ES2359629T3 - PROTEIN G CHEMIOKIN RECEIVER G (CCR5) HUMAN HDGNR10 PROTEIN CHEMIOKIN RECEIVER G (CCR5) HUMAN HDGNR10 PROTEIN CHEMIOKIN RECEIVER G (CCR5) HUMAN HDGNR10 GIRIOCIN 10 GETHROGEN RECR. 10 - Google Patents

Abstract

A human or humanized antibody or fragment thereof that binds to G-protein Chemokine Receptor polypeptide (CCR5), said antibody or fragment thereof comprising: (a) the amino acid sequences of the VH domain of the antibody expressed by the cell line of hybridoma deposited with the Deposit No. of ATCC PTA-4054; and (b) the amino acid sequence of the VL domain of the antibody expressed by the hybridoma cell line deposited with the ATCC Deposit No. PTA-4054.

Description

Field of the Invention

The present invention relates to antibodies that bind with the G-protein Chemokine Receptor polypeptide (CCR5), as defined in the claims as well as polynucleotides encoding said antibodies and corresponding vectors and host cells. The invention also relates to a method for preparing an antibody or fragment thereof comprising expressing the antibody or fragment thereof, encoded by the polynucleotide as defined in the claims and recovering said antibody or fragment thereof. The invention further relates to pharmaceutical compositions comprising the antibodies of the invention and the use of the antibodies of the invention for the treatment or prevention of HIV or rheumatoid arthritis. Methods for detecting the expression of a G-protein Chemokine Receptor (CCR5) that can be used to detect diseases, disorders and / or conditions related to the immune system are also provided. In particular, the invention relates to methods for detecting, diagnosing or predicting HIV infection or rheumatoid arthritis and / or conditions associated with HIV infection. Kits comprising antibodies of the invention are also provided. The G-protein Chemokine Receptor (CCR5) is also known as CCR5.

Background of the Invention

It is well established that many medically significant biological processes are mediated by proteins that participate in signal transduction pathways that involve G proteins and / or second messengers, for example, cAMP (Lefkowitz, Nature, 351: 353-354 (1991)) . Herein these proteins are called proteins that participate in routes with G proteins or PPG proteins. Some examples of these proteins include GPC receptors, such as those of adrenergic agents and dopamine (Koblika, BK, et al., PNAS, 84: 46-50 (1987); Koblika, BK, et al., Science, 238: 650 -656 (1987); Bunzow, JR, et al., Nature, 336: 783-787 (1988)), G proteins themselves, effector proteins, for example, phospholipase C, adenyl cyclase and phosphodiesterase, and acting proteins, for example, protein kinase A and protein kinase C (Simon, M. I, et al., Science, 252: 802-8 (1991)).

For example, in a form of signal transduction, the effect of hormone binding is the activation of an enzyme, adenylate cyclase, within the cell. Enzyme activation by hormones is dependent on the presence of the GTP nucleotide and GTP also influences hormone binding. A G protein connects the hormone receptors with adenylate cyclase. It has been shown that G protein exchanges GTP for bound GDP when activated by hormone receptors. The form carrying GTP is then linked to an activated adenylate cyclase. Hydrolysis of GTP to GDP, catalyzed by the G protein itself, returns the G protein to its inactivated basal form. Thus, protein G serves a double role, as an intermediary that transmits the signal from the receiver to the effector and as a clock that controls the duration of the signal.

The membrane protein gene superfamily of G-protein coupled receptors has been characterized by having seven potential transmembrane domains. It is believed that the domains represent -transmembrane helices connected by extracellular or cytoplasmic loops. G-protein coupled receptors include a wide variety of biologically active receptors, such as hormonal, viral, growth factor and neuroreceptor.

G-protein coupled receptors have been characterized as inclusive of these seven conserved hydrophobic stretches of approximately 20 to 30 amino acids, which connect at least eight divergent hydrophilic loops. The G-protein family of coupled receptors includes dopamine receptors that bind to neuroleptic drugs used for the treatment of psychotic and neurological disorders. Other examples of members of this family include calcitonin, adrenergic, endothelin, cAMP, adenosine, muscarinic, acetylcholine, serotonin, histamine, thrombin, quinine, follicle-stimulating hormone, opsin, and Endothelial differentiation gene receptor 1 and receptors of rhodopsins, odorants, cytomegalovirus, etc.

G protein-coupled receptors can be intracellularly coupled by heterotrimeric G proteins to various enzymes, ion channels and intracellular transporters (see, Johnson et al., Endoc., Rev., 10: 317-331 (1989)). Different un G protein subunits preferably stimulate particular effectors to modulate various biological functions in a cell. Phosphorylation of cytoplasmic residues of G-protein coupled receptors have been identified as an important mechanism for the regulation of G protein coupling of some G-protein coupled receptors. G-protein coupled receptors are found in numerous sites within a mammalian host. .

Chemokines, also called intercrine cytokines, are a subfamily of structurally and functionally related cytokines. These molecules are 8-10 kd in size. In general, chemokines show a homology of 20% to 75% at the amino acid level and are characterized by four conserved cysteine residues that form two disulfide bonds. Based on the arrangement of the first two cysteine residues, chemokines have been classified into two subfamilies, alpha and beta. In the alpha subfamily, the first two cysteines are separated by an amino acid and are therefore called the "C-X-C" subfamily. In the beta subfamily, the two cysteines are in an adjacent position, and are therefore called the "C-C" subfamily. So far, at least nine different members of this family have been identified in humans.

Intercrine cytokines show a wide variety of functions. A distinctive feature is its ability to induce chemotactic migration of different cell types, including monocytes, neutrophils, T lymphocytes, basophils and fibroblasts. Many chemokines have proinflammatory activity and are involved in multiple stages during an inflammatory reaction. These activities include stimulation of histamine release, lysosomal enzyme and leukotriene release, increased adherence of target immune cells to endothelial cells, enhanced complement protein binding, induced expression of granulocyte adhesion adhesion molecules and complement receptors and respiratory explosion. In addition to its involvement in inflammation, certain chemokines have been shown to show other activities. For example, macrophage inflammatory protein 1 (MIP-1) is capable of suppressing the proliferation of hematopoietic stem cells, platelet factor 4 (PF-4) is a potent inhibitor of endothelial cell growth, Interleukin 8 (IL- 8) promotes keratinocyte proliferation and GRO is an autocrine growth factor for melanoma cells.

In light of the various biological activities, it is not surprising that chemokines have been implicated in various physiological conditions and diseases, including lymphocyte trafficking, scarring, hematopoietic regulation and immunological disorders such as allergy, asthma and arthritis.

Thus, there is a need for polypeptides that modulate the regulation of the immune system, since alterations of said regulation may be involved in diseases, disorders and / or conditions that are related to the immune system. Therefore, there is a need for identification and characterization of such human polypeptides that can play a role in the detection, prevention, improvement or correction of such diseases, disorders and / or conditions.

The G-protein Chemokine Receptor (CCR5) is a seven-step transmembrane G-protein coupled receptor that is expressed in immune system cells such as, for example macrophages, including immature dendritic cells such as Langerhans cells and T lymphocytes, including effector lymphocytes Th0 and Th1. The G-protein Chemokine Receptor (CCR5) has also been detected in microglia, astrocytes, neurons and vascular endothelial cells of the central nervous system (CNS). G-protein chemokine receptor (CCR5) is also expressed in monocytes and T lymphocytes in synovial fluid of patients with rheumatoid arthritis and has also been implicated in other forms of arthritis.

G-protein Chemokine Receptor ligands (CCR5) include MIP-1, MTP-1, MCP-1, MCP-2, MCP-3, MCP-4, RANTES, and Eotaxin. CCR5 is also a major coreceptor for HIV and can also be recognized by other infectious agents, such as other viruses, to allow entry into the cell. It has recently been discovered that certain individuals harboring a mutation of the CCR5 gene were resistant to HIV infection despite multiple exposures to the virus. This mutation nullified the expression of CCR5 on the cell surface (Liu et al., Cell 86: 1 (1996)).

HIV is currently the most important lethal infectious disease in the world, causing 2.6 million deaths in 1999. The number of deaths resulting from HIV infection continues to increase; In 1999, there were 5.6 million new cases of HIV infection and 33.6 million infected people living in the world. Although there are currently 14 drugs approved to treat HIV, up to half of the patients fail to be treated successfully (defining success as having no detectable HIV RNA in serum (which in effect is equal to or less than 50 copies / ml of RNA from HIV-1) after one year of drug regimen The reasons for the inability of these pharmacological regimens to effectively treat HIV are multiple: the use of certain drugs results in the development of drug-resistant strains of HIV; some individuals they are intolerant of certain drugs or the drugs have negative side effects; patients have difficulty following complex dosing regimens; and the drugs may not be able to access HIV stores in the body. Thus, there is still a need in the technique of developing vaccines and improved HIV therapies.

Compendium of the Invention

The present invention relates to a human or humanized antibody or fragment thereof that binds to the G-protein Chemokine Receptor polypeptide (CCR5), said antibody or fragment thereof comprising:

(to)

 the amino acid sequence of the VH domain of the antibody expressed by the hybridoma cell line deposited with the ATCC Deposit No. PTA-4054; Y

(b)

 the amino acid sequence of the VL domain of the antibody expressed by the hybridoma cell line deposited with the ATCC Deposit No. PTA-4054.

In addition, the present invention relates to a human or humanized antibody or fragment thereof that specifically binds to the G-protein Chemokine Receptor polypeptide (CCR5), said antibody comprising

or fragment thereof the amino acid sequences of each of the domains VHCDR1, VHCDR2, VHCDR3, VLCDR1, VLCDR2 and VLCDR3 of the antibody expressed by the hybridoma cell line deposited with the ATCC Deposit No. PTA-4054;

said antibody or fragment thereof having an activity selected from the group consisting of:

(to)

 inhibition of the binding of RANTES with cells expressing G-protein Chemokine Receptor (CCR5);

(b)

 inhibition of MIP-1alpha binding with cells expressing the G-protein Chemokine Receptor (CCR5); Y

(C)

 inhibition of the binding of MIP-1 beta with cells expressing the G-protein Chemokine Receptor (CCR5);

and said antibody or fragment thereof having an activity selected from the group consisting of:

(d)

 inhibition of HIV binding with cells expressing G-protein Chemokine Receptor (CCR5); Y

(and)

 inhibition of HIV infection of cells expressing the G-protein Chemokine Receptor (CCR5).

The invention further relates to an antibody expressed by the cell line deposited with the ATCC Deposit No. PTA-4054. In addition, the invention relates to a polynucleotide encoding the antibody or fragment thereof of the invention, to a vector comprising the polynucleotide of the invention and to a host cell comprising the vector of the invention or the polynucleotide of the invention.

The invention also encompasses a method for preparing an antibody or fragment thereof comprising:

(to)

 expressing the antibody or fragment thereof encoded by the polynucleotide of the invention; Y

(b)

 recover said antibody or fragment thereof.

The present invention also relates to a pharmaceutical composition comprising the human or humanized antibody or fragment thereof of the invention and, optionally a pharmaceutically acceptable carrier.

In addition, the present invention relates to the use of a human or humanized antibody or fragments thereof of the invention for the preparation of a pharmaceutical composition for the treatment or prevention of HIV infection or rheumatoid arthritis and the human or humanized antibody or fragment. thereof of the invention for use in the treatment or prevention of HIV infection or rheumatoid arthritis.

The present invention also relates to a method for detecting the expression of a G-protein Chemokine Receptor polypeptide (CCR5) comprising:

(to)

 assaying the expression of a G protein Chemokine Receptor polypeptide (CCR5) in a biological sample of an individual using the human or humanized antibody or fragment thereof of the invention; Y

(b)

 compare the level of a G-protein Chemokine Receptor polypeptide (CCR5) with a conventional level of a G-protein Chemokine Receptor polypeptide (CCR5).

In addition, the present invention relates to a method for detecting, diagnosing or predicting HIV infection and / or conditions associated with HIV infection comprising:

(to)

 assaying the expression of a G protein Chemokine Receptor polypeptide (CCR5) in a biological sample of an individual using the human or humanized antibody or fragment thereof of the invention; Y

(b)

 compare the level of a G-protein Chemokine Receptor polypeptide (CCR5) with a conventional level of a G-protein Chemokine Receptor polypeptide (CCR5).

The present invention also provides a method to detect, diagnose or predict rheumatoid arthritis comprising:

(to)

 assaying the expression of a G protein Chemokine Receptor polypeptide (CCR5) in a biological sample of an individual using the human or humanized antibody or fragment thereof of the invention; Y

(b)

 compare the level of a G-protein Chemokine Receptor polypeptide (CCR35) with a conventional level of a G-protein Chemokine Receptor polypeptide (CCR5).

Additionally, the present invention relates to a kit comprising the human or humanized antibody or fragment thereof of the invention.

The present invention relates to antibodies that bind to the G-protein Chemokine Receptor polypeptide (CCR5) as defined in the claims. The present disclosure encompasses antibodies (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof) that bind immunospecifically with a G-protein Chemokine Receptor polypeptide (CCR5) or polypeptide fragment or variant of a G-protein Chemokine Receptor (CCR5). In particular, the description encompasses antibodies (including molecules comprising, or alternatively consisting of, antibody fragments

or variants thereof) that bind immunospecifically with a polypeptide or polypeptide fragment or variant of the Human G-Chemokine Receptor (CCR5) such as those of SEQ ID NO: 2 or of the polypeptide encoded by the deposited clone.

The present invention relates to pharmaceutical compositions and use of the antibodies of the invention to prevent or treat HIV infection or rheumatoid arthritis.

The present invention relates to methods for detecting, diagnosing or predicting MV infection and / or conditions associated with HIV infection or rheumatoid arthritis. Other diseases or disorders that can be detected, diagnosed or predicted with the antibodies of the invention include, but are not limited to, immune disorders (for example, autoimmune disorders such as multiple sclerosis, Grave's disease and rheumatoid arthritis), neurodegenerative disorders (eg disease Alzheimer's disease) inflammatory disorders (for example, asthma, allergic disorders or inflammatory diseases of the kidney, such as glomerulonephritis) infectious diseases (for example, Hepatitis infections, viral herpes infections and other viral infections) and proliferative disorders.

The antibodies of the invention can be used as a diagnostic tool to detect the expression of the Human G-protein Chemokine Receptor (CCR5) in cells.

The present invention also encompasses cell lines expressing antibodies of the invention that bind immunospecifically with the human G-protein Chemokine Receptor polypeptide (CCR5).

In addition, the present invention encompasses the polynucleotides encoding the antibodies of the invention expressed by said cell lines, as well as the amino acid sequences encoding the antibodies expressed by these cell lines. Molecules are described which comprise, or alternatively, consisting of fragments or variants of these antibodies, for example, heavy chains, VH domains, VH CDR, light chains, VL domains or VL CDR domains having an amino acid sequence of any one of those that can be expressed by a cell line that expresses antibodies, which bind immunospecifically with the G-protein Chemokine Receptor (CCR5) as well as nucleic acid molecules encoding these antibodies and / or molecules. In highly preferred embodiments, antibodies of the invention, or fragments thereof, that bind to the extracellular regions / domains of the G-protein Chemokine Receptor (CCR5) are encompassed.

The present inventors have generated hybridoma cell lines that express antibodies that immunospecifically bind to one or more G-protein Chemokine Receptor polypeptides (CCR5) (eg, SEQ ID NO: 2 or the polypeptide encoded by the deposited clone). Thus, the description encompasses these cell lines, listed in Table 2 below that were deposited in the American Type Culture Collection (“ATCC”) on the dates listed in Table 2 and received the identified ATCC Deposit Numbers in Table 2. The ATCC is located at 10801 University Boulevard, Manassas, VA 20110-2209, United States. The deposit in the ATCC was made in accordance with the terms of the Budapest treaty on the International Recognition of the deposit of microorganisms for patent purposes. The present invention encompasses the antibody expressed by the deposited cell line with the ATCC Deposit No. PTA-4054.

In addition, the present invention encompasses polynucleotides encoding the antibody expressed by this cell line as well as the amino acid sequences encoding the antibody expressed by this cell line. Molecules comprising, or alternatively consisting of, fragments of this antibody are described (eg, heavy chains, VH domains, VH CDR, light chains, VL domains or VL CDR domains having an amino acid sequence of one any of those expressed by one or more cell lines mentioned in Table 2), which bind immunospecifically with the G-protein Chemokine Receptor (CCR5), as well as nucleic acid molecules encoding this antibody and / or molecule. The present description encompasses antibodies,

or fragments or variants thereof, which bind to the extracellular regions / domains of the G-protein Chemokine Receptor (CCR5).

The present invention also provides antibodies of the invention that can bind to the G-protein Chemokine Receptor (CCR5) polypeptide that is coupled with a detectable label, such as an enzyme, a fluorescent label, a luminescent label or a bioluminescent marker. The antibodies of the invention can bind to the G-protein Chemokine Receptor polypeptides (CCR5) that are coupled with a therapeutic or cytotoxic agent. The antibodies of the invention can bind to the G-protein Chemokine Receptor polypeptide (CCR5) that is coupled with a radioactive material.

The present invention further provides the antibodies of the invention that inhibit the ability of HIV to bind and to inhibit HIV infection of cells expressing G-protein Chemokine Receptor (CCR5). In highly preferred embodiments of the present invention, the G-protein chemokine receptor (CCR5) antibodies of the present invention as defined in the claims are used to treat or prevent HIV infection. In other highly preferred embodiments, the G protein Chemokine Receptor antibodies of the present invention are for administration to an individual alone or in combination with other therapeutic compounds, especially antiretroviral agents, to treat or prevent HIV infection.

Antibodies that bind to one or more G-protein Chemokine Receptor (CCR5) polypeptides that act as agonists of the G-protein Chemokine Receptor (CCR5) or antagonists of the G-protein Chemokine Receptor (CCR5) are described. The antibodies of the invention stimulate the chemotaxis of the cells that

5 express G-protein Chemokine Receptor (CCR5). The antibodies inhibit the binding of the G-protein Chemokine Receptor ligand with a G-protein Chemokine Receptor (CCR5). Antibodies positively regulate the expression of the G-protein Chemokine Receptor (CCR5).

Antibodies that negatively regulate the expression of the G-protein Chemokine Receptor (CCR5) are described. Anti-protein G Chemokine Receptor (CCR5) antibodies negatively regulate the expression of the G-protein Chemokine Receptor (CCR5) by promoting internalization of the G-protein Chemokine Receptor (CCR5).

The present invention further provides antibodies that inhibit the binding of a G-protein Chemokine Receptor ligand (CCR5), ie MIP1-beta, MIP-1alpha and RANTES, with cells expressing G-Chemokine Receptor (CCR5).

The present invention also provides a generally isolated nucleic acid molecule or molecules that encode an antibody (including molecules, such as scFv, VH domains or VL domains, which comprise, or alternatively consisting of, an antibody fragment or variant thereof) of the invention. The present invention also provides a host cell transformed with a nucleic acid molecule encoding an antibody (including molecules, such as scFv, VH domains or VL domains, comprising, or alternatively consisting of, an antibody fragment or variant of the same) of the invention and descendants thereof. The present invention also provides a method for the production of an antibody (including the molecule comprising, or alternatively consisting of, an antibody fragment

or variant thereof) of the invention. The present invention further provides a method for expressing an antibody (including a molecule comprising, or alternatively consisting of, a fragment of

25 antibody or variant thereof) of the invention from a nucleic acid molecule. These and other aspects of the invention are described in more detail below.

The present description describes vaccines comprising, or as an alternative consisting of, polynucleotides or polypeptides of the G-protein Chemokine Receptor (CCR5) or fragments, variants or derivatives thereof.

Methods to explore with respect to compounds that bind to and activate or inhibit the activation of G-protein Chemokine Receptor polypeptides (CCR5) are described.

Compounds are described that are for administration to a host that bind and activate the receptor polypeptide that are useful in stimulating hematopoiesis, scarring, coagulation, angiogenesis, to treat solid tumors, chronic infections, leukemia, autoimmune diseases mediated by T lymphocytes. , parasitic infections, psoriasis and to stimulate growth factor activity.

The administration of receptor polypeptides by gene therapy to treat conditions related to the less than normal expression of the polypeptides or less than normal expression of a ligand for the G-protein Chemokine Receptor Polypeptide (CCR5) is also described.

In accordance with yet another embodiment of the present invention, pharmaceutical compositions are provided for administration to a host that bind and inhibit the activation of the CCR5 polypeptide that are useful in the prevention and / or treatment of rheumatoid arthritis.

In accordance with yet another aspect of the present description, nucleic acid probes comprising nucleic acid molecules of sufficient length to specifically hybridize with the polynucleotide sequences of CCR5 are described.

In accordance with another aspect of the present description, diagnostic assays are described to detect

45 diseases related to mutations in the nucleic acid sequences encoding such polypeptides and to detect an altered level of the soluble form of the receptor polypeptides.

In accordance with a further aspect of the present description, methods for using such receptor polypeptides or polynucleotides encoding such polypeptides are described, for in vitro purposes related to scientific research, DNA synthesis and DNA vector manufacturing.

These and other aspects of the present invention should be apparent to those skilled in the art from the teachings herein.

Brief Description of the Drawings

The following drawings are illustrative of embodiments of the invention and are not intended to limit the scope of the invention as encompassed by the claims.

FIGURE 1 shows the DNA sequence and the corresponding deduced amino acid sequence of the G-protein coupled receptor (CCR5). The abbreviation of a conventional letter is used for amino acids. Sequencing was performed using an Automatic 373 DNA sequencer (Applied Biosystems, Inc.).

FIGURE 2 illustrates an amino acid alignment of the G-protein Chemokine Receptor (CCR5) and the human MCP-1 receptor (SEQ ID NO: 9). This figure shows the regions of identity between the amino acid sequence of the G-protein Chemokine Receptor protein (CCR5) and the translation product of human MCP-1 A receptor (MCP-1 RA) (SEQ ID NO: 9), determined by BLAST analysis. Identical amino acids between the two polypeptides are indicated by lines, while highly conservative amino acids are indicated by two points and conservative amino acids are indicated by points. By examining the regions of identical, highly conserved and conserved amino acids, the person skilled in the art can easily identify conserved domains between the two polypeptides.

FIGURE 3 shows an analysis of the amino acid sequence of the G-protein Chemokine Receptor (CCR5). Alpha, beta, turn and curl regions are shown; hydrophilicity and hydrophobicity; amphipathic regions; flexible regions; antigenic index and surface probability, and all were generated using the default settings. In the "Antigenic or Jameson-Wolf Index" chart, positive peaks indicate locations of the highly antigenic regions of the G-Chemokine Receptor protein (CCR5), that is, regions from which epitope-bearing peptides can be obtained. The domains defined by these graphs are contemplated in the present invention.

The data presented in FIGURE 3 are also represented in tabular form in Table 1. The columns are marked with the headings "Res", "Position" and Roman Numerals I-XIV. Column headings refer to the following characteristics of the amino acid sequence presented in FIGURE 3 and Table 1: "Res": amino acid residue of SEQ ID NO: 2 and FIGURE 1; "Position": position of the corresponding remainder within SEQ ID NO: 2 and FIGURE 1; I: Alpha, Regions - Garnier-Robson; II: Alpha, Regions - Chou-Fasman; III: Beta, Regions - Garnier-Robson; IV : Beta, Regions - Chou-Fasman; V: Turn, Regions - Garnier-Robson; VI: Turn, Regions - Chou-Fasman VII: Winding, Regions - Garnier-Robson; VIII: Hydrophilic Representation - Kyte-Doolittle ;. IX : Hydrophobicity Representation - Hopp-Woods; X: Alpha, Amphipathic Regions - Eisenberg; XI: Beta, Amphipathic Regions - Eisenberg; XII: Flexible Regions - Karplus-Schulz; XIII: Antigenic Index - Jameson-Wolf; and

XIV: Surface Probability Representation - Emini.

FIGURE 4 shows the polynucleotide and amino acid sequence of the VH (SEQ ID NO: 59-60) and VL (SEQ ID NO: 61-62) domains of the anti-CCR5 antibody XF11.1D8. Each CDR is indicated by a line on the nucleotide sequence. See also Table 6.

FIGURE 5 shows the polynucleotide and amino acid sequence of the VH domains (SEQ ID NO: 63-64) and VL (SEQ ID NO: 65-66) of the anti-CCR5 antibody XF22.3C9 (i.e., XF22.3C9. 6). Each CDR is indicated by a line on the nucleotide sequence. See also, Table 6.

FIGURE 6 shows the polynucleotide and amino acid sequence of the VH domains (SEQ ID NO: 67-68) and VL (SEQ ID NO: 69-70) of the anti-CDR5 antibody XF22.9E6. Each CDR is indicated by a line on the nucleotide sequence. See also Table 6.

Detailed description

In accordance with one aspect of the present description, an isolated nucleic acid (polynucleotide) encoding the mature polypeptide having the amino acid sequence deduced from FTG is described. 1 (SEQ ID NO: 2) or the mature polypeptide encoded by the clone deposited with ATCC Deposit No. 97183 on June 1, 1995. A sample of the deposited clone, which contains the open reading phase of the Protein Chemokine Receptor G (CCR5), has been obtained from the ATCC and has been re-sequenced. The sequence data of the resequenced clone are shown in SEQ ID NO: 21 and 22. SEQ ID NO: 21 differs from SEQ ID NO: 1 in 5 positions (nucleotides 320, 433, 442, 646 and 1289 of SEQ ID NO: 1 ) SEQ ID NO: 22 differs from SEQ ID NO: 2 in 5 positions (amino acid residues 21, 59, 62, 130 and 344).

The polynucleotide was discovered in a genomic library derived from human monocytes. It is structurally related to the G-protein-coupled receptor family. It contains an open reading phase that encodes a protein of 352 amino acid residues. The protein shows the highest degree of homology with an MCP-1 receptor (SEQ ID NO: 9) with 70.1% identity and 82.9% similarity over a stretch of 347 amino acids.

Polynucleotides include, but are not limited to, the nucleotide sequence of SEQ ID NO: 1, the nucleotide sequence of the deposited clone HDGNR10 (ATCC Deposit Number 97183), the nucleotide sequence of SEQ ID NO: 21), and / or fragments, variants or derivatives thereof.

The polynucleotide may be in the form of RNA or in the form of DNA, including cDNA, genomic DNA and synthetic DNA. The DNA can be double stranded or single stranded and, if single stranded, it can be the coding strand

or the non-coding (anti-sense) thread. The coding sequence encoding the mature polypeptide may be identical to the coding sequence shown in FIGURE 1 (SEQ ID NO: 1) or that of the deposited clone or it may be a different coding sequence, encoding said coding sequence, as a result of the redundancy or degeneracy of the genetic code, the same mature polypeptide as the DNA of FIGURE 1 (SEQ ID NO: 1) or the deposited clone.

The polynucleotide encoding the mature polypeptide of FIGURE 1 or the mature polypeptide encoded by the deposited clone may include: only the coding sequence for the mature polypeptide; the coding sequence for the mature polypeptide and additional coding sequence such as a transmembrane (TM) or intracellular domain; the coding sequence for the mature polypeptide (and optionally additional coding sequence) and non-coding sequence, such as introns or 5 'and / or 3' non-coding sequence of the coding sequence for the mature polypeptide.

Thus, the term "polynucleotide encoding a polypeptide" encompasses a polynucleotide that includes only a coding sequence for the polypeptide as well as a polynucleotide that includes additional coding and / or non-coding sequences.

The present description further relates to variants of the polynucleotides described herein above that encode fragments, analogs and derivatives of the polypeptide having the deduced amino acid sequence of FIGURE 1 or the polypeptide encoded by the deposited clone. The polynucleotide variant may be a naturally occurring allelic variant of the polynucleotide or an unnatural variant of the polynucleotide.

Thus, polynucleotides encoding the same mature polypeptide as shown in FIGURE 1 (SEQ ID NO: 2) or the same mature polypeptide encoded by the deposited clone as well as variants of such polynucleotides are described, said variants encoding a fragment, derivative or analogue of the polypeptide of FIGURE 1 (SEQ ID NO: 2) or the polypeptide encoded by the deposited clone. Such nucleotide variants include deletion variants, substitution variants and addition or insertion variants.

As indicated hereinbefore, the polynucleotide may have a coding sequence that is a naturally occurring allelic variant of the coding sequence shown in FIGURE 1 (SEQ ID NO: 1) or of the coding sequence of the deposited clone. As is known in the art, an allelic variant is an alternative form of a polynucleotide sequence that can have a substitution, deletion or addition of one or more nucleotides, which does not substantially alter the function of the encoded polypeptide.

The polynucleotides can also encode a soluble form of the G-protein Chemokine Receptor polypeptide (CCR5) that is the extracellular part of the polypeptide that has been cleaved from the TM and intracellular domain of the full-length polypeptide.

The polynucleotides may also have the phase-fused coding sequence with a marker sequence that allows purification of the polypeptide described above. The marker sequence may be a hexa-histidine marker provided by a pQE-9 vector to enable purification of the mature polypeptide fused with the label in the case of a bacterial host or, for example, the marker sequence may be a hemagglutinin marker. (HA) when a mammalian host is used, for example, COS-7 cells. The HA marker corresponds to an epitope derived from the hemagglutinin influenza protein (Wilson, I., et al., Cell, 37: 767 (1984)).

The term "gene" means the segment of DNA involved in the production of a polypeptide chain; It includes regions that precede and follow the coding region (leader and posterior) as well as intermediate sequences (introns) between individual coding segments (exons).

The full length gene fragments can be used as a hybridization probe for a cDNA library to isolate the full length cDNA and to isolate other cDNAs that have a high sequence similarity to the gene or similar biological activity. Probes of this type preferably have at least 30 bases and may contain, for example, 50 or more bases. The probe can also be used to identify a cDNA clone corresponding to a full length transcript and a clone or genomic clones containing the complete gene that includes regulatory and promoter regions, exons and introns. An example of an exploration comprises isolating the coding region of the gene using the known DNA sequence to synthesize an oligonucleotide probe. Labeled oligonucleotides having a sequence complementary to that of the gene are used to explore a human cDNA, genomic DNA or mRNA library to determine with which members of the library hybridizes the probe.

Polynucleotides that hybridize with the sequences described herein are further described if there is at least 70%, preferably at least 90% and more preferably at least 95% identity between the sequences. Polynucleotides are described, which hybridize under stringent conditions with the polynucleotides described hereinbefore. As used herein, the term "stringent conditions" means that hybridization will only occur if there is at least 95% and preferably at least 97% identity between the sequences. The polynucleotides that hybridize with the polynucleotides described herein above encode polypeptides that retain the same biological function or activity as the mature polypeptide encoded by the DNA of FIGURE 1 (SEQ ID NO: 1) or the deposited clone.

Alternatively, the polynucleotide may have at least 20 bases, preferably 30 bases and more preferably at least 50 bases that hybridize with a polynucleotide and that has an identity thereto, as described hereinbefore and which may or may not. Keep activity For example, such polynucleotides can be used as probes for the polynucleotide of SEQ ID NO: 1 or of the clone deposited, for example, for recovery of the polynucleotide or as a diagnostic probe or as a PCR primer.

Polynucleotides having at least 70% identity, preferably at least 90% and more preferably at least 95% identity are described with a polynucleotide encoding the polypeptide of SEQ ID NO: 2 or that encoded by the deposited clone as well as fragments of the same, said fragments having at least 30 bases and preferably at least 50 bases and with polypeptides encoded by said polynucleotides.

The deposit or deposits indicated herein shall be maintained under the terms of the Budapest Treaty in the International Recognition of the Deposit of Microorganisms for Patent Purposes. These deposits are provided merely for convenience to those skilled in the art and are not an admission that a deposit is required under 35 U.S.C. §112 A license may be required to prepare or sell deposited materials and such license is not guaranteed herein.

The present description further describes a G-protein Chemokine Receptor polypeptide (CCR5) that has the amino acid sequence deduced from FIGURE 1 (SEQ ID NO: 2) or that has the amino acid sequence encoded by the deposited clone (SEQ ID Nº: 22), as well as fragments, analogs and derivatives of said polypeptide.

The terms "fragment", "derivative" and "analog" when referring to the polypeptide of FIGURE 1 or to the one encoded by the deposited clone, means a polypeptide that retains substantially the same biological function or activity as said polypeptide, that is, acts as a G-protein Chemokine Receptor (CCR5) or retains the ability to bind the ligand or receptor even if the polypeptide does not function as a G-protein Chemokine Receptor (CCR5), for example, a soluble form of the receptor. An analog includes a proprotein that can be activated by cleavage of the proprotein portion to produce an active mature polypeptide.

The polypeptide can be a recombinant polypeptide, a natural polypeptide or a synthetic polypeptide, preferably a recombinant polypeptide.

The fragment, derivative or analogue of the polypeptide of FIGURE 1 (SEQ ID NO: 2) or the one encoded by the deposited clone may be (i) one in which one or more of the amino acid residues are substituted with a conserved amino acid residue or not conserved (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code or (ii) one in which one or more of the amino acid residues includes a substituent group or (iii) one in the that the mature polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (e.g., polyethylene glycol) or (iv) one in which additional amino acids are fused with the mature polypeptide for purification of the polypeptide or ( v) one in which a fragment of the polypeptide is soluble, ie not membrane bound, but binds to ligands of the membrane bound receptor. Said fragments, derivatives and analogues are considered within the scope of those skilled in the art from the teachings herein.

Polypeptides and polynucleotides are preferably provided in an isolated form and preferably purified to homogeneity.

The polypeptides include the polypeptide of SEQ ID NO: 2 (in particular the mature polypeptide) or the one encoded by the deposited clone as well as polypeptides having at least 70% similarity (preferably an identity of 70%) with the polypeptide of SEQ ID No.: 2) or with the one encoded by the deposited clone and more preferably a 90% similarity (more preferably an identity of 90%) with the polypeptide of SEQ ID NO: 2) or with the one encoded by the deposited clone and even more preferably a 95% similarity (even more preferably a 90% identity) with the polypeptide of SEQ ID NO: 2 and with parts of said polypeptide containing said part of the polypeptide generally at least 30 amino acids and more preferably at least 50 amino acids.

As is known in the art, the "similarity" between two polypeptides is determined by comparison of the amino acid sequence and conserved amino acid substitutions thereof of the polypeptide with the sequence of a second polypeptide.

The fragments or parts of the polypeptides can be used to produce the corresponding full length polypeptide by peptide synthesis, therefore, the fragments can be used as intermediates to produce the full length polypeptides. The fragments or parts of the polynucleotides can be used to synthesize full length polynucleotides.

The term "gene" means the segment of DNA involved in producing a polypeptide chain; it includes regions that precede and follow the "leading and subsequent" coding region as well as intermediate sequences (introns) between individual coding segments (exons).

The term "isolated" means that the material is removed from its original environment (for example, the natural environment if it is of natural origin). For example, a naturally occurring polynucleotide or polypeptide present in a live animal is not isolated, but the same polynucleotide or polypeptide separated from some or all of the coexisting materials in the natural system is isolated. Such polynucleotides could be part of a vector and / or such polynucleotides or polypeptides could be part of a composition and still be isolated as long as such vector or composition is not part of its natural environment.

The polypeptides include the polypeptide of SEQ ID NO: 2 or that encoded by the deposited clone (in particular the mature polypeptide) as well as polypeptides having at least 70% similarity (preferably at least 70% identity) and more preferably at least 90% similarity (more preferably at least 90% identity) and even more preferably at least 95% similarity (even more preferably at least 95% identity) with the polypeptide of SEQ ID NO: 2 or with the one encoded by the clone deposited and also includes parts of such polypeptides containing said part of the polypeptide generally at least 30 amino acids and more preferably at least 50 amino acids.

As is known in the art, the "similarity" between two polypeptides is determined by comparing the amino acid sequence and its conserved amino acid substitutions of a polypeptide with the sequence of a second polypeptide.

Fragments or parts of the polypeptides can be used to produce the corresponding full length polypeptide by peptide synthesis; therefore, the fragments can be used as intermediates to produce full length polypeptides. Fragments or portions of the polynucleotides can be used to synthesize full length polynucleotides.

Vectors that include polynucleotides described above, host cells that are engineered with the vectors and the production of the polypeptides by recombinant techniques are described.

Host cells are engineered (transduced, transformed or transfected) with vectors that can be, for example, a cloning vector or an expression vector. The vector may be, for example, in the form of a plasmid, a viral particle, a phage, etc. Genetically engineered host cells can be grown in conventional nutrient media modified as appropriate to activate promoters, select transformants or amplify the genes of the present invention. The culture conditions, such as temperature, pH and the like, are those previously used with the host cell selected for expression and will be apparent to those skilled in the art.

The polynucleotides can be used to produce polypeptides by recombinant techniques. Thus, for example, the polynucleotide can be included in any of a variety of expression vectors to express a polypeptide. Such vectors include chromosomal, non-chromosomal and synthetic DNA sequences, for example, derivatives of SV40; bacterial plasmids; Phage DNA; baculovirus; yeast plasmids; vectors derived from combinations of plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, avian influenza virus and pseudorabies. However, any other vector can be used as long as it is replicable and viable in the host.

The appropriate DNA sequence can be inserted into the vector by a variety of procedures. In general, the DNA sequence is inserted into an appropriate restriction endonuclease site or sites by methods known in the art. Such procedures and others are considered to be within the scope of those skilled in the art.

The DNA sequence in the expression vector is operably linked to an appropriate expression control sequence or sequences (promoter) to direct mRNA synthesis. As representative examples of such promoters, there may be mentioned: LTR or SV40 promoter, E. coli lac or trp, phage lambda PL promoter and other promoters that are known to control gene expression in prokaryotic or eukaryotic cells or their viruses . The expression vector also contains a ribosome binding site for translation initiation and a transcription terminator. The vector may also include appropriate sequences to amplify the expression.

In addition, the expression vectors preferably contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells such as resistance to dihydrofolate reductase or neomycin for culturing eukaryotic cells or such as resistance to tetracycline or ampicillin in E. coli .

The vector containing the appropriate DNA sequence as described hereinbefore, as well as an appropriate promoter or control sequence, can be used to transform an appropriate host to allow the host to express the protein.

As representative examples of appropriate hosts may be mentioned: bacterial cells, such as

E. coli, Streptomyces, Salmonella typhimurium; fungal cells, such as yeast; insect cells such as Drosophila and Spodoptera Sf9; animal cells such as CHO, COS or Bowes melanoma; adenovirus; plant cells, etc. The selection of an appropriate host is considered to be within the scope of those skilled in the art from the teachings herein.

More particularly, recombinant constructs comprising one or more of the sequences are described as described above in general. The constructs comprise a vector, such as a plasmid or viral vector, which has inserted a sequence described above in a direct or reverse orientation. In a preferred aspect of this embodiment, the construction further comprises regulatory sequences, including, for example, a promoter, operably linked to the sequence. Those skilled in the art know a great variety of suitable vectors and promoters, and these are available in the market. The following vectors are provided as an example. Bacterial: pQE70, pQE60, pQE-9 (Qiagen), pbs, pD10, phagescript, psiX174, pbluescript SK, pbsks, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene); ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia). Eukaryotes: pWLNEO, pSV2CAT, pOG44, pXT1, pSG (Stratagene) pSVK3, pBPV, pMSG, pSVL (Pharmacia). However, any other plasmid or vector can be used as long as it is replicable and viable in the host.

Promoter regions can be selected from any desired gene using CAT (chloramphenicol transferase) vectors or other vectors with selectable markers. Two appropriate vectors are PKK232-8 and PCM7. Particularly named bacterial promoters include lacI, lacZ, T3, T7, gpt, lambda PR, PL and trp. Eukaryotic promoters include CMV immediate early, HSV thymidine kinase, early and late SV40, retrovirus LTR and mouse metallothionein-I. The selection of the appropriate vector and promoter is within the level of usual skill in the art.

Host cells containing the constructions described above are described. The host cell can be an upper eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast cell or the host cell can be a prokaryotic cell, such as a bacterial cell. The introduction of the construct into the host cell can be effected by transfection of calcium phosphate, transfection mediated by DEAE-Dextran or electroporation (Davis, L., et al., Basic Methods in Molecular Biology, (1986)).

Host cell constructs can be used in a conventional manner to produce the gene product encoded by the recombinant sequence. Alternatively, the polypeptides can be synthetically produced by conventional peptide synthesizers.

Mature proteins can be expressed in mammalian cells, yeasts, bacteria or other cells under the control of appropriate promoters. Cellless translation systems can also be used to produce such proteins that use RNA derived from DNA constructs. Cloning and expression vectors appropriate for use with prokaryotic and eukaryotic hosts are described in Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, N. Y., (1989).

The transcription of the DNA encoding the polypeptides by higher eukaryotes increases by inserting an enhancer sequence into the vector. Enhancers are elements that act in cis of DNA, usually about 10 to 300 bp that act in a promoter to increase their transcription. Examples include the SV40 enhancer on the late side of the origin of replication of pb 100 to 270, an early cytomegalovirus promoter enhancer, the polyoma enhancer on the late side of the origin of replication and adenovirus enhancers.

Generally, recombinant expression vectors will include replication origins and selectable markers that allow host cell transformation, for example, the E. coli and S. cerevisiae ampicillin resistance gene, TRP1 gene, and a promoter derived from a Highly expressed gene to direct the transcription of a structural sequence down the chain. Such promoters can be derived from operons that encode glycolytic enzymes such as 3-phosphoglycerate kinase (PGK), factor-factor, acid phosphatase or heat shock proteins, among others. The heterologous structural sequence is assembled in an appropriate phase with translation initiation and termination sequences and preferably, a leader sequence capable of directing the secretion of the translated protein in the periplasmic space or extracellular medium. Optionally, the heterologous sequence can encode a fusion protein that includes an N-terminal identification peptide that provides the desired characteristics, for example, stabilization or simplified purification of expressed recombinant product.

Expression vectors useful for bacterial use are constructed by inserting a structural DNA sequence encoding a desired protein together with suitable translation initiation and termination signals in operable reading phase with a functional promoter. The vector will comprise one or more selectable phenotypic markers and an origin of replication to ensure maintenance of the vector and, if desirable, provide amplification within the host. Prokaryotic hosts suitable for transformation include E. coli, Bacillus subtilis, Salmonella typhimurium and various species within the genera Pseudomonas, Streptomyces, and Staphylococcus, although others of choice may also be employed.

As a representative but not limiting example, expression vectors useful for bacterial use may comprise a selectable marker and bacterial origin of replication derived from commercially available plasmids comprising genetic elements of the well-known cloning vector pBR322 (ATCC 37017). Such commercial vectors include, for example, pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and GEM1 (Promega Biotec, Madison, WI, United States). These "main chain" sections of pBR322 are combined with an appropriate promoter and the structural sequence to be expressed.

After transformation of a suitable host strain and growth of the host strain to an appropriate cell density, the selected promoter is induced by appropriate means (e.g., temperature change or chemical induction) and the cells are cultured for an additional period. .

The cells are typically collected by centrifugation, broken by physical or chemical means and the resulting crude extract is preserved for further purification.

Microbial cells employed in protein expression can be broken by any convenient method, including freeze-thaw cycles, sonication, mechanical breakage or use of cell lysing agents, such methods are well known to those skilled in the art.

Various mammalian cell culture systems can also be used to express recombinant protein. Examples of mammalian expression systems include the COS-7 lines of monkey kidney fibroblasts, described by Gluzman, Cell 23: 175 (1981), and other cell lines capable of expressing a compatible vector, for example, cell lines C127, 3T3, CHO, HeLa and BHK. Mammalian expression vectors will comprise a suitable origin of replication, a promoter and enhancer and also any necessary ribosome binding sites, polyadenylation sites, donor and splice acceptor sites, transcription termination sequences and non-transcribed sequences. 5 'flanks. DNA sequences derived from the SV40 splice and polyadenylation sites can be used to provide the required non-transcribed genetic elements.

Polypeptides of the G-protein Chemokine Receptor (CCR5) can be recovered and purified from recombinant cell cultures by methods that include precipitation with ammonium or ethanol sulfate, acid extraction, anionic or cationic exchange chromatography, phosphocellulose chromatography, chromatography of hydrophobic interaction, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Protein refolding steps may be used, as necessary, to complete the mature protein configuration. Finally, high performance liquid chromatography (HPLC) can be used for the final purification steps.

The polypeptides can be a naturally purified product or a product of chemical synthetic procedures or be produced by recombinant techniques of a prokaryotic or eukaryotic host (for example, by bacterial, yeast, higher plant, insect and mammalian cells in culture ). Depending on the host used in a recombinant production process, the polypeptides may be glycosylated or may be non-glycosylated. The polypeptides may also include an initial methionine amino acid residue.

Polynucleotides and polypeptides can be used as reagents and research materials for the discovery of treatments and diagnoses for human diseases.

The G-protein Chemokine Receptor (CCR5) can be used in a procedure to explore for compounds that activate (agonists) or inhibit (antagonists) the activation of the receptor polypeptide.

In general, such scanning procedures involve providing appropriate cells that express the receptor polypeptide on their surface. Such cells include mammalian, yeast, drosophilic or E. coli cells. In particular, a polynucleotide encoding the receptor is used to transfect cells to thereby express the G-protein Chemokine Receptor (CCR5). The expressed receptor is then contacted with a test compound to observe the binding, stimulation or inhibition of a functional response.

Such an examination procedure involves the use of melanophores that are transfected to express the G-protein Chemokine Receptor (CCR5). Such a scanning technique is described in PCT WO 92/01810 published on February 6, 1992.

Thus, for example, such an assay can be used to scan for a compound that inhibits the activation of the receptor polypeptide by contacting the melanophore cells encoding the receptor with the receptor ligand and a compound to be explored. Inhibition of the signal generated by the ligand indicates that a compound is a potential antagonist to the receptor, that is, it inhibits receptor activation.

The scan can be used to determine a compound that activates the receptor by contacting such cells with compounds to be screened and determining whether said compound generates a signal, that is, activates the receptor.

Other scanning techniques include the use of cells expressing the G-protein Chemokine Receptor (CCR5) (for example transfected CHO cells) in a system that measures extracellular pH changes caused by receptor activation, for example, as described. in Science 246: 181-296 (October 1989). For example, the compounds can be contacted with a cell expressing the receptor polypeptide and a response from the second messenger, for example signal transduction or pH changes, can be measured to determine whether the potential compound activates or inhibits the receptor.

Another such scanning technique involves introducing RNA encoding the G-protein Chemokine Receptor (CCR5) into Xenopus oocytes to transiently express the receptor. The oocytes with a receptor can then contact a receptor ligand and a compound to be screened, followed by detection of inhibition or activation of a calcium signal in the case of exploration with respect to compounds believed to inhibit the activation of the receiver.

Another scanning technique involves expressing the G-protein Chemokine Receptor (CCR5) in which the receptor binds to a C or D phospholipase. As representative examples of such cells, there may be mentioned endothelial cells, smooth muscle cells, kidney cells embryonic, etc. Scanning can be achieved as described hereinbefore by detecting receptor activation or inhibiting receptor activation of the second phospholipase signal.

Another method involves exploring with respect to compounds that inhibit the activation of the receptor polypeptide antagonists by activating the inhibition of labeled ligand binding with cells that have the receptor on the surface thereof. Said method involves transfecting a eukaryotic cell with DNA encoding the G-protein Chemokine Receptor (CCR5) so that the cell expresses the receptor on its surface and contacting the cell with a compound in the presence of a labeled form of a ligand known. The ligand can be labeled, for example, by radioactivity. The amount of labeled ligand bound to the receptors is measured, for example, by measuring the radioactivity of the receptors. If the compound binds to the receptor as determined by a reduction of labeled ligand that binds to the receptors, binding of labeled ligand with the receptor is inhibited.

An antibody, or in some cases an oligopeptide, can activate a G-protein Chemokine Receptor (CCR5), by binding to the G-protein Chemokine Receptor (CCR5) and initiating the second messenger response. Antibodies include anti-idiotypic antibodies that recognize unique determinants generally associated with the antigen binding site of an antibody. Potential agonist compounds also include proteins that are closely related to the G-protein Chemokine Receptor ligand (CCR5), for example, a ligand fragment.

An antibody, or in some cases an oligopeptide, can antagonize a G-protein Chemokine Receptor (CCR5), by binding to the G-protein Chemokine Receptor (CCR5) but not being able to induce a second messenger response so that the activity of the G-protein Chemokine Receptor (CCR5) is avoided. Antibodies include anti-idiotypic antibodies that recognize unique determinants generally associated with the antigen binding site of an antibody. Potential antagonist compounds also include proteins that are closely related to the G-protein Chemokine Receptor ligand (CCR5), for example, a fragment of the ligand that has lost biological function and does not induce response when it binds to the Chemokine Receptor of protein G (CCR5).

An antisense construct prepared through the use of Antisense technology can be used to control gene expression through the formation of triple helices or RNA or antisense DNA, both methods based on the binding of a polynucleotide with DNA or RNA. For example, the 5 'coding part of the polynucleotide sequence, which encodes mature polypeptides, is used to design an antisense RNA oligonucleotide approximately 10 to 40 base pairs in length. A DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription (triple helix; see Lee et al., Nucl. Acids Res.

6: 3073 (1979); Cooney et al, Science 241: 456 (1988); and Dervan et al., Science 251: 1360 (1991)), thereby avoiding transcription and production of the G-protein Chemokine Receptor (CCR5). The anti-sense RNA oligonucleotide hybridizes with mRNA in vivo and blocks the translation of mRNA molecules to G-protein coupled receptor (antisense - Okano, J. Neurochem. 56: 560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression , CRC Press, Boca Raton, FL (1988)). The oligonucleotides described above can also be delivered to cells so that the antisense DNA or RNA can be expressed in vivo to inhibit the production of G-protein Chemokine Receptor (CCR5).

A small molecule that binds to the G-protein Chemokine Receptor (CCR5), making it inaccessible to ligands so that normal biological activity, for example peptide-like molecules or small peptides, can also be used to inhibit polypeptide activation. receiver.

A soluble form of the G-protein Chemokine Receptor (CCR5), for example a receptor fragment, can be used to inhibit receptor activation by binding with the ligand of a polypeptide described herein and preventing the ligand from interacting with the membrane-bound G protein chemokine receptor (CCR5).

Compounds that bind and activate the G-protein Chemokine Receptor (CCR5) can be used to stimulate hematopoiesis, scarring, coagulation, angiogenesis, to treat solid tumors, chronic infections, leukemia, autoimmune diseases mediated by T lymphocytes, parasitic infections, psoriasis and to stimulate growth factor activity.

Compounds that bind and inhibit the G-protein Chemokine Receptor (CCR5) can be used to treat allergy, atherogenesis, anaphylaxis, malignant tumors, chronic and acute inflammation, allergic reactions mediated by histamine and IgE, prostaglandin independent fever, insufficiency of bone marrow, silicosis, sarcoidosis, rheumatoid arthritis, shock and hypereosinophilic syndrome.

The compounds can be used in combination with a suitable pharmaceutical vehicle. Such compositions comprise a therapeutically effective amount of the compound and a pharmaceutically acceptable carrier or excipient. Said vehicle includes, but is not limited to saline, buffered saline, dextrose, water, glycerol, ethanol and combinations thereof. The formulation should be adapted to the mode of administration.

A pharmaceutical package or kit is described comprising one or more packages containing one or more of the ingredients of the pharmaceutical compositions of the invention. Associated with said container or said containers there may be a notice in the manner prescribed by a government agency that regulates the manufacture, use or sale of pharmaceutical or biological products, said notice reflecting the approval by the agency of the manufacture, use or sale for human administration In addition, the compounds of the present invention can be used together with other therapeutic compounds.

The pharmaceutical compositions can be administered in a convenient manner such as by the topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal routes. The pharmaceutical compositions are administered in an amount that is effective for the treatment and / or prophylaxis of the specific symptom. In general, the pharmaceutical compositions will be administered in an amount of at least about 10 µg / kg of body weight and in most cases they will be administered in an amount of no more than about 8 mg / kg of body weight per day. In most cases, the dosage is from about 10 g / kg to about 1 mg / kg of daily body weight, taking into account the routes of administration, symptoms, etc.

Polypeptides of the G-protein Chemokine Receptor (CCR5) and antagonists or agonists that are polypeptides can also be used by expression of such polypeptides in vivo, which is often referred to as "gene therapy."

Thus, for example, cells from a patient with a polynucleotide (DNA or RNA) encoding an ex vivo polypeptide can be genetically engineered, then the genetically engineered cells being provided to a patient to be treated with the polypeptide. Such methods are well known in the art. For example, cells can be genetically engineered by methods known in the art by the use of an RNA-containing retroviral particle encoding a polypeptide as described above.

Similarly, cells in vivo can be genetically engineered for expression of a polypeptide in vivo by, for example, methods known in the art. As is known in the art, a producer cell for producing a retroviral particle that contains RNA encoding the polypeptide can be administered to a patient to genetically engineer cells in vivo and expression of the polypeptide in vivo. These and other methods for administering a polypeptide by such method should be apparent to those skilled in the art from the teachings of the present description. For example, the expression vehicle for genetically engineered cells may be different from a retrovirus, for example, an adenovirus that can be used for genetically engineered cells in vivo after combination with a suitable delivery vehicle.

Retroviruses from which the retroviral plasmid vectors mentioned herein may be derived include, but are not limited to, Moloney Murine Leukemia Virus, spleen necrosis virus, retroviruses such as Rous Sarcoma Virus, Sarcoma Virus of Harvey, avian leukosis virus, gibbon leukemia virus, human immunodeficiency virus, adenovirus, Myeloproliferative Sarcoma Virus and breast tumor virus. The retroviral plasmid vector is derived from the Moloney Murine Leukemia virus.

The vector includes one or more promoters. Suitable promoters that can be employed include, without limitation, the retroviral LTR; the SV40 promoter; and the human cytomegalovirus (CMV) promoter described in Miller, et al., Biotechniques 7: 980-990 (1989), or any other promoter (eg, cell promoters such as eukaryotic cell promoters including, but not limited to, promoters of histone, pol III and -actin). Other viral promoters that may be employed include, but are not limited to, adenovirus promoters, thymidine kinase (TK) promoters and B19 parvovirus promoters. The selection of a suitable promoter will be apparent to those skilled in the art from the teachings contained herein.

The nucleic acid sequence encoding the polypeptide is under the control of a suitable promoter. Suitable promoters that may be employed include, without limitation, adenoviral promoters, such as the adenoviral major late promoter; or heterologous promoters, such as the cytomegalovirus (CMV) promoter; the respiratory syncytial virus (RSV) promoter; inducible promoters, such as the MMT promoter, the metallothionein promoter; heat shock promoters; the albumin promoter; the ApoAl promoter; human globin promoters; viral thymidine kinase promoters, such as the Herpes Simplex thymidine kinase promoter; Retroviral LTRs (including the modified retroviral LTRs described hereinbefore); the -actin promoter; and human growth hormone promoters. The promoter can also be the native promoter that controls the genes encoding the polypeptides.

The retroviral plasmid vector is used to transduce packaging cell lines to form producing cell lines. Examples of packaging cells that can be transfected include, but are not limited to, the PE501, PA317, -2, -AM, PA12, T19-14X, VT-19-17-H2, CRE, CRIP, cell lines GP + E-86, GP + envAM12, and DAN as described in Miller, Human Gene Therapy 1: 5-14 (1990). The vector can transduce the packaging cells through any means known in the art. Such means include, but are not limited to electroporation, the use of liposomes and precipitation by CaPO4. In an alternative, the retroviral plasmid vector can be encapsulated in a liposome or coupled to a lipid and then administered to a host.

The producer cell line generates infectious retroviral vector particles that include the nucleic acid sequence or sequences encoding the polypeptides. Such retroviral vector particles can then be used to transduce eukaryotic cells in vitro or in vivo. Transduced eukaryotic cells will express the nucleic acid sequence or sequences encoding the polypeptide. Eukaryotic cells that can be transduced include, but are not limited to, embryonic stem cells, embryonic carcinoma cells, as well as hematopoietic stem cells, hepatocytes, fibroblasts, myoblasts, keratinocytes, endothelial cells and bronchial epithelial cells.

A method is also described for determining whether a ligand that is not known to be able to bind to a G-protein Chemokine Receptor (CCR5) can bind to a receptor that comprises contacting a mammalian cell that expresses a Receptor of G-protein chemokine (CCR5) with the ligand under conditions that allow ligand binding with the G-protein Chemokine Receptor (CCR5), detect the presence of a ligand that binds to the receptor and thus determine whether the ligand is binds to the G-protein Chemokine Receptor (CCR5). The systems described hereinbefore to determine agonists and / or antagonists can also be used to determine ligands that bind to the receptor.

A method is described for detecting the expression of a G-protein Chemokine Receptor polypeptide (CCR5) on the surface of a cell by detecting the presence of mRNA encoding the receptor that comprises obtaining total mRNA from the cell and putting in Contact the mRNA thus obtained with a nucleic acid probe comprising a nucleic acid molecule of at least 10 nucleotides capable of specifically hybridizing with a sequence included within the sequence of a nucleic acid molecule encoding the receptor under hybridizing conditions. , detect the presence of mRNA hybridized with the probe and thereby detect the expression of the receptor by the cell.

A method for identifying receptors related to receptor polypeptides is described. These related receptors can be identified by homology with a G-protein Chemokine Receptor polypeptide (CCR5), by cross-hybridization of low stringency or by identifying receptors that interact with related natural and synthetic ligands and / or induce similar behaviors after blocking Genetic or pharmacological chemokine receptor polypeptides.

Fragments of the genes can be used as a hybridization probe for a cDNA library to isolate other genes that have a high sequence similarity to the genes or that have similar biological activity. Probes of this type have at least 20 bases, preferably at least 30 bases and more preferably at least 50 bases or more. The probe can also be used to identify a cDNA clone that corresponds to a full length transcript and a clone or genomic clones that contain the entire gene including regulatory and promoter regions, exons and introns. An example of such an exploration comprises isolating the coding region of the gene by using the known DNA sequence to synthesize an oligonucleotide probe. Labeled oligonucleotides that have a sequence complementary to that of the genes described herein are used to explore a human cDNA, genomic DNA or mRNA library to determine with which members of the library hybridizes the probe.

The use of genes as a diagnosis is described, for example, some diseases will result from inherited defective genes. These genes can be detected by comparing the sequences of the defective gene with those of a normal one. Subsequently, it can be verified that a "mutant" gene is associated with an abnormal receptor activity. In addition, mutant receptor genes can be inserted into a vector suitable for expression in a functional assay system (e.g., colorimetric assay, MacConkey plate expression, complementation experiments, in a strain deficient in HEK293 cell receptor) as another More means to verify or identify the mutation. Once "mutant" genes have been identified, the population can be screened for vehicles of the "mutant" receptor gene.

Individuals that carry mutations in the gene can be detected in DNA levels by a variety of techniques. Nucleic acids used to diagnose a patient's cells can be obtained, including but not limited to blood, urine, saliva, tissue biopsy and autopsy material. Genomic DNA can be used directly for detection or can be amplified enzymatically by the use of PCR (Saiki, et al., Nature 324: 163-166 (1986)) before analysis. RNA or cDNA can also be used for the same purpose. As an example, PCR primers complementary to the nucleic acid of the present invention can be used to identify and analyze mutations in the gene. For example, deletions and insertions can be detected by a change in size of the amplified product compared to the normal genotype. Point mutations can be identified by hybridizing amplified DNA with radiolabeled RNA or, alternatively, radiolabeled antisense DNA sequences. Perfectly coincident sequences of mismatched double chains can be distinguished by digestion with RNase A or by differences in melting temperatures. Such a diagnosis would be particularly useful for prenatal or even neonatal trials.

Sequence differences between the reference gene and "mutants" can be revealed by the method of direct DNA sequencing. In addition, cloned DNA segments can be used as probes to detect specific DNA segments. The sensitivity of this method is greatly enhanced when combined with PCR. For example, a sequence primer is used with a double stranded PCR product or a single stranded template molecule generated by a modified PCR. Sequence determination is performed by conventional procedures with radiolabeled nucleotide or by an automatic sequencing procedure with fluorescent markers.

Genetic assays based on DNA sequence differences can be achieved by detecting alterations in the electrophoretic mobility of DNA fragments in gels with or without denaturing agents. Sequence changes at specific locations can also be revealed by core protection assays, such as S1 and RNase protection or the chemical cleavage method (e.g. Cotton, et al., PNAS, USA 85: 4397-4401 (1985) ).

In addition, some diseases are a result of, or are characterized by changes in gene expression that can be detected by changes in mRNA. Alternatively, genes can be used as a reference to identify individuals expressing a decrease in functions associated with receptors of this type.

The present description also relates to a diagnostic assay to detect altered levels of soluble forms of the G-protein Chemokine Receptor polypeptides (CCR5) in various tissues. Assays used to detect levels of soluble receptor polypeptides in a sample derived from a host are well known to those skilled in the art and include radioimmunoassays, competitive binding assays, Western blot analysis and preferably as an ELISA assay.

An ELISA assay initially comprises preparing an antibody specific for antigens of the G-protein Qumiocin Receptor polypeptide (CCR5), preferably a monoclonal antibody. In addition, a reporter antibody against the monoclonal antibody is prepared. To the reporter antibody a detectable reagent such as radioactivity, fluorescence or, in this example, a horseradish peroxidase enzyme is attached. A sample from a host is now removed and incubated on a solid support, for example a polystyrene plate, which binds to the proteins in the sample. Any free protein binding site on the plate is then covered by incubation with a non-specific protein such as bovine serum albumin. Next, the monoclonal antibody is incubated on the plate, during which time the monoclonal antibodies bind to any protein of the G-protein Chemokine Receptor (CCR5) bound to the polystyrene plate. All unbound monoclonal antibodies are removed by washing with buffer. The reporter antibody bound to horseradish peroxidase is now placed on the plate resulting in the binding of the reporter antibody with any monoclonal antibody bound to G-Chemokine Receptor proteins (CCR5). The unbound reporter antibody is then washed off. Peroxidase substrate is then added to the plate and the amount of color developed in a given period of time is a measure of the amount of G-Chemokine Receptor proteins (CCR5) present in a given volume of a patient sample when It compares against a standard curve.

The sequences are also valuable for chromosomal identification. The sequence specifically targets and can hybridize with a particular location on an individual human chromosome. In addition, there is a current need to identify particular sites on chromosomes. Few chromosome marker reagents based on actual sequence data (repeat polymorphisms) are currently available to mark chromosomal locations. Chromosome DNA mapping is an important first stage in correlating those sequences with genes associated with disease.

Briefly, the sequences can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp) of the clone. Computer analysis of the DNA of the deposited clone is used to quickly select primers that do not cover more than one exon in the genomic DNA, thereby complicating the amplification process. These primers are then used for PCR scanning of somatic cell hybrids containing individual human chromosomes. Only hybrids containing the human gene corresponding to the primer will produce an amplified fragment.

PCR mapping of somatic cell hybrids is a quick procedure to assign a particular DNA to a particular chromosome. Using the same oligonucleotide primers, sublocalization can be achieved with panels of specific chromosome fragments or groups of large genomic clones in an analogous manner. Other mapping strategies that can be similarly used to map your chromosome include in situ hybridization, preexploration with marked flow-selected chromosomes and hybridization preselection to construct specific chromosome DNA libraries.

Fluorescence in situ hybridization (FISH) of a DNA clone in a chromosomal metaphase distribution can be used to provide accurate one-stage chromosomal localization. This technique can be used with DNA as short as 50 or 60 bases. For a review of this technique, see Verma et al., Human Chromosomes: a Manual of Basic Techniques, Pergamon Press, New York (1988).

Once a sequence has been mapped to a precise chromosomal location, the physical position of the sequence on the chromosome can be correlated with genetic map data. Such data can be found, for example, in V. McKusick, Mendelian Inheritance in Man (available online through Johns Hopkins University Welch Medical Library). The relationship between genes and diseases that have been mapped in the same chromosomal region is then identified through ligation analysis (joint inheritance of physically adjacent genes).

Next, it is necessary to determine the differences in the cDNA or genomic sequence between affected and unaffected individuals. If a mutation is observed in some or all affected individuals but not in any normal individual, then the mutation is probably the causative agent of the disease.

With the current resolution of genetic mapping and physical mapping techniques, a cDNA precisely located in a chromosomal region associated with the disease could be one of 50 to 500 potential causative genes (this assumes a mapping resolution of 1 megabase and one gene per 20 kb).

The polypeptides, their fragments or other derivatives or analogs thereof, or cells that express them can be used as an immunogen to produce antibodies thereto. These antibodies can be, for example, polyclonal or monoclonal antibodies. Chimeric, single chain and humanized antibodies are described, as well as Fab fragments or the product of a Fab expression library. Various methods known in the art can be used for the production of such antibodies and fragments.

Antibodies generated against the polypeptides corresponding to a sequence described above can be obtained by direct injection of the polypeptides into an animal or by administration of the polypeptides to an animal, preferably non-human. The antibody thus obtained will then bind the polypeptides themselves. Thus, even a sequence that encodes only a fragment of the polypeptides can be used to generate antibodies that bind to all native polypeptides. Such antibodies can then be used to isolate the tissue polypeptide that expresses that polypeptide.

For the preparation of monoclonal antibodies, any technique that provides antibodies produced by continuous cell line cultures can be used. Examples include the hybridoma technique (Kohler and Milstein, Nature 256: 495-497 (1975)), the trioma technique, the human B lymphocyte hybridoma technique (Kozbor et al., Immunology Today 4: 72 (1983) ), and the EBB hybridoma technique to produce human monoclonal antibodies (Cole, et al., in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc. (1985), pp. 77-96).

The techniques described for the production of single chain antibodies (US Patent 4,946,778) can be adapted to produce single chain antibodies for immunogenic polypeptide products described herein. In addition, transgenic mice can be used to express humanized antibodies to polypeptide or immunogenic products.

The present invention will be further described with reference to the following examples; however, it should be understood that the present invention is not limited to such examples. All parts or quantities unless otherwise specified, are by weight.

To facilitate the understanding of the following examples, certain methods and / or terms of frequent occurrence will be described.

"Plasmids" are designated by a p preceded and / or followed by capital letters and / or numbers. Starting plasmids herein are commercially available, publicly available on an unrestricted basis or can be constructed from available plasmids according to published procedures. In addition, plasmids equivalent to those described are known in the art and will be apparent to those skilled in the art.

"Digestion" of DNA refers to catalytic cleavage of DNA with a restriction enzyme that acts only on certain sequences in the DNA. The various restriction enzymes used herein are commercially available and their reaction conditions, cofactors and other requirements were used as is known to those skilled in the art. For analytical purposes, typically 1 µg of plasmid or DNA fragment with about 2 units of enzyme in about 20 µl of buffer solution is used. For the purpose of isolating DNA fragments for plasmid construction, typically 5 to 50 µg of DNA with 20 to 250 units of enzyme are digested in a larger volume. Suitable buffers and amounts of substrate for particular restriction enzymes are specified by the manufacturer. Incubation times of approximately 1 hour at 37 ° C are ordinarily used, but may vary according to the supplier's instructions. After digestion the reaction is electrophoresed directly on a polyacrylamide gel to isolate the desired fragment.

Separation by size of the cleaved fragments is performed using 8 percent polyacrylamide gel described by Goeddel, D. et al., Nucleic Acids Res. 8: 4057 (1980).

"Oligonucleotides" refers to single stranded polydeoxynucleotides or two complementary strands of polydeoxynucleotide that can be chemically synthesized. Such synthetic oligonucleotides do not have 5 ′ phosphate and thus will not bind to another oligonucleotide without adding a phosphate with an ATP in the presence of a kinase. A synthetic oligonucleotide will be ligated with a fragment that has not been dephosphorylated.

"Ligation" refers to the process of forming phosphodiester bonds between two double stranded nucleic acid fragments (Maniatis, T., et al., Id., P. 146). Unless otherwise provided, ligation should be achieved using known buffers and conditions with 10 units of T4 ligase DNA ("ligase") per 0.5 µg of approximately equimolar amounts of the DNA fragments to be ligated.

Unless indicated otherwise, the transformation was performed as described in the method of Graham, F. and Van der Eb, A., Virology 52: 456-457 (1973).

In the present invention, "isolated" refers to material removed from its original environment (for example, the natural environment if it is of natural origin) and thus is altered "by the hand of man" from its natural state. For example, an isolated polynucleotide could be part of a vector or a composition of matter or it could be contained within a cell and still be "isolated" because the particular vector, composition of matter or cell is not the original environment of the polynucleotide The term "isolated" does not refer to genomic or cDNA libraries, whole cell or mRNA preparations, genomic DNA preparations (including those separated by electrophoresis and transferred to transfer spots), genomic DNA preparations of cut whole cell or other compositions in which the technique does not demonstrate distinctive features of the polynucleotide / sequences.

A "secreted" or "soluble" G-protein Chemokine Receptor protein (CCR5) refers to a protein capable of targeting ER, secretory vesicles or extracellular space as a result of a signal sequence, as well as a Receptor protein. G protein chemokine (CCR5) released in the extracellular space without necessarily containing a signal sequence. If the secreted protein of the G-protein Chemokine Receptor (CCR5) is released into the extracellular space, the secreted protein of the G-protein Chemokine Receptor (CCR5) may undergo extracellular processing to produce a G-protein Chemokine Receptor protein ( CCR5) "mature". Release into the extracellular space can occur by many mechanisms, including exocytosis and proteolytic excision. Examples of secreted or soluble protein G Chemokine Receptor (CCR5) proteins include fragments that comprise, or alternatively consisting of, parts of the G-protein Chemokine Receptor (CCR5) described herein. Preferred secreted or soluble fragments comprise an extracellular loop, an intracellular loop, the N-terminal extracellular domain or the C-terminal intracellular domain or fragments thereof. Additional preferred secreted or soluble fragments comprise an epitope of the G-protein Chemokine Receptor (CCR5), as described herein.

As used herein, a "polynucleotide" of the G-protein Chemokine Receptor (CCR5) refers to a molecule having a nucleic acid sequence contained in SEQ ID NO: 1 or the protein Chemokine Receptor DNA. G (CCR5) contained within the clone deposited in the ATCC. For example, the G protein Chemokine Receptor polynucleotide (CCR5) may contain the nucleotide sequence of the full length genomic sequence, including the 5 ’and 3’ untranslated sequences, the coding region, with

or without the signal sequence, the coding region of the secreted protein, as well as fragments, epitopes, domains and variants of the nucleic acid sequence. In addition, as used herein, a "polypeptide" of the G-protein Chemokine Receptor (CCR5) refers to a molecule having the translated amino acid sequence generated from the polynucleotide as defined generally.

The polynucleotides have at least 15, at least 30, at least 50, at least 100, at least 125, at least 500 or at least 1000 continuous nucleotides but are less than or equal to 300 kb, 200 kb, 100 kb, 50 kb , 15 kb, 10 kb, 7.5 kb, 5 kb, 2.5 kb, 2.0 kb or 1 kb, in length. The polynucleotides comprise a part of the coding sequences, as described herein, but do not comprise all or a part of any intron. Polynucleotides comprising coding sequences do not contain coding sequences of a genomic flanking gene (i.e. 5 'or 3' of the G-protein Chemokine Receptor gene (CCR5) of interest in the genome). The polynucleotides do not contain the coding sequence of more than 1000, 500, 250, 100; 50, 25, 20, 15, 10, 5, 4, 3, 2 or 1 gene or genomic flanking genes.

A representative clone containing the open reading phase of the sequence of SEQ ID NO: 1 was deposited in the American Type Culture Collection ("ATCC") on June 1, 1995 and obtained the Deposit Number of ATCC 97183. The ATCC is located at 10801 University Boulevard, Manassas, VA 20110-2209, United States. The deposit of ATCC was made in accordance with the terms of the Budapest Treaty on the international recognition of the deposit of microorganisms for patent purposes.

A "polynucleotide" of the G-protein Chemokine Receptor (CCR5) also includes polynucleotides capable of hybridizing, under stringent hybridization conditions with sequences contained in SEQ ID NO: 1, the complement thereof or the DNA within the deposited clone. "Rigorous hybridization conditions" refers to an overnight incubation at 42 degrees C in a solution comprising 50% formamide, 5x SSC (750 mM NaCl, 75 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6) , 5x Denhardt solution, 10% dextran sulfate and cut salmon sperm DNA, denatured 20 µg / ml, followed by washing the filters in 0.1x SSC at about 65 degrees C.

Nucleic acid molecules that hybridize with the G-protein Chemokine Receptor polynucleotides (CCR5) under conditions of low stringency hybridization are also contemplated. Changes in hybridization stringency and signal detection are achieved primarily through manipulation of the formamide concentration (lower percentages of formamide result in lower stringency); salt conditions

or temperature For example, low stringency conditions include overnight incubation at 37 degrees C in a solution comprising 6X SSPE (20X SSPE = 3M NaCl; 0.2M NaH2PO4; 0.02M EDTA, pH 7.4) , 0.5% SDS, 30% formamide, 100 µg / ml salmon sperm blocking DNA; followed by washing at 50 degrees C with 1X SSPE, 0.1% SDS. In addition, to achieve even less stringency, washings performed after rigorous hybridization at higher salt concentrations (for example SSC 5X) can be made.

Note that variations in the above conditions can be achieved through the inclusion and / or substitution of alternative blocking reagents used to suppress the background in hybridization experiments. Typical blocking reagents include Denhardt reagent, BLOTTO, heparin, denatured salmon sperm DNA and commercially available proprietary formulations. The inclusion of specific blocking reagents may require modification of the hybridization conditions described above, due to compatibility problems.

Of course, a polynucleotide that hybridizes only with polyA + sequences (such as any 3 'terminal polyA + region of a DNA shown in the sequence list) or with a complementary stretch of T (or U) moieties, would not be included in the definition of "polynucleotide", since such a polynucleotide would hybridize with any nucleic acid molecule that contains a stretch of poly (A) or complement thereof (eg, virtually any double stranded cDNA clone generated using oligo dT as a primer).

The G protein Chemokine Receptor polynucleotide (CCR5) may be composed of any polyiribonucleotide or polydeoxyribonucleotide, which may be unmodified DNA or RNA or modified DNA or RNA. For example, G-protein Chemokine Receptor polynucleotides (CCR5) may be composed of single or double stranded DNA, DNA that is a mixture of single and double stranded regions, single stranded and double stranded RNA and RNA that is a mixture of single and double stranded regions , hybrid molecules comprising DNA and RNA that can be single stranded or, more typically, double stranded or a mixture of single stranded and double stranded regions. In addition, the G-protein Chemokine Receptor polynucleotides (CCR5) may be composed of three-stranded regions comprising RNA or DNA or both RNA and DNA. The G-protein Chemokine Receptor polynucleotides (CCR5) may also contain one or more modified bases of modified DNA or RNA main chains with respect to stability or for other reasons. "Modified" bases include, for example, tritylated bases and unusual bases such as inosine. A variety of modifications can be made to DNA and RNA; thus, "polynucleotide" encompasses chemically, enzymatically or metabolically modified forms.

The G-protein Chemokine Receptor polynucleotides (CCR5) may be composed of amino acids linked together by peptide bonds or modified peptide bonds, ie, peptide isosters and may contain amino acids other than the 20 amino acids encoded by genes. Polypeptides of the G-protein Chemokine Receptor (CCR5) can be modified by natural methods, such as post-translational processing, or by chemical modification techniques that are well known in the art. Such modifications are well described in basic texts and in more detailed monographs, as well as in a large volume of research literature. Modifications can occur at any site in the G-protein Chemokine Receptor polypeptide (CCR5), including the peptide backbone, amino acid side chains and amino or carboxy terminal ends. It will be appreciated that the same type of modification may be present at the same or varying degrees at various sites in a given G-protein Chemokine Receptor polypeptide (CCR5). In addition, a G-protein Chemokine Receptor polypeptide (CCR5) may contain many types of modifications. Polypeptides of the G-protein Chemokine Receptor (CCR5) can be branched, for example, as a result of ubiquitinization, and can be cyclic, with or without branching. Cyclic, branched and branched cyclic G protein Chemokine Receptor (CCR5) polypeptides may result from natural post-translational procedures or may be prepared by synthetic methods. Modifications include acetylation, acylation, ADP-ribosylation, amidation, covalent binding of flavin, covalent binding of a heme residue, covalent binding of a nucleotide or nucleotide derivative, covalent binding of a lipid or lipid derivative, covalent binding of phosphatidylinositol , cross-linking, cyclization, disulfide bond formation, demethylation, covalent cross-linking formation, cysteine formation, pyroglutamate formation, formylation, gamma-carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristylation, oxidation, pegylation, proteolytic processing, phosphorylation, prepylation, racemization, selenilation, sulphation, RNA-mediated addition of amino acid transfer to proteins such as arginylation and ubiquitinization. (See, for example, PROTEINS - STRUCTURE AND MOLECULAR PROPERTIES, 2nd Ed., TE Creighton, WH Freeman and Company, New York (1993); POSTTRANSLATIONAL COVALENT MODIFICATION OF PROTEINS, BC Johnson, Ed., Academic Press, New York, p. 1-12 (1983); Seifter et al., Meth Enzymol

182: 626-646 (1990); Rattan et al., Ann NY Acad Sci 663: 48-62 (1992).)

"SEQ ID NO: 1" refers to the polynucleotide sequence of the G-protein Chemokine Receptor (CCR5) while "SEQ ID NO: 2" refers to the polypeptide sequence of the G-protein Chemokine Receptor (CCR5).

A G-protein Chemokine Receptor polypeptide (CCR5) "having biological activity" refers to polypeptides that show activity similar, but necessarily identical to, an activity of a G-protein Chemokine Receptor polypeptide (CCR5), including forms mature, as measured in a particular biological test, with or without dose dependence. In the case where there is dose dependence, it is not necessary to be identical to that of the G-protein Chemokine Receptor polypeptide (CCR5), but rather substantially similar to dose dependence in a given activity compared to G-protein Chemokine Receptor polypeptide (CCR5) (ie, the candidate polypeptide will show an activity greater than or not more than about 25 times less and, preferably, no more than about 10 times less activity and more preferably, no more than about three times less activity in relation to the G protein Chemokine Receptor polypeptide (CCR5).

G-protein Chemokine Receptor Polynucleotides and Polypeptides (CCR5)

Clone HDGNR10 from a genomic DNA library of human monocytes was isolated. This clone contains the entire coding region identified as SEQ ID NO: 2. The deposited clone contains a DNA insert having a total of 1414 nucleotides, which encodes a predicted open reading phase of 352 amino acid residues. (See FIGURE 1). The open reading phase begins at an N-terminal methionine located at nucleotide position 259 and ends at the last triplet encoding an amino acid at nucleotide position 1314. The termination codon is at positions 1315-1317.

Subsequent expression analysis also showed expression of the G-protein Chemokine Receptor (CCR5) in macrophages, including immature dendritic cells such as Langerhans cells, and T lymphocytes, including Th0 and Th1 effector lymphocytes, a pattern consistent with the specific expression of the immune system. The G-protein Chemokine Receptor (CCR5) has also been detected in microglia, astrocytes, neurons and vascular endothelial cells of the central nervous system (CNS). The G-protein Chemokine Receptor (CCR5) is also expressed in monocytes and T lymphocytes in the synovial fluid of patients with rheumatoid arthritis and has also been implicated in other forms of arthritis.

Chemokine receptors coupled to protein G. Using BLAST analysis, it was found that SEQ ID NO: 2 was homologous to family members of the Chemoyocin Receptor family COUPLED to protein G. Particularly, SEQ ID NO: 2 contains domains homologous to the translation product. of the MonoMac 6 mRNA for the human MCP-1 receptor (MCP-1R) A (FIGURE 2) (GenBank Accession No. U03882; SEQ ID NO: 9), including the transmembrane domain containing seven characteristic transmembrane segments of the G protein-coupled receptor family, which begins with amino acid 37 of SEQ ID NO: 2 or the polypeptide encoded by the deposited clone. The G-protein Chemokine Receptor (CCR5) also includes the DRY motif, which is known to be necessary for signal transduction, found in many G-protein coupled receptors immediately after the third transmembrane segment. Because it is believed that MCP-1R is important in the immune system, the homology between MCP-1R and the G-protein Chemokine Receptor (CCR5) suggests that the G-protein Chemokine Receptor (CCR5) may also be involved in the immune system

A second MCP-1R sequence has also been isolated that is identical to the MCP-1RA sequence of the 5 ’untranslated region through the seventh potential transmembrane domain but contains a different cytoplasmic tail. This second sequence, called MCP-1RB, appears to be an alternative splice version of MCP-1RA. It is further described in US Patent No. 5,707,815.

Domains Using BLAST analysis, SEQ ID NO: 2 was found to be homologous to members of the G-protein Chemokine Receptor family (CCR5). Particularly, SEQ ID NO: 2 contains domains homologous to the MonoMac 6 mRNA translation product for the human MCP-1 receptor (MCP-1R) A (FIGURE 2) (GenBank Accession No. U03882; SEQ ID NO: 9 ), including the following conserved domains: (a) a predicted N-terminal extracellular domain located approximately in amino acids 1 to 36; (b) a predicted transmembrane domain located approximately at amino acids 37 to 305; and (c) a predicted C-terminal intracellular domain located approximately at amino acids 306 to 352. The predicted transmembrane domain includes: seven transmembrane segments approximately at amino acids 37 to 58 (segment 1), 68 to 88 (segment 2), 103 a 124 (segment 3), 142 to 166 (segment 4), 196 to 223 (segment 5), 236 to 260 (segment 6) and 287 to 305 (segment 7); three intracellular loops approximately at amino acids 59 to 67 (intracellular loop 1), 125 to 141 (intracellular loop 2) and 224 to 235 (intracellular loop 3); and three extracellular loops approximately at amino acids 89 to 102 (extracellular loop 1), 167 to 195 (extracellular loop 2) and 261 to 274 (extracellular loop 3). These polypeptide fragments of the G-protein Chemokine Receptor (CCR5) are described as defined above or as encoded by the deposited clone (SEQ ID NO: 22) as well as combinations of these and other regions described herein. Polypeptides that exclude one or more of these domains, segments and loops are also described. "Loops" are also referred to as "regions", "domains" and "parts" herein and in the art, for example, extracellular "regions", intracellular "regions", extracellular "domains" and intracellular "domains", Extracellular "parts" and intracellular "parts".

SEQ ID NO: 1 and translated SEQ ID NO: 2 are sufficiently accurate and otherwise suitable for a variety of uses well known in the art and are further described below. For example, SEQ ID NO: 1 is useful for designing nucleic acid hybridization probes that will detect nucleic acid sequence contained in SEQ ID NO: 1 or the DNA contained in the deposited clone. These probes will also hybridize with nucleic acid molecules in biological samples, thereby allowing a variety of forensic and diagnostic methods of the invention. Similarly, polypeptides identified from SEQ ID NO: 2 can be used, for example, to generate antibodies that specifically bind to proteins of the G protein Chemokine Receptor.

However, DNA sequences generated by sequencing reactions may contain sequencing errors. The errors exist as erroneously identified nucleotides or as insertions or deletions of nucleotides in the generated DNA sequence. Erroneously inserted or deleted nucleotides cause phase shifts in the reading phases of the predicted amino acid sequence. In these cases, the predicted amino acid sequence differs from the actual amino acid sequence, even though the generated DNA sequence may be more than 99.9% identical to the actual DNA sequence (for example, an insertion or deletion of a base in an open reading phase of more than 1000 bases).

Accordingly, for applications that require precision in the nucleotide sequence or amino acid sequence, the present invention provides not only the generated nucleotide sequence identified as SEQ ID NO: 1 and the predicted translated amino acid sequence identified as SEQ ID NO. : 2, but also a sample of plasmid DNA containing a human DNA from the G-protein Chemokine Receptor (CCR5) deposited in the ATCC. The nucleotide sequence of the deposited G-protein Chemokine Receptor clone (CCR5) can be readily determined by sequencing the deposited clone according to known methods. The amino acid sequence of the predicted G-protein Chemokine Receptor (CCR5) can then be verified from such deposits. In addition, the amino acid sequence of the protein encoded by the deposited clone can also be determined directly by peptide sequencing or by expression of the protein in a suitable host cell containing the deposited human G Chemokine Receptor DNA (CCR5) DNA, collecting the protein and determined its sequence. A sample of the deposited clone, which contains the open reading phase of the G-protein Chemokine Receptor (CCR5), was obtained from the ATCC and resequenced. The sequence data of the resequenced clone are shown in SEQ ID NO: 21 and 22. SEQ ID NO: 21 differs from SEQ ID NO: 1 in 5 positions (nucleotides 320, 433, 442, 646 and 1289 of SEQ ID NO: 1 ) SEQ ID NO: 22 differs from SEQ ID NO: 2 in 5 positions (amino acid residues 21, 59, 62, 130 and 344).

The present description also refers to the G protein Chemokine Receptor (CCR5) gene corresponding to SEQ ID NO: 1, SEQ ID NO: 2 or the deposited clone. The G protein Chemokine Receptor (CCR5) gene can be isolated according to known methods using the sequence information described herein. Such methods include preparing probes or primers of the described sequence and identifying or amplifying the G protein Chemokine Receptor (CCR5) gene from appropriate sources of genomic material.

Allelic variants, orthologs and / or species counterparts are also described. Methods known in the art can be used to obtain full length genes, allelic variants, splicing variants, full length coding parts, orthologs and / or gene species homologs corresponding to SEQ ID NO: 1, SEQ ID NO. : 2 or to the clone deposited, using information from the sequences described herein or the clones deposited in the ATCC. For example, allelic variants and / or species homologs can be isolated and identified by preparing suitable probes or primers from the sequences provided herein and exploring a suitable nucleic acid source with respect to allelic variants and / or the desired homolog.

The G-protein Chemokine Receptor (CCR5) polypeptides can be prepared in any suitable manner. Such polypeptides include isolated naturally occurring polypeptides, recombinantly produced polypeptides, synthetically produced polypeptides or polypeptides produced by a combination of these methods. Means for preparing such polypeptides are well known in the art.

The G-protein Chemokine Receptor (CCR5) polypeptides may be in the form of the secreted protein, including the mature form, or they may be part of a larger protein, such as a fusion protein (see below). It is often advantageous to include an additional amino acid sequence containing secretory or leader sequences, prosequences, sequences that aid purification, such as multiple histidine residues or an additional sequence for stability during recombinant production.

Polypeptides of the G-protein Chemokine Receptor (CCR5) are preferably provided in an isolated form and are preferably substantially purified. A recombinantly produced version of a G protein Chemokine Receptor polypeptide (CCR5) that includes the secreted polypeptide can be substantially purified using techniques described herein or otherwise known in the art, such as, for example, by the one-stage method described in Smith and Johnson, Gene 67: 31-40 (1988). G-protein Chemokine Receptor (CCR5) polypeptides can also be purified from natural, synthetic or recombinant sources using techniques described herein or otherwise known in the art, such as, for example, antibodies of the invention induced against G protein Chemokine Receptor protein (CCR5).

A polynucleotide is described which comprises, or as an alternative consisting of, the nucleic acid sequence of SEQ ID NO: 1 and / or a clone contained in the ATCC 97183 reservoir. A polypeptide is also described which comprises, or alternatively, consisting of the polypeptide sequence of SEQ ID NO: 2 and / or a polypeptide encoded by the clone contained in the ATCC 97183 reservoir. The polynucleotides encoding a polypeptide comprising, or alternatively consisting of, the polypeptide sequence of SEQ ID NO: 2 and / or a polypeptide sequence encoded by the clone contained in the ATCC 97183 reservoir are also described.

Signal Sequences

Mergers of a signal sequence with the polypeptide of SEQ ID NO: 2, and fragments thereof, and / or the polypeptide encoded by the deposited clone, and fragments thereof, to direct secretion of the polypeptide or fragment are described herein. . Polynucleotides encoding such fusions are also described.

Mature forms of the polypeptide having the sequence of SEQ ID NO: 2, and fragments thereof, and / or the polypeptide sequence encoded by the deposited clone and fragments thereof are also described. Polynucleotides encoding mature forms are also described (such as, for example, the polynucleotide sequence of SEQ ID NO: 1, and fragments thereof, and / or the polynucleotide sequence contained in the deposited clone and fragments thereof).

According to the signal hypothesis, proteins secreted by mammalian cells have a signal sequence

or secretory leader that is cleaved from the mature protein once the export of the growing chain has begun through the rough endoplasmic reticulum. Most mammalian cells and even insect cells cleave secreted proteins with the same specificity. However, in some cases, the cleavage of a secreted protein is not completely uniform, which results in two or more mature species of the protein. Additionally, it has long been known that the specificity of cleavage of a secreted protein is ultimately determined by the primary structure of the complete protein, that is, it is inherent in the amino acid sequence of the polypeptide.

Methods are available to predict whether a protein has a signal sequence, as well as the cleavage point for that sequence. For example, McGeoch's method, Virus Res. 3: 271-286 (1985), uses information from a short N-loaded region and a subsequent non-loaded region of the complete (uncleaved) protein. Von Heinje's method, Nucleic Acids Res. 14: 4683-4690 (1986) uses information from the residues surrounding the cleavage site, typically residues -13 to +2, indicating +1 the amino terminal end of the protein secreted The prediction accuracy of the cleavage points of known mammalian secretory proteins for each of these methods is in the range of 75-80% (von Heinje, mentioned above). However, the two methods do not always produce the same point or predicted cleavage points for a given protein.

The deduced amino acid sequence of a secreted polypeptide can be analyzed by a computer program called SignalP (Henrik Nielsen et al., Protein Engineering 10: 1-6 (1997)), which predicts the cellular location of a protein based on the amino acid sequence . As part of this computerized location prediction, the McGeoch and von Heinje methods are incorporated.

As one skilled in the art would appreciate, however, cleavage sites sometimes vary from one organism to another and cannot be predicted with absolute certainty. The cleavage of a heterologous signal sequence in a fusion protein can occur at the junction point of the polypeptide sequences or the cleavage can occur at a position on each side of the junction point. Accordingly, secreted polypeptides having a sequence shown in SEQ ID NO: 2, and fragments thereof, having an N-terminus starting in a space of 5 residues (i.e., + or - 5 residues) of the predicted cleavage point. Similarly, it is also recognized that in some cases, the cleavage of the signal sequence of a secreted protein is not completely uniform, resulting in more than one secreted species. These polypeptides and fragments, and polynucleotides encoding such polypeptides and fragments are described.

In addition, the signal sequence identified by the above analysis may not necessarily predict the signal sequence of natural origin. For example, the signal sequence of natural origin may be more upstream of the predicted signal sequence. However, it is likely that the predicted signal sequence will be able to direct the secreted protein to the ER. However, the mature protein or fragment produced by expression of the polynucleotide sequence of SEQ ID NO: 1 or a fragment thereof and / or the polynucleotide sequence contained in the deposited clone or a fragment thereof, in a cell is described mammalian (for example, COS cells, as described below). These polypeptides and the polynucleotides encoding such polypeptides are described.

Variants of Polynucleotide and Polypeptide

A variant of the polynucleotide sequence described in SEQ ID NO: 1, the strand complementary thereto and / or the sequence contained in a deposited clone is described herein.

Variants of the polypeptide sequence described in SEQ ID NO: 2 and / or encoded by a deposited clone are also described.

"Variant" refers to a polynucleotide or polypeptide that differs from the G-protein Chemokine Receptor polynucleotide or polypeptide (CCR5), but retains essential properties thereof. Generally, the variants are globally very similar and, in many regions, identical to the G-protein Chemokine Receptor polynucleotide or polypeptide (CCR5).

Nucleic acid molecules are described which comprise, or alternatively consisting of, a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to , for example, the nucleotide coding sequence of SEQ ID NO: 1 or the strand complementary thereto, the nucleotide coding sequence contained in a deposited clone or the strand complementary thereto, a nucleotide sequence encoding the polypeptide of SEQ ID NO: 2, a nucleotide sequence encoding the polypeptide encoded by the deposited clone HDGNR10 and / or polynucleotide fragments of any of these nucleic acid molecules (eg, the fragments described herein). The polynucleotides that hybridize with these nucleic acid molecules under stringent hybridization conditions or conditions of less stringency are also described, as well as polypeptides encoded by these polynucleotides.

Polypeptides are also described which comprise, or alternatively consisting of, an amino acid sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to, for example , the polypeptide sequence shown in SEQ ID NO: 2, the polypeptide sequence encoded by the deposited clone and / or polypeptide fragments of any of these polypeptides (eg, the fragments described herein).

By a nucleic acid having a nucleotide sequence of at least, for example, 95% "identical" to a reference nucleotide sequence described herein, it is intended that the nucleotide sequence of the nucleic acid be identical to the sequences of reference except that the nucleotide sequence may include up to five point mutations per 100 nucleotides of the reference nucleotide sequence encoding the G-protein Chemokine Receptor polypeptide (CCR5). In other words, to obtain a nucleic acid having a nucleotide sequence at least 95% identical to a reference nucleotide sequence, up to 5% of the nucleotides in the reference sequence can be deleted or replaced with another nucleotide or several nucleotides. Up to 5% of the total nucleotides in the reference sequence can be inserted into the reference sequence. The search sequence may be a complete sequence shown in SEQ ID NO: 1, the ORF (open reading phase) of the HDGNR10 DNA in the deposited clone or any fragment specified as described herein.

In practical terms, if any particular nucleic acid or polypeptide molecule is at least 80%, 85%. 90%, 95%, 96%, 97%, 98% or 99% identical to a nucleotide or polypeptide sequence described above can be determined conventionally using known computer programs. A referred method for determining the best overall match between a search sequence (a sequence of the present invention) and a subject sequence, also called a global sequence alignment, can be determined using the FASTDB software based on the algorithm of Brutlag et al. . (Comp. App. Biosci. (1990) 6: 237-245). In a sequence alignment the search and subject sequences are both DNA sequences. An RNA sequence can be compared by converting the U to T. The result of said global sequence alignment is in percent identity. Preferred parameters used in a FASTDB alignment of DNA sequences to calculate percent identity are: Matrix = Unitary, k-tuple = 4, Wrong Match Penalty = 1, Union Penalty = 30, Random Selection Group Length = 0, Cut Score = 1, Gap Penalty = 5, Gap Size Penalty 0.05, Window Size = 500 or the length of the subject nucleotide sequence, whichever is shorter.

If the subject sequence is shorter than the search sequence due to 5 'or 3' deletions, not due to internal deletions, a manual correction of the results should be performed. This is because the FASTDB program does not take into account 5 ’and 3’ truncation of the subject sequence when calculating the percent identity. For subject sequences truncated at the 5 'or 3' ends, in relation to the search sequence, the percent identity is corrected by calculating the number of bases of the search sequence that are 5 'and 3' of the subject sequence, which they are not paired / aligned, as a percentage of the total bases of the search sequence. If a nucleotide is matched / aligned it is determined by the results of the sequence alignment of FASTDB. This percentage is subtracted after the identity percentage, calculated using the previous FASTDB program using the specified parameters, to arrive at a final percentage identity score. This corrected score is what is used for the purposes of the present invention. Only the bases outside the 5 'and 3' bases of the subject sequence are calculated, as presented by the alignment of FASTDB, which do not match / align with the search sequence, in order to manually adjust the percent identity for the percentage identity score.

For example, a subject sequence of 90 bases is aligned with a search sequence of 100 bases to determine the percentage of identity. Deletions occur at the 5 ’end of the subject sequence and, therefore, the FASTDB alignment does not show a match / alignment of the first 10 bases at the 5’ end. The 10 unpaired bases represent 10% of the sequence (number of bases at the 5 'and 3' unpaired ends / total number of bases in the search sequence) so that 10% of the percentage percentage score is subtracted. identity calculated by the FASTDB program. If the remaining 90 bases coincided perfectly, the final identity percentage would be 90%. In another example, a subject sequence of 90 bases is compared to a search sequence of 100 bases. On this occasion, the deletions are internal deletions so that there are no bases at the 5 ’or 3’ end of the subject sequence that do not match / align with the search. In this case the percentage of identity calculated by FASTDB is not corrected manually. Again, they are only manually corrected with respect to 5 ’and 3’ bases of the subject sequence that do not match / align with the search sequence. No other manual corrections are made for the purposes of the present invention.

By a polypeptide having an amino acid sequence at least, for example, 95% "identical" to a search amino acid sequence described above, it is intended that the amino acid sequence of the subject polypeptide be identical to the search sequence except that The subject polypeptide sequence may include up to five amino acid alterations per 100 amino acids of the search amino acid sequence. In other words, to obtain a polypeptide having an amino acid sequence at least 95% identical to a search amino acid sequence, up to 5% of the amino acid residues in the subject sequence can be inserted, deleted, (indels) or substituted with another amino acid These alterations of the reference sequence may occur at the amino or carboxy terminal positions of the reference amino acid sequence or at any site between those terminal positions, sandwiched individually between the residues in the reference sequence or in one or more contiguous groups within of the reference sequence.

In practical terms, if any particular polypeptide is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to, for example, the amino acid sequences of SEQ ID NO: 2 or the amino acid sequence encoded by the deposited clone can be determined in a conventional manner using known software. A preferred method for determining the best overall match between a search sequence (a sequence of the present invention) and a subject sequence, also called global sequence alignment, can be determined using the FASTDB software based on the algorithm of Brutlag et al. (Comp. App. Biosci.

6: 237-245 (1990)). In a sequence alignment the search and subject sequences are both nucleotide sequences or both amino acid sequences. The result of said global sequence alignment is in percent identity. Preferred parameters used in an amino acid alignment of FASTDB are: Matrix = PAM 0, k-tuple = 2, Wrong Match Penalty = 1, Union Penalty = 20, Random Selection Group Length = 0, Cut Score = 1, Window Size = sequence length, Gap Penalty = 5, Gap Size Penalty 0.05, Window Size = 500 or the length of the subject amino acid sequence, whichever is shorter.

If the subject sequence is shorter than the search sequence due to terminal N or C deletions, not due to internal deletions, a manual correction of the results must be performed. This is because the FASTDB program does not take into account N and C terminal truncation of the subject sequence when calculating the percentage of global identity. For subject sequences truncated at the N and C terminal ends, in relation to the search sequence, the percent identity is corrected by calculating the number of remains of the search sequence that are N and C terminal of the subject sequence, which do not match / align with a corresponding subject residue, as a percentage of the total bases of the search sequence. If a remainder matches / aligns it is determined by results of the sequence alignment FASTDB. This percentage is subtracted after the identity percentage, calculated by the previous FASTDB program using the specified parameters, to arrive at a final percentage identity score. This final percent identity score is what is used for the purposes of the present invention. Only the remains of the N and C terminal ends of the subject sequence, which do not match / align with the search sequence, are considered for the purpose of manually adjusting the identity percentage score. That is, only the positions of search residues outside the farthest N and C terminal residues of the subject sequence.

For example, a subject sequence of 90 amino acid residues is aligned with a search sequence of 100 residues to determine the percent identity. Deletion occurs at the N-terminal end of the subject sequence and, therefore, the alignment of FASTDB does not show a match / alignment of the first 10 residues at the N-terminal end. The 10 unpaired residues represent 10% of the sequence (number of residues at the N and C terminally mismatched ends / total number of residues in the search sequence) so that 10% of the percentage percentage score is subtracted. identity calculated by the FASTDB program. If the remaining 90 remains were perfectly coincidental, the final identity percentage would be 90%. In another example, a subject sequence of 90 residues is compared to a search sequence of 100 residues. On this occasion, the deletions are internal deletions so that there are no residues at the N and C terminal ends of the subject sequence that do not match / align with the search. In this case the percentage of identity calculated using FASTDB is not corrected manually. Again, only the positions of residues outside the N and C terminal ends of the subject sequence, as presented in the FASTDB alignment, which are not coincident / aligned with the search sequence are manually corrected. No other manual corrections are made for the purposes of the present invention.

Variants of the G-protein Chemokine Receptor (CCR5) may contain alterations in the coding regions, non-coding regions or both. Especially preferred are polynucleotide variants that contain alterations that produce silent substitutions, additions or deletions, but that do not alter the properties or activities of the encoded polypeptide. Nucleotide variants produced by silent substitutions due to degeneracy of the genetic code are preferred. In addition, variants in which 5-10, 1-5 or 1-2 amino acids in any combination are substituted, deleted or added are also preferred. Variants of the G protein Chemokine Receptor polynucleotide (CCR5) can be produced for a variety of reasons, for example, to optimize codon expression for a particular host (change the codons in the human mRNA to those preferred by such a bacterial host like E. coli).

Variants of the naturally occurring G-protein Chemokine Receptor (CCR5) are called "allelic variants", and refer to one of several alternative forms of a gene that occupies a given locus on a chromosome of an organism (Genes II, Lewin , B., ed., John Wiley & Sons, New York (1985)). These allelic variants may vary at the polynucleotide and / or polypeptide level. Alternatively, variants of unnatural origin can be produced by mutagenesis techniques or by direct synthesis.

Using known methods of protein engineering and recombinant DNA technology, variants can be generated to improve or alter the characteristics of the G-protein Chemokine Receptor polypeptides (CCR5). For example, one or more amino acids can be deleted from the N-terminal or C-terminal of the secreted protein without substantial loss of biological function. The authors of Ron et al., J. Biol. Chem. 268: 2984-2988 (1993), indicated variant KGF proteins that had heparin binding activity even after deleting 3, 8 or 27 amino terminal amino acid residues. Similarly, gamma interferon showed up to 10 times greater activity after deleting 8-10 amino acid residues from the carboxy terminal of this protein (Dobeli et al., J. Biotechnology 7: 199-216 (1988).)

In addition, extensive evidence demonstrates that variants often retain a biological activity similar to that of naturally occurring protein. For example, Gayle et al. (J. Biol. Chem 268: 22105-22111 (1993)) performed a thorough mutational analysis of the human cytokine IL-la. They used random mutagenesis to generate more than 3,500 individual mutants of IL-1a that averaged 2.5 amino acid changes per variant over the total length of the molecule. Multiple mutations were examined at each possible amino acid position. The researchers discovered that "most of the molecule could be altered with little effect on [biological binding or activity]." (See, Summary.) In fact, only 23 unique amino acid sequences, among more than

3,500 nucleotide sequences examined produced a protein that differed significantly in wild-type activity.

Furthermore, even if the deletion of one or more amino acids from the N-terminal or C-terminal of a polypeptide results in the modification or loss of one or more biological functions, other biological activities can still be conserved. For example, the ability of a deletion variant to induce and / or bind to antibodies that recognize the secreted form will probably be preserved when less than most of the remains of the secreted form are removed from the N-terminal or C-terminal end. If a particular polypeptide lacking the N-terminal or C-terminal residues of a protein retains such immunogenic activities can be determined by routine methods described herein and otherwise known in the art.

Thus, G-protein Chemokine Receptor (CCR5) polypeptide variants that show substantial biological activity are further described. Such variants include deletions, insertions, inversions, repetitions and substitutions selected in accordance with general rules known in the art to have little effect on the activity.

The present application relates to nucleic acid molecules at least 90%, 95%, 96%, 97%, 98% or 99% identical to the nucleic acid sequences described herein, (eg, encoding a polypeptide having the amino acid sequence of an N and / or C terminal deletion described later as mn of SEQ ID NO: 2) or corresponding to the polypeptide encoded by the deposited clone, regardless of whether they encode a polypeptide having functional activity of the Receptor of G protein chemokine (CCR5). This is because even when a particular nucleic acid molecule does not encode a polypeptide that has functional activity of the G-protein Chemokine Receptor (CCR5), one skilled in the art would still know how to use the nucleic acid molecule, for example, as a hybridization probe or a polymerase chain reaction (PCR) primer. Uses of nucleic acid molecules that do not encode a polypeptide that has functional activity of the G-protein Chemokine Receptor (CCR5) include, among others, (1) isolating a G-protein Chemokine Receptor gene (CCR5) or variants. allelic or splicing thereof in a cDNA library; (2) in situ hybridization (eg, "FISH") with metaphase chromosomal extensions to provide accurate chromosomal localization of the G-protein Chemokine Receptor gene (CCR5), as described in Verma et al., Human Chromosomes: A Manual of Basic Techniques, Pergamon Press, New York (1988); and (3) Northern blot analysis to detect mRNA expression of the G-protein Chemokine Receptor (CCR5) in specific tissues.

However, nucleic acid molecules having sequences of at least 90%, 95%, 96%, 97%, 98% are preferred

or 99% identical to the nucleic acid sequences described herein, which, in fact, encode a polypeptide that has functional activity of the G-protein Chemokine Receptor (CCR5). By "a polypeptide having functional activity of the G-protein Chemokine Receptor (CCR5)" polypeptides are shown that show similar, but not necessarily identical, activity to a functional activity of the G-protein Chemokine Receptor polypeptides (CCR5) ( for example, full-length (full-length) G-protein chemokine receptor, mature G-protein chemokine (CCR5) receptor and soluble G-protein (CCR5) chemokine receptor (for example, having sequences contained in the regions or the extracellular domain of the G-protein Chemokine Receptor), as measured, for example, in a particular immunoassay or biological assay.For example, a functional activity of the G-protein Chemokine Receptor (CCR5) can be measured routinely determining the ability of a G-protein Chemokine Receptor polypeptide (CCR5) to bind a G-protein Chemokine Receptor ligand (CCR5). Functional ivity of the G-protein Chemokine Receptor (CCR5) can also be measured by determining the ability of a polypeptide, such as a related ligand that is free or expressed on a cell surface, to induce cells that express the polypeptide.

Of course, due to the degeneracy of the genetic code, one skilled in the art will immediately recognize that a large number of nucleic acid molecules having a sequence of at least 90%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of the deposited clone, the nucleic acid sequence shown in FIGURE 1 (SEQ ID NO: 1), or fragments thereof, will encode polypeptides "having functional activity of the Chemokine Receptor of G protein (CCR5) ”. In fact, since degenerate variants of any of these nucleotide sequences encode all the same polypeptide, in many cases, this will be apparent to the person skilled in the art even without performing the comparison test described above. It will be further recognized in the art that, for such nucleic acid molecules that are not degenerate variants, a reasonable number will also encode a polypeptide that has functional activity of the G-protein Chemokine Receptor (CCR5). This is because the person skilled in the art is fully aware of amino acid substitutions that are less likely or unlikely to perform protein function significantly (for example, replacing an aliphatic amino acid with a second aliphatic amino acid), as further described. later.

For example, guidelines are provided regarding how to prepare phenotypically silent amino acid substitutions in Bowie et al., "Deciphering the Message in Protein Sequences: Tolerance to Amino Acid Substitutions," Science 247: 1306-1310 (1990), in which The authors indicate that there are two main strategies to study the tolerance of an amino acid sequence to change.

The first strategy exploits the tolerance of amino acid substitutions by natural selection during the evolution process. By comparison of amino acid sequences in different species, conserved amino acids can be identified. These conserved amino acids are probably important for protein function. In contrast, the amino acid positions in which substitutions have been tolerated by natural selection indicate that these positions are not critical to protein function. Therefore, positions that tolerate amino acid substitution could be modified while still maintaining the biological activity of the protein.

