ES2359320T3 - TEMPERATURE CONTROL OF A REACTION CONTAINER, SYSTEM WITH REACTION CONTAINER AND USE OF THE SYSTEM. - Google Patents

Abstract

A process for rapid thermal control of a reaction volume (4) of a reaction vessel (2) comprising a closed reaction volume (4) <= 2 ml, preferably <= 50 μl, surrounded by at least two walls (6, 8), a first wall (6) and a second wall (8), said first wall (6) being of a first material that is permeable to at least one wavelength of light and said second wall ( 8) of a second material with a high thermal conductivity in which the thermal control of said reaction volume (4) in said reaction vessel (2) comprises a temperature change of the reaction volume (4) from a previous temperature to an objective temperature at which said temperature change is carried out: a) by placing the walls (6, 8) of the reaction vessel (2) in contact with a first thermal block (14 to 19) i) at a higher temperature at the target temperature if the target temperature is higher than the temperature to the previous one, or in the same way as before, ii) at a temperature below the target temperature if the target temperature is below the temperature for a time necessary to bring the temperature of the reaction volume (4) to the target temperature or near her; and b) then putting said walls (6, 8) in contact with a second thermal block (14 to 19) at the target temperature to bring the reaction volume (4) to said target temperature and / or maintain the reaction volume (4 ) at said target temperature for the stipulated time, in which the first thermal block (14 to 19) is a constant first predetermined temperature and the second thermal block (14 to 19) is at a constant second predetermined temperature, that is , the target temperature, characterized in that the walls (6, 8) are put in direct contact with said first and said second thermal block (14 to 19) and said reaction vessel (2) used also comprises a hole (10) for introducing a sample, a channel through which the sample flows to the reaction volume (4), a second channel, an expansion volume (25), a third channel and a second hole (12) through which the air flows displaced by the shows towards the outside of the reaction vessel, in which said expansion volume (25) allows the expansion of an analytical reaction mixture within said reaction volume (4) and prevents the breakage of said reaction vessel (2) by the increase in pressure caused by evaporation during heating of said reaction mixture inside the reaction volume (4), and the heat transfer between the reaction vessel (2) and a thermal block (14 to 19) is intensifies by pressing said walls (6, 8) of said reaction vessel (2) and said walls of the thermal blocks (14 to 19) against each other and in direct contact with each other.

Description

FIELD OF THE INVENTION

The present invention relates to a rapid temperature control method of a reaction vessel comprising a reaction volume for reacting biological or chemical analytes in order to detect and quantify said analytes in a sample containing said analytes. The present invention also relates to a system, and software for the system, which is used in the process. The present invention also relates to the use of the system for the detection of specific types of analytes.

BACKGROUND OF THE INVENTION

The polymerase chain reaction (PCR; Saiki et al., 1985) is a good example of a chemical reaction that requires a rigorous temperature control: in the PCR, a specific DNA sequence is amplified by subjecting the DNA sample to cyclic temperature changes. First, the double stranded template DNA is denatured by increasing the temperature of the reaction mixture to approximately 95 ° C. Then, the temperature is lowered to approximately between 40 and 70 ° C. At this temperature, hybridization of the short synthetic oligonucleotide primers with their complementary sequences takes place, which has led to a single chain state in the previous stage of heating. After this, the temperature can be increased to approximately 72 ° C. At this temperature, a thermostable DNA polymerase extends the primers, thus creating a complementary copy of the original single stranded template DNA. (In many applications, this extension stage can be carried out at the same temperature as the hybridization stage. Quite often, both primer hybridization and primer extension are carried out at approximately 60 ° C). Repeating the temperature cycle many times, if the amplification efficiency is ideal, the amount of template DNA is doubled in each cycle. In addition to PCR, many, if not all, biological and chemical reactions require a certain temperature to occur predictably. Examples of such reactions with defined temperature conditions include other nucleic acid amplification reactions [such as nucleic acid sequence based amplification (NASBA) (Compton, 1991), ligase chain reaction (LCR) ( Barany, 1991), chain shift amplification (SDA) (Walker et al., 1992) and rolling circle amplification (RCA) (Banér et al., 1998)], immunocomplex formation (ie binding of an antibody to an antigen) (Price and Newman, 1997) and virtually all other enzymatic and chemical reactions.

There are several solutions to control a reaction temperature. In PCR, reaction vessels are normally placed in a metal block, whose temperature is changed periodically. However, this solution has an important drawback: considerable time is required for the temperature of the block to change; Once the target temperatures have been reached, the reaction occurs very quickly. Therefore, it is the thermal mass of the block, and not the reaction itself, that limits the speed of the reaction.

The rate of change of the temperature inside a reaction vessel can be increased by a technique known to those skilled in the art as over or under shooting: to cool the contents of a reaction vessel. until a low target temperature, the metal block is first cooled to a temperature below the target temperature, after which the metal block is reheated to the target temperature. Or, to heat the contents of the reaction vessel to a high target temperature, the metal block is first heated to a temperature above the target temperature, after which the metal block is cooled to the high target temperature. In this way, the rate of temperature change inside a reaction vessel can be increased. However, the process is still quite slow, due to the fact that the metal block takes some time to change temperature.

