ES2358785T3 - 3-QUINASA DELTA PHOSFATIDYLINOSITOL INHIBITORS - Google Patents

Abstract

A compound with a structure ** (See formula) ** where Y is selected from the group consisting of none and NH; R4 is selected from the group consisting of H, halogen, NO2, OH, OCH3, CH3, and CF3; R5 is selected from the group consisting of H, OCH3, and halo; or R4 and R5 together with C-6 and C-7 of the quinazoline ring system define a 5 or 6 membered aromatic ring that optionally contains one or more atoms of O, N, or S; R6 is selected from the group consisting of C1-C6alkyl, phenyl, halophenyl, alkoxyphenyl, alkylphenyl, biphenyl, benzyl, pyridinyl, 4-methylpiperazinyl, C (= O) OC2H5, and morpholinyl; Rd, independently, is selected from the group consisting of NH2, halo, C1-3alkyl, S (C1-3alkyl), OH, NH (C1-3alkyl), N (C1-3alkyl) 2, NH (C1-3alkylenephenyl); and ** (See formula) ** q is 1 or 2; and pharmaceutically acceptable salts and solvates thereof, provided that at least one of R4 and R5 is different from H when R6 is phenyl or 2-chlorophenyl.

Description

Phosphatidylinositol Inhibitors 3-delta kinase.

This application claims the benefit of the US provisional application with serial number 60 / 199,655, filed on April 25, 2000 and the application US provisional with serial number 60 / 238.057, filed on October 25, 2000.

The present invention generally relates to phosphatidylinositol 3-kinase enzymes (PI3K) and more specifically to selective inhibitors of the activity of the PI3K and the methods of use of these materials.

Cell signaling by phosphorylated phosphoinositides in position 3 has been implicated in various cellular processes, such as malignant transformation, growth factor signaling, inflammation and immunity (see Rameh et al ., J. Biol Chem, 274: 8347 -8350 (1999) for a review). The enzyme responsible for generating these phosphorylated signaling products, phosphatidylinositol 3-kinase (PI 3-kinase; PI3K), was originally identified as an activity associated with viral oncoproteins and the tyrosine kinase growth factor that phosphorylates phosphatidylinositol (PI) and its phosphorylated derivatives in the position 3 hydroxyl of the inositol ring (Panayotou et al ., Trends Cell Biol 2: 358-60 (1992)).

The levels of phosphatidylinositol-3,4,5-triphosphate (PIP3), the main product of the activation of PI3-kinase, increase after treatment of the cells with various agonists. Therefore, PI 3-kinase activation is believed to be involved in a series of cellular responses, including cell growth, differentiation and apoptosis (Parker et al ., Current Biology, 5: 577-99 (1995); Yao et al ., Science, 267: 2003-05 (1995)). Although the descendants of phosphorylated lipids that are generated after the activation of PI3-kinase have not been well characterized, emerging evidence suggests that proteins that contain the homology domain with pleckstrin and the finger-like domain FYVE are activated when bind to various phosphatidylinositol lipids (Sternmark et al ., J Cell Sci, 112: 4175-83 (1999); Lemmon et al ., Trends Cell Biol, 7: 237-42 (1997)). In vitro , some isoforms of protein kinase C (PKC) are directly activated by PIP3; and it has been shown that PKC-related protein kinase, PKB, is activated by PI 3-kinase (Burgering et al ., Nature, 376: 599-602 (1995)).

Currently, the PI enzyme family 3-kinases has been divided into three classes based in the specificities of its substrate. Class I PI3K can phosphorylate phosphatidylinositol (PI), phosphatidylinositol-4-phosphate and phosphatidylinositol-4,5-bisphosphate (PIP2) to produce phosphatidylinositol-3-phosphate (PIP), phosphatidylinositol-3,4-bisphosphate and phosphatidylinositol-3,4,5-triphosphate, respectively. Class II PI3K phosphorylate PI and phosphatidylinositol-4-phosphate, while class III PI3K can only phosphorylate PI.

Initial purification and molecular cloning of PI 3-kinase revealed that it was a heterodimer composed of the p85 and p110 subunits (Otsu et al ., Cell, 65: 91-104 {1991); Hiles et al ., Cell, 70: 419-29 (1992)). Since then, four class I PI3Ks, designated PI3K?,?,?, And?, Have been identified, each consisting of a 110 kDa catalytic subunit and a different regulatory subunit. More specifically, three of the catalytic subunits, that is p110?, P110? And p110?, Each interact with the same regulatory subunit, p85; while p110γ interacts with a different regulatory subunit, p101. As described below, the expression patterns of each of these PI3Ks in human tissues and cells are also different. Although much information has recently been accumulated on the cellular functions of PI3-kinases in general, the functions performed by individual isoforms are largely unknown.

The cloning of bovine p110α has been described. It was identified that this protein was related to Saccharomyces cerevisiae protein: Vps34p, a protein involved in the processing of the vacuolar protein. It was also shown that the product of the recombinant p110α is associated with p85α, to generate a PI3K activity in the transfected COS-1 cells. See Hiles et al ., Cell, 70, 419-29 (1992).

The cloning of a second human isoform of p110, called p110β, is described in Hu et al ., Mol Cell Biol, 13: 7677-88 (1993). It is said that this isoform is associated with p85 in cells, and that it is expressed omnipresently, since p110? MRNA has been found in numerous human and murine tissues, as well as in endothelial cells of the human umbilical vein, T cells of Jurkat human leukemia, 293 human embryo renal cells, murine 3T3 fibroblasts, HeLA cells and bladder carcinoma cells in NBT2 rats. This broad expression suggests that this isoform is very important for signaling the pathways.

The identification of the p110? Isoform of PT 3-kinase is described in Chantry et al ., J Biol. Chem, 272: 19236-41 (1997). It was observed that the isoform of human p110? Is expressed in a limited way in tissues. It is expressed at high levels in lymphocytes and lymphoid tissues, suggesting that the protein could participate in signaling mediated by PI3-kinase in the immune system. Details concerning the isoform of P110? Can also be found in U.S. Patent Nos. 5,858,753; 5,822,910; and 5,985,589. See also Vanhaesebroeck et al ., Proc Natl Acad Sci USA, 94: 4330-5 (1997), and international publication WO 97/46688.

In each of the PI3K?,?, And? Subtypes, the p85 subunit acts to locate the PI 3-kinase in the plasma membrane by interacting its SH2 domain with phosphorylated tyrosine residues (present in the context of an appropriate sequence) in the target proteins (Rameh et al ., Cell, 83: 821-30 (1995)). Two isoforms of p85 have been identified: p85a, which is ubiquitously expressed, and p85?, Which is found mainly in the brain and lymphoid tissues (Volinia et al ., Oncogene, 7: 789-93 (1992)) . The association of the p85 subunit with the catalytic subunits p110?,? Or? Of the PI3-kinase seems to be necessary for the catalytic activity and stability of these enzymes. On the other hand, the binding of Ras proteins also regulates the activity of PI 3-kinase.

Cloning of p110γ revealed even greater complexity within the PI3K family of enzymes (Stoyanov et al ., Science, 269: 690-93 (1995)). The isoform of p110? Is closely related to p110? And p110? (45-48% identity in the catalytic domain), but as noted it does not use p85 as a target subunit. Instead, p110γ contains an additional domain called "pleckstrin homology domain" near its amino terminal. This domain allows the interaction of p110? With the?? Subunits of the heterotrimeric G proteins and this interaction seems to regulate its activity.

The p101 regulatory subunit for PI3Kgamma was originally cloned in pigs and the human ortholog was subsequently identified (Krugmann et al ., J Biol Chem, 274: 17152-8 (1999)). The interaction between the N-terminal region of p101 and the N-terminal region of p110? Seems to be critical for the activation of PI3K? By G?? Mentioned above.

In international publication WO 96/25488, a constitutively active polypeptide of PI3K is described. This publication reveals the preparation of a chimeric fusion protein in which a fragment of residue 102 of p85, known as the inter-SH2 region (iSH2), is fused through an N-terminal binding region of murine p110 . Apparently the iSH2 domain of p85 is capable of activating PI3K activity in a manner comparable to intact p85 (Klippel et al ., Mol Cell Biol, 14: 2675-85 (1994)).

In this way, PI 3-kinases can be defined by the identity of their amino acid or by their activity. Additional members of this growing family of genes include more distantly lipid and related protein kinases, including Vps34 TOR1 and TOR2 from Saccharomyces cerevisiae (and its mammalian counterparts such as FRAP and mTOR), the genetic product of ataxia telangiectasia (ATR ) and the catalytic subunit of the DNA-dependent protein kinase (DNA-PK). See, in general, Hunter, Cell, 83: 1-4 (1995).

PI 3-kinase also appears to be involved in various aspects of leukocyte activation. It has been shown that the activity of PI 3-kinase associated with p85 is physically associated with the cytoplasmic domain of CD28, which is an important costimulatory molecule for the activation of T cells in response to the antigen (Pages et al ., Nature, 369: 327-29 (1994); Rudd, Immunity, 4: 527-34 (1996)). Activation of T cells by CD28 reduces the threshold for activation by the antigen and increases the magnitude and duration of the proliferative response. These effects are linked to increases in the transcription of a series of genes, including interleukin-2 (IL2), an important T-cell growth factor (Fraser et al ., Science, 251: 313-16 (1991 )). The mutation of CD28 so that it can no longer interact with PI 3-kinase prevents the production of IL2 from being initiated, which suggests a fundamental role of PI 3-kinase in the activation of T cells.

Specific inhibitors against individual members of a family of enzymes represent extremely valuable tools for deciphering the functions of each enzyme. Two compounds, LY294002 and wortmanin, have been widely used as PI 3-kinase inhibitors. However, these compounds are non-specific PI3K inhibitors, since they do not distinguish between the four members of the family of class I PI 3-kinases. For example, the IC 50 values of wortmanin versus each of the various PI 3-class kinases are in the range of 1-10 nM. Similarly, the IC 50 values of LY294002 against each of these PI 3-kinases are around 1 µM (Fruman et al ., Ann Rev Bio-chem, 67: 481-507 (1998) ). Therefore, the usefulness of these compounds to study the functions of each of the PI 3-kinase Class I is limited.

Based on studies with wortmanin, there is evidence that the role of PI 3-kinase is also necessary for some aspects of leukocyte signaling through G-protein-bound receptors (Thelen et al ., Proc Natl Acad Sci USA, 91: 4960-64 (1994)). On the other hand, it has been shown that wortmanin and LY294002 block neutrophil migration and superoxide release. However, since these compounds do not distinguish between the various isoforms of PI3K, it is not clear which isoform or isoforms of PI3K in particular are involved in these phenomena.

one

1100

In view of the above considerations, it is Of course, there is not enough information about structural and functional characteristics of PI enzymes 3-kinase, including subcellular location, activation states, affinity for the substrate and the like. Moreover, the functions that these enzymes perform both in Healthy tissues as in diseased tissues are about to clear up. In In particular, the role of PI3K? in leukocytes has not been characterized above and the knowledge related to its Function in human physiology remain limited. The coexpression in these tissues of other isoforms of PI3K has confused so far the efforts to segregate the activities of Each enzyme On the other hand, the separation of activities from various PI3K isoenzymes may not be possible without the Identification of inhibitors that demonstrate characteristics of selective inhibition. In fact, Applicants do not have evidence at this time that the existence has been proven of these selective inhibitors of PI3K isoenzymes.

Therefore, there is a need in the field of deepen the structural characterization of the polypeptide PI3K \ delta. There is also a need to deepen the functional characterization of PI3K?. On the other hand, we need to expand our knowledge of PI3K \ delta so which concerns the structural interactions of p110?, both with its regulatory subunit and with other proteins of the cell. The discovery of inhibitors is still pending selective or specific of PI3K isoenzymes, in order to be able to better characterize the functions of each of them. In particular, the discovery of selective inhibitors or Specific PI3K? is recommended to study the Role of this isoenzyme and for product development Pharmacists who modulate their activity.

An aspect of the present invention consists in provide compounds that can inhibit the biological activity of the PI3K? human. Another aspect of the invention consists in provide compounds that inhibit PI3K? in a manner selective, maintaining a relatively low inhibitory potency with respect to the other isoforms of PI3K. Another aspect of the invention is to provide methods to characterize the function of human PI3K?. Another aspect of the invention it consists of providing methods to selectively modulate the activity of human PI3K?, thus promoting treatment doctor of diseases mediated by dysfunction of the PI3K \ delta. Other aspects and advantages of the invention will result immediately obvious to the professional with the knowledge normal in the field.

It has now been discovered that these and other aspects can be achieved with the present invention, which, on the one hand, is an in vitro or ex vivo method for altering leukocyte function, consisting of contacting leukocytes with a compound that selectively inhibits phosphatidylinositol 3-kinase delta (PI3K?) activity in leukocytes. According to the method, the leukocytes may comprise cells selected from the group consisting of neutrophils, B lymphocytes, T lymphocytes and basophils.

For example, in cases where leukocytes comprise neutrophils, the method may consist of impaired function of at least one neutrophil selected from the group, consisting of stimulation of superoxide release, stimulation of exocytosis and chemotactic migration. Preferably the method does not substantially alter the phagocytosis or the elimination of bacteria by neutrophils In cases where leukocytes understand B lymphocytes, the method may consist of altering the B lymphocyte proliferation or antibody production of B lymphocytes. In cases where leukocytes understand T lymphocytes, the method may consist of the alteration of proliferation of T lymphocytes. In cases where leukocytes understand basophils, the method may consist of alter histamine release from basophils.

In the methods of the invention in which employ a selective PI3K? inhibitor, it is preferable that the compound be at least 10 times more selective for inhibition of PI3K? With respect to the other class I PI3K isoforms in a cell test. More preferably, the compound will be at least 20 times more selective for inhibition of PI3K? With respect to the other class I PI3K isoforms in a cell test. Even more preferably, the compound will be at least 50 times more selective for inhibition of PI3K? With respect to the other isoforms of PI3K class X in a biochemical test.

The present invention provides the compounds, methods and uses collected in the set of claims attached. The preferable characteristics of the present invention are set out in the dependent claims attached.

Useful preferable selective compounds of according to the present invention include the compounds that present the structure (I):

2

where A is a ring system optionally substituted bicyclic or monocyclic containing the at least two nitrogen atoms and at least one ring of the system is aromatic;

X is selected from the group consisting of CHR b, CK 2 CHR b, and CH = C (R b);

And it is selected from the group consisting of none, S, SO, SO2, NH, O, C (= O), OC (= O), C (= O) O, and NHC (= O) CH2 S;

R 1 and R 2, independently, are selected from the group consisting of hydrogen. C 1-6 alkyl, aryl, heteroaryl, halo, NHC (= O) C 1-3 alkylene N (R a) 2, NO 2, OR a, OCF_ {3}, N (R a) 3, CN, OC (= O) R a, C (= O) R a, C (= O) OR , arylOR b, Het, NR a C (= O) C 1-3 C alkylene (= O) OR a, arylOC 1-3 N-alkylene (R < a}) 2, arylOC (= O) R a, C 1-4 alkylene C (= O) OR a, OC 1-4
alkylene C (= O) OR a, C 1-4 alkyleneOC 1-4 alkylene C (= O) OR a, C (= O) -NR a SO 2 R a, C 1-4 alkylene N, (R a) 2, C 2-6 alkeni
lenoN (R a) 2, C (= O) NR a C 1-4 alkyleneOR a, C (= O) NR a C 1-4 alkyleneHet, OC 2-4 -alkyleneN (R a) 2, OC 1-4 alkyleneCH
(OR b) CH 2 N (R a) 2, OC 1-4 alkenylene Het, OC 2-4 alkyleneOR a, OC 2- 4 alkylene NR a C (= O) OR a, NR a C 1-4 alkylene N (R a), NR a C (= O) R ^ {a}, NR a C (= O) N (R a) 2, N (SO 2 C 1-4 alkyl) 2, NR a (SO 2 C 1-4 alkyl), SO 2 N (R a) 2, OSO 2 CF 3, C 1-3 alkylenearyl, C_ {1-4 alkyleneHet, C 1-6 alkyleneOR b, C 1-3 alkylene N (R a) 2, C (= O) N (R a) ) 2, NHC (= O) C 1 -C 3 alkylene-aryl, C 3-8 acyclo-
alkyl, C 3-8 heterocycloalkyl, aryl-OC 1-3 alkylene N (R a) 2, arylOC (= O) R b, NHC (= O) C 1 -3} C 3-8 alkylene heterocyc
chloalkyl, NHC (= O) C 1-3 alkyleneHet, OC 1-4 alkyleneOC 1-4 alkylene C (= O) OR b, C (= O) C 1-4 } alkyleneHet, and
NHC (= O) haloC 1-6 alkyl;

or R 1 and R 2 join to form a component with an alkenylene or alkylene chain of 3 or 4 members of a ring of 5 or 6 members, which contains at least one heteroatom;

R 3 is selected from the group consisting of optionally substituted hydrogen, C 1-6 alkyl, C 3-8 cycloalkyl, C 3-8 heterocycloalkyl, C 1-4 alkylenecycloalkyl, C_ {2-6 alkenyl, C 1-3 alkylenearyl, arylC 1-3 alkyl, C (= O) R a, aryl, heteroaryl, C (= O) OR a, C (= O) N (R a) 2, C (= S) N (R a) 2, SO 2 R a, SO 2 N (R a) 2, S (= O) R a, S (= O) N (R a) 2, C (= O) NR a } C_4-4
lenoOR a, C (O) NR a C 1-4 alkyleneHet, C (= O) C 1-4 alkyl-enearyl, C (= O) C 1-4 alkyleneheteroazyl , C 1-4 alkylenearyl optionally substituted by one or more halos, SO 2 N (R a) 2, N (R a) 2, C (= O ) OR a, NR a SO 2 CF 3, CN, NO 2, C (= O) R a, OR a, C 1-4 alkylene N (R a) 2, and OC 1-4 alkylene N (R a) 2, C 2-4 -alkyleneheteroaryl, C 1-4 alkyleneHet , C 1-4 alkylene C (= O) -C 1-4 alkylenearyl, C 1-4 alkylene C (= O) C 1-4 alkylenehetero-aryl, C 1-4 alkylene C ( = O) Het, C 1-4 alkylene C (= O)
N (R a) 2, C 1-4 alkyleneOR a, C 1-4 alkylene NR a C (= O) R a, C 1 -4} alkylene O-C 1-4 alkyleneOR a, C 1-4 alkylene N (R a) 2, C 1-4
C alkylene (= O) -OR a, and C 1-4 alkyleneOC 1-4 alkylene C (= O) OR a;

R a is selected from the group consisting of hydrogen, C 1-6 alkyl, C 3-8 cycloalkyl, C 3-8 heterocycloalkyl, C 1-3
alkylene N (R a) 2, aryl, arylC 1-3 alkyl, C 1-3 alkyl alkanoxy, heteroaryl, heteroaryl C 1-3 alkyl, and C 1-3 alkylenehete -
ro arilo;

or join two groups R a to form a 5 or 6 member ring, which may optionally contain at least a heteroatom;

R b is selected from the group consisting of hydrogen, C 1-6 alkyl, aryl, heteroaryl, arylC 1-3 alkyl, heteroaryl
C 1-3 alkyl, C 1-3 alkylenearyl, and C 1-3 alkyl-eneheteroaryl;

Het is a 5 or 6 heterocyclic ring members, saturated or partially or totally unsaturated that contains the minus a heteroatom selected from the group consisting of oxygen, nitrogen and sulfur, and optionally substituted by C 1-4 alkyl or C (= O) OR a;

and salts and solvates thereof (for example, hydrates) pharmaceutically acceptable,

where the compound is at least 10 times more selective for inhibition of PI3K? with respect to others Class I PI3K isoforms in a cell test.

       \ vskip1.000000 \ baselineskip
    

In another aspect, a method for the treatment of a neutrophil-mediated medical condition, which it consists of the administration to an animal that needs an amount effective of a compound that selectively inhibits the activity of phosphatidylinositol 3-kinase delta (PIK?) in Neutrophils Exemplary medical conditions that can be treat according to the disclosed method include those characterized by an unwanted neutrophil function selected from the group consisting of the stimulation of the superoxide release, exocytosis stimulation and migration chemotactic Preferably, according to this aspect, the activity phagocytic or the elimination of bacteria by Neutrophils are substantially inhibited.

In another aspect, a method that alters a function of osteoclasts, which includes the contact of osteoclasts with a compound that selectively inhibits activity phosphatidylinositol 3-kinase delta (PI3K?) in osteoclasts.

According to the method, the compound may comprise a fraction that preferably binds to the bone.

In another aspect, a method for improve a bone resorption disorder in an animal that need, consisting of the administration to the animal of an amount effective of a compound that inhibits the activity of phosphatidylinositol 3-kinase delta (PI3K?) in the osteoclasts of the animal. A bone resorption disorder preferably it can be subjected to treatment according to the method revealed is osteoporosis.

In another aspect, a method for inhibit the growth or proliferation of cancer cells of hematopoietic origin, which consists of the contact of the cells carcinogenic with a compound that selectively inhibits activity phosphatidylinositol 3-kinase delta (PI3K?) in cancer cells. The method can be beneficial for inhibit the growth or proliferation of selected cancers from the group consisting of lymphomas, multiple myelomas and leukemia. In another aspect, a method for inhibiting kinase activity is revealed of a phosphatidylinositol 3-kinase polypeptide delta (PI3K?), which consists of a contact of the polypeptide PI3K? With a compound presenting the generic structure (I): Preferable compounds useful according to the invention include compounds selected from the group consisting of:

3

where Y is selected from the group composed of none, S, and NH;

R 4 is selected from the group consisting of H, halogen, NO 2, OH, OCH 3, CH 3, and CF 3;

R 5 is selected from the group consisting of H, OCH 3, and halo;

or R 4 and R 5 together with C-6 and C-7 ring system Quinazoline defines a 5 or 6-membered aromatic ring that optionally contains one or more atoms of O, H, or S;

R 6 is selected from the group consisting of C 1 -C 6 alkyl, phenyl, halophenyl, alkoxyphenyl, alkylphenyl, biphenyl, benzyl, pyridinyl, 4-methylpiperazinyl, C (= O) OC 2 H 5, and morpholinyl;

R d, independently, is selected from group consisting of NH2, halo, C 1-3 alkyl, S (C 1-3) alkyl, OH, NH (C 1-3) alkyl, N (C 1-3 alkyl) 2, NH (C 1-3 alkylene phenyl), and

4

what is 1 or 2,

provided that at least one of R 4 and R 5 is different from H when R 6 is phenyl or 2-chlorophenyl.

