are between 10 and 60 kDa in size. For example, a PAG polymer can be at least 10, 20, 30, 40, 50, 60 or 80 kDa in size. Such polymers can be linear or branched. In some embodiments, the polymers are PEG. In some embodiment, the polymers are branched PEG. In still other embodiments, the polymers are 40 kDA branched PEG as depicted in Figure 5. In some embodiments, the 40 kDA branched PEG is attached to the 5 'end of the aptamer as depicted in Figure 6.

[0266] Unlike biologically expressed protein therapeutic agents, nucleic acid therapeutic agents are normally chemically synthesized from nucleotides of activated monomers. PEG-nucleic acid conjugates can be prepared by incorporating PEG using the same iterative monomer synthesis. For example, PEGs activated by conversion to a phosphoramidite form can be incorporated into solid phase oligonucleotide synthesis. Alternatively, oligonucleotide synthesis can be completed with site-specific incorporation of a reactive PEG binding site. More commonly, this has been accomplished by adding a free primary amine to the 5 'end (incorporated using a modifying phosphoramidite in the last stage of solid phase synthesis coupling). Using this approach, a reactive PEG (for example, one that is activated so that it will react and form a bond with an amine) is combined with the purified oligonucleotide and the coupling reaction is carried out in solution.

[0267] The ability of PEG conjugation to alter the biodistribution of a therapeutic agent is related to several factors that include the apparent size (eg, as measured in terms of hydrodynamic radius) of the conjugate. It is known that larger conjugates (> 10 kDa) more effectively block filtration by the kidney and therefore increase the serum half-life of small macromolecules (eg, peptides, antisense oligonucleotides). It has been shown that the ability of PEG conjugates to block filtration increases with the size of PEG up to about 50 kDa (additional increases have a minimal beneficial effect since half-life is defined by macrophage-mediated metabolism rather than elimination by the kidneys).

[0268] The production of high molecular weight PEG (> 10 kDa) can be difficult, inefficient and expensive. As a route to the synthesis of high molecular weight-nucleic acid PEG conjugates, previous work has been based on the generation of higher molecular weight activated PEGs. A method for generating such molecules involves the formation of a branched activated PEG in which two or more PEGs are attached to a central nucleus carrying the activated group. The terminal portions of these higher molecular weight PEG molecules, that is, the relatively non-reactive hydroxyl (-OH) moieties, can be activated, or become functional moieties, for the binding of one or more of the PEGs to other compounds in reactive sites in the compound. Branched activated PEGs will have more than two ends, and in cases where two or more ends have been activated, such higher activated molecular weight PEG molecules are referred to herein as multi-activated PEGs. In some cases, not all ends are activated in a branched PEG molecule. In cases where any two ends of a branched PEG molecule are activated, such PEG molecules are hereinafter referred to as bi-activated PEG. In some cases where only one end is activated in a branched PEG molecule, such PEG molecules are hereinafter referred to as mono-activated. As an example of this approach, the activated PEG prepared by the union of two monomethoxy-PEG to a lysine nucleus that is subsequently activated for the reaction has been described (Harris et al., Nature, vol. 2: 214-221, 2003 ).

[0269] The present disclosure provides another cost-effective route for the synthesis of high molecular weight PEG-nucleic acid (preferably aptamer) conjugates that include multi-PEGylated nucleic acids. The present disclosure also encompasses PEG-linked multimeric oligonucleotides, for example, dimerized aptamers. The present disclosure also relates to high molecular weight compositions in which a PEG stabilizing moiety is a linker that separates different portions of an aptamer, for example, PEG is conjugated within a single aptamer sequence, so that the Linear arrangement of the high molecular weight composition of the aptamer is, for example, nucleic acid-PEG-nucleic acid (-PEG-nucleic acid) n in which n is greater than or equal to 1.

[0270] The high molecular weight compositions of the disclosure include those having a molecular weight of at least 10 kDa. The compositions normally have a molecular weight between 10 and 80 kDa in size. The high molecular weight compositions of the disclosure are at least 10, 20, 30, 40, 50, 60 or 80 kDa in size.

[0271] A stabilizing moiety is a molecule, or portion of a molecule, that improves the pharmacokinetic and pharmacodynamic properties of the high molecular weight aptamer compositions of the disclosure. In some cases, a stabilizing moiety is a molecule or portion of a molecule that carries two or more aptamers,

or aptamer domains, in proximity, or provides a decrease in the overall rotational freedom of the high molecular weight aptamer compositions of the disclosure. A stabilizing moiety can be a polyalkylene glycol, such as a polyethylene glycol, which can be linear or branched, a homopolymer or a heteropolymer. Other stabilizing moieties include polymers such as peptide nucleic acids (PNA). The oligonucleotides can also be stabilizing moieties; such oligonucleotides may include modified nucleotides and / or modified bonds such as phosphorothioates. A stabilizing moiety may be an integral part of an aptamer composition, that is, it is covalently bound to the aptamer.

[0272] The compositions of the disclosure include high molecular weight aptamer compositions in which two or more nucleic acid residues are covalently conjugated with at least one polyalkylene glycol moiety. The polyalkylene glycol moieties serve as stabilizing moieties. In compositions in which a polyalkylene glycol moiety is covalently bonded at either end with an aptamer, such that the polyalkylene glycol bonds the nucleic acid moieties together in a molecule, the polyalkylene glycol is said to be a binding moiety. In such compositions, the primary structure of the covalent molecule includes the linear nucleic acid-PAG-nucleic acid arrangement. An example is a composition that has the primary nucleic acid-PEG nucleic acid structure. Another example is a linear arrangement of: nucleic acid - PEG - nucleic acid - PEG - nucleic acid.

[0273] To produce the nucleic acid-PEG-nucleic acid conjugate, the nucleic acid is originally synthesized to carry a single reactive site (for example, is mono-activated). In a preferred embodiment, this reactive site is an amino group introduced at the 5 'end by the addition of a modifying phosphoramidite as a last step in the solid phase synthesis of the oligonucleotide. After deprotection and purification of the modified oligonucleotide, it is reconstituted at high concentration in a solution that minimizes the spontaneous hydrolysis of the activated PEG. In a preferred embodiment, the concentration of oligonucleotide is 1 mM and the reconstituted solution contains 200 mM NaHCO3 buffer, pH 8.3. The synthesis of the conjugate is initiated by the slow stepwise addition of highly purified bi-functional PEG. In a preferred embodiment, PEG-diol is activated at both ends (bi-activated) by derivatization with succinimidyl propionate. After the reaction, the PEG-nucleic acid conjugate is purified by gel electrophoresis or liquid chromatography to separate completely conjugated, partially conjugated and unconjugated species. Concatenated multiple PAG molecules (for example, as random or block copolymers) or smaller PAG chains can be ligated to achieve various lengths (or molecular weights). Non-PAG linkers can be used between PAG chains of varying lengths.

[0274] Modifications of nucleotides modified with 2'-O-methyl, 2'-fluorine and others stabilize the aptamer against nucleases and increase their half-life in vivo. The 3'-3'-dT cap also increases resistance to exonucleases. See, for example, US Pat. 5,674,685; 5,668,264; 6,207,816; and 6,229,002.

PAY DERIVATIZATION OF A REACTIVE NUCLEIC ACID

[0275] High molecular weight PAG-nucleic acid-PAG conjugates can be prepared by reacting a mono-functional activated PEG with a nucleic acid containing more than one reactive site. In one embodiment, the nucleic acid is bi-reactive, or bi-activated, and contains two reactive sites: a 5 'amino group and a 3' amino group introduced into the oligonucleotide by conventional phosphoramidite synthesis, for example: '-5'-di-PEGylation as illustrated in Figure 7. In alternative embodiments, the reactive sites can be introduced into internal positions using, for example, the 5' position of pyrimidines, the 8 position of purines or the 2 'position of ribose as sites for the binding of primary amines. In such embodiments, the nucleic acid may have several activated or reactive sites and is said to be multiple activated. After synthesis and purification, the modified oligonucleotide is combined with the mono-activated PEG under conditions that promote selective reaction with the reactive sites of the oligonucleotide while minimizing spontaneous hydrolysis. In the preferred embodiment, the monomethoxy-PEG is activated with succinimidyl propionate and the coupled reaction is carried out at pH 8.3. To trigger the synthesis of the bi-substituted PEG, stoichiometric excess PEG is provided with respect to the oligonucleotide. After the reaction, the PEG-nucleic acid conjugate is purified by gel electrophoresis or liquid chromatography to separate completely conjugated, partially conjugated and unconjugated species.

[0276] The binding domains may also have one or more polyalkylene glycol moieties attached thereto. Such PAGs can be of varying lengths and can be used in appropriate combinations to achieve the desired molecular weight of the composition.

[0277] The effect of a particular linker can be influenced both by its chemical composition and its length. A linker that is too long, too short or forms steric and / or ionic interactions unfavorable with the target will exclude complex formation between the aptamer and the target. A linker that is longer than necessary to cover the distance between nucleic acids can reduce binding stability by decreasing the effective concentration of the ligand. Therefore, it is often necessary to optimize the compositions and linker lengths in order to maximize the affinity of an aptamer for a target.

[0278] The mention of publications and patent documents is not intended as an admission that any one is relevant prior art or that it constitutes admission of the content or date thereof.

EXAMPLES

EXAMPLE 1: Synthesis of large-scale aptamers and conjugation

[0279] ARC 126 (5 '- (SEQ ID NO: 1) -HEG- (SEQ ID NO: 2) -HEG- (SEQ ID NO: 3) -3'-dT-3') is an aptamer of 29 nucleotides (excluding an inverted T at the 3 'end) specific for PDGF containing a 3' inverted dT cap to enhance stability against nuclease attack. The PEG residues can be conjugated with ARC126 using a 5 'amino terminus modifier for subsequent conjugation reactions. The syntheses were performed using conventional solid phase phosphoramidite chemistry. The oligonucleotide was deprotected with ammonium hydroxide / methylamine (1: 1) at room temperature for 12 hours and purified by ion exchange HPLC. ARC 128 (5 '- (SEQ ID NO. 4) -HEG- (SEQ ID NO: 5) -HEG- (SEQ ID NO: 6) -3'), an inactive variant that no longer binds to PDGF, was synthesized using the same procedure.

[0280] ARC126 was conjugated with several different PEG residues: 20 kDa PEG (ARC240, (5 '- [20 K PEG]

(SEQ ID NO: 1) -HEG- (SEQ ID NO: 2) -HEG- (SEQ ID NO: 3) -3'-dT-3 ')); 30 kDa PEG (ARC308, (3 '- [30 K PEG]

(SEQ ID NO: 1) -HEG- (SEQ ID NO: 2) -HEG- (SEQ ID NO: 3) -3'-dT-3 ')); 40 kDa PEG (ARC 127, (5 '- [40 K PEG]

(SEQ ID NO: 1) -HEG- (SEQ ID NO: 2) -HEG- (SEQ ID NO: 3) -3'-dT-3 ')). ARC126 was dissolved at 2 mM in buffer

5 100 mM sodium carbonate, pH 8.5, and reacted for 1 hour with a 2.5 molar excess of mPEG-SPA (MW

20 kDa) or mPEG2-NHS ester (MW 40 kDa) (Shearwater Corp., Huntsville, AL) and 3.5 molar excess (over 24

hours) of mPEG-nPNC (MW 30kDa) (NOF Corporation, Tokyo, Japan) in equal volumes of acetonitrile.

Then, the resulting products were purified by ion exchange HPLC on a 50 ml Super column.

Q 5PW (Tosoh Bioscience, Montgomeryville, PA) using aqueous NaCl as eluent. Then, the 10 conjugated oligonucleotides were desalted on a 100 ml column Amberchrom CG300S (Tosoh) using a

water / acetonitrile gradient. Aptamer conjugates were lyophilized for storage.

[0281] In order to use ARC127 in animal models, the quality of the synthesized material was tested for

Endotoxin levels The endotoxin content of the synthesized ARC127 was determined using the LAL 15 test (workers of Nelson Labs, AZ). The results for the endotoxin test are shown in the following Table

1. The amounts of endotoxin detected were below the ISO standard for sterile irrigation solutions (0.5 EU / ml), that is, below the levels allowed for IV administration. This indicated that the ARC126 and ARC127 preparations were sterile and that it was possible to advance the efficacy models in animals.

20 Table 1. Endotoxin levels in large-scale synthesis of therapeutic aptamers.

Sample

Dilution Endotoxin detected Recovery of the added substance

1: 10

2.5 EU / ml and 0.52 EU / mg 73%

ARC126

1: 100 2.8 EU / ml and, 58 EU / mg 103%

1: 200

2.5 EU / ml and 0.52 EU / mg 104%

eleven

0.19 EU / ml and 0.17 EU / mg 51%

ARC127

1: 10 0.33 EU / ml and 0.30 EU / mg 97%

1: 100

0.45 EU / ml and 0.41 EU / mg 115%

eleven

0.52 EU / ml and 0.76 EU / mg 105%

ARC128

1: 10 0.57 EU / ml and 0.82 EU / mg 127%

1: 100

0.43 EU / ml and 0.62 EU / mg 136%

[0282] Small-scale synthesis of the defluorinated ARC-126 aptamer variants were made in the

25 Expedite 8909 DNA synthesizer from Applied Biosystems (Foster City, CA) using conventional solid phase phosphoramidite chemistry and coupling protocols recommended by the vendor. The aptamers were cleaved and deprotected by adding 250 µl of ammonium hydroxide / 40% aqueous methylamine (1: 1) to the column support and seeded in a thermal block at 65 ° C for 30 minutes. The aptamers were dried in Speed Vac (Savant), then resuspended in 200 μl of deionized H2O. HPLC purification was performed

30 in HPLC Transgenomic WAVE (Omaha, NE). The columns used for ion exchange are DNAPAC (Dionex, Sunnyvale, CA) and Resource (Amersham Biosciences, Piscataway, NJ). Buffer A: 25 mM sodium phosphate / 25% acetonitrile; Buffer B: 25 mM sodium phosphate / 400 mM sodium perchlorate / 25% acetonitrile, a gradient of 0-80% B was used. Then, the purified fractions were pooled and dried in Speed Vac and resuspended in 200 μl of deionized H2O.

35 EXAMPLE 2: Stability studies with fluorinated aptamers

[0283] ARC126 and ARC127 recently synthesized in the company were compared with inherited ARC126 and ARC127 that were synthesized by Proligo (Boulder, CO) and had been freeze-dried for 2 years at -20 ° C.

40 Recently synthesized aptamers are hereinafter referred to as "ARC126 (Archemix)" and "ARC 127 (Archemix)", while inherited aptamers are hereinafter referred to as "ARC126 (Proligo)" and "ARC127 (Proligo)".

[0284] The ARC127 synthesized in the company and the inherited ARC127 were passed through an HPLC column of

45 ion exchange for analysis. Figure 8A is a profile of a freshly synthesized ARC 127 ion exchange HPLC analysis (lower profile) and inherited (upper profile) showing that, after 2 years of lyophilized storage at -20 ° C, relatively no degradation of the ARC127 inherited.

[0285] The inherited ARC126 and ARC127 aptamers stored at -20 ° C for two years are also

50 tested for potency, and were compared with ARC126 and ARC127 recently synthesized in the company using the 3T3 cell proliferation assay (Example 3). Figure 8B shows the results of the cell-based assay for potency that demonstrate that, even after lyophilization and storage at -20 degrees Celsius for 2 years, inherited aptamers were just as potent as ARC126 and ARC127 recently synthesized in the company .

EXAMPLE 3A: Composition and sequence optimization of ARC126 variants

[0286] The sequence and secondary structure of the anti-PDGF aptamer designated ARC126 is shown in Figure 9A. The sequence and secondary structure of ARC 126 derivatives in which the nucleotides have been substituted with 2'-fluorine substituents are shown in Figure 9B. The loops shown at the ends of the two internal stems are polyethylene glycol 6 (PEG-6) spacers and the modified nucleotides are represented by dA = deoxy-adenosine; dG = deoxy guanosine; mA = 2'-O-methyl-adenosine; dT = deoxy-thymidine; dC = deoxy-cytosine; mG = 2'-O-methyl-guanosine; mC = 2'-O-methyl-cytosine; [3'T] = inverted deoxythymidine; fC = 2'-fluoro-cytosine; and fU = 2'-fluoro-uridine.

[0287] As shown in Figure 9A (left panel), the 29 nucleotide composition of ARC126 contains seven 2'-fluorine residues (three 2'-fluoro-uridines and four 2'-fluoro-cytosines). Due to considerations that include genotoxicity of degradation products, ARC 126 was optimized to modify the sequence composition by eliminating all or most of the 2'-fluorine residues without compromising the potency or stability of the existing molecule. A route for the elimination of 2'-fluorine residues consisted of the simple replacement of the seven 2'-fluorine residues with deoxy residues. A variant of all such DNA was synthesized from ARC126, designated ARC299 (SEQ ID NO: 42-PEG-SEQ ID NO: 43-PEG-SEQ ID NO: 44 in which PEG = PEG-6 spacer) and tested on in vitro biochemical binding and cell-based proliferation assays. These experiments showed that the simple replacement of all 2'-fluorine residues by deoxy residues in the 29-mere composition of ARC126 induced instability in the central and upper stems, leading to significantly reduced activity / potency.

[0288] The second approach taken to effect the elimination of 2'-fluoride residues from ARC126 was the replacement, both individually and in blocks, of 2'-fluoride residues with 2'-O-methyl residues to improve relative mating instability of bases in the central and upper stems observed with the composition of all deoxy. Various composition variants representing substitutions of a single point of 2'-fluorine residues by 2'-O-methyl or deoxy residues (ARC277.5 '- (SEQ ID NO: 39) -PEG- (SEQ ID NO: 40) -PEG- (SEQ ID NO: 41) - [3'T] -3 '), in addition to block substitutions of 2'-fluoride residues with 2'-O-methyl residues (ARC337, 5' - (SEC ID NO: 42) -PEG- (SEQ ID NO: 43) -PEG- (SEQ ID NO: 41) - [3'T] -3 '; ARC338, 5' - (SEQ ID NO: 52) -PEG- (SEQ ID NO: 43) -PEG- (SEQ ID NO: 44) - [3'T] -3 '; ARC339, 5' - (SEQ ID NO: 48) -PEG- (SEQ ID NO: 43) - PEG- (SEQ ID NO: 53) - [3'T] -3 '; ARC340, 5' - (SEQ ID NO: 50) -PEG- (SEQ ID NO: 43) -PEG- (SEQ ID NO: 54 ) - [3'T] -3 '; combinations of individual and block substitutions (ARC341, 5' - (SEQ ID NO: 36) -PEG- (SEQ ID NO: 37) -PEG- (SEQ ID NO: 41 ) - [3'T] -3 '; ARC342, 5' - (SEQ ID NO: 55) -PEG- (SEQ ID NO: 37) -PEG- (SEQ ID NO: 41) - [3'T] - 3 '; ARC344, 5' - (SEQ ID NO: 56) -PEG- (SEQ ID NO: 37) -PEG- (SEQ ID NO: 41) - [3'T] -3 '; ARC345, 5'- (SEQ ID NO: 36) -PEG- (SEQ ID NO: 57) -PEG- (SEQ ID NO. : 41) - [3'T] 3 '; (ARC346, 5' - (SEQ ID NO: 36) -PEG- (SEQ ID NO: 58) -PEG- (SEQ ID NO: 41) - [3'T ]-3'; ARC347, 5 '- (SEQ ID NO: 59) -PEG- (SEQ ID NO: 60) -PEG- (SEQ ID NO: 61) - [3'T] -3'; ARC362, 5 '- (SEQ ID NO: 36) -PEG- (SEQ ID NO: 37) -PEG- (SEQ ID NO: 62) - [3'T] -3'; ARC363, 5 '- (SEQ ID NO: 63) -PEG- (SEQ ID NO: 37) -PEG- (SEQ ID NO: 64) - [3'T] -3'; ARC364, 5 '- (SEQ ID NO: 50) -PEG- (SEQ ID NO: 43) -PEG- (SEQ ID NO: 65) - [3'T] -3'; ARC365, 5'-NH2- (SEQ ID NO: 39) -PEG- (SEQ ID NO: 40) -PEG- (SEQ I D NO: 41) - [3'T] -3 '; ARC366, 5 '- (SEQ ID NO: 66) -PEG- (SEQ ID NO: 40) -PEG- (SEQ ID NO: 65) - [3'T] -3'; ARC404, 5 '- (SEQ ID NO: 55) -PEG- (SEQ ID NO: 40) -PEG- (SEQ ID NO: 41) - [3'T] -3'; ARC405, 5 '- (SEQ ID NO: 56) -PEG (SEQ ID NO: 40) -PEG- (SEQ ID NO: 41) - [3'T] -3'; ARC406, 5 '- (SEQ ID NO: 39) -PEG- (SEQ ID NO: 57) -PEG- (SEQ ID NO: 41) - [3'T] -3'; ARC407, 5 '- (SEQ ID NO: 39) -PEG- (SEQ ID NO: 58) -PEG- (SEQ ID NO: 41) - [3'T] -3'; ARC408, 5 '- (SEQ ID NO: 39) -PEG- (SEQ ID NO: 40) -PEG- (SEQ ID NO: 62) - [3'T] -3'; ARC409, 5 '- (SEQ ID NO: 39) -PEG- (SEQ ID NO: 40) -PEG (SEQ ID NO: 67) - [3'T] -3'; ARC410, 5 '- (SEQ ID NO: 39) -PEG- (SEQ ID NO: 40) -PEG- (SEQ ID NO: 68) - [3'T] -3'; ARC513 (5 '- (SEQ ID NO: 69) - PEG - (SEQ ID NO: 40) - PEG - (SEQ ID NO: 70) - [3'T] -3'), ARC514 (5 '- (SEC ID NO: 69) - PEG - (SEQ ID NO: 40) - PEG - (SEQ ID NO: 71) - [3'T] -3 '), ARC515 (5' - (SEQ ID NO: 69) - PEG - (SEQ ID NO: 40) - PEG - (SEQ ID NO: 72) - [3'T] -3 '), and ARC516 (5' - (SEQ ID NO: 69) - PEG - (SEQ ID NO: 40) - PEG - (SEQ ID NO: 73) - [3'T] -3 '), and finally a composition of all 2'-O-methyl (ARC300 (or 300B), 5' - (SEQ ID NO: 45) -PEG- (SEQ ID NO: 46) -PEG- (SEQ ID NO: 47) [3'T] -3 '). Other composition variants include: ARC276, 5 '- (SEQ ID NO: 36) -PEG- (SEQ ID NO: 37) -PEG- (SEQ ID NO: 38) - [3'T] -3'; ARC335, 5 '- (SEQ ID NO: 48) -PEG- (SEQ ID NO: 43) -PEG- (SEQ ID NO: 49) - [3'T] -3'; ARC336, 5 '- (SEQ ID NO: 50) -PEG- (SEQ ID NO: 43) -PEG- (SEQ ID NO: 51) - [3'T] -3'; ARC343, 5 '- (SEQ ID NO: 52) -PEG- (SEQ ID NO: 43) -PEG- (SEQ ID NO: 41) - [3'T] -3'.

[0289] The following Table 2 summarizes the sequence and composition of all variants of ARC126 synthesized and tested. The sequences shown are listed 5 '' 3 'from right to left in the table. Table 2 also summarizes the identity of composition, average affinity and activity of all variants of ARC 126 synthesized and tested in in vitro assays (competitive binding assay and 3T3 proliferation assay) described later in Example 5. In the table, d = deoxy residue; f = 2'-fluorine residue; m = 2'-O-methyl residue; PEG = polyethylene glycol spacer (PEG-6); 3T = inverted deoxythymidine.