Another solution for thermal cycling includes the use of hot and cold air to change the temperature of a reaction mixture that is placed inside a glass capillary with a large surface-volume ratio (Wittwer et al., 1997). This allows to achieve a very rapid temperature change. However, when glass capillaries are used, the maximum reaction volume is often so small that it begins to limit the analytical sensitivity of the application. In addition, the chemical properties of glass can inhibit some chemical reactions. The fragility of glass capillaries is also a problem, since they break very easily when handled. Another solution is based on physically moving the reaction mixture through a channel that passes through areas with different temperatures. Said technique has been described, for example, by Kopp et al. (1998). However, in these applications, the reaction volumes are even smaller and, therefore, the analytical sensitivity is seriously compromised. In addition, the same channel must be reused for many samples, which introduces a serious risk of contamination by trawling between different samples or, otherwise, the amplification vessels must be disposable and single-use, which increases considerably the total costs of the test, since the production costs of the microfluidic channels can be much higher than the production costs of simple plastic reaction tubes; Of course, depending on the volume of manufacture. Another solution is based on having several metal blocks or water baths at defined temperatures and changing the location of the reaction vessel cyclically between the blocks or baths with different temperatures. Examples of thermocyclers based on this principle that are available on the market include RoboCycler (Stratagene, USA) and H2OBIT Thermal Cycler (ABgene, United Kingdom). In these applications, a higher rate of temperature change is achieved than with a single block. However, when using sample tubes with small surface-volume ratios, the rate of temperature change is still not as fast as it can be.

In US 4,902,624, EP 0 31 8255 and US 5,736,106, techniques have been described in which a reaction vessel with a high surface-volume ratio moves cyclically between thermal blocks at defined temperatures. In these solutions there are certain problems. First, the rate of temperature change is not ideal for all applications. Second, when the reaction mixture is heated to high temperatures, the pressure inside the reaction vessel increases, which can cause the reaction vessel to break and the reaction mixture to evaporate.

In cases where cyclic temperature changes are not needed, for example in most immunoassays, the usual practice is to place the reaction vessel in the atmosphere of an incubator set at a defined temperature. In these procedures, it takes considerable time to heat or cool the contents of the reaction vessel, since, due to the low surface-volume ratio of the vessels and the low thermal conductivity of static air, the rate of thermal exchange between the container and its surroundings is not ideal. A device for selectively adjusting the temperature of a sample to different values is described in US 5,446,263.

OBJECTIVES AND SUMMARY OF THE PRESENT INVENTION

An object of the present invention is to provide a process for rapid thermal control of a reaction volume (4) of a reaction vessel (2). Another object of the present invention is to provide an improved system (20) for detecting and / or quantifying a biological and / or chemical analyte or analytes in a sample that supposedly contains said analyte or analytes. A further object of the present invention is to provide uses for the detection and / or quantification system.

Thus, the invention relates to a method according to claim 1.

The invention also relates to a system (20) for detecting and / or quantifying a biological and / or chemical analyte or analytes in a sample that is supposed to contain said analyte or analytes according to claim 8.

The invention also relates to uses of the system according to the invention for the real-time polymerase chain reaction (real-time PCR), for nucleic acid amplification reactions, preferably nucleic acid sequence based amplification (NASBA) , chain shift amplification (SDA), rolling circle amplification (RCA) and ligase chain reaction (LCR), and for ligand binding assays.

BRIEF DESCRIPTION OF THE DRAWINGS

Fig. 1 shows a schematic drawing of an embodiment of a reaction vessel according to the present invention.

Figs. 2a and 2b schematically show an embodiment of a system according to the present invention.

Fig. 3 shows the temperature control of a reaction vessel using a thermal cycling procedure and a system for thermal control according to the present invention and a conventional thermal cycler.

Fig. 4 shows an amplification graph showing the applicability of the present invention to carry out polymerase chain reactions in real time.

Fig. 5 schematically shows the way in which the temperature control of reaction vessels according to the invention can be carried out.

DETAILED DESCRIPTION OF THE INVENTION

The term "ligand binding assay," as used herein, refers to any analytical procedure in which at least one covalent or non-covalent bond is formed between a binding agent and a ligand thereof.

The term "binding agent," as used herein, refers to any molecule capable of forming at least one covalent or non-covalent bond with a second molecule. Examples of binding agents include, but are not limited to, immunoglobulins and derivatives thereof, such as recombinant antibodies, Fab fragments and scFv fragments; nucleic acid binding ligands such as nucleic acids and derivatives of nucleic acids and aptamers and DNAzymes and ribozymes; and proteins capable of binding specific ligands.

The term "ligand," as used herein, refers to any molecule capable of forming at least one covalent or non-covalent bond with a binding agent. The ligands can be of natural or synthetic origin. In a ligand binding assay, a ligand can be the analyte and / or a substance necessary for the detection of the analyte.

The term "temperature near the target temperature," as used herein, refers to a temperature that is not more than 3 ° C higher or lower than the target temperature, usually not more than 1 ° C higher or lower than the target temperature, preferably no more than 0.5 ° C higher or lower than the target temperature.

The present invention provides a process that allows rapid thermal control of the contents of a reaction vessel. Normally several temperature changes are carried out in the reaction volume, and more than one of said temperature changes are carried out using a pair of thermal blocks consisting of a first and a second thermal block, in which each thermal block of each of said pairs may also be a thermal block of one or more of the other pairs mentioned, in accordance with steps a) and b) defined above. Preferably, all temperature changes of the reaction volume are carried out following these steps.