       \ vskip1.000000 \ baselineskip
    

More preferably, the compound is selected of the group consisting of:

5

where Y is selected from the group composed of none, S, and NH;

R 7 is selected from the group consisting of H, halo, OH, OCH 3, CH 3, and CF 3;

R 8 is selected from the group consisting of H, OGH3, and halogen;

or R 7 and R 8 together with C-6 and C-7 ring system Quinazoline defines a 5 or 6-membered aromatic ring that optionally contains one or more atoms of O, N, or S;

R 9 is selected from the group consisting of C 1 -C 6 alkyl, phenyl, halophenyl, alkylphenyl, biphenyl, benzyl, pyridinyl, 4-methylpiperazinyl, C (= O) -OC 2 H 5, and morpholinyl;

R d, independently, is selected from group consisting of NH2, halo, C 1-3 alkyl, S (C 1-3) alkyl, OH, NH (C 1-3) alkyl, N (C 1-3 alkyl) 2, NH (C 1-3 alkylene phenyl); Y

which is 1 or 2,

provided that at least one of R 7 and R 8 be different from 6-halo groups or 6,7-dimethoxy, and that R 9 is different from 4, -chlorophenyl.

       \ vskip1.000000 \ baselineskip
    

In another aspect, a method for alter leukocyte function, consisting of putting in contact leukocytes with a compound with a general structure (I).

In another aspect a class of compounds that have been observed to inhibit the activity of PI3K? In biochemical assays and performed with cells, and expected to demonstrate a therapeutic benefit in conditions medical where the activity of PI3K? is excessive or undesirable. Thus, the invention provides compounds of class a-1 with structure (II).

Preferably, the compounds have a general structure (IV)

6

where Y is selected from the group composed of none, S, and NH;

R 10 is selected from the group consisting of H, halo, OH, OCH 3, CH 3, and CF 3;

R 11 is selected from the group consisting of H, OCH 3, and halo;

or R 10 and R 11 together with C-6 and G-7 ring system Quinazoline defines a 5 or 6-membered aromatic ring that optionally contains one or more atoms of O, N, or S;

R 12 is selected from the group consisting of C 1 -C 6 alkyl, phenyl, halophenyl, alkylphenyl, biphenyl, benzyl, pyridinyl, 4-methylpiperazinyl, C (= O) C 2 H 5, and morpholinyl;

R d, independently, is selected from group consisting of NH2, halo, C 1-3 alkyl, S (C 1-3) alkyl, OH, NH (C 1-3) alkyl, N (C 1-3 alkyl) 2, NH (C 1-3 alkylene phenyl); Y

which is 1 or 2,

as long as:

(a) at least one of R 10 and R 11 is different from 6-halo groups or 6,7-dimethoxy;

(b) R 12 is different from 4-chlorophenyl; Y

(c) at least one of R 10 and R 11 is different from H when R 12 is phenyl or 2-chlorophenyl and X is S.

       \ vskip1.000000 \ baselineskip
    

These and other features and advantages of the The present invention will be appreciated in the detailed description and examples that are collected in this document. The description Detailed and examples are provided to facilitate the understanding of the invention

Figure 1 shows the effect of an inhibitor Selective PI3K? of the invention on the activity of three isoforms of PI3K.

Figure 2 shows the effect of an inhibitor selective of PI3K? on the generation of superoxide by part of human neutrophils in the presence of TNF or IgG.

Figure 3 shows the effect of an inhibitor selective of PI3K? on the generation of superoxide by part of human neutrophils in the presence of TNF or fMLP.

Figure 4 shows the effect of an inhibitor Selective PI3K? on elastase exocytosis in fMLP presence by human neutrophils.

Figure 5 shows the effect of an inhibitor Selective PI3K? on the chemotaxis induced by fMLP by part of human neutrophils.

Figure 6 shows that a selective inhibitor of PI3K? Does not affect phagocytosis and elimination of S. aureus by neutrophils.

Figure 7 shows the effect of an inhibitor selective of PI3K? on the proliferation and production of antibodies from human B lymphocytes.

Figure 8 shows the effect of an inhibitor Selective PI3K? on B lymphocyte proliferation murine spleen stimulated by anti-IgM.

Figure 9 shows the effect of an inhibitor Selective PI3K? on elastane exocytosis in a animal model

The invention provides compounds that selectively inhibit the activity of PI3Kδ. The invention also provides in vitro and ex vivo methods for inhibiting the activity of PI3K?, Including methods for selectively modulating the activity of the PI3K? Isoenzyme in cells, especially leukocytes, osteoclasts and cancer cells.

The methods are particularly beneficial to selectively modulate the activity of PI3K? in the clinical environment, in order to improve disease or disorders mediated by the activity of PI3K?. In this way, the treatment of diseases or disorders characterized by excessive or inappropriate activity of PI3K? can be addressed by using selective modulators of PX3K?.

Other methods of the invention include a better characterization of the physiological function of the isoenzyme. For other part, the invention provides pharmaceutical compositions that they comprise selective inhibitors of PI3K?. It also provide manufacturing articles comprising a compound selective PI3K? inhibitor (or a pharmaceutical composition comprising the compound), as well as instructions for using the compound. Now the details of these and others are described Useful embodiments of the invention.

The methods described herein benefit from the use of compounds that selectively inhibit, and preferably specifically inhibit, the activity of PI3K? In cells, including cells in vitro or ex vivo . Cells useful in the methods include those expressing endogenous PI3K?, Where endogenous indicates that cells express the absent recombinant introduction of PI3K? Into cells of one or more polynucleotides encoding a PI3K? Polypeptide or a biologically fragment active of her. The methods also encompass the use of cells expressing exogenous PI3K?, Where one or more polynucleotides encoding PI3K? Or a biologically active fragment thereof has been introduced into the cells using recombinant methods.

Of particular relevance, although not stated here, is that the cells can be in vivo , that is, in a living subject, such as an animal or a human, where a PI3K? Inhibitor can be used as a therapeutic to inhibit activity of PI3K \ delta in the subject. Alternatively, the cells can be isolated as discrete cells or in a tissue, for ex vivo or in vitro methods. The in vitro methods also included in the invention may comprise the step of contacting a PI3K? Enzyme or a biologically active fragment thereof with an inhibitor compound of the invention.

The PI3K? Enzyme can include an enzyme purified and isolated, in which the enzyme is isolated from a source natural (for example, cells or tissues that express normally an absent modification of the PI3K? polypeptide by recombinant technology) or isolated from modified cells by Recombinant techniques to express the exogenous enzyme.

The term "selective inhibitor of PI3K δ "used herein refers to a compound that inhibits PIK? isoenzyme more effectively than others isozymes of the PI3K family. It is understood that a compound "selective inhibitor of PI3K?" is more selective for PI3K? That the compounds conventionally named and generic PI3K inhibitors, such as wortmanin or LY294002. Concomitantly, wortmanin and LY294002 are considered "non-selective PI3K inhibitors". The compounds of any type that negatively regulates activity or expression PI3K? selectively can be used as selective inhibitors of PI3K? in the methods of invention. On the other hand, compounds of any kind that negatively regulate the activity or expression of PI3K? Selectively and possessing pharmacological properties acceptable can be used as selective inhibitors of PI3K? In the therapeutic methods of the invention.

The relative efficiencies of compounds such as inhibitors of the activity of an enzyme (or other activity biological) can be established by determining the concentrations at which each compound inhibits activity to a predefined degree to then compare the results. Typically, the preferable determination is the concentration that inhibits 50% of the activity in a biochemical assay, that is the determination of 50% inhibitory concentration or IC 50 can be achieved using conventional techniques known in the field. In In general, an IC50 can be determined by measuring the activity of a certain enzyme in the presence of a series of concentrations of the inhibitor studied. Then the values obtained experimentally the enzyme activity are related to the inhibitor concentrations used. The concentration of inhibitor demonstrating 50% enzyme activity (in comparison with activity in the absence of any inhibitor) is takes as the value EC_ {50}. Similarly, they can be defined other inhibitory concentrations through determinations appropriate activity. For example, in some contexts you can it is advisable to establish an inhibitory concentration of 90, that is IC_ {90}, etc.

Therefore, alternatively you can understand that a "selective inhibitor of PI3K?" is refers to a compound that has an inhibitory concentration of 50% (IC_ {50}) with respect to PI3K?, Which is at least 10 times, preferably at least 20 times and ideally at least 30 times lower than the IC_ {50} value with respect to some or all other members of the class I PI3K family. The term "PI3K? specific inhibitor" can be understood to be refers to a selective inhibitor compound of PI3K? which has an IC_ {50} value with respect to PI3K? which is at at least 50 times, preferably at least 100 times, more preferably at least 200 times and ideally at least 500 times less than the IC_ {50} value with respect to some or all of the other members of the PI3K family of class I.

Among other things, the invention provides methods to inhibit leukocyte function. More specifically, the invention provides methods to inhibit or suppress functions of neutrophils and T and B lymphocytes. Regarding neutrophils, it has been found unexpectedly that the inhibition of the activity of PI3K? inhibits the functions of neutrophils For example, it has been observed that the compounds of the invention cause the inhibition of the classic functions of neutrophils, such as stimulation of the release of superoxide, exocytosis stimulation and migration chemotactic However, it has also been observed that the method of the invention allows the suppression of certain functions of the neutrophils, without substantially affecting other functions of those cells. For example, it has been observed that phagocytosis of bacteria by neutrophils does not look substantially inhibited by PI3K? selective inhibitor compounds of the invention.

Thus, the invention includes methods for inhibit neutrophil functions, without inhibiting substantially phagocytosis of bacteria. The functions of Neutrophils susceptible to inhibition according to the method include any function mediated by the activity or expression of PIK? These functions include, merely enunciative, the stimulation of the release of superoxide, the stimulation of exocytosis or degranulation, migration chemotactic, adhesion to the vascular endothelium (for example, the Neutrophil capture / binding, neutrophil activation, activity and / or the binding of neutrophils to the endothelium), the diapsis or emigration through the endothelium to peripheral tissues. In general, these functions can be collectively called "functions inflammatory, "since they are usually related to Neutrophil response to inflammation. The functions Inflammatory neutrophils can be distinguished from Bacterial elimination functions that these cells present, such as phagocytosis and elimination of bacteria. Therefore, the invention also includes methods for the treatment of diseases in which one or more of the inflammatory functions of Neutrophils are abnormal or unwanted.

It has also been established through the invention that PI3K? participates in the stimulation of the lymphocyte proliferation, including B and T cells. On the other part, it seems that PI3K? participates in the stimulation of secretion of antibodies from B cells. They have been used PI3K? selective inhibitor compounds of the invention to establish that these phenomena can be canceled by PI3K? inhibition. Thus, the invention includes methods to inhibit lymphocyte proliferation, and methods to inhibit Antibody production of B lymphocytes. Among others methods provided by the invention include methods for the treatment of diseases in which one or more of these functions lymphocytes are abnormal or undesirable.

It has now been determined that the activity of PI3K? Can be inhibited selectively or specifically for facilitate the treatment of a disease mediated by PI3K? reducing or eliminating complications at the same time typically associated with concomitant activity inhibition of the other I PI 3-class kinases I. To illustrate this embodiment, the methods of the invention can be practice using members of a class of compounds that have been found out that allow a selective inhibition of PI3K? with with respect to the other isoforms of PI3K.

The methods of this embodiment can be practice using compounds that have the general structure (III). Preferable methods employ compounds that have been empirically demonstrated that they allow at least 10 times the selective inhibition of PI3K? with respect to the others PI3K isoforms. For example, the methods can be practiced using the following compounds:

3- (2-Isopropylphenyl) -5-methyl-2- (9H-purin-6-yl-sulfanylmethyl) -3H-quinazolin-4-one;

5-Chloro-2- (9H-purin-6-ylsulfanylmethyl) -3-o-tolyl-3H-quinazolin-4-one;

5-Chloro-3- (2-fluorophenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3- (2-fluorophenyl) -5-methyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3- (2-Methoxyphenyl) -5-methyl-2- (9H-purin-yl-ylsulfanylmethyl-3H-quinazolin-4-one;

3- (2,6-Dichlorophenyl) -5-methyl-2- (9H-purin-6-yl-sulfanylmethyl) -3H-quinazolin-4-one;

3- (2-chlorophenyl) -6-fluoro-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

5-Chloro-3- (2-chlorophenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3- (2-Chlorophenyl) -5-methyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3- (3-methoxyphenyl-2- (9H-purin-6-ylsulfanylmethyl-3H-quinazolin-4-one;

3- (2-chlorophenyl) -5-fluoro-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3-benzyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3-butyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3- (2-chlorophenyl) -7-fluoro-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3-morpholin-4-yl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one, acetate salt;

8-Chloro-3- (2-chlorophenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3- (2-Chlorophenyl) -6,7-difluoro-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3- (2-methoxyphenyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

6-Chloro-3- (2-chlorophenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3- (3-chlorophenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

2- (9H-purin-6-ylsulfanylmethyl) -3-pyridin-4-yl-3H-quinazo1in-4-one;

3- (2-Chlorophenyl) -2- (9H-purin-6-ylsulfanylmethyl) -trifluoromethyl-3H-quinazolin-4-one;

3-benzyl-5-fluoro-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3- (4-methylpiperazin-1-yl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one, acetate salt;

3- (2-Chlorophenyl) -6-hydroxy-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

[5-fluoro-4-oxo-2- (9H-purin-6-ylsulfanylmethyl) -4H-quinazolin-3-yl] ethyl ester of acetic acid;

3- (2,4-dimethoxyphenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3-biphenyl-2-yl-5-chloro-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -3- (2-isopropylphenyl) -5-methyl-3H-quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -5-methyl-3-o-tolyl-3H-quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -3-biphenyl-2-yl-5-chloro-3H-quinazolin-4-one;

5-Chloro-3- (2-methoxyphenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -3- (2-fluorophenyl) -5-methyl-3H-quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -5-chloro-3- (2-fluorophenyl) -3H-quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -8-chloro-3- (2-chlorophenyl) -3H-quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -5-chloro-3- (2-chlorophenyl) -3H-quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -3- (2-chlorophenyl) -5-methyl-3H-quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -3- (2-chlorophenyl) -5-fluoro-3H-quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -3-benzyl-5-fluoro-3H-quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -3-butyl-3H-quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -3-morpholin-4-yl-3H-quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -3- (2-chlorophenyl) -7-fluoro-3H-quinazolin-4-one;

3- (2-Chlorophenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3-phenyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -5-chloro-3- (2-isopropylphenyl) -3H-quinazolin-4-one; Y

2- (6-aminopurin-9-ylmethyl) -5-chloro-3-o-tolyl-3H-quinazolin-4-one.

       \ vskip1.000000 \ baselineskip
    

It has also been determined that the methods of invention can be practiced profitably using members of a class of compounds that have an activity PI3K? inhibitor, thus facilitating the inhibition of PI3K? activity in diseases mediated by it. By example, in this embodiment, the methods of the invention can be practice using compounds that have the general structure (I).

7

where A is a ring system optionally substituted bicyclic or monocyclic containing the at least two nitrogen atoms and at least one ring of the system is aromatic;

X is selected from the group consisting of CHR b, CH 2 CHR b, and CH = C (R b);

And it is selected from the group consisting of none, S, SO, SO2, NH, O, C (= O), OG (-O), C (= O) O, and NHC (= O) CH2 S;

R 1 and R 2, independently, are selected from the group consisting of hydrogen, C 1-6 alkyl, aryl, heteroaryl, halo, NHC (= O) C 1-3 alkylene N (R a) 2, NO 2, OR a, OCF 3, N (R a) 2, CN, OC (= O) R a , C (= O) R a, C (= O) OR a, arilOR b, Het, NR a C (= O) C 1-3 C alkylene ( = O) OR 3, arylOC 1-3 alkylene-N (R a) 2, arylOC (= O) R a, C 1-4 alkylene C (= O) OR a, OC 1-4 alky
lenoC (= O) OR a, C 1-4 alkyleneOC 1-4 alkylene C (= O) OR a, C (= O) -NR a SO 2 R a, C 1-4 alkylene N (R a) 2, C 2-6 alkenylene N (R a) 2, C (= O) NR ^ {a} C 1-4 alkyleneOR a, C (= O) NR a C 1-4 alkylene Het, OC 2-4 alkylene N (R a) 2 , OC 1-4 alkylene CH (OR b)
CH 2 N (R a) 2, OC 1-4 alkyleneHet, OC 2-4 alkyleneOR a, OC 2-4 alkylene-NR a C (= O) OR a, NR a C 1-4 alkylene N (R a) 2, NR a
C (= O) R a, NR a C (= O) N (R a) 2, N (SO 2 C 1-4 alkyl) 2, NR a (SO 2 C 1-4 alkyl), SO 2 N (R a) 2, OSO 2 CF 3, C_ { 1-3} alkylenearyl, C 1-4 alkylene Het, C 1-6 alkyleneOR b, C 1-3 alkylene N (R a) 2, C (= O) N (R a) 2, NHC (= O) C 1 -C 3 alkylenearyl, C 3-8 cycloal-
chyl, C 3-8 heterocycloalkyl, arylOC 1-3 alkylene N (R a) 2, arylOC (= O) R b, NHC (= O) C 1-3 C 3-8 alkylene heterocycloalkyl
lo, NHC (= O) C 1-3 alkyleneHet, OC 1-4 alkyleneOC 1-4 alkylene C (= O) OR b, C (= O) C 1-4 alkyleneHet , and NHC (= O) halo
C 1-6 alkyl;

or R 1 and R 2 join to form a component with an alkenylene or alkylene chain of 3 or 4 members of a ring of 5 or 6 members, which contains at least one heteroatom;

R 3 is selected from the group consisting of optionally substituted hydrogen, C 1-6 alkyl, C 3-8 cycloalkyl, C 3-8 heterocycloalkyl, C 1-4 alkylenecycloalkyl, C 2 -6} alkenyl, C 1-3 alkylenearyl, arylC 1-3 alkyl, C (= O) R a, aryl, heteroaryl, C (= O) OR a, C (= O) N (R a) 2, C (= S) N (R a) 2, SO 2 R a, SO 2 N (R a) 2, S (= O) R a, S (= O) N (R a) 2, C (= O) NR a C_ {1-4} -alk-
noOR a, C (= O) NR a C 1-4 alkylene Het, C (= O) C 1-4 alkyl-enearyl, C (= O) C 1-4 alkyleneheteroaryl, C 1-4 alkylenearyl optionally substituted by one or more of halo SO 2 N (R a) 2, N (R a) 2, C (= O) OR a, NR a SO 2 CF 3, CN, NO 2, C (= O) R a, OR a, C 1- 4 alkylene N (R a) 2, and OC 1-4 alkylene N (R a) 2, C 1-4 alkyleneheteroaryl, C 1-4 alkyleneHet , C 1-4 alkylene-C (= O) C 1-4 alkylenearyl, C 1-4 alkylene C (= O) C 1-4 alkylene heteroaryl, C 1-4 alkyleneC (= O) Het, C 1-4 alkylene C (= O) -
N (R a) 2, C 1-4 alkyleneOR a, C 1-4 alkylene NR a C (= O) R a, C 1 -4} alkyleneOC 1-4 alkyleneOR a, C 1-4 alkylene N (R a) 2, C 1-4
alkylene C (= O) OR a, and C 1-4 alkyleneOC 1-4 alkylene-C (= O) OR a;

R a is selected from the group consisting of C 1-6 hydrogen, C 3-8 cycloalkyl, C 3-8 heterocycloalkyl, C 1-3 alkylene N (R a) 2, aryl, arylC 1-3 alkyl, C 1-3 alkylenearyl, heteroaryl, heteroarylC 1-3 alkyl, and C 1-3 alkyleneheteroaryl;

or join two groups R a to form a 5 or 6 member ring, which may optionally contain at least a heteroatom;

R b is selected from the group consisting of hydrogen, C 1-5 alkyl, aryl, heteroaryl, arylC 1-3 alkyl, heteroaryl
C 1-3 alkyl, C 1-3 alkylenearyl, and C 1-3 alkyleneheteroaryl;

Het is a 5 or 6 heterocyclic ring members, saturated or partially or totally unsaturated that contains the minus a heteroatom selected from the group consisting of oxygen, nitrogen and sulfur, and optionally substituted by C 1-4 alkyl or C (= O) OR a;

and salts and solvates thereof (for example, hydrates) pharmaceutically acceptable.