The second strategy uses genetic engineering to introduce amino acid changes at specific positions of a cloned gene to identify critical regions for protein function. For example, directed mutagenesis or alanine scanning mutagenesis (introduction of simple alanine mutations in each moiety in the molecule) can be used. (Cunningham and Wells, Science 244: 1081-1085 (1989)). The resulting mutant molecules can then be tested for biological activity.

As the authors indicate, these two strategies have revealed that proteins are surprisingly tolerant of amino acid substitutions. The authors further indicate what amino acid changes are likely permissive at certain amino acid positions in the protein. For example, the majority of interned amino acid residues (within the tertiary structure of the protein) require non-polar side chains, while few characteristics of surface side chains are generally preserved. In addition, tolerated conservative amino acid substitutions involve the replacement of aliphatic or hydrophobic amino acids Ala, Val, Leu and Ile; the replacement of the hydroxyl moieties Ser and Thr; the replacement of the acidic remains Asp and Glu; the replacement of the amide residues Asn and Gln, the replacement of the basic residues Lys, Arg and His; the replacement of the aromatic residues Phe, Tyr and Trp and the replacement of the small-sized amino acids Ala, Ser, Thr, Met and Gly.

For example, directed changes in the amino acid level of the G-protein Chemokine Receptor (CCR5) can be made by replacing a particular amino acid with a conservative amino acid. Preferred conservative mutations of the G-protein Chemokine Receptor (CCR5) (SEQ ID NO: 2) include: M1 replaced with A, G, I, L, S, T, or V; D2 replaced with E; Y3 replaced with F, or W; Q4 replaced with N; V5 replaced with A, G, I, L, S, T, or M; S6 replaced with A, G, I, L, T, M, or V; S7 replaced with A, G, I, L, T, M, or V; I9 replaced with A, G, L, S, T, M, or V; Y10 replaced with F, or W; D11 replaced with E; I12 replaced with A, G, L, S, T, M, or V; N13 replaced with Q; Y14 replaced with F, or W; Y15 replaced with F, or W; T16 replaced with A, G, I, L, S, M, or V; S17 replaced with A, G, I, L, T, M, or V; E18 replaced with D; K22 replaced with H, or R; I23 replaced with A, G, L, S, T, M, or V; N24 replaced with Q; V25 replaced with A, G, I, L, S, T, or M; K26 replaced with H, or R; Q27 replaced with N; I28 replaced with A, G, L, S, T, M, or V; A29 replaced with G, I, L, S, T, M, or V; A30 replaced with G, I, L, S, T, M, or V; R31 replaced with H, or K; L32 replaced with A, G, I, S, T, M, or V; L33 replaced with A, G, I, S, T, M, or V; L36 replaced with A, G, I, S, T, M, or V; Y37 replaced with F, or W; S38 replaced with A, G, I, L, T, M, or V; L39 replaced with A, G, I, S, T, M, or V; V40 replaced with A, G, I, L, S, T, or M; F41 replaced with W, or Y; I42 replaced with A, G, L, S, T, M, or V; F43 replaced with W, or Y; G44 replaced with A, I, L, S, T, M, or V; F45 replaced with W, o- Y; V46 replaced with A, G, I, L, S, T, or M; G47 replaced with A, I, L, S, T, M, or V; N48 replaced with Q; M49 replaced with A, G, I, L, S, T, or V; L50 replaced with A, G, I, S, T, M, or V; V51 replaced with A, G, I, L, S, T, or M; I52 replaced with A, G, L, S, T, M, or V; L53 replaced with A, G, I, S, T, M, or V; I54 replaced with A, G, L, S, T, M, or V; L55 replaced with A, G, I, S, T, M, or V; I56 replaced with A, G, L, S, T, M, or V; N57 replaced with Q; Q59 replaced with N; R60 replaced with H, or K; L61 replaced with A, G, I, S, T, M, or V; E62 replaced with D; S63 replaced with A, G, I, L, T, M, or V; M64 replaced with A, G, I, L, S, T, or V; T65 replaced with A, G, I, L, S, M, or V; D66 replaced with E; I67 replaced with A, G, L, S, T, M, or V; Y68 replaced with F, or W; L69 replaced with A, G, I, S, T, M, or V; L70 replaced with A, G, I, S, T, M, or V; N71 replaced with Q; L72 replaced with A, G, I, S, T, M, or V; A73 replaced with G, I, L, S, T, M, or V; 174 replaced with A, G, L, S, T, M, or V; S75 replaced with A, G, I, L, T, M, or V; D76 replaced with E; L77 replaced with A, G, I, S, T, M, or V; F78 replaced with W, or Y; F79 replaced with W, or Y; L80 replaced with A, G, I, S, T, M, or V; L81 replaced with A, G, I, S, T, M, or V; T82 replaced with A, G, I, L, S, M, or V; V83 replaced with A, G, I, L, S, T, or M; F85 replaced with W, or Y; W86 replaced with F, or Y; A87 replaced with G, I, L, S, T, M, or V; H88 replaced with K, or R; Y89 replaced with F, or W; A90 replaced with G, I, L, S, T, M, or V; A91 replaced with G, I, L, S, T, M, or V; A92 replaced with G, I, L, S, T, M, or V; Q93 replaced with N; W94 replaced with F, or Y; D95 replaced with E; F96 replaced with W, or Y; G97 replaced with A, I, L, S, T, M, or V; N98 replaced with Q; T99 replaced with A, G, I, L, S, M, or V; M100 replaced with A, G, I, L, S, T, or V; Q102 replaced with N; L103 replaced with A, G, I, S, T, M, or V; L104 replaced with A, G, I, S, T, M, or V; T105 replaced with A, G, I, L, S, M, or V; G106 replaced with A, I, L, S, T, M, or V; L107 replaced with A, G, I, S, T, M, or V; Y108 replaced with F, or W; F109 replaced with W, or Y; I110 replaced with A, G, L, S, T, M, or V; G111 replaced with A, I, L, S, T, M, or V; F112 replaced with W, or Y; F113 replaced with W, or Y; S114 replaced with A, G, I, L, T, M, or V; G115 replaced with A, I, L, S, T, M, or V; I116 replaced with A, G, L, S, T, M, or V; F117 replaced with W, or Y; F118 replaced with W,

or Y; I119 replaced with A, G, L, S, T, M, or V; I120 replaced with A, G, L, S, T, M, or V; L121 replaced with A, G, I, S, T, M, or V; L122 replaced with A, G, I, S, T, M, or V; T123 replaced with A, G, I, L, S, M, or V; I124 replaced with A, G, L, S, T, M, or V; D125 replaced with E; R126 replaced with H, or K; Y127 replaced with F, or W; L128 replaced with A, G, I, S, T, M, or V; A129 replaced with G, I, L, S, T, M, or V; I130 replaced with A, G, L, S, T, M, or V; V131 replaced with A, G, I, L, S, T, or M; H132 replaced with K, or R; A133 replaced with G, I, L, S, T, M, or V; V134 replaced with A, G, I, L, S, T, or M; F135 replaced with W, or Y; A136 replaced with G, I, L, S, T, M, or V; L137 replaced with A, G, I, S, T, M, or V; K138 replaced with H, or R; A139 replaced with G, I, L, S, T, M, or V; R140 replaced with H, or K; T141 replaced with A, G, I, L, S, M, or V; V142 replaced with A, G, I, L, S, T, or M; T143 replaced with A, G, I, L, S, M, or V; F144 replaced with W, or Y; G145 replaced with A, I, L, S, T, M, or V; V146 replaced with A, G, I, L, S, T, or M; V147 replaced with A, G, I, L, S, T, or M; T148 replaced with A, G, I, L, S, M, or V; S149 replaced with A, G, I, L, T, M, or V; V150 replaced with A, G, I, L, S, T, or M; I151 replaced with A, G, L, S, T, M, or V; T152 replaced with A, G, I, L, S, M, or V; W153 replaced with F, or Y; V154 replaced with A, G, I, L, S, T, or M; V155 replaced with A, G, I, L, S, T, or M; A156 replaced with G, I, L, S, T, M, or V; V157 replaced with A, G, I, L, S, T, or M; F158 replaced with W, or Y; A159 replaced with G, I, L, S, T, M, or V; S160 replaced with A, G, I, L, T, M, or V; L161 replaced with A, G, I, S, T, M, or V; G163 replaced with A, I, L, S, T, M, or V; I164 replaced with A, G, L, S, T, M, or V; I165 replaced with A, G, L, S, T, M, or V; F166 replaced with W, or Y; T167 replaced with A, G, I, L, S, M, or V; R168 replaced with H, or K; S169 replaced with A, G, I, L, T, M, or V; Q170 replaced with N; K171 replaced with H, or R; E172 replaced with D; G173 replaced with A, I, L, S, T, M, or V; L174 replaced with A, G, I, S, T, M, or V; H175 replaced with K, or R; Y176 replaced with F, or W; T177 replaced with A, G, I, L, S, M, or V; S179 replaced with A, G, I, L, T, M, or V; S180 replaced with A, G, I, L, T, M, or V; H181 replaced with K, or R; F182 replaced with W, or Y; Y184 replaced with F, or W; S185 replaced with A, G, I, L, T, M, or V; Q186 replaced with N; Y187 replaced with F, or W; Q188 replaced with N; F189 replaced with W, or Y; W190 replaced with F, or Y; K191 replaced with H, or R; N192 replaced with Q; F193 replaced with W, or Y; Q194 replaced with N; T195 replaced with A, G, I, L, S, M, or V; L196 replaced with A, G, I, S, T, M, or V; K197 replaced with H, or R; I198 replaced with A, G, L, S, T, M, or V; V199 replaced with A, G, I, L, S, T, or M; 1200 replaced with A, G, L, S, T, M, or V; L201 replaced with A, G, I, S, T, M, or V; G202 replaced with A, I, L, S, T, M, or V; L203 replaced with A, G, I, S, T, M, or V; V204 replaced with A, G, I, L, S, T, or M; L205 replaced with A, G, I, S, T, M, or V; L207 replaced with A, G, I, S, T, M, or V; L208 replaced with A, G, I, S, T, M, or V; V209 replaced with A, G, I, L, S, T, or M; M210 replaced with A, G, I, L, S, T, or V; V211 replaced with A, G, I, L, S, T, or M; I212 replaced with A, G, L, S, T, M, or V; Y214 replaced with F, or W; S215 replaced with A, G, I, L, T, M, or V; G216 replaced with A, I, L, S, T, M, or V; I217 replaced with A, G, L, S, T, M, or V; L218 replaced with A, G, I, S, T, M, or V; K219 replaced with H, or R; T220 replaced with A, G, I, L, S, M, or V; L221 replaced with A, G, I, S, T, M, or V; L222 replaced with A, G, I, S, T, M, or V; R223 replaced with H, or K; R225 replaced with H, or K; N226 replaced with Q; E227 replaced with D; K228 replaced with H, or R; K229 replaced with H, or R; R230 replaced with H, or K; H231 replaced with K, or R; R232 replaced with H, or K; A233 replaced with G, I, L, S, T, M, or V; V234 replaced with A, G, I, L, S, T, or M; R235 replaced with H, or K; L236 replaced with A, G, I, S, T, M, or V; I237 replaced with A, G, L, S, T, M, or V; F238 replaced with W, or Y; T239 replaced with A, G, I, L, S, M, or V; I240 replaced with A, G, L, S, T, M, or V; M241 replaced with A, G, I, L, S, T, or V; I242 replaced with A, G, L, S, T, M, or V; V243 replaced with A, G, I, L, S, T, or M; Y244 replaced with F, or W; F245 replaced with W, or Y; L246 replaced with A, G, I, S, T, M, or V; F247 replaced with W, or Y; W248 replaced with F, or Y; A249 replaced with G, I, L, S, T, M, or V; Y251 replaced with F, or W; N252 replaced with Q; I253 replaced with A, G, L, S, T, M, or V; V254 replaced with A, G, I, L, S, T, or M; L255 replaced with A, G, I, S, T, M, or V; L256 replaced with A, G, I, S, T, M, or V; L257 replaced with A, G, I, S, T, M, or V; N258 replaced with Q; T259 replaced with A, G, I, L, S, M, or V; F260 replaced with W, or Y; Q261 replaced with N; E262 replaced with D; F263 replaced with W, or Y; F264 replaced with W, or Y; G265 replaced with A, I, L, S, T, M, or V; L266 replaced with A, G, I, S, T, M, or V; N267 replaced with Q; N268 replaced with Q; S270 replaced with A, G, I, L, T, M, or V; S271 replaced with A, G, I, L, T, M, or V; S272 replaced with A, G, I, L, T, M, or V; N273 replaced with Q; R274 replaced with H, or K; L275 replaced with A, G, I, S, T, M, or V; D276 replaced with E; Q277 replaced with N; A278 replaced with G, I, L, S, T, M, or V; M279 replaced with A, G, I, L, S, T, or V; Q280 replaced with N; V281 replaced with A, G, I, L, S, T, or M; T282 replaced with A, G, I, L, S, M, or V; E283 replaced with D; T284 replaced with A, G, I, L, S, M, or V; L285 replaced with A, G, I, S, T, M, or V; G286 replaced with A, I, L, S, T, M, or V; M287 replaced with A, G, I, L, S, T, or V; T288 replaced with A, G, I, L, S, M, or V; H289 replaced with K, or R; I292 replaced with A, G, L, S, T, M, or V; N293 replaced with Q; I295 replaced with A, G, L, S, T, M, or V; I296 replaced with A, G, L, S, T, M, or V; Y297 replaced with F, or W; A298 replaced with G, I, L, S, T, M, or V; F299 replaced with W, or Y; V300 replaced with A, G, I, L, S, T, or M; G301 replaced with A, I, L, S, T, M, or V; E302 replaced with D; K303 replaced with H, or R; F304 replaced with W, or Y; R305 replaced with H, or K; N306 replaced with Q; Y307 replaced with F, or W; L308 replaced with A, G, I, S, T, M, or V; L309 replaced with A, G, I, S, T, M, or V; V310 replaced with A, G, I, L, S, T, or M; F311 replaced with W, or Y; F312 replaced with W, or Y; Q313 replaced with N; K314 replaced with H, or R; H315 replaced with K, or R; I316 replaced with A, G, L, S, T, M, or V; A317 replaced with G, I, L, S, T, M, or V; K318 replaced with H, or R; R319 replaced with H, or K; F320 replaced with W, or Y; K322 replaced with H, or R; S325 replaced with A, G, I, L, T, M, or V; I326 replaced with A, G, L, S, T, M, or V; F327 replaced with W, or Y; Q328 replaced with N; Q329 replaced with N; E330 replaced with D; A331 replaced with G, I, L, S, T, M, or V; E333 replaced with D; R334 replaced with H, or K; A335 replaced with G, I, L, S, T, M, or V; S336 replaced with A, G, I, L, T, M, or V; S337 replaced with A, G, I, L, T, M, or V; V338 replaced with A, G, I, L, S, T, or M; Y339 replaced with F, or W; T340 replaced with A, G, I, L, S, M, or V; R341 replaced with H, or K; S342 replaced with A, G, I, L, T, M, or V; T343 replaced with A, G, I, L, S, M, or V; G344 replaced with A, I, L, S, T, M, or V; E345 replaced with D; Q346 replaced with N; E347 replaced with D; I348 replaced with A, G, L, S, T, M, or V; S349 replaced with A, G, I, L, T, M, or V; V350 replaced with A, G, I, L, S, T, or M; G351 replaced with A, I, L, S, T, M, or V; and / or L352 replaced with A, G, I, S, T, M, or V.

Preferred conservative mutations of the G-protein Chemokine Receptor (CCR5) as encoded by the deposited clone HDGNR10 (SEQ ID NO: 22) include: M1 replaced with A, G, I, L, S, T, or V; D2 replaced with E; Y3 replaced with F, or W; Q4 replaced with N; V5 replaced with A, G, I, L, S, T, or M; S6 replaced with A, G, I, L, T, M, or V; S7 replaced with A, G, I, L, T, M, or V; I9 replaced with A, G, L, S, T, M, or V; Y10 replaced with F, or W; D11 replaced with E; I12 replaced with A, G, L, S, T, M, or V; N13 replaced with Q; Y14 replaced with F, or W; Y15 replaced with F, or W; T16 replaced with A, G, I, L, S, M, or V; S17 replaced with A, G, I, L, T, M, or V; E18 replaced with D; Q21 replaced with N; K22 replaced with H, or R; I23 replaced with A, G, L, S, T, M, or V; N24 replaced with Q; V25 replaced with A, G, I, L, S, T, or M; K26 replaced with H, or R; Q27 replaced with N; I28 replaced with A, G, L, S, T, M, or V; A29 replaced with G, I, L, S, T, M, or V; A30 replaced with G, I, L, S, T, M, or V; R31 replaced with H, or K; L32 replaced with A, G, I, S, T, M, or V; L33 replaced with A, G, I, S, T, M, or V; L36 replaced with A, G, I, S, T, M, or V; Y37 replaced with F, or W; S38 replaced with A, G, I, L, T, M, or V; L39 replaced with A, G, I, S, T, M, or V; V40 replaced with A, G, I, L, S, T, or M; F41 replaced with W, or Y; I42 replaced with A, G, L, S, T, M, or V; F43 replaced with W, or Y; G44 replaced with A, I, L, S, T, M, or V; F45 replaced with W, or Y; V46 replaced with A, G, I, L, S, T, or M; G47 replaced with A, I, L, S, T, M, or V; N48 replaced with Q; M49 replaced with A, G, I, L, S, T, or V; L50 replaced with A, G, I, S, T, M, or V; V51 replaced with A, G, I, L, S, T, or M; I52 replaced with A, G, L, S, T, M, or V; L53 replaced with A, G, I, S, T, M, or V; I54 replaced with A, G, L, S, T, M, or V; L55 replaced with A, G, I, S, T, M, or V; I56 replaced with A, G, L, S, T, M, or V; N57 replaced with Q; K59 replaced with H, or R; R60 replaced with H, or K; L61 replaced with A, G, I, S, T, M, or V; K62 replaced with H, or R; S63 replaced with A, G, I, L, T, M, or V; M64 replaced with A, G, I, L, S, T, or V; T65 replaced with A, G, I, L, S, M, or V; D66 replaced with E; I67 replaced with A, G, L, S, T, M, or V; Y68 replaced with F, or W; L69 replaced with A, G, I, S, T, M, or V; L70 replaced with A, G, I, S, T, M, or V; N71 replaced with Q; L72 replaced with A, G, I, S, T, M, or V; A73 replaced with G, I, L, S, T, M, or V; I74 replaced with A, G, L, S, T, M, or V; S75 replaced with A, G, I, L, T, M, or V; D76 replaced with E; L77 replaced with A, G, I, S, T, M, or V; F78 replaced with W, or Y; F79 replaced with W, or Y; L80 replaced with A, G, I, S, T, M, or V; L81 replaced with A, G, I, S, T, M, or V; T82 replaced with A, G, I, L, S, M, or V; V83 replaced with A, G, I, L, S, T, or M; F85 replaced with W, or Y; W86 replaced with F, or Y; A87 replaced with G, I, L, S, T, M, or V; H88 replaced with K, or R; Y89 replaced with F, or W; A90 replaced with G, I, L, S, T, M, or V; A91 replaced with G, I, L, S, T, M, or V; A92 replaced with G, I, L, S, T, M, or V; Q93 replaced with N; W94 replaced with F, or Y; D95 replaced with E; F96 replaced with W, or Y; G97 replaced with A, I, L, S, T, M, or V; N98 replaced with Q; T99 replaced with A, G, I, L, S, M, or V; M100 replaced with A, G, I, L, S, T, or V; Q102 replaced with N; L103 replaced with A, G, I, S, T, M, or V; L104 replaced with A, G, I, S, T, M, or V; T105 replaced with A, G, I, L, S, M, or V; G106 replaced with A, I, L, S, T, M, or V; L107 replaced with A, G, I, S, T, M, or V; Y108 replaced with F, or W; F109 replaced with W, or Y; I110 replaced with A, G, L, S, T, M, or V; G111 replaced with A, I, L, S, T, M, or V; F112 replaced with W, or Y; F113 replaced with W, or Y; S114 replaced with A, G, I, L, T, M, or V; G115 replaced with A, I, L, S, T, M, or V; I116 replaced with A, G, L, S, T, M, or V; F117 replaced with W, or Y; F118 replaced with W,

or Y; I119 replaced with A, G, L, S, T, M, or V; I120 replaced with A, G, L, S, T, M, or V; L121 replaced with A, G, I, S, T, M, or V; L122 replaced with A, G, I, S, T, M, or V; T123 replaced with A, G, I, L, S, M, or V; I124 replaced with A, G, L, S, T, M, or V; D125 replaced with E; R126 replaced with H, or K; Y127 replaced with F, or W; L128 replaced with A, G, I, S, T, M, or V; A129 replaced with G, I, L, S, T, M, or V; V130 replaced with A, G, I, L, S, T, or M; V131 replaced with A, G, I, L, S, T, or M; H132 replaced with K, or R; A133 replaced with G, I, L, S, T, M, or V; V134 replaced with A, G, I, L, S, T, or M; F135 replaced with W, or Y; A136 replaced with G, I, L, S, T, M, or V; L137 replaced with A, G, I, S, T, M, or V; K138 replaced with H, or R; A139 replaced with G, I, L, S, T, M, or V; R140 replaced with H, or K; T141 replaced with A, G, I, L, S, M, or V; V142 replaced with A, G, I, L, S, T, or M; T143 replaced with A, G, I, L, S, M, or V; F144 replaced with W, or Y; G145 replaced with A, I, L, S, T, M, or V; V146 replaced with A, G, I, L, S, T, or M; V147 replaced with A, G, I, L, S, T, or M; T148 replaced with A, G, I, L, S, M, or V; S149 replaced with A, G, I, L, T, M, or V; V150 replaced with A, G, I, L, S, T, or M; I151 replaced with A, G, L, S, T, M, or V; T152 replaced with A, G, I, L, S, M, or V; W153 replaced with F, or Y; V154 replaced with A, G, I, L, S, T, or M; V155 replaced with A, G, I, L, S, T, or M; A156 replaced with G, I, L, S, T, M, or V; V157 replaced with A, G, I, L, S, T, or M; F158 replaced with W, or Y; A159 replaced with G, I, L, S, T, M, or V; S160 replaced with A, G, I, L, T, M, or V; L161 replaced with A, G, I, S, T, M, or V; G163 replaced with A, I, L, S, T, M, or V; I164 replaced with A, G, L, S, T, M, or V; I165 replaced with A, G, L, S, T, M, or V; F166 replaced with W, or Y; T167 replaced with A, G, I, L, S, M, or V; R168 replaced with H, or K; S169 replaced with A, G, I, L, T, M, or V; Q170 replaced with N; K171 replaced with H, or R; E172 replaced with D; G173 replaced with A, I, L, S, T, M, or V; L174 replaced with A, G, I, S, T, M, or V; H175 replaced with K, or R; Y176 replaced with F, or W; T177 replaced with A, G, I, L, S, M, or V; S179 replaced with A, G, I, L, T, M, or V; S180 replaced with A, G, I, L, T, M, or V; H181 replaced with K, or R; F182 replaced with W, or Y; Y184 replaced with F, or W; S185 replaced with A, G, I, L, T, M, or V; Q186 replaced with N; Y187 replaced with F, or W; Q188 replaced with N; F189 replaced with W, or Y; W190 replaced with F, or Y; K191 replaced with H, or R; N192 replaced with Q; F193 replaced with W, or Y; Q194 replaced with N; T195 replaced with A, G, I, L, S, M, or V; L196 replaced with A, G, I, S, T, M, or V; K197 replaced with H, or R; I198 replaced with A, G, L, S, T, M, or V; V199 replaced with A, G, I, L, S, T, or M; 1200 replaced with A, G, L, S, T, M, or V; L201 replaced with A, G, I, S, T, M, or V; G202 replaced with A, I, L, S, T, M, or V; L203 replaced with A, G, I, S, T, M, or V; V204 replaced with A, G, I, L, S, T, or M; L205 replaced with A, G, I, S, T, M, or V; L207 replaced with A, G, I, S, T, M, or V; L208 replaced with A, G, I, S, T, M, or V; V209 replaced with A, G, I, L, S, T, or M; M210 replaced with A, G, I, L, S, T, or V; V211 replaced with A, G, I, L, S, T, or M; I212 replaced with A, G, L, S, T, M, or V; Y214 replaced with F, or W; S215 replaced with A, G, I, L, T, M, or r V; G 2 16 replaced with A, I, L, S, T, M, or V; I217 replaced with A, G, L, S, T, M, or V; L218 replaced with A, G, I, S, T, M, or V; K219 replaced with H, or R; T220 replaced with A, G, I, L, S, M, or V; L221 replaced with A, G, I, S, T, M, or V; L222 replaced with A, G, I, S, T, M, or V; R223 replaced with H, or K; R225 replaced with H, or K; N226 replaced with Q; E227 replaced with D; K228 replaced with H, or R; K229 replaced with H, or R; R230 replaced with H, or K; H231 replaced with K, or R; R232 replaced with H, or K; A233 replaced with G, I, L, S, T, M, or V; V234 replaced with A, G, I, L, S, T, or M; R235 replaced with H, or K; L236 replaced with A, G, I, S, T, M, or V; I237 replaced with A, G, L, S, T, M, or V; F238 replaced with W, or Y; T239 replaced with A, G, I, L, S, M, or V; I240 replaced with A, G, L, S, T, M, or V; M241 replaced with A, G, I, L, S, T, or V; I242 replaced with A, G, L, S, T, M, or V; V243 replaced with A, G, I, L, S, T, or M; Y244 replaced with F, or W; F245 replaced with W, or Y; L246 replaced with A, G, I, S, T, M, or V; F247 replaced with W, or Y; W248 replaced with F, or Y; A249 replaced with G, I, L, S, T, M, or V; Y251 replaced with F, or W; N252 replaced with Q; I253 replaced with A, G, L, S, T, M, or V; V254 replaced with A, G, I, L, S, T, or M; L255 replaced with A, G, I, S, T, M, or V; L256 replaced with A, G, I, S, T, M, or V; L257 replaced with A, G, I, S, T, M, or V; N258 replaced with Q; T259 replaced with A, G, I, L, S, M, or V; F260 replaced with W, or Y; Q261 replaced with N; E262 replaced with D; F263 replaced with W, or Y; F264 replaced with W, or Y; G265 replaced with A, I, L, S, T, M, or V; L266 replaced with A, G, I, S, T, M, or V; N267 replaced with Q; N268 replaced with Q; S270 replaced with A, G, I, L, T, M, or V; S271 replaced with A, G, I, L, T, M, or V; S272 replaced with A, G, I, L, T, M, or V; N273 replaced with Q; R274 replaced with H, or K; L275 replaced with A, G, I, S, T, M, or V; D276 replaced with E; Q277 replaced with N; A278 replaced with G, I, L, S, T, M, or V; M279 replaced with A, G, I, L, S, T, or V; Q280 replaced with N; V281 replaced with A, G, I, L, S, T, or M; T282 replaced with A, G, I, L, S, M, or V; E283 replaced with D; T284 replaced with A, G, I, L, S, M, or V; L285 replaced with A, G, I, S, T, M, or V; G286 replaced with A, I, L, S, T, M, or V; M287 replaced with A, G, I, L, S, T, or V; T288 replaced with A, G, I, L, S, M, or V; H289 replaced with K, or R; I292 replaced with A, G, L, S, T, M, or V; N293 replaced with Q; I295 replaced with A, G, L, S, T, M, or V; I296 replaced with A, G, L, S, T, M, or V; Y297 replaced with F, or W; A298 replaced with G, I, L, S, T, M, or V; F299 replaced with W, or Y; V300 replaced with A, G, I, L, S, T, or M; G301 replaced with A, I, L, S, T, M, or V; E302 replaced with D; K303 replaced with H, or R; F304 replaced with W, or Y; R305 replaced with H, or K; N306 replaced with Q; Y307 replaced with F, or W; L308 replaced with A, G, I, S, T, M, or V; L309 replaced with A, G, I, S, T, M, or V; V310 replaced with A, G, I, L, S, T, or M; F311 replaced with W, or Y; F312 replaced with W, or Y; Q313 replaced with N; K314 replaced with H, or R; H315 replaced with K, or R; I316 replaced with A, G, L, S, T, M, or V; A317 replaced with G, I, L, S, T, M, or V; K318 replaced with H, or R; R319 replaced with H, or K; F320 replaced with W, or Y; K322 replaced with H, or R; S325 replaced with A, G, I, L, T, M, or V; I326 replaced with A, G, L, S, T, M, or V; F327 replaced with W, or Y; Q328 replaced with N; Q329 replaced with N; E330 replaced with D; A331 replaced with G, I, L, S, T, M, or V; E333 replaced with D; R334 replaced with H, or K; A335 replaced with G, I, L, S, T, M, or V; S336 replaced with A, G, I, L, T, M, or V; S337 replaced with A, G, I, L, T, M, or V; V338 replaced with A, G, I, L, S, T, or M; Y339 replaced with F, or W; T340 replaced with A, G, I, L, S, M, or V; R341 replaced with H, or K; S342 replaced with A, G, I, L, T, M, or V; T343 replaced with A, G, I, L, S, M, or V; E344 replaced with D; E345 replaced with D; Q346 replaced with N; E347 replaced with D; I348 replaced with A, G, L, S, T, M, or V; S349 replaced with A, G, I, L, T, M, or V; V350 replaced with A, G, I, L, S, T, or M; G351 replaced with A, I, L, S, T, M, or V; and / or L352 replaced with A, G, I, S, T, M, or V.

The resulting constructs can be routinely explored with respect to activities or functions described throughout the specification and are known in the art. Preferably, the resulting constructs have an activity or function of the G-protein Chemokine Receptor (CCR5) increased and / or decreased, while the remaining activities or functions of the G-protein Chemokine Receptor (CCR5) are maintained. More preferably, the resulting constructs have more than one activity or function of the G-protein Chemokine Receptor (CCR5) increased and / or decreased, while the rest of the activities or functions of the remaining G-Chemokine Receptor (CCR5) are keep.

In addition to conservative amino acid substitution the variants of the G-protein Chemokine Receptor (CCR5) include (i) substitutions with one or more of the unconserved amino acid residues, in which the substituted amino acid residues may or may not be one encoded by the genetic code or (ii) substitution with one or more amino acid residues having a substituent group or (iii) fusion of the mature polypeptide with another compound, such as a compound to increase the stability and / or solubility of the polypeptide (eg, polyethylene glycol) or (iv) fusion of the polypeptide with additional amino acids, such as, for example, an IgG Fc fusion region peptide or secretory or leader sequence or a sequence that facilitates purification. Such variant polypeptides are considered within the scope for those skilled in the art from the teachings herein.

For example, variants of the G-protein Chemokine Receptor polypeptide (CCR5) containing amino acid substitutions of amino acids loaded with other charged or neutral amino acids can produce proteins with improved characteristics, such as less aggregation. The aggregation of pharmaceutical formulations reduces the activity and increases the clearance due to the immunogenic activity of the aggregate. (Pinckard et al., Clin. Exp. Immunol. 2: 331-340 (1967); Robbins et al., Diabetes 36: 838-845 (1987); Cleland et al., Crit. Rev. Therapeutic Drug Carrier Systems 10 : 307-377 (1993)).

For example, preferred non-conservative substitutions of the G-protein Chemokine Receptor (CCR5) (SEQ ID NO: 2) include: M1 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; D2 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; Y3 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; Q4 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; V5 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; S6 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; S7 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; P8 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or C; I9 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; Y10 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; D11 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; I12 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; N13 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; Y14 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; Y15 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; T16 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; S17 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; E18 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; P19 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or C; C20 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P; P21 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or C; K22 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; I23 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; N24 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; V25 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; K26 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; Q27 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; I28 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; A29 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; A30 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; R31 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; L32 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L33 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; P34 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or C; P35 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or C; L36 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; Y37 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; S38 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L39 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V40 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; F41 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; I42 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; F43 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; G44 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; F45 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; V46 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; G47 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; N48 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; M49 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L50 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V51 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; I52 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L53 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; I54 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L55 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; I56 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; N57 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; C58 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P; Q59 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; R60 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; L61 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; E62 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; S63 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; M64 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; T65 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; D66 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; I67 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; Y68 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; L69 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L70 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; N71 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; L72 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; A73 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; I74 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; S75 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; D76 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; L77 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; F78 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; F79 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; L80 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L81 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; T82 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V83 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; P84 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or C; F85 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; W86 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; A87 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; H88 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; Y89 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; A90 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; A91 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; A92 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; Q93 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; W94 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; D95 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; F96 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; G97 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; N98 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; T99 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; M100 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; C101 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P; Q102 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; L103 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L104 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; T105 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; G106 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L107 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; Y108 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; F109 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; I110 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; G111 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; F112 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; F113 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; S 114 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; G115 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; I116 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; F117 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; F118 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; I119 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; I120 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L121 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L122 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; T123 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; I124 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; D125 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; R126 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; Y127 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; L128 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; A129 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; I130 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V131 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; H132 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; A133 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V134 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; F135 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; A136 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L137 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; K138 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; A139 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; R140 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; T141 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V142 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; T143 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; F144 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; G145 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V146 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V147 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; T148 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; S149 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V150 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; I151 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; T152 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; W153 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; V154 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V155 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; A156 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V157 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; F158 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; A159 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; S160 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L161 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; P162 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or C; G163 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; I164 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; I165 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; F166 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; T167 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; R168 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; S169 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; Q170 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; K171 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; E172 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; G173 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L174 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; H175 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; Y176 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; T177 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; C178 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P; S179 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; S 180 replaced with D, E, H, K, R, N, Q, F, W, Y, P,

or C; H181 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; F182 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; P183 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or C; Y184 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; S185 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; Q186 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; Y187 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; Q188 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; F189 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; W190 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; K191 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; N192 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; F193 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; Q194 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; T195 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L196 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; K197 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; I198 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V199 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; I200 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L201 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; G202 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L203 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V204 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L205 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; P206 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or C; L207 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L208 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V209 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; M210 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V211 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; I212 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; C213 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P; Y214 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; S215 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; G216 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; I217 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L218 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; K219 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; T220 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L221 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L222 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; R223 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; C224 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P; R225 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; N226 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; E227 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; K228 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; K229 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; R230 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; H231 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; R232 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; A233 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V234 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; R235 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; L236 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; I237 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; F238 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; T239 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; I240 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; M241 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; I242 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V243 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; Y244 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; F245 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; L246 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; F247 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; W248 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; A249 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; P250 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W. Y, or C; Y251 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; N252 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P,

or C; 1253 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V254 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L255 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L256 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L257 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; N258 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; T259 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; F260 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; Q261 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P,

or C; E262 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; F263 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; F264 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; G265 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L266 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; N267 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; N268 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; C269 replaced with D, E, H, K, R, A, GJ. L, S, T, M, V, N, Q, F, W, Y, or P; S270 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; S271 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; S272 replaced with D, E, H. K, R, N, Q, F, W, Y, P, or C; N273 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; R274 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; L275 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; D276 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; Q277 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; A278 replaced with D, E, H, K, R, N,

Q, F, W, Y, P, or C; M279 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; Q280 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; V281 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; T282 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; E283 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; T284 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L285 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; G286 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; M287 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; T288 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; H289 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; C290 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P; C291 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P; I292 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; N293 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; P294 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or C; I295 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; I296 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; Y297 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; A298 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; F299 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; V300 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; G301 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; E302 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; K303 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; F304 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; R305 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; N306 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; Y307 replaced with D, E, H, K. R, N, Q, A, G, I, L, S, T, M, V, P, or C; L308 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L309 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V310 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; F311 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; F312 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; Q313 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; K314 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; H315 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; I316 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; A317 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; K318 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; R319 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; F320 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; C321 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P; K322 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; C323 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P; C324 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P; S325 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; I326 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; F327 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; Q328 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; Q329 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; E330 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; A331 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; P332 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or C; E333 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; R334 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; A335 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; S336 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; S337 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V338 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; Y339 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; T340 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; R341 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; S342 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; T343 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; G344 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; E345 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; Q346 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; E347 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; I348 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; S349 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V350 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; G351 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; and / or L352 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C.

In addition, preferred non-conservative substitutions of the G-protein Chemokine Receptor (CCR5) as encoded by the deposited clone HDGNR10 (SEQ ID NO: 22) include: M1 replaced with D, E, H, K, R, N, Q , F, W, Y, P, or C; D2 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; Y3 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; Q4 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; V5 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; S6 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; S7 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; P8 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or C; I9 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; Y10 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; D11 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; I12 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; N13 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; Y14 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; Y15 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; T16 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; S17 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; E18 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; P19 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or C; C20 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P; Q21 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; K22 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; I23 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; N24 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; V25 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; K26 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; Q27 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; I28 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; A29 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; A30 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; R31 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; I32 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L33 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; P34 replaced with D, E, H, Y, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or C; P35 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or C; L36 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; Y37 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; S38 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L39 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V40 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; F41 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; I42 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; F43 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; G44 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; F45 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; V46 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; G47 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; N48 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; M49 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L50 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V51 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; I52 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L53 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; I54 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L55 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; I56 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; N57 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; C58 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P; K59 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; R60 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; L61 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; K62 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; S63 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; M64 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; T65 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; D66 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; I67 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; Y68 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; L69 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L70 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; N71 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; L72 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; A73 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; I74 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; S75 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; D76 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; L77 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; F78 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; F79 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; L80 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L81 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; T82 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V83 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; P84 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or C; F85 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; W86 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; A87 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; H88 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; Y89 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; A90 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; A91 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; A92 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; Q93 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; W94 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; D95 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; F96 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; G97 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; N98 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; T99 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; M100 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; C101 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P; Q102 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; L103 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L104 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; T105 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; G106 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L107 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; Y108 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; F109 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; I110 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; G111 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; F112 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; F113 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; S 114 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; G115 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; I116 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; F117 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; F118 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; I119 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; I120 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L121 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L122 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; T123 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; I124 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; D125 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; R126 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; Y127 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; L128 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; A129 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V130 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V131 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; H132 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; A133 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V134 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; F135 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; A136 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L137 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; K138 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; A139 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; R140 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; T141 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V142 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; T143 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; F144 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; G145 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V146 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V147 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; T148 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; S149 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V150 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; 1151 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; T152 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; W153 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; V154 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V155 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; A156 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V 157 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; F158 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; A159 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; S160 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L161 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; P162 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or C; G163 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; 1164 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; I165 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; F166 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; T167 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; R168 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; S169 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; Q170 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; K171 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; E172 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; G173 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L174 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; H175 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; Y176 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; T177 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; C178 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P; S179 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; S 180 replaced with D, E, H, K, R, N, Q, F, W, Y, P,

or C; H181 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; F182 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; P183 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or C; Y184 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; S185 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; Q186 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; Y187 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; Q188 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; F189 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; W190 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; K191 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; N192 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; F193 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; Q194 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; T195 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L196 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; K197 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; I198 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V199 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; I200 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L201 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; G202 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L203 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V204 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L205 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; P206 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F; W, Y, or C; L207 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L208 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V209 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; M210 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V211 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; I212 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; C213 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P; Y214 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; S215 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or r C; G216 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; I 217 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L218 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; K219 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; T220 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L221 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L222 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; R223 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; C224 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P; R225 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; N226 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; E227 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; K228 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; K229 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; R230 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; H231 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; R232 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; A233 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V234 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; R235 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; L236 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; 1237 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; F238 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; T239 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; I240 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; M241 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; I242 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V243 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; Y244 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; F245 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; L246 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; F247 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; W248 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; A249 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; P250 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or C; Y251 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; N252 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P,

or C; I253 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V254 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L25 5 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L 2 56 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L257 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; N258 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; T259 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; F260 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; Q261 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; E262 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; F263 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; F264 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; G265 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L266 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or

C; N267 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; N268 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; C269 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P; S270 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; S271 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; S272 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; N273 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, P, W, Y, P, or C; R274 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; L275 replaced with D, E, H, K, R, N, Q, P, W, Y, P, or C; D276 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; Q277 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; A278 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; M279 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; Q280 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; V281 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; T282 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; E283 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; T284 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L285 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; G286 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; M287 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; T288 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; H289 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; C290 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P; C291 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P; I292 replaced with D, E, H, K, R, N, Q, F, W, Y. P, or C; N293 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; P294 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or C; I295 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; 1296 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; Y297 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; A298 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; F299 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; V300 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; G301 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; E302 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; K303 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; F304 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; R305 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; N306 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, P, W, Y, P, or C; Y307 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; L308 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L309 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V310 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; F311 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; F312 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; Q313 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; K314 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; H315 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, P, W, Y, P, or C; L316 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; A317 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; K318 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; R319 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, P, W, Y, P, or C; F320 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; C321 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P; K322 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; C323 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P; C324 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P; S325 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; I326 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; F327 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; Q328 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; Q329 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; E330 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; A331 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; P332 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or C; E333 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; R334 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; A335 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; S336 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; S337 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V338 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; Y339 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; T340 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; R341 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; S342 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; T343 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; E344 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; E345 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; Q346 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; E347 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; 1348 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; S349 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V350 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; G351 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; and / or L352 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C.

The resulting constructs can be routinely explored with respect to activities or functions described throughout the specification and known in the art. Preferably, the resulting constructs have an increased or decreased activity or function of the G-chemokine Receptor (CCR5), while the remaining activities or functions of the G-protein Chemokine Receptor (CCR5) are maintained. More preferably, the resulting constructs have more than one activity or function of the G-protein Chemokine Receptor (CCR5) increased and / or decreased, while the remaining activities or functions of the G-protein Chemokine Receptor (CCR5) are maintained.

Additionally, more than one amino acid (for example, 2, 3, 4, 5, 6, 7, 8, 9 and 10) can be replaced with the substituted amino acids as described above (conservatively or non-conservatively). The substituted amino acids may appear in the full-length, mature or proprotein form of the G-protein Chemokine Receptor protein (CCR5), as well as the N-terminal and C-terminal deletion mutants, which have the general formula mn, listed later.

A polypeptide comprising the amino acid sequence of a G-protein Chemokine Receptor polypeptide (CCR5) having an amino acid sequence containing at least one amino acid substitution, but not more than 50 amino acid substitutions, even more, is further described. preferably no more than 40 amino acid substitutions, even more preferably, no more than 30 amino acid substitutions and even more preferably, no more than 20 amino acid substitutions. Of course, in order of increasing preference, it is highly preferable for a polypeptide to have an amino acid sequence comprising the amino acid sequence of a G protein Chemokine Receptor polypeptide (CCR5), which contains at least one, but not more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 amino acid substitutions. The number of additions, substitutions and / or deletions in the amino acid sequence of FIGURE 1 or that encoded by the deposited clone or fragments thereof (eg, the mature form and / or other fragments described herein) is 15, 5-10, 5-25, 5-50, 10-50 or 50-150; conservative amino acid substitutions are preferable.

Polynucleotide and Polypeptide Fragments

The present description also relates to polynucleotide fragments of the CCR5 polynucleotides. A "polynucleotide fragment" refers to a short polynucleotide that has a nucleic acid sequence that: is a part of that contained in a deposited clone or that encodes the polypeptide encoded by the deposited clone; is a part of that shown in SEQ ID NO: 1 or the strand complementary thereto or is a part of a polynucleotide sequence encoding the polypeptide of SEQ ID NO: 2. The nucleotide fragments are preferably at least about 15 nt, and more preferably at least about 20 nt, even more preferably at least about 30 nt, and even more preferably, at least about 40 nt, at least about 50 nt, at least about 75 nt, or at least about 150 nt in length. A fragment "at least 20 nt in length", for example; It is intended to include 20 or more contiguous bases of the HDGNR10 DNA sequence contained in a deposited clone or the nucleotide sequence shown in SEQ ID NO: 1. In this context "approximately" includes the value named in particular, a greater or lesser value in several nucleotides (5, 4, 3, 2 or 1) at either end or at both ends. These nucleotide fragments have uses that include, without limitation, as probes and diagnostic primers as discussed herein. Of course, larger fragments are preferred (for example, 50, 150, 500, 600, 1000 nucleotides).

In addition, representative examples of polynucleotide fragments include, for example, fragments comprising, or alternatively consisting of, a sequence of approximately nucleotide number 150, 51-100, 101-150, 151-200, 201-250, 251-300, 301-350, 351-400, 401-450, 451-500, 501-550, 551-600, 651-700, 701-750, 751-800, 800-850, 851-900, 901- 950, 951-1000, 1001-1050, 1051-1100, 1101-1150, 1151-1200, 12011250, 1251-1300, 1301-1350, 1351-1400 or 1401 to the end of SEQ ID NO: 1 or the complementary strand thereof or the HDGNR10 DNA contained in the deposited clone. In this context "approximately" includes the particularly named intervals and major or minor intervals in several nucleotides (5, 4, 3, 2 or 1), at either end or at both ends. Preferably, these fragments encode a polypeptide that has biological activity. More preferably, these polynucleotides can be used as probes or primers as discussed herein. Polynucleotides that hybridize with these nucleic acid molecules under stringent hybridization conditions or less stringent conditions are also described, as are polypeptides encoded by these polynucleotides. A "polypeptide fragment" refers to an amino acid sequence that is a part of that contained in SEQ ID NO: 2 or encoded by the HDGNR10 DNA contained in the deposited clone. Protein fragments (polypeptides) may be "independent" or be comprised within a larger polypeptide than the fragment forms a part or region, more preferably as a single continuous region. Representative examples of polypeptide fragments are, for example, fragments comprising, or alternatively consisting of, approximately amino acid number 1-20, 21-40, 41-60, 61-80, 81100, 102-120, 121-140, 41-160 or 161 to the end of the coding region. In addition, the polypeptide fragments can be approximately 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140 or 150 amino acids in length. In this context "approximately" includes the intervals or values named in particular and intervals or values greater or lesser in several amino acids (5, 4, 3, 2 or 1), at either end or at both ends. Polynucleotides encoding these polypeptides are also described.

Even if the deletion of one or more amino acids from the N-terminus of a protein results in a modification of loss of one or more biological functions of the protein, other functional activities (e.g., biological activities, ability to multimerize, ability to bind A ligand of the G-protein Chemokine Receptor (CCR5)) can still be conserved. For example, the ability of shortened muteins of the G-protein Chemokine Receptor (CCR5) to induce and / or bind to antibodies that recognize the complete or mature forms of the polypeptides will generally be conserved at least of the majority of the polypeptide moieties. Complete or mature are removed from the N terminal end. If a particular polypeptide lacking the N-terminal residues of a complete polypeptide retains such immunological activities can be readily determined by routine methods described herein and otherwise known in the art. It is possible that a G protein Chemokine Receptor (CCR5) mutein with a large number of N-terminal amino acid residues deleted may retain some biological or immunogenic activities. In fact, peptides composed of as few as six amino acid residues of the G-protein Chemokine Receptor (CCR5) can often induce an immune response.

Preferred polypeptide fragments include the secreted protein as well as the mature form. Additional preferred polypeptide fragments include the secreted protein or mature form having a continuous series of deleted residues of the carboxy or amino terminal end or both. For example, any number of amino acids.

Accordingly, polypeptide fragments include the secreted G-chemokine Receptor protein (CCR5) as well as the mature form. Additional preferred polypeptide fragments include the secreted G protein Chemokine Receptor protein (CCR5) or the mature form having a continuous series of deleted residues of the amino or carboxy terminal end or both. For example, any number of amino acids, ranging from 1 to 60, can be deleted from the amino terminal end of the polypeptide or the mature form of the secreted G-protein Chemokine Receptor (CCR5). Similarly, any number of amino acids, varying from 1 to 30, can be deleted from the carboxy-terminal end of the protein or mature form of the secreted Chemokine G-protein Receptor (CCR5). In addition, any combination of the above deletions of the amino and carboxy terminus is preferred. Similarly, polynucleotides encoding these polypeptide fragments are also preferred.

These polypeptide fragments may retain the biological activity of the G-protein Chemokine Receptor polypeptides (CCR5) and / or may be useful for generating or scanning for antibodies, as described further below. Polynucleotides encoding these polypeptide fragments are also described.

The present application also relates to nucleic acid molecules comprising, or alternatively consisting of, a polynucleotide sequence at least 90%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the polynucleotide sequence encoding the G protein Chemokine Receptor polypeptide (CCR5) described above. The above polynucleotide sequences fused with a heterologous polynucleotide sequence are also described.

Additionally, the present application also relates to proteins containing polypeptides at least 90%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the chemokine Receptor polypeptide fragments of protein G (CCR5) set forth above. Polynucleotides encoding these polypeptides are also described.

Preferably, the polynucleotide fragments encode a polypeptide that demonstrates a functional activity of the G-protein Chemokine Receptor (CCR5). By a polypeptide that demonstrates "functional activity" of the G-protein Chemokine Receptor (CCR5) is meant a polypeptide capable of exhibiting one or more known functional activities associated with a full-length G-protein Chemokine Receptor protein (CCR5) ( complete). Such functional activities include, but are not limited to, biological activity, antigenicity [ability to bind (or compete with a G-protein Chemokine Receptor polypeptide (CCR5) with respect to binding) with an anti-G-protein Chemokine Receptor antibody ( CCR5)], immunogenicity (ability to generate antibody that binds to a G-protein Chemokine Receptor polypeptide (CCR5)), ability to form multimers with G-protein Chemokine Receptor polypeptides (CCR5) and ability to bind to a receptor or ligand for a G protein Chemokine Receptor polypeptide (CCR5).

The functional activity of the G-protein Chemokine Receptor polypeptides (CCR5) and fragments, derived variants and analogs thereof can be tested by various methods.

For example, in one embodiment in which it is tested for the ability to bind or compete with full-length G-protein Chemokine Receptor polypeptide (CCR5) by binding with anti-G-protein Chemokine Receptor antibody (CCR5 ), various immunoassays known in the art may be used, including but not limited to, competitive and non-competitive assay systems using techniques such as radioimmunoassays, ELISA (enzyme-linked immunosorbent assay), sandwich-type immunoassays, immunodiometric assays, reactions gel diffusion precipitation, immunodiffusion assays, in situ immunoassays (using colloidal, gold, enzymatic or radioisotope markers, for example), Western blots, precipitation reactions, agglutination assays (e.g., agglutination assays in gel, hemagglutinization assays), complement fixation assays, immunofluorescence assays, and Protein A tests and immunoelectrophoresis assays, etc. Antibody binding is detected by detecting a marker in the primary antibody. The primary antibody is detected by detection of binding of a secondary antibody or reactive with the primary antibody. The secondary antibody is labeled. Many means are known in the art to detect binding in an immunoassay.

When a G-protein Chemokine Receptor ligand (CCR5) is identified or the ability of a fragment, variant or polypeptide derivative to multimerize is evaluated, binding can be tested, for example, by means well known in the art, such as, for example, reducing and non-reducing gel chromatography, protein affinity chromatography and affinity transfer. See generally, Phizicky, E., et al., 1995, Microbiol. Rev. 59: 94-123. In another embodiment, physiological equivalents of the G-protein Chemokine Receptor (CCR5) that bind to their substrates (signal transduction) can be tested.

In addition, the assays described herein (see Examples) and otherwise known in the art can be routinely applied to measure the ability of the G-protein Chemokine Receptor (CCR5) polypeptides and fragments, derived variants and analogs thereof. same to induce biological activity related to G protein Chemokine Receptor (CCR5) (in vitro or in vivo). Other methods will be known to the person skilled in the art.

Particularly preferred fragments include fragments characterized by structural or functional attributes of the G-protein Chemokine Receptor (CCR5). Such fragments include amino acid residues comprising alpha helices and alpha helix forming regions ("alpha regions"), beta sheets and beta sheet forming regions ("beta regions"), turns and spin forming regions ("back regions") , curls and winding regions ("winding regions"), hydrophilic regions, hydrophobic regions, amphipathic alpha regions, amphipathic beta regions, surface forming regions and regions of high antigenic index (ie, containing four or more contiguous amino acids which have an antigenic index of more than or equal to 1.5, as identified using the default parameters of the Jameson-Wolf program) of the complete G protein chemokine receptor (CCR5) (ie full length) (SEC ID Nº: 2) or encoded by the deposited clone. Certain preferred regions are those set forth in FIGURE 3 and include, without limitation, regions of the aforementioned types identified by analysis of the amino acid sequence depicted in FIGURE 1 (SEQ ID NO: 2) or encoded by the deposited clone, such Preferred regions include; alpha regions, beta regions, return regions and predicted winding regions of Garnier-Robson; alpha regions, beta regions, return regions and predicted winding regions of Chou-Fasman; predicted hydrophilic and hydrophobic regions of Kyte-Doolittle; amphipathic alpha and beta regions of Eisenberg; Emini surface forming regions; and regions of high Jameson-Wolf antigen index, as predicted using the default parameters of these computer programs. Polynucleotides encoding these polypeptides are also described.

The polynucleotides encode functional attributes of the G-protein Chemokine Receptor (CCR5). Fragments comprising alpha helices and alpha helic forming regions ("alpha regions"), beta sheets and beta sheet forming regions ("beta regions"), turns and lap forming regions ("turning regions") are also described. curls and winding regions ("winding regions"), hydrophilic regions, hydrophobic regions, amphipathic alpha regions, amphipathic beta regions, flexible regions, surface forming regions and regions of high antigenic index of the G protein chemokine receptor.

Data presenting the functional or structural attributes of the G-protein Chemokine Receptor (CCR5) set forth in FIGURE 1 or encoded by the deposited clone and / or Table 1, as described above, were generated using the various modules and DNA * STAR algorithms adjusted to default parameters. The data presented in columns VIII, IX, XIII and XIV of Table 1 can be used to determine regions of the G-protein Chemokine Receptor (CCR5) that show a high degree of potential for antigenicity. High antigenicity regions are determined from the data presented in columns VIII, IX, XIII and / or IV by selecting values that represent regions of the polypeptide that are likely to be exposed on the surface of the polypeptide in an environment in which recognition of Antigens can be produced in the process of initiating an immune response.

Certain preferred regions in this regard are set forth in FIGURE 3, but may, as shown in Table 1, be represented or identified by the use of tabular representations of the data presented in FIGURE 3. The DNA * STAR computer algorithm used to generating FIGURE 3 (adjusted to the original default parameters) was used to present the data in FIGURE 3 in a tabular format (See Table 1). The tabular format of the data of FIGURE 3 can be used to easily determine the specific boundaries of a preferred region.

The aforementioned preferred regions set forth in FIGURE 3 and Table 1 include, but are not limited to, regions of the aforementioned types identified by analysis of the amino acid sequence set forth in FIGURE 1 or encoded by the deposited clone. As set forth in FIGURE 3 and Table 1, such preferred regions include alpha regions, beta regions, lap regions and Garnier-Robson winding regions; alpha regions, beta regions and winding regions of Chou-Fasman; hydrophilic regions and hydrophobic regions of Kyte-Doolittle, amphipathic alpha and beta regions of Eisenberg, flexible regions of Karplus-Schulz, surface-forming regions of Emini and Jameson-Wolf regions of high antigenic index.

Table 1

Beef

Position I II III IV V SAW VII VIII IX X XI XII XIII XIV

Met

one . · B . . · . 0.24 0.06 . * · 0.05 1.68

Asp

2 . · B B . · . 0.33 0.27 . * · - 0.98

0.30

Tyr

3 . · B B . · . 0.42 0.23 . * · - 1.02

0.15

Gln

4 . · B B . · . 0.60 0.19 . * · - 1.38

0.15

Val

5 . · B B . · . 0.10 0.00 . * F 0.00 1.28

Be

6 . · B B . . . 0.46 0.69 * * F - 0.57

0.45

Be

7 . · B B . . . 0.46 0.69 * * F - 0.52

0.45

Pro

8 . · B B . . . -0.19 0.29 * * F 0.00 1.17

Ile

9 . B B . . . -0.19 0.33 * * · - 0.61

0.30

Tyr

10 . · B . . . . 0.42 0.34 * · · - 0.73

0.30

Asp

eleven . · B . . T . 0.48 0.71 . · · - 0.74

0.20

Ile

12 . . B . . T . 0.47 1.04 . · · - 1.66

0.05

Asn

13 . . B . . T . 0.38 0.84 * · · - 1.53

*

0.05

Tyr

14 . . B . . T . 1.27 0.47 . · · - 1.23

0.05

Tyr

fifteen . . . B T · . 1.30 0.47 . * · - 3.03

Beef

Position I II III IV V SAW VII VIII IX X XI XII XIII XIV

0.05

Thr

16 , . . B T · . 0.63 0.21 . * F 0.65 2.91

Be

17 . . · B T · . 1.31 0.39 . * F 0.75 1.00

Glu

18 . · B . T · . 1.36 0.06 . * F 0.80 0.98

Pro

19 . . . . T . . 0.71 - . * F 2.50 1.36

.

T 0.70

Cys

twenty · . · . T T . 0.96 - . * F 2.50 0.71

.

0.50

Pro

twenty-one . . . . T T . 0.41 - . * F 2.25 0.66

.

0.49

Lys

22 · . · . T T . 0.76 0.16 . * F 1.40 0.32

Ile

2. 3 TO . · . . T . 0.76 - * * F 1.50 1.19

0.27

Asn

24 TO TO · . . · . 0.08 - . * F 0.85 1.33

0.44

Val

25 TO TO · . . · . 0.16 - . * · 0.30 0.47

0.19

Lys

26 . TO B . . · . -0.22 0.31 . * · - 0.67

0.30

Gln

27 . TO B . . . . -0.16 0.13 * * · - 0.42

0.30

Ile

28 . TO B . . . . -0.08 - * * · 0.45 1.11

0.27

To

29 . TO B . . . . 0.89 - * * · 0.30 0.46

0.23

To

30 . TO B . . . . -0.24 0.46 * * . - 0.22

0.60

Arg

31 . TO B . . . . -0.50 0.49 * * . - 0.48

0.60

Res Position I II III IV V VI VII VIII IX X XI XII XIII XIV

Leu 32. A B . . . -1.31 0.23 * *. -0.74 0.30

Leu 33. A B . . . -0.67 0.41 * *. -0.60 0.60

Pro 34. . . . . T C -0.38 0.67 * * F 0.15 0.48

Pro 35 . . . T T. -0.60 1.06. . F 0.35 0.78

Leu 36 · · B · · T. -1.57 1.06 * * -0.78 0.20

Tyr 37. . B. . T. -1.46 1.01. . . -0.38 0.20

Be 38. . B B. . . -1.53 1.37. . . -0.21 0.60

Leu 39 · · B B · ·. -2.02 1.63. . . -0.18 0.60

Val 40 . B B. . . -2.16 1.73. . . -0.10 0.60

Phe 41. . B B. . . -2.04 1.40. . . -0.07 0.60

Ile 42. . B B. . . -2.66 1.80. . . -0.08 0.60

Phe 43. . B B. . . -2.70 1.76. . . -0.08 0.60

Gly 44 . B B. . . -1.89 1.54. . . -0.09 0.60

Phe 45 · · · B T ·. -1.63 1.16 · · · -0.20 0.20

Val 46 · · · B · · C -1.74 1.09 · · · -0.23

Beef

Position I II III IV V SAW VII VIII IX X XI XII XIII XIV

0.40

Gly

47 · · · B · · C -1.71 0.99 · · · - 0.19

0.40

Asn

48 TO . . B . . . -1.90 1.20 · · · - 0.16

0.60

Met

49 TO . . B . . . -2.37 1.10 · · · - 0.15

0.60

Leu

fifty TO · · B · · . -2.56 1.14 · · · - 0.13

0.60

Val

51 . . B B . . . -2.51 1.40 · · · - 0.06

0.60

Ile

52 . . B B . . . -3.06 1.69 · · · - 0.05

0.60

Leu

53 · · B B · · . -3.06 1.76 · · · - 0.04

0.60

Ile

54 . . B B . . . -3.12 1.47 · * · - 0.09

0.60

Leu

55 · · B B · · . -2.31 1.40 * · · - 0.07

0.60

Ile

56 . . B B . . . -1.34 1.11 * · · - 0.14

0.60

Asn

57 . . B B . . . -1.27 0.43 . * . - 0.39

0.60

Cys

58 . TO B B . . . -0.46 0.43 · · · - 0.39

0.60

Gln

59 TO TO · B · · . 0.13 - * · · 0.30 0.96

0.26

Beef

Position I II III IV V SAW VII VIII IX X XI XII XIII XIV

Arg

60 TO TO · B · · . 0.34 - · · F 0.75 0.80

0.56

Leu

61 TO TO · B · · . 0.92 - · · F 0.60 1.47

0.34

Glu

62 · TO B B · · · 0.92 - · * F 0.60 1.23

0.43

Be

63 · TO B · · · . 0.70 - * * F 0.90 1.05

0.83

Met

64 · TO B B · · · 0.46 - * * F 0.45 0.89

0.14

Thr

65 . TO B B . . . -0.47 - · * F 0.45 0.80

0.07

Asp

66 TO TO . B . . . -0.47 0.61 · * · - 0.50

0.60

Ile

67 TO TO . B . . . -0.47 0.91 · · · - 0.41

0.60

Tyr

68 TO TO . B . . . -0.98 0.70 · · · - 0.46

0.60

Leu

69 TO TO · B · · · -0.97 0.90 · · · - 0.23

0.60

Leu

70 TO TO · B · · · -1.54 1.40 · * · - 0.33

0.60

Asn

71 TO TO . B . . . -1.84 1.40 · · · - 0.15

0.60

Leu

72 · TO B B · · · -0.96 1.03 * · · - 0.24

0.60

To

73 TO TO . B . . . -1.52 0.34 * · · - 0.48

Beef

Position I II III IV V SAW VII VIII IX X XI XII XIII XIV

0.30

Ile

74 TO TO . B . . . -1.41 0.34 · · · - 0.25

0.30

Be

75 TO TO . B . . . -1,30 0.73 · * · - 0.26

0.60

Asp

76 TO TO . B . . . -2.11 0.83 · · · - 0.22

0.60

Leu

77 · TO B B · · · -2.11 1.01 · · · - 0.26

0.60

Phe

78 . TO B B . . . -1.83 1.01 · · · - 0.16

0.60

Phe

79 . TO B B . . . -1.80 1.11 · · · - 0.14

0.60

Leu

80 · TO B B · · · -1.71 1.76 · * · - 0.13

0.60

Leu

81 · TO B B · · · -2.41 1.50 · * · - 0.22

0.60

Thr

82 . TO B B . . . -1.89 1.50 · * · - 0.22

0.60

Val

83 . TO . B . . C -1.78 1.63 . * . - 0.29

0.40

Pro

84 TO TO · B · · · -1.11 1.44 · * · - 0.35

0.60

Phe

85 TO TO . B . . . -0.54 1.26 · · · - 0.33

0.60

Trp

86 TO TO . B . . . -0.32 1.53 · * · - 0.70

0.60

Beef

Position I II III IV V SAW VII VIII IX X XI XII XIII XIV

To

87 TO TO . B . . . -0.60 1.39 · · · - 0.45

0.60

His

88 TO TO . B . . . -0.33 1.46 · · · - 0.53

0.60

Tyr

89 TO TO . B . . . -0.12 1.17 · · · - 0.51

0.60

To

90 TO TO · B · · · 0.29 0.66 · * · - 0.87

0.60

To

91 TO TO · · · · · 0.58 1.07 · * · - 0.67

0.60

To

92 TO TO · · · · · 0.47 0.57 · * · - 0.72

0.60

Gln

93 TO TO · · · · · 0.16 0.60 · * · - 0.62

0.60

Trp

94 TO TO · · · · · 0.40 0.53 · * · - 0.60

0.60

Asp

95 · · · · T T · 0.68 0.43 · * · 0.20 0.96

Phe

96 · · · · T T · 0.67 0.41 · * · 0.20 0.80

Gly

97 · · · · T T · 0.59 0.63 * * F 0.35 0.75

Asn

98 · · · · T T · 0.59 0.29 * * F 0.65 0.24

Thr

99 · · · B T · · 0.07 0.69 * · · - 0.48

0.20

Met

100 · · · B T · · -0.74 0.59 * · · - 0.40

0.20

Cys

101 · · B B · · · -0.36 0.84 * · · - 0.21

0.60

Gln

102 · · B B · · · -0.36 0.93 * · · - 0.21

Beef

Position I II III IV V SAW VII VIII IX X XI XII XIII XIV

0.60

Leu

103 · · B B · · · -1.17 0.87 * · · - 0.21

0.60

Leu

104 · · B B · · · -1.10 0.94 · · · - 0.32

0.60

Thr

105 · · B B · · · -1.20 1.13 * · · - 0.29

0.60

Gly

106 · · B B · · · -1.42 1.51 * · · - 0.30

0.60

Tyr

108 · · B B · · · -1.66 1.26 · · · - 0.18

0.60

Phe

109 · · B B · · · -1.54 1.56 · · · - 0.15

0.60

Ile

110 · · B B · · · -1.53 1.91 · · · - 0.16

0.60

Gly

111 · · B B · · · -1.53 1.61 · · · - 0.14

0.60

Phe

112 B B -1.61 1.29 · · · - 0.16

0.60

Phe

113 · · B B · · · -2.07 1.19 · · · - 0.16

0.60

Be

114 · · · B · · C -2.07 1.29 · · · - 0.14

0.40

Gly

115 · · · B · · C -2.07 1.64 · · · - 0.14

0.40

Ile

116 · · · B · · C -2.61 1.54 · · · - 0.11

0.40

Beef

Position I II III IV V SAW VII VIII IX X XI XII XIII XIV

Phe

117 · · B B · · · -2.72 1.44 · · · - 0.06

0.60

Phe

118 · · B B · · · -2.83 1.74 · · · - 0.05

0.60

Ile

119 · · B B · · · -2.84 2.00 · · · - 0.06

0.60

Ile

120 · · B B · · · -3.39 1.80 · * · - 0.10

0.60

Leu

121 · · B B · · · -2.50 1.70 * · · - 0.08

0.60

Leu

122 · · B B · · · -1.69 0.91 * · · - 0.18

0.60

Thr

123 TO · · B · · · -1.23 0.23 * · · - 0.52

0.30

Ile

124 TO · · B · · · -1.16 0.60 * · · - 0.98

0.30

Asp

125 TO · · · · T · -0.86 0.30 * · F 0.25 0.98

Arg

126 TO · · · · T · -0.93 0.11 * · · 0.10 0.69

Tyr

127 TO · · · · T · -0.98 0.31 * · · 0.10 0.69

Leu

128 TO · · · · T · -0.70 0.27 * · · 0.10 0.30

To

129 TO · · B · · · -0.40 0.77 * · · - 0.21

0.50

Ile

130 TO · · B · · · -1.26 1.27 * · · - 0.14

0.60

Val

131 TO · · B · · · -2.07 1.16 * · · - 0.12

0.60

His

132 TO · · B · · · -2.41 1.26 · · · - 0.11

Beef

Position I II III IV V SAW VII VIII IX X XI XII XIII XIV

0.60

To

133 TO · · B · · · -2.41 1.26 · * · - 0.15

0.60

Val

134 TO · · B · · · -1.78 1.26 · * · - 0.17

0.60

Phe

135 TO · · B · · · -1.48 0.61 · * · - 0.25

0.60

To

136 TO · · B · · · -0.51 0.61 · * · - 0.25

0.60

Leu

137 TO · · B · · · -0.79 0.11 · * · - 0.65

0.30

Lys

138 TO · · B · · · -1.06 - · * F 0.60 1.09

0.04

To

139 TO · · B · · · -0.51 - · * F 0.45 0.80

0.19

Arg

140 TO B -0.51 - · * F 0.60 1.40

0.20

Thr

141 · · B B · · · -0.27 - · * F 0.45 0.61

0.10

Val

142 · · B B · · · -0.31 0.33 · * · - 0.59

0.30

Thr

143 · · B B · · · -1.21 0.47 · * · - 0.23

0.60

Phe

144 · · B B · · · -0.93 1.11 · · · - 0.12

0.60

Gly

145 · · B B · · · -1.34 1.11 · · · - 0.23

0.60

Beef

Position I II III IV V SAW VII VIII IX X XI XII XIII XIV

Val

146 · · B B · · · -1.89 0.86 · · · - 0.21

0.60

Val

147 · · B B · · · -1.92 1.01 · · · - 0.18

0.60

Thr

148 · · B B · · · -1.92 0.91 · · · - 0.13

0.60

Be

149 · · B B · · · -1.51 0.97 * · · - 0.25

0.60

Val

150 · · B B · · · -2.02 1.24 * · · - 0.35

0.60

Ile

151 · · B B · · · -2.02 1.24 * · · - 0.18

0.60

Thr

152 · · B B · · · -1.76 1.40 * · · - 0.10

0.60

Trp

153 · · B B · · · -2.30 1.51 * · · - 0.14

0.60

Val

154 · · B B · · · -2.70 1.51 * · · - 0.14

0.60

Val

155 · · B B · · · -2.43 1.61 * · · - 0.09

0.60

To

156 · · B B · · · -1.84 1.63 * · · - 0.08

0.60

Val

157 · · B B · · · -2.34 1.10 · · · - 0.15

0.60

Phe

158 · · B B · · · -2.27 1.14 · · · - 0.17

0.60

To

159 · · B B · · · -1.76 0.93 · · · - 0.25

Beef

Position I II III IV V SAW VII VIII IX X XI XII XIII XIV

0.60

Be

160 · · · B · · C -1.79 0.86 · · · - 0.34

0.40

Leu

161 · · · B · · C -2.09 0.90 · · · - 0.27

0.40

Pro

162 · · · B · · C -1.93 0.80 · · · - 0.19

0.40

Gly

163 · · · B T · · -1.54 1.09 * · · - 0.12

0.20

Ile

164 · · B B · · · -0.84 1.19 · · · - 0.22

0.60

Ile

165 · · B B · · · -0.84 0.50 · * · - 0.27

0.60

Phe

166 . . B B . . . -0.03 0.46 · · · - 0.37

0.26

Thr

167 · · B · · T · 0.22 0.43 * · F 0.63 0.91

Arg

168 · · B · · T · 0.57 - * · F 2.02 2.60

0.26

Be

169 . . . . . T C 1.11 - * . F 2.86 5.21

0.94

Gln

170 . . . . T T . 1.19 - * . F 3.40 3.57

1.30

Lys

171 · · · · T · · 1.86 - * · F 2.86 1.50

1.10

Glu

172 . . . . T . . 1.91 - * . F 2.52 1.53

0.60

Gly

173 · · · B T · · 1.50 - * * F 1.68 1.38

Beef

Position I II III IV V SAW VII VIII IX X XI XII XIII XIV

0.23

Leu

174 · · B B · · · 1.13 - · · · 0.64 1.00

0.14

His

175 · · B B · · 0, · 83 0.43 · · · - 0.31

0.60

Tyr

176 · · B B · · · 0.49 0.81 · · · - 0.42

0.60

Thr

177 · · B B · · · 0.46 0.77 · * · - 0.68

0.60

Cys

178 · · B · · T · 0.10 0.59 · * · - 0.68

0.20

Be

179 · · · · T T 0.70 0.87 · * · 0.20 0.38

Be

180 · · · · T T 0.49 0.54 · · · 0.20 0.40

His

181 · · · · T T 0.43 0.81 · · · 0.35 1.18

Phe

182 · · · · · T C 0.74 0.63 · · · 0.15 1.18

Pro

183 · · · · T T · 1.17 0.64 · · · 0.35 1.52

Tyr

184 · · · · T T · 1.47 1.01 · * · 0.35 1.75

Be

185 · · · · T T · 1.07 0.91 · · · 0.35 3.50

Gln

186 · · B B · · · 0.81 0.91 * · · - 1.96

0.45

Tyr

187 · · · B T · · 1.56 1.40 * · · - 1.31

0.05

Gln

188 · · · B T · · 1.77 0.64 * · · - 1.96

0.05

Phe

189 · · · B T · · 1.31 0.66 * * · - 1.82

0.05

Trp

190 · · · B T · · 1.61 1.04 * * · - 1.01

Beef

Position I II III IV V SAW VII VIII IX X XI XII XIII XIV

0.05

Lys

191 · · B B · · · 1.30 0.69 * * · - 1.01

0.45

Asn

192 · · · B T · · 0.73 0.77 * · · - 1.68

0.05

Phe

193 · · · B T · · 0.78 0.67 * * · - 1.32

0.05

Gln

194 TO · · B · · · 0.59 - * · F 0.60 1.32

0.24

Thr

195 · · · B · · C 0.02 0.44 * * F - 0.57

0.25

Leu

196 . . B B . . . -0.91 0.69 * · · - 0.49

0.60

Lys

197 · · B B · · · -1.72 0.59 · · · - 0.20

0.60

Ile

198 · · B B · · · -1.37 0.87 * · · - 0.11

0.60

Val

199 · · B B · · · -2.18 0.81 * * · - 0.14

0.60

Ile

200 · · B B · · · -2.72 0.81 · * · - 0.06

0.60

Leu

201 · · B B · · · -2.72 1.46 · * · - 0.06

0.60

Gly

202 · · B B · · · -2.98 1.46 · * · - 0.07

0.60

Leu

203 · · B B · · · -2.90 1.24 · · · - 0.15

0.60

Beef

Position I II III IV V SAW VII VIII IX X XI XII XIII XIV

Val

204 · · B B · · · -2.86 1.24 · · · - 0.15

0.60

Leu

205 · · B B · · · -2.82 1.24 · · · - 0.12

0.60

Pro

206 · · B B · · · -2.61 1.46 · · · - 0.11

0.60

Leu

207 · · B B · · · -3.12 1.39 · · · - 0.15

0.60

Leu

208 · · B B · · · -3.20 1.39 · · · - 0.13

0.60

Val

209 · · B B · · · -3.01 1.39 · · · - 0.06

0.60

Met

210 · · B B · · · -2.44 1.53 · · · - 0.04

0.60

Val

211 · · B B · · · -2.53 1.60 · · · - 0.07

0.60

Ile

212 · · B B · · · -2.07 1.30 · · · - 0.13

0.60

Cys

213 · · B · · T · -2.14 1.09 · · · - 0.13

0.20

Tyr

214 · · B · · T · -2.10 1.16 · · · - 0.13

0.20

Be

215 · · B · · T · -1.46 1.20 · · · - 0.15

0.20

Gly

216 · · B · · T · -0.91 0.51 * · · - 0.55

0.20

Ile

217 · · B B · · · -0.83 0.43 · · · - 0.51

Beef

Position I II III IV V SAW VII VIII IX X XI XII XIII XIV

0.60

Leu

218 · · B B · · · -0.98 0.36 * * · - 0.31

0.30

Lys

219 · · B B · · · -0.62 0.66 * * F - 0.26

0.45

Thr

220 · · B B · · · -0.99 0.23 * * · - 0.73

0.30

Leu

221 · · B B · · · -0.53 0.11 * * · - 0.47

0.30

Leu

222 TO · · B · · · 0.36 - * * · 0.60 0.46

0.57

Arg

223 TO · · B · · · 1.17 - * * · 0.30 0.52

0.17

Cys

224 TO · · · · T · 1.17 - · * · 1.15 1.08

0.66

Arg

225 TO · · · · T · 1.52 - * * F 1.30 2.63

1.34

Asn

226 TO · · · · T · 2.44 - * * F 1.30 2.68

2.03

Glu

227 TO · · · · T · 3.22 - · * F 1.30 9.80

2.03

Lys

228 TO · · · · · · 3.22 - · * F 1.10 6.81

2.10

Lys

229 TO · · · · · · 3.30 - * * F 1.10 8.29

2.10

Arg

230 TO · · · · · · 2.33 - * · F 1.10 4.83

2.00

Beef

Position I II III IV V SAW VII VIII IX X XI XII XIII XIV

His

231 TO · · B · · · 2.44 - * * · 0.75 1.79

1.36

Arg

232 TO · · B · · · 1.63 - * · · 0.75 1.76

1.36

To

233 TO · · B · · · 0.70 - * * · 0.60 0.74

0.67

Val

2. 3. 4 TO · · B · · · -0.04 0.01 * · · - 0.38

0.30

Arg

235 TO · · B · · · -0.47 0.30 * * · - 0.17

0.30

Leu

236 · · B B · · · -1.32 0.79 * * · - 0.24

0.60

Ile

237 · · B B · · · -2.03 0.97 * * · - 0.23

0.60

Phe

238 · · B B · · · -2.33 0.94 * * · - 0.11

0.60

Thr

239 · · B B · · · -2.33 1.63 * * · - 0.10

0.60

Ile

240 · · B B · · · -2.69 1.59 * * · - 0.10

0.60

Met

241 · · B B · · · -2.58 1.66 · · · - 0.19

0.60

Ile

242 · · B B · · · -2.50 1.66 · · · - 0.11

0.60

Val

243 · · B B · · · -2.50 1.86 · · · - 0.13

0.60

Tyr

244 · · B B · · · -2.48 1.96 · · · - 0.12

Beef

Position I II III IV V SAW VII VIII IX X XI XII XIII XIV

0.60

Phe

245 · · B B · · · -2.18 2.26 · · · - 0.17

0.60

Leu

246 · · B B · · · -1.79 2.07 · · · - 0.24

0.60

Phe

247 · · · B T · · -1.14 1.86 · · · - 0.23

0.20

Trp

248 . . . B . . C -0.28 1.86 . * . - 0.42

0.40

To

249 . . . . . T C -0.93 1.47 · · · 0.00 0.82

Pro

250 . . . . . T C -1.09 1.47 · * · 0.00 0.67

Tyr

251 . . . . T T . -1.09 1.33 · · · 0.20 0.47

Asn

252 · · B · · T · -1.20 1.10 · * · - 0.38

0.20

Ile

253 · · B B · · · -1.72 1.29 · * · - 0.20

0.60

Val

254 · · B B · · · -1.13 1.54 · * · - 0.11

0.60

Leu

255 · · B B · · · -1.23 1.19 * · · - 0.11

0.60

Leu

256 · · B B · · · -1.69 1.27 * · · - 0.22

0.60

Leu

257 · · B B · · · -1.69 1.37 * · · - 0.26

0.60

Asn

258 · · B B · · · -0.80 1.13 * · · - 0.54

0.60

Thr

259 TO · · B · · · -0.64 0.44 * · · - 1.14

Beef

Position I II III IV V SAW VII VIII IX X XI XII XIII XIV

0.45

Phe

260 TO · · B · · · -0.53 0.54 * · · - 1.20

0.45

Gln

261 · · B B · · · -0.07 0.64 * · · - 0.64

0.60

Glu

262 · · B B · · · -0.07 0.67 * · · - 0.44

0.60

Phe

263 · · B · · · · -0.07 0.87 * · · - 0.42

0.40

Phe

264 · · · · T · · 0.24 0.49 · · · 0.00 0.39

Gly

265 · · · · T · · 0.28 0.49 · · · 0.00 0.36

Leu

266 · · · · T · · -0.02 1.06 · · · 0.00 0.22

Asn

267 . . . . T . . -0.32 0.66 · · · 0.00 0.35

Asn

268 · · · · T · · 0.08 0.26 · · F 0.45 0.47

Cys

269 · · · · T T · 0.78 0.21 * * F 0.65 0.76

Be

270 . . . . T T . 1.23 - * * F 1.25 0.76

0.07

Be

271 . . . . T T . 1.23 - . * F 1.25 0.93

0.47

Be

272 . . . . . T C 1.23 - * * F 1.20 1.43

0.19

Asn

273 · TO · · T · · 1.23 - * F 1.30 1.79

0.76

Arg

274 · TO · · T · · 1.31 - * * F 1.30 2.31

0.74

Leu

275 TO TO · · · · · 1.01 - * * F 0.90 1.74

0.63

Beef

Position I II III IV V SAW VII VIII IX X XI XII XIII XIV

Asp

276 TO TO · · · · · 1.31 - * * F 0.60 1.07

0.40

Gln

277 TO TO · · · · · 0.76 - * * · 0.30 0.95

0.40

To

278 TO · · B · · · 0.44 0.24 * * · - 0.85

0.30

Met

279 · · B B · · · 0.33 0.04 * * · - 0.74

0.30

Gln

280 · · B B · · · 0.83 0.04 * * · - 0.74

0.30

Val

281 · · B B · · · 0.02 0.13 * · · - 1.05

0.15

Thr

282 TO · · B · · · -0.32 0.31 * · F - 0.88

0.15

Glu

283 TO · · B · · · -0.33 0.13 * · F - 0.50

0.15

Thr

284 TO · · B · · · -0.04 0.34 · * F - 0.67

0.15

Leu

285 TO · · B · · · -0.08 0.19 · · · - 0.67

0.30

Gly

286 · · · B T · · 0.11 0.20 · · · 0.10 0.52

Met

287 · · · B T · · -0.24 0.77 · · · - 0.19

0.20

Thr

288 · · B B · · · -1.13 0.86 · · · - 0.13

0.60

His

289 · · B B · · · -0.82 0.86 · · · - 0.09

0.60

Beef

Position I II III IV V SAW VII VIII IX X XI XII XIII XIV

Cys

290 · · B B · · · -0.22 0.83 · · · - 0.15

0.60

Cys

291 · · B B · · · -0.77 0.64 · · · - 0.16

0.60

Ile

292 · · B B · · · -1.06 0.84 · · · - 0.08

0.60

Asn

293 · · B B · · · -0.99 1.03 * * · - 0.11

0.60

Pro

294 · · B B · · · -1.54 1.21 * · · - 0.31

0.60

Ile

295 · TO B B · · · -1.58 1.14 * · · - 0.44

0.60

Ile

296 · TO B B · · · -1.77 1.24 * · · - 0.24

0.60

Tyr

297 · TO B B · · · -1.22 1.49 * · · - 0.11

0.60

To

298 · TO B B · · · -1.22 1.49 · · · - 0.16

0.60

Phe

299 · TO B B · · · -0.97 0.80 · · · - 0.40

0.60

Val

300 · TO B B · · · -0.78 0.11 * * · - 0.51

0.30

Gly

301 TO TO · B · · · 0.22 0.14 * * F - 0.44

0.15

Glu

302 TO TO · · · · · 0.47 - * * F 0.45 0.99

0.36

Lys

303 TO TO · · · · · 0.81 - * * F 0.90 2.14

Beef

Position I II III IV V SAW VII VIII IX X XI XII XIII XIV

0.74

Phe

304 TO . . . . T . 0.70 - * * F 1.30 3.39

0.63

Arg

305 TO . . . . T . 0.74 - * * . 0.85 1.62

0.37

Asn

306 TO . . . . T . 0.23 0.31 * * . 0.10 0.67

Tyr

307 TO . . . . T . -0.47 0.96 * * . - 0.57

0.20

Leu

308 TO . . B . . . -1.21 0.96 * * . - 0.25

0.60

Leu

309 TO . . B . . . -0.51 1.74 * * . - 0.14

0.60

Val

310 TO . . B . . . -0.58 1.74 . . . - 0.15

0.60

Phe

311 TO . . B . . . -0.61 0.99 * . . - 0.36

0.60

Phe

312 TO . . B . . . -1.26 0.80 * . . - 0.60

0.60

Gln

313 TO . . B . . . -1.03 0.80 * . . - 0.57

0.60

Lys

314 TO . . B . . . -0.18 0.66 * . . - 0.66

0.60

His

315 TO TO . . . . . 0.79 - * * · 0.45 1.53

0.13

Ile

316 TO . . . . . . 0.79 - * · · 0.75 1.73

0.91

To

317 TO TO . . . . . 0.82 - * · · 0.88 0.75

Beef

Position I II III IV V SAW VII VIII IX X XI XII XIII XIV

0.53

Lys

318 TO TO . . . . . 0.87 0.04 * · · 0.26 0.30

Arg

319 TO . . T . . 0.16 - * · . 1.54 0.84

0.46

Phe

320 . TO . . T . . -0.48 - * · · 2.12 0.45

0.57

Cys

321 . . . . T T . 0.11 - * · · 2.80 0.12

0.50

Lys

322 . . . . T T . -0.19 - * . . 2.22 0.08

0.11

Cys

323 . . . . T T . -0.93 0.57 * . . 1.04 0.07

Cys

324 . . . . T T . -1.04 0.57 * . . 0.76 0.11

Be

325 . TO . . T . . -0.34 0.40 * . . 0.38 0.09

Ile

326 . TO B . . . . 0.32 0.80 * . . - 0.30

0.60

Phe

327 . TO B . . . . -0.31 0.23 * . . - 0.97

0.30

Gln

328 TO TO . . . . . 0.14 0.16 . . F - 0.73

0.15

Gln

329 TO TO . . . . . 0.81 0.20 . * F 0.00 1.61

Glu

330 TO TO . . . . . 1.22 - . * F 0.60 3.22

0.49

To

331 . TO . . . . C 1.52 - . * F 1.10 3.64

1.27

Pro

332 TO TO . . . . . 1.92 - * * F 0.90 2.13

1.17

Res Position I II III IV V VI VII VIII IX X XI XII XIII XIV Glu 333 A A. . . . . 1.62 - * * F 0.90 1.64 1.19 Arg 334 A A. . . . . 0.77 - *. F 0.90 2.18 0.80 Ala 335 A A. B. . . 0.52 - * * F 0.90 1.05 0.66 Ser 336. A B B. . . 0.80 - * * F 0.45 0.95 0.33 Ser 337. . B B. . . 1.12 0.16 *. F -0.70 0.15 Val 338. . B B. . . 0.82 0.16 * *. -1.35 0.15 Tyr 339. . B B. . . 0.40 0.04 * * F 0.30 1.35 Thr 340. . B B. . . 0.64 0.14 * * F 0.60 1.46 Arg 341. . . B. . C 0.94 0.19. * F 1.10 1.94 Ser 342. . . . . T C 1.24 -. * F 2.40 2.15 0.46 Thr 343. . . . . T C 2.10 -. * F 3.00 2.58 0.81 Gly 344. . . . . T C 1.46 -. * F 2.70 2.28 1.30 Glu 345. . . . . T C 1.47 -. * F 2.40 1.19 0.61 Gln 346. . B B. . . 0.50 -. * F 1.50 1.11 0.61 Glu 347. . B B. . . 0.46 -. * F 0.75 0.83

0.46 5

10

fifteen

twenty

25

30

35

Res Position I II III IV V VI VII VIII IX X XI XII XIII XIV

Ile 348. . B B. . . -0.04 -. * F 0.45 0.47

0.46

Be 349. . B B. . . -0.09 0.23. *. -0.23

0.30

Val 350 . B B. . . -0.48 0.26. *. -0.17

0.30

Gly 351. . B B. . . -0.87 0.69. *. -0.30

0.30

Leu 352 A. . B. . . -1.26 0.43. *. -0.29

0.60

Among the highly preferred fragments in this regard are those comprising regions of the G-protein Chemokine Receptor (CCR5) that combine several structural features, such as several of the features set forth above.

Other preferred polypeptide fragments are biologically active G protein Chemokine Receptor fragments (CCR5). Biologically active fragments are those that show similar, but not necessarily identical, activity to an activity of the G-protein Chemokine Receptor polypeptide (CCR5). The biological activity of the fragments may include an improved desired activity or a decreased undesirable activity. Polynucleotides encoding these polypeptide fragments are also described.

However, many polynucleotide sequences, such as EST sequences, are publicly available and accessible through sequence databases. Some of these sequences are related to SEQ ID NO: 1 or to the deposited clone and may have been publicly available. Listing each related sequence would be uncomfortable. Accordingly, one or more polynucleotides comprising a nucleotide sequence described by the general formula of ab are preferably excluded from the present description, wherein a is any integer between 1 and 1400 of SEQ ID NO: 1, b is a integer from 15 to 1414, corresponding to both the positions of the nucleotide residues shown in SEQ ID NO: 1 or of the deposited clone and b being greater than or equal to a + 14.

Epitopes and Antibodies

Polypeptides comprising, or alternatively consisting of, an epitope of the polypeptide having an amino acid sequence of SEQ ID NO: 2 or an epitope of the polypeptide sequence encoded by a polynucleotide sequence contained in ATCC Deposit No. 97183 are described. or encoded by a polynucleotide that hybridizes with the sequence complement of SEQ ID NO: 1 or contained in ATCC Deposit No. 97183 under stringent hybridization conditions or less stringent hybridization conditions as defined above. Polynucleotide sequences encoding an epitope of a described polypeptide sequence are further described in which (such as, for example, the sequence described in SEQ ID NO: 1 or the sequence of the deposited clone), the polynucleotide sequences of the complementary strand of a polynucleotide sequence encoding an epitope and polynucleotide sequences that hybridize with the complementary strand under stringent hybridization conditions or less stringent hybridization conditions defined above.

The term "epitopes," as used herein, refers to parts of a polypeptide that have antigenic or immunogenic activity in an animal, preferably a mammal and more preferably in a human being. A polypeptide comprising an epitope is described, as well as the polynucleotide encoding this polypeptide. An "immunogenic epitope", as used herein, is defined as a part of a protein that induces an antibody response in an animal, as determined by any method known in the art, for example, by methods for generate antibodies described below. (See, for example, Geysen et al., Proc. Natl. Acad. Sci. USA 81: 3998-4002 (1983)). The term "antigenic epitope", as used herein, is defined as a part of a protein to which an antibody can specifically bind its antigen as determined by any method well known in the art, for example, by immunoassays described herein. Immunospecific binding excludes non-specific binding but does not necessarily exclude cross reactivity with other antigens. Antigenic epitopes do not necessarily need to be immunogenic. The full length protein or an antigenic peptide fragment can be used. Regions that have a high antigenicity index are shown in Table 1 and FIGURE 3.

Antibodies from these regions or discrete fragments in these regions are preferably prepared. However, antibodies from any region of the peptide can be prepared as described herein. A preferred fragment produces an antibody that completely decreases or prevents ligand binding. Antibodies can be developed against the complete receptor or parts of the receptor, for example, the intracellular carboxy terminal domain, the extracellular amino terminal domain, the complete transmembrane domain or specific transmembrane segments, any of the intracellular or extracellular loops or any part of these regions . Antibodies can also be developed against specific functional sites, such as ligand binding site, G protein coupling site or sites that are glycosylated, phosphorylated, myristoylated or amidated.

Fragments that function as epitopes can be produced by any conventional means (See, for example, Houghten, Proc. Natl. Acad. Sci. USA 82: 5131-5135 (1985), further described in US Patent No. 4,631,211).

Antigenic epitopes preferably contain a sequence of at least 4, at least 5, at least 6, at least 7, more preferably at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 20, at least 25, at least 30, at least 40, at least 50, and more preferably, between about 15 and about 30 amino acids. Preferred polypeptides comprising immunogenic or antigenic epitopes have at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 100 residues amino acids in length. Additional non-exclusive preferred antigenic epitopes include the antigenic epitopes described herein, as well as parts thereof. Antigenic epitopes are useful, for example, to induce antibodies, including monoclonal antibodies, that specifically bind to the epitope. Preferred antigenic epitopes include the antigenic epitopes described herein, as well as any combination of two, three, four, five or more of these antigenic epitopes. Antigenic epitopes can be used as the target molecules in immunoassays (See, for example, Wilson et al., Cell 37: 767-778 (1984); Sutcliffe et al., Science 219: 660-666 (1983)). It should not be construed, however, that these fragments encompass any fragment that can be described before the invention.

Similarly, immunogenic epitopes, for example, can be used to induce antibodies according to methods well known in the art. (See, for example, Sutcliffe et al., Mentioned above; Wilson et al., Mentioned above; Chow et al., Proc. Natl. Acad. Sci. USA 82: 910-914; and Bittle et al., J. Gen. Virol. 66: 2347-2354 (1985) Preferred immunogenic epitopes include the immunogenic epitopes described herein, as well as any combination of two, three, four, five or more of these immunogenic epitopes. Polypeptides comprising one or more immunogenic epitopes may be presented to induce an antibody response together with a carrier protein, such as an albumin, to an animal system (such as rabbit or mouse) or, if the polypeptide is of sufficient length (at least about 25 amino acids ), the polypeptide can be presented without a vehicle, however, immunogenic epitopes comprising as few as 8 to 10 amino acids have proven sufficient to induce antibodies capable of binding at least epitope linear positions in a denatured polypeptide (for example, in Western blotting).

Polypeptides bearing epitopes can be used to induce antibodies according to methods well known in the art including, but not limited to, in vivo immunization, in vitro immunization and phage display methods. See, for example, Sutcliffe et al., Mentioned above; Wilson et al., Mentioned above, and Bittle et al., J. Gen. Virol., 66: 2347-2354 (1985). If immunization is used in vivo, animals can be immunized with free peptide; however, the titer of antiseptic antibodies can be stimulated by coupling the peptide with a macromolecular vehicle, such as Californian lapa hemacyanin (KLH) or tetanus toxoid. For example, peptides containing cysteine residues can be coupled to a vehicle using a linker such as maleimidobenzoyl-N-hydroxysuccinimide ester (MBS), while other peptides can be coupled to vehicles using a more general binding agent such as glutaraldehyde.

Peptides bearing epitopes can also be synthesized as multiple antigenic peptides (MAP), first described by J. P. Tam in Proc. Natl Acad Sci. U.S.A. 85: 5409. MAPs consist of multiple copies of a specific peptide bound to a non-immunogenic lysine core. MAP peptides usually contain 4 or 8 copies of the peptide often referred to as MAP-4 or MAP-8 peptides. As a non-limiting example, MAPs can be synthesized in a lysine core matrix attached to a polyethylene glycol-polystyrene (PEG-PS) support. The peptide of interest is synthesized in the lysine residues using 9-fluorenylmethoxycarbonyl (Fmoc) chemistry. For example, Applied Biosystems (Foster City, CA) offers MAP resins, such as, for example, the Fmoc 4 Resin Branch and the Fmoc 8 Resin Branch that can be used to synthesize MAP. The cleavage of the resin MAPs is performed with conventional trifluoroacetic acid (TFA) based cocktails known in the art. MAP purification, except for desalination, is not necessary. MAP peptides can be used as an immunization vaccine that induces antibodies that recognize both the MAP and the native protein from which the peptide was derived.

Epitope-bearing peptides can also be incorporated into a virus-covering protein that can then be used as an immunogen or a vaccine with which to immunize animals, including humans, to enhance the production of anti-epitope antibodies. For example, the V3 loop of the gp120 glycoprotein of human immunodeficiency virus type 1 (HIV-1) has been engineered to express itself on the surface of rhinovirus. Immunization with this rhinovirus presenting the V3 loop peptide produced apparently effective HIV mimetics, immunogens (as measured by its ability to neutralize by anti-HIV-1 antibodies as well as its ability to induce the production of antibodies capable of neutralizing HIV1 in cell culture These techniques of using genetically engineered viral particles as an immunogen are described in more detail in Smith et al., Behring Inst Mitt Feb; (98): 229-39 (1997), Smith et al, J Virol 72: 651-9 (1998), and Zhang et al., Biol Chem 380: 365-74 (1999).

Polypeptides bearing epitopes can be modified, for example, by the addition of amino acids at the amino and / or carboxy terminal of the peptide. Such modifications can be made, for example, to alter the conformation of the epitope carrying polypeptide so that the epitope will have a conformation more closely related to the epitope structure in the native protein. An example of a CCRS polypeptide carrying modified epitope is a polypeptide in which one or more cysteine residues have been added to the polypeptide to allow the formation of a disulfide bond between two cysteines, resulting in a stable loop structure of the epitope that polypeptide carrier under non-reducing conditions. Disulfide bonds can be formed between a cysteine residue added to the polypeptide and a cysteine residue of the naturally occurring epitope or they can be formed between two cysteines both of which have been added to the naturally occurring epitope carrying polypeptide. Additionally, it is possible to modify one or more amino acid residues of the naturally occurring epitope carrying polypeptide by replacing them with cysteines to promote the formation of disulfide bond structures. Synthetic peptide cyclic thioether molecules can be routinely generated using techniques known in the art and are described in PCT publication WO 97/46251. Other modifications of polypeptides bearing epitopes contemplated by the present invention include biotinylation.

Animals such as rabbits, rats and mice are immunized with free or vehicle-coupled peptides or MAP peptides, for example, by intraperitoneal and / or intradermal injection of emulsions containing approximately 100 µg of Freund's carrier or vehicle protein and adjuvant or any another adjuvant known to stimulate an immune response. Several booster injections may be needed, for example, at intervals of approximately two weeks, to provide a useful titre of antiseptic antibody that can be detected, for example by ELISA assay using free peptide adsorbed on a solid surface. The serum antipeptide antibody titer of an immunized animal can be increased by the selection of antiseptic antibodies, for example, by adsorption with the peptide on a solid support and elution of the selected antibodies according to methods well known in the art.

As one skilled in the art will appreciate, and as discussed above, polypeptides comprising an immunogenic or antigenic epitope can be fused with other polypeptide sequences. For example, the polypeptides can be fused to the constant domain of immunoglobulins (IgA, IgE, IgG, IgM) or parts thereof (CH1, CH2, CH3 or any combination thereof and parts thereof) of albumin (including without Limitation of recombinant human albumin or fragments or variants thereof (see, for example, U.S. Patent No. 5,876,969 issued March 2, 1999, EP 0 413 622 and U.S. Patent No. 5,766,883 , issued on June 16, 1998)), resulting in chimeric polypeptides. Such fusion proteins may facilitate purification and may increase the half-life in vivo. This has been shown for chimeric proteins that consist of the first two domains of the human CD4 polypeptide and various domains of the constant regions of the mammalian immunoglobulin heavy or light chains. See, for example, EP 394,827; Traunecker et al., Nature, 331: 84-86 (1988). Enhanced delivery of an antigen through the epithelial barrier to the immune system has been demonstrated for antigens (for example insulin) conjugated to an FcRn binding partner such as Fc or IgG fragments (see, for example, PCT Publications WO 96/22024 and WO 99/04813). IgG fusion proteins having a disulfide-linked dimeric structure due to the disulfide bonds of the IgG part have also been found to be more effective in binding and neutralizing other molecules than monomeric polypeptides or fragments thereof by yes alone. See, for example, Fountoulakis et al., J. Biochem., 270: 3958-3964 (1995). Nucleic acids encoding the above epitopes can also be recombined with a gene of interest as an epitope marker (eg, the hemagglutinin marker ("HA") or flag marker) to aid in the detection and purification of the expressed polypeptide. For example, a system described by Janknecht et al. allows the easy purification of non-denatured fusion proteins expressed in human cell lines (Janknecht et al., 1991, Proc. Natl. Acad. Sci. USA 88: 8972-897). In this system, the gene of interest is subcloned into a vaccinia recombination plasmid so that the open reading phase of the gene is fused translationally with an aminoterminal marker consisting of six histidine residues. The marker serves as a matrix binding domain for the fusion protein. Extracts from cells infected with the recombinant vaccinia virus are loaded onto Ni2 + agarose-nitrileacetic acid columns and histidine-labeled proteins can be selectively eluted with imidazole-containing buffers.

Additional fusion proteins can be generated through gene combination, motif combination, exon combination and / or codon combination techniques (collectively referred to as "DNA shuffling"). DNA shuffling can be used to modulate polypeptide activities, such methods can be used to generate polypeptides with altered activity, as well as agonists and antagonists of polypeptides. See, generally, U.S. Patent Nos. 5,605,793; 5,811,238; 5,830,721; 5,834,252; and 5,837,458, and Patten et al., Curr. Opinion Biotechnol. 8: 724-33 (1997); Harayama, Trends Biotechnol. 16 (2): 76-82 (1998); Hansson, et al., J. Mol. Biol. 287: 265-76 (1999); and Lorenzo and Blasco, Biotechniques 24 (2): 308-13 (1998). The alteration of polynucleotides corresponding to SEQ ID NO: 1 and the polypeptides encoded by these polynucleotides can be achieved by DNA shuffling. DNA shuffling involves the assembly of two or more DNA segments by homologous or site-specific recombination to generate variation in the polynucleotide sequence. The polynucleotides, or encoded polypeptides, can be altered by subjecting them to random mutagenesis by error-prone PCR, random nucleotide insertion or other methods before recombination. In another embodiment, one or more components, motifs, sections, parts, domains, fragments, etc. of a polynucleotide encoding a polypeptide can be recombined with one or more components, motifs, sections, parts, domains, fragments, etc. of one or more heterologous molecules.

Antibodies

Apart from the antibodies of the invention mentioned above, the (TCR) that binds immunospecifically to a polypeptide, polypeptide fragment or variant of SEQ ID NO: 2 or of the polypeptide encoded by the deposited clone and / or an epitope (as determined by immunoassays well known in the art to assay for binding of antigen to specific antibody.

It is known that the basic antibody structural unit comprises a tetramer. Each tetramer is composed of two identical pairs of polypeptide chains, each pair having a "light" (approximately 25 kDa) and a "heavy" (approximately 50-70 kDa) chain. The amino-terminal part of each chain includes a variable region of approximately 100 to 110 or more amino acids primarily responsible for antigen recognition. The carboxy terminal part of each chain defines a constant region primarily responsible for effector function. Human light chains are classified as kappa and lambda light chains. Heavy chains are classified as mu, delta, gamma, alpha, or epsilon and define the antibody isotype as IgM, IgD, IgG, IgA and IgE, respectively. See generally, Fundamental Immunology Ch. 7 (Paul, W., ed., 2nd ed. Raven Press, N. Y. (1989)). The variable regions of each light / heavy chain pair form the antibody binding site.

Thus, an intact IgG antibody has two binding sites. Except in bifunctional or bispecific antibodies, the two binding sites are the same.

The chains show all the same general structure of relatively conserved flanking regions (FR) joined by three hypervariable regions, also called complementarity determining regions or CDR. The CDRs of the heavy and light chains of each pair are aligned by the flanking regions, allowing binding to a specific epitope. From N terminal to C terminal, light and heavy chains comprise the domains, FR1, CDR1, FR2, CDR2, FR3, CDR3 and FR4. The allocation of amino acids to each domain is in accordance with the definitions of Kabat Sequences of Proteins of Immunological Interest (National Institutes of Health, Bethesda, Md. (1987 and 1991)), or Chothia and Lesk J Mol. Biol. 196: 901-917 (1987); Chothia et al. Nature 342: 878-883 (1989).

A bispecific or bifunctional antibody is an artificial hybrid antibody that has two different pairs of heavy / light chains and two different binding sites: bispecific antibodies can be produced by a variety of methods including hybridoma fusion or Fab ’fragment binding. See, for example, Songsivilai and Lachmann Clin. Exp. Immunol. 79: 315-321 (1990), Kostelny et al. J Immunol. 148: 1547 1553 (1992). In addition, bispecific antibodies such as "diabodies" (Holliger et al. "'Diabodies': small bivalent and bispecific antibody fragments" PNAS USA 90: 6444-6448 (1993)) or "Janusins" (Trau-necker et al. " Bispecific single chain molecules (Janusins) target cytotoxic lymphocytes on HIV infected cells "EMBO J 10: 3655-3659 (1991) and Traunecker et al." Janusin: new molecular design for bispecific reagents "Int J Cancer Suppl 7: 51-52 ( 1992)).

Antibodies of the invention include, but are not limited to, monoclonal, multispecific, human, humanized or chimeric antibodies, single chain antibodies, Fab fragments, F (ab ') fragments, fragments produced by a Fab expression library, anti-antibody idiotypic (anti-Id) (including, for example, anti-Id antibodies for antibodies of the invention), intracellularly prepared antibodies (i.e., intrabodies) and epitope binding fragments of any of the foregoing. The term "antibody," as used herein, refers to immunoglobulin molecules and immunologically active parts or fragments of immunoglobulin molecules, that is, molecules that contain an antigen binding site that immunospecifically binds to an antigen. . The immunoglobulin molecules of the invention can be of any type (eg, IgG, IgE, IgM, IgD, IgA and IgY), class (eg, IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2) or molecule subclass of immunoglobulin. In a preferred embodiment, the immunoglobulin is an IgM isotype. In a preferred embodiment, the immunoglobulin is an IgG1 isotype. In another preferred embodiment, the immunoglobulin is an IgG2 isotype. In another preferred embodiment, the immunoglobulin is an IgG4 isotype. Immunoglobulins can have both a heavy and a light chain. A series of heavy chains of IgG, IgE, IgM, IgD, IgA and IgY can be paired with a light chain of the kappa or lambda forms.

More preferably the antibodies are human antigen binding antibody fragments of the present invention and include, without limitation, Fab, Fab 'and F (ab') 2, Fd, single chain Fv (scFv), single chain antibodies, Disulfide bound Fv (sdFv) and fragments comprising a VL or VH domain. Antigen-binding antibody fragments, including single chain antibodies, may comprise the variable region or regions alone or in combination with all or a portion of the following: hinge region, CH1, CH2 and CH3 domains. Also included in the invention are antigen-binding fragments that further comprise any combination of a variable region or regions with a hinge region, CH1, CH2 and CH3 domains. The antibodies of the invention can be of any animal origin including birds and mammals. Preferably, the antibodies are human, murine (eg, mouse and rat), donkey, rabbit, goat, guinea pig, camel, horse or chicken. As used herein, "human" antibodies include antibodies that have the amino acid sequence of a human immunoglobulin and include antibodies isolated from human immunoglobulin libraries or from transgenic animals for one or more human immunoglobulins and that do not express endogenous immunoglobulins, as described below and, for example, in U.S. Patent No.

5,939,598 to Kucherlapati et al.

The antibodies of the present invention can be monospecific, bispecific, triespecific or of greater multispecificity. Multi-specific antibodies may be specific for different epitopes of a polypeptide described herein or they may be specific for a polypeptide described herein as well as for a heterologous epitope, such as a heterologous polypeptide or solid support material. See, for example, PCT publications WO 93/17715; WO 92/08802; WO 91/00360; WO 92/05793; Tutt, et al., J. Immunol. 147: 60-69 (1991); United States Patents No. 4,474,893; 4,714,681; 4,925,648; 5,573,920; 5,601,819; Kostelny et al., J. Immunol. 148: 1547-1553 (1992).

The antibodies of the present description can be described or specified in terms of the epitope or epitopes

or part or parts of a polypeptide described herein that they recognize or to which they specifically bind. The epitope or epitopes or part or parts of the polypeptide may be specified as described herein, for example, by N-terminal and C-terminal positions, by size in contiguous amino acid residues or listed in Tables and Figures. Preferred epitopes of the invention include: Thr16-Va125, Gln59-Thr65, Thr167-Leu174, Ser 179-Ser185, Leu222-Ala233, Asn268-Gln277, His315-Ser325, Glu330-Ser336, Tyr339-Ile348 of SEQ ID NO: 2 or of the polypeptide encoded by the deposited clone, as well as polynucleotides encoding these epitopes. Even more preferred epitopes include peptides corresponding to the extracellular loops of the G-protein Chemokine Receptor (CCR5) or fragments and variants thereof, for example, amino acids 89102, 167-195 and / or 261-274 of SEQ ID NO: 2 or of the polypeptide encoded by the deposited clone. Antibodies that specifically bind to any epitope or polypeptide can also be excluded. Therefore, the present invention includes antibodies that specifically bind to CCR5 polypeptides and allow their exclusion.