By using a first and a second block according to the previous steps a) and b), the rate of change of temperature inside a reaction vessel is higher than in the case where only a second is used block, maintained at the target temperature, to change the temperature inside the reaction vessel until the temperature of the second block is reached. Another advantage of using a first block according to the previous stage a) is that the temperature of the second block, maintained at the target temperature, remains more constant, which results in a more precise control of the temperature inside of the reaction vessel. This is because, when a first block is used according to the previous stage a), a reaction vessel that passes, according to the previous stage b), the second block maintained at the target temperature is already at target temperature or at a temperature close to the target temperature. Because the difference in temperature between the reaction vessel and the second block maintained at the target temperature is very small at the time of transferring the reaction vessel to the second block, the effect of the reaction vessel on the temperature of the second block is very small. If a first block was not used in accordance with the previous step a), the effect of transferring a reaction vessel to a block maintained at the target temperature would have a greater impact on the temperature of the block and, therefore, time would be required. and energy to bring the block temperature back to the target temperature. This would make it more difficult to control the temperature of the contents of the reaction vessel.

The container is usually flat in shape and comprises a continent space in which specific analyte reactions can occur. In addition, the container comprises two channels and two holes. When a sample is introduced into the vessel through a first orifice, said sample flows through a first channel into said continent space and excess gas flows from said continent space through a second channel and exits the reaction vessel through a second hole. Normally, the walls of the container are thin and one of the walls is normally made of a material that is permeable to visible and ultraviolet light and one of the walls is made of a material with a high thermal conductivity, such as a sheet metallic

The process of the present invention provides for rapid thermal control of a liquid. The process normally comprises the steps consisting in: placing said liquid inside a normally flat reaction vessel; placing said reaction vessel in a support of reaction vessels that is fixed to a mobile support that can take different positions; and moving said mobile support in order to place the reaction vessel in a groove inside a thermal block maintained at a defined temperature. To increase the temperature inside the reaction vessel to a certain target temperature, the vessel is placed, first, in the groove of a thermal block that is hotter than said target temperature and then placed in a block which is at said target temperature. To reduce the temperature inside the reaction vessel to a second target temperature, the vessel is placed, first, in a thermal block that is colder than said second target temperature and then in a block that is at said second target temperature.

The present invention also provides a system for detecting and / or quantifying a biological and / or chemical analyte or analytes in a sample that allegedly contains said analyte or analytes, which comprises a temperature cycling system for rapid thermal control of a liquid, according to claim 8.

In a typical embodiment of the invention, the thermal conductivity of the second material, that is, the material of the second wall of the reaction volume of the reaction vessel, is ≥ 10 mW / mmK, preferably ≥ 100 mW / mmK. Normally, the material is a metal, preferably aluminum or copper. The thickness of the second wall is normally ≤ 0.5 mm, preferably ≤ 0.1 mm. The outer surface of the second wall is normally flattened and preferably flat. In a typical embodiment of the reaction vessel according to the invention, the ratio of the area of the second wall it encloses, that is, the area of the second wall oriented towards, the reaction volume with respect to said volume is ≥ 0, 5 mm2 / μl, preferably ≥ 5 mm2 / μl.

Normally, the first wall of the reaction vessel is permeable to visible light and ultraviolet (UV). The first material of the first wall is usually plastic or glass. The thickness of the first wall is normally ≤ 5 mm, preferably ≤ 2 mm.

In the system according to the invention, the reaction vessel comprises an inlet for introducing the sample and, optionally, reagents in the reaction volume and an outlet of the reaction vessel for evacuating the displaced air and / or the sample and the reagents of the volume of reaction. The reaction vessel also comprises an expansion volume, for the expansion of the sample and / or the reagents during the reaction and / or to contain the vapor pressure created by the heating.

In preferred embodiments of the process of the invention, the ratio of the area of the second wall in direct contact with the thermal blocks with respect to the reaction volume is ≥ 0.5 mm2 / μl, preferably ≥ 5 mm2 / μl.

The typical embodiments of the system according to the invention comprise more than four thermal blocks at different predetermined temperatures. In some preferred embodiments, the predetermined temperatures of these four blocks would be approximately: 10 to 25 ° C; 40 to 72 ° C; 80 to 98 ° C; and 90 at 120 ° C. However, the number of blocks may be greater than four and the temperatures of the blocks may be different from the temperatures indicated. Typical embodiments of the system comprise means for putting more than one of the walls of said reaction vessels in direct contact with the thermal blocks. The means for putting the wall or walls of the reaction vessel in direct contact with the thermal blocks normally comprise a support for said container with means for moving said support in a circular or linear path and said thermal blocks are located at different points of said circular or linear path, so that said wall or walls of said reaction vessel can be brought into direct contact with each thermal block by moving said support along said circular or linear path.

The system comprises means for pressing the wall or walls of said reaction vessel against the wall or walls of the thermal blocks, in direct contact with each other. Such means could be any mechanical, electromechanical, pneumatic or hydraulic means, for example, simple means comprising one or more springs.