[0290] Following synthesis, these composition variants were tested in biochemical and proliferation assays based on in vitro cells described herein. These experiments showed a wide range of affinities in in vitro binding assays and a similarly wide range of activities in cell-based proliferation assays (the results are described below). Composition variants that showed the highest levels of binding affinity and activity in the cell-based assay are exemplified by the ARC513-516 series shown in Figure 9B. Figure 9B shows the optimal composition variants of ARC 126: ARC513 (5 '- (SEQ ID NO: 69) - PEG - (SEQ ID NO: 40) - PEG - (SEQ ID NO: 70) - [3'T ] 3 '), ARC514 (5' - (SEQ ID NO: 69) - PEG - (SEQ ID NO: 40) - PEG - (SEQ ID NO: 71) - [3'T] -3 '), ARC515 ( 5 '- (SEQ ID NO: 69) -PEG - (SEQ ID NO: 40) - PEG - (SEQ ID NO: 72) - [3'T] -3'), and ARC516 (5 '- (SEQ ID Nº: 69) - PEG - (SEQ ID NO: 40) - PEG (SEQ ID NO: 73) - [3'T] -3 '). From Figure 9B, all optimal composition variants consist of an extended stem, with respect to ARC126, by two base pairs, and in the upper stems, a common set of point substitutions of 2'-fluorine residues by 2'- O-methyl, in addition to the pre-existing 2'-O-methyl residues of ARC126. Composition variants ARC513-516 differ only in two aspects: (1) the identity of deoxy

or 2'-fluorine of the three guanosine residues at the 3 'end in the central stem; and (2) the deoxy or 2'-Omethyl identity of the cytosine residue at the top of the central stem on the 3 'side.

[0291] The in vitro binding affinity of the optimal composition variants for PDGF is shown in Figure 10A. The data shown in the figure were derived from a competitive binding assay in which the indicated concentration of unlabeled competing aptamer was assessed in separate reactions against a fixed amount (<0.1 nM) of the radiolabelled ARC 126 aptamer with 32P in buffer containing a fixed amount (0.1 nM) of the target related to the aptamer (PDGF-BB; PeproTech, Rocky Hill, NJ). ARC 126 was radiolabelled at the 5 'end by incubation with conr-32P-ATP (MP Biomedicals, Irvine, CA) and polynucleotide kinase (New England Biolabs ("NEB"), Beverly, MA). Binding reactions were carried out in phosphate buffered saline (Cellgro, Herndon, VA) containing 0.2 mg / ml bovine serum albumin (NEB) and 0.02 mg / ml tRNA (Sigma, St Louis, MO). The reactions were equilibrated over a period of 15-30 minutes at room temperature, then filtered through a sandwich of nitrocellulose membranes (Protra membrane, Perkin-Elmer, Boston, MA) and nylon (Hybond membrane, Amersham, Piscataway, NJ) to separate the target bound aptamer from the free aptamer. The subsequent autoradiographic analysis of the filter membranes corresponding to each concentration of unlabeled aptamer revealed the degree of competitive displacement of 32P-ARC126 per unlabeled aptamer. The data is shown in Figure 10A in which ARC128 ((5 '- (SEQ ID NO: 4) -HEG- (SEQ ID NO: 5) -HEG- (SEQ ID NO: 6) -3')) represents a negative control sequence and, therefore, the inactive variant of ARC126.

[0292] Figure 10B shows data from proliferation assays based on 3T3 cells in vitro showing the activity of some variants of ARC126 composition. 3T3 cells, a line of rat fibroblast cells (ATCC, Manassas, VA), were seeded at 3,000 cells / well in a 96-well plate one day before the start of the assay in 100 ul of DMEM / 10% SBF . The next day, the cells were washed once with linear DMEM and then 75 ul of 0.8% DMEM / SBF was added to each well. Then 25 ul of PDGF-BB (PeproTech,

Rocky Hill, NJ) at a final concentration of 50 ng / ml +/- of ARC126 variants (6 points, final concentration 0200 nM) at each well. The cells were incubated for 3 days. After incubation, 10 ul of MTT (Promega, Madison, WI) was added to each well and incubated for an additional 1.5 hours. The medium was then removed, 200 ul of isopropanol (2-propanol) was added to each well, the cells were meticulously resuspended and the absorbance at 570 nm was read in a 96-well plate reader. As shown in Figure 10B, it is evident that (1) all the composition variants shown are active; and (2) the relative activity classification of ARC513 (5 '- (SEQ ID NO: 69) - PEG - (SEQ ID NO: 40) - PEG - (SEQ ID NO: 70) - [3'T] -3 '), ARC514 (5' - (SEQ ID NO: 69) - PEG - (SEQ ID NO: 40) - PEG - (SEQ ID NO: 71) - [3'T] -3 '), ARC515 (5' - (SEQ ID NO: 69) - PEG - (SEQ ID NO: 40) - PEG - (SEQ ID NO: 72) - [3'T] -3 ') and ARC516 (5' - (SEQ ID NO: 69 ) - PEG - (SEQ ID NO: 40) - PEG - (SEQ ID NO:

10 73) - [3'T] -3 ') is similar.

Example 3B: Modifications of ARC513

MU substitutions

[0293] ARC513 was further modified to replace the 3 'or 5' PEG spacers with 2'-OMe tribes or 2'-OMe tetrabucles, resulting in the following aptamers:

[0294]

[0295]

[0296]

[0298] [0299]

3T3 proliferation assay with modified ARC513 aptamers

[0300] 3T3 cells, which are derived from a rat fibroblast cell line (ATCC, Manassas, VA), are

5 used in a proliferation assay to test the potency of modified ARC513 aptamers. 3T3 fibroblast cells have PDGF receptors on their cell surface and respond to mitogen, for example, stimulation of PDGF by proliferation. The assay was performed as follows: 3T3 cells were seeded at 3,000 cells / well in a 96-well plate one day before the start of the assay in 100 ul of DMEM / 10% SBF. The next day, the cells were washed once with linear DMEM and then 75 ul of 0.8% DMEM / SBF was added to each

10 well Then 25 ul of PDGF-BB (PeproTech, Rocky Hill, NJ) was added at a final concentration of 50 ng / ml to each well +/- aptamer condition to be tested. Each plate included the following conditions in triplicate: without PDGF that corresponds to growth without mitogen (negative control), a negative control aptamer control (ARC128) in which no effect on the growth rate (negative control) is observed, a positive control in which maximum growth is observed in the absence of PDGF aptamer and a series of dilutions of

15 functional PDGF aptamer from which a good IC50 curve could be calculated. The functional PDGF aptamer dilutions normally consisted of 6 points in serial double dilutions.

[0301] The cells were incubated for 3 days. After incubation, 10 ul of MTT (Promega, Madison, WI) was added to each well and incubated for an additional 1.5 hours. The medium was removed, 200 μl was added

20 of isopropanol (2-propanol) to each well, the cells were meticulously resuspended and the absorbance at 570 nm was read in a 96-well plate reader. The present example represents the comparison of the potency of the ARG513 PDGF aptamer with that of 3 variants of ARC 513.

[0302] The 3T3 cell proliferation assay was performed with ARC513 and derivatives of ARC 513, ARC1012 a

25 ARC1017. ARC513 routinely showed IC50 values <10 nM in which negative control ARC 128 never showed an effect on 3T3 cell proliferation (ARC128 data not shown). The following Table 3A shows the IC50 of variants of ARC513 in the 3T3 proliferation assay.

Table 3A: Variants of ARC513 in the 3T3 proliferation assay. 30

ARC No.

Average IC50

513

 3.7

1012

 2.79

1013

 15.4

1014

 10.61

1015

 10.1

1016

 8.5

1017

 14.3

Conjugation of ARC 513-5'-PEG

[0303] The oligonucleotide 5'-NH2-dCdCdCdAdGdGdCTdAdCmG (SEQ ID No. 69) PEG

35 dCdGTdAmGdAmGdCdAmUmCmA (SEQ ID No. 40) PEG TdGdATmCdCTmGmGmG-3T-'3 (SEQ ID No. 70) was synthesized in an AKTA OligoPilot 100 synthesizer (GE Healthcare, Uppsala, Sweden) according to the procedures recommended by the manufacturer using 2'e-using OM-2e Conventionally commercially available RNA, deoxy-inosine and DNA-phosphoramidites (Glen Research, Sterling, VA) and an inverted deoxy-thymidine CpG support. A terminal amine function was linked with a 5'-amino C6-TFA modifier (Glen Research, Sterling, VA). After the

After deprotection, the oligonucleotide was purified by ion exchange chromatography on Super Q 5PW resin (30) (Tosoh Biosciences) and precipitated with ethanol.

[0304] Aliquots of the 5'-amine modified aptamer were post-synthetically conjugated with a PEG residue of 30 kDa linear, 20 kDa linear and 40 kDa both branched and linear. The aptamers were dissolved in a water / DMSO solution (1: 1) at a concentration between 1.5 and 3 mM. Sodium carbonate buffer, pH 8.5, was added at a final concentration of 100 mM, and the oligonucleotide was reacted overnight with a 1.7 molar excess of the desired PEG reagent (eg, Sunbright p-nitrophenyl carbonate ester MENP-20T 20 kDa [NOF Corp, Japan], Sunbright p-nitrophenyl carbonate ester MENP-30T 30 kDa [NOF Corp, Japan], Sunbright GL2-400NP pnitrophenyl carbonate ester [NOF Corp, Japan], mPEG2-ester 40 kDa or 60 kDa NHS [Nektar,

50 Huntsville AL]) dissolved in an equal volume of acetonitrile. The resulting PEGylated products were purified by ion exchange chromatography on Super Q 5PW resin (30) (Tosoh Biosciences) and desalted using reverse phase chromatography performed on Amberchrom CG300-S resin (Rohm and Haas) and lyophilized.

[0305] The structures of the resulting PEGylated aptamers are given below: 55 ARC594:

in which

Atamer = dCdCdCdAdGdGdCTdAdCmG (SEQ ID No. 69) - PEG - dCdGTdAmGdAmGdCdAmUmCmA (SEQ ID No. 40) - PEG TdGdATmCdCTmGmGmG-3T-3 '(SEQ ID No. 70); in which d denotes a deoxy-nucleotide, m denotes a 2'-OMe-nucleotide, PEG denotes a PEG spacer and 3T denotes an inverted deoxy-thymidine cap.

ARC1472:

10 in which

Atamer = 5'dCdCdCdAdGdGdCTdAdCmG (SEQ ID No. 69) - PEG - dCdGTdAmGdAmGdCdAmUmCmA (SEQ ID No. 40) - PEG - TdGdATmCdCTmGmGmG-3T-3 '(SEQ ID No. 70); in which d denotes a deoxy-nucleotide, m denotes a 2'-OMe-nucleotide, PEG denotes a PEG spacer and 3T denotes an inverted deoxy-thymidine cap.

15 ARC592:

in which

20 Atamer = 5'dCdCdCdAdGdGdCTdAdCmG (SEQ ID No. 69) - PEG - dCdGTdAmGdAmGdCdAmUmCmA (SEQ ID No. 40) - PEG - TdGdATmCdCTmGmGmG-3T-3 '(SEQ ID No. 70); in which d denotes a deoxy-nucleotide, m denotes a 2'-OMe-nucleotide, PEG denotes a PEG spacer and 3T denotes an inverted deoxy-thymidine cap.

ARC593:

in which

Atamer = 5'dCdCdCdAdGdGdCTdAdCmG (SEQ ID NO: 69) - PEG - dCdGTdAmGdAmGdCdAmUmCmA (SEQ ID NO: 40) - PEG - TdGdATmCdCTmGmGmG-3T-3 '; SEQ ID NO: 70); wherein d denotes a deoxy-nucleotide, m denotes 30 a 2'-OMe-nucleotide, PEG denotes a PEG spacer and 3T denotes an inverted deoxy-thymidine cap.

Conjugates of aptamer-3'-5'-PEG

[0306] The oligonucleotide 5'-NH2-dCdCdCdAdGdGdCdTdAdCmG (SEQ ID No. 69) PEG

35 dCdGdTdAmGdAmGdCdAmUmCmA (SEQ ID No. 40) PEG dTdGdAdTmCdCdTmGmGmG-NH2-3 '(SEQ ID No. 102) was synthesized in an AKTA OligoPilot 100 synthesizer (GE Healthcare Uppsala, Sweden) using the procedures recommended by the OM-ARs-2 using AR procedures conventional commercially available deoxy-inosine and DNA-phosphoramidites (Glen Research, Sterling, VA) and a 3'-phthalimide-amino C6 CPG modifier support (Glen Research, Sterling, VA). The functions of the terminal amine were linked to a 5'-amino C6-TFA modifier (Glen

40 Research, Sterling, VA). After deprotection, the oligonucleotides were purified by ion exchange chromatography on the Super Q 5PW resin (30) (Tosoh Biosciences) and precipitated with ethanol.

[0307] Aliquots of the aptamer modified with 3'-5'-diamine were conjugated with different PEG residues synthetically. The aptamers were dissolved in a water / DMSO solution (1: 1) at a concentration between 1.5 and 45 mM. Sodium carbonate buffer, pH 8.5, was added at a final concentration of 100 mM and the oligonucleotide was reacted overnight with a 2.7 molar excess of the desired PEG reagent (eg, Sunbright MENP-20T pnitrophenyl carbonate ester 20 kDa [NOF Corp, Japan], Sunbright p-nitrophenylcarbonate ester

30 kDa MENP-30T [NOF Corp, Japan]) dissolved in an equal volume of acetonitrile. The resulting 2 x 20 kDa or 2 x 30 kDa PEGylated products were purified by ion exchange chromatography on the Super Q 5PW resin

(30) (Tosoh Biosciences) and were desalted using reverse phase chromatography performed on the Amberchrom CG300-S resin (Rohm and Haas) and lyophilized.

[0308] The structures of the resulting di-PEGylated aptamers are given below:

ARC1473:

in which

Atamer = dCdCdCdAdGdGdCTdAdCmG (SEQ ID No. 69) - PEG - dCdGTdAmGdAmGdCdAmUmCmA (SEQ ID No. 40) - PEG - TdGdATmCdCTmGmGmG-3 '(SEQ ID No. 70); in which d denotes a deoxy-nucleotide, m denotes a 2'OMe-nucleotide and PEG denotes a PEG spacer.

ARC1474:

in which

Atamer = dCdCdCdAdGdGdCTdAdCmG (SEQ ID No. 69) - PEG - dCdGTdAmGdAmGdCdAmUmCmA (SEQ ID No. 40) - PEG - TdGdATmCdCTmGmGmG-3 '(SEQ ID No. 70); in which d denotes a deoxy-nucleotide, m denotes a 2'OMe-nucleotide and PEG denotes a PEG spacer.

3T3 proliferation assay with variants of ARC513 conjugated to PEG

[0309] The previously described 3T3 proliferation assay was used to test the potency of all PEG-conjugated ARC513 variants described immediately before. The assay was performed as follows: 3T3 cells were seeded at 3,000 cells / well in a 96-well plate one day before the start of the assay in 100 ul of DMEM / 10% SBF. The next day, the cells were washed once with linear DMEM and then 75 ul of 0.8% DMEM / SBF was added to each well. Then 25 ul of PDGF-BB (PeproTech, Rocky Hill, NJ) was added at a final concentration of 50 ng / ml to each well +/- aptamer condition to be tested. Each plate included the following conditions in triplicate: without PDGF that corresponds to growth without mitogen (negative control), a negative control aptamer control (ARC128) in which no effect on the growth rate (negative control) is observed, a positive control in which the maximum growth in absence is observed

35 of PDGF aptamer and a series of functional PDGF aptamer dilutions from which a good IC50 curve could be calculated. The functional PDGF aptamer dilutions normally consisted of 6 points in serial double dilutions.

[0310] The cells were incubated for 3 days. After incubation, 10 ul of MTT (Promega, Madison, WI) was added to each well and incubated for an additional 1.5 hours. The medium was removed, 200 µl of isopropanol (2-propanol) was added to each well, the cells were meticulously resuspended and the absorbance at 570 nm was read in a 96-well plate reader. The present example represents the comparison of the potency of the ARG513 PDGF aptamer with that of the PEGylated ARC513 aptamers.

[0311] The 3T3 cell proliferation assay was performed with ARC513 and with all PEG-conjugated ARC513 aptamers that were synthesized as described immediately before. ARC513 routinely showed IC50 values <10 nM when the negative control ARC128 never showed an effect on the proliferation of 3T3 cells (ARC128 data not shown). The following Tables 3B and 3C show the IC50 of ARC513 compared to the ARC513 aptamers conjugated to PEG in the 3T3 proliferation assay.

Table 3B: Variants of ARC513 in the 3T3 proliferation assay. Table 3C: Variants of ARC513 in the 3T3 proliferation assay.

ARC No.

Average IC50

513

 3.7

594

 1.95

1472

 2.43

1473

 3.42

1474

 3.32

ARC No.

Average IC50

513

 3.2

592

 0.88

593

 1.45

Example 3C: Optimization of pharmacokinetic and biodistribution properties of ARC126 in vivo

[0312] In addition to optimizing the composition of the ARC126 sequence with respect to the target binding affinity assay and in vitro cell-based activity, it is desired to optimize the properties of pharmacokinetic half-life (PK) in vivo, t1 / 2 and biodistribution of the optimal sequence composition (compositions) for the anti-PDGF aptamers previously described. This modulation of the pharmacokinetic and biodistribution properties of an aptamer composition can be carried out (see U.S. Serial No. 10 / 718,833 filed on November 21, 2003 and U.S. Serial No. 60 / 550,790 filed on March 5, 2004) by conjugation of the 3 'or 5' end, or an internal site or sites, of the molecule with a polyethylene glycol (PEG) chain or chains, that is, PEGylation (the range is ~ 2 kDa at 100 kDa, with typical PEGs having molecular weights of 2 kDa, 10 kDa, 20 kDa, 30 kDa, 40 kDa, 50 kDa). Note that for each pharmacokinetic study described herein, all mass-based concentration data only refer to the molecular weight of the oligonucleotide portion of the aptamer, regardless of the mass conferred by conjugation with PEG.

[0313] In order to establish the feasibility of using a given PEGylated aptamer sequence composition it was necessary to confirm that putative PEGylation did not significantly interfere with the activity of the aptamer in in vitro binding and cell-based proliferation assays. Competitive binding assays were performed and analyzed as described herein, except that NH2-ARC126 labeled with 3.32P was used instead of 5'-32P-ARC126 (the nucleotide sequence of ARC 126 incorporates a reverse thymidine at the 3 'end, which is a substrate for the radiolabeled reaction catalyzed by polynucleotide kinase).

[0314] Figure 11A is a graph of competition binding assay data for ARC 126 and two variants that are conjugated in 5 'with PEG groups of 30 kDa (ARC308) and 40 kDa (ARC127). Figure 11B shows proliferation assay data based on 3T3 cells in vitro for ARC126 as a function of conjugation with the PEG group at 5 '(ARC126 + 30 kDa = ARC308 and ARC126 + PEG 40 kDa = ARC 127). The data shown in Figure 11B demonstrate that the 5 'conjugation of ARC126 with PEG groups of 30k Da and 40kDa seems to lead to a slight decrease in the in vitro activity of the aptamer, the effect of the presence of PEG groups is lower twice with respect to the non-PEGylated aptamer, ARC126. The data shown in Figure 11B also demonstrates that the 5 'conjugation of ARC126 with PEG groups of 30 kDa and 40 kDa does not significantly reduce in vitro activity in the 3T3 proliferation assay of the aptamer with respect to the composition of ARC 126 .

[0315] Figure 12A shows the in vivo pharmacokinetic profile of ARC126 as a function of conjugation with PEG groups in 5 '. Studies were done on CD-1 mice as described in Example 10 (Charles River Labs, Wilmington, MA). From the figure it is evident that the terminal elimination half-life, t1 / 2, is strongly affected by the size of the 5 'PEG group conjugated to the aptamer.

[0316] The pharmacokinetic (PK) data shown in Figure 12A was subjected to non-compartmental analysis (NCA) using the WinNonLin industry standard software package &#8482; v.4.0 (Pharsight Corp., Mountain View, CA). The following Table 4 lists the in vivo pharmacokinetic (PK) parameters derived from primary NCAs for ARC126 + 20 kDa PEG groups (ARC240), +30 kDa (ARC308) and +40 kDa (ARC127) after intravenous (IV) administration at 10 mg / kg in mice. The data shown in Table 4 demonstrate that the in vivo pharmacokinetic elimination half-life, t1 / 2, of ARC 126 is modulated. 4 times by changing the size of the PEG group in 5 'conjugated to the aptamer affected by the size of the PEG group in 5' conjugated with the aptamer from 20 kDa to 40 kDa. Figure 12B shows the in vivo pharmacokinetic profile of ARC 127 (ARC126 + PEG 40 kDa) after intravenous (IV), intraperitoneal (IP) and subcutaneous (SC) administration at a dose level of 10 mg / kg in mice . The pharmacokinetic (PK) data shown in Figure 12B was subjected to non-compartmental analysis (NCA) using the WinNonLin ™ industry standard software package v.4.0 (Pharsight Corp., Mountain View, CA).

Table 4. Non-compartmental pharmacokinetic analysis of conjugates in 5 'of ARC126

PEG

Cmax, nM ABC, nM · h tmax (h) MRT (h) t1 / 2 (h) V (ml / kg)

ACR240

20K 34317 0.5 39277 1.16 0.94 0.3

ACR308

30K 27659 1.0 64867 2.14 1.67 0.3

ACR127

40K 60964 2.0 344356 5.08 6.84 0.1

Pharmacokinetic parameters (non-compartmental analysis) of 5 'conjugates of ARC126: ARC240 = ARC126 + 20 kD PEG; ARC308 = ARC126 + PEG of 30 kD; and ARC127 = ARC126 + 40 kD PEG after IV administration at 10 mg / kg in mice.

[0317] Table 5 below lists the in vivo pharmacokinetic (PK) parameters derived from primary NCAs for ARC 126 + PEG of 40 kDa depending on the route of administration at 10 mg / kg in mice. The pharmacokinetic (PK) data shown in Figure 12B was subjected to non-compartmental analysis (NCA) using the WinNonLin ™ industry standard software package v.4.0 (Pharsight Corp., Mountain View, CA).

Table 5. Pharmacokinetic profile of ARC127 (ARC126 + PEG 40 kD)

Cmax, nM

tmax (h) ABC, (h nM) MRT (h) t1 / 2 (h) V (l / kg) Bioavailability F

IV

29711.6  2 229686.8 6,573  8,602 0.053 1,000

IP

12756.0  8 143605.5 11,231  7,856 0.078 0.625

SC

3176.7  8 55030.91 16,632  9,176 0.238 0.240

Post-intravenous (IV), intraperitoneal (IP) and subcutaneous (SC) administration at a dose level of 10 mg / kg in mice

[0318] From the data shown in Figure 12B, two primary points are evident: (1) the pharmacokinetics of ARC127 (ARC126 + PEG 40 kD) after intravenous (IV), intraperitoneal (IP) or subcutaneous ( SC) at a dose level of 10 mg / kg in mice at a plasma concentration of ~ 1 μM is present 24 h after the dose; and (2) the systemic bioavailability, F, of ARC127 after intraperitoneal (IP) administration is quite high (~ 63%), while for subcutaneous administration (SC) bioavailability is still high enough (~ 24%) to guarantee consideration for clinical applications.