       \ vskip1.000000 \ baselineskip
    

For example, the methods of the invention can use compounds that exhibit an inhibitory activity of PI3K \ delta, as follows:

3- (2-Isopropylphenyl) -5-methyl-2- (9H-purin-6-yl-sulfanylmethyl) -3H-quinazolin-4-one;

5-Chloro-2- (9H-purin-6-ylsulfanylmethyl) -3-o-tolyl-3H-quinazolin-4-one;

5-Chloro-3- (2-fluorophenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3- (2-fluorophenyl) -5-methyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3- (2-Methoxyphenyl) -5-methyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3- (2,6-Dichlorophenyl) -5-methyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3- (2-chlorophenyl) -6-fluoro-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

5-Chloro-3- (2-chlorophenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3- (2-Chlorophenyl) -5-methyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3- (2-methoxyphenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3- (2-chlorophenyl) -5-fluoro-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3-benzyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3-butyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3- (2-chlorophenyl) -7-fluoro-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3-morpholin-4-yl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one, acetate salt;

8-Chloro-3- (2-chlorophenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3- (2-Chlorophenyl) -6,7-difluoro-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3- (3-methoxyphenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

6-Chloro-3- (2-chlorophenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3- (3-chlorophenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

(9H-purin-6-ylsulfanylmethyl) -3-pyridin-4-yl-3H-quinazolin-4-one;

3- (2-Chlorophenyl) -2- (9H-purin-6-ylsulfanylmethyl) -trifluoromethyl-3H-quinazolin-4one;

3-benzyl-5-fluoro-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3- (4-methylpiperazin-1-yl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-cruinazolin-4-one, acetate salt;

3- (2-chlorophenyl) -6-hydroxy-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazo1in-4-one;

[5-fluoro-4-oxo-2- (9H-purin-6-ylsulfanylmethyl) -4H-quinazolin-3-yl] ethyl ester of acetic acid;

3-biphenyl-2-yl-5-chloro-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

5-Chloro-3- (2-methoxyphenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -3- (2-isopropylphenyl) -5-methyl-3H-quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -5-methyl-3-o-tolyl-3H-quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -3-biphenyl-2-yl-t-chloro-3H-quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -3- (2-fluorophenyl) -5-methyl-3H-quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -5-chloro-3- (2-fluorophenyl) -3H-quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -8-chloro-3- (2-chlorophenyl) -3H-quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -5-chloro-3- (2-chlorophenyl) -3H-quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -3- (2-chlorophenyl) -5-methyl-3H-quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -3- (2-chlorophenyl) -5-fluoro-3H-quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -3-benzyl-5-fluoro-3H-quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -3-butyl-3H-quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -3-morpholin-4-yl-3H-quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -3- (2-chlorophenyl) -7-fluoro-3H-quinazolin-4-one;

3- (2-Chlorophenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3-phenyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -5-chloro-3- (2-chlorophenyl) -3H-quinazolin-4-one;

3- (4-chlorophenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3- (2-Chlorophenyl) -6,7-dimethoxy-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3- (2-Chlorophenyl) -7-nitro-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -6-bromo-3- (2-chlorophenyl) -3H-quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -3- (2-chlorophenyl) -6,7-dimethoxy-3H-quinazolin-4-one;

6-Bromo-3- (2-chlorophenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3- (2-chlorophenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-benzo [g] quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -5-chloro-3-o-tolyl-3H-quinazolin-4-one; Y

2- (6-aminopurin-9-ylmethyl) -5-chloro-3- (2-methoxyphenyl) -3H-quinazolin-4-one.

       \ vskip1.000000 \ baselineskip
    

The invention also provides compounds that they are selective inhibitors of PI3K? activity. The Compounds demonstrate PIK? inhibition in assays biochemicals, and selectively alter the function of the cells that express PI3K? in cell tests. How I know described herein, it has been shown that the compounds of the invention inhibit certain functions of neutrophils and others leukocytes, as well as osteoclast functions.

In general, the compounds provided by the invention present the general structure (I), a salt Pharmaceutically acceptable or a prodrug thereof:

8

where A is a ring system optionally substituted bicyclic or monocyclic containing the at least two nitrogen atoms and at least one ring of the system is aromatic;

X is selected from the group consisting of CHR b, CH 2 CHR b, and CH = C (R b);

And it is selected from the group consisting of none, S, SO, SO2, NH, O, C (= O), OC (= O), C (= O) O, and NHC (= O) CH2 S;

R 1 and R 2, independently, are selected from the group consisting of hydrogen, C 1-6 alkyl, aryl, heteroaryl, halo, NHC (= O) C 1-3 alkylene N (R a) 2, NO 2, OR a, OCF 3, N (R a) 2, CN, OC (= O) R a , C (= O) R a, C (= O) OR a, arilOR b, Het, NR a C (= O) C 1-3 C alkylene ( = O) OR a, arylOC 1-3 alkylene-N (R a) 2, arylOC (= O) R a, C 1-4 alkylene C (= O) OR a, OC 1-4 alky
lenoC (= O) OR a, C 1-4 alkyleneOC 1-4 alkylene C (= O) OR a, C (= O) -NR a SO 2 R a, C 1-4 alkylene N (R a) 2, C 2-6 alkenylene N (R a) 2, C (= O) -NR a C 1-4 alkyleneOR a, C (= O) NR a C 1-4 alkylene Het, OC 2-4 alkylene N (R a) 2, OC 1-4 alkylene CH (OR b)
CH 2 N (R a) 2, OC 1-4 alkyleneHet, OC 2-4 alkyleneOR a, OC 2-4 alkylene-NR a C (= O) OR a, NR a C 1-4 alkylene N (R a) 2, NR a
C (= O) R a, NR a C (= O) N (R a) 2, N (SO 2 C 1-4 alkyl) 2, NR a (SO 2 C 1-4 alkyl), SO 2 N (R a) 2, OSO 2 CF 3, C_ { 1-3} alkylenearyl, C 1-4 alkylene Het, C 1-6 alkyleneOR b, C 1-3 alkylene N (R a) 2, C (= O) N (R a) 2, NHC (= O) C 1 -C 3 alkyleneoaryl, C 3-8 cyclo-
alkyl, C 3-8 heterocycloalkyl, arylOC 1-3 alkylene N (R a) 2, arylOC (= O) R b, NHC (= O) C 1-3 C 3-8 alkylene heterocycle-
alkyl, NHC (= O) C 1-3 -alkyleneHet, OC 1-4 alkyleneOC 1-4 alkylene C (= O) OR b, C (= O) C 1-4 alkyleneHet, and NHC (= O) haloC 1-6 alkyl;

or R 1 and R 2 join to form a component with an alkenylene or alkylene chain of 3 or 4 members of a ring of 5 or 6 members, which contains at least one heteroatom;

R 3 is selected from the group consisting of optionally substituted hydrogen, C 1-6 alkyl, C 3-8 cycloalkyl, C 3-8 heterocycloalkyl, C 1-4 alkylenecycloalkyl, C 2 -6 alkenyl, C 1-3 alkylenearyl, arylC 1-3 alkyl, C (= O) R a, aryl, heteroaryl, C (= O) OR a, C (= O) N (R a) 2, C (= S) N (R a) 2, SO 2 R a, SO 2 N (R a) 2, S (= O) R a, S (= O) N (R a) 2, C (= O) NR a C_ {1-4} -al-
chyleneOR a, C (= O) NR 3 C 1-4 alkylene Het, C (= O) C 1-4 alkylenearyl, C (= O) C 1-4 alkyleneheteroaryl, C 1-4 alkylenearyl
optionally substituted by one or more of halo SO 2 N (R a) 2, N (R a) 2, C (= O) OR a, NR a SO 2 CF 3, CN, NO 2, C (= O) R a, OR a, C 1-4 alkylene N (R a) ) 2, and OC 1-4 alkylene N (R a) 2, C 1-4 alkyleneheteroaryl, C 1-4 alkyleneHet, C 1-4 alkyleneC ( = O) -C 1-4 alkylenearyl, C 1-4 alkylene C (= O) C 1-4 alkyleneheteroaryl, C 1-4 alkylene C (= O) Het, C 1-4} alkyleneC (= O) N (R a) 2, C 1-4 alkyleneOR a, C 1-4 alkyleneNR a C (= O) R a , C 1-4 alkylene O-C 1-4 alkyleneOR a, C 1-4 alkylene N (R a) 2, C 1-4 alkylene
C (= O) -OR a, and C 1-4 alkyleneOC 1-4 alkylene C (= O) OR a;

R a is selected from the group consisting of hydrogen, C 1-6 alkyl, C 3-8 cycloalkyl, C 3-8 heterocycloalkyl, C 1-3
alkylene N (R a) 2, aryl, arylC 1-3 alkyl, C 1-3 alkylenearyl, heteroaryl, heteroaryl C 1-3 alkyl, and C 1-3 alkylenehetero-
aryl;

or join two groups R a to form a 5 or 6 member ring, which may optionally contain at least a heteroatom;

R b is selected from the group consisting of hydrogen, C 1-6 alkyl, aryl, heteroaryl, arylC 1-3 alkyl, heteroaryl
C 1-3 alkyl, C 1-3 alkylenearyl, and C 1-2 alkyl eneheteroaryl;

Het is a 5 or 6 heterocyclic ring members, saturated or partially or totally unsaturated that contains the minus a heteroatom selected from the group consisting of oxygen, nitrogen and sulfur, and optionally substituted by C 1-4 alkyl or C (= O) OR a;

and salts and solvates thereof (for example, hydrates) pharmaceutically acceptable.

       \ vskip1.000000 \ baselineskip
    

The term "alkyl" used here includes straight and branched chain hydrocarbon groups that contain the indicated number of carbon atoms, typically methyl, ethyl and the straight chain butyl and propyl groups and branched. The hydrocarbon group can contain up to 16 carbon atoms, preferably one to eight carbon atoms. The term "alkyl" includes "attached alkyl", that is a polycyclic or bicyclic hydrocarbons group C 5 -C 16, for example, norbornyl, adamantyl, bicyclo [2.2.2] octyl, bicyclo [2.2.1] -heptyl, bicyclo [3.2.1] octyl, or decahydronaphthyl. The term "cycloalkyl" is defined as a hydrocarbon group C 3 -C 8 cyclic, such as cyclopropyl, cyclobutyl, cyclohexyl and cyclopentyl.

The term "alkenyl" is defined in a way identical to "alkyl", except that they contain a double bond carbon-carbon "Cycloalkenyl" is defined as similar to cycloalkyl, except that there is a double bond carbon-carbon present in the ring.

The term "alkylene" refers to a alkyl group that has a substituent. For example, him term "C 1-3 alkylenearyl" is refers to a group of alkyls containing from one to three atoms of carbon, and substituted by a group of aryls.

The term "halo" or "halogen" used here includes fluorine, bromine, chlorine and iodine.

The term "haloalkyl" is defined here. as a group of alkyls substituted by one or more substituents halo, be it fluorine, chlorine, bromine, iodine or combinations thereof. Similarly, "halocycloalkyl" is defined as a group of cycloalkyl having one or more halo substituents.

The term "aryl", alone or in combination, is defined here as a monocyclic or polycyclic aromatic group, preferably a monocyclic or polycyclic aromatic group, such as phenyl or naphthyl. Unless otherwise indicated, a group "aryl" may or may not be substituted, for example, by one or more, and in particular between one and three halos, alkyls, phenyls, hydroxyalkyl, alkoxy, alkoxyalkyl, haloalkyl, nitros, aminos, alkylamino, acylamino, alkylthio, alkylsulfinyl and alkylsulfonyls. Some aryl groups include phenyl, naphthyl, biphenyl, tetrahydronaphthyl, chlorophenyl, fluorophenyl, amino-phenyl, methylphenyl, methoxyphenyl, trifluoro-methylphenyl, nitrophenyl, carboxyphenyl and Similar. The terms "arilC_ {1-3} alkyl" and "heteroaryl-C 1-3 alkyl" is defined as an aryl or heteroaryl group that has a C 1-3 alkyl substituent.

The term "heteroaryl" is defined here. as a monocyclic or bicyclic ring system that contains one or two aromatic rings and at least one atom of nitrogen, oxygen or sulfur, and which may or may not be substituted, for example, by one or more, and in particular one to three substituents, such as halo, alkyl, hydroxy, hydroxyalkyl, alkoxy, alkoxyalkyl, haloalkyl, nitro, amino, alkylamino, acylamino, alkylthio, alkylsulfinyl and alkylsulfonyl. Some examples of the groups heteroaryls include thienyl, furyl, pyridyl, oxazolyl, quinolyl, isoquinolyl, indolyl, triazolyl, isothiazolyl, isoxazolyl, imidizolyl, benzothiazolyl, pyrazinyl, pyrimidinyl, thiazolyl and thiadiazolyl.

The term "Het" is defined as groups monocyclic, bicyclic and tricyclic containing one or more heteroatoms selected from the group consisting of oxygen, nitrogen and sulfur. A "Het" group can also contain a oxo group (= O) attached to the ring.

Some examples of Het groups include 1,3-dioxolane, 2-pyrazoline, pyrazolidine, pyrrolidine, piperazine, 1-pyrroline, 2H-pyrano, 4H-pyrano, morpholine, thiopholine, piperidine, 1,4-dithian, and 1,4-dioxane.

The term "hydroxy" is defined as -OH.

The term "alkoxy" is defined as -OR, where R is alkyl.

The term "alkoxyalkyl" is defined as an alkyl group in which a hydrogen has been replaced by a alkoxy group. The term "(alkylthio) alkyl" is defined as similar to an alkoxyalkyl, except that there is an atom of sulfur, instead of an oxygen atom, present.

The term "hydroxyalkyl" is defined as a hydroxy group attached to an alkyl group.

The term "amino" is defined as -NH2, and the term "alkylamino" is defined as -NR2, where at least one R is alkyl and the second R is alkyl or hydrogen.

The term "acylamino" is defined as RC (= O) N, where R is alkyl or aryl.

The term "alkylthio" is defined as -SR, where R is alkyl.

The term "alkylsulfinyl" is defined as R-SO2, where R is alkyl.

The term "amino" is defined as -NH2, and the term "alkylamino" is defined as -NR2, where at least one R is alkyl and the second R is alkyl or hydrogen.

The term "acylamino" is defined as RC (= O) N, where R is alkyl or aryl.

The term "alkylthio" is defined as -SR, where R is alkyl.

The term "alkylsulfinyl" is defined as R-SO2, where R is alkyl.

The term "alkylsulfonyl" is defined as R-SO3, where R is alkyl.

The term "nitro" is defined as -NO_ {2}.

The term "trifluoromethyl" is defined as -CF_ {3}.

The term "trifluoromethoxy" is defined as -OCF_ {3}.

The term "cyano" is defined as -CN.

In preferable embodiments, X is select from the group consisting of CH2, CH2CH2, CH = CH, CH (CH 3), CH 2 CH (CH 3), and C (CH 3) 2. In other preferable embodiments, And it is selected from the group consisting of none, S, and NH.

Ring A can be monocyclic or bicyclic. Monocyclic ring A systems are aromatic. The systems of bicyclic ring A contain at least one aromatic ring, but Both rings can be aromatic. Some examples of system Ring A include, by way of example only, imidazolyl, pyrazolyl, 1,2,3-triazolyl, pyridizinyl, pyrimidinyl, pyrazinyl, 1,3,5-triazinyl, purinyl, cinnolinyl, phthalazinyl, quinazolinyl, quinoxalinyl, 1,8-naphthyridinyl, pteridinyl, 1H-indazolyl, and benzimidazolyl.

In a preferable group of compounds of formula (I), A is represented with an optionally ring system substituted selected from the group consisting of:

9

900

Ring system A can be replaced. optionally for one to three, and preferably for one or two, substituents selected from the group consisting of N (R a) 2, halo, C 1-3 alkyl, S (C 1-3 alkyl), OR a, and

10

Specific substituents include, although without limitation a, NH2, NH (CH3), N (CH 3) 2, NHCH 2 C 6 H 5, NH (C 2 H 5), Cl, F, CH 3, SCH 3, OH, and

eleven

In another preferable group of compounds of formula (I), R 1 and R 2, independently, are represented by hydrogen, OR a, halo, C 1-6 alkyl, CF 3, NO 2, N (R a) 2, NR a C 1-3 alkylene N (R a) 2, and OC_ 1-3 alkyleneOR a. Substituents Specific include, but are not limited to, H, OCH 3, Cl, Br, F, CH 3, CF 3, NO 2, OH, N (CH 3) 2,

12

Y O (CH 2) 2 OCH 2 C 6 H 5. R1 and R2 can also be joined to form a ring, for example, a ring of phenyl.

       \ vskip1.000000 \ baselineskip
    

In a preferred embodiment, R 3 is selected from the group consisting of one of the following optionally substituted elements: C 1-6 alkyl, aryl, heteroaryl, C 3-8 acycloalkyl, C 3-8 heterocycloalkyl, C (= O) OR a, C 1-4 alkylene
Het, C 1-4 alkylene cycloalkyl, C 1-4 alkylenearyl, C 1-4 alkylene C (= O) C 1-4 alkylenearyl, C 1-4 alkylene C (= O) OR a, C 1-4 alkylene-C (= O) N (R a) 2, C 1_4 alkylene C (= O) Het, C 1-4 alkylene N (R a) 2, and C 1-4 alkylene NR a C (= O) R a. Specific R3 groups include, but are not limited to,

13

       \ vskip1.000000 \ baselineskip
    

14

       \ newpage
    

The group R 3 can be substituted by one to three substituents, for example, halo, OR a, C 1-6 alkyl, aryl, heteroaryl, NO 2, N (R a) 2, NR a SO 2 CF 3, NR a C (= O) R a, C (= O) OR a, N (R a) C 1-4 alkylene (R a) 2, SO 2 N (R a) 2, CN, C (= O) R a, C 1-4 alkylene N (R a) 2, and OC 1-4 alkylene N (R a) 2. Specific substituents for the R3 group include, although not limited to, Cl, F, CH 3, CH (CH 3) 2, OCH 3, C 6 H 5, NO 2, NH 2, NHC (= O) CH 3, CO 2 H, and N (CH 3) CH 2 CH 2 N (CH 3) 2.

As used here, the structure of the quinazoline ring, and the numbering of the ring structure, is

fifteen

The purine ring structure, and the ring structure numbering, is

16

The compounds provided by the invention they are exemplified as follows;

3- (2-Isopropylphenyl) -5-methyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

5-Chloro-2- (9H-purin-6-ylsulfanylmethyl) -3-o-tolyl-3H-quinazolin-4-one;

5-Chloro-3- (2-fluorophenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3- (2-fluorophenyl) -5-methyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3- (2-Methoxyphenyl) -5-methyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3- (2,6-Dichlorophenyl) -5-methyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3- (2-chlorophenyl) -6-fluoro-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

5-Chloro-3- (2-chlorophenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3- (2-Chlorophenyl) -5-methyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3- (2-methoxyphenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3- (2-chlorophenyl) -5-fluoro-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3-benzyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3-butyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3- (2-chlorophenyl) -7-fluoro-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3-morpholin-4-yl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one, acetate salt;

8-Chloro-3- (2-chlorophenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3- (2-Chlorophenyl) -6,7-difluor-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3- (3-methoxyphenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

6-Chloro-3- (2-chlorophenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3- (3-chlorophenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

2- (9H-purin-6-ylsulfanylmethyl) -3-pyridin-4-yl-3H-quinazolin-4-one;

3- (2-Chlorophenyl) -8-trifluoromethyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3-benzyl-5-fluoro-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3- (4-methylpiperazin-1-yl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one, acetate salt;

3- (2-Chlorophenyl) -6-hydroxy-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

[5-fluoro-4-oxo-2- (9H-purin-6-ylsulfanylmethyl) -4H-quinazolin-3-yl] ethyl ester of acetic acid;

3- (2-methoxyphenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3-biphenyl-2-yl-5-chloro-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

5-Chloro-3- (2-methoxyphenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -3- (2-isopropylphenyl) -5-methyl-3H-quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -5-methyl-3-o-tolyl-3H-quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -3-biphenyl-2-yl-5-chloro-3H-quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -3- (2-fluorophenyl) -5-methyl-3H-quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -5-chloro-3- (2-fluorophenyl) -3H-quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -8-chloro-3- (2-chlorophenyl) -3H-quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -5-chloro-3- (2-chlorophenyl) -3H-quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -3- (2-chlorophenyl) -5-methyl-3H-quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -3- (2-chlorophenyl) -5-fluoro-3H-quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -3-benzyl-5-fluoro-3H-quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -3-butyl-3H-quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -3-morpholin-4-yl-3H-quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -3- (2-chlorophenyl) -7-fluoro-3H-quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -6-chloro-3- (2-chlorophenyl) -3H-quinazolin-4-one;

3- (4-chlorophenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3- (2-Chlorophenyl) -6,7-dimethoxy-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3- (2-Chlorophenyl) -7-nitro-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -6-bromo-3- (2-chlorophenyl) -3H-quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -3- (2-chlorophenyl) -6,7-dimethoxy-3H-quinazolin-4-one;

6-Bromo-3- (2-chlorophenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3- (2-chlorophenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-benzo [g] quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -5-chloro-3-o-tolyl-3H-quinazolin-4-one; Y

2- (6-aminopurin-9-ylmethyl) -5-chloro-3- (2-methoxyphenyl) -3H-quinazolin-4-one.

       \ vskip1.000000 \ baselineskip
    

Preferable compounds provided by the invention have the structure (IV), exemplified as follows:

3- (2-Isopropylphenyl) -5-methyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

5-Chloro-2- (9H-purin-6-ylsulfanylmethyl) -3-o-tolyl-3H-quinazolin-4-one;

5-Chloro-3- (2-fluorophenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3- (2-fluorophenyl) -5-methyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3- (2,6-Dichlorophenyl) -5-methyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3- (2-chlorophenyl) -6-fluoro-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

5-Chloro-3- (2-chlorophenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3- (2-Chlorophenyl) -5-methyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3- (2-chlorophenyl) -5-fluoro-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3-benzyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3-butyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3- (2-chlorophenyl) -7-fluoro-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3-morpholin-4-yl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one, acetate salt;

8-Chloro-3- (2-chlorophenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3- (2-Chlorophenyl) -6,7-difluor-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

6-Chloro-3- (2-chlorophenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin4-one;

3- (3-chlorophenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

2- (9H-purin-6-ylsulfanylmethyl) -3-pyridin-4-yl-3H-quinazolin-4-one;

3- (2-Chlorophenyl) -2- (9H-purin-6-ylsulfanylmethyl) -trifluoromethyl-3H-quinazolin-4-one;

3-benzyl-5-fluoro-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

3- (4-methylpiperazin-1-yl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one, acetate salt;

3- (2-Chlorophenyl) -6-hydroxy-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

[5-fluoro-4-oxo-2- (9H-purin-6-ylsulfanylmethyl) -4H-quinazolin-3-yl] ethyl ester of acetic acid;

3-biphenyl-2-yl-5-chloro-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -3- (2-isopropylphenyl) -5-methyl-3H-quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -5-methyl-3-o-tolyl-3H-quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -3-biphenyl-2-yl-5-chloro-3H-quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -3- (2-fluorophenyl) -5-methyl-3H-quinazolin-4-one;

2- (S-aminopurin-9-ylmethyl) -5-chloro-3- (2-fluorophenyl) -3H-quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -8-chloro-3- (2-chlorophenyl) -3H-quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -5-chloro-3- (2-chlorophenyl) -3H-quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -3- (2-chlorophenyl) -5-methyl-3H-quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -3- (2-chlorophenyl) -5-fluoro-3H-quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -3-benzyl-5-fluoro-3H-quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -3-butyl-3H-quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -3-morpholin-4-yl-3H-quinazolin-4-one;

2- (6-aminopurin-9-ylmethyl) -3- (2-chlorophenyl) -7-fluoro-3H-quinazolin-4-one; Y

2- (6-aminopurin-9-ylmethyl) -5-chloro-3-o-tolyl-3H-quinazolin-4-one.