Description of the system reaction vessel

Fig. 1 shows a schematic drawing of a reaction vessel 2 of an embodiment of the system according to the present invention. For clarity, a wall 8 of the container 2 is separated from the body 5 of the container. During use, the wall 8 is firmly attached to the body 5. The body 5 of the container 2 is made of polypropylene and the wall separated 8 from, for example, aluminum foil. The body 5 is permeable to at least one wavelength of light. The container 2 comprises a hole 10 for introducing a sample, a channel through which the sample flows into a reaction volume 4, a second channel, an expansion volume 25, a third channel and a second hole 12 through which the air displaced by the sample leaves the reaction vessel 2. The reaction vessel 2 can be sealed, for example, by pressing the holes 10, 12 with a hot press, so that the plastic melts and, therefore, blocks the holes 10, 12 or, for example, by inserting plugs into holes 10, 12 that fit tightly into holes 10, 12 and prevent leakage of liquid or gas through holes 10, 12 after sealing . The shapes of the holes 10, 12; channels; reaction volume 4; and expansion volume 25 are determined by the structure of the body 5 of the reaction vessel 2; however, a wall 8 of the reaction vessel 2 is made of a relatively thin material with high thermal conductivity, such as an aluminum foil that can be fixed to the body 5 of the vessel 2, for example, with the help of a press hot. Other suitable materials of the separate part 8, other than aluminum foil, may include, but are not limited to, copper and other metals. In this embodiment, the metal sheet forms a wall of each channel and the reaction volume 4 and the expansion volume 25. The analytical reactions take place mainly within the reaction volume 4. When a reaction mixture is heated inside the reaction volume 4, the expansion volume 25 allows the expansion of the analytical reaction mixture inside the reaction volume 4 and prevents the reaction vessel 2 from breaking, which could happen due to the increase in pressure caused by evaporation produced during heating. The high surface-volume ratio allows rapid thermal control of the contents of the reaction vessel. For example, a surface-volume ratio is 1 square millimeter per 1 microliter and preferably should be even greater. To increase the speed of thermal control of the content of the reaction vessel, the reaction vessel is preferably flattened: its thickness 11 is smaller than its width 13. The flattened shape, together with the fact that one of the walls 8 is manufactured With a material with a high thermal conductivity, such as aluminum foil, it allows to achieve an improved thermal control of the content of the reaction volume. In addition to the thermal and structural characteristics of the reaction vessel 2 of the present invention, said vessel 2 is characterized by its optical properties. The body 5 of the container 2 is suitably made of a material that allows fluorescence measurements to be made through the wall 6 of the reaction volume 4 comprising a part of the body 5 of the container 2. In a preferred application, the measurements are performed by fluorometry in delayed time. All materials used to build the container 2 should preferably withstand high temperatures (up to about 80 to 120 ° C), such as the high temperatures necessary to carry out the polymerase chain reaction. Suitable materials for body 5 of container 2 include, among others, polypropylene and other plastics, as well as glass. Some variations of the basic structure of the container 2 can be constructed. For example, several compositions of holes, channels and volumes can be mounted in a single body, which allows the analysis of more than one sample in a body. On the other hand, several reaction volumes can be mounted, each of them used for the analysis of at least one analyte, in a single body, so that, when the sample is introduced through the first hole, it is divided into several channels that lead to different reaction volumes. A reaction vessel of the system according to the present invention can be used, for example, to carry out a polymerase chain reaction (PCR), suitably real-time PCR, and other nucleic acid amplification reactions, such as amplification. based on nucleic acid sequences (NASBA), chain shift amplification (SDA), rolling circle amplification (RCA), reverse transcription PCR (RT-PCR), and ligase chain reaction (LCR). The reaction vessel can also be used to carry out immunoassays and other ligand binding assays.

System description

Figures 2a and 2b schematically show an embodiment of a system 20 according to the present invention. In Figure 2a, the system 20 is seen from above and in Figure 2b a cross section is seen from the side. The system 20 comprises reaction vessels 2, a disk 22 to which a support of the reaction vessel 24 and heating blocks 14 to 19 are attached. The disk 22 is controlled by a stepper motor (not shown), which moves the support of the reaction vessel 24 and the vessels 2 fixed thereto from a heating block 14 to 19 to another 14 to 19, as quickly as possible. The motor is controlled by programmable electronic components.

One 14 of the heating blocks 14 to 19 could more precisely be called a cold block, considering that it is made to keep it at a low temperature. It is made of a metal with high thermal conductance properties. The block has a slit, which can accommodate the reaction vessels. The cover of the slit may be operated by a spring, so that it presses lightly on the cuvettes. The system comprises means for pressing the reaction vessels against the lid or the bottom of the slit, in order to achieve greater efficiency in the heat transfer between the block and the reaction vessel. The cold block can be maintained at a temperature of, for example, 10 ° C, which can be achieved with, for example, a Peltier element and the electronic devices necessary to control it.

Some of the other heating blocks 15 to 18 are also made of a metal with high thermal conductance properties. The blocks 15 to 18 have slits, which can accommodate the reaction vessels 2. The covers of the slits can be operated by a spring, so that they are lightly pressed on the containers 2. The system comprises means for pressing the containers of reaction against the lid or the bottom of the slit, in order to achieve greater efficiency in the heat transfer between the block and the reaction vessel. The temperatures of the heating blocks 15 to 18 can be adjusted (usually between 40 and 120 ° C) with heaters and electronic devices that control them (not shown).

Another 19 of the heating blocks 14 to 19 is a measuring block 19. This block 19 is like the heating blocks, but with a hole in its upper part for fluorescence measurements. It is necessary to protect the block and the reaction vessels located therein from external light.

The measuring block of the device has a UV light source (for example, a flash lamp), whose energy is guided to the container to be measured through filters, lenses and the orifice of the measuring block. The emission with a long lifetime (approximately 100 μs) from the vessel after the excitation is finished is guided through the hole in the measuring block, lenses and filters and, finally, is measured with, for example, a photomultiplier tube

The purpose of the system 20 is to change the temperature of liquids inside reaction vessels 2 as quickly as possible between temperatures normally within the range of 40 to 120 ° C. Normally, the system 20 should be able to measure the fluorescence in delayed time of the reaction vessels 2. The user can program the temperatures of the blocks (normally, the cold block is always at 10 ° C, the heating blocks at temperatures of 40 to 120 ° C), the temporary programming followed by the stepper motor and the temporary programming of the fluorescence measurement can be controlled with a laptop that acts as an interface with the system, or with an integrated interface panel. The system is preferably as small and light as possible. It can be portable or even handheld.