The antibodies of the present invention can also be described or specified in terms of their cross reactivity. Antibodies that do not bind to any other analogue, ortholog or homologue of a polypeptide described herein are included. Antibodies that bind to polypeptides with at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 65%, are also included in the present description. at least 60%, at least 55% and at least 50% identity (as calculated using methods known in the art and described herein) with a polypeptide described herein. The antibodies can cross-react with murine, monkey, rat and / or rabbit homologs of human proteins and the corresponding epitopes thereof. Antibodies that do not bind polypeptides with less than 95%, less than 90%, less than 85%, less than 80%, less than 75%, less than 70%, less than 65%, less than 60% are also described , less than 55% and less than 50% identity (as calculated using methods known in the art and described herein) with a polypeptide described herein. In a specific embodiment, the cross-reactivity described above is with respect to any single specific antigenic or immunogenic polypeptide or a combination or combinations of 2, 3, 4, 5 or more of the specific antigenic and / or immunogenic polypeptides described herein. . Additionally, antibodies that bind to polypeptides encoded by polynucleotides that hybridize with a polynucleotide of the present description under stringent hybridization conditions (as described herein) are included herein.

Antibodies (including molecules that comprise, or alternatively consist of, antibody fragments

or variants thereof) may be immunospecifically linked to a polypeptide or polypeptide fragment or variant of the Human G-Chemokine Receptor (CCR5) (SEQ ID NO: 2 or of the polypeptide encoded by the deposited clone) and / or Chemokine Receptor of monkey G protein (CCR5). Preferably, the antibodies of the invention bind immunospecifically to the human G-protein Chemokine Receptor. Preferably, the antibodies of the invention bind immunospecifically to the human and monkey G protein Chemokine Receptor. Also preferably, the antibodies of the invention bind immunospecifically to the human G-protein Chemokine Receptor (CCR5) and the murine G-protein Chemokine Receptor. More preferably, the antibodies bind immunospecifically and with greater affinity to the human G-protein Chemokine Receptor (CCR5) than to the murine G-protein Chemokine Receptor.

In preferred embodiments, the antibodies of the present invention (including molecules comprising, or alternatively consisting of, antibody fragments thereof), immunospecifically bind to the G-protein Chemokine Receptor (CCR5) and do not cross-react. With any other antigen. In preferred embodiments, the antibodies of the invention bind immunospecifically with the G-protein Chemokine Receptor (CCR5) and do not cross-react with other chemokine receptors such as, for example, US28, CCR1, CCR2, CCR3, CCR4, CCR6, CCR7, CCR8, CCR9, CXCR1, CXCR2, CXCR3, CXCR4 and / or CXCR5.

In other preferred embodiments, the antibodies bind immunospecifically to the G-protein Chemokine Receptor (CCR5) and cross-react with other chemokine receptors such as, for example, US28, CCR1, CCR2, CCR3, CCR4, CCR6, CCR7, CCR8, CCR9, CXCR1, CXCR2, CXCR3, CXCR4 and / or CXCR5. In more preferred embodiments, the antibodies of the invention bind immunospecifically to the G-protein Chemokine Receptor (CCR5) and do not cross-react with CCR3 and / or CXCR4.

In a preferred embodiment, antibodies preferably bind to the G-protein Chemokine Receptor (CCR5) (SEQ ID NO: 2 or of the polypeptide encoded by the deposited clone) or fragments and variants thereof in relation to their ability to bind to others. antigens (such as, for example, other chemokine receptors).

As a non-limiting example, an antibody can be considered to bind to a first antigen preferably if it binds to said first antigen with a dissociation constant (KD) that is less than the KD of the antibody for the second antigen. In another non-limiting embodiment, an antibody may be considered to bind to a first antigen preferably if it binds to said first antigen with an affinity that is at least an order of magnitude less than the KD of the antibody for the second antigen. In another non-limiting embodiment, an antibody can be considered to bind to a first antigen preferably if it binds to said first antigen with an affinity that is at least two orders of magnitude less than the KD of the antibody for the second antigen.

In another non-limiting example, an antibody can be considered to bind to a first antigen preferably if it binds to said first antigen with a dissociation rate (koff) that is less than the koff of the antibody for the second antigen. In another non-limiting embodiment, an antibody is considered to bind to a first antigen preferably if it binds to said first antigen with an affinity that is at least an order of magnitude less than the koff of the antibody for the second antigen. In another non-limiting embodiment, an antibody may be considered to bind to a first antigen preferably if it binds to said first antigen with an affinity that is at least two orders of magnitude less than the koff of the antibody for the second antigen.

The antibodies of the present invention can also be described or specified in terms of their binding affinity with a CCR5 polypeptide. Binding affinities may include those with a dissociation constant or Kd of less than 5 X 10-2 M, 10-2 M, 5 X 10-3 M, 10-3 M, 5 X 10-4 M, 10- 4 M. Binding affinities may include those with a dissociation constant or Kd of less than 5 X 10-5, M, 10-5 M, 5 X 10-6 M, 10-6M, 5 X 10-7 M , 107 M, 5 X 10-8 M or 10-8 M. Binding affinities may include those with a dissociation constant or Kd of less than 5 X 10-9 M, 5 X 10-10 M, 10-10 M, 5 X 10-11 M, 10-11 M, 5 X 10-12 M, 10-12 M, 5 X 10-13 M, 10-13 M, 5 X 10-14 M, 10-14 M, 5 X 10-15 M, or 10-15 M. The human or humanized antibody or fragment thereof of the present invention has a dissociation constant (KD) of 10-9 M or less.

In specific embodiments, the antibodies of the invention bind to G-protein Chemokine Receptor polypeptides (CCR5) with a dissociation rate (koff) of at least 10-3 / s or 10-4 / s. Antibodies that bind to G-protein Chemokine Receptor polypeptides (CCR5) or fragments or variants thereof with a dissociation rate (koff) less than or equal to 5 X 10-4 s-1, 10-4 s are described -1, 5 X 10-5 s-1, or 10-5 s-1 5 X 10-6 s-1, 10-6 s-1, 5 X 10-7 s-1 or 10-7 s-1 . Antibodies that bind to CCR5 polypeptides or fragments or variants thereof with a dissociation rate (koff) less than or equal to 5 X 10-2 s-1, 10-2 s-1 or 5 X 10- are also described. 3 s-1.

In other embodiments, the antibodies of the invention bind to G-protein Chemokine Receptor polypeptides (CCR5) with an association rate (kon) greater than or equal to 103 M-1 s-1, 5 X 103 M-1 s -1, 104 M-1 s-1 or 5 X 104 M-1 s-1. Antibodies that bind to G-protein Chemokine Receptor (CCR5) polypeptides with an association rate (kon) greater than or equal to 105 M-1 s-1, 5 X 105 M-1 s-1, 106 M are described -1 s-1, or 5 X 106 M-1 s-1 or 107

M-1-1

s.

The description also describes antibodies that competitively inhibit the binding of an antibody with an epitope as determined by any method known in the art to determine competitive binding, for example, the immunoassays described herein. In preferred embodiments, the antibody competitively inhibits epitope binding by at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 60%, or at least 50%.

The antibodies of the present invention can act as antagonists of the polypeptides described herein. For example, antibodies that disrupt receptor / ligand interactions with the polypeptides described herein are partially or completely described. Preferably, the antibodies bind to an antigenic epitope described herein or a part thereof. The description presents specific receptor antibodies and ligand specific antibodies. The description also presents specific receptor antibodies that do not prevent ligand binding but prevent receptor activation. The activation of the receptor (ie, signaling) can be determined by techniques described herein or otherwise known in the art. For example, receptor activation can be determined by detection of phosphorylation (eg, tyrosine or serine / threonine) of the receptor or its substrate by immunoprecipitation followed by Western blot analysis. (for example, as described above). In specific embodiments, antibodies that inhibit ligand activity or receptor activity are provided in at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at at least 60%, or at least 50% of the activity in the absence of the antibody.

The description also presents receptor specific antibodies that prevent ligand binding and receptor activation as well as antibodies that recognize the receptor-ligand complex and, preferably, do not specifically recognize the unbound receptor or unbound ligand. Similarly, neutralizing antibodies that bind to the ligand and prevent binding of the ligand with the receptor are included in the description, as well as antibodies that bind to the ligand, thereby preventing receptor activation, but that do not prevent the ligand binds to the receptor. Antibodies can act as receptor agonists, that is, they potentiate or activate all or a set of the biological activities of ligand-mediated receptor activation, for example, by inducing receptor dimerization. Antibodies can be specified as agonists, antagonists or inverse agonists for biological activities that comprise the specific biological activities of the peptides described herein. The above antibody agonists can be prepared using methods known in the art. See, for example, PCT publication WO 96/40281; U.S. Patent No. 5,811,097; Deng et al., Blood 92 (6): 1981-1988 (1998); Chen et al., Cancer Res. 58 (16): 3668-3678 (1998); Harrop et al., J. Immunol. 161 (4): 1786-1794 (1998); Zhu et al., Cancer Res. 58 (15): 3209-3214 (1998); Yoon et al., J. Immunol. 160 (7): 3170-3179 (1998); Prat et al., J. Cell. Sci. 111 (Pt2): 237-247 (1998); Pitard et al., J: Immunol. Methods 205 (2): 177-190 (1997); Liautard et al., Cytokine 9 (4): 233-241 (1997); Carlson et al., J. Biol. Chem. 272 (17): 11295-11301 (1997); Taryman et al., Neuron 14 (4): 755-762 (1995); Muller et al., Structure 6 (9): 1153-1167 (1998); Bartunek et al., Cytokine 8 (1): 14-20 (1996).

Antibodies of the invention that bind immunospecifically with a G-protein Chemokine Receptor (CCR5) may comprise a polypeptide having the amino acid sequence of any one of the heavy chains expressed by a cell line that expresses anti-Chemokine Receptor antibody of protein G (CCR5) and / or any of the light chains expressed by a cell line expressing G-protein Chemokine Receptor antibody (CCR5). The antibodies of the present invention that bind immunospecifically with a G-protein Chemokine Receptor (CCR5) may comprise a polypeptide having the amino acid sequence of any one of the VH domains of a heavy chain expressed by a cell line that expresses antibody G-protein Chemokine Receptor (CCR5) and / or any of the VL domains of a light chain expressed by a cell line expressing G-protein Chemokine Receptor antibody (CCR5). The antibodies of the present invention may comprise the amino acid sequence of a VH domain and VL domain expressed by a single cell line expressing G-protein Chemokine Receptor antibody (CCR5). The antibodies of the present invention may comprise the amino acid sequence of a VH domain and a VL domain expressed by two different cell lines that express G-protein Chemokine Receptor antibody (CCR5). Molecules comprising, or alternatively consisting of, antibody fragments of the VH and / or VL domains expressed by a cell line that expresses anti-G-Chemokine Receptor antibody (CCR5) that bind immunospecifically to a Receptor of G protein chemokine (CCR5) are also encompassed by the invention, as are nucleic acid molecules encoding these VH and VL domains, molecules and / or fragments.

Antibodies that immunospecifically bind to a polypeptide or variant or polypeptide fragment of a G-protein Chemokine Receptor (CCR5) are described, said antibodies comprising, or alternatively consisting of, a polypeptide having an amino acid sequence of one, two, three or more any of the VH CDRs contained in a heavy chain expressed by one or more cell lines expressing G-protein Chemokine Receptor antibodies (CCR5). In particular, the antibodies of the present invention that bind immunospecifically with a G-protein Chemokine Receptor (CCR5) may comprise, or alternatively, consist of a polypeptide having the amino acid sequence of a VH CDR1 contained in a chain Weighing expressed by one or more cell lines expressing G-protein Chemokine Receptor antibody (CCR5). Antibodies that immunospecifically bind to a G-protein Chemokine Receptor (CCR5), comprise, or alternatively consist of, a polypeptide having the amino acid sequence of a VH CDR2 contained in a heavy chain expressed by one or more lines Cells expressing G-protein Chemokine Receptor Antibody (CCR5). Antibodies that immunospecifically bind to a G-protein Chemokine Receptor (CCR5), comprise, or alternatively consist of, a polypeptide having the amino acid sequence of a VH CDR contained in a heavy chain expressed by one or more lines Cells expressing G-protein Chemokine Receptor Antibody (CCR5). Also described are molecules comprising, or as an alternative consisting of, these antibodies or antibody fragments or variants thereof, that bind immunospecifically with a G protein Chemokine Receptor (CCR5) or a protein Chemokine Receptor fragment G (CCR5) or variant thereof, as well as nucleic acid molecules encoding these antibodies, molecules, fragments and / or variants.

The antibodies of the present invention that bind immunospecifically with a G-protein Chemokine Receptor (CCR5), may comprise, or alternatively consist of, a polypeptide having an amino acid sequence of one, two, three or more of any of the VR CDR contained in a light chain expressed by one or more cell lines expressing G-protein Chemokine Receptor antibody (CCR5). In particular, the antibodies of the present invention that bind immunospecifically with a G-protein Chemokine Receptor (CCR5), may comprise, or alternatively, consist of a polypeptide having the amino acid sequence of a VL CDR1 contained in a light chain expressed by one or more cell lines expressing G-protein Chemokine Receptor antibody (CCR5). The antibodies of the present invention that bind immunospecifically with a G-protein Chemokine Receptor (CCR5), may comprise, or alternatively, consist of a polypeptide having the amino acid sequence of a VL CDR2 contained in an expressed light chain by one or more cell lines expressing G-protein Chemokine Receptor antibody (CCR5). Antibodies that bind immunospecifically with a G-protein Chemokine Receptor (CCR5) may comprise, or alternatively, consist of a polypeptide having the amino acid sequence of a VL CDR contained in a light chain expressed by one or more cell lines expressing G-protein Chemokine Receptor antibody (CCR5). Also described are molecules comprising, or alternatively consisting of, these antibodies, or antibody fragments or variants thereof, that bind immunospecifically with G-protein Chemokine Receptor (CCR5) or a fragment of the Protein Chemokine Receptor G (CCR5) or variant thereof, as well as nucleic acid molecules encoding these antibodies, molecules, fragments and / or variants.

The antibodies of the present invention (including molecules that may comprise, or alternatively consist of, antibody fragments) that bind immunospecifically with a G-protein Chemokine Receptor polypeptide (CCR5) or polypeptide fragment or variant of a Chemokine Receptor of protein G (CCR5), said antibodies comprising, or alternatively consisting of, one, two, three or more CDR of VH and one, two, three or more CDR of VL, as contained in a heavy chain or expressed light chain by a

or more cell lines expressing G-protein Chemokine Receptor antibody (CCR5) of the invention. In particular, the antibodies of the present invention that bind immunospecifically with G-protein Chemokine Receptor (CCR5), may comprise, or alternatively consist of, a VH CDR1 and a VL CDR1, a VH CDR1 and a CDR2 of VL, a CDR1 of VH and a CDR3 of VL, a CDR2 of VH and a CDR1 of VL, a CDR2 of VH and CDR2 of VL, a CDR2 of VH and a CDR3 of VL, a CDR3 of VH and a CDR1 of VH, a CDR3 of VH a CDR2 of VL, a CDR3 of VH and a CDR3 of VL or any combination thereof, of the VH CDRs and VR CDRs contained in a light chain or light chain expressed by one or more lines Cells expressing G-protein Chemokine Receptor Antibody (CCR5). One or more of these combinations are from a single cell line that expresses G-protein Chemokine Receptor antibody (CCR5). Also described are molecules that comprise, or alternatively that consist of, fragments or variants of these antibodies, that bind immunospecifically with a G-protein Chemokine Receptor (CCR5), as well as nucleic acid molecules encoding these antibodies, molecules, fragments or variants.

The present invention also provides generally isolated nucleic acid molecules encoding an antibody of the invention (including molecules comprising, or alternatively consisting of, antibody fragments thereof). In a specific embodiment, a nucleic acid molecule of the invention encodes an antibody (including molecules that comprise or as an alternative consisting of antibody fragments or variants thereof), which comprise, or as an alternative consisting of, a VH domain that it has an amino acid sequence of any one of the VH domains of a heavy chain expressed by a cell line that expresses G-protein Chemokine Receptor antibody (CCR5) of the invention and a VL domain that has an amino acid sequence of a light chain expressed by a cell line expressing G-protein Chemokine Receptor antibody (CCR5) of the invention. In another embodiment, a nucleic acid molecule of the invention encodes an antibody (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof), comprising, or as an alternative consisting of, a VH domain. which has an amino acid sequence of any one of the VH domains of a heavy chain expressed by a cell line that expresses G-protein Chemokine Receptor antibody (CCR5) of the invention or a VL domain that has an amino acid sequence of a light chain expressed by a cell line expressing G-protein Chemokine Receptor antibody (CCR5).

Antibodies comprising, or alternatively consisting of, variants (including derivatives) of the antibody molecules (for example, VH domains and / or VL domains) described herein are described, said antibodies binding immunospecifically with a Receptor of G protein chemokine (CCR5) or fragment or variant thereof. Conventional techniques known to those skilled in the art can be used to introduce mutations in the nucleotide sequence encoding a molecule of the invention, including, for example, directed mutagenesis and PCR-mediated mutagenesis that results in amino acid substitutions. Preferably, the variants (including derivatives) encode less than 50 amino acid substitutions, less than 40 amino acid substitutions, less than 30 amino acid substitutions, less than 25 amino acid substitutions, less than 20 amino acid substitutions, less than 15 amino acid substitutions , less than 10 amino acid substitutions, less than 5 amino acid substitutions, less than 4 amino acid substitutions, less than 3 amino acid substitutions or less than 2 amino acid substitutions in relation to the reference VH domain, VHCDR1, VHCDR2, VHCDR3, VL, VLCDR1, VLCDR2, or VLCDR3 domain. A "conservative amino acid substitution" is one in which the amino acid residue is replaced with an amino acid residue having a side chain with a similar charge. Families of amino acid residues having side chains with similar charges have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, Threonine, tyrosine, cysteine), non-polar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), branched beta side chains (e.g. threonine, valine, isoleucine) and aromatic side chains (for example, tyrosine, phenylalanine, tryptophan, histidine). Alternatively, mutations may be introduced randomly throughout all or part of the coding sequence, such as by saturation mutagenesis, and the resulting mutants can be screened for biological activity to identify mutants that retain activity (e.g., the ability to join a G-protein Chemokine Receptor).

For example, it is possible to introduce mutations only in flanking regions or only in CDR regions of an antibody molecule. The mutations introduced can be silent or neutral missense mutations, that is, they have little or no effect on the ability of an antibody to bind to the antigen. These types of mutations can be useful for optimizing the use of codons or improving the production of antibodies to a hybridoma. Alternatively, non-neutral missense mutations can alter the ability of an antibody to bind to an antigen. The location of most silent and neutral missense mutations is probably in the flanking regions, while the location of most nonneutral missense mutations is probably in CDR, although this is not an absolute requirement. One skilled in the art would be able to design and test mutant molecules with desired properties such as no alteration in antigen binding activity or alteration in binding activity (eg, improvements in antigen binding activity or change in specificity of antibody). After mutagenesis, the encoded protein can be routinely expressed and the functional and / or biological activity of the encoded protein (eg, ability to immunospecifically bind to a G-protein Chemokine Receptor) can be determined using techniques described herein or by routine modification techniques known in the art.

An antibody (including a molecule comprising, or as an alternative consisting of, an antibody fragment or variant thereof), which immunospecifically binds with G-protein Chemokine Receptor polypeptides (CCR5) or fragments or variants thereof, it comprises, or alternatively consists of, an amino acid sequence encoded by a nucleotide sequence that hybridizes with a nucleotide sequence that is complementary to that encoded by one of the VH or VL domains expressed by the cell line expressing anti-Receptor antibody of Protein Chemokine G (CCR5) of the invention, under stringent conditions, for example, hybridization with filter-bound DNA in sodium citrate / 6X sodium chloride (SSC) at approximately 45 ° C followed by one or more washes in 0.2x SSC / 0.1% SDS at about 50-65 ° C, under highly stringent conditions, for example, hybridization with filter bound nucleic acid in 6x SSC at about 45 ° C followed by and one or more washes in 0.1x SSC / 0.2% SDS at about 68 ° C or in other stringent hybridization conditions known to those skilled in the art (see, for example, Ausubel,

FM et al., Eds., 1989, Current Protocols in Molecular Biology, Vol. I, Green Publishing Associates, Inc. and John Wiley & Sons, Inc., New York on pages 6.3.1-6.3.6 and 2.10. 3). Nucleic acid molecules encoding these antibodies are also described.

It is well known within the art that polypeptides, or fragments or variants thereof, with similar amino acid sequences often have similar structure and many of the same biological activities. An antibody (including a molecule comprising, or as an alternative consisting of, an antibody fragment or variant thereof), which immunospecifically binds with a G-protein Chemokine Receptor polypeptide or fragments or variants of a Receptor Polypeptide Protein chemokine G, comprises, or alternatively consists of, a VH domain having an amino acid sequence that is at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at minus 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical, to the sequence of amino acids of a VH domain of a heavy chain expressed by a cell line that expresses an anti-G protein Chemokine Receptor antibody (CCR5).

An antibody (including a molecule comprising, or alternatively consisting of, an antibody fragment or variant thereof), which binds immunospecifically with a G-protein Chemokine Receptor polypeptide (CCR5) or fragments or variants of a polypeptide of the G-protein Chemokine Receptor (CCR5), comprises, or alternatively consists of, a VL domain having an amino acid sequence that is at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to the amino acid sequence of a VL domain of a light chain expressed by a cell line expressing G-protein Chemokine Receptor antibody (CCR5).

The antibodies of the invention (including molecules comprising, or alternatively consisting of, antibody fragments), may have one or more of the same biological characteristics as one or more of the antibodies described herein. By "biological characteristics" is meant the in vitro or in vivo activities or properties of the antibodies, such as, for example, the ability to bind to G-protein Chemokine Receptor (CCR5) (eg, G-protein Chemokine Receptor (CCR5) expressed on a cell surface, G-protein Chemokine Receptor (CCR5) included in membrane and / or a fragment or variant of G-protein Chemokine Receptor (CCR5)); the ability to substantially inhibit or suppress the binding of the G-protein Chemokine Receptor (CCR5) with a G-protein Chemokine Receptor ligand (CCR5) (eg, MIPI-beta, see, for example, Example 61); the ability to negatively regulate the expression of the G-protein Chemokine Receptor (CCR5) on the cell surface; the ability to inhibit or suppress the biological activity mediated by G-protein Chemokine Receptor (CCR5) (eg, HIV binding with, infection (entry / fusion), and / or replication in cells expressing G-protein Chemokine Receptor (CCR5) (see, for example, Example 60), the ability to inhibit or suppress MIP1-beta-induced chemotaxis of PBMC peripheral blood mononuclear cells (or other cells expressing G-protein Chemokine Receptor (CCR5)) or the ability to induce an intracellular calcium flux in cells expressing G-protein Chemokine Receptor (CCR5) (see, for example, Example 63). Optionally, the antibodies of the invention can bind to the same epitope as at least one of the antibodies specifically indicated herein Such epitope binding can be routinely determined using assays known in the art.

The antibodies of the present invention (including molecules comprising, or alternatively consisting of, antibody fragments), can neutralize the G-protein Chemokine Receptor (CCR5), said antibodies being able to comprise, or alternatively consist of, a part (for example, VH CDR1, VH CDR2, VH CDR3, VL CDR1, VL CDR2, and / or VL CDR3) of a VH or VL domain of an antibody of the invention. An antibody that "neutralizes the G-protein Chemokine Receptor (CCR5) or a fragment or variant thereof" is, for example, an antibody that decreases or suppresses the ability of the G-protein Chemokine Receptor (CCR5) or a fragment or variant thereof to bind with its ligand (for example, HIV and MIP1-beta); that decreases or suppresses MIP1-beta-induced chemotaxis of PBMC or another cell that expresses CCR5; and / or that suppresses or inhibits the signaling cascade of the G-protein Chemokine Receptor (CCR5) (for example, calcium flow initiated by an activated G-protein Chemokine Receptor (CCR5), see, for example, Example 63) . In one embodiment, an antibody that neutralizes the G-protein Chemokine Receptor (CCR5), comprises, or alternatively consists of, a polypeptide having the amino acid sequence of a VH domain of an antibody or a fragment thereof of the invention. and a VL domain of an antibody or a fragment thereof of the invention. In another embodiment, an antibody that neutralizes the G-protein Chemokine Receptor (CCR5) comprises, or alternatively consists of, a polypeptide having the amino acid sequence of a VH domain and a VL domain of a single antibody (or scFv fragment or Fab) or fragments thereof of the invention. In one embodiment, an antibody that neutralizes the G-protein Chemokine Receptor (CCR5) comprises, or alternatively consists of, a polypeptide having the amino acid sequence of a VH domain of an antibody or a fragment thereof of the invention. In another embodiment, an antibody that neutralizes the G-protein Chemokine Receptor (CCR5) comprises, or alternatively consists of, a polypeptide having the amino acid sequence of a VL domain of an antibody or a fragment thereof of the invention. In another embodiment, an antibody that neutralizes the G-protein Chemokine Receptor (CCR5) or a fragment thereof comprises, or alternatively consists of, a polypeptide having the amino acid sequence of a VH CDR domain of an antibody or a fragment thereof of the invention. In a preferred embodiment, an antibody that neutralizes the G-protein Chemokine Receptor (CCR5) or a fragment thereof comprises, or alternatively consists of, a polypeptide having the amino acid sequence of a VH CDR3 of an antibody or a fragment thereof of the invention. In another embodiment, an antibody that neutralizes the G-protein Chemokine Receptor (CCR5) or a fragment thereof comprises, or alternatively consists of, a polypeptide having the amino acid sequence of a VL CDR of an antibody or a fragment of the same of the invention. In another preferred embodiment, an antibody that neutralizes the G-protein Chemokine Receptor (CCR5) or a fragment thereof comprises, or alternatively consists of, a polypeptide having the amino acid sequence of a VL CDR3 of an antibody or a fragment thereof of the invention. Nucleic acid molecules encoding these antibodies are also described.

The antibodies of the present invention (including molecules comprising, or alternatively consisting of, antibody fragments), can reduce or suppress the ability of HIV viruses, particularly those that use G-protein Chemokine Receptor (CCR5) as a co-receptor, to bind to, infect (enter / merge with) and / or replicate in cells expressing G-protein Chemokine Receptor (CCR5), as determined by any method known in the art such as, for example, tests described in the Example

60. Such antibodies may comprise, or alternatively consist of, a part (for example, VH CDR1, VH CDR2, VH CDR3, VL CDR1, VL CDR2, or VL CDR3) of a VH or VL domain having an amino acid sequence of an antibody or a fragment thereof of the invention. In one embodiment, an antibody that reduces or suppresses the ability of HIV viruses, particularly those that use G-protein Chemokine Receptor (CCR5) as a co-receptor, to bind, infect (enter / fuse with) and / or replicate in cells expressing G-protein Chemokine Receptor (CCR5), comprises, or alternatively consists of, a polypeptide having the amino acid sequence of a VH domain of an antibody, or a fragment thereof of the invention and a VL domain of an antibody, or a fragment thereof of the invention. In another embodiment, an antibody that reduces or suppresses the ability of HIV viruses, particularly those that use the G-protein Chemokine Receptor (CCR5) as a co-receptor, to bind, infect (enter / fuse with) and / or replicate in cells expressing the G-protein Chemokine Receptor (CCR5), it comprises, or alternatively consists of, a polypeptide having the amino acid sequence of a VH domain and a VL domain of a single antibody (or scFv or Fab fragment) or fragments thereof of the invention. In one embodiment, an antibody that reduces or suppresses the ability of HIV viruses, particularly those that use G-protein Chemokine Receptor (CCR5) as a co-receptor to bind, infect (enter / fuse with) and / or replicate in cells which express G-protein Chemokine Receptor (CCR5), comprises, or alternatively consists of, a polypeptide having the amino acid sequence of a VH domain of an antibody or a fragment thereof of the invention. In another embodiment, an antibody that reduces or suppresses the ability of HIV viruses, particularly those that use G-protein Chemokine Receptor (CCR5) as a co-receptor, to bind, infect (enter / fuse with) and / or replicate in cells expressing G-protein Chemokine Receptor (CCR5), comprises, or alternatively consists of, a polypeptide having the amino acid sequence of a VL domain of an antibody or a fragment thereof of the invention. In a preferred embodiment an antibody that reduces or suppresses the ability of HIV viruses, particularly those that use the G-protein Chemokine Receptor (CCR5) as a co-receptor, to bind to, infect (enter / fuse with) and / or replicate in cells expressing G-protein Chemokine Receptor (CCR5), comprises,

or alternatively it consists of a polypeptide having the amino acid sequence of a VH CDR3 of an antibody or a fragment thereof of the invention. In another preferred embodiment, an antibody that reduces or suppresses the ability of HIV viruses, particularly those that use the G-protein Chemokine Receptor (CCR5) as a co-receptor, to bind, infect (enter / fuse with) and / or replicating in cells expressing G-protein Chemokine Receptor (CCR5), comprises, or alternatively consists of, a polypeptide having the amino acid sequence of a VL CDR3 of an antibody or a fragment thereof of the invention. Nucleic acid molecules encoding these antibodies are also encompassed by the invention.

The antibodies of the present invention (including molecules comprising, or alternatively consisting of, antibody fragments thereof), can inhibit or suppress MIP1-beta-induced chemotaxis of PBMC peripheral blood mononuclear cells or other cells expressing Receptor of Protein Chemokine G (CCR5) as determined by any method known in the art such as, for example, the assays described in Example 62. Such antibodies may comprise, or alternatively consist of, a part (for example, VH CDR1 , VH CDR2, VH CDR3, VL CDR1, VL CDR2, or VL CDR3) of a VH or VL domain having an amino acid sequence of an antibody or a fragment thereof of the invention. In one embodiment, an antibody that inhibits or suppresses MIP1-beta-induced chemotaxis of PBMC peripheral blood mononuclear cells or other cells that express G-protein Chemokine Receptor (CCR5) comprises, or alternatively consists of, a polypeptide having the amino acid sequence of a VH domain of an antibody, or a fragment thereof of the invention and a VL domain of an antibody, or a fragment thereof of the invention. In another embodiment, an antibody that inhibits or suppresses MIP1-beta-induced chemotaxis of PBMC peripheral blood mononuclear cells or other cells that express G-protein Chemokine Receptor (CCR5) comprises, or alternatively consists of, a polypeptide having the amino acid sequence of a VH domain and a VL domain of a single antibody (or scFv or Fab fragment) or fragments thereof of the invention. In one embodiment, an antibody that inhibits or suppresses MIP1-beta-induced chemotaxis of PBMC peripheral blood mononuclear cells or other cells that express G-protein Chemokine Receptor (CCR5) comprises, or alternatively consists of, a polypeptide having the amino acid sequence of a VH domain of an antibody or a fragment thereof of the invention. In another embodiment, an antibody that inhibits or suppresses MIP1-beta-induced chemotaxis of PBMC peripheral blood mononuclear cells or other cells that express G-protein Chemokine Receptor (CCR5), comprises, or alternatively consists of, a polypeptide that it has the amino acid sequence of a VL domain of an antibody or a fragment thereof of the invention. In a preferred embodiment, an antibody that inhibits or suppresses MIP1-beta-induced chemotaxis of PBMC peripheral blood mononuclear cells or other cells that express G-protein Chemokine Receptor (CCR5) comprises, or alternatively consists of, a polypeptide having the amino acid sequence of a VH CDR3 of an antibody or a fragment thereof of the invention. In another preferred embodiment, an antibody that inhibits or suppresses MIP1-beta-induced chemotaxis of PBMC peripheral blood mononuclear cells or other cells that express G-protein Chemokine Receptor (CCR5), comprises, or alternatively consists of, a polypeptide that it has the amino acid sequence of a VL CDR3 of an antibody or a fragment thereof of the invention. Nucleic acid molecules encoding these antibodies are also encompassed by the invention.

The present description also provides antibodies (including molecules comprising, or alternatively consisting of, antibody fragments thereof), which negatively regulate cell surface expression of G-protein Chemokine Receptor (CCR5), as determined by Any method known in the art such as, for example, FACS analysis / assays described in Examples 61 or 63. As a non-limiting hypothesis, such negative regulation may be the result of antibody-induced internalization of the protein Chemokine Receptor. G (CCR5). Such antibodies may comprise, or alternatively consist of, a part (for example, VH CDR1, VH CDR2, VH CDR3, VL CDR1, VL CDR2, and / or VL CDR3) of a VH or VL domain having an amino acid sequence of an antibody described herein or a fragment or variant thereof. In one embodiment, an antibody that negatively regulates cell surface expression of the G-protein Chemokine Receptor (CCR5), comprises, or alternatively consists of, a polypeptide having the amino acid sequence of a VH domain of an antibody described in the present specification or a fragment or variant thereof and a VL domain of an antibody described herein or a fragment or variant thereof. In another embodiment, an antibody that negatively regulates the cell surface expression of the G-protein Chemokine Receptor (CCR5), comprises, or alternatively consists of, a polypeptide having the amino acid sequence of a VH domain and a VL domain of a single antibody (or scFv or Fab fragment) or fragments thereof of the invention. In one embodiment, an antibody that negatively regulates the cell surface expression of the G-protein Chemokine Receptor (CCR5), comprises, or alternatively consists of, a polypeptide having the amino acid sequence of a VH domain of an antibody described in the present report or a fragment or variant thereof. In another embodiment, an antibody that negatively regulates cell surface expression of G-protein Chemokine Receptor (CCR5), comprises, or alternatively consists of, a polypeptide having the amino acid sequence of a VL domain of an antibody described in the present report or a fragment or variant thereof. In a preferred embodiment, an antibody that negatively regulates cell surface expression of the G-protein Chemokine Receptor (CCR5), comprises, or alternatively consists of, a polypeptide having the amino acid sequence of a VH CDR3 of an antibody described herein or a fragment or variant thereof. In another preferred embodiment, an antibody that negatively regulates cell surface expression of the G-protein Chemokine Receptor (CCR5), comprises, or alternatively consists of, a polypeptide having the amino acid sequence of a VL CDR3 of an antibody described herein or a fragment or variant thereof. Nucleic acid molecules encoding these antibodies are also described.

Antibodies are also described (including molecules comprising, or as an alternative consisting of, antibody fragments or variants thereof), which enhance the activity of the G-protein Chemokine Receptor (CCR5), said antibodies comprising, or as an alternative consisting in, a part (eg, VH CDR1, VH CDR2, VH CDR3, VL CDR1, VL CDR2, or VL CDR3) of a VH or VL domain of an antibody described herein or a fragment or variant thereof. As a non-limiting example, an antibody that "improves the activity of the G-protein Chemokine Receptor (CCR5) or a fragment or variant thereof" is an antibody that increases the ability of the G-protein Chemokine Receptor (CCR5) to stimulate the chemotaxis of PBMC (or other cells that express G-protein Chemokine Receptor (CCR5)) and / or stimulate the signaling cascade of the G-protein Chemokine Receptor (CCR5) (for example, to initiate an intracellular calcium flow, see Example 63). In one embodiment, an antibody that enhances the activity of the G-protein Chemokine Receptor (CCR5), comprises, or alternatively consists of, a polypeptide having the amino acid sequence of a VH domain of an antibody described herein or a fragment or variant thereof and a VL domain of an antibody described herein or a fragment or variant thereof. In another embodiment, an antibody that enhances the activity of the G-protein Chemokine Receptor (CCR5), comprises, or alternatively consists of, a polypeptide having the amino acid sequence of a VH domain and a VL domain of a single antibody ( or scFv or Fab fragment) or fragments or variants thereof. In one embodiment, an antibody that enhances the activity of the G-protein Chemokine Receptor (CCR5) or a fragment or variant thereof, comprises, or alternatively consists of, a polypeptide having the amino acid sequence of a VH domain of a antibody described herein or a fragment or variant thereof. In another embodiment, an antibody that enhances the activity of the G-protein Chemokine Receptor (CCR5), or a fragment or variant thereof, comprises, or alternatively consists of, a polypeptide having the amino acid sequence of a VL domain of an antibody described herein or a fragment or variant thereof. In another embodiment, an antibody that enhances the activity of the G-protein Chemokine Receptor (CCR5) or a fragment or variant thereof, comprises, or alternatively consists of, a polypeptide having the amino acid sequence of a CDR domain of VH indicated in Table 2 or a fragment or variant thereof. In a preferred embodiment, an antibody that enhances the activity of the G-protein Chemokine Receptor (CCR5) or a fragment or variant thereof, comprises, or alternatively consists of, a polypeptide having the amino acid sequence of a VH CDR3 of an antibody described herein or a fragment or variant thereof. In another embodiment, an antibody that enhances the G-protein Chemokine Receptor (CCR5) or a fragment or variant thereof, comprises, or alternatively, consists of a polypeptide having the amino acid sequence of a CDR domain of a VL of a antibody described herein

or a fragment or variant thereof. In another preferred embodiment, an antibody that enhances the activity of the G-protein Chemokine Receptor (CCR5) or a fragment or variant thereof, comprises, or alternatively consists of, a polypeptide having the amino acid sequence of a CDR3 of VL of an antibody described herein or a fragment or variant thereof. Nucleic acid molecules encoding these antibodies are also described.

Fusion proteins are described which comprise, or alternatively consisting of, an antibody of the invention (including molecules comprising, or alternatively consisting of, antibody fragments thereof), which binds immunospecifically with Protein Chemokine Receptor G (CCR5) and a heterologous polypeptide. Preferably, the heterologous polypeptide with which the antibody is fused is useful for the function or is useful for targeting cells that express G-protein Chemokine Receptor (CCR5), including, but not limited to, MIP-1-beta; a CD4 binding polypeptide such as an anti-CD4 antibody, a CXCR4 binding polypeptide such as stromal-derived factor 1-alpha (SDF1-alpha); and / or a CCR3 binding protein, such as MIP1alpha). In a preferred alternative embodiment, the heterologous polypeptide with which the antibody is fused is useful for the cellular function of T lymphocytes, macrophages and / or monocytes or is useful for directing the antibody to a T lymphocyte, macrophage or monocyte, including but without limitation, MIP-1-beta; a CD4 binding polypeptide such as an anti-CD4 antibody; a CXCR4 binding polypeptide such as stromal-derived factor 1-alpha (SDF1-alpha); and / or a CCR3 binding protein, such as MIP1-alpha). In one embodiment, a fusion protein comprises, or alternatively consists of, a polypeptide having the amino acid sequence of one or more of the VH domains of an antibody of the invention or the amino acid sequence of any one or more of the VL domains of an antibody of the invention or fragments or variants thereof and a heterologous polypeptide sequence. In another embodiment, a fusion protein comprises, or alternatively consists of, a polypeptide having the amino acid sequence of one, two, three or more of the VH CDRs of an antibody of the invention or the amino acid sequence of one, two, three or more any of the VL CDRs of an antibody of the invention,

or fragments or variants thereof, and a heterologous polypeptide sequence. In a preferred embodiment, the fusion protein comprises, or alternatively consists of, a polypeptide having the amino acid sequence of a VH CDR3 of an antibody of the invention, or fragment or variant thereof, a heterologous polypeptide sequence, whose fusion protein binds immunospecifically to the G-protein Chemokine Receptor (CCR5). In another embodiment, a fusion protein comprises, or alternatively consists of, a polypeptide having the amino acid sequence of at least one VH domain of an antibody of the invention and the amino acid sequence of at least one VL domain of an antibody. of the invention or fragments or variants thereof and a heterologous polypeptide sequence. Preferably, the VH and VL domains of the fusion protein correspond to a single antibody (or scFv or Fab fragment) of the invention. In yet another embodiment, a fusion protein of the invention comprises, or alternatively consists of, a polypeptide having the amino acid sequence of any one, two, three or more of the VH CDRs of an antibody of the invention and the amino acid sequence of any one, two, three or more of the VL CDRs of an antibody of the invention

or fragments or variants thereof, and a heterologous polypeptide sequence. Preferably, two, three, four, five, six or more of the VHCDR or VLCDR correspond to a single antibody (or scFv or Fab fragment) of the invention. Nucleic acid molecules encoding these fusion proteins are also described.

The antibodies of the present invention can be used, for example, but without limitation, to purify, detect and target the polypeptides described herein, including diagnostic and therapeutic methods in vitro and in vivo. For example, antibodies are used in immunoassays to measure quantitatively and qualitatively the levels of polypeptides in biological samples. See, for example, Harlow et al., Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory Press, 2nd ed. 1988).

As another non-limiting example, the antibodies of the invention can be administered to individuals as a form of passive immunization. Alternatively, the antibodies of the present invention can be used for epitope mapping to identify the epitope or epitopes to which the antibody binds. Epitopes identified in this way can, in turn, for example, be used as vaccine candidates, that is, to immunize an individual to induce antibodies against naturally occurring forms of the G-protein Chemokine Receptor.

As discussed in more detail below, the antibodies of the present invention can be used alone or in combination with other compositions. The antibodies can be additionally fused recombinantly with a heterologous polypeptide at the N or C terminal end or chemically conjugated (including covalent and non-covalent conjugates) with polypeptides or other compositions. For example, the antibodies of the present invention can be fused or conjugated recombinantly with molecules useful as markers in detection assays and effector molecules such as heterologous polypeptide, drugs, radionuclides or toxins. See, for example, PCT publications WO 92/08495; WO 91/14438; WO 89/12624; U.S. Patent No. 5,314,995; and EP 396,387.

The antibodies of the invention include derivatives that are modified, that is, by covalently binding any type of molecule with the antibody. For example, but not limited to, antibody derivatives include antibodies that have been modified, for example, by glycosylation, acetylation, pegylation, phosphorylation, phosphorylation, amidation, derivatization by known protection / blocking groups, proteolytic cleavage, ligand binding. cell or other protein, etc. Any of numerous chemical modifications can be carried out by known techniques, including, but not limited to specific chemical cleavage, acetylation, formylation, metabolic synthesis of tunicamycin, etc. Additionally, the derivative may contain one or more non-classical amino acids.

The antibodies of the present invention can be generated by any suitable method known in the art. Polyclonal antibodies to an antigen of interest can be produced by various methods well known in the art. For example, a CCR5 polypeptide can be administered to various host animals including, without limitation rabbits, mice, rats, etc. to induce the production of sera containing polyclonal antibodies specific for the antigen. Various adjuvants can be used to increase the immune response, depending on the host species, and include, but not limited to, Freund's adjuvant (complete or incomplete), mineral gels such as aluminum hydroxide, surfactants such as lisolecithin, pluronic polyols, polyanions , peptides, oil emulsions, California limpet hemocyanins, dinitrophenol and potentially useful human adjuvants such as BCG (Calmette-Guerin bacillus) and Corinobacterium parvum. Such adjuvants are also well known in the art.

Monoclonal antibodies can be prepared using a wide variety of techniques known in the art including the use of hybridoma, recombinant and phage display technologies or a combination thereof. For example, monoclonal antibodies can be produced using hybridoma techniques including those known in the art and taught, for example, in Harlow et al., Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory Press, 2nd ed. 1988) ; Hammerling, et al., In: Monoclonal Antibodies and T-Cell Hybridomas 563-681 (Elsevier, N. Y., 1981). The term "monoclonal antibody" as used herein is not limited to antibodies produced through hybridoma technology. The term "monoclonal antibody" refers to an antibody that is derived from a single clone including any eukaryotic, prokaryotic or phage clone and not the method by which it is produced.

Methods for producing and scanning for specific antibodies using hybridoma technology are routine and are well known in the art and are discussed in detail in the Examples. In a non-limiting example, mice can be immunized with a polypeptide described herein or a cell expressing such a peptide. Once an immune response is detected, for example, antibodies specific for the antigen are detected in the mouse serum, the mouse spleen is collected and the splenocytes are isolated. The splenocytes are then fused by well known techniques with any suitable myeloma cell, for example SP20 or P3X63-AG8.653 cell line cells available from the ATCC. Hybridomas are selected and cloned by limited dilution. Hybridoma clones are then assayed by methods known in the art with respect to cells that secrete antibodies capable of binding to a polypeptide described herein. Ascites fluid, which generally contains high levels of antibodies, can be generated by immunization of mice with positive hybridoma clones.

Accordingly, the present invention provides methods for generating monoclonal antibodies as well as antibodies produced by the method comprising culturing a hybridoma cell that secretes an antibody of the invention in which, preferably, the hybridoma is generated by fusion of splenocytes isolated from a mouse immunized with an antigen with myeloma cells and then scanning the hybridomas resulting from the fusion with respect to hybridoma clones that secrete an antibody capable of binding to a polypeptide described herein.

Another well-known method of producing polyclonal and monoclonal cell lines of human B cells is transformation using Epstein Barr Virus (EBV). Protocols for generating B cell lines transformed with EBV are commonly known in the art, such as, for example, the protocol described in Chapter 7.22 of Current Protocols in Immunology, Coligan et al., Eds., 1994, John Wiley and Sons, NY, which is hereby incorporated in its entirety by reference herein. The source of B lymphocytes for transformation is usually human peripheral blood, but B lymphocytes can also be derived for transformation from other sources including, without limitation, lymph nodes, tonsil, spleen, tumor tissue and infected tissues. Tissues generally become single cell suspensions before transformation with EBV. Additionally, steps can be taken to physically remove or inactivate T lymphocytes (for example, by treatment with cyclosporin A) in samples containing B lymphocytes, because T lymphocytes of seropositive individuals for anti EBV antibodies can suppress immortalization of B lymphocytes by VEB. In general, the sample containing human B lymphocytes is inoculated with EBV and cultured for 3-4 weeks. A typical source of EBV is the culture supernatant of the B95-8 cell line (ATCC No. VR-1492). Physical signs of transformation with EBV can generally be seen towards the end of the 3-4 week culture period. By phase contrast microscopy, transformed cells can appear large, transparent, hairy and tend to aggregate into narrow groups of cells. Initially, VEB lines are generally polyclonal. However, over prolonged periods of cell culture, EBV lines can be made monoclonal, polyclonal as a result of the selective growth of particular B lymphocyte clones. Alternatively, lines transformed with polyclonal EBV can be subcloned (for example, limiting the dilution culture) or fused with a suitable fusion partner and plated at a limiting dilution to obtain monoclonal B lymphocyte lines. Suitable fusion partners for cell lines transformed with EBV include mouse myeloma cell lines (eg, SP2 / 0, X63-Ag8.653), heteromyeloma cell lines (human x mouse; for example, SPAM-8, SBC -H20 and CB-F7) and human cell lines (for example, GM 1500, SKO-007, RPMI 8226 and KR-4). Thus, a method for generating polyclonal or monoclonal human antibodies against polypeptides described herein or fragments thereof, comprising transformation with EBV of human B lymphocytes, is described.

Antibody fragments that recognize specific epitopes can be generated by known techniques. For example, Fab and F (ab ') 2 fragments of the invention can be produced by proteolytic cleavage of immunoglobulin molecules, using enzymes such as papain (to produce Fab fragments) or pepsin (to produce F (ab') 2 fragments ). F (ab ’) 2 fragments contain the variable region, the light chain constant region and the CH1 domain of the heavy chain.

For example, the antibodies of the present invention can also be generated using various phage display methods known in the art. In phage display methods, functional antibody domains are presented on the surface of phage particles that carry the polynucleotide sequences encoding them. In a particular embodiment, such a phage can be used to present antigen binding domains expressed from a combinatorial antibody repertoire or library (eg, human or murine). Phages expressing an antigen binding domain that binds to the antigen of interest can be selected or identified with antigen, for example, using labeled antigen or antigen bound or captured on a solid or pearl surface. The phage used in these methods is typically a filamentous phage that includes fd and M134 binding domains expressed from the phage with Fv antibody domains stabilized with disulfide, Fab, or Fv recombinantly fused with the phage III gene or the gene protein VIII. Examples of phage display methods that can be used to prepare the antibodies of the present invention include those described in Brinkman et al.,

J. Immunol. Methods 182: 41-50 (1995); Ames et al., J. Immunol. Methods 184: 177-186 (1995); Kettleborough et al.,

Eur. J. Immunol. 24: 952-958 (1994); Persic et al., Gene 187 9-18 (1997); Burton et al., Advances in Immunology 57: 191-280 (1994); PCT application No. PCT / GB91 / 01134; PCT publications WO 90/02809; WO 91/10737; WO 92/01047; WO 92/18619; WO 93/11236; WO 95/15982; WO 95/20401; and United States Patents No. 5,698,426; 5,223,409; 5,403,484; 5,580,717; 5,427,908; 5,750,753; 5,821,047; 5,571,698; 5,427,908; 5,516,637; 5,780,225; 5,658,727; 5,733,743 and 5,969,108.

As described in the references above, after phage selection, phage antibody coding regions can be isolated and used to generate complete antibodies, including human antibodies.

or any other desired antigen binding fragment and expressed in any desired host, including mammalian cells, insect cells, plant cells, yeast and bacteria, for example, as described in detail below. For example, techniques for recombinantly producing Fab, Fab ’and F (ab’) 2 fragments can also be employed using methods known in the art such as those described in PCT publication WO 92/22324; Mullinax et al., BioTechniques 12 (6): 864-869 (1992); and Sawai et al., AJRI 34: 2634 (1995); and Better et al., Science 240: 1041-1043 (1988).

Examples of techniques that can be used to produce antibodies and single chain Fv include those described in US Patents 4,946,778 and 5,258,498; Huston et al., Methods in Enzymology 203: 4688 (1991); Shu et al., PNAS 90: 7995-7999 (1993); and Skerra et al., Science 240: 1038-1040 (1988). For some uses, including in vivo use of antibodies in humans and in vitro detection assays, it may be preferable to use chimeric, humanized or human antibodies. A chimeric antibody is a molecule in which different parts of the antibody are derived from different animal species, such as antibodies that have a variable region derived from a murine monoclonal antibody and a constant region of human immunoglobulin. Methods for producing chimeric antibodies are known in the art. See, for example, Morrison, Science 229: 1202 (1985); Oi et al., BioTechniques 4: 214 (1986); Gillies et al., (1989) J. Immunol. Methods 125: 191-202; United States Patents No. 5,807,715; 4,816,567; and 4,816,397. Humanized antibodies are non-human species antibody molecules that bind to the desired antigen that has one or more complementarity determining regions (CDRs) of the non-human species and a flanking region of a human immunoglobulin molecule. Frequently, the flanking moieties in the human flanking regions will be substituted with the corresponding moiety of the CDR donor antibody to preferably alter the antigen binding. These flanking substitutions are identified by methods well known in the art, for example, by modeling the interactions of the CDR and flanking moieties to identify flanking moieties important for antigen binding and sequence comparison to identify unusual flanking moieties at particular positions. (See, for example, Queen et al., U.S. Patent No. 5,585,089; Riechmann et al., Nature 332: 323 (1988)). Antibodies can be humanized using a variety of techniques known in the art including, for example, CDR grafting (EP 239,400; PCT Publication WO 91/09967; U.S. Patent Nos. 5,225,539; 5,530,101; and 5,585. 089), coating or resurgence (EP 592,106; EP 519,596; Padlan, Molecular Immunology 28 (4/5): 489-498 (1991); Studnicka et al., Protein Engineering 7 (6): 805-814 (1994) ; Roguska et al., PNAS 91: 969-973 (1994)) and chain redistribution (U.S. Patent No. 5,565,332).

Fully human antibodies are particularly desirable for therapeutic treatment of human patients. Human antibodies can be prepared by a variety of methods known in the art including phage display methods described above using antibody libraries derived from human immunoglobulin sequences. See also, U.S. Patent Nos. 4,444,887 and 4,716,111; and PCT publications WO 98/46645, WO 98/50433, WO 98/24893, WO 98/16654, WO 96/34096, WO 96/33735, and WO 91/10741.

Human antibodies can also be produced using transgenic mice that are unable to express functional endogenous immunoglobulins, but which can express human immunoglobulin genes. For example, heavy and light chain human immunoglobulin gene complexes can be introduced randomly or by homologous recombination into mouse embryonic stem cells. Alternatively, the variable region, constant region and human diversity region can be introduced into mouse embryonic stem cells in addition to human heavy and light chain genes. The mouse heavy and light chain immunoglobulin genes can be made non-functional separately or simultaneously with the introduction of human immunoglobulin loci by homologous recombination. In particular, the homozygous deletion of the JH region prevents the production of endogenous antibody. The modified embryonic stem cells expand and microinject into blasts to produce chimeric mice. The chimeric mice are then reared to produce homozygous offspring that express human antibodies. Transgenic mice immunize in a normal manner with a selected antigen, for example, all or a portion of a polypeptide described herein. Monoclonal antibodies directed against the antigen can be obtained from transgenic immunized mice using conventional hybridoma technology. Human immunoglobulin transgenes carried by transgenic mice are redistributed during B lymphocyte differentiation and subsequently undergo class change and somatic mutation. Thus, using such a technique, it is possible to produce therapeutically useful IgG, IgA, IgM and IgE antibodies. For a review of this technology to produce human antibodies, see Lonberg and Huszar, Int. Rev. Immunol. 13: 65-93 (1995). For a detailed analysis of this technology for producing human antibodies and human monoclonal antibodies and protocols for producing such antibodies, see, for example, PCT publications WO 98/24893; WO 92/01047; WO 96/34096; WO 96/33735; European Patent No. 0 598 877; United States Patents No. 5,413,923; 5,625,126; 5,633,425; 5,569,825; 5,661,016; 5,545,806; 5,814,318; 5,885,793; 5,916,771; 5,939,598; 6,075,181; and 6,114,598. In addition, companies such as Abgenix, Inc. (Fremont, CA) and Genpharm (San Jose, CA) can be contacted to provide human antibodies directed against a selected antigen using technology similar to that described above.

Fully human antibodies that recognize a selected epitope can be generated using a technique called "guided selection" in this approach a selected non-human monoclonal antibody, for example, a mouse antibody is used, to guide the selection of a fully human antibody that recognizes the same epitope (Jespers et al., Bio / technology 12: 899-903 (1988)).

In addition, the antibodies to the polypeptides described herein can, in turn, be used to generate anti-idiotypic antibodies that "mimic" the polypeptides described herein using techniques well known to those skilled in the art (See , for example, Greenspan and Bona, FASEB J. 7 (5): 437-444; (1989) and Nissinoff, J. Immunol. 147 (8): 2429-2438 (1991)). For example, antibodies that bind and competitively inhibit multimerization of polypeptides and / or binding of a CCR5 polypeptide with a ligand can be used to generate anti-idiotypes that "mimic" multimerization of polypeptides and / or domain binding and, as a consequence, they bind and neutralize the polypeptide and / or its ligand. Such neutralization anti-idiotypes or Fab fragments of such anti-idiotypes can be used in therapeutic regimens to neutralize the polypeptide ligand. For example, such anti-idiotypic antibodies can be used to bind a polypeptide described herein and / or to bind their ligands / receptors and thereby activate or block their biological activity.

Intrabodies are antibodies, often scFv, that are expressed from a recombinant nucleic acid molecule and are engineered to be conserved intracellularly (for example, preserved in the cytoplasm, endoplasmic reticulum or periplasm). Intrabodies can be used, for example, to suppress the function of a protein to which the intrabody binds. Intrabody expression can also be regulated through the use of inducible promoters in the nucleic acid expression vector comprising the intrabody. The intrabodies of the invention can be produced using methods known in the art, such as those described and reviewed in Chen et al., Hum. Gene Ther. 5: 595-601 (1994); Marasco, W.A., Gene Ther. 4: 11-15 (1997); Rondon and Marasco, Annu. Rev. Microbiol. 51: 257-283 (1997); Proba et al., J. Mol. Biol. 275: 245-253 (1998); Cohen et al., Oncogene 17: 2445-2456 (1998); Ohage and Steipe, J. Mol. Biol. 291: 1119-1128 (1999); Ohage et al., J. Mol. Biol. 291: 1129-1134 (1999); Wirtz and Steipe, Protein Sci. 8: 2245-2250 (1999); Zhu et al., J. Immunol. Methods

231: 207-222 (1999); and references cited therein. In particular, a CCR5 intrabody has been produced by Steinberger et al., Proc. Natl Acad. Sci. USA 97: 805-810 (2000).

XenoMouse Technology

Antibodies according to the invention are preferably prepared by the use of a transgenic mouse that has a substantial part of the human antibody producing genome inserted but that is deficient in the production of murine endogenous antibodies (eg, XenoMouse strains available from Abgenix Inc., Fremont, CA). Such mice, therefore, are capable of producing immunoglobulin molecules and human antibodies and are deficient in the production of immunoglobulin molecules and human antibodies. The technologies used to achieve the same are described in the patents, applications and references described herein.

The ability to clone and reconstruct human loci of megabase sizes in YAC and introduce them into the mouse germ line provides a powerful approach to elucidate the very large or mapped functional components of rudimentary loci as well as generate useful models of human disease. In addition, the use of such technology for the replacement of mouse loci with its human equivalents could provide unique information on the expression and regulation of human gene products during development, their communication with other systems and their involvement in disease induction and progression. .

An important practical application of such a strategy is the "humanization" of the mouse humoral immune system. The introduction of human immunoglobulin (Ig) loci in mice in which endogenous Ig genes have been inactivated offer the opportunity to study the mechanisms underlying the programmed expression and assembly of antibodies as well as their role in the development of B lymphocytes. , such a strategy could provide an ideal source for the production of fully human monoclonal antibodies (Mab) an important milestone to complete the goal of antibody therapy in human disease.

Completely human antibodies are expected to minimize intrinsic immunogenic and allergic responses of mouse monoclonal or mouse derivatized antibodies and thereby increase the efficacy and safety of the administered antibodies. The use of fully human antibodies can be expected to provide a substantial advantage in the treatment of chronic and recurrent human diseases, such as cancer, that require repeated administrations of antibodies.

One approach to this objective was to genetically engineer mouse strains deficient in mouse antibody production with large fragments of human Ig loci anticipating that such mice would produce a large repertoire of human antibodies in the absence of mouse antibodies. Large human Ig fragments would preserve the wide variable gene diversity as well as the appropriate regulation of antibody production and expression. By exploiting the mouse machinery for diversification and selection of antibodies and the lack of immunological tolerance against human proteins, the repertoire of human antibodies reproduced in these mouse strains would produce high affinity antibodies against any antigen of interest, including human antigens. Using hybridoma technology, antigen-specific human monoclonal antibodies with the desired specificity can be easily produced and selected.

This general strategy was demonstrated in relation to the generation of the first strains of XenoMouse ™ as published in 1994. See Green et al. Nature Genetics 7: 13-21 (1994). The XenoMouse ™ strains were genetically engineered with artificial yeast chromosomes (YACS) that contained germline configuration fragments 245 kb and 190 kb in size from the human heavy chain locus and the kappa light chain locus, respectively, which contained main variable and constant region sequences. Same as in the previous reference. YACs containing human Ig proved to be compatible with the mouse system for redistribution and antibody expression and were able to replace inactivated mouse Ig genes. This was demonstrated by its ability to induce development of B lymphocytes, produce an adult-type human repertoire of fully human antibodies and generate antigen-specific human monoclonal antibodies. These results also suggested that the introduction of larger parts of human Ig loci that contained a wide variety of V gains, additional regulatory elements and constant regions of human Ig could substantially recapitulate the entire repertoire that is characteristic of the human humoral response for infection. and immunization. The work of Green et al. it was recently extended to the introduction of more than about 80% of the human antibody repertoire through the introduction of YAC fragments of megabase size germline configuration of human heavy chain loci and kappa light chain loci, respectively , to produce XenoMouse ™ mice. See Mendez et al. Nature Genetics 15: 146156 (1997), Green and Jakobovits J Exp. Med. 188: 483-495 (1998), Green, Journal of Immunological Methods 231: 1123 (1999) and U.S. Patent Application Serial No. 08 / 759,620, filed on December 3, 1996.

Such an approach is further analyzed and described in U.S. Patent Applications Serial No. 07 / 466,008, filed on January 12, 1990, 07 / 710,515, filed on November 8, 1990, 07 / 919,297, filed on 24 July 24, 1992, 07 / 922,649, filed on July 30, 1992, 08 / 031,801, filed on March 15, 1993, 08 / 112,848, filed on August 27, 1993, 08 / 234,145, filed on 28 April 1994, 08 / 376,279, filed January 20, 1995, 08 / 430,938, filed April 27, 1995, 0-8 / 464,584, filed June 5, 1995, 08 / 464,582, filed May 5 June 5, 1995, 08 / 471,191, filed June 5, 1995, 08 / 462,837, filed June 5, 1995, 08 / 486,853, filed June 5, 1995, 08 / 486,857, filed June 5 of 1995, 08 / 486,859, filed on June 5, 1995, 08 / 462,513, filed on June 5, 1995, 08 / 724,752, filed on October 2, 1996 and 08 / 759,620, filed on December 3 re of 1996. See also Mendez et al. Nature Genetics 15: 146-156 (1997) and Green and Jakobovits J Exp. Med. 188: 483 495 (1998). See also European Patent No. EP 0 471 151 B1, concession published on June 12, 1996, International Patent Application No. WO 94/02602, published on February 3, 1994, International Patent Application No. WO 96/34096, published on October 31, 1996 and WO 98/24893, published on June 11, 1998.

Human anti-mouse antibody (HAMA) responses have made the industry prepare chimeric or otherwise humanized antibodies. Although the chimeric antibodies have a human constant region and a murine variable region, certain human anti-chimeric antibody (HACA) responses are expected, particularly in multidose or chronic uses of the antibody. Thus, it would be desirable to provide fully human antibodies against G-protein Chemokine Receptor polypeptides (CCR5) to dispel concerns and / or effects of HAMA or HACA responses.

Monoclonal antibodies specific for G-protein Chemokine Receptor (CCR5) polypeptides were prepared using hybridoma technology. (Kohler et al., Nature 256: 495 (1975); Kohler et al., Eur. J. Immunol. 6: 511 (1976); Kohler et al., Eur. J. Immunol. 6: 292 (1976); Hammerling et al., In: Monoclonal Antibodies and T-Cell Hybridomas Elsevier, NY, pp. 571-681 (1981)). Briefly, XenoMouse ™ mice were humanized with cells transfected with an expression vector of the G-protein Chemokine Receptor (CCR5) (for details, see Example 54). After immunization, splenocytes from such mice were extracted and fused with a suitable myeloma cell line. Any suitable myeloma cell line can be used in accordance with the present invention; however, it is preferable to use the parental myeloma cell line (P3X63-AG8.653), available from the ATCC. After fusion, the resulting hybridoma cells are selectively maintained in HAT medium and then cloned by limiting dilution as described in Wands et al. (Gastroenterology 80: 225-232 (1981)). The hybridoma cells obtained through such a selection are then tested for clones that secrete antibodies capable of binding to the G-protein Chemokine Receptor polypeptides (CCR5).

The present invention relates to fully human antibodies, as defined in the claims that immunospecifically bind to G-protein Chemokine Receptor polypeptides (CCR5). Essentially, XenoMouse mouse lines from Abgenix, Inc. (Fremont, CA) expressing human antibodies were immunized

5

10

fifteen

twenty

25

30

35

40

Four. Five

with cells expressing G-protein Chemokine Receptor (CCR5) (for details of immunization protocols, see Example 54); lymph node and / or spleen cells (containing B lymphocytes) were recovered from the mouse that had high titre of G-protein Chemokine Receptor antibodies (CCR5); and said recovered cells were fused with a myeloid type cell line to prepare immortal hybridoma cell lines. The hybridoma cell lines were screened to select and identify hybridoma cell lines that produced antibodies specific for the immunogen. The inventors used these techniques for the preparation of specific antibodies to G-protein Chemokine Receptor polypeptides (CCR5). Here, the inventors describe the production of multiple hybridoma cell lines that produce antibodies specific for the G-protein Chemokine Receptor polypeptide (CCR5). In addition, the inventors provide a characterization of the antibodies produced by such cell lines.

Antibodies derived from hybridoma cell lines analyzed herein are listed in Table 2. Antibodies include antibodies expressed by the following cell lines: XF11.1D8, XF11.4D10, XF11.4C4, XF11.5H1, XF11.1G8 , XF22.3C9.6, XF22.9E6, XF27 / 28.7D5, XF27 / 28.18B5, XF27 / 28.25G10, XF27 / 28.36A12, XF27 / 28.36F11 and XF27 / 28.55G4. The antibody of the invention is expressed by the cell line XF27 / 28.43E2. The XenoMouse mouse strains of Abgenix, Inc. express human kappa light chains with human IgG1, IgG2 or IgG4. Each of the XenoMouse strains can also produce antibodies of the human IgM isotype. The strain expressing IgG2 was used to prepare the cell lines and antibodies of the present invention, thus each of the antibodies produced by cell lines are completely human IgG2 heavy chains with human kappa light chains or heavy IgM chains with chains. Light human kappa. These hybridoma cell lines were deposited in the American Type Culture Collection (“ATCC”) on the date indicated in Table 2 and received the ATTCC Deposit numbers listed in Table 2. The ATCC is located at 10801 University Boulevard, Manassas, VA 201102209, United States. The deposit of the ATCC was made in accordance with the terms of the Budapest Treaty on the international recognition of the deposit of microorganisms for patent purposes.

Hybridoma XF11.1D8 was deposited with ATCC on February 7, 2001 and received the ATCC Deposit Number PTA-3030. Hybridoma XF11.4D10 was deposited with the ATCC on February 7, 2001 and received the ATCC Deposit Number PTA-3026. Hybridoma XF11.4C4 was deposited with the ATCC on February 7, 2001 and received the ATCC Deposit Number PTA-3028. Hybridoma XF11.5H1 was deposited with the ATCC on February 7, 2001 and received the ATCC Deposit Number PTA-3029. Hybridoma XF11.1G8 was deposited with the ATCC on February 7, 2001 and received the ATCC Deposit Number PTA-3027. The XF3.5F1 hybridoma was deposited with the ATCC on March 2, 2001 and received the ATCC Deposit Number PTA-3147. Hybridoma XF11.1F8 was deposited with ATCC on March 2, 2001 and received the ATCC Deposit Number PTA-3150. Hybridoma XF3.6A2 was deposited with the ATCC on March 21, 2001 and received the ATCC Deposit Number PTA-3148. Hybridoma XF3.10B8 was deposited with the ATCC on March 2, 2001 and received the ATCC Deposit Number PTA-3151. Hybridoma XF22.3C9.6 was deposited with ATCC on September 12, 2001 and received the ATCC Deposit Number PTA-3702. Hybridoma XF22.9E6 was deposited with ATCC on November 14, 2001 and received the ATCC Deposit Number PTA-3859. Hybridoma XF27 / 28.7D5 was deposited with the ATCC on February 1, 2002 and received the ATCC Deposit Number PTA-4049. Hybridoma XF27 / 28.18B5 was deposited with ATCC on February 1, 2002 and received the ATCC Deposit Number PTA-4050. Hybridoma XF27 / 28.25G10 was deposited with ATCC on February 1, 2002 and received the ATCC Deposit Number PTA-4051. Hybridoma XF27 / 28.36A12 was deposited with ATCC on February 1, 2002 and received the ATCC Deposit Number PTA-4052. Hybridoma XF27 / 28.36F11 was deposited with ATCC on February 1, 2002 and received the ATCC Deposit Number PTA-4053. Hybridoma XF27 / 28.43E2 was deposited with ATCC on February 1, 2002 and received the ATCC Deposit Number PTA-4054. The XF27 / 28.55G4 hybridoma was deposited with the ATCC and received the ATCC PTA- Deposit Number. The ATCC Deposit Numbers and hybridoma assignments are also presented in Table 2.

Table 2: Hybridoma Cell Lines Expressing G-protein Chemokine Receptor Receptor Antibodies (CCR5)

Hybridoma

ATCC Deposit Number Deposit Date in ATCC

XF11.1D8

PTA-3030 February 7, 2001

XF11.4D10

PTA-3026 February 7, 2001

XF11.4C4

PTA-3028 February 7, 2001

XF11.5H1

PTA-3029 February 7, 2001

XF11.1G8

PTA-3027 February 7, 2001

XF3.5F1

PTA-3147 March 2, 2001

Hybridoma

ATCC Deposit Number Deposit Date in ATCC

XF11.1F8

PTA-3150 March 2, 2001

XF3.6A2

PTA-3148 March 2, 2001

XF3.10B8

PTA-3151 March 2, 2001

XF22.3C9.6

PTA-3702 September 12, 2001

XF22.9E6

PTA-3859 November 14, 2001

XF27 / 28.7D5

PTA-4049 February 1, 2002

XF27 / 28.18B5

PTA-4050 February 1, 2002

XF27 / 28.25G10

PTA-4051 February 1, 2002

XF27 / 28.36A12

PTA-4052 February 1, 2002

XF27 / 28.36F11

PTA-4053 February 1, 2002

XF27 / 28.43E2

PTA-4054 February 1, 2002

XF27 / 28.55G4

In one embodiment, the present invention provides hybridoma cell lines that express the antibody of the invention such as XF27 / 28.43E2. Other hybridoma cell lines are XF11.1D8, XF11.4D10, XF11.4C4, XF11.5H1, XF11.1G8, XF3.5F1, XF11.1F8, XF3.6A2, XF3.10B8, XF22.3C9.6, XF22. 9E6, XF27 / 28.7D5, XF27 / 28.18B5, XF27 / 28.25G10, XF27 / 28.36A12 and XF27 / 28.36F11. The hybridoma cell line of the invention is

5 XF27 / 28.43E2. Another hybridoma cell line is XF27 / 28.55G4.

The present invention encompasses antibodies (including molecules comprising, or alternatively consisting of, antibody fragments thereof) that immunospecifically bind to a G-protein Chemokine Receptor polypeptide (CCR5). A G-protein Chemokine Receptor polypeptide (CCR5) includes, but is not limited to, the G-protein Chemokine Receptor polypeptide (CCR5) of SEQ ID NO: 2 or the polypeptide.

10 encoded by the DNA in clone HDGNR10 contained in the ATCC Deposit 97183 deposited on June 1, 1995; The G-protein Chemokine Receptor (CCR5) can be produced through recombinant expression of nucleic acids encoding the polypeptides of SEQ ID NO: 2 or the HDGNR10 DNA in the ATCC Deposit Number 97183).

In one embodiment of the present invention, antibodies that bind immunospecifically with a Receptor

15 of Chemokine G protein (CCR5), comprise a polypeptide having the amino acid sequence of the heavy chains expressed by the XF 27 / 28.43E2 cell line indicated in Table 2 and the light chains expressed by the XF 27 / cell line 28.43E2 indicated in Table 2. In another embodiment of the present invention, antibodies that immunospecifically bind to a G-protein Chemokine Receptor (CCR5) comprise a polypeptide having the amino acid sequence of the VH domains of a heavy chain

20 expressed by the XF 27 / 28.43E2 cell line indicated in Table 2 and the VL domains of a light chain expressed by the XF 27 / 28.43E2 cell line indicated in Table 2. The antibodies of the present invention may comprise amino acid sequence of a VH domain and VL domain expressed by the cell line XF 27 / 28.43E2 indicated in Table 2. In alternative embodiments, the antibodies comprise the amino acid sequence of a VH domain and a VL domain of different indicated cell lines in Table 2. It is also

25 describe molecules comprising, or alternatively consisting of, antibody fragments or variants of the VH and / or VL domains expressed by at least one of the cell lines indicated in Table 2 that bind immunospecifically to a Chemokine Receptor of G protein (CCR5), as well as nucleic acid molecules that encode these VH and VL domains, molecules, fragments and / or variants.

Antibodies that bind immunospecifically with a polypeptide or polypeptide fragment or are described

A variant of a G-protein Chemokine Receptor (CCR5), said antibodies comprising, or alternatively consisting of, a polypeptide having an amino acid sequence of one, two, three or more any of the VH CDRs contained in a chain Weighing expressed by one or more cell lines indicated in Table 2. In particular, antibodies are described that bind immunospecifically with a G-protein Chemokine Receptor (CCR5), comprising, or alternatively consisting of, a polypeptide having

The amino acid sequence of a VH CDR1 contained in a heavy chain expressed by one or more cell lines indicated in Table 2. Antibodies that immunospecifically bind to a G-protein Chemokine Receptor (CCR5), comprise, or as Alternatively, they consist of a polypeptide having the amino acid sequence of a VH CDR2 contained in a heavy chain expressed by one or more cell lines indicated in Table 2. Antibodies that bind immunospecifically with a G-protein Chemokine Receptor ( CCR5), comprise, or alternatively consist of a polypeptide having the amino acid sequence of a VH CDR3 contained in a heavy chain expressed by one or more cell lines indicated in Table 2. Molecules comprising, or as alternative consisting of, these antibodies or antibody fragments or variants thereof, that bind immunospecifically with a Receptor of G-protein Chemokine (CCR5) or a fragment of the G-protein Chemokine Receptor (CCR5) or variant thereof, as well as nucleic acid molecules encoding these antibodies, molecules, fragments and / or variants.

Antibodies that bind immunospecifically with a polypeptide, or polypeptide fragment or variant of a G-protein Chemokine Receptor (CCR5) are also described, said antibodies comprising, or alternatively consisting of, a polypeptide having the amino acid sequence of one, two, three or more any of the VL CDRs contained in a light chain expressed by one or more cell lines indicated in Table 2. In particular, antibodies that immunospecifically bind to a G-protein Chemokine Receptor (CCR5) are described. , comprising, or as an alternative consisting of, a polypeptide having the amino acid sequence of a VL CDR1 contained in a light chain expressed by one or more cell lines indicated in Table 2. Antibodies that bind immunospecifically with a G-protein chemokine receptor (CCR5), comprise, or alternatively consist of, a polypeptide having the sequence of amino acids of a VL CDR2 contained in a light chain expressed by one or more cell lines indicated in Table 2. Antibodies that immunospecifically bind to a G-protein Chemokine Receptor (CCR5), comprise, or alternatively consist of , a polypeptide having the amino acid sequence of a CDR3 of VL contained in a light chain expressed by one or more cell lines indicated in Table 2. Also described are molecules comprising, or alternatively consisting of, these antibodies, or antibody fragments or variants thereof, which immunospecifically bind to a G-protein Chemokine Receptor (CCR5) or a G-protein Chemokine Receptor fragment (CCR5) or variant thereof, as well as nucleic acid molecules that encode these antibodies, molecules, fragments and / or variants.

The antibodies of the invention (including molecules comprising, or alternatively consisting of, antibody fragments) that bind immunospecifically with a G-protein Chemokine Receptor polypeptide (CCR5) may comprise, or alternatively consist of, one, two, three or more CDR of VH and one, two, three or more CDR of VL, as contained in a heavy chain or light chain expressed by the cell line XF 27 / 28.43E2 indicated in Table 2. In particular, describe antibodies that immunospecifically bind to a polypeptide or polypeptide fragment or variant of a G-protein Chemokine Receptor (CCR5), said antibodies comprising, or alternatively consisting of, a CDR 1 of VH and a CDR1 of VL, a CDR1 of VH and a CDR2 of VL, a CDR1 of VH and a CDR3 of VL, a CDR2 of VH and a CDR1 of VL, CDR2 of VH and CDR2 of VL, a CDR2 of VH and a CDR3 of VL, a CDR3 of VH and a VH CDR1, a VH CDR3 and a VL CDR2, a VH CDR3 and a VL CDR3, or any combination thereof, of the VH CDRs and VL CDRs contained in a heavy chain or light chain expressed by one or more cell lines indicated in Table 2. In one embodiment preferred, one or more of these combinations are of the same scFv as described in Table 2. Also described are molecules comprising, or alternatively consisting of, fragments or variants of these antibodies, which bind immunospecifically with Chemokine Receptor of G protein (CCR5), as well as nucleic acid molecules that encode these antibodies, molecules, fragments or variants.

Nucleic Acid Molecules Encoding G-protein Chemokine Receptor Antibodies (CCR5) Corresponding to Xenomouse Strain-derived Antibodies.

The present invention also provides generally isolated nucleic acid molecules encoding an antibody of the invention (including molecules comprising, or alternatively consisting of, antibody fragments thereof). In a specific embodiment, a nucleic acid molecule of the invention encodes an antibody (including molecules that comprise, or alternatively consisting of, antibody fragments or variants thereof), which comprises, or as an alternative consisting of, a domain VH having an amino acid sequence of any one of the VH domains of a heavy chain expressed by the cell line of the invention, XF 27 / 28.43E2 indicated in Table 2 and a VL domain having an amino acid sequence of a chain light expressed by the cell line of the invention indicated in Table 2. In another embodiment, a nucleic acid molecule of the invention encodes an antibody (including molecules comprising, or alternatively consisting of, antibody fragments or variants thereof). ), which comprises, or as an alternative consisting of, a VH domain containing an amino acid sequence of any one of the VH domains of a heavy chain expressed by the cell line of the invention indicated in Table 2 or a VL domain having an amino acid sequence of a light chain expressed by the cell line of the invention indicated in Table

2.

Antibodies are described which comprise, or as an alternative consisting of, variants (including derivatives) of the antibody molecules (for example, the VH domains and / or VL domains) described herein, said antibodies binding immunospecifically with a Receptor of G protein chemokine (CCR5) or fragment or variant thereof. Conventional techniques known to those skilled in the art can be used to introduce mutations in the nucleotide sequence encoding a molecule of the invention, including, for example, directed mutagenesis and PCR-mediated mutagenesis that results in amino acid substitutions. Preferably, the variants (including derivatives) encode less than 50 amino acid substitutions, less than 40 amino acid substitutions, less than 30 amino acid substitutions, less than 25 amino acid substitutions, less than 20 amino acid substitutions, less than 15 amino acid substitutions , less than 10 amino acid substitutions, less than 5 amino acid substitutions, less than 4 amino acid substitutions, less than 3 amino acid substitutions or less than 2 amino acid substitutions in relation to the reference VH domain, VHCDR1, VHCDR2, VHCDR3, VL, VLCDR1, VLCDR2, or VLCDR3 domain. A "conservative amino acid substitution" is one in which the amino acid residue is replaced with an amino acid residue having a side chain with a similar charge. Families of amino acid residues having side chains with similar charges have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, Threonine, tyrosine, cysteine), non-polar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), branched beta side chains (e.g. threonine, valine, isoleucine) and aromatic side chains (for example, tyrosine, phenylalanine, tryptophan, histidine). Alternatively, mutations can be introduced randomly throughout all or part of the coding sequence, such as by saturation mutagenesis and the resulting mutants can be screened for biological activity to identify mutants that retain activity (e.g., the ability to bind to a G protein chemokine receptor).

For example, it is possible to introduce mutations only in flanking regions or only in CDR regions of an antibody molecule. The mutations introduced can be silent or neutral missense mutations, that is, they have little or no effect on the ability of an antibody to bind to an antigen. These types of mutations may be useful for optimizing codon use or improving antibody production of a hybridoma. Alternatively, non-neutral missense mutations can alter the ability of an antibody to bind antigen. The location of most silent and neutral missense mutations is probably in the flanking regions, while the location of most nonneutral missense mutations is probably in CDR, although this is not an absolute requirement. One skilled in the art would be able to design and test mutant molecules with desired properties such as no alteration in antigen binding activity or alteration in binding activity (e.g., improvements in antigen binding activity or changes in specificity of antibodies). After mutagenesis, the modified protein can be routinely expressed and the functional and / or biological activity of the encoded protein (eg, ability to immunospecifically bind to a G-protein Chemokine Receptor) can be determined using techniques described herein or by routine modification techniques known in the art.

In a specific embodiment, an antibody (including a molecule comprising, or alternatively consisting of, an antibody fragment or variant thereof), which binds immunospecifically with G-protein Chemokine Receptor (CCR5) polypeptides or fragments or variants thereof, comprises, or alternatively consists of, an amino acid sequence encoded by a nucleotide sequence that hybridizes with a nucleotide sequence that is complementary to that encoded by one of the VH or VL domains expressed by one or more lines Cells indicated in Table 2, under stringent conditions, for example, hybridization with filter-bound DNA in 6X sodium chloride / sodium citrate (SSC) at approximately 45 ° C followed by one or more washes in 0.2% SSC / 0.1% SDS at about 50-65 ° C, under highly stringent conditions, for example, hybridization with filter bound nucleic acid in 6x SSC at about 45 ° C followed by one or more washes in 0.1x SSC / 0.2% SDS at about 68 ° C or in other stringent hybridization conditions known to those skilled in the art (see, for example, Ausubel, FM et al., eds., 1989, Current Protocols in Molecular Biology, Vol. I, Green Publishing Associates, Inc. and John Wiley & Sons, Inc., New York on pages 6.3.1-6.3.6 and 2.10.3). Nucleic acid molecules encoding these antibodies are also described. It is well known within the art that polypeptides, or fragments or variants thereof, with similar amino acid sequences often have similar structure and many of the same biological activities. Thus, an antibody (including a molecule comprising, or alternatively consisting of, an antibody fragment or variant thereof), which binds immunospecifically with a G-protein Chemokine Receptor polypeptide (CCR5) or fragments or variants of a G-protein Chemokine Receptor polypeptide (CCR5), comprises, or alternatively consists of, a VH domain having an amino acid sequence that is at least 35%, at least 40%, at least 45%, at minus 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to the amino acid sequence of a VH domain of a heavy chain expressed by at least one of the cell lines indicated in Table 2.

An antibody (including a molecule comprising, or alternatively consisting of, an antibody fragment or variant thereof), which binds immunospecifically with a G-protein Chemokine Receptor polypeptide (CCR5) or fragments or variants of a polypeptide of the G-protein Chemokine Receptor (CCR5), comprises, or alternatively consists of, a VL domain having an amino acid sequence that is at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical to the amino acid sequence of a VL domain of a light chain expressed by at least one of the cell lines indicated in Table 2.

Polynucleotides Encoding Antibodies

The antibodies of the invention (including antibody fragments) can be produced by any method known in the art. For example, it will be appreciated that antibodies according to the present invention can be expressed in cell lines other than hybridoma cell lines. Sequences encoding cDNAs or genomic clones may be used for particular antibodies for transformation of suitable mammalian or non-mammalian host cells or to generate phage display libraries, for example. Additionally, antibody polypeptide recombinant expression systems of the invention can be chemically synthesized or produced through the use of recombinant expression systems.

One way of producing the antibodies of the invention would be to clone the VH and / or VL domains expressed by the hybridoma cell line of the invention indicated in Table 2. To isolate the VH and VL domains of the hybridoma cell line, they can PCR primers including VH or VL nucleotide sequences (see example 55) may be used to amplify the expressed VH and VL sequences contained in total RNA isolated from the hybridoma cell line. The PCR products can then be cloned using vectors, for example, which have a PCR product cloning site consisting of a 5 'and 3' single T nucleotide protrusion, which is complementary to the outgoing single adenine nucleotide added in the 5 'and 3' end of PCR products by many DNA polymerases used for PCR reactions. The VH and VL domains can then be sequenced using conventional methods known in the art.

The cloned VH and VL genes can be located in one or more suitable expression vectors. As a non-limiting example, PCR primers that include VH or VL nucleotide sequences, a restriction site and a flanking sequence can be used to protect the restriction site, to amplify the VH or VL sequences. Using cloning techniques known to those skilled in the art, the VH domains amplified by PCR can be cloned into vectors expressing the appropriate immunoglobulin constant region, for example, the human IgG1 or IgG4 constant region for VH domains and the kappa or constant regions. human lambda for VL kappa and lambda domains, respectively. Preferably, the vectors for the expression of VH or VL domains comprise a promoter suitable for directing the expression of the heavy and light chains in the selected expression system, a secretion signal, a cloning site for the immunoglobulin variable domain, domains immunoglobulin constants and a selection marker such as neomycin. The VH and VL domains can also be cloned into a simple vector that expresses the necessary constant regions. Heavy chain conversion vectors and light chain conversion vectors are then co-transfected into cell lines to generate stable or transient cell lines that express full-length antibodies, eg, IgG, using techniques known to those skilled in the art (See , for example, Guo et al., J. Clin. Endocrinol. Metab. 82: 925-31 (1997), and Ames et al., J. Immunol. Methods 184: 177-86 (1995)).

The invention further provides polynucleotides comprising a nucleotide sequence encoding an antibody and fragments thereof of the invention. Polynucleotides that hybridize under stringent or less stringent hybridization conditions are also described, for example, as defined above, with polynucleotides encoding an antibody, preferably, which specifically binds to a polypeptide described herein, preferably, a antibody that binds with a polypeptide having the amino acid sequence of SEQ ID NO: 2 or a polypeptide encoded by the deposited clone.

The polynucleotides can be obtained, and the nucleotide sequence of the polynucleotides can be determined, by any method known in the art. For example, if the nucleotide sequence of the antibody is known, a polynucleotide encoding the antibody can be assembled from chemically synthesized oligonucleotides (for example, as described in Kutmeier et al., BioTechniques 17: 242 (1994)), which Briefly, it involves the synthesis of overlapping oligonucleotides that contain portions of the sequence encoding the antibody, which hybridizes and binds with those oligonucleotides, and then amplification of the oligonucleotides bound by PCR.

Alternatively, a polynucleotide encoding an antibody can be generated from nucleic acid from a suitable source. If a clone containing a nucleic acid encoding a particular antibody is not available, but the sequence of the antibody molecule is known, a nucleic acid encoding the immunoglobulin can be chemically synthesized or obtained from a suitable source (e.g., a library of antibody cDNA

or a cDNA library generated from, or nucleic acid, preferably poly A + RNA, isolated from, any tissue or cells expressing the antibody, such as hybridoma cells selected to express an antibody of the invention) by PCR amplification using synthetic primers hybridizable with the 3 'and 5' ends of the sequence (See Example 55) or by cloning using an oligonucleotide probe specific to the particular gene sequence to identify, for example, a cDNA clone from a cDNA library encoding the antibody. The amplified nucleic acids generated by PCR can then be cloned into replicable cloning vectors using any method well known in the art.

Once the nucleotide sequence and the corresponding amino acid sequence of the antibody is determined, the nucleotide sequence of the antibody can be manipulated using methods well known in the art for nucleotide sequence manipulation, for example, recombinant DNA techniques, mutagenesis. directed, PCR, etc. (See, for example, the techniques described in Sambrook et al., 1990, Molecular Cloning, A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY and Ausubel et al., eds., 1998, Current Protocols in Molecular Biology, John Wiley & Sons, NY), to generate antibodies that have a different amino acid sequence, for example to create amino acid substitutions, deletions and / or insertions.

The amino acid sequence of the heavy and / or light chain variable domains can be inspected to identify the sequences of the complementarity determining regions (CDRs) by methods that are well known in the art, for example, by comparison with known amino acid sequences. from other heavy and light chain variable regions to determine the regions of sequence hypervariability. Using routine recombinant DNA techniques, one or more of the CDRs can be inserted into flanking regions, for example, in human flanking regions to humanize a non-human antibody, as described above. The flanking regions may be of natural origin or consensus flanking regions, and preferably human flanking regions (see, for example, Chothia et al., J. Mol. Biol 278: 457-479 (1998) for an enumeration of human flanking regions) .

Preferably, the polynucleotide generated by the combination of the flanking and CDR regions encodes an antibody that specifically binds to a CCR5 polypeptide. Preferably, as discussed above, one or more amino acid substitutions may be made within the flanking regions and preferably amino acid substitutions improve the binding of the antibody with its antigen. Additionally, such methods can be used to make amino acid substitutions or deletions of one or more cysteine moieties of variable region that participate in an intracatenary disulfide bond to generate antibody molecules that lack one or more intracatenary disulfide bonds. Other alterations of the polynucleotide are described and are within the skill of the art.

For some uses, such as for in vitro affinity maturation of an antibody of the invention, it may be useful to express the VH and VL domains of the heavy and light chains of the antibody of the invention as single chain antibodies or Fab fragments in a library of phage presentation. For example, cDNAs encoding the VH and VL domains of the antibody of the invention can be expressed in all possible combinations using a phage display library, allowing the selection of VH / VL combinations that bind with Chemokine Receptor Polypeptides of G protein (CCR5) with preferred binding characteristics such as improved affinity or improved dissociation rates. Additionally, VH and VL segments - the CDR regions of the VH and VL domains of the antibody of the invention, in particular, in vitro can be mutated. The expression of VH and VL domains with "mutant" CDRs in a phage display library allows the selection of VH / VL combinations that bind with a G protein Chemokine Receptor polypeptide (CCR5) with preferred binding characteristics such as improved affinity or improved dissociation rates.

In phage display methods, functional antibody domains are presented on the surface of phage particles carrying the polynucleotide sequences encoding them. In particular, DNA sequences encoding VH and VL domains are amplified from animal cDNA libraries (for example, human or murine cDNA libraries of lymphoid tissues) or synthetic cDNA libraries. The DNA encoding the VH and VL domains is linked by an scFv linker by PCR and cloned into a phagemid vector (e.g., pCANTAB 6 or pComb 3 HSS). The vector is electroporated in E. coli and E. coli is infected with auxiliary phage: The phages used in these methods are typically filamentous phages that include fd and M13 and the VL and VH domains usually fuse recombinantly with gene III or phage gene VIII. The phage expressing an antigen binding domain that binds with an antigen of interest (i.e., a G-protein Chemokine Receptor polypeptide or a fragment thereof) can be selected or identified with antigen, for example, using labeled antigen. or antigen bound or captured on a solid or pearl surface. Examples of phage display methods that can be used to prepare the antibodies of the present invention include, but are not limited to, those described in Brinkman et al., J. Immunol. Methods 182: 41-50 (1995); Ames et al., J. Immunol. Methods 184: 177-186 (1995); Kettleborough et al., Eur. J. Immunol. 24: 952-958 (1994); Persic et al., Gene 187 9-18 (1997); Burton et al., Advances in Immunology 57: 191-280 (1994); PCT application No. PCT / GB91 / O1 134; PCT publications WO 90/02809; WO 91/10737; WO 92/01047; WO 92/18719; WO 93/1 1236; WO 95/15982; WO 95/20401; WO97 / 13844; and United States Patents No. 5,698,426; 5,223,409; 5,403,484; 5,580,717; 5,427,908; 5,750,753; 5,821,047; 5,571,698; 5,427,908; 5,516,717; 5,780,225; 5,648,727; 5,735,743 and 5,969,108.

In addition, techniques developed by the production of "chimeric antibodies" (Morrison et al., Proc. Natl. Acad. Sci. 81: 851-855 (1984); Neuberger et al., Nature 312: 604-608 (1984) ); Takeda et al., Nature 314: 452454 (1985)) by splicing genes of a mouse antibody molecule of appropriate antigen specificity together with genes of a human antibody molecule of appropriate biological activity. As described above, a chimeric antibody is a molecule in which different parts are derived from different animal species, such as those that have a variable region derived from a murine mAb and a constant region of human immunoglobulin, for example, humanized antibodies.

Alternatively, techniques described for the production of single chain antibodies can be adapted (US Patent No. 4,946,778; Bird, Science 242: 423-42 (1988); Huston et al., Proc. Natl. Acad. Sci.

USA 85: 5879-5883 (1988); and Ward et al., Nature 334: 544-54 (1989)) to produce single chain antibodies. Single chain antibodies are formed by binding heavy and light chain fragments of the Fv region via an amino acid bridge, resulting in a single chain polypeptide. Techniques can also be used for assembling functional Fv fragments in E. coli (Skerra et al., Science 242: 1038-1041 (1988)).

Methods to Produce Antibodies

The antibodies of the invention can be produced by any method known in the art for the synthesis of antibodies, in particular, by chemical synthesis, by intracellular immunization (i.e., intrabody technology) or preferably, by recombinant expression techniques. Methods for producing antibodies include, without limitation, hybridoma technology, EBV transformation and other methods discussed herein as well as through the use of recombinant DNA technology, as discussed below.

Recombinant expression of an antibody of the invention, or fragment, derivative, variant or analog thereof, (for example, a heavy or light chain of an antibody of the invention or a single chain antibody of the invention), requires the construction of an expression vector containing a polynucleotide encoding the antibody. Once a polynucleotide encoding an antibody molecule or a heavy or light chain of an antibody, or part thereof (preferably containing the heavy or light chain variable domain), of the invention, the vector for the Production of the antibody molecule can be produced by recombinant DNA technology using techniques well known in the art. Thus, methods for preparing a protein by expression of a polynucleotide containing a nucleotide sequence encoding an antibody are described herein. Methods that are well known to those skilled in the art can be used to construct expression vectors containing appropriate transcriptional and translational antibody coding sequences and controls. These methods include, for example, in vitro recombinant DNA techniques, synthetic techniques and in vivo genetic recombination. The invention thus provides replicable vectors comprising a nucleotide sequence encoding an antibody molecule of the invention. Also described are replicable vectors comprising a nucleotide sequence encoding a heavy or light chain thereof, or a heavy or light chain variable domain, operably linked with a promoter. Such vectors may include the nucleotide sequence encoding the constant region of the antibody molecule (see, for example, PCR Publication WO 86/05807; PCT Publication WO 89/01036; and U.S. Patent No. 5,122,464) and the variable domain of the antibody can be cloned into such a vector for the expression of the complete heavy or light chain.

The expression vector is transferred to a host cell by conventional techniques and the transfected cells are then cultured by conventional techniques to produce an antibody of the invention. Thus, the invention includes host cells that contain a polynucleotide encoding an antibody of the invention or host cells that contain a polynucleotide that encodes a heavy or light chain thereof, or a single chain antibody of the invention, bound together. Operationally with a heterologous promoter. In preferred embodiments for the expression of double-chain antibodies, vectors encoding heavy and light chains in the host cell can be co-expressed for expression of the entire immunoglobulin molecule, as detailed below.

A variety of host-expression vector systems can be used to express the antibody molecules of the invention. Such host-expression systems represent vehicles through which the coding sequences of interest can be produced and subsequently purified, but also represent cells that can, when transformed or transfected with the appropriate nucleotide coding sequences, express an antibody molecule of the invention. on-site. These include without limitation microorganisms such as bacteria (eg, E. coli, B. subtilis) transformed with recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vectors containing antibody coding sequences; yeast (eg, Saccharomyces, Pichia) transformed with recombinant yeast expression vectors containing antibody coding sequences; insect cell systems infected with recombinant virus expression vectors (eg, baculovirus) containing antibody coding sequences; plant cell systems infected with recombinant virus expression vectors (for example cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors (eg, Ti plasmid) containing antibody coding sequences; or mammalian cell systems (e.g., COS, CHO, BHK, 293, 3T3, NSO cells) carrying recombinant expression constructs containing promoters derived from the genome of mammalian cells (e.g., metallothionein promoter) or virus from mammal (for example, the adenovirus late promoter; the 7.5 K promoter of vaccinia virus). Preferably, bacterial cells such as Escherichia coli and, more preferably, eukaryotic cells, especially for the expression of a complete recombinant antibody molecule, are used for the expression of a recombinant antibody molecule. For example, mammalian cells such as Chinese hamster ovary (CHO) cells, together with a vector such as the main intermediate early gene promoter element of human cytomegalovirus is an effective expression system for antibodies (Foecking et al., Gene 45: 101 (1986); Cockett et al., Bio / Technology 8: 2 (1990)).

In bacterial systems, several expression vectors can be advantageously selected depending on the intended use for the antibody molecule that is expressed. For example, when a large amount of such a protein must be produced, for the generation of pharmaceutical compositions of an antibody molecule, vectors that direct the expression of high levels of easily purified protein fusion products may be desirable. Such vectors include, without limitation, the E. coli expression vector pUR278 (Ruther et al., EMBO J.

2: 1791 (1983)), in which the antibody coding sequence can be individually ligated into the phase vector with the lac Z coding region so that a fusion protein is produced; pIN vectors (Inouye & Inouye, Nucleic Acids Res. 13: 3101-3109 (1985); Van Heeke & Schuster, J. Biol. Chem. 24: 5503-5509 (1989)); and the like PGEX vectors can also be used to express foreign polypeptides as fusion proteins with glutathione Stransferase (GST). In general, such fusion proteins are soluble and can easily be purified from lysed cells by adsorption and binding with glutathione-agarose matrix beads followed by elution in the presence of free glutathione. PGEX vectors are designed to include cleavage sites of factor Xa protease or thrombin so that the cloned target gene product can be released from the rest of GST.

In an insect system, Autographa californica nuclear polyhedrosis virus (AcNPV) is used as a vector to express foreign genes. The virus grows in Spodoptera frugiperda cells. The antibody coding sequence can be cloned individually in non-essential regions (for example the polyhedrin gene) of the virus and placed under the control of an AcNPV promoter (for example the polyhedrin promoter).

In mammalian host cells, several virus-based expression systems can be used. In cases where an adenovirus is used as an expression vector, the antibody coding sequence of interest can be ligated with an adenovirus transcription / translation control complex, for example, the late promoter and tripartite leader sequence. This chimeric gene can then be inserted into the adenovirus genome by recombination in vitro or in vivo. Insertion into a non-essential region of the viral genome (eg, E1 or E3 region) will result in a recombinant virus that is viable and capable of expressing the antibody molecule in infected hosts (for example, see Logan & Shenk, Proc. Natl. Acad. Sci. USA 81: 355-359 (1984)). Specific initiation signals may also be required for effective translation of inserted antibody coding sequences. These signals include the ATG initiation codon and adjacent sequences. In addition, the initiation codon may be in phase with the reading phase of the desired coding sequence to ensure translation of the entire insert. These exogenous translational control signals and initiation codons can be of various origins, both natural and synthetic. Expression efficiency can be improved by the inclusion of appropriate transcription enhancer elements, transcription terminators, etc. (see Bittner et al., Methods in Enzymol. 153: 51-544 (1987)).

In addition, a host cell strain that modulates the expression of the inserted sequences or modifies or processes the gene product in the specific manner desired can be selected. Such modifications (for example glycosylation) and processing (for example, cleavage) of protein products may be important for protein function. Different host cells have specific characteristics and mechanisms for post-translational processing and modification of proteins and gene products. Appropriate host systems or cell lines can be selected to ensure correct modification and processing of the expressed foreign protein. To this end, eukaryotic host cells that possess the cellular machinery for the proper processing of the primary transcript, glycosylation and phosphorylation of the gene product can be used. Such mammalian host cells include but are not limited to CHO, VERY, BHK, Hela, COS, MDCK, 293, 3T3, WI38 and, in particular, breast cancer cell lines such as, for example, BT483, Hs578T, HTB2, BT20 and T47D, and normal mammary gland cell line such as, for example, CRL7030 and Hs578Bst.

For long-term high yield production of recombinant proteins, stable expression is preferred. For example, cell lines that stably express the antibody molecule can be obtained by genetic engineering. Instead of using expression vectors containing viral origins of replication, host cells can be transformed with DNA controlled by appropriate expression control elements (e.g., promoter, enhancer sequences, transcription terminators, polyadenylation sites, etc.) and a selectable marker. After the introduction of foreign DNA, genetically engineered cells can be allowed to grow for 1-2 days in an enriched medium and then changed to a selective medium. The selectable marker in the recombinant plasmid confers resistance to selection and allows cells to stably integrate the plasmid into their chromosomes and grow to form foci that in turn can be cloned and expanded into cell lines. This method can be used advantageously to genetically modify cell lines that express the antibody molecule. Such genetically engineered cell lines can be particularly useful in the exploration and evaluation of compounds that interact directly or indirectly with the antibody molecule.

Various screening systems can be used, including without limitation the thymidine kinase genes of herpes simplex virus (Wigler et al., Cell 11: 223 (1977)), hypoxanthine-guanine phosphoribosyltransferase (Szybalska & Szybalski, Proc. Natl. Acad. Sci. USA 48: 202 (1992)), and adenine phosphoribosyltransferase (Lowy et al., Cell 22: 817 (1980)) which can be used in tk-, hgprt- or aprt- cells, respectively. In addition, antimetabolite resistance can be used as the basis of selection for the following genes: dhfr, which confers resistance to methotrexate (Wigler et al., Natl. Acad. Sci. USA 77: 357 (1980); O'Hare et al., Proc. Natl. Acad. Sci. USA 78: 1527 (1981)); gpt, which confers resistance to mycophenolic acid (Mulligan & Berg, Proc. Natl. Acad. Sci. USA 78: 2072 (1981)); neo, which confers resistance to aminoglycoside G-418 (Clinical Pharmacy 12: 488-505; Wu and Wu, Biotherapy 3: 87-95 (1991); Tolstoshev, Ann. Rev. Pharmacol. Toxicol. 32: 573-596 (1993 ); Mulligan, Science 260: 926-932 (1993); and Morgan and Anderson, Ann. Rev. Biochem. 62: 191-217 (1993); May, 1993, TIB TECH 11 (5): 155-215); and higro, which confers resistance to hygromycin (Santerre et al., Gene 30: 147 (1984)). Methods commonly known in the art of recombinant DNA technology can be routinely applied to select the desired recombinant clone and such methods are described, for example, in Ausubel et al. (eds.), Current Protocols in Molecular Biology, John Wiley & Sons, NY (1993); Kriegler, Gene Transfer and Expression, A Laboratory Manual, Stockton Press, NY (1990); and in Chapters 12 and 13, Dracopoli et al. (eds), Current Protocols in Human Genetics, John Wiley & Sons, NY (1994); Colberre-Garapin et al., J. Mol. Biol. 150: 1 (1981).

Expression levels of an antibody molecule can be increased by vector amplification (for a review, see Bebbington and Hentschel, The use of vectors based on gene amplification for the expression of cloned genes in mammalian cells in DNA cloning, Vol. 3. (Academic Press, New York, 1987)). When a marker in the vector system that expresses the antibody is amplifiable, an increase in the level of the inhibitor present in host cell culture will increase the number of copies of the marker gene. Since the amplified region is associated with the antibody gene, the production of the antibody will also increase (Crouse et al., Mol. Cell. Biol. 3: 257 (1983)).

Vectors using glutamine synthase (GS) or DHFR as the selectable markers can be amplified in the presence of the drugs methionine sulfoximin or methotrexate, respectively. An advantage of glutamine synthase-based vectors is the availability of cell lines (eg, the murine myeloma cell line, NS0) that are negative for glutamine synthase. Glutamine synthase expression systems can also function in cells that express glutamine synthase (for example, Chinese Hamster Ovary Cells (CHO)) by providing additional inhibitor to prevent endogenous gene functioning.

Vectors using glutamine synthase as a selectable marker include, without limitation, the expression vector pEE6 described in Stephens and Cockett, Nucl. Acids Res 17: 7110 (1989). A glutamine synthase expression system and components thereof are detailed in PCT publications: WO87 / 04462; WO86 / 05807; WO89 / 01036; WO89 / 10404; and WO91 / 06657. Additionally, glutamine synthase expression vectors that can be used in accordance with the present invention are available from the vendor market, including, for example, Lonza Biologics, Inc. (Portsmouth, NH). The expression and production of monoclonal antibodies using a GS expression system in murine myeloma cells are described in Bebbington et al., Bio / technology 10: 169 (1992) and in the Bible and Robinson Biotechnol. Prog. 11: 1 (1995).

The host cell can be co-transfected with two expression vectors of the invention, the first vector encoding a heavy chain derived polypeptide and the second vector encoding a light chain derived polypeptide. The two vectors may contain identical selectable markers that allow equal expression of heavy and light chain polypeptides. Alternatively, a simple vector that encodes and is capable of expressing both heavy and light chain polypeptides can be used. In such situations, the light chain should be placed before the heavy chain to avoid excess toxic free heavy chain (Proudfoot, Nature 322: 52 (1986); Kohler, Proc. Natl. Acad. Sci. USA 77: 2197 (1980 )). The coding sequences for the heavy and light chains may comprise cDNA or genomic DNA.

Once an antibody molecule of the invention has been produced by an animal, has been chemically synthesized or expressed recombinantly, it can be purified by any method known in the art for purification of an immunoglobulin molecule, for example, by chromatography (for example, ion exchange, affinity chromatography, particularly by affinity for the specific antigen after Protein A, and column size selection), centrifugation, differential solubility or by any other conventional protein purification technique . In addition, the antibodies of the present invention or fragments thereof can be fused with heterologous polypeptide sequences described herein or otherwise known in the art, to facilitate purification.

Antibody Conjugates

The antibodies of the invention can be recombinantly fused or chemically conjugated (including covalent and non-covalent conjugates) with a CCR5 polypeptide (or part thereof, preferably at least 10, 20, 30, 40, 50, 60, 70, 80 , 90 or 100 amino acids of the polypeptide) to generate fusion proteins. Fusion does not necessarily need to be direct, but can occur through linker sequences. Antibodies may be specific for antigens other than polypeptides (or part thereof, preferably at least 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 amino acids of the polypeptide) described herein. For example, antibodies can be used to target the polypeptides described herein for particular cell types, in vitro or in vivo, by fusion or conjugation of the polypeptides with antibodies specific for particular cell surface receptors. Polypeptides and / or antibodies of the present invention (including fragments thereof) can be fused to the N or C terminal end of the heterologous protein (eg, immunoglobulin Fc polypeptide or human serum albumin polypeptide). The antibodies of the invention can also be fused with albumin (including but not limited to recombinant human serum albumin (see, for example, U.S. Patent No. 5,876,969, filed March 2, 1999, EP 0 413 622 and U.S. Patent No. 5,766,883, filed June 16, 1998)), resulting in chimeric polypeptides. In a preferred embodiment, polypeptides and / or antibodies of the present invention (including fragments or variants thereof) are fused with the mature form of human serum albumin (ie amino acids 1-585 of human serum albumin as shown in Figures 1 and 2 of EP Patent 0 322 094). In another preferred embodiment, polypeptides and / or antibodies of the present invention (including fragments or variants thereof) are fused with polypeptide fragments comprising, or alternatively consisting of, the 1-z amino acid residues of human serum albumin, z being an integer from 369 to 419, as described in US Patent 5,766,883. The invention also encompasses polynucleotides encoding fusion proteins of the invention. Such fusion proteins can, for example, facilitate purification and increase half-life in vivo. Antibodies fused or conjugated to CCR5 polypeptides can also be used in in vitro immunoassays and purification methods using methods known in the art. See, for example, Harbor et al., Mentioned above, and PCT publication WO 93/21232; EP 439,095; Naramura et al., Immunol. Lett. 39: 91-99 (1994); US Patent 5,474,981; Gillies et al., PNAS 89: 1428-1432 (1992); Fell et al., J. Immunol. 146: 2446-2452 (1991).

The present description further includes compositions comprising the CCR5 polypeptides fused or conjugated with antibody domains other than the variable regions. For example, the polypeptides can be fused or conjugated with an antibody Fc region, or part thereof. The antibody portion fused to a polypeptide described herein may comprise the constant region, hinge region, CH1 domain, CH2 domain and CH3 domain or any combination of complete domains or portions thereof. The polypeptides can also be fused or conjugated with the above antibody portions to form multimers. For example, the Fc portions fused with the polypeptides described herein can form dimers through disulfide bonds between the Fc parts. Larger multimeric forms can be prepared by fusion of the polypeptides with parts of IgA and IgM. Methods to fuse or conjugate the polypeptides with antibody parts are known in the art. See, for example, U.S. Patent No. 5,336,603; 5,622,929; 5,359,046; 5,349,053; 5,447,851; 5,112,946; EP 307,434; EP 367,166; PCT publications WO 96/04388; WO 91/06570; Ashkenazi et al., Proc. Natl Acad. Sci. USA 88: 10535-10539 (1991); Zheng et al., J. Immunol. 154: 5590-5600 (1995); and Vil et al., Proc. Natl Acad. Sci. USA 89: 1133711341 (1992).