       \ vskip1.000000 \ baselineskip
    

The term "prodrug" used herein refers to compounds that are rapidly transformed in vivo into a compound with the structural formula (I) mentioned, for example, by hydrolysis. The design of the prodrug is discussed in general terms in Hardma et al . (Eds.), Goodman and Gilman's The Pharmacological Basis of Therapeutics, 9th ed., Pp. 11-16 (1996). An in-depth debate is collected in Higuchi et al ., Prodrugs as Novel Delivery Systems, Vol. 14, ASCD Symposium Series, and in Roche (ed.), Bioreversible Carriers in Drug Design, American Pharmaceutical Association and Pergamon Press (1987). Briefly explained, the administration of a drug is followed by the elimination of the organism or some biotransformation whereby the biological activity of the drug is reduced or canceled. Alternatively, a biotransformation process can cause a metabolic byproduct, which is more active or equally active compared to the drug initially administered. A deeper knowledge of these biotransformation processes allows the design of the so-called "prodrugs" which, after a biotransformation, become physiologically more active in their altered state. Therefore, prodrugs comprise pharmacologically inactive compounds that become biologically active metabolites.

By way of illustration, prodrugs can be convert into a pharmacologically active form by means of hydrolysis of, for example, an ester or amide bond, introducing in this way or by exposing a functional group to the resulting product. Prodrugs can be designed to react with a endogenous compound in order to form a water soluble conjugate that improves the pharmacological properties of the compound, by example, increasing the circulatory half-life. Alternatively, prodrugs can be designed to undergo a modification covalent in a functional group with, for example, glucuronic acid, sulfate, glutathione, amino acids or acetate. The resulting conjugate can be inactivated and excreted in the urine or endowed with greater potency than the matrix compound. Conjugates with a high weight Molecular can also be excreted in the bile, subject to enzymatic cleavage, and be returned to the circulation, increasing thus effectively the biological shelf life of the compound originally administered

       \ vskip1.000000 \ baselineskip
    

Methods to identify negative regulators of PI3K \ delta activity

PIK? Protein, as well as fragments thereof that have biological activity, can be used to investigate alleged negative regulatory compounds with any of The various drug research techniques. A regulator Negative PI3K? is a compound that reduces or eliminates ability of PI3K \ delta to perform any of its biological functions An example of this compound is an agent that reduces the ability of a PI3K? polypeptide to phosphorylate phosphatidylinositol or target the appropriate structures of a cell. The selectivity of a compound that negatively regulates the PI3K? activity can be evaluated by comparing its activity on PIK? with its activity on other proteins. The selective negative regulators include, for example, antibodies and other proteins or peptides that specifically bind to a PI3K? polypeptide, oligonucleotides that bind specifically to PI3K? polypeptides, and other compounds not peptides (as synthetic or isolated organic molecules) that they interact specifically with PI3K? polypeptides. The negative regulators also include compounds previously described, but that interact with another binding compound specific for PIK? polypeptides.

Currently, preferable goals for the development of selective negative regulators of PI3K? include, for example:

(1) the cytoplasmic regions of the PI3K? polypeptides that contact other proteins and / or locate PI3K? within a cell;

(2) polypeptide regions PI3K? Which bind to other binding compounds specific;

(3) polypeptide regions PI3K? That bind to the substrate;

(4) the allosteric regulatory sites of PI3K? polypeptides that can interact directly or not with the active place after the regulatory signal;

(5) polypeptide regions PI3K? That mediate multimerization.

       \ vskip1.000000 \ baselineskip
    

For example, an objective for the development of modulators is the identified regulatory interaction of p85 with p110?, which may be involved in activation and / or subcellular location of the p110? fraction. But nevertheless, other selective modulators include those that recognize the specific regulator or nucleotide sequences encoding PI3K \ delta. PIK? Activity modulators can be therapeutically useful in the treatment of a wide range of diseases and physiological conditions that involve an activity of PI3K \ aberrant delta.

Accordingly, the invention provides methods to characterize the potency of a test compound as a PI3K? polypeptide inhibitor, said comprising method the steps of (a) measuring the activity of a polypeptide PI3K? In the presence of a test compound; (b) comparison of the activity of the PI3K? polypeptide in the presence of test compound with the activity of the polypeptide PI3K? in presence of an equivalent amount of a reference compound (for example, a PI3K? inhibitor compound of the invention described herein), where a lower activity of the PI3K? polypeptide in the presence of the test compound that in presence of the reference compound indicates that the compound of test is a more potent inhibitor than the reference compound and superior activity of the PI3K? polypeptide in the presence of test compound that in the presence of the reference compound indicates that the test compound is a less potent inhibitor than the reference compound.

The invention also provides methods for characterizing the potency of a test compound as an inhibitor of the PI3K? Polypeptide, which comprises the steps of (a) determining an amount of a control compound (eg, a PI3K inhibitor compound \ delta of the invention described herein): which inhibits an activity of a PI3K? polypeptide in a percentage inhibition reference, thus defining a reference inhibitory amount for the control compound; (b) determining an amount of a test compound that inhibits an activity of a PI3K? polypeptide at a percentage inhibition reference, thereby defining a reference inhibitory amount for the test compound; (c) comparison of the reference inhibitory amount for the test compound with the reference inhibitory amount for the control compound, where a lower reference inhibitory amount for the test compound than for the control compound indicates that the compound of The test is a more potent inhibitor than the control compound and a higher reference inhibitory amount for the test compound than for the control compound indicates that the test compound is a less potent inhibitor than the control compound. In one aspect, the method uses a reference inhibitory amount, which is the amount of the compound that inhibits the activity of the PI3K? Polypeptide by 50%, 60%, 70%, or 80%. In another aspect, the method uses a reference inhibitory amount, which is the amount of the compound that inhibits the activity of the PI3K? Polypeptide by 90%, 95%, or 99%. These methods comprise the determination of the reference inhibitory amount of the compounds in an in vitro biochemical assay , in an in vitro cell assay , or in an in vivo assay.

The invention also provides methods for identify a negative regulator of PI3K? activity, comprising the steps of (i) measuring the activity of a PI3K? polypeptide in the presence and absence of a compound of proof, and (ii) identification as a negative regulator of a test compound that reduces the activity of PI3K? and that competes with a compound of the invention to bind PI3K?. On the other hand, the invention provides methods for identifying compounds that inhibit the activity of PI3K?, which comprise the steps of (i) contacting a PI3K? polypeptide with a compound of the invention in the presence and absence of a test compound, and (ii) identification of a test compound as a negative regulator of the activity of PI3K? where the compound competes with a compound of the invention to bind to PI3K \ delta. Therefore, the invention provides a method for investigate negative regulators candidates for the activity of PI3K? And / or confirm their mode of action. These methods can be used with other PI3K isoforms in parallel, to establish the comparative activity of the test compound with the isoforms and / or with respect to a compound of the invention.

In these methods, the PI3K? Polypeptide it can be a fragment of p110? that records activity kinase, that is a fragment comprising the catalytic site of p110 δ. Alternatively, the PI3K? Polypeptide can be a fragment of the p110? binding domain of p85 and provides a method to identify allosteric modulators of PI3K \ delta. The methods can be used in cells that express PI3K? Or its subunits, endogenously or exogenously. By consequently, the polypeptide used in these methods may be free in solution, fixed to a solid support, modified to deploy on the surface of a cell or located intracellularly In this way, the modulation of the activity or formation of binding complexes between the polypeptide PI3K? And the agent to be tested.

Human PI3K polypeptides are suitable for high performance screening (HTS) assays performed with cells or biochemicals according to the methods known and practiced in the field, including test systems with melanophores for investigate receptor-ligand interactions, yeast assay systems and cell expression systems of mammals For a review, see Jayawickreme and Kost, Curr Opin Biotechnol, 8: 629-34 (1997). HTS trials Miniaturized and automated are also included as described, for example, in Houston and Banks, Curr Opin Biotechnol, 8: 734-40 (1997).

These HTS assays are used to analyze compound banks, in order to identify certain compounds that have a desired property. It can be used any compound bank, including chemical banks, banks of natural products, and combination banks comprising oligopeptides, oligonucleotides or other organic compounds random or designed.

Chemical banks may contain compounds known analogues with a patented structure of compounds known or identified compounds from studies with products natural

Natural product banks are collections of materials isolated from natural sources, typically microorganisms, animals, plants or marine organisms. Natural products are isolated from their sources by fermentation of microorganisms, followed by isolation and extraction of fermentation broths or by direct extraction of the microorganisms themselves or tissues (plants or animals). Natural product banks include polypeptides, non-ribosomal peptides and variants (including variants not present in nature) thereof. For a review, see Cane et al ., Science, 282: 63-68 (1998).

Combination banks are made up of large amounts of related compounds, such as peptides, oligonucleotides or other organic compounds in the form of a mixture. These compounds are relatively easy to design and prepare. using traditional automated synthesis protocols, PCR, cloned or patented synthetic methods. Combination banks of peptides and oligonucleotides are particularly interesting.

However, other interest banks include peptides, proteins, peptidomimetics, synthetic collections multiparallel, recombinant and polypeptides. For a review of combinatorial banks and chemicals thus created, see Myers, Curr Opin Biotechnol, 8: 701-07 (1997).

Once compounds have been identified that demonstrate an activity as negative regulators of the function of PI3K \ delta, an optimization program can be performed in a effort to improve the potency and selectivity of the activity. This analysis of structure-activity relationships (SAR) normally involves an iterative series of modifications selective structures of the compounds and their correlation with Biochemical or biological activity. Families of related compounds that record all the desired activity, with certain family members, specifically those who own some appropriate pharmacological profiles, potentially suitable as therapeutic candidates

       \ vskip1.000000 \ baselineskip
    

Therapeutic uses of activity inhibitors PI3K \ delta

A method to inhibit is disclosed herein. selectively or specifically the activity of PI3K? Therapeutically or prophylactically. The method comprises the administration of a selective or specific inhibitor of the PI3K? activity in an effective amount thereof. This method can be used in the treatment of humans or animals that have or may present any condition whose symptoms or pathology are associated with the activity or expression of PI3K \ delta.

In this document, "treatment" is refers to the prevention of the development of a disorder in an animal that may present a predisposition to that disorder, but to which He has not yet been diagnosed; disorder inhibition, is say the arrest of its development; relief of the disorder is say causing its regression; or the improvement of the disorder, that is reducing the severity of symptoms associated with it. Be understands that "disorder" encompasses medical disorders, diseases, conditions, syndromes and the like, without limitation.

The methods of the invention encompass various modes of treatment of an animal, preferably a mammal, more preferably a primate and ideally a human. Between the mammalian animals that can be treated are found, for example, pets (pets), including dogs and cats; animals farm, including cattle, horses, sheep, pigs and goats; laboratory animals, including rats, mice, rabbits and guinea pigs, and nonhuman primates and specimens of the zoo. Animals not mammals include, for example, birds, fish, reptiles and amphibians

In one aspect, the method can be used to treat subjects therapeutically or prophylactically who suffer or may suffer from an inflammatory disorder An aspect of the present invention is derived from the involvement of PI3K? in the mediating aspects of the inflammatory process. No intention of be linked to any theory, it is theorized that, since inflammation it involves processes typically mediated by leukocytes (by example, neutrophils, lymphocytes, etc.), activation and chemotactic transmigration, and since the PI3K? can mediating these phenomena, the antagonists of PI3K? they can use to contain the lesions associated with the inflammation.

In this document, "disorder inflammatory "can refer to any disease, disorder or syndrome in which an excessive inflammatory response or not regulated cause excessive inflammatory symptoms, damage to the host tissue, or loss of tissue function. "Disorder inflammatory "also refers to a mediated pathological state by the influence of leukocytes and / or neutrophil chemotaxis.

In this document, "inflammation" is refers to a localized protection response caused by injuries or tissue destruction, which serves to destroy, dilute or isolate both the damaging agent and the tissue injured. Inflammation is particularly associated with the leukocyte influx and / or neutrophil chemotaxis. The inflammation may result from infection by pathogenic organisms and viruses and non-infectious media, such as trauma or reperfusion, after an accident or myocardial infarction, in response Immune to a foreign antigen and autoimmune responses. Consequently, inflammatory disorders suitable for invention encompass disorders associated with system reactions of specific defense as well as with reactions of the defense system not specific.

       \ newpage
    

In this document, the term "system specific defense "refers to the system component immunological that reacts to the presence of antigens specific. Among the examples of inflammation resulting from a response of the specific defense system the answer is included classical to foreign antigens, autoimmune diseases and the delayed type hypersensitivity response mediated by T cells. Chronic inflammatory diseases, rejection of solid transplanted organs and tissues, such as transplants bone marrow and kidney, and graft versus host disease (GVHD) are other examples of inflammatory system reactions of specific defense.

In this document, the term "system non-specific defense "refers to inflammatory disorders leukocyte-mediated without immune memory (such as granulocytes and macrophages). Among the examples of the resulting inflammation, at less in part, of a non-specific defense system reaction inflammation associated with conditions such as the syndrome is included of adult (acute) respiratory distress (ARDS) or syndrome of multiple organic dysfunction; reperfusion lesions, acute glomerulonephritis, reactive arthritis, dermatosis with acute inflammatory components, acute purulent meningitis or others inflammatory disorders of the central nervous system, such as stroke, thermal injuries, diseases inflammatory bowel syndromes associated with transfusion of granulocyte and cytokine-induced toxicity.

In this document "disease autoimmune "refers to any group of disorders in which tissue injury is associated with humoral or mediated responses by cells to the body's own components. In the present document "allergic disease" refers to any symptoms, tissue damage or loss of tissue function resulting from allergy. In this document "arthritic disease" refers to any disease characterized by inflammatory lesions of the joints attributable to various etiologies. In the present Document "dermatitis" refers to any of a broad family of skin diseases characterized by inflammation of the skin attributable to various etiologies. In the present document "transplant rejection" refers to any Immune reaction directed against grafted tissue, such as organs or cells (for example, bone marrow) characterized by loss of function of the grafted tissue and surrounding tissues, pain, swelling, leukocytosis and thrombocytopenia.

Therapeutic methods include methods for the treatment of disorders associated with cell activation inflammatory "Activation of inflammatory cells" refers to the induction of a stimulus (including, merely by way of enunciative, cytokines, antigens or autoantibodies) of a proliferative cell response, mediator production soluble (including, by way of example, cytokines, oxygen radicals, enzymes, prostanoids or vasoactive amines), or cell surface expression of new mediators or in increased amounts (including, but not limited to, the main histocompatibility antigens or molecules of cell adhesion) in inflammatory cells (including, by way of merely enunciative, monocytes, macrophages, T lymphocytes, B lymphocytes, granulocytes - that is, polymorphonuclear leukocytes, like neutrophils, basophils and eosinophils-, mast cells, cells dendritic, Langerhans cells and endothelial cells). The understood in the field will appreciate that the activation of one of these phenotypes or a combination of them in these cells can contribute to the initiation, perpetuation or worsening of a inflammatory disorder

It has been discovered that the compounds of the invention inhibit the release of superoxide by the neutrophils The superoxide is released by neutrophils in response to various stimuli, including signs of infection, as a cell removal mechanism. By For example, it is known that superoxide release is induced by tumor necrosis factor alpha (TNFα), which is released by macrophages, mast cells and lymphocytes after contact with bacterial components of the cell wall, such as liposaccharides (LPS) TNFα is an extraordinarily potent activator and promiscuous inflammatory processes, participating in the activation of neutrophils and several other types of cells, the induction of leukocyte adhesion / endothelial cell, pyrexia, increased production of MHC class I and stimulation of angiogenesis Alternatively, superoxide release can be stimulated by formyl-methionyl-leucine-phenylalanine (fMLP) or other peptides blocked at the N-terminal by formyl methionine. Usually these peptides are not found in eukaryotes, but are fundamentally characteristic of bacteria and indicate the presence of bacteria in the system immunological Leukocytes expressing the fMLP receptor, such as neutrophils and macrophages are stimulated to migrate to gradients of these peptides (i.e. chemotaxis) towards the site of the infection As demonstrated here, the compounds of the invention inhibit the release of superoxide stimulated by Neutrophils in response to TNF? or fMLP. It has also shown that other functions of neutrophils, including the stimulation of exocytosis and targeted chemotactic migration, they are inhibited by the PI3K? inhibitors of the invention. By consequently, the compounds of the invention can be expected to be useful for treating disorders such as inflammatory disorders mediated by any of these neutrophil functions or by All of them.

The present invention provides methods for treat disorders such as arthritic diseases, such as arthritis rheumatoid, monoarticular arthritis, osteoarthritis, arthritis gouty, spondylitis, Behcet's disease, sepsis, septic shock, endotoxic shock, gram-negative sepsis, sepsis for gram-positive and toxic shock syndrome; multiple organ dysfunction syndrome secondary to a septicemia, trauma or hemorrhage; ophthalmic disorders, such as allergic conjunctivitis, vernal conjunctivitis, uveitis and ophthalmopathy associated with the thyroid; eosinophilic granuloma; disorders respiratory or pulmonary, such as asthma, chronic bronchitis, rhinitis allergic ARJD3, chronic inflammatory lung disease (such as chronic obstructive pulmonary disease), silicosis, sarcoidosis pulmonary, pleurisy, alveolitis, vasculitis, emphysema, pneumonia, bronchiectasis and oxygen toxicity of the lung; injury of reperfusion of myocardium, brain or limbs; fibrosis like cystic fibrosis; keloid formation or tissue formation of scar; atherosclerous; autoimmune diseases, such as lupus systemic erythematosus (SLE), autoimmune thyroiditis, sclerosis multiple, some forms of diabetes and Reynaud's syndrome; transplant rejection disorders, such as GVHD and rejection of allografts; chronic glomerulonephritis; inflammatory diseases of the intestine, such as chronic inflammatory bowel disease (CIBD), Crohn's disease, ulcerative colitis and enterocolitis necrotizing; inflammatory dermatoses such as dermatitis contact, atopic dermatitis, psoriasis or hives; fever and myalgias due to an infection; inflammatory disorders of central or peripheral nervous system, such as meningitis, encephalitis, and brain or spinal cord injuries due to trauma mild Sjogren's syndrome; diseases that involve a diapedesis leukocyte; alcoholic hepatitis; bacterial pneumonia; complex-mediated diseases antigen-antibody; hypovolemic shock; diabetes type I mellitus; acute and delayed hypersensitivity; diseases caused leukocyte dyscrasis and metastasis; injury thermal; syndromes associated with granulocyte transfusion and cytokine induced toxicity.

The method can be useful for trying subjects who suffer or may suffer reperfusion injuries, is say injuries resulting from situations in which a tissue or organ experiences a period of ischemia followed by reperfusion. He term "ischemia" refers to a localized anemia of a tissue due to obstruction of incoming blood flow arterial. A temporary ischemia followed by reperfusion causes characteristically an activation of the neutrophil and the transmigration through the endothelium of blood vessels in the area affected. The accumulation of activated neutrophils, in turn, causes the generation of reactive oxygen metabolites, which damage the components of the affected tissue or organ. This phenomenon of "injury by reperfusion "is normally associated with states such as vascular accident (including focal and global ischemia), shock hemorrhagic, myocardial infarction or ischemia, organ transplantation and cerebral vasospasm. By way of illustration, the injury due to reperfusion occurs at the conclusion of the procedures of coronary bypass or during a heart failure when the heart, After having stopped receiving blood, it begins to reperfuse. It is expected that inhibition of PI3K? Activity will result in a decrease of reperfusion injuries in these situations.

With respect to the nervous system, ischemia global occurs when the blood flow of the entire brain is interrupts for a period. Global ischemia can be consequence of a heart failure. Focal ischemia occurs when a part of the brain is deprived of its supply of normal blood Focal ischemia may result from occlusion. thromboembolic of a cerebral vessel, a traumatic brain injury, an edema or a brain tumor. Even when it's temporary, the Focal and global ischemia can cause significant neuronal damage. Although nerve tissue damage occurs during hours or even days later, the onset of ischemia, some Permanent tissue and nerve damage can develop in the first minutes after the interruption of the blood flow of the brain.

Ischemia can also occur in the heart in myocardial infarction and other cardiovascular disorders in those that the coronary arteries become clogged as a result of a atherosclerosis, a thrombus or spasm. Therefore, it is believed that the invention will be useful for the treatment of damage to the heart tissue, particularly the damage resulting from the cardiac ischemia or caused by reperfusion lesions in mammals

In another aspect, selective inhibitors of PIK? Activity, such as the compounds of the invention, can be used in methods for the treatment of bone diseases, especially diseases in which osteoclast function is abnormal or undesirable. As shown in Example 6, below, the compounds of the invention inhibit osteoclast function in vitro . Therefore, the use of these compounds and other selective PI3Kδ inhibitors may be useful for the treatment of osteoporosis, Paget's disease and other related bone resorption disorders.

In another aspect, the invention includes methods to use PI3K? inhibitor compounds to inhibit the growth or proliferation of cancer cells of origin hematopoietic, preferably cancer cells of origin lymphoid and more preferably related cancer cells or derived from B lymphocytes or B lymphocyte progenitors. Types of cancer suitable for treatment using the method of invention include, by way of example only, lymphomas, such as malignant neoplasms of lymphoid and reticuloendothelial tissues, like Burkitt lymphoma, Hodgkins lymphoma, non-Hodgkins lymphomas, lymphocytic lymphomas and the like; multiple myelomas; as well as leukemia, such as lymphocytic leukemia, leukemia (myelogenous) chronic myeloids and the like. The inhibitor compounds of PI3K? Can be used to inhibit or control the growth or proliferation of leukemia (myelogenous) cells chronic myeloid

In another aspect, the invention includes a method to suppress a function of basophils and / or mast cells and, therefore Therefore, it allows the treatment of diseases or disorders characterized by excessive or undesirable activity of basophils and / or mast cells. According to the method, you can use a compound that selectively inhibits expression or phosphatidylinositol 3-kinase delta activity (PI3K?) In basophils and / or mast cells. Preferably, the method employs a PI3K? inhibitor in an amount enough to inhibit histamine release stimulated by part of basophils and / or mast cells. Therefore, the use of these compounds and other selective inhibitors of PI3K? they can be useful for the treatment of diseases characterized by histamine release, such as disorders allergic, including disorders such as lung disease chronic obstructive (COPD), asthma, ARDS, emphysema and disorders related.