The software used to control the thermal control process directs the precise transfers of the reaction vessel between different thermal blocks in order to achieve a desired thermal profile for the reaction mixture inside the vessel. In principle, the temperature control inside the container can be based on two different mechanisms: incubation times in the different thermal blocks can be calibrated with a temperature sensor, so that a thermal profile is achieved that approximates maximum possible to the desired thermal profile by programming the approximate times that the container must remain in each thermal block. Another possibility is to build a feedback mechanism that allows the program to measure the temperature inside the container in real time and carry out the necessary transfers based on the actual temperature that exists inside the container. The software included in the system can use both or only one of these mechanisms to control the thermal control procedure.

In addition to controlling temperature changes, the data processing unit and corresponding software are used or can be used in the detection and / or quantification of the analyte or analytes. If the system incorporates a fluorescence or delayed time fluorescence measurement unit, the software can be used to direct the measurement unit, so that the fluorescence or delayed fluorescence signals from the inside of the vessel are recorded during the protocol thermal cycling or after the thermal cycling protocol ends. Next, the software, following an analytical algorithm contained in the software or programmed by the user or by the system manufacturer, calculates and presents a qualitative and / or quantitative result of the particular reaction based on the result or results of the measurement or delayed time fluorescence or fluorescence measurements. If, for example, the reaction vessel is used in the detection of a harmful bacterium by PCR, the reaction vessel may contain a sample suspected of containing the bacterium, and all PCR reagents, including

5

10

fifteen

twenty

25

30

35

40

Four. Five

fifty

55

Fluorogenic detection reagents that emit an increased fluorescence signal if the DNA of said harmful bacteria is amplified inside the vessel. In that case, the software would be programmed to control the fluorescence measurement unit so that the measurement unit makes fluorescence measurements at appropriate intervals, and so that the reaction vessel is properly positioned with respect to the measurement unit. Depending on the fluorescence signals recorded, the software reports whether or not the sample contained such bacteria. In addition to these qualitative analytical procedures, the software can perform calculations that allow quantitative determination of the analyte sought.

Typically, the software also contains functions that allow quality control of the results with the help of defined control samples that contain a known amount of the analyte sought. The software also allows you to store the thermal and analytical data of the thermal cycling performed and the measurement operations. A barcode reader that is connected to the software can also be included in the system so that the software recognizes each reaction vessel introduced into the system, based on a barcode printed on the vessel and, depending on the information stored in the software, can carry out a desired thermal cycling and measurement protocol, and analyze, communicate and store the data obtained, in a way that is appropriate for the reaction vessel in question. Those skilled in the art will observe that, instead of a barcode, a different coding technique can be used, provided that it is capable of communicating relevant information about the content of the reaction vessel to the software that controls the system.

Temperature control

To control the temperature inside a reaction vessel as described above, an ideal procedure is to fix the reaction vessel to a firm support that is capable of adopting several different positions. Next to the firm support, several thermal blocks are placed. Ideally, the blocks should be made of a metal or other material with high thermal conductivity. The blocks suitably have a shape that incorporates a slit in which the reaction vessel fits as tightly as possible. In an ideal embodiment of the present invention, the blocks also have a mechanism, for example, a spring cover, which ensures close contact between the block and the reaction vessel when the firm support moves to introduce a container of reaction in a recess in a thermal block. In a suitable embodiment, the size of the thermal block and the groove included therein is such that when a reaction vessel is placed inside the groove of the thermal block, at least one, preferably two and preferably three surfaces of the reaction vessel are covered by the surface of the thermal block to the greatest extent possible. At least one of the thermal blocks may also include a hole that is positioned such that, when there is a reaction vessel located in the slot of the thermal block incorporating said hole, luminescence measurements can be made through the hole and the wall of a reaction volume. To increase the temperature inside the reaction vessel until it reaches a target temperature, the firm support to which the vessel is attached is moved to introduce the reaction vessel into the groove of a thermal block that is hotter than the target temperature. . The reaction vessel is maintained in this first heating block for a time necessary for the temperature inside the vessel to reach or approach the target temperature; then the firm support is moved to move the reaction vessel from the first heating block to a second block that is maintained at the target temperature. To cool the contents of a reaction vessel, the vessel is first moved to the slit of a block that is colder than the target temperature; it is kept in the cooling block for a time necessary to decrease the temperature inside the reaction vessel until it reaches the cold target temperature or approaches it; and then the container is moved to a block that is maintained at the cold target temperature. In this way, the rate of change of temperature inside the reaction vessel can be accelerated, if compared with a procedure in which the reaction vessel is moved directly to a target temperature or if compared with a procedure in the that the temperature of the thermal block is changed, instead of the position of the reaction vessel. The firm support and the thermal blocks located around it can be constructed in many different ways. Suitably, for example, the thermal blocks are placed in a circle, so that the firm support, placed in the middle or just outside the circle formed by the blocks, can change the position of the reaction vessel attached thereto, by performing a circular movement around its own axis (in which case, the firm support is in the middle of the circle formed by the blocks)

or around the axis of the circle formed by the blocks (in which case, the firm support is located outside the circle formed by the blocks). Another possibility is to place the thermal blocks, for example, in a row, in which case the firm support moves back and forth along the row to move a reaction vessel from one thermal block to another. In addition, in a configuration with a single instrument, several sets of thermal blocks may exist to allow simultaneous control of several reaction vessels. In addition, the thermal blocks can be larger than a single reaction vessel, which allows more than one reaction vessel to be introduced at the same time.

Examples

Example 1

Effect of the use of hotter and colder thermal blocks than the target temperatures on the rate of increase and decrease of temperature in the system reaction vessel.