[0319] As a secondary test of both plasma pharmacokinetics and in vivo bioactivity of ARC127 (ARC126 + PEG 40 kD), the competition binding assay described above in reference to Figure 10A was used to test the same samples of plasma used to generate the data shown in Figure 12B. Serial 1:10 solutions of plasma samples in phosphate buffered saline (1X PBS) were prepared and mixed with a fixed concentration of 32P-ARC126, then added to human PDGF-BB. The final concentration of PDGF in each assay was 0.1 nM, and the final concentration of 32P-ARC126 <0.1 nM. In this experiment, plasma samples were analyzed by comparing with a standard curve generated with samples of known ARC127 concentrations in 1X PBS. Compared to the reference standards, the effective concentration of active aptamer could be calculated in each plasma sample. The effective concentration of active aptamer, as calculated using the results of the competition binding assay analysis of the plasma PK samples, is shown in Figure 12C. Figure 12C shows the bioactivity profile of 40 kD ARC126 + PEG after intravenous (IV) administration at a dose level of 10 mg / kg in mice. So,

This ex vivo analysis provides verification that (1) the aptamer was present and was active in the mouse model plasma at t = 48 h after the dose; and (2) plasma concentrations calculated from the fluorescence-based pharmacokinetic assay are accurate.

EXAMPLE 4: Cross Reactivity of ARC126 and ARC127 Species

[0320] Studies were conducted to determine which PDGF isoforms would bind to ARC126. Competition binding assays were established using the point transfer analysis previously described to test ARC126 for binding to human PDGF-AA, PDGF-BB and PDGF-AB (all from PeproTech, Rocky Hill, NJ). The results of the competition binding test show that ARC126 (SEQ ID No. 1-HEG-SEC ID No.: 2-HEG-SEC

ID No. 3-3T) binds PDGF-BB with a Kd of approximately 100 pM, and PDGF-AB with a Kd of approximately 100 pM, but does not bind PDGF-AA (Figure 13A). A study was then carried out to determine if ARC126 cross-reacted with PDGF-BB from species other than human. Competition binding assays were established by point transfer analysis, as previously described, using human, rat and mouse PDGF-BB (PeproTech, Rocky Hill, NJ). The results of the competition binding assay show that ARC126 binds to human, rat and mouse PDGF-BB with equal affinity (Figure 13B).

EXAMPLE 5: 3T3 Cell Proliferation Assay

[0321] As it was shown that ARC126 cross-reacted with human, rat and mouse PDGF-BB, 3T3 cells, which are derived from a line of rat fibroblast cells (ATCC, Manassas, VA), could used in a proliferation assay to test the potency of all PDGF aptamers, which include aptamers that were obtained as part of the defluorination efforts described in Example 3A. 3T3 fibroblast cells have PDGF receptors on their cell surface and respond to mitogen, for example, stimulation of PDGF by proliferation. The assay was performed as follows: 3T3 cells were seeded at 3,000 cells / well in a 96-well plate one day before the start of the assay in 100 ul of DMEM / 10% SBF. The next day, the cells were washed once with linear DMEM and then 75 ul of 0.8% DMEM / SBF was added to each well. Then 25 ul of PDGF-BB (PeproTech, Rocky Hill, NJ) was added at a final concentration of 50 ng / ml to each well +/- aptamer condition to be tested. Each plate included the following conditions in triplicate: without PDGF that corresponds to growth without mitogen (negative control), an aptamer control

5 negative (ARC128) in which there is no effect on the growth rate (negative control), a positive control in which the maximum growth is observed in the absence of PDGF aptamer and a series of functional PDGF aptamer dilutions a from which a good curve of IC50 could be calculated. The functional PDGF aptamer dilutions normally consisted of 6 points in serial double dilutions.

10 [0322] Cells were incubated for 3 days. After incubation, 10 ul of MTT (Promega, Madison, WI) was added to each well and incubated for an additional 1.5 hours. The medium was removed, 200 µl of isopropanol (2-propanol) was added to each well, the cells were meticulously resuspended and the absorbance at 570 nm was read in a 96-well plate reader. The present example represents the comparison of the potency of the ARG127 PDGF aptamer with that of a PDGF neutralizing polyclonal antibody as shown in Figure

15 14A (R & D Systems, Minneapolis, MN). The data shown in Figure 14A demonstrate that the aptamer shows better potency than the polyclonal antibody.

[0323] The 3T3 cell proliferation assay was performed with ARC126, ARC127, ARC128 and with all other PDGF aptamer derivatives that were obtained as described in Example 3A above. ARC126 and

20 ARC127 routinely show IC50 values <20 nM when negative control ARC128 never shows a 3T3 cell proliferation effect. The following Table 6 shows the IC50 of variants of ARC126 in the 3T3 proliferation assay.

Table 6. IC50 of defluorinated variants of ARC126 in the 3T3 proliferation assay. 25

ARC No.

Average IC50

124

 20.67

126

 3.40

127

 3.45

276

 18.00

277

 8.67

299

 1000.00

300

 900.00

335

 90.00

336

 196.67

337

 1000.00

338

 1000.00

339

 766.67

340

 866.67

341

 1000.00

343

342

 1000.00

344

 200.00

3. 4. 5

 13.00

346

 15.00

347

 1000.00

362

 315.00

363

 3.92

364

 1719.00

365

 6.79

366

 5.54

404

 3.89

405

 8.65

406

 17.15

407

 16.36

408

 28.40

409

 7.31

410

 6.79

513

 2.07

514

 3.16

515

 4.66

516

 3.05

127

 3.45

[0324] The PDGF ARC127 aptamer also blocks the proliferation of 3T3 cells better than known tyrosine kinase inhibitors such as compounds AG 1295 and AG 1433 (Sigma Aldrich Biochemicals, St Louis, MO). The test conditions were exactly the same as described above. ARC127 reduced the increase triggered by PDGF in proliferation at reference levels at a concentration of only 30 nM. Both AG compounds showed much worse potencies compared to ARC127. AG-1433 appeared to have non-specific toxic effects at micromolar levels. This effect is visible from 300 nM when the signal levels are lower than single samples without treatment corresponding to the signal loss due to cell lethality only in the presence of compound AG (Figure 14B).

EXAMPLE 6: 3T3 cell viability test

[0325] The reduction in 3T3 cell growth observed in the cell proliferation assay described in Example 5 after the addition of ARC126, ARC127 and other PDGF active aptamer derivatives could possibly be due to toxic effects of the aptamer. To test this possibility, a cell viability test was performed on calcein AM (Molecular Probes, Eugene, OR). 3T3 cells were seeded at 3,000 cells / well, treated with various concentrations of PDGF aptamer up to 40 µM, tested for 24 and 48 hours. TNF-a (100 pg / ml) was provided and used as a positive control to induce apoptosis. After incubation, the cells were washed with 1X PBS. Calcein AM was prepared according to instructions recommended by the manufacturer, incubated for 30 minutes and the fluorescence intensity signal was determined in a 96-well plate reader. No increase in apoptosis rate of 3T3 cells was observed due to ARC127 (Figure 15).

EXAMPLE 7: 3T3 or RPE cell migration assay

[0326] PDGF is a strong mitogen, in addition to a chemotactic factor. A migration assay conducted in both 24 and 96 well forms was chosen as an additional functional assay to test the potency of ARC.

127. In the cell migration assay, 80,000 3T3 rat fibroblast cells (ATCC, Manassas, VA) or RPE (retinal pigment epithelial) cells (ATCC, Manassas, VA) were seeded per well in a 24-well plate with 8 micrometer filters (BD Biosciences, Discovery Labware, Bedford, MA). 0.5 ml of 0.2% DMEM / SBF was added to the upper chamber and 0.8 ml of 0.2% DMEM / SBF was added to the lower chamber. The system was equilibrated by incubating for 4 hours at 37 degrees Celsius. Human PDGF-BB (PeproTech, Rocky Hill, NJ) (for RPE cells) or rat PDGF-BB (PeproTech) (for 3T3 cells) was added to the lower chamber (0 ng / ml - 100 ng / ml final concentration ). The system was incubated 4 hours to 12 hours. The cells were scraped off the top of the filter with Q-tip. The cells that migrated to the bottom of the filter were fixed with a mixture of 50% cold methanol / 50% acetone for 3 minutes.

[0327] After incubation, the filters were washed with 1X PBS and stained with Giemsa Stain (Matheson Coleman and Bell) for 1-2 hours and the migration was visualized by taking photos on a Zeiss Axiovert 200M microscope. Specifically, the migration was visualized under four different conditions: (1) reference migration observed in the absence of PDGF; (2) migration observed in the presence of 5 nM PDGF-BB; (3) migration observed in the presence of 5 nM PDGF-BB and 100 nM ARC127 functional aptamer; and (4) migration observed in the presence of 5 nM PDGF-BB and 100 nM ARC128 negative control aptamer. The results of the migration displayed show that the presence of 100 nM ARC127 inhibits the effects of 5 nM PDGF-BB, shown by the migration of 3T3 or RPE cells at reference levels. The ARC 128 negative control shows no activity and the migration observed at this condition is the same as that observed with 5 nM PDGF-BB alone.

[0328] Figure 16A shows the results of a 96-well cell migration experiment using the 96-well QCM Chemotaxis migration test (#ECM 510) (Chemicon, Temecula, CA). The 96-well form allowed a more quantitative analysis of cell migration than the 24-well form, which was more qualitative. The 96-well test begins by bringing the plates and reagents to room temperature. 150 ul of 0.2% DMEM / DBF with or without chemotactic factor was added to the wells of the feeder tray. 200,000 RPE cells in 100 ul of 0.2% DMEM / SBF medium were added to the migration chamber and incubated for 1-24 hours at 37 degrees Celsius.

[0329] After incubation, the migration chamber plate was removed and the non-migratory cells were discarded. The number of migratory cells was quantified according to instructions recommended by the manufacturer. In summary, the medium on the upper side was removed by pulling the suspension of remaining cells, and placed on a new feeder tray containing 150 ul of preheated cell shedding solution. This mixture was incubated for 30 minutes at 37 degrees Celsius. The CyQuant GR 1:75 dye was diluted with 4X lysis buffer and 50 ul of the lysis buffer / dye solution was added to each well containing 150 ul of the solution containing migratory cells. This mixture was further incubated for 15 minutes at room temperature, then transferred to a new 96-well plate and read at 480/520 nm absorbance in a 96-well plate reader.

[0330] The results obtained in this 96-well cell migration experiment (Figure 16A) confirmed the cell migration experiments performed in the 24-well form. ARC127 reduced the migration levels to the reference and the negative control aptamer did not affect the migration. Figure 16B shows that the observed migration increases linearly as a function of the number of cells or concentration of mitogen added.

EXAMPLE 8: Clonogenic Growth Assay

[0331] U87 glioblastoma cells (ATCC) were cultured in the presence or absence of mitogen, in addition to aptamer as shown in the panels. U87 cells were seeded in DMEM / 10% SBF at 50% confluence in 100 mm plates. The cells were incubated with PDGF-BB (PeproTech) +/- ARC127 until the cells appeared confluent (1-2 days). The addition of a final concentration of 50 ng / ml of PDGF-BB only produced the appearance of highly connected three-dimensional cell clusters. The addition of 50 ng / ml PDGF-BB plus 10 nM ARC127 functional aptamer to 100 nM reduced the occurrence of clusters at the reference level. The presence of aptamer had no effect on the proliferation rate of the cells determined by the MTT assay. Thus, the aptamer blocks cell adhesion to U87 cell cells that are known to have PDGF-activated autocrine loops. It appears that ARC 127 is blocking the binding of the exposed ligand on the cell surface to another cell receptor as exposed by adhesion of cells to cells.

EXAMPLE 9: PDKF-Activated ELK Luciferase Assay

[0332] To further demonstrate the activity of the PDGF aptamer ARC 127, mechanistic indicator gene assays of Elk luciferase were established. 10,000 3T3 cells / well were seeded in DMEM / 10% SBF in a 96-well plate. They were transfected using FuGene (Roche, Indianapolis, IN) at a 3: 1 ratio with 5 ng of ELK-1 (Stratagene, La Jolla, CA) and 20 ng of plasmids of pFR-luciferase (Stratagene, La Jolla, CA). When PDGF is added at a final concentration of 50 ng / ml to 3T3 cells, an increase in the luciferase signal can be observed that corresponds to the effect of the mitogen on the indicator gene. The Steady Glo luciferase assay (Promega, Madison, WI) was used to detect luciferase. The results indicate that an ARC 127 concentration of only 3 nM reduces the luciferase signal to non-mitogenic levels. The IC50 of ARC127 deduced from this analysis is <2 nM. (Figure 17)

EXAMPLE 10: In vivo data in xenograft of colon cancer HT-29, LS174T and HCT-116

Models

[0333] In vivo efficacy studies were established to test the hypothesis that inhibition of PDGF-BB and / or its receptor with ARC127 and ARC308 increase the efficacy of cytotoxic drugs.

HT-29 and LS147T studies

[0334] Experimental overview. Human HT-29 or LS174T colon cancer xenotransplants were established in nude hairless mice (Nu / Nu mice, Charles River Labs, Wilmington, MA) by injecting mice with 1x107 HT29 cells (ATCC, Manassas, VA) or 2x106 LS174T cells ( ATCC Manassas, VA) subcutaneously and letting the tumors grow for 5 days. On day 5, two dimensional measurements of established tumors were taken using a digital caliper. Once the tumor measurements had been taken, the mice were randomized into groups so that the average tumor size was the same in each group. Once randomized, mice were treated with irinotecan (Pfizer, NY, NY), which is a cytotoxic drug that is shown to be effective against colon cancer in the presence or absence of PDGF block using a specific PDGF aptamer or other Small molecule inhibitor, to determine if PDGF blockade increases the efficacy of the cytotoxic drug.

Materials and procedures. An experiment (Experiment 1) was designed to test a combination of the known chemotherapeutic agents GLEEVEC ™ and irinotecan in a dose optimization study in a model of HT29 colon cancer xenograft. The following Table 7 summarizes the experimental design of Experiment 1 using an HT29 human colon carcinoma cell line (ATCC, Manassas, VA), with a cytotoxic drug, irinotecan (Pfizer, NY, NY) administered at 150 mg / kg per injection intraperitoneal once a week, in addition to a drug to block the signaling of PDGF, GLEEVEC ™ (Novartis, Basel, Switzerland), dosed orally at 50 mg / kg twice daily (Monday to Friday). The GLEEVEC ™ mode of action is known to block the function of PDGF receptors, in addition to other receptors for other growth factors, the effect is not necessarily specific to PDGF. The results of this experiment are shown in Figure 18A showing a representation of the average diameter of the average tumor per group in mm as a function of time for each of the irinotecan 150 mg / kg treatment regimens per week, GLEEVEC ™ 50 mg / kg orally twice daily for 5 days and combination therapies of irinotecan 150 mg / GLEEVEC ™ 50 mg / kg twice daily for 5 days. These data show that GLEEVEC ™ increases the effectiveness of irinotecan only in the HT29 colon cancer xenotransplantation model. GLEEVEC ™-mediated PDGF blockade enhanced the efficacy of irinotecan treatment as demonstrated by the decrease in tumor growth rate compared to animals treated with irinotecan alone. The results are statistically significant (bilateral Student's t test).

Table 7: Experiment 1: Irinotecan / GLEEVEC dose optimization study for HT29

Tumor inoculation

Administration of the test article Administration of combination therapy (DOSE AFTER THE TEST ARTICLE) Euthanasia day

Group

 No. of animals Test material Dose  Via Day Test material Dose (mg / kg) Via Day Test material Dose (mg / kg g) Via Day

one

10 HT-29 1x107 cells SC Day 0 Diluent  DVE IP Days 7, 14, 21 NA NA IP Days 4 - 21 once a day Determined

2

10 Diluent DVE ARC 127 fifty

3

10 Irinotecan 150 NA NA

4

10 Irinotecan fifty NA NA

5

10 Irinotecan 150 ARC 127 fifty

6

10 Irinotecan fifty ARC 127 fifty

7

10 Irinotecan 150 Gleevec 100 PO

8

10 Irinotecan fifty Gleevec 100

9

Diluent DVE Gleevec 100

1. Observations beside the cage and clinically - daily 2. Body weights - every two weeks 3. Tumor measurements - every two weeks starting approximately on day 7 4. Total necessary Irinotecan - 450 mg (for 3 doses) 5. Total Gleevec needed - 1350 mg (for 36 doses) 6. Total PDGF aptamer needed - 675 mg (for 18 doses) DVE = equivalent to the volume of buffer buffer HT29 = human colon carcinoma; ATCC No. HTB-38 IP = Intraperitoneal PO = orally

52

[0335] Another experiment (Experiment 2) was designed to test ARC 127 and irinotecan in a colon cancer xenograft model using the human colon carcinoma cell line LS174T (ATCC, Manassas, VA). The cytotoxic drug, irinotecan (Pfizer, NY, NY), was dosed once a week at 150 mg / kg by intraperitoneal administration. The ARC127 used to block PDGF signaling was dosed at 50 mg / kg by intraperitoneal administration once daily, and GLEEVEC ™ (Novartis, Basel, Switzerland) was orally dosed at 100 mg / kg once daily, Monday to Friday. ARC127 prevents PDGF-BB from joining the PDGF receiver; and has a 40K PEG attached. The following Table 8 summarizes the experimental design for Experiment 2. The results of Experiment 2 are shown in Figure 18B and Figure 18C that demonstrate that ARC 127 enhanced the efficacy of irinotecan treatment as demonstrated by the decrease in growth rate of the tumor with respect to

10 animals treated with irinotecan alone. The results are statistically significant (bilateral Student's t test). The data clearly shows that ARC127 increases the effectiveness of irinotecan better than both the combination treatment of GLEEVEC ™ / irinotecan and irinotecan alone in the LS174T colon cancer xenotransplantation model. The dosing schedule of GLEEVEC ™ (100 mg / kg once daily, Monday through Friday, P.O.) caused the animals to be dying and these groups were terminated soon in the experiment (Fig. 18B).

Table 8. Experiment 2: Dosage study of ARC127 / irinotecan in the experimental design of the LS174T colon cancer xenograft model:

Tumor inoculation

Administration of the test article Administration of combination therapy (DOSE AFTER THE TEST ARTICLE) Euthanasia day

Group

 No. of animals Test material Dose  Via Day Test material Dose (mg / kg) Via Day Test material Dose (mg / k) g) Via Day

one

10 LS174T 2 × 106 cells SC Day 0 Diluent  IP DVE IP Days 8, 15, 22 NA NA IP Days 4, 22 once a day Determined

2

10 Diluent DVE ARC 127 fifty

3

10 Irinotecan 150 NA NA

4

10 Irinotecan 150 ARC 127 fifty

5

10 Irinotecan 150 Gleevec 100 PO

6

10 Diluent 150 Gleevec 100

1. Observation next to the cage and clinically - daily 2. Body weights - every two weeks 3. Tumor measurements - every two weeks starting approximately on day 4 4. Total Irinotecan needed - 337.5 mg (for 3 doses) 5. Total Gleevec needed - 360 mg (for 18 doses) 6. Total PDGF aptamer needed - 450 mg (for 10 doses) DVE = equivalent to the volume of buffer dose LS174T = human colon carcinoma IP = Intraperitoneal

54

[0336] A third experiment (Experiment 3) was designed to test dosing guidelines for

ARC308 / irinotecan and GLEEVEC ™ / irinotecan in a xenotransplant model of colon cancer using the line

cell colon carcinoma cell LS174T (ATCC). Table 9 summarizes the experimental design for the

Experiment 3. The cytotoxic drug irinotecan (Pfizer, NY, NY) was dosed by intraperitoneal administration at 150

5 mg / kg once a week. ARC308 was dosed by intraperitoneal administration at 50 mg / kg once daily, and

GLEEVEC ™ was dosed at 50 mg / kg once daily, Monday through Friday. ARC308 prevents PDGF-BB from joining

PDGF receiver; This molecule has a PEG of 30 K attached. The results of Experiment 3 are shown in the

Figures 19A and 19B showing that ARC308 enhanced the efficacy of irinotecan treatment as demonstrated

by the decrease in the growth rate of the tumor with respect to animals treated with irinotecan alone. On the other hand, the dosage schedule of GLEEVEC ™ (50 mg / kg once a day, Monday through Friday, P.O) did not enhance the

Irinotecan efficacy. The results are statistically significant (bilateral Student's t test).

Table 9. Experiment 3: Study of ARC308 / irinotecan and GLEEVEC / irinotecan in the xenograft model of colon cancer LS174T.

Tumor inoculation

Administration of the test article Administration of combination therapy (DOSE AFTER THE TEST ARTICLE) Euthanasia day

Group

 No. of animals Test material Dose  Via Day Test material Dose (mg / kg) Via Day Test material Dose (mg / kg g) Via Day

one

10 LS174T 2x 106 cells SC Day 0 Diluent  DVE IP Days 8, 15, 22 NA NA IP Days 5 - 22 once a day Determined

2

10 Diluent DVE ARC 308 fifty

3

10 Irinotecan 150 NA NA

4

10 Irinotecan 150 ARC 308 fifty

5

10 Irinotecan 150 Gleevec fifty PO L-V

6

10 Diluent DVE Gleevec fifty

1. Observations next to the cage and clinically - daily 2. Body weights - every two weeks 3. Tumor measurements - every two weeks starting approximately on day 4 4. Total necessary Irinotecan - 337.5 mg (for 3 doses) 5. Total Gleevec needed - 360 mg (for 18 doses) 6. Total PDGF aptamer needed - 450 mg (for 18 doses) DVE = equivalent to the volume of buffer dose LS174T = human colon carcinoma IP = Intraperitoneal

56

[0337] An efficacy analysis of three treatment groups in this study is shown in Table 10 in terms of log destruction of cells and log net destruction of cells. Log cell destruction is the logarithm (base 10) of the number of tumor cells before treatment divided by the number of cells after treatment. Log cell destruction is calculated as (CT) / (3.32 x D) in which T = the time in days for the treated group to reach a certain tumor size in volume, C = the time in days for the control group reaches the same tumor size in volume and D = the time for the control treated tumor to double in volume. A log destruction of cells less than 0.7 indicates no activity, while a value greater than 2.8 indicates high activity. The net log destruction of cells takes into account the duration of treatment (R), which was 18 days, using the formula [(T-C) -R] / (3.32 x D). A net destruction of cells below 0 indicates no activity of the treatment compared to the control, while a value greater than or equal to 0 indicates activity. The target size was 1000 mm3, the doubling time was 3.25 days and the control group was the group to which the vehicle was administered (0.9% sodium chloride in water). ARC308 alone showed no activity. Although irinotecan showed activity, the addition of concomitant treatment with ARC308 (50 mg / kg) increased 1.62 and 5.29 times the activity determined by log destruction of cells and log net destruction of cells. The values of log destruction of cells and log

Net cell destruction for the combined treatment with irinotecan and ARC308 (50 mg / kg) were obtained by extrapolating the tumor size for this group with respect to the target size using a growth curve with the same slope as that of the irinotecan treated group alone, since the average volume of the combination treatment group never reached 1000 mm3 in the period of time of the experiment.

Table 10: Analysis of the effectiveness of ARC308

Treatment

Log destruction of cells Log destruction of cells Activity Evaluation

ARC308

0 -1.67 Inactive

Irinotecan

1.95  0.28  Active

Irinotecan + ARC308

3.15  1.48  Active

[0338] In summary, these in vivo studies in the xenograft models of colon cancer HT-29 and LS174T confirm that the blockade of PDGF affected by the therapeutic aptamers of the present disclosure may

25 increase the effectiveness of irinotecan treatment.