       \ vskip1.000000 \ baselineskip
    

Pharmaceutical composition of activity inhibitors PI3K \ delta

A compound of the present invention can be administer as a pure chemical, although it is usually it is preferable to administer the compound in the form of a formulation or pharmaceutical composition Accordingly, the present invention also provides pharmaceutical compositions comprising a chemical or biological compound ("agent") that is active as PI3K? activity modulator and a vehicle, adjuvant or biocompatible pharmaceutical carrier. The composition may include the agent as the only active fraction or in combination with others agents, such as oligo or polynucleotides, oligo or polypeptides, drugs or hormones mixed with an excipient or excipients or other pharmaceutically acceptable carriers. The bearers and other ingredients can be considered pharmaceutically acceptable to the extent that they are compatible with other ingredients of the formulation and are not harmful to the recipient of same.

Formulation techniques can be found and administration of pharmaceutical compositions at Remington's Pharmaceutical Sciences, 18th Ed., Mack Publishing Co, Easton, PA, 1990. The pharmaceutical compositions of the present invention are they can manufacture using any conventional method, such as mixing, dissolving, granulating, making dragees, levigation, emulsification, encapsulation, entrapment, rapid solidification, spray drying or freeze drying processes. However, the Optimum pharmaceutical formulation will be determined by a professional in the field depending on the route of administration and the dose desired.

These formulations can influence the physical state, stability, in vivo release rate and in vivo removal rate of the administered agent. Depending on the condition to be treated, these pharmaceutical compositions can be formulated and administered systemically or locally.

The pharmaceutical compositions are formulated from form containing pharmaceutically acceptable carriers and may optionally contain excipients and auxiliaries that facilitate the processing of the active compounds in the preparations that They can be used for pharmaceutical purposes. Usually the Administration modality will determine the nature of the bearer. For example, formulations for parenteral administration may understand aqueous solutions of the active compounds in form soluble in water. Suitable carriers for administration parenteral can be selected from saline solutions, buffered saline solutions, dextrose, water and other solutions Physiologically compatible. The preferable carriers for parenteral administration are physiologically compatible buffers, such as Hank's solution, Ringer's solution or a solution saline physiological buffer. For cellular or tissue administration, appropriate penetrants are used for the particular barrier in the formulation These penetrants are generally known in field. For preparations comprising proteins, the formulation may include stabilizing materials, such as polyols (for example, sucrose) and / or surfactants (for example, nonionic surfactants) and the like.

Alternatively, formulations for use parenteral may comprise dispersions or suspensions of the active compounds made in the form of injection suspensions oilseeds Appropriate lipophilic vehicles or solvents include fatty oils, such as sesame oil and acid esters synthetic fatty, such as ethyl oleate or triglycerides, or liposomes Aqueous injection suspensions may contain substances that increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol or dextran. Optionally, the suspension may also contain agents or stabilizers appropriate that increase the solubility of the compounds, for allow the preparation of highly concentrated solutions. Aqueous polymers can also be used that provide a pH sensitive solubilization and / or sustained release of active agent such as coatings or matrix structures, for example, methacrylic polymers, such as the EUDRAGIT® series available from Röhm America Inc. (Piscataway, NJ). Can also be used emulsions, for example oil dispersions in water and water in oil, optionally stabilized with a dispersant or agent emulsifier (surface active materials; surfactants). The suspensions may contain suspending agents such as alcohols of ethosoxylated isostearyl, polyoxyethylene sorbitol and esters of sorbitan, microcrystalline cellulose, bentonite / metahydroxide aluminum, agar-agar, gum tragacanth and mixtures of the same.

You can also use liposomes that contain the active agent for parenteral administration. For the In general, liposomes are derived from phospholipids or other substances lipids Liposome-shaped compositions can also contain other ingredients, such as stabilizers, preservatives, excipients and the like. Preferable lipids include phospholipids and phosphatididyl hills (lecithins), both natural as synthetic The methods to form liposomes are known in field. See, for example, Prescott (Ed.), Methods in Cell Biology, Vol. XIV, p. 33, Academic Press, New York (1976).

Pharmaceutical compositions comprising the agent in appropriate doses for oral administration can be formulated using pharmaceutically acceptable carriers known in the art. Preparations formulated for oral administration may be in the form of tablets, pills, capsules, tablets, dragees, lozenges, liquids, gels, syrups, pastes, elixirs, suspensions or powders. By way of illustration, pharmaceutical preparations for oral use can be obtained by combining the active compounds with a solid excipient, optionally grinding the resulting mixture and processing the granule mixture, after adding suitable excipients if necessary, to obtain tablets or dragees Oral formulations may employ liquid carriers of a similar type to those described for parenteral use, such as aqueous buffer solutions, suspensions and
Similar.

Preferable oral formulations include gelatin tablets, dragees and capsules. These preparations can contain one or more excipients, including, by way of merely enunciative:

a) diluents, such as sugars, including lactose, dextrose, sucrose, mannitol or sorbitol;

b) binders, such as aluminum silicate of magnesium, corn starch, wheat, rice, potato, etc .;

c) cellulose materials, such as methylcellulose, hydroxypropylmethyl cellulose and sodium carboxymethyl cellulose, polyvinylpyrrolidone, gums, such as gum arabic and gum tragacanth, and proteins, such as gelatin and collagen;

d) disintegration or solubilization agents, such as polyvinyl pyrrolidone, starches, agar, alginic acid or a salt thereof, such as sodium alginate or compositions effervescent;

e) lubricants, such as silica, talc, acid stearic or its magnesium or calcium salt, and glycol polyethylene;

f) flavorings and sweeteners;

g) dyes or pigments, for example for identify the product or characterize the quantity (dose) of the active compound; Y

h) other ingredients, such as preservatives, stabilizers, slowing agents, emulsifiers, promoters of the solution, salts for the regulation of osmotic pressure and tampons

       \ vskip1.000000 \ baselineskip
    

Gelatin capsules include hard capsules made of gelatin, and soft capsules, which are sealed capsules, made of gelatin and with a coating like glycerol or sorbitol. Hard capsules may contain the ingredient or ingredients assets mixed with fillers, binders, lubricants and / or stabilizers, etc. In soft capsules, the components assets can be dissolved or suspended in appropriate liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycol, with or without stabilizers.

Dragees can be supplied coatings, such as concentrated sugar solutions, which also may contain gum arabic, talc, polyvinyl pyrrolidone, gel of carbopol, polyethylene glycol and / or titanium dioxide, lacquer solutions, and appropriate organic solvents or mixtures solvents

The pharmaceutical composition can be provide as a salt of the active agent. Salts tend to be more soluble in aqueous solvents or other protonic solvents than the corresponding forms in base or free acid. Salts Pharmaceutically acceptable are well known in the field. The compounds containing acidic fractions can form salts Pharmaceutically acceptable with the appropriate cations. The Appropriate pharmaceutically acceptable cations include, by eg, alkali metal (for example, sodium or potassium) and cations alkaline earth metals (such as calcium or magnesium).

Compounds of structural formula (I) containing basic fractions can form pharmaceutically acceptable acid addition salts with the appropriate acids. For example, Berge et al . describe pharmaceutically acceptable salts in detail in J Pharm Sci, 66: 1 (1977). The salts can be prepared in situ during final isolation and purification of the components of the invention or separately, by reacting a free base function with an appropriate acid.

Representative acid addition salts include, by way of example, acetate, adipate, alginate, citrate, aspartate, benzoate, benzenesulfonate, bisulfate, butyrate, canforate, camphor sulphonate, digluconate, glycerophosphate, hemisulfate, heptanoate, hexanoate, fumarate, hydrochloride, hydrobromide, hydroiodide, 2-hydroxyethane sulfonate (isothionate), lactate, maleate, methane sulphonate or sulfate, nicotinate, 2-naphthalene sulfonate, oxalate, pamoate, pectinate, persulfate, 3-phenylpropionate, picrate, pivalate, propionate, succinate, tartrate, thiocyanate, phosphate or hydrogen phosphate, glutamate, bicarbonate, p-toluenesulfonate, and undecanoate.

Examples of acids that can be used to form pharmaceutically acceptable acid addition salts include, by way of example only, inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid and phosphoric acid, and organic acids such as oxalic acid, maleic acid, acid. succinic and acidic
citric.

In view of the above, any reference to The compounds of the present invention herein will include the compounds of the structural formula (I) - (V), as well as solvates and pharmaceutically acceptable salts, and prodrugs, of the same.

The basic addition salts may be prepared in situ during final isolation and purification of the compounds of the invention or separately by reacting a fraction containing carboxylic acid with an appropriate base such as hydroxide, carbonate or bicarbonate of a metal cation. pharmaceutically acceptable or with ammonium or a primary, secondary or tertiary organic amine. Pharmaceutically acceptable basic addition salts include, by way of example only, cations based on alkali metals or alkaline earth metals, such as lithium, sodium, potassium, calcium, magnesium and aluminum salts and the like, and nontoxic ammonium quaternium and amine cations, including ammonium, tetramethylammonium, tetraethylammonium, ethylammonium, dimethylammonium, trimethylammonium, ethylammonium, diethylammonium, triethylammonium and the like. Other representative organic amines useful for the formation of basic addition salts include ethylenediamine, ethanolamine, diethanolamine, piperidine, piperazine and the like.

Groups containing basic nitrogen can be quaternized with agents such as lower alkyl halides, such such as methyl, ethyl, propyl and butyl chlorides, bromides and iodides; dialkyl sulfates, such as dimethyl, diethyl, dibutyl and dialkyl sulfates; long chain alkyl halide, such as decyl, lauryl, myristyl and stearyl chlorides, bromides and iodine aryl-alkyl halides, such as benzyl and phenethyl bromides, and others. In this way products are obtained with a modified dispersibility or solubility.

Compositions comprising a compound of the invention formulated in a carrier pharmaceutically acceptable, put them in a container appropriate and label them for the treatment of a certain state. Consequently, an article of manufacturing, as a container comprising a dose of a compound of the invention and a label containing instructions of use of the compound. The kits are also contemplated in the invention. For example, the kit may comprise a dose of one pharmaceutical composition and a text inserted in the package with the instructions for use of the compound for the treatment of a condition doctor. In any case, the states indicated on the label may include the treatment of inflammatory disorders, cancer, etc.

       \ vskip1.000000 \ baselineskip
    

Methods of administration of activity inhibitors PI3K \ delta

The pharmaceutical compositions comprising an inhibitor of PI3K? activity can be administered to the subject by any conventional method, including techniques Enteral and parenteral. The modalities of administration parenteral include those in which the composition is administered by a different route to the gastrointestinal tract, for example, intravenously, intraarterially, intraperitoneally, intramedullaryly, intramuscular, intraarticular, intrathecal and injections intraventricular The modalities of enteral administration include, for example, oral administration (including oral and sublingual) and rectal. The modalities of administration transepithelial include, for example, transmucosal administration and transdermal administration Transmucosal administration includes, for example, enteral administration, as well as nasal, inhalation and pulmonary; vaginal and rectal administration. The administration transdermal includes transcutaneous or transdermal modalities active or passive, including, for example, patches and devices of iontophoresis, as well as topical application of pastes, ointments or ointments Parenteral administration can also be performed. with a high pressure technique, for example POWDERJECT®.

Surgical techniques include the implementation of reserve compositions (deposit), pumps Osmotic and similar. A preferable route of administration for The treatment of inflammation may be local administration or topical for localized disorders, such as arthritis, or systemic administration for disseminated disorders, such as intravenous administration for reperfusion injury or for systemic states such as septicemia. For other diseases, including those that affect the respiratory tract, such as chronic obstructive pulmonary disease, asthma and emphysema, the Administration can be performed by inhalation or administration pulmonary atomizers, aerosols, powders and the like.

For the treatment of neoplastic diseases, especially leukemia and other disseminated cancers, it is usually parenteral administration is preferable. The recommended compound formulations to optimize them for biodistribution after parenteral administration. The compounds PI3K? inhibitors can be administered before, during or after administration of chemotherapy, radiotherapy and / or surgery.

On the other hand, the therapeutic index of PI3K? Inhibitor compounds can be improved, by modifying or derivatizing the compounds for the intended administration for cancer cells that express a marker that identifies the cells as such. For example, the compounds can be bound to an antibody that recognizes a marker that is selective or specific for cancer cells, so that the compounds are carried alongside the cells to exert their effects locally, as described above (see above) (see , for example, Pietersz et al ., Immunol Rev, 129: 57 (1992); Trail et al ., Science, 261: 212 (1993); and Rowlinson-Busza et al ., Curr Opin Oncol, 4: 1142 (1992 )). Objective administration to the tumor of these compounds improves the therapeutic benefit, among other things, by minimizing the possible non-specific toxicities that may result from radiation or chemotherapy treatment. In another aspect, the PI3K? Inhibitor compounds and radioisotopes or chemotherapeutic agents can be conjugated with the same antibody against the tumor.

For the treatment of bone resorption disorders or osteoclast-mediated disorders, PI3K? Inhibitors can be administered by any appropriate method. Focal administration may be recommended, such as intra-articular injection. In some cases, it may be advisable to bind the compounds to a fraction that can direct the compounds to the bone. For example, a PI3K? Inhibitor can bind compounds with a high affinity for hydroxyapatite, which is a major component of bone. This can be done, for example, by adapting a tetracycline binding method developed for selective administration of estrogen to bone (Orme et al ., Bioorg Med Chem Lett, 4 (11): 1375-80 (1994)).

       \ newpage
    

To be therapeutically effective in the modulation of the objectives of the central nervous system, the agents used in the methods of the invention should penetrate quickly in the blood brain barrier when administered peripherally However, compounds that cannot penetrate in the blood brain barrier they can also be effective if administered intravenously.

As noted, the characteristics of the agent itself and the formation of the agent can influence the physical state, stability, in vivo release rate and in vivo removal rate of the administered agent. This pharmacokinetic and pharmacological information can be collected through in vitro and in vivo preclinical studies, subsequently confirmed in humans during the course of clinical trials. Thus, for any compound used in the method of the invention, a therapeutically effective dose can be calculated initially with biochemical tests or performed with cells. Next, the dose can be formulated in animal models to achieve a desirable concentration range in the circulation that modulates the expression or activity of PI3K?. When studies are conducted with humans, more information will be obtained regarding the levels of the appropriate dose and the duration of treatment for various diseases and conditions.

The toxicity and therapeutic efficacy of these Compounds can be determined by pharmaceutical procedures standard in cell cultures or experimental animals, by example to determine the LD50 (the lethal dose for 50% of population) and ED 50 (the therapeutically effective dose in 50% of the population). The dose ratio between effects Toxic and therapeutic is the "therapeutic index", which is normally expressed as the ratio LD50 / ED50. The compounds that they have high therapeutic indexes, that is to say in which the Toxic dose is substantially higher than the effective dose, they are preferable The data obtained from these culture tests of cells and other animal studies can be used to Formulate a series of doses for human use. The dose of these compounds are preferably within the range of Circulation concentrations that include ED 50 with poor or no toxicity

For the methods of the invention, it can be use any effective administration regime that regulates Times and dose sequence. Agent doses include preferably pharmaceutical dose units comprising a effective amount of agent. In this document, "amount effective "refers to an amount sufficient to modulate the expression or activity of PI3K? and / or cause a change measurable in a physiological parameter of the subject through administration of one or more pharmaceutical dose units.

Exemplary dose levels for a subject human range from about 0.001 milligrams of the active agent per kilogram of body weight (mg / kg) up to about 100 mg / kg. Typically, the dose units of the active agent comprise from about 0.01 mg to about 10,000 mg, preferably from about 0.1 mg to about 1,000 mg, depending on the indication, via administration, etc. Depending on the route of administration, may calculate an appropriate dose according to body weight, the body surface or organ size. The dose regimen final will be determined by the responsible doctor, taking into account good medical practices, the various factors that modify the action of drugs, such as the specific activity of the agent, the identity and severity of the disease, the ability to patient response, age, condition, body weight, sex and the patient's diet, as well as the severity of any infection. Other factors that can be taken into account are time and frequency of administration, drug combinations, reaction sensitivities and tolerance / response to therapy. A more precise adjustment of the appropriate dose for treatment in which participates any of the formulations mentioned in the This is performed routinely by the specialized doctor without excessive experimentation, especially in view of the dose information and published trials, as well as Pharmacokinetic data observed in clinical trials with humans. Appropriate doses can be ascertained through the use of assays. established to determine the concentration of the agent in a body fluid or other sample along with the response data to the dose.

The frequency of the doses will depend on the Pharmacokinetic parameters of the agent and the route of administration. The dose and administration are adjusted to provide levels enough of the active fraction or to maintain the desired effect. Accordingly, pharmaceutical compositions can be administer in a single dose, multiple discrete doses, infusion continuous, sustained release, reserves or combinations thereof, as necessary to maintain the desired minimum level of agent. Short acting pharmaceutical compositions (i.e. with a reduced shelf life) can be administered once a day or more than once a day (for example, two, three or four times a day). The pharmaceutical compositions of prolonged update can be administered every 3 or 4 days, every week or every two weeks Pumps, such as subcutaneous, intraperitoneal pumps or subdural, may be preferable for continuous infusion.

The following examples are provided for help understand the invention and presuppose a knowledge of conventional methods well known to people with about normal knowledge in the field to which the examples, for example the construction of vectors and plasmids, the insertion of genetic coding polypeptides into these vectors and plasmids, or the introduction of vectors and plasmids into cells Guest.

These methods are described in detail in numerous publications, including, for example, Sambrook et al ., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press (1989), Ausubel et al . (Eds.), Current Protocols in Molecular Biology, John Wiley & Sons, Inc. (1994); and Ausubel et al . (Eds.), Short Protocols in Molecular Biology, 4th ed., John Wiley & Sons, Inc. (1999). The conditions and materials in particular described below are intended to exemplify certain aspects of the invention.

Example 1 Preparation and purification of Pl3K?,?, And? recombinant

Heterodimeric complexes were overexposed of recombinant PI3K compounds of a p110 catalytic subunit and a p85 regulatory subunit using the expression system of BAC-TO-BAC® H9 baculovirus (GIBCO / -BRL), and subsequently purified for use in trials biochemicals The four PI 3-class kinases were cloned into baculovirus vectors as follows:

p110?: A FLAG® labeled version of human p110? (SEQ ID NO: 1) (see Chantry et al ., J Biol Chem, 272: 19236-41 (1997)) was subcloned using standard recombinant DNA techniques at the BamHI-XbaI site of the pFastbac HTb insect cell expression vector (Life Technologies, Gaithersburg, MD), so that the clone was in the same reading frame as the His mark of the vector. The FLAG® system is described in U.S. Patent Nos. 4,703,004; 4,782,137; 4,851,341; and 5,011,912, and reagents are available from Eastman Kodak Co.

p110?: similar to the method used for p110?, described above, a FLAG® version of p110? (see Volinia et al ., Genomics, 24 (3): 427-477 (1994)) was subcloned into the BamHI-HindIII sites of pFastbac HTb (Life Technologies) so that the clone was in the same reading frame as the His mark of the vector.

p110?: A clone of p110? (see Hu et al ., Mol Cell Biol, 13: 7677-88 (1993)) was amplified from the human spleen cDNA bank MARATHON® Ready (Clontech, Palo Alto CA) according with the manufacturer's protocol using the following primers:

Primer 5' 5'-GATCGAATTCGGCGCCACCATGGACTACAAGGACGACGATGACAAGTGCTT  \ hskip0.3cm CAGTTTCATAATGCCTCC-3 ' (SEQ ID NO: 3) Primer 3' 5'-GATCGCGGCCGCTTAAGATCTGTAGTCTTTCCGAACTGTGTG-3 ' (I KNOW THAT ID NO: 4)

       \ vskip1.000000 \ baselineskip
    

The 5 'primer was created to contain a brand FLAG® in the same reading frame as the p110? Sequence. After amplification, the FLAG®-p110? Sequence was subcloned using standard recombinant techniques at sites EcoRI-NotI of pFastbac HTa (Life Technologies), of way that the clone was in the same reading frame as the brand His vector.

p110 γ: The p110 γ cDNA cDNA [see Stoyanov et al ., Science, 269: 690-93 (1995)) was amplified from a Marathon Ready human cDNA bank (Clontech according to the manufacturer's protocol, using the following primers:

Primer 5' 5'-AGAATGCGGCCGCATGGAGCTGGAGAACTATAAACAGCCC-3 ' (I KNOW THAT ID NO: 5) Primer 3' 5'-AGAATGCGGCCGCATGGAGCTGGAGAACTATAAACAGCCC-3 ' (I KNOW THAT ID NO: 6)

       \ vskip1.000000 \ baselineskip
    

Subsequently, a FLAG® brand was added to the 5 'end of the p110γ sequence and was cloned into the sites BamHI-SpeI of pFastbac HTb (Life Technologies) using standard recombinant DNA techniques, with the sequence FLAG®-110? In the same reading frame as the His mark of the vector.

p85α: A BamHI-EcoRI fragment of p85 cDNA labeled with FLAG® (see Skolnik et al ., Cell, 65: 83-89 (1991)) was subcloned into the BamHI-EcoRI sites of the dual pFastbac vector (Life Technologies ).

The recombinant baculoviruses that contain the Previous clones were generated using the protocol recommended by the manufacturer (Life Technologies). The baculoviruses that express the catalytic subunit marked with His p110α, p110?, or p110? and the p85 subunit were coinfected in Sf21 insect cells. To enrich the enzyme complex heterodimeric, an excessive amount of baculovirus that expressed the p85 subunit was infected and the subunit complex catalytic p110 labeled with His and p85 was purified on a column of nickel affinity. Since p110? Is not associated with p85, Sf21 cells were infected with recombinant baculovirus which express only p110? marked with His. In a Alternative approach, p101 can be cloned into baculovirus, to allow co-expression with its preferable joint element p110γ.