As discussed above, the polypeptides corresponding to a polypeptide, polypeptide fragment or a variant of SEQ ID No. 2 or of the polypeptide encoded by the deposited clone can be fused or conjugated with the above antibody portions to increase the in vivo half-life of the polypeptides or for use in immunoassays using methods known in the art. In addition, the polypeptides corresponding to SEQ ID NO: 2

or to the polypeptide encoded by the deposited clone can be fused or conjugated with the above antibody portions to facilitate purification. An indicated example describes chimeric proteins that consist of the first two domains of the human CD4 polypeptide and various domains of the constant regions of the heavy or light chains of mammalian immunoglobulins. (EP 394,827; Traunecker et al., Nature 331: 84-86 (1988). Polypeptides fused or conjugated with an antibody having dimeric structures linked by disulfide (due to IgG) may also be more effective in binding and neutralization of other molecules, which the monomeric secreted protein or protein fragment alone (Fountoulakis et al., J. Biochem. 270: 3958-3964 (1995)). In many cases, the Fc part in a fusion protein is beneficial in therapy and diagnosis and therefore may result in, for example, improved pharmacokinetic properties (EP A 232,262) Alternatively, suppressing the Fc part after the fusion protein has been expressed, detected and purified would be desirable. For example, the Fc part may hinder therapy and diagnosis if the fusion protein is used as an antigen for immunizations In the discovery of drugs, for example, human proteins, such as mo hIL-5, have been fused with Fc parts in order to perform high-performance screening assays to identify hIL-5 antagonists (See, Bennett et al., J. Molecular Recognition 8: 52-58 (1995); Johanson et al., J. Biol. Chem. 270: 9459-9471 (1995).

In addition, the antibodies or fragments thereof of the present invention can be fused with marker sequences, such as a peptide to facilitate purification. In preferred embodiments, the marker amino acid sequence is a hexahistidine peptide, such as the marker provided in a pQE vector (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, CA, 91311), among others, many of which are available in the market, as described in Gentz et al., Proc. Natl Acad. Sci. USA 86: 821-824 (1989), for example, hexahistidine enables convenient purification of the fusion protein. Other peptide markers useful for purification include, but are not limited to, the "HA" marker, which corresponds to an epitope derived from the hemagglutinin influenza protein (Wilson et al., Cell 37: 767 (1984)) and the marker. "Flag."

The present invention further encompasses antibodies or fragments thereof conjugated with a diagnostic or therapeutic agent. Antibodies can be used diagnosticly to, for example, control the development or progression of a tumor as part of a clinical trial procedure to, for example, determine the efficacy of a given treatment regimen. Detection can be facilitated by coupling the antibody with a detectable substance. Examples of detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, radioactive materials, positron emitting metals using various positron emission tomographs and non-radioactive paramagnetic metal ions. The detectable substance can be coupled or conjugated directly with the antibody (or fragment thereof) or indirectly through an intermediate (such as, for example, a linker known in the art) using techniques known in the art. See, for example, U.S. Patent No.

4,741,900 for metal ions that can be conjugated to antibodies for use as diagnostic agents according to the present invention. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, beta-galactosidase or acetylcholinesterase; Examples of suitable prosthetic group complexes include streptavidin / biotin and avidin / biotin; Examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriacinylamine fluorescein, dansyl chloride or phycoerythrin; An example of a luminescent material includes luminol; Examples of bioluminescent materials include luciferase, luciferin and aecuorin; and examples of suitable radioactive material include iodine (121I, 123I, 125I, 131I), carbon (14C), sulfur (35S), tritium (3H), indium (111In, 112In, 113mIn, 115mIn), technetium (99Tc, 99mTc ), thallium (201Ti), gallium (68Ga, 67Ga), palladium (103Pd), molybdenum (99Mo), xenon (133Xe), fluorine (18F), 153Sm, 177Lu, 159Gd, 149Pm, 140La, 175Yb, 166Ho 90Y, 47Sc , 186Re, 188Re, 142Pr, 105Rh, and 97Ru.

G-protein Chemokine Receptor (CCR5) polypeptides bind to macrocyclic chelators useful for conjugating radiometallic ions, including but not limited to 111In, 177Lu, 90Y, 166Ho, and 153Sm, with polypeptides. The radiometallic ion associated with macrocyclic chelators bound to G-protein Chemokine Receptor polypeptides (CCR5) is 111In. The radiometallic ion associated with the macrocyclic chelator bound with G-protein Chemokine Receptor polypeptides (CCR5) is 90Y. The macrocyclic chelator is 1,4,7,10-tetracyclozadecane-N, N ", N", N "-tetraacetic acid (DOTA). DOTA binds to the G-protein Chemokine Receptor polypeptide (CCR5) by a linker molecule. Examples of linker molecules useful for conjugating DOTA with a polypeptide are commonly known in the art - see, for example, DeNardo et al., Clin Cancer Res. 4 (10): 2483-90, 1998; Peterson et al., Bioconjug. Chem. 10 (4): 553-7, 1999; and Zimmerman et al, Nucl. Med. Biol. 26 (8): 943-50, 1999. In addition, US Patents 5,652,361 and 5,756,065, which describe chelating agents that can be conjugated with antibodies and methods for their preparation and use. Although US Patents 5,652,361 and 5,756,065 focus on conjugating chelating agents with antibodies, one skilled in the art could readily adapt the methods described herein to conjugate chelating agents with other polypeptides.

A cytotoxin or cytotoxic agent includes any agent that is harmful to cells. Examples include paclitaxol, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, tenoposide, vincristine, vinblastine, colchicine, doxorubicin, daunorubicin, dihydroxy dione atrazine, mitoxantrone, mithramycin, actinomycin D, 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol and puromycin and analogs or homologs thereof. Therapeutic agents include, but are not limited to, antimetabolites (for example methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil decarbazine), alkylating agents (for example, mechlorethamine, thiotepa, chlorambucil, melphalan, carmustine (BSNU) and Lomustine (CCNU), cyclophosphamide, busulfan, dibromomanitol, streptozotocin, mitomycin C and platinum cis-dichlorodiamine (DDP) cisplatin), anthracyclines (for example, daunorubicin (formerly daunomycin) and doxorubicin), antibiotics (eg (formerly actinomycin), bleomycin, mitramycin and antramycin (AMC)) and antimitotic agents (for example, vincristine and vinblastine).

The antibody conjugates of the invention can be used to modify a given biological response, the therapeutic agent or pharmacological moiety should not be construed as limited to classical chemical therapeutic agents. For example, the pharmacological moiety may be a protein or polypeptide that possesses a desired biological activity. Such proteins may include, for example, a toxin such as abrin, ricin A, pseudomonas exotoxin or diphtheria toxin; a protein such as tumor necrosis factor, interferon , interferon , neuronal growth factor, platelet-derived growth factor, tissue plasminogen activator, an apoptotic agent, for example, TNF-alpha, TNF-beta, AIM I ( See, International Publication No. WO 97/33899), AIM II (See, International Publication No. WO 97/34911), Ligando Fas (Takahashi et al., Int. Immunol., 6: 1567-1574 (1994)), VEGI ( See, International Publication No. WO 99/23105), a thrombotic agent or an antiangiogenic agent, for example, angioestatin or endostatin; or biological response modifiers such as, for example, lymphokines, interleukin-1 ("IL-1"), interleukin-2 ("IL-2"), interleukin-6 ("IL-6"), stimulating factor macrophage and granulocyte colonies ("GM-CSF"), granulocyte colony stimulating factor ("G-CSF"), or other growth factors.

Antibodies can also be attached to solid supports, which are particularly useful for immunoassays or purification of the target antigen. Such solid supports include, but are not limited to, glass, cellulose, polyacrylamide, nylon, polystyrene, polyvinyl chloride or polypropylene.

The techniques for conjugating said therapeutic moiety with antibodies are well known, see, for example, Arnon et al., "Monoclonal Antibodies For Immunotargeting Of Drugs In Cancer Therapy", in Monoclonal Antibodies And Cancer Therapy, Reisfeld et al. (eds.), p. 243-56 (Alan R. Liss, Inc. 1985); Hellstrom et al., "Antibodies For Drug Delivery", in Controlled Drug Delivery (2nd Ed.), Robinson et al. (eds.), p. 623-53 (Marcel Dekker, Inc. 1987); Thorpe, "Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A Review", in Monoclonal Antibodies ’84: Biological And Clinical Applications, Pinchera et al. (eds.), p. 475-506 (1985); "Analysis, Results, And Future Prospective Of The Therapeutic Use Of Radiolabeled Antibody In Cancer Therapy", in Monoclonal Antibodies For Cancer Detection And Therapy, Baldwin et al. (eds.), p. 303-16 (Academic Press 1985), and Thorpe et al., "The Preparation And Cytotoxic Properties Of Antibody-Toxin Conjugates", Immunol. Rev. 62: 119-58 (1982).

Alternatively, an antibody can be conjugated with a second antibody to form an antibody heteroconjugate as described by Segal in U.S. Patent No. 4,676,980.

An antibody, with or without a therapeutic moiety conjugated to it, administered alone or in combination with a cytotoxic factor or factors and / or a cytokine or cytokines can be used as a therapeutic agent.

Immunophenotyping

The antibodies of the invention can be used for immunophenotyping cell lines and biological samples. The gene translation product described herein may be useful as a specific cell marker or more specifically as a cell marker that is differentially expressed at various stages of differentiation and / or maturation of particular cell types. Monoclonal antibodies directed against a specific epitope, or combination of epitopes, will allow the exploration of cell populations that express the marker. Various techniques using monoclonal antibodies can be used to screen for cell populations that express the marker or markers and include magnetic separation using magnetic beads coated with antibody, "selection" with antibody bound to a solid matrix (ie, plate) and flow cytometry (See, for example, US Patent 5,985,660; and Morrison et al., Cell, 96: 737-49 (1999)).

These techniques allow the exploration of particular populations of cells, such as those that could be found with hematological malignancies (ie minimal residual disease (MRD) in patients with acute leukemia) and “non-own” cells in transplants to avoid graft disease against guest (GVHD). As an alternative, these techniques allow the exploration of stem cells and hematopoietic progenitors capable of experiencing proliferation and / or differentiation, as they could be found in human umbilical cord blood.

Trials for Antibody Binding

The antibodies of the invention can be tested for immunospecific binding by any method known in the art. Immunoassays that can be used include but are not limited to competitive and non-competitive assay systems that use techniques such as BIAcore analysis (see, for example, Example 59), FACS analysis (Fluorescence activated cell separation) (see, for example, Example 54), immunofluorescence (see, for example, Example 56), immunocytochemistry, western blots (see Examples 64 and 65), radioimmunoassays, ELISA (enzyme-linked immunosorbent assay) (See, for example, Example 54), immunoassays "sandwich" type, immunoprecipitation assays, precipitin reactions, gel diffusion precipitin reactions, immunodiffusion assays, agglutination assays, complement fixation assays, immunoradiometric assays, fluorescence immunoassays, protein A immunoassays, to name only a few. Such assays are routine and well known in the art (see, for example, Ausubel et al, eds, 1994, Current Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York). Exemplary immunoassays are briefly described below (but are not intended to be limiting).

Immunoprecipitation protocols generally comprise lysing a population of cells in a lysis buffer such as RIPA buffer (NP-40 or Triton X-100, 1% sodium deoxycholate, 0.1% SDS, 0.15 M NaCl, 0 sodium phosphate , 01 M at pH 7.2, Trasylol 1%) supplemented with protease inhibitors and / or protein phosphatase (for example, EDTA, PMSF, aprotinin, sodium vanadate), add the antibody of interest to the cell lysate, incubate for a period of time (for example, 1-4 hours) at 4 ° C, add sepharose beads of protein G and / or protein A to the cell lysate, incubate for about an hour or more at 4 ° C, wash the beads in lysis buffer and resuspend beads in sample buffer / SDS. The ability of the antibody of interest to immunoprecipitate a particular antigen can be evaluated by, for example, western blot analysis. One skilled in the art will know the parameters that can be modified to increase the binding of the antibody with an antigen and decrease the background (for example, by pre-clarifying the cell lysate with sepharose beads). For further analysis regarding immunoprecipitation protocols see, for example, Ausubel et al, eds, 1994, Current Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York at 10.16.1.

Western reference analysis generally comprises preparing protein samples, electrophoresis of the protein samples in a polyacrylamide gel (for example, SDS-PAGE 8% -20% depending on the molecular weight of the antigen, transferring the protein sample from the polyacrylamide gel to a membrane such as nitrocellulose, PVDF or nylon, block the membrane in blocking solution (for example, PBS with 3% BSA or nonfat milk), wash the membrane in wash buffer (for example, PBS-Tween 20), block the membrane with primary antibody (the antibody of interest) diluted in blocking buffer, washing the membrane in washing buffer, blocking the membrane with a secondary antibody (which recognizes the primary antibody, for example, an anti-human antibody) conjugated with a substrate Enzymatic (for example, horseradish peroxidase or alkaline phosphatase) or radioactive molecule (for example 32P or 1251) diluted in blocking buffer, wash the membrane in wash buffer or and detect the presence of the antigen. A person skilled in the art will know the parameters that can be modified to increase the detected signal and reduce the background noise. For further analysis regarding western blotting protocols see, for example, Ausubel et al, eds, 1994, Current Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York at 10.8.1.

ELISAs comprise preparing antigen, coating the wells of a 96-well microtiter plate with the antigen, adding the antibody of interest conjugated to a detectable compound such as an enzyme substrate (eg, horseradish peroxidase or alkaline phosphatase) with the well and incubate for a period of time and detect the presence of the antigen. In ELISAs the antibody of interest does not have to be conjugated to a detectable compound; instead, a second antibody (which recognizes the antibody of interest) conjugated to a detectable compound can be added to the well. In addition, instead of coating the well with the antigen, the antibody can coat the well. In this case, a second antibody conjugated to a detectable compound can be added after the addition of the antigen of interest to the coated well. One skilled in the art will know the parameters that can be modified to increase the detected signal as well as other variations of ELISAs known in the art. For additional analysis regarding ELISAs see, for example, Ausubel et al, eds, 1994, Current Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York at 11.2.1.

The binding affinity of an antibody with an antigen and the rate of dissociation of an antigen-antibody interaction can be determined by competitive binding assays. An example of a competitive binding assay is a radioimmunoassay comprising incubation of labeled antigen (e.g., 3H or 125I), or fragment or variant thereof, with the antibody of interest in the presence of increasing amounts of unlabeled antigen and the detection of the antibody bound to the labeled antigen. The affinity of the antibody of interest for a G protein Chemokine Receptor (CCR5) and binding dissociation rates can be determined from the data by scatchard representation analysis. Competition with a second antibody can also be determined using radio-assays. In this case, the G-protein Chemokine Receptor (CCR5) is incubated with antibody of interest conjugated with a labeled compound (eg, 3H or 125I labeled compound) in the presence of increasing amounts of a second unlabeled antibody. This type of competitive assay between two antibodies can also be used to determine whether two antibodies bind to the same or different epitopes.

In a preferred embodiment, BIAcore kinetic analysis is used to determine the rates of association and dissociation of antibody binding (including antibody fragments or variants thereof) with a G-protein Chemokine Receptor (CCR5) or fragments of a Receptor of G protein chemokine (CCR5). BIAcore kinetic analysis comprises analyzing the binding and dissociation of microplate antibodies with immobilized G-protein Chemokine Receptors (CCR5) on their surface as described in Example 59.

Therapeutic Uses

The antibodies of the invention can be used for administration to an animal patient, preferably a mammal and more preferably a human being, for the treatment of one or more of the diseases, disorders.

or conditions described. The therapeutic compounds of the invention include, but are not limited to, antibodies of the invention (including fragments thereof as described herein) and nucleic acids encoding antibodies of the invention (including fragments, analogs and derivatives thereof and anti-idiotypic antibodies as described herein). The antibodies of the invention can be used to treat, inhibit or prevent diseases, disorders or conditions associated with aberrant activity and / or expression of a CCR5 polypeptide, including, but not limited to, any one or more of the diseases, disorders or conditions described. In the present memory. The treatment and / or prevention of diseases, disorders or conditions associated with aberrant activity and / or expression of a CCR5 polypeptide includes, but is not limited to, relieving symptoms associated with those diseases, disorders or conditions. The antibodies of the invention can be provided in pharmaceutically acceptable compositions as are known in the art or as described herein.

A summary of the ways in which the antibodies of the present invention can be used therapeutically includes CCR5 polynucleotide or polypeptide binding locally or systemically in the body or by direct cytotoxicity of the antibody, for example as mediated by complement (CDC ) or by effector cells (ADCC). Some of these approaches are described in more detail below. Having the teachings provided herein, one skilled in the art will know how to use the antibodies of the present invention for diagnostic, control or therapeutic purposes without undue experimentation.

The antibodies of the present invention can be used advantageously in combination with other monoclonal or chimeric antibodies or with lymphocines or hematopoietic growth factors (such as, for example, IL2, IL-3 and IL-7), for example, which serve to increase the number or activity of effector cells that interact with the antibodies.

The antibodies of the invention can be administered alone or in combination with other types of treatments (for example, radiation therapy, chemotherapy, hormonal therapy, immunotherapy, antitumor agents and antiretroviral agents) (see Example 28, below). In a highly preferred embodiment, the antibodies of the invention can be administered alone or in combination with anti-retroviral agents (see Example 28, below). Generally, administration of products of a species origin or species reactivity (in the case of antibodies) which is the same species as that of the patient is preferred. Thus, in a preferred embodiment, antibodies, derived fragments, analogs or human nucleic acids are administered to a human patient for therapy or prophylaxis.

It is preferred to use potent and / or high affinity neutralizing antibodies and / or inhibitors against polypeptides or polynucleotides described herein, fragments or regions thereof, for both immunoassays directed to and therapy of disorders related to polynucleotides or polypeptides, including fragments thereof, described herein. Such antibodies, fragments or regions will preferably have an affinity with respect to polynucleotides or polypeptides described herein, including fragments thereof. Preferred binding affinities include those with a dissociation constant or Kd of less than 5 X 10-2 M, 10-2 M, 5 X 10-3 M, 10-3 M, 5 X 10-4 M, 10- 4 M. Most preferred binding affinities include those having a dissociation constant or Kd of less than 5 X 10-5 M, 10-5 M, 5 X 10-6 M, 10-6M, 5 X 10-7 M, 107 M, 5 X 10-8 M or 10-8 M. Even more preferred binding affinities include those with a dissociation constant or Kd of less than 5 X 10-9 M, 10-9 M, 5 X 10- 10 M, 10-10 M, 5 X 10-11 M, 10-11 M, 5 X 10-12 M, 10-12 M, 5 X 10-13 M, 10-13 M, 5 X 10-14 M , 10-14 M, 5 X 10-15 M, or 10-15 M.

Composition and Therapeutic / Prophylactic Administration

The invention provides human or humanized antibodies or fragments thereof and pharmaceutical compositions for the treatment or prevention that are for administration to a subject. In a preferred aspect, the compound is substantially purified (for example, substantially without substances that limit its effect or produce unwanted side effects). The subject is preferably an animal, including without limitation animals such as cows, pigs, horses, chickens, cats, dogs, etc., and is preferably a mammal and more preferably a human being.

The formulations and administration methods that can be employed when the compound comprises a nucleic acid or an immunoglobulin have been described above; additional appropriate formulations and routes of administration may be selected from those described hereinbelow.

Various delivery systems are known and can be used to administer an antibody or pharmaceutical composition of the invention, for example, encapsulation in liposomes, microparticles, microcapsules, recombinant cells capable of expressing the compound, receptor-mediated endocytosis (see, for example, Wu and Wu,

J. Biol. Chem. 262: 4429-4432 (1987)), construction of a nucleic acid as part of a retroviral or other vector, etc. Introduction methods include, but are not limited to intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural and oral routes. The compounds or compositions can be administered by any convenient route, for example by infusion or injection of embolate, by absorption through the epithelial or mucocutaneous lining (for example, oral mucosa, rectal and intestinal mucosa, etc.) and can be administered together with others. biologically active agents. Administration can be systemic or local. In addition, it may be desirable to introduce the antibodies or pharmaceutical compositions of the invention into the central nervous system by any suitable route, including intraventricular and intrathecal injection; Intraventricular injection can be facilitated by an intraventricular catheter, for example, attached to a reservoir, such as an Ommaya reservoir. Pulmonary administration may also be employed, for example, by the use of an inhaler or nebulizer and formulation with aerosol forming agent.

It may be desirable to administer the antibodies or pharmaceutical compositions of the invention locally to the area that needs treatment; this can be achieved by, for example, and without limitation, local infusion during surgery, topical application, for example, together with a dressing after surgery, by injection, by means of a catheter, by means of a suppository or by means of a implant, said implant being porous, non-porous or gelatinous material, including membranes, such as sialastic fibers or membranes. Preferably, when administering an antibody of the invention care should be taken to use materials in which the protein is not absorbed.

The compound or composition can be delivered in a vesicle, in particular a liposome (see Langer, Science

249: 1527-1533 (1990); Treat et al., In Liposomes in the Therapy of Infectious Disease and Cancer, Lopez-Berestein and Fidler (eds.), Liss, New York, p. 353-365 (1989); Lopez-Berestein, as in the previous reference, p. 317-327; see generally the same as in the previous reference).

The compound or composition can be supplied in a controlled release system. A pump can be used (see Langer, mentioned above; Sefton, CRC Crit. Ref. Biomed. Eng. 14: 201 (1987); Buchwald et al., Surgery 88: 507 (1980); Saudek et al., N. Engl J. Med. 321,574 (1989)). Polymeric materials can be used (see Medical Applications of Controlled Release, Langer and Wise (eds.), CRC Pres., Boca Raton, Florida (1974); Controlled Drug Bioavailability, Drug Product Design and Performance, Smolen and Ball (eds.), Wiley, New York (1984); Ranger and Peppas, J., Macromol. Sci. Rev. Macromol. Chem. 23: 61 (1983); see also Levy et al., Science 228: 190 (1985); During et al ., Ann. Neurol. 25: 351 (1989); Howard et al., J. Neurosurg. 71: 105 (1989)). A controlled release system may be placed near the therapeutic target, that is, the brain, thus requiring only a fraction of the systemic dose (see, for example, Goodson, in Medical Applications of Controlled Release, mentioned above, vol. 2 , p 115-138 (1984)).

Other controlled release systems are analyzed in the Langer review (Science 249: 1527-1533 (1990)).

When the compound is a nucleic acid encoding a protein, the nucleic acid can be administered in vivo to promote expression of its encoded protein, constructing it as part of an appropriate nucleic acid expression vector and administering it so that it becomes intracellular, for example, by using a retroviral vector (see U.S. Patent No. 4,980,286), by direct injection, by using microparticle bombardment (e.g., a gene gun; Biolistic, Dupont), coating with lipids, cell surface receptors or transfection agents, or by administration in connection with a homeobox-like peptide that is known to enter the nucleus (see, for example, Joliot et al., Proc. Natl. Acad. Sci. USA 88: 1864-1868 (1991)), etc. Alternatively, a nucleic acid can be introduced intracellularly and incorporated into the host cell's DNA for expression, by homologous recombination.

The present invention also provides pharmaceutical compositions. Such compositions comprise a therapeutically effective amount of a compound, ie an antibody of the invention, and a pharmaceutically acceptable carrier. In a specific embodiment, the term "pharmaceutically acceptable" means approved by a Federal government regulatory agency or a state government or listed in the United States Pharmacopoeia or other pharmacopoeia generally recognized for use in animals and more particularly in humans. The term "vehicle" refers to a diluent, adjuvant, excipient or transporter with which the therapeutic agent is administered. Such pharmaceutical vehicles may be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water is a preferred vehicle when the pharmaceutical composition is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be used as liquid vehicles, particularly for injectable solutions. Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, skimmed milk powder, glycerol, propylene glycol, water, ethanol and the like. The composition, if desired, may also contain minor amounts of wetting or emulsifying agents, or pH buffering agents. These compositions may take the form of solutions, suspensions, emulsions, tablets, pills, capsules, powders, prolonged release formulations and the like. The composition can be formulated as a suppository, with traditional binders and vehicles such as triglycerides. The oral formulation may include conventional vehicles such as those for pharmaceutical use of mannitol, lactose, starch, magnesium stearate, sodium saccharin, cellulose, magnesium carbonate, etc. Examples of suitable pharmaceutical vehicles are described in "Remington's Pharmaceutical Sciences" by E. W. Martin. Such compositions will contain therapeutically effective amounts of the compound, preferably in a purified form, together with a suitable amount of vehicle to provide the form for proper administration to the patient. The formulation should be adapted to the mode of administration.

In a preferred embodiment, the composition is formulated according to routine procedures as a pharmaceutical composition adapted for intravenous administration to humans. Typically, compositions for intravenous administration are solutions in sterile isotonic aqueous buffer. When necessary, the composition may also include a solubilizing agent and a local anesthetic such as lignocaine to soften the pain at the injection site. Generally, the ingredients are provided separately.

or mixed together in unit dosage form, for example, as a dry lyophilized powder or concentrated without water in a hermetically sealed container such as a blister or wafer indicating the amount of active agent. When the composition must be administered by infusion, it can be distributed with an infusion bottle containing sterile pharmaceutical water or saline solution. When the composition is administered by injection, a sterile water vial for injection or saline solution can be provided so that the ingredients can be mixed before administration.

The compounds of the invention can be formulated as neutral or salt forms. Pharmaceutically acceptable salts include those formed with anions such as those derived from hydrochloric, phosphoric, acetic, oxalic, tartaric acids, etc. and those formed with cations such as sodium, potassium, ammonium, calcium derivatives, ferric hydroxides, isopropylamine, triethylamine, 2-ethylamino ethanol, histidine, procaine, etc.

The amount of the compound of the invention that will be effective in the treatment, inhibition and prevention of a disease or disorder associated with aberrant activity and / or expression of a polypeptide described herein can be determined by conventional clinical techniques. In addition, in vitro assays can optionally be used to help identify the optimum dosage ranges. The precise dose to be used in the formulation will also depend on the route of administration and the severity of the disease or disorder and should be decided according to the discretion of the physician and the circumstances of each patient. The effective doses can be extrapolated from dose response curves derived from animal or in vitro model test systems.

For antibodies, the dosage administered to a patient is typically 0.1 mg / kg to 100 mg / kg of the patient's body weight. Preferably, the dosage to be administered to a patient is between 0.1 mg / kg and 20 mg / kg of the patient's body weight, more preferably 1 mg / kg to 10 mg / kg of the patient's body weight. Generally, human antibodies have a longer half-life within the human body than antibodies of other species due to the immune response to foreign polypeptides. Thus, lower dosages of human antibodies and less frequent administration are frequently possible. In addition, the dosage and frequency of antibody administration of the invention can be reduced by enhancing tissue uptake and penetration (eg, in the brain) of antibodies by modifications such as, for example, lipidation.

The invention also provides a kit comprising the antibody of the invention. Optionally there may be a notice associated with such container or containers in the manner prescribed by a government agency that regulates the manufacture, use or sale of biological or pharmaceutical products, said notice reflecting the approval by the agency of the manufacture, use or sale for administration human

Diagnostics and Imaging

Marked antibodies, and derivatives and analogs thereof, that specifically bind to a polypeptide of interest can be used for diagnostic purposes to detect, diagnose, predict or control diseases, disorders and / or conditions associated with aberrant activity and / or expression. of a CCR5 polypeptide. The detection of aberrant expression of a polypeptide of interest is described, comprising (a) testing the expression of the polypeptide of interest in cells or body fluid of an individual using one or more antibodies specific for the polypeptide of interest and (b) comparing the level of gene expression with a level of conventional gene expression, whereby an increase or decrease in the level of gene expression of the polypeptide tested compared to the level of conventional expression is indicative of an aberrant expression.

The invention provides a diagnostic assay for diagnosing a disorder, which comprises (a) testing the expression of the polypeptide of interest in cells or body fluid of an individual using antibodies of the invention specific to the polypeptide of interest and (b) comparing the level of gene expression with a conventional gene expression level, whereby an increase or decrease in the level of gene expression of the polypeptide tested compared to the level of conventional expression is indicative of a particular disorder. With respect to cancer, the presence of a relatively high amount of transcript in an individual's biopsy tissue may indicate a predisposition for the development of the disease or may provide a means to detect the disease before the appearance of actual clinical symptoms. A more definitive diagnosis of this type may allow health professionals to employ preventive measures or aggressive treatment earlier thus preventing further development or progression of cancer.

The antibodies of the invention can be used to test protein levels in a biological sample using classical immunohistological methods known to those skilled in the art (for example, see Jalkanen, et al.,

J. Cell. Biol. 101: 976-985 (1985); Jalkanen, et al., J. Cell. Biol. 105: 3087-3096 (1987)). Other antibody-based methods useful for detecting protein gene expression include immunoassays, such as the enzyme-linked immunosorbent assay (ELISA) and radioimmunoassay (RIA). Suitable antibody assay markers are known in the art and include enzymatic markers, such as glucose oxidase; radioisotopes, such as iodine (125I, 121I), carbon (14C), sulfur (35S), tritium (3H), indium (112In), and technetium (99Tc); luminescent markers such as luminol; and fluorescent markers, such as fluorescein and rhodamine, and biotin.

One aspect of the description in the detection and diagnosis of a disease or disorders associated with aberrant expression of a polypeptide of interest in an animal, preferably a mammal and more preferably a human being. The diagnosis comprises: a) administering (for example, parenterally, subcutaneously or intraperitoneally) to a subject an effective amount of a labeled molecule that specifically binds to the polypeptide of interest; b) wait for a temporary interval after administration to allow the labeled molecule to preferentially concentrate on sites in the subject where the polypeptide is expressed (and for the unbound labeled molecule to be removed at the background level); c) determine the level of fund; and d) detecting the labeled molecule in the subject, so that the detection of labeled molecule above the background level indicates that the subject has a particular disease or disorder associated with aberrant expression of the polypeptide of interest. The background level can be determined by various methods, including comparing the amount of labeled molecule detected with a previously determined conventional value for a particular system.

It will be understood in the art that the size of the subject and the imaging system used will determine the amount of other images necessary to produce diagnostic images. In the case of a radioisotope residue, for a human subject, the amount of radioactivity injected will normally vary from about 5 to 20 millicuries of 99 mTc. The antibody or labeled antibody fragment will preferably accumulate in the location of cells containing the specific protein. In vivo tumor imaging is described in S. W. Burchiel et al., "Immunopharmacokinetics of Radiolabeled Antibodies and Their Fragments." (Chapter 13 in Tumor Imaging: The Radiochemical Detection of Cancer, S.W. Burchiel and B. A. Rhodes, eds., Masson Publishing Inc. (1982).

Depending on several variables, including the type of marker used and the mode of administration, the time interval after administration to allow the labeled molecule to preferentially concentrate on sites in the subject and for the unbound labeled molecule to be eliminated at the level in the background it is from 6 to 48 hours, from 6 to 24 hours or from 6 to 12 hours. The time interval after administration may be 5 to 20 days or 5 to 10 days.

The control of the disease or disorder is carried out by repeating the method for diagnosis of the disease or disease, for example, one month after the initial diagnosis, six months after the initial diagnosis, one year after the initial diagnosis, etc.

The presence of the labeled molecule in the patient can be detected using methods known in the art for in vivo scanning. These methods depend on the type of marker used. Those skilled in the art will be able to determine the appropriate method to detect a particular marker. The methods and devices that can be used in the diagnostic methods of the invention include, but are not limited to, computerized tomography (CT), full body scanning such as positron emission tomography (PET), magnetic resonance imaging (MRI) and ultrasound .

In a specific embodiment, the molecule is labeled with a radioisotope and detected in the patient using a radiation-sensitive surgical instrument (Thurston et al., U.S. Patent No. 5,441,050). In another embodiment, the molecule is labeled with a fluorescent compound and is detected in the patient using a fluorescence sensitive scanning instrument. In another embodiment, the molecule is labeled with a positron emitting metal and is detected in the patient using positron emission tomography. In yet another embodiment, the molecule is labeled with a paramagnetic marker and detected in a patient using magnetic resonance imaging (MRI).

Kits

The present invention provides kits that can be used in the above methods. In one embodiment, a kit comprises an antibody of the invention, preferably a purified antibody, in one or more packages. In a specific embodiment, the kits of the present invention may additionally contain a substantially isolated polypeptide comprising an epitope that is specifically immunoreactive with an antibody included in the kit. Preferably, the kits of the present invention further comprise a control antibody that does not react with the polypeptide of interest. In another specific embodiment, the kits of the present invention contain a means for detecting the binding of an antibody with a polypeptide of interest (for example, the antibody can be conjugated to a detectable substrate such as a fluorescent compound, an enzyme substrate, a compound radioactive or a luminescent compound or a second antibody that recognizes the first antibody can be conjugated with a detectable substrate).

In another specific embodiment of the present invention, the kit is a diagnostic kit for use in serum screening containing specific antibodies against cancerous and / or proliferative polynucleotides and polypeptides. Such a kit may include a control antibody that does not react with the polypeptide of interest. Such a kit may include a substantially isolated polypeptide antigen comprising an epitope that is specifically immunoreactive with at least one anti-polypeptide antigen antibody. In addition, said kit includes means for detecting the binding of said antibody with the antigen (for example, the antibody can be conjugated to a fluorescent compound such as fluorescein or rhodamine that can be detected by flow cytometry). The kit may include a chemically synthesized or recombinantly produced polypeptide antigen. The kit's polypeptide antigen can also bind to a solid support.

In a more specific embodiment, the detection means of the kit described above includes a solid support to which said polypeptide antigen binds. Such a kit may also include an anti-human antibody labeled with an unbound reporter. In this embodiment, the binding of the antibody with the polypeptide antigen can be detected by binding said reporter labeled antibody.

In a further embodiment, the invention includes a diagnostic kit for use in serum screening containing CCR5 polypeptide antigens. The diagnostic kit includes a substantially isolated antibody specifically immunoreactive with polypeptide or polynucleotide antigens and means for detecting the binding of the polynucleotide or polypeptide antigen with the antibody. The antibody can bind to a solid support. The antibody can be a monoclonal antibody. The detection means of the kit may include a second labeled monoclonal antibody. Alternatively, or in addition, the detection means may include a labeled competitor antigen.

In a diagnostic configuration, the test serum is reacted with a solid phase reagent having a surface bound antigen obtained by the methods of the present description. After binding with antigen specific antibody to the reagent and removing unbound serum components by washing, the reagent is reacted with reporter-labeled anti-human antibody to bind the reporter with the reagent in proportion to the amount of antibody anti-antigen bound in the solid support. The reagent is washed again to remove the unbound labeled antibody and the amount of reporter associated with the reagent is determined. Typically, the reporter is an enzyme that is detected by incubation of the solid phase in the presence of a suitable fluorometric, luminescent or colorimetric substrate (Sigma, St. Louis, MO).

The solid surface reagent in the above test is prepared by known techniques for joining protein material with solid support material, such as polymer beads, rods, 96-well plates or filter material. These binding methods generally include non-specific absorption of the protein with the support or covalent binding of the protein, typically through a free amine group, with a chemically reactive group on the solid support, such as a carboxyl, hydroxyl or aldehyde group. activated. Alternatively, streptavidin coated plates may be used together with a biotinylated antigen or antigens.

In this way, a test system or kit for carrying out this diagnostic method is described. The kit generally includes a support with surface bound recombinant antigens and a reporter labeled anti-human antibody to detect surface bound anti-antigen antibody.

Fusion Proteins

Any G-protein Chemokine Receptor (CCR5) polypeptide can be used to generate fusion proteins. For example, the G-protein Chemokine Receptor polypeptide (CCR5), when fused with a second protein, can be used as an antigen marker. Antibodies induced against the G-protein Chemokine Receptor polypeptide (CCR5) can be used to indirectly detect the second protein by binding with the G-protein Chemokine Receptor. In addition, because secreted proteins are directed to cellular locations. Based on traffic signals, G-protein Chemokine Receptor (CCR5) polypeptides can be used as targeting molecules once fused with other proteins.

Examples of domains that can be fused with G-protein Chemokine Receptor polypeptides (CCR5) include not only heterologous signal sequences, but also other heterologous functional regions. Fusion does not necessarily have to be direct, but can occur through linker sequences.

The G-protein Chemokine Receptor (CCR5) proteins may comprise fusion proteins in which the G-protein Chemokine Receptor (CCR5) polypeptides are those described above as m-n. The application describes nucleic acid molecules at least 90%, 95%, 96%, 97%, 98% or 99% identical to nucleic acid sequences encoding polypeptides having the amino acid sequence of specific N and C terminal deletions indicated herein. Polynucleotides encoding these polypeptides are also described.

In addition, fusion proteins can also be obtained by genetic engineering to improve the characteristics of the G-protein Chemokine Receptor polypeptide (CCR5). For example, a region of additional amino acids, particularly charged amino acids, can be added to the N-terminus of the G-protein Chemokine Receptor polypeptide (CCR5) to improve stability and persistence during host cell purification or subsequent handling and storage. In addition, peptide moieties can be added to the G-protein Chemokine Receptor polypeptide (CCR5) to facilitate purification. Such regions can be removed before final preparation of the G protein Chemokine Receptor polypeptide (CCR5). The addition of peptide moieties to facilitate manipulation of polypeptides are familiar and routine techniques in the field.

As one skilled in the art will appreciate, the polypeptides and epitope-bearing fragments thereof described above can be combined with heterologous polypeptide sequences. For example, polypeptides (including fragments or variants thereof), can be fused to the constant domain of immunoglobulins (IgA, IgE, IgG, IgM), or parts thereof (CH1, CH2, CH3, or any combination thereof). themselves and parts thereof), resulting in chimeric polypeptides. As another non-limiting example, the polypeptides and / or antibodies of the present invention (including fragments or variants thereof) can be fused with albumin (including without limitation recombinant human serum albumin or fragments or variants thereof (see, for example , U.S. Patent No. 5,876,969, issued March 2, 1999, EP 0 413 622 and U.S. Patent No. 5,766,883, issued June 16, 1998)). In a preferred embodiment, the antibodies of the present invention, (including fragments thereof) are fused with the mature form of human serum albumin (i.e. amino acids 1-585 of human serum albumin as shown in Figures 1 and 2 of EP Patent 0 322 094). In another preferred embodiment, the antibodies of the present invention, (including fragments thereof) are fused with polypeptide fragments comprising, or as an alternative consisting of, 1-z amino acid residues of human serum albumin, z being an integer 369-419, as described in US Patent 5,766,883. The antibodies of the present invention (including fragments thereof) can be fused to the N or C terminal end of the heterologous protein (for example, immunoglobulin Fc polypeptide or human serum albumin polypeptide). Polynucleotides encoding fusion proteins of the invention are also encompassed by the invention.

These fusion proteins facilitate purification and show an increased in vivo half-life. An indicated example describes chimeric proteins consisting of the first two domains of the human CD4 polypeptide and various domains of the constant regions of the mammalian immunoglobulin heavy or light chains (EP A 394,827; Traunecker et al., Nature 331: 84- 86 (1988)). Fusion proteins that have disulfide-linked dimeric structures (due to IgG) may also be more effective in binding and neutralizing other molecules, than the secreted monomeric protein or protein fragment alone. (Fountoulakis et al., J. Biochem. 270: 3958-3964 (1995).)

Similarly, EP-A-O 464 533 (Canadian homologue 2045869) describes fusion proteins that comprise various parts of the constant region of immunoglobulin molecules together with another human protein or part thereof. In many cases, the Fc part in a fusion protein is beneficial in therapy and diagnosis and thus can result in, for example, improved pharmacokinetic properties (EP-A 0232 262). Alternatively, it would be desirable to remove the Fc part after the fusion protein has been expressed, detected and purified. For example, the Fc part may hamper therapy and diagnosis if the fusion protein is used as an antigen for immunizations. In drug discovery, for example, human proteins, such as hIL-5, have been fused with Fc parts in order to perform high-performance screening assays to identify hIL-5 antagonists. (See, D. Bennett et al., J. Molecular Recognition 8: 52-58 (1995); K. Johanson et al., J. Biol. Chem. 270: 9459-9471 (1995)).

In addition, polypeptides of the G-protein Chemokine Receptor (CCR5) can be fused with marker sequences, such as a peptide that facilitates purification of the G-protein Chemokine Receptor. In preferred embodiments, the marker amino acid sequence is a hexahistidine peptide, such as the marker provided in a pQE vector (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, CA, 91311), among others, many of which are commercially available. As described in Gentz et al., Proc. Natl Acad. Sci. USA

86: 821-824 (1989), for example, hexahistidine enables convenient purification of the fusion protein. Another peptide marker useful for purification, the "HA" marker, corresponds to an epitope derived from influenza hemagglutinin protein (Wilson et al., Cell 37: 767 (1984).)

Thus, any of these above fusions can be obtained by genetic engineering using polynucleotides or G-protein Chemokine Receptor polypeptides (CCR5).

Production of Proteins, Vectors and Hosting Cells

Vectors containing the G protein Chemokine Receptor polynucleotide (CCR5), host cells and the production of polypeptides by recombinant techniques are also described. The vector can be, for example, a phage, plasmid, viral or retroviral vector. Retroviral vectors may be competent in replication or defective in replication. In the second case, viral propagation will generally only occur in complementary host cells.

The G-protein Chemokine Receptor polynucleotides (CCR5) can be linked to a vector containing a selectable marker for propagation in a host. Generally, a plasmid vector is introduced into a precipitate, such as a calcium phosphate precipitate or into a complex with a charged lipid. If the vector is a virus, it can be packaged in vitro using an appropriate packaging cell line and then transduced into host cells.

The G protein Chemokine Receptor polynucleotide insert (CCR5) should be operably linked to an appropriate promoter, such as the phage lambda PL promoter, the E. coli lac, trp, phoA and tac promoters, the early and late promoters of SV40 and the retroviral LTR promoters, to name a few. Other suitable promoters will be known to those skilled in the art. Expression constructs will additionally contain sites for initiation, termination of transcription and, in the transcribed region, a ribosome binding site for translation. The coding part of the transcripts expressed by the constructs will preferably include a translation start codon at the beginning and a termination codon (UAA, UGA or UAG) appropriately located at the end of the polypeptide to be translated.

As indicated, the expression vectors will preferably include at least one selectable marker. Such markers include dihydrofolate reductase, G418, glutamine synthase or neomycin resistance for eukaryotic cell culture and tetracycline, kanamycin or ampicillin resistance genes for culturing in E. coli and other bacteria. Representative examples of appropriate hosts include, but are not limited to, bacterial cells, such as E. coli, Streptomyces and Salmonella typhimurium cells; fungal cells, such as yeast cells (for example, Saccharomyces cerevisiae or Pichia pastoris (ATCC Accession No. 201178)); insect cells such as Drosophila S2 and Spodoptera Sf9 cells; animal cells such as CHO, NSO, COS, 293 and Bowes melanoma cells; and plant cells. Culture media and conditions suitable for the host cells described above are known in the art.

Vectors using glutamine synthase (GS) or DHFR as the selectable markers can be amplified in the presence of the drugs methionine sulfoximiin or methotrexate, respectively. The availability of drugs that inhibit the function of the enzymes encoded by these selectable markers allows the selection of cell lines in which the sequences of the vectors have been amplified after integration into the host cell's DNA. An advantage of glutamine synthase-based vectors is the availability of cell lines (eg, the murine myeloma cell line, NS0) that are negative for glutamine synthase. Glutamine synthase expression systems can also act on cells expressing glutamine synthase (for example, Chinese Hamster Ovary (CHO) cells) by providing an additional inhibitor to prevent the action of the endogenous gene. Vectors using glutamine synthase as the selectable marker include the expression vector pEE6 described in Stephens and Cockett, Nucl. Acids Res 17: 7110 (1989). A glutamine synthase expression system and components thereof are detailed in PCT publications: WO87 / 04462; WO86 / 05807; WO89 / 01036; WO89 / 10404; and WO91 / 06657. Additionally, glutamine synthase expression vectors that can be used in accordance with the present invention are available from the vendor market that include, for example, Lonza Biologics, Inc. (Portsmouth, NH). The expression and production of monoclonal antibodies using a GS expression system in murine myeloma cells are described in Bebbington et al., Bio / technology 10: 169 (1992) and in the Bible and Robinson Biotechnol. Prog. 11: 1 (1995).

Preferred vectors for use in bacteria include pQE70; pQE60 and pQE-9, available from QIAGEN, Inc .; pBluescript vectors, Phagescript vectors, pNH8A, pNH16a, pNH18A, pNH46A, available from Stratagene Cloning Systems, Inc .; and ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 available from Pharmacia Biotech, Inc. Among the preferred eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXT1 and pSG available from Stratagene; and pSVK3, pBPV, pMSG and pSVL available from Pharmacia. Preferred expression vectors for use in yeast systems include, but are not limited to pYES2, pYD1, pTEF1 / Zeo, pYES2 / GS, pPICZ, pGAPZ, pGAPZalph, pPIC9, pPIC3.5, pHIL-D2, pHIL-S1, pPIC3 .5K; pPIC9K, and PA0815 (all available from Invitrogen, Carlsbad, CA). Other suitable vectors will be apparent to the person skilled in the art.

The introduction of the construct into the host cell can be effected by transfection of calcium phosphate, transfection mediated by DEAE-dextran, transfection mediated by cationic lipids, electroporation, transduction, infection or other methods. Such methods are described in many conventional laboratory manuals, such as Davis et al., Basic Methods In Molecular Biology (1986). It is specifically contemplated that G-protein Chemokine Receptor (CCR5) polypeptides can in fact be expressed by a host cell lacking a recombinant vector.

G-protein Chemokine Receptor (CCR5) polypeptides can be recovered and purified from recombinant cell cultures by well known methods including precipitation with ammonium or ethanol sulfate, acid extraction, anionic or cationic exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxyapatite chromatography and lectin chromatography. More preferably, high performance liquid chromatography ("HPLC") is used for purification.

Polypeptides of the G-protein Chemokine Receptor (CCR5), and preferably the secreted form, can also be recovered from: purified products from natural sources, including cells, tissues and body fluids, directly isolated or cultured; chemical synthetic process products; and products produced by recombinant techniques from a prokaryotic or eukaryotic host, including, for example, bacterial, yeast, higher plant, insect and mammalian cells. Depending on the host employed in a recombinant production process, the G-protein Chemokine Receptor (CCR5) polypeptides may be glycosylated or non-glycosylated. In addition, the G-protein Chemokine Receptor polypeptides (CCR5) may also include an initial modified methionine moiety, in some cases as a result of host-mediated procedures. Thus, it is well known in the art that the N-terminal methionine encoded by the translation start codon is generally removed with high efficiency from any protein after translation in all eukaryotic cells. Although the N-terminal methionine in most proteins is also effectively removed in most prokaryotes, for some proteins, this prokaryotic withdrawal process is ineffective, depending on the nature of the amino acid to which the covalently bound N-terminal methionine.

Pichia pastoris yeast can be used to express G-Chemokine Receptor protein (CCR5) in a eukaryotic system. Pichia pastoris is a methylotrophic yeast that can metabolize methanol as its sole source of carbon. A major stage in methanol metabolization pathways is the oxidation of methanol to formaldehyde using O2. This reaction is catalyzed by the enzyme alcohol oxidase. To metabolize methanol as its sole source of carbon, Pichia pastoris must generate high levels of alcohol oxidase due, in part, to the relatively low affinity of alcohol oxidase for O2. Consequently, in a methanol-dependent growth medium as a main carbon source, the promoter region of one of the two alcohol oxidase (AOX1) genes is highly active. In the presence of methanol, the alcohol oxidase produced from the AOX1 gene comprises up to about 30% of the total soluble protein in Pichia pastoris. See, Ellis, S. B., et al., Mol. Cell Biol. 5: 1111-21 (1985); Koutz, P. J, et al., Yeast 5: 167-77 (1989): Tschopp, J. F., et al., Nucl. Acids Res. 15: 3859-76 (1987). Thus, a heterologous coding sequence, such as, for example, a G-protein Chemokine Receptor polynucleotide (CCR5) in transcriptional regulation of all or part of the AOX1 regulatory sequence is expressed at exceptionally high levels in Pichia yeast. grown in the presence of methanol.

In one example, the pPIC9K plasmid vector is used to express DNA encoding a G-protein Chemokine Receptor polypeptide (CCR5) as set forth herein, in a Pichia yeast system essentially as described in "Pichia Protocols. : Methods in Molecular Biology, ”DR Higgins and J. Cregg, eds. The Humana Press, Totowa, NJ, 1998. This expression vector allows the expression and secretion of a G-protein Chemokine Receptor protein (CCR5) based on the strong AOX1 promoter bound to the signal peptide (i.e., leader) Pichia pastoris alkaline phosphatase (PHO) secretor located upstream of a multiple cloning site.

Many other yeast vectors could be used in place of pPIC9K, such as, pYES2, pYD1, pTEF1 / Zeo, pYES2 / GS, pPICZ, pGAPZ; pGAP2alfa, pPIC9, pPIC3.5, pHIL-D2, pHIL-S1, pPIC3.5K, and PAO815, as one skilled in the art would readily appreciate, provided that the proposed expression construct provides signals located appropriately for transcription, translation , secretion (if desired) and the like, including a phase AUG as required.

High-level expression of a heterologous coding sequence, such as, for example, a G-protein Chemokine Receptor polynucleotide (CCR5) can be achieved by cloning the heterologous polynucleotide into an expression vector such as, for example, pGAPZ or pGAPZalfa and letting the yeast culture grow in the absence of methanol.

In addition to encompassing host cells that contain the vector constructs analyzed herein, primary, secondary and immortalized host cells of vertebrate origin, particularly of mammalian origin, which have been engineered to remove or replace material are also described. Endogenous genetic (for example, coding sequence of the G-protein Chemokine Receptor (CCR5)) and / or to include genetic material (eg, heterologous polynucleotide sequences) that is operatively associated with G-protein Chemokine Receptor polynucleotides ( CCR5) and that activates, alters and / or amplifies endogenous G-protein Chemokine Receptor (CCR5) polynucleotides. For example, techniques known in the art can be used to operatively associate heterologous control regions (eg, promoter and / or enhancer) and endogenous G-protein Chemokine Receptor polynucleotide sequences (CCR5) by homologous recombination, giving as result of the formation of a new transcription unit (see, for example, US Patent No. 5,641,670, issued June 24, 1997; United States Patent No. 5,733,761, issued March 31, 1998; Publication International No. WO 96/29411, published September 26, 1996; International Publication No. WO 94/12650, published August 4, 1994; Koller et al., Proc. Natl. Acad. Sci. USA 86: 8932-8935 (1989); and Zijlstra et al., Nature 342: 435-438 (1989).

In addition, polypeptides can be chemically synthesized using techniques known in the art (eg, see Creighton, 1983, Proteins: Structures and Molecular Principles, WH Freeman & Co., NY, and Hunkapiller et al., Nature, 310: 105-111 ( 1984)). For example, a polypeptide corresponding to a fragment of a G-protein Chemokine Receptor polypeptide (CCR5) can be synthesized by the use of a peptide synthesizer. In addition, if desired, non-classical amino acids or chemical amino acid analogs can be introduced as a substitution or addition in the G-Chemokine Receptor polypeptide sequence (CCR5). Non-classical amino acids include, but are not limited to, the D-isomers of the usual amino acids, 2,4-diaminobutyric acid, a-amino isobutyric acid, 4-aminobutyric acid, Abu, 2-amino butyric acid, g-Abu, e-Ahx , 6-amino hexanoic acid, Aib, 2-amino isobutyric acid, 3-amino propionic acid, ornithine, norleucine, norvaline, hydroxyproline, sarcosine, citrulline, homocitrulline, cysteic acid, t-butylglycine, t-butylalanine, phenylglycine, cyclohexylalanine Alanine, fluoro amino acids, design amino acids such as b-methyl amino acids, Ca-methyl amino acids, Na-methyl amino acids and amino acid analogs in general. In addition, the amino acid can be D (dextrógiro) or L (levógiro).

Polypeptides of the G-protein Chemokine Receptor (CCR5) are described that are differentially modified during or after translation, for example, by glycosylation, acetylation, phosphorylation, amidation, derivatization by known protecting groups / blockages, proteolytic cleavage, binding with an antibody molecule or other cell ligand, etc. Any of numerous chemical modifications can be carried out by known techniques, including, but not limited to, specific chemical cleavage by cyanogen bromide, trypsin, chymotrypsin, papain, protease V8, NaBH4; acetylation, formylation, oxidation, reduction, metabolic synthesis in the presence of tunicamycin; etc.

Additional post-translational modifications encompassed include, for example, N-linked or O-linked carbohydrate chains, N-terminal or C-terminal end processing, chemical moieties with the main amino acid chain, chemical modifications of linked carbohydrate chains in N or O-linked and addition or deletion of a N-terminal methionine residue as a result of expression in prokaryotic host cells. The polypeptides can also be modified with a detectable label, such as an enzymatic, fluorescent, isotopic or affinity label to allow detection and isolation of the protein.

Chemically modified derivatives of the polypeptides that can provide additional advantages such as increased solubility, stability and circulation time of the polypeptide or decreased immunogenicity are also described (see US Patent No. 4,179,337). The chemical moieties for derivatization can be selected from water soluble polymers such as polyethylene glycol, ethylene glycol / propylene glycol copolymers, carboxymethyl cellulose, dextran, polyvinyl alcohol and the like. The polypeptides may be modified at random positions within the molecule or at predetermined positions within the molecule and may include one, two, three or more attached chemical moieties.

The polymer can be of any molecular weight and can be branched or unbranched. For polyethylene glycol, the preferred molecular weight is between about 1 kDa and about 100 kDa (indicating the term "about" than in polyethylene glycol preparations, some molecules will weigh more, some less, than the indicated molecular weight) to facilitate handling and manufacturing. Other sizes may be used, depending on the desired therapeutic profile (for example, the duration of the desired prolonged release, the effects, if any, on the biological activity, the ease of handling, the degree or lack of antigenicity and other known effects of polyethylene glycol with a therapeutic or analog protein).

Polyethylene glycol molecules (or other chemical moieties) should bind with the protein considering the effects on the functional or antigenic domains of the protein. There are several methods of attachment available to those skilled in the art, for example, EP 0 401 384, (coupling of PEG with G-CSF), see also Malik et al., Exp. Hematol. 20: 1028-1035 (1992) (indicating pegylation of GM-CSF using tresyl chloride). For example, polyethylene glycol can be covalently linked through amino acid residues by a reactive group, such as, a free amino or carboxyl group. Reactive groups are those that can bind with an activated polyethylene glycol molecule. Amino acid residues having a free amino group may include lysine residues and N-terminal amino acid residues; Those with a free carboxyl group may include aspartic acid residues, glutamic acid residues and the C-terminal amino acid residue. Sulfhydryl groups can also be used as a reactive group to bind polyethylene glycol molecules. For therapeutic purposes, binding in an amino group is preferred, such as binding at the N-terminus or lysine group.

Specifically, chemically modified proteins may be desired at the N-terminal end. Using polyethylene glycol as an illustration of the present composition, the proportion of polyethylene glycol molecules with protein molecules (polypeptides) in the reaction mixture, can be selected from a variety of polyethylene glycol molecules (by molecular weight, branching, etc.). type of pegylation reaction to be carried out and the method to obtain the pegylated protein in N terminal selected. The method of obtaining the pegylated N-terminal preparation (that is, separating this rest from other monopegylated moieties if necessary) can be by purification of the pegylated N-terminal material from a population of pegylated protein molecules. The chemically modified selective proteins in the modification of the N-terminal end can be achieved by reductive alkylation that takes advantage of the differential reactivity of different types of primary amino groups (lysine versus N-terminal) available for derivatization in a particular protein. Under the appropriate reaction conditions, substantially selective derivatization of the protein at the N-terminal end is achieved with a polymer containing carbonyl group.

Polypeptides of the G-protein Chemokine Receptor (CCR5) may be in monomers or multimers (ie, dimers, trimers, tetramers and larger multimers). Accordingly, monomers and multimers of the G-protein Chemokine Receptor polypeptides (CCR5), their preparation and compositions (preferably, Therapeutic) containing them are described. The polypeptides can be monomers, dimers, trimers or tetramers. The multimers can be at least dimers, at least trimers or at least tetramers.

The encompassed multimers can be homomers or heteromers. As used herein, the term "homomer" refers to a multimer containing only polypeptides corresponding to the amino acid sequence of SEQ ID NO: 2 or encoded by the HDGNR10 DNA contained in the deposited clone (including fragments, variants , splice variants and fusion proteins, corresponding thereto as described herein). These homomers may contain G-protein Chemokine Receptor polypeptides (CCR5) that have identical or different amino acid sequences. A homomer can be a multimer containing only polypeptides of the G-protein Chemokine Receptor (CCR5) having an identical amino acid sequence. A homomer can be a multimer containing polypeptides of the G-protein Chemokine Receptor (CCR5) that have different amino acid sequences. The multimer may be a homodimer (for example, which contains G-protein Chemokine Receptor polypeptides (CCR5) having identical or different amino acid sequences) or a homotimer (for example, which contain G-protein Chemokine Receptor polypeptides ( CCR5) that have identical and / or different amino acid sequences). The homomeric multimer can be at least one homodimer, at least one homotimer or at least one homotetramer.

As used herein, the term "heteromer" refers to a multimer containing one or more heterologous polypeptides (i.e., polypeptides of different proteins) in addition to the polypeptides of the G-protein Chemokine Receptor (CCR5). The multimer may be a heterodimer, a heterotrimer or a heterotetramer. The heteromeric multimer can be at least one heterodimer, at least one heterotrimer or at least one heterotetramer.

The multimers may be the result of hydrophobic, hydrophilic, ionic and / or covalent associations and / or may be indirectly linked by, for example, liposome formation. In this way, multimers, such as, for example, homodimers or homotymers, can be formed when the polypeptides come into contact with each other in solution. Heteromultimers, such as, for example, heterotrimers or heterotetramers, may be formed when the polypeptides come into contact with antibodies of the polypeptides (including antibodies to the heterologous polypeptide sequence in a fusion protein) in solution. Multimers can be formed by covalent associations with and / or between the G-protein Chemokine Receptor polypeptides (CCR5). Such covalent association may involve one or more amino acid residues contained in the polypeptide sequence (for example, that indicated in SEQ ID NO: 2 or contained in the polypeptide encoded by clone HDGNR10). In one case, covalent associations form cross-linking between cysteine residues located within the polypeptide sequences that interact in the native polypeptide (i.e., of natural origin). In another case, covalent associations are the consequence of chemical or recombinant manipulation. Alternatively, such covalent associations may involve one or more amino acid residues contained in the heterologous polypeptide sequence in a fusion protein of the G-protein Chemokine Receptor (CCR5). In one example, covalent associations are between the heterologous sequence contained in a fusion protein (see, for example, US Patent No. 5,478,925). Covalent associations may be between the heterologous sequence contained in a F-Chemokine Receptor fusion protein G protein (CCR5) (as described herein). Covalent associations of fusion proteins may be between heterologous polypeptide sequence of another protein that is capable of forming covalently associated multimers, such as, for example, osteoprotegerin (see, for example, International Publication No. WO 98/49305). Two or more polypeptides can be linked through peptide linkers. Examples include the peptide linkers described in U.S. Patent No. 5,073,627. Proteins comprising multiple polypeptides of the invention separated by peptide linkers can be produced using conventional recombinant DNA technology.

Another method of preparing multimeric polypeptides involves the use of fused polypeptides with a leucine zipper or isoleucine zipper polypeptide sequence. The leucine zipper and isoleucine zipper domains are polypeptides that promote the multimerization of the proteins in which they are found. Leucine zippers were originally identified in several DNA binding proteins (Landschulz et al., Science 240: 1759, (1988)) and have since been discovered in a variety of different proteins. Known leucine zippers include naturally occurring peptides and derivatives thereof that dimerize or trimerize. Examples of leucine zipper domains suitable for producing soluble multimeric proteins of the invention are those described in PCT application WO 94/10308. Recombinant fusion proteins comprising a polypeptide described herein are fused with a polypeptide sequence that dimerizes or trimerizes in solution in suitable host cells and the resulting soluble multimeric fusion protein is recovered from the culture supernatant using techniques known in the art. .

Trimeric polypeptides may offer the advantage of improving biological activity. The preferred leucine zipper moieties and isoleucine moieties are those that preferably form trimers. An example is a leucine zipper derived from lung surfactant protein D (SPD), as described in Hoppe et al. (FEBS Letters

344: 191, (1994)) and in U.S. Patent Application Serial No. 08 / 446,922. Other peptides derived from naturally occurring trimeric proteins can be used in the preparation of trimeric polypeptides.

In another example, the proteins are associated by interactions between Flag® polypeptide sequence contained in fusion proteins containing Flag® polypeptide sequence. Association proteins can be associated by interactions between heterologous polypeptide sequences contained in the Flag® and anti-Flag® antibody fusion proteins.

Multimers can be generated using chemical techniques known in the art. For example, the polypeptides that are desired to be contained in the multimers can be chemically crosslinked using linker molecules and linker length optimization techniques known in the art (see, for example, US Patent No. 5,478,925). Additionally, multimers can be generated using techniques known in the art to form one or more intermolecular crosslinks between cysteine residues located within the sequence of the polypeptides that are desired to be contained in the multimer (see, for example, US Pat. No. 5,478,925). Additionally, the polypeptides can be routinely modified by the addition of cysteine or biotin at the C-terminal or N-terminus of the polypeptide and techniques known in the art can be applied to generate multimers containing one or more of these modified polypeptides (see, for example, U.S. Patent No. 5,478,925). Additionally, techniques known in the art can be applied to generate liposomes containing the components containing the polypeptide components that are desired to be contained in the multimer of the invention (see, for example, US Patent No. 5,478,925).

Alternatively, multimers can be generated using genetic engineering techniques known in the art. Polypeptides contained in multimers can be produced recombinantly using fusion protein technology described herein or otherwise known in the art (see, for example, US Patent 5,478,925). Polynucleotides encoding a homodimer can be generated by linking a polynucleotide sequence encoding a polypeptide with a sequence encoding a linker polypeptide and then additionally with a synthetic polynucleotide encoding the translated product of the polypeptide in the reverse orientation from the original C-terminal end to the N-terminal (without the leader sequence) (see, for example, US Patent Number 5,478,925). Recombinant techniques described herein or otherwise known in the art can be applied to generate recombinant polypeptides that contain a transmembrane domain (or signal or hydrophobic peptide) and that can be incorporated by membrane reconstitution techniques in liposomes (see, for example , U.S. Patent No. 5,478,925).

Uses of G-protein Chemokine Receptor polynucleotides (CCR5)

The G-protein Chemokine Receptor polynucleotides (CCR5) identified herein can be used in numerous ways as reagents. The following description should be considered exemplary and uses known techniques.

There is a constant need to identify new chromosomal markers, since few chromosomal marker reagents are currently available, based on actual sequence data (repeat polymorphisms).

Briefly, sequences can be mapped onto chromosomes by preparing PCR primers (preferably 15-25 bp) of the sequences shown in SEQ ID NO: or of the deposited clone. The primers can be selected using computer analysis so that the primers do not cover more than one exon predicted in the genomic DNA. These primers can then be used for PCR scanning of somatic cell hybrids containing individual human chromosomes. Only hybrids that contain the human G-protein Chemokine Receptor gene (CCR5) corresponding to SEQ ID NO: 1 or the deposited clone will produce an amplified fragment.

Similarly, somatic hybrids provide a rapid method of PCR mapping of polynucleotides on particular chromosomes. Three or more clones can be assigned per day using a simple thermal cycler. In addition, sublocalization of the G-protein Chemokine Receptor polynucleotides (CCR5) with panels of specific chromosomal fragments can be achieved. Other gene mapping strategies that can be used include in situ hybridization, preexploration with labeled flow-selected chromosomes and hybridization preselection to construct chromosome-specific cDNA libraries.

The precise chromosomal localization of the G protein Chemokine Receptor polynucleotides (CCR5) can also be achieved using in situ fluorescence hybridization (FISH) of a metaphase chromosome extension. This technique uses polynucleotides as short as 500 or 600 bases; however, 2,000-4,000 bp polynucleotides are preferred. For a review of this technique, see Verma et al., "Human Chromosomes: a Manual of Basic Techniques," Pergamon Press, New York (1988).

For chromosome mapping, G-protein Chemokine Receptor polynucleotides (CCR5) can be used individually (to mark a single chromosome or a single site on that chromosome) or in panels (to mark multiple sites and / or multiple chromosomes). Preferred polynucleotides correspond to the non-coding regions of the cDNA or genomic clone because the coding sequences are probably more conserved within gene families, thereby increasing the possibility of cross hybridization during chromosomal mapping.

Once a polynucleotide has been mapped to a precise chromosomal location, the physical position of the polynucleotide can be used in link analysis. The linkage analysis establishes joint inheritance between a chromosomal location and the presentation of a particular disease. (Disease mapping data are found, for example, in V. McKusick, Mendelian Inheritance in Man (available online through Johns Hopkins University Welch Medical Library)). Assuming a mapping resolution of one megabase and one gene for every 20 kb, a cDNA precisely located in a chromosomal region associated with the disease could be one of 50-500 potential causative genes.

Thus, once joint inheritance is established, differences in the G-protein Chemokine Receptor polynucleotide (CCR5) and the corresponding gene between affected and unaffected individuals can be examined. First, visible structural alterations in chromosomes, such as deletions, are examined

or translocations in chromosome extensions or by PCR. If there are no structural alterations, the presence of specific mutations is determined. The mutations observed in some or all affected individuals, but not in normal individuals, indicate that the mutation can cause the disease. However, complete sequencing of the G protein Chemokine Receptor (CCR5) polypeptide and the corresponding gene from several normal individuals is required to distinguish a polymorphism mutation. If a new polymorphism is identified, this polymorphic polypeptide can be used for further binding analysis.

In addition, increased or decreased gene expression in affected individuals compared to unaffected individuals can be evaluated using G protein Chemokine Receptor polynucleotides (CCR5). Any of these alterations (altered expression, chromosomal rearrangement or mutation) can be used as a diagnostic or prognostic marker.

A useful diagnostic method is described during the diagnosis of a disorder, which involves measuring the level of expression of polynucleotides encoding CCR5 in cells or body fluid of an individual and comparing the level of expression of the measured gene with a conventional level of level of polynucleotide expression, so an increase

or decrease in the level of gene expression compared to conventional is indicative of a disorder.

A kit for analyzing samples with respect to the presence of cancerous and / or proliferative polynucleotides derived from a test subject is described. The kit may include at least one polynucleotide probe containing a nucleotide sequence that will specifically hybridize with a CCR5 polynucleotide and a suitable container. The kit may include two polynucleotide probes that define an internal region of the polynucleotide, each probe having a chain containing a 31'mer end internal to the region. The probes may be useful as primers for polymerase chain reaction amplification.

When a diagnosis of a disorder has already been made according to conventional methods, the present description is useful as a prognostic indicator, so that patients who show enhanced or reduced polynucleotide expression will experience a worse clinical outcome in relation to patients. that express the gene at a level closer to the conventional level.

By "measuring the level of CCR5 polynucleotide expression" it is intended to measure qualitatively or quantitatively or estimate the level of the CCR5 polypeptide or the level of the mRNA encoding the polypeptide in a first biological sample directly (for example, by determining or estimating of the absolute protein level or mRNA level) or relatively (for example, by comparison of the polypeptide level or mRNA level in a second biological sample). Preferably, the level of polypeptides or mRNA level in the first biological sample is measured or estimated and compared to a conventional polypeptide level or mRNA level, the conventional one being taken from a second biological sample obtained from an individual who does not have the disorder. or being determined by average levels of a population of individuals who do not have a disorder. As will be understood in the art, once a polypeptide level or conventional mRNA level is known, it can be repeatedly used as a standard for comparison.

By "biological sample" is intended any biological sample obtained from an individual, body fluid, cell line, tissue culture or any other source containing the mRNA or polypeptide of CCR5. As indicated, biological samples include body fluids (such as semen, lymph, serum, plasma, urine, synovial fluid and spinal fluid) that contain the CCR5 polypeptide and any other tissue source that has been discovered to express the CCR5 polypeptide. . Methods for obtaining tissue biopsies and mammalian body fluids are well known in the art. When the biological sample must include mRNA, the preferred source is a tissue biopsy.

The method or methods provided above may preferably be applied in a diagnostic method and / or kits in which the polynucleotides and / or polypeptides are attached to a solid support. In an exemplary method, the support can be a "gene microplate" or a "biological microplate" as described in US Patents 5,837,832, 5,874,219 and 5,856,174. In addition, such a gene microplate with bound CCR5 polynucleotides can be used to identify polymorphisms between the polynucleotide sequences, with polynucleotides isolated from a test subject. The knowledge of such polymorphisms (ie their location, as well as their existence) would be beneficial to identify disease loci for many disorders, including cancerous diseases and conditions. Such a method is described in US Patents 5,858,659 and 5,856,104.

CCR5 polynucleotides that are chemically synthesized or reproduced as nucleic acid peptides (PNA) or according to other methods known in the art are described. The use of PNA would serve as the preferred form if the polynucleotides are incorporated into a solid support or a gene microplate. For the purposes of the present invention a nucleic acid peptide (PNA) is a polyamide type of DNA analog and the monomer units for adenine, guanine, thymine and cytosine are commercially available (Perceptive Biosystems). Certain components of DNA, such as phosphorus, phosphorus oxides or deoxyribose derivatives are not present in PNAs. As described in P. E. Nielsen, M. Egholm, R. H. Berg and O. Buchardt, Science 254, 1497 (1991); Y

M. Egholm, O. Buchardt, L. Christensen, C. Behrens, S. M. Freier, D. A. Driver, R. H. Berg, S. K. Kim, B. Norden, and

P. E. Nielsen, Nature 365, 666 (1993), PNAs bind specifically and closely to complementary strands of DNA and do not degrade by nucleases. In fact, PNA binds more strongly to DNA than the DNA itself. This is probably due to the fact that there is no electrostatic repulsion between the two strands and also the main polyamide chain is more flexible. Because of this, the double PNA / DNA chains bind in a wider range of stringent conditions than the double DNA / DNA chains, making it easier to perform multiple hybridization. Smaller probes can be used than with DNA due to strong binding. In addition, it is more likely that single-base mismatches with PNA / DNA hybridization can be determined because a single mismatch in a 15-mer PNA / DNA decreases the melting point (Tm) by 8-20 ° C versus 4º-16º C for the double 15-mer DNA / DNA chain. In addition, the absence of groups with PNA loading means that hybridization at low ionic strengths can be performed and possible interference by salts during the analysis can be reduced.

The present description is useful for detecting cancer in mammals. In particular, the description is useful during the diagnosis of pathological cell proliferative neoplasms that include, but are not limited to: acute myelogenous leukemia including acute monocytic leukemia, acute myeloblastic leukemia, acute promyelocytic leukemia, acute myelomonocytic leukemia, acute erythroleukemia, acute megakaryocytic leukemia and undifferentiated leukemia acute, etc .; and chronic myelogenous leukemias including chronic myelomonocytic leukemia, chronic granulocytic leukemia, etc. Preferred mammals include monkeys, apes, cats, dogs, cows, pigs, horses, rabbits and humans. Particularly preferred are humans.

Pathological cell proliferative disorders are often associated with inappropriate activation of protooncogenes. (Gelmann, E. P. et al., "The Etiology of Acute Leukemia: Molecular Genetics and Viral Oncology," in Neoplastic Diseases of the Blood, Vol 1., Wiemik, P. H. et al. Eds., 161-182 (1985)). It is now believed that neoplasms result from the qualitative alteration of a normal cellular gene product or from the quantitative modification of gene expression by insertion into the chromosome of a viral sequence, by chromosomal translocation of a gene to a more actively transcribed region or by some another mechanism (Gelmann et al., mentioned above). It is likely that mutated or altered expression of specific genes is involved in the pathogenesis of some leukemias, among other cell and cell types. (Gelmann et al., Mentioned above) in fact, the human homologs of the oncogenes involved in some animal neoplasms have been amplified or translocated in some cases of human leukemia and carcinoma (Gelmann et al., Mentioned above)

For example, c-myc expression is highly amplified in the HL-60 non-lymphocytic leukemia cell line. When HL-60 cells are chemically induced to stop proliferation, it is discovered that the level of c-myc is regulated negatively (International Publication Number WO 91/15580). However, it has been shown that exposure of HL-60 cells to a DNA construct that is complementary to the 5 'end of c-myc or cmyb blocks the translation of corresponding mRNAs that negatively regulate the expression of c-myc proteins or c-myb and causes arrest of cell proliferation and differentiation of treated cells (International Publication Number WO 91/15580; Wickstrom et al., Proc. Natl. Acad. Sci. 85: 1028 (1988); Anfossi et al. , Proc. Natl. Acad. Sci. 86: 3379 (1989)). However, the person skilled in the art will appreciate that the usefulness of the present description would not be limited to the treatment of diseases, disorders and / or proliferative conditions of hematopoietic cells and tissues in light of the numerous cells and cell types of various origins that are known to show proliferative phenotypes

In addition to the above, a G protein Chemokine Receptor polynucleotide (CCR5) can be used to control gene expression through triple helix formation or antisense DNA or RNA. Antisense techniques are analyzed, for example, in Okano, J. Neurochem. 56: 560 (1991); "Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988). Triple helix formation is analyzed in, for example, Lee et al., Nucleic Acids Research 6: 3073 (1979); Cooney et al ., Science 241: 456 (1988); and Dervan et al., Science 251: 1360 (1991) Both methods are based on the binding of the polynucleotide with a complementary DNA or RNA.For these techniques, the preferred polynucleotides are usually oligonucleotides. 20 to 40 bases in length and complementary to the region of the gene involved in transcription (triple helix-see Lee et al., Nucl. Acids Res. 6: 3073 (1979); Cooney et al., Science 241: 456 (1988 ); and Dervan et al., Science 251: 1360 (1991))

or to mRNA itself (antisense - Okano, J. Neurochem. 56: 560 (1991); Oligodeoxy-nucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988). Triple helix formation gives as Optimally resulted in an arrest of RNA transcription from DNA, while antisense RNA hybridization blocks the translation of a mRNA molecule into a polypeptide, both techniques are effective in model systems and the information described herein can be used to design antisense or triple helix polynucleotides in an attempt to treat or prevent disease.

G-protein Chemokine Receptor polynucleotides (CCR5) are also useful in gene therapy. An objective of gene therapy is to insert a normal gene into an organism that has a defective gene, in an attempt to correct the genetic defect. The G-protein Chemokine Receptor (CCR5) offers a means of directing such genetic defects in a highly precise manner. Another objective is to insert a new gene that was not present in the host genome, thereby producing a new trait in the host cell.

G-protein Chemokine Receptor polynucleotides (CCR5) are also useful for identifying individuals from minimal biological samples. The United States Army, for example, is considering the use of restriction fragment length polymorphism (RFLP) for the identification of its personnel. In this technique, the genomic DNA of an individual is digested with one or more restriction enzymes and tested in a Southern blot to produce unique bands to identify personnel. This method does not suffer from the current “Identification Badges” limitations that may be lost, changed or stolen, making conclusive identification difficult. G-protein Chemokine Receptor polynucleotides (CCR5) can be used as additional DNA markers for RFLP.

G-protein Chemokine Receptor polynucleotides (CCR5) can also be used as an alternative to RFLP, determining the base real DNA sequence based on selected parts of an individual's genome. These sequences can be used to prepare PCR primers to amplify and isolate said selected DNA, which can then be sequenced. Using this technique, individuals can be identified because each individual will have a unique set of DNA sequences. Once a unique ID database for an individual has been established, the conclusive identification of that individual, living or dead, can be made from extremely small tissue samples.

Forensic biology also benefits from the use of DNA-based identification techniques as described herein. DNA sequences taken from very small biological samples such as tissues, for example, hair or skin, or body fluids, for example, blood, saliva, semen, synovial fluid, amniotic fluid, breast milk, lymph, pulmonary sputum or surfactant, urine, fecal matter, etc., can be amplified using PCR. In a prior art technique, gene sequences amplified from polymorphic loci, such as HLA class II DQa gene, are used in forensic biology to identify individuals (Erlich, H., PCR Technology, Freeman and Co. (1992) Once these specific polymorphic loci have been amplified, they are digested with one or more restriction enzymes, producing an identifier set of bands in a Southern blot assayed with DNA corresponding to the HLA class II DQa gene. Similarly, G protein Chemokine Receptor polynucleotides (CCR5) can be used as polymorphic markers for forensic purposes.

There is also a need for reagents capable of identifying the source of a particular tissue. Such a need arises, for example, in forensic science when you have a tissue of unknown origin. Appropriate reagents may comprise, for example, DNA probes or primers specific for particular tissue prepared from sequences of the G-protein Chemokine Receptor (CCR5). The panels of said reagents can identify tissue by species and / or by type of organ. In a similar manner, these reagents can be used to explore head cultures with respect to contamination.

Because the G-protein Chemokine Receptor (CCR5) is expressed in macrophages and T-memory lymphocytes, the G-protein Chemokine Receptor polynucleotides (CCR5) are useful as hybridization probes for differential tissue or tissue identification or the type or cell types present in a biological sample. Similarly, polypeptides and antibodies directed to G-protein Chemokine Receptor (CCR5) polypeptides are useful for providing immunological probes for differential identification of tissue or tissues or cell type or types. In addition, for various diseases, disorders and / or conditions of the above tissues or cells, or in which these cells play a role, significantly higher or lower levels of expression of the G-protein Chemokine Receptor gene (CCR5) can be detected in certain tissues (e.g., cancerous and injured tissues) or body fluids (e.g., serum, plasma, urine, synovial fluid or spinal fluid) taken from an individual who has such a disorder, in relation to a level of expression of the recipient's gene of "conventional" G-protein Chemokine (CCR5), that is, the level of G-protein Chemokine Receptor (CCR5) expression in healthy tissue of an individual who does not have the immune system-related disorder.

Thus, the invention provides a method of diagnosing a disorder, which involves: (a) testing the level of expression of the G-protein Chemokine Receptor gene (CCR5) in cells or body fluids of an individual; (b) compare the level of expression of the G protein Chemokine Receptor gene (CCR5) with a level of expression of the G protein Chemokine Receptor gene (CCR5), so that an increase or decrease in the level of expression of the G-protein Chemokine Receptor (CCR5) gene tested in comparison to the level of conventional expression is indicative of a disorder in the immune system or related to the immune system.

A method for using G-protein Chemokine Receptor polynucleotides (CCR5) or fragments or variants thereof as a vaccine to induce an immune response to G-protein Chemokine Receptor (CCR5) is also described. A method is also described for using G-protein Chemokine Receptor polynucleotides (CCR5) or fragments or variants thereof as a DNA vaccine to induce a humoral (antibody-mediated) immune response to G-protein Chemokine Receptor. describes a method for using G-protein Chemokine Receptor polynucleotides (CCR5) comprising the nucleotide sequence of one or more extracellular loops of the G-protein Chemokine Receptor (CCR5) (ie amino acids 89-102, 167- 195 and / or 261-274 of SEQ ID NO: 2 or of the polypeptide encoded by the deposited clone (SEQ ID NO: 22)) as a DNA vaccine to induce immune response to the G protein Chemokine Receptor. A method is described. for using polynucleotides of the G-protein Chemokine Receptor (CCR5) comprising the nucleotide sequence of the first extracellular loop of the G-protein Chemokine Receptor (CCR5) (ie amino acids 89-102 of SEQ ID NO: 2 or of the polypeptide encoded by the deposited clone (SEQ ID NO: 22)) as a DNA vaccine to induce an immune response to G-protein Chemokine Receptor (CCR5). A method is described for using the G-protein Chemokine Receptor polynucleotides (CCR5) comprising the nucleotide sequence of the second extracellular loop of the G-protein Chemokine Receptor (CCR5) (i.e. amino acids 167-195 of SEQ ID Nº: 2 or of the polypeptide encoded by the deposited clone (SEQ ID NO: 22)) as a DNA vaccine to induce an immune response to the G-protein Chemokine Receptor (CCR5). A method is also described for using G-protein Chemokine Receptor polynucleotides (CCR5) comprising the nucleotide sequence of the third extracellular loop of the G-protein Chemokine Receptor (CCR5) (ie, 261-274 of SEQ ID NO: 2 or of the polypeptide encoded by the deposited clone (SEQ ID NO: 22)) as a DNA vaccine to induce an immune response to the G-protein Chemokine Receptor (CCR5).

A method for using polynucleotides of the G-protein Chemokine Receptor (CCR5) comprising the nucleotide sequence of one or more extracellular loops of the G-protein Chemokine Receptor (CCR5) (ie amino acids 89-102, 167) is described. -195 and / or 261-274 of SEQ ID NO: 2 or of the polypeptide encoded by the deposited clone (SEQ ID NO: 22)) as a DNA vaccine to induce a humoral immune response to the G-protein Chemokine Receptor. describes a method for using G-protein Chemokine Receptor polynucleotides (CCR5) comprising the nucleotide sequence of the first extracellular loop of the G-protein Chemokine Receptor (CCR5) (ie amino acids 89-102 of SEQ ID NO: 2 or of the polypeptide encoded by the deposited clone (SEQ ID NO: 22)) as a DNA vaccine to induce a humoral immune response to the G-protein Chemokine Receptor (CCR5). A method for using polynucleotides of the G-protein Chemokine Receptor (CCR5) comprising the nucleotide sequence of the second extracellular loop of the G-protein Chemokine Receptor (CCR5) (ie amino acids 167-195 of SEQ ID NO. : 2 or of the polypeptide encoded by the deposited clone (SEQ ID NO: 22)) as a DNA vaccine to induce a humoral immune response to the G-protein Chemokine Receptor (CCR5). In addition, a method for using polynucleotides of the G-protein Chemokine Receptor (CCR5) comprising the nucleotide sequence of the third extracellular loop of the G-protein Chemokine Receptor (CCR5) (ie, 261-274 of SEQ ID NO. : 2 or of the polypeptide encoded by the deposited clone (SEQ ID NO: 22)) as a DNA vaccine to induce a humoral immune response to the G-protein Chemokine Receptor (CCR5).

A DNA vaccine is also described which comprises, or as an alternative consisting of, a G-protein Chemokine Receptor polynucleotide (CCR5) or fragment or variant thereof. A DNA vaccine is described comprising, or as an alternative consisting of, a G-protein Chemokine Receptor polynucleotide (CCR5) encoding the nucleotide sequence of one or more extracellular loops of the G-protein Chemokine Receptor (CCR5) (ie, amino acids 89-102, 167-195 and / or 261-274 of SEQ ID NO: 2 or of the polypeptide encoded by the deposited clone (SEQ ID NO: 22)). A DNA vaccine is described comprising, or as an alternative consisting of, a G-protein Chemokine Receptor polynucleotide (CCR5) encoding the nucleotide sequence of the first extracellular loop of the G-protein Chemokine Receptor (CCR5) (is ie, amino acids 89-102 of SEQ ID NO: 2 or of the polypeptide encoded by the deposited clone (SEQ ID NO: 22)). A DNA vaccine is described comprising, or as an alternative consisting of, a G-protein Chemokine Receptor polynucleotide (CCR5) encoding the nucleotide sequence of the second extracellular loop of the G-protein Chemokine Receptor (CCR5) (is that is, amino acids 167-195 of SEQ ID NO: 2 or of the polypeptide encoded by the deposited clone (SEQ ID NO: 22)). A DNA vaccine is described comprising, or as an alternative consisting of, a G-protein Chemokine Receptor polynucleotide (CCR5) encoding the nucleotide sequence of the third extracellular loop of the G-protein Chemokine Receptor (CCR5) (en ie, amino acids 261-274 of SEQ ID NO: 2 or of the polypeptide encoded by the deposited clone (SEQ ID NO: 22)).

The vaccines described above can be administered to an animal, including humans, to prevent viral infection. The vaccines described above can be administered to an animal, including humans, to prevent HIV infection. The vaccines described above can be administered to an animal, including humans, to prevent poxvirus infection. The vaccines described above can be administered to an animal, including humans, to prevent cytomegalovirus infection.

At least, G-protein Chemokine Receptor polynucleotides (CCR5) can be used as molecular weight markers in Southern gels, as diagnostic probes for the presence of a specific mRNA in a particular cell type, such as a probe to "subtract "Sequences known in the process of discovering new polynucleotides, to select and prepare oligomers for binding to a" gene microplate "or other support, to induce anti-DNA antibodies using DNA immunization techniques and as an antigen to induce an immune response .

Uses of G-protein Chemokine Receptor Polypeptides (CCR5)

G-protein Chemokine Receptor polypeptides (CCR5) can be used in numerous ways. The following description should be considered exemplary and uses known techniques.

G-protein Chemokine Receptor (CCR5) polypeptides can be used to test protein levels in a biological sample using antibody-based techniques. For example, protein expression in tissues can be studied with classical immunohistochemical methods (Jalkanen, M., et al., J. Cell. Biol. 101: 976985 (1985); Jalkanen, M., et al., J. Cell Biol. 105: 3087-3096 (1987) Other antibody-based methods useful for the detection of protein gene expression include immunoassays such as the enzyme-linked immunosorbent assay (ELISA) and radioimmunoassay (RIA). Suitable antibody assay markers and include enzymatic markers, such as glucose oxidase and radioisotopes, such as iodine (125I, 121I), carbon (14C), sulfur (35S), tritium (3H), indium (112In) and technetium (99mTc) and fluorescent markers, such as fluorescein and rhodamine, and biotin.

In addition to testing G protein levels in a biological sample, proteins can also be detected in vivo by imaging. Antibody markers or labels for in vivo protein imaging include those detectable by radiography, NMR or ESR. For radiographs, suitable markers include radioisotopes such as barium or cesium, which emit detectable radiation but are not excessively harmful to the subject. Suitable markers for NMR and ESR include those with a detectable characteristic spin, such as deuterium, that can be incorporated into the antibody by labeling nutrients for the relevant hybridoma.

A protein-specific antibody or antibody fragment that has been labeled with an appropriate detectable imaging moiety, such as a radioisotope (e.g. 131I, 112In, 99mTc), a radiopaque substance

or a material detectable by nuclear magnetic resonance, is introduced (for example, parenterally, subcutaneously or intraperitoneally) in the mammal. It will be understood in the art that the size of the subject and the imaging system used will determine the amount of imaging remains necessary to produce diagnostic images. In the case of a radioisotope moiety, for a human subject, the amount of radioactivity injected will normally vary from about 5 to 20 millicuries of 99 mTc. The labeled antibody or antibody fragment will then preferably accumulate in the location of cells containing the specific protein. In vivo tumor imaging is described in S. W. Burchiel et al., "Immunopharmacokinetics of Radiolabeled Antibodies and Their Fragments." (Chapter 13 in Tumor Imaging: The Radiochemical Detection of Cancer, S.W. Burchiel and B. A. Rhodes, eds., Masson Publishing Inc. (1982).

Thus, a method of diagnosing a disorder is described, which involves (a) testing the expression of the G-protein Chemokine Receptor (CCR5) polypeptide in cells or body fluid of an individual; (b) compare the level of gene expression with a level of expression of the conventional gene, so an increase or decrease in the level of expression of the G-chemokine Receptor polypeptide gene (CCR5) tested compared to the level Conventional expression is indicative of a disorder. With respect to cancer, the presence of a relatively high amount of transcript in an individual's biopsy tissue may indicate a predisposition for the development of the disease or may provide a means to detect the disease before the onset of the clinical symptoms themselves. A more definitive diagnosis of this type may allow health professionals to employ preventive measures or aggressive treatment earlier thus preventing further development or progression of cancer.

In addition, G-protein Chemokine Receptor polypeptides (CCR5) can be used to treat, prevent and / or diagnose disease. For example, patients may be administered to G-protein Chemokine Receptor (CCR5) polypeptides in an attempt to replace absent or reduced levels of the G-protein Chemokine Receptor (CCR5) polypeptide (e.g., insulin), to supplement absent or reduced levels of a different polypeptide (e.g., hemoglobin S for hemoglobin B, SOD, catalase, DNA repair proteins), to inhibit the activity of a polypeptide (e.g., an oncogene or tumor suppressor), to activate the activity of a polypeptide (for example, by binding to a receptor), to reduce the activity of a membrane-bound receptor by competition with it by free ligand (for example, soluble TNF receptors used in the reduction of inflammation), or to provide a desired response (for example, inhibition of blood vessel growth, potentiation of the immune response to proliferating cells or tissues).

Similarly, antibodies directed to G-protein Chemokine Receptor (CCR5) polypeptides can also be used to treat, prevent and / or diagnose disease. For example, administration of an antibody directed to a G-protein Chemokine Receptor polypeptide (CCR5) can bind and reduce the overproduction of the polypeptide. Similarly, administration of an antibody can activate the polypeptide, such as by binding with a membrane-bound polypeptide (receptor).

A method is described for using G-protein Chemokine Receptor polypeptides (CCR5) or fragments or variants as a vaccine to induce an immune response to G-protein Chemokine Receptor (CCR5). A method is also described for using G-protein Chemokine Receptor polypeptides (CCR5) or fragments or variants thereof as a vaccine to induce a humoral (antibody-mediated) immune response to G-protein Chemokine Receptor. A method is described. for using polypeptides of the G-protein Chemokine Receptor (CCR5) comprising the amino acid sequence of one or more extracellular loops of the G-protein Chemokine Receptor (CCR5) (i.e., amino acids 89-102, 167-195 and / or 261-274 of SEQ ID NO: 2 or of the polypeptide encoded by the deposited clone (SEQ ID NO: 22)) as a vaccine to induce an immune response to the G-protein Chemokine Receptor. A method for using polypeptides of the G-protein chemokine receptor (CCR5) comprising the amino acid sequence of the first extracellular loop of the G-protein chemokine receptor (CCR5) (ie amino acids 89-102 of SEQ ID NO: 2 or of the pol Ipeptide encoded by the deposited clone (SEQ ID NO: 22)) as a vaccine to induce an immune response to the G-protein Chemokine Receptor (CCR5). A method for using G-protein Chemokine Receptor (CCR5) polypeptides comprising the amino acid sequence of the second extracellular loop of the G-protein Chemokine Receptor (CCR5) (ie amino acids 167-195 of SEQ ID NO. : 2 or of the polypeptide encoded by the deposited clone (SEQ ID NO: 22)) as a vaccine to induce an immune response to the G-protein Chemokine Receptor (CCR5). A method is also described for using G-protein Chemokine Receptor (CCR5) polypeptides comprising the amino acid sequence of the third extracellular loop of the G-protein Chemokine Receptor (CCR5) (ie, 261-274 of SEQ ID NO: 2 or of the polypeptide encoded by the deposited clone (SEQ ID NO: 22)) as a vaccine to induce an immune response to the G-protein Chemokine Receptor (CCR5).

A method for using polynucleotides of the G-protein Chemokine Receptor (CCR5) comprising the amino acid sequence of one or more extracellular loops of the G-protein Chemokine Receptor (CCR5) (ie, amino acids 89-102, 167-) is described. 195 and / or 261-274 of SEQ ID NO: 2 or of the polypeptide encoded by the deposited clone (SEQ ID NO: 22)) as a vaccine to induce a humoral immune response to the G protein Chemokine Receptor. method for using polypeptides of the G-protein Chemokine Receptor (CCR5) comprising the amino acid sequence of the first extracellular loop of the G-protein Chemokine Receptor (CCR5) (ie amino acids 89-102 of SEQ ID NO: 2 or of the polypeptide encoded by the deposited clone (SEQ ID NO: 22)) as a vaccine to induce a humoral immune response for the G-protein Chemokine Receptor (CCR5). A method for using G-protein Chemokine Receptor (CCR5) polypeptides comprising the amino acid sequence of the second extracellular loop of the G-protein Chemokine Receptor (CCR5) (ie amino acids 167-195 of SEQ ID NO: 2 or of the polypeptide encoded by the deposited clone (SEQ ID NO: 22)) as a vaccine to induce a humoral immune response to the G-protein Chemokine Receptor (CCR5). A method for using G-protein Chemokine Receptor (CCR5) polypeptides comprising the amino acid sequence of the third extracellular loop of the G-protein Chemokine Receptor (CCR5) (ie, 261-274 of SEQ ID NO: 2) is described. or of the polypeptide encoded by the deposited clone (SEQ ID NO: 22)) as a vaccine to induce a humoral immune response to the G-protein Chemokine Receptor (CCR5).

In addition, a vaccine is described which comprises, or as an alternative consisting of, a G-protein Chemokine Receptor polypeptide (CCR5) or fragment or variant thereof. A vaccine is described comprising, or as an alternative consisting of, a G-protein Chemokine Receptor polypeptide (CCR5) encoding the amino acid sequence of one or more extracellular loops of the G-protein Chemokine Receptor (CCR5) (is ie, amino acids 89-102, 167-195 and / or 261-274 of SEQ ID NO: 2 or of the polypeptide encoded by the deposited clone (SEQ ID NO: 22)). A vaccine is described comprising, or as an alternative consisting of, a G-protein Chemokine Receptor polypeptide (CCR5) encoding the amino acid sequence of the first extracellular loop of the G-protein Chemokine Receptor (CCR5) (i.e., amino acids 89-102 of SEQ ID NO: 2

or of the polypeptide encoded by the deposited clone (SEQ ID NO: 22)). A vaccine is also described comprising, or as an alternative consisting of, a G-protein Chemokine Receptor polypeptide (CCR5) encoding the amino acid sequence of the second extracellular loop of the G-protein Chemokine Receptor (CCR5) (i.e. , amino acids 167-195 of SEQ ID NO: 2 or of the polypeptide encoded by the deposited clone (SEQ ID NO: 22)). A vaccine is described comprising, or as an alternative consisting of, a G-protein Chemokine Receptor polypeptide (CCR5) encoding the amino acid sequence of the third extracellular loop of the G-protein Chemokine Receptor (CCR5) (i.e., amino acids 261-274 of SEQ ID NO: 2 or of the polypeptide encoded by the deposited clone (SEQ ID NO: 22)).

The vaccines described above can be administered to an animal, including humans, to prevent viral infection. The vaccines described above can be administered to an animal, including humans, to prevent HIV infection. The vaccines described above can be administered to an animal, including humans, to prevent poxvirus infection. The vaccines described above can be administered to an animal, including humans, to prevent cytomegalovirus infection.

At least, G-protein Chemokine Receptor (CCR5) polypeptides can be used as molecular weight markers in SDS-PAGE gels or in molecular sieve gel filtration columns using methods well known to those skilled in the art. G-protein Chemokine Receptor (CCR5) polypeptides can also be used to induce antibodies, which in turn are used to measure the protein expression of a recombinant cell, as a way of assessing the transformation of the host cell. In addition, G-protein Chemokine Receptor polypeptides (CCR5) can be used to test the following biological activities.

Biological Activities of the G-protein Chemokine Receptor

Polynucleotides or polypeptides of the G-protein Chemokine Receptor (CCR5) or agonists or antagonists of the G-protein Chemokine Receptor (CCR5) can be used in tests to test for one or more biological activities. If polynucleotides or polypeptides of the G-protein Chemokine Receptor (CCR5) or agonists or antagonists of the G-protein Chemokine Receptor (CCR5) show activity in a particular assay, it is likely that the G-protein Chemokine Receptor (CCR5) may be involved in diseases associated with biological activity. Therefore, the G-protein Chemokine Receptor (CCR5) could be used to treat, prevent and / or diagnose the associated disease.

Ligands of the G-protein Chemokine Receptor (CCR5) include MIP-1alpha, MIP-1beta, MCP-1, MCP-2, MCP-3, MCP-4, RANTES, and Eotaxin. The G-protein Chemokine Receptor (CCR5) is also a major co-receptor for HIV and can be recognized by other infectious agents, such as other viruses, to allow entry into the cell. Thus, G-protein Chemokine Receptor polynucleotides (CCR5), polypeptides, agonists and antagonists thereof are useful for the treatment, prevention and diagnosis of diseases associated with any of the above ligands, such as the diseases described in This memory. In highly preferred embodiments, G protein Chemokine Receptor polynucleotides (CCR5), polypeptides, agonists and antagonists thereof are useful for the treatment, prevention and diagnosis of HIV infection and / or conditions associated with HIV infection as described in the section entitled "Treatment and prevention of HIV infection".

The G-protein Chemokine Receptor (CCR5) is predominantly expressed in monocytes and T-lymphocytes. The expression of the G-protein Chemokine Receptor (CCR5) is found in microglia, dendritic cells and some hematopoietic stem cells. Activation of the G-protein Chemokine Receptor (CCR5) in macrophages and lymphocytes by G-protein Chemokine Receptor ligands (CCR5) (especially, RANTES, MIP-1beta and MIP-1alpha) primarily results in chemoattraction of these cell types to sites of inflammation, often sites of infection. The G-protein Chemokine Receptor (CCR5) may also be involved in the induction of chemotaxis in NK cells, eosinophils and basophils. Activation of the G-protein Chemokine Receptor (CCR5) in macrophages and lymphocytes by ligands of the G-protein Chemokine Receptor (CCR5) (especially, RANTES, MIP-1beta and MIP-1alpha) can promote interactions between T lymphocytes and cells antigen presentation (eg, dendritic cells, macrophages and B lymphocytes). The G-protein Chemokine Receptor (CCR5) may also be involved in adhesion and migration of cells through blood vessels through adhesion molecules in transit to the site of inflammation. Accordingly, compositions (including polynucleotides, polypeptides and antibodies of the invention and fragments and variants thereof) may be used in the diagnosis, prognosis, prevention and / or treatment of diseases and / or disorders associated with defects in the biological activities of the Receptor of Protein Chemokine G (CCR5) such as those described above.

The compositions (including polynucleotides, polypeptides and antibodies of the invention and fragments and variants thereof) can be used in the diagnosis, prognosis, prevention and / or treatment of diseases and / or disorders related to immune function (eg, viral infection ( especially HIV infection, poxvirus infection and / or cytomegalovirus infection); autoimmune diseases (such as Rheumatoid Arthritis, Grave disease and Multiple Sclerosis); immune cell chemotaxis; inflammatory conditions; and / or as described in "Immune Activity ”) And neoplastic disorders such as those described under“ Hyperproliferative Disorders ”below.

Polynucleotides, polypeptides, agonists and antagonists of the G-protein Chemokine Receptor (CCR5) (including antibodies) are useful in the diagnosis, prognosis, prevention and / or treatment of diseases and / or disorders associated with activities that include, but are not limited to. , chemoattraction of immune cells, activation of immune cells, presentation of antigens, inflammation and viral infection.

More generally, polynucleotides, polypeptides, agonists and antagonists of the G-protein Chemokine Receptor (CCR5) (including antibodies) may be useful for the diagnosis, prognosis, prevention and / or treatment of diseases and / or disorders described below.

Treatment and Prevention of HIV infection. Since CCR5 is an HIV tropic receptor for tropic macrophages, it has a significant impact on HIV infection and disease progression, especially early on HIV infection when HIV is predominantly from the tropic strains for macrophage R5. Therefore, polynucleotides or polypeptides of the G-protein Chemokine Receptor (CCR5) or agonists (including antibodies) or antagonists (including antibodies) of the G-protein Chemokine Receptor (CCR5), can be used to diagnose, treat, prevent and / or relieve HIV infection.

In specific embodiments, the antibodies of the invention can be used to diagnose, treat, prevent and / or alleviate the diseases, disorders or conditions associated with HIV infection. Conditions associated with HIV infection include, but are not limited to, Pneumocystis carinii pneumonia, cachexia, Kaposi sarcoma, Esophageal candidiasis and Pulmonary Candidiasis, extrapulmonary or disseminated Mycobacterium avium-intracellular complex, Myphobacterium kansasii extrapulmonary or disseminated Mycobacterium kansasii , Cytomegalovirus retinitis, HIV encephalopathy, Herpes simplex disease, Extrapulmonary cryptococcosis, Toxoplasmosis of the brain, Chronic cryptosporidiosis, Chronic intestinal cryptosporidiosis, Immunoblastic lymphoma, Mycobacterium tuberculosis extrapulmonary mycobacterium tuberculosis, Mycobacterial lymphatic disease progressive multifocal leukoencephalopathy, primary cerebral lymphoma, chronic isosporiasis, chronic intestinal isosporiasis, extrapulmonary or disseminated coccidioidomycosis, Salmonella sepsis, recurrent or multiple bacterial infections, c invasive cervical arcinoma, extrapulmonary or disseminated histoplasmosis, lymphoid interstitial pneumonia, pulmonary lymphoid hyperplasia, recurrent pneumonia, severe dementia, immunosuppression and / or AIDS.

In preferred embodiments, the antibodies of the invention can be used to diagnose, treat, prevent and / or relieve opportunistic infections (eg, Herpes virus infection, Mycobacterium tuberculosis infection or cytomegalovirus infection) associated with HIV infection.

In preferred embodiments, the antibodies of the invention can be used to diagnose, treat, prevent and / or relieve opportunistic infection by Pneumocystis carinii associated with HIV infection.

In preferred embodiments, the antibodies of the invention can be used to diagnose, treat, prevent and / or alleviate Kaposi's sarcoma associated with HIV infection.

In preferred embodiments, the antibodies of the invention can be used to diagnose, treat, prevent and / or alleviate the early stages of HIV infection.

In preferred embodiments, the antibodies of the invention can be used to diagnose, treat, prevent and / or alleviate the early stages of HIV infection.

In preferred embodiments, the antibodies of the invention can be used to diagnose, treat, prevent and / or alleviate the late stages of HIV infection.

In yet other embodiments, the antibodies of the invention can be used as a prophylactic method to prevent HIV infection in people who have an HIV-infected sexual partner or people with reasons to believe they have been exposed to HIV (for example, people who a needle that had previously been in contact with the biological fluid of another individual (or animal) or rape victims) has been applied.

In further embodiments, the antibodies of the invention can be used as a prophylactic method to prevent maternal fetal transmission of HIV.

Immune activity Polynucleotides or polypeptides of the G-protein Chemokine Receptor (CCR5) or agonists

or antagonists of the G-protein Chemokine Receptor (CCR5), may be useful in the treatment of diseases, disorders and / or conditions of the immune system, by activating or inhibiting the proliferation, differentiation or mobilization (chemotaxis) of immune cells. Immune cells develop through a process called hematopoiesis, which produces myeloid cells (platelets, red blood cells, neutrophils and macrophages) and lymphoid cells (B and T lymphocytes) from pluripotential stem cells. The etiology of these diseases, disorders and / or immune conditions can be genetic, somatic, such as cancer or some autoimmune diseases, disorders and / or conditions acquired (for example by chemotherapy or toxins) or infectious. In addition, polynucleotides or polypeptides of the G-protein Chemokine Receptor (CCR5) or agonists or antagonists of the G-protein Chemokine Receptor (CCR5) can be used as a marker or detector of a particular disease or disorder of the immune system.

Polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof can be used to modulate hematopoietic activity (blood cell formation). For example, polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof can be used to increase the amount of all or subsets of blood cells, such as, for example, erythrocytes, lymphocytes (B or T lymphocytes), myeloid cells (for example, basophils, eosinophils, neutrophils, mast cells, macrophages) and platelets. The ability to reduce the amount of blood cells or subsets of blood cells may be useful in the prevention, detection, diagnosis and / or treatment of anemias and leukopenias described below. Alternatively, polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or antagonist agonists thereof can be used to reduce the amount of all or subsets of blood cells such as, for example, erythrocytes, lymphocytes (B or T lymphocytes), myeloid cells (for example, basophils, eosinophils, neutrophils, mast cells, macrophages) and platelets. The ability to decrease the amount of blood cells or subsets of blood cells may be useful in the prevention, detection, diagnosis and / or treatment of leukocytosis, such as, for example, eosinophilia.

Polynucleotides or polypeptides of the G-protein Chemokine Receptor (CCR5) or agonists or antagonists of the G-protein Chemokine Receptor (CCR5), may be useful in the treatment, prevention and / or diagnosis of diseases, disorders and / or conditions of hematopoietic cells. Polynucleotides or polypeptides of the G-protein Chemokine Receptor (CCR5) or agonists or antagonists of the G-protein Chemokine Receptor (CCR5), could be used to increase differentiation and proliferation of hematopoietic cells, including pluripotential stem cells, in an attempt of treating or preventing those diseases, disorders and / or conditions associated with a decrease in certain (or many) types of hematopoietic cells. Examples of immunological deficiency syndromes include, but are not limited to, diseases, disorders and / or conditions of blood proteins (e.g. agammaglobulinemia, dysgammaglobulinemia), ataxia telangiectasia, common variable immunodeficiency, Digeorge syndrome, HIV infection, HTLV infection- BLV, leukocyte adhesion deficiency syndrome, lymphopenia, phagocyte bactericidal dysfunction, severe combined immunodeficiency (SCID), Wiskott-Aldrich disorder, anemia, thrombocytopenia, leukopenia, neutropenia, anemia or hemoglobinuria. Alternatively, polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof could be used to increase the differentiation and proliferation of hematopoietic cells, including pluripotential stem cells, in an attempt to treat or prevent diseases, disorders and / or conditions associated with an increase in certain (or many) types of hematopoietic cells, including without limitation, histiocytosis.

A G-protein Chemokine Receptor polypeptide (CCR5) or polynucleotides, antibodies, agonists or antagonists that correspond to that G-protein Chemokine Receptor polypeptide (CCR5), can be used to treat diseases and disorders of the immune system and / or inhibit or enhance an immune response generated by cells associated with the tissue or tissues in which the polypeptide is expressed.

Polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof may be useful in the treatment, prevention, diagnosis and / or prognosis of immunodeficiencies, including congenital and acquired immunodeficiencies. Examples of B lymphocyte immunodeficiencies in which immunoglobulin levels, B lymphocyte function and / or B lymphocyte numbers decrease include: X-linked agammaglobulinemia (Bruton disease), X-linked childhood agammaglobulinemia, X-linked immunodeficiency with hyper IgM, non-X-linked immunodeficiency with hyper IgM, X-linked lymphoproliferative syndrome (XLP), agammaglobulinemia that includes congenital and acquired agammaglobulinemia, late-onset agammaglobulinemia, dysgammaglobulinemia, hypogammaglobulomamia-globulinemia, hypogammaglobulomamia Swiss type), selective IgM deficiency, selective IgA deficiency, selective IgG subclass deficiencies, IgG subclass deficiency (with or without IgA deficiency), Ig deficiency with increased IgM, IgG deficiency and IgA with increased IgM, antibody deficiency with normal or high Ig, deletions of ca heavy Ig dena, kappa chain deficiency, B lymphocyte lymphocyte disorders (BLPD), common variable immunodeficiency (CVID), common variable immunodeficiency (CVI) (acquired) and transient hypogammaglobulinemia of childhood.

Ataxia-telangiectasia or conditions associated with ataxia-telangiectasia can be treated, prevented, diagnosed and / or predicted using the polypeptides or polynucleotides and / or antagonists or agonists thereof.