[0339] A fourth experiment (Experiment 4) was designed to further test dosage guidelines for ARC308 / irinotecan in a xenotransplantation model of colon cancer using the human colon carcinoma cell line LS174T (ATCC). Table 11 summarizes the experimental design for Experiment 4.

30 [0340] These studies again showed that ARC308 prevents PDGF-BB from binding to the PDGF receptor and enhanced the efficacy of irinotecan treatment as demonstrated by the decrease in tumor growth rate with respect to animals treated with irinotecan only in a dose dependent mode. As shown in Figure 28, ARC308 showed a dose-dependent enhancement of treatment efficacy.

35 with irinotecan as demonstrated by the decrease in the growth rate of the tumor in the group treated with irinotecan plus ARC308 (25 mg / kg) with respect to animals treated with irinotecan plus ARC308 (1 mg / kg). This was particularly evident in the post-dosing period (days 23-53) when the mice were neither administered nor irinotecan nor ARC308. Figure 29 is a Kaplan-Meier representation of the data shown in Figure 28 in which the percentage of mice in a treatment group presenting tumors below

40 500 mm3 [as calculated from digital caliper measurements of the length and width of tumors using the following formula: volume = (length x width2) / 2]. Again, a statistically significant difference is observed between the group treated with irinotecan plus ARC308 (25 mg / kg) with respect to animals treated with irinotecan plus ARC308 (1 mg / kg), supporting a dose-dependent enhancement of the efficacy of irinotecan of ARC 308. On day 38, all mice in the irinotecan group plus ARC308 (1

45 mg / kg) had developed tumors greater than or equal to 500 mm3, while 56% of the mice in the irinotecan group plus ARC308 at 25 mg / kg still had tumors less than 500 mm3.

Table 11: Experiment 4: Study of ARC308 / irinotecan in the LS174T colon cancer xenograft model.

Tumor inoculation

Administration of the test article Administration of combination therapy (DOSE AFTER THE TEST ARTICLE) Euthanasia day

Grup or

No. of animals Test material Dose  I saw Day Test material Dose (mg / kg) I saw Day Test material Dose (mg / kg g) Via Day

one

10 LS174T 2 x 106 cells SC Day 0 Diluent DVE IP Days 8, 15, 22 Diluent DVE IP Days 5-22 once a day Determined

2

10 Diluent DVE ARC 308 fifty

3

10 Diluent DVE 50 empty control fifty

4

10 irinotecan 150 Diluent DVE

5

10 irinotecan 150 ARC 308 fifty

6

10 irinotecan 150 ARC 308 25

7

10 irinotecan 150 ARC 308 10

8

10 irinotecan 150 ARC 308 one

9

10 irinotecan 150 ARC 308 fifty Days 7, 8, 14, 15, 21, 22 once a day

1. Observations next to the cage and clinically - daily 2. Body weights - every two weeks 3. Tumor measurements - every two weeks starting approximately on day 4 4. Total Irinotecan needed- 562.5 mg (for 3 doses) 5. Total PDGF aptamer required - 612 mg (for 18 doses); 75 mg for 6 doses: total sum = 687 mg 6. Total negative control aptamer required - 225 mg (for 18 doses) DVE = equivalent to the volume of buffer dose LS174T = human colon carcinoma IP = Intraperitoneal

58

[0341] A fifth xenograft study was conducted to examine the effect of treating human tumors in athymic mice with ARC593 compared to vehicle. On day 0, LS174T tumor cells of a human colorectal cancer cell line were implanted subcutaneously in the right flank of non-consanguineous female hairless mice 8-9 weeks old from Harlan (Indianapolis, Indiana). The resulting subcutaneous tumors were measured on day 6 with calipers to determine their length and width and the mice were weighed; Tumor sizes were calculated using the formula (length x width2) / 2 and expressed as cubic millimeters. Mice with tumors less than 7.2 mm3 and greater than 26.95 mm3 were excluded from the following group formation. Two groups of mice, 12 mice per group, were formed by randomization so that the average tumor sizes for each group were essentially equal (mean of groups ± standard deviation of groups = 17.16 ± 0.16 mm3), with deviations similar group standards (mean of standard deviations of groups ± standard deviation of standard deviations of groups = 6.20 ± 1.0 mm3).

[0342] Each group was assigned to a treatment schedule as follows. All mice were administered once a day ARC593 or vehicle starting on day 6 with the last dose administered on day 23. The doses were adjusted for body weight changes twice a week and all mice were administered vehicle. or aptamer to 10 ml of dosage solution per kg of body weight administered intraperitoneally. Group 1 received normal saline as a vehicle control; Group 2 received ARC593, 50 mg / kg of mouse body weight.

[0343] Dosing solutions of ARC593 were prepared by dissolving lyophilized aptamer in normal saline, adjusting the concentration of the dosing solution with normal saline until the correct concentration was achieved as determined by spectrophotometric analysis, and sterilizing by filtration The resulting solutions through a 0.22 μm filter in sterile sample vials that were then maintained were frozen at -20 ° C and thawed overnight for use the next day at 4 ° C. The aptamer was allowed to reach room temperature for one hour before dosing. Unused material was stored at 4 ° C for use the next day.

[0344] During and after the dosing period, mice were weighed and tumors were measured twice a week. All results in terms of tumor volume are shown in Figure 30. Group 1 showed the expected tumor growth rate, with a doubling time of approximately 5 days. A mouse in group 1 treated with vehicle was found dead on day 12. Death was due to intraperitoneal hemorrhage resulting from mechanical injury during intraperitoneal dosing the previous day. That mouse was excluded from other data analyzes. Tumor volumes per group were analyzed by the Wilcoxon order test for independent groups, considering that p <0.05 was significant. On day 20, on the last day that all mice were still alive in the aptamer-treated groups, the tumor volumes in group 2 were significantly higher than those in group 1. After day 20, three mice in the group were sacrificed. 2 since their tumors exceeded the maximum volumes authorized by the IACUC. The effect of tumor volume enhancement from treatment with ARC593 was evident in the majority of mice treated with ARC593.

[0345] The change during the study in body weights corrected with the group mean was examined as an indication of the toxicity of the treatments. The corrected body weight is the body weight of a mouse minus the approximate weight of the subcutaneous tumor. The approximate weight of the tumor is determined from the formula "weight (g) = volume (mm3)", the volume being determined as before. Corrected body weights thus determined reflect changes in non-tumor body weight and, therefore, are better indicators of weight loss due to toxicity. All groups showed some decrease in corrected body weight as expected with the growth of this xenograft tumor. There was no significant difference between the groups treated with vehicle or aptamer (group 1, 2). Therefore, aptamer treatment did not increase toxicity as measured by body weight.

[0346] A sixth xenograft study was conducted to examine the effect of treating human tumors in athymic mice with ARC594 compared to vehicle. On day 0, LS174T tumor cells from a human colorectal cancer cell line were implanted subcutaneously in the left shoulder of female non-consanguineous hairless mice 8-9 weeks old from Harlan (Indianapolis, Indiana). The resulting subcutaneous tumors were measured on day 12 with calipers to determine their length and width and the mice were weighed; Tumor sizes were calculated using the formula (length x width2) / 2 and expressed as cubic millimeters. Mice with tumors less than 49.69 mm3 and greater than 233.44 mm3 were excluded from the following group formation. Two groups of mice, 12 mice per group, were formed by randomization so that the average tumor sizes for each group were essentially equal (mean of groups ± standard deviation of groups = 136.83 ± 1.2 mm3), with deviations similar group standards (mean of standard deviations of groups ± standard deviation of standard deviations of groups = 62.38 ± 5.03 mm3).

[0347] Each group was assigned to a treatment schedule as follows. All mice were administered once a day ARC594 or vehicle starting on day 12 with the last dose administered on day 27. The doses were adjusted for body weight changes twice a week and all mice were given vehicle. or aptamer to 10 ml of dosage solution per kg of body weight administered intraperitoneally. Group 1 received normal saline as a vehicle control; Group 2 received ARC594, 50 mg / kg of mouse body weight.

[0348] The dosing solutions of ARC594 were prepared by dissolving lyophilized aptamer in normal saline, adjusting the concentration of the dosing solution with normal saline until the correct concentration was achieved as determined by spectrophotometric analysis and sterilizing by filtration. resulting solutions through a 0.22 μm filter in sterile sample vials that were then maintained, frozen at -20 ° C and thawed overnight for use the next day at 4 ° C. The aptamer was allowed to reach room temperature for one hour before dosing. Unused material was stored at 4 ° C for use the next day.

[0349] During and after the dosing period the mice were weighed and the tumors measured twice a week. Group 1 showed the expected tumor growth rate, with a doubling time of approximately 7 days. Tumor volumes per group were analyzed by the Wilcoxon order test for independent groups, considering that p <0.05 was significant. There was no significant difference between the average volume of tumors of group 1 and 2.

[0350] After further analysis of the data, it was observed that 2 mice (2-8 and 2-9) in group 2 had tumors with very fast growth rates and had to be sacrificed on day 24 since their tumors exceeded the maximum volumes authorized by the IACUC. Their tumor duplication times were 2.3 and 1.6 days (for the mouse 2-8 and 2-9, respectively), compared to the average doubling time of the 7-day group 1 and all other members from group 2 of 6 days. Tumors of two group 2 mice treated with ARC594 grew much faster than any of the other members of group 2 or group 1.

HCT-116 study

[0351] A seventh xenograft study (Experiment 7) was performed to confirm the efficacy of ARC308 and ARC594 in inhibiting human tumor growth in athymic mice. On day 0, HCT116 tumor cells from a human colorectal cancer cell line were implanted subcutaneously in the right flank of non-consanguineous female hairless mice 8-9 weeks old from Harlan (Indianapolis, Indiana). The resulting subcutaneous tumors were measured on day 8 with calipers to determine their length and width and the mice were weighed; Tumor sizes were calculated using the formula (length x width2) / 2 and expressed as cubic millimeters. Mice with tumors less than 62.65 mm3 and greater than 126.0 mm3 were excluded from the following group formation. Ten groups of mice, 12 mice per group, were formed by randomization so that the average tumor sizes for each group were essentially equal (mean of groups ± standard deviation of groups = 82.67 ± 0.00 mm3), with deviations similar group standards (mean of standard deviations of groups ± standard deviation of standard deviations of groups = 21.34 ± 0.00 mm3). An additional group of 10 mice (mean ± standard deviation = 81.45 ± 24.87 mm3) was also formed as a group that did not receive treatment, but was monitored for body height and tumor volume (group 1).

[0352] Each group was assigned to a treatment schedule as follows. All mice were administered once daily ARC308, ARC 594 or 10 ml / kg vehicle starting on day 8 with the last dose administered on day 25. The doses were adjusted for body weight changes twice a week. and all mice were administered vehicle or aptamer to 10 ml of dosing solution per kg of body weight administered intraperitoneally. Group 2 received normal saline as a vehicle control; Groups 4 and 5 received ARC308, 50 mg / kg of mouse body weight; Groups 6 and 7 received ARC594, 50 mg / kg of mouse body weight; group 8 received ARC594, 10 mg / kg of mouse body weight; and group 9 received ARC594, 1 mg / kg of mouse body weight. Groups 3, 10 and 11 were administered intraperitoneally once a day on days 8-25. Groups 3, 5, 7, 8, and 9 were administered on day 11, 18 and 25 irinotecan (100 mg / kg, intraperitoneally). Group 10 was given imatinib (a small molecule drug that inhibits PDGFR, in addition to other tyrosine kinases) at 50 mg / kg orally twice daily at 12-hour intervals, starting on day 8. Group 11 It was administered on day 11 and 25 irinotecan (100 mg / kg, intraperitoneally) and twice daily imatinib at 50 mg / kg administered orally on days 8-12 and 23-25.

[0353] Dosing solutions of ARC308 and ARC594 were prepared by dissolving lyophilized aptamer in normal saline, adjusting the concentration of the dosing solution with normal saline until the correct concentration was achieved as determined by spectrophotometric analysis, and sterilizing by filtration of the resulting solutions through a 0.22 μm filter in sterile sample vials that were then maintained at 4 ° C for transport, frozen at -20 ° C after reception by Piedmont and thawed overnight for daily use next at 4 ° C. The aptamer was allowed to reach room temperature for one hour before dosing. Unused material was stored at 4 ° C for use the next day. The normal saline solution for vehicle control was sterilized by filtration in sample vials and stored in the same manner as the aptamer dosing solutions. The aptamer and vehicle dosage solutions were coded so that the personal dosage was blindly identifiable. For each dosage irinotecan (Camptosar, NDC 009-7529) was prepared again by dissolving the compound in 5% dextrose in water (pH 4.8). For each dosage, Gleevec (imantinib mesylate, NDC 0078-0373-866) was prepared by dissolving in 5% dextrose in water (pH 4.8).

[0354] During and after the dosing period the mice were weighed and the tumors measured twice a week. Group 1 showed the expected tumor growth rate, with a doubling time of approximately 7 days. Tumor volumes per group were analyzed by the Wilcoxon order test for independent groups, considering that p <0.05 was significant. There was no significant difference in tumor volumes between the untreated groups (group1) and any vehicle (group 2), ARC308 (50 mg / kg, group 4) or ARC594 (50 mg / kg, group 6). On day 17, the tumor volumes of the groups administered irinotecan alone or with aptamer (groups 3, 5, 7, 8, 9) were significantly smaller than those of the vehicle-treated group, and it went on like this during the rest of the study. The tumor volumes of the irinotecan plus ARC308 group (50 mg / kg, group 5) were significantly smaller than those in the irinotecan-only group on day 21 and days 28-38, after which few mice remained sufficiently in groups to allow comparison. The tumor volumes of the irinotecan plus ARC594 group (50 mg / kg, group 7) were significantly smaller than those in the irinotecan-only group on days 28-52, after which few mice remained sufficiently in the groups to allow comparison. The tumor volumes of the irinotecan plus ARC594 group (10 mg / kg, group 8) were significantly smaller than those of the irinotecan-only group on days 17-42. The tumor volumes of the irinotecan plus ARC594 group (1 mg / kg, group 9) were not significantly smaller than those of the irinotecan-only group during this study. There was no significant difference in tumor volumes between the groups treated with irinotecan plus ARC308 (50 mg / kg, group 5), irinotecan plus ARC594 (50 mg / kg, group 7) or irinotecan plus ARC594 (10 mg / kg, group 8 ). There was a significant difference in tumor volumes between irinotecan plus ARC594 (1 mg / kg, group 9) and the group treated with irinotecan plus ARC594 (50 mg / kg, group 7) on days 38-56. Therefore, the addition of ARC 308 or ARC594 to irinotecan treatment resulted in an increase in the effectiveness of irinotecan as measured by the reduced tumor volume in this xenograft study, and there was a dose response to treatment with ARC594.

[0355] There was no significant difference in tumor volumes between the vehicle-treated group (group 2) and with Gleevec (group 10). The addition of irinotecan to the treatment with Gleevec caused unacceptable toxicity that caused 4 of 12 mice to die on day 17. As a result, treatment with both drugs stopped for this group until day 23. The group of irinotecan plus Gleevec showed in actually significantly less effective as measured by tumor volumes on days 28-45.

[0356] The change during the study in body weights corrected with the group mean was examined as an indication of the toxicity of the treatments. The corrected body weight is the body weight of a mouse minus the approximate weight of the subcutaneous tumor. The approximate weight of the tumor is determined from the formula "weight (g) = volume (mm3)", the volume being determined as before. Corrected body weights thus determined reflect changes in non-tumor body weight and, therefore, are better indicators of weight loss due to toxicity. All groups showed some decrease in corrected body weight as expected with the growth of this xenograft tumor. There was no significant difference between the groups without treatment, vehicle, treated with both aptamer alone and with Gleevec alone (group 1, 2, 4, 5, 10). There was a significant difference with the addition of irinotecan to the treatment protocol observed for some moments in the study, but there was no difference between the groups that received aptamer and irinotecan versus irinotecan alone, with the exception of day 17, when there was a Significant decrease in body weight among the irinotecan plus ARC594 group (50 mg / kg, group 7), which was not evident at any other time. Therefore, the addition of aptamer to irinotecan treatment did not increase toxicity, as measured by body weight.

EXAMPLE 11: PDGF / VEGF bifunctional aptamers as oncological therapeutic agents

[0357] Combination therapies have advantages over single agent therapies in the treatment of solid tumors as shown in the xenograft models of colon cancer with the aptamers of the present disclosure (Example 10). Similarly, aptamers that can bind to more than one of the targets that participate in solid tumor cancers are effective in enhancing the therapeutic effects of individual therapeutic agents. Atamers such as these can inhibit multiple proteins (or other targets) and, therefore, provide a single compound that acts in a manner that is substantially equivalent to a combination of compounds. Multi-functional aptamers can be manipulated, for example, from combinations of known aptamers. It is shown that these multifunctional aptamers can be linked to multiple targets, and can be generated either directly or by solid phase chemical synthesis, or by transcription of a corresponding DNA template. Examples of such multi-functional aptamers include aptamers that can bind VEGF and PDGF for indications against cancer.

[0358] In order to design multifunctional aptamers of previously identified aptamers (or regions of aptamers) it is important to jointly combine the individual aptamers by regions of the individual aptamer that do not contact the target. This can normally be done by identifying regions of the secondary structure that tolerate the replacement of individual nucleotides in most or all positions. If structural units, such as a stem, are required, then they can be preserved in the final design. Additionally, it is important that the structural integrity of each individual aptamer be preserved in the final folded structure. This can be achieved more easily by predicting the secondary structures of the original sequence of the aptamers using an algorithm such as infold and then ensuring that these predicted secondary structures are preserved, according to the same algorithm, when they are part of the jointly linked structure. The general infold algorithm for determining multiple optimal and suboptimal secondary structures is described by program author Dr. Michael Zuker (Science 244, 48-52 (1989)). A description of the folding parameters used in the algorithm is presented in Jaeger, Turner and Zuker, Proc. Natl Acad. Sci. USA, (1989) 86, 7706-7710 (see also M. Zuker et al., Algorithms and Thermodynamics for RNA Secondary Structure Prediction: A Practical Guide in RNA Biochemistry and Biotechnology, J. Barciszewski and BFC Clark, eds., NATO ASI Series, Kluwer Academic Publishers, (1999)). Other programs that can be used according to the methods of the present disclosure to obtain secondary nucleic acid sequence structures include, without limitation, RNAStructure (Mathews, DH; Sabina, J .; Zuker, M .; and Turner, DH, "Expanded Sequence Dependence of Thermodynamic Parameters Improves Prediction of RNA Secondary Structure ”Journal of Molecular Biology, 288, 911-940 (1999), and RnaViz (Nucleic Acids Re., Nov. 15; 25 (22): 4679-84 (1997).

[0359] Having determined the secondary structural motifs and the units of the component aptamers, these are combined into a single oligonucleotide that folds in a manner that preserves the functionalities of each of the constituent aptamers. As a result, multifunctional aptamers can be linked to multiple targets and can be generated both directly by solid phase chemical synthesis and by transcription of a corresponding template DNA.

[0360] VEGF and PDGF bifunctional aptamers. The methods of the present disclosure were applied to generate an aptamer having binding specificity to PDGF-BB and VEGF. This multi-functional aptamer was generated by joining two individually identified aptamers using SELEX-one (ARC 245, SEQ ID No. 7) that recognized VEGF but not PDGF (see Figure 20A) and one (ARC126, 5 '- (SEQ ID NO: 1) -HEG- (SEQ ID NO: 2) -HEG (SEQ ID NO: 3) -3'-dT-3 ') which recognized PDGF but not VEGF (see Figure 20B). ARC245 (SEQ ID NO. 7) is a fully methylated aptamer with 2'O (2'-OMe) with VEGF binding specificity with a KD of approximately 2 nM. The ARC126 used in the multivalent aptamer is completely DNA with PDGF binding specificity with a KD of approximately 100 pM.

[0361] A schematic of the structure and sequence of the multivalent aptamer that can be linked to PDGF and VEGF resulting from this combination, the sequence TK.131.012.A (SEQ ID NO: 9), is shown in Figure 21A. A second multivalent aptamer that can bind VEGF and PDGF, sequence TK.131.012.B (SEQ ID NO. 10), was also formed by combining ARC245 (SEQ ID NO. 7) and ARC 126 (Figure 21 B). As shown in Figure 21B, in this VEGF-PDGF multivalent aptamer, the first mA-mU pair of the ARC245 stem was removed before joining ARC245 and all deoxy-ARC126. In each case, as shown in Figure 21, one of the PEG linkers to ARC126 was removed for the addition of the VEGF specific aptamer and the other was replaced with an oligonucleotide linker having the sequence dGdAdAdA (SEQ ID NO: 97).

[0362] Binding data for constituent aptamers and multivalent aptamers were collected by point transfer assays in which the radiolabeled aptamer is incubated with target protein and then forced to pass through a nitrocellulose sandwich over nylon and the results are shown in Figure 22. The protein-associated radiolabel is captured on the nitrocellulose membrane while the radiolabel equilibrium is captured on the nylon membrane. Radiolabel data is collected on a radioactivity detection and quantification plate. This data is then used to calculate the binding coefficients. The multivalent aptamers TK.131.012.A (SEQ ID No. 9) and TK.131.012.B (SEQ ID No. 10) were prepared synthetically.

[0363] Multivalent aptamers with the sequence TK.131.012.A (SEQ ID NO: 9) show a KD of approximately 10 nM for PDGF and approximately 10 nM for VEGF. The multivalent aptamer with the sequence TK.131.012.B (SEQ ID NO. 10) shows a KD of approximately 10 nM for PDGF and approximately 5 nM for VEGF.

EXAMPLE 12: PDGF and VEGF aptamers containing immunostimulatory motifs

[0364] To test the ability of aptamers comprising CpG motif (s) to stimulate the innate immune response, a murine CpG motif was manipulated in a PDGF-B specific aptamer. Then, these aptamers were used in in vitro mouse cell based assays to confirm the functionality of CpG motifs (eg, stimulation of the release of IL-6 and TNF-a). These aptamers were also used in biological activity assays based on the aptamer mechanism (PDGF-B signaling by the MAPK pathway as measured by the effect of the CpG-PDGF-B aptamer on the activation of phosphorylation PDGF-B ERK) to confirm the functionality of the CpG motif comprising aptamer upon attachment of the aptamer to its target, in this case PDGF-B.

[0365] To generate the aptamers disclosed herein with a CpG motif incorporated or attached, the sequence of previously identified immunostimulatory oligonucleotides comprising CpG motifs ("ISS-ODN" or "ODN") or fragments thereof were manipulated in ARC124, an aptamer identified by the SELEX procedure that binds PDGF-AB and -BB with a Kd of approximately 100 pm. The sequence of ARC124 is shown below.

ARC124

5 'CACAGGCTACGGCACGTAGAGCATCACCATGATCCTGTG3'InvdT (SEQ ID NO: 11)

[0366] The various ODN sequences, both full length and fragments or derivatives thereof, are shown below 5 '' 3 'from left to right (in which * indicates a phosphorothioate bond and 3'InvdT indicates a T inverted at the 3 'end). In addition to these ODN sequences or fragments thereof that are manipulated in PDGF aptamers were also used for controls in the assay of the ability of these aptamers to stimulate the immune response.