Sf21 cells 72 hours after infection (3 liters) were collected and homogenized in a buffer Hypotonic (20 mM HEPES-KOH, pH 7.8, 5 mM KCl, full protease inhibitor cocktail (Roche Biochemicals, Indianapolis, IN), using a Dounce homogenizer. The homogenates were centrifuged at 1,000 x g for 15 min. The supernatants were also centrifuged at 10,000 x g for 20 min, followed by ultracentrifugation at 100,000 x g for 60 min. The soluble fraction was immediately loaded in 10 ml of a HITRAP® nickel affinity column (Pharmacia, Piscataway, NJ) equilibrated with 50 mL of Buffer A (50 mM HEPES-KOH, pH 7.8, 0.5 M NaCl, 10 mM imidazole). The column was washed widely with Buffer A and eluted with a linear gradient of 10-500 mM imidazole. The free p85 subunit was removed from the column during the washing step and only the heterodimeric enzyme complex was eluted at 250 mM of imidazole Aliquots of nickel were analyzed by 10% SDS-propylacrylamide gel electrophoresis (SDS-PAGE), stained with SYPRO® Red (Molecular Probes, Inc., Eugene, OR), and quantified with STORM® PhosphoImager (Molecular Dynamics, Sunnyvale, CA). The active fractions were bound and loaded directly into a 5 mL heparin column Hi-trap pre-balanced with Buffer B containing 50 mM HEPES-KOH, pH 7.5, 50 mM NaCl, 2 mM dithiothreitol (DTT). The column was washed with 50 mL of Buffer B and eluted with a linear gradient of 0.05-2 M NaCl. A single peak containing the PI3K enzyme complex was eluted at 0.8 M NaCl. The gel analysis of SDS-polyacrylamide showed that the fractions of the Purified PI3K enzyme contained a 1: 1 stoichiometric complex of subunits p110 and p85.

The protein profile of the enzyme complex during heparin chromatography corresponded to that of the lipid kinase activity. The active fractions were gathered and frozen under liquid nitrogen.

       \ vskip1.000000 \ baselineskip
    

Example 2 High resolution analysis (HTS) of PI3K? And test of selectivity

A high resolution analysis of a patented chemical bank to identify possible inhibitors of PI3K? activity. PI3K? Delta catalyzes a γ - [32 P] ATP phototransfer to liposomes PIP2 / PS at the D3 'position of the inositol ring PIP_ {2}. This reaction is dependent on MgCl2 and is turned off. with a high molarity potassium phosphate buffer with a pH 8.0 containing 30 mM EDTA. In the analysis, this reaction is performed in presence or absence of bank compounds. The products of the reaction (and all unlabeled products) are transferred to a 96-well preheated PVDF filtration plate, filtered and washed with high molar potassium phosphate. It adds scintillant to dried wells and incorporated radioactivity It is quantified.

Most test operations are performed using a BIOMEK® 1000 robotic workstation (Beckman) and all plates were read using protocols Wallac liquid scintillation plate count.

The inventories of the 3X test of the substrate and the enzyme were made and stored in a bucket (for assays robotic) or a V-bottom 96 well propylene plate (for manual tests). The reagents were stable for at least Three hours at room temperature.

The 3X substrate for HTS contained 0.6 mM Na 2 ATP, 0.10 mCi / mL γ - [32 P] ATP (NEN, Pittsburgh, PA), 6 µM PIP2 / PS liposomes (Avanti Polar Lipids, Inc., Atlanta, GA), in 20 mM HEPES, pH 7.4.

The 3X enzyme inventory for HTS contained 1.8 nM PI3K δ, 150 µg / mL horse IgG (used only as stabilizer), 15 mM MgCl2, 3 mM DTT at 20 mM HEPES, pH 7.4.

Bank samples (each containing a group of 22 compounds) of the high resolution analysis (HTS) Chemical in dimethyl sulfoxide (DMSO) were diluted to 18.75 µM or 37.8 µM in double distilled water and 20 µL of the dilutions were placed in the 96-well polypropylene plate for the rehearsal The negative inhibitor control (or enzymatic control positive) was DMSO diluted in water and inhibitor controls positive employed concentrations of LY294002 sufficient to provide a 50% and 100% inhibition.

To the chemical bank dilutions grouped from 20 µL 20 µL of 3X substrate was added. The reaction is started with 20 µL of the 3X enzyme and incubated at temperature ambient for 10 minutes. This dilution established a final concentration of 200 µM ATP in the reaction volume. The reaction was stopped with a quench buffer of 150 µL (1.0 M potassium phosphate, pH 8.0, 30 mM EDTA). A part of the solution temperate (180 µL) was then transferred to a plate of PVDF filtering (Millipore #MAIP NOB pre-moistened with washes sequential 200 µL of 100% methanol, water, and finally a 1.0 M potassium phosphate wash buffer pH 8.0).

The PVDF filter plate was aspirated under a moderate vacuum (2-5 mm Hg), washed with 5 x 20C µL of wash buffer, and vacuum dried. The filter was subsequently dried, allowed to air dry completely and inserted into a Wallac counting box with 50 µL of a cocktail Ecoscint scintillation added per well. The built-in radioactivity and data were analyzed, after normalization with respect to the positive control of the enzyme (fixed 100%), to identify the intersection of the curve at the value of 50% inhibition to estimate IC 50 values for inhibitors

       \ newpage
    

A total of 57 wells joined were selected for deconvolution, based on criteria combined of <42% residual activity in the concentration tested and an accepted total success rate not exceeding 0.2%. TO 22 compounds per well, a total of 1254 compounds were identified through this deconvolution and tested individually at concentration IX of 27.7 µM for Identify which compounds had the desired activity. From these tests, 73 compounds were selected and tested for develop IC 50 curves. From the results of the curve of IC 50, 34 compounds were selected for the assays of selectivity against PI3K? and PI3K? (see protocol of the test in Example 11).

Of the selectivity tests, a compound, 3- (2-Chlorophenyl) -2- (9H-purin-S-ylsulfanylmethyl) -3H-quinazolin-4-one (Compound D-000), was selected as a relatively potent and selective compound. Searches in catalogs and selectivity tests of many analog compounds of potent and selective compounds resulted in only a compound that was both an active and selective analog of D-000 This compound was purchased from Contract Services Corporation (Catalog # 7232154) and differed from D-000 by replacing a phenyl group for the group 2-chlorophenyl of D-000.

17

As described, the PI inhibitor 3-kinase LY294002 (Calbiochem, La Jolla, CA) no has a significant selectivity between the different isoforms of PI 3-kinase tested. In the conditions of our trial, LY294002 inhibited the three isoforms of PI 3-kinases with an IC 50 of 0.3 to 1 µM. Do not However, when compound D-000 was tested for the same isoforms of PI 3-kinase, a different selectivity Specifically, as shown in the Figure 1, D-000 inhibited isoform activity δ of PI3K with an IC 50 of about 0.3 µM, while under similar conditions it did not inhibit the activities of isoforms α and β at a limit of 100 µM of compound. These results show that D-000 inhibits selectively the activity of PI3K?.

       \ vskip1.000000 \ baselineskip
    

Examples 3-7

Since PI3K? Is expressed at levels significant only in leukocytes, it is important to study the effects of the selective inhibitor of PI3K? on the leukocyte functions Therefore, the effects were examined of inhibition of PI3K? in several types of leukocytes. The Neutrophils were examined to determine the effects that the selective inhibition of PIK? could cause (Example 3, a continuation). Surprisingly it was found that the inhibition Selective activity of PI3K? seems to be significantly associated with the inhibition of some, but not of all characteristic functions of activated neutrophils. On the other hand, the effects of PI3K? Inhibition on The function of B and T cells were also tested (Examples 4-5, below). Also, since PI3K? Is also expressed in osteoclasts, the effect of PI3K? inhibition on the function of these specialized cells (Example 6, below).

       \ vskip1.000000 \ baselineskip
    

Example 3

Characterization of the role of PI3K? In the function of neutrophils

The effects of an inhibitor of PI3K? Of the invention, ie D-000, about Neutrophil functions such as superoxide generation, the elastase exocytosis, chemotaxis and elimination bacterial

       \ vskip1.000000 \ baselineskip
    

A. Preparation of human blood neutrophils

Aliquots (8 mL) of heparinized blood of healthy volunteers were stratified on 3 mL buffers of 7.3% FICOLL® (Sigma, St. Louis, MO) and 15.4% HYPAQUE® (Sigma) and centrifuged at 900 rpm for 30 at room temperature in a table centrifuge (Beckman). The band rich in neutrophils immediately above the FICOLL®-HYPAQUE® buffer was collected and washed with a Hanks balanced salt solution (HBSS) that It contained 0.1% gelatin. The residual erythrocytes were removed by hypotonic lysis with 0.2% NaCl. The preparation of the neutrophil was washed twice with HBSS containing 0.1% of Jelly and was used immediately.

       \ vskip1.000000 \ baselineskip
    

B. Measurement of superoxide production by neutrophils

The generation of superoxide is one of the characteristics of neutrophil activation. Various activators enhance the generation of superoxide by neutrophils. The effect of the PI3K? D-000 inhibitor on the generation of superoxide by three different agonists was measured: TNF1α, IgG, and fMLP, each representing separate classes of the activator. The superoxide generated by neutrophils was measured by controlling the change in absorbance after the reduction of cytochrome C by modifying the method described by Green et al ., (Pp. 14.5.1-14.5.11 in Supp. 12, Curr Protocols Immunol (Eds., Colligan et al .) (1994)), as follows. The individual wells of a 96-well plate were covered overnight at 4 ° C with 50 µL of 2 mg / mL solution of human IgG or fibrinogen.

The wells were washed with PBS and added the following reagents to each well: 50 µL of HBSS or superoxide dismutase (1 mg / mL), 50 µL of HBSS or TNF1α (50 ng / mL), 50 µC cytochrome C (2.7 mg / mL), and 100 µL of purified human neutrophil suspension (2 x 10 6 cells / mL). The plate was centrifuged for two minutes at 200 rpm and the absorbance at 550 nm was monitored for two hours. To measure the relative amounts of superoxide generated, the values obtained from wells containing superoxide dismutase were subtracted from everyone and normalized with respect to the values obtained from wells without any inhibitor.

As shown in Figure 2, the inhibitor of PI3K? D-000 inhibits the generation of TNF-induced superoxide of neutrophils in one way concentration dependent. The superoxide generation TNF-induced was reduced to its maximum average value to about 3 µM D-000. Figure 2 also reveals that the IgG-induced superoxide generation did not look significantly inhibited by D-000. In fact, even at 10 µM this PI3K? inhibitor had no effect on the generation of superoxide induced by IgG.

The effect of D-000 on the generation of superoxide induced by another potent inducer, the fMLP formylated bacterial peptide. To the like the generation of superoxide induced by TNF, the fMLP-induced superoxide generation was also inhibited by D-000 (Figure 3). These results demonstrate that the PI3K? D-000 inhibitor can prevent the specific induction of the stimulus of the generation of superoxide by neutrophils, indicating that PI3K? Is involved in this process.

       \ vskip1.000000 \ baselineskip
    

C. Measurement of elastase exocytosis of neutrophils

In addition to the generation of superoxide, activated neutrophils also respond by releasing several proteases that are responsible for the destruction of tissues and cartilage during inflammation. The effect of D-000 on elastase exocytosis was measured as an indication of protease release. The exocytosis of elastase was quantified by modifying the procedure described by Ossanna et al . (J Clin Invest, 77: 1939-1951 (1986)), as follows. Purified human neutrophils (0.2 x 10 6) (treated with DMSO or a serial dilution of D-000 in DMSO) were stimulated with fMLP in PBS containing 0.01 mg / mL of cytocolain B, 1, 0 µM sodium azide (NaN3), 5 µg / mL L-methionine and 1 µM fMLP for 90 min. at 37 ° C in a 96-well plate. At the end of the incubation period, the plate was centrifuged for 5 minutes at 1000 rpm, and 90 µL of the supernatant was transferred to 10 µL of 10 mM solution of an elastase substrate peptide, MeO-suc-Ala-Ala -Pro-Val-pNA, where MeO-suc = methoxy-succinyl; pNA = p-nitroanilide (Calbiochem, San Diego, CA). The absorbance at 410 nm was controlled for two hours in a 96-well plate reader. To measure the relative amounts of excited elastase, all absorbance values were normalized with respect to values without any inhibitor. As shown in Figure 4, the PI3K? D-000 inhibitor remarkably inhibits exocytosis of elastase induced by fMLP and does so in a dose-dependent manner. The inhibition reached the maximum average at a concentration of about 2-3 of µM D-000.

       \ vskip1.000000 \ baselineskip
    

D. Measurement of human neutrophil migration fMLP induced

Neutrophils have the intrinsic ability to migrate through tissues and are one of the first types of cells to reach the sites of inflammation or tissue injury. The effect of D-000 on neutrophil migration to a concentration gradient of gMLP was measured. Migration assays were performed the day before: six-well plates were coated with a recombinant ICAM-I / Fc fusion protein (Van der Vieren et al ., Immunity, 3: 683-690 (1995)) (25 µg / mL in bicarbonate buffer, pH 9.3) and left overnight at 4 ° C. After washing, a 1% agarose solution in RPMI-1640 with 0.5% bovine serum albumin (BSA) was added to the wells with or without an inhibitor and the plates were placed in a refrigerator before making the holes in gelled agarose to generate proliferation (a central hole surrounded by six peripherals per well).

Human neutrophils were obtained as described above and resuspended in an RPMI medium supplemented with 0.5% BSA at 5 x 10 6 cells / mL. After combining volumes equal to the medium and the neutrophil suspension (either with DMSO or a serial dilution of test compound in DMSO), neutrophils they were aliquoted in the peripheral holes, while the central hole received fMLP (5 µM). The plates were incubated at 37 ° C in the presence of 5% CO2 for four hours, followed by termination of migration by adding a solution of 1% glutaraldehyde in D-PBS. After withdrawing the agarose layer, the wells were washed with distilled water and dried

Neutrophil migration analysis is performed at a video workstation with microscope inverted DIAPHOT® (1x objective) using the NIH 1.61 program. Using the Microsoft Excel and Table Curve 4 programs (SSPS Inc., Chicago IL), a migration index was obtained for each of the conditions studied. The migration rate was defined as the surface under a curve representing the number of neutrophils migrated against the net migration distance per cell.

As shown in Figure 5, the inhibitor of PI3K? D-000 had a profound effect on the Neutrophil migration, inhibiting this activity in a way dose dependent. The EC50 of this compound for the Neutrophil migration inhibition in this assay is about 1 µM. Based on a visual inspection of the recorded trajectories of the cells of this assay, it seems that the total path length of the neutrophils was not seen significantly affected by the test compound. But nevertheless, the compound affected the direction or orientation of the neutrophil, so that instead of migrating along the axis of the gradient chemoattractant, the cells migrated in an non-directed way or less directed.

       \ vskip1.000000 \ baselineskip
    

E. Measurement of bactericidal capacity of neutrophils

Since the PI3K? D-000 inhibitor affects certain neutrophil functions detailed above, it was interesting to check if the compound affects the elimination of neutrophil-mediated bacteria. The effect of D-000 on the elimination of neutrophil - mediated Staphylococcus aureus was studied according to the method described by Clark and Nauseef (pp. 7.23.4-7.23.6 in Vol. 2, Supp. 6, Curr Protocols Immunol (Eds ., Colligan et al .) (1994)). The purified human neutrophils (5 x 10 6 cells / mL) (treated with DMSO or a serial dilution of D-000 in DMSO) were mixed with autologous serum. S. aureus cells generated overnight were washed, resuspended in HBSS and opsonized serum neutrophils were added at a ratio of 10: 1. Neutrophils were allowed to internalize the bacteria by phagocytosis by incubation at 37 ° C for 20 minutes. The non-internalized bacteria were removed by 10 units / mL of lisostafine at 37 ° C for 5 minutes and the total mixture was rotated at 37 ° C. Samples were taken at various times up to 90 minutes and the neutrophils were lysed by dilution in water. Viable bacteria were counted by placing appropriate dilutions on a tripticase-soy-agar plate and S. aureus colonies were counted after being grown overnight.

As shown in Figure 6, the elimination of neutrophil - mediated S. aureus was similar in samples treated with DMSO (control) and with D-000. These results indicate that the PI3K? Inhibitor does not significantly affect the ability of neutrophils to eliminate S. aureus , suggesting that PI3K? Is not involved in this neutrophil function path.

       \ vskip1.000000 \ baselineskip
    

Example 4

Characterization of the role of PI3K? In the function of B lymphocytes

The effect of the inhibitor of PI3-kinase on the functions of B cells, including classic indices such as antibody production and Proliferation induced by a specific stimulus.

       \ vskip1.000000 \ baselineskip
    

A. Preparation and stimulation of blood B cells peripheral human

Heparinized blood (200 mL) of Healthy volunteers with an equal volume of D-PBS, will stratified on 10 x 10 mL FICOLL-PAQUE® (Pharmacia), and centrifuged at 1600 rpm for 30 minutes at room temperature. Peripheral blood mononuclear cells (PBMC) were collected from the F1COLL® / serum combination, covered with 10 mL of fetal bovine serum (FBS) and centrifuged at 800 rpm for 10 min to remove platelets. After washing, the cells were incubated with DYNAL® Antibody Mix (B cell kit) (Dynal Corp., Lake Success, NY) for 20 minutes at 4-8 ° C. After removing unbound antibody, PBL was mixed with beads magnetic coated against mouse IgG (Dynal) for 20 minutes at 4-8 ° C, stirring gently for later remove non-B cells marked on the pearl separator magnetic This procedure was repeated once more. B cells were resuspended in RPMI-1640 with 10% FBS, and kept on ice until use.

       \ vskip1.000000 \ baselineskip
    

B. Measurement of antibody production of human B cells

To study antibody production, B cells were aliquoted to 50-75 x 10 3 cells / well in a 96-well plate with or without inhibitor, to which IL-2 (100 U / mL) was added. and PANSORBIN® (Calbiochem) Staphylococcus aureus cells (1: 90,000). Part of the medium was removed after 24-36 hours and a new medium (with or without inhibitor) and IL-2 was added. The cultures were incubated at 37 ° C, in the presence of a CO2 incubator for another seven days. Samples of each condition were taken (in triplicate) and analyzed to check the IgG and IgM values, with an ELISA. Briefly said, four IMMULON® 96-well plates (50 µL / well) were coated with 150 ng / mL human anti-IgG donkey serum (H + L) (Jackson ImmunoResearch, West Grove PA), or 2 µg / mL donkey anti human IgG + IgM (H + L) (Jackson ImmunoResearch) in a bicarbonate buffer, and left overnight at 4 ° C. After a triple wash with a phosphate buffered saline solution with TWEEN®-80 (PBST) (350 µL / well), and blocking with 3% goat serum in PBST (100 µL / well) for one hour at room temperature, samples (100 µL / well) of the B cell supernatant diluted in PBST were added. For the IgG plates the dilution range was 1: 500 to 1: 10000, and for the IgM from 1:50 to 1: 1000. After one hour, the plates were exposed to biotin-conjugated anti-human IgG serum (100 ng / mL) or human anti-IgM serum (200 ng / mL) (Jackson ImmunoResearch) for 30 minutes, followed by streptavidin-HRP (1 : 20,000) for 30 min., And finally, to a solution of TMB (1: 100) with H 2 O 2 (1: 10000) for 5 min., With three washes in PBST between these steps. The color development was stopped with a solution of H 2 SO 4 and the plates were read in an ELTSA plate reader.

As shown in Figure 7, D-000 significantly inhibited the production of antibodies IgM production was affected to a greater extent that IgG production: inhibition of IgM production maximum mean was observed at approximately 1 µM, compared to 7 µM for comparable inhibition of IgG production.

       \ vskip1.000000 \ baselineskip
    

C. Measurement of B-cell proliferation in response to the stimulation of IgM on the cell surface

In the previous experiment, B cells were stimulated using PANSORBIN®. The effect of D-000 on the cell proliferation response B when stimulated through the IgM of its cell surface using an anti-IgM antibody. Splenocytes murine (Balb / c) were placed in 96 microtiter plates wells at 2 x 10 5 cells per well in 10% FBS / RPMI. Be added the appropriate dilutions of the test inhibitor in the complete medium to the cells and the plates were incubated for 30-60 minutes before stimulus addition. After preincubation with the test inhibitor, a Preparation F (ab1) 2 of goat antibody specific for the mouse IgG p chain to the wells, at a final concentration of 25 µg / mL. The plates were incubated at 37 ° C for 3 days and 1 µCi of [<3> H] -thymidine to each well during the four Last hours of cultivation. The plates were collected on filters of fiber, washed and the incorporation of the radiolabel was determined using a beta counter (Matrix 96, Packard Instrument Co., Downers Grove, IL) and expressed as counts per minute (CPM).

Figure 8 shows the effect of D-000 on stimulated B-cell proliferation with anti-IgM. The compound inhibited proliferation B cell stimulated with anti-IgM form dose dependent. At approximately I µM, the Proliferation was reduced to its maximum average value.

Since the D-000 compound inhibits the proliferation of B cells, it is anticipated that this compound and other PI3K? inhibitors could be used to suppress a proliferation of B cells in clinical settings. For example, in the malignancy of B cells, B cells of various phases of Differentiation show a deregulated proliferation. Based on the results shown above, it can be deduced that the inhibitors Selective PI3K? could be used to control, limit or inhibit the growth of said cells.

       \ vskip1.000000 \ baselineskip
    

Example 5

Characterization of the role of PI3K? In the function of T lymphocytes

T cell proliferation was measured in response to costimulation of CD3 + CD28. T cells were purified from healthy human blood by negative selection using magnetic beads coated with antibodies, okay with the manufacturer's protocol (Dynal) and resuspended in RPMI. The cells were treated with DMSO or a serial dilution of D-000 in DMSO and placed at 1 x 10 5 cells / well in a 96 well plate precoated with serum Goat anti-mouse IgG. Antibodies monoclonal anti-CD3 and anti-CD28 mouse were then added to each well at 0.2 ng / mL and 0.2 \ mug / mL, respectively. The plate was incubated at 37 ° C for 24 hours and [3 H] -thimidine (1 \ muCi / well). After another 18 hours of incubation they were collected the cells with an automatic cell collector, washed and quantified the incorporated radioactivity.