Examples of congenital immunodeficiencies in which the function of T lymphocytes and / or B lymphocytes and / or their number decreases include, without limitation: DiGeorge anomaly, severe combined immunodeficiencies (SCID) (including, but not limited to X-linked SCID, Autosomal recessive SCID, adenosine deaminase deficiency, purine nucleoside phosphorylase (PNP) deficiency, MHC Class II deficiency (naked lymphocyte syndrome), Wiskott-Aldrich syndrome and ataxia telangiectasia), thymic hypoplasia, third and third syndrome Fourth pharyngeal diverticulum, deletion from 22 to 11.2, chronic mucocutaneous candidiasis, cytolytic cell deficiency (NK), idiopathic CD4 + T lymphocytopenia, immunodeficiency with predominant (unspecified) T lymphocyte defect and unspecified immunity of cell-mediated immunity.

The DiGeorge anomaly or conditions associated with the DiGeorge anomaly can be treated, prevented, diagnosed and / or predicted using polypeptides or polynucleotides or antagonists or agonists thereof.

Other immunodeficiencies that can be treated, prevented, diagnosed and / or predicted using polypeptides or polynucleotides and / or agonists or antagonists thereof, include, but are not limited to, chronic granulomatous disease, Chédiak-Higashi syndrome, myeloperoxidase deficiency, glucose deficiency. -6-leukocyte phosphate dehydrogenase, X-linked lymphoproliferative syndrome (XLP), leukocyte adhesion deficiency, complement component deficiencies (including deficiencies of C1, C2, C3, C4, C5, C6, C7, C8 and / or C9), reticular dysgenesis, thymic aplasia-alinfoplasia, thymoma immunodeficiency, severe congenital leukopenia, dysplasia with immunodeficiency, neonatal neutropenia, short limb dwarfism and immunodeficiency combined with Nezelof syndrome with Ig.

The immunodeficiencies and / or conditions associated with the immunodeficiencies indicated above may be treated, prevented, diagnosed and / or predicted using polynucleotides and / or polypeptides of the G-Chemokine Receptor (CCR5) and / or agonists or antagonists thereof.

Polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or antagonists or agonists thereof could be used as an agent to enhance the immune response among immunodeficient individuals. Polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof could be used as an agent to potentiate the immune response between immunodeficient individuals for B lymphocytes and / or T lymphocytes.

In addition, polynucleotides or polypeptides of the G-protein Chemokine Receptor (CCR5) or agonists or antagonists of the G-protein Chemokine Receptor (CCR5) can also be used to modulate hemostatic (stopping bleeding) or thrombolytic (clot formation) ). For example, by increasing hemostatic or thrombolytic activity, polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) or agonists or antagonists of the G-protein Chemokine Receptor (CCR5) could be used to treat or prevent diseases, disorders and / or blood clotting conditions (for example, afibrinogenemia, factor deficiencies), diseases, disorders and / or conditions of blood platelets (for example thrombocytopenia) or injuries resulting from trauma, surgery or other causes. Alternatively, polynucleotides or polypeptides of the G-protein Chemokine Receptor (CCR5) or agonists or antagonists of the G-Chemokine Receptor (CCR5) that can decrease hemostatic or thrombolytic activity could be used to inhibit or dissolve clots. These molecules could be important in the treatment or prevention of heart attacks (infarction), strokes or scarring.

Polynucleotides or polypeptides of the G-protein Chemokine Receptor (CCR5) or agonists or antagonists of the G-protein Chemokine Receptor (CCR5) may also be useful in the treatment, prevention and / or diagnosis of diseases, disorders and / or conditions Autoimmune Many autoimmune diseases, disorders and / or conditions result from inappropriate recognition of own material as foreign by immune cells. This inappropriate recognition results in an immune response that leads to the destruction of the host tissue.

Therefore, the administration of polynucleotides or polypeptides of the G-protein Chemokine Receptor (CCR5) or agonists or antagonists of the G-protein Chemokine Receptor (CCR5) that can inhibit an immune response, particularly lymphocyte proliferation, differentiation or chemotaxis T, can be an effective therapy in the prevention of diseases, disorders and / or autoimmune conditions.

Examples of autoimmune diseases, disorders and / or conditions that can be treated, prevented and / or diagnosed or detected by G-protein Chemokine Receptor (CCR5) include, but are not limited to: Addison's disease, hemolytic anemia, antiphospholipid syndrome, rheumatoid arthritis , dermatitis, allergic encephalomyelitis, glomerulonephritis, Goodpasture's Syndrome, Graves' Disease, Multiple Sclerosis, Myasthenia Grave, Neuritis, Ophthalmia, Ampoular Pemphigoid, Pemphigus, Poliochinopathies, Purple, Reiter's Disease, Rhytidus Syndrome, Lymphoiditis Systemic, Autoimmune Pulmonary Inflammation, Guillain-Barre Syndrome, insulin-dependent diabetes melitus and autoimmune inflammatory eye disease. The present invention relates to the use of antibodies as defined in the claims for the preparation of a pharmaceutical composition for the treatment or prevention of rheumatoid arthritis.

Similarly, allergic reactions and conditions, such as asthma (particularly allergic asthma) or other respiratory problems, can also be treated, prevented and / or diagnosed by polynucleotides or polypeptides of the G-protein Chemokine Receptor (CCR5), or agonists or G-protein Chemokine Receptor antagonists. In addition, these molecules can be used to treat anaphylaxis, hypersensitivity to an antigenic molecule or incompatibility of blood groups.

Additionally, polypeptides or polynucleotides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof, can be used to treat, prevent, diagnose and / or predict IgE-mediated allergic reactions. Such allergic reactions include, but are not limited to, asthma, rhinitis and eczema. Polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof can be used to modulate IgE concentrations in vitro or in vivo.

Polynucleotides or polypeptides of the G-protein Chemokine Receptor (CCR5) or agonists or antagonists of the G-protein Chemokine Receptor (CCR5) can also be used to treat, prevent and / or diagnose organ rejection or graft-versus-host disease ( GVHD). Organ rejection is caused by destruction of immune cells from the host of the transplanted tissue through an immune response. Similarly, an immune response is also involved in GVHD, but, in this case, foreign transplanted immune cells destroy host tissues. The administration of polynucleotides or polypeptides of the G-protein Chemokine Receptor (CCR5) or agonists or antagonists of the G-protein Chemokine Receptor (CCR5), which inhibits an immune response, particularly proliferation, differentiation or chemotaxis of T lymphocytes, can be an effective therapy in the prevention of organ rejection or GVHD. Polypeptides, antibodies or polynucleotides and / or agonists or antagonists thereof, that inhibit an immune response, particularly the activation, proliferation, differentiation or chemotaxis of T lymphocytes, may be an effective therapy in the prevention of hyperacute and allergic xenotransplantation rejection. experimental.

Similarly, polynucleotides or polypeptides of the G-protein Chemokine Receptor (CCR5) or agonists or antagonists of the G-Chemokine Receptor (CCR5) can also be used to modulate inflammation. For example, since polypeptides, antibodies or polynucleotides and / or agonists or antagonists can inhibit the activation, proliferation and / or differentiation of cells involved in an inflammatory response, these molecules can be used to prevent and / or treat chronic and acute inflammatory conditions. . Such inflammatory conditions include, but are not limited to, for example, inflammation associated with infection (eg, septic shock, sepsis or systemic inflammatory response syndrome), ischemia reperfusion injury, endotoxin mortality, complement-mediated hyperacute rejection, nephritis, cytokine or chemokine-induced lung injury, inflammatory bowel disease, Crohn's disease, cytokine overproduction (for example, TNF or IL-1), respiratory disorders (eg, asthma and allergy); gastrointestinal disorders (for example, inflammatory bowel disease); cancers (for example, gastric, ovarian, lung, bladder, liver and breast); CNS disorders (eg, multiple sclerosis; ischemic brain injury and / or stroke, traumatic brain injury, neurodegenerative disorders (e.g., Parkinson's disease and Alzheimer's disease); AIDS-related dementia and prion disease); cardiovascular disorders (for example, atherosclerosis, myocarditis, cardiovascular disease and complications of cardiopulmonary bypass); as well as many diseases, conditions and additional disorders characterized by inflammation (for example, hepatitis, rheumatoid arthritis, gout, trauma, pancreatitis, sarcoidosis, dermatitis, reperfusion injury from renal ischemia, Grave disease, systemic lupus erythematosus, diabetes melitus and allogeneic transplant rejection).

Because inflammation is a fundamental defense mechanism, inflammatory disorders can affect virtually any tissue in the body. Accordingly, the polynucleotides, polypeptides and antibodies of the invention, as well as agonists or antagonists thereof, have uses in the treatment of tissue-specific inflammatory disorders, including, but not limited to, adrenalitis, alveolitis, angiocolecystitis, appendicitis, balanitis, blepharitis, bronchitis, bursitis, carditis, cellulitis, cervicitis, cholecystitis, corditis, coclitis, colitis, conjunctivitis, cystitis, dermatitis, diverticulitis, encephalitis, endocarditis, esophagitis, eustachitis, fibrositis, folliculitis, gastritis, gastroenteritis, gingivitis, glositis, glositis keratitis, labirintitis, laryngitis, lymphangitis, mastitis, otitis media, meningitis, metritis, mucitis, myocarditis, myositis, myringitis, nephritis, neuritis, orchitis, osteochondritis, otitis, pericarditis, peritendonitis, peritonitis, pharyngitis, phlebitis, polio, hepatitis , retinitis, rhinitis, salpingitis, scleritis, sclerochoroiditis, escrotiti s, sinusitis, spondylitis, steatitis, stomatitis, synovitis, syringitis, tendonitis, tonsillitis, urethritis and vaginitis.

Polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof may be useful as an agent to improve migration, phagocytosis, superoxide production, neutrophil antibody-dependent cell cytotoxicity, eosinophils and macrophages.

Polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof may be useful in the diagnosis, prognosis, prevention and / or treatment of diseases and disorders characterized by or associated with increased numbers. or reduced white blood cells. Leukopenia occurs when the number of white blood cells decreases below normal. Leukopenias include, but are not limited to, neutropenia and lymphocytopenia. An increase in the number of white lymphocytes compared to normal is known as leukocytosis. The body generates larger numbers of white blood cells during an infection. In this way, leukocytosis can simply be a normal physiological parameter that reflects an infection. Alternatively, leukocytosis may be an indicator of injury or other disease such as cancer. Leukocytosis includes, but is not limited to, eosinophilia and macrophage accumulations. Polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof may be useful in the diagnosis, prognosis, prevention and / or treatment of leukopenia. Polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof may be useful in the diagnosis, prognosis, prevention and / or treatment of leukocytosis.

Leukopenia may be a generalized decrease in all types of white blood cells or it may be a specific depletion of particular types of white blood cells. Thus, polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof may be useful in the diagnosis, prognosis, prevention and / or treatment of the decrease in the number of neutrophils. , known as neutropenia. Neutropenias that can be diagnosed, predicted, prevented and / or treated by polynucleotides and / or polypeptides of the G-Chemokine Receptor (CCR5) and / or agonists or antagonists thereof include, but are not limited to, infant genetic agranulocytosis, neutropenia familial, cyclic neutropenia, neutropenias that result from or are associated with dietary deficiencies (for example, vitamin B12 deficiency

or folic acid deficiency), neutropenias that result from or are associated with pharmacological treatments (eg, antibiotic regimens such as penicillin treatment, sulfonamide treatment, anticoagulant treatment, anticonvulsant drugs, antithyroid drugs and cancer chemotherapy) and resulting netropenias of increased neutrophil destruction that may occur in association with some bacterial or viral infections, allergic disorders, autoimmune diseases, conditions in which an individual has an enlarged spleen (for example Felty's syndrome, malaria and sarcoidosis) and some drug treatment regimens .

The polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof may be useful in the diagnosis, prognosis, prevention and / or treatment of lymphocytopenia (decrease in the numbers of B lymphocytes and / or T), including, without limitation, lymphocytopenias that result from or are associated with stress, pharmacological treatments (for example, drug treatment with corticosteroids, cancer chemotherapies and / or radiation therapies), AIDS and / or other diseases such as, for for example, cancer, rheumatoid arthritis, systemic lupus erythematoses, chronic infections, some viral infections and / or inherited disorders (for example, DiGeorge syndrome, Wiskott-Aldrich syndrome, combined severe immunodeficiency, ataxia telangiectasia).

Polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof may be useful in the diagnosis, prognosis, prevention and / or treatment of diseases and disorders associated with the number of macrophages and / or the macrophage function including, but not limited to, Gaucher disease, Niemann-Pick disease, Letterer-Siwe disease and HandSchuller-Christian disease.

Polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or antagonists or agonists thereof may be useful in the diagnosis, prognosis, prevention and / or treatment of diseases and disorders associated with the number of eosinophils and / or the function of eosinophils including, but not limited to, idiopathic hypereosinophilic syndrome, eosinophilia-myalgia syndrome and Hand-Schuller-Christian disease.

Polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof may be useful in the diagnosis, prognosis, prevention and / or treatment of leukemia and lymphomas including, but not limited to, leukemia. acute lymphocytic (lymphoblastic) (ALL), acute myeloid leukemia (myelocytic, myelogenous, myeloblastic or myelomonocytic), chronic lymphocytic leukemia (for example, B lymphocyte leukemia, T lymphocyte leukemia, Sezary leukemia and tricoleukemia), chronic myelocytic leukemia ( myeloid, myelogenous or granulocytic), Hodgkin lymphoma, non-hodgkin lymphoma, Burkitt lymphoma and fungoid mycosis.

Polypeptides, antibodies of the invention or polynucleotides and / or agonists or antagonists thereof, may be useful for diagnosing, predicting, preventing and / or treating complex immune diseases, including, but not limited to, serum sickness, post-streptococcal glomerulonephritis, polyarteritis. nodosa and vasculitis induced by immune complex.

Polypeptides, antibodies of the invention, polynucleotides and / or agonists or antagonists can be used to treat, detect and / or prevent infectious agents. For example, by increasing the immune response, particularly increasing the activation of the proliferation and / or differentiation of B and / or T lymphocytes, infectious diseases can be treated, detected and / or prevented. The immune response can be increased by enhancing an existing immune response or by initiating a new immune response. Alternatively, polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof can also directly inhibit the infectious agent (refer to the section of the application that lists infectious agents, etc. .) without necessarily inducing an immune response.

Polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof can be used as a vaccine adjuvant that enhances the immune response to an antigen. Polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof can be used as an adjuvant to enhance tumor-specific immune responses.

Polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof can be used as an adjuvant to potentiate the antiviral immune responses. Antiviral immune responses that can be enhanced using the compositions described herein as an adjuvant, include viruses and diseases associated with viruses or symptoms described herein or otherwise known in the art. The compositions of the invention can be used as an adjuvant to improve an immune response to a virus, disease or symptom selected from the group consisting of AIDS, meningitis, Dengue, EBV and hepatitis (eg, hepatitis B). The compositions of the invention can be used as an adjuvant to enhance an immune response to a virus, disease or symptom selected from the group consisting of HIV-AIDS, respiratory syncytial virus, Dengue, rotavirus, Japanese encephalitis B, influenza A and B, paragripe , measles, cytomegalovirus, rabies, Junin, Chikungunya, Rift Valley Fever, herpes simplex and yellow fever.

Polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof can be used as an adjuvant to enhance antibacterial or antifungal immune responses. Antifungal or antibacterial immune responses that can be enhanced using the compositions of the invention as an adjuvant, include bacteria or fungi and diseases associated with bacteria or fungi or symptoms described herein or otherwise known in the art. The compositions of the invention can be used as an adjuvant to enhance an immune response to a bacterium or fungus, disease or symptom selected from the group consisting of: tetanus, diphtheria, botulism and type B meningitis.

The compositions of the invention can be used as an adjuvant to enhance an immune response to a bacterium or fungus, disease or symptom selected from the group consisting of: Vibrio cholerae, Mycobacterium leprae, Salmonella typhi, Salmonella paratyphi, Meisseria meningitidis, Streptococcus pneumoniae, streptococcus Group B, Shigella spp., Escherichia coli Enterotoxigenic, E. coli Enterohemorrhagic, and Borrelia burgdorferi.

Polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof can be used as an adjuvant to enhance antiparasitic immune responses. Antiparasitic immune responses that can be enhanced using the compositions of the invention as an adjuvant, include parasites and diseases associated with parasites or symptoms described herein.

or otherwise known in the art. The compositions of the invention can be used as an adjuvant to enhance an immune response to a parasite. The compositions of the invention can be used as an adjuvant to enhance an immune response to Plasmodium (malaria) or Leishmania.

Polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof can also be used to treat infectious diseases including silicosis, sarcoidosis and idiopathic pulmonary fibrosis, for example, preventing the recruitment and activation of mononuclear phagocytes

Polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof can be used as an antigen for the generation of antibodies to inhibit or enhance the mediated immune responses against these polypeptides.

The polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof can be administered to an animal (eg, mouse, rat, rabbit, hamster, guinea pig, pigs, miniaturized pigs, chicken , camel, goat, horse, cow, sheep, dog, cat, non-human primate and human being, more preferably human being) to boost the immune system to produce larger amounts of one or more antibodies (eg, IgG, IgA, IgM and IgE), to induce higher affinity antibody production and immunoglobulin class change (eg, IgG, IgA, IgM and IgE) and / or to increase an immune response.

Polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof can be used as a stimulator of B-lymphocyte sensitivity to pathogens.

Polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof can be used as a T-cell activator.

Polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof can be used as an agent that elevates an individual's immune status before receiving immunosuppressive therapies.

Polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof can be used as an agent to induce higher affinity antibodies.

Polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof can be used as an agent to increase serum immunoglobulin concentrations.

Polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof can be used as an agent to accelerate the recovery of immunocompromised individuals.

Polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof can be used as an agent to enhance the immune response between larger and / or newborn populations.

Polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof can be used as an immune system enhancer before, during or after bone marrow transplantation and / or other transplants ( for example, allogeneic or xenogenic organ transplantation). With respect to transplants, the compositions of the invention can be administered before, together with and / or after transplantation. The compositions of the invention can be administered after transplantation, before the start of recovery of T lymphocyte populations. The compositions of the invention can be administered first after transplantation, after the start of recovery of T lymphocyte populations, but before of the complete recovery of B lymphocyte populations.

Polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof can be used as an agent to enhance the immune response among individuals who have an acquired loss of B-lymphocyte function. Conditions that result in an acquired loss of function of B lymphocytes that can be improved or treated by the administration of polypeptides, antibodies, polynucleotides and / or agonists or antagonists thereof, include, but are not limited to, HIV infection, AIDS, transplantation of bone marrow and chronic lymphocytic B-lymphocytic leukemia (CLL).

Polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof can be used as an agent to enhance the immune response among individuals who have a temporary immune deficiency. Conditions that result in a temporary immune deficiency that can be alleviated or treated by administration of the polypeptides, antibodies, polynucleotides and / or agonists or antagonists thereof, include, but are not limited to, recovery from viral infections (e.g., influenza ), conditions associated with malnutrition, recovery of infectious mononucleosis or conditions associated with stress, measles recovery, blood transfusion recovery and surgery recovery.

The polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof can be used as a regulator of antigen presentation by monocytes, dendritic cells and / or lymphocytes B. The polynucleotides and / or G protein Chemokine Receptor polypeptides (CCR5) and / or agonists

or antagonists thereof may enhance the presentation of antigen or antagonize the presentation of antigen in vitro or in vivo. In addition, said potentiation or antagonism of antigen presentation may be useful as an antitumor treatment or to modulate the immune system.

Polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof can be used as an agent to direct the immune system of an individual towards the development of a humoral response (ie TH2) as opposed to a TH1 cellular response.

Polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof can be used as a means to induce tumor proliferation and thus make it more susceptible to antineoplastic agents. For example, multiple myeloma is a disease of slow division and thus is resistant to virtually all antineoplastic regimens. If these cells were forced to proliferate more rapidly, their susceptibility profile would probably change.

Polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof can be used as a stimulator of production of B lymphocytes in pathologies such as AIDS, chronic lymphocytic disorder and / or common variable immunodeficiency .

Polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof can be used as a therapy for generation and / or regeneration of lymphoid tissues after surgery, trauma or genetic defect. The polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof can be used in the pretreatment of bone marrow samples before transplantation.

Polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof can be used as a gene-based therapy for genetically inherited disorders resulting in immunincompetence / immunodeficiency such as that observed among patients with SCID

Polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof can be used as a means to activate monocytes / macrophages to defend against parasitic diseases that affect monocytes such as Leishmania.

Polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof can be used as a means to regulate secreted cytokines that are induced by the polypeptides.

Polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof can be used in one or more of the applications described herein, as well as can be applied to veterinary medicine.

Polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof can be used as a means to block various aspects of immune responses to foreign or proprietary agents. Examples of diseases or conditions in which blocking certain aspects of immune responses may be desired include autoimmune diseases such as lupus and arthritis as well as immune response to skin allergies, inflammation, bowel disease, injuries and diseases / disorders associated with pathogens.

Polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof can be used as a therapy to prevent the proliferation of B lymphocytes and the secretion of Ig associated with autoimmune diseases such as thrombocytopenic purpura. idiopathic, systemic lupus erythematosus and multiple sclerosis.

Polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof can be used as an inhibitor of migration of B and / or T lymphocytes in endothelial cells. This activity alters the tissue architecture or related responses and is useful, for example, to alter the immune response and block sepsis.

Polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof can be used as a therapy for chronic hypergammaglobulinemia evident in such diseases as monoclonal gammopathy of undetermined significance (MGUS), disease of Waldenstrom, related idiomatic monoclonal gammopathies and plasmacytomas.

Polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof can be used, for example, to inhibit chemotaxis of polypeptides and activation of macrophages and their precursors and neutrophils, basophils, B lymphocytes and some subsets of T lymphocytes, for example, activated and cytotoxic CD8 T lymphocytes and cytolytic cells, in certain chronic autoimmune and inflammatory and infectious diseases. Examples of autoimmune diseases are described herein and include multiple sclerosis and insulin-dependent diabetes.

Polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof can also be used to treat idiopathic hypereosinophilic syndrome by, for example, preventing the production and migration of eosinophils.

Polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof can be used to enhance or inhibit complement-mediated cell lysis.

Polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof can be used to enhance or inhibit antibody-dependent cellular cytotoxicity.

Polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof can also be used to treat atherosclerosis, for example, by preventing infiltration of monocytes into the arterial wall.

Polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof can be used to treat adult respiratory distress syndrome (ARDS).

Polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof may be useful for stimulating tissue and wound repair, stimulating angiogenesis and / or stimulating the repair of lymphatic diseases or disorders or vascular Additionally, agonists and antagonists can be used to stimulate the regeneration of mucous surfaces.

The polynucleotides or polypeptides and / or agonists thereof can be used to diagnose, predict, treat and / or prevent a disorder characterized by primary or acquired immunodeficiency, production of deficient serum immunoglobulins, recurrent infections and / or immune system dysfunction. In addition, polynucleotides or polypeptides and / or agonists thereof can be used to treat or prevent infections of the joints, bones, skin and / or parotid glands, blood borne infections (eg, sepsis, meningitis, septic arthritis and / or osteomyelitis), autoimmune diseases (for example, those described herein), inflammatory disorders and malignant tumors and / or any disease or disorder or condition associated with these infections, diseases, disorders and / or malignant tumors) including, but not limited to , CVID, other primary immune deficiencies, HIV disease, CLL, recurrent bronchitis, sinusitis, otitis media, conjunctivitis, pneumonia, hepatitis, meningitis, herpes zoster (for example, severe herpes zoster) and / or pneumocystis camii. Other diseases and disorders that can be prevented, diagnosed, predicted and / or treated with polynucleotides or polypeptides and / or agonists include, but are not limited to, HIV infection, HTLV-BLV infection, lymphopenia, phagocyte bactericidal dysfunction anemia, thrombocytopenia and hemoglobinuria

Polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof can be used to treat and / or diagnose an individual who has a common variable immunodeficiency disease ("CVID"; also known such as "acquired agammaglobulinemia" and "acquired hypogammaglobulinemia") or a subset of this disease.

Polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof can be used to diagnose, predict, prevent and / or treat cancers or malignancies that include cancers or neoplasms of immune or related cells. with immune tissue. Examples of cancers or malignancies that can be prevented, diagnosed or treated by polynucleotides and / or polypeptides of the G-Chemokine Receptor (CCR5) and / or agonists or antagonists thereof include, but are not limited to, acute myelogenous leukemia, myelogenous leukemia. chronic, Hodgkin's disease, non-Hodgkin's lymphoma, acute lymphocytic anemia (ALL), chronic lymphocytic leukemia, plasmacytomas, multiple myeloma, Burkitt's lymphoma, EBV-transformed diseases and / or diseases and disorders described in the section entitled "Hyperproliferative Disorders" elsewhere in this report.

Polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof can be used as a therapy to decrease cell proliferation of large B lymphocyte lymphomas.

Polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof can be used as a means to decrease the involvement of B and Ig lymphocytes associated with Chronic Myelogenous Leukemia.

The compositions of the invention can be used as an agent to enhance the immune response among immunodeficient individuals for B lymphocytes, such as, for example, an individual who has undergone partial or complete splenectomy.

Antagonists include, for example, binding antibodies and / or inhibitors, antisense nucleic acids, ribozymes.

or soluble forms of the polypeptides described herein (eg, Fc fusion protein). Agonists include, for example, binding antibodies or stimulators and soluble forms of the polypeptides (eg, Fc fusion proteins). Polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof can be employed in a composition with a pharmaceutically acceptable carrier, for example, as described herein.

Polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof can be administered to an animal (including, but not limited to, those listed above and also including transgenic animals) unable to produce molecules. of functional endogenous antibodies or having an otherwise compromised endogenous immune system, but which is capable of producing human immunoglobulin molecules by means of a reconstituted or partially reconstituted immune system of another animal (see, for example, published PCT Applications No. WO98 / 24893, WO / 9634096, WO / 9633735, and WO / 9110741). The administration of polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof to said animals may be useful for the generation of monoclonal antibodies against the polynucleotides and / or polypeptides of the Chemokine Receptor of protein G (CCR5) and / or agonists or antagonists thereof.

Chemotaxis Polynucleotides or polypeptides of the G-protein Chemokine Receptor (CCR5) or agonists or antagonists of the G-protein Chemokine Receptor (CCR5) may have chemotactic activity. A chemotactic molecule attracts or mobilizes cells (for example, monocytes, fibroblasts, neutrophils, T lymphocytes, mast cells, eosinophils, epithelial cells and / or endothelial cells) to a particular site of the body, such as inflammation, infection

or hyperproliferation site. The mobilized cells can thus fight and / or cure the trauma or the particular anomaly.

Polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) or agonists or antagonists of the G-protein Chemokine Receptor (CCR5) can increase the chemotactic activity of particular cells. These chemotactic molecules can then be used to treat, prevent and / or diagnose inflammation, infection, diseases, disorders and / or hyperproliferative conditions or any other immune system disorder by increasing the number of cells directed to a particular location in the body. For example, chemotactic molecules can be used to treat, prevent and / or diagnose wounds and other trauma to tissues by attracting immune cells to the location of the lesion. Chemotactic molecules can also attract fibroblasts, which can be used to treat, prevent and / or diagnose wounds.

It is also contemplated that polynucleotides or polypeptides of the G-protein Chemokine Receptor (CCR5) or agonists or antagonists of the G-protein Chemokine Receptor (CCR5), can inhibit chemotactic activity. These molecules could also be used to treat, prevent and / or diagnose diseases, disorders and / or conditions. Thus, polynucleotides or polypeptides of the G-protein Chemokine Receptor (CCR5) or agonists or antagonists of the G-protein Chemokine Receptor (CCR5) could be used as a chemotaxis inhibitor.

Infectious disease Polynucleotides or polypeptides of the G-protein Chemokine Receptor (CCR5) or agonists or antagonists of the G-protein Chemokine Receptor (CCR5) can be used to treat, prevent and / or diagnose infectious agents. For example, by increasing the immune response, particularly increasing the proliferation and differentiation of B and / or T lymphocytes, infectious diseases can be treated, prevented and / or diagnosed. The immune response can be increased by enhancing an existing immune response or by initiating a new immune response. Alternatively, polynucleotides or polypeptides of the G-protein Chemokine Receptor (CCR5) or agonists or antagonists of the G-protein Chemokine Receptor (CCR5), can also directly inhibit the infectious agent, without necessarily inducing an immune response.

Viruses are an example of an infectious agent that can cause disease or symptoms that can be treated, prevented and / or diagnosed by a polynucleotide or polypeptide and / or agonist or antagonist.

Examples of viruses include, but are not limited to the following DNA and RNA viruses and viral families: Arbovirus, Adenoviridae, Arenaviridae, Arterivirus, Birnaviridae, Bunyaviridae, Caliciviridae, Circoviridae, Coronaviridae, Dengue, EBV, HIV, Flaviviridae, Hepadnaviridae (Hepatitis) , Herpesviridae (such as, Cytomegalovirus, Herpes Simplex, Herpes Zoster), Mononegavirus (for example, Paramyxoviridae, Morbillivirus, Rhabdoviridae), Orthomyxoviridae (for example, Influenza A, Influenza B and paragripal), Papiloma virus, Papovaviridae, Parvonaviridae, Parvoviridae, Parvonaviridae Poxviridae (such as Smallpox or Vaccinia), Reoviridae (for example, Rotavirus), Retroviridae (HTLV-I, HTLV-II, Lentivirus), and Togaviridae (for example, Rubivirus). Viruses that remain within these families can cause a variety of diseases or symptoms, including, but not limited to: arthritis, bronchiolitis, respiratory syncytial virus, encephalitis, eye infections (e.g. conjunctivitis, keratitis), chronic fatigue syndrome, hepatitis (A, B, C, E, Active Chronic, Delta), Japanese encephalitis B, Junin, Chikungunya, Rift Valley Fever, yellow fever, meningitis, opportunistic infections (for example AIDS), pneumonia, Burkitt Lymphoma, chickenpox, Hemorrhagic fever, measles, mumps, paragripe, Rabies, common cold, Polio, leukemia, Rubella, sexually transmitted diseases, skin diseases (for example, Kaposi, warts) and viremia. The polynucleotides or polypeptides, or agonists or antagonists of the invention, can be used to treat, prevent and / or diagnose any of these symptoms or diseases. The polynucleotides, polypeptides, or agonists or antagonists of the invention are used to treat: meningitis, Dengue, EBV and / or hepatitis (for example, hepatitis B). Polynucleotides, polypeptides, or agonists or antagonists, can be used to treat patients who do not respond to one or more additional commercially available hepatitis vaccines. Polynucleotides, polypeptides, or agonists or antagonists, can be used to treat, prevent and / or diagnose AIDS.

Polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof, can be used to diagnose, treat, prevent or improve HIV infection.

Polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof, can be used to diagnose, treat, prevent or alleviate cytomegalovirus infections.

Polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof, can be used to diagnose, treat, prevent or alleviate Poxviridae infections.

Similarly, bacterial or fungal agents that can cause disease or symptoms and that can be treated, prevented and / or diagnosed by a polynucleotide or polypeptide and / or agonist or antagonist include, but are not imitated, the following Gram-Negative and Gram bacteria -positive and bacterial and fungal families: Actinomycetales (for example, Corynebacterium, Mycobacterium, Norcardia), Cryptococcus neoformans, Aspergillosis, Bacillaceae (for example, Anthrax, Clostridium), Bacteroidaceae, Blastomycosis, Bordetella, Borrelia, eg Brucellosis, Candidiasis, Campylobacter, Coccidioidomycosis, Cryptococcosis, Dermatocycoses, E. coli (for example, E. coli Enterotoxigenic and E. coli Enterohemorrhagic), Enterobacteriaceae (Klebsiella, Salmonella (for example, Salmonella typhi, and Salmonella Ser-keph) , Yersinia), Erysipelothrix, Helicobacter, Legionellosis, Leptospirosis, Listeria, Mycoplasmatales, Mycobacterium leprae, Vibr io cholerae, Neisseriaceae (for example, Acinetobacter, Gonorrhea, Menigococcal), Neisseria meningitidis, Pasteurellacea infections (for example, Actinobacillus, Heamophilus (for example, Heamophilus type B flu), Pasteurella), Pseudomonas, Ricketydiaceae, Rickettsiaceae , Shigella spp., Staphylococcal, meningococcal, pneumococcal and streptococcal (for example, Streptococcus pneumoniae and Group B Streptococcus). These bacterial or fungal families can cause the following diseases or symptoms, including, but not limited to: bacteremia, endocarditis, eye infections (conjunctivitis, tuberculosis, uveitis), gingivitis, opportunistic infections (e.g., AIDS-related infections), paronychia, infections related to prostheses, Reiter's disease, respiratory tract infections, such as whooping cough or Empyema, sepsis, Lyme disease, Cat scratch disease, Dysentery, Parathyroid Fever, food poisoning, Typhus, pneumonia, Gonorrhea, meningitis (for example , meningitis type A and B), Chlamydia, Syphilis, Diphtheria, Leprosy, Paratuberculosis, Tuberculosis, Lupus, Botulism, gangrene, tetanus, impetigo, Rheumatic Fever, Scarlet fever, sexually transmitted diseases, skin diseases (e.g. cellulite, dermatocytosis) , toxemia, urinary tract infections, wound infections. Polynucleotides or polypeptides, agonists or antagonists can be used to treat, prevent and / or diagnose any of these symptoms or diseases. Polynucleotides, polypeptides, agonists or antagonists can be used to treat: tetanus, diphtheria, botulism and / or type B meningitis.

In addition, parasitic agents that cause diseases or symptoms that can be treated, prevented and / or diagnosed by a polynucleotide or polypeptide and / or agonist or antagonist include, but are not limited to, the following families or classes: Amebiasis, Babesiosis, Coccidiosis, Cryptosporidiosis, Dientamoebiasis, durine, Ectoparasitic, Giardiasis, Helminthiasis, Leishmaniasis, Teileriasis, Toxoplasmosis, Trypanosomiasis and Trichomonas and Esporozoides (for example, Plasmodium virax, Plasmodium falciparium, Plasmodium malariae and Plasmodium ovale).

These parasites can cause a variety of diseases or symptoms, including, but not limited to: Scabiosis, Thrombiculiasis, eye infections, intestinal disease (e.g., dysentery, giardiasis), liver disease, lung disease, opportunistic infections (e.g., related with AIDS), malaria, pregnancy complications and toxoplasmosis. Polynucleotides or polypeptides, or agonists or antagonists may be used to treat, prevent and / or diagnose any of these symptoms or diseases. Polynucleotides, polypeptides or agonists or antagonists can be used to treat, prevent and / or diagnose malaria.

Preferably, the treatment or prevention using a polypeptide or polynucleotides and / or agonist or antagonist could be by administration of an effective amount of a polypeptide to the patient or by removing the patient's cells, providing the cells with a polynucleotide and returning the engine-modified cells. genetics to the patient (ex vivo therapy). In addition, the polypeptide or polynucleotide can be used as an antigen in a vaccine to induce an immune response against infectious disease.

Neurological diseases. Diseases, disorders and / or conditions of the nervous system that can be treated with G-protein Chemokine Receptor (CCR5) compositions (e.g., polypeptides, polynucleotides and / or agonists or antagonists of the G-protein Chemokine Receptor (CCR5)) They include, but are not limited to, nervous system injuries and diseases, disorders and / or conditions that result in axon disconnection, a decrease or degeneration of neurons or demyelination. Lesions of the nervous system that can be treated in a patient (including human and non-human mammalian patients) include, but are not limited to, the following lesions of the central nervous system (including spinal cord, brain) or peripheral: (1) ischemic lesions, in those that a lack of oxygen in a part of the nervous system results in neuronal injury or death, including ischemia or cerebral infarction or ischemia or spinal cord infarction; (2) traumatic injuries, including injuries caused by physical injury or associated with surgery, for example, injuries that section a part of the nervous system or compression injuries; (3) malignant lesions, in which a part of the nervous system is destroyed or injured by malignant tissue that is a malignant tumor associated with the nervous system

or a malignant tumor derived from tissue not from the nervous system; (4) infectious lesions, in which a part of the nervous system is destroyed or injured as a result of infection, for example, by an abscess or associated with infection by human immunodeficiency virus, herpes zoster or herpes simplex virus or with disease of Lyme, tuberculosis, syphilis; (5) degenerative lesions, in which a part of the nervous system is destroyed or injured as a result of a degenerative process that includes but not limited to degeneration associated with Parkinson's disease, Alzheimer's disease, Huntington's chorea or amyotrophic lateral sclerosis (ALS) ; (6) injuries associated with diseases, disorders and / or nutritional conditions, in which a part of the nervous system is destroyed or injured by a nutritional disorder or metabolism disorder that includes but is not limited to vitamin B12 deficiency, folic acid deficiency , Wernicke's disease, tobacco-alcohol amblyopia, Marchiafava-Bignami disease (primary degeneration of the corpus callosum) and alcoholic cerebellar degeneration, (7) neurological lesions associated with systemic diseases that include, but are not limited to, diabetes (diabetic neuropathy, paralysis Bell), systemic lupus erythematosus, carcinoma or sarcoidosis; (8) injuries caused by toxic substances that include alcohol, lead or particular neurotoxins; and (9) demyelinated lesions in which a part of the nervous system is destroyed or injured by a demyelinating disease that includes, but is not limited to, multiple sclerosis, myelopathy associated with human immunodeficiency virus, transverse myelopathy or various etiologies, progressive multifocal leukoencephalopathy and central myelinolysis of the bridge.

Polypeptides, polynucleotides or agonists or antagonists of the G-protein Chemokine Receptor (CCR5) can be used to protect neural cells from the damaging effects of cerebral hypoxia. The G-protein Chemokine Receptor (CCR5) compositions can be used to treat, prevent and / or diagnose neural cell injury associated with cerebral hypoxia. Polypeptides, polynucleotides or agonists or antagonists of the G-protein Chemokine Receptor (CCR5) can be used to treat, prevent and / or diagnose neural cell injury associated with cerebral ischemia. Polypeptides, polynucleotides or agonists or antagonists of the G-protein Chemokine Receptor (CCR5) can be used to treat, prevent and / or diagnose neural cell injury associated with cerebral infarction. Polypeptides, polynucleotides or agonists or antagonists of the G-protein Chemokine Receptor (CCR5) can be used to treat, prevent and / or diagnose neural cell injury associated with a stroke. Polypeptides, polynucleotides or agonists or antagonists of the G-protein Chemokine Receptor (CCR5) can be used to treat, prevent and / or diagnose brain neural cell injury associated with a stroke.

Polypeptides, polynucleotides or agonists or antagonists of the G-protein Chemokine Receptor (CCR5) can be used to treat, prevent and / or diagnose neural cell injury associated with myocardial infarction.

Polypeptides, polynucleotides or agonists or antagonists of the G-protein Chemokine Receptor (CCR5) can be used to treat, prevent and / or diagnose brain neural cell injury associated with myocardial infarction.

Compositions that may be useful for treating, preventing and / or diagnosing a nervous system disorder can be selected by assay with respect to biological activity by promoting survival or differentiation of neurons. For example, and not as a limitation, G-protein Chemokine Receptor (CCR5) compositions that induce any of the following effects may be useful in accordance with the invention: (1) increased survival time of neurons in culture; (2) increased growth of neurons in culture

or in vivo; (3) increased production of molecules associated with neurons in culture or in vivo, for example, choline acetyltransferase or acetylcholinesterase with respect to motor neurons; or (4) decrease in neuron dysfunction symptoms in vivo. Such effects can be measured by any method known in the art. The increase in neuron survival can be routinely measured using a method set forth herein or otherwise known in the art, such as, for example, the method set forth in Arakawa et al. (J. Neurosci. 10: 3507-3515 (1990)); The growth of neurons can be detected by methods known in the art, such as, for example, the methods set forth in Pestronk et al. (Exp. Neurol. 70: 65-82 (1980)) or Brown et al. (Ann. Rev. Neurosci. 4: 17-42 (1981)); the increase in the production of molecules associated with neurons can be measured by bioassay, enzymatic assay, antibody binding, Northern blotting assay, etc., using techniques known in the art and depending on the molecule to be measured; and motor neuron dysfunction can be measured by assessing the physical manifestation of motor neuron disorder, for example, weakness, motor neuron conduction velocity or functional disability.

Diseases, disorders and / or conditions of motor neurons that can be treated include, but are not limited to, diseases, disorders and / or conditions such as infarction, infection, toxin exposure, trauma, surgical damage, degenerative disease or malignant tumor that may affect motor neurons as well as other components of the nervous system, as well as diseases, disorders and / or conditions that selectively affect neurons such as amyotrophic lateral sclerosis and including, but not limited to, progressive spinal muscular atrophy, progressive bulbar paralysis , primary lateral sclerosis, infantile and juvenile muscular atrophy, progressive bulbar paralysis of childhood (Fazi-Londe syndrome), poliomyelitis and post-polio syndrome and hereditary sensory and motor neuropathy (Charcot-Marie-Tooth disease).

In addition, polypeptides or polynucleotides of the G-protein Chemokine Receptor (CCR5) may play a role in neuronal survival; synopsis formation; conductance; neural differentiation, etc. Thus, the compositions (including polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof) can be used to diagnose and / or treat or prevent diseases or disorders associated with these roles. , including, but not limited to, learning disorders and / or cognition. The compositions may also be useful in the treatment or prevention of neurodegenerative pathologies and / or behavioral disorders. Such neurodegenerative pathologies and / or behavioral disorders include, but are not limited to, Alzheimer's disease, Parkinson's disease, Huntington's disease, Tourette's syndrome, schizophrenia, mania, dementia, paranoia, obsessive compulsive disorder, panic disorder, learning disabilities , ALS, psychosis, autism and altered behaviors, including eating disorders, sleep patterns, balance and perception. In addition, the compositions may also play a role in the treatment, prevention and / or detection of developmental disorders associated with the developing embryo or sex-linked disorders.

Additionally, polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists

or antagonists thereof, may be useful in protecting neural cells from diseases, damage, disorders or injury, associated with cerebrovascular disorders including, but not limited to, carotid artery diseases (eg, carotid artery thrombosis, stenosis of carotid or Moyamoya disease), cerebral amyloid angiopathy, cerebral aneurysm, cerebral anoxia, cerebral arteriosclerosis, cerebral arteriovenous malformations, diseases of the cerebral arteries, cerebral embolism and thrombosis (for example, carotid artery thrombosis, sinus thrombosis or Wallenberg syndrome), cerebral hemorrhage (for example, epidural or subdural hematoma or subarachnoid hemorrhage), cerebral infarction, cerebral ischemia (for example, transient cerebral ischemia, Subclavian steal syndrome or vertebrobasilar insufficiency), vascular dementia (for example, multi-infarction), leukomalacia, periventricular and vascular headache (for example plo, cluster headache or migraines).

According to a further aspect, a method for using polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof, for therapeutic purposes, for example, to stimulate proliferation is described and / or differentiation of neurological cells. Therefore, polynucleotides, polypeptides, agonists and / or antagonists can be used to treat and / or detect neurological diseases. Furthermore, polynucleotides and / or polypeptides of the G-protein Chemokine Receptor (CCR5) and / or agonists or antagonists thereof can be used as a marker or detector of a particular nervous system disease or disorder.

Examples of neurological diseases that can be treated or detected with the G-protein Chemokine Receptor polynucleotides and / or polypeptides and / or agonists or antagonists thereof, include brain diseases, such as metabolic brain diseases that include phenylketonuria; such as maternal phenylketonuria; pyruvate carboxylase deficiency, pyruvate dehydrogenase complex deficiency, Wernicke encephalopathy, cerebral edema, cerebral neoplasms such as cerebellar neoplasms, including infratentorial neoplasms, cerebral ventricle neoplasms such as choroid plexus neoplasms, supra-hyposoplasias neoplasias , cerebellar diseases such as cerebellar ataxia including spinocerebellar degeneration such as telangiectasia ataxia, cerebellar dysinergia, Friederich's ataxia, Machado-Joseph's disease, olivopontocerebellar atrophy, cerebellar neoplasms such as infratentorial neoplasms, diffuse cerebral sclerosis such as periatrial encephalitis, periatrial globitis, periaphoid leiatritis, periaphoid leiatritis, periatrial globitis Metachromatic leukodystrophy and subacute sclerosing panencephalitis.

Additional neurological diseases that can be treated or detected with the G-protein Chemokine Receptor polynucleotides and / or polypeptides and / or agonists or antagonists thereof, include cerebrovascular disorders (such as carotid artery diseases that include thrombosis of the carotid artery, carotid stenosis and Moyamoya disease), cerebral amyloid angiopathy, cerebral aneurysm, cerebral anoxia, cerebral arteriosclerosis, cerebral arteriovenous malformations, cerebral artery diseases, embolism and cerebral thrombosis such as carotid artery thrombosis, sinus thrombosis and Wallenberg syndrome, cerebral haemorrhage such as epidural hematoma, subdural hematoma and subarachnoid hemorrhage, cerebral infarction, cerebral ischemia such as transient cerebral ischemia, Subclavian steal syndrome and vertebrovasilar insufficiency, vascular dementia such as multi-infarct dementia, leukomalacia peri ventricular, vascular headache such as cluster headache and migraine.

Additional neurological diseases that can be treated or detected with the G-protein Chemokine Receptor polynucleotides and / or polypeptides or agonists or antagonists thereof, include dementia such as AIDS Dementia Complex, presenile dementia such as Disease of Alzheimer's and Creutzfeldt-Jakob Syndrome, senile dementia such as Alzheimer's disease and progressive supranuclear paralysis, vascular dementia such as multi-infarct dementia, encephalitis that includes periaxial encephalitis, Viral encephalitis such as epidemic encephalitis, Japanese encephalitis, St. Louis encephalitis , tick-borne encephalitis and West Nile Fever, acute disseminated encephalomyelitis, meningoencephalitis such as uveomeningoencephalitic syndrome, post-encephalitic Parkinson's disease and subacute sclerosing panencephalitis, encephalomalacia such as periventricular leukomalacia, epilepsy such as general epilepsy infants, absence epilepsy, myoclonic epilepsy that includes MERRF syndrome, clonic tonic epilepsy, partial epilepsy such as complex partial epilepsy, frontal lobe epilepsy and temporal lobe epilepsy, post-traumatic epilepsy, epileptic status such as Continuous Partial Epilepsy and Continuous Partial Epilepsy from Hallervorden-Spatz.

Additional neurological diseases that can be treated or detected with the G-protein Chemokine Receptor polynucleotides and / or polypeptides and / or agonists or antagonists thereof, include hydrocephalus such as Dandy-Walker Syndrome and normal pressure hydrocephalus , hypothalamic diseases such as hypothalamic neoplasms, cerebral malaria, narcolepsy including cataplexy, bulbar polio, cerebral pseudotumor, Rett syndrome, Reye syndrome, thalamic diseases, cerebral toxoplasmosis, intracranial tuberculoma and Zellweger syndrome, nervous system infections such as Complex of AIDS Dementia, Cerebral Abscess, subdural empyema, encephalomyelitis such as Equine Encephalomyelitis, Venezuelan Equine Encephalomyelitis, Necrotizing Hemorrhagic Encephalomyelitis, Visna and cerebral malaria.

Additional neurological diseases that can be treated or detected with the G-protein Chemokine Receptor polynucleotides and / or polypeptides (CCR5) and / or agonists or antagonists thereof, include meningitis such as arachnoiditis, aseptic meningitis, such as viral meningitis that includes lymphocytic choriomeningitis, Bacterial meningitis that includes Haemophilus Meningitis, Listeria Meningitis, Meningococcal Meningitis such as Waterhouse-Friderichsen Syndrome, Pneumococcal Meningitis and Meningeal Tuberculosis, Fungal Meningitis such as Cryptococcal Meningitis, subdural effusion such as meningoencephalic encephalogenesis Myelitis such as transverse myelitis, neurosyphilis such as dorsal tabes, poliomyelitis that includes bulbar polio and postpolio syndrome, prion diseases (such as Creutzfeldt-Jakob Syndrome, Bovine Spongiform Encephalopathy, Gerstmann-Straussler Syndrome, Kuru, Tembl adera) and cerebral toxoplasmosis.

Additional neurological diseases that can be treated or detected with the G-protein Chemokine Receptor polynucleotides and / or polypeptides (CCR5) and / or agonists or antagonists thereof, include central nervous system neoplasms such as brain neoplasms that include cerebellar neoplasms such as infratentorial neoplasms, cerebral ventricle neoplasms such as choroid plexus neoplasms, hypothalamic neoplasms and supratentorial neoplasms, meningeal neoplasms, spinal cord neoplasms that include epidural neoplasms, demyelinating diseases such as diphtheria dysplasia, strokes of the brain periaxial encephalitis, globular leukodystrophy, diffuse cerebral sclerosis such as metachromatic leukodystrophy, allergic encephalomyelitis, necrotizing hemorrhagic encephalomyelitis, progressive multifocal leukoencephalopathy, multiple sclerosis, central myelinolysis of the p Source, transverse myelitis, optic neuromyelitis, scrapie, lordosis, Chronic Fatigue Syndrome, Visna, High Pressure Nervous Syndrome, Meningism, spinal cord diseases such as congenital amyotonia, amyotrophic lateral sclerosis, spinal muscular atrophy such as Werdnig's Disease Hoffmann, spinal cord compression, spinal cord neoplasms such as epidural neoplasms, syringomyelia, Dorsal Tabes, Rigid Person Syndrome, mental retardation such as Angelman Syndrome, Cat Meow Syndrome, De Lange Syndrome, Down, Gangliosidosis such as gangliosidosis G (M1), Sandhoff's disease, Tay-Sachs disease, Hartnup's disease, homocystinuria, Laurence-Moon-Biedl syndrome, Lesch-Nyhan's syndrome, Urine with Smell of Syrup Maple, mucolipidosis such as fucosidosis, neuronal zeroide lipofuscinosis, oculocerebrorrenal syndrome, phenylketonuria such as maternal phenylketonuria , Prader-Willi syndrome, Rett syndrome, Rubinstein-Taybi syndrome, Tuberous sclerosis, WAGR syndrome, nervous system abnormalities such as holoprosencephaly, neural tube defects such as anencephaly including hydranencephaly, Arnold-Chairi deformity, encephalocele , meningocele, meningomyelocele, spinal dysraphism such as cystic spina bifida and hidden spina bifida.

Additional neurological diseases that can be treated or detected with G-protein Chemokine Receptor polynucleotides and / or polypeptides (CCR5) and / or agonists or antagonists thereof include hereditary sensory and motor neuropathies that include Charcot-Marie disease, atrophy Hereditary optics, Refsum disease, hereditary spastic paraplegia, Werdnig-Hoffmann disease, Hereditary Autonomic and Sensitive Neuropathies such as Congenital Analgesia and Family Dysautonomia, Neurological manifestations (such as agnosia that includes Gerstmann Syndrome, Amnesia such as retrograde amnesia, aprara, neurogenic bladder, cataplexy, communicative disorders such as hearing disorders including deafness, partial hearing loss, volume and tinnitus recruitment, language disorders such as aphasia including agrafia, anomia, drill aphasia and Wernicke's aphasia, Dyslexia tal as Acquired Dyslexia, language development disorders, speech disorders such as aphasia that includes anomia, drill aphasia and Wernicke's aphasia, joint disorders, communicative disorders such as speech disorders that include dysarthria, ecolalia, mutism and stuttering, voice disorders such such as aphonia and hoarseness, state of debrakeration, delirium, fasciculation, hallucinations, meningism, movement disorders such as angelman syndrome, ataxia, athetosis, chorea, dystonia, hypokinesia, muscular hypotonia, myoclonus, tic, torticollis and tremor, muscular hypertonia such such as muscle stiffness such as rigid person syndrome, muscular spasticity, paralysis such as facial paralysis that includes Herpes Zoster Ophthalmic, Gastroparesis, Hemiplegia, ophthalmoplegia such as diplopia, Duane syndrome, Horner syndrome, Chronic progressive external ophthalmoplegia such as Kearns, Bulbar Paralysis, Tropical Spastic Paraparesis, Paraplegia such as Brown-Sequard syndrome, tetraplegia, respiratory paralysis and vocal cord paralysis, paresis, phantom limb, taste disorders such as ageusia and dysgeusia, vision disorders such as amblyopia, blindness, color vision defects, diplopia, hemianopia, scotoma and vision less than normal, sleep disorders such as hypersomnia that includes Kleine-Levin syndrome, insomnia, and sleepwalking, spasms such as trismus, unconsciousness such as coma, persistent vegetative state and syncope and vertigo, diseases neuromuscular factors such as congenital amyotonia, amyotrophic lateral sclerosis, Lambert-Eaton Mysthenic Syndrome, motor neuron disease, muscular atrophy such as spinal muscular atrophy, Charcot-Marie disease and Werdnig-Hoffmann disease, Postpolyomelitis syndrome, Muscular dystrophy, Myasthenia Severe, Atrophic Myotonia, Congenital Myotonia, Nemalinic Myopathy, Periodi Palsy Ca family, Multiple Paramioclonia, Tropical Spastic Paraparesis and Rigid Person Syndrome, peripheral nervous system diseases such as acrodynia, amyloid neuropathies, autonomic nervous system diseases such as Adie Syndrome, Barre-Lieou Syndrome, Family Dysautonomy, Horner, Sympathetic Dystrophy Reflect and Shy-Drager Syndrome, Cranial Nerve Diseases such as Acoustic Nerve Diseases such as Acoustic Neuroma that includes Neurofibromatosis 2, Facial Nerve Diseases such as Facial Neuralgia, Melkersson-Rosenthal Syndrome, ocular motility disorders which include amblyopia, nystagmus, oculomotor nerve paralysis, ophthalmoplegia such as Duane Syndrome, Horner Syndrome, Chronic Progressive External Ophthalmoplegia that includes Kearns Syndrome, Strabismus such as Esotropia and Exotropia, Oculomotor Nerve Paralysis, Optic Nerve Diseases such as Optic atrophy This includes Hereditary Optic Atrophy, Optical Disc Drusen, Optic Neuritis such as Optic Neuromyelitis, Papiledema, Trigeminal Neuralgia, Vocal Rope Paralysis, Demyelinating Diseases such as Optic Neuromyelitis and Lordosis and Diabetic Neuropathies such as diabetic foot.

Additional neurological diseases that can be treated or detected with the G-protein Chemokine Receptor polynucleotides and / or polypeptides and / or agonists or antagonists thereof, include nerve compression syndromes such as carpal tunnel syndrome, carpal tunnel syndrome, tarsal tunnel, thoracic operculum syndrome such as cervical rib syndrome, ulnar nerve compression syndrome, neuralgia such as causalgia, cervico-brachial neuralgia, facial neuralgia and trigeminal neuralgia, neuritis such as experimental allergic neuritis, optic neuritis, polyneuritis, polyradiculoneuritis and radiculitis such as polyradiculitis, hereditary motor and sensory neuropathies such as Charcot-Marie Disease, Hereditary Optic Atrophy, Refsum Disease, Hereditary Spastic Paraplegia and Werdnig-Hoffmann Disease, Sensory and Autonomous Hereditary Neuropathies and Congenital Autonomy Analgesia liar, POEMS syndrome, sciatica, gustatory sweating and tetany).

Hyperproliferative disorders Polynucleotides or polypeptides of the G-protein Chemokine Receptor (CCR5) or agonists or antagonists of the G-protein Chemokine Receptor (CCR5) can be used to treat, prevent and / or diagnose hyperproliferative diseases, disorders and / or conditions, including neoplasms. Polynucleotides or polypeptides of the G-protein Chemokine Receptor (CCR5), agonists or antagonists of the G-protein Chemokine Receptor (CCR5) can inhibit the proliferation of the disorder through direct or indirect interactions. Alternatively, polynucleotides or polypeptides of the G-protein Chemokine Receptor (CCR5) or agonists or antagonists of the G-protein Chemokine Receptor (CCR5) can proliferate other cells that can inhibit the hyperproliferative disorder.

For example, by increasing an immune response, particularly by increasing the antigenic qualities of the hyperproliferative disorder or by proliferation, differentiation or mobilization of T lymphocytes, hyperproliferative diseases, disorders and / or conditions can be treated, prevented and / or diagnosed. This immune response can be increased by enhancing an existing immune response or by initiating a new immune response. Alternatively, decreasing an immune response can also be a method to treat, prevent and / or diagnose diseases, disorders and / or hyperproliferative conditions, such as a chemotherapeutic agent.

Examples of diseases, disorders and / or hyperproliferative conditions that can be treated, prevented and / or diagnosed by polynucleotides or polypeptides of the G-protein Chemokine Receptor (CCR5) or agonists or antagonists of the G-protein Chemokine Receptor (CCR5), include , but without limitation neoplasms located in the colon, abdomen, bone, breast, digestive system, liver, pancreas, peritoneum, endocrine glands (adrenal, parathyroid, pituitary, testicles, ovary, thymus, thyroid), eye, head and neck, system nervous (central and peripheral), lymphatic system, pelvis, skin, soft tissue, spleen, thorax and urogenital.

Similarly, other diseases, disorders and / or hyperproliferative conditions can also be treated, prevented and / or diagnosed by polynucleotides or polypeptides of the G-protein Chemokine Receptor (CCR5) or agonists or antagonists of the G-protein Chemokine Receptor. Examples of such diseases, disorders and / or hyperproliferative conditions include, but are not limited to: hypergammaglobulinemia, diseases, and lifoproliferative disorders, paraproteinemias, purpura, sarcoidosis, Sezary syndrome, Waldenstron macroglobulinemia, Gaucher disease, histiocytosis and any other disease hyperproliferative, in addition to neoplasia, located in an organ system listed above.

CCR5 polynucleotides can be used to inhibit aberrant cell division, by gene therapy and / or protein fusions or fragments thereof.

Thus, a method for treating cell proliferative diseases, disorders and / or conditions is described by inserting into a cell that abnormally proliferates a CCR5 polynucleotide in which said polynucleotide represses said expression.

A method is also described for treating diseases, disorders and / or cellular proliferative conditions in individuals comprising the administration of one or more active gene copies to a cell or cells that proliferate abnormally. The polynucleotides can be a DNA construct comprising a recombinant expression vector effective in the expression of a DNA sequence encoding said polynucleotides. The DNA construct encoding the polynucleotides described herein can be inserted into the cells to be treated using a retrovirus or more preferably an adenoviral vector (See G J. Nabel, et al., PNAS 1999 96: 324-326). The viral vector may be defective and will not transform non-proliferative cells, only proliferative cells. In addition, the polynucleotides can be inserted into proliferative cells alone or in combination with or fused with other polynucleotides, can then be modulated by an external stimulus (i.e. magnetic, specific small molecule, chemical agent or drug administration, etc.), which acts on the upstream promoter of said polynucleotides to induce the expression of the encoded protein product. As such the beneficial therapeutic effect of the present invention can be expressly modulated (ie, to increase, decrease

or inhibit expression) based on said external stimuli.

Polynucleotides may be useful in repressing the expression of oncogenic genes or antigens. By "repression of expression of oncogenic genes" is intended the suppression of gene transcription, degradation of gene transcript (pre-messenger RNA), inhibition of splicing, destruction of messenger RNA, prevention of post modifications -translational protein, destruction of the protein or inhibition of normal protein function.

For local administration to abnormally proliferating cells, polynucleotides can be administered by any method known to those skilled in the art including, but not limited to transfection, electroporation, microinjection of cells or in vehicles such as liposomes, lipofectin or as naked polynucleotides or any other method described throughout the specification. The polynucleotide can be supplied by known gene delivery systems such as, but not limited to, retroviral vectors (Gilboa, J. Virology 44: 845 (1982); Hocke, Nature 320: 275 (1986); Wilson, et al., Proc. Natl. Acad. Sci. USA 85: 3014), vaccinia virus systems (Chakrabarty et al., Mol. Cell Biol. 5: 3403 (1985)) or other effective DNA delivery systems (Yates et al., Nature 313 : 812 (1985)) known to those skilled in the art. To specifically deliver or transfect abnormally proliferating cells and avoid non-dividing cells, it is preferable to use a retrovirus or adenoviral delivery system (as described in the art and elsewhere herein) known to subject matter experts Since host DNA replication is necessary for retroviral DNA to be integrated and the retrovirus will be unable to self-replicate due to the lack of the retrovirus genes necessary for its life cycle, using such a retroviral delivery system for polynucleotides will direct it to said gene and constructions to cells with abnormal proliferation and will avoid normal cells not in division.

The polynucleotides can be delivered directly to sites of cell proliferative disorder / disease in internal organs, body cavities and the like by using imaging devices used to guide an injection needle directly to the diseased site. The polynucleotides can also be administered to disease sites at the time of surgical intervention.

By "proliferative cell disease" is meant any animal or human disease or disorder, which affects any one or any combination of organs, cavities or parts of the body, characterized by single or multiple local anomalous proliferations of cells, cell groups or benign or malignant tissues.

Any amount of polynucleotides can be administered as long as they have a biologically inhibitory effect on the proliferation of treated cells. In addition, it is possible to administer more than one of the polynucleotides simultaneously at the same site. By "biological inhibition" is meant inhibition of total or partial growth as well as decrease in the rate of proliferation or growth of cells. The dose of biological inhibition can be determined by evaluating the effects of polynucleotides on abnormally or malignant proliferative cell growth in tissue culture, tumor growth in animals and cell culture or any other method known to one skilled in the art.

Antibody-based therapies involving administration of anti-polypeptide and anti-polynucleotide antibodies to a mammalian patient, preferably human, for treating one or more of the diseases, disorders and / or conditions described are described. Methods for producing anti-polypeptide and polyclonal and monoclonal antipolinucleotide antibodies are described in detail elsewhere in the present specification. Such antibodies can be provided in pharmaceutically acceptable compositions as are known in the art.

or as described herein.

A compendium of the ways in which the antibodies of the present invention can be used therapeutically includes the binding of CCR5 polynucleotides or polypeptides locally or systemically in the body or by direct cytotoxicity of the antibody, for example, as mediated by complement cells ( CDC) or effectors (ADCC). Some of these approaches are described in more detail below. Having the teachings provided herein, one skilled in the art will know how to use the antibodies of the present invention for diagnostic, control or therapeutic purposes without undue experimentation.

In particular, the antibodies, fragments and derivatives of the present invention are useful for treating a subject who has or develops diseases, disorders and / or cell differentiation and / or proliferative conditions as described herein. Said treatment comprises administering a single or multiple dose of the antibody, or a fragment, derivative or a conjugate thereof.

The antibodies of the present invention can be used advantageously in combination with other monoclonal or chimeric antibodies or with lymphokines or hematopoietic growth factors, for example, which serve to increase the number or activity of effector cells that interact with the antibodies.

It is preferred to use potent and / or high affinity neutralizing antibodies and / or inhibitors against CCR5 polypeptides or polynucleotides, fragments or regions thereof, for both immunoassays directed to and therapy of diseases, disorders and / or conditions related to these polynucleotides. or polypeptides, including fragments thereof. Such antibodies, fragments or regions will preferably have an affinity for polynucleotides or polypeptides, including fragments thereof. Preferred binding affinities include those of a dissociation constant or Kd of less than 5 X 10-2 M, 10-2 M, 5 X 10-3 M, 10-3 M, 5 X 10-4 M, 10-4 M. The most preferred binding affinities include those with a dissociation constant or Kd of less than 5 X 10-5 M, 10-5 M, 5 X 10-6 M, 10-6M, 5 X 10-7 M, 107 M, 5 X 10-8 M or 10-8 M. Even more preferred binding affinities include those with a dissociation constant or Kd of less than 5 X 10-9 M, 10-9 M, 5 X 10- 10 M, 10-10 M, 5 X 1011 M, 10-11 M, 5 X 10-12 M, 10-12 M, 5 X 10-13 M, 10-13 M, 5 X 10-14 M, 10 -14 M, 5 X 10-15 M, or 10-15 M.

In addition, polypeptides may be useful in inhibiting angiogenesis of proliferative cells or tissues, alone, as a fusion protein or in combination with other polypeptides directly or indirectly, as described elsewhere in the present specification. Said anti-angiogenesis effect can be achieved indirectly, for example, through the inhibition of tumor-specific hematopoietic cells, such as tumor-associated macrophages (See Joseph IB, et al. J Natl Cancer Inst, 90 (21): 1648- 53 (1998)). Antibodies directed to polypeptides or polynucleotides can also result in inhibition of angiogenesis directly or indirectly (See Witte L, et al., Cancer Metastasis Rev. 17 (2): 155-61 (1998)).

Polypeptides, including G protein fusions or fragments thereof, may be useful in inhibiting proliferative cells or tissues through induction of apoptosis. Such polypeptides can act directly or indirectly to induce apoptosis of proliferative cells and tissues, for example in the activation of a death domain receptor, such as a tumor necrosis factor (TNF) receptor 1 CD95 (Fas / APO-1) , TNF receptor-related apoptosis-mediated protein (TRAMP) and TNF-related apoptosis-inducing ligand receptor (TRAIL) 1 and 2 (See Schutze-Osthoff K, et al., Eur J Biochem 254 (3): 439- 59 (1998)). In addition, said polypeptides can induce apoptosis through other mechanisms, such as the activation of other proteins that will activate apoptosis, or through stimulation of the expression of said proteins, alone or in combination with drugs or adjuvants of small molecules, such as apoptonin, galectins, thioredoxins, anti-inflammatory proteins (See for example, Mutat Res 400 (1-2): 447-55 (1998), Med Hypotheses. 50 (5): 423-33 (1998), Chem Biol Interact. Apr 24 ; 111-112: 23-34 (1998), J Mol Med. 76 (6): 402-12 (1998), Int J Tissue React; 20 (1): 3-15 (1998)).

Polypeptides, including G protein fusions, or fragments thereof, may be useful in inhibiting metastasis of proliferative cells or tissues. Inhibition may occur as a direct result of the administration of polypeptides or antibodies directed to said polypeptides as described elsewhere or indirectly, such as by activating the expression of proteins known to inhibit metastasis, for example integrins. alpha 4 (See, for example, Curr Top Microbiol Immunol 1998; 231: 125-41). Such therapeutic effects of the present invention can be achieved alone or in combination with drugs or adjuvants of small molecules.

A method for delivering compositions containing the polypeptides (for example compositions containing polypeptides or polypeptide antibodies associated with heterologous polypeptides, heterologous nucleic acids, toxins or prodrugs) to target cells expressing the polypeptide is described. The polypeptide or polypeptide antibodies of the invention can be associated with heterologous polypeptides, heterologous nucleic acids, toxins or prodrugs by hydrophobic, hydrophilic, ionic and / or covalent interactions.

Polypeptides, protein fusions or fragments thereof, are useful in enhancing the immunogenicity and / or antigenicity of proliferative cells or tissues, directly, as would occur if polypeptides "vaccinate" the immune response to respond to antigens and immunogens. proliferative, or indirectly, such as in the activation of the expression of proteins that are known to potentiate the immune response (eg, chemokines), for said antigens and immunogens.

Cardiovascular disorders Polynucleotides or polypeptides of the G-protein Chemokine Receptor (CCR5) or agonists or antagonists of the G-protein Chemokine Receptor (CCR5), which encode G-protein Chemokine Receptor (CCR5) can be used to treat, prevent and / or diagnose cardiovascular diseases, disorders and / or conditions, including peripheral artery disease, such as limb ischemia.

Cardiovascular diseases, disorders and / or conditions include cardiovascular abnormalities, such as arterioarterial fistula, arteriovenous fistula, cerebral arteriovenous malformations, congenital heart defects, pulmonary atresia and Scimitar Syndrome. Congenital heart defects include aortic coarctation, cor triatriatum, coronary vessel abnormalities, crisscross heart, dextrocardia, persistent arterial ductus, Ebstein anomaly, Eisenmenger complex, left heart hypoplasia syndrome, levocardia, tetralogy of fallot, transposition of large vessels, right ventricle with double outlet, tricuspid atresia, persistent truncus arteriosus and heart septal defects, such as aortopulmonary septum defect, endocardial pad defects, Lutembacher syndrome, Fallot trilogy, ventricular cardiac septum defects .

Cardiovascular diseases, disorders and / or conditions also include heart disease, such as arrhythmias, carcinoid heart disease, high cardiac output, low cardiac output, cardiac tamponade, endocarditis (including bacterial), cardiac aneurysm, cardiac arrest, congestive heart failure, cardiomyopathy congestive, paroxysmal dyspnea, cardiac edema, cardiac hypertrophy, congestive cardiomyopathy, left ventricle hypertrophy, right ventricle hypertrophy, post-infarction cardiac rupture, ventricular septum rupture, coronary valve diseases, myocardial diseases, myocardial ischemia, pericardial effusion , pericarditis (including constrictive and tuberculous), pneumopericardium, post-pericardiotomy syndrome, pulmonary heart disease, rheumatic heart disease, ventricular dysfunction, hyperemia, cardiovascular complications of pregnancy, Scimitar syndrome, cardiovascular syphilis and tubercle cardiovascular system

Arrhythmias include breast arrhythmia, atrial fibrillation, atrial flutter, bradycardia, extrasystole, Adams-Stokes syndrome, branch block, sinoatrial block, long QT syndrome, parasystole, Lown-Ganong-Levine syndrome, pre-excitation syndrome Mahaim type, Wolff-Parkinson-White syndrome, sick node syndrome, tachycardia and ventricular fibrillation. Tachycardia includes paroxysmal tachycardia, supraventricular tachycardia, accelerated idioventricular rhythm, atrioventricular nodal reentry tachycardia, ectopic atrial tachycardia, ectopic junction tachycardia, sinus atrial reentry tachycardia, sinus ventricular tachycardia.

Heart valve disease include aortic valve insufficiency, aortic valve stenosis, heart murmurs, aortic valve prolapse, mitral valve prolapse, tricuspid valve prolapse, mitral valve insufficiency, mitral valve stenosis , pulmonary atresia, pulmonary valve insufficiency, pulmonary valve stenosis, tricuspid atresia, tricuspid valve insufficiency and tricuspid valve stenosis.

Myocardial diseases include alcoholic cardiomyopathy, congestive cardiomyopathy, hypertrophic cardiomyopathy, aortic subvalvular stenosis, pulmonary subvalvular stenosis, restrictive cardiomyopathy, Chagas cardiomyopathy, endocardial fibrolastosis, endomyocardial fibrosis, Kearocardial lesion syndrome

Myocardial ischemia includes coronary disease, such as angina pectoris, coronary aneurysm, coronary arteriosclerosis, coronary thrombosis, coronary vasospasm, myocardial infarction and myocardial stunning.

Cardiovascular diseases also include vascular diseases such as aneurysms, angiodysplasia, angiomatosis, bacillary angiomatosis, Hippel-Lindau disease, Klippel-Trenaunay-Weber syndrome, Sturge-Weber syndrome, angioneurotic edema, aortic diseases, Takayasu arteritis, aortitis Leriche syndrome, arterial occlusive diseases, arteritis, enarteritis, polyarteritis nodosa, diseases, disorders and / or cerebrovascular conditions, diabetic angiopathies, diabetic retinopathy, embolisms, thrombosis, erythromelalgia, hemorrhoids, hepatic venoocclusive disease, hypertension, hypotension, ischemia, vascular diseases peripheral, phlebitis, pulmonary venoocclusive disease, Raynaud's disease, CREST syndrome, retinal vein occlusion, Scimitar syndrome, superior vena cava syndrome, telangiectasia, ataxia telangiectasia, hereditary hemorrhagic telangiectasia, varicocele, varicose veins, var ulcer icosa, vasculitis and venous insufficiency.

Aneurysms include dissection aneurysms, false aneurysms, infected aneurysms, ruptured aneurysms, aortic aneurysms, cerebral aneurysms, coronary aneurysms, cardiac aneurysms and iliac aneurysms.

Arterial occlusive diseases include arteriosclerosis, intermittent claudication, carotid stenosis, fibromuscular dysplasia, mesenteric vascular occlusion, Moyamoya disease, renal artery obstruction, renal artery occlusion and thromboangeitis oblieterans.

Diseases, disorders and / or cerebrovascular conditions include carotid artery diseases, cerebral amyloid angiopathy, cerebral aneurysm, cerebral anoxia, cerebral arteriosclerosis, cerebral arteriovenous malformation, cerebral artery diseases, embolism and cerebral thrombosis, carotid artery thrombosis, thrombosis of the breast, Wallenberg syndrome, cerebral hemorrhage, epidural hematoma, subdural hematoma, subarachnoid hemorrhage, cerebral infarction, cerebral ischemia (including transient), subclavian theft syndrome, periventricular leukomalacia, vascular headache, cluster headache, migraine and vertebrobasilar insufficiency .

Embolisms include gas embolisms, amniotic fluid embolisms, cholesterol embolisms, blue finger syndrome, fat embolisms, pulmonary embolisms and thromboembolism. Thrombosis includes coronary thrombosis, hepatic vein thrombosis, retinal vein occlusion, carotid artery thrombosis, sinus thrombosis, Wallenberg thrombosis and thrombophlebitis.

Ischemia includes cerebral ischemia, ischemic colitis, compartment syndromes, anterior compartment syndrome, myocardial ischemia, reperfusion injuries and peripheral limb ischemia. Vasculitis includes aortitis, arteritis, Behcet syndrome, Churg-Strauss syndrome, mucocutaneous lymph node syndrome, thromboangeitis obliterans, hypersensitivity vasculitis, Schoenlein-Henoch purpura, allergic skin vasculitis and Wegener granulomatosis.

Polynucleotides or polypeptides of the G-protein Chemokine Receptor (CCR5) or agonists or antagonists of the G-protein Chemokine Receptor (CCR5) are especially effective for the treatment of critical limb ischemia and coronary heart disease.

G-protein Chemokine Receptor (CCR5) polypeptides can be administered using any method known in the art, including, but not limited to, direct needle injection at the delivery site, intravenous injection, topical administration, catheter infusion, injectors. biolistics, particle accelerators, gel foam sponge deposits, other commercially available deposit materials, osmotic pumps, solid oral or suppository pharmaceutical formations, topical or decanting applications during surgery, aerosol supply. Such methods are known in the art. G-protein Chemokine Receptor polypeptides (CCR5) can be administered as part of a therapeutic compound described in more detail below. Methods for delivering the G-protein Chemokine Receptor polynucleotides (CCR5) are described in more detail herein.

Carbohydrate Embolism Disorders Treatment

The polynucleotides and / or polypeptides corresponding to this gene and / or agonists or antagonists of those polypeptides (including antibodies) as well as fragments and variants of those polynucleotides, polypeptides, agonists and antagonists, can be used to diagnose, predict, treat, prevent or improve diseases and disorders associated with glucose metabolism or glucose uptake in aberrant cells.

The polynucleotides and / or polypeptides corresponding to this gene and / or agonists and / or antagonists thereof can be used to diagnose, predict, treat, prevent and / or relieve type I diabetes (insulin-dependent diabetes melitus, IDDM).

The polynucleotides and / or polypeptides corresponding to this gene and / or agonists and / or antagonists thereof can be used to diagnose, predict, treat, prevent and / or relieve type II diabetes mellitus (insulin resistant diabetes melitus).

The polynucleotides and / or polypeptides corresponding to this gene and / or antagonists thereof (especially antagonistic or neutralizing antibodies) can be used to diagnose, predict, treat, prevent and / or alleviate the conditions associated with diabetes melitus (type I or type n), which include, but are not limited to, diabetic ketoacidosis, diabetic coma, hyperglycemic-hyperosmolar non-ketotic coma, seizures, mental confusion, drowsiness, cardiovascular disease (for example, heart disease, atherosclerosis, microvascular disease, hypertension, stroke and other diseases and disorders as described in the section "Cardiovascular Disorders"), dyslipidemia, kidney disease (for example, kidney failure and nephropathy) nerve damage, neuropathy, impaired vision (for example diabetic retinopathy and blindness), ulcers and impaired scarring, infections (for example, infectious diseases and disorders as described in the section "Infectious Diseases" especially of the urinary tract and skin), carpal tunnel syndrome and Dupuytren's contracture.

The polynucleotides and / or polypeptides corresponding to this gene and / or agonists and / or antagonists thereof are administered to an animal, preferably a mammal and more preferably a human being to regulate the weight of the animal. The polynucleotides and / or polypeptides corresponding to this gene and / or agonists or antagonists thereof are administered to an animal, preferably a mammal and more preferably a human being, to control the weight of the animal by modulating a biochemical pathway that It involves insulin. The polynucleotides and / or polypeptides corresponding to this gene and / or agonists and / or antagonists thereof are administered to an animal, preferably a mammal and more preferably a human being, to control the weight of the animal by modulating a route. biochemistry that involves insulin-like growth factor.

Anti-Angiogenesis Activity. The naturally occurring balance between endogenous angiogenesis stimulators and inhibitors is one in which inhibitory influences predominate. Rastinejad et al., Cell 56: 345-355 (1989). In the rare cases in which neovascularization occurs under normal physiological conditions, such as healing processes, organ regeneration, embryogenic development and female reproduction, angiogenesis is rigorously regulated and spatially and temporally delimited. Under conditions of pathological angiogenesis such as those that characterize the growth of solid tumors, these regulatory controls fail. Deregulated angiogenesis becomes pathological and maintains the progression of many neoplastic and non-neoplastic diseases. Several serious diseases are dominated by abnormal neovascularization including growth of solid tumors and metastases, arthritis, some types of diseases, disorders and / or eye conditions and psoriasis. See, for example, reviews by Moses et al., Biotech. 9: 630-634 (1991); Folkman et al., N. Engl. J. Med, 333: 1757-1763 (1995); Auerbach et al., J. Microvasc. Res. 29: 401-411 (1985); Folkman, Advances in Cancer Research, eds. Klein and Weinhouse, Academic Press, New York, p. 175-203 (1985); Patz, Am. J. Opthalmol. 94: 715-743 (1982); and Folkman et al., Science 221: 719-725 (1983). In several pathological conditions, the angiogenesis process contributes to the pathology. For example, significant data has been accumulated that suggests that solid tumor growth depends on angiogenesis. Folkman and Klagsbrun, Science 235: 442-447 (1987).

A treatment of diseases, disorders and / or conditions associated with neovascularization by the administration of polynucleotides and / or polypeptides as well as agonists or antagonists is described. Malignant and metastatic conditions that can be treated with polynucleotides and polypeptides or agonists or antagonists include, but are not limited to, malignant tumors, solid tumors and cancers described herein and otherwise known in the art (for a review of such disorders. , see Fishman et al., Medicine, 2nd Ed., JB Lippincott Co., Philadelphia (1985)). Thus, a method of treating a disease and / or disorder related to angiogenesis is described, which comprises administering to a person in need thereof a therapeutically effective amount of a polynucleotide, polypeptide, antagonist and / or agonist. For example, polynucleotides, polypeptides, antagonists and / or agonists can be used in a variety of additional methods to treat therapeutically or prevent a cancer or a tumor. Cancers that can be treated with polynucleotides, polypeptides, antagonists and / or agonists include, but are not limited to solid tumors, including prostate, lung, breast, ovarian, stomach, pancreas, larynx, esophageal, testis, liver, parotid, biliary tract, colon, rectum, cervix, uterus, endometrium, kidney, bladder, thyroid; primary tumors and metastases; melanomas; glioblastoma; Kaposi's sarcoma; leiomyosarcoma; non-small cell lung cancer; Colorectal cancer; advanced malignant tumors; and tumors of blood origin such as leukemia. For example, polynucleotides, polypeptides, antagonists and / or agonists can be given topically, to treat or prevent cancers such as skin cancer, head and neck tumors, breast tumors and Kaposi's sarcoma.

Within other aspects, polynucleotides, polypeptides, antagonists and / or agonists can be used to treat, prevent and / or diagnose superficial forms of bladder cancer by, for example, intravesical administration. Polynucleotides, polypeptides, antagonists and / or agonists can be delivered directly into the tumor or near the tumor site, by injection or a catheter. Of course, as the skilled person will appreciate, the appropriate mode of administration will vary according to the cancer to be treated. Other modes of delivery are discussed herein.

Polynucleotides, polypeptides, antagonists and / or agonists may be useful in the treatment of other diseases, disorders and / or conditions, in addition to cancers, which involve angiogenesis. These diseases, disorders and / or conditions include, but are not limited to: benign tumors, for example hemangiomas, acoustic neuromas, neurofibromas, trachomas and pyogenic granulomas; atherosclerotic plaques; ocular angiogenic diseases, for example, diabetic retinopathy, retinopathy of prematurity, macular degeneration, corneal graft rejection, neovascular glaucoma, retrolental fibroplasia, rubeosis, retinoblastomas, uveitis and Pterygia (abnormal blood vessel growth) of the eye; rheumatoid arthritis; psoriasis; delayed healing; endometriosis; vasculogenesis; granulations; hypertrophic scars (keloids); non-union fractures; scleroderma; trachoma; vascular adhesions; myocardial angiogenesis; coronary collaterals; cerebral collaterals; arteriovenous malformations; ischemic limb angiogenesis; Osler-Webber syndrome; neovascularization of plaques; telangiectasia; hemophilic joints; angiofibroma, fibromuscular dysplasia; wound granulation; Crohn's disease and atherosclerosis.

For example, methods for treating hypertrophic and keloid scars are provided, which comprise the step of administering a polynucleotide, polypeptide, antagonist and / or agonist to a hypertrophic or keloid scar.

Polynucleotides, polypeptides, antagonists and / or agonists can be injected directly into a hypertrophic scar or keloid, to prevent the progression of these lesions. This therapy is of particular value in the prophylactic treatment of conditions that are known to result in the development of hypertrophic and keloid scars (for example, burns) and preferably begins after the proliferative phase has had time to progress (approximately 14 days after the initial injury), but before the development of hypertrophic or keloid scar. As indicated above, methods for treating neovascular diseases of the eye are described, including for example, corneal neovascularization, neovascular glaucoma, proliferative diabetic retinopathy, retrolental fibroplasia and macular degeneration.

In addition, eye diseases, disorders and / or conditions associated with neovascularization that can be treated with polynucleotides and polypeptides (including agonists and / or antagonists) include, but are not limited to; neovascular glaucoma, diabetic retinopathy, retinoblastoma, retrolental fibroplasia, uveitis, retinopathy of prematurity, macular degeneration, corneal graft neovascularization, as well as other inflammatory eye diseases, eye tumors and choroidal associated diseases or iris neovascularization. See, for example, reviews by Waltman et al., Am. J. Ophthal. 85: 704-710 (1978) and Gartner et al. Surv. Ophthal 22: 291-312 (1978).

Thus, methods for treating neovascular diseases of the eye such as neovascularization of the cornea (including corneal graft neovascularization) are described, which comprise the step of administering to a patient a therapeutically effective amount of a compound (as described above) to the cornea, so that the formation of blood vessels is inhibited. Briefly, the cornea is a tissue that normally lacks blood vessels. Certain pathological conditions, however, can extend capillaries to the cornea from the pericorneal vascular plexus of the limbus. When the cornea is vascularized, it also becomes cloudy, resulting in a decrease in the patient's visual acuity. Visual loss can be complete if the cornea becomes completely opaque. A wide variety of diseases, disorders and / or conditions can result in corneal neovascularization, including, for example, corneal infections (eg, tracheoma, herpes simplex keratitis, leishmaniasis and onchocerciasis), immunological processes (for example, graft rejection and Stevens-Johnson syndrome), alkaline burns, trauma, inflammation (of any cause), nutritional and toxic deficit states and as a complication of wearing contact lenses.

The compounds described herein can be prepared for topical administration in saline solution (combined with any of the preservatives and antimicrobial agents commonly used in eye preparations) and administered in the form of eye drops. The solution or suspension can be prepared in its pure form and administered several times a day. Alternatively, antiangiogenic compositions, prepared as described above, can also be administered directly to the cornea. The anti-angiogenic composition can be prepared with a mucoadhesive polymer that binds to the cornea. The anti-angiogenic factors or anti-angiogenic compositions can be used as adjuncts to conventional steroid therapy. Topical therapy can also be useful prophylactically in corneal lesions that are known to have a high probability of inducing an angiogenic response (such as chemical burns). In these cases the treatment, probably in combination with steroids, can be implanted immediately to help prevent further complications.

The compounds described above can be injected directly into the corneal stroma by an ophthalmologist with microscopic guidance. The preferred injection site may vary with the morphology of the individual lesion, but the purpose of the administration will be to place the composition in the front of the vasculature (i.e., sandwiched between the blood vessels and the normal cornea). In most cases this would imply perilimbic corneal injection to "protect" the cornea of the advancing blood vessels. This method can also be used shortly after a corneal lesion to prevent prophylactically corneal neovascularization. In this situation, the material could be injected into the perilimbic cornea interspersed between the corneal lesion and its unwanted potential limbic blood supply. Such methods can also be used in a similar manner to prevent capillary invasion of transplanted corneas. In a prolonged release form injections may only be required 2-3 times a year. A steroid could also be added to the injection solution to reduce the inflammation resulting from the injection itself.

Methods for treating neovascular glaucoma are described, which comprise the step of administering to a patient a therapeutically effective amount of a polynucleotide, polypeptide, antagonist and / or agonist to the eye, so that the formation of blood vessels is inhibited. The compound can be administered topically to the eye to treat or prevent early forms of neovascular glaucoma. The compound can be implanted by injection in the region of the anterior chamber angle. The compound can also be placed at any location so that the compound is released continuously in the aqueous humor. Methods for treating proliferative diabetic retinopathy are described, comprising the step of administering to a patient a therapeutically effective amount of a polynucleotide, polypeptide, antagonist and / or agonist to the eyes, so that the formation of blood vessels is inhibited.

Proliferative diabetic retinopathy can be treated by injection into the aqueous or vitreous humor to increase the local concentration of the polynucleotide, polypeptide, antagonist and / or agonist in the retina. Preferably, this treatment should be initiated before the acquisition of serious disease that requires photocoagulation.

Methods for treating retrolental fibroplasia are described, comprising the step of administering to a patient a therapeutically effective amount of a polynucleotide, polypeptide, antagonist and / or agonist to the eye, so that the formation of blood vessels is inhibited. The compound can be administered topically, by intravitreal injection and / or by intraocular implants.

Additionally, diseases, disorders and / or conditions that can be treated with polynucleotides, polypeptides, agonists and / or antagonists include, but are not limited to, hemangioma, arthritis, psoriasis, angiofibroma, atherosclerotic plaques, delayed scarring, granulations, hemophilic joints, scars hypertrophic, fractures without union, Osler-Weber syndrome, pyogenic granuloma, scleroderma, trachoma and vascular adhesions.

In addition, diseases, disorders and / or conditions and / or conditions, which can be treated with polynucleotides, polypeptides, agonists and / or antagonists include, but are not limited to, solid tumors, tumors of blood origin such as leukemia, tumor metastasis. , Kaposi's sarcoma, benign tumors, for example hemangiomas, acoustic neuromas, neurofibromas, trachiomas and pyogenic granulomas, rheumatoid arthritis, psoriasis, angiogenic eye diseases, for example, diabetic retinopathy, retinopathy of prematurity, macular degeneration, corneal graft rejection, glaucoma neovascular, retrolental fibroplasia, rubeosis, retinoblastoma and uveitis, delayed scarring, endometriosis, vasculogenesis, granulations, hypertrophic scars (keloids), non-union fractures, scleroderma, trachoma, vascular adhesions, myocardial angiogenesis, coronary angiogenesis, coronary angiogenesis, coronary angiogenesis ischemic of extremities, Osler-Webber syndrome, plaque neovascularization, telangiectasia, hemophilic joints, angiofibroma, fibromuscular dysplasia, wound granulation, Crohn's disease, atherosclerosis, birth control agent by preventing the vascularization required for embryo implantation which controls menstruation, diseases that have angiogenesis as a pathological consequence such as cat scratch disease (Rochele minalia quintosa), ulcers (Helicobacter pylori), Bartonellosis and bacillary angiomatosis.

In one aspect of the birth control method, an amount of the compound sufficient to block embryo implantation is administered before or after sexual intercourse and fertilization has occurred, thereby providing an effective method of birth control. , possibly a "day after" method. Polynucleotides, polypeptides, agonists and / or antagonists can also be used in the control of menstruation or administered as a peritoneal lavage fluid or for peritoneal implantation in the treatment of endometriosis.

Polynucleotides, polypeptides, agonists and / or antagonists can be incorporated into surgical sutures to prevent granulomas of the spots.

Polynucleotides, polypeptides, agonists and / or antagonists can be used in a wide variety of surgical procedures. For example, a composition (in the form of, for example, a spray or a film) can be used to coat or spread by spraying in an area before removal of a tumor, to isolate normal surrounding tissues from malignant tissue and / or to prevent the spread of the disease to surrounding tissues. The compositions (for example, in the form of a sprayer) can be delivered by endoscopic procedures to coat tumors or inhibit angiogenesis at a desired location. Surgical meshes that have been coated with antiangiogenic compositions can be used in any procedure in which a surgical mesh could be used. A surgical mesh loaded with an anti-angiogenic composition can be used during abdominal cancer resection surgery (for example, after colon resection) to provide support to the structure and to release an amount of the anti-angiogenic factor.

Methods for treating tumor excision sites are described, which comprise administering a polynucleotide, polypeptide, agonist and / or antagonist to the margins of tumor resection after excision, so that local cancer recurrence is inhibited and formation of new blood vessels at the site. The antiangiogenic compound can be administered directly to the tumor excision site (for example, applied by hyssop, rubbing or otherwise coating the margins of tumor resection with the antiangiogenic compound). Alternatively, antiangiogenic compounds can be incorporated into known surgical pastes before administration. The anti-angiogenic compounds can be applied after liver resections for malignant tumors and after neurosurgical operations.

Polynucleotides, polypeptides, agonists and / or antagonists can be administered outside the resection of a wide variety of tumors, including, for example, breast, colon, brain and liver tumors. For example, antiangiogenic compounds can be administered at the site of a neurological tumor after excision, so that the formation of new blood vessels at the site is inhibited.

Polynucleotides, polypeptides, agonists and / or antagonists can also be administered together with other antiangiogenic factors. Representative examples of other antiangiogenic factors include: Anti-Invasive Factor, retinoic acid and derivatives thereof, Suramine, Tissue Inhibitor of Metalloproteinase-1, Tissue Inhibitor of Metalloproteinase-2, Inhibitor of Plasminogen 1, Inhibitor of Plasminogen 2 and various forms of the light transition metals of "group d".

The lighter transition metals of "group d" include, for example, vanadium, molybdenum, tungsten, titanium, niobium and tantalum. Such transition metal species can form transition metal complexes. Suitable complexes of the aforementioned transition metal species include oxo transition metal complexes.

Representative examples of vanadium complexes include oxovanadium complexes such as vanadate and vanadyl complexes. Suitable vanadate complexes include metavanadate and orthovanadate complexes such as, for example, ammonium metavanadate, sodium metavanadate and sodium orthovanadate. Suitable vanadyl complexes include, for example, vanadyl acetylacetonate and vanadyl sulfate including vanadyl sulfates hydrates such as mono vanadyl sulfates and trihydrates.

Representative examples of tungsten and molybdenum complexes also include oxo complexes. Suitable oxotungsten complexes include tungstate and tungsten oxide complexes. Suitable tungstate complexes include ammonium tungstate, calcium tungstate, sodium tungstate dihydrate and tungstic acid. Suitable tungsten oxides include tungsten oxide (IV) and tungsten oxide (VI). Suitable oxomolibdene complexes include molybdate, molybdenum oxide and molybdenyl complexes. Suitable molybdate complexes include ammonium molybdate and its hydrates, sodium molybdate and its hydrates and potassium molybdate and its hydrates. Suitable molybdenum oxides include molybdenum oxide (VI), molybdenum oxide

(VI) and molybdic acid. Suitable molybdenyl complexes include, for example, molybdenyl acetylacetonate. Other suitable tungsten and molybdenum complexes include hydroxyl derivatives derived from, for example, glycerol, tartaric acid and sugars.

A wide variety of other antiangiogenic factors can also be used within the context of the present description. Representative examples include platelet factor 4; protamine sulfate; sulfated chitin derivatives (preparations of snow crab shells), (Murata et al., Cancer Res. 51: 22-26, 1991); Sulfated Polysaccharide Peptidoglycan Complex (SP-PG) (the function of this compound can be enhanced by the presence of steroids such as estrogen and tamoxifen citrate); staurosporine, matrix metabolism modulators, including, for example, proline analogs, cishidroxyproline, d, L-3,4-dehydroproline, Thiaproline, alpha, alpha-dipyridyl, aminopropionitrile fumarate; 4-propyl-5- (4-pyridinyl) -2 (3H) -oxazolone; Methotrexate; Mitoxantrone; Heparin; Interferons; Macroglobulin 2 serum; ChIMP-3 (Pavloff et al., J. Bio. Chem.

267: 17321-17326, 1992); Chymostatin (Tomkinson et al., Biochem J. 286: 475-480, 1992); Cyclodextrin tetradecasulfate; Eponemycin; Camptothecin; Fumagiline (Ingber et al., Nature 348: 555-557, 1990); Golden Sodium Thiomalate ("GST"; Matsubara and Ziff, J. Clin. Invest. 79: 1440-1446; 1987); anticolagenase serum; antiplasmin alfa2 (Holmes et al., J. Biol. Chem. 262 (4): 1659-1664, 1987); Bisantrene (National Cancer Institute); Lobenzarit disodium (N- (2) -carboxyphenyl-4- chloroantronyl disodium acid or "CCA"; Takeuchi et al., Agents Actions 36: 312-316, 1992); Thalidomide; Angostatic steroid; AGM-1470; carboxinaminolmidazole; and metalloproteinase inhibitors such as BB94.

Union activity. G-protein Chemokine Receptor (CCR5) polypeptides can be used to scan for molecules that bind to the G-protein Chemokine Receptor (CCR5) or for molecules that the G-protein Chemokine Receptor binds to ( CCR5). The binding of the G-protein Chemokine Receptor (CCR5) and the molecule can activate (agonist), increase, inhibit (antagonist) or decrease the activity of the G-protein Chemokine Receptor (CCR5) or the bound molecule. Examples of such molecules include antibodies, oligonucleotides, proteins (for example receptors) or small molecules.

Preferably, the molecule is closely related to the natural ligand of the G-protein Chemokine Receptor (CCR5), for example, a fragment of the ligand or a natural substrate, a ligand, a structural mimetic

or functional (See, Coligan et al., Current Protocols in Immunology 1 (2): Chapter 5 (1991). Similarly, the molecule may be closely related to the natural receptor to which the G protein Chemokine Receptor binds (CCR5 ) or at least one fragment of the receptor capable of binding to the G-protein Chemokine Receptor (CCR5) (eg, active site) In both cases, the molecule can be rationally designed using known techniques.

Preferably, scanning with respect to these molecules involves producing appropriate cells that express G-protein Chemokine Receptor (CCR5), as a secreted protein or in the cell membrane. Preferred cells include mammalian, yeast, Drosophyll, or E. coli cells. Cells expressing G-protein Chemokine Receptor (CCR5) (or cell membrane containing the expressed polypeptide) are then preferably contacted with a test compound potentially containing the molecule to observe binding, stimulation or inhibition of activity. of the G-protein Chemokine Receptor (CCR5) or the molecule.

The assay may simply assay the binding of a candidate compound with G-protein Chemokine Receptor (CCR5), the binding being detected by a marker or in an assay that involves competition with a labeled competitor. In addition, the test can test whether the candidate compound results in a signal generated by binding to the G protein Chemokine Receptor.

Alternatively, the assay can be carried out using preparations without cells, polypeptides / molecules fixed with a solid support, chemical libraries or mixtures of natural products. The assay may also simply comprise the steps of mixing a candidate compound with a solution containing G-protein Chemokine Receptor (CCR5), measuring the activity or binding of G-protein Chemokine Receptor / molecule and comparing the activity or binding of Receptor Chemokine G protein / molecule with a standard.

Preferably, an ELISA assay can measure the level or activity of the G-protein Chemokine Receptor (CCR5) in a sample (eg, biological sample) using a monoclonal or polyclonal antibody. The antibody can measure the level or activity of the G-protein Chemokine Receptor (CCR5) by binding, directly or indirectly, with the G-protein Chemokine Receptor (CCR5) or by competition with the G-protein Chemokine Receptor (CCR5) with Regarding a substrate.

Additionally, the ligands to which the G-protein Chemokine Receptor (CCR5) binds can be identified by numerous methods known to those skilled in the art, for example, ligand selection and FACS classification (Coligan, et al., Current Protocols in Immun., 1 (2), Chapter 5, (1991) For example, expression cloning is used in which polyadenylated RNA is prepared from a polypeptide sensitive cell, for example, NIH3T3 cells known to be which contain multiple receptors for FGF family proteins and SC-3 cells and a cDNA library created from this RNA is divided into groups and used to transfect COS cells or other cells that are not sensitive to polypeptides. Transfected cells that are grown on glass slides are exposed to the CCR5 polypeptide, after they have been labeled.The polypeptides can be labeled by a variety of means including iodination or inclusion of a recognition site for a site specific protein kinase.

After fixation and incubation, the slides are subjected to autoradiographic analysis. Positive groups are identified and subgroups are prepared and re-transfected using an iterative subgrouping and reexploration procedure, eventually producing a unique clone that encodes the potential receptor.

As an alternative approach to the identification of receptors, labeled polypeptides can be linked by photoaffinity with a cell membrane or extract preparations expressing the receptor molecule. The crosslinked material is resolved by PAGE analysis and exposed to X-ray film. The labeled complex containing the polypeptide receptors can be cleaved, resolved into peptide fragments and subjected to protein microsequencing. The amino acid sequence obtained from microsequencing would be used to design a set of degenerate oligonucleotide probes to explore a cDNA library to identify the genes encoding potential receptors.

In addition, the techniques of gene combination, combination of motifs, combination of exons and / or combination of codons (collectively referred to as "DNA shuffling") can be used to modulate the activities of the G-protein Chemokine Receptor (CCR5) by generating thus effectively agonists and antagonists of the G-protein Chemokine Receptor (CCR5). See generally, U.S. Patent Nos. 5,605,793, 5,811,238, 5,830,721, 5,834,252 and 5,837,458, and Patten, P. A., et al., Curr. Opinion Biotechnol.

8: 724-33 (1997); Harayama, S. Trends Biotechnol. 16 (2): 76-82 (1998); Hansson, L. O., et al., J. Mol. Biol. 287: 26576 (1999); and Lorenzo, M. M. and Blasco, Biotechniques 24 (2): 308-13 (1998). Alteration of the G protein Chemokine Receptor polynucleotides (CCR5) and corresponding polypeptides can be achieved by shuffling DNA. DNA shuffling involves assembling two or more segments of DNA into a desired G-protein Chemokine Receptor molecule (CCR5) by homologous or site-specific recombination. G-protein Chemokine Receptor polynucleotides (CCR5) and corresponding polypeptides can be altered by subjecting them to random mutagenesis by error-prone PCR, random nucleotide insertion or other methods prior to recombination. One or more components, motifs, sections, parts, domains, fragments, etc. of the G-protein Chemokine Receptor (CCR5) can be recombined with one or more components, motifs, sections, parts, domains, fragments, etc. Of one or more heterologous molecules. Heterologous molecules are members of the G protein Chemokine Receptor family (CCR5). The heterologous molecule can be a growth factor such as, for example, platelet-derived growth factor (PDGF), insulin-like growth factor (IGF-I), transforming growth factor (TGF) -alpha, growth factor epidermal (EGF), fibroblast growth factor (FGF), TGF-beta, bone morphogenetic protein (BMP) -2, BMP-4, BMP-5, BMP-6, BMP-7, activins A and B, decapentaplegic (dpp), 60A, OP-2, dorsaline, growth differentiation factors (GDF), nodal factor, MIS, inhibin-alpha, TGF-beta1, TGF-beta2, TGF-beta3, TGF-beta5 and neurotrophic factor derived from the glia (GDNF).

Other preferred fragments are biologically active G protein Chemokine Receptor fragments (CCR5). Biologically active fragments are those that show similar, but not necessarily identical, activity to an activity of the G-protein Chemokine Receptor polypeptide (CCR5). The biological activity of the fragments may include an improved desired activity or a decreased unwanted activity.

Additionally, a method for exploring compounds to identify those that modulate the action of CCR5 polypeptides is described. An example of such an assay comprises combining a mammalian fibroblastic cell, a CCR5 polypeptide, the compound to be screened and 3 [H] thymidine under cell culture conditions in which the fibroblastic cell would normally proliferate. A control assay can be performed in the absence of the compound to be explored and compared with the amount of fibroblast proliferation in the presence of the compound to determine if the compound stimulates proliferation by determining the uptake of 3 [H] thymidine in each case. The amount of fibroblast cell proliferation is measured by liquid scintillation chromatography that measures the incorporation of 3 [H] thymidine. Both agonist and antagonist compounds can be identified by this procedure.

In another method, a mammalian cell or membrane preparation expressing a receptor for a polypeptide described herein is incubated with a labeled polypeptide described herein in the presence of the compound. The ability of the compound to enhance or block this interaction can then be measured. Alternatively, the response of a known second messenger system after interaction of a compound to be explored and the G-protein Chemokine Receptor (CCR5) is measured and the ability of the compound to bind with the receptor and induce a response of second messenger to determine if the compound is a potential agonist or antagonist. Such second messenger systems include but are not limited to cAMP guanylate cyclase, ion channels or phosphoinositide hydrolysis.

All these previous trials can be used as diagnostic or prognostic markers. The molecules discovered using these assays can be used to treat, prevent and / or diagnose disease or to provide a particular result in a patient (e.g., blood vessel growth) by activation or inhibition of the polypeptide / molecule. In addition, assays may discover agents that can inhibit or enhance the production of polypeptides from properly manipulated cells or tissues. Therefore, a method is described for identifying compounds that bind to the G-protein Chemokine Receptor (CCR5) comprising the steps of: (a) incubating a candidate binding compound with G-protein Chemokine Receptor; and (b) determine if union has occurred. In addition, a method for identifying agonists / antagonists is described which comprises the steps of: (a) incubating a candidate compound with G-protein Chemokine Receptor (CCR5), (b) testing a biological activity and (b) determining whether it has been altered a biological activity of the G-protein Chemokine Receptor (CCR5).

In addition, molecules that bind to the G-protein Chemokine Receptor (CCR5) could be identified experimentally using the beta-folded sheet regions described in FIGURE 3 and Table 1. Polynucleotides encoding polypeptides comprising, or alternatively, are described. which consist of, the amino acid sequence of each beta-folded sheet region described in FIGURE 3 / Table 1. Polynucleotides encoding G-protein Chemokine Receptor polypeptides (CCR5) comprising, or alternatively consisting of, are described, any combination of all beta folded sheet regions described in FIGURE 3 / Table 1. Polypeptides are described which comprise, or alternatively consist of, the amino acid sequence of the G-protein Chemokine Receptor (CCR5) of each of the beta folded sheet regions described in FIGURE 3 / Table 1. G-protein Chemokine Receptor polypeptides are described CR5) comprising, or alternatively consisting of, any combination of all beta-folded sheet regions described in FIGURE 3 / Table 1.

Targeted Supply

A method for delivering compositions to target cells expressing a receptor for a CCR5 polypeptide or cells expressing a cell-bound form of a CCR5 polypeptide is described.

As discussed herein, the polypeptides or antibodies of the invention can be associated with heterologous polypeptides, heterologous nucleic acids, toxins or prodrugs by hydrophobic, hydrophilic, ionic and / or covalent interactions. A method for the specific delivery of compositions of the invention to cells by administration of polypeptides or antibodies of the invention that are associated with heterologous polypeptides or nucleic acids is described. A method of delivering a therapeutic protein to the target cells is described. In another example, a method for delivering a single stranded nucleic acid (for example, antisense or ribozymes) or double stranded nucleic acid (for example, DNA that can be integrated into the genome of the cell or replicated episomally and that can be transcribed is described) ) in the target cell.

A method for the specific destruction of cells (for example, the destruction of tumor cells) by the administration of polypeptides (for example, polypeptides or antibodies of the invention) in association with cytotoxic toxins or prodrugs is also described.

By "toxin" are meant compounds that bind and activate endogenous cytotoxic effector systems, radioisotopes, holotoxins, modified toxins, catalytic subunits of toxins or any molecule or enzyme that is not normally present on or on the surface of a cell that under defined conditions It causes cell death. Toxins that can be used according to the methods include, but are not limited to, radioisotopes known in the art, compounds such as, for example, antibodies (or parts thereof containing complement binding) that bind to a cytotoxic effector system Endogenously induced or inherent, thymidine kinase, endonuclease, RNase, alpha toxin, ricin, abrin, Pseudomonas exotoxin A, diphtheria toxin, saponin, momordine, gelonin, ombú antiviral protein, alpha-sarcin and cholera toxin. By "cytotoxic prodrug" is meant a non-toxic compound that is converted by an enzyme normally present in the cell, into a cytotoxic compound. Cytotoxic prodrugs that can be used according to the methods include, but are not limited to, glutamyl derivatives of benzoic mustard alkylating agent, etoposide phosphate derivatives or mitomycin C, araboside cytosine, daunorubicin and doxorubicin phenoxyacetamide derivatives.

Drug Exploration

The use of the polypeptides, or polynucleotides encoding these polypeptides, is further contemplated to explore with respect to molecules that modify the activities of the polypeptides. Such method would include contacting the polypeptide with a selected compound or compounds suspected of having antagonistic activity.

or agonist and assay the activity of these polypeptides after binding.

The present description is particularly useful for the exploration of therapeutic compounds by using the polypeptides or binding fragments thereof, in any of a variety of drug exploration techniques. The polypeptide or fragment used in said assay can be fixed on a solid support, expressed on a cell surface, be free in solution or located intracellularly. A drug screening method uses eukaryotic or prokaryotic host cells that are stably transformed with recombinant nucleic acids that express the polypeptide or fragment. Drugs are screened against such transformed cells in competitive binding assays. For example, the complex formulation between the agent being tested and a polypeptide can be measured.

Thus, methods to explore with respect to drugs or any other agent that affect the activities mediated by the polypeptides are described. These methods comprise contacting said agent with a polypeptide or a fragment thereof and testing with respect to the presence of a complex between the agent and the polypeptide or a fragment thereof, by methods well known in the art. In such a competitive binding assay, the agents to be explored are typically labeled. After incubation, the free agent is separated from the present in bound form and the amount of free or non-complex label is a measure of the ability of a particular agent to bind to the polypeptides.

Another drug screening technique provides high throughput screening for compounds that have adequate binding affinity with the polypeptides and is described in great detail in European Patent Application 84/03564, published September 13, 1984. Briefly indicated, synthesizes a variety of test compounds of different small peptides on a solid substrate, such as plastic tips or any other surface. The peptide test compounds are reacted with the polypeptides and washed. Bound polypeptides are then detected by methods well known in the art. Plates are coated with purified polypeptides directly for use in the aforementioned drug screening techniques. In addition, non-neutralizing antibodies can be used to capture the peptide and immobilize it on the solid support.

The use of competitive drug screening assays in which neutralizing antibodies capable of binding the polypeptides specifically with a test compound with respect to binding with the polypeptides or fragments thereof is described. Thus, antibodies are used to detect the presence of any peptide that shares one or more antigenic epitopes with the polypeptide.