ISS-ODN (SEQ ID NO: 12) T * G * A * C * T * G * T * G * A * A * C * G * T * T * C * G * A * G * A * T * G * A

ISS-ODN2 (SEQ ID NO: 13) T * G * A * A * C * G * T * T * C * G * A * G * A * T *

ISS-ODN3 (SEQ ID NO: 14) A * A * C * G * T * T * C * G * A * G * A * T *

ISS-ODN4 (SEQ ID NO: 15) A * A * C * G * T * T * C * G * A * G

ISS-ODN5 (SEQ ID NO: 16) G * T * G * A * A * C * G * T * T * C * C * A * G

ODN 2006 (SEQ ID NO: 17) T * C * G * T * C * G * T * T * T * T * G * T * C * G * T * T * T * T * G * T * C * G * T * T

ODN 2006.2 (SEQ ID NO: 18) G * T * C * G * T * T * T * T * G * T * C * G * T * T * T * T * G * T

ODN 2006.3 (SEQ ID NO: 19) G * T * C * G * T * T * T * T * G * T * C * G * T * T

[0367] ISS-ODN was identified by Martin-Orzco et al., Int. Immunol., 1999. 11 (7): 1111-1118. ISS-ODN 2-5 are fragments of ISS-ODN. ODN 2006 was identified by Hartmann et al., Eur. J. Immunol. 2003. 33: 1633-1641. ODN 2006.2 and 2006.3 are fragments of ODN 2006.

[0368] The sequences of the PDGF aptamers comprising a CpG motif are shown below 5 '' 3 'from left to right (where * indicates a phosphorothioate bond and 3'InvdT indicates an inverted T at the 3' end ). A schematic of the sequence and secondary structure of these aptamers is shown in Figure 23.

TransARC124.1 (SEQ ID NO: 23) C * A * G * GCTAC * G * T * T * C * GTAGAGCATCACCATGATC * C * T * G * / 3InvdT /

TransARC124.2 (SEQ ID NO: 24) C * A * G * GCTAC * G * T * T * T * C * GTAGAGCATCACCATGATC * C * T * G * / 3InvdT /

TransARC124.3 (SEQ ID NO: 25) C * A * G * GCAAC * G * T * T * T * C * GTTGAGCATCACCATGATC * C * T * G * / 3InvdT /

TransARC124.4 (SEQ ID NO: 26) C * A * G * GCAAC * G * T * T * C * GTTGAGCATCACCATGATC * C * T * G * / 3InvdT /

TransARC124.5 (SEQ ID NO: 27) C * A * G * GCAAC * G * T * T * T * T * C * GTTGAGCATCACCATGATC * C * T * G * / 3InvdT /

TransARC124.6 (SEQ ID NO: 28) C * A * G * GCTACGTTTCGTAGAGCATCACCATGATC * C * T * G * / 3InvdT /

TransARC124.7 (SEQ ID NO: 29) C * A * GGCTACGTTTCGTAGAGCATCACCATGATCC * T * G * / 3InvdT /

TransARC124.8 (SEQ ID NO: 30) C * A * G * GCGTCGTTTTCGACGAGCATCACCATGATC * C * T * G * / 3InvdT /

TransARC124.9 (SEQ ID NO: 31) C * A * G * GCGTCGTCGTCGACGAGCATCACCATGATC * C * T * G * / 3InvdT /

TransARC124.10 (SEQ ID NO: 32) C * A * G * GCTTCGTCGTCGAAGAGCATCACCATGATC * C * T * G * / 3InvdT /

TransARC124.11 (SEQ ID NO: 33) C * A * G * GCTACGTCGTCGTAGAGCATCACCATGATC * C * T * G * / 3InvdT /

[0369] As indicated above, ISS-ODN and ODN 2006 are phosphorothioated oligonucleotides that are reported to be immunostimulants and their sequences are derived from the literature. The truncated versions of these oligonucleotides were designed by shortening them at their two 5 'and 3' ends. The resulting constructs are ISS-ODN2 to 5 and ODN 2006.2 to 3. Each of the newly designated constructs was tested in the IL-6 release assay to assess the effect on immunostimulatory capacity. The shorter construct that still retained the ability to induce the release of IL-6 was chosen for the sequence linked to both the 5 'and 3' ends of ARC 124. The constructs that are marked as GpGARC124short a.k.a. shortARC124, LongCpGARC124 a.k.a. longARC124 and FullCpGARC124 a.k.a. fullARC124 correspond to constructions in which ISS-ODN4 is attached to the 5 'end of ARC 124. These constructions carry phosphorylated bonds at their 5' and 3 'ends, in addition to inverted T at their 3' end to ensure adequate stability in the cell-based assay, but the central part of the nucleus corresponding to ARC 124 is free of phosphorothioate bonds.

[0370] ARC124 at position 8-9 and 13-14 has two naturally occurring CpG islands. Constructs with the nomenclature of TransARC124.1 to TransARC124.11 correspond to the constructions that made use of these two naturally occurring CpG sequences to create an immunostimulatory sequence that would maximize the CpG response based on reports in the literature that CpG motifs that are incorporated in varying lengths of T create maximum immunostimulatory effect. Therefore, the changes that were made in ARC 124 consisted of replacing the non-essential GCA protuberance at position 1012 with various T residues. The effect of varying the protuberance of T on the immunostimulatory effect, in addition to the addition of phosphorothioated bonds on Construction stability is evaluated with the IL-6 release and ERK phosphorylation assay as described herein.

[0371] For negative controls, ARC124 was manipulated to eliminate CpG motifs. These control sequences are shown below.

TransARC124.3control (CpG negative control aptamer) (SEQ ID NO: 34)

C * A * G * GCAAG * C * T * T * T * G * CTTGAGCATCACCATGATC * C * T * G * / 3InvdT /

TransARC124.5 control (CpG negative control aptamer) (SEQ ID NO: 35)

C * A * G * GCAAG * C * T * T * T * T * G * CTTGAGCATCACCATGATC * C * T * G * / 3InvdT /

[0372] The activity of PDGF aptamers containing CpG islands of the present disclosure was tested in cell-based assays. Supernatants of J774A.1 cells (TIB cells), a mouse macrophage cell line (ATCC No. TIB-67), in the presence of CpG motifs will contain more IL-6 and TNF-alpha than cells not in the presence of CpG islands . Therefore, a solid-phase ELISA of IL-6 and TNF-alpha was used to quantify the levels of IL-6 and TNF-alpha released in supernatants (both from R and D Systems, Minneapolis, MN) after exposure to various oligonucleotides comprising CpG sequences. For the IL-6 ELISA, a monoclonal antibody specific for mouse IL-6 was previously coated on a 96-well microplate. An enzyme-linked polyclonal antibody specific for mouse IL-6 was used to detect any bound IL-6 of cell supernatants. For TNF-alpha ELISA, an affinity-purified polyclonal antibody specific for mouse TNT-alpha was previously coated on a 96-well microplate. An enzyme-linked polyclonal antibody specific for mouse TNF-alpha was used to detect any bound TNF-alpha from cell supernatants. Both ELISAs used a quantized colorimetric reading by spectrophotometry.

[0373] J774A.1 cells (TIB cells) were grown in Dulbecco-modified Eagle's medium (DMEM) with 10% fetal bovine serum (SBF) (Invitrogen, Carlsbad, CA) at 37 ° C, 5% CO2. 100,000 cells were seeded in a number of appropriate wells in a 24-well plate one day before the experiment. PDGF aptamers incorporated into CpG were incubated with the cells for 24 and 48 hours at 37 ° C, 5% COY. The final aptamer concentrations were 1 uM and 10 uM. Supernatants were collected at the indicated time points and centrifuged for 8 minutes at 5,000 rpm at 4 ° C. The centrifuged supernatants were frozen at -20 ° C until use in the ELISA of IL-6 or TNF-alpha. Both ELISAs were used according to the manufacturer's recommendations. Oligonucleotides containing the CpG motif previously reported to be immunostimulants, (ISS ODN and ODN2006) and LPS (Sigma), were used as positive controls and aptamers that did not contain CpG were used as negative controls. Figure 24A shows the results of an IL-6 ELISA that measures the release of IL-6 in TIB cells using only the standard ODN as positive controls, and aptamers that do not contain CpG islands as negative controls in the assay. The positive and negative controls were only used in this experiment to establish whether this assay was sufficiently consistent to measure the release of IL-6 induced by CpG. The data shown in Figure 24B demonstrate that ODN ISS and shortened versions of ODN ISS induce the release of IL-6 in TIB cells better than ODN2006 and shortened versions thereof. Figure 24C shows that short, long and full versions of ARC 124 incorporated with CpG motifs induce the release of IL-6 in TIB cells, in addition to the ISS ODN. The data shown in Figure 24D shows that TransARC124.1TransARC124.7 (SEQ ID NO: 23 - SEQ ID NO: 29) induces the release of IL-6 in TIB cells. The data shown in Figure 24E shows that TransARC124.1-TransARC124.7 induces the release of TNF-alpha in TIB cells.

[0374] The results of the IL-6 release and TNF-alpha release tests show that when CpG motifs are incorporated into existing aptamers, in this case ARC124 (SEQ ID NO: 11), the aptamer can elicit a response of CpG.

EXAMPLE 13: PDGF aptamers containing CpG islands in the ERK phosphorylation assay

[0375] ERK phosphorylation was used to test whether ARC124 (SEQ ID NO: 11) retained its functionality after incorporation of CpG motifs into the aptamer sequence. One hundred fifty thousand 3T3 cells (a line of mouse fibroblast cells containing PDGF-R) were seeded in an appropriate number of wells in a 12-well plate one day before the experiment and deprived of serum in 0.5 SBF % overnight. Cells were treated with 10 ng / ml PDGF-BB (R & D Systems, Minneapolis, MN) in the presence or absence of PDGF aptamers containing CpG islands for 30 minutes. Cells were collected and lysed with lysis buffer containing 10 mM Tris at pH 7.5, 100 mM NaCl, 0.125% NP-40, 0.875% Brij 97, 1.5 mM sodium vanadate and 1 min. EDTA free protease inhibitor tablet. The protein concentration in cell lysates was determined using BIO-RAD protein assay reagent according to the manufacturer's recommendations (Bio-Rad, Hercules, CA). Lysates were prepared by adding 4X NuPage LDS sample buffer with 0.1 M DTT at a final concentration of 1X (Invitrogen, Carlsbad, CA) and incubated at 70 ° C for 7 minutes. Forty micrograms of total protein were loaded into each well of a 10% Bis-Tris gel from NuPage (Invitrogen, Carlsbad, CA). The gel was run at 100 mAmp for 1 hour. Then, the gel was transferred to a HyBond ECL nitrocellulose membrane (Amersham, Piscataway, NJ) at 250 mAmp for 3 hours. After transfer, nitrocellulose was blocked with 5% BSA (Sigma, St. Louis, MO) in PBS for one hour at room temperature. The nitrocellulose membrane was incubated with a MAP kinase p44 / 42 antibody overnight at 4 ° C (Cell Signaling Technology, Beverly, MA). The nitrocellulose membrane was washed 3X with PBS containing 1% Tween 20 and then incubated with an antibody directed against rabbit IgG conjugated with HRP for 1 hour (Amersham, Piscataway, NJ). After one hour of incubation, the nitrocellulose membrane was washed 3X with PBS containing Tween-20. The membrane was developed using an ECL + Western blot detection system according to the manufacturer's recommendations (Amersham, Piscataway, NJ) and was swept using STORM 860 (Amersham). 3T3 cells in the presence of PDGF-BB without aptamer were used as a positive control.

[0376] The results show that shortARC124 and longARC124, both PDGF aptamers bearing known CpG motifs, are still functionally active and can block ERK phosphorylation upon PDGF binding.

[0377] Together, the data shows that when CpG motifs are incorporated into existing aptamers, the aptamer can elicit a CpG response and still maintain the ability to block the effects triggered by non-CpG target (eg, PDGF) (for example, phosphorylation of ERK-MAPK) with the same potency as native aptamers.

EXAMPLE 14: PDGF-AA Selection

PDGF-AA SELECTION SUMMARY

[0378] A selection of the short form of PDGF-AA (Roche Biomedical) was completed using a set containing 2-fluoro-pyrimidine. Round 1 of the selection began with incubation of 2x1014 molecules of the ARC 212 assembly modified with 2'F-pyrimidine (5 'GGGAAAAGCGAAUCAUACACAAGA-N40-GCUCCGCCAGAGACCAACCGAGAA 3') (SEQ ID NO: 74), which included a marked set addition with a32 P-ATP, with 50 pmoles of PDGF-AA protein in a final volume of 100 μl for 1 h at room temperature. The selection was made in 1X SHMCK buffer, pH 7.4 (20 mM Hepes at pH 7.4, 120 mM NaCl, 5 mM KCl, 1 mM MgCl2, 1 mM CaCl2). The RNA complexes: PDGF-AA and the RNA-free molecules were separated using 0.45 um nitrocellulose centrifugation columns from Schleicher and Schuell (Keene, NH). The column was previously washed with 1 ml of 1X SHMCK, and then the solution containing RNA: protein was added to the column and centrifuged in a centrifuge at 1500 g for 2 min. Buffer washes were performed to remove non-specific binders from the filters (1, 2 x 500 µl round of 1X SHMCK; in subsequent rounds, more rigorous washes (increased number of washes and volume) were used to enrich specific binders, complexes RNA: protein bound to the filters were then eluted with 2 x 200 ul of washes (2 x100 µl of washes in subsequent rounds) of elution buffer (7 M urea, 100 mM sodium acetate, 3 mM EDTA, preheated to 95 ° C) The eluted RNA was extracted with phenol: chloroform, then precipitated (40 μg of glycogen, 1 volume of isopropanol.) The RNA was reverse transcribed with the ThermoScript RT-PCR ™ system according to its instructions using primers KMT.108.38 .C (5 'TAATACGACTCACTATAGGGAAAAGCGAATCATACACAAGA 3') (SEQ ID NO: 75) and KMT.108.38.D (5 'TTCTCGGTTGGTCTCTGGCGGAGC 3') (SEQ ID NO: 76), followed by PCR amplification (20 mM Tris at pH 8, 4, 50 mM KCl, 2 mM MgCl2, KMT.108.38.C 0.5 μM, KMT.10 8.38.D 0.5 μM, 0.5 mM of each dNTP, 0.05 units / μl of Taq polymerase (New England Biolabs). The PCR template was purified using the QIAquick PCR purification kit (Qiagen). The templates were transcribed using ATp body marking with a32P overnight at 37 ° C (4% PEG-8000, 40 mM Tris at pH 8.0, 12 mM MgCl2, 1 mM spermidine, 0.002% Triton x-100, 3 mM 2'OH-purines, 3 mM 2'F-pyrimidines, 25 mM DTT, inorganic pyrophosphatase, individual mutant RNA polymerase T7 Y639F, 5 uCi of a32P-ATP). The reactions were desalted using Bio Spin columns (Bio-Rad) according to the manufacturer's instructions.

[0379] Subsequent rounds were repeated using the same procedure as for round 1, but with the addition of a negative selection stage. Before incubation with target protein, the whole RNA was passed through 0.45 micrometer nitrocellulose to remove the filter binding sequences, then the filtrate continued in the positive selection step. In alternate rounds, the whole RNA was gel purified. Transcription reactions were quenched with 50 mM EDTA and precipitated with ethanol, then purified on 1.5 mm of denaturing polyacrylamide gels (8 M urea, 10% acrylamide; 19: 1 acrylamide: bisacrylamide). The RNA from the set was removed from the gel by electroelution in an Elutrap® apparatus (Schleicher and Schuell, Keene, NH) at 225 V for 1 hour in 1X TBE (90 mM Tris, 90 mM boric acid, 0.2 mM EDTA). The eluted material was precipitated by the addition of 300 mM sodium acetate and 2.5 volumes of ethanol.

[0380] RNA remained in excess of the protein through selection (RNA ~ 1 μM). The protein concentration was 500 nM for the first 4 rounds, and then dripped gradually over the successive rounds. The competing tRNA was added to the binding reactions at 0.1 mg / ml starting in round 2. A total of 11 rounds were completed, binding assays being performed in the selection rounds. Table 12 contains the details of the selection that include the set RNA concentration, the protein concentration and the tRNA concentration used for each round. Elution values (ratio of CPM values of RNA bound to protein versus

5 Total RNA flowing through the filtration column) together with binding assays were used to monitor the progress of the selection.

Table 12. Conditions used for the selection of PDGF-AA (human short form)

sfh-PDGFAA

Round nº

Conc. Of the RNA set (uM) Type of protein Protein Conc. (UM) Conc. Of tRNA (mg / ml) neg % elution No. of PCR cycles

one

3.3 sfhPDGFAA 0.5 0 any 0.92 8

2

-one sfhPDGFAA 0.5 0.1 NC 0.24 fifteen

3

-one sfhPDGFAA 0.5 0.1 NC 0.46 12

4

-one sfhPDGFAA 0.5 0.1 NC 0.1 fifteen

5

one sfhPDGFAA 0.4 0.1 NC 1.39 10

6

-one sfhPDGFAA 0.4 0.1 NC 0.5 8

7

one sfhPDGFAA 0.3 0.1 NC 1.23 8

8

-one sfhPDGFAA 0.3 0.1 NC 0.44 10

9

one sfhPDGFAA 0.3 0.1 NC 5.05 8

10

 -one sfhPDGFAA 0.2 0.1 NC 0.83 10

eleven

 one sfhPDGFAA 0.2 0.1 NC 4.32 7

10 Protein binding analysis

[0381] Punctual transfer binding assays were performed throughout the selection to monitor

the protein binding affinity of the set. Trace RNA labeled with 32P was combined with PDGF-AA and incubated at

15 room temperature for 30 min in 1X SHMCK plus 0.1 mg / ml tRNA for a final volume of 20 μl. The reaction was added to a point transfer apparatus (punctual transfer of 1 Schleicher and Schuell mini-reader, acrylic), assembled (from top to bottom) with nitrocellulose, nylon and gel transfer membranes. RNA that is bound to protein is captured on the nitrocellulose filter, while RNA not bound to protein is captured on the nylon filter. When a significant positive relationship of RNA binding was observed in

In the presence of PDGF-AA versus in the absence of PDGF-AA, the whole was cloned using the TOPO TA cloning kit (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. The cast of round 10 was cloned and 17 sequences were obtained. Only five different sequences were observed, with two main families and a single sequence (not of the two families). For the determination of Kd, the RNA transcripts of the clone were labeled at the 5 'end with r-32P-ATP. Kd values were determined using the point transfer test and adjusting

An equation describing a 1: 1 complex of RNA: protein to the resulting data (Kaleidagraph, Figures 25A and 25B). The results of protein binding characterization are tabulated in Table 13. Clones with high affinity for PDGF-AA were studied and screened for functionality in cell-based assays.

Table 13. Clone binding activity * 30

R10

PDGF-AA clones

No.

Clone name PDGF-AA (human short form) Kd (nM) PDGF-AA (rat) Kd (nM)

one

ARX33P1.D1 WILDEBEEST. WILDEBEEST.

2

ARX33P1.D2 104.5 51.7

3

ARX33P1.E5 117.0 57.4

4

ARX33P1.E10 132.9 47.1

5

ARX33P1.E11 N.B. N.B.

WILDEBEEST. = no significant binding is observed * All measurements were made in the presence of 0.1 tRNA throughout the set without prior ARC 212 treatment (which showed no significant binding). When tRNA was not included in the reactions, the measured Kd values were approximately 2-3-fold lower (ie, higher affinity).

PDGF-AA aptamers

[0382] The sequences for the short-form aptamers PDGF-AA of the disclosure are presented in Table 14. In the aptamers of the disclosure derived under the conditions of this selection, the pyrimidines (C and U) are fluorinated in the 2 'position.

68

Cell-based assays with PDGF-AA aptamers

[0383] PDGF-AA aptamers that showed in vitro binding were tested in the 3T3 proliferation assay for their ability to inhibit 3T3 cell proliferation induced by PDGF-AA. The assay was established 5 as previously described using a PDGF-AA aptamer titre (0-1 µM) against a constant concentration (50 ng / ml) of PDGF-AA protein (R & D Systems). The results in Figure 26 show that the PDGF-AA aptamers ARX33P1.D2, ARX33P1.E5 and ARX33P1.E10 inhibit the proliferation of 3T3 cells induced by PDGF-AA, but are not very potent. Figure 27 shows that PDGF-AA aptamers have no effect on the proliferation of 3T3 cells induced by PDGF-BB, which indicates that aptamers of

10 PDGF-AA are highly specific for the PDGF-AA isoform.

EXAMPLE 15: Daily dose study of ARC308 and ARC594 in mouse Lewis lung carcinoma model

[0384] A 1 mm3 piece of Lewis lung carcinoma was implanted under the dorsal skin of C57BL / 6 mice

15 natural and let it grow. Starting on day five after implantation, five mice were treated for seven days, intraperitoneally, as follows: five mice were treated with vehicle (saline) once daily, five mice were treated with the ARC308 aptamer at 50 mg / kg, once a day, and five mice were treated with the ARC594 aptamer at 50 mg / kg, once a day. ARC308 is also referred to herein as AX101 and ARC594 is also referred to herein as AX102. At the end of the seven day period, the mice will

20 anesthetized, and the following tissues were fixed by vascular perfusion with 1% paraformaldehyde, removed and frozen to section in the cryostat: tumor tissue (Lewis lung carcinoma), pancreas, liver, kidney, trachea, spleen, jejunum and thyroid. The resulting slices were stained with antibodies against various markers as described below.

25 Staining with anti-CD31 and anti-a-SMA antibodies

[0385] Tumor sections were cut (80 μm) and stained with both anti-CD31 and smooth muscle anti-actin antibodies ("-SMA"). Digital fluorescence microscopy images were obtained for the

to area density measurements using a 3-chip RGB CCD camera with low CoolCam light. The results of this experiment are represented in Figure 31. In addition, images of the tumors were obtained by confocal microscopy.

[0386] A fluorescence threshold value of 45 to 50 (fluorescence intensity = 0 <255) was determined that most accurately represented the area density of staining with CD31 and a-SMA in images

35 microscopic fluorescence of Lewis lung carcinoma (section thickness 80 μm). The mean values for the area density (% of the mean surface area of the tumor ± EE; n = 3-5 mice per group) for blood vessels stained with CD31 and immunoreactive pericytes of a-SMA are summarized in the following Table 15 .

Table 15: Area Densities 40

Treatment

CD31 average E.E. from CD31 asthma E.E. from a-SMA Count

Vehicle

 16.21 1.47  11.48 0.73 3

ARC308

 8.42 0.92 2.87 0.71 5

ARC594

 6.05 0.68 2.03 0.32 4

[0387] The results are statistically significant as assessed using ANOVA (analysis of variance between groups) followed by the Fisher and Bonferroni test for multiple comparisons, see, Nouchedehi JM, White RJ, Dunn CD. Comput Biomed programs. 1982 14 (2): 197-205, as shown in the

45 following Tables 16 and 17.

Table 16: Table 17 *:

Fisher PLSD for area density Effect: group Significance level: 5%

Mean differences

Critical differences P value

ARC308-CD31

 veh-CD31 -7,797 2,557 <0.0001 S

ARC594-CD31

 veh-CD31 -10,165 2,696 <0.0001 S

ARC308-CD31

 ARC594-CD31 2,368 2,557 0.0676

ARC308-SMA

 veh-SMA -8,612 2,784 <0.0001 S

ARC594-SMA

 veh-SMA -9,459 2,912 <0.0001 S

ARC308-SMA

 ARC594-SMA 0.846 2,557 0.4969

Bonferroni / Dunn for area density Effect: group Significance level: 5%

Mean differences

Critical differences Pes value

ARC308-CD31

 veh-CD31 -7,797 4,098 <0.0001 S

ARC594-C.D31

 veh-CD31 -10,165 4.32 <0.0001 S

ARC308-CD31

 ARC594-CD31 2,368 4,098 0.0676

ARC308-SMA

 veh-SMA -8,612 4,462 <0.0001 S

ARC594-SMA

 veh-SMA -9,459 4,666 <0.0001 S

ARC308-SMA

 ARC594-SMA 0.846 4,098 0.4969

* The comparisons in this table are not significant unless the corresponding p-value is less than 0.0033.