Although the PI3K? Inhibitor D-000 inhibited T cell proliferation induced by anti-CD3 and anti-CD28, its effect it is not as strong as its effect on B cells or on some of neutrophil functions.

The maximum average inhibition of incorporation thymidine was not achieved at the maximum concentration tested, it is say 10 µM D-000.

       \ vskip1.000000 \ baselineskip
    

Example 6

Characterization of the role of PI3K? In the function of osteoclasts

To analyze the effect of the inhibitor of PI3K? D-000 on osteoclasts, is they isolated mouse bone marrow cells and differed from those osteoclasts treating cells with the Stimulator Factor of Macrophage-1 colonies (mCSF-1) and the Osteoprotegerin ligand (OPGL) in a serum medium (αMEM with 10% heat-inactivated FBS; Sigma) for three days. On the fourth day the osteoclasts had developed, they He removed the medium and the cells were collected. Osteoclasts are placed on portions of dentin at 10 5 cells / well in a growth medium, ie αMEM with 1% serum and 2% BSA with 55 µg / mL OPGL and 10 ng / mL mCSF-1. After 3 hours, the medium was changed to 1% serum and 1% BSA, with or without osteopontin (25 µg / mL) and PI3K inhibitors (100 nM). He half was changed every 24 hours for new osteopontin and the inhibitors At 72 hours the medium and the surfaces of dentin was washed with water to remove cell debris, and stained with acidic hematoxylin. The excess dye was washed and they quantified the depths of the holes by microscopy confocal

As shown in Table 1, in both experiments, PI 3-kinase inhibitors they had an inhibitory effect on osteoclast function.

The two non-specific inhibitors, LY294002 and Wortmanin, inhibited osteoclast activity. However the PI3K? D-000 inhibitor had the most effect pronounced, since at 100 nM this compound inhibited almost by Complete osteoclast activity.

18

       \ vskip1.000000 \ baselineskip
    

Example 7

Characterization of the role of PI3K? In function basophilic

The evaluation of the effect of a compound of the invention on basophilic function was tested using a conventional histamine release assay, in general according to the method described in Miura et al ., J Immunol, 162: 4198-206 (1999). Briefly explained, enriched basophils were pre-incubated with test compounds at different concentrations from 0.1 nM to 1,000 nM, for 10 minutes at 37 ° C. Next, polyclonal goat anti-human IgE (0.1 µg / mL) or fMLP was added and left to incubate for another 30 minutes. Histamine release in the supernatant was measured using an automated fluorometric technique. The two compounds shown below were tested.

19

       \ vskip1.000000 \ baselineskip
    

twenty

A dose dependent reduction was observed in histamine release for 3- (2-Chlorophenyl) -5-methyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one (D-026) when basophils were stimulated with anti-IgE. This suppression of the release of histamine was basically 100% at 1,000 nM, with an EC_ {50} close to 25 nM.

Other compound, 3- (2-Chlorophenyl) -2- (1H-pyrazolo [3,4-d] pyrimidin-4-ylsulfanylmethyl) -3H-quinazolin-4-one (D-999), in which the structure of the purine ring, was less effective in inhibiting release of histamine. No compound caused any effect when Basophils were stimulated with fMLP. By comparison, the inhibitor of non-selective PI3K LY294002 was tested at 0.1 nM and 10,000 nM, recording a near 100% inhibition of the release of Histamine at maximum concentration.

These data indicate that the inhibitors of PI 3-kinase delta activity can be used to suppress histamine release, which is one of the allergy mediators. Since the activity of the various IP 3-kinases are necessary for exocytosis, protein secretion and trafficking in many cell types, the previous data suggest that histamine release by of other cells, such as mast cells, can also be altered by selective PI 3-kinase inhibitors delta.

       \ vskip1.000000 \ baselineskip
    

Examples of chemical synthesis

Specific examples are listed below. of compounds of the invention. It is understood in the field that protection groups can be used when necessary, of compliance with the general principles of synthetic chemistry. These protection groups are removed in the last steps of the synthesis in basic, acidic or hydrogen hydrogen conditions Quickly apparent to people understood in the field. Employing proper handling and protection of any of chemical functionalities, the synthesis of compounds of the structural formula (I) not specifically set forth herein it can be done by methods analogous to the schemes that collect below.

Unless otherwise indicated, all starting materials were obtained from commercial suppliers and were They used without other purifications. All reactions and chromatography fractions were analyzed by chromatography in thin layer (TLC) on 250 mm silica gel plates, visualized with ultraviolet (UV) light and stained with iodine (I2). The products and intermediates were purified by flash chromatography or high performance liquid chromatography in reverse phase

In synthetic examples, the following abbreviations: aq (aqueous), H2O (water), CHCJ3 (chloroform), HCl (hydrochloric acid), MeOH (methanol), NaOH (sodium hydroxide), NaOMe (sodium methoxide), TFA (acid trifluoroacetic acid), K2CO3 (potassium carbonate), SOCl 2 (thionyl chloride), CH 2 Cl 2 ( methylene), EtOAC (ethyl acetate), DMF (dimethylformamide), EtOH (ethanol), DMSO (dimethyl sulfoxide), NaHCO3 (bicarbonate) sodium), TLC (thin layer chromatography), HPLC (chromatography high resolution liquid), HOBT (hydroxybenzotriazole), EDC (ethyldiethylaminopropylcarbodiimide), DIEA (diisopropylethylamine), and HOAc (acetic acid).

       \ vskip1.000000 \ baselineskip
    

I. General procedures

Process TO

Trionyl chloride was added to a rapidly stirred solution of anthranilic acid or benzoic acid in benzene, and the mixture was stirred under reflux for 5 to 18 hours. The reaction was concentrated in vacuo , and cleaned twice with benzene. The resulting oil was dissolved in CHCl3 and the corresponding aniline was added to that solution. The reaction mixture was heated under reflux and stirred until TLC determined its conclusion, at which time the reaction mixture was cooled to room temperature. The precipitate was filtered and the result concentrated in vacuo . The crude product was purified by chromatography and / or recrystallized with MeOH to provide 1a-1r amides.

       \ vskip1.000000 \ baselineskip
    

Process B

Chloroacetyl chloride was added to a rapidly stirred suspension of an amide in glacial acetic acid. The reaction mixture was heated to 120 ° C and stirred at that temperature until the TLG determined that it was complete. After cooling briefly, the reaction mixture was concentrated in vacuo . The crude residue was purified by extraction, chromatography and / or recrystallization to provide 2a-2r chlorides.

       \ vskip1.000000 \ baselineskip
    

Process C

A mixture of a chloride, either nitrogen or a sulfur nucleophile, for example, mercaptopurine monohydrate or adenine, and K 2 CO 3 in DMF was stirred at room temperature for 15-72 hours. The resulting suspension is poured into water and kept at 4 ° C for several hours. The solid in crude was filtered, washed with water and purified by chromatography or recrystallization to provide the products late.

       \ vskip1.000000 \ baselineskip
    

Example 8 Preparation of intermediate compounds: amides 2-amino-N- (2-chlorophenyl) -4,5-dimethoxybenzamide (1st)

Prepared according to Procedure A using 4,5-dimethoxyanthranilic acid (5.0 g, 25.4 mmol) and SOCl 2 (5.5 mL, 76.1 mmol) in benzene (100 mL), followed by 2-Chloroaniline (6.7 mL, 63.5 mmol) and CHCl3 (75 mL) The product was washed with aqueous NaHCO3 (2 x 25 mL) and HCl (0.5 M, 75 mL) and purified by CH 2 Cl 2 chromatography to provide 4.3 g of a brown foam (55%). 2 H NMR (CDCl 3) δ: 8.42 (dd, J = 1.5, 8.3 Hz, 1H); 8-32 (br s, 1H); 7.40 (dd, J = 1.4, 8.0 Hz, 1H); -7.31 (dt, J = 1.4, 7.9 Hz, 1H); 7.05 (dt, J = 1.5, 7.7 Hz, 1H); 7.03 (s, 1 H); 6.24 (s, 1 H); 3.88 (s, 3 H); 3.87 (s, 3H). MS (ES): m / z 307.0 (M +).

       \ vskip1.000000 \ baselineskip
    

2-amino-5-bromo-N- (2-chlorophenyl) benzamide (1 B)

Prepared according to Procedure A using acid 2-amino-5-bromobenzoic (5.0 g, 23.1 mmol) and SOCl 2 (7.0 mL, 95.9 mmol) in benzene (50 mL), followed by 2-chloroaniline (7.3 mL, 69.3 mmol) and CHCl3 (50 mL). The product was purified by two CH 2 Cl 2 chromatographs to provide 1.48 g of a yellowish orange solid (20%). 1 H NMR (CDCl 3) δ: 8.36 (dd, J = 1.2, 8.2 Hz, 1H); 8.20 (br s, 1H); 7.62 (d, J = 2.1 Hz, 1 HOUR); 7.42 (dd, J = 1.3, 8.0 Hz, 1H); 7.34 (dd, J = 2.2, 8.8 Hz, 1H); 7.28-7.33 (m, 1 H); 7.09 (dt, J = 1.4, 7.7 Hz, 1H); 6.62 (d, J = 8.7 Hz, 1H); 5.57 (br s, 2H).

       \ vskip1.000000 \ baselineskip
    

2-amino-N- (2-chlorophenyl) -4-fluorobenzamide (1 C)

Prepared according to Procedure A using acid 2-amino-4-fluorobenzoic (1.15 g, 7.41 mmol) and SOCl2 (1.4 mL, 18.5 mmol) in benzene (25 mL), followed by 2-chloroaniline (1.6 mL, 14.8 mmol) and CHCl3 (25 mL). The product was chromatographed on CH 2 Cl 2 and then crushing hexanes to provide 1.02 g of an off-white solid (52%). 1 H NMR (CDCl 3) δ: 12.91 (br S, 1H); 8.72 (dd, J = 2.7, 12 Hz, 1 HOUR); 8.34 (dd, J = 6.4, 9.2 Hz, 1H); 8.29 (dd, J = 5.9, 8.8 Hz, 1H); 7.81 (dd, J = 6.2, 8.8 Hz, 1H); 7.28 (dt, J = 2.4, 8.4 Hz, 1H); 7.21 (dd, J = 2.4, 9.0 Hz, 1H); 6.92 (ddd, J = 2.4, 7.3, 9.1 Hz, 1H); 6.54 (ddd, J = 2.4, 7.8, 8.8 Hz, 1H); 6.45 (dd, J = 2.4, 11 Hz, 1H); 5.93 (br s, 2H). MS (ES): m / z 265.0 (M +).

       \ vskip1.000000 \ baselineskip
    

2-amino-5-chloro-N- (2-chlorophenyl) benzamide (1d)

Prepared according to Procedure A using acid 2-amino-5-chlorobenzoic (2.0 g, 11.7 mmol) and SOCl 2 (2.2 mL, 29.2 mmol) in benzene (50 mL), followed by 2-chloroaniline (2.5 mL, 23.3 mmol) and CHCl3 (50 mL). The product was purified by recrystallization with MeOH to provide 1.72 g of a solid dark yellow (52%). 1 H NMR (CDCl 3) δ: 8.37 (dd, J = 1.5, 8.3 Hz, 1H); 3.22 (br S, 1H); 7.48 (d, J = 2.3 Hz, 1H); 7.42 (dd, J = 1.5, 8.1 Hz, 1H); 7.31 (dt, J = 1.4, 7.8 Hz, 1H); 7.22 (dd, J = 2.4, 8.8 Hz, 1H); 7.09 (dt, J = 1.5, 7.7 Hz, 1H); 6.67 (d, J = 8.8 Hz, 1 HOUR); 5.56 (br s, 2H).

       \ vskip1.000000 \ baselineskip
    

2-amino-N- (2-chlorophenyl) -6-fluorobenzamide (1e)

Prepared according to Procedure A using acid 2-amino-6-fluorobenzoic (2.0 g, 12.9 mmol) and SOCl 2 (2.3 mL, 32.2 mmol) in benzene (50 mL), followed by 2-chloroaniline (2.7 mL, 25.8 mmol) and CHCl3 (50 mL). The product was purified by EtOAc / hexanes chromatography to provide 2.06 g of a solid light orange (60%). 1 H MR (CDCl 3) δ: 9.00 (d, J = 17 Hz, 1H); 8.47 (d, J = 8.3 Hz, 1H); 7.41 (d, J = 8.0 Hz, 1H); 7.30 (t, J = 7.9Hz, 1H); 7.10-7.20 (m, 1H); 7.07 (t, J = 7.7 Hz, 1 HOUR); 6.49 (d, J = 8.3 Hz, 1H); 6.03 (br s, 2H). MS (ES): m / z 265.0 (M +).

       \ vskip1.000000 \ baselineskip
    

2-amino-6-chloro-N- (2-chlorophenyl) benzamide (1f)

Prepared according to Procedure A using acid 2-amino-6-chlorobenzoic (2.5 g, 14.6 mmol) and SOCl 2 (2.7 mL, 36.4 mmol) in benzene (75 mL), followed by 2-chloroaniline (3.1 mL, 29.1 mmol) and CHCl3 (75 mL). The product was chromatographed on CH 2 Cl 2 to provide 1.05 g of an orange solid yellowish (26%). 1 H NMR (CDCl 3) δ: 8.54 (d, J = 8.1 Hz, 1H); 8.30 (br s, 1H); 7.41 (dd, J = 1.5, 8.0 Hz, 1H); 7.33 (t, J = 7, .8 Hz, 1H); 7.10 (t, J = 8.1 Hz, 1H); 7.09 (dt, J = 1.6, 7.8 Hz, 1 HOUR); 6.78 (dd, J = 0.4, 7.9 Hz, 1H); 6.63 (dd, J = 0.9, 8.2 Hz, 1H); 4.69 (br s, 2H). MS (ES): m / z 303.0 (M + 22), 281.0 (M +).

       \ newpage
    

2-amino-N- (2-chlorophenyl) -6-methylbenzamide (1g)

Prepared according to Procedure A using acid 2-amino-6-methylbenzoic (2.5 g, 16.5 mmol) and SOCl2 (3.0 mL, 41.3 mmol) in benzene (75 mL), followed by 2-chloroaniline (3.5 mL, 33.0 mmol) and CHCl3 (75 mL). The product was chromatographed on CH 2 Cl 2 to provide 2.19 g of a brown oil (51%). 1 H NMR (CDCl 3) δ: 8.58 (d, J = 8.1 Hz, 1H); 7.99 (br s, 1H); 7.40 (dd, J = 1.4, 8.0 Hz, 1H); 7.34 (t, J = 7.7 Hs, 1H); 7.11. (t, J = 7.8 Hz, 1H); 7.09 (dt, J = 1.5, 7.7 Hz, 1H); 6.64 (d, J = 7.5Hz, 1 HOUR); 6.59 (d, J = 8.1 Hz, 1H); 4.29 (br s, 2H); 2.45 (s, 3H). MS (ES): m / z 283.0 (M + 22).

       \ vskip1.000000 \ baselineskip
    

2-amino-3-chloro-N- (2-chlorophenyl) benzamide (1 hour)

Prepared according to Procedure A using acid 2-amino-3-chlorobenzoic (1.0 g, 5.82 mmol) and SOCl 2 (1.1 mL, 14.6 mmol) in benzene (25 mL), followed by 2-chloroaniline (1.2 mL, 11.7 mmol) and CHCl3 (25 mL). The product was recrystallized from MeOH to provide 1.29 g of a yellow solid (78%). 1 H NMR (CDCl 3) δ: 8.43 (dd, J = 1.4, 8 3 Hz, 1H); 8.30 (br s, 1 HOUR); 7.47 (dd, J = 1.1, 8.0 Hz, 1H); 7.42 (d, J = 8.0 Hz, 2H); 7.33 (dt, J = 1.4, 7.9Hz, 1H); 7.09 (dt, J = 1.5, 7.7 Hz, 1H); 6.68 (t, J = 7.9 Hz, 1 HOUR); 6.13 (br s, 2H), MS (ES): m / z 281.0 (M +).

       \ vskip1.000000 \ baselineskip
    

2-amino-N-biphenyl-2-yl-6-chlorobenzamide (1i)

Prepared according to Procedure A using acid 2-amino-6-chlorobenzoic (2.0 g, 11.7 mmol) and SOCl 2 (2.1 mL, 29.3 mmol) in benzene (60 mL), followed by 2-aminobiphenylamine (4.15 g, 24.5 mmol) and CHCl3 (60 mL). The product was chromatographed on CH 2 Cl 2 to provide 2.16 g of a dark amber residue sparkling (57%). 1 H NMR (CDCl 3) δ: 8.48 (d, J = 8.2 Hz, 1H); 7.79 (br s, 1 H); 7.34-7.46 (ra, 6H); 7.20-7.30 (m, 2H); 7.00 (t, J = 8.1 Hz, 1H); 6.63 (dd, J = 0.6, 7.9 Hz, 1H); 6.54 (d, J = 8.3 Hz, 1H); 4.58 (br s, 2H). MS (ES): m / z 323.1 (M +).

       \ vskip1.000000 \ baselineskip
    

2-amino-6-chloro-N-o-tolylbenzamide (1j)

Prepared according to Procedure A using acid 2-amino-6-chlorobenzoic (1.0 g, 5.83 mmol) and SOCl 2 (1.1 mL, 14.6 mmol) in benzene (30 mL), followed by o-toluidine (1.4 mL, 12.8 mmol) and CHCl3 (30 mL). The product was chromatographed on CH 2 Cl 2 to provide 840 mg of a yellow solid oilseed (55%). 1 H NMR (CDCl 3) δ: 7.96 (d, J = 7. 9 Hz, 1H); 7.60 (br s, 1 H); 7.23-7.30 (m, 2H); 7.14 (t, J = 7.5 Hz, 1H) 7.11 (t, J = 8.3 Hz, 1H); 6.78 (d, J = 7.9 Hz, 1H); 6.64 (d, J = 8.2 Hz, 1H); 4.73 (br s, 2H); 2.35 (s, 3H). MS (ES): m / z 261.0 (M +).

       \ vskip1.000000 \ baselineskip
    

2-amino-6-chloro-N- (2-fluorophenyl) benzamide (1k)

Prepared according to Procedure A using acid 2-amino-6-chlorobenzoic (2.0 g, 11.7 mmol) and SOCl 2 (2.1 mL, 29.1 mmol) in benzene (60 mL), followed by 2-fluoroaniline (2.3 mL, 23.4 mmol) and CHCl3 (60 mL). The product was chromatographed on CH 2 Cl 2 to provide 1.05 g of a yellow solid (3. 4%). 1 H NMR (CDCl 3) δ: 8.45 (t, J = 8.0 Hz, 1H); 8.01 (br s, 1 H); 7.02-7.22 (m, 4H); 6.78 (dd, J = 0.5, 7.9 Hz, 1H); 6.64 (dd, J = 0.8, 8.2 Hz, 1H); 4.73 (br s, 2H). MS (ES): m / z 265.0 (M +).

       \ vskip1.000000 \ baselineskip
    

2-amino-6-chloro-N- (2-methoxyphenyl) benzamide (1l)

Prepared according to Procedure A using acid 2-amino-6-chlorobenzoic (2.0 g, 11.7 mmol) and SOCl 2 (2.1 mL, 29.1 mmol) in benzene (60 mL), followed by o-anisidine (2.6 mL, 23.4 mmol) and CHCl3 (60 mL). The product was chromatographed on CH 2 Cl 2 to provide 2.61 g of a yellow oil dark (81%). 1 H NMR (CDCl 3) δ: 8.53 (dd, J = 1.7, 7.9 Hz, 1H); 8.39 (br s, 1 H); 7.11 (dt, J = 1.6, 7.8 Hz, 1H); 7.09 (t, J = 8.1 Hz, 1H); 7.02 (dt, J = 1.4, 7.8 Hz, 1H); 6.92 (dd, J = 1.4, 8.0 Hz, 1H); 6.62 (dd, J = 0.9, 8.2 Hz, 1H); 4.66 (br s, 2H); 3.87 (s, 3H). MS (ES): m / z 277.0 (M +).

       \ vskip1.000000 \ baselineskip
    

2-amino-N- (2-chlorophenyl) -3-trifluoromethylbenzamide (1m)

Prepared according to Procedure A using 3-trifluoromethyl anthranilic acid (2.0 g, 9.75 mmol) and SOCl 2 (1.8 mL, 24.4 mmol) in benzene (50 mL), followed by 2-Chloroaniline (2.1 mL, 19.5 mmol) and CHCl3 (50 mL) The product was purified by recrystallization with MeOH to provide 2.38 g of yellow crystals (78%). 1 H NMR (CDCl 3) δ: 8.40 (dd, J = 1.4, 8.3 Hz, 1H); 8.25 (br s, 1 HOUR); 7.71 (d, J = 7.8 Hz, 1H); 7.60 (d, J = 7.8 Hz, 1H); 7.43 (dd, J = 1.4, 8.0 Hz, 1H); 7.34 (dt, J = 1.3, 7.9 HZ, 1H); 7.11 (dt, J = 1.5, 7.7 Hz, 1H); 6.77 (t, J = 7.8 Hz, 1H); 6.24 (br s, 2H). MS (ES): m / z 315.0 (M +).

       \ vskip1.000000 \ baselineskip
    

Acid 3-aminonaphthalene-2-carboxylic (2-chlorophenyl) amide (1n)

Prepared according to Procedure A using acid 3-amino-2-naphthoic (2.0 g, 10.7 mmol) and SOCl 2 (1.9 mL, 26.7 mmol) in benzene (50 mL), followed by 2-chloroaniline (2.3 mL, 21.4 mmol) and CHCl3 (50 mL). The product was recrystallized from MeOH to provide 1.71 g of a brown solid (54%). 1 H NMR (CDCl 3) δ: 10.88 (br s, 1H); 9.21 (s, 1 H); 8.91 (s, 1 H); 8.70 (dd, J = 1.0, 8.3 Hz, 1H); 7.95-8.01 (m, 1 H); 7.87-7.94 (m, 1 H); 7.60-7.68 (m, 2H); 7.41 (dd, J = 1.3, 8-0 Hz, 1H); 7.34 (dt, J = 1.2, 7.8 Hz, 1H); 7.07 (dt, J = 1.4, 7.7 Hz, 1H). MS (ES): m / z 297.1 (M +).