To optimize the speed of thermal cycling, a system was constructed in accordance with the present invention comprising several heating blocks maintained at predetermined temperatures. The blocks were kept at 29 ° C (the cold block); 61 ° C; 97 ° C and 115 ° C. A temperature sensor was placed inside a flat reaction vessel and the rates of heating and cooling of the contents of the vessel were determined using two different thermal cycling procedures. In the first procedure, the reaction vessel was moved from the block at 61 ° C directly to the block at 97 ° C and from the block at 97 ° C directly back to the block at 61 ° C. The second procedure was carried out in accordance with the present invention, so that, to heat the contents of the reaction vessel from 61 ° C to 97 ° C, the vessel was moved from the block at 61 ° C to the block held at 115 ° C for ten seconds, after which the vessel was moved to the block at 97 ° C. From the block at 97 ° C, the container was moved to the block at 29 ° C for ten seconds, after which the container was relocated to the block at 61 ° C. The times used to heat the contents of the container from 61 to 97 ° C (heating time) and cool it from 97 to 61 ° C (cooling time) were recorded using these two different thermal cycling procedures. Using the first procedure, the heating time of 61 to 97 ° C was 25 seconds and the cooling time of 97 to 61 ° C was 48 seconds. With the second procedure, the process of the present invention, the heating time was only 8 seconds, that is, less than the time during which the vessel was incubated at 115 ° C. The cooling time using the second procedure was only 7 seconds. Clearly, the process of the present invention provides a considerable improvement in the speed of thermal cycling: during a PCR reaction of 40 cycles, these savings of 58 seconds per cycle total approximately 40 minutes of time saved, which is important for a laboratory that You have to carry out as many PCR reactions as possible during a work day. It should be noted that the incubation times and exact temperatures used in this example were chosen arbitrarily; an even greater speed can be achieved by adjusting the cold block to a cooler temperature and the hot block to a warmer temperature. In this experiment, 10-second incubations were used in the hot and cold blocks, but in reality they proved to be too long: the target temperatures were reached in less than 10 seconds. Ideally, the reaction vessel would have been moved from the hot block to the block at 97 ° C after 8 seconds and from the cold block to the block at 61 ° C after 7 seconds to prevent the reaction vessel from reaching temperatures above 97 ° C or below 61 ° C.

Example 2

Effect of the use of aluminum foil as a material for the system reaction vessel on the rate of temperature change inside the container.

To determine the effect of using an aluminum foil instead of a plastic wall on one side of the reaction vessel, two identical halves of the vessel were coated with aluminum foil or with a plastic foil. A temperature sensor was placed inside each vessel and the rates of temperature change were determined for both vessels using a system according to the present invention. This was done by changing the position of the container from a thermal block set at 105 ° C to a block set at 27 ° C to cool or, conversely, to heat. Different temperature measurement data were recorded for cooling and heating the contents of the containers. The data were adjusted to a single exponential function and the half-lives of temperature change were determined, that is, the times necessary for the temperature inside the vessel to change to the intermediate point between 105 ° C and 27 ° C. When a plastic sheet was used, the half-lives for cooling and heating were, respectively, 7.6 and 9.6 seconds; For a vessel that incorporates a wall made of aluminum foil, the half-lives were 5.7 and 6.3 seconds. Therefore, it is clear that the use of a wall made of a material with high thermal conductivity offers a clear advantage in terms of thermal control speed.

Example 3

Thermal cycling speed using the method and system of the present invention versus a conventional thermal cycling procedure.

To demonstrate the accelerating effect of the present invention on the speed of thermal cycling, temperature sensors were placed inside a reaction vessel according to the present invention and inside a 0.2 PCR plastic tube ml. Both reaction vessels were filled with water and the temperatures inside the vessels were measured during a normal thermal cycling protocol, during which the temperature varied cyclically between 95 ° C and 60 ° C. The temperature inside the reaction vessel was controlled according to the present invention, using a system according to the present invention, in which the reaction vessel was placed on a firm support, which was cylindrical in shape. Around the firm support, four thermal blocks were placed, whose temperatures were maintained at 27 ° C, 60 ° C, 95 ° C and 105 ° C. To increase the temperature inside the container to 95 ° C, the container was placed, first, inside the slit of the block maintained at 105 ° C; then, after a few seconds, the vessel was moved to the block at 95 ° C. Then, to cool the reaction volume to 60 ° C, the vessel was first moved to the slit of the block at 27 ° C for a few seconds, after which it was moved to the block at 60 ° C. To establish the comparison, the rates of temperature change were measured within a conventional 0.2 ml PCR tube, of which the content temperature was controlled using a PTC 200 DNA Engine (MJ Research, USA). .

Figure 3 shows the temperature control of a reaction vessel using a thermal cycling procedure and a system for thermal control according to the present invention (open squares; "Proto") or using a conventional 0 PCR tube , 2 ml and thin walls and conventional thermal cycling (PTC 200 DNA Engine, MJ Research, USA; open triangles, MJ-Res PCR). Temperature measurement data is displayed based on elapsed time. The rate of temperature change using the system according to the present invention (squares) is much higher than the rate obtained using a conventional PCR machine (triangles), which is based on the use of a metal block, whose temperature It changes periodically. The time required to change the temperature inside the reaction vessel between the two target temperatures (95 and 60 ° C) is much shorter for the prototype instrument than for the conventional PCR machine.