Thus, polypeptides can be used to identify compounds that modulate receptor activity. Both the receptor protein and appropriate variants and fragments can be used in high-performance scans to test candidate compounds for receptor binding capacity. These compounds can be further explored against a functional receptor to determine the effect of the compound on the activity of the receptor. Compounds that activate (agonists) or inactivate (antagonists) the receptor with a desired degree can be identified.

The terms "agonist" and "antagonist" represent compounds that enhance or decrease a response. As a form of an agonist, the compound binds to the same site as the endogenous compound and produces the same type of signal, usually of equal or greater magnitude than the endogenous agent. Another form of agonist binds to a different site than the first agonist, not producing a signal by itself, however, an enhanced signal is generated when the endogenous agent also binds in place. This is called an allosteric action. An antagonist form binds to the site used by the endogenous agent and decreases or blocks the signal generated by the endogenous agent. Another form of antagonist binds to an allosteric site, similar to the second form of agonist, but produces a diminished signal generated by the endogenous agent. A third form of antagonist dissolves in the membrane or crosses the membrane and intercepts the signal generated by the endogenous agent within the membrane or on the intracellular side. An antagonist, therefore, encompasses negative agonists or "reverse agonists", which have a negative intrinsic activity that reduces the signal activity of the receptor in relation to the signaling activity measured in the absence of the inverse agonist. Said antagonist is distinguished from an antagonist that has no intrinsic activity or effect on the basal activity of the receptor. Thus, for example, an inverse agonist could alter receptor confirmation, thereby reducing or eliminating interaction with a ligand. See, Milligan et al., TIPS 16: 10 (1995).

Receptor polypeptides can be used to explore a compound with respect to the ability to stimulate

or inhibit the interaction between the receptor protein and a target molecule that normally interacts with the receptor protein. The target can be ligand or a component of the signaling pathway with which the receptor protein normally interacts (for example, a G protein or other interaction agent involved in cAMP or phosphatidyl inositol renewal and / or adenylate cyclase or phospholipase activation C). The assay includes the steps of combining the receptor protein with a candidate compound under conditions that allow the receptor protein or fragment to interact with the target molecule and detect the formation of a complex between the protein and the target or detect the biochemical consequence of the interaction. with the receptor protein and the target, so that any of the associated effects of signal transduction, such as ion flow, phosphorylation of G protein, renewal of phosphatidyl inositol or cyclic AMP and activation of phospholipase C or adenylate cyclase.

Receptor polypeptides are useful in cell-based assays when they are overexpressed in a cell. Consequently, such cells that overexpress the receptor are useful for identifying compounds that are capable of modulating or compensating for overexpression. Cells that overexpress the receptor can be derived from natural sources or can be created by routine recombinant methods.

Receptor polypeptides are also useful for exploring compounds in a cell-based assay when they are constitutively activated in a cell. Such cells expressing constitutively activated receptors are useful for exploring compounds that modulate receptor activation. Such cells can be derived from natural sources or can be created by recombinant means that are well known in the art. For example, see Scheer et al., J. Receptor Signal Transduction Res. 17: 57-73 (1997); U.S. Patent No. 5,750,353.

Candidate compounds include, for example, (1) peptides such as soluble peptides, including Ig-tail fusion peptides and members of random peptide libraries (see, for example Lam et al., Nature 354: 8284 (1991); Houghten et al., Nature 354: 84-86 (1991)) and molecular libraries derived from combinatorial chemistry made of amino acids of D and / or L configuration; (2) phosphopeptides (eg, members of randomized and partially degenerate directed phosphopeptide libraries, see, for example, Songyang et al., Cell 72: 767-778 (1993)); (3) antibodies (e.g., polyclonal, monoclonal, humanized, anti-idiotypic, chimeric, intrabody and single chain antibodies, as well as Fab, F (ab) 2, Fab expression library fragments and epitope binding fragments of the antibodies); and (4) small organic and inorganic molecules (for example, molecules obtained from combinatorial and natural product libraries).

A candidate compound is a soluble full-length receptor or fragment that competes for ligand binding. Other candidate compounds include mutant receptors or appropriate fragments that contain mutations that affect receptor function and thus compete for the ligand. Accordingly, a fragment that competes for the ligand, for example with a higher affinity, or a fragment that binds ligand but does not allow release, are encompassed by the invention.

Other assessment criteria are described to identify compounds that modulate (stimulate or inhibit) receptor activity. Assays typically involve an assay of events in the signal transduction pathway that indicate receptor activity. Thus, the expression of genes that are positively or negatively regulated in response to the cascade of receptor protein dependent signals can be tested. The regulatory region of such genes can be operatively linked to a marker that is readily detectable, such as luciferase. Alternatively, phosphorylation of the receptor protein or a target of the receptor protein could also be measured.

It is also understood that a disorder caused by aberrant levels or mutations in the protein can be used as a basis for an assessment criterion. Consequently, specific deviations in the development or course of the disorder in response to a compound that acts on the recipient can serve as an assessment criterion. Any of the biological or biochemical functions mediated by the receptor can be used as an endpoint assay. These include all the biochemical or biochemical / biological events described herein, in the references cited herein, with respect to these endpoint assay targets and other functions known to those of ordinary skill in the art.

Binding and / or activation compounds can also be screened by the use of chimeric receptor proteins in which the aminoterminal extracellular domain, or parts thereof, the entire transmembrane domain or subregions, such as any of the seven transmembrane segments or any of the intracellular or extracellular loops and the intracellular carboxy terminal domain; or parts thereof, can be replaced with heterologous domains or subregions. For example, a G protein binding region that interacts with a different G protein than that recognized by the native receptor can be used. Consequently, a different set of signal transduction components is available as an endpoint test for activation. Alternatively, the entire transmembrane part or subregions (such as transmembrane segments or extracellular or intracellular loops) can be replaced with the complete transmebrane part or specific subregions of a host cell that is different from the host cell from which the amino terminal extracellular domain derives. and / or the protein G binding region. This allows assays to be performed on cells other than the specific host from which the receptor is derived. Alternatively, the amino terminal extracellular domain (and / or other ligand binding regions) could be replaced by a domain (and / or other binding region) that binds to a different ligand, thereby providing an assay for test compounds that interact with the heterologous amino terminal extracellular domain (or region) but still cause signal transduction. Finally, activation can be detected by an reporter gene that contains an easily detectable coding region operably linked to a transcriptional regulatory sequence that is part of the native signal transduction path.

Receptor polypeptides are also useful in competition binding assays in methods designed to discover compounds that interact with the receptor. Thus, a compound is exposed to a receptor polypeptide under conditions that allow the compound to bind or otherwise interact with the polypeptide. Soluble receptor polypeptide is also added to the mixture. If the test compound interacts with the soluble receptor polypeptide, the amount of complex formed or activity of the recipient target decreases. This type of assay is particularly useful in cases where compounds that interact with specific regions of the receptor are sought. Thus, the soluble polypeptide that competes with the target receptor region is designed to contain peptide sequences corresponding to the target region.

In order to perform drug-free drug testing, it is desirable to immobilize the receptor protein, or fragment, or its target molecule to facilitate the separation of complexes from non-complex forms of one or both proteins, as well as to facilitate the automation of the assay.

Techniques can be used to immobilize G proteins in matrices in drug screening assays. A fusion protein can be provided that adds a domain that allows the protein to bind to a matrix. For example, fusion proteins of the G-protein Chemokine Receptor (CCR5) / glutathione-Stransferase can be adsorbed into glutathione sepharose beads (Sigma Chemical, St. Louis, MO) for glutathione derivatized microtiter plates, which are then combined with the cell lysates (for example, labeled with 35S) and the candidate compound and the mixture incubated under conditions that lead to complex formation (for example, under physiological conditions for salt and pH). After incubation, the beads are washed to remove any unbound label and the matrix is immobilized and the radiolabel is determined directly or in the supernatant after complexes are dissociated. Alternatively, the complexes can be dissociated from the matrix, separated by SDS-PAGE and the level of receptor-bound protein found in the pearl fraction from the gel quantified using conventional electrophoretic techniques. For example, the polypeptide or its target molecule can be immobilized using conjugation of biotin and streptavidin using techniques well known in the art. Alternatively, antibodies reactive with the protein can be derivatized but do not interfere with the binding of the protein to its target molecule in the wells of the plate and the protein is trapped in the wells by antibody conjugation. Preparations of a receptor binding protein and a candidate compound are incubated in the receptor protein presenting wells and the amount of complex trapped in the well can be quantified. Methods for detecting such complexes, in addition to those described above for complexes immobilized with GST, include immunodetection of complexes using antibodies reactive with the recipient protein target molecule or that are reactive with the receptor protein and compete with the target molecule; as well as enzyme linked assays that are based on the detection of an enzymatic activity associated with the target molecule.

Modulators of the receptor protein activity identified in accordance with these drug screening assays can be used to treat a subject with a disorder mediated by the receptor pathway, treating the cells expressing the receptor protein. These treatment methods include the steps of administering protein activity modulators in a pharmaceutical composition as described herein, to a subject in need of such treatment.

Antisense and Ribozyme (Antagonists)

The antagonists can be nucleic acids corresponding to the sequences contained in SEQ ID NO: 1 or the complementary strand thereof, and / or nucleotide sequences contained in the deposited clone 97183. The antisense sequence can be generated internally, by the organism, the antisense sequence can be administered separately (see, for example, O'Connor, J., Neurochem. 56: 560 (1991). Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988) Antisense technology can be used to control gene expression through antisense DNA or RNA or through triple helix formation Antisense techniques are analyzed, for example, in Okano, J., Neurochem 56: 560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988) Triple helic formation is analyzed in, for example, Lee et al., Nucleic Acids Research 6: 3073 (1979); Cooney et al ., Science 241: 456 (1988); and Dervan et al., Science 251: 1300 (1991). The methods are based on the binding of a polynucleotide with a complementary DNA or RNA.

For example, the use of c-myc and c-myb antisense RNA constructs to inhibit the growth of the HL-60 non-lymphocytic leukemia cell line and other cell lines has been previously described (Wickstrom et al. (1988); Anfossi et al. (1989) These experiments were performed in vitro by incubating cells with the oligoribonucleotide.A similar procedure for in vivo use is described in WO 91/15580. Briefly, a pair of oligonucleotides for an RNA is produced. antisense given as follows: A sequence complementary to the first 15 bases of the open reading phase is flanked by an EcoRl site at the 5 'end and a HindIII site at the 3' end. Next, the pair of oligonucleotides is heated at 90 ° C for one minute and then hybridized in 2X ligation buffer (20 mM TRIS HCl pH 7.5, 10 mM MgCl 2, 10 mM dithiothreitol (DTT) and 0.2 mM ATP) and then ligated with the EcoR1 / site Hind of the PMV7 retroviral vector (d document WO 91/15580).

For example, the 5 ′ coding part of a polynucleotide encoding the mature polypeptide can be used to design an antisense RNA oligonucleotide approximately 10 to 40 base pairs in length. A DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription thereby preventing transcription and receptor production. The antisense RNA oligonucleotide hybridizes with the mRNA in vivo and blocks the translation of the mRNA molecule to the receptor polypeptide.

The antisense nucleic acid of the G-protein Chemokine Receptor (CCR5) is produced intracellularly by transcription from an exogenous sequence. For example, a vector or a part thereof can be transcribed, producing an antisense nucleic acid (RNA). Such a vector would contain a sequence encoding the antisense nucleic acid of the G-protein Chemokine Receptor (CCR5). Such a vector could remain episomal.

or integrate chromosomally as long as it can be transcribed to produce the desired antisense RNA. Such vectors can be constructed by recombinant DNA technology methods conventional in the art. Vectors can be plasmid, viral or other known in the art, used for replication and expression in vertebrate cells. Expression of the sequence encoding the G-protein Chemokine Receptor (CCR5)

or fragments thereof, can be by any promoter known in the art that acts in vertebrates, preferably human cells. Such promoters can be inducible or constitutive. Such promoters include, but are not limited to, the SV40 early promoter region (Bernoist and Chambon, Nature 29: 304-310 (1981), the promoter contained in the 3 'long terminal repeat of the Rous sarcoma virus (Yamamoto et al. , Cell

22: 787-797 (1980), the herpes thymidine promoter (Wagner et al., Proc. Natl. Acad. Sci. USA 78: 1441-1445 (1981), the regulatory sequences of the metallothionein gene (Brinster, et al., Nature 296: 39-42 (1982)), etc.

The antisense nucleic acids comprise a sequence complementary to at least a part of an RNA transcript of a G-protein Chemokine Receptor gene (CCR5). However, absolute complementarity, although preferred, is not necessary. A sequence "complementary to at least a part of an RNA", referred to herein, means a sequence that has sufficient complementarity to be able to hybridize with the RNA, forming a stable double chain; in the case of double-stranded G protein Chemokine Receptor (CCR5) antisense nucleic acids, a single strand of double stranded DNA can be tested in this way or triple strand formation can be tested. The ability to hybridize will depend on the degree of complementarity and the length of the antisense nucleic acid. Generally, the larger the nucleic acid that hybridizes, the more mismatches with an RNA of the G-protein Chemokine Receptor (CCR5) can contain and still form a stable double chain (or triple as the case may be). One skilled in the art can establish a tolerable degree of mismatch by using conventional procedures to determine the melting point of the hybridized complex.

Oligonucleotides that are complementary to the 5 ’end of the message, for example, the 5’ untranslated sequence up to and including the AUG initiation codon, should work more effectively in inhibiting translation. However, sequences complementary to the 3 ’untranslated sequences of mRNAs have been shown to be effective in inhibiting mRNA translation as well. See generally, Wagner, R., 1994, Nature 372: 333-335. Thus, oligonucleotides complementary to the 5 'or 3' non-translated non-coding regions of the G-protein Chemokine Receptor (CCR5) shown in Figures 1A-B or within the coding region of the deposited clone could be used in one approach antisense to inhibit mRNA translation of the G-protein Chemokine Receptor (CCR5). Oligonucleotides complementary to the 5 ’untranslated region of the mRNA should include the AUG start codon complement. Antisense oligonucleotides complementary to mRNA coding regions are less effective inhibitors of translation but could be used. If they are designed to hybridize with the 5 ', 3' or mRNA coding region of the G-protein Chemokine Receptor (CCR5) or within the coding region of the deposited clone, the antisense nucleic acids should be at least 6 nucleotides in length and are preferably oligonucleotides ranging from 6 to 50 nucleotides in length. In specific aspects the oligonucleotide is at least 10 nucleotides, at least 17 nucleotides, at least 25 nucleotides or at least 50 nucleotides.

The polynucleotides of the invention can be DNA or RNA or chimeric mixtures or derivatives or modified versions thereof, double stranded or single stranded. The oligonucleotide can be modified in the base moiety, sugar moiety or phosphate backbone, for example, to improve the stability of the molecule, hybridization, etc. The oligonucleotide may include other added groups such as peptides (eg, to target host cell receptors in vivo) or agents that facilitate transport across the cell membrane (see, for example, Letsinger et al., 1989, Proc. Natl. Acad. Sci. USA 86: 6553-6556; Lemaitre et al., 1987, Proc. Natl. Acad. Sci. 84: 648-652; PCT Publication No. WO88 / 09810, published December 15, 1988) or the blood-brain barrier (see, for example, PCT Publication No. WO89 / 10134, published on April 25, 1988), cleavage agents triggered by hybridization (See, for example, Krol et al., 1988, BioTechniques 6 : 958976) or intercalating agents. (See, for example, Zon, 1988, Pharm. Res. 5: 539-549). For this purpose, the oligonucleotide can be conjugated to another molecule, for example, a peptide, crosslinking agent triggered by hybridization, transport agent, cleavage agent triggered by hybridization, etc.

The antisense oligonucleotide may comprise at least one modified base moiety that is selected from the group that includes, but is not limited to, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4acetylcytosine, 5- (carboxyhydroxylmethyl) ) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylkeosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methyl -methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylkeosine, 5'-methoxycarboxymethyluracil, 5methoxyuracil, 2-methylthio-N6-isopentenyl-5-isopentenyl -oxyacetic (v), wibutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxoacetic acid methyl ester, uracil-5- acid oxyacetic (v); 5-methyl-2-thiouracil, 3- (3-amino-3-N-2-carboxypropyl) uracil, (acp3) w and 2,6-diaminopurine.

The antisense oligonucleotide may also comprise at least one modified sugar moiety selected from the group that includes, but is not limited to, arabinose, 2-fluoroarabinous, xylulose and hexose.

The antisense oligonucleotide may comprise at least one modified phosphate main chain selected from the group that includes, but is not limited to, a phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a phosphorodiamidate, a methylphosphonate, an alkyl phosphotriester and an analog or formacetal of the same.

The antisense oligonucleotide can be an α-anomeric oligonucleotide. An a-anomeric oligonucleotide forms specific double-stranded hybrids with complementary RNA in which, unlike the usual b units, the chains are arranged parallel to each other (Gautier et al., 1987, Nucl. Acids Res. 15: 6625-6641) . The oligonucleotide is a 2'-0-methylribonucleotide (Inoue et al., 1987, Nucl. Acids Res. 15: 6131-6148), or a chimeric DNA-RNA analog (Inoue et al., 1987, FEBS Lett. 215 : 327-330).

The polynucleotides can be synthesized by conventional methods known in the art, for example, by using an automated DNA synthesizer (such as those available in the market of Biosearch, Applied Biosystems, etc.). As examples, phosphorothioate oligonucleotides can be synthesized by the method of Stein et al. (1988, Nucl. Acids Res. 16: 3209), methylphosphonate oligonucleotides can be prepared by using controlled pore glass polymer supports (Sarin et al., 1988, Proc. Natl. Acad. Sci. USA 85: 74487451 ), etc.

Although antisense nucleotides complementary to the coding region sequence of the G-protein Chemokine Receptor (CCR5) could be used, those complementary to the transcribed untranslated region are more preferred.

Potential antagonists also include catalytic RNA or a ribozyme (See, for example, PCT International Publication WO 90/11364, published October 4, 1990; Sarver et al, Science 247: 1222-1225 (1990). Although they can be used ribozymes that cleave mRNA in site-specific recognition sequences to destroy mRNA of the G-protein Chemokine Receptor (CCR5), the use of hammerhead ribozymes is preferred Hammerhead ribozymes cleave mRNA in locations marked by flanking regions which form complementary base pairs with the target mRNA.The only requirement is that the target mRNA has the following sequence of two bases: 5'-UG-3 '. The construction and production of hammer chain ribozymes is well known in the technique and is described more fully in Haseloff and Gerlach, Nature 334: 585-591 (1988) There are numerous sites of cleavage of potential hammerhead ribozymes within the sec Nucleotide uence of the G-protein Chemokine Receptor (CCR5) (Figures 1A-B or the sequence of the deposited clone). Preferably, the ribozyme is engineered so that the cleavage recognition site is located near the 5 ′ end of the G-protein Chemokine Receptor mRNA (CCR5); that is, to increase the efficiency and minimize the intracellular accumulation of non-functional mRNA transcripts.

As in the antisense approach, ribozymes can be composed of modified oligonucleotides (for example to improve stability, direction, etc.) and should be delivered to cells expressing G-protein Chemokine Receptor (CCR5) in vivo. DNA constructs encoding ribozyme can be introduced into the cell in the same manner as described above for the introduction of antisense coding DNA. A preferred method of delivery involves using a DNA construct "encoding" the ribozyme under the control of a strong constitutive promoter, such as, for example, pol III or pol II promoter, so that the transfected cells will produce sufficient amounts of the Ribozyme to destroy the messages of the G-protein Chemokine Receptor (CCR5) and inhibit translation. Since ribozymes, unlike antisense molecules, are catalytic, a lower intracellular concentration is required for their effectiveness.

Antagonist / agonist compounds can be used to inhibit the effects of cell proliferation and growth of polypeptides in neoplastic cells and tissues, i.e. stimulation of tumor angiogenesis and, therefore, retardation or prevention of abnormal cell growth and proliferation, for example , in formation or growth of tumors.

The antagonist / agonist can also be used to prevent hypervascular diseases and prevent the proliferation of lens epithelial cells after extracapsular cataract surgery. Prevention of the mitogenic activity of the polypeptides may also be desirable in cases such as restenosis after balloon angioplasty.

The antagonist / agonist can also be used to prevent the growth of scar tissue during wound healing.

The antagonist / agonist can also be used to treat the diseases described herein.

This describes a method to treat or prevent diseases, disorders and / or conditions, including but not limited to the diseases, disorders and / or conditions listed throughout this application, associated with the overexpression of a CCR5 polynucleotide by means of administration to a patient of (a) an antisense molecule directed to the polynucleotide and / or (b) a ribozyme directed to the polynucleotide.

Use of Transmembrane Fragments as Antagonists / Inhibitors

The modulation, especially inhibition, of biological activities of the G-protein Chemokine Receptor (CCR5) is described by exposure to molecules that interfere with the correct assembly of the receptor. In particular, isolated fragments or peptides of the transmembrane domain of the G-protein Chemokine Receptor (CCR5) that inhibit signal transduction mediated by G-protein Chemokine Receptor or ligand binding are described. Loaded remains may be added at a terminal end of the fragment to promote correct orientation of the fragment in the membrane.

It has been shown that the transmembrane (TM) domain segments of the G-protein coupled receptor (GPCR) interact in a specific manner during the assembly of receptor molecules. These interactions do not lead to a rigid structure because some flexibility is required for conformational changes after ligand binding, which allows the molecule to signal from the cell surface to the intracellular parts. It was also demonstrated for several GPCRs that the transmembrane domain is involved in ligand binding and therefore contains openings that allow ligand penetration. Reports that the expression of absent transmembrane domains rescue inactive truncated vasopressin V2, muscarinic and beta-adrenergic M3 receptors (Schoneberg et al. EMBO J. 15: 1283 (1996); Wong et al., J. Biol. Chem. 265: 6219 (1990); Monnot et al., J. Biol. Chem. 271: 1507 (1996); Gudermann et al., Annu. Rev. Neurosci. 20: 399 (1997); Osuga et al., J. Biol. Chem. 272: 25006 (1997)) suggested that a peptide derived from the sixth transmembrane domain of the P2-adrenergic receptor inhibits receptor activation and dimerization (Hebert et al., J. Biol. Chem., 271 (27): 16384- 92 (1996)). In this way, the GPCR function can be rescued by targeting intramembrane GPCR interactions.

Additionally, GPCR function can be inhibited by targeting intramembrane interactions. For example, fragments corresponding to predicted TM segments of CCR5, which function as a co-receptor during HIV entry into cells, produced a potent inhibition of HIV entry without apparent toxicity to cells (See WO 99/43711) . The utility of the method was also demonstrated by the specific labeling of CXCR4, which functions as a co-receptor during entry into tropic strain cells for HIV-1 T lymphocytes. Fragments containing 20-25 amino acid residues inhibited receptor signaling and HIV-1 infection in vitro at a concentration as low as 0.2 micromolar (See WO 99/43711).

The hydrophobic and / or amphipathic nature of the transmembrane fragments allows their penetration into the bilayer. In addition, the orientation within the membrane can be controlled by the addition of charged debris at the end that is exposed on the extracellular side of the membrane in the intact receptor. The membrane insertion is assayed by fluorescence microscopy of labeled peptide analogs using methodology known to those skilled in the art and as described in WO 99/43711.

Transmembrane fragments that modulate and preferably inhibit the biological properties and activities of the G-protein Chemokine Receptor (CCR5) by transmembrane domain targeting of this receptor are described.

Methods for altering the function of the G-protein Chemokine Receptor (CCR5) through the use of these antagonists are also described.

Recombinant or chemical DNA technology can be used to obtain transmembrane fragments of the G-protein Chemokine Receptor (CCR5), which are preferably as small as possible while still maintaining a sufficiently high affinity for binding with, or association with, Chemokine Receptor. G protein (CCR5). Non-limiting examples of G-protein Chemokine Receptor polypeptides (CCR5) include fragments of 10 to 50 amino acids corresponding to at least one transmembrane segment of segments 1-7.

An isolated G-protein Chemokine Receptor modulating molecule comprising a fragment, a peptide or peptidomimetic is described which is a structural analogue of a part of a transmembrane segment of the G-protein Chemokine Receptor (CCR5), said molecule having one end extracellular and an intracellular end and said molecule at said extracellular end having a negatively charged group and at said intracellular end a neutral charge under physiological conditions; said molecule is spontaneously inserted into a membrane in the same orientation as the transmembrane domain from which it is derived; and said molecule modulates an activity or biological property of said G-protein Chemokine Receptor.

The molecules may contain a negatively charged hydrophilic non-peptide head group and an uncharged tail, which ensures the correct orientation of the molecule in the cell membrane. The negatively charged head group may be one or more acidic amino acids.

The activity of the G-protein Chemokine Receptor (CCR5) modulated by said fragment includes inhibition of intracellular Ca2 + release mediated by G-protein Chemokine Receptor and inhibition of HIV infection mediated by G-protein Chemokine Receptor. G-protein chemokine receptor (CCR5) modulated by said peptide also includes the binding of a G-protein chemokine receptor ligand (CCR5). Additional activities of the G-protein Chemokine Receptor (CCR5) modulated by said peptide include those of the Description and Examples herein.

Methods for modulating the biological activity of a G-protein Chemokine Receptor (CCR5) by contacting a cell expressing the G-protein Chemokine Receptor (CCR5) with a molecule of the invention are described. In one method, the modulated biological activity is inhibition of HIV infection mediated by G-protein Chemokine Receptor. In another method, the modulated biological activity is inhibition of intracellular Ca2 + release mediated by G-protein Chemokine Receptor (CCR5). Other modulated activities include those described elsewhere herein.

A method for inhibiting HIV-1 infection is described, comprising contacting a cell that expresses the G-protein Chemokine Receptor (CCR5) that binds to HIV-1 with a molecule comprising a polypeptide fragment, a peptide or peptidomimetic which is a structural analogue of a part of the transmembrane domain of said G-protein Chemokine Receptor (CCR5), in which the contact of the cell with said molecule inhibits HIV-1 infection. The peptide or peptidomimetic may be a structural analogue of a part of a transmembrane domain of the G-protein Chemokine Receptor.

The molecule mimics a transmembrane segment of the G-protein Chemokine Receptor (CCR5) and blocks receptor self-assembly, possibly by competitive inhibition with the native TM segment. These therefore block or inhibit signal transduction in the affected cell.

Also described are peptide and peptidomimetic analogs that have beneficial properties such as increased half-life, lack of immunogenicity and the ability to cross the blood-brain barrier.

Peptide analogs mediate the chemical and / or biological effects of agonists / antagonists of hormones or other peptides. They are useful for the development of pharmaceutical, therapeutic and diagnostic techniques. Accordingly, methods for producing a therapeutic or prophylactic response in a mammal are described by administering to the mammal a pharmaceutically effective amount of one or more peptide analogs. Methods for producing such responses are described by modulating the activity of the G-protein Chemokine Receptor (CCR5) by administering an effective amount of one or more peptide analogs.

More than one peptide can be administered as a cocktail to modulate the biological activity of the G-protein Chemokine Receptor.

The term "transmembrane peptide of the G-protein Chemokine Receptor (CCR5)" may include a fragment of the transmembrane domain, a transmembrane segment, a fragment of a transmembrane segment and / or a homologous peptide thereof. Preferred fragments include those of at least 4-50 and preferably at least 4-30 and preferably at least 10-30 amino acids in length or any range thereof. Further preferred fragments include those of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26 , 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 amino acids of length. Any corresponding sequence that has conservative amino acid substitutions is also included.

Transmembrane fragments of the sample include, but are not limited to, any fragment described herein. A preferred transmembrane fragment, when contacted with a cell or membrane structure (eg, liposome) containing biologically active G-protein Chemokine Receptor (CCR5), modulates the biological activity of said G-protein Chemokine Receptor ( CCR5) in vitro, in vivo, or in situ. The concentration of the fragment in a solution that contacts the cell in vivo (for example blood plasma or interstitial fluid) or in vitro (for example culture medium) is between 1 nanomolar and 50 micromolar, preferably between 1 nanomolar and 1 micromolar and more preferably less than 5 micromolar.

"Negatively charged" refers to amino acids, amino acid derivatives, amino acid mimetics and chemical moieties that are negatively charged at physiological pH. Negatively charged amino acids include, for example, Asp and Glu. An "acidic" moiety is a moiety that is negatively charged at physiological pH.

"Positively charged" refers to amino acids, amino acid derivatives, amino acid mimetics and chemical moieties that are positively charged at physiological pH. Positively charged amino acids include, for example, Lys and Arg. A "basic moiety" is a moiety that is positively charged at physiological pH.

"Neutral" refers to amino acids, amino acid derivatives, amino acid mimetics and chemical moieties that are neither positively nor negatively charged at physiological pH.

The term "modulates a biological activity or property" means that in the presence of a transmembrane test fragment a biological parameter or measurable event increases or decreases in relation to a control in the absence of said peptide. Examples of biological activities or properties include: conformation of the G-protein Chemokine Receptor (CCR5), association of the G-protein Chemokine Receptor (CCR5) with other molecules, signal transduction, extracellular secretion of cellular proteins, conformational changes in proteins , changes in enzyme activity, changes in metabolic activity, changes in affinity for a ligand, changes in viral infection levels, changes in vasodilation, heart rate modulation, bronchodilation modulation, endocrine secretion modulation and modulation of peristaltic movements of the intestine. Note that the biological activity of the G-protein Chemokine Receptor (CCR5) may not be one that is limited to the precise in vivo role performed by the G-protein Chemokine Receptor. The expression also encompasses properties of the G-protein Chemokine Receptor ( CCR5) such as viral protein binding, which are not part of the in vivo biological role of the G-protein Chemokine Receptor. Additionally it encompasses intrinsic properties of the G-protein Chemokine Receptor (CCR5) that are only described by experimental laboratory manipulation. , such as the ability of the G-protein Chemokine Receptor (CCR5) in artificial bilayers (for example liposomes) to interact with ligands of the G-protein Chemokine Receptor (CCR5).

"Signal transduction" is the process by which the binding of a ligand with a receptor results in physiological change. In general, the binding of a ligand with a receptor causes a change in a physical property of the receptor, for example a change in its conformation or orientation or in its ability to bind to other ligands. This change in a physiological property may result, directly or indirectly, in an increase or decrease in ionic fluxes, increase or decrease in enzymatic activity, increase or decrease in phosphorylation, increase or decrease in translocation of the receptor or of any molecule (for example an inositol residue or a subunit of G protein) from one cell compartment to another.

"G-protein Chemokine Receptor Ligands (CCR5)" refers to biological molecules that bind to the G-protein Chemokine Receptor (CCR5) in vitro, in situ, or in vivo and may include hormones, neurotransmitters, viruses or domains. receptor binding thereof, G proteins, opsins, rhodopsins, nucleosides, nucleotides, coagulation cascade factors, odorizers or pheromones, toxins, colony stimulating factors, platelet activating factors, neuroactive peptides, neurohumor or any biologically active compound , such as drugs or compounds of natural or synthetic origin.

The phrase "inhibits HIV infection" means that a peptide described herein inhibits the binding of an HIV with a G-protein Chemokine Receptor (CCR5) or inhibits the biological activity of a G-protein Chemokine Receptor (CCR5) which mediates the entry and successful reproduction of an HIV virus in a cell that expresses G-protein Chemokine Receptor.

Polypeptides of the G-protein Chemokine Receptor (CCR5) or nucleic acids encoding them, include a finite set of substantially corresponding sequences such as substitution peptides or polynucleotides that can be routinely obtained by one skilled in the art, without undue experimentation, based on the teachings and guidelines presented herein. For a detailed description of protein structure and chemistry, see Schulz et al., PRINCIPLES OF PROTEIN STRUCTURE, Springer-Verlag, New York, 1978, and Creighton, TE, PROTEINS: STRUCTURE AND MOLECULAR PROPERTIES, WH Freeman & Co., San Francisco, 1983. For a presentation of nucleotide sequence substitutions, such as coding preferences, see Ausubel et al, mentioned above, in sections A.1.1-A.1.24, and Sambrook et al., Mentioned above, in the Appendices C and D.

Polypeptides of the G-protein Chemokine Receptor (CCR5) include homologous sequences and / or fragments of the transmembrane domain, in particular, at least one of the transmembrane segments 1-7 of the G-protein Chemokine Receptor (CCR5) or homologs of the same.

However, G-protein Chemokine Receptor (CCR5) polypeptides of at least 15-20 amino acids are preferred so that G-protein Chemokine Receptor (CCR5) polypeptides are capable of encompassing the lipid bilayer.

Particularly it is preferred that the peptides be selected or modified so that one end is charged and the other is neutral under physiological conditions. This is so that the peptide is inserted spontaneously into a membrane. It is of particular importance that the peptide be inserted in the same orientation as the transmembrane domain of the G-protein Chemokine Receptor (CCR5) from which it is derived.

Peptides can be derived from any of the 7 TM segments. The amino acid positions of the TM segments can be determined using molecular modeling, optionally combined with hydrophobicity analysis (see Table 1) and / or adjusting to model helices, as non-limiting examples. Such modeling can be achieved according to known methods, for example, ECEPP, INSIGHT, DISCOVER, CHEM-DRAW, AMBER, FRODO and CHEM-X. Such algorithms compare transmembrane domains and segments between related GPCRs, determine probable minimized energy structures and define alternative transmembrane sequences.

Fragments of the transmembrane domain of the G-protein-coupled Chemokine Receptor that are useful as antagonists comprise, or alternatively consist of, the following parts of SEQ ID NO: 2 or of the polypeptide encoded by the deposited clone:

Segment 1: amino acids 31-58, 32-58, 33-58, 34-58, 35-58, 36-58, 37-58, 38-58, 31-57, 32-57, 33-57, 34- 57, 35-57, 36-57, 37-57, 31-56, 32-56, 33-56, 34-56, 35-56, 36-56, 31-55, 32-55, 33-55, 34-55, 35-55, 31-54, 32-54, 33-54, 34-54, 31-53, 32-53, 33-53, 31-52, 32-52, 31-51 of SEQ ID No.: 2 or of the polypeptide encoded by the deposited clone, or any combination thereof, preferably at least 15 amino acids in length;

Segment 2: amino acids 68-97, 69-97, 70-97, 71-97, 72-97, 73-97, 74-97, 75-97, 76-97, 68-96, 69-96, 70- 96, 71-96, 72-96, 73-96, 74-96, 75-96, 76-96, 68-95, 69-95, 70-95, 71-95, 72-95, 73-95, 74-95, 75-95, 68-94, 69-94, 70-94, 71-94, 72-94, 73-94, 74-94, 68-93, 69-93, 70-93, 71- 93, 72-93, 73-93, 68-92, 69-92, 70-92, 71-92, 72-92, 68-91, 69-91, 70-91, 71-91, 68-90, 69-90, 70-90, 68-89, 69-89, 68-88 of SEQ ID NO: 2 or of the polypeptide encoded by the deposited clone, or any combination thereof, preferably at least 15 amino acids in length;

Segment 3: amino acids 103-124, 104-124, 105-124, 106-124, 107-124, 108-124, 109-124, 103-123, 103-122, 103-121, 103-120, 103- 119, 103-118 of SEQ ID NO: 2 or of the polypeptide encoded by the deposited clone, or any combination thereof, preferably at least 15 amino acids in length;

Segment 4: amino acids 142-169, 143-169, 144-169, 145-169, 146-169, 147-169, 148-169, 149-169, 142-168, 143-168, 144-168, 145- 168, 146-168, 147-168, 148-168, 142-167, 143-167, 144-167, 145-167, 146-167, 147167,

142-166, 143-166, 144-166, 145-166, 146-166, 142-165, 143-165, 144-165, 145-165, 142-164, 143-164, 144164, 142-163, 143-163, 142-163 of SEQ ID NO: 2 or of the polypeptide encoded by the deposited clone, or any combination thereof, preferably at least 15 amino acids in length;

Segment 5: amino acids 196-223, 197-223, 198-223, 199-223, 200-223, 201-223, 202-223, 203-223, 196-222, 197-222, 198-222, 199- 222, 200-222, 201-222, 202-222, 196-221, 197-221, 198-221, 199-221, 200-221, 201221, 196-220, 197-220, 198-220, 199- 220, 200-220, 196-219, 197-219, 198-219, 199-219, 196-218, 197-218, 198-218, 196-217, 197-217, 196-216 of SEQ ID NO: 2 or of the polypeptide encoded by the deposited clone, or any combination thereof, preferably at least 15 amino acids in length,

Segment 6: amino acids 236-260, 237-260, 238-260, 239-260, 240-260, 236-259, 237-259, 238-259, 239-259, 236-258, 237-258, 238- 258, 236-257, 237-257, 236-256 of SEQ ED NO: 2 or of the polypeptide encoded by the deposited clone, or any combination thereof, preferably at least 15 amino acids in length;

Segment 7: amino acids 275-305, 276-305, 277-305, 278-305, 279-305, 280-305, 281-305, 282-305, 283-305, 284-305, 285-305, 275- 304, 276-304, 277-304, 278-304, 279-304, 280-304, 281-304, 282-304, 283-304, 284304, 275-303, 276-303, 277-303, 278- 303, 279-303, 280-303, 281-303, 282-303, 283-303, 275-302, 276-302, 277-302, 278-302, 279-302, 280-302, 281-302, 282-302, 275-301, 276-301, 277-301, 278-301, 279-301, 280301, 281-301, 275-300, 276-300, 277-300, 278-300, 279-300, 280-300, 275-299, 276-299, 277-299, 278-299, 279-299, 275-298, 276-298, 277-298, 278-298, 275-297, 276-297, 277- 297, 275-296, 276-296, 275-295 of SEQ ID NO: 2 or of the polypeptide encoded by the deposited clone, or any combination thereof, preferably at least 15 amino acids in length;

The CCR5 fragments described in WO 99/43711 are specifically excluded from the description in this section.

Negatively charged amino acids, such as Asp or Glu, can be substituted or added to the extracellular end of the fragment. The number of negatively charged amino acids is typically 1, 2 or 3. Neutral amino acids can be substituted or added at the intracellular end of the fragment. See, also, Example 57.

Other activities

A polypeptide, polynucleotide, agonist or antagonist as a result of the ability to stimulate the growth of vascular endothelial cells, can be used in the treatment for the stimulation of the revascularization of ischemic tissues due to various diseases such as thrombosis, arteriosclerosis and other cardiovascular conditions. The polypeptide, polynucleotide, agonist or antagonist can also be used to stimulate limb angiogenesis and regeneration, as discussed above.

A polypeptide, polynucleotide, agonist or antagonist can also be used for the treatment, prevention and / or diagnosis of wounds due to injuries, burns, repair of postoperative tissue and ulcers because they are mitogenic for various cells of different origins, such as fibroblast cells. and skeletal muscle cells and, therefore, facilitate repair or replacement of damaged or diseased tissue.

A polypeptide, polynucleotide, agonist or antagonist can also be used to stimulate neuronal growth and to treat and prevent neuronal damage that occurs in certain diseases, disorders and / or neuronal conditions or neurodegenerative conditions such as Alzheimer's disease, Parkinson's disease and complex AIDS related. A polypeptide, polynucleotide, agonist or antagonist may have the ability to stimulate chondrocyte growth, therefore they can be used to enhance bone and periodontal regeneration and aid in bone transplants or bone grafts.

A polypeptide, polynucleotide, agonist or antagonist can also be used to prevent skin aging due to sunburn by stimulating the growth of keratinocytes.

A polypeptide, polynucleotide, agonist or antagonist can also be used to prevent hair loss, since members of the FGF family activate hair-forming cells and promote the growth of melanocytes. Along the same lines, a polypeptide, polynucleotide, agonist or antagonist can be used to stimulate the growth and differentiation of hematopoietic cells and bone marrow cells when used in combination with other cytokines.

A polypeptide, polynucleotide, agonist or antagonist can also be used to maintain organs before transplantation or to support cell cultures of primary tissues. A polypeptide, polynucleotide, agonist or antagonist can also be used to induce tissue of mesodermal origin to differentiate into early embryos.

A polypeptide, polynucleotide, agonist or antagonist can also increase or decrease the differentiation or proliferation of embryonic stem cells, in addition, as discussed above, of hematopoietic lineage.

A polypeptide, polynucleotide, agonist or antagonist can also be used to modulate characteristics of mammals, such as body height, weight, hair color, eye color, skin, percentage of adipose tissue, pigmentation, size and shape (for example cosmetic surgery ). Similarly, a polypeptide, polynucleotide, agonist or antagonist can also be used to modulate mammalian metabolism that affects catabolism, anabolism, processing, utilization and storage of energy.

A polypeptide, polynucleotide, agonist or antagonist can also be used to change the mental state of a mammal or its physical state by influencing biorhythms, circadian rhythms, depression (including diseases, disorders and / or depressive conditions), tendency to violence, tolerance pain, reproductive abilities (preferably through Activin or Inhibin-like activity), hormonal or endocrine levels, appetite, libido, memory, stress or other cognitive qualities.

A polypeptide, polynucleotide, agonist or antagonist can also be used as a food additive or preservative, such as to increase or decrease storage capacities, fat content, lipids, proteins, carbohydrates, vitamins, minerals, cofactors or other nutritional components.

The aforementioned applications have uses in a wide variety of hosts. Such hosts include, but are not limited to, humans, murine, rabbit, goat, guinea pig, camel, horse, mouse, rat, hamster, pig, miniaturized pig, chicken, goat, cow, sheep, dog, cat, non-human primate and human being. As the host a mouse, rabbit, goat, guinea pig, chicken, rat, hamster, pig, sheep, dog or cat is preferred. In preferred embodiments, the host is a mammal. In more preferred embodiments, the host is a human being.

Having described the invention in general, it will be more readily understood by reference to the following examples, which are provided as illustrations and are not intended to be limiting.

Examples

Example 1

Bacterial Expression and Purification of HDGNR10

The DNA sequence encoding HDGNR10, ATCC No. 97183 is initially amplified using oligonucleotide PCR primers that correspond to the 5 'end sequences of the HDGNR10 protein (without the signal peptide sequence) and the 3' vector sequences of the gene from HDGNR10. Additional nucleotides corresponding to HDGNR10 were added to the 5 ’and 3’ sequences respectively. The 5 'oligonucleotide primer has the sequence 5' CGGAATTCCTCCATGGATTATCAAGTGTCA 3 '(SEQ ID NO: 3) and contains an EcoRI restriction enzyme site followed by 18 nucleotides of the HDGNR10 coding sequence beginning with the assumed terminal amino acid of the protein codon processed.

The sequence 3 ’5’ CGGAAGCTTCGTCACAAGCCCACAGATAT 3 ’(SEQ ID NO: 4) contains sequences complementary to a HindIII site and is followed by 18 nucleotides of the coding sequence of HDGNR10. The restriction enzyme sites correspond to the restriction enzyme sites of the bacterial expression vector pQE-9 (Qiagen, Inc. 9259 Eton Avenue, Chatsworth, CA, 91311). pQE-9 encodes antibiotic resistance (Ampr), a bacterial origin of replication (ori), a promoter operator adjustable by IPTG (P / O), a ribosome binding site (RBS), a 6-His marker and sites of restriction enzyme. pQE-9 was then digested with EcoRI and HindIII. The amplified sequences were ligated into pQE-9 and inserted in phase with the histidine marker coding sequence and the RBS. The ligation mixture was then used to transform E. coli strain M15 / rep 4 (Qiagen, Inc.) by the procedure described in Sambrook, J. et al., Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989). M15 / rep4 contains multiple copies of plasmid pREP4, which expresses the lacI repressor and also confers resistance to kanamycin (Kanr). Transformants were identified by their ability to grow on LB plates and ampicillin / kanamycin resistant colonies were selected. Plasmid DNA was isolated and confirmed by restriction analysis.

Clones containing the desired constructs were grown overnight (O / N) in liquid culture in LB medium supplemented with Amp (100 µg / ml) and Kan (25 µg / ml). The O / N culture was used to inoculate a large culture at a ratio of 1: 100 to 1: 250. The cells were cultured at an optical density 600 (O.D. 600) between 0.4 and 0.6. IPTG ("Isopropyl-B-D-pyranoside thiogalate") was then added to a final concentration of 1 mM. IPTG induces by inactivation of the lacI repressor, eliminating the P / O which leads to an increase in gene expression. Cells were cultured for an additional 3 to 4 hours. The cells were then collected by centrifugation. The cell pellet was solubilized in the chaotropic agent Guanidine HCl 6 Molar. After clarification, HDGNR10 of this solution was purified by chromatography on a Nickel Chelated column under conditions that allow tight binding by proteins containing the 6-His marker. Hochuli, E. et al., J. Chromatography

411: 177-184 (1984). HDGNR10 was eluted from the column in 6 molar guanidine HCl pH 5.0 and in order to renaturalize it was adjusted to 3 molar guanidine HCl, 100 mM sodium phosphate, 10 mmolar glutathione (reduced) and 2 mmolar glutathione (oxidized). After incubation in this solution for 12 hours the protein was dialyzed to 10 mmolar sodium phosphate.

Example 2

Expression of Recombinant HDGNR10 in COS cells

Plasmid HDGNR10 HA expression is derived from a pcDNAI / Amp vector (Invitrogen) containing: 1) SV40 origin of replication, 2) ampicillin resistance gene, 3) E. coli origin of replication, 4) CMV promoter followed by a polylinker region, an SV40 intron and polyadenylation site. A DNA fragment encoding the complete HDGNR10 precursor and a phase-fused HA marker with its 3 ′ end was cloned into the polylinker region of the vector, therefore, the expression of the recombinant protein is directed under the CMV promoter. The HA marker corresponds to an epitope derived from the hemagglutinin influenza protein as previously described (I. Wilson, et al., Cell 37: 767 (1984)). Infusion of the HA marker to the target protein allows easy detection of the recombinant protein with an antibody that recognizes the HA epitope.

The plasmid construction strategy is described as follows:

The DNA sequence encoding HDGNR10, ATCC No. 97183, was constructed by PCR using two primers:

primer 5 ’5’ GTCCAAGCTTGCCACCATGGATTATCA AGTGTCA 3 ’(SEQ ID NO: 5) contains a HindIII site followed by 18 nucleotides of the HDGNR10 coding sequence starting from the start codon; sequence 3 '5' CTAGCTCGAGTCAAGCGTAGTCTGGGACGTCGTATGGGTAGCACAA GCCCACAGATATTTC 3 '(SEQ ID NO: 6) contains sequences complementary to an XhoI site, translation termination codon, HA marker and the last 18 nucleotides of the coding sequence without including HDGNR10 ( of termination). Therefore, the PCR product contains an HindIII site HDGNR10 coding sequence followed by a phase-merged HA marker, a translation termination codon next to the HA marker and an XhoI site. The PCR amplified DNA fragment and the vector, pcDNAI / Amp were digested with restriction enzyme HindIII and XhoI and ligated. The ligation mixture was transformed into the strain of E. coli SURE (available from Stratagene Cloning Systems, 11099 North Torrey Pines Road, La Jolla, CA 92037), the transformed culture was seeded in medium plates with ampicillin and resistant colonies were selected . Plasmid DNA was isolated from the transformants and examined by restriction analysis with respect to the presence of the correct fragment. For the expression of the recombinant HDGNR10, COS cells were transfected with the expression vector by the DEAE-DEXTRANO method (J. Sambrook, E. Fritsch, T. Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989 )). HDGNR10 HA protein expression was detected by radiolabeling and immunoprecipitation method (E. Harlow, D. Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, (1988)). The cells were labeled for 8 hours with 35S-cysteine two days after transfection. The culture media were then collected and the cells lysed with detergent (RIPA buffer (150 mM NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50 mM Tris, pH 7.5) (Wilson, I. et al., Id. 37: 767 (1984). Both the cell lysate and the culture medium were precipitated with an HA-specific monoclonal antibody. The precipitated proteins were analyzed in gels of SDS-PAGE 15%.

Example 3

Cloning and Expression of HDGNR10 Using the Baculovirus Expression System

The DNA sequence encoding the full length HDGNR10 protein, ATCC No. 97183, was amplified using oligonucleotide PCR primers corresponding to the 5 'and 3' sequences of the gene:

Primer 5 ’has the sequence

5 'CGGGATCCCTCCATGGATTATCAAGTGTCA 3' (SEQ ID NO: 7) and contains a BamHI restriction enzyme site followed by 4 nucleotides that resemble an effective signal for translation initiation in eukaryotic cells (Kozak, M., J. Mol. Biol 196: 947-950 (1987)) and just behind the first 18 nucleotides of the HDGNR10 gene (the start codon for translation is "ATG").

Primer 3 ’has the sequence

5 'CGGGATCCCGCTCACAAGCCCACAGATAT 3' (SEQ ID NO: 8) and contains the cleavage site for the BamHI restriction endonuclease and 18 nucleotides complementary to the 3 'untranslated sequence of the HDGNR10 gene. The amplified sequences were isolated from a 1% agarose gel using a commercially available kit ("Geneclean," BIO 101 Inc., La Jolla, Ca.). The fragment was then digested with the BamHI endonuclease and purified as described above. This fragment is designated F2.

The vector pRG1 (modification of the vector pVL941, analyzed below) is used for the expression of the HDGNR10 protein using the baculovirus expression system (for a review see: Summers, MD and Smith, GE 1987, A manual of methods for baculovirus vectors and insect cell culture procedures, Texas Agricultural Experimental Station Bulletin No. 1555). This expression vector contains the Autographa californica nuclear polyhedrosis virus (AcMNPV) strong polyhedrin promoter followed by recognition sites for BamHI restriction endonuclease. The simian virus (SV) 40 polyadenylation site is used for effective polyadenylation. For an easy selection of recombinant viruses the E. coli beta-galactosidase gene is inserted in the same orientation as the polyhedrin promoter followed by the polyadenylation signal of the polyhedrin gene. The polyhedrin sequences are flanked on both sides by viral sequences for homologous recombination mediated by co-transfected wild-type viral DNA cells. Many other baculovirus vectors could be used in place of pRG1 such as pAc373, pVL941 and pAcIM1 (Luckow, V. A. and Summers, M. D., Virology 170: 3139).

The plasmid was digested with the restriction enzyme BamHI and then dephosphorylated using calf intestinal phosphatase by procedures known in the art. The DNA was isolated after a 1% agarose gel as described above. This vector DNA is designated V2.

Fragment F2 and dephosphorylated plasmid V2 were ligated with T4 DNA ligase. E.coli HB101 cells were then transformed and bacteria containing the plasmid (pBacHDGNR10) were identified with the HDGNR10 gene using the BamHI enzyme. The cloned fragment sequence was confirmed by DNA sequencing.

5 µg of the plasmid pBacHDGNR10 was co-transfected with 1.0 µg of a commercially available linearized baculovirus ("BaculoGold ™ baculovirus DNA", Pharmingen, San Diego, CA.) using the lipofection method (Felgner, et al. , Proc. Natl. Acad Sci. USA 84: 7413-7417 (1987)).

1 µg of BaculoGold ™ virus DNA and 5 µg of plasmid pBacHDGNR10 were mixed in a sterile well of a microtiter plate containing 50 µg of serum-free Grace medium (Life Technologies Inc., Gaithersburg, MD). Then 10 µl of lipofectin plus 90 µl of Grace's medium were added, mixed and incubated for 15 minutes at room temperature. The transfection mixture was then added dropwise to the Sf9 insect cells (ATCC CRL 1711) seeded in a 35 mm tissue culture plate with 1 ml of Grace medium without serum. The plate was swung back and forth to mix the newly added solution. The plate was then incubated for 5 hours at 27 ° C. After 5 hours the transfection solution was removed from the plate and 1 ml of Grace insect medium supplemented with 10% fetal calf serum was added. The plate was put back in an incubator and the culture continued at 27 ° C for 4 days.

After four days the supernatant was collected and a plaque assay similar to that described in Summers and Smith (mentioned above) was performed. An agarose gel with "Blue Gal" (Life Technologies Inc., Gaithersburg) that allows easy isolation of blue-stained plates was used as a modification. (A detailed description of a "plaque assay" can also be found in the user guide for insect cell culture and baculovirology distributed by Life Technologies Inc., Gaithersburg, pages 9-10).

Four days after serial dilution, viruses were added to the cells, blue-stained plates were taken with the tip of an Eppendorf pipette. The agar containing the recombinant viruses was then resuspended in an Eppendorf tube containing 200 µl of Grace's medium. The agar was removed by a brief centrifugation and the supernatant containing the recombinant baculoviruses was used to infect Sf9 cells seeded in 35 mm plates. Four days later the supernatants from these culture plates were collected and then stored at 4 ° C.

Sf9 cells were cultured in Grace medium supplemented with 10% heat-inactivated FBS. The cells were infected with the recombinant baculovirus V-HDGNR10 at a multiplicity of infection (MOI) of 2. Six hours later the medium was removed and replaced with SF900 II medium minus methionine and cysteine (Life Technologies Inc., Gaithersburg). 42 hours later, 5 Ci of 35S-methionine and 5 Ci of 35S cysteine (Amersham) were added. The cells were further incubated for 16 hours before being collected by centrifugation and the labeled proteins were visualized by SDS-PAGE and autoradiography.

Example 4

Expression by Gene Therapy

Fibroblasts of a subject are obtained by skin biopsy. The resulting tissue is placed in tissue culture medium and separated into small pieces. Small parts of the tissue are placed on a wet surface of a tissue culture flask, approximately ten pieces are placed in each flask. The flask is turned around, closed tightly and left at room temperature overnight. After 24 hours at room temperature, the flask is inverted and the pieces of tissue remain fixed at the bottom of the flask and fresh medium is added (for example, Ham's F12 medium, with 10% FBS, penicillin and streptomycin). This is then incubated at 37 ° C for about a week. At this time, fresh media are added and subsequently changed every several days. After an additional two weeks in culture, a monolayer of fibroblasts emerges. The monolayer is trypsinized and enlarged to larger flasks.

pMV-7 (Kirschmeier, P. T. et al, DNA 7: 219-25 (1988)) flanked by long terminal repeats of Moloney murine sarcoma virus, digested with EcoRI and HindIII and subsequently treated with calf intestinal phosphatase. The linear vector is fractionated on agarose gel and purified, using glass beads.

The cDNA encoding a CCR5 polypeptide is amplified using PCR primers that correspond to the 5 ’and 3 ′ end sequences respectively. Primer 5 ’contains an EcoRI site and primer 3’ contains a HindIII site. Equal amounts of the Moloney murine sarcoma virus linear chain and the EcoRI and Hind III fragment are added together in the presence of T4 DNA ligase. The resulting mixture is maintained under appropriate conditions for ligation of the two fragments. The ligation mixture is used to transform HB101 bacteria, which are plated on agar plates containing kanamycin to confirm that the vector has the gene of interest properly inserted.

Amphotropic pA317 or GP + am12 packing cells are allowed to grow in tissue culture to a confluence density in Dulbecco's Modified Eagle (DMEM) medium with 10% calf serum (CS), penicillin and streptomycin. The MSV vector containing the ge is then added to the medium and the packaging cells are transduced with the vector. The packaging cells now produce infectious viral particles that contain the gene (the packaging cells are now called producing cells).

Fresh medium is added to the transduced producing cells and subsequently the medium is collected from a 10 cm plate of confluent producing cells. The depleted medium, which contains the infectious viral particles, is filtered through a membrane filter to remove the separate producing cells and this medium is then used to infect fibroblast cells. The medium of a fibroblast plate below the confluence is removed and quickly replaced with the medium of the producing cells. This medium is removed and replaced with fresh medium. If the virus titre is high, then virtually all fibroblasts will become infected and selection is not required. If the titration is very low, then it is necessary to use a retroviral vector that has a selectable marker, such as neo or his.

Genetically engineered fibroblasts are then injected into the host, alone or after they have been cultured until confluence in cytodex 3 microcarrier beads. Fibroblasts now produce the protein product.

Example 5

Isolation of the DNA Clone of the G-protein Chemokine Receptor (CCR5) from the Deposited Sample

The DNA for the G-protein Chemokine Receptor (CCR5) is inserted into the multiple cloning site of pQE-9 (Qiagen, Inc.). pQE-9 contains an Ampicillin resistance gene and can be transformed into E. coli strain DH10B, available from Life Technologies. (See, for example, Gruber, C. E., et al., Focus 15: 59- (1993).)

Two approaches can be used to isolate G-protein Chemokine Receptor (CCR5) from the deposited sample. First, the deposited clone is transformed into a suitable host (such as XL-1 Blue (Stratagene)) using techniques known to those skilled in the art, such as those provided by the vector supplier or in related publications or patents. The transformants are plated on 1.5% agar plates (containing the appropriate selection agent, for example ampicillin) to a density of approximately 150 transformants (colonies) per plate. A simple colony is then used to generate DNA using nucleic acid isolation techniques well known to those skilled in the art. (for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Edition, (1989), Cold Spring Harbor Laboratory Press.)

Alternatively, two 17-20 nucleotide primers derived from both ends of SEQ ID NO: 1 are synthesized

or SEQ ID NO: 21 (ie, within the region of SEQ ID NO: o SEQ ID NO: 21 limited by the NT 5 'and the NT 3' of the clone) and are used to amplify the Chemokine Receptor DNA of G protein (CCR5) using the plasmid DNA deposited as a template. The polymerase chain reaction is carried out under routine conditions, for example, in 25 µl of reaction mixture with 0.5 µg of the above DNA template. A convenient reaction mixture is 1.5-5 mM MgCl2, 0.01% (w / v) gelatin, dATP, dCTP, dGTP, 25 µM dTTP each, 25 pmol of each primer and 0.25 Taq Units polymerase Thirty-five PCR cycles are performed (denaturation at 94 degrees C for 1 minute; hybridization at 55 degrees C for 1 minute; elongation at 72 degrees C for 1 minute) with a Perkin-Elmer Cetus automatic thermal cycler. The amplified product is analyzed by agarose gel electrophoresis and the DNA band with the expected molecular weight is cleaved and purified. It is verified that the PCR product is the sequence selected by subcloning and sequencing the DNA product.

Several methods are available for the identification of the 5 ’or 3’ non-coding parts of the G protein Chemokine Receptor (CCR5) gene that may not be present in the deposited clone. These methods include, but are not limited to, filter assay, clone enrichment using specific probes and protocols similar or identical to the "RACE" 5 "and 3" protocols that are well known in the art. For example, a method similar to RACE 5 ’is available to generate the missing 5’ end of a desired full-length transcript. (Fromont-Racine et al., Nucleic Acids Res. 21 (7): 1683-1684 (1993).)

Briefly, a specific RNA oligonucleotide is ligated to the 5 ′ ends of a population of RNA that presumably contains full length gene RNA transcripts. A set of primers containing a specific primer for the bound RNA oligonucleotide and a specific primer for a known sequence of the G protein Chemokine Receptor gene (CCR5) of interest is used to PCR amplify the 5 'part of the gene from full length of the G-protein Chemokine Receptor (CCR5). This amplified product can then be sequenced and used to generate the full length gene.

This above method starts with total RNA isolated from the desired source, although poly-A + RNA can be used. The RNA preparation can then be treated with phosphatase if necessary to remove 5 ’phosphate groups in degraded or damaged RNA that may interfere with the subsequent RNA ligase stage. The phosphatase should then be inactivated and the RNA treated with tobacco acid pyrophosphatase to remove the protective structure present at the 5 ′ ends of messenger RNAs. This reaction leaves a 5 ′ phosphate group at the 5 ′ end of the cleaved coated RNA that can then be ligated with an RNA oligonucleotide using T4 RNA ligase.

This modified RNA preparation is used as a template for first strand cDNA synthesis using a gene specific oligonucleotide. The first chain synthesis reaction is used as a template for PCR amplification of the desired 5 ′ end using a specific primer for the bound RNA oligonucleotide and a specific primer for the known sequence of the gene of interest. The resulting product is then sequenced and analyzed to confirm that the 5 ’end sequence belongs to the G protein Chemokine Receptor (CCR5) gene.

Example 6

Isolation of Genomic Clones of the G-protein Chemokine Receptor (CCR5)

A library of human genomic P1 (Genomic Systems, Inc.) is screened by PCR using primers selected for the DNA sequence corresponding to SEQ ID NO: 1 or SEQ ID NO: 21, according to the method described in Example 5 ( See also, Sambrook.)

Example 7

Tissue Distribution of G-protein Chemokine Receptor Polypeptides (CCR5)

The tissue distribution of the G-protein Chemokine Receptor mRNA expression (CCR5) is determined using Northern blot analysis protocols, described by, among others, Sambrook et al. For example, a G-protein Chemokine Receptor (CCR5) probe produced by the method described in Example 5 is labeled with P32 using the rediprime ™ DNA labeling system (Amersham Life Science), according to the manufacturer's instructions . After labeling, the probe is purified using CHROMA SPIN100 ™ column (Clontech Laboratories, Inc.), according to the manufacturer's protocol number PT1200-1. The purified labeled probe is then used to examine various human tissues with respect to mRNA expression.

Multiple Tissue Northern blots (MTN) containing various human tissues (H) or human immune system (IM) tissues (Clontech) are examined with the labeled probe using ExpressHyb ™ hybridization solution (Clontech) according to the protocol of the Manufacturer number PT1190-1. After hybridization and washing, the transfer spots are mounted and exposed to film at -70 degrees C overnight and the films are developed according to conventional procedures.

Example 8

G-protein Chemokine Receptor Chromosomal Mapping

A set of oligonucleotide primers is designed according to the sequence at the 5 'end of SEQ ID NO: 1 or SEQ ID NO: 21. This primer preferably encompasses approximately 100 nucleotides. This set of primers is then used in a polymerase chain reaction under the following set of conditions: 30 seconds, 95 degrees C; 1 minute, 56 degrees C; 1 minute, 70 degrees C. This cycle is repeated 32 times followed by a 5 minute cycle at 70 degrees C. Human, mouse and hamster DNA is used as a template in addition to a panel of somatic cell hybrids containing individual chromosomes or chromosomal fragments (Bios, Inc). The reactions are analyzed in 8% polyacrylamide gels or 3.5% agarose gels. Chromosomal mapping is determined by the presence of a PCR fragment of approximately 100 bp in the particular somatic cell hybrid.

Example 9

Bacterial Expression of G-protein Chemokine Receptor

The G protein Chemokine Receptor polynucleotide (CCR5) encoding a G protein Chemokine Receptor polypeptide (CCR5) of the invention is amplified using PCR oligonucleotide primers corresponding to the 5 'and 3' ends of the sequence of DNA, as defined in Example 5, to synthesize insert fragments. The primers used to amplify the cDNA insert should preferably contain restriction sites, such as BamHI and XbaI at the 5 ′ end of the primers to clone the amplified product in the expression vector. For example, BamHI and XbaI correspond to the restriction enzyme sites of the bacterial expression vector pQE-9. (Qiagen, Inc., Chatsworth, CA). This plasmid vector encodes antibiotic resistance (Ampr), a bacterial origin of replication (ori), a promoter / operator adjustable by IPTG (P / O), a ribosome binding site (RBS), a 6-histidine marker ( 6-His) and restriction enzyme cloning sites.

The pQE-9 vector is digested with BamHI and XbaI and the amplified fragment is ligated into the pQE-9 vector while maintaining the reading phase initiated in the bacterial RBS. The ligation mixture is then used to transform E. coli strain M15 / rep4 (Qiagen, Inc.) containing multiple copies of plasmid pREP4, which expresses the lacI repressor and also confers resistance to kanamycin (Kanr). Transformants are identified by their ability to grow on LB plates and ampicillin / kanamycin resistant colonies are selected. Plasmid DNA is isolated and confirmed by restriction analysis.

Clones containing the desired constructs are grown overnight (O / N) in liquid culture in LB medium supplemented with Amp (100 µg / ml) and Kan (25 µg / ml). The O / N culture is used to inoculate a large culture at a ratio of 1: 100 to 1: 250. Cells are cultured to an optical density at 600 (D.O. 600) between 0.4 and 0.6. IPTG (Isopropyl-B-D-pyranoside thiogalate) is then added to a final concentration of 1 mM. IPTG induces by inactivation of the lacI repressor, eliminating the P / O which leads to an increase in gene expression.

The cells are cultured for an additional 3 to 4 hours. The cells are harvested by centrifugation (20 minutes at 6000 Xg). The cell pellet is solubilized in the chaotropic agent Guanidine HCl 6 Molar by stirring for 3-4 hours at 4 degrees C. The cell residue is removed by centrifugation and the supernatant containing the polypeptide is loaded on an acid affinity resin column. nickel-nitrile-triacetic ("Ni-NTA") (available from QIAGEN, Inc., mentioned above). Proteins with a 6 x His marker bind to the Ni-NTA resin with high affinity and can be purified in a single step procedure (for details see: The QIAexpressionist (1995) QIAGEN, Inc., mentioned above).

Briefly, the supernatant is loaded into the column in 6 M guanidine-HCl pH 8, the column is first washed with 10 volumes of 6 M guanidine HCl pH 8, then washed with 10 volumes of 6 M guanidine-HCl pH 6 and finally the polypeptide is eluted with guanidine-6 M HCl, pH 5.

The purified G-protein Chemokine Receptor protein (CCR5) is then renatured by dialysis against phosphate buffered saline (PBS) or 50 mM Na-acetate buffer pH 6 plus 200 mM NaCl. Alternatively, the G-protein Chemokine Receptor protein (CCR5) can be successfully folded back while being immobilized in the Ni-NTA column. The recommended conditions are as follows: renaturation using a linear gradient of 6 M-1 M urea in 500 mM NaCl, 20% glycerol, 20 mM Tris / HCl, pH 7.4, containing protease inhibitors. Renaturation should be performed for a period of 1.5 hours or more. After renaturation the proteins are eluted by the addition of 250 mM imidazole. The imidazole is removed by a final dialysis step against PBS or 50 mM sodium acetate buffer pH 6 plus 200 mM NaCl. The purified protein G Chemokine Receptor protein (CCR5) is stored at 4 ° C or frozen at -80 degrees C.

In addition to the above expression vector, the present invention additionally includes an expression vector comprising promoter and phage operator elements operably linked to a G protein Chemokine Receptor polynucleotide (CCR5), called pHE4a. (ATCC Accession Number 209645, deposited on February 25, 1998). This vector contains: 1) a neomycin phosphotransferase gene as a selection marker, 2) an E. coli origin of replication, 3) a T5 phage promoter sequence, 4) two lac operating sequences, 5) a Shine-Delgarno sequence and 6) the lactose operon repressor gene (lacIq). The origin of replication (oriC) derives from pUC19 (LTI, Gaithersburg, MD). The promoter sequence and the operating sequences are prepared synthetically.

DNA can be inserted into the pHEa by restricting the vector with NdeI and XbaI, BamHI, XhoI or Asp718, running the restricted product on a gel and isolating the larger fragment (the largest fragment should be approximately 310 base pairs). The DNA insert is generated according to the PCR protocol described in Example 5, using PCR primers that have restriction sites for NdeI (primer 5 ') and XbaI, BamHI, XhoI or Asp718 (primer 3'). The PCR insert is gel purified and restricted with compatible enzymes. The insert and the vector are linked according to conventional protocols.

The vector developed by genetic engineering could easily be substituted in the previous protocol to express protein in a bacterial system.

Example 10

Purification of the G-protein Chemokine Receptor Polypeptide (CCR5) from an inclusion body

The following alternative method can be used to purify G protein Chemokine Receptor polypeptide (CCR5) expressed in E. coli when present as inclusion bodies. Unless otherwise specified, all the following stages are performed at 4-10 degrees C.

After completion of the production phase of E. coli fermentation, the cell culture is cooled to 4-10 degrees C and the cells are harvested by continuous centrifugation at 15,000 rpm (Heraeus Sepatech). Based on the expected protein yield per unit weight of cell concentrate and the amount of purified protein required, an appropriate amount of cell concentrate, by weight, is suspended in a buffer solution containing 100 mM Tris, 50 mM EDTA, pH 7.4. The cells are dispersed to a homogeneous suspension using a high shear mixer.

The cells are then lysed by passing the solution through a microfluidizer (Microfuidics, Corp. or APV Gaulin, Inc.) twice at 4000-6000 psi (27.57-41.36 MPa). The homogenate is then mixed with NaCl solution to a final concentration of 0.5 M NaCl, followed by centrifugation at 7000 xg for 15 min. The resulting sediment is washed again using 0.5 M NaCl, 100 mM Tris, 50 mM EDTA, pH 7.4.

The resulting washed inclusion bodies are solubilized with 1.5 M guanidine hydrochloride (GuHCl) for 2-4 hours. After centrifugation 7000 xg for 15 minutes, the pellet is discarded and the supernatant-containing polypeptide is incubated at 4 degrees C overnight to allow additional GuHCl extraction.

After high speed centrifugation (30,000 xg) to remove insoluble particles, the GuHCl solubilized protein is refolded by rapid mixing of the GuHCl extract with 20 volumes of buffer containing 50 mM sodium, pH 4.5, NaCl 150 mM, 2 mM EDTA by vigorous stirring. The refolded diluted protein solution is maintained at 4 degrees C without mixing for 12 hours before the additional purification steps.

To clarify the refolded polypeptide solution, a previously prepared tangential filtration unit equipped with a 0.16 µM membrane filter with appropriate surface area (e.g., Filtron), equilibrated with 40 mM sodium acetate, pH 6 is employed. , 0. The filtered sample is loaded into a cation exchange resin (for example, Poros HS-50, Perseptive Biosystems). The column is washed with 40 mM sodium acetate, pH 6.0 and eluted with 250 mM, 500 mM, 1000 mM and 1500 mM NaCl in the same buffer, in a stepwise manner. The absorbance at 280 nm of the effluent is continuously monitored. Fractions are collected and further analyzed by SDS-PAGE.

Fractions containing the G protein Chemokine Receptor polypeptide (CCR5) are then pooled and mixed with 4 volumes of water. The diluted sample is then loaded into a previously prepared set of tandem columns of strong anion exchange (Poros HQ-50, Perseptive Biosystems) and weak anionic (Poros CM-20, Perseptive Biosystems) resins. The columns are equilibrated with 40 mM sodium acetate, pH 6.0. Both columns are washed with 40 mM sodium acetate, pH 6.0, 200 mM NaCl. The CM-20 column is then eluted using a linear gradient of column volume 10 which varies from 0.2 M NaCl, 50 mM sodium acetate, pH 6.0 to 1.0 M NaCl, 50 mM sodium acetate, pH 6, 5. Fractions are collected with constant A280 control of the effluent. Fractions containing the polypeptide (determined, for example, by 16% SDS-PAGE) are then grouped.

The resulting G protein Chemokine Receptor polypeptide (CCR5) should show more than 95% purity after the previous refolding and purification steps. Important bands of 16% SDS-PAGE gel contaminants stained with Commassie blue should not be observed when loading 5 µg of purified protein.

The purified protein G Chemokine Receptor protein (CCR5) can also be tested for endotoxin / LPS contamination and typically the LPS content is less than 0.1 ng / ml according to LAL assays.

Example 11

Cloning and Expression of the G-protein Chemokine Receptor (CCR5) in a Baculovirus Expression System

In this example, the plasmid shuttle vector pA2 is used to insert a polynucleotide of the G-protein Chemokine Receptor (CCR5) into a baculovirus to express the G-protein Chemokine Receptor. This expression vector contains the strong polyhedrin promoter of the virus. of Autographa californica nuclear polyhedrosis (AcMNPV) followed by convenient restriction site sites such as BamHI, Xba I and Asp718. The simian virus polyadenylation site 40 ("SV40") is used for effective polyadenylation. For the simple selection of recombinant viruses, the plasmid contains the E. coli beta galactosidase gene under the control of a weak Drosophila promoter in the same orientation, followed by the polyadenylation signal of the polyhedrin gene. The inserted genes are flanked on both sides by viral sequences for homologous recombination cell-mediated with wild-type viral DNA to generate a viable virus that expresses the cloned protein Chemokine Receptor polynucleotide (CCR5).

Many other baculovirus vectors can be used in place of the previous vector, such as pAc373, pVL941 and pAcIM1, as will be readily appreciated by one skilled in the art, provided that the construction provides localized signals appropriate for transcription, translation, secretion and the like, including a signal peptide and a phase AUG as required. Such vectors are described, for example, in Luckow et al., Virology 170: 31-39 (1989).

Specifically, the G-protein Chemokine Receptor cDNA sequence (CCR5) contained in the deposited clone, including the AUG initiation codon and any naturally associated leader sequence, is amplified using the PCR protocol described in Example 5. If the naturally occurring signal sequence is used to produce the secreted protein, the pA2 vector does not need a second signal peptide. Alternatively, the vector can be modified (pA2 GP) to include a baculovirus leader sequence, using the conventional methods described in Summers et al., "A Manual of Methods for Baculovirus Vectors and Insect Cell Culture Procedures," Texas Agricultural Experimental Station Bulletin No. 1555 (1987).

The amplified fragment is isolated from a 1% agarose gel using a commercially available kit ("Geneclean," BIO 101 Inc., La Jolla, Ca.). The fragment is then digested with appropriate restriction enzymes and purified again on a 1% agarose gel.

The plasmid is digested with the corresponding restriction enzymes and, optionally, can be dephosphorylated using calf intestinal phosphatase, using routine procedures known in the art. The DNA is isolated after a 1% agarose gel using a commercially available kit ("Geneclean" BIO 101 Inc., La Jolla, Ca.).

The fragment and the dephosphorylated plasmid are ligated together with T4 DNA ligase. E. coli HB101 or other suitable E. coli hosts such as XL-1 Blue cells (Stratagene Cloning Systems, La Jolla, CA) are transformed with the ligation mixture and spread on culture plates. The bacteria that contain the plasmid are identified by DNA digestion of individual colonies and by analyzing the gel electrophoresis digestion product. The sequence of the cloned fragment is confirmed by DNA sequencing.

Five µg of a plasmid containing the polynucleotide with 1.0 µg of a commercially available linearized baculovirus DNA ("BaculoGold ™ baculovirus DNA", Pharmingen, San Diego, CA) is co-transfected using the described lipofection method by Felgner et al., Proc. Natl Acad. Sci. USA 84: 7413-7417 (1987). One µg of BaculoGold ™ virus DNA and 5 µg of the plasmid are mixed in a sterile well of a microtiter plate containing 50 µl of serum-free Grace medium (Life Technologies Inc., Gaithersburg, MD). Then, 10 µl of Lipofectin plus 90 µl of Grace's medium are added, mixed and incubated for 15 minutes at room temperature. The drop transfection mixture is then added to Sf9 insect cells (ATCC CRL 1711) seeded in 35 mm tissue culture plates with 1 ml of serum-free Grace medium. The plate is then incubated for 5 hours at 27 degrees C. The transfection solution is removed after the plate and 1 ml of Grace insect medium supplemented with 10% fetal calf serum is added. The culture is then continued at 27 degrees C for four days.

After four days the supernatant is collected and a plaque assay is performed, as described in Summers and Smith, mentioned above. An agarose gel with "Blue Gal" (Life Technologies Inc., Gaithersburg) is used to allow easy identification and isolation of clones expressing gal, which produce blue-stained plates. (A detailed description of such a "plaque assay" can also be found in the user guide for insect cell culture and baculovirology distributed by Life Technologies Inc., Gaithersburg, pages 9-10). After appropriate incubation, the blue-stained plates were taken with the tip of a micropipette (for example, Eppendorf). The agar containing the recombinant viruses is then resuspended in a microcentrifuge tube containing 200 µl of Grace's medium and the suspension containing the recombinant baculovirus is used to infect Sf9 cells seeded in 35 mm plates. Four days later the supernatants of these culture plates are collected and then stored at 4 degrees C.

To verify the expression of the polypeptide, Sf9 cells are cultured in Grace medium supplemented with 10% heat-inactivated FBS. The cells are infected with the recombinant baculovirus containing the polynucleotide at a multiplicity of infection ("MOI") of approximately 2. If radiolabeled proteins are desired, 6 hours later the medium is removed and replaced with SF900 II medium without methionine or cysteine (available from Life Technologies Inc., Rockville, MD). After 42 hours, 5 µCi of 35S-methionine and 5 µCi 35S-cysteine (available from Amersham) are added. The cells are further incubated for 16 hours and then collected by centrifugation. Proteins in the supernatant as well as intracellular proteins are analyzed by SDSPAGE followed by autoradiography (if radiolabeled).

Microsequencing of the amino terminal sequence of the amino terminal end of the purified protein can be used to determine the amino terminal sequence of the G protein Chemokine Receptor protein (CCR5) produced.

Example 12

Expression of G-protein Chemokine Receptor (CCR5) in Mammalian Cells

The G-protein Chemokine Receptor polypeptide (CCR5) can be expressed in a mammalian cell. A typical mammalian expression vector contains a promoter element, which mediates the initiation of mRNA transcription, a protein coding sequence and signals required for termination of transcription and polyadenylation of the transcript. Additional elements include enhancers, Kozak sequences and intermediate sequences flanked by donor and acceptor sites for RNA splicing. Highly effective transcription is achieved with the SV40 early and late promoters, the long terminal repeats (LTR) of Retrovirus, for example, VSR, HTLVI, HIVI and the cytomegalovirus early promoter (CMV). However, cellular elements can also be used (for example the human actin promoter).

Expression vectors suitable for use in the practice of the present invention include, for example, vectors such as pSVL and pMSG (Pharmacia, Uppsala, Sweden), pRSVcat (ATCC 37152), pSV2DHFR (ATCC 37146), pBC12MI (ATCC 67109 ), pCMVSport 2.0 and pCMVSport 3.0. Mammalian host cells that could be used include human Hela, 293, H9 and Jurkat cells, mouse NIH3T3 and C127 cells, Cos 1, Cos 7 and CV1, quail QC1-3 cells, mouse L cells and ovarian cells Chinese hamster (CHO).

Alternatively, the G protein Chemokine Receptor (CCR5) polypeptide can be expressed in stable cell lines that contain the G protein Chemokine Receptor polynucleotide (CCR5) integrated into a chromosome. Co-transfection with a selectable marker such as DHFR, gpt, neomycin, hygromycin allows the identification and isolation of transfected cells.

The transfected G protein Chemokine Receptor (CCR5) gene can also be amplified to express large amounts of the encoded protein. The DHFR marker (dihydrofolate reductase) is useful in the development of cell lines carrying several hundred or even several thousand copies of the gene of interest (see, for example, Alt, FW, et al., J. Biol. Chem. 253: 1357-1370 (1978); Hamlin, JL and Ma, C., Biochem. Et Biophys. Acta, 1097: 107143 (1990); Page, MJ and Sydenham, MA, Biotechnology 9: 64-68 (1991)) . Another useful selection marker is the enzyme glutamine synthase (GS) (Murphy et al., Biochem J. 227: 277-279 (1991); Bebbington et al., Bio / Technology

10: 169-175 (1992)). Using these markers, mammalian cells are cultured in selective medium and cells with the highest resistance are selected. These cell lines contain the amplified gene or genes integrated into a chromosome. Chinese hamster ovary (CHO) and NSO cells are often used for protein production.

Plasmid derivatives pSV2-DHFR (ATCC Accession No. 37146), pC4 expression vectors (ATCC Accession No. 209646) and pC6 (ATCC Accession No. 209647) contain the strong promoter (LTR) of Sarcoma Virus de Rous (Cullen et al., Molecular and Cellular Biology, 438-447 (March, 1985)) plus a CMV enhancer fragment (Boshart et al., Cell 41: 521-530 (1985)). Multiple cloning sites, for example, with the restriction enzyme cleavage sites BamHI, XbaI and Asp718, facilitate cloning of the G-protein Chemokine Receptor. Vectors also contain the 3 'intron, the polyadenylation and termination signal. of the rat preproinsulin gene and the mouse DHFR gene under the control of the SV40 early promoter.

Specifically, plasmid pC6 or pC4 is digested with restriction enzymes that cut into the multiple cloning site and then dephosphorylated using calf intestinal phosphates or procedures known in the art. The vector is isolated after a 1% agarose gel.

The vector can be modified to include a heterologous signal sequence in an attempt to secrete the protein from the cells (see, for example, WO 96/34891).

The amplified fragment is then digested with restriction enzymes that generate ends complementary to those of the digested vector and purified on a 1% agarose gel using a commercially available kit ("Geneclean," BIO 101 Inc., La Jolla, Ca .). The isolated fragment and the dephosphorylated vector are then ligated with T4 DNA ligase. HB101 or XL-1 Blue cells from E. coli are then transformed and bacteria containing the fragment inserted into plasmid pC6 or pC4 are identified using, for example, restriction enzyme analysis.

Chinese hamster ovary cells that lack an active DHFR gene are used for transfection. Five µg of the expression plasmid pC6 or pC4 is co-transfected with 0.5 µg of the plasmid pSVneo using lipofectin (Felgner et al., Mentioned above). Plasmid pSV2-neo contains a dominant selectable marker, the Tn5 neo gene that encodes an enzyme that confers resistance to a group of antibiotics including G418. Cells are seeded in MEM minus alpha supplemented with 1 mg / ml G418. After 2 days, the cells are trypsinized and seeded in hybridoma cloning plates (Greiner, Germany) in MEM minus alpha supplemented with 10, 25 or 50 ng / ml methotrexate plus G418 1 mg / ml. After about 10-14 days, simple clones are trypsinized and then seeded in 6-well petri dishes or 10 ml flasks using different concentrations of methotrexate (50 nM, 100 nM, 200 nM, 400 nM, 800 nM). Clones that grow at higher concentrations of methotrexate are then transferred to new 6-well plates containing even higher concentrations of methotrexate (1 M, 2 M, 5 M, 10 mM, 20 mM). The same procedure is repeated until clones growing at a concentration of 100-200 µM are obtained. Expression of the G-protein Chemokine Receptor (CCR5) is analyzed, for example, by SDS-PAGE and Western blotting or by reverse phase HPLC analysis.

Example 13

Construction of Mutants with Deletion N Terminal and / or C Terminal

The following general approach can be used to clone a mutant with deletion of the G-protein Chemokine Receptor (CCR5) of N-terminal or C-terminal deletion. Generally, two oligonucleotide primers of approximately 15-25 nucleotides derive from the desired 5 ′ and 3 ′ positions of a polynucleotide of SEQ ID NO: 1

or of the deposited clone (SEQ ID NO: 21). The 5 'and 3' positions of the primers are determined based on the desired G-protein Chemokine Receptor polynucleotide fragment (CCR5). A start and end codon is added to primers 5 ’and 3’ respectively, if necessary, to express the G-protein Chemokine Receptor (CCR5) polypeptide fragment encoded by the polynucleotide fragment. Preferred polynucleotide fragments of the G-protein Chemokine Receptor (CCR5) are those encoding the N-terminal and C-terminal deletion mutants described above in the "Polynucleotide and Polypeptide Fragments" section of the specification.

Additional nucleotides containing restriction sites can also be added to facilitate cloning of the G-protein Chemokine Receptor polynucleotide fragment (CCR5) into a desired vector to the 5 'and 3' primer sequences. The polynucleotide fragment of the G-protein Chemokine Receptor (CCR5) is amplified from genomic DNA or from the cDNA clone deposited using the appropriate oligonucleotide PCR primers and the conditions discussed herein or known in the art. The G-protein Chemokine Receptor (CCR5) polypeptide fragments encoded by the G-protein Chemokine Receptor polynucleotide fragments (CCR5) can be expressed and purified in the same general manner as full-length polypeptides, although routine modifications may be necessary. due to differences in chemical and physical properties between a particular fragment and a full length polypeptide.

As a means to exemplify but not limit the present invention, the polynucleotide encoding the G-protein Chemokine Receptor polypeptide fragment (CCR5) Y-37 to Q-280 is amplified and cloned as follows: a 5 'primer is generated comprising a restriction enzyme site followed by a phase initiation codon with the polynucleotide sequence encoding the N-terminal part of the polypeptide fragment that begins with Y

37. A complementary 3 'primer is generated comprising a restriction enzyme site followed by a phase termination codon with the polynucleotide sequence encoding the C-terminal part of the G protein Chemokine Receptor polypeptide fragment (CCR5) that terminates in Q-280.

The amplified polynucleotide fragment and the expression vector are digested with restriction enzymes that recognize the sites in the primers. The digested polynucleotides are then linked together. The polynucleotide fragment of the G-protein Chemokine Receptor (CCR5) is inserted into the restricted expression vector, preferably in a manner that places the coding region of the G-protein Chemokine Receptor (CCR5) polypeptide fragment downstream of the promoter. The ligation mixture is transformed into competent E. coli cells using conventional procedures and as described in the Examples herein. Plasmid DNA from resistant colonies is isolated and the identity of the cloned DNA is confirmed by restriction analysis, PCR and DNA sequencing.

Example 14

Protein Fusions of the G-protein Chemokine Receptor

The G-protein Chemokine Receptor polypeptides (CCR5) are preferably fused with other proteins.

These fusion proteins can be used for a variety of applications. For example, fusion of the G protein Chemokine Receptor (CCR5) polypeptides with His marker, HA marker, protein A, IgG domains and maltose binding protein facilitate purification. (See Example 9; see also EP A 394,827; Traunecker, et al., Nature 331: 84-86 (1988)). Similarly, fusion with IgG-1, IgG-3 5 and albumin increases the half-life in vivo. Nuclear localization signals fused with G-protein Chemokine Receptor (CCR5) polypeptides can direct the protein to a specific subcellular location, while covalent heterodimers or homodimers can increase or reduce the activity of a fusion protein. Fusion proteins can also create chimeric molecules that have more than one function. Finally, fusion proteins can increase the solubility and / or stability of the fusion protein in

10 comparison with the unbound protein. All types of fusion proteins described above can be prepared by modifying the following protocol, which describes the fusion of a polypeptide with an IgG molecule, or the protocol described in Example 9.

Briefly, the human Fc part of the IgG molecule can be amplified by PCR, using primers that span the 5 ’and 3’ ends of the sequence described below. These primers should also have sites of

Convenient restriction enzyme that will facilitate cloning into an expression vector, preferably a mammalian expression vector.

For example, if pC4 (Accession No. 209646) is used, the human Fc part can be ligated into the BamHI cloning site. Note that the BamHI 3 ’site should be destroyed. Next, the vector containing the human Fc part is restricted with BamHI, linearizing the vector, and the G protein Chemokine Receptor polynucleotide.

20 (CCR5), isolated by the PCR protocol described in Example 5, is ligated into this BamHI site. Note that the polynucleotide is cloned without a termination codon, otherwise a fusion protein would not be produced.

If the naturally occurring signal sequence is used to produce the secreted protein, pC4 does not require a second signal peptide. Alternatively, if the naturally occurring signal sequence is not used, the vector can be modified to include a heterologous signal sequence (See, for example, WO 96/34891).

25 Fc region of human IgG:

image 1

Example 15

Production of an Antibody

Hybridoma Technology

The antibodies of the present invention can be prepared by a variety of methods (See, Current Protocols, Chapter 2). As an example of such methods, cells expressing G-protein Chemokine Receptor (CCR5) are administered to an animal to induce the production of sera containing polyclonal antibodies. In a preferred method, a protein preparation of the G-Chemokine Receptor protein (CCR5) is prepared and purified to make it substantially free of natural contaminants. This preparation is

35 then introduced into an animal to produce polyclonal antisera of greater specific activity.

Monoclonal antibodies specific for G-Chemokine Receptor protein (CCR5) are prepared using hybridoma technology (Kohler et al., Nature 256: 495 (1975); Kohler et al., Eur. J. Immunol. 6: 511 ( 1976); Kohler et al., Eur. J. Immunol. 6: 292 (1976); Hammerling et al., In: Monoclonal Antibodies and T-Cell Hybridomas, Elsevier, NY, pp. 563-681 (1981)). In general, an animal (preferably a mouse) is immunized with G-protein Chemokine Receptor polypeptide (CCR5) or, more preferably, with a cell expressing secreted G-protein Chemokine Receptor (CCR5) polypeptide. Such polypeptide-expressing cells are cultured in any suitable tissue culture medium, preferably in Earle-modified Eagle medium supplemented with 10% fetal bovine serum (inactivated at approximately 56 ° C) and supplemented with nonessential amino acids approximately 10 g / l, penicillin approximately 1,000 U / ml and streptomycin approximately 100 /g / ml.

Splenocytes from such mice are extracted and fused with a suitable myeloma cell line. Any suitable myeloma cell line can be used in accordance with the present invention; however, it is preferable to use in the parental myeloma cell line (SP20), available from the ATCC. After fusion, the resulting hybridoma cells are selectively maintained in HAT medium and then cloned by limiting dilution as described in Wands et al. (Gastroenterology 80: 225-232 (1981)). The hybridoma cells obtained through such a selection are then tested for clones that secrete antibodies capable of binding to the G-protein Chemokine Receptor polypeptide (CCR5).

Alternatively, additional antibodies capable of binding to the G-protein Chemokine Receptor (CCR5) polypeptide can be produced in a two-stage procedure using anti-idiotypic antibodies. Such a method makes use of the fact that the antibodies are themselves antigens and, therefore, it is possible to obtain an antibody that binds to a secondary antibody. According to this method, protein specific antibodies are used to immunize an animal, preferably a mouse. Splenocytes of such an animal are then used to produce hybridoma cells and hybridoma cells are screened to identify clones that produce an antibody whose ability to bind to the specific protein antibody of the G protein Chemokine Receptor (CCR5) can be blocked by Protein Chemokine Receptor G. Such antibodies comprise anti-idiotypic antibodies to the protein specific Chemokine Receptor protein antibody (CCR5) and are used to immunize an animal to induce formation of protein specific antibodies to the Chemokine Receptor. additional G protein (CCR5).

For in vivo use of antibodies in humans, an antibody is "humanized." Such antibodies can be produced using genetic constructs derived from hybridoma cells that produce the monoclonal antibodies described above. Methods for producing humanized and chimeric antibodies are known in the art and are discussed herein. (See, for review, Morrison, Science 229: 1202 (1985); Oi et al., BioTechniques 4: 214 (1986); Cabilly et al., U.S. Patent No. 4,816,567; Taniguchi et al., EP document 171496; Morrison et al., EP 173494; Neuberger et al., WO 8601533; Robinson et al., WO 8702671; Boulianne et al., Nature 312: 643 (1984); Neuberger et al., Nature 314: 268 (1985).

Isolation of Antibody Fragments Targeted Against G-protein Chemokine Receptor (CCR5) from an scFv Library

Naturally occurring V genes isolated from human PBL are constructed in a library of antibody fragments containing reactivities against the G-protein Chemokine Receptor (CCR5) to which the donor may or may not have been exposed (see, for example, US Pat. United States 5,885,793 incorporated herein by reference in its entirety).

Rescue of the Library. A scFv library is constructed from human PBL RNA as described in PCT publication WO 92/01047. To rescue phages that exhibit antibody fragments, 109 are used

E. coli carrying the phagemid to inoculate 50 ml of 2xTY containing 1% glucose and 100 µg / ml ampicillin (2xTYAMP-GLU) and grown in a D.O. of 0.8 with stirring. Five ml of this culture are used to inoculate 50 ml of 2xTY-AMP-GLU, 2 x 108 TU of auxiliary delta 3 gene (delta gene M13 III, see PCT publication WO 92/01047) are added and the culture is incubated at 37 ° C for 45 minutes without stirring and then at 37 ° C for 45 minutes with stirring. The culture is centrifuged at 4000 r.p.m. for 10 minutes and the sediment is resuspended in 2 liters of 2xTY containing 100 µg / ml ampicillin and 50 µg / ml kanamycin and allowed to grow overnight. Phages are prepared as described in PCT publication WO 92/01047.

The M13 III delta gel is prepared as follows: the auxiliary phage of the M13 III delta gene does not encode gene III protein, so the phage (or phagemid) that has antibody fragments has a greater avidity for antigen binding. Infectious M13 III delta gene particles are prepared by culturing the auxiliary phage in cells that carry a pUC19 derivative that provides wild-type gene III protein during phage morphogenesis. The culture is incubated for 1 hour at 37 ° C without shaking and then for an additional 1 hour at 37 ° C with shaking. The cells are centrifuged (IEC-Centra 8,400 rpm for 10 minutes), resuspended in 300 ml of 2xTY culture containing 100 g of ampicillin / ml and 25 g of kanamycin / ml (2xTY-AMP-KAN) and left grow overnight, stirring at 37 ° C. The phage particles are purified and concentrated from the culture medium by two precipitations with PEG (Sambrook et al., 1990), resuspended in 2 ml of PBS and passed through a 0.45 µm filter (NML minisart; Sartorius) to provide a final concentration of approximately 1013 transduction units / ml (ampicillin resistant clones).

Library Selection. Immunotubes (Nunc) are coated overnight in PBS with 4 ml of a 100 µg / ml or 10 µg / ml polypeptide of the present invention. Tubes are blocked with 2% Marvel-PBS for 2 hours at 37 ° C and then washed 3 times in PBS. Approximately 1013 TU of the phage are applied to the tube and incubated for 30 minutes at room temperature by turning on a lower and upper turntable and then allowed to remain for another 1.5 hours. The tubes are washed 10 times with PBS 0.1% Tween-20 and 10 times with PBS. The phage is eluted by adding 1 ml of 100 mM triethylamine and rotating 15 minutes on a lower and upper rotary plate after which the solution is immediately neutralized with 0.5 ml of 1.0 M Tris-HCl, pH 7 ,4. Phages are then used to infect 10 ml of semi-logarithmic TG1 E. coli by incubating phage eluted with bacteria for 30 minutes at 37 ° C. E. coli are then seeded in TYE plates containing 1% glucose and 100 µg / ml ampicillin. The resulting bacterial library is then rescued with delta 3 helper phage as described above to prepare phages for a subsequent selection cycle. This procedure is then repeated until a total of 4 affinity purification cycles with tube washing increased to 20 times with PBS, 0.1% Tween-20 and 20 times with PBS for cycles 3 and 4.

Characterization of Union Agents. The eluted phage of the 3rd and 4th selection cycles is used to infect E. coli HB 2151 and soluble scFv (Marks, et al., 1991) is produced from single colonies for assay. ELISAs are performed with microtiter plates coated with polypeptide of the present invention 10 pg / ml in 50 mM bicarbonate pH 9.6. Positive ELISA clones are further characterized by genetic identification by PCR (see, for example, PCT publication WO 92/01047) and then by sequencing. These positive ELISA clones can be further characterized by techniques known in the art, such as, for example, epitope mapping, binding affinity, receptor signal transduction, ability to competitively block or inhibit antibody / antigen binding and agonist activity. or competitive antagonist.

Example 16

Production of G-protein Chemokine Receptor Ligand or Protein (CCR5) for High Performance Screening Assays

The following protocol contains a supernatant containing a G-protein Chemokine Receptor polypeptide (CCR5) or a G-protein Chemokine Receptor ligand (CCR5) to be tested. Ligands of the G-protein Chemokine Receptor (CCR5) include MIP-1, MIP-1, MCP-1, MCP-2, MCP-3, MCP-4, Eotaxin, RANTES and HIV. This supernatant can then be used in the screening assays described in Examples 18-25.

First, dilute poly-D-Lysine stock solution (644 587 Boehringer-Mannheim) (1mg / ml in PBS) 1:20 in PBS (without calcium or magnesium 17-516F Biowhittaker) for a working solution of 50 /g / ml. Add 200 µl of this solution to each well (24-well plates) and incubate at room temperature for 20 minutes. Be sure to distribute the solution over each well (note: a 12-channel pipettor with tips every two channels can be used). Remove the poly-D-Lysine solution by aspiration and rinse with 1 ml of PBS (Phosphate Buffered Saline). The PBS should remain in the well until just before sowing the cells in plates and the plates should be coated with polylysine beforehand for two weeks.

Sow 293T cells in plates (do not bring cells beyond P + 20) to 2 x 105 cells / well in 0.5 ml DMEM (Dulbecco Modified Eagle Medium) (with glucose 4.5 G / L and L -glutamine (12-604F Biowhittaker)) / Heat-inactivated FBS 10% (14-503F Biowhittaker) / 1x Penstrep (17-602E Biowhittaker). Let the cells grow overnight.

The next day, mix together in a sterile solution cuvette: 300 µl of Lipofectamine (18324-012 Gibco / BRL) and 5ml of Optimen I (31985070 Gibco / BRL) / 96-well plate. Using a small volume multichannel pipettor, distribute approximately 2 g of an expression vector containing a polynucleotide insert, produced by the methods described in Examples 8-10, on a round shape 96-well bottom plate appropriate. With a multichannel pipettor, add 50 µl of the Lipofectamine / Optimen I mixture to each well. Pipette up and down gently to mix. Incubate at room temperature for 15-45 minutes. After approximately 20 minutes use a multichannel pipettor to add 150 µl of Optimen I to each well. As a control, a vector DNA plate without an insert should be transfected with each set of transfections.

Preferably, the transfection should be done by distributing the different tasks as a team. Distributed as a team, the work time is divided in half and the cells do not spend too much time in PBS. First, person A sucks the medium out of four 24-well plates of cells by aspiration and then person B clears each well with 0.5-1 ml of PBS. Person A then sucks the PBS rinse by aspiration and person B using a 12-channel pipettor with tips every two channels, adds the 200 µl of DNA / Lipofectamine / Optimen I complex to the odd wells first, then to the wells pairs, to each row of 24-well plates. Incubate at 37 ° C for 6 hours.

While the cells are being incubated, prepare appropriate medium, 1% BSA in DMEM with 1 x or 1 HGS CHO-5 medium (CaCl 2116.6 mg / l (anhydrous); CuSO4-5H2O 0.00130 mg / l; Fe (NO3 ) 3-9H2O 0.050 mg / l; FeSO4-7H2O 0.417 mg / l; Kcl 311.80 mg / l; MgCl2 28.64 mg /; MgSO4 48.84 mg / l; NaCl 6995.50 mg / l; NaHCO3 2400 , 0 mg / l; NaH2PO4-H2O 62.50 mg / l; Na2HPO4 71.02 mg / l; ZnSO4-7H2O 0.4320 mg / l; Arachidonic acid 0.002 mg / l; Cholesterol 1.022 mg / l; DL-alpha -Tocoferol-Acetate 0.070 mg / l; Linoleic Acid 0.0520 mg / l; Linolenic Acid 0.010 mg / l; Myristic Acid 0.010mg / l; Oleic Acid 0.010 mg / l; Palmic Acid 0.010 mg / l; Palmite Acid 0.010 mg / l; Pluronic F-68 100 mg / l; Stearic Acid 0.010 mg / l; Tween 80 2.20 mg / l; D-Glucose 4551 mg / l; L-Alanine 130.85 mg / ml; L-Arginine- HCl 147.50 mg / ml; L-Asparagine-H2O 7.50 mg / ml; L-Aspartic Acid 6.65 mg / ml; L-Cysteine-2HCL-H2O 29.56 mg / ml; L-Cystine2HCL 31, 29 mg / ml; L-Glutamic Acid 7.35 mg / ml; L-Glutamine 365.0 mg / ml; Glycine 18.75 mg / ml; L-Histidine-HCLH2O 52.48 mg / ml; L-Isoleucine 106.97 mg / ml; L-Leucine 111.45 mg / ml; L-Lysine HCl 163.75 mg / ml; L-Methionine 32.34 mg / ml; L-Phenylalanine 68.48 mg / ml; L-Proline 40.0 mg / ml; L-Serine 26.25 mg / ml; L-Threonine 101.05 mg / ml; L-Tryptophan 19.22 mg / ml; L-Tyrosine-2Na-2H2O 91.79 mg / ml and L-Valine 99.65 mg / ml; Biotin 0.0035 mg / l; D-CaPantotenate 3.24 mg / l; Choline Chloride 11.78 mg / l; Folic Acid 4.65 mg / l; i-Inositol 15.60 mg / l; Niacinamide 3.02 mg / l; Pyridoxal HCL 3.40 mg / l; Pyridoxine HCl 0.031 mg / l; Riboflavin 0.319 mg / l; Thiamine HCl 3.17 mg / l; Thymidine 0.365 mg / l; Vitamin B12 0.680 mg / l; 25 mM HEPES buffer; Na Hypoxanthine 2.39 mg / l; Lipoic Acid 0.105 mg / l; Putrescine Sodium-2HCl 0.081 mg / l; Sodium Pyruvate 55.0 mg / l; Sodium Selenite 0.0067 mg / l; 20 laM ethanolamine; Ferric Citrate 0.122 mg / l; Methyl-B-Cyclodextrin in complex with Linoleic Acid 41.70 mg / l; Methyl-B-Cyclodextrin complexed with Oleic Acid 33.33 mg / l; Methyl-B-Cyclodextrin in complex with Retinal Acetate 10 mg / l. Adjust the osmolarity to 327 mOsm) with 2 mm glutamine and 1x penstrep (BSA (81-068-3 Bayer) 100gm dissolved in 1 l of DMEM for a 10% BSA stock solution). Filter the media and collect 50 µl for endotoxin assay in 15 ml of conical polystyrene.

The transfection reaction is stopped, preferably by teamwork, at the end of the incubation period. Person A removes the transfection medium by aspiration while person B adds 1.5 ml of appropriate medium to each well. Incubate at 37 degrees C for 42 or 72 hours depending on the medium used: 1% BSA for 45 hours or CHO-5 for 72 hours.

On day four, using a 300 l multichannel pipettor, distribute 600 all in aliquots in a 1 ml deep well plate and the remaining supernatant in a 2 ml deep well. Supernatants from each well can then be used in the tests described in Examples 18-25.

It is specifically understood that when activity is obtained in any of the assays described below using a supernatant, the activity originates from the G-protein Chemokine Receptor polypeptide (CCR5) directly (eg, as a secreted, soluble or membrane-associated protein ) or of the G-protein Chemokine Receptor ligand (CCR5) directly or by inducing the G-protein Chemokine Receptor ligand (CCR5) expression of other proteins, which are then secreted into the supernatant. Therefore, the invention further provides a method for identifying the protein in the supernatant characterized by an activity in a particular assay.

Example 17

GAS Informative Construction Construction

A signal transduction pathway involved in cell differentiation and proliferation is called the Jaks-STAT route. The proteins activated in the Jaks-STAT pathway bind to "GAS" elements of gamma activation sites or interferon-sensitive response elements ("ISRE"), located in the promoter of many genes. The binding of a protein to these elements alters the expression of the associated gene.

The GAS and ISRE elements are recognized by a class of transcription factors called signal transducers and transcription activators or "STAT". There are six members of the STAT family. Stat1 and Stat3 are present in many cell types, as is Stat2 (since the response to IFN-alpha is widespread). Stat4 is more restricted and is not in many cell types although it has been found in helper T cells of class I after treatment with IL-12. Stat5 was originally called breast growth factor, but it has been found in higher concentrations in other cells including myeloid cells. It can be activated in tissue culture cells by many cytokines.

STATs are activated to translocate from the cytoplasm to the nucleus after tyrosine phosphorylation by a set of kinases known as the Janus kinase family ("Jaks"). Jaks represents a particular family of soluble tyrosine kinase and includes Tyk2, Jak1 Jak2 and Jak3. These kinases have a significant sequence similarity and are generally catalytically inactive in resting cells.

Jaks are activated by a wide range of receptors summarized in Table 3 below. (Adapted from the review by Schidler and Darnell, Ann. Rev. Biochem. 64: 621-51 (1995)). A family of the cytokine receptor, capable of activating Jaks, is divided into two groups: (a) Class 1 includes receptors for IL-2, IL-3, IL-4, IL-6, IL-7, IL-9 , IL-11, IL-12, IL-15, Epo, PRL, GH, G-CSF, GM-CSF, LIF, CNTF and thrombopoietin; and (b) Class 2 includes IFN-a, IFN-g and IL-10. Class 1 receptors share a conserved cysteine motif (a set of four conserved cysteines and a tryptophan) and a WSXWS motif (a proximal membrane region encoding Trp-Ser-Xxx-Trp-Ser (SEQ ID NO: 11) ).

Thus, by binding a ligand to a receptor, Jaks are activated, which in turn activate STAT, which are then translocated and linked to GAS elements. This complete procedure is covered in the Jaks-STAT signal transduction path.

Therefore, activation of the Jaks-STAT pathway, reflected by the union of the GAS element or the ISRE, can be used to indicate proteins involved in cell proliferation and differentiation. For example, it is known that growth factors and cytokines activate the Jaks-STAT route (See Table 3 below). Therefore, by using GAS elements attached to reporter molecules, activators of the Jaks-STAT pathway can be identified.

Table 3

JAK STATS GAS (elements) or ISRE

Flirting tyk2 Jak1 Jak2 Jak3

IFN Family IFN-a / B + + --1, 2, 3 ISRE IFN-g + + -1 GAS (IRF1> Lys6> IFP) Il-10 +? ? -1.3

GP130 family

IL-6 (Pleiotropic) + + +? 1.3 GAS (IRF1> Lys6> IFP)

Il-11 (Pleiotropic)? +? ? 1.3

OnM (Pleiotropic)? + +? 1.3

LIF (Pleiotropic)? + +? 1.3

CNTF (Pleiotropic) / + - + +? G-CSF (Pleiotropic)? +? ? 1.3 IL-12 (Pleiotropic) + - + + 1.3 Family g-C IL-2 (lymphocytes) - + - + 1,3,5 GAS

JAK STATS GAS (elements) or ISRE Ligando tyk2 Jak1 Jak2 Jak3

IL-4 (lympho / myeloid) - + - + 6 GAS (IRF1 = IFP >> Ly6) (IgH) IL-7 (lymphocytes) - + - + 5 GAS IL-9 (lymphocytes) - + - + 5 GAS IL -13 (lymphocyte) - +? ? 6 GAS IL-15? +? + 5 GAS 140 gp family

IL-3 (myeloid) - + -5 GAS (IRF1> IFP >> Ly6) IL-5 (myeloid) - + -5 GAS GM-CSF (myeloid) - + -5 GAS

Growth hormone family

GH? - + -5 PRL? + / - + -1,3,5 EPO? - + -5 GAS (B-CAS> IRF1 = IFP >> Ly6) EGF Receptor Tyrosine Kinases? + + -1.3 GAS (IRF1) PDGF? + + -1.3 CSF-1? + + -1.3 GAS (not IRF1)

To construct a synthetic GAS containing promoter element, which is used in the biological assay described in Examples 18-19, a PCR-based strategy is employed to generate a promoter sequence of GAS-SV40. The 5 'primer contains 4 four tandem copies of the GAS binding site found in the IRF1 promoter and which has previously been shown to bind to STAT after induction with a series of cytokines (Rothman et al., Immunity 1: 457-468 (1994), although other GAS or ISRE elements may be used instead The 5 'primer also contains 18 bp of sequence complementary to the SV40 early promoter sequence and is flanked with an Xhol site. ' is:

image 1

The downstream primer is complementary to the SV40 promoter and is flanked with a Hind III: 10 5 ’site: GCGGCAAGCTTTTTGCAAAGCCTAGGC: 3’ (SEQ ID NO: 13)

PCR amplification is performed using the SV40 promoter template present in the B-gal plasmid: promoter obtained from Clontech. The resulting PCR fragment is digested with XhoI / Hind III and subcloned into BLSK2 (Stratagene). Sequence with direct and reverse primers confirms that the insert contains the following sequence:

image 1

With this GAS promoter element linked to the SV40 promoter, a GAS reporter construction: SEAP2 is then obtained by genetic engineering. Here, the reporter molecule is a secreted alkaline phosphatase or "SEAP". Clearly, however, any reporter molecule can be used in place of SEAP, in this or in any of the other examples. Well-known reporter molecules that can be used in place of SEAP include chloramphenicol acetyltransferase (CAT), luciferase, alkaline phosphatase, B-galactosidase, green fluorescent protein (GFP) or any protein detectable by an antibody.