5 [0388] These results demonstrate that both aptamers significantly reduced the area density of blood vessels stained with CD31 and a-SMA positive pericytes in Lewis lung carcinoma. ARC308 reduced the density of tumor blood vessels by 50%, while ARC594 reduced it by 60%. The area of density of immunoreactive pericytes of a-SMA was reduced by approximately 75% with any aptamer. In addition, obtaining confocal imaging revealed that Lewis lung carcinoma that had not been treated

10 with aptamer had abundant vessels with abnormally loose pericytes, while treatment with any aptamer resulted in the survival of vessels that did not have pericytes as well as pericytes that had normal close association on tumor vessels.

Staining with anti-CD31 and anti-collagen type IV antibodies

[0389] Tumor sections were cut (80 μm) and stained with both anti-CD31 antibody and type IV anti-collagen. Digital fluorescence microscope images were obtained for area density measurements using a CoolCam camera. The results of this experiment are depicted in Figure 32. In addition, images of the tumors were obtained by confocal microscopy.

[0390] A fluorescence threshold value of 45 to 50 (fluorescence intensity = 0 <255) was determined that most accurately represented the area density of staining with CD31 and a-SMA in microscopic images of carcinoma fluorescence Lewis lung (section thickness 80 μm). Mean values for area density (% of the mean surface area of the tumor ± E.E; n = 3-5 mice per group) for vessels

25 blood stained with CD31 and basal membrane stained with type IV collagen.

Table 18

Medium Treatment of CD31 E.E. of CD31 Collagen IV Medium E.E. Collagen IV Vehicle 100.00 9.09 100.00 2.06 ARC308 51.91 5.70 90.99 3.47 ARC594 37.31 4.18 85.14 2.58

[0391] The significance of the difference between groups was evaluated using ANOVA followed by a posterior Fisher test for multiple comparisons as shown in the following Table 19.

Table 19:

Fisher's PLSD for% Differences of differences Differences Effect value: critical averages p Level of significance: ARC308-CD31, Veh- -15.3 <0.000 S ARC594-CD31. Veh- -16.2 <0.000 S ARC308-CD31, ARC594-14.6 15.3 0.0 ARC308-col IV, ARC594-5.8 15.3 0.4 ARC308-Co -14.5 0.2 ARC594-col IV, Veh- -15.3 0.0

[0392] These results indicate that PDGF-B inhibition leads to a decrease in the density of blood vessels with minor effects on the vascular basement membrane. ARC308 and ARC594 reduced 48% and 63%, respectively, the density of blood vessel area, which indicates that ARC594 was more effective than ARC 308 under the conditions of the experiment. Although the effect of PDGF-B inhibition on type IV collagen

40 was relatively small (9% and 15%, respectively, with ARC308 and 594), the reduction in type IV collagen produced by ARC594 was significant. Although it is not desired to adhere to any theory, this effect may indicate a side effect on the vascular basement membrane.

Combination staining of anti-CD31, anti-PDGFR-�, anti-a-SMA, anti-NG2 and anti-demin antibody

[0393] Tumor sections in mice that had been treated with vehicle, ARC308 or ARC594 were cut (80 μm) and stained with anti-CD31 and anti-PDGFR-�, anti-CD31 and anti a-SMA, anti -CD31 and anti-NG2 or anti-CD31 and anti-demin antibody. The expression of pericytes was measured using Cool Cam and confocal images were also taken.

10 [0394] A fluorescence threshold value of 40-50 was determined that most accurately represented the immunoreactivities of CD31, PDGFR-�, a-SMA, NG2 and Lewis lung carcinoma demines in the digital images of the experiment (sections 80 μm thick).

[0395] The results are presented in Figure 33 and are summarized in the following Table 20. The values are

15 mean area densities ± E.E. (n = 4-5 mice per group) expressed as% of vehicle. The significance of differences between groups was evaluated using ANOVA followed by a posteriori Fisher test for multiple comparisons.

Table 20:

Medium Treatment of CD31 E.E. from E.E. from E.E. CD31 PDGFR-beta PDGFR-beta alpha-SMA alpha-SMA

Vehicle 100.00 9.09 100.00 3.59 100.00 6.37 ARC308 51.91 5.70 47.04 4.53 25.01 6.14 ARC594 37.31 4.18 27.18 3, 75 17.64 2.81

Average Treatment of NG2 E.E. of NG2 Media from E.E. Count

demines demines Vehicle 100.00 10.26 100.00 13.97 3 to 5 ARC308 20.12 2.41 15.60 2.61 5 ARC594 11.10 1.87 9.82 1.79 4 to 5

[0396] The significance of differences between groups was evaluated using ANOVA followed by a posterior Fisher test for multiple comparisons as shown in the following Table 21 (AX101 refers to ARC308 and AX102 refers to ARC594 in the following Table 20, in addition to any site used in this application and figures).

Table 21:

Fisher PLSD for vehicle% Effect: Group Level of significance: 5%

Mean differences Critical differences Value p AX101-CD31, Veh-CD31 -48.09 15.38 <0.0001 S AX102-CD31, Veh-CD31 -62.69 16.22 <0.0001 S AX101-CD31, AX102- CD31 14.61 15.38 0.06 AX101-APB5, Veh-APB5 -52.96 15.38 <0.0001 S AX102-APB5, Veh-APB5 -72.82 15.38 <0.0001 S AX101- APB5, AX102-APBS 19.86 14.50 0.01 S AX101-SMA, Veh-SMA -74.99 16.75 <0.0001 S AX102-SMA, Veh-SMA -82.36 17.52 <0 , 0001 S AX101-SMA, AX102-SMA 7.37 15.38 0.34 AX101-NG2, Veh-NG2 -79.88 15.38 <0.0001 S AX102-NG2, Veh-NG2 -88.90 15 , 38 <0.0001 S AX101-NG2, AX102-NG2 9.02 14.50 0.22 AX101-demining, Veh-demining -84.40 15.38 <0.0001 S AX102-demining, Veh-demining - 90.18 16.22 <0.0001 S AX101-demin, AX102-demin 5.78 15.38 0.46

[0397] These results indicate that treatment with the PDGF-B 308 or 594 aptamer (50 mg / kg, ip, daily)

30 for 7 days) decreased blood vessel density by no less than 63% and produced an even greater reduction in pericytes, with decreases of 73, 82, 89 and 90% found with three immunohistochemical markers (PDGFR-�, a- smooth muscle actin, NG2 and demines, respectively). The confocal images confirmed these findings and it was shown that the aptamer treatment left some tumor vessels without pericytes and others with pericytes that were more closely associated with endothelial cells than the

35 found in untreated tumors.

Colocalization of CD31, PDGFR-beta, a-SMA, NG2 and demin markers

[0398] Sections of vehicle-treated tumors or ARC594 were cut (20 μm) and stained with: anti-CD31 and anti-PDGFR-beta antibodies, anti-CD31 and anti-a-SMA antibodies, anti-CD31 and anti antibodies -NG2 and 5 anti-CD31 and anti-desmin antibodies. The degree of colocalization of pericytes with endothelial cells was then measured in Cool Cam digital images.

[0399] A fluorescence threshold value of 40-50 was determined that most accurately represented the area densities of Lewis lung carcinoma CD31 and NG2 in the digital images of experiment 10 (20 µm thick sections).

[0400] The results are represented in the graph of Figure 34 and are summarized in the following Table 22. The values are colocalization in percentage ± E.E. (n = 4 per group).

15 Table 22:

Colocalization

Average of CD31- E.E. from CD31- Average of CD31- E.E. from CD31-

PDGFR

PDGFR

SMA SMA

Vehicle

40.01  2.00 47.27 2.27

ARC594

19.11  3.34 8.42 1.13

Colocalization

Average of CD31- E.E. from CD31- Average of CD31- E.E. from CD31- Count

NG2

NG2

demining demining

Vehicle 50.68 1.42 39.67 1.68 4

ARC594 4.82 0.50 6.11 0.88 4

[0401] The significance of differences between groups was evaluated using ANOVA followed by a posterior Fisher test for multiple comparisons, shown in the following Table 23.

20 Table 23:

Fisher PLSD for colocalization Effect: Group Level of significance: 5%

Mean differences Critical differences Value p AX102-PDGFR, Veh-PDGFR -20.90 5.43 <0.0001 S AX102-SMA, Veh-SMA -38.85 5.43 <0.0001 S AX102-NG2, Veh- NG2 -45.86 5.43 <0.0001 S AX102-demining, Veh-demining -33.57 5.43 <0.0001 S

[0402] These results indicate that in Lewis lung carcinoma under reference conditions

About half of the endothelial surface of blood vessels was covered by pericytes (40-51%). However, when the tumors were treated for 7 days with ARC594, the number of tumor vessels was reduced ~ 60%, and the pericyte coverage of the surviving tumor vessels was reduced to 5-19%. These findings indicate that the majority of tumor vessels that survived treatment with PDGF-B aptamer lack pericytes. However, a certain fraction of the tumor vessels were coated with pericytes that presented a

30 "normalized" phenotype with respect to pericyte-endothelial cell interactions. The survival of pericyte-wrapped tumor vessels was normalized in the sense that the pericytes were more closely associated with endothelial cells than in untreated tumors. This effect of ARC594 is very different from the effect of VEGF signaling inhibitors, in which the majority of surviving tumor vessels are covered by pericytes. The data presented in this document indicate that the treatment of solid tumors with

35 anti-PDGF-B agents such as ARC594 produce the survival of at least two types of tumor vessels, 1) those with few to any pericyte attached to or lining the vessel wall, and 2) those that have a more normalized phenotype with pericytes more closely associated. These results suggest that the use of anti-PDGF-B agents, such as ARC594, can alter the tumor vasculature making the remaining vessels more susceptible to treatment with a combination of agents such as anti-VEGF agents, antivascular agents,

40 other antiangiogenic agents or cytotoxic agents. Therefore, combination therapy of a PDGF aptamer (eg, PDGF-B) in combination with known cancer therapies is an effective method for treating a variety of solid tumors.

[0403] Lewis lung carcinoma images treated with aptamer suggest that pericytes do not

45 are uniformly distributed over the surviving tumor vessels. It seems that the rest of the vessels lack coverage of pericytes (more common) or it seems to have dense coverage of pericytes (less common).

Colocalization of CD31 and NG2 in individual tumor vessels

[0404] Sections of 20 μm of Lewis lung carcinomas treated with both vehicle and ARC594 were stained with anti-CD31 and anti-NG2 antibodies. The degree of colocalization of pericytes with endothelial cells was measured in digital images with CoolCam. The individual vessels were examined in the images to determine the distribution of vessels covered with pericytes or empty of pericytes.

[0405] A threshold value of 40-50 was determined that most accurately represented the area densities of CD31 and NG2 in Lewis lung carcinoma (the sections were 20 μm thick). The results are

10 are represented in the graph of Figure 35 and are summarized in the following Table 24. The values are colocalization in percentage (n = 3 mice per group, 12-15 glasses per mouse).

Table 24:

Distribution Number of vessels in that interval X axis = colocalization interval (%) Vehicle ARC594

0-9 0 34 10-19 0 1 20-29 1 2 30-39 6 0 40-49 5 0 50-59 10 0 60-69 12 0 70-79 5 5 80-89 2 1 90-100 1 1

Total vessels examined 42 44

[0406] These results indicate that in Lewis lung carcinoma under reference conditions there is a homogeneous distribution of pericyte coverage over blood tumor vessels. However, treatment with ARC594 for seven days affects this distribution and vessels covered with very few pericytes or vessels that are covered with pericytes are detected. However, there is practically nothing in between.

20 Example 16: Dose response of ARC594 in mouse Lewis lung carcinoma model

[0407] A 1 mm3 piece of Lewis lung carcinoma was implanted under the dorsal skin of natural C57BL / 6 mice and allowed to grow. Starting on day five after implantation, five mice were treated

25 for seven days, intraperitoneally, as follows: five mice were treated with vehicle (saline) once a day, five mice were treated with the ARC594 aptamer at 2 mg / kg, once a day, five mice were treated with ARC594 at 10 mg / kg once daily, and five mice were treated with ARC594 at 50 mg / k once daily. At the end of the seven day period, each of the mice was anesthetized, and the following tissues were fixed by vascular perfusion, removed and frozen to section in the cryostat: tumor (lung carcinoma of

30 Lewis), pancreas, liver, kidney, trachea, spleen, jejunum, heart, brain and thyroid. Tumor sections were cut and stained with antibodies directed against markers as described below. Digital fluorescence microscopy images were obtained for area density measurements using CoolCam images. In addition, images of the tumors were obtained by confocal microscopy.

35 Staining with anti-CD31 and anti-collagen type IV antibody

[0408] Sections of 80 μm of Lewis lung carcinoma were stained with anti-CD31 antibodies and anti-collagen type IV. A fluorescence threshold value of 40 was determined that most accurately represented the area density of immunoreactivities of CD31 and type IV collagen in Lewis lung carcinoma (thickness of

40 section 80 μm). The results are shown graphically in Figure 36 and are summarized in the following Table 25. The values are mean area densities ± E.E .; (n = 3-5 mice per group) expressed as% of the average value for the vehicle.

Table 25:

Medium E.E. of Collagen E.E. Collagen Count CD31 CD31 IV IV

Vehicle 100 5.96 100 3.64 5

2 mg / kg of ARC594 77.16 9.27 95.11 8.03 3

10 mg / kg ARC594 60.67 4.35 97.68 4.72 3

50 mg / kg ARC594 39.14 2.65 81.55 2.58 5

[0409] The significance of differences between groups was evaluated using ANOVA followed by Fisher's test to

posteriori for multiple comparisons as shown in the following Table 26:

Table 26:

Fisher PLSD for vehicle% Effect: Group Level of significance: 5%

Mean differences Critical differences P-value 10 mg / kg of CD31, 2 mg / kg of CD31 -16.49 15.75 0.04 S 10 mg / kg of CD31, 50 mg / kg of CD31 21.53 13.31 0 , 00 S 10 mg / kg of CD31, Veh-CD31 -39.33 13.64 <0.0001 S 2 mg / kg of CD31, 50 mg / kg of CD31 38.03 13.31 <0.0001 S 2 mg / kg of CD31, Veh-CD31 -22.84 13.64 0.00 S 10 mg / kg of cabbage IV, 2 mg / kg of cabbage IV 2.56 15.75 0.74 10 mg / kg of cabbage IV, 50 mg / kg of cabbage IV 16.13 13.31 0.02 S 10 mg / kg of cabbage IV, Veh-col IV -2.32 13.31 0.73 2 mg / kg of cabbage IV, 50 mg / kg of cabbage IV 13.57 13.31 0.05 S 2 mg / kg of cabbage IV, Veh-col IV -4.89 13.31 0.46

5 [0410] The results indicate that the reduction of blood vessels induced by PDGF-B inhibition depends on the dose. The magnitude of the decrease in immunoreactive blood vessels of CD31 increased with the dose of ARC594. The reduction in immunoreactivity of type IV collagen was only observed at the highest dose (50 mg / kg i.p., daily for 7 days).

10 Staining with anti-CD31 and anti-a-SMA antibody

[0411] 80 µm sections of Lewis lung carcinoma were stained with anti-CD31 and anti-a-SMA antibodies. A threshold value of 40 was determined that most accurately represented the area density of

15 immunoreactivities of CD31 and a-SMA in Lewis lung carcinoma (section thickness 80 μm). The results are shown graphically in Figure 37 and are summarized in the following Table 27. The values are mean area densities ± E.E; (n = 3-5 mice per group) expressed as% of the average value for the vehicle.

20 Table 27:

Medium Treatment of CD31 E.E. from CD31 Media by SMA E.E. of SMA Vehicle Count 100 5.96 100 4.44 5

2 mg / kg of ARC594 77.16 9.27 31.44 4.52 3 10 mg / kg of ARC594 60.67 4.35 19.47 3.74 3 50 mg / kg of ARC594 39.14 2.65 16.57 2.06 5

[0412] The significance of differences between groups was assessed using ANOVA followed by a posterior Fisher test for multiple comparisons as shown in the following Table 28: 25

Table 28:

Fisher PLSD for vehicle% Effect: Group Level of significance: 5%

Mean differences Critical differences Value p

10 mg / kg of SMA, 2 mg / kg of SMA -11.97 15.75 0.13 10 mg / kg of SMA, 50 mg / kg of SMA 2.89 13.31 0.66 10 mg / kg of SMA, Veh-SMA -80.53 14.09 <, 0001 S 2 mg / kg of SMA, 50 mg / kg of SMA 14.87 13.31 0.03 S 2 mg / kg of SMA, Veh-SMA - 68.56 14.09 <, 0001 S 50 mg / kg of SMA, Veh-SMA -83.43 11.30 <, 0001 S

[0413] The results indicate a significant reduction in immunoreactive pericytes of a -SMA even at the lowest dose (2 mg / kg i.p., daily for 7 days). Higher concentrations of ARC594 had high efficacy.

Colocalization of CD31 and multiple markers of pericytes

[0414] Sections of 20 μm of Lewis lung carcinoma of mice treated with vehicle or 2, 10 or 50

35 ms / kg of ARC594 as described above were stained with anti-CD31 and anti-a-SMA or anti-CD31 and anti-NG2 antibodies. The degree of colocalization of pericytes with endothelial cells was measured in digital images with CoolCam.

[0415] A threshold value of 40-50 represented with greater accuracy the area densities of CD31-a-SMA and CD31-NG2 in Lewis lung carcinoma (the sections were 20 μm thick). The results are represented in Figure 38 and are summarized in the following Table 29. The values are mean colocalization ± E.E. (n = 2-5 mice per group).

Table 29:

Medium Treatment of CD31-E.E. from CD31-Media from CD31-E.E. CD31-Count SMA SMA NG2 NG2

Vehicle 54.44 1.67 48.79 0.72 2

2 mg / kg of ARC594 18.40 1.46 14.01 1.73 3 10 mg / kg of ARC594 16.30 1.28 12.33 1.22 5 50 mg / kg of ARC594 7.15 0.68 6.69 0.20 4

[0416] The significance of differences between groups was assessed using ANOVA followed by a posterior Fisher test for multiple comparisons as shown in Table 30.

Table 30:

Fisher PLSD for% colocalization Effect: Group Level of significance: 5%

Mean differences Critical differences P-value 2 mg / kg of CD31-SMA, 50 mg / kg of CD31-SMA 11,253 3,444 <0.0001 S 2 mg / kg of CD31-SMA, VehCD31-SMA -36.037 4.177 <0.0001 S 10 mg / kg of CD31-SMA, VehCD31-SMA -38,137 4,117 <0.0001 S 10 mg / kg of CD31-SMA, 50 mg / kg of CD31-SMA 9,153 3,444 <0.0001 S 10 mg / kg of CD31 -SMA, 2 mg / kg of CD31-SMA -2.1 3,682 0.2464 50 mg / kg of CD31-SMA, VehCD31-SMA -47.29 3,906 <0.0001 S 2 mg / kg of CD31-NG2, 50 mg / kg of CD31-NG2 7,318 3,444 0.0003 S 2 mg / kg of CD31-NG2, VehCD31-NG2 -34,784 4,117 <0.0001 S 10 mg / kg of CD31-NG2, 2 mg / kg of CD31- NG2 -1,678 3,293 0,2986 10 mg / kg of CD31-NG2, 50 mg / kg of CD31-NG2 5.64 3,025 0.001 S 10 mg / kg of CD31-NG2, VehCD31-NG2 -36,462 3,773 <0.0001 S 50 mg / kg of CD31-NG2, VehCD31-NG2 -42,102 3,906 <0.0001 S

[0417] These results indicate that in Lewis lung carcinoma treated for 7 days with 2 mg / kg of

ARC594 the number of tumor vessels was only reduced ѝ 23%, but the coverage of pericytes was reduced to 14-18%.

After treatment with 10 mg / kg of ARC594, the number of tumor vessels was reduced ѝ 40% and the pericyte coverage was reduced to 12-16%. Although it is not desired to adhere to any theory, these findings indicate that ARC594 first reduces the number of pericytes that leave the remaining blood vessels both naked and with reduced coverage of pericytes and secondly reduces the number of blood vessels, probably by reducing support and stromal pericytes of basement membrane cells.

[0418] At the lowest dose, the survival of surviving tumor vessels enveloped by pericytes was normalized in the sense that the pericytes were more closely associated with endothelial cells than in untreated tumors.

[0419] The findings of the dose response study confirm that ARC594 acts at multiple levels. Although it is not desired to adhere to any theory, these results provide strong evidence that the primary action of ARC594 produces a reduction in the number of pericytes (whose function is to support the capillary network that supplies blood and nutrients to the tumor). Again, although it is not desired to adhere to any theory, the reduction in blood vessels could be indirect due to the PDGF-B aptamer-dependent blockage of growth factors derived from tumor pericytes and tumor stromal derivatives such as VEGF. Example 17A: Short time course of ARC: 594 in the Lewis lung carcinoma model

[0420] A 1 mm3 piece of Lewis lung carcinoma was implanted under the dorsal skin of natural C57BL / 6 mice and then starting on day 6, treated for 7 days with vehicle or 50 mg / kg of ARC594, depending on The following protocol:

n = 4 mice treated with vehicle (saline solution i.p., once a day) for 7 days,

n = 4 mice treated with ARC594 (50 mg / kg, i.p., once daily) for 1 day,

n = 4 mice treated with ARC594 (50 mg / kg, i.p., once daily) for 2 days,

n = 4 mice treated with ARC594 (50 mg / kg, i.p., once daily) for 4 days,

5 n = 4 mice treated with ARC594 (50 mg / kg, i.p., once daily) for 7 days.

[0421] At the end of each treatment, each group of mice was perfused and Lewis lung carcinoma and the different organs were collected. Sections of 80 μm of Lewis lung carcinomas were cut and stained with antibodies directed against various markers as described below. Finally the glass

Blood pressure and pericyte area density were determined using the Cool Cam.

[0422] A threshold value of 30-50 was determined that most accurately represented the area density of immunoreactivities of CD31, a-SMA and NG2 in 80 µm sections of Lewis lung carcinoma. The results are presented in the graph of Figure 39 and are summarized in the following Table 31. The values are

15 mean area densities ± E.E. (n = 3-5 mice per group) expressed as% of the average value for the vehicle. The significance of differences between groups was evaluated using ANOVA followed by a posteriori Fisher test for multiple comparisons.