Figure 5 schematically shows the way in which the temperature control of the reaction vessels can be carried out. The figure shows the temperature of the reaction vessels during steps "a" to "h" as a function of time. The stages are as follows:

a) 0 s: the containers are moved to a heating block at 120 ° C

b) 2 s: the containers are moved to a heating block at 95 ° C

c) 12 s: the containers move to a cold block at 10 ° C

d) 15 s: the containers are moved to a heating block at 60 ° C

e) 40 s: the containers move to a cold block at 10 ° C

f) 41 s: the vessels are moved to a measuring block at 50 ° C

g) 42 to 45 s: fluorescence measurements are made

h) 46 s: the containers are moved to a heating block at 120 ° C; A new cycle begins.

The temperature curve that shows the temperature of the containers during the previous stages clearly demonstrates a very rapid temperature control of the containers.

Example 3

Use of the method and system according to the present invention to carry out the polymerase chain reaction in real time

To demonstrate the applicability of the present invention to carry out the polymerase chain reaction in real time, a PCR assay for bacteriophage T4 was prepared. The chemistry of the assay was described by Nurmi et al. (2002). The sequences of the oligonucleotides used in the assay were as follows: primer 5 'ATGTTCCACGCTAAAAGACCTTATTGAAAA (SEQ ID NO: 1); primer 3 'CAGCAGAATGAACCGAATCCACAAATAT (SEQ ID NO: 2); probe marked with Europium ATTATTCATCACCGAGCGACTATTCAAGATA (SEC ID #: 3) and probe with neutralizer (“quencher”) marked with QSY-7 GCTCGGTGATGAATAAT (SEC ID No.: 4). The 30 µl amplification reactions consisted of: 1 X HotMaster Taq buffer (Eppendorf, Germany), 0.3 µM primers, 28 nM europium probe, 280 nM probe with neutralizer, 2.5 mM magnesium chloride , 0.2 mM dNTPs and 1.25 U of Taq HotMaster polymerase. The amplification reactions were carried out using the type of reaction vessel described in fig. 1. For thermal cycling, a thermal cycler according to the present invention was used (example 2). A thermal cycling protocol consisting of 40 cycles of 3 seconds at 95 ° C and 13 seconds at 60 ° C was used with heating and cooling in the blocks maintained at 110 and 25 ° C, respectively. Europium fluorescence was measured in delayed time in selected selected PCR cycles. All measurements were made at room temperature.

Figure 4 shows an amplification graph showing the applicability of the present invention to carry out polymerase chain reactions in real time. Amplification graphs obtained from a negative control reaction (NTC) are shown, in which no bacteriophage T4 DNA was added to the reaction and from a positive reaction, in which approximately 100 copies of T4 DNA were added as template . As can be seen in the figure, the presence of the specific DNA sought in the sample results in a detectable increase in the fluorescence of the europium. Therefore, it is clear that the reaction vessel, the thermal control procedure and thermal cycling system described herein can be applied to real-time PCR.

It will be noted that the methods of the present invention can be incorporated in various embodiments, of which only some are described herein.

REFERENCES

Baner J, Nilsson M, Mendel-Hartvig M, Landgren U. (1998) Signal amplification of padlock by rolling circle replication. Nucleic Acids Res. 26 (22): 5073-8. Barany F. (1991) Genetic disease detection and DNA amplification using cloned thermostable ligase. Proc. Natl Acad Sci

USA 88 (1): 189-93.

5 Compton J. (1991) Nucleic acid sequence-based amplification. Nature 350 (6313): 91-2. Kopp MU, Mello AJ, Manz A. (1998) Chemical amplification: continuous-flow PCR on a chip. Science 280 (5366): 1046-8. Nurmi J, Wikman T, Karp M, Lovgren T. (2002) High performance real-time quantitative RT-PCR using lanthanide probes

and a dual-temperature hybridization assay. Anal cChem. 74 (14): 3525-32. Price CP, Newman DJ (ed.) (1997) Principles and practice of immunoassay. Macmillan, London.

10 Saiki RK, Scharf S, Faloona F, Mulli KB, Horn GT, Erlich HA, Arnheim N (1985) Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science 230: 1350-4. Walker GT, Fraiser MS, Schram JL, Little MC, Nadeau JG, Malinowski DP. (1992) Strand displacement amplification-an

isothermal, in vitro DNA amplification techcnique. Nucleic Acids Res. 20 (7): 1691-6. Wittwer CT, Ririe KM, Andrew RV, David DA, Gundry RA, Balis UJ. (1997) The LightCycler: a microvolume multisample 15 fluorimeter with rapid temperature control. Biotechniques 22 (1): 176-81.

Claims (18)

1. A process for rapid thermal control of a reaction volume (4) of a reaction vessel (2) comprising a closed reaction volume (4) ≤ 2 ml, preferably ≤ 50 μl, surrounded by at least two walls (6, 8), a first wall (6) and a second wall (8), said first wall (6) being of a first material that is permeable to at least one wavelength of light and said second wall ( 8) of a second material with a high thermal conductivity in which the thermal control of said reaction volume (4) in said reaction vessel (2) comprises a temperature change of the reaction volume (4) from a previous temperature to a target temperature at which said temperature change is carried out: a) placing the walls (6, 8) of the reaction vessel (2) in contact with a first thermal block (14 to 19) i) at a temperature above the target temperature if the target temperature is higher than the previous temperature, or in the same way ii) at a temperature below the target temperature if the target temperature is below the previous temperature, for a time necessary to bring the temperature of the reaction volume (4) to the target temperature or near her; Y b) then putting said walls (6, 8) in contact with a second thermal block (14 to 19) at the target temperature to bring the reaction volume (4) to said target temperature and / or maintain the reaction volume (4 ) at said target temperature for the stipulated time, wherein the first thermal block (14 to 19) is a constant first predetermined temperature and the second thermal block (14 to 19) is at a constant second predetermined temperature, that is, the target temperature, characterized in that the walls ( 6, 8) are put in direct contact with said first and said second thermal block (14 to 19) and said reaction vessel (2) used also comprises a hole (10) for introducing a sample, a channel through which the sample flows to the reaction volume (4), a second channel, an expansion volume (25), a third channel and a second hole (12) through which the air displaced by the sample flows out of the reaction vessel, wherein said expansion volume (25) allows the expansion of an analytical reaction mixture within said reaction volume (4) and prevents the rupture of said reaction vessel (2) by the increase in pressure caused by evaporation during heating said reaction mixture within the reaction volume (4), and heat transfer between the reaction vessel (2) and a thermal block (14 to 19) is intensified by pressing said walls (6, 8) of said reaction vessel (2) and said walls of the thermal blocks (14 to 19 ) against each other and in direct contact with each other.