The confirmed synthetic GAS-SV40 promoter element of the above sequence is subcloned into the pSEAP-Promoter vector obtained from Clontech using HindIII and XhoI, effectively replacing the SV40 promoter with the amplified GAS promoter element: SV40, to create the GAS-SEAP vector. However, this vector does not contain a neomycin resistance gene and therefore is not preferred for mammalian expression systems.

Therefore, to generate stable mammalian cell lines expressing the GAS-SEAP reporter, the GAS-SEAP cassette is removed from the GAS-SEAP vector using SalI and NotI, and inserted into a main chain vector containing the gene of Neomycin resistance, such as pGFP-1 (Clontech), using these restriction sites at the multiple cloning site, to create the GAS-SEAP / Neo vector. Once this vector is transfected into mammalian cells, this vector can then be used as a reporter molecule for GAS binding as described in Examples 18-19.

Other constructs can be prepared using the above description and replacing GAS with a different promoter sequence. For example, the construction of reporter molecules containing the NFK-B and EGR promoter sequences is described in Examples 20 and 21. However, many other promoters can be substituted using the protocols described in these Examples. For example, the SRE, IL-2, NFAT or Osteocalcin promoters can be substituted, alone or in combination (eg, GAS / NF-KB / EGR, GAS / NF-KB, Il-2 / NFAT or NFKB / GAS). Similarly, other cell lines can be used to test reporter building activity, such as HELA (epithelial), HUVEC (endothelial), Reh (B lymphocytes), Saos-2 (osteoblast), HUVAC (aortic) or Cardiomyocytes.

Example 18

High Performance Exploration Test for T Lymphocyte Activity.

The following protocol is used to evaluate T lymphocyte activity by identifying factors and determining whether the supernatant containing a polypeptide or a ligand thereof proliferates and / or differentiates T lymphocytes. T lymphocyte activity is evaluated using the construct. GAS / SEAP / Neo produced in the Example

17. Therefore, factors that increase SEAP activity indicate the ability to activate the Jaks-STAT signal transduction path. The T lymphocytes used in this assay are Jurkat T lymphocytes (ATCC Accession No. TIB-152), although Molt-3 cells (ATCC Accession No. CRL-1552) and Molt-4 cells (Accession No. ATCC CRL-1582).

Jurkat T lymphocytes are CD4 + lymphoblast helper Th1 lymphocytes. To generate stable cell lines, approximately 2 million Jurkat cells are transfected with the GAS-SEAP / neo vector using DMRIE-C (Life Technologies) (transfection procedure described below). Transfected cells are seeded at a density of approximately 20,000 cells per well and 1 mg / ml denticin resistant transfectants are selected. Resistant colonies expand and are then tested for their response to increasing concentrations of interferon gamma. The dose response of a selected clone is demonstrated.

Specifically, the following protocol will produce enough cells for 75 wells that contain 200 µl of cells. In this way, the scale is enlarged or performed multiple times to generate enough cells for multiple 96-well plates. Jurkat cells are maintained in RPMI + 10% serum with 1% Pen-Strep. Combine 2.5 ml of OPTI-MEM (Life Technologies) with 10 g of plasmid DNA in a T25 flask. Add 2.5 ml of OPTIMEM containing 50 µl of DMRIE-C and incubate at room temperature for 15-45 minutes.

During the incubation period, count the cell concentration, centrifuge the required number of cells (107 per transfection) and resuspend OPTI-MEM to a final concentration of 107 cells / ml. Then add 1 ml of 1 x 107 cells in OPTI-MEM to a T25 flask and incubate at 37 degrees C for 6 hours. After incubation, add 10 ml of RPMI plus 15% serum.

The stable Jurkat: GAS-SEAP reporting lines are maintained in RPMI + 10% serum, 1 mg / ml Genticin and 1% Pen-Strep. These cells are treated with supernatants containing G protein Chemokine Receptor polypeptides (CCR5) or Protein G Chemokine Receptor-induced polypeptides (CCR5) as produced by the protocol described in Example 16.

On the day of treatment with the supernatant, the cells should be washed and resuspended in fresh RPMI + 10% serum to a density of 500,000 cells per ml. The exact number of cells required will depend on the number of supernatants to be explored. For a 96-well plate, approximately 10 million cells are required (for 10 plates, 100 million cells).

Transfer the cells to a triangular canister, to distribute the cells in a 96-well plate, using a 12-channel pipette. Using a 12-channel pipette, transfer 200 µl of cells to each well (thus adding 100,000 cells per well).

After all plates have been seeded, 50 µl of the supernatants are transferred directly from the 96-well plate containing the supernatants to each well using a 12-channel pipette. In addition, a dose of exogenous gamma interferon (0.1, 1.0, 10 ng) is added to wells H9, H10 and H11 to serve as additional positive controls for the assay.

96-well plates containing Jurkat cells prepared with supernatants are placed in an incubator for 48 hours (note: this time is variable between 48-72 hours). Samples of 35 µl of each well are then transferred to an opaque 96-well plate using a 12-channel pipette. The opaque plates should be covered (using selofen covers) and stored at -20 ° C until SEAP tests are performed according to Example 18. Plates containing the remaining treated cells are placed at 4 degrees C and serve as a source of material to repeat the test in a specific well if desired.

As a positive control, 100 Units / ml interferon gamma that is known to activate Jurkat T lymphocytes can be used. Typically an induction of more than 30 times is observed in the positive control wells.

The above protocol can be used in the generation of transiently transfected cells, as well as stable ones, which would be evident to those skilled in the art.

Example 19

High Performance Exploration Test Identifying Myeloid Activity

The following protocol is used to evaluate the myeloid activity of the G-protein Chemokine Receptor (CCR5) by determining whether the G-protein Chemokine Receptor (CCR5) or G-protein Chemokine Receptor ligand (CCR5) proliferates and / or differentiates myeloid cells. Myeloid cell activity is evaluated using the GAS / SEAP / Neo construct produced in Example 17. Thus, factors that increase SEAP activity indicate the ability to activate the Jaks-STATS signal transduction path. The myeloid cell used in this assay is U937, a premonocyte cell line, although TF-1, HL60 can be used

or KG1.

To transiently transfect U937 cells with the GAS / SEAP / Neo construct produced in Example 17, a DEAE-Dextran method is used (Kharbanda et al., 1994, Cell Growth & Differentiation, 5: 259-265). First, collect 2x10e7 U937 cells and wash with PBS. U937 cells are normally grown in RPMI 1640 medium containing 10% heat-inactivated fetal bovine serum (FBS) supplemented with 100 units / ml penicillin and 100 mg / ml streptomycin.

Then, suspend the cells in 1 ml of 20 mM Tris-HCl buffer (pH 7.4) containing 0.5 mg / ml DEAE-Dextran, 8 µg of GAS-SEAP2 plasmid DNA, 140 mM NaCl, KCl 5 mM, Na2HPO4. 7H2O 375 M, MgCl21 mM and CaCl2 675 M. Incubate at 37 degrees C for 45 minutes.

Wash the cells with RPMI 1640 medium containing 10% FBS and then resuspend in 10 ml of complete medium and incubate at 37 degrees C for 36 hours.

Stable GAS-SEAP / U937 cells are obtained by growing the cells in G418 400 g / ml. The medium without G418 is used for routine growth but every one to two months, the cells should be allowed to grow back in G418 400 g / ml for a couple of passes.

These cells are tested by collecting 1x108 cells (this is sufficient for an assay in ten 96-well plates) and washed with PBS. Suspend the cells in 200 ml of the growth medium described above, with a final density of 5x105 cells / ml. Sow 200 µl of cells per well in the 96-well plate (or 1x105 cells / well).

Add 50 µl of supernatant prepared by the protocol described in Example 16. Incubate at 37 degrees C for 48 to 72 hours. As a positive control, 100 Units / ml interferon gamma that is known to activate U937 cells can be used. Typically an induction of more than 30 times is observed in the positive control wells. Test the supernatant by SEAP according to the protocol described in Example 22.

Example 20

High Performance Exploration Test Identifying Neuronal Activity

When cells undergo differentiation and proliferation, a group of genes is activated through many different signal transduction pathways. One of these genes, EGR1 (early growth response gene 1), is induced in various tissues and cell types after activation. The EGR1 promoter is responsible for such induction. Using the EGR1 promoter linked to reporter molecules, cell activation by Protein G Chemokine Receptor (CCR5) or a ligand thereof can be evaluated.

In particular, the following protocol is used to evaluate neuronal activity in PC12 cell lines. It is known that PC12 cells (rat phenochromocytoma cells) proliferate and / or differentiate by activation with various mitogens, such as TPA (tetradecanoyl forbol acetate), NGF (neuronal growth factor) and EGF (epidermal growth factor). EGR1 gene expression is activated during this treatment. Thus, by stably transfecting PC12 cells with a construct containing an EGR promoter linked to a SEAP reporter, the activation of PC12 cells can be assessed by G-protein Chemokine Receptor (CCR5) or a ligand thereof.

The EGR / SEAP reporter construct can be assembled by the following protocol. The promoter sequence of EGR-1 (-633 to +1) (Sakamoto K et al., Oncogene 6: 867-871 (1991)) can be amplified by PCR from human genomic DNA using the following primers:

5 ’GCGCTCGAGGGATGACAGCGATAGAACCCCGG -3’ (SEQ ID NO: 15)

5 ’GCGAAGCTTCGCGACTCCCCGGATCCGCCTC-3’ (SEQ ID NO: 16)

Using the GAS: SEAP / Neo vector produced in Example 17, amplified product of EGR1 can then be inserted into this vector. Linearize the GAS: SEAP / Neo vector using XhoI / HindIII restriction enzymes, removing the GAS / SV40 filler. Restrict the amplified product of EGR1 with these same enzymes. Link the vector and the EGR1 promoter.

To prepare 96-well plates for cell culture, 2 ml of a coating solution is added (dilution

1:30 of type I collagen (Upstate Biotech Inc. Cat. No. 08-115) in 30% ethanol (sterilized by filtration)) per 10 cm or 50 ml plate per well of the 96-well plate and allowed to air dry for 2 hours.

PC12 cells are routinely grown in RPMI-1640 medium (Bio Whittaker) containing 10% horse serum (JRH BIOSCIENCES, Cat. No. 12449-78P), 5% heat-inactivated fetal bovine serum (FBS) supplemented with penicillin 100 Units / ml and streptomycin 100 /g / ml in a 10 cm tissue culture plate previously coated. A dilution of one to four is made every three or four days. The cells are removed from the plates by scraping and resuspended by pipetting up and down more than 15 times.

Transfect PC12 with the EGR / SEAP / Neo construct using the lipofectamine protocol described in the Example

16. Stable EGR-SEAP / PC12 cells are obtained by culturing the cells in G418 300 µg / ml. The medium without G418 is used for routine growth but every one to two months, the cells should be cultured again in G418 300 /g / ml for a couple of passes.

To test for neuronal activity, a 10 cm plaque with cells at a confluence of approximately 70 to 80% is scanned by removing the old medium. Wash the cells once with PBS (phosphate buffered saline). After depriving the food cells in low serum medium (RPMI-1640 containing 1% horse serum and 0.5% FBS with antibiotics) overnight.

The next morning, remove the medium and wash the cells with PBS. Scrape off the cells from the plate, suspend the cells in 2 ml of low serum medium. Count the number of cells and add more low serum medium to achieve a final cell density of 5x105 cells / ml.

Add 200 µl of the cell suspension to each well of the 96-well plate (equivalent to 1x105 cells / well). Add 50 µl of supernatant produced by Example 12, 37 degrees C for 48 to 72 hours. As a positive control, a growth factor known to activate PC12 cells through EGR, such as 50 ng / Ne Neuronal Growth Factor (EGF), can be used. Typically, an induction of more than fifty times of SEAP is seen in the positive control wells. Test with SEAP the supernatant according to Example 22.

Example 21

High Performance Scan for T Lymphocyte Activity

NF-KB (KB Nuclear Factor) is a transcription factor activated by a wide variety of agents that includes inflammatory cytokines IL-1 and TNF, CD30 and CD40, lymphotoxin-alpha and lymphotoxin-beta, by exposure to LPS or

5 thrombin and by expression of certain viral gene products. As a transcription factor, NF-KB regulates the expression of genes involved in the activation of immune cells, control of apoptosis (NF-KB seems to protect cells from apoptosis), development of B and T lymphocytes, antiviral and antimicrobial responses and multiple responses to stress.

Under unstimulated conditions, NF-KB is conserved in the cytoplasm with I-KB (KB Inhibitor). However, after the

10 stimulation, I-KB phosphorylates and degrades, causing NF-KB to be transported to the nucleus, thereby activating the transition of target genes. Target genes activated by NF-KB include IL-2, IL-6, GM-CSF, ICAM-1 and MHC class 1.

Due to its main role and ability to respond to a series of stimuli, informative constructs that use the NF-KB promoter element are used to explore the supernatants produced in the Example

15 16. NF-KB activators or inhibitors would be useful in the treatment, prevention and / or diagnosis of diseases. For example, NF-KB inhibitors could be used to treat diseases related to acute or chronic activation of NF-KB, such as rheumatoid arthritis.

To construct a vector containing the NF-KB promoter element, a PCR based strategy is employed. The upstream primer contains four tandem copies of the NF-KB binding site (GGGGACTTTCCC) (SEQ ID

20 Nº: 17), 18 bp of the sequence complementary to the 5 ’end of the SV40 early promoter sequence and is flanked with an XhoI site:

image 1

The downstream primer is complementary to the 3 ’end of the SV40 promoter and is flanked with a Hind site

III:

 5 ’: GCGGCAAGCTTTTTGCAAAGCCTAGGC: 3’ (SEQ ID NO: 19)

PCR amplification is performed using the SV40 promoter template present in the plasmid pB-gal: promoter obtained from Clontech. The resulting PCR fragment is digested with XhoI and Hind III and subcloned into BLSK2- (Stratagene). Sequencing with primers T7 and T3 confirms that the insert contains the following sequence:

image 1

Next, replace the minimum SV40 promoter element present in the plasmid pSEAP2-promoter (Clontech) with this NF-KB / SV40 fragment using XhoI and HindIII. However, this vector does not contain a neomycin resistance gene and therefore is not preferred for mammalian expression systems.

To generate stable mammalian cell lines, the NF-KB / SV40 / SEAP cassette is removed from the previous NFKB / SEAP vector using SalI and NotI restriction enzymes and inserted into a vector containing neomycin resistance.

In particular, the NF-KB / SV40 / SEAP cassette is inserted into pGFP-1 (Clontech), replacing the GFP gene, after restricting pGFP-1 with SalI and NotI.

Once the NF-KB / SV40 / SEAP / Neo vector is created, stable Jurkat T lymphocytes are created and maintained in accordance with the protocol described in Example 18. Similarly, the method for testing supernatants with these T lymphocytes Jurkat stable is also described in Example 18. As a positive control, TNF alpha is added

Exogenous (0.1, 1, 10 ng) to wells H9, H10 and H11, typically an activation of 5-10 times.

Example 22

SEAP Activity Test

As a reporter molecule for the assays described in Examples 18-21, SEAP activity is tested using the Tropix Phospho-light Kit (Cat. BP-400) according to the following general procedure. The Tropix 5 Phospho-light Kit provides the Dilution, Test and Reaction Buffers used later.

Prepare a dispenser with the 2.5x Dilution Buffer and distribute 15 µl of 2.5x dilution buffer on Optiplate plates containing 35 µl of a supernatant. Seal the plates with a plastic sealer and incubate at 65 degrees C for 30 minutes. Separate the Optiplate plates to avoid uneven heating.

Cool the samples at room temperature for 15 minutes. Empty the dispenser and prepare with the buffer

10 essay Add 50 ml of assay buffer and incubate at room temperature for 5 minutes. Empty the dispenser and prepare with the reaction buffer (see table below). Add 50 µl of reaction buffer and incubate at room temperature for 20 minutes. Since the intensity of the chemiluminescent signal depends on the time and it takes approximately 10 minutes to read 5 plates on the luminometer, 5 plates should be treated each time and the second set started 10 minutes later.

15 Read the relative light unit on the luminometer. Set H12 as the target and print the results. An increase in chemiluminescence indicates reporting activity.

Reaction Buffer Formulation:

No. of plates Rxn buffer diluent (ml) CSPD (ml)

1060 3 11 65 3.25 12 70 3.5 13 75 3.75 1480 4 15 85 4.25 16 90 4.5 17 95 4.75 18100 5 19 105 5.25 20 110 5.5 21 115 5, 75 22 120 6 23 125 6.25 24 130 6.5 25 135 6.75 26140 7 27 145 7.25 28 150 7.5 29 155 7.75 30160 8 Number of plates Rxn buffer diluent (ml) CSPD (ml )

31 165 8.25 32 170 8.5 33 175 8.75 34180 9 35 185 9.25 36 190 9.5 37 195 9.75 38 200 10 39 205 10.25 40 210 10.5 41 215 10.75 42 220 11 43 225 11.25 44 230 11.5 45 235 11.75 46 240 12 47 245 12.25 48 250 12.5 49 255 12.75 50 260 13

image 1

Example 23

High Performance Exploration Test Identifying Changes in Small Molecule Concentration and Membrane Permeability

5 It is known that the binding of a ligand with a receptor alters intracellular levels of small molecules, such as calcium, potassium, sodium and pH, as well as alters the membrane potential. These alterations can be measured in an assay to identify supernatants that bind to receptors in a particular cell. Although the following protocol describes an assay for calcium, this protocol can be easily modified to detect changes in potassium, sodium, pH, membrane potential or any other small molecule that is detectable by a probe.

10 fluorescent.

The following test uses Fluorometric Imaging Plate Reader (“FLIPR”) to measure changes in fluorescent molecules (Molecular Probes) that bind to small molecules. Clearly, any fluorescent molecule that detects a small molecule can be used in place of the calcium fluorescent molecule, fluo-4 (Molecular Probes, Inc .; catalog No. F-14202), used herein.

15 For adherent cells, sow the cells at 10,000-20,000 cells / well in a black Costar 96-well plate with transparent bottom. The plate is incubated in a CO2 incubator for 20 hours. The adherent cells are washed twice in a Biotek scrubber with 200 µl of HBSS (Hank's Balanced Saline Solution) leaving 100 µl of the buffer after the final wash.

A stock solution of 1 mg / ml fluo-4 in 10% DMSO of pluronic acid is prepared. To recharge cells with

20 fluo-4, 50 µl of fluo-4 12 g / ml is added to each well. The plate is incubated at 37 degrees C in a CO2 incubator for 60 minutes. The plate is washed four times in the Biotek washer with HBSS leaving 100 µl of buffer.

For non-adherent cells, the cells are centrifuged from culture medium. The cells are resuspended at 25x106 cells / ml with HBSS in a 50 ml conical tube. 4 µl of 1 mg / ml fluo-4 solution in 10% pluronic acid DMSO is added to each ml of cell suspension. The tube is then placed in a 37 degree C water bath for 30-60 minutes. The cells are washed twice with HBSS, resuspended at 1x106 cells / ml and distributed in a microplate, 100 µl / well. The plate is centrifuged at 1000 rpm for 5 minutes. The plate is washed once later in Denley Cell Wash with 200 µl, followed by a suction stage to a final volume of 100 µl.

For a non-cell-based assay, each well contains a fluorescent molecule, such as fluo-4. The supernatant is added to the well and a change in fluorescence is detected.

To measure intracellular calcium fluorescence, the FLIPR is adjusted for the following parameters: (1) The system gain is 300-800 mW; (2) The exposure time is 0.4 seconds; (3) Camera F / stop is F / 2; (4) The excitation is 488 nm; (5) The emission is 530 nm; and (6) The sample addition is 50 µl. An increase in emission at 530 nm indicates an extracellular signaling event caused by a molecule, such as G-protein Chemokine Receptor (CCR5), or a ligand thereof, or a G-Chemokine Receptor-induced molecule (CCR5) , which has resulted in an increase in the concentration of intracellular Ca ++.

Example 24

High Performance Exploration Test Identifying Tyrosine Kinase Activity

The Tyrosine Kinase Proteins (PTK) represent a diverse group of transmembrane and cytoplasmic kinases. Within the group of Receptor Tyrosine Kinase Protein (RPTK) there are receptors for a number of metabolic and mitogenic growth factors including the subfamilies of the insulin receptor and PDGF, FGF, EGF, NGF, HGF. In addition, there is a large family of RPTK for which the corresponding ligand is unknown. Ligands for RPTK mainly include small secreted proteins but also extracellular matrix and membrane bound proteins.

Activation of RPTK by ligands involves ligand-mediated receptor dimerization, resulting in transphosphorylation of receptor subunits and activation of cytoplasmic tyrosine kinases. Cytoplasmic tyrosine kinases include receptor-associated tyrosine kinase of the src family (e.g., src, yes, Ick, lyn, fyn) and cytosolic and non-receptor-linked tyrosine kinase protein, such as the Jak family, members of which mediate signal transduction triggered by the cytokine superfamily of the receptors (for example, interleukins, Interferons, GM-CSF and Leptin).

Due to the wide range of known factors capable of stimulating tyrosine kinase activity, it is of interest to identify whether the G-protein Chemokine Receptor (CCR5) or a ligand thereof or a G-Chemokine Receptor-induced molecule (CCR5) is capable of activating tyrosine kinase signal transduction pathways. Therefore, the following protocol is designed to identify such molecules capable of activating the tyrosine kinase signal transduction pathways.

Sow target cells (e.g., primary keratinocytes) at a density of approximately 25,000 cells per well in a 96-well plate of Loprodyne Silent Exploration obtained from Nalge Nunc (Naperville, IL). The plates are sterilized with two 30-minute rinses with 100% ethanol, rinsed with water and dried overnight. Some plates are coated for 2 hours with 100 ml of type I collagen for use in cell culture (50 mg / ml), gelatin (2%) or polylysine (50 mg / ml), all of which can be obtained from Sigma Chemicals (St Louis, MO) or Matrigel 10% obtained from Becton Dickinson (Bedford, MA), or calf serum, rinsed with PBS and stored at 4 degrees C. The cell growth of these plates is tested by sowing 5,000 cells / well in the middle of growth and by indirect quantification of the number of cells through the use of alamarBlue as described by the manufacturer Alamar Biosciences, Inc. (Sacramento, CA) after 48 hours. Becton Dickinson Falcon No. 3071 (Bedford, MA) plate covers are used to cover Loprodyne's Silent Exploration Plates. Falcon Microtest III cell culture plates can also be used in some proliferation experiments.

To prepare the extracts, A431 cells are seeded on the nylon membranes of Loprodyne plates (20,000 / 200 ml / well) and grown overnight in complete medium. The cells are stabilized by incubation in basal medium without serum for 24 hours. After 5-20 minutes of treatment with EGF (60 ng / ml) or 50 µl of the supernatant produced in Example 16, the medium is removed and 100 ml of extraction buffer ((20 mM HEPES pH 7.5) is added , 0.15 M NaCl, 1% Triton X-100, 0.1% SDS, 2 mM Na3VO4, 2 mM Na4P2O7 and a protease inhibitor cocktail (No. 1836170) obtained from Boeheringer Mannheim (Indianapolis, IN) to each well and the plate is stirred on a rotary shaker for 5 minutes at 4 ° C. The plate is then placed in a vacuum transfer manifold and the extract is filtered through the 0.45 mm membrane bottoms of each well using domestic vacuum Extracts are collected in a 96-well capture / test plate at the bottom of the vacuum manifold and immediately placed on ice To obtain clarified extracts by centrifugation, the contents of each well, after solubilization with detergent for 5 minutes, it is removed and centrifuged for 15 minutes at 4 ° C at

16,000 x g.

Test the filtered extracts with respect to levels of tyrosine kinase activity. Although many methods for detecting tyrosine kinase activity are known, a method is described herein.

Generally, the tyrosine kinase activity of a supernatant is evaluated by determining its ability to phosphorylate a tyrosine moiety on a specific substrate (a biotinylated peptide). Biotinylated peptides that can be used for this purpose include PSK1 (corresponding to amino acids 6-20 of the cell division kinase cdc2p34) and PSK2 (corresponding to amino acids 1-17 of gastrin). Both peptides are substrates for a series of tyrosine kinases and are available from Boehringer Mannheim.

The tyrosine kinase reaction is established by adding the following components in order. First, add 10 μl of 5 μM Biotinylated Peptide, then 10 μl of ATP / Mg 2+ (5 mM ATP / 50 mM MgCl 2), then 10 μl of 5x Test Buffer (40 mM imidazole hydrochloride, pH 7, 3, 40 mM beta-glycerophosphate, 1 mM EGTA, 100 mM MgCl2, 5 mM MnCl2, 0.5 mg / ml BSA), then 5 µl of Sodium Vanadate (1 mM) and then 5 µl of water. Mix the components gently and pre-incubate the reaction mixture at 30 ° C for 2 minutes. Start the reaction by adding 10 µl of the control enzyme or the filtered supernatant.

The tyrosine kinase assay reaction is then stopped by adding 10 µl of 120 mm EDTA and the reactions are placed on ice.

Tyrosine kinase activity is determined by transferring 50 µl aliquots of reaction mixture to a microtiter plate module (MTP) and incubating at 37 degrees C for 20 minutes. This allows the streptavidin coated 96-well plate to associate with the biotinylated peptide. Wash the MTP module with PBS 300 µl / well four times. Then add 75 µl of anti-phosphotyrosine antibody coupled with horseradish peroxidase (anti-P-Tyr-POD (0.5 u / ml)) to each well and incubate at 37 degrees C for one hour. Wash the well as before.

Then add 1000 µl of peroxidase substrate solution (Boehringer Mannheim) and incubate at room temperature for at least 5 minutes (up to 30 minutes). Measure the absorbance of the sample at 405 nm using ELISA reader. The level of bound peroxidase activity is quantified using an ELISA reader and reflects the level of tyrosine kinase activity.

Example 25

High Performance Exploration Test Identifying Phosphorylation Activity

As a potential alternative and / or complement to the tyrosine kinase protein activity assay described in Example 24, an assay that detects the activation (phosphorylation) of major intracellular signal transduction intermediates can also be used. For example, as described below, a particular assay can detect tyrosine phosphorylation of Erk-1 and Erk-2 kinases. However, phosphorylation of other molecules, such as Raf, JNK, MAP p38, Map kinase kinase (MEK), MEK kinase, Src, Muscle specific kinase (MuSK), IRAK, Tec and Janus, as well as any other molecule can be detected. phosphoserine, phosphotyrosine or phosphotreonine, replacing these molecules with Erk-1 or Erk-2 in the following test.

Specifically, test plates are prepared by coating the wells of a 96-well ELISA plate with 0.1 ml of G protein (1 µg / ml) for 2 hours at room temperature (RT). The plates are then rinsed with PBS and blocked with 3% BSA / PBS for 1 hour at RT. The G protein plates are then treated with 2 commercial monoclonal antibodies (100 ng / well) against Erk-1 and Erk-2 (1 hour at RT) (Santa Cruz Biotechnology). (To detect other molecules, this step can be easily modified by replacing a monoclonal antibody that detects any of the molecules described above). After 3-5 rinses with PBS, the plates are stored at 4 degrees C until use.

A431 cells at 20,000 / well are seeded in a 96-well Loprodyne filter plate and grown overnight in growth medium. The cells are then deprived of food for 48 hours in basal medium (DMEM) and then treated with EGF (6 ng / well) or 50 µl of the supernatants obtained in Example 16 for 5-20 minutes. The cells are then solubilized and the extracts are filtered directly on the assay plate.

After incubation with the extract for 1 hour at RT, the wells are rinsed again. As a positive control, a commercial preparation of MAP kinase (10 ng / well) is used instead of A431 extract. The plates are then treated with a commercial polyclonal (rabbit) antibody (1 µg / ml) that specifically recognizes the phosphorylated epitope of the Erk-1 and Erk-2 kinases (1 hour at RT). This antibody is biotinylated by conventional procedures. The bound polyclonal antibody is then quantified by successive incubations with Europioestreptavidin and Europio fluorescence enhancer reagent in the Wallac DELFIA instrument (time resolved fluorescence). An increased fluorescent signal on the background indicates phosphorylation by G-protein Chemokine Receptor (CCR5) or a ligand thereof or a molecule induced by G-protein Chemokine Receptor.

Example 26

Method to Determine Alterations in the G-protein Chemokine Receptor Gene (CCR5)

RNA is isolated from entire families or individual patients who present a phenotype of interest (such as a disease). CDNA from these RNA samples is then generated using protocols known in the art (see, Sambrook). The cDNA is then used as a template for PCR, using primers surrounding regions of interest in SEQ ID NO: 1. The suggested PCR conditions consist of 35 cycles at 95 degrees C for 30 seconds; 60-120 seconds at 52-58 degrees C; and 60-120 seconds at 70 degrees C, using buffer solutions described in Sidransky, D., et al., Science 252: 706 (1991).

The PCR products are then sequenced using primers labeled at their 5 'end with T4 polynucleotide kinase, using SequiTherm Polymerase (Epicenter Technologies). The intron-exon ends of selected exons of the G-protein Chemokine Receptor (CCR5) are also determined and the genomic PCR products are analyzed to confirm the results. PCR products that harbor suspicious mutations in the G-protein Chemokine Receptor (CCR5) are then cloned and sequenced to validate the results of direct sequencing.

The PCR products of the G-protein Chemokine Receptor (CCR5) are cloned into T-tailed vectors as described in Holton, TA and Graham, MW, Nucleic Acids Research, 19: 1156 (1991) and sequenced with T7 polymerase (United States Biochemical). Affected individuals are identified by mutations in the G-protein Chemokine Receptor (CCR5) not present in unaffected individuals.

Genomic rearrangements are also observed as a method to determine alterations in a gene corresponding to the G-protein Chemokine Receptor. Genomic clones isolated according to Example 6 are notched by translation with digoxigenindesoxyuridin 5'-triphosphate (Boehringer Manheim) and FISH is performed as described in Johnson, Cg. et al., Methods Cell Biol. 35: 73-99 (1991). Hybridization is performed with the labeled probe using a large excess of human cot-1 DNA for specific hybridization with the genomic locus of the G-protein Chemokine Receptor (CCR5).

Chromosomes are counterstained with 4,6-diamino-2-phenylidol and propidium iodide, producing a combination of C and R bands. Aligned images are obtained for precise mapping using a set of triple band filters (Chroma Technology, Brattleboro, VT ) in combination with a device chamber coupled to a cooled load (Photometrics, Tucson, AZ) and variable excitation wavelength filters. (Johnson, Cv. Et al., Genet. Anal. Tech. Appl., 8: 75 (1991). Image collection, analysis and measurements of chromosomal fractional length are performed using the ISee Graphical Program System. (Inovision Corporation , Durham, NC.) Chromosomal alterations of the genomic region of the G-protein Chemokine Receptor (CCR5) (hybridized by the probe) are identified as insertions, deletions and translocations. These alterations of the G-protein Chemokine Receptor (CCR5) They are used as a diagnostic marker for an associated disease.

Example 27

Method for Detecting Abnormal Levels of the G-protein Chemokine Receptor (CCR5) in a Biological Sample

Polypeptides of the G-protein Chemokine Receptor (CCR5) can be detected in a biological sample and if an increase or decrease in the level of the G-protein Chemokine Receptor (CCR5) is detected, this polypeptide is a marker for a particular phenotype. The detection methods are numerous and therefore, it is understood that one skilled in the art can modify the following assay to suit their particular needs.

For example, antibody sandwich ELISAs are used to detect G-protein Chemokine Receptor (CCR5) in a sample, preferably a biological sample. The wells of a microtiter plate are coated with antibodies specific for the G-protein Chemokine Receptor (CCR5) at a final concentration of 0.2 to 10 g / ml. The antibodies are monoclonal or polyclonal and are produced by the method described in Example 15. The wells are blocked so that it is reduced to non-specific binding of the G-protein Chemokine Receptor (CCR5) to the well.

The coated wells are then incubated for> 2 hours at RT with a sample containing Protein Chemokine Receptor G. Preferably, serial dilutions of the sample should be used to validate the results. The plates are then washed three times with deionized or distilled water to remove unbound G-chemokine Receptor.

Next, 50 µl of specific antibody alkaline phosphatase conjugate is added, at a concentration of 25-400 ng, and incubated for 2 hours at room temperature. The plates are washed again three times with deionized or distilled water to remove unbound conjugate.

Add 75 µl of 4-methylumbelliferyl phosphate (MUP) or p-nitrophenyl phosphate (NPP) substrate solution to each well and incubate for 1 hour at room temperature. Measure the reaction by a microtiter plate reader. Prepare a standard curve, using serial dilutions of a control sample and represent the concentration of the G-protein Chemokine Receptor polypeptide (CCR5) on the X axis (logarithmic scale) and fluorescence or absorbance on the Y axis (linear scale). Interpolate the concentration of the G-protein Chemokine Receptor (CCR5) in the sample using the standard curve.

Example 28

Formulation

The invention also provides methods of treatment and / or prevention of diseases, disorders and / or conditions (such as, for example, any one or more of the diseases, disorders and / or conditions described herein) by administration to a subject of an effective amount of a therapeutic agent. By therapeutic agent is meant polynucleotides or polypeptides of the invention (including fragments and variants), agonists or antagonists thereof and / or antibodies thereto, in combination with a pharmaceutically acceptable type of vehicle (eg, a sterile vehicle).

The Therapeutic agent will be formulated and dosed in a manner consistent with good medical practice, taking into account the clinical condition of the individual patient (especially the side effects of treatment with the therapeutic agent alone), the delivery site, the method of administration, the administration program and other factors known to physicians. The "effective amount" for the purposes of the present specification is thus determined by such considerations.

As a general proposition, the total pharmaceutically effective amount of the therapeutic agent administered parenterally per dose will be in the range of about 1 µg / kg / day to 10 mg / kg / day of the patient's body weight, although, as has been noted above, this will be subject to therapeutic description. More preferably, this dose is at least 0.01 mg / kg / day and more preferably for humans between about 0.01 and 1 mg / kg / day for the hormone. If provided continuously, the therapeutic agent is typically administered at a dose rate of about 1 µg / kg / hour at about 50 µg / kg / hour, for 1-4 injections per day or for continuous subcutaneous infusions, for example, using a minipump. An intravenous bag solution can also be used. The length of treatment necessary to observe changes and the interval after treatment for responses to occur seems to vary depending on the desired effect.

The therapeutic agents can be administered orally, rectally, parenterally, intracisternally, intravaginally, intraperitoneally, topically (as by powders, ointments, gels, drops or transdermal patches), orally or as an oral or nasal spray. "Pharmaceutically acceptable carrier" refers to a filler, diluent, encapsulant or adjuvant material of solid, semi-solid formulation or non-toxic liquid of any kind. The term "parenteral" as used herein refers to modes of administration that include intravenous, intramuscular, intraperitoneal, intrasternal, subcutaneous and intraarticular injection and infusion.

The therapeutic agents of the invention are also suitably administered by prolonged release systems. Suitable examples of extended-release therapeutic agents are administered orally, rectally, parenterally, intracisternally, intravaginally, intraperitoneally, topically (such as powders, ointments, gels, drops or transdermal patches), oral or as an oral or nasal spray. "Pharmaceutically acceptable carrier" refers to a filler, diluent, encapsulant or adjuvant material of solid, semi-solid formulation or non-toxic liquid of any kind. The term "parenteral" as used herein refers to modes of administration that include intravenous, intramuscular, intraperitoneal, intrasternal, subcutaneous and intraarticular injection and infusion.

The therapeutic agents of the invention are also suitably administered by prolonged release systems. Suitable examples of extended release therapeutic agents include suitable polymeric materials (such as, for example, semipermeable polymeric matrices in the form of molded articles, for example, films or microcapsules), suitable hydrophobic materials (for example as an emulsion in an acceptable oil ) or ion exchange resins and poorly soluble derivatives (such as, for example, a poorly soluble salt).

Prolonged-release matrices include polylactides (U.S. Patent No. 3,773,919, EP 58,481), L-glutamic acid and gamma-ethyl-L-glutamate copolymers (Sidman et al., Biopolymers 22: 547-556 (1983 )), poly (2- hydroxyethyl methacrylate) (Langer et al., J. Biomed. Mater. Res. 15: 167-277 (1981), and Langer, Chem. Tech. 12: 98-105 (1982)), ethylene vinyl acetate (Langer et al., Same as above) or poly-D - (-) - 3-hydroxybutyric acid (EP 133,988).

The extended-release therapeutic agents also include therapeutic agents trapped in liposomes of the invention (see generally, Langer, Science 249: 1527-1533 (1990); Treat et al., In Liposomes in the Therapy of Infectious Disease and Cancer, Lopez- Berestein and Fidler (eds.), Liss, New York, p. 317-327 and 353365 (1989)). Liposomes containing the therapeutic agent are prepared by methods known per se: DE 3,218,121; Epstein et al., Proc. Natl Acad. Sci. (USA) 82: 3688-3692 (1985); Hwang et al., Proc. Natl Acad. Sci. (USA) 77: 4030-4034 (1980); EP 52,322; EP 36,676; EP 88,046; EP 143,949; EP 142,641;

Japanese Patent Application 83-118008; US Patents No. 4,485,045 and 4,544,545; and EP document

102,324. Usually, the liposomes are of the small unilamellar type (about 200-800 Angstroms) in which the lipid content is greater than about 30 mole percent. of cholesterol, adjusting the proportion selected for the optimal therapeutic agent.

In a further embodiment, the therapeutic agents of the invention are delivered by means of a pump (see Langer, mentioned above; Sefton, CRC Crit. Ref. Biomed. Eng. 14: 201 (1987); Buchwald et al., Surgery 88: 507 (1980); Saudek et al., N. Engl. J. Med. 321: 574 (1989)).

Other controlled release systems are analyzed in the Langer review (Science 249: 1527-1533 (1990)).

For parenteral administration, in one embodiment, the therapeutic agent is generally formulated by mixing it to the desired degree of purity, in an injectable unit dosage form (solution, suspension or emulsion) with a pharmaceutically acceptable carrier, that is, one that is not toxic to the receptors at the dosages and concentrations used and is compatible with other ingredients of the formulation. For example, the formulation preferably does not include oxidizing agents and other compounds that are known to be deleterious to the therapeutic agent.

Generally, the formulations are prepared by contacting the therapeutic agent uniformly and intimately with liquid vehicles or finely divided solid vehicles or both. Then, if necessary, the product is molded into the desired formulation. Preferably the vehicle is a parenteral vehicle, more preferably a solution that is isotonic with the recipient's blood. Examples of such adjuvant vehicles include water, saline, Ringer's solution and dextrose solution. Non-aqueous vehicles such as fixed oils and ethyl oleate are also useful herein, as well as liposomes.

The vehicle suitably contains smaller amounts of additives such as substances that enhance isotonicity and chemical stability. Such materials are non-toxic for receptors at the dosages and concentrations employed and include buffers such as phosphate, citrate, succinate, acetic acid and other organic acids or their salts; antioxidants such as ascorbic acid; low molecular weight polypeptides (less than about ten residues), for example, polyarginine or tripeptides; proteins, such as serum albumin, gelatin or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids, such as glycine, glutamic acid, aspartic acid or arginine; monosaccharides, disaccharides and other carbohydrates that include cellulose

or its derivatives, glucose, mannose or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; counterions such as sodium; and / or non-ionic surfactants such as polysorbates, poloxamers or PEG.

The therapeutic agent is typically formulated in such vehicles at a concentration of about 0.1 mg / ml to 100 mg / ml, preferably 1-10 mg / ml, at a pH of about 3 to 8. It will be understood that the use of some of the above excipients, vehicles or stabilizers will result in the formation of polypeptide salts.

Any pharmaceutical agent used for therapeutic administration can be sterile. Sterility is easily achieved by filtration through sterile filtration membranes (for example, 0.2 micrometer membranes). The therapeutic agents are generally placed in a container that has a sterile access hole, for example, an intravenous solution bag or vial that has a cap that can be pierced with a hypodermic injection needle.

The therapeutic agents will usually be stored in unit or multi-dose containers, for example, sealed ampoules or bottles, as an aqueous solution or as a lyophilized formulation for reconstitution. As an example of a lyophilized formulation, 10 ml bottles are filled with 5 ml of 1% (w / v) aqueous therapeutic solution sterilized by filtration and the resulting mixture is lyophilized. The infusion solution is prepared by reconstituting the lyophilized therapeutic agent using water for bacteriostatic injection.

The invention also provides a pharmaceutical kit or package comprising one or more containers filled with one or more of the ingredients of the therapeutic agents of the invention. Associated with such a container or such containers there may be a notice in the manner prescribed by a government agency that regulates the manufacture, use

or sale of pharmaceutical agents or biological products, said notice reflecting the approval by the agency of the manufacture, use or sale for human administration. In addition, therapeutic agents can be used together with other therapeutic compounds.

Therapeutic agents of the invention can be administered alone or in combination with adjuvants. Adjuvants that can be administered with the therapeutic agents of the invention include, but are not limited to, alum, alum plus deoxycholate (ImmunoAg), MTP-PE (Biocine Corp.), QS21 (Genentech, Inc.), BCG and MPL. In a specific embodiment, the Therapeutic agents of the invention are administered in combination with alum. In another specific embodiment, the Therapeutic agents of the invention are administered in combination with QS-21. Additional adjuvants that can be administered with the Therapeutic agents of the invention include, but are not limited to, Monophosphoryl lipid immunomodulator, AdjuVax 100a, QS-21, QS-18, CRL1005, Aluminum salts, MF-59 and Virosomal adjuvant technology. Vaccines that can be administered with the Therapeutic agents of the invention include, but are not limited to, vaccines directed towards protection against SPR (measles, papera, rubella), polio, chicken pox, tetanus / diphtheria, hepatitis A, hepatitis B, Haemophilus influenzae B , whooping cough, pneumonia, influenza, Lyme disease, rotavirus, cholera, yellow fever, Japanese encephalitis, polio, rabies, typhoid fever and pertussis. Combinations can be administered together, for example, as a mixture, separately but simultaneously or simultaneously; or sequentially. This includes presentations in which the combined agents are administered together as a therapeutic mixture and also procedures in which the combined agents are administered separately but simultaneously, for example, as through separate intravenous lines in the same individual. Administration "in combination" further includes separate administration of one of the compounds or agents provided first, followed by the second.

The therapeutic agents of the invention can be administered alone or in combination with other therapeutic agents. The therapeutic agents that can be administered in combination with the therapeutic agents of the invention include, but are not limited to, other members of the TNF family, chemotherapeutic agents, antibiotics, steroidal and non-steroidal anti-inflammatory agents, conventional immunotherapeutic agents, cytokines and / or factors of increase. The combinations can be co-administered, for example, as a mixture, separately but simultaneously or simultaneously; or sequentially. This includes presentations in which the combined agents are administered together as a therapeutic mixture and also procedures in which the combined agents are administered separately but simultaneously, for example, as through separate intravenous lines in the same individual. Administration "in combination" further includes separate administration of one of the compounds or agents provided first, followed by the second.

In one embodiment, the Therapeutic agents of the invention are administered in combination with members of the TNF family. TNF, TNF-related or TNF-like molecules that can be administered with the Therapeutic agents of the invention include, but are not limited to, soluble forms of TNF-alpha, lymphotoxin-alpha (LT-alpha, also known as TNF-beta), LT -beta (found in heterotrimeric complex LT-alpha2-beta), OPGL, FasL, CD27L, CD30L, CD40L, 4-1BBL, DcR3, OX40L, TNF-gamma (International Publication No. WO 96/14328), AIM-I (Publication International No. WO 97/33899), endocina-alfa (International Publication No. WO 98/07880), TR6 (International Publication No. WO 98/30694), OPG and neutrocina-alfa (International Publication No. WO 98/18921, OX40 and Neuronal growth factor (NGF) and soluble forms of Fas, CD30, CD27, CD40 and 4-IBB, TR2 (International Publication No. WO 96/34095), DR3 (International Publication No. WO 97/33904), DR4 (International Publication No. WO 98/32856), TR5 (International Publication No. WO 98/30693), TR6 (International Publication No. WO 98/30694), T R7 (International Publication No. WO 98/41629), TRANK, TR9 (International Publication No. WO 98/56892), TR10 (International Publication No. WO 98/54202), 312C2 (International Publication No. WO 98/06842) and TR12 and forms soluble CD154, CD70 and CD153.

In certain embodiments, Therapeutic agents of the invention are administered in combination with antiretroviral agents, nucleoside reverse transcriptase inhibitors (NRTI), non-nucleoside reverse transcriptase inhibitors (NNRTI), and / or protease inhibitors (PI) . NRTIs that can be administered in combination with the Therapeutic agents of the invention include, but are not limited to, RETROVIR ™ (zidovudine / AZT), VIDEX ™ (didanosine / ddI), HIVID ™ (zalcitabine / ddC), ZERIT ™ (stavudine / d4T ), EPIVIR ™ (lamivudine / 3TC) and COMBIVIR ™ (zidovudine / lamivudine). NNRTIs that can be administered in combination with the Therapeutic agents of the invention include, but are not limited to, VIRAMUNE ™ (nevirapine), RESCRIPTOR ™ (delavirdine), and SUSTIVA ™ (efavirenz). Protease inhibitors that can be administered in combination with the Therapeutic agents of the invention include, but are not limited to, CRIXIVAN ™ (indinavir), NORVIR ™ (ritonavir), INVIRASE ™ (saquinavir), and VIRACEPT ™ (nelfinavir). In a specific embodiment, antiretroviral agents, nucleoside reverse transcriptase inhibitors, non-nucleoside reverse transcriptase inhibitors and / or protease inhibitors may be used in any combination with Therapeutic agents of the invention to treat AIDS and / or prevent or treat infection by HIV

Additional NRTIs include LODENOSINE ™ (F-ddA; an acid stable adenosine NRTI; Triangle / Abbott; COVIRACIL ™ (emtricitabine / FTC; structurally related to lamivudine (3TC) but with a 3 to 10 times higher activity in vitro; Triangle / Abbott); dOTC (BCH-10652, also structurally related to lamivudine but retains activity against a substantial proportion of lamivudine-resistant isolates; Biochem Pharma); Adefovir (approval rejected for FDA anti-HIV therapy; Gilead Sciences ); PREVEON® (Adefovir Dipivoxil, the active prodrug of adefovir; its active form is PMEA-pp); TENOFOVIR ™ (bis-POC PMPA, a PMPA drug; Gilead); DAPD / DXG (active metabolite of DAPD; Triangle / Abbott); D-D4FC (related to 3TC, with activity against AZT / 3TC resistant virus); GW420867X (Glaxo Wellcome); ZIAGEN ™ (abacavir / 159U89; Glaxo Wellcome Inc.); CS-87 (3'azido-2 ', 3'-dideoxyuridine; WO 99/66936); and pro -macological forms bearing S-acyl-2-thioethyl (SATE) of -L-FD4C and -L-FddC (WO 98/17281).

Additional NNRTIs include COACTINON ™ (Emivirine / MKC-442, powerful NNRTI of the HEPT class; Triangle / Abbott); CAPRAVIRINE ™ (AG-1549 / S-1153, a next-generation NNRTI with activity against viruses containing the K103N mutation; Agouron); PNU-142721 (has activity 20 to 50 times greater than its predecessor delavirdine and is active against mutants K103N; Pharmacia &Upjohn); DPC-961 and DPC-963 (second generation derivatives of efavirenz, designed to be active against viruses with the K103N mutation; DuPont); GW-420867X (has 25 times greater activity than HBY097 and is active against K103N mutants; Glaxo Wellcome); CALANOLIDE A (natural agent of the latex tree; active against viruses that contain one of the mutations Y181C and K103N

or both); and Propolis (WO 99/49830).

Additional protease inhibitors include LOPINAVIR ™ (ABT378 / r; Abbott Laboratories); BMS-232632 (an azapeptide; Bristol-Myres Squibb); TIPRANAVIR ™ (PNU-140690, a non-peptide dihydropyrone; Pharmacia &Upjohn); PD-178390 (a non-peptide dihydropyrone; Parke-Davis); BMS 232632 (an azapeptide; Bristol-Myers Squibb); L-756.423 (an indinavir analogue; Merck); DMP-450 (a cyclic urea compound; Avid &DuPont); AG1776 (a peptidomimetic with in vitro activity against protease inhibitor resistant viruses; Agouron); VX175 / GW-433908 (amprenavir phosphate prodrug; Vertex & Glaxo Welcome); CGP61755 (Ciba); and AGENERASE ™ (amprenavir; Glaxo Wellcome Inc.).

Additional antiretroviral agents include fusion inhibitors / gp41 binding agents. The fusion inhibitors / binding agents of gp41 include T-20 (a peptide of residues 643-678 of the transmembrane HIV gp41 protein ectodomain that binds to gp41 in its resting state and prevents transformation to the fusogenic state; Trimeris ) and T-1249 (a second generation fusion inhibitor; Trimeris).

Additional antiretroviral agents include fusion inhibitors / chemokine receptor antagonists. Chemokine receptor fusion inhibitors / antagonists include CXCR4 antagonists such as AMD 3100 (a biciclam), SDF-1 and its analogs and ALX40-4C (a cationic peptide), T22 (an 18 amino acid peptide; Trimeris) and the analogues of T22 T134 and T140; CCR5 antagonists such as RANTES (9-68), AOP-RANTES, NNY-RANTES and TAK-779; and CCR5 / CXCR4 antagonists such as NSC 651016 (a distamycin analog). Also included are antagonists of CCR2B, CCR3 and CCR6. Chemokine receptor agonists such as RANTES, SDF-1, MIP-1, MIP-1, etc., can also inhibit fusion.

Additional antiretroviral agents include integrase inhibitors. Integrase inhibitors include dicaphenoquinic acids (DFQA); L-Chicoric acid (a dicafeoyltartaric acid (DCTA); quinalizarin (QLC) and related anthraquinones; ZINTEVIR ™ (AR 177, an oligonucleotide that probably acts on the cell surface instead of being a true integrase inhibitor; Arondex); and naphthols such as those described in WO 98/50347.

Additional antiretroviral agents include hydroxyurea type compounds such as BCX-34 (a purine nucleoside phosphorylase inhibitor; Biocryst); ribonucleotide reductase inhibitors, such as DIDOX ™ (Molecules for Health); Inosine monophosphate dehydrogenase (IMPDH) inhibitors such as VX-497 (Vertex); and mivopholic acids such as CellCept (mycophenolate mofetil; Roche).

Additional antiretroviral agents include viral integrase inhibitors, viral genomic nuclear translocation inhibitors such as arylene bis (methyl ketone) compounds; HIV entry inhibitors such as fusion protein AOP-RANTES, NNY-RANTES, RANTES-IgG, soluble complexes of RANTES and glycosaminoglycans (GAG) and AMD-3100; core-capsid zinc finger inhibitors such as dithian compounds; HIV targets Tat and Rev; and pharmaco-potentiators such as ABT-378.

Other antiretroviral therapies and adjunctive therapies include cytokines and lymphokines such as MIP-1, MIP-1, SDF-1, IL-2, PROLEUKIN ™ (aldesleukin / L2-7001; Chiron), IL-4, IL-10 , IL-12, and IL-13; interferons such as IFN-a2a; TNF, NFKB, GM-CSF, M-CSF and IL-10 antagonists; agents that modulate immune activation such as cyclosporine and prednisone; vaccines such as Remune ™ (HIV immunogen), APL 400-003 (Apollon), fragments and recombinant gp120, bivalent recombinant envelope glycoprotein (B / E), rgp120CM235, MN rgp120, SF-2 rgp120, soluble CD4 complex / gp120, Delta JR-FL protein, branched synthetic peptide derived from C3 / C4 domain of discontinuous gp120, competent immunogens for fusion and Gag, Pol, Nef and Tat vaccines; gene-based therapies such as genetic suppressor elements (GSE; WO 98/54366) and intrakines (genetically modified CC chemokines directed to the ER to block surface expression of newly synthesized CCR5 (Yang et al., PNAS 94: 11567-72 (1997); Chen et al., Nat. Med. 3: 1110-16 (1997)); antibodies (eg, anti-CXCR4 antibodies such as anti-CXCR4 12G5 antibody, anti-CCR5 antibodies such as anti antibodies -CCR5 2D7, 5C7, PA8, PA9, PA10, PA11, PA12 and PA14, anti-CD4 antibodies such as anti-CD4 antibodies Q4120 and RPA-T4, anti-CCR3 antibodies such as anti-CCR3 7B11 antibody, anti antibodies -gp120 such as anti-gp120 17b, 48d, 447-52D, 257-D, 268-D and 50.1 antibodies, anti-Tat antibodies, anti-TNF- antibodies and monoclonal antibody 33A); agonists and receptor antagonists aryl hydrocarbon (AH) such as TCDD, 3,3 ', 4,4', 5-pentachlorobiphenyl, 3,3 ', 4,4'-tetrachlorobiphenyl and -naphthoflavone (doc umento WO 98/30213); and antioxidants such as -L-glutamyl-L-cysteine ethyl ester (-GCE; WO 99/56764).

Additional agents that can be used with Therapeutic agents of the present invention with or without the above agents include anti-lymphoproliferative agents such as transretinoic acid (trans-RA), IFN-, EPOCH and Cidofovir; angiogenesis inhibitors such as thalidomide; cytostatic chemotherapeutic agents such as hydroxyurea; anti-infective agents such as Rifabutin, Isoniazide and Rifampin; and antidemence agents such as LU 02-584 (CPI-1189; Centuar Pharmaceuticals Inc.).

The dosages of these various agents are known in the art and can be found, for example, in The Physician’s Desk Reference and in the scientific literature.

The virus mutates very rapidly due to an error-prone reverse transcriptase (RT), thus developing resistance to multiple therapeutic agents. When targeting multiple points on the viral route (RT, protease, viral entry and viral neutralization) using combination therapy, the mutation rate should be counteracted effectively. Thus, the Therapeutic agents of the invention can be used with combinations of antiretroviral agents, including combinations of two drugs, three drugs, four drugs, five drugs, six drugs, seven drugs, eight drugs, nine drugs and more. Such combinations of antiretroviral agents may be referred to in the literature as active antiretroviral therapy (ART), highly active antiretroviral therapy (HAART), continuous HAART, intermittent HAART, "mega" HAART (more than 4, 5, 6, 7 or 8 and preferably more of 9 agents), high-dose multi-drug intensive therapy, early treatment intensification (TSI), maximum assisted therapy (MAT), self-administered therapy (SAT), subcutaneous recombinant human IL-2 in HIV-infected patients with Low CD4 + in active antiretroviral therapy (SILCAAT) and maintenance therapy. Preferably, the Therapeutic agents of the invention are used in combination with highly active antiretroviral therapy. Therapeutic agents of the invention can also be used in combination with adjunctive agents, such as those described hereinbefore and otherwise and those that are well known in the art, alone or together with antiretroviral agents.

When therapeutic agents of the invention are combined with any of the above agents or combinations of agents, the doses are adjusted as necessary. NRTIs generally do not require dose adjustments when combined, but NRTIs and PIs can affect their respective levels and potencies. The guidelines for such dose adjustments and for initiation, continuation, treatment, alteration and maintenance of antiretroviral therapy in general are well known to practitioners and are readily available in, for example, Guidelines for the Use of Antiretroviral Agents In HIV-Infected Adults and Adolescents, Panel on Clinical Practices for Treatment of HIV Infection, Dept. Health and Human Services and Henry J. Kaiser Foundation, January 28, 2000, and << http://www.hivatis.org >> and other scientific literature .

In other embodiments, the Therapeutic agents of the invention can be administered in combination with opportunistic anti-infection agents. Anti-opportunistic agents that may be administered in combination with the Therapeutic agents of the invention include, but are not limited to, TRIMETHOPRIM-SULPAMETHOXAZOLE ™, DAPSONE ™, PENTAMIDINE ™, ATOVAQUONE ™, ISONIAZID ™, RIFAMPIN ™, PYRAZINAMIDE ™, ETHAMBUTOL ™ ™, CLARITHROMYCIN ™, AZITHROMYCIN ™, GANCICLOVIR ™, FOSCARNET ™, CIDOFOVIR ™, FLUCONAZOLE ™, ITRACONAZOLE ™, KETOCONAZOLE ™, ACYCLOVIR ™, FAMCICOLVIR ™, PYRIMETHAMINE ™, LEUCOVFIMIN-G-LECIOVORIN GENE (LEUCOVORIN) LEUKINE ™ (sargramostim / GM-CSF). In a specific embodiment, the Therapeutic agents of the invention are used in any combination with TRIMETHOPRIM-SULFAMETHOXAZOLET ™, DAPSONE ™, PENTAMIDINE ™, and / or ATOVAQUONE ™ to treat prophylactically or prevent pneumonia infection by opportunistic Pneumocystis carinii. In another specific embodiment, the Therapeutic agents of the invention are used in any combination with ISONIAZID ™, RIFAMPIN ™, PYRAZINAMIDE ™, and / or ETHAMBLTTOL ™ to treat prophylactically or prevent a complex opportunistic Mycobacterium avium infection. In another specific embodiment, the Therapeutic agents of the invention are used in any combination with RIFABUTIN ™, CLARITHROMYCIN ™, and / or AZITHROMYCIN ™ to prophylactically treat or prevent opportunistic Mycobacterium tuberculosis infection. In another specific embodiment, the Therapeutic agents of the invention are used in any combination with GANCICLOVIR ™, FOSCARNET ™ and / or CIDOFOVIR ™ to prophylactically treat or prevent an opportunistic cytomegalovirus infection. In another specific embodiment, the Therapeutic agents of the invention are used in any combination with FLUCONAZOLE ™, ITRACONAZOLET ™ and / or KETOCONAZOLE ™ to treat prophylactically

or prevent an opportunistic fungal infection. In another specific embodiment, the Therapeutic agents of the invention are used in any combination with ACYCLOVIR ™ and / or FAMCICOLVIR ™ to prophylactically treat or prevent an infection with herpes simplex virus type I and / or opportunistic type II. In another specific embodiment, the Therapeutic agents of the invention are used in any combination with PYRIMETHAMINE ™ and / or LEUCOVORIN ™ to prophylactically treat or prevent an opportunistic Toxoplasma gondii infection. In another specific embodiment, the Therapeutic agents of the invention are used in any combination with LEUCOVORIN ™ and / or NEUPOGEN ™ to prophylactically treat or prevent an opportunistic bacterial infection.

In a further embodiment, the Therapeutic agents of the invention are administered in combination with an antiviral agent. Antiviral agents that can be administered with the Therapeutic agents of the invention include, but are not limited to, acyclovir, ribavirin, amantadine and remantidine.

In a further embodiment, the Therapeutic agents of the invention are administered in combination with an antibiotic agent. Antibiotic agents that can be administered with the therapeutic agents of the invention include, but are not limited to, amoxicillin, beta-lactamases, aminoglycosides, beta-lactam (glycopeptide), beta-lactamases, Clindamycin, chloramphenicol, cephalosporins, ciprofloxacin, ciprofloxacin, erythromycin, fluoroquinolones, macrolides, metronidazole, penicillins, quinolones, rifampin, streptomycin, sulfonamide, tetracyclines, trimethoprim, trimethoprimsulfamtoxazole and vancomycin.

Conventional non-specific immunosuppressive agents that can be administered in combination with the therapeutic agents of the invention include, but are not limited to, steroids, cyclosporine, cyclosporine analogues, cyclophosphamide, methylprednisone, prednisone, azathioprine, FK-506, 15-deoxyspergualine and other agents. immunosuppressants that act by suppressing T lymphocyte response function.

In specific embodiments, the Therapeutic agents of the invention are administered in combination with immunosuppressants. Immunosuppressive preparations that can be administered with the Therapeutic agents of the invention include, but are not limited to, ORTHOCLONE ™ (OKT3), SANDIMMUNE ™ / NEORAL ™ / SANGDYA ™ (cyclosporine), PROGRAF ™ (tacrolimus), CELLCEPT ™ (mycophenolate), Azathioprine , glucorticosteroids and RAPAMUNE ™ (sirolimus). In a specific embodiment, immunosuppressants can be used to prevent rejection of organ or bone marrow transplantation.

In a further embodiment, the Therapeutic agents of the invention are administered alone or in combination with one or more intravenous immunoglobulin preparations. Intravenous immunoglobulin preparations that can be administered with the Therapeutic agents of the invention include, but are not limited to, GAMMAR ™, IVEEGAM ™, SANDOGLOBULIN ™, GAMMAGARD S / D ™ and GAMIMUNE ™. In a specific embodiment, the Therapeutic agents of the invention are administered in combination with intravenous immunoglobulin preparations in transplant therapy (for example, bone marrow transplantation).

In a further embodiment, the Therapeutic agents of the invention are administered alone or in combination with an anti-inflammatory agent. Anti-inflammatory agents that can be administered with the Therapeutic agents of the invention include, but are not limited to, glucocorticoids and non-steroidal anti-inflammatories, aminoarylcarboxylic acid derivatives, arylacetic acid derivatives, arylbutyric acid derivatives, arylcarboxylic acids, derivatives of arylpropionic acid, pyrazoles, pyrazolones, derivatives of salicylic acid, thiacincarboxamides, eacetamidocaproic acid, S-adenosylmethionine, 3-amino-4-hydroxybutyric acid, amixetrin, bendazac, benzydamine, bucolome, diphenpyramide, ditazole, naorbonazone orgoteína, oxaceprol, paranilina, perisoxal, pifoxime, procazona, proxazol and tenidap.

In another embodiment, the compositions of the invention are administered in combination with a chemotherapeutic agent. Chemotherapeutic agents that can be administered with the therapeutic agents of the invention include, but are not limited to, antibiotic derivatives (eg, doxorubicin, bleomycin, daunorubicin and dactinomycin); antiestrogens (for example, tamoxifen); antimetabolites (for example, fluorouracil, 5-FU, methotrexate, floxuridine, interferon alfa-2b, glutamic acid, plicamycin, mercaptopurine and 6-thioguanine); cytotoxic agents (for example, carmustine, BCNU, lomustine, CCNU, cytosine arabinoside, cyclophosphamide, estramustine, hydroxyurea, procarbacin, mitomycin, busulfan, cisplatin and vincristine sulfate); hormones (eg, medroxyprogesterone, estramustine sodium phosphate, ethinyl estradiol, estradiol, megestrol acetate, methyltestosterone, diethylstilbestrol diphosphate, chlorotrianisene and testolactone); nitrogen mustard derivatives (for example, mefalen, chlorambucil, mechlorethamine (nitrogen mustard) and thiotepa); steroids and combinations (for example, betamethasone sodium phosphate); and others (for example, dicarbazine, asparaginase, mitotane, vincristine sulfate, vinblastine sulfate and etoposide).

In a specific embodiment, the Therapeutic agents of the invention are administered in combination with CHOP (cyclophosphamide, doxorubicin, vincristine and prednisone) or any combination of the CHOP components. In another embodiment, the Therapeutic agents of the invention are administered in combination with Rituximab. In a further embodiment, the therapeutic agents of the invention are administered with Rituxmab and CHOP, or Rituxmab and any combination of the CHOP components.

In a further embodiment, the Therapeutic agents of the invention are administered in combination with cytokines. Cytokines that can be administered with the Therapeutic agents of the invention include, but are not limited to, IL2, IL3, ILA, IL5, IL6, IL7, IL10, IL12, IL13, IL15, anti-CD40, CD40L, IFN-gamma and TNF- alpha. In another embodiment, The Therapeutic agents of the invention can be administered with any interleukin, including, but not limited to, IL-1alpha, IL-1beta, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, 1L-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL- 19, IL-20 and IL-21.

In a further embodiment, the Therapeutic agents of the invention are administered in combination with angiogenic proteins. Angiogenic proteins that can be administered with the Therapeutic agents of the invention include, but are not limited to, Glioma Derived Growth Factor (GDGF), as described in European Patent Number EP-399816; Platelet-derived Growth Factor A (PDGF-A), as described in European Patent Number EP-682110; Platelet-derived Growth Factor B (PDGF-B), as described in European Patent Number EP-282317; Placental Growth Factor (P1GF), as described in International Publication Number WO 92/06194; Placental Growth Factor 2 (PlGF-2), as described in Hauser et al., Growth Factors, 4: 259-268 (1993); Vascular Endothelial Growth Factor (VEGF), as described in International Publication Number WO 90/13649; Vascular Endothelial Growth Factor A (VEGFA), as described in European Patent Number EP-506477; Vascular Endothelial Growth Factor 2 (VEGF-2), as described in International Publication Number WO 96/39515; Vascular Endothelial Growth Factor B (VEGF-3); Vascular Endothelial Growth Factor B-186 (VEGF-B186), as described in International Publication Number WO 96/26736; Vascular Endothelial Growth Factor D (VEGF-D), as described in International Publication Number WO 98/02543; Vascular Endothelial Growth Factor D (VEGFD), as described in International Publication Number WO 98/07832; and Vascular Endothelial Growth Factor E (VEGF-E), as described in German Patent Number DE19639601. The aforementioned references are incorporated herein by reference.

5

fifteen

25

35

Four. Five

In a further embodiment, the Therapeutic agents of the invention are administered in combination with Hematopoietic Growth Factor. Hematopoietic Growth Factors that can be administered with the Therapeutic agents of the invention include, but are not limited to, LEUKINE ™ (SARGRAMOSTIM ™) and NEUPOGEN ™ (FILGRASTIM ™).

In a further embodiment, the Therapeutic agents of the invention are administered in combination with Fibroblast Growth Factors. Fibroblast Growth Factors that can be administered with the therapeutic agents of the invention include, but are not limited to, FGF-1, FGF-2, FGF-3, FGF-4, FGF-5, FGF-6, FGF-7, FGF-8, FGF-9, FGF-10, FGF-11, FGF-12, FGF-13, FGF-14 and FGF-15.

In other embodiments, the Therapeutic agents of the invention can be administered in combination with porcine or human insulin or mixtures thereof; insulin analogs; recombinant human insulin such as HUMULIN ™ and NOVOLIN ™; oral hypoglycemic agents such as ORAMIDE ™ and ORINASE ™ (tolbutamide), DIABINESE ™ (chlorpropamide), TOLAMIDE ™ and TOLINASE ™ (tolazamide), DYMELOR ™ (acetohexamide), glibenclamide, MICRONASE ™, DIBETA ™ and GLYNROLID (GLUCNROL) ™ (glipicide), and DIAMICRON ™ (gliclacida), GLUCOPHAGE ™ (metformin), PRECOSE ™ (acarbose), AMARYL ™ (glimepiride) and ciglitazone; thiazolidinediones (TZD) such as rosiglitazone, AVANDIA ™ (rosiglitazone maleate) ACTOS ™ (piogliatazone) and troglitazone; alpha-glucosidase inhibitors; bovine or porcine glucagon; somatostatins such as SANDOSTATIN ™ (octreotide); and diazoxides such as PROGLYCEM ™ (diazoxide). In yet other embodiments, the Therapeutic agents of the invention are administered in combination with one or more of the following: an antidiabetic agent of biguanide, an antidiabetic agent of glitazone and an antidiabetic agent of sulfonylurea.

In further embodiments, the Therapeutic agents of the invention are administered in combination with other therapeutic or prophylactic regimens, such as, for example, radiotherapy.

Example 29

Method for the Treatment of Reduced Levels of G-protein Chemokine Receptor

The present invention relates to a method of treating an individual in need of an increase in the level of a polypeptide of the invention in the body comprising administering to said individual a composition comprising a therapeutically effective amount of an agonist of the invention (including polynucleotides of the invention). In addition, it will be appreciated that conditions caused by a decrease in the level of conventional or normal expression of the G-protein Chemokine Receptor (CCR5) in an individual can be treated by administration of a G-protein Chemokine Receptor agonist (CCR5), preferably in the secreted form. Thus, the invention also provides a method of treating an individual in need of an increased level of G-protein Chemokine Receptor polypeptide (CCR5) which comprises administering to an individual such a Therapeutic agent comprising an amount of Receptor agonist. of G-protein Chemokine (CCR5) to increase the level of activity of the G-protein Chemokine Receptor (CCR5) in such an individual.

For example, a patient with decreased levels of G-protein Chemokine Receptor polypeptide (CCR5) receives a daily dose of 0.1-100 µg / kg of the agonist for six consecutive days. The exact details of the dosing schedule, based on administration and formulation, are provided in Example 28.

Example 30

Method for Treating Increased Levels of G-protein Chemokine Receptor

The present invention also relates to a method of treating an individual in need of a reduced level of a polypeptide of the invention in the body comprising administering to said individual a composition comprising a therapeutically effective amount of an antagonist of the invention (including polypeptides and antibodies of the invention).

In one example, antisense technology is used to inhibit the production of the G-protein Chemokine Receptor. This technology is an example of a method for reducing polypeptide levels of the G-protein Chemokine Receptor (CCR5), preferably a soluble form, due to a variety of etiologies, such as cancer.

For example, a patient diagnosed with abnormally elevated levels of G-protein Chemokine Receptor (CCR5) is given intravenously antisense polynucleotides at 0.5, 1.0, 1.5, 2.0 and 3.0 mg / kg day for 21 days. This treatment is repeated after a rest period of 7 days if the treatment was well tolerated. The antisense polynucleotide formulation is provided in Example 28.

Other methods to decrease the G-protein Chemokine Receptor (CCR5) or to inhibit its activity are described herein (such as in Example 57).

Example 31

Treatment Method Using Gene Therapy - Ex Vivo

A method of gene therapy transplants fibroblasts, which are capable of expressing G-protein Chemokine Receptor (CCR5) polypeptides to a patient. Generally, fibroblasts are obtained from a subject by skin biopsy. The resulting tissue is placed in tissue culture medium and separated into small parts. Small pieces of tissue are placed on a wet surface of a tissue culture flask, approximately ten parts are placed in each flask. The flask is turned, closed tightly and left at room temperature overnight. After 24 hours at room temperature, the flask is inverted and the pieces of tissue remain fixed to the bottom of the flask and fresh medium is added (for example Ham's F12 medium, with 10% FBS, penicillin and streptomycin). The flasks are then incubated at 37 ° C for about a week.

At this time, fresh medium is added and subsequently changed every several days. After an additional two weeks in culture, a monolayer of fibroblasts emerges. The monolayer is trypsinized and increased to larger flasks.

pMV-7 (Kirschmeier, PT et al., DNA, 7: 219-25 (1988)), flanked by long terminal repeats of the Moloney murine sarcoma virus, is digested with EcoRI and HindIII and subsequently treated with intestinal phosphatase calf The linear vector is fractionated on agarose gel and purified, using glass beads.

The DNA encoding the G-protein Chemokine Receptor (CCR5) can be amplified using PCR primers corresponding to the sequences of the 5 'and 3' ends respectively as set forth in Example 5. Preferably, the 5 'primer contains a EcoRI site and the 3 'primer includes a HindIII site. Equal amounts of the Moloney murine sarcoma virus linear main chain and the modified EcoRI and HindIII fragment are added together, in the presence of T4 DNA ligase. The resulting mixture is maintained under appropriate conditions for ligation of the two fragments. The ligation mixture is then used to transform HB101 bacteria, which are then plated in kanamycin-containing agar to confirm that the vector contains the appropriately inserted Chemokine G-receptor.

GP + am12 or pA317 amphotropic packing cells are grown in tissue culture to confluence density in Dulbecco Modified Eagle's Medium (DMEM) with 10% calf serum (CS), penicillin and streptomycin. The MSV vector containing the G protein Chemokine Receptor (CCR5) gene is then added to the medium and the packaging cells are transduced with the vector. Packaging cells now produce infectious viral particles that contain the G-protein Chemokine Receptor gene (CCR5) (the packaging cells are now called producing cells).

Fresh medium is added to the transduced producer cells and, subsequently, the medium is collected from a 10 cm plate of confluent producer cells. The medium used, which contains the infectious viral particles, is filtered through a membrane filter to remove separate producing cells and this medium is then used to infect fibroblast cells. The medium is removed from a subconfluent fibroblast plate and quickly replaced with the medium from the producing cells. This medium is removed and replaced with fresh medium. If the virus titre is high, then virtually all fibroblasts will be infected and no selection is needed. If the titration is very low, then it is necessary to use a retroviral vector that has a selectable marker, such as neo or his. Once the fibroblasts have been infected effectively, the fibroblasts are analyzed to determine if G-Chemokine Receptor protein (CCR5) is produced.

Genetically modified fibroblasts are then transplanted into the host, alone or after they have been cultured until confluence in cytodex 3 microcarrier beads.

Example 32

Gene Therapy Using Endogenous G-protein Chemokine Receptor Gene (CCR5)

Another method of gene therapy according to the present invention involves operatively associating the sequence of the endogenous G-protein Chemokine Receptor (CCR5) with a promoter by homologous recombination as described, for example, in U.S. Patent No. 5,641,670, issued June 24, 1997; International Publication No. WO 96/29411, published on September 26, 1996; International Publication No. WO 94/12650, published on August 4, 1994; Koller et al., Proc. Natl Acad. Sci. USA 86: 8932-8935 (1989); and Zijlstra et al., Nature 342: 435-438 (1989). This method involves the activation of a gene that is present in the target cells, but is not expressed in the cells or is expressed at a lower level than desired.

Polynucleotide constructs containing a promoter and targeting sequences are prepared, which are homologous to the 5 ’non-coding sequence of the endogenous G-protein Chemokine Receptor (CCR5), which flank the promoter. The targeting sequence will be sufficiently close to the 5 ′ end of the G-protein Chemokine Receptor (CCR5) so that the promoter will be operably linked to the endogenous sequence after homologous recombination. The promoter and address sequences can be amplified using PCR. Preferably, the amplified promoter contains specific restriction enzyme sites at the 5 'and 3' ends. Preferably, the 3 'end of the first address sequence contains the same restriction enzyme site as the 5' end of the amplified promoter and the 5 'end of the second address sequence contains the same restriction site as the 3' end of the amplified promoter.

The amplified promoter and amplified targeting sequences are digested with the appropriate restriction enzymes and subsequently treated with calf intestinal phosphatase. The digested promoter and digested targeting sequences are added together in the presence of T4 DNA ligase. The resulting mixture is maintained under appropriate conditions for ligation of the two fragments. The construction is fractionated by size on an agarose gel and then purified by phenol extraction and ethanol precipitation.

In this Example, polynucleotide constructs are administered as naked polynucleotides by electroporation. However, polynucleotide constructs can also be administered with transfection facilitating agents, such as liposomes, viral sequences, viral particles, precipitation agents, etc. Such delivery methods are known in the art.

Once the cells are transfected, homologous recombination will take place that will result in the promoter being operably linked to the endogenous G-protein Chemokine Receptor (CCR5) sequence. This results in the expression of the G-protein Chemokine Receptor (CCR5) in the cell. Expression can be detected by immunological staining or any other method known in the art.

Fibroblasts of a subject are obtained by skin biopsy. The resulting tissue is placed in DMEM + 10% fetal calf serum. Fibroblasts in exponential growth or early stationary phase are trypsinized and cleared of the plastic surface with nutrient medium. An aliquot of the cell suspension is removed for counting and the remaining cells are subjected to centrifugation. The supernatant is aspirated and the pellet is resuspended in 5 ml of electroporation buffer (20mM HEPES pH 7.3, 137 mM NaCl, 5 mM KCl, 0.7 mM Na2 HPO4, 6 mM dextrose). The cells are recentrifuged, the supernatant is aspirated and the cells are resuspended in electroporation buffer containing 1 mg / ml acetylated bovine serum albumin. The final cell suspension contains approximately 3X106 cells / ml. Electroporation should be performed immediately after resuspension.

Plasmid DNA is prepared according to conventional techniques. For example, to construct a plasmid to direct the locus of the G-protein Chemokine Receptor (CCR5), plasmid pUC18 (MBI Fermentas, Amherst, NY) is digested with HindIII. The CMV promoter is amplified by PCR with an XbaI site at the 5 'end and a BamHI site at the 3' end. Two non-coding sequences of the G-protein Chemokine Receptor (CCR5) are amplified by PCR: a non-coding sequence of the G-protein Chemokine Receptor (CCR5) (G-protein Chemokine Receptor fragment (CCR5) 1) is amplified with a HindIII site at the 5 'end and an Xba site at the 3' end; the other non-coding sequence of the G-protein Chemokine Receptor (CCR5) (fragment of the G-protein Chemokine Receptor (CCR5) 2) is amplified with a BamHI site at the 5 'end and a Hind III site at the 3' end . The CMV promoter and G-protein Chemokine Receptor fragments (CCR5) (1 and 2) are digested with the appropriate enzymes (CMV-XbaI and BamHI promoter; G-protein Chemokine Receptor fragments (CCR5) 1-XbaI fragments of the G-protein Chemokine Receptor (CCR5) 2 -BamHI) and ligated together. The resulting ligation product is digested with HindIII and ligated with the plasmid pUC18 digested with HindIII.

Plasmid DNA is added to a sterile cuvette with a 0.4 cm electrode gap (Bio-Rad). The final DNA concentration is generally at least 120 µg / ml. 0.5 ml of the cell suspension (containing approximately 1.5X106 cells) is then added to the cuvette and the cell suspension and the DNA solutions are mixed gently. Electroporation is performed with a Gene-Pulser (Bio-Rad) device. Training and voltage are set to 960 F and 250-300 V, respectively. As tension increases, cell survival decreases, but the percentage of surviving cells that stably incorporate the DNA introduced into the genome increases dramatically. Given these parameters, a pulse time of approximately 14-20 ms should be observed.

The electroporated cells are kept at room temperature for approximately 5 minutes and the contents of the cuvette are then gently removed with a sterile transfer pipette. The cells are added directly to 10 ml of preheated nutrient medium (DMEM with 15% calf serum) in a 10 cm plate and incubated at 37 degrees C. The next day, the medium is aspirated and replaced with 10 ml of medium fresh and incubated for an additional 16-24 hours.

Genetically engineered fibroblasts are then injected into the host, alone or after having been cultured until confluence in cytodex 3 microcarrier beads. Fibroblasts now produce the protein product. Fibroblasts can then be introduced into a patient as described above.

Example33

Treatment Method Using Gene Therapy - In Vivo

The use of in vivo gene therapy methods to treat diseases, disorders and conditions is also described. The method of gene therapy refers to the introduction of sequences of the Nucleic acid Chemokine Receptor G (CCR5) (DNA, RNA and DNA or antisense RNA) into an animal to increase or reduce the expression of the Receptor Polypeptide. G protein chemokine (CCR5). The G-protein Chemokine Receptor polynucleotide (CCR5) may be operably linked to a promoter or any other genetic element necessary for the expression of the G-protein Chemokine Receptor polypeptide (CCR5) by the target tissue. Such gene therapy and delivery techniques and methods are known in the art, see, for example, WO90 / 11092, WO98 / 11779; U.S. Patent No. 5693622, 5705151, 5580859; Tabata H. et al. (1997) Cardiovasc. Res. 35 (3): 470-479, Chao J et al. (1997) Pharmacol. Res. 35 (6): 517-522, Wolff J. A. (1997) Neuromuscul. Disord 7 (5): 314-318, Schwartz B. et al. (1996) Gene Ther. 3 (5): 405-411, Tsurumi Y. et al. (1996) Circulation 94 (12): 3281-3290 (incorporated herein by reference).

G-protein Chemokine Receptor polynucleotide constructs (CCR5) can be supplied by any method that supplies injectable materials to an animal's cells, such as injection into the interstitial space of tissues (heart, muscle, skin, lung, liver, intestine and the like). Polynucleotide constructs of the G-protein Chemokine Receptor (CCR5) can be supplied in a pharmaceutically acceptable liquid or aqueous vehicle.

The term "naked" polynucleotide, DNA or RNA refers to sequences that are without any delivery vehicle that acts to assist, promote or facilitate entry into cells, including viral sequences, viral particles, liposome formulations, lipofectin or agents. precipitation and the like However, G-protein Chemokine Receptor polynucleotides (CCR5) can also be supplied in liposome formulations (such as those taught in Felgner PL et al. (1995) Ann. NY Acad. Sci. 772: 126-139 and Abdallah B. et al. (1995) Biol. Cell 85 (1): 1-7) which can be prepared by methods well known to those skilled in the art.

The polynucleotide vector constructs of the G-protein Chemokine Receptor (CCR5) used in the gene therapy method are preferably constructs that will not be integrated into the host genome or contain sequences that allow replication. Any strong promoter known to those skilled in the art can be used to drive DNA expression. Unlike other gene therapies, a major advantage of introducing naked nucleic acid sequences into target cells is the transient nature of polynucleotide synthesis in cells. Studies have shown that non-replicating DNA sequences can be introduced into cells to provide production of the desired polypeptide for periods of up to six months.

The polynucleotide construct of the G-protein Chemokine Receptor (CCR5) can be delivered to the interstitial space of tissues within the animal, including muscle, skin, brain, lung, liver, spleen, bone marrow, thymus, heart, lymph, blood, bone , cartilage, pancreas, kidney, gallbladder, stomach, intestine, testis, ovary, uterus, rectum, nervous system, eye, gland and connective tissue. The interstitial space of the tissues comprises the intercellular fluid, mucopolysaccharide matrix between the reticular fibers of the organ tissues, elastic fibers in the walls of vessels or chambers, collagen fibers of fibrous tissues or that same matrix within connective tissue that Wraps muscle cells or bone gaps. It is similarly the space occupied by the plasma of the circulation and the lymphoid fluid of the lymphatic channels. The interstitial space supply of muscle tissue is preferred for the reasons discussed below. They can be conveniently delivered by injection into tissues comprising these cells. They are preferably supplied and expressed in non-dividing persistent cells that are differentiated although delivery and expression can be achieved in undifferentiated or less completely differentiated cells, such as, for example, blood stem cells or skin fibroblasts. Muscle cells in vivo are particularly competent in their ability to capture and express polynucleotides.

For injection of naked protein G Chemokine Receptor polynucleotide (CCR5), an effective dosage amount of DNA or RNA is in the range of about 0.05 g / kg body weight to about 50 mg / kg body weight . Preferably the dosage will be from about 0.05 mg / kg to about 20 mg / kg and more preferably from about 0.5 mg / kg to about 5 mg / kg. Of course, as the person skilled in the art will appreciate, this dosage will vary according to the tissue site of the injection. The appropriate and effective dosage of the nucleic acid sequence can easily be determined by those skilled in the art and may depend on the condition to be treated and the route of administration. The preferred route of administration is by the parenteral route of injection into the interstitial space of tissues. However, other parenteral routes can also be used, such as inhalation of an aerosol formulation particularly for delivery to the lungs or bronchial tissues, throat or mucous membranes of the nose. In addition, naked protein G Chemokine Receptor polynucleotide constructs (CCR5) can be delivered to arteries during angioplasty by the catheter used in the procedure.

The dose response effects of the G protein Chemokine Receptor polynucleotide (CCR5) injected into muscle in vivo is determined as follows. The template DNA of the G-protein Chemokine Receptor (CCR5) suitable for the production of mRNA encoding the G-protein Chemokine Receptor polypeptide (CCR5) is prepared according to a conventional recombinant DNA methodology. The template DNA, which can be circular or linear, is used as naked DNA or complexing with liposomes. The quadriceps muscles of mice are then injected with various amounts of the template DNA.

Male and female Balb / C mice from five to six weeks of age are anesthetized by intraperitoneal injection with 0.3 ml of 2.5% Avertin. A 1.5 cm incision is made in the anterior thigh and the quadriceps muscle is directly visualized. The template DNA of the G-protein Chemokine Receptor (CCR5) is injected into 0.1 ml of vehicle in a 1 cc syringe through a 27-gauge needle for one minute, approximately 0.5 cm from the insertion site distal muscle in the knee and approximately 0.2 cm deep. Sutures were placed on the injection site for future location and the skin is closed with stainless steel clips.

After an appropriate incubation time (for example, 7 days) muscle extracts are prepared by cleaving the entire quadriceps. Each fifth 15 µm cross section of the individual quadriceps muscles is stained histochemically with respect to protein expression of the G protein Chemokine Receptor (CCR5). A temporary sequence for protein expression of the G-protein Chemokine Receptor (CCR5) can be performed in a similar manner except that the quadriceps of different mice are collected at different times. The persistence of G-protein Chemokine Receptor DNA (CCR5) in muscle after injection can be determined by Southern blot analysis after preparing HIRT supernatants and total cell DNA from injected and control mice. The results of the previous experimentation in mice can be used to extrapolate appropriate dosages and other treatment parameters in humans and other animals using naked DNA from the G-protein Chemokine Receptor (CCR5).

Example 34

Transgenic Animals for the G-protein Chemokine Receptor (CCR5)

G-protein Chemokine Receptor (CCR5) polypeptides can also be expressed in transgenic animals. Animals of any species, including, but not limited to, mice, rats, rabbits, hamsters, guinea pigs, pigs, miniaturized pigs, goats, sheep, cows and nonhuman primates, for example, baboons, monkeys and chimpanzees can be used to generate animals transgenic The techniques described herein or otherwise known in the art are used to express polypeptides of the invention in humans, as part of a gene therapy protocol.

Any technique known in the art can be used to introduce the transgene (i.e., polynucleotides of the invention) into animals to produce the founding lines of transgenic animals. Such techniques include, but are not limited to, pronuclear microinjection (Paterson et al., Appl. Microbiol. Biotechnol. 40: 691-698 (1994); Carver et al., Biotechnology (NY) 11: 1263-1270 (1993); Wright et al., Biotechnology (NY) 9: 830-834 (1991); and Hoppe et al., U.S. Patent No. 4,873,191 (1989)); gene transfer mediated by retrovirus in germ lines (Van der Putten et al., Proc. Natl. Acad. Sci., USA 82: 6148-6152 (1985)), blastocysts or embryos; gene direction in embryonic stem cells (Thompson et al., Cell 56: 313-321 (1989)); electroporation of cells or embryos (Lo, 1983, Mol Cell. Biol. 3: 1803-1814 (1983)); introduction of polynucleotides using a gene gun (see, for example, Ulmer et al., Science 259: 1745 (1993); introducing nucleic acid constructs into embryonic pluripotential stem cells and transferring stem cells back to the blastocyst; and gene transfer sperm-mediated (Lavitrano et al., Cell 57: 717-723 (1989)); etc. For a review of such techniques, see Gordon, "Transgenic Animals," Intl. Rev. Cytol. 115: 171-229 (1989 ).

Any technique known in the art can be used to produce transgenic clones containing polynucleotides, for example, nuclear transparency in enucleated oocytes of embryonic, fetal or adult cultured resting resting nuclei (Campell et al., Nature 380: 64-66 ( 1996); Wilmut et al., Nature 385: 810-813 (1997)).

The present invention provides transgenic animals that carry the transgene in all their cells, as well as animals that carry the transgene in some, but not all of their cells, that is, mosaic or chimeric animals. The transgene can be integrated as a single transgene or as multiple copies such as in concatamers, for example, head-to-head or head-to-tail tandems. The transgene can also be introduced selectively and activated in a particular cell type following, for example, the teachings of Lasko et al. (Lasko et al., Proc. Natl. Acad. Sci. USA 89: 6232-6236 (1992)). The regulatory sequences required for a specific activation of such a cell type will depend on the particular cell type of interest and will be apparent to those skilled in the art. When it is desired that the polynucleotide transgene be integrated into the chromosomal site of the endogenous gene, gene targeting is preferred.

Briefly, when such a technique is to be used, vectors are designed that contain some nucleotide sequences homologous to the endogenous gene in order to integrate, by homologous recombination, chromosomal consequences, and alter the nucleotide sequence function of the endogenous gene. The transgene can also be selectively introduced into a particular cell type, thereby inactivating the endogenous gene only in that cell type, following, for example, the teachings of Gu et al. (Gu et al., Science 265: 103-106 (1994)). The regulatory sequences required for a specific cell type activation will depend on the particular cell type of interest and will be apparent to those skilled in the art.

In addition to expressing the polypeptide in a ubiquitous or tissue-specific manner in transgenic animals, it would also be routine for a person skilled in the art to generate constructs that regulate the expression of the polypeptide by a variety of other means (eg, developmentally or chemically regulated expression ).

Once transgenic animals have been generated, recombinant gene expression can be assayed using conventional techniques. Initial screening can be achieved by Southern blot analysis or PCR techniques to analyze animal tissues to verify that transgene integration has taken place. The level of transgene mRNA expression in the tissues of transgenic animals can also be assessed using techniques that include, but are not limited to, Northern blot analysis of tissue samples obtained from the animal, in situ hybridization analysis and reverse transcriptase PCR. (rt-PCR). Tissue samples expressing transgenic gene can also be evaluated immunocytochemically or immunohistochemically using antibodies specific for the transgenic product.

Once the founding animals have been produced, they can be raised, generated by inbreeding, generated by exogamy or crossed to produce colonies of the particular animal. Examples of such breeding strategies include, but are not limited to: exogamy of founding animals with more than one integration site to establish separate lines; inbreeding of separate lines to produce transgenic compounds that express the transgene at higher levels due to the effects of the additive expression of each transgene; crossing of heterozygous transgenic animals to produce homozygous animals for a given integration site to increase expression and eliminate the need to explore animals by DNA analysis; crossing separate homozygous lines to produce homozygous or heterozygous compound lines; and breeding to place the transgene in a different background that is appropriate for an experimental model of interest.

Transgenic animals have uses that include, but are not limited to, animal model systems useful for developing the biological function of G-protein Chemokine Receptor polypeptides (CCR5), studying diseases, disorders and / or conditions associated with aberrant expression of the Receptor of G protein chemokine (CCR5) and to explore with respect to compounds effective in relieving such diseases, disorders and / or conditions.

Example 35

Knock-Out Animals for G-protein Chemokine Receptor (CCR5).

The expression of the endogenous G protein Chemokine Receptor (CCR5) gene can also be reduced by inactivating or knocking out with the G protein Chemokine Receptor gene (CCR5) and / or its promoter using homologous directed recombination (for example , see Smithies et al., Nature 317: 230-234 (1985); Thomas & Capecchi, Cell 51: 503-512 (1987); Thompson et al., Cell 5: 313-321 (1989). For example, you can a mutant non-functional polynucleotide of the invention (or a non-related DNA sequence at all) flanked by DNA homologous to the endogenous polynucleotide sequence (the coding regions or regulatory regions of the gene), with or without a selectable marker and / or a negative selectable marker, to transfect cells that express polypeptides of the invention in vivo Techniques known in the art are used to generate knock out in cells that contain, but do not express the gene of interest. n DNA, by targeted homologous recombination, results inactivation of the target gene. Such approaches are particularly suitable in research and fields of agriculture in which embryonic stem cell modifications can be used to generate animal offspring with an inactive target gene (for example, see Thomas & Capecchi 1987 and Thompson 1989, mentioned above). However, this approach can be routinely adapted for use in humans provided that recombinant DNA constructs are administered directly or directed to the required site in vivo using appropriate viral vectors that will be apparent to those skilled in the art.

Cells that are engineered to express the CCR5 polypeptides or, alternatively, that are engineered to not express the CCR5 polypeptides (e.g., knockouts) are administered to a patient in vivo. Such cells can be obtained from the patient (i.e., animal, including human) or a compatible MHC donor and may include, but are not limited to, fibroblasts, bone marrow cells, blood cells (e.g., lymphocytes), adipocytes, cells muscle, endothelial cells, etc. Cells are engineered in vitro using recombinant DNA techniques to introduce the polypeptide coding sequence into cells or, alternatively, alter the endogenous coding sequence and / or regulatory sequence associated with CCR5 polypeptides, for example, by transduction (using viral vectors and preferably vectors that integrate the transgene into the cell genome) or transfection procedures, including, but not limited to, the use of plasmids, cosmic, YAC, naked DNA, electroporation, liposomes, etc. The coding sequence of the CCR5 polypeptides can be placed under the control of a strong inducible or constitutive promoter or promoter / enhancer to achieve expression, and preferably secretion, of the G-protein Chemokine Receptor polypeptides (CCR5). Genetically engineered cells that express and secrete CCR5 polypeptides can be introduced into the patient systemically, for example, into the circulation or intraperitoneally.

Alternatively, cells can be incorporated into a matrix and implanted in the body, for example, genetically engineered fibroblasts can be implanted as part of a skin graft; Genetic engineering modified endothelial cells can be implanted as part of a lymphatic or vascular graft (see, for example, Anderson et al. U.S. Patent No. 5,399,349; and Mulligan & Wilson, U.S. Patent No. 5,460,959).

When the cells to be administered are non-MHC-compatible or non-autologous cells, they can be administered using well known techniques that prevent the development of a host immune response against the introduced cells. For example, cells can be introduced in an encapsulated form that, while allowing an exchange of components with the immediate extracellular environment, does not allow introduced cells to be recognized by the host's immune system.

Knock-out animals have uses that include, but are not limited to, animal model systems useful for developing the biological function of G-protein Chemokine Receptor polypeptides (CCR5), studying diseases, disorders and / or conditions associated with aberrant expression of Chemokine G-protein receptor (CCR5) and to explore for compounds effective in relieving such diseases, disorders and / or conditions.

Example 36

Trials Detecting Stimulation or Inhibition of Proliferation and Differentiation of B Lymphocytes

The generation of functional humoral immune responses requires soluble and related signaling between B-line lymphocytes and their microenvironment. The signals can provide a positive stimulus that allows a B-line lymphocyte to continue its programmed development or a negative stimulus that induces the cell to stop its current development path. To date, numerous stimulatory and inhibitory signals have been found to influence B lymphocyte responses including IL-2, IL-4, IL-5, IL-6, IL-7, IL10, IL-13, IL-14 and IL-15. Interestingly, these signals are themselves weak effectors but can, in combination with various costimulatory proteins, induce activation, proliferation, differentiation, direction, tolerance and death among B lymphocyte populations.

One of the best studied classes of B-lymphocyte co-stimulatory proteins is the TNF superfamily. Within this family it has been discovered that CD40, CD27 and CD30 together with their respective ligands CD154, CD70 and CD153 regulate a variety of immune responses. Assays that allow the detection and / or observation of the proliferation of differentiation of these populations of B lymphocytes and their precursors are valuable tools to determine the effects that various proteins can have on these populations of B lymphocytes in terms of proliferation and differentiation. Listed below are two assays designed to allow the detection of differentiation, proliferation or inhibition of B-lymphocyte populations and their precursors.

In Vitro Assay: Purified G protein Chemokine Receptor Protein (CCR5), or truncated forms thereof, or purified Protein G Chemokine Receptor ligand (CCR5) is evaluated for its ability to induce activation, proliferation, differentiation or inhibition and / or death in populations of B lymphocytes and their precursors. The protein activity of the G-protein Chemokine Receptor (CCR5) in human tonsil B cells, measured qualitatively in the dose range of 0.1 to 10,000 ng / ml, is evaluated in a conventional B-cell costimulation assay. in which purified lymphocyte B lymphocytes are cultured in the presence of Staphylococcus aureus Cowan I (SAC) fixed with formalin or immobilized human anti-IgM antibody as the sensitizing agent. Second signals such as IL-2 and IL-15 act synergistically with SAC and IgM cross-linking to induce B lymphocyte proliferation as measured by tritiated thymidine incorporation. New synergistic agents can easily be identified using this assay. The assay involves isolating B lymphocytes from human tonsils by depletion with magnetic beads (MACS) of CDR positive cells. The resulting cell population is greater than 95% of B lymphocytes as assessed by CD45R expression (B220).

Various dilutions of each sample are placed in individual wells of a 96-well plate to which 105 B lymphocytes suspended in culture medium are added (RPMI 1640 containing 10% FBS, 2ME 5 X 10-5 M, 100 U penicillin / ml, streptomycin 10 µg / ml and 10-5 dilution of SAC) in a total volume of 150 µl. Proliferation or inhibition is quantified by a pulse of 20 hours (1 Ci / well with 3H-thymidine (6.7 Ci / mM) starting 72 hours after factor addition. Positive and negative controls are IL2 and a half respectively .

In Vivo Assay: BALB / c (ip) mice are injected twice daily with buffer alone or protein from the G-protein Chemokine Receptor (CCR5) 2 mg / Kg or truncated forms thereof or ligand from the Chemokine Receptor protein G (CCR5). Mice receive this treatment for 4 consecutive days, at which time they are sacrificed and various tissues and serum are collected for analysis. Comparison of the hematoxylin and eosin sections of spleens treated with G protein Chemokine Receptor protein (CCR5) and normal identifies the results of G protein Chemokine Receptor protein (CCR5) activity in spleen cells, such as the diffusion of periarterial lymphatic envelopes and / or significant increases in the nucleated cellularity of the red pulp regions, which may indicate the activation of differentiation and proliferation of B lymphocyte populations. Immunohistochemical studies using a marker of B lymphocytes, anti-CD45R (B220), to determine if any physiological change of spleen cells, such as disorganization of the spleen, is due to an increased representation of B lymphocytes within areas of slightly defined B lymphocytes that infiltrate regions of established T lymphocytes.

Flow cytometric analyzes of the spleens of mice treated with G-protein Chemokine Receptor protein (CCR5) are used to indicate whether G-protein Chemokine Receptor protein (CCR5) specifically increases the proportion of ThB + B lymphocytes, without CD45R (B220) versus that observed in control mice.

Similarly, a predicted consequence of increased representation of mature B lymphocytes in vivo is a relative increase in serum Ig titers. Accordingly, serum IgM and IgA levels are compared between buffer and mice treated with G-Chemokine Receptor protein (CCR5).

The studies described in this example test the activity in the G-protein Chemokine Receptor protein (CCR5). However, one skilled in the art could easily modify the exemplified studies to test the polynucleotide activity of the G-protein Chemokine Receptor (CCR5) (eg, gene therapy), agonists (including ligands) and / or Receptor antagonists. Chemokine protein G.

Example 37

T Lymphocyte Proliferation Assay

A CD3-induced proliferation assay in PBMC is performed and measured by 3H-thymidine uptake. The test is performed as follows. 96-well plates are coated with 100 µl / well mAb for CD3 (HIT3a, Pharmingen) or coincident isotype control mAb (B33.1) overnight at 4 ° C (1 µg / ml in 0.05 M bicarbonate buffer, pH 9.5), then washed three times with PBS. PBMCs are isolated by F / H gradient centrifugation of human peripheral blood and added to quadruplicate wells (5 x 104 / well) of mAb coated plates in RPMI containing 10% FCS and P / S in the presence of various concentrations of Chemokine Receptor protein G protein (CCR5) (total volume 200 µl). The relevant protein buffer and the medium are only controls. After 48 hours of culture at 37 ° C, the plates are centrifuged for 2 minutes at 1000 rpm and 100 µl of the supernatant is removed and stored at -20 ° C for measurement of IL-2 (or other cytokines) if effect on the proliferation. The wells are supplemented with 100 µl of medium containing 0.5 µCi of 3H-thymidine and grown at 37 ° C for 18-24 hours. The wells are collected and the incorporation of 3H-thymidine is used as a measure of proliferation. Anti-CD3 is only the positive control for proliferation. IL-2 (100 U / ml) is also used as a control that enhances proliferation. Control antibody that does not induce T lymphocyte proliferation is used as the negative control for the protein effects of the G protein Chemokine Receptor (CCR5).

The studies described in this example test the activity in the G-protein Chemokine Receptor protein (CCR5). However, one skilled in the art could easily modify the exemplified studies to test the polynucleotide activity of the G-protein Chemokine Receptor (CCR5) (eg, gene therapy), agonists (including ligands) and / or Receptor antagonists. Chemokine protein G.

Example 38

Effect of G-protein Chemokine Receptor (CCR5) on the Expression of MHC Class II, Costimulatory Molecules and Cell Adhesion and Differentiation of Monocytes and Monocyte Derived Human Dendritic Cells

Dendritic cells are generated by the expansion of proliferative precursors found in peripheral blood: adherent PBMC or elutriated monocytic fractions are grown for 7-10 days with GM-CSF (50 ng / ml) and IL-4 (20 ng / ml). These dendritic cells have the characteristic immature cell phenotype (expression of CD1, CD80, CD86, CD40 and MHC class II antigens). Treatment with activation factors, such as TNF- causes a rapid change in the surface phenotype (increased expression of MHC class I and II, costimulatory and adhesion molecules, negative FCRII regulation, positive regulation of CD83). These changes are correlated with an increased antigen presentation capacity and with functional maturation of dendritic cells.

FACS analysis of surface antigens is performed as follows. Cells are treated 1-3 days with increasing concentrations of G-protein Chemokine Receptor (CCR5) or a ligand thereof or LPS (positive control), washed with PBS containing 1% BSA and 0.02 mM sodium azide and they are then incubated with 1:20 dilution of appropriate FITC or PE labeled monoclonal antibodies for 30 minutes at 4 ° C. After further washing, the labeled cells are analyzed by flow cytometry in a FACScan (Becton Dickinson).

Effect on cytokine production. Cytokines generated by dendritic cells, in particular IL-12, are important in the initiation of T-lymphocyte-dependent immune responses. IL-12 strongly influences the development of the Thl helper T lymphocyte immune response and induces the function of NK cells and cytotoxic T lymphocytes. An ELISA is used to measure the release of IL-12 as follows. Dendritic cells (106 / ml) are treated with increasing concentrations of G-protein Chemokine Receptor (CCR5) for 24 hours. LPS (100 ng / ml) is added to the cell culture as a positive control. Supernatants are then collected from cell cultures and analyzed for IL-12 content using commercial ELISA kit (eg, R&D Systems (Minneapolis, MN)). Conventional protocols provided with the kits are used.

Effect on the expression of MHC Class II, costimulatory and adhesion molecules. Three main families of cell surface antigens can be identified in monocytes: adhesion molecules, molecules involved in antigen presentation and Fc receptor. Modulation of the expression of MHC class II antigens and other costimulatory molecules, such as B7 and ICAM-1, may result in changes in the ability to present monocyte antigens and the ability to induce T lymphocyte activation. Fc receptor expression can be correlated with improved cytotoxic monocyte activity, cytokine release and phagocytosis.

FACS analysis is used to examine surface antigens as follows. Monocytes are treated 1-5 days with increasing concentrations of G-protein Chemokine Receptor (CCR5) or LPS (positive control), washed with PBS containing 1% BSA and 0.02 mM sodium azide and then incubated with dilution 1 : 20 of appropriate FITC or PE labeled monoclonal antibodies for 30 minutes at 4 ° C. After further washing, the labeled cells are analyzed by flow cytometry in a FACScan (Becton Dickinson).

Monocyte activation and / or increased survival. Assays are known in the art for molecules that activate (or alternatively, inactivate) monocytes and / or increase monocyte survival (or alternatively, decrease monocyte survival) and can be routinely applied to determine if a molecule of the The invention acts as a monocyte inhibitor or activator. G-protein Chemokine Receptor (CCR5), agonists or antagonists of G-protein Chemokine Receptor (CCR5) can be screened using the three assays described below. For each of these assays, peripheral blood mononuclear cells (PBMC) are purified from single donor leukocyte packages (American Red Cross, Baltimore, MD) by centrifugation through a Histopaque gradient (Sigma). PBMC monocytes are isolated by countercurrent centrifugation elutriation.

Monocyte Survival Test. Monocytes of human peripheral blood progressively lose viability when grown in the absence of serum or other stimuli. His death results from an internally regulated procedure (apoptosis). The addition to the culture of activating factors, such as TNF-alpha dramatically improves cell survival and prevents DNA fragmentation. Staining with propidium iodide (PI) is used to measure apoptosis as follows. Monocytes are cultured for 48 hours in polypropylene tubes in serum-free medium (positive control), in the presence of 100 ng / ml TNF-alpha (negative control) and in the presence of various concentrations of the compound to be tested. The cells are suspended at a concentration of 2 x 106 / ml in PBS containing PI at a final concentration of 5 µg / ml and then incubated at room temperature for 5 minutes before analysis with FACScan. It has been shown that IP uptake correlates with DNA fragmentation in this experimental paradigm.

Effect on cytokine release. An important function of monocytes / macrophages is their regulatory activity on other cellular populations of the immune system through the release of cytokines after stimulation. An ELISA is performed to measure cytokine release as follows. Human monocytes are incubated at a density of 5x105 cells / ml with increasing concentrations of the G-protein Chemokine Receptor (CCR5) and under the same conditions, but in the absence of the G-protein Chemokine Receptor. For IL-12 production, cells are stimulated overnight with IFN (100 U / ml) in the presence of G-protein Chemokine Receptor (CCR5). LPS (10 ng / ml) is then added. Conditioned media are collected after 24 hours and kept frozen until use. TNF-alpha, IL-10, MCP-1 and IL-8 are then measured using a commercially available ELISA kit (for example, R&D Systems (Minneapolis, MN)) and applying the conventional protocols provided with the kit

Oxidative Explosion Purified monocytes are seeded in 96-well plates at 2-1x105 cells / well. Increasing concentrations of the G-protein Chemokine Receptor (CCR5) are added to the wells in a total volume of 0.2 ml of culture medium (RPMI 1640 + 10% FCS, glutamine and antibiotics). After 3 days of incubation, the plates are centrifuged and the medium is removed from the wells. To the macrophage monolayers, 0.2 ml are added per well of phenol red solution (140 mM NaCl, 10 mM potassium phosphate buffer pH 7.0, 5.5 mM dextrose, 0.56 mM phenol red and HRPO 19 U / ml) together with the stimulator (PMA 200 nM). The plates are incubated at 37 ° C for 2 hours and the reaction is stopped by adding 20 µl of 1 N NaOH per well. The absorbance is read at 610 nM. To calculate the amount of H2O2 produced by macrophages, a standard curve of an H2O2 solution of known molarity is performed for each experiment.

The studies described in this example test the activity in the G-protein Chemokine Receptor protein (CCR5). However, one skilled in the art could easily modify the exemplified studies to test the polynucleotide activity of the G-protein Chemokine Receptor (CCR5) (eg, gene therapy), agonists (including ligands) and / or Receptor antagonists. Chemokine protein G.

Example 39

Biological Effects of the G-protein Chemokine Receptor (CCR5)

Neuronal and Astrocyte Assays

The recombinant G-protein Chemokine Receptor (CCR5), expressed in Escherichia coli and purified as described above, can be tested for activity in promoting survival, neurite growth or phenotypic differentiation of cortical neuronal cells and with respect to induce proliferation of immunopositive cells for glial fibrillar acid proteins, astrocytes. The selection of cortical cells for the bioassay is based on the prevalent expression of FGF-1 and FGF-2 in cortical structures and on the previously indicated increase in cortical neuronal survival resulting from treatment with FGF-2. A thymidine incorporation assay, for example, can be used to elucidate the activity of the G-protein Chemokine Receptor in these cells.