Table 31:

Medium E.E. from E.E. from E.E. Count CD31 CD31 SMA SMA NG2 NG2

Vehicle 100.00 3.85 100.00 5.34 100.00 6.86 4

ARC594 1 day 102.77 5.39 63.83 9.14 34.83 4.72 3 ARC594 2 days 100.41 7.36 40.64 1.96 29.92 0.83 4 ARC594 4 days 79.75 4.02 39.80 5.96 17.73 1.83 4 ARC594 7 days 55.17 3.55 13.64 3.90 11.64 0.27 3

20 [0423] These data indicate that after one day of treatment with ARC594 (50 mg / kg) the pericytes were reduced 36% for positive for a-SMA and 66% for NG2. After 7 days of treatment they are reduced even more (total decrease of 86% -89%). In contrast, the area density of CD31 is significantly changed until after 4 days of treatment with ARC594. Although you don't want to stick to any theory, these

25 results provide strong evidence that the primary effect of ARC594 is on pericytes, while the side effect reduces endothelial cells by a reduction in VEGF derived from pericytes. Therefore, under these conditions of treatment with PDGF-B, the net effect is to reduce the abundance of pericytes, thus directly reducing the source of VEGF derived from the host, which in turn produces a net reduction in the abundance of tumor endothelial cells.

[0424] In a similar study, Lewis lung carcinomas treated with vehicle or ARC594 for seven days were also stained for the detection of a total of 4 pericyte markers: a-SMA, NG2, PDGFR-� and demin. Under reference conditions, the experts expressed the 4 markers. Specifically, the area density of a -SMA was 10.0%, NG2 was 14.9%, PDGFR-� was 14.0% and demining was 9.0%. Compared

35 with vehicle-treated Lewis lung carcinoma, treatment with ARC594 for 1 day resulted in a reduction in the 4 pericyte markers (Figure 40). Although there was a significant reduction in the 4 markers after one day of treatment with ARC564, the reductions in a-SMA (45.4 ± 7.8%) and NG2 (69.8 ± 4.2%) were greater than in PDGF-� (31.3 ± 2.8%) and demining (25.7 ± 16.0%: Figure 40). Although it is not desired to adhere to any theory, this unequal reduction in pericyte markers may indicate that, although

40 lose some pericytes, the pericytes have changed their phenotype by changing their expression markers. However, after 7 days of treatment with ARC594, the 4 markers of pericytes were reduced 70-80% (Figure 40), thus leaving naked blood tumor vessels of pericytes 7 days. Obtaining confocal images confirmed these results.

45 Example 17B: Long time course of ARC594 in the Lewis lung carcinoma model

[0425] A 1 mm3 piece of Lewis lung carcinoma was implanted under the dorsal skin of natural C57BL / 6 mice (day 0). Starting on day 6, mice were treated for 7-14-28 days with vehicle or 50 mg / kg of ARC594, according to the following protocol:

50 n = 5 mice treated with vehicle (saline solution i.p., once a day) for 7 days,

n = 5 mice treated with ARC594 (50 mg / kg, i.p., once daily) for 7 days,

55 n = 6 mice treated with vehicle (saline solution i.p., once a day) for 14 days,

n = 6 mice treated with ARC594 (50 mg / kg, i.p., once daily) for 14 days,

n = 6 mice treated with vehicle (saline solution i.p., once a day) for 28 days, n = 6 mice treated with ARC594 (50 mg / kg, i.p., once a day) for 28 days.

[0426] During treatment, mice were weighed daily and tumor size was monitored. He

Tumor size was measured with calipers every two days during treatment. Tumor volume was calculated using the following formula: Tumor volume = (0.52 * width ^ 2) * length. The tumors were also weighed at the end of the experiment.

Tumor and mouse growth

[0427] The growth of the tumor (as represented by the volume of the tumor) during the treatment is represented in Figure 41. The weight of the tumor during the treatment is represented in Figure 42. The growth of the mouse during the treatment is shown in Figure 43.

[0428] Treatment with ARC594 did not affect the size of the Lewis lung carcinoma tumor: the growth curves for tumors treated with ARC594 (50 mg / kg) and vehicle are the same. In addition, there was no significant difference in tumor weights measured at the end of the experiment. However, it appeared that mice treated with ARC594 gained more weight in the third and fourth week of treatment.

20 Staining with anti-CD31 and anti-NG2 antibodies

[0429] A threshold value of 40-50 was determined that most accurately represented the area density of CD31 and NG2 immunoreactivities in 80 µm sections of Lewis lung carcinoma. The results are represented in Figure 44 and are summarized in the following Table 32: The values are normalized to

25 mean area densities ± E.E. (n = 1-5 mice per group) expressed as% of the average value for the vehicle. AX102 refers to ARC594. The significance of differences between groups was evaluated using ANOVA followed by a posteriori Fisher test for multiple comparisons.

Table 32:

Medium Treatment of CD31 E.E. of CD31 Media from NG2 E.E. of NG2 Count

Vehicle 1 week 100.0 2.0 100.0 2.1 4 AX102 1 week 59.3 4.9 22.2 3.0 5 Vehicle 2 weeks 107.1 5.8 94.1 8.3 5 Ax102 2 weeks 40.5 4.2 18.2 3.4 4 Vehicle 3 weeks 101.4 100.3 1 Ax102 3 weeks 39.9 1.2 15.4 1.5 3 Vehicle 4 weeks 98.9 2.4 113 , 6 7.5 3 Ax 102 4 weeks 15.0 0.2 14.9 1.4 2

[0430] In vehicle-treated Lewis lung carcinoma, the area density of CD31 did not change. The NG2 area density of Lewis lung carcinoma treated with vehicle remained approximately the same after weeks 1, 2 and 3 of treatment, although it increased somewhat after week 4 of treatment. This

The difference was only statistically significant when compared with the time points of week 2 and week 4.

[0431] In Lewis lung carcinoma treated with ARC594 (50 mg / kg), the area density of CD31 decreased 40% compared to the vehicle after one week, 60% after two weeks,

40 remained the same after three weeks and decreased 85% after four weeks. In Lewis lung carcinoma treated with ARC594, the area density of NG2 decreased 80% after one week and then remained almost the same. These data show that treatment with ARC594 reduces the area density of NG2 faster than the area density of CD31.

[0432] In a similar study, sections of Lewis lung carcinoma that had been treated with ARC594 for 28 days were stained with anti-CD31 and anti-PDGFR-beta antibodies. Although treatment with ARC594 produced an immediate reduction of pericytes after 1 day of treatment, the density of tumor vessel area did not change. However, the additional treatment revealed that there was a reduction observed in tumor vessels at 7 days - a trend that continued during the 28 days of treatment. The quantification of the

50 CD31 area density revealed that after 4 days of treatment the blood tumor vessels were significantly reduced by 31.3% compared to vehicle treated mice (Figure 45). Tumor vessels progressively decreased 46.5% after 7 days of treatment and 79.9% after 28 days of treatment (Figure 45).

[0433] Figure 45 illustrates a further reduction in tumor vessels, but not in pericytes positive for PDGFR-beta with additional ARC594 treatment for 28 days. Tumor vessels of vehicle-treated mice were covered 48.6% by pericytes, while the rest of the vessels after ARC594 treatment for 7 days only 19.1% were covered by pericytes (Figure 46). After treatment with ARC594 for 28 days, which further reduces tumor vessels, the rest of the blood tumor vessels were covered 40.1% by pericytes (Figure 46).

[0434] Previous results indicated that naked blood vessels were affected by treatment with ARC594 for 28 days. To determine if the affected vessels were those that lacked pericytes, the distribution of CD31 and PDGFR-beta over individual vessels was examined. In vehicle-treated CPL, most of the vessels are covered by pericytes, with most of the vessels between 40% and 90% coverage (Figure 47). After 7 days of treatment, fewer vessels survived and the rest of the vessels were covered by few or no pericytes (<40% coverage; Figure 47). Additional treatment with ARC594 for 28 days led to even further reductions in tumor vessels. However, these remaining vessels lost the population of naked vessels observed after 7 days of treatment and in fact had an equal distribution of pericyte coverage (Figure 47).

[0435] It was investigated whether the reduction in pericytes produced by ARC594 had an effect on vessel diameter or not. The vehicle-treated CPL had blood tumor vessels with a diameter of 12.8 μm. However, treatment with ARC594 increased the diameter at 4 days (Figure 48) and increased further at 14 days (Figure 48). However, the additional treatment after 14 days produced tumor vessels that decreased in diameter as shown on days 21 and 28. (Figure 48).

[0436] In a similar experiment it was investigated whether or not treatment with ARC594 affected the basement membrane. In vehicle-treated Lewis lung carcinoma, CD31 positive vessels were enveloped by type IV collagen. ARC594 did not change the total amount of collagen IV after 1 day of treatment, when the number of pericytes began to decrease; or after 4 days of treatment, when the number of blood vessels began to decrease. However, after 7 days of treatment, the vascular basement membrane gradually began to decrease, reaching the greatest reduction after 28 days. In fact, the area density of type IV collagen was reduced by 20% on day 7 and 50% on day 28 (Figure 49).

[0437] In a similar experiment, changes in the vascular basement membrane were also analyzed using two other markers for the components of the basement membrane: nidogen and laminin. Double staining with type IV collagen, or laminin, and nidogen showed that these markers have the same immunoreactivity and the vascular basement membrane was positive for all three. The analysis of the area density showed that nidogen and laminin were reduced in the same way as type IV collagen (Figure 50).

Example 18: Long time course of dose response of ARC594 in Lewis lung carcinoma

[0438] A 1 mm3 piece of Lewis lung carcinoma (CPL) was implanted under the dorsal skin of C57BL / 6 mice aged 9 to 10 weeks. The treatment began 4-6 days later. The ARC594 aptamer (2, 10 or 50 mg / kg) or vehicle (saline) was injected ip daily for up to 28 days. In addition, the ARC128 negative control aptamer (also referred to herein as AX 104) (50 mg / kg), which contains the same nucleotides as ARC594 but in a random order, was used to determine the specificity of ARC594. At the end of the treatment the mice were anesthetized, perfused with fixative and the tissue of each mouse was collected.

[0439] For staining, endothelial cells of tumor vessels, cryostat sections 80 µm thick of Lewis lung carcinoma, were stained with anti-CD31 antibody (clone 2H8 Chemicon). For the pericytes, the sections were stained with one or more of four antibodies: smooth muscle a-actin (a-SMA, clone 1 A4, Sigma Chemical Co.), chondroitin sulfate proteoglycan NG2 (AB5320, Chemicon), PDGFR -� (clone APB5, by Akiyoshi Uemura, University of Kyoto, Japan) and demining (DAKO).

[0440] The area densities of the CD31 and pericyte markers (proportion of the area of the section) were measured by fluorescence microscopy in images acquired at 10X. Transmission electron microscopy of 50-100 nm sections were stained with lead citrate and examined with a Zeiss EM-10 electron microscope.

[0441] The coverage of pericytes was measured in sections of 20 μm stained with marker of CD31 and pericytes (a-SMA, NG2, PDGFR-� and demining). The images of each marker were captured separately and analyzed by Image J: After determining the threshold of each channel, the images were combined and the colocalized pixels were measured. The area density was determined as the proportion of colocalized pixels with respect to positive pixels for CD31.

Staining with anti-a-SMA antibodies

[0442] Tumors treated with ARC594 (50 mg / kg), negative control aptamer (50 mg / kg) or vehicle for up to 7 days were sectioned and stained with anti-a-SMA antibodies. As shown in Figure 51, ARC594 decreased dea-SMA immunoreactive pericytes in a dose response mode. Figure 52 shows that ARC594 (50 mg / kg) reduced the pericytes after only one day of treatment. The confocal images show that the negative control aptamer did not affect the tumor vasculature.

Example 19: Dose response of ARC594 in the RIP Tag2 model

5 [0443] Mice positive for RIP-Tag2 of 9 weeks of age were treated for 7 days with vehicle, or 2 mg / kg, 10 mg / kg or 50 mg / kg of ARC594, according to the following protocol:

n = 4 mice treated with vehicle (saline solution i.p., once daily)

10 n = 5 mice treated with ARC594 (2 mg / kg, i.p., once daily)

n = 5 mice treated with ARC594 (10 mg / kg, i.p., once daily)

n = 5 mice treated with ARC594 (50 mg / kg, i.p., once daily)

[0444] At the end of this treatment, the mice were perfused and the liver, spleen, thyroid, trachea, kidney, jejunum, heart, brain and pancreas were collected for each mouse. Finally, 80 μm sections were cut and stained for CD31, type IV collagen, PDGFR-beta, a-SMA and NG2.

[0445] A threshold value of 40 was determined that most accurately represented the area density of immunoreactivities of CD31 and NG2 in 80 µm sections of RIP-Tag2 tumor. The results are represented in Figure 53 and are summarized in the following Table 33. The values are mean area densities ± E.E. (n = 4-5 mice per group) expressed as area density and also as the% of the average value for the vehicle.

25 Table 33:

Medium Treatment of CD31 E.E. of CD31 Media from NG2 E.E. of NG2 Vehicle Count 100.0 4.0 100.0 1.8 4

ARC594 2 mg / kg 101.6 3.8 88.2 3.5 4 ARC594 10 mg / kg 93.5 2.4 72.0 2.9 5 ARC594 50 mg / kg 91.6 2.3 73.5 1,1 4

[0446] The significance of differences between groups was evaluated using ANOVA followed by a posterior Fisher test for multiple comparisons as shown in Table 34.

30 Table 34:

Fisher PLSD for area density Effect: Group Level of significance: 5%

Differences Differences Value p critical averages

ARC594-2 mg / kg of CD31, veh-CD31 0.86 4.52 0.6889 ARC 594-2 mg / kg of CD31, ARC594-50 mg / kg of CD31 5.509 4.52 0.0188 S ARC594-10 mg / kg of CD31, veh-CD31 -3,604 4,288 0.0959 ARC594-10 mg / kg of CD31, ARC594-2 mg / kg of CD31 -4,464 4,288 0.0419 S ARC594-10 mg / kg of CD31, ARC594- 50 mg / kg of CD31 1,045 4,288 0.6205 ARC594-50 mg / kg of CD31, veh-CD31 -4.649 4.52 0.0442 S ARC594-2 mg / kg of NG2, veh-NG2 -5.618 4.52 0 , 0168 S AARC594-2 mg / kg of NG2, Ax102-50 mg / kg of NG2 6.99 4.52 0.0038 S ARC594-10 mg / kg of NG2, veh-NG2 -13,306 4,288 <0.0001 S ARC594-10 mg / kg of NG2, ARC594-2 mg / kg of NG2 -7,688 4,288 0.0011 S ARC594-10 mg / kg of NG2, ARC594-50 mg / kg of NG2 -0,698 4,288 0,7405 ARC594-50 mg / kg of NG2, veh-NG2 -12,608 4.52 <0.0001 S

[0447] These results indicate that in RIP-Tag2 tumors treated for 7 days with 2 mg / kg of ARC594 the

The density of pericytes positive for NG2 was reduced by 12%. At 10 mg / kg dose the reduction was greater (28%). The 50 mg / kg dose had the same effect as the 10 mg / kg dose. ARC594 at 10 mg / kg and 50 mg / kg dose induces a 10% reduction in RIP-Tag2 tumor vessels.

[0448] In another study, treatment of RIPTag2 tumor with ARC594 for 7 days led to a reduction

40 in pericytes and this reduction was greater after 28 days. Untreated RIP-Tag2 tumors are highly vascularized. Treatment with ARC594 produced a regression of blood vessels (area density of CD31) and this decrease depended on time; the blood vessels began to remit after 7 days of treatment. The extension of the treatment to 28 days produced a greater reduction in blood vessels. The measurements showed that the 7-day treatment with ARC594 decreased the immunoreactivity of a-SMA and CD31 by 27.2% and 12.3%, respectively. After 14 days, the immunoreactivity of a -SMA and CD31 were reduced by 45.8% and 26.6%, respectively. After 28 days, the immunoreactivity of -SMA and CD31 reduced the

at 45.5% and 38.1%, respectively (Figure 54).

[0449] Pericytes in RIP-Tag2 tumors were closely associated with the endothelium. As observed in the Lewis lung carcinoma model, after treatment with ARC594, surviving pericytes were closely associated with blood vessels, which indicates that in this tumor model PDGF-BB inhibition induced phenotypic changes of pericytes.

Example 20: Pharmacokinetic analysis of ARC594 in mice.

[0450] For the pharmacokinetic studies described herein, all mass-based concentration data only refer to the molecular weight of the oligonucleotide portion of the aptamer, regardless of the mass conferred by conjugation with PEG.

[0451] Each dose group consisted of 3 mice that were terminally sacrificed at each moment of time for plasma collection. The aptamer was formulated for injection of a lyophilized powder at a final concentration of 10 mg / ml (oligonucleotide weight) in 0.9% of conventional saline solution and sterilized by filtration (0.2 μm) before dosing. The route of administration used was a single intravenous bolus injection through the tail vein at a dose of 10 mg / kg. At specified times of time, t = pre-dose, 0.5, 1, 2, 4, 8, 16, 24, 32 and 48 hours, blood samples were obtained from jugular vein catheters, transferred directly to EDTA coated tubes, mixed by inversion and placed on common ice. Plasma was collected by centrifugation of EDTA blood tubes at 3000 rpm for 5 minutes. Plasma samples were stored at -80 ° C until analysis. Plasma sample analysis for aptamer concentration was carried out using a homogeneous assay form using the direct addition of plasma aliquots to test wells containing the commercially available Oligreen ™ fluorescent nucleic acid detection reagent. After a brief incubation period (5 min) at room temperature, protected from light, the test plates were read by a fluorescence plate reader.

[0452] The fluorescence signal of each well was proportional to the aptamer concentration in the well, and the sample concentrations were calculated by interpolation of fluorescence values of a standard fluorescence concentration curve (mean values of duplicate curves). The average plasma concentrations were obtained at each moment of time from three animals in each group. Plasma concentration data versus time at which they appeared were subjected to non-compartmental analysis (NCA) using the conventional pharmacokinetic modeling software in the WinNonLin ™ v.4.0 industry. The approximate calculations were obtained for the following primary pharmacokinetic parameters: maximum plasma concentration, Cmax; area under the concentration-time curve, ABC; terminal half-life, t1 / 2; terminal elimination, Cl; and volume of distribution in the steady state, Vss. The mean plasma concentration versus time data appeared to be monophasic with respect to the entire time course studied (0-48 h).

[0453] The previously described competitive binding assay was used to determine the binding affinity and in vitro selectivity of ARC594 for different isoforms of PDGF. The different concentrations of unlabeled competing aptamer were evaluated in separate reactions against a fixed amount (<0.1 nM) of radiolabelled ARC594 in buffer containing a fixed amount (0.1 nM) of the target related to the aptamer ( PDGF-BB; PeproTech): The non-PEGylated version of ARC594 was radiolabeled at the 5 'end by incubation with r-32P-ATP (ICN) and polynucleotide kinase (NEB). Binding reactions were carried out in phosphate buffered saline (Cellgro) containing 0.2 mg / ml bovine serum albumin (NEB) and 0.02 mg / ml tRNA (Sigma). The reactions were equilibrated over a period of 15-30 minutes at room temperature, then filtered through a sandwich of nitrocellulose membranes (Protra membrane, Perkin-Elmer) and nylon (Hybond membrane, Amersham) to separate the aptamer bound to target aptamer target. Subsequent autoradiographic analysis of the filter membranes corresponding to each concentration of unlabeled aptamer revealed the degree of competitive displacement of 32P-ARC594 per unlabeled aptamer. The data were expressed as the ratio of counts per minute (CPM) of radioactivity due to 32P-ARC594 bound to PDGF-BB on the nitrocellulose membrane (CPMnitrocellulose or CPMnc) with respect to total CPM (CPMtotal = CPMnitrocellulose + CPMnailon).

[0454] Of the different PDGF ligands, ARC594 had the highest affinity for PDGF-BB (Kd = 0.09 ± 0.02 nM) and PDGF-AB (Kd = 0.10 ± 0.01 nM), but no PDGF-AA (Kd = 2.6 ± 0.2 nM (Figure 55).

[0455] As a secondary test of both plasma pharmacokinetics and in vivo bioactivity of ARC594, the competition binding assay was used to test the same plasma samples used to generate pharmacokinetic data. Serial 1:10 solutions of the plasma sample in phosphate buffered saline (1X PBS) were prepared and mixed with a fixed concentration of 32P-ARC594, then added to human PDGF-BB. The final concentration of PDGF in each assay was 0.1 nM, and the final concentration of 32P-ARC594 <0.1 nM. In this experiment, plasma samples were analyzed by comparing with a standard curve generated with samples of known ARC594 concentrations in 1X PBS. Compared to the reference standards, the effective concentration of active aptamer could be calculated in each plasma sample.

[0456] The results of this study indicate that a dose of 10 mg / kg of ARC594 has a half-life of approximately 4 hours (Figures 56A and 56B), and the pharmacodynamic profile is according to its pharmacokinetic data (Figure 57). The bioactivity profile of this ex vivo analysis, shown in Figure 57, provides verification that (1) the aptamer was present and active in the mouse model plasma at t = 48 h after the dose; and (2) plasma concentrations calculated from the fluorescence-based pharmacokinetic assay were correct.

SEQUENCE LIST

<110> Archemix Corp. et al.