2.

The method according to claim 1, characterized in that several temperature changes of the reaction volume (4) are carried out, and more than one of said temperature changes are carried out using each pair of thermal blocks (14 to 19 ) consisting of a first and a second thermal block (14 to 19), in which each thermal block (14 to 19) of each of said pairs can also be a thermal block (14 to 19) of one or more of the other said pairs, according to steps a) and b) of claim 1.

3.

The method according to claim 2, characterized in that all temperature changes of the reaction volume (4) are carried out according to steps a) and b) of claim 1.

Four.

The method according to any one of claims 1 to 3, characterized in that the thermal conductivity of the second material is ≥ 10 mW / mmK, preferably ≥ 100 mW / mmK.

5.

The method according to any one of claims 1 to 4, characterized in that the second material of the second wall (8) is selected from the group consisting of metals, preferably aluminum or copper.

6.

The method according to any one of the preceding claims, characterized in that the external surface of the second wall (8) is flattened, preferably flat.

7.

The method according to any one of the preceding claims, characterized in that the ratio of the area of the second wall (8) that encloses, that is, the area of the second wall oriented towards, the reaction volume

(4) with respect to said volume is ≥ 0.5 mm2 / µl, preferably ≥ 5 mm2 / µl. 8. A system (20) for detecting and / or quantifying a biological and / or chemical analyte or analytes in a sample allegedly containing said analyte or analytes, comprising i) one or more reaction vessels (2) comprising a closed reaction volume (4) ≤ 2 ml, preferably ≤ 50 μl, surrounded by at least two walls (6, 8), a first wall (6) and a second wall (8), said first wall (6) being of a first material that is permeable to at least one wavelength of light and said second wall (8) being of a second material with a high thermal conductivity, ii) four or more thermal blocks (14 to 19), and iii) means (22) for putting said walls (6, 8) of said reaction vessels (2) in contact with each of said thermal blocks (14 to 19), wherein a data processing unit, with dedicated data reduction software for said detection and / or quantification of said analyte or analytes, is arranged to control at least one temperature change of the reaction volume (4) from a preceding temperature up to an objective temperature according to the method of claim 1, characterized in that said walls (6, 8) are arranged to put them in direct contact with said first and second thermal blocks (14 to 19), and said reaction vessel (2) used also comprises a hole (10) for introducing a sample, a channel through which the sample flows to the reaction volume (4), a second channel, an expansion volume (25), a third channel and a second hole (12) through which the air displaced by the sample flows out of the reaction vessel (2), wherein said expansion volume (25) allows the expansion of an analytical reaction mixture within said reaction volume (4) and prevents the rupture of said reaction vessel (2) by the increase in pressure caused by evaporation during the heating of said reaction mixture within the reaction volume (4), and said system comprises means for pressing said walls (6, 8) of said reaction vessel (2) and said walls of the thermal blocks (14 to 19) against each other and in direct contact with each other.

9.

The system according to claim 8, characterized in that the thermal conductivity of the second material is ≥ 10 mW / mmK, preferably ≥ 100 mW / mmK.

10.

The system according to claim 9, characterized in that the second material of the second wall (8) is selected from the group consisting of metals, preferably aluminum or copper.

eleven.

The system according to any one of claims 8 to 10, characterized in that the external surface of the second wall (8) is flattened, preferably flat.

12.

The system according to any one of claims 8 to 11, characterized in that the ratio of the area of the second wall (8) that encloses, that is, the area of the second wall oriented towards, the reaction volume (4) with respect to said volume is ≥ 0.5 mm2 / µl, preferably ≥ 5 mm2 / µl.

13.

The system according to any one of claims 8 to 12, characterized in that the first wall (6) is permeable to visible and ultraviolet (UV) light.

14.

The system according to any one of claims 8 to 13, characterized in that the first material of the first wall (6) is selected from the group consisting of plastics or glass.

fifteen.

The system (20) according to any one of claims 8 to 14, characterized in that the means (22) for placing the walls of the reaction vessel in direct contact with the thermal blocks (14 to 19) comprise a support (24) for said container (2) with means (22) for moving said support (24) in a circular or linear path and said thermal blocks (14 to 19) are located at different points of said circular or linear path, so that said walls ( 6, 8) of said reaction vessel (2) can be brought into direct contact with each thermal block (14 to 19) by moving said support (24) along said circular or linear path.

16.

The use of the system according to any one of claims 8 to 15 for the real-time polymerase chain reaction (real-time PCR).

17.

The use of the system according to any one of claims 8 to 15 for nucleic acid amplification reactions, preferably nucleic acid sequence based amplification (NASBA), chain shift amplification (SDA), rolling circle amplification (RCA) and ligase chain reaction (CSF).

18.

The use of the system according to any one of claims 8 to 15 for ligand binding assays.