In addition, previous reports describing the biological methods of FGF-2 (basic FGF) in cortical or hippocampal neurons in vitro have shown increases in neuronal survival and neurite growth (Walicke, P. et al., "Fibroblast growth factor promotes survival of dissociated hippocampal neurons and enhances neurite extension. "Proc. Natl. Acad. Sci. USA 83: 3012-3016. (1986)). However, reports of experiments conducted on PC-12 cells suggest that these two responses are not necessarily synonymous and may depend not only on what FGF is tested but also on which receptor or receptors are expressed in the target cells. Using the primary cortical neuronal culture paradigm, the ability of the G-protein Chemokine Receptor (CCR5) to induce neurite growth can be compared with the response achieved with FGF-2 using, for example, a thymidine incorporation assay.

Endothelial cell and fibroblast assays

Human lung fibroblasts are obtained from Clonetics (San Diego, CA) and maintained in the middle of Clonetics growth. Dermal microvascular cells are obtained from Cell Applications (San Diego, CA). For proliferation assays, human lung fibroblasts and dermal microvascular endothelial cells can be cultured at 5,000 cells / well in a 96-well plate for a day in growth medium. The cells are then incubated for one day in 0.1% BSA basal medium. After replacing the medium with 0.1% fresh BSA medium, the cells are incubated with the test proteins for 3 days. Alamar Blue (Alamar Biosciences, Sacramento, CA) is added to each well to a final concentration of 10%. The cells are incubated for 4 hours. Cell viability is measured by reading in a CytoFluor fluorescence reader. For PGE2 assays, human lung fibroblasts are cultured at 5,000 cells / well in a 96-well plate for one day. After a change of medium to 0.1% BSA basal medium, the cells are incubated with FGF-2 or G-protein Chemokine Receptor (CCR5) with or without IL-1 for 24 hours. Supernatants are collected and tested for PGE2 by EIA kit (Cayman, Ann Arbor, MI). For IL-6 assays, human lung fibroblasts are cultured at 5,000 cells / well in a 96-well plate for one day. After a change of medium to 0.1% BSA basal medium, the cells are incubated with FGF-2 or G-protein Chemokine Receptor (CCR5) with or without IL-1 for 24 hours. Supernatants are collected and tested with respect to IL-6 by ELISA kit (Endogen, Cambridge, MA).

Human lung fibroblasts are cultured with FGF-2 or G-protein Chemokine Receptor (CCR5) for 3 days in basal medium before the addition of Alamar Blue to assess effects on fibroblast growth. FGF-2 should show a stimulation at 10-200 ng / ml that can be used to compare stimulation with G-protein Chemokine Receptor.

Parkinson's models.

The loss of motor function in Parkinson's disease is attributed to a deficiency of striated dopamine resulting from the degeneration of nigrostriated dopamine projection neurons. An animal model for Parkinson's that has been thoroughly characterized involves the systemic administration of 1-methyl-4 phenyl 1,2,3,6-tetrahydropyridine (MPTP). In the CNS, MPTP is captured by astrocytes and catabolized by monamine oxidase B to 1-methyl-4-phenyl pyridine (MPP +) and released. Subsequently, MPP + is actively accumulated in dopaminergic neurons by the high affinity reuptake transporter for dopamine. MPP + is then concentrated in mitochondria by the electrochemical gradient and selectively inhibits nicotidamide adenine diphosphate: ubiquinone oxidoreductase (complex I), thereby interfering with electron transport and eventually generating oxygen radicals.

It has been demonstrated in tissue culture paradigms that FGF-2 (basic FGF) has trophic activity towards dopaminergic neurons of the black substance (Ferrari et al., Dev. Biol. 1989). Recently, Dr. Unsicker's group has shown that the administration of FGF-2 in gel foam implants in the striatum results in the almost complete protection of black substance dopaminergic neurons from toxicity associated with MPTP exposure (Otto and Unsicker, J. Neuroscience, 1990).

Based on the data with FGF-2, the G-protein Chemokine Receptor (CCR5) can be evaluated to determine if it has an action similar to that of FGF-2 in increasing survival of in vitro dopaminergic neurons and can also be tested in vivo with respect to protection of dopaminergic neurons in the striatum from damage associated with MPTP treatment. The potential effect of the G-protein Chemokine Receptor (CCR5) is first examined in vitro in a cell culture paradigm of dopaminergic neurons. Cultures are prepared by dissecting the basal plate of the midbrain from Wistar rat embryos on day 14 of gestation. The tissue dissociates with trypsin and is sown at a density of 200,000 cells / cm2 in glass coverslips coated with polyortinin-laminin. The cells are maintained in Dulbecco's Modified Eagle medium and F12 medium containing hormonal supplements (N1). The cultures are fixed with paraformaldehyde after 8 days in vitro and processed with respect to tyrosine hydroxylase, a specific marker for dopaminergic neurons, immunohistochemical staining. Dissociated cell cultures of embryonic rats are grown. The culture media are changed every three days and the factors are also added at that time.

Since dopaminergic neurons are isolated from animals on gestation day 14, a developmental time that is subsequent to the stage at which dopaminergic precursor cells are proliferating, an increase in the number of immunopositive neurons for tyrosine hydroxylase would represent an increase in the number of dopaminergic neurons that survive in vitro. Therefore, if the G-protein Chemokine Receptor (CCR5) acts to prolong the survival of dopaminergic neurons, it would be suggested that the G-protein Chemokine Receptor (CCR5) may be involved in Parkinson's Disease.

The studies described in this example test activity in the G-protein Chemokine Receptor protein (CCR5). However, one skilled in the art could easily modify the exemplified studies to test the polynucleotide activity of the G-protein Chemokine Receptor (CCR5) (eg, gene therapy), agonists (including ligands) and / or Receptor antagonists. G protein chemokine (CCR5).

Example 40

The Effect of the G-protein Chemokine Receptor (CCR5) on the Growth of Vascular Endothelial Cells

On day 1, human umbilical vein endothelial cells (HUVEC) are seeded at a density of 2-5x104 cells / 35 mm plate in M199 medium containing 4% fetal bovine serum (FBS), 16 units / ml heparin and supplements of endothelial cell growth 50 units / ml (ECGS, Biotechnique, Inc.). On day 2, the medium is replaced with M199 containing 10% FBS, 8 units / ml heparin. Protein Chemokine Receptor protein G (CCR5) of SEQ ID NO: 2 or SEQ ID NO: 22, and positive controls, such as VEGF and basic FGF (bFGF), are added at different concentrations. On days 4 and 6 the medium is replaced. On day 8, the number of cells is determined with a Coulter Counter.

An increase in the number of HUVEC cells indicates that the G-protein Chemokine Receptor (CCR5) can proliferate vascular endothelial cells.

The studies described in this example test the activity in the G-protein Chemokine Receptor protein (CCR5). However, one skilled in the art could easily modify the exemplified studies to test the polynucleotide activity of the G-protein Chemokine Receptor (CCR5) (eg, gene therapy), agonists (including ligands) and / or Receptor antagonists. G protein chemokine (CCR5).

Example 41

Stimulatory Effects of G-protein Chemokine Receptor (CCR5) on Proliferation of Vascular Endothelial Cells

For the evaluation of mitogenic activity of growth factors, the MTS colorimetric test (3 (4,5-dimethylthiazol-2-yl) -5- (3-carboxymethoxyphenyl) -2- (4-sulfophenyl) 2H-tetrazolium is performed ) with the electron coupling reagent PMS (phenacin methosulfate) (CellTiter 96 AQ, Promega). The cells are seeded in a 96-well plate (5,000 cells / well) in 0.1 ml of serum supplemented medium and allowed to bind overnight. After serum deprivation for 12 hours in 0.5% FBS, the conditions (bFGF, VEGF165 or G-protein Chemokine Receptor (CCR5) in 0.5% FBS) with or without Heparin (8 U / ml) are added to the wells for 48 hours. 20 mg of MTS / PMS mixture (1: 0.05) are added per well and allowed to incubate for 1 hour at 37 ° C before measuring absorbance at 490 nm in an ELISA plate reader. The background absorbance of the control wells (some medium, without cells) is subtracted and seven wells are made in parallel for each condition. See, Leak et al. In Vitro Cell. Dev. Biol. 30A: 512-518 (1994).

The studies described in this example test activity in the G-protein Chemokine Receptor protein (CCR5). However, one skilled in the art could easily modify the exemplified studies to test the polynucleotide activity of the G-protein Chemokine Receptor (CCR5) (eg, gene therapy), agonists (including ligands) and / or Receptor antagonists. G protein chemokine (CCR5).

Example 42

Endothelial Migration Stimulation

This example will be used to explore the possibility that the G-protein Chemokine Receptor (CCR5) can stimulate lymphatic endothelial cell migration.

Endothelial cell migration assays are performed using a 48-well microchemotaxis chamber (Neuroprobe Inc., Cabin John, MD; Falk, W., et al., J. Immunological Methods 1980; 33: 239-247). Polycarbonate filters without polyvinylpyrrolidone with a pore size of 8 µm (Nucleopore Corp. Cambridge, MA) are coated with 0.1% gelatin for at least 6 hours at room temperature and dried in sterile air. Test substances are diluted to appropriate concentrations in M199 supplemented with 0.25% bovine serum albumin (BSA) and 25 µl of the final dilution is placed in the lower chamber of the modified Boyden apparatus. HUVEC or BMEC cultures of early pass (2-6) subconfluents are washed and trypsinized for the minimum time required to achieve cell separation. After placing the filter between the upper and lower chamber, 2.5 x 105 cells suspended in 50 µl of M199 containing 1% FBS are seeded in the upper compartment. The apparatus is then incubated for 5 hours at 37 ° C in a humidified chamber with 5% CO2 to allow cell migration. After the incubation period, the filter is removed and the upper face of the filter is scraped with the non-migrated cells with a rubber tip rod. The filters are fixed with methanol and stained with a solution of Giemsa (Diff-Quick, Baxter, McGraw Park, IL). Migration is quantified by counting cells from three random high-power fields (40x) in each well and all groups are performed in quadruplicate.

The studies described in this example test the protein activity of the G-protein Chemokine Receptor (CCR5). However, one skilled in the art could easily modify the exemplified studies to test the polynucleotide activity of the G-protein Chemokine Receptor (CCR5) (eg, gene therapy), agonists (including ligands) and / or Receptor antagonists. G protein chemokine (CCR5).

Example 43

Effect of G-protein Chemokine Receptor (CCR5) on Tube Formation in Angiogenesis

Another stage in angiogenesis is the formation of tubes, marked by the differentiation of endothelial cells. This bioassay measures the ability of microvascular endothelial cells to form capillary-like structures (hollow structures) when grown in vitro.

CADMEC (microvascular endothelial cells) are obtained from Cell Applications, Inc. as proliferative cells (pass 2) and grown in Cell Applications CADMEC growth medium and used in step 5. For the in vitro angiogenesis assay, wells of a 48-well cell culture plate is coated with Cell Applications Binding Factor Medium (200 ml / well) for 30 minutes at 37 ° C. CADMECs are seeded on the coated plates at 7500 cells / well and grown overnight in growth medium. The growth medium is then replaced with 300 mg of Cell Applications Tube Formation Medium containing control buffer or G-protein Chemokine Receptor (CCR5) (0.1 to 100 ng / ml) and the cells are cultured for 48 additional hours. The numbers and lengths of capillary tubes are quantified through the use of the Boeckeler VIA-170 video image analyzer. All tests are performed in triplicate.

Commercial VEGF (50 ng / ml) commercial (R&D) is used as a positive control. B-steradiol (1 ng / ml) is used as a negative control. The appropriate buffer (without protein) is also used as a control.

The studies described in this example test the protein activity of the G-protein Chemokine Receptor (CCR5). However, one skilled in the art could easily modify the exemplified studies to test the polynucleotide activity of the G-protein Chemokine Receptor (CCR5) (eg, gene therapy), agonists (including ligands) and / or Receptor antagonists. G protein chemokine (CCR5).

Example 44

Angiogenic Effect on Chicken Chorioallantoid Membrane

Chicken Choriolantoid Membrane (CAM) is a well established system to examine angiogenesis. The formation of blood vessels in CAM is easily visible and quantifiable. The ability of the G-protein Chemokine Receptor (CCR5) or a ligand thereof to stimulate angiogenesis in CAM can be examined.

Fertilized eggs of chicken Leghorn (Gallus gallus) and Japanese quail (Coturnix coturnix) are incubated at 37.8 ° C and 80% humidity. Differentiated CAMs of 16-day chicken and 13-day quail embryos are studied with the following methods.

On day 4 of development, a window is made in the eggshell of chicken eggs. Embryos are checked for normal development and the eggs are sealed with masking tape. They are further incubated until day 13. Thermanox coverslips (Nunc, Naperville, IL) are cut into discs approximately 5 mm in diameter. Salt and sterile growth factors are dissolved in distilled water and approximately 3.3 mg / 5 ml are pipetted into the discs. After air drying, inverted discs are applied in CAM. After 3 days, the test samples are fixed in 3% glutaraldehyde and 2% formaldehyde and rinsed in 0.12 M sodium cacodylate buffer. Photographed with a stereo microscope [Wild M8] and included for semi-ultra-thin sectioning. as described above. Controls are performed with support discs only.

The studies described in this example test protein activity of the G-protein Chemokine Receptor (CCR5). However, one skilled in the art could easily modify the exemplified studies to test the polynucleotide activity of the G-protein Chemokine Receptor (CCR5) (eg, gene therapy), agonists (including ligands) and / or Receptor antagonists. G protein chemokine (CCR5).

Example 45

Angiogenesis Assay Using a Matrigel Implant in Mouse

The in vivo angiogenesis assay of the G-protein Chemokine Receptor (CCR5) measures the ability of an existing capillary network to form new vessels in an implanted capsule of murine extracellular matrix material (Matrigel). The protein is mixed with the liquid Matrigel at 4 degrees C and the mixture is then injected subcutaneously into mice, in which it solidifies. After 7 days, the solid “plug” of Matrigel is removed and examined for the presence of new blood vessels. The Matrigel is obtained from Becton Dickinson Labware / Collaborative Biomedical Products.

When defrosted at 4 degrees C, the Matrigel material is a liquid. The Matrigel is mixed with G-protein Chemokine Receptor (CCR5) at 150 ng / ml at 4 degrees C and placed in cold 3 ml syringes. The C57B1 / 6 female mice of approximately 8 weeks of age are injected with the mixture of Matrigel and experimental protein at two sites in the mesoventral aspect of the abdomen (0.5 ml / site). After 7 days the mice are sacrificed by cervical dislocation, the Matrigel plugs are removed and cleaned (i.e., all the fibrous tissue and hanging membranes are removed). Complete plugs replicated in 10% neutral buffered formaldehyde are fixed, included in paraffin and used to produce sections for histological examination after staining with Masson's Trichrome. Cross sections of 3 different regions of each cap are processed. The selected sections are stained with respect to the presence of vWF. The positive control for this test is bovine basic FGF (150 ng / ml). Matrigel is used only to determine baseline levels of angiogenesis.

The studies described in this example test protein activity of the G-protein Chemokine Receptor (CCR5). However, one skilled in the art could easily modify the exemplified studies to test the polynucleotide activity of the G-protein Chemokine Receptor (CCR5) (eg, gene therapy), agonists (including ligands) and / or Receptor antagonists. G protein chemokine (CCR5).

Example 46

Rescue of Ischemia in Rabbit Lower Limb Model

To study the in vivo effects of the G-protein Chemokine Receptor (CCR5) in ischemia, a model of ischemia of rabbit hind limbs is created by surgical removal of a femoral artery as described previously (Takeshita, S. et al. , Am J. Pathol 147: 1649-1660 (1995)). Excision of the femoral artery results in a retrograde spread of thrombi and occlusion of the external iliac artery. Consequently, blood flow to the ischemic limb is dependent on collateral vessels that originate from the internal iliac artery (Takeshita, S. et al. Am J. Pathol 147: 1649-1660 (1995)). A 10-day interval is allowed for postoperative recovery of rabbits and development of endogenous collateral vessels. On day 10 after the operation (day 0), after performing a baseline measurement angiogram, the internal iliac artery of the ischemic limb is transfected with 500 mg of G protein Chemokine Receptor expression plasmid (CCR5) naked by Arterial gene transfer technology using a hydrogel coated balloon catheter as described (Riessen, R. et al. Hum Gene Ther. 4: 749-758 (1993); Leclerc, G. et al. J. Clin. Invest 90: 936-944 (1992)). When G-protein Chemokine Receptor (CCR5) is used in the treatment, a single 500 mg bolus of Chemokine G-protein Receptor (CCR5) or control in the internal iliac artery of the ischemic limb is given over a period of time. 1 minute through an infusion catheter. On day 30, various parameters are measured in these rabbits: (a) BP ratio - The blood pressure ratio of systolic pressure of the ischemic limb to that of normal limb; (b) Blood Flow and Flow Reserve - Resting FL: blood flow during non-dilated condition and Maximum FL: blood flow during fully dilated condition (also an indirect measure of the amount of blood vessels) and the flow reserve is reflects by the ratio of maximum FL: FL at rest; (c) Angiographic Score - this is measured by the angiogram of collateral vessels. A score is determined by the percentage of circles on a grid superimposed with opacified arteries that cross divided by the total number on the thigh of the rabbit; (d) Capillary Density - the number of collateral capillaries determined in light microscopic sections taken from the hind limbs.

The studies described in this example test protein activity of the G-protein Chemokine Receptor (CCR5). However, one skilled in the art could easily modify the exemplified studies to test the polynucleotide activity of the G-protein Chemokine Receptor (CCR5) (eg, gene therapy), agonists (including ligands) and / or Receptor antagonists. G protein chemokine (CCR5).

Example 47

Peripheral Arterial Disease Model

Angiogenic therapy using G-protein Chemokine Receptor (CCR5) is a new therapeutic strategy to obtain restoration of blood flow around ischemia in the case of peripheral arterial diseases. The experimental protocol includes:

a) One side of the femoral artery is ligated to create ischemic muscle of the posterior limb, the other lateral of the posterior limb serves as a control.

b) G-protein Chemokine Receptor protein (CCR5) is supplied in a dosage range of 20 mg - 500 mg intravenously and / or intramuscularly 3 times (perhaps more) per week for 2-3 weeks.

c) Ischemic muscle tissue is collected after ligation of the femoral artery at 1, 2 and 3 weeks for the expression analysis of the G-protein Chemokine Receptor (CCR5) and histology. A biopsy is also performed on the other side of the normal muscle of the contralateral posterior limb.

The studies described in this example test protein activity of the G-protein Chemokine Receptor (CCR5). However, one skilled in the art could easily modify the exemplified studies to test the polynucleotide activity of the G-protein Chemokine Receptor (CCR5) (eg, gene therapy), agonists (including ligands) and / or Receptor antagonists. G protein chemokine (CCR5).

Example 48

Ischemic Myocardial Disease Model

G-protein Chemokine Receptor (CCR5) is evaluated as a potent mitogen capable of stimulating the development of collateral vessels and restructuring new vessels after coronary artery occlusion. The alteration of the expression of the G-protein Chemokine Receptor (CCR5) is investigated in situ. The experimental protocol includes:

a) The heart is exposed through a thoracotomy of the left side in the rat. Immediately, the left coronary artery is occluded with a fine suture (6-0) and the thorax is closed.

b) Protein from the G-protein Chemokine Receptor (CCR5) is supplied, in a dosage range of 20 mg - 500 mg, intravenously and / or intramuscularly 3 times (perhaps more) per week for 2-4 weeks.

c) Thirty days after surgery, the heart is removed and a cross section is performed for morphometric and in situ analysis.

The studies described in this example test protein activity of the G-protein Chemokine Receptor (CCR5). However, one skilled in the art could easily modify the exemplified studies to test the polynucleotide activity of the G-protein Chemokine Receptor (CCR5) (eg, gene therapy), agonists (including ligands) and / or Receptor antagonists. G protein chemokine (CCR5).

Example 49

Suppression of TNF alpha-induced adhesion molecule expression by G-protein Chemokine Receptor

Lymphocyte recruitment to areas of inflammation and angiogenesis involves specific ligand-receptor interactions between cell surface adhesion molecules (CAM) in lymphocytes and the vascular endothelium. The adhesion process, in normal and pathological situations, follows a multistage cascade that involves the expression of intercellular adhesion molecule 1 (ICAM-1), vascular cell adhesion molecule 1 (VCAM-1) and endothelial leukocyte adhesion molecules 1 (E-selectin) in endothelial cells (EC). The expression of these molecules and others in the vascular endothelium determines the effectiveness with which leukocytes can adhere to the local vasculature and extravagate the local tissue during the development of an inflammatory response. The local concentration of cytokines and growth factor participates in the modulation of the expression of these CAM.

Tumor necrosis factor alpha (TNF-a), a potent proinflammatory cytosine, is a stimulator of all three CAMs in endothelial cells and may be involved in a wide variety of inflammatory responses, often resulting in a pathological outcome.

The potential of the G-protein Chemokine Receptor (CCR5) to mediate a suppression of CAM expression induced by TNF-a can be examined. A modified ELISA assay using EC as a solid phase absorber is used to measure the amount of CAM expression in EC treated with TNF-a when co-stimulated with a member of the FGF family of proteins.

To perform the experiment, endothelial cell cultures of the human umbilical vein (HUVEC) are obtained from clustered cord collections and maintained in growth medium (EGM-2; Clonetics, San Diego, CA) supplemented with 10% FCS and penicillin / streptomycin 1% in a humidified incubator at 37 ° C containing 5% CO2. HUVEC are seeded in 96-well plates at concentrations of 1 x 104 cells / well in EGM medium at 37 degrees C for 18-24 hours or until confluence. The monolayers are subsequently washed 3 times with a serum-free solution of RPMI-1640 supplemented with 100 U / ml penicillin and 100 mg / ml streptomycin and treated with a given cytokine and / or growth factor or factors for 24 hours at 37 degrees C. After incubation, cells are then evaluated for CAM expression.

Endothelial cells of the Human Umbilical Vein (HUVEC) are allowed to grow in a conventional 96-well plate until confluence. The growth medium is removed from the cells and replaced with 90 µl of Medium 199 (10% FBS). Test samples and positive or negative controls are added to the plate in triplicate (volumes of 10 µl). Plates are incubated at 37 degrees C for 5 hours (selectin and integrin expression) or 24 hours (integrin expression only). The plates are aspirated to remove medium and 100 µl of 0.1% paraformaldehyde-PBS (with Ca ++ and Mg ++) is added to each well. The plates are kept at 4 ° C for 30 minutes.

The fixative is then removed from the wells and the wells are washed 1X with PBS (+ Ca, Mg) + 0.5% BSA and emptied. Do not allow wells to dry. Add 10 µl of diluted primary antibody to the test and control wells. Anti-ICAM-1-Biotin, Anti-VCAM-1-Biotin and Anti-E-selectin-Biotin are used at a concentration of 10 g / ml (1:10 dilution of 0.1 mg / ml reserve antibody) . The cells are incubated at 37 ° C for 30 minutes in a humidified environment. Wells X3 are washed with PBS (+ Ca, Mg) + 0.5% BSA.

Then 20 µl of diluted Alkaline Phosphatase-ExtrAvidin (1: 5,000 dilution) is added to each well and incubated at 37 ° C for 30 minutes. Wells X3 are washed with PBS (+ Ca, Mg) + 0.5% BSA. 1 tablet of p-Nitrophenol Phosphate pNPP is dissolved in 5 ml of glycine buffer (pH 10.4). 100 µl of pNPP substrate in glycine buffer is added to each test well. Conventional triplicate wells are prepared from the working dilution of the Alkaline Phosphatase-ExtrAvidin in glycine buffer: 1: 5,000 (100)> 10-0.5> 10-1> 10-1.5. 5 µl of each dilution is added to triplicate wells and the resulting AP content in each well is 5.50 ng, 1.74 ng, 0.55 ng, 0.18 ng. Then 100 µl of pNNP reagent should be added to each of the conventional wells. The plate should be incubated at 37 ° C for 4 hours. A volume of 50 µl of 3M NaOH is added to all wells. The results are quantified in a plate reader at 405 nm. The option of subtracting the bottom in white wells filled with glycine buffer only is used. The mold is set to indicate the concentration of AP conjugate in each conventional well [5.50 ng; 1.74 ng; 0.55 ng; 0.18 ng]. The results are indicated as the amount of AP conjugate bound in each sample.

The studies described in this example test protein activity of the G-protein Chemokine Receptor (CCR5). However, one skilled in the art could easily modify the exemplified studies to test the polynucleotide activity of the G-protein Chemokine Receptor (CCR5) (eg, gene therapy), agonists (including ligands) and / or Receptor antagonists. G protein chemokine (CCR5).

Example 50

Methods to Inhibit G-protein Coupled Receptor Activity Using Transmembrane Fragments

WO 94/05695 and US Patent No. 5,508,384 disclose sequences of transmembrane regions for 74 GPCRs. Patent publication WO 94/05695 describes and claims polypeptides that correspond to homologous GPCR fragments or sequences that can bind to a GPCR ligand or that can modulate ligand binding. Both references describe that a fragment that crosses the membrane of the third TM domain of the dopamine D2 receptor specifically bound an intact receptor ligand in a simple small unilamellar vesicle model. The fragment used was terminated with a lysine (which is positively charged at physiological pH) at one end and with an aspartic acid (which is negatively charged at physiological pH) at the other. This peptide would not be expected to be easily inserted into a biological membrane.

On the contrary, this example refers to modulation, especially inhibition, of biological activities of the G-protein Chemokine Receptor (CCR5) by exposure to molecules that interfere with the correct assembly of the receptor. In particular, recombinant, synthetic and / or isolated consensus peptides, fragments and / or peptides of the G-protein Chemokine Receptor transmembrane domain (CCR5) inhibit G-Chemokine Receptor-mediated signal transduction (CCR5). Loads loaded at one end may be added to promote the correct orientation of the membrane peptide. In particular, the addition of two negatively charged moieties, such as Asp, at the extracellular end of the fragment improves antagonistic activity.

Fragments of the transmembrane domain can be synthesized by solid phase peptide synthesis of continuous flow in Applied Biosystems 432A peptide synthesizer using Fmoc amino acid derivatives. To overcome the aggregation that can occur during the synthesis of the peptides and which can lead to blockage of the growing peptide chain, FmocHmb derivatives of Ala, Val and Leu are introduced. Charged moieties are added to the end of the peptide to ensure proper orientation of the peptides during penetration into the cell membrane and to improve the solubility of hydrophobic peptides. The purity of the peptides is evaluated by reverse phase HPLC and the structures are confirmed by time-assisted mass spectrometry of matrix-assisted laser desorption (MALDI-TOF) (Tarasova et al., Ad. Exp. Med. Biol. , Plenum Press, NY, page 201-206 (1998).

The antagonistic effect of the fragments is tested in human kidney carcinoma (HEK) cells that stably express the G-protein Chemokine Receptor. RANTES is used as the agonist. Cells grown in chamber slides are incubated with Nunc coverslips with 1 / AMM AM / Fura-2 for 20 minutes in a CO2 incubator, rinsed with PBS and mounted on the platform of a Zeiss Axiovert inverted microscope. Measurements of [Ca2 +] i are made using an Attofluor digital imaging system (Atto Instruments). Fluorescence is controlled by an intensified CCD camera using a 505 cut-off filter. Calibrations of [Ca2 +] and using Ca2 + standards containing Fura 1 M are performed. The antagonistic activity of the fragments is further optimized as described in Examples 1-4 of WO 99/43711.

The antagonist activity of the fragments is also tested for the ability to inhibit HIV cell fusion-G-protein Chemokine Receptor and the ability to inhibit the binding of a labeled ligand of the G-protein Chemokine Receptor (CCR5) by well known methods in the art as described for CXCR4 in WO 99/43711.

Example 51

Immortalized T lymphocytes with Herpes Virus Expressing the G-protein Chemokine Receptor (CCR5)

The construction of a T lymphocyte cell line immortalized with Herpes Virus expressing the G-protein Chemokine Receptor (CCR5) is described in Vella, et al., J. Virol. Methods 79: 51-63 (1999). This or a similar cell line is useful for testing agonists and antagonists in the methods described herein.

Example 52

Isolation of CCR5 ligands and anti-CCR5 antibodies

A general method for solubilizing CCR5 in its native state that can be used in ligand and antibody screening assays is described in Mirzabekov et al., J. Biol. Chem. 274: 28745-50 (1999). A method for selecting CCR5 antibody from a human antibody phage display library is described in Osbourn et al., Nat. Biotechnol. 16: 778-81 (1998). Lee et al. describes that the epitope recognized by the CCR5 2D7 specific antibody is a preferred target for antibodies to inhibit HIV entry. Lee et al. J. Biol. Chem. 274: 9617-26 (1999). Other screening methods for ligands and antibodies are well known in the art and are described herein.

Example 53

Antibody Neutralization Assays

A cell line based assay to measure HIV-1 neutralization by antibody is described in Trkola et al., J. Virol. 73: 8966-74 (1999). An assay for antibodies that neutralize HIV and explore for a molecule that inhibits HIV binding or entry at any stage is described in Boritz et al., J. Virol. 73: 6937-45 (1999). A method to analyze inhibition of the co-receptor is described in Klasse et al., J. Virol. 73: 7453-66 (1999). Additional methods to test input neutralization, fusion, replication, etc. of HIV are well known in the art and are described herein.

Example 54

Generation of G-protein Chemokine Receptor Antibodies (CCR5) using Xenomouse ™ Strains.

Xenomouse ™ mouse strains obtained by genetic engineering to express a repertoire of human kappa / IgG2 or Kappa / IgM antibodies were obtained from Abgenix, Inc, (Fremont, CA). Groups of mice were immunized according to the following programs:

Immunization program 1 (fusion of XF3):

Xenomouse ™ mice (n = 5) were initially injected at the base of the tail 100 micrograms in PBS of a DNA plasmid expression vector encoding the full-length G protein Chemokine Receptor (CCR5) gene (CCR5 pcDNA3T) ). This was followed by three subcutaneous injections provided at two week intervals, each consisting of 10 million CHO cells transfected with a CCR5 expression vector (hereinafter "CCR5 CHO cells") in incomplete Freund's adjuvant . The animals were allowed to rest for 12 weeks and then two more subcutaneous injections were given, separated by two weeks, each consisting of 10 million NSO cells transfected with a CCR5 expression vector (hereinafter referred to as "cells CCR5 NSO ”) in incomplete Freund's adjuvant. Three days after the last injection the mice were sacrificed and the lymph node and / or spleen cells were collected in order to generate hybridomas. The hybridomas generated from this fusion are called "XF3 .----" (Table 4).

Immunization program 2 (fusion of XF6):

Xenomouse ™ mice (n = 5) were initially injected intraperitoneally with 7 million CCR5 CHO cells in Freund's complete adjuvant. This was followed by six intraperitoneal injections given at two-week intervals, each consisting of 10 million CCR5 CHO cells. The animals were allowed to rest for 5 weeks and then two more intraperitoneal injections, separated by two weeks, each consisting of 10 million CCR5 NSO cells in incomplete Freund's adjuvant. Three days after the last injection, mice were sacrificed and lymph node and / or spleen cells were collected in order to generate hybridomas. The hybridomas generated from this fusion are called "XF6 .---" (Table 4).

5

10

fifteen

twenty

25

30

35

40

Immunization program 3 (fusion of XF7):

Xenomouse ™ mice (n = 5) were initially injected at the base of the tail 7 million CCR5 CHO cells in Freund's complete adjuvant. This was followed by six additional injections at the base of the tail delivered at two-week intervals, each consisting of 10 million CCR5 CHO cells. The animals were allowed to rest for 5 weeks and then two more injections were given at the base of the tail, separated by two weeks, each consisting of 10 million CCR5 NSO cells in incomplete Freund's adjuvant. Three days after the last injection, mice were sacrificed and lymph node and / or spleen cells were collected in order to generate hybridomas. The hybridomas generated from this fusion are called "XF7 .----" (Table 4).

Immunization program 4 (fusion of XF11):

Xenomouse ™ mice (n = 5) were immunized by injection into the plantar pads provided at two week intervals. Each immunization consisted of a total of 10 million NSO CCR5 cells in RIBI adjuvant. A total of eight such immunizations were administered. Three days after the last injection, mice were sacrificed and lymph node and / or spleen cells were collected in order to generate hybridomas. The hybridomas generated from this fusion are called "XF11 .----" (Table 4).

Immunization program 5 (fusion of XF12):

Xenomouse ™ mice (n = 5) were initially immunized with 10 million NSO CCR5 cells in complete Freund's adjuvant administered by a combination of intraperitoneal and subcutaneous routes. This was followed by six additional immunizations, given at two-week intervals, each consisting of 10 million CCR5 CHO cells in incomplete Freund's adjuvant, also administered by a combination of intraperitoneal and subcutaneous routes. An animal was sacrificed for fusion three days after the third sensitization immunization in incomplete Freund's adjuvant. Three days after the last injection the remaining mice were sacrificed and lymph node and / or spleen cells were collected in order to generate hybridomas. The hybridomas generated from this fusion are called "XF12 .----" (Table 4).

Immunization program 6 (fusion XF27 / 28):

CCR5 / XF27 & 28 FP immunization program

Animals, 20 mice

No. of Day

Action Antigen Quantity Volume Adjuvant

Day 1

Injection CCR5 NSO cells FP 5x106 cells / ms 50 l 1: 1 PBS / RIBI

Day 14

Injection CCR5 NSO cells FP 5x106 cells / ms 50 l 1: 1 PBS / RIBI

Day 28

Injection CCR5 NSO cells FP 5x106 cells / ms 50 l 1: 1 PBS / RIBI

Day 38

Injection CCR5 NSO cells FP 5x106 cells / ms 50 l PBS

Day 41

Fusion

Hybridomas were generated according to protocols that are commonly known in the art. The fusion partner used to generate these hybridomas was P3X63-AG8.653 obtained from the ATCC, Lot F11545.

Antibodies produced by these hybridomas were screened for the ability to bind to CCR5 by FACS and ELISA scanning.

Membrane ELISA Exploration Regarding Specific Antibodies to G-protein Chemokine Receptor (CCR5)

Plasma Membrane Preparation Plasma membranes of CCR5 CHO cells and CHO cells transfected with vector control were prepared. Briefly, between 108 and 109 CCR5 CHO or CHO cells were suspended in 40-50 milliliters of cold 12 mM Tris, pH 7.5, 250 mM sucrose. The cells were lysed on ice, by homogenization using a variable speed electric homogenizer. Cell lysis was confirmed by microscopy. The cell homogenate was centrifuged at 270 x g for 10 minutes at 4 ° C. The supernatant (containing the plasma membranes) was collected while the sediment (containing the nuclear fraction) was discarded. The supernatant was then centrifuged at 8000 x g, for 10 minutes at 4 ° C. Again the supernatant (which contained the plasma membranes) was collected while the sediment (containing the lysosomal and mitochondrial fractions) was discarded. Plasma membranes were separated by centrifugation of the supernatant in an ultracentrifuge at 100,000 x g for 60 minutes at 4 ° C. The supernatant was discarded. The sedimented plasma membranes were resuspended in approximately 1 ml of PBS. After resuspension the volume of plasma membranes was brought to 5-10 ml with additional PBS. The membrane solution was kept on ice and sonicated (on ice) until a uniform solution was obtained. Care was taken not to overheat the solution during sonication. The plasma membrane protein concentration was determined using the BCA protein determination kit available from Pierce Chemical Company (Rockford Illinois). Plasma membranes were stored at -70 ° C until use.

5 Membrane ELISA. 4 Immulon plates (Dynex) were coated with 50 microliters of CHO plasma membranes transfected with vector control or CCR5 CHO (the membrane solutions were at a concentration of 20 micrograms / milliliter) overnight at 4 ° C. The next morning, the plates were washed three times with PBST (PBST = PBS containing 0.01% Tween20). The plates were then blocked for 1 hour at room temperature with 200 microliters / well of 3% BSA / PBS. The blocking solution was removed from the plates and added

10 50 microliters / well of samples (hybridoma supernatant) and controls were plated and incubated for 2 hours at room temperature or overnight at 4 ° C. Each sample / control was tested for binding to both CCR5 CHO membranes as well as CHO membranes transfected with control vector. The plates were then washed three times with PBST. After washing, 50 microliters / well of secondary antibody (Vector Goat Human IgG (H + L) at 0.25 /g / ml in 0.1% BSA / PBST + serum was added

15% goat) to the wells and incubated for 1 hour at room temperature. While the plates were incubating, the ABC reagent (Vector Laboratories) was prepared. The plate was then washed three times with PBST. Then 50 microliters / well of diluted ABC was added to the plates and incubated for 30 minutes at room temperature. The plates were then washed 6 times with PBST. 100 microliters / well of TMB reagent (Sigma Chemical Company, St. Louis, MO) was added to the wells and incubated for 10 minutes at room temperature. The

The reaction was then stopped by the addition of 25 microliters / well of 2M H2SO4. The plate was read at 405 nm.

Results 238 hybridomas showed binding to CCR5 CHO cell membranes, of which approximately half showed increased binding with CCR5 CHO membranes compared to CHO membranes transfected with vector control. 217 (Table 4) of these hybridomas were expanded and the membrane ELISA was repeated. The results of the second scan showed that the results of this procedure of

25 exploration were reproducible.

Table 4: Hybridomas that secrete antibodies that bind to CCR5 CHO membranes

XF3 Fusion

XF6 Fusion XF7 Fusion XF11 Fusion XF12 Fusion

XF3.10B8

XF6.LNG9 XF7.1A10 XF11.1 E2 XF12.10B2

XF3.10C4

XF6.4D11 XF7.2 E10 XF11.1 E6 XF12.11F5

XF3.10G4

XF6.LNC6 XF7.2A2 XF11.1A11 XF12.12B11

XF3.10H12

XF6.LNF6 XF7.2C4 XF11.1A2 XF12.13H6

XF3.11B5

XF6.LNC11 XF7.3A5 XF11.1A8 XF12.15B11

XF3.13D3

XF6.LND9 XF7.3H1 XF11.1B10 XF12.1B8

XF3.14E12

XF6.LNF2 XF7.3H2 XF11.1B12 XF12.2E1

XF3.15C2

XF7.3H8 XF11.1B4 XF12.2E12

XF3.15F6

XF7.4 E8 XF11.1B7 XF12.2H5

XF3.2A3

XF7.4E9 XF11.1B9 XF12.2H8

XF3.2E5

XF7.4A6 XF11.1C1 XF12.3E2

XF3.3H1

XF7.4B2 XF11.1C7 XF12.3A9

XF3.4B6

XF7.4G3 XF11.1D10 XF12.3C2

XF3.4C5

XF7.4G7 XF11.1D8 XF12.3G11

XF3.5F1

XF7.4H4 XF11.1F8 XF12.4A8

XF3.6A1

XF7.4H7 XF11.1G11 XF12.4G7

XF3.6A2

XF7.5A1 XF11.1G8 XF12.5B10

XF3.6H11

XF7.5B8 XF11.1H7 XF12.5B11

XF3 Fusion

XF6 Fusion XF7 Fusion XF11 Fusion XF12 Fusion

XF3.7C11

XF7.5B9 XF11.2 E4 XF12.5F1

XF3.8D5

XF7.5H8 XF11.2 E5 XF12.5H1

XF3.8G10

XF7.6B11 XF11.2B9 XF12.6B12

XF3.9G3

XF7.6B12 XF11.2C9 XF12.6H1

XF3.LNA2

XF7.6B3 XF11.2D1 XF12.6H7

XF3.LNB12

XF7.6D12 XF11.2D10 XF12.7F12

XF3.LNC10

XF7.6D3 XF11.2D11 XF12.LND11

XF3.LNC11

XF7.6D7 XF11.2D5

XF3.LNC2

XF7.7A9 XF11.2D8

XF3.LNC3

XF7.7B6 XF11.2F3

XF3.LNC4

XF7.7C11 XF11.2F5

XF3.LNC6

XF7.7C4 XF11.2F6

XF3.LND9

XF7.7E8 XF11.2F7

XF3.LNE7

XF7.7F8 XF11.2F8

XF3.LNF1

XF7.7G4 XF11.2F9

XF3.LNH5

XF7.LN1B1 XF11.2G11

XF7.LN1B7

XF11.2G4

XF7.LN1D10

XF11.2G6

XF7.LN1D11

XF11.2G8

XF7.LN1D9

XF11.2G9

XF7.LN1E10

XF11.2H10

XF7.LN1E11

XF11.2H2

XF7.LN1E12

XF11.2H4

XF7.LN2A11

XF11.2H8

XF7.LN2A7

XF11.3A3

XF11.3B10

XF11.3B9

XF11.3C3

XF11.3C6

XF11.3C7

XF11.3D1

XF11.3D12

XF11.3D2

XF3 Fusion

XF6 Fusion XF7 Fusion XF11 Fusion XF12 Fusion

XF11.3D3

XF11.3F4

XF11.3G12

XF11.3G2

XF11.3G3

XF11.3H7

XF11.4E11

XF11.4A1

XF11.4A5

XF11.4B10

XF11.4B12

XF11.4B3

XF11.4B4

XF11.4C10

XF11.4C12

XF11.4C4

XF11.4D10

XF11.4D12

XF11.4D3

XF11.4D4

XF11.4D5

XF11.4F11

XF11.5 E2

XF11.5A2

XF11.5C10

XF11.5D12

XF11.5F2

XF11.5F3

XF11.5G10

XF11.5G11

XF11.5G4

XF11.5G5

XF11.5G6

XF3 Fusion

XF6 Fusion XF7 Fusion XF11 Fusion XF12 Fusion

XF11.5H1

XF11.5H4

XF11.5H5

XF11.6E12

XF11.6E4

XF11.6E7

XF11.6A3

XF11.6A5

XF11.6B3

XF11.6B4

XF11.6B9

XF11.6C11

XF11.6C5

XF11.6D7

XF11.6D8

XF11.6D9

XF11.6F2

XF11.6F9

XF11.6G1

XF11.6G6

XF11.6H11

XF11.6H2

XF11.6H4

XF11.6H7

FACS Exploration Regarding Specific G-Chemokine Receptor Antibodies (CCR5)

CHO cells transfected with vector control or transfected with G-protein Chemokine Receptor (CCR5) were collected, washed with FACS buffer (PBS with 0.1% NaN3 and 0.1% BSA). One million 5 cells in 100 µl were distributed to FACS tubes (Falcon 2052). 10 microliters of hybridoma supernatant was added to each tube and incubated for 20 minutes at 4 ° C. Each supernatant was analyzed for binding to CHO cells transfected with control vector and CCR5 CHO. The cells were washed and resuspended in 100 microliters of FACS buffer and 10 microliters of biotinylated Goat anti-Human IgG (H + L) (Vector) was added at 1 microgram / milliliter in the tubes and incubated for 20 minutes at 4 ° C The cells were washed, 10 were resuspended in 100 microliters of FACS buffer and 5 milliliters of streptavidin PE (DAKO) was added followed by an incubation for 10 minutes at 4 degrees C. The cells were washed, resuspended in 200 microliters of FACS buffer containing 0.5 microgram / milliliter propidium iodide and analyzed in FACScan (Becton Dickinson).

Results Of the 217 hybridoma supernatants screened by FACS analysis, it was identified that XF11.1D8, XF11.4D10, XF11.4C4, XF11.5H1 and XF11.1G8 showed significant increase in binding with CCR5 CHO in

15 comparison with CHO cells transfected with control vector.

Additional hybridomas were produced and their supernatants were screened for specific anti-G-Chemokine Receptor antibodies (CCR5). It was found that several of these had a significant increase in CCR5 binding compared to controls. They are described herein as preferred antibodies and are listed in Table 2.

5 Example 55

Identification and Cloning of VH and VL domains

One method to identify and clone VH and VL domains of cell lines that express a particular antibody is to perform PCR with specific VH and VL primers on cDNA prepared from cell lines that express antibody. Briefly, RNA is isolated from cell lines and used as a template for RT-PCR designed to amplify the VH and VL domains of antibodies expressed by cell lines with EBV. Cells can be lysed in the TRIzol® reagent (Life Technologies, Rockville. MD) and extracted with a chloroform volume of one fifth. After the addition of the chloroform, the solution is allowed to incubate at room temperature for 10 minutes and centrifuged at 14,000 rpm for 15 minutes at 4 ° C in a tabletop centrifuge. The supernatant is collected and RNA is precipitated using an equal volume of isopropanol. The precipitated RNA is sedimented by

15 centrifugation at 14,000 rpm for 15 minutes at 4 ° C in a desktop centrifuge. After centrifugation, the supernatant is discarded and washed with 75% ethanol. After washing, the RNA is centrifuged again at 800 rpm for 5 minutes at 4 ° C. The supernatant is discarded and the sediment is allowed to air dry. The RNA is then dissolved in DEPC water and heated at 60 ° C for 10 minutes. The amounts of RNA can be determined using optical density measurements.

20 cDNA, according to methods well known in the art, can be synthesized from 1.5-2.5 micrograms of RNA using reverse transcriptase and random hexamic primers. CDNA is then used as a template for PCR amplification of VH and VL domains. The primers used to amplify VH and VL genes are shown in Table 5. Typically a PCR reaction makes use of a simple 5 'primer and a simple 3' primer. Occasionally, when the amount of available RNA template is limiting, or for greater efficiency, they can be used

25 groups of 5 ’and / or 3’ primers. For example, sometimes the five VH-5 ’primers and all JH3’ primers are used in a single PCR reaction. The PCR reaction is carried out in a volume of 50 microliters containing 1X PCR buffer, 2 mM dNTP each, 0.7 units of High Fidelity Taq polymerase, 5 'primer mix, 3' primer mix and 7.5 microliters of cDNA. The 5 ’and 3’ primer mix of both VH and VL can be prepared by grouping 22 pmol and 28 pmol, respectively, of each of the individual primers. The

30 PCR conditions are: 96 ° C for 5 minutes; followed by 25 cycles of 94 ° C for 1 minute, 50 ° C for 1 minute and 72 ° C for 1 minute; followed by an extension cycle of 72 ° C for 10 minutes. After the reaction is complete, the test tubes are stored at 4 ° C.

Table 5: Primer Sequences Used to Amplify VH and VL Domains

Primer Name SEC ID No. Primer Sequence (5’-3 ’)

VH primers

Hu VH1-5 ’23 CAGGTGCAGCTGGTGCAGTCTGG

Hu VH2-5 ’24 CAGGTCAACTTAAGGGAGTCTGG

Hu VH3-5 ’25 GAGGTGCAGCTGGTGGAGTCTGG

Hu VH4-5 ’26 CAGGTGCAGCTGCAGGAGTCGGG

Hu VH5-5 ’27 GAGGTGCAGCTGTTGCAGTCTGC

Hu VH6-5 ’28 CAGGTACAGCTGCAGCAGTCAGG

Hu JH1,2-5 ’29 TGAGGAGACGGTGACCAGGGTGCC

Hu JH3-5 ’30 TGAAGAGACGGTGACCATTGTCCC

Hu JH4,5-5 ’31 TGAGGAGACGGTGACCAGGGTTCC

Hu JH6-5 ’32 TGAGGAGACGGTGACCGTGGTCCC

VL primers

Hu Vkappal-5 ’33 GACATCCAGATGACCCAGTCTCC

Hu Vkappa2a-5 ’34 GATGTTGTGATGACTCAGTCTCC

Hu Vkappa2b-5 ’

35 GATATTGTGATGACTCAGTCTCC

Hu Vkappa3-5 ’

36 GAAATTGTGTTGACGCAGTCTCC

Hu Vkappa4-5 ’

37 GACATCGTGATGACCCAGTCTCC

Hu Vkappa5-5 ’

38 GAAACGACACTCACGCAGTCTCC

Hu Vkappa6-5 ’

39 GAAATTGTGCTGACTCAGTCTCC

Hu Vlambda1-5 ’

40 CAGTCTGTGTTGACGCAGCCGCC

Hu Vlambda2-5 ’

41 CAGTCTGCCCTGACTCAGCCTGC

Hu Vlambda3-5 ’

42 TCCTATGTGCTGACTCAGCCACC

Hu Vlambda3b-5 ’

43 TCTTCTGAGCTGACTCAGGACCC

Hu Vlambda4-5 ’

44 CACGTTATACTGACTCAACCGCC

Hu Vlambda5-5 ’

Four. Five CAGGCTGTGCTCACTCAGCCGTC

Hu Vlambda6-5 ’

46 AATTTTATGCTGACTCAGCCCCA

Hu Jkappa1-3 ’

47 ACGTTTGATTTCCACCTTGGTCCC

Hu Jkappa2-3 ’

48 ACGTTTGATCTCCAGCTTGGTCCC

Hu Jkappa3-3 ’

49 ACGTTTGATATCCACTTTGGTCCC

Hu Jkappa4-3 ’

fifty ACGTTTGATCTCCACCTTGGTCCC

Hu Jkappa5-3 ’

51 ACGTTTAATCTCCAGTCGTGTCCC

Hu Jlambda1-3 ’

52 CAGTCTGTGTTGACGCAGCCGCC

Hu Jlambda2-3 ’

53 CAGTCTGCCCTGACTCAGCCTGC

Hu Jlambda3--3 ’

54 TCCTATGTGCTGACTCAGCCACC

Hu Jlambda3b-3 ’

55 TCTTCTGAGCTGACTCAGGACCC

Hu Jlambda4-3 ’

56 CACGTTATACTGACTCAACCGCC

Hu Jlambda5-3 ’

57 CAGGCTGTGCTCACTCAGCCGTC

Hu Jlambda6-3 ’

58 AATTTTATGCTGACTCAGCCCCA

Table 6: Anti-CCR5 Antibodies XF11.1D8, XF22.3C9 (for example, XF22.3C9.6) and XF22.9E6

Hybridoma / A nthibody Cell Line

VH DNA SEQ ID NO: VH protein SEQ ID NO: VH CDR1 amino acids VH CDR2 amino acids VH CDR3 amino acid s VL DNA SEQ ID NO: Protein VL SEQ ID NO: Amino acid s of VL CDR1 Amino acid s of VL CDR2 Amino acid s of VL CDR3 ATCC Deposit Number Deposit Date in ATCC

XF11.1D8

59 60 31-35 50-65 98-110 61 62 24-35 51-57 90-98 PTA-3030 February 7, 2001

XF22.3C9

63 64 31-35 50-68 102-115 65 66 24-34 50-56 89-97 PTA-3702 September 12, 2001

XF22.9E6

67 68 31-35 50-65 98-115 69 70 24-35 51-57 90-98 PTA-3859 November 14, 2001

198

The PCR samples are then subjected and electrophoresis on a 1.3% agarose gel. DNA bands of the expected sizes (~ 506 base pairs for VH domains and 344 base pairs for VL domains) can be cut from the gel and purified methods well known in the art. The purified PCR products can be ligated into a PCR cloning vector (TA vector from Invitrogen Inc., Carlsbad, CA). Individual cloned PCR products can be isolated after E. coli transfection and blue / white color selection. The cloned PCR products can then be sequenced using methods known in the art. The polynucleotide and amino acid sequences of the VH and VL domains of anti-CCR5 antibodies XF11.1D8, XF22.3C9.6 and XF22.9E6 are shown in FIGURES 4, 5 and 6 (see also, Table 6).

PCR bands containing the VH domain and VL domains can also be used to create full-length Ig expression vectors. The VH and VL domains can be cloned into vectors containing the nucleotide sequences of constant regions of a heavy chain (eg, human IgG1 or human IgG4) or light (human kappa or human lambda) so that a chain molecule could be expressed heavy or light complete from these vectors when transfected into an appropriate host cell. In addition, when the cloned light and heavy chains are both expressed in a cell line (from one or two vectors), they can be assembled into a complete functional antibody molecule that is secreted in the cell culture medium. Methods that use polynucleotides encoding the VH and VL antibody domain to generate expression vectors encoding complete antibody molecules are well known in the art.

Example 56

Immunofluorescence Assay

The following immunofluorescence protocol can be used, for example, to verify expression of the G-protein Chemokine Receptor (CCR5) in cells or to verify the presence of one or more antibodies that bind to the expressed G-protein Chemokine Receptor (CCR5) on the surface of cells. Briefly, Lab-Tek II camera slides are coated at 4 ° C overnight with 10 microgram / milliliter Type II bovine collagen in DPBS containing calcium and magnesium (DPBS ++). The slides are then washed twice with cold DPBS ++ and seeded with 8,000 cells transfected with CHO-CCR5 or CHO pC4 in a total volume of 125 microliters and incubated at 37 ° C in the presence of 95% oxygen / 5% carbon dioxide. The culture medium is removed by gentle aspiration and the adhered cells are washed twice with DPBS ++ at room temperature. The slides are blocked with DPBS ++ containing 0.2% BSA (blocker) at 0-4 ° C for one hour. The blocking solution is removed by gentle aspiration and 125 ml of solution containing antibodies (a solution containing antibodies can be, for example, a hybridoma culture supernatant that is usually used undiluted or serum / plasma that is usually used diluted -approximately 1/100 dilution). The slides are incubated for 1 hour at 0-4 ° C. The antibody solutions are then removed by gentle aspiration and the cells are washed 5 times with 400 microliters of ice-blocking solution. Next, 125 microliters of a secondary antibody labeled with rhodamine 1 microgram / milliliter (for example anti human IgG) in the blocker is added to the cells. Again, the cells are incubated for 1 hour at 0.-4 ° C. The secondary antibody solution is then gently aspirated and the cells are washed 3 times with 400 µl of ice-blocking solution and 5 times with cold DPBS ++. The cells are then fixed with 125 µl of 3.7% formaldehyde in DPBS ++ for 15 minutes at room temperature. The cells are washed 5 times with 400 µl of DPBS ++ at room temperature. Finally, the cells are mounted in 50% aqueous glycerol and observed under a fluorescence microscope using rhodamine filters.

Example 57

Western blot to detect binding to the G-protein Chemokine Receptor (CCR5)

The G-protein Chemokine Receptor (CCR5) is a membrane-included protein. To perform a Western blot on proteins of the G-protein Chemokine Receptor (CCR5), cell membranes must first be solubilized. The following protocol was developed by Mirzabekov et al., J. Biol. Chem. 274: 28745 (1999) which is hereby incorporated in its entirety by reference herein. A single cell suspension of CHO cells with G-protein Chemokine Receptor (CCR5) or pC4-CHO cells (CHO control transfected with vector), is sedimented and resuspended in 100 mM (NH4) 2SO4, solubilization buffer, Tris-HCl 20 mM (pH 7.5) and Cymal ™ -5 1% (w / v) (Anatrace Inc., Maumee, OH) and protease inhibitor mixture (one tablet of Complete ™ (Roche Molecular Biochemicals) per 25 ml) . After a 30 minute incubation at 4 ° C on a balancing platform, the samples are centrifuged for 30 minutes at

14,000 x g to remove cell debris. The G-protein Chemokine Receptor (CCR5) of the solubilized membrane is immunoprecipitated using, for example, the G-protein Chemokine Receptor monoclonal antibody (CCR5) 2D7 described in Wu et al., J. Exp. Med. 186 : 1373 (1997) conjugated with sepharose beads. After immunoprecipitation, the beads are washed thoroughly with solubilization buffer and resuspended in 2X SDS sample buffer. The samples are incubated in SDS-sample buffer for 1 hour at 55 ° C before electrophoresis through a polyacrylamide-SDS 11% gel. Western blotting can then be carried out in the samples of the G-protein Chemokine Receptor (CCR5) according to conventional protocols known in the art.

Example 58

Western blot, Immunoprecipitation and Purification of the G-protein Chemokine Receptor (CCR5).

The membrane solubilization protocol or Mirzabekov et al described in Example 57 above can also be used to prepare samples containing G-protein Chemokine Receptor (CCR5) for Western blotting, immunoprecipitation or purification.

Example 59

BIAcore Analysis of the Affinity of Polypeptides that bind to the G-protein Chemokine Receptor (CCR5)

The binding of anti-G-protein Chemokine Receptor antibody (CCR5) with G-protein Chemokine Receptor (CCR5), for example, can be analyzed by BIAcore analysis. The G-protein Chemokine Receptor (CCR5) (or other antigen for which it is desired to know the affinity of a G-protein Chemokine Receptor antibody (CCR5)) or G-protein Chemokine Receptor antibody (CCR5) it can be immobilized covalently with a BIAcore sensor microplate (CM5 microplate) by amino groups using N-ethyl-N '(dimethylaminopropyl) carboxyimide / N-hydroxysuccinimide chemistry. Various dilutions of G-protein Chemokine Receptor (CCR5) or G-protein Chemokine Receptor (CCR5) (or other antigen for which it is desired to know the affinity of an anti-G-Chemokine Receptor antibody (CCR5) )), are flowed respectively on the CM5 microplate derivatized in flow cells at 15 microliters / minute for a total volume of 50 microliters. The amount of bound protein is determined during the washing of the flow cell with HBS buffer (10 mM HEPES pH 7.4, 150 mM NaCl, 3.4 mM EDTA, 0.005% p20 surfactant). The binding specificity for the protein of interest is determined by competition with a soluble competitor in the presence of the protein of interest.

The surface of the flow cell can be regenerated by scrubbing bound protein with 20 microliters of 10 mM glycine-HCl, pH 2.3. For kinetic analysis, flow cells are tested at different flow rates and different polypeptide densities in the CM5 microplate. Association rates and dissociation rates can be determined using the kinetic evaluation program in a BIAevaluation 3 software.

Example 60

Virus Neutralization Assay

Antibodies of the invention can be tested for their ability to inhibit or reduce the ability of HIV-1 to infect cells (expressing CCR5) using a virus neutralization assay such as the assay described in Zolla-Pazner and Sharpe, AIDS Res Hum. Back 11: 1449 (1995) which is incorporated in its entirety by reference herein. Briefly, 2 x 105 PBMC are added at rest at dilution or appropriate dilutions of antibodies of the invention. After one hour of incubation, the cells are exposed to viruses for 2 hours, washed and resuspended in culture medium containing PHA and IL-2. At various time points after infection, such as days 7 and 9, the amount of HIV p24 antigen in the culture supernatant is measured using ELISA. The percentage of neutralization was calculated in relation to a control experiment in which HIV was allowed to infect cells in the absence of antibodies of the invention or as an alternative (or in addition), in the presence of a control antibody (of matching isotype, if necessary ) with irrelevant specificity.

A variation of this test is to perform it on activated PBMC, rather than at rest. This can be achieved by culturing the PBMC in the presence of PHA and IL-2 for two days before performing the virus neutralization assay.

Example 61

MIP-1beta Union Test

The antibodies of the invention can be tested for their ability to prevent a natural CCR5 ligand, for example MP1-beta, from binding to the CCR5 receptor.

The following 125 I-MIP1-beta binding assay is an example of an assay that could be performed to determine the ability of an antibody of the invention to prevent a natural CCR5 ligand, MIP1-beta, from binding to the CCR5 receptor.

Twenty-five microCurios of 125I-MIP-1 beta (Amersham Pharmacia Biotech, Cat. No. IM310, 25 microCurios, 2000 Ci / mmol) are dissolved in 1 milliliter of distilled water to prepare a 12.5 nM stock solution. If cultured cells, such as CCR5 CHO cells are used, in this experiment, they are trypsinized, washed and resuspended at 10x106 cells / milliliter in binding buffer (1mM CaCl2, 5mM MgCl2, 50mM Hopes, BSA 0 , 5%, 0.1% NaN3, pH 7.5). If peripheral blood mononuclear cells (PBMC) are to be used in this assay, they are isolated from healthy donors and resuspended at 2 x 106 cells / milliliter in binding buffer.

To determine what concentration or amount of MIP-1beta would saturate the cells in this assay, a series of dilutions of 125I-MIP-1beta is prepared at four times the desired final concentration (For example, for final concentrations of 3 nM, one should prepare a 12 nM solution). Typically, the final concentration

5 desired of 125I-MIP-1beta varies from 3 nM to 0.05 nM. Additionally, a cold MIP-1 beta solution (non-radioactive) is prepared at four times the desired final concentration. Typically the desired final concentration of cold MIP1beta is 200 nM, so that an 800 nM solution is prepared.

To measure the total binding of 125I-MIP-1beta with cells, 25 microliters of binding buffer, 25 microliters of 125I-MIP-1beta hot and 50 microliters of cell suspension are added to a U-bottom 96-well microplate (10 Costa, Cat. No. 3799). The cells are always added at the end. If the union of 125I-MIP-1beta is not specific, it will not be effectively overcome by cold MIP-1beta competition. Therefore, to assess binding specificity, 25 microliters of cold MIP-1 beta (800 nM), 25 microliters of 125I-MIP-1 hot beta (various dilutions) and 50 microliters of cell suspension are added to a 96-well microplate background in U. Again the cells are always added at the end. The mixtures are then incubated at room temperature on a shaker for 1 hour. After incubation, each sample is transferred to the top of tubes containing 200 microliters of an oily mixture (dibutyl phthalate: dioctyl phthalate 2: 1). The tubes are centrifuged at 12000 rpm for 20 seconds using a microcentrifuge. The bottom of the tube, which contains the cell pellet, is cut and counted in a gamma counter. If the binding of MIP-1beta is specific, less radioactivity will be measured in the gamma counter in the competition test. As a control to ensure that MIT-1beta binds to Chemokine Receptor

20 G protein (CCR5), the experiment can be chosen to perform in suitable cells that do not express CCR5, for example, CHO cells transfected with vector.

To perform a competition assay to determine whether a chemokine or antibody can compete with MIP1beta to bind to the same G-protein coupled receptor, a series of dilutions of cold chemokine or antibody is prepared at four times the desired final concentrations. Additionally, a solution of 125I is prepared

25 MIP-1 beta at four times the desired final concentration. For this type of competition test, a 2 nM solution of 125I-MIP-1 beta is prepared, which will give a final concentration of 0.5 nM.

To measure the total binding of 125I-MIP-1beta to the cells, 25 microliters of binding buffer, 25 microliters of 125I-MIP-1beta hot (2nM) and 50 microliters of cell suspension are added to a 96-well bottom microplate in

U. Cells are always added at the end. If another substance (for example, anti-Chemokine Receptor antibody

Protein G (CCR5) or other chemokine) binds to the MIP-1 beta receptor (i.e., G-protein Chemokine Receptor (CCR5)) the presence of increasing amounts of cold substance (non-radioactive) (e.g., anti-antibody -G protein chemokine receptor (CCR5) or other chemokine) will compete with respect to binding with the MIP-1beta receptor (ie, protein G chemokine receptor (CCR5)). Therefore, to determine if a substance binds to the MIP-1beta receptor (i.e., G-protein Chemokine Receptor (CCR5)) and inhibits MIP binding

35beta (radiolabelled) with its receptor (i.e. G-protein Chemokine Receptor (CCR5)), 25 microliters of cold substance are added (e.g., G-protein Chemokine Receptor antibody (CCR5) at various dilutions) , 25 microliters of 125I-MIP-1beta (2nM) hot and 50 microliters of cell suspension to a 96-well micro bottom plate in U. Again the cells are always added at the end. The mixtures are then incubated at room temperature on a shaker for 1 hour. After incubation, each sample is

40 transfers to the top of tubes containing 200 microliters of an oily mixture (dibutyl phthalate: dioctyl phthalate 2: 1). The tubes are centrifuged at 12000 rpm for 20 seconds using a microcentrifuge. The bottom of the tube, which contains the cell pellet, is cut and counted in a gamma counter. If the binding of MIP-1beta is specific, less radioactivity will be measured in the gamma counter in the competition test. As a control to ensure that MIP-1beta binds to the G-protein Chemokine Receptor (CCR5), it may be chosen to perform the

Experiment in suitable cells that do not express CCR5, for example, CHO cells transfected with vector.

An alternative, but similar, assay to determine the ability of an antibody of the invention to prevent a natural CCR5 ligand, MIP-1beta, from binding to the CCR5 receptor is described in Lopalco et al., J. Immunol., 164: 3426 (2000) and in Trkola et al., Nature, 384: 184 (1996) which are incorporated in their entirety by reference herein. Briefly, 106 cells expressing CCR5 (eg, CD4 + T lymphocytes, CHO 50 cells transfected with CCR5) are incubated on ice with dilution or appropriate dilutions of the antibody of the invention. After 45 minutes of incubation, 0.2 microCurios of radiolabeled MIP1-beta (for example, 125I-MIP1-beta (DuPont-NEN, Boston, MA) are added to a final concentration of 0.1 nM. After an incubation of two hours on ice, unbound radioactivity is removed using a two-stage gradient, as described in Grassi et al., J Exp Med.

174: 53 (1991) which is incorporated in its entirety by reference herein, in which the lower layer

55 consists of fetal calf serum containing 10% sucrose and the top layer consists of 80% silicone (Sigma Aldrich) and 20% mineral oil (Sigma Aldrich). The bound reactivity in cell sediments is measured in a gamma counter.

Example 62

Chemotaxis Assay

The polypeptides and agonists or antagonists thereof of the invention can be tested for their ability to significantly improve, inhibit or not significantly alter the chemotaxis of cells expressing G-protein Chemokine Receptor (CCR5) in response to MIP1-beta. Cells expressing G-protein Chemokine Receptor (CCR5) may be a homogeneous population of cells expressing purified G-protein Chemokine Receptor (CCR5) or a heterogeneous population, (e.g., peripheral blood mononuclear cells, PBMC).

The next test to measure MIP1-beta-induced chemotaxis of cells expressing CCR5 involves marking cells with an indicator molecule (fluorescent), inducing chemotaxis in a well of a 96-well plate containing a filter through which cells can pass and measure the number of migrated cells by fluorescence emission. The following materials are needed to perform this test:

HBSS, without calcium, without magnesium (Biofluids Cat. No.: p 325-000)

Albumin, Bovine Powder, fraction V, without IgG (Sigma Cat. No.: A-2058)

ChemoTx No. 105-2 (for T lymphocytes, PBMC, NK cells), 108-1 (for eosinophils, PMN) (Neuro Probe, Inc)

Calcein, AM (1 milligram / ml in dry DMSO) (Molecular Probes Cat. No.: C-3099) PBS, 1X, pH 7.4, without calcium or magnesium (Biofluids Cat. No.: p 312-00)

Briefly, the cells (for example PBMC) are washed twice with HBSS (Biofluids Cat. No.: p325-000) / 0.1% BSA and resuspended in the buffer at 10x106 cells / milliliter. 5 microliters of calcein AM (1 milligram / milliliter reserve) is added to 1 milliliter of the cell suspension. The cells are incubated in a 37 ° C incubator with a loose cap for 30 minutes. After incubation, the cells are washed twice with 0.1% HBSS / BSA and resuspended at 10x106 / milliliter in 0.1% HBSS / BSA buffer. Twenty-nine microliters of test chemokine or lower chamber control buffer of the chemotaxis microplate are added. The filter adjusts to the position of the 96-well plate ensuring that no air bubbles are put between the filter and the solution. Next, 20 microliters of the cells are loaded onto the filter and the plate is covered to prevent evaporation. The plate is then incubated at 37 ° C for 2 hours for B lymphocytes, PBMC, PMN and NK cells and 3 hours for eosinophils. After incubation, carefully rinse the upper surface of the filter with PBS buffer and gently remove the non-migrated cells from the top of the filter with a spatula. Measure the plate and filter at 485 nm excitation / 530 nM emission using CytoFluor fluorescence reader. The results are expressed as a chemotactic index, which represents the increase in the number of cells migrated in response to chemokine compared to spontaneous cell migration in the control medium.

This protocol can be easily modified to test whether an agonist or antagonist of the G-protein Chemokine Receptor (for example anti-G-protein Chemokine Receptor antibodies (CCR5)) can enhance, inhibit

or not significantly alter the ability of MIP-1 beta to induce chemotaxis in cells expressing CCR5. To do this, cells could be pre-incubated with G-protein Chemokine Receptor antibodies (CCR5) (possibly at various concentrations to generate a dose response curve) before loading the cells onto the filter.

An alternative assay to measure the ability of polypeptides and agonists or antagonists thereof of the invention to significantly improve, inhibit or not alter the chemotaxis of cells expressing G-protein Chemokine Receptor (CCR5) in response to MIP-1beta can be performed. in a Transwell chamber, instead of a 96-well microplate. The following materials are needed to perform this test:

RPMI 1640 (GIBCO-BRL Cat. No. 21870-084)

Albumin, Bovine Powder, fraction V, without IgG (Sigma Cat. No.: A-2058)

Transwell Plate (Costar Cat.No .: 3421), diameter 6.5 mm, pore size 5.0 m

MIP-1 (R&D Systems Cat.No .: 271-BME)

Lymphocyte Separation Medium (ICN Biochemical Cat. No. 50494)

Briefly, PBMC are isolated from fresh human peripheral blood by using lymphocyte separation medium and cultured in RPMI-1640 with 10% FBS for 2 days. Cultured PBMCs are resuspended in RPMI 1640 / 0.5% BSA at 20x106 cells / milliliter. MIP-1beta is diluted in RPMI-1640 / BSA 0.5% to final concentrations of 10, 100 and 1000 nanograms / milliliter. 600 microliters of MIP-1beta or RPMI 1640 / BSA 0.5% solution alone is added to the lower chamber of the Transwell and 100 microliters of the cell suspension is added to the top of the filter. The cells are incubated at 37 ° C for 4 hours. After incubation, the cells that migrate to the bottom of the chamber can be collected and then performed an FACS analysis, for example, to determine the number and type of the population or migrated cell populations. The results are expressed as a chemotactic index, which represents the increase in the number of migrated cells in response to chemokine versus spontaneous cell migration in control medium.

An additional assay to determine the ability of an antibody of the invention to prevent a natural CCR5 ligand, MIP1-beta, from inducing chemotaxis in cells expressing MIP-1beta is described in Lopalco et al., J. Immunol., 164 : 3426 (2000). Briefly, PBMCs are activated (for example, with phytohemagglutinin and IL-2) for 3 days in the presence of antibodies of the invention. Then 3x105 activated PBMCs are placed in 50 microliters of 1640 RPMI containing 3% human serum albumin in the upper chamber of a 5 micrometer pore size (CoStar) bare filter transwell. 1.5 micrograms of MIP1-beta are placed in the lower chambers. Chemotaxis is allowed to happen for half an hour while the transwell chamber was incubated at 37 degrees Celsius. Cells that migrated from the upper to the lower chamber were then quantified by FACS analysis. The results are expressed in terms of a migration index, (i.e., the number of cells that migrate to a lower chamber that contain MIP1-beta / the number of cells that migrate to a lower chamber that contain only control medium.

Example 63

Calcium Mobilization After Activating G-protein Chemokine Receptor Protein (CCR5)

When the G-protein Chemokine Receptor (CCR5) is activated, calcium is mobilized from intracellular stores and extracellular spaces. This calcium mobilization can be controlled using fluorescent Ca ++ indicators that can be excited with ultraviolet light, such as, for example, Fura-2, AM available from Molecular Probes, Eugene, OR (Cat. No. F-1221). An assay to control calcium mobilization using Fura-2 AM is described below.

Briefly, cells (for example, purified PBMC or cells transfected with CCR5 such as CCR5 CHO cells) are suspended at 5 x 106 cells / milliliter in calcium buffer (20 mM Hepes buffer, 125 mM NaCl, 5 mM KCl, 0 glucose, 5 mM, 1 mM CaCl2, 1 mM MgCl2, 0.025% BSA, pH 7.4). Fura-2, AM (50 /g / bottle) is dissolved in 25 del of DMSO. The cells are labeled with dye by adding 1 µl of the Fura-1 AM to 2 ml of cell suspension. The cells are then incubated for 30 minutes at room temperature in the dark. After incubation, the cells are washed twice with calcium buffer and suspended at 1x106 cells / milliliter in calcium buffer. Two milliliters of the cell suspension are placed in a cuvette under continuous stirring at 37 ° C. The concentration of [Ca ++] i is measured using double excitation wavelengths 340 nm and 380 nm and a single emission wavelength of 510 nm in a Hitachi spectrophotometer. An initial measurement is established for 60 seconds before adding the test chemokine or G-protein coupled anti-Receptor antibody (CCR5). Twenty microliters of the test chemokine (100 times the final concentration) is then added to the cuvette and changes in intracellular calcium concentration are controlled using the spectrophotometer. This assay can be used, for example, if a G-protein coupled anti-Receptor antibody (CCR5) is agonist (induces calcium mobilization) or antagonist (does not induce calcium mobilization).

Example 64

Models of Defective Healing in Glucocorticoids and Diabetic Mice

Model of Diabetic Mice db + / db +

To demonstrate that the G-protein Chemokine Receptor (CCR5) accelerates the healing process, the healing model of genetically diabetic mice is used. The full thickness healing model in the db + / db + mouse is a well characterized, clinically relevant and reproducible model of altered healing. The healing of the diabetic wound depends on the formation of granulation and reepithelialization tissue rather than contraction (Gartner, M. H: et al., J. Surg. Res. 52: 389 (1992); Greenhalgh, DG et al. , Am. J. Pathol. 136: 1235 (1990)).

Diabetic animals have many of the characteristic elements observed in type II diabetes mellitus. Homozygous mice (db + / db +) are obese compared to their normal heterozygous littermates (db + / + m). Diabetic mutant mice (db + / db +) have an autosomal recessive mutation on chromosome 4 (db +) (Coleman et al. Proc. Natl. Acad. Sci. USA 77: 283-293 (1982)). Animals show polyphagia, polydipsia and polyuria. Diabetic mutant mice (db + / db +) have elevated glucose levels, normal or increased insulin levels and suppressed cell-mediated immunity (Mandel et al., J. Immunol. 120: 1375 (1978); Debray-Sachs, M. et al., Clin. Exp. Immunol. 51 (1): 1-7 (1983); Leiter et al., Am. J. of Pathol. 114: 46-55 (1985)). Peripheral neuropathy, myocardial complications and microvascular lesions, thickening of the basement membrane and abnormalities in glomerular filtration in these animals have been described (Norido, F. et al., Exp. Neurol. 83 (2): 221-232 (1984) ; Robertson et al., Diabetes 29 (1): 60-67 (1980); Giacomelli et al., Lab Invest. 40 (4): 460-473 (1979); Coleman, DL, Diabetes 31 (Suppl): 1 -6 (1982)). These homozygous diabetic mice develop hyperglycemia that is resistant to insulin analogous to human type II diabetes (Mandel et al., J. Immunol. 120: 1375-1377 (1978)).

The characteristics observed in these animals suggest that the cure in this model may be similar to the cure observed in human diabetes (Greenhalgh, et al., Am. J. of Pathol. 136: 1235-1246 (1990)).

C57BL / KsJ genetically diabetic female mice (db + / db +) and their non-diabetic heterozygous litter partners (db + / + m) are used in this study (Jackson Laboratories). The animals are obtained at 6 weeks of age and are 8 weeks old at the beginning of the study. Animals are housed individually and receive food and water at will. All these manipulations are performed using aseptic techniques. Experiments are conducted in accordance with the rules and guidelines of the Institutional Animal Care and Use Committee and the Guidelines for the Care and Use of Laboratory Animals of Human Genome Sciences, Inc.

The wound protocol is performed according to previously indicated methods (Tsuboi, R. and Rifkin, D. B., J. Exp. Med 172: 245-251 (1990)). Briefly, on the day of the wound, the animals are anesthetized with an intraperitoneal injection of Avertin (0.01 mg / ml), 2,2,2-tribromoethanol and 2-methyl-2-butanol dissolved in deionized water. The dorsal region of the animal is shaved and the skin is washed with 70% ethanol solution and iodine. The surgical area is dried with sterile gauze before making the wound. An 8 mm thick wound is then created using a Keyes tissue piercer. Immediately after making the wound, the surrounding skin is gently stretched to eliminate the expansion of the wound. The wounds are left open for the duration of the experiment. The treatment is applied topically for 5 consecutive days beginning on the day of the injury. Before treatment, the wounds are gently cleaned with sterile saline and gauze sponges.

The wounds are examined visually and photographed at a fixed distance on the day of surgery and at intervals of two days from that moment. Wound closure is determined by daily measurements on days 1-5 and day 8. Wounds are measured horizontally and vertically using a calibrated Jameson caliper. The wounds are considered to be healed if the granulation tissue is no longer visible and the wound is covered by a continuous epithelium.

G-protein Chemokine Receptor (CCR5) is administered using different doses of G-protein Chemokine Receptor (CCR5) at a range of 4 mg to 500 mg per wound per day for 8 days in vehicle. Vehicle control groups receive 50 ml of vehicle solution.

Animals are sacrificed on day 8 with an intraperitoneal injection of sodium pentobarbital (300 mg / kg). The wounds and surrounding skin are then collected for histology and immunohistochemistry. Tissue test samples are placed in 10% neutral buffered formalin in tissue cassettes between biopsy sponges for further processing.

Three groups of 10 animals each (5 diabetics and 5 non-diabetic controls) are evaluated: 1) placebo vehicle control, 2) untreated and 3) treated group.

The wound closure is analyzed by measuring the area on the vertical and horizontal axis and obtaining the total square area of the wound. The contraction is then estimated by establishing the differences between the initial wound area (day 0) and the post-treatment area (day 8). The wound area on day 1 is 64 mm2, the corresponding size of the dermal perforation. Calculations are made using the following formula:

[Area open on day 8] - [Area open on day 1] / [Area open on day 1]

The test samples are fixed in 10% buffered formalin and blocks included in paraffin perpendicular to the wound surface (5 mm) are cut and cut using a Reichert-Jung microtome. Routine hematoxylin-eosin (H&E) staining is performed on cross sections of bisected wounds. Histological examination of the wounds is used to assess whether the healing process and the morphological appearance of the repaired skin is altered by treatment with G-protein Chemokine Receptor. This evaluation includes verification of the presence of accumulation of cells, inflammatory cells, capillaries, fibroblasts, reepithelialization and epidermal maturity (Greenhalgh, DG et al., Am. J. Pathol. 136: 1235 (1990)). A lens micrometer calibrated by a blind observer is used.

Tissue sections are also stained and immunohistochemically with a rabbit anti-human keratin antibody using ABC Elite detection system. Human skin is used as a positive tissue control while non-immune IgG is used as a negative control. Keratinocyte growth is determined by assessing the extent of wound reepithelialization using a calibrated lens micrometer.

Cyclin / proliferating cell nuclear antigen (PCNA) is demonstrated in skin test samples by using anti-PCNA antibodies (1:50) with an ABC Elite detection system. Human colon cancer can serve as a positive tissue control and human brain tissue can be used as a negative tissue control. Each specimen includes a section with omission of the primary antibody and substitution with non-immune mouse IgG. The score of these sections is based on the extent of proliferation on a scale of 0-8, reflecting the lower part of the light proliferation scale and reflecting the upper part intense proliferation.

Experimental data were analyzed using a t-test for unrelated samples. A p value of <0.05 was considered significant.

Rat Model Steroid Deficient

Inhibition of steroid wound healing has been well documented in various in vitro and in vivo systems (Wahl, S. M. Glucocorticoids and Wound healing. In: Anti-Inflammatory Steroid Action: Basic and Clinical Aspects.

280-302 (1989); Wahl, S. M. et al., J. Immunol. 115: 476-481 (1975); Werb, Z. et al., J. Exp. Med 147: 1684-1694 (1978)). Glucocorticoids delay wound healing by inhibiting angiogenesis, decreasing vascular permeability (Ebert, RH, et al., An. Intern. Med 37: 701-705 (1952)), fibroblast proliferation and collagen synthesis (Beck, LS et al., Growth Factors. 5: 295-304 (1991); Haynes, BF et al., J. Clan. Invest. 61: 703-797 (1978)) and producing a transient reduction of circulating monocytes (Haynes, BF, et al., J. Clin. Invest. 61: 703-797 (1978); Wahl, SM, "Glucocorticoids and wound healing", In: Anti-Inflammatory Steroid Action: Basic and Clinical Aspects, Academic Press, New York, p. 280 -302 (1989)). Systemic steroid administration for altered wound healing is a well established phenomenon in rats (Beck, LS et al., Growth Factors. 5: 295-304 (1991); Haynes, BF, et al., J. Clin. Invest 61: 703-797 (1978); Wahl, SM, "Glucocorticoids and wound healing", In: Anti-Inflammatory Steroid Action: Basic and Clinical Aspects, Academic Press, New York, p. 280-302 (1989); Pierce, GF et al., Proc. Natl. Acad. Sci. USA 86: 2229-2233 (1989)).

To demonstrate that the G-protein Chemokine Receptor (CCR5) can accelerate the healing process, the effects of multiple topical applications of the G-protein Chemokine Receptor (CCR5) on full-thickness skin excision wounds in rats are evaluated in which had been altered healing by systemic administration of methylprednisolone.

Young adult male Sprague Dawley rats weighing 250-300 g (Charles River Laboratories) are used in this example. The animals are obtained at 8 weeks of age and are 9 weeks old at the beginning of the study. The cure response of rats is altered by the systemic administration of methylprednisolone (17 mg / kg / rat intramuscularly) at the time of injury. Animals are housed individually and receive food and water at will. All manipulations are performed using aseptic techniques. This study is conducted in accordance with the rules and guidelines of the Institutional Animal Care and Use Committee and the Guidelines for the Care and Use of Laboratory Animals of Human Genome Sciences, Inc.

The wound protocol is followed according to section A, above. On the day of the wound, the animals are anesthetized with an intramuscular injection of ketamine (50 mg / kg) and xylazine (5 mg / kg). The dorsal region of the animal is shaved and the skin is washed with iodine and 70% ethanol solutions. The surgical area is dried with sterile gauze before making the wound. A full thickness wound of 8 mm is created using a Keyes tissue perforator. The wounds are left open for the duration of the experiment. The applications of the test materials are performed topically once a day for 7 consecutive days starting the day of the wound and after the administration of methylprednisolone. Before treatment, the wounds are gently cleaned with sterile saline and gauze sponges.

The wounds are examined visually and photographed at a fixed distance on the day of the wound and at the end of the treatment. Wound closure is determined by daily measurement on days 1-5 and day 8. Wounds are measured horizontally and vertically using a calibrated Jameson caliper. Wounds are considered to be healed if granulation tissue is no longer visible and the wound is covered by a continuous epithelium.

G-protein Chemokine Receptor (CCR5) is administered using different doses of G-protein Chemokine Receptor (CCR5) at a range of 4 mg to 500 mg per wound per day for 8 days in vehicle. Vehicle control groups received 50 ml of vehicle solution.

Animals are sacrificed on day 8 with an intraperitoneal injection of sodium pentobarbital (300 mg / kg). Wounds and surrounding skin are then collected for histology. Tissue test samples are placed in 10% neutral buffered formalin in head cassettes between biopsy sponges for further processing.

Four groups of 10 animals each are evaluated (5 with metitlprednisolone and 5 without glucocorticoids): 1) untreated group 2) placebo vehicle control, 3) groups treated with G-protein Chemokine Receptor (CCR5).

The wound closure is analyzed by measuring the area on the vertical and horizontal axis and obtaining the total area of the wound. The closure is estimated after establishing the differences between the initial wound area (day 0) and the post-treatment area (day 8). The wound area on day 1 is 64 mm2, the corresponding size of the dermal perforation. Calculations are made using the following formula:

[Area open on day 8] - [Area open on day 1] / [Area open on day 1]

The test samples are fixed in 10% buffered formalin and blocks included in paraffin are cut perpendicular to the wound surface (5 mm) and cut using an Olympus microtome. Routine hematoxylin-eosin (H&E) staining is performed on cross sections of bisected wounds. The histological examination of the wounds allows the evaluation of whether the healing process and the morphological appearance of the repaired skin is improved by treatment with G-protein Chemokine Receptor. A lens micrometer calibrated by a blind observer is used to determine the distance from the wound gap.

Experimental data is analyzed using a t-test for unrelated samples. A p value of <0.05 is considered significant.

The studies described in this example test the activity of the G-protein Chemokine Receptor protein (CCR5). However, one skilled in the art could easily modify the exemplified studies to test the polynucleotide activity of the G-protein Chemokine Receptor (CCR5) (eg, gene therapy), agonists (including ligands) and / or receptor Receptor antagonists. Chemokine protein G.

Example 65

Evaluation of the G-protein Chemokine Receptor (CCR5) in a Diabetic Mouse Model

The diabetic mouse model used in Example 64 can also be used to determine if the G-protein Chemokine Receptor (CCR5) is effective in preventing, treating and / or improving the diabetic condition itself. G-protein Chemokine Receptor (CCR5) is administered to db + / db + mice parenterally for various periods of time before or after the mouse has developed diabetes and insulin and / or blood glucose levels are measured or other methods known in the art to measure the severity of the disease to determine whether the administration prevents, slows or decreases the onset or severity of diabetes.

This example tests the protein activity of the G-protein Chemokine Receptor (CCR5). However, one skilled in the art could easily modify the exemplified studies to test the polynucleotide activity of the G-protein Chemokine Receptor (CCR5) (eg, gene therapy), agonists (including ligands) and / or receptor Receptor antagonists. Chemokine protein G.

Example 66

Evaluation of the G-protein Chemokine Receptor (CCR5) in a Model of Inflammatory Bowel Disease and Colitis

The purpose of this study is to determine if the G-protein Chemokine Receptor (CCR5) is effective in a model of murine colitis induced by exposure to sodium dextran sulfate in drinking water at will.

Swiss Webster female mice six to eight weeks old (20-25 g, Charles River, Raleigh, NC) are used in a model of inflammatory bowel disease induced with a 4% solution of sodium sulfate (DSS, 36,000

44,000 PM, American International Chemistry, Natick, MA) administered at will for one week. Agonists, antagonists, preferably antibodies of the present invention, of the G-protein Chemokine Receptor (CCR5) are provided by daily parenteral administration (n = 10). Three parameters are used to determine efficacy: 1) clinical score, based on the evaluation of feces; 2) histological score, based on the evaluation of the colon and 3) weight change. The clinical score is comprised of two parts that total a maximum score of four. Stool consistency is classified as: 0 = firm; 1 = loose; 2 diarrhea Blood in the stool is also evaluated on a scale of 0 to 2 with 0 = no blood; 1 = hidden blood; and 2 = global rectal hemorrhage. A mean group score above 3 indicates probable mortality and disease that has progressed beyond its treatable stage. Clinical scores are taken on Day 0, 4, 5, 6 and

7. To reach a histological score, slides of the ascending, transverse and descending colon are evaluated in a blind manner based on inflammation score (0-3) and crypt score (0-4). Body weight is measured daily. Data are expressed as mean + ETM. A Student's t-test is used for unrelated samples to determine significant differences compared to disease control (* p <0.05; ** p <0.01; *** p <0.001).

The results of this study may suggest a role for the G-protein Chemokine Receptor (CCR5) in IBD and colitis, including ulcerative colitis. Thus, agonists, antagonists, including antibodies of the present invention and fragments of the G-protein Chemokine Receptor (CCR5) can be used to treat, prevent or alleviate patients who have IBD, colitis and / or ulcerative colitis or any other inflammation. of the intestine

SEQUENCE LIST

<110> Human Genome Sciences, Inc. Roschke, Viktor Rosen, Craig A. Ruben, Steven, M.

<120> Human protein G chemokine receptor (CCR5) HDGNR10

<130> 1488.115PC0J

<150> PCT / US01 / 04153

<151> 02-02-2001

<150> 09 / 779,880

<151> 02-02-2001

<150> 60 / 297,257

<151> 06-12-2001

<150> 60 / 310,458

<151> 08-08-2001

<150> 60 / 328,447

<151> 12-10-2001

<150> 60 / 341,725

<151> 12-21-2001

<160> 70

<170> PatentIn version 3.1

<210> 1

<211> 1414

<212> DNA

<213> Homo sapiens

<220>

<221> CDS

<222> (259) .. (1314)

<400> 1

image 1

image 1

image 1

<210> 2

<211> 352

<212> PRT

<213> Homo sapiens

<400> 2

image 1

image 1

<210> 3

<211> 30 5 <212> DNA

<213> Artificial

<220>

<223> 5 'oligonucleotide primer for HDGNR10 10

<400> 3

image 1

<210>

4 15 <211> 29

<212> DNA

<213> Artificial

<220>

<223> 3 'oligonucleotide primer for HDGNR10

<400> 4

<210> 5

<211> 34

<212> DNA

<213> Artificial

<220>

<223> 5 'oligonucleotide primer for HDGNR10

<400> 5

<210> 6

<211> 61

<212> DNA

<213> Artificial

<220>

<223> 3 'oligonucleotide primer for HDGNR10

<400> 6

<210> 7

<211> 30

<212> DNA

<213> Artificial

<220>

<223> 5 'oligonucleotide primer for HDGNR10

<400> 7

<210>

8 5 <211> 29

image 1

image 1

image 1

image 1

<212> DNA

<213> Artificial

<220> 10 <223> 3 'oligonucleotide primer for HDGNR10

<400> 8

image 1

15 <210> 9

<211> 344

<212> PRT

<213> Homo sapiens

20 <400> 9

image 1

image 1

<210> 10

<211> 733

<212> DNA

<213> Homo sapiens

<400> 10

image 1

<210> 11

<211> 5 5 <212> PRT

<213> Reason for the proximal membrane region

<220>

<221> Variant 10 <222> (3)

<223> It can be any amino acid

<400> 11

image 1

fifteen

<210> 12

<211> 86

<212> DNA

<213> Artificial 20

<220>

<223> 5 'primer for SV40 early promoter construction - gamma activation site

<400> 12 <210> 13

image 1

<211> 27 5 <212> DNA

<213> Artificial

<220>

<223> 3 'oligonucleotide primer for SV40 early promoter 10

<400> 13

image 1

<210> 14 15 <211> 271

<212> DNA

<213> Artificial

<220> 20 <223> SV40 early promoter construction - gamma activation site

<400> 14

image 1

25 <210> 15

<211> 32

<212> DNA

<213> Artificial

30 <220>

<223> 5 'oligonucleotide primer for EGR-1 promoter sequence <400> 15

image 1

<210> 16

<211> 31

<212> DNA

<213> Artificial

<220>

<223> 3 'oligonucleotide primer for EGR-1 promoter sequence

<400> 16

image 1

<210> 17

<211> 12

<212> DNA

<213> Homo Sapiens

<400> 17

image 1

<210> 18

<211> 73

<212> DNA

<213> Artificial

<220>

<223> 5 'oligonucleotide primer for SV40 early promoter construction - NF-KB

<400> 18

image 1

<210> 19

<211> 27

<212> DNA

<213> Artificial

<220>

<223> 3 'oligonucleotide primer for SV40 early promoter

<400> 19

image 1

10

<210> 20

<211> 256

<212> DNA

<213> Artificial 15

<220>

<223> Construction of SV40 NF-KB early promoter

<400> 20

image2

<210> 21

<211> 1056

<212> DNA 25 <213> Homo sapiens

<220>

<221> CDS

<222> (1) .. (1056) 30

<400> 21

image 1

image 1

<210> 22

<211> 352

<212> PRT

<213> Homo sapiens

<400> 22

image 1

<210> 23

<211> 23

<212> DNA

<213> Artificial

<220>

<223> 5 'oligonucleotide primer for VH domain

<400> 23

image 1

<210> 24

<211> 23

<212> DNA

<213> Artificial

<220>

<223> 5 'oligonucleotide primer for VH domain

<400> 24

image 1

<210> 25

<211> 23

<212> DNA

<213> Artificial

<220>

<223> 5 'oligonucleotide primer for VH domain

<400> 25

image 1

<210> 26

<211> 23

<212> DNA

<213> Artificial

<220>

<223> 5 'oligonucleotide primer for VH domain

<400> 26

image 1

<210> 27

<211> 23

<212> DNA

<213> Artificial

<220>

<223> 5 'oligonucleotide primer for VH domain

<400> 27

image 1

<210> 28

<211> 23

<212> DNA

<213> Artificial

<220>

<223> 5 'oligonucleotide primer for VH domain

<400> 28

image 1

<210> 29

<211> 24

<212> DNA

<213> Artificial

<220>

<223> 5 'oligonucleotide primer for VH domain

<400> 29

image 1

<210> 30

<211> 24

<212> DNA

<213> Artificial

<220>

<223> 5 'oligonucleotide primer for VH domain

<400> 30

image 1

<210> 31

<211> 24

<212> DNA

<213> Artificial

<220>

<223> 5 'oligonucleotide primer for VH domain

<400> 31

image 1

<210> 32

<211> 24

<212> DNA

<213> Artificial

<220>

<223> 5 'oligonucleotide primer for VH domain

<400> 32

image 1

<210> 33

<211> 23

<212> DNA

<213> Artificial

<220>

<223> 5 'oligonucleotide primer for VL domain

<400> 33

image 1

<210> 34

<211> 23

<212> DNA

<213> Artificial

<220>

<223> 5 'oligonucleotide primer for VL domain

<400> 34

image 1

<210> 35

<211> 23

<212> DNA

<213> Artificial

<220>

<223> 5 'oligonucleotide primer for VL domain

<400> 35 <210> 36

image 1

<211> 23

<212> DNA

<213> Artificial

<220>

<223> 5 'oligonucleotide primer for VL domain

<400> 36

image 1

<210> 37

<211> 23

<212> DNA

<213> Artificial

<220>

<223> 5 'oligonucleotide primer for VL domain

<400> 37

image 1

<210> 38

<211> 23

<212> DNA

<213> Artificial

<220>

<223> 5 'oligonucleotide primer for VL domain

<400> 38

image 1

<210> 39

<211> 23

<212> DNA

<213> Artificial

<220>

<223> 5 'oligonucleotide primer for VL domain

<400> 39

image 1

<210> 40

<211> 23

<212> DNA

<213> Artificial

<220>

<223> 5 'oligonucleotide primer for VL domain

<400> 40

image 1

<210> 41

<211> 23

<212> DNA

<213> Artificial

<220>

<223> 5 'oligonucleotide primer for VL domain

<400> 41

image 1

<210> 42

<211> 23

<212> DNA

<213> Artificial

<220>

<223> 5 'oligonucleotide primer for VL domain

<400> 42

image 1

<210> 43

<211> 23

<212> DNA

<213> Artificial

<220>

<223> 5 'oligonucleotide primer for VL domain

<400> 43

image 1

<210> 44

<211> 23

<212> DNA

<213> Artificial

<220>

<223> 5 'oligonucleotide primer for VL domain

<400> 44

image 1

<210> 45

<211> 23

<212> DNA

<213> Artificial

<220>

<223> 5 'oligonucleotide primer for VL domain

<400> 45 <210> 46

image 1

<211> 23

<212> DNA

<213> Artificial

<220>

<223> 5 'oligonucleotide primer for VL domain

<400> 46

image 1

<210> 47

<211> 24

<212> DNA

<213> Artificial

<220>

<223> 3 'oligonucleotide primer for VL domain

<400> 47

image 1

<210> 48

<211> 24

<212> DNA

<213> Artificial

<220>

<223> 3 'oligonucleotide primer for VL domain

<400> 48

image 1

<210> 49

<211> 24

<212> DNA

<213> Artificial

<220>

<223> 3 'oligonucleotide primer for VL domain

<400> 49

image 1

<210> 50

<211> 24

<212> DNA

<213> Artificial

<220>

<223> 3 'oligonucleotide primer for VL domain

<400> 50

image 1

<210> 51

<211> 24

<212> DNA

<213> Artificial

<220>

<223> 3 'oligonucleotide primer for VL domain

<400> 51

image 1

<210> 52

<211> 23

<212> DNA

<213> Artificial

<220>

<223> 3 'oligonucleotide primer for VL domain

<400> 52

image 1

<210> 53

<211> 23

<212> DNA

<213> Artificial

<220>

<223> 3 'oligonucleotide primer for VL domain

<400> 53

image 1

<210> 54

<211> 23

<212> DNA

<213> Artificial

<220>

<223> 3 'oligonucleotide primer for VL domain

<400> 54

image 1

<210> 55

<211> 23

<212> DNA

<213> Artificial

<220>

<223> 3 'oligonucleotide primer for VL domain

<400> 55

image 1

<210> 56

<211> 23

<212> DNA

<213> Artificial

<220>

<223> 3 'oligonucleotide primer for VL domain

<400> 56

image 1

<210> 57

<211> 23

<212> DNA

<213> Artificial

<220>

<223> 3 'oligonucleotide primer for VL domain

<400> 57

image 1

<210> 58

<211> 23

<212> DNA

<213> Artificial

<220>

<223> 3 'oligonucleotide primer for VL domain

<400> 58 <210> 59

image 1

<211> 363

<212> DNA 5 <213> Homo sapiens

<220>

<221> CDS

<222> (1) .. (363) 10 <223>

<400> 59

image 1

15 <210> 60

<211> 121

<212> PRT

<213> Homo sapiens

20 <400> 60 <210> 61

image 1

<211> 327 5 <212> DNA

<213> Homo sapiens

<220>

<221> CDS 10 <222> (1) .. (327)

<223>

<400> 61

image 1

<210> 62

<211> 109

<212> PRT

<213> Homo sapiens

<400> 62

image 1

<210> 63

<211> 379

<212> DNA

<213> Homo sapiens

<220>

<221> CDS

<222> (1) .. (378)

<223>

<400> 63

image3

<210> 64

<211> 126

<212> PRT 15 <213> Homo sapiens

<400> 64 <210> 65

image 1

<211> 324 5 <212> DNA

<213> Homo sapiens

<220>

<221> CDS 10 <222> (1) .. (324)

<223>

<400> 65

image 1

image 1

<210> 66

<211> 108

<212> PRT

<213> Homo sapiens

<400> 66

image 1

10

<210> 67

<211> 378

<212> DNA

<213> Homo sapiens

fifteen

<220>

<221> CDS

<222> (1) .. (378)

<223>

<400> 67

image 1

5

<210> 68

<211> 126

<212> PRT

<213> Homo sapiens

10

<400> 68

image 1

<210> 69

<211> 327 5 <212> DNA

<213> Homo sapiens

<220>

<221> CDS 10 <222> (1) .. (327)

<223>

<400> 69

image 1

<210> 70

<211> 109

<212> PRT

<213> Homo sapiens

<400> 70

image 1

Claims (44)

1. A human or humanized antibody or fragment thereof that binds to G-protein Chemokine Receptor polypeptide (CCR5), said antibody or fragment thereof comprising: 5 (a) the amino acid sequences of the VH domain of the antibody expressed by the hybridoma cell line deposited with the ATCC Deposit No. PTA-4054; Y (b) the amino acid sequence of the VL domain of the antibody expressed by the hybridoma cell line deposited with the ATCC Deposit No. PTA-4054. 2. A human or humanized antibody or fragment thereof that specifically binds to polypeptide of 10 G-protein chemokine receptor (CCR5), said antibody or fragment thereof comprising the amino acid sequences of each of the VHCDR1, VHCDR2, VHCDR3, VLCDR1, VLCDR2 and VLCDR3 domains of the antibody expressed by the hybridoma cell line deposited with ATCC Deposit No. PTA-4054; said antibody or fragment thereof having an activity selected from the group consisting of: (a) inhibition of RANTES binding with cells expressing G-protein Chemokine Receptor (CCR5); 15 (b) inhibition of MIP-1alpha binding with cells expressing G-protein Chemokine Receptor (CCR5); Y

(C)

 MIP-1beta binding inhibition with cells expressing G-protein Chemokine Receptor (CCR5); and said antibody or fragment thereof having an activity selected from the group consisting of:

(d)

 inhibition of HIV binding with cells expressing G-protein Chemokine Receptor (CCR5); Y

(and)

 inhibition of HIV infection of cells expressing G-protein Chemokine Receptor (CCR5).

The human or humanized antibody or fragment thereof of claim 1 or 2, which additionally comprises an immunoglobulin heavy chain constant domain selected from the group consisting of: (a) a constant domain of IgM; (b) a constant domain of IgG; and 25 (c) a constant domain of IgA.

Four.

The human or humanized antibody or fragment thereof of claim 3 wherein the immunoglobulin heavy chain constant domain is selected from the group consisting of a constant domain of IgG1, a constant domain of IgG2, a constant domain of IgG3 and a constant domain of IgG4.

5.

The human or humanized antibody or fragment thereof of any one of claims 1 to

30 4, which additionally comprises an immunoglobulin light chain constant domain selected from the group consisting of:

(to)

 a constant kappa domain; Y

(b)

 a constant lambda domain.

6. The human or humanized antibody or fragment thereof of any one of claims 1 to 35, wherein said G-protein Chemokine Receptor (CCR5) is expressed on the surface of a cell.

7.

The human or humanized antibody or fragment thereof of any one of claims 1 to 6, which binds to G-protein Chemokine Receptor (CCR5) in a Western blot or in an ELISA.

8.

The human or humanized antibody or fragment thereof of any one of claims 1 to 7, said antibody or fragment thereof being selected from the group consisting of:

40 (a) a Fab fragment;

(b)

 a Fab ’fragment;

(C)

 an F (ab ’) 2;

(d)

 an Fd;

(and)

 a single chain Fv;

(F)

 a Fv with disulfide bond; Y

(g)

 a monoclonal antibody.

9.

The human or humanized antibody or fragment thereof of any one of claims 1 to 8, said antibody or fragment thereof having a dissociation constant (KD) of 10-9 M or less.

10.

The human or humanized antibody or fragment thereof of any one of claims 1 to 9, said antibody or fragment thereof having a dissociation rate selected from the group consisting of:

(to)

 a dissociation rate of at least 10-3 / s; Y

(b)

 a dissociation rate of at least 10-4 / s.

eleven.

An antibody expressed by the deposited cell line with the ATCC Deposit No. PTA-4054.

12.

The human or humanized antibody or fragment thereof of any one of claims 1 to 11, said antibody or fragment thereof being fused with a heterologous polypeptide.

13.

The human or humanized antibody or fragment thereof of claim 12, wherein the heterologous polypeptide is human serum albumin.

14.

The human or humanized antibody or fragment thereof of any one of claims 1 to 13, said antibody or fragment thereof being coupled or conjugated with a detectable label.

fifteen.

The human or humanized antibody or fragment thereof of claim 14, wherein the detectable label is a radioactive label.

16.

The human or humanized antibody or fragment thereof of claim 15, wherein the radioactive label is 125I, 131I, 111In, 90Y, 99Tc, 177Lu, 166Ho or 153Sm.

17.

The human or humanized antibody or fragment thereof of claim 14, wherein the detectable label is an enzyme, a fluorescent label, a luminescent label or a bioluminescent label.

18.

The human or humanized antibody or fragment thereof of any one of claims 1 to 17, the antibody or fragment thereof being biotinylated.

19.

The human or humanized antibody or fragment thereof of any one of claims 1 to 18, said antibody or fragment thereof being conjugated with a therapeutic or cytotoxic agent.

twenty.

The human or humanized antibody or fragment thereof of claim 19, wherein the therapeutic or cytotoxic agent is an antimetabolite, an alkylating agent, an antibiotic, a growth factor, a cytokine, an antiangiogenic agent, an antimitotic agent, a anthracycline, a toxin or an apoptotic agent.

twenty-one.

The human or humanized antibody or fragment thereof of any one of claims 1 to 20, in a pharmaceutically acceptable carrier.

22

A polynucleotide encoding the antibody or fragment thereof of any one of claims 1 to 13.

2. 3.

A vector comprising the polynucleotide of claim 22.

24.

A host cell comprising the vector of claim 23 or the polynucleotide of claim 22.

25.

The host cell of claim 24, which is a cell line capable of expressing the human or humanized antibody or fragment thereof of any one of claims 1 to 13.

26.

The cell line of claim 25, wherein the cells are NSO cells or CHO cells.

27.

The human or humanized antibody or fragment thereof of any one of claims 1 to 13, said antibody or fragment thereof can be obtained by expression of the cell line of claim 25 or 26.

28.

A method for preparing an antibody or fragment thereof comprising:

(to)

 expressing the antibody or fragment thereof encoded by the polynucleotide of claim 22; Y

(b)

 recover said antibody or fragment thereof.

29.

The human or humanized antibody or fragment thereof of any one of claims 1 to

13, said antibody or fragment thereof can be obtained by the method of claim 28.

30

A pharmaceutical composition comprising the human or humanized antibody or fragment thereof of any one of claims 1 to 21, 27 and 29 and, optionally, a pharmaceutically acceptable carrier.

31.

Use of a human or humanized antibody or fragment thereof of any one of claims 1 to 21, 27 and 29 for the preparation of a pharmaceutical composition for the treatment or prevention of HIV infection.

32

The human or humanized antibody or fragment thereof of any one of claims 1 to 21, 27 and 29 for use in the treatment or prevention of HIV infection.

33.

Use of a human or humanized antibody or fragment thereof of any one of claims 1 to 21, 27 and 29 for the preparation of a composition of a pharmaceutical composition for the treatment or prevention of rheumatoid arthritis.

3. 4.

The human or humanized antibody or fragment thereof of any one of claims 1 to 21, 27 and 29 for use in the treatment or prevention of rheumatoid arthritis.

35

The pharmaceutical composition of claim 30 or the use of claim 31 or 33, the pharmaceutical composition being for administration in a human being.

36.

The human or humanized antibody or fragment thereof of claim 32 or 34, wherein the treatment or prevention is applied to a human being.

37.

The pharmaceutical composition of claim 30 or 35 or the use of any one of claims 31, 33 and 35, the pharmaceutical composition being for administration of the human or humanized antibody or fragment thereof in combination with a chemotherapeutic agent or an antiretroviral agent.

38.

The human or humanized antibody or fragment thereof of any one of claims 32, 34 and 36, the antibody or fragment thereof being administered in combination with a chemotherapeutic agent or an antiretroviral agent.

39.

The pharmaceutical composition of any one of claims 30, 35 and 37 or the use of any one of claims 31, 33, 35 and 37, the pharmaceutical composition further comprising an antiretroviral agent.

40

The human or humanized antibody or fragment thereof of any one of claims 32, 34, 36 and 38, wherein an antiretroviral agent is additionally administered.

41.

A method for detecting expression of a G protein Chemokine Receptor polypeptide (CCR5) comprising:

(to)

 assaying the expression of a G-protein Chemokine Receptor polypeptide (CCR5) in a biological sample of an individual using the human or humanized antibody or fragment thereof of any one of claims 1 to 21, 27 and 29; Y

(b)

 compare the level of a G-protein Chemokine Receptor polypeptide (CCR5) with a conventional level of a G-protein Chemokine Receptor polypeptide (CCR5).

42

A method to detect, diagnose or predict HIV infection and / or conditions associated with HIV infection comprising:

(to)

 assaying the expression of a G-protein Chemokine Receptor polypeptide (CCR5) in a biological sample of an individual using the human or humanized antibody or fragment thereof of any one of claims 1 to 21, 27 and 29; Y

(b)

 compare the level of a G-protein Chemokine Receptor polypeptide (CCR5) with a conventional level of a G-protein Chemokine Receptor polypeptide (CCR5).

43

A method to detect, diagnose or predict rheumatoid arthritis that comprises:

to.

 assaying the expression of a G-protein Chemokine Receptor polypeptide (CCR5) in a biological sample of an individual using the human or humanized antibody or fragment thereof of any one of claims 1 to 21, 27 and 29; Y

b.

 compare the level of a G-protein Chemokine Receptor polypeptide (CCR5) with a conventional level of a G-protein Chemokine Receptor polypeptide (CCR5).

44.

A kit comprising the human or humanized antibody or fragment thereof of any one of claims 1 to 21, 27 and 29.

Four. Five.

The kit of claim 44 further comprising a control antibody.