<120> Stabilized aptamers for platelet-derived growth factor and its use as oncological therapeutic agents

<130> 23239-558A CIP3-061

<140> To be determined

<141> 11/02/2005

<150>

US 10 / 980.211 <151> 11/02/2004

<150>

US 60 / 632.358 <151> 11/30/2004

<150>

US 60 / 632.609 <151> 12/01/2004

<150>

US 60 / 652.496 <151> 02/10/2005

<150>

US 60 / 652.494 <151> 02/11/2005

<150>

US 60 / 667,866 <151> 04/01/2005

<150>

US 60 / 672.200 <151> 04/15/2005

<160> 102

<170> PatentIn version 3.2

<210> 1

<211> 9

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> modified_base

<222> (6) .. (6)

<223> uridine is 2'-fluorine

<220>

<221> modified_base

<222> (8) .. (8)

<223> citidine is 2'-fluorine

<220>

<221> modified_base

<222> (9) .. (9)

<223> gm

<400> 1

<210> 2

<211> 12

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> modified_base

<222> (5) .. (5)

<223> gm

<220>

<221> modified_base

<222> (7) .. (7)

<223> gm

<220>

<221> modified_base

<222> (10) .. (10)

<223> uridine is 2'-fluorine

<220>

<221> modified_base

<222> (11) .. (11)

<223> citidine is 2'-fluorine

<220>

<221> modified_base

<222> (12) .. (12)

<223> Adenosine is 2'-O-methyl

<400> 2

<210> 3

<211> 8

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> modified_base

<222> (5) .. (6)

<223> citidine is 2'-fluorine

<220>

<221> modified_base

<222> (7) .. (7)

<223> uridine is 2'-fluorine

<220>

<221> modified_base

<222> (8) .. (8)

<223> gm

<400> 3

<210> 4

<211> 9

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> modified_base

<222> (4) .. (4)

<223> citidine is 2'-fluorine

<220>

<221> modified_base

<222> (5) .. (5)

<223> gm

<220>

<221> modified_base

<222> (6) .. (6)

<223> uridine is 2'-fluorine

<220>

<221> modified_base

<222> (8) .. (8)

<223> citidine is 2'-fluorine

<220>

<221> modified_base

<222> (9) .. (9)

<223> gm

<400> 4

<210> 5

<211> 12

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> modified_base

<222> (7) .. (7)

<223> gm

<220> <221> modified_base

<222> (10) .. (10)

<223> uridine is 2'-fluorine

<220>

<221> modified_base

<222> (11) .. (11)

<223> citidine is 2'-fluorine

<220>

<221> modified_base <222> (12) .. (12)

<223> Adenosine is 2'-O-methyl

<400> 5

<210> 6

<211> 8

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> modified_base

<222> (6) .. (6)

<223> citidine is 2'-fluorine

<220>

<221> modified_base

<222> (7) .. (7)

<223> uridine is 2'-fluorine

<220>

<221> modified_base

<222> (8) .. (8)

<223> gm

<400> 6

<210> 7

<211> 23

<212> RNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> modified_base

<222> (1) .. (23)

<223> All pyrimidines and all purines are 2'-O-methyl

<400> 7

<210> 8

<211> 29

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<400> 8

<210> 9

<211> 56

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> modified_base

<222> (10) .. (32)

<223> Of nucleotides 10 to 32, all purines (A and G) and all pyrimidines (C and U) are 2'-O-methyl

<400> 9

<210> 10

<211> 54

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> modified_base

<222> (10) .. (30)

<223> Of nucleotides 10 to 30, all purines (A and G) and all pyrimidines (C and U) are 2'-O-methyl

<400> 10

<210> 11

<211> 39

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<210> 12

<211> 22

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220> <221> misc_feature

<222> (1) .. (22)

<223> phosphorothioate skeleton

<400> 12

<210> 13

<211> 14

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> misc_feature

<222> (1) .. (14)

<223> phosphorothioate skeleton

<400> 13

<210> 14

<211> 12

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> misc_feature

<222> (1) .. (12)

<223> phosphorothioate skeleton

<400> 14

<210> 15

<211> 10

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> misc_feature

<222> (1) .. (10)

<223> phosphorothioate skeleton

<400> 15

<210> 16

<211> 13

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> misc_feature

<222> (1) .. (13)

<223> phosphorothioate skeleton

<400> 16

<210> 17

<211> 24

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> misc_feature

<222> (1) .. (24)

<223> phosphorothioate skeleton

<400> 17

<210> 18

<211> 18

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> misc_feature

<222> (1) .. (18)

<223> phosphorothioate skeleton

<400> 18

<210> 19

<211> 14

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> misc_feature

<222> (1) .. (14)

<223> phosphorothioate skeleton

<400> 19

<210> 20

<211> 46

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> misc_feature

<222> (1) .. (11)

<223> phosphorothioate skeleton between nucleotides 1-11

<220>

<221> misc_feature

<222> (44) .. (46)

<223> phosphorothioate skeleton between nucleotides 44-46

<400> 20

<210> 21

<211> 49

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> misc_feature

<222> (1) .. (14)

<223> phosphorothioate skeleton between nucleotides 1-14

<220>

<221> misc_feature

<222> (47) .. (49)

<223> phosphorothioate skeleton between nucleotides 47-49

<400> 21

<210> 22

<211> 64

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> misc_feature

<222> (1) .. (23)

<223> phosphorothioate skeleton between nucleotides 1-23

<220>

<221> misc_feature

<222> (56) .. (64)

<223> phosphorothioate skeleton between nucleotides 56-64

<400> 22 <210> 23

<211> 34

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> misc_feature

<222> (1) .. (4)

<223> phosphorothioate skeleton between nucleotides 1-4

<220>

<221> misc_feature

<222> (8) .. (13)

<223> phosphorothioate skeleton between nucleotides 8-13

<220>

<221> misc_feature

<222> (31) .. (34)

<223> phosphorothioate skeleton between nucleotides 31-34

<400> 23

<210> 24

<211> 35

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> misc_feature

<222> (1) .. (4)

<223> phosphorothioate skeleton between nucleotides 1-4

<220>

<221> misc_feature

<222> (8) .. (14)

<223> phosphorothioate skeleton between nucleotides 8-14

<220>

<221> misc_feature

<222> (32) .. (35)

<223> phosphorothioate skeleton between nucleotides 32-35

<400> 24

<210> 25

<211> 35

<212> DNA

<213> Artificial

<220> <223> Synthetic aptamer

<220>

<221> misc_feature

<222> (1) .. (4)

<223> phosphorothioate skeleton between nucleotides 1-4

<220>

<221> misc_feature

<222> (8) .. (14)

<223> phosphorothioate skeleton between nucleotides 8-14

<220>

<221> misc_feature

<222> (32) .. (35)

<223> phosphorothioate skeleton between nucleotides 32-35

<400> 25

<210> 26

<211> 34

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> misc_feature

<222> (1) .. (4)

<223> phosphorothioate skeleton between nucleotides 1-4

<220>

<221> misc_feature

<222> (8) .. (13)

<223> phosphorothioate skeleton between nucleotides 8-13

<220>

<221> misc_feature

<222> (31) .. (34)

<223> phosphorothioate skeleton between nucleotides 31-34

<400> 26

<210> 27

<211> 36

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> misc_feature

<222> (1) .. (4)

<223> phosphorothioate skeleton between nucleotides 1-4

<220>

<221> misc_feature

<222> (8) .. (15)

<223> phosphorothioate skeleton between nucleotides 8-15

<220>

<221> misc_feature

<222> (33) .. (36)

<223> phosphorothioate skeleton between nucleotides 33-36

<400> 27

<210> 28

<211> 35

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> misc_feature

<222> (1) .. (4)

<223> phosphorothioate skeleton between nucleotides 1-4

<220>

<221> misc_feature

<222> (32) .. (35)

<223> phosphorothioate skeleton between nucleotides 32-35

<400> 28

<210> 29

<211> 35

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> misc_feature

<222> (1) .. (3)

<223> phosphorothioate skeleton between nucleotides 1-3

<220>

<221> misc_feature

<222> (33) .. (35)

<223> phosphorothioate skeleton between nucleotides 33-35

<400> 29

<210> 30

<211> 36

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> misc_feature <222> (1) .. (4)

<223> phosphorothioate skeleton between nucleotides 1-4

<220>

<221> misc_feature

<222> (33) .. (36)

<223> phosphorothioate skeleton between nucleotides 33-36

<400> 30

<210> 31

<211> 36

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> misc_feature

<222> (1) .. (4)

<223> phosphorothioate skeleton between nucleotides 1-4

<220>

<221> misc_feature

<222> (33) .. (36)

<223> phosphorothioate skeleton between nucleotides 33-36

<400> 31

<210> 32

<211> 36

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> misc_feature

<222> (1) .. (4)

<223> phosphorothioate skeleton between nucleotides 1-4

<220>

<221> misc_feature

<222> (33) .. (36)

<223> phosphorothioate skeleton between nucleotides 33-36

<400> 32

<210> 33

<211> 36

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220> <221> misc_feature

<222> (1) .. (4)

<223> phosphorothioate skeleton between nucleotides 1-4

<220>

<221> misc_feature

<222> (33) .. (36)

<223> phosphorothioate skeleton between nucleotides 33-36

<400> 33

<210> 34

<211> 35

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> misc_feature

<222> (1) .. (4)

<223> phosphorothioate skeleton between nucleotides 1-4

<220>

<221> misc_feature

<222> (8) .. (14)

<223> phosphorothioate skeleton between nucleotides 8-14

<220>

<221> misc_feature

<222> (32) .. (35)

<223> phosphorothioate skeleton between nucleotides 32-35

<400> 34

<210> 35

<211> 36

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> misc_feature

<222> (1) .. (4)

<223> phosphorothioate skeleton between nucleotides 1-4

<220>

<221> misc_feature

<222> (8) .. (15)

<223> phosphorothioate skeleton between nucleotides 8-15

<220>

<221> misc_feature

<222> (33) .. (36)

<223> phosphorothioate skeleton between nucleotides 33-36

<400> 35 <210> 36

<211> 9

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> modified_base

<222> (9) .. (9)

<223> gm

<400> 36

<210> 37

<211> 12

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> modified_base

<222> (5) .. (5)

<223> gm

<220>

<221> modified_base

<222> (7) .. (7)

<223> gm

<220>

<221> modified_base

<222> (12) .. (12)

<223> Adenosine is 2'-O-methyl

<400> 37

<210> 38

<211> 8

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> modified_base

<222> (8) .. (8)

<223> gm

<400> 38

<210> 39

<211> 9

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> modified_base

<222> (6) .. (6)

<223> um

<220>

<221> modified_base

<222> (8) .. (8)

<223> cm

<220>

<221> modified_base

<222> (9) .. (9)

<223> gm

<400> 39

<210> 40

<211> 12

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> modified_base

<222> (5) .. (5)

<223> gm

<220>

<221> modified_base

<222> (7) .. (7)

<223> gm

<220>

<221> modified_base

<222> (10) .. (10)

<223> um

<220>

<221> modified_base

<222> (11) .. (11)

<223> cm

<220>

<221> modified_base

<222> (12) .. (12)

<223> Adenosine is 2'-O-methyl

<400> 40

<210> 41

<211> 8

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> modified_base

<222> (5) .. (6)

<223> cm

<220>

<221> modified_base

<222> (7) .. (7)

<223> um

<220>

<221> modified_base

<222> (8) .. (8)

<223> gm

<400> 41

<210> 42

<211> 9

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<400> 42

<210> 43

<211> 12

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<400> 43

<210> 44

<211> 8

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<400> 44

<210> 45

<211> 9

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> modified_base

<222> (1) .. (9)

<223> All purines (A and G) and all pyrimidines (C and U) are 2'-O-methyl

<400> 45

<210> 46

<211> 12

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> modified_base

<222> (1) .. (12)

<223> All purines (A and G) and all pyrimidines (C and U) are 2'-O-methyl

<400> 46

<210> 47

<211> 8

<212> RNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> modified_base

<222> (1) .. (8)

<223> All purines (A and G) and all pyrimidines (C and U) are 2'-O-methyl

<400> 47

<210> 48

<211> 10

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<400> 48

<210> 49

<211> 9

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<400> 49

<210> 50

<211> 11

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<400> 50

<210> 51

<211> 10

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<400> 51

<210> 52

<211> 9

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> modified_base

<222> (1) .. (1)

<223> cm

<220>

<221> modified_base

<222> (2) .. (2)

<223> Adenosine is 2'-O-methyl

<220>

<221> modified_base

<222> (3) .. (4)

<223> gm

<400> 52

<210> 53

<211> 9

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> modified_base

<222> (5) .. (6)

<223> cm

<220>

<221> modified_base

<222> (7) .. (7)

<223> um

<220>

<221> modified_base

<222> (8) .. (8)

<223> gm

<220>

<221> modified_base

<222> (9) .. (9)

<223> um

<400> 53

<210> 54

<211> 10

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> modified_base

<222> (5) .. (6)

<223> cm

<220>

<221> modified_base

<222> (7) .. (7)

<223> um

<220>

<221> modified_base

<222> (8) .. (8)

<223> gm

<220>

<221> modified_base

<222> (9) .. (9)

<223> um

<220>

<221> modified_base

<222> (10) .. (10)

<223> gm

<400> 54

<210> 55

<211> 9

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> modified_base

<222> (8) .. (8)

<223> cm

<220>

<221> modified_base

<222> (9) .. (9)

<223> gm

<400> 55

<210> 56

<211> 9

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> modified_base

<222> (6) .. (6)

<223> um

<220>

<221> modified_base

<222> (9) .. (9)

<223> gm

<400> 56

<210> 57

<211> 12

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> modified_base

<222> (5) .. (5)

<223> gm

<220>

<221> modified_base

<222> (7) .. (7)

<223> gm

<220>

<221> modified_base

<222> (11) .. (11)

<223> cm <220>

<221> modified_base

<222> (12) .. (12)

<223> 2'-O-methyl-adenosine

<400> 57

<210> 58

<211> 12

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> modified_base

<222> (5) .. (5)

<223> gm

<220>

<221> modified_base

<222> (7) .. (7)

<223> gm

<220>

<221> modified_base

<222> (10) .. (10)

<223> um

<220>

<221> modified_base

<222> (12) .. (12)

<223> 2'-O-methyl-adenosine

<400> 58

<210> 59

<211> 9

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> modified_base

<222> (5) .. (5)

<223> cm

<220>

<221> modified_base

<222> (6) .. (6)

<223> um

<220>

<221> modified_base

<222> (8) .. (8)

<223> cm

<400> 59

<210> 60

<211> 12

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> modified_base

<222> (1) .. (1)

<223> cm

<220>

<221> modified_base

<222> (3) .. (3)

<223> um

<220>

<221> modified_base

<222> (8) .. (8)

<223> cm

<220>

<221> modified_base

<222> (10) .. (10)

<223> um

<220>

<221> modified_base

<222> (11) .. (11)

<223> cm

<400> 60

<210> 61

<211> 8

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> modified_base

<222> (1) .. (1)

<223> um

<220>

<221> modified_base

<222> (4) .. (4)

<223> um

<220>

<221> modified_base

<222> (5) .. (6)

<223> cm

<220>

<221> modified_base

<222> (7) .. (7)

<223> um

<400> 61

<210> 62

<211> 8

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> modified_base

<222> (6) .. (6)

<223> cm

<220>

<221> modified_base

<222> (7) .. (7) <223> um

<220>

<221> modified_base

<222> (8) .. (8)

<223> gm

<400> 62

<210> 63

<211> 11

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> modified_base

<222> (11) .. (11)

<223> gm

<400> 63

<210> 64

<211> 10

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<400> 64

<210> 65

<211> 10

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> modified_base

<222> (6) .. (6)

<223> cm

<220>

<221> modified_base

<222> (7) .. (7)

<223> um

<220>

<221> modified_base

<222> (8) .. (8)

<223> gm

<220>

<221> modified_base

<222> (9) .. (9)

<223> um

<220>

<221> modified_base

<222> (10) .. (10)

<223> gm

<400> 65

<210> 65

<211> 11

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> modified_base

<222> (8) .. (8)

<223> um

<220>

<221> modified_base

<222> (10) .. (10)

<223> cm

<220>

<221> modified_base

<222> (11) .. (11)

<223> gm

<400> 66

<210> 67

<211> 8

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> modified_base

<222> (5) .. (5)

<223> cm

<220>

<221> modified_base

<222> (7) .. (7)

<223> um

<220>

<221> modified_base

<222> (8) .. (8)

<223> gm

<400> 67

<210> 68

<211> 8

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> modified_base

<222> (5) .. (6)

<223> cm

<220>

<221> modified_base

<222> (8) .. (8)

<223> gm

<400> 68

<210> 69

<211> 11

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> modified_base

<222> (11) .. (11)

<223> gm

<400> 69

<210> 70

<211> 10

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> modified_base

<222> (5) .. (5)

<223> cm

<220>

<221> modified_base

<222> (8) .. (10)

<223> gm

<400> 70

<210> 71

<211> 10

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> modified_base

<222> (8) .. (10)

<223> gm

<400> 71

<210> 72

<211> 10

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<400> 72

<210> 73

<211> 10

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> modified_base

<222> (5) .. (5)

<223> cm

<400> 73 <210> 74

<211> 88

<212> RNA

<213> Artificial

<220>

<223> synthetic mold

<220>

<221> modified_base

<222> (1) .. (88)

<223> All pyrimidines (C and U) are 2'-fluorine

<220>

<221> misc_feature

<222> (25) .. (64)

<223> n is a, g, c or u

<400> 74

<210> 75

<211> 41

<212> DNA

<213> Artificial

<220>

<223> synthetic primer

<400> 75

<210> 76

<211> 24

<212> DNA

<213> Artificial

<220>

<223> synthetic primer

<400> 76

<210> 77

<211> 87

<212> RNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> modified_base

<222> (1) .. (87)

<223> All pyrimidines (C and U) are 2'-fluorine

<400> 77 <210> 78

<211> 88

<212> RNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> modified_base

<222> (1) .. (88)

<223> All pyrimidines (C and U) are 2'-fluorine

<400> 78

<210> 79

<211> 88

<212> RNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> modified_base

<222> (1) .. (88)

<223> All pyrimidines (C and U) are 2'-fluorine

<400> 79

<210> 80

<211> 88

<212> RNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> modified_base

<222> (1) .. (88)

<223> All pyrimidines (C and U) are 2'-fluorine

<400> 80

<210> 81

<211> 88

<212> RNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> modified_base

<222> (1) .. (88)

<223> All pyrimidines (C and U) are 2'-fluorine

<400> 81

<210> 82

<211> 93

<212> DNA

<213> Artificial

<220>

<223> synthetic mold

<220>

<221> modified_base

<222> (1) .. (93)

<223> All purines (A and G) and all pyrimidines (C and T) can be 2'-O-methyl

<220>

<221> misc_feature

<222> (25) .. (54)

<223> n is a, g, c or t

<400> 82

<210> 83

<211> 92

<212> DNA

<213> Artificial

<220>

<223> synthetic mold

<220>

<221> misc_feature

<222> (1) .. (92)

<223> All purines (A and G) and all pyrimidines (C and T) can be 2'-O-methyl

<220>

<221> misc_feature

<222> (24) .. (53)

<223> n is a, g, c, or t

<400> 83 <210> 84

<211> 92

<212> DNA

<213> Artificial

<220>

<223> synthetic mold

<220>

<221> modified_base

<222> (1) .. (92)

<223> All pyrimidines (C and T) can be 2'-O-methyl

<220>

<221> misc_feature

<222> (24) .. (53)

<223> n is a, g, c or t

<400> 84

<210> 85

<211> 10

<212> DNA

<213> Artificial

<220>

<223> synthetic

<400> 85

<210> 86

<211> 26

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> modified_base

<222> (11) .. (14)

<223> 2'-O-methyl

<220>

<221> modified_base

<222> (19) .. (19)

<223> 2'-O-methyl

<220>

<221> modified_base

<222> (21) .. (21)

<223> 2'-O-methyl

<220>

<221> modified_base

<222> (24) .. (26)

<223> 2'-O-methyl

<400> 86

<210> 87

<211> 10

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> modified_base

<222> (5) .. (5)

<223> 2'-O-methyl

<220>

<221> modified_base

<222> (8) .. (10)

<223> 2'-O-methyl

<400> 87

<210> 88

<211> 27

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> modified_base

<222> (11) .. (15)

<223> 2'-O-methyl

<220>

<221> modified_base

<222> (20) .. (20)

<223> 2'-O-methyl

<220>

<221> modified_base

<222> (22) .. (22)

<223> 2'-O-methyl

<220>

<221> modified_base

<222> (25) .. (27)

<223> 2'-O-methyl

<400> 88

<210> 89

<211> 11

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> modified_base

<222> (11) .. (11)

<223> 2'-O-methyl

<400> 89

<210> 90

<211> 6

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<400> 90

<210> 91

<211> 25

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> modified_base

<222> (5) .. (5)

<223> 2'-O-methyl

<220>

<221> modified_base

<222> (7) .. (7)

<223> 2'-O-methyl

<220>

<221> modified_base

<222> (10) .. (15)

<223> 2'-O-methyl

<220>

<221> modified_base

<222> (20) .. (20)

<223> 2'-O-methyl

<220>

<221> modified_base

<222> (23) .. (25)

<223> 2'-O-methyl

<400> 91

<210> 92

<211> 4

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<400> 92

<210> 93

<211> 26

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> modified_base

<222> (5) .. (5)

<223> 2'-O-methyl

<220>

<221> modified_base

<222> (7) .. (7)

<223> 2'-O-methyl

<220>

<221> modified_base

<222> (10) .. (16)

<223> 2'-O-methyl

<220>

<221> modified_base

<222> (21) .. (21)

<223> 2'-O-methyl

<220>

<221> modified_base

<222> (24) .. (26)

<223> 2'-O-methyl

<400> 93

<210> 94

<211> 39

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> modified_base

<222> (11) .. (14)

<223> 2'-O-methyl

<220>

<221> modified_base

<222> (19) .. (19)

<223> 2'-O-methyl <220>

<221> modified_base

<222> (21) .. (21)

<223> 2'-O-methyl

<220>

<221> modified_base

<222> (24) .. (29)

<223> 2'-O-methyl

<220>

<221> modified_base

<222> (34) .. (34)

<223> 2'-O-methyl

<220>

<221> modified_base

<222> (37) .. (39)

<223> 2'-O-methyl

<400> 94

<210> 95

<211> 41

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> modified_base

<222> (11) .. (15)

<223> 2'-O-methyl

<220>

<221> modified_base

<222> (20) .. (20)

<223> 2'-O-methyl

<220>

<221> modified_base

<222> (22) .. (22)

<223> 2'-O-methyl

<220>

<221> modified_base

<222> (25) .. (31)

<223> 2'-O-methyl

<220>

<221> modified_base

<222> (36) .. (36)

<223> 2'-O-methyl

<220>

<221> modified_base

<222> (39) .. (41)

<223> 2'-O-methyl

<400> 95 <210> 96

<211> 4

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<400> 96

<210> 97

<211> 4

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<400> 97

<210> 98

<211> 6

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<400> 98

<210> 99

<211> 4

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> misc_feature

<222> (1) .. (1)

<220>

<221> misc_feature

<222> (1) .. (1)

<223> n is a, c, g or t

<220>

<221> misc_feature

<222> (4) .. (4)

<220>

<221> misc_feature

<222> (4) .. (4)

<223> n is a, c, g or t

<400> 99

<210> 100

<211> 6

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> misc_feature

<222> (1) .. (2)

<223> n is a, c, g or t

<220>

<221> misc_feature

<222> (5) .. (6)

<223> n is a, c, g or t

<400> 100

<210> 101

<211> 6

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<400> 101

<210> 102 <211> 10

<212> DNA

<213> Artificial

<220>

<223> Synthetic aptamer

<220>

<221> modified_base

<222> (5) .. (5)

<223> 2'-O-methyl

<220>

<221> modified_base

<222> (8) .. (10)

<223> 2'-O-methyl

<400> 102

Claims (11)

1. A specific aptamer for PDGF comprising the following structure: in which  indicates a linker 10 Atamer = 5'dCdCdCdAdGdGdCdTdAdCmG (SEQ ID NO: 69) - PEG-dCdGdTdAmGdAmGdCdAmUmCmA (SEQ ID NO: 40) - PEG - dTdGdAdTmCdCdTmGmGmG (SEC) ID: 70 in which d denotes a deoxy-nucleotide, m denotes a 2'-OMe-nucleotide, PEG denotes a PEG spacer and 3T denotes an inverted deoxy-thymidine cap. The aptamer of claim 1, wherein the linker is an alkyl linker. 3. The aptamer of claim 2, wherein the alkyl linker comprises 2 to 18 consecutive CH2 groups. 4. The aptamer of claim 2, wherein the alkyl linker comprises 2 to 12 consecutive CH2 groups. twenty

5.

 The aptamer of claim 2, wherein the alkyl linker comprises 3 to 6 consecutive CH2 groups.

6.

 The aptamer of claim 5, wherein the aptamer comprises the following structure:

in which Atamer = 5'dCdCdCdAdGdGdCdTdAdCmG (SEQ ID NO: 69) -PEG -dCdGdTdAmGdAmGdCdAmUmCmA (SEQ ID NO: 40) - PEG - dTdGdATmCdCdTmGmGmG (SEC # 3: SEC) in which d denotes a deoxy-nucleotide, m denotes a 2'-OMe-nucleotide, PEG denotes a PEG spacer and 3T 30 denotes an inverted deoxy-thymidine cap. 7. An aptamer according to any one of claims 1-6, wherein the spacer is a PEG spacer 6. A composition comprising a therapeutically effective amount of an aptamer of any one of claims 1-7 or a salt thereof. 9. The composition of claim 8, wherein the composition comprises a pharmaceutically carrier Acceptable or diluent. 40 10. A composition according to claim 9 for use in a method for treating a solid tumor, a method comprising administering the composition to a subject having the solid tumor. 11. The composition for use according to claim 10, the method of treating a solid tumor further comprising administering to the subject a cytotoxic agent. 12. A PDGF specific aptamer according to any one of claims 1-7 for use in a method of treating a PDGF mediated tumor in a subject, the method comprising administering the specific PDGF aptamer to the subject and treating the subject with radiotherapy. .