       \ vskip1.000000 \ baselineskip
    

2-amino-N- (2-chlorophenyl) -4-nitrobenzamide (1st)

Prepared according to Procedure A using 4-nitroantranilic acid (5.0 g, 27.5 mmol) and SOCl 2 (5.0 mL, 68.6 mmol) in benzene (150 mL), followed by 2-Chloroaniline (5.8 mL, 55.0 mmol) and CHCl3 (150 mL) The product was purified by chromatography on CH 2 Cl 2 followed by recrystallization with MeOH to provide 2.20 g of a 31% orange brown solid). 1 H NMR (CDCl 3) δ: 8.41 (dd, J = 1.3, 8.3 Hz, 1 H); 8.31 (br s, 1H); 7.67 (d, J = 8.6 Hz, 1H); 7.57 (d, J = 2.1 Hz, 1H); 7.52 (dd, J = 2.2, 8.5 Hz, 1H); 7.44 (dd, J = 1.3, 8.1 Hz, 1H); 7.35 (dt, J = 1.3, 7.9 Hz, 1H); 7.13 (dt, J = 1.4, 7.8 Hz, 1H); 5.88 (br s, 2H). MS (SS): m / z 292.0 (M +).

       \ vskip1.000000 \ baselineskip
    

2-amino-N- (2-chlorophenyl) -5-hydroxybenzamide (1 p)

Prepared according to Procedure A using acid 2-amino-5-hydroxybenzoic (5.0 g, 32.7 mmol) and SOCl 2 (6.0 mL, 81.6 mmol) in benzene (150 mL), followed by 2-chloroaniline (6.9 mL, 65.4 mmol) and CHCl3 (150 mL). The product was purified by two Chromatographs in MeOH / CH 2 Cl 2 to provide 990 mg of a brown solid (12%). 1 H NMR (MeOH-d 4) δ: 7.92 (dd, J = 1.6, 8.1 Hz, 1H); 7.48 (dd, J = 1.5, 7.7 Hz, 1 HOUR); 7.34 (dt, J = 1.5, 7.7 Hz, 1H); 7.20 (dt, J = 1.7, 7.7 HZ, 1H); 7.16 (d, J = 2.7 Hz, 1H); 6.83 (dd, 3 = 2.7, 8.7 Hz, 1H); 6.76 (d, J = 8.7 Hz, 1H); [6.24 (br s, 2H)]. MS (ES): m / z 263.0 (M +).

       \ vskip1.000000 \ baselineskip
    

2-amino-N- (2-chlorophenyl) -4,5-difluorobenzamide (1q)

Prepared according to Procedure A using 4,5-Difluoroantranilic acid (2.0 g, 11.6 mmol) and SOCl2 (2.1 mL, 28.9 mmol) in benzene (60 mL), followed of 2-chloroaniline (2.4 mL, 23.2 mmol) and CHCl3 (60 mL). The product was purified by two chromatographs in CH 2 Cl 2 and EtOAc / hexanes to provide 769 mg of a yellow solid (23%). 1 H NMR (CDCl 3) δ: 8.69-8.82 (m, 1 H); 8.00 (dd, J = 8.4, 9.0 Hz, 1H); 7.90 (dd, J = 8.9, 12 Hz, 1H); 7.39 (dd, J = 6.8, 10 Hz, 1H); 6.53 (dd, J = 6.6, 12 Hz, 1H); -6.41 (br s, 2H); 5.79 (br s, 1H). MS (ES): m / z 283.1 (M +).

       \ vskip1.000000 \ baselineskip
    

2-amino-N- (2-chlorophenyl) -5-fluorobenzamide (1st)

Prepared according to Procedure A using acid 2-amino-5-fluorobenzoic (1.0 g, 6.45 mmol) and SOCl 2 (1.2 mL, 16.1 mmol) in benzene (30 mL), followed by 2-chloroaniline (1.4 mL, 12.9 mmol) and CHCl3 (30 mL). The product was crushed from CH 3 Cl 2 to provide 985 mg of a mustard yellow solid (58%). 1 H NMR (CDCl 3) δ: 7.66 (dd, J = 2.9, 8.7 Hz, 1H); 7.52-7.55 (m, 1H); 7.32-7.37 (m, 3H); 7.09 (dt, J = 3.0, 8.5 Hz, 1H); 6.71 (dd, J = 4.3, 8.7 Hz, 1H). MS (ES): m / z 305.0 (M + 40).

       \ vskip1.000000 \ baselineskip
    

Example 9 Preparation of intermediate compounds: chlorides 2-Chloromethyl-3- (2-chlorophenyl) -6,7-dimethoxy-3H-quinazolin-4-one (2nd)

Prepared according to Procedure B with the (2.95 g, 9.63 mmol) and chloroacetyl chloride (2.3 mL, 28.9 mmol) in acetic acid (30 mL). Purified by extracting Aqueous K 2 CO 3 and recrystallization with isopropanol for provide 1.61 g of a brown crystalline solid (46%). 1 H NMR (CDCl3) δ: 7.59-7.66 (m, 2H); 7.45-7.56 (m, 3H); 7.20 (s, 1 H); 4.37 (d, J = I2 Hz, 1H), 4.08 (d, J = 12 Hz, 1H); 4.04 (s, 3H); 4.00 (s, 3H). MS (ES): m / z 365.0 (M +).

       \ vskip1.000000 \ baselineskip
    

6-Bromo-2-chloromethyl-3- (2-chlorophenyl) -3H-quinazolin-4-one (2b)

Prepared according to Procedure B with 1b (500 mg, 1.54 mmol) and chloroacetyl chloride (0.37 mL, 4.61 mmol) in acetic acid (10 mL). Purified by recrystallization with isopropanol to provide 490 mg of an off-white solid (83%). 1 H NMR (CDCl 3) δ: 8.43 (d, J = 2.3 Hz, 1H); 7.91 (dd, J = 2.3, 8.7 Hz, 1H); 7.67 (d, J = 8.7 Hz, 1H); 7.60-7.65 (m, 1 H); 7.47-7.56 (m, 2H); 7.52 (t, J = 5.3 Hz, 1H); 7.47-7.56 (m, 1 H); 4.37 (d, J = 12 Hz, 1H), 4.06 (d, J = 12 Hz, 1H). MS (ES): m / z 385.0 (M +).

       \ vskip1.000000 \ baselineskip
    

       \ global \ parskip0.930000 \ baselineskip
    

2-chloromethyl-3- (2-chlorophenyl) -7-fluoro-3H-quinazolin-4-one (2 C)

Prepared according to Procedure B with 1c (500 mg, 1.89 mmol) and chloroacetyl chloride (0.45 mL, 5.67 mmol) in acetic acid (10 mL). Purified by extracting Aqueous K 2 CO 3 followed by recrystallization with isopropanol to provide 501 mg of a yellow crystalline solid (82%). 1 H NMR (CDCl 3) δ: 8.32 (dd, J = 6.0, 8.9 Hz, 1H); 7.59-7.66 (m, 1 H); 7.50-7.55 (m, 3H); 7.44 (dd, J = 2.4, 9.4HZ, 1H); 7.27 (dt, J = 2.5, 8.5 Hz, 1H); 4.37 (d, J = 12 Hz, 1H), 4.07 (d, J = 12 Hz, 1H). MS (ES): m / z 323.0 (M +).

       \ vskip1.000000 \ baselineskip
    

6-chloro-2-chloromethyl-3- (2-chlorophenyl) -3H-quinazolin-4-one (2d)

Prepared according to Procedure B with 1d (500 mg, 1.78 mmol) and chloroacetyl chloride (0.42 mL, 5.33 mmol) in acetic acid (10 mL). Purified by recrystallization with isopropanol to provide 555 mg of a yellow solid (92%). 1 H NMR (CDCl 3) δ: 8.27 (d, J = 1.9 Hz, 1H); 7.74-7.78 (m, 2H); 7.60-7.66 (m, 1 HOUR); 7.48-7.57 (m, 3H); 4.37 (d, J = 12 Hz, 1H), 4.07 (d, J = 12 Hz, 1H). MS (ES): m / z 339.0 (M +).

       \ vskip1.000000 \ baselineskip
    

2-chloromethyl-3- (2-chlorophenyl) -5-fluoro-3H-quinazolin-4-one (2e)

Prepared according to Procedure B with 1e (500 mg, 1.89 mmol) and chloroacetyl chloride (0.45 mL, 5.67 mmol) in acetic acid (10 mL). Purified by extracting Aqueous K 2 CO 3 and recrystallization with isopropanol for provide 430 mg of an off-white crystalline solid (70%). 1 H NMR (CDCl 3) δ: 7.76 (dt, J = 5.3, 8.2 Hz, 1H); 7.56-7.65 (m, 2H); 7.47-7.56 (m, 3H); 7.16-7.25 (m, 1H); 4.35 (d, J = 12 Hz, 1H), 4.07 (d, J = 12 Hz, 1H). MS (ES): m / z 323.0 <M +).

       \ vskip1.000000 \ baselineskip
    

5-Chloro-2-chloromethyl-3- (2-chlorophenyl) -3H-quinazolin-4-one (2f)

Prepared according to Procedure B with 1f (1.00 g, 3.56 mmol) and chloroacetyl chloride (0.85 mL, 10.7 mmol) in acetic acid (15 mL). Purified by recrystallization with isopropanol to provide 791 mg of a crystalline solid off-white (65%). 1 H NMR (CDCl 3) δ: 7.70 (s, 1H); 7.68 (d, J = 3.8 Hz, 1H); 7.61-7.65 (m, 1 H); 7.55 (dd, J = 2.7, 6.4 Hz, 1H); 7.51 (d, J = 3.1 Hz, 1H); 7.50 (s, 2H); 4.35 (d, J = 12 Hz, 1H), 4.05 (d, J = 12 Hz, 1H). MS (ES): m / z 339.0 (M +).

       \ vskip1.000000 \ baselineskip
    

2-Chloromethyl-3- (2-chlorophenyl) -5-methyl-3H-quinazolin-4-one (2 g)

Prepared according to Procedure B with 1g (2.18 g, 8.36 mmol) and chloroacetyl chloride (2.0 mL, 25.1 mmol) in acetic acid (40 mL). Purified by two chromatographs in CH 2 Cl 2 and EtOAc / hexanes, followed by recrystallization with isopropanol to provide 638 mg of a crystalline solid off-white (24%). 1 H NMR (DMSO-d 6) δ: 7.73-7.80 (m, 3H); 7.58-7.64 (m, 3H); 7.41 (d, J = 7.4 Hz, 1H); 4.40 (d, J = 12 Hz, 1H), 4.26 (d, J = 12 Hz, 1H); 2.74 (s, 3H). MS (ES): m / z 319.0 (M +).

       \ vskip1.000000 \ baselineskip
    

8-Chloro-2-chloromethyl-3- (2-chlorophenyl) -3H-quinazolin-4-one (2h)

Prepared according to Procedure B with 1h (500 mg, 1.78 mmol) and chloroacetyl chloride (0.49 mL, 6.13 mmol) in acetic acid (10 mL). Purified by extracting Aqueous K 2 CO 3 followed by recrystallization with isopropanol to provide 448 mg of a yellow solid (74%). 1 H NMR (CDCl 3) δ: 8.23 (dd, J = 1.4, 8.0 Hz, 1H); 7.90 (dd; J = 1.4, 7.8 Hz, 1H); 7.61-7.66 (m, 1 H); 7.51-7.55 (m, 3H); 7.47 (t, J = 8.0 Hz, 1H); 4.48 (d, J = 12 Hz, 1H), 4.12 (d, J = 12 Hz, 1H). MS (ES): m / z 339.0 (M +).

       \ vskip1.000000 \ baselineskip
    

3-biphenyl-2-yl-5-chloro-2-chloromethyl-3H-quinazolin-4-one (2i)

Prepared according to Procedure B with 1i (2.0 g, 6-20 mmoL) and chloroacetyl chloride (1.5 mL 18.6 mmol) in acetic acid (30 mL). Purified by CH 2 Cl 2 chromatography, followed by recrystallization with isopropanol to provide 1.44 g of an off-white solid (61%). 1 H NMR (CDCl 3) δ: 7.61-7.64 (m, 1 1 HOUR); 7.58-7.59 (m, 1 H); 7.54-7.57 (m, 2H); 7.52-7.53 (m, 1 H); 7.45-7.52 (m, 2H); 7.24 (m, 5H); 3.92-4.03 (m, 2H). MS (ES): m / z 381.0 (M +).

       \ vskip1.000000 \ baselineskip
    

5-Chloro-2-chloromethyl-3-o-tolyl-3H-quinazolin-4-one (2j)

Prepared according to Procedure B with 1j (750 mg, 2.88 mmol) and chloroacetyl chloride (0.69 mL, 8.63 mmol) in acetic acid (15 mL). Purified by chromatography on CH 2 Cl 2, followed by recrystallization with isopropanol to provide 340 mg of a white solid (37%). 1 H NMR (CDCl 3) δ: 7.69 (d, J = 2.1 Hz, 1H); 7:68 (q, J = 7.4 Hz, 1 HOUR); 7.54 (dd, J = 2.2, 7.0 Hz, 1H); 7.35-7.47 (m, 3H); 7.21-7.25 (m, 1 H); 4.27 (d, J = 12 Hz, 1H); 4.11 (d, J = 12 Hz, 1H); 2.18 (s, 3H). MS (ES): m / z 319.0 (M +).

       \ global \ parskip1.000000 \ baselineskip
    

5-Chloro-2-chloromethyl-3- (2-fluorophenyl) -3H-quinazolin-4-one (2k)

Prepared according to Procedure B with 1k (1.0 g, 3.78 mmol) and chloroacetyl chloride (0.90 mL, 11.3 mmol) in acetic acid (20 mL). Purified by chromatography on CH 2 Cl 2 to provide 484 mg of a light pink solid (40%) 1 H NMR (CDCl 3) δ: 7.69 (s, 1H); 7.68 (d, J = 3.2 Hz, 1H); 7.56 (d, J = 3.0 Hz, 1H); 7.54 (d, J = 3.0 Hz, 1H); 7.40-7.47 (m, 1 H); 7.35-7.38 (m, 1 HOUR); 7.27-7.32 (m, 1 H); 4.35 (d, J = 12 Hz, 1H); 4.18 (d, J = 12 Hz, 1H). MS (ES): m / z 323.0 (M +).

       \ vskip1.000000 \ baselineskip
    

5-Chloro-2-chloromethyl-3- (2-methoxyphenyl) -3H-quinazolin-4-one (2l)

Prepared according to Procedure B with 1l (2.6 g, 9.41 mmol) and chloroacetyl chloride (2.2 mL, 28.2 mmol) in acetic acid (40 mL). Purified by chromatography on CH 2 Cl 2, followed by recrystallization with isopropanol to provide 874 mg of a light yellow solid (28%). 1 H NMR (CDCl 3) δ: 7.55-7.74 (m, 2H); 7.47-7.54 (m, 2H); 7.34 (dd, J = 1.7, 7.8 Hz, 1H); 7.13 (dt, J = 1.2, 7.7 Hz, 1H); 7.08 (dd, J = 1.0, 8.4 Hz, 1H); 4.29 (d, J = 12 Hz, 1H); 4.11 (d, J = 12 Hz, 1H); 3.80 (s, 3H). MS (ES): m / z 335.0 (M +).

       \ vskip1.000000 \ baselineskip
    

2-chloromethyl-3- (2-chlorophenyl) -8-trifluoromethyl-3H-quinazolin-4-one (2m)

Prepared according to Procedure B with 1m (500 mg, 1.59 mmol) and chloroacetyl chloride (0.38 mL, 4.77 mmol) in acetic acid (10 mL). Purified by recrystallization with isopropanol to provide 359 mg of a white crystalline solid (61%). 1 H NMR (CDCl 3) δ: 8.51 (dd, J = 1.0, 8.0 Hz, 1 HOUR); 8.14 (d, J = 7.3 Hz, 1H); 7.65 (dd, J = 2.5, 5.6 Hz, 1H); 7.62 (d, J = 3.9 Hz, 1H); 7.48-7.60 (m, 3H); 4.44 (d, J = 12 Hz, 1H), 4.12 (d, J = 12 HZ, 1H). MS (ES): m / z 373.0 (M +).

       \ vskip1.000000 \ baselineskip
    

2-chloromethyl-3- (2-chlorophenyl) -3H-benzo [g] quinazolin-4-one (2n)

Prepared according to Procedure B with 1n (500 mg, 1.68 mmol) and chloroacetyl chloride (0.40 mL, 5.05 mmol) in acetic acid (10 mL). Purified by chromatography on CH 2 Cl 2, followed by recrystallization with isopropanol to provide 232 mg of a light brown solid (39%). 1 H NMR (CDCl 3) δ: 8.92 (s, 1H); 8.29 (s, 1 H); 8.81 (d, J = 8.3, 1 HOUR); 8.32 (d, J = 8.3 Hz, 1H); 7.51-7.69 (m, 4H); 7.55 (d, J = 5.2 Hz, 1H); 7.53 (d, J = 3.8 Hz, 1H); 4.43 (d, J = 12 Hz, 1H), 4.12 (d, J = 12 Hz, 1H). MS (ES): m / z 355.0 (M +).

       \ vskip1.000000 \ baselineskip
    

2-chloromethyl-3- (2-chlorophenyl) -7-nitro-3H-quinazolin-4-one (2nd)

Prepared according to Procedure B with 1st (500 mg, 1.71 mmol) and chloroacetyl chloride (0.41 mL, 5.14 mmol) in acetic acid (10 mL). Purified by extracting Aqueous K 2 CO 3 followed by two chromatographs in CH 2 Cl 2 to provide 338 mg of a yellow oil (56%). 1 H NMR (CDCl 3) δ: 8.64 (d, J = 2.2 Hz, 1H); 8.48 (d, J = 8.8 Hz, 1H); 8.32 (dd, J = 2.2, 8.7 Hz, 1H); 7.66 (dd, J = 2.5, 6.0 Hz, 1H); 7.52-7.59 (m, 3H); 4.41 (d, J = 12 Hz, 1H), 4.10 (d, J = 12 Hz, 1H). MS (ES): m / z 350.0 (M +).

       \ vskip1.000000 \ baselineskip
    

Acetic acid ester 2-chloromethyl-3- (2-chlorophenyl) -4-oxo-3,4-dihydro-quinazolin-6-yl (2 P)

Prepared according to Procedure B with 1p (670 mg, 255 mmol) and chloroacetyl chloride (0.61 mL, 7.65 mmol) in acetic acid (10 mL). Purified by chromatography on 0-3% MeOH / CH 2 Cl 2, followed by recrystallization with isopropanol to provide 523 mg of acetate in the form of orange crystals (57%). 1 H NMR (CDCl 3) δ: 8.00 (d, J = 2.7 Hz, 1H); 7.82 (d, J = 8.8 Hz, 1 HOUR); 7.60-7.66 (m, 1 H); 7.56 (dd, J = 2.7, 8.8 Hz, 1 HOUR); 7.51 (t, J = 4.7 Hz, 2H); 7.50 (s, 1 H); 4.38 (d, J = 12 Hz, 1H), 4.08 (d, J = 12 Hz, 1H); 2.36 (s, 3H). MS (ES): m / z 363.0 (M +).

       \ vskip1.000000 \ baselineskip
    

2-Chloromethyl-3- (2-chlorophenyl) -6,7-difluoro-3H-quinazolin-4-one (2q)

Prepared according to Procedure B with 1q (700 mg, 2.48 mmol) and chloroacetyl chloride (0.60 mL, 7.43 mmol) in acetic acid (12 mL). Purified by chromatography on CH 2 Cl 2, followed by recrystallization with isopropanol to provide 219 mg of a yellow crystalline solid (26%). 1 H NMR (CDCl 3) δ: 8.07 (dd, J = 8.5, 9.7 Hz, 1H); 7.64 (dd, J = 2.5, 5.6 Hz, 1H); 7.60 (dd, J = 3.5, 11 Hz, 1H), -7.55 (q, J = 2.9 Hz, 3H); 7.52 (d, J = 1.9Hz, 1H); 7.49-7.51 (m, 1 H); 4.36 (d, J = 12 Hz, 1H), 4.06 (d, J = 12 Hz, 1H). MS (ES): m / z 341.0 (M +).

       \ vskip1.000000 \ baselineskip
    

2-chloromethyl-3- (2-chlorophenyl) -6-fluoro-3H-quinazolin-4-one (2nd)

Prepared according to Procedure B with 1st (850 mg, 3.21 mmol) and chloroacetyl chloride (0.77 mL, 9.63 mmol) in acetic acid (15 mL). Purified by extraction of Aqueous K 2 CO 3, followed by chromatography on EtOAc / hexanes. A second chromatography in acetone / hexanes provided 125 mg of a white solid (12%). 1 H NMR (CDCl 3) δ: 7.95 (dd, J = 2.9, 8.2Hz, 1H); 7.81 (dd, J = 4.8, 9.0 Hz, 1H); 7.61-7.66 (m, 1 H); 7.57 (dd, J = 2.7, 8.6 Hz, 1H); 7.57 (dd, J = 2.7, 8.6 Hz, 1H); 7.52 (dd, J = 3.2, 6.9 Hz, 1H); 7.52 (br s, 2H); 4.38 (d, J = 12 Hz, 1H), 4.08 (d, J = 12 Hz, 1H). MS (ES): m / z 323.0 (M +).

       \ vskip1.000000 \ baselineskip
    

Example 10 Preparation of PI3K? Inhibitor compounds

Compound D-001

2- (6-aminopurin-9-ylmethyl) -3- (2-chlorophenyl) -6,7-dimethoxy-3H-quinazolin-4-one

Prepared according to Procedure C using Intermediate 2a (200 mg, 0.546 mmol), adenine (81 mg, 0.601 mmol), K 2 CO 3 (83 mg, 0.601 mmol), and DMF (4 mL). The product in crude was recrystallized from (EtOH) to provide 164 mg of a beige solid (65%), mp 281.5-282.7 ° C (se decomposes). 1 H NMR (DMSO-d 6) δ: 8.06 (s, 1 H); 8.04 (s, 1 H); 7.76-7.81 (m, 1 H); 7.70-7.76 (m, 1 H); 7.60-7.67 (m, 2H); 7.45 (s, 1 H); 7.22 (s, 2H); 6.90 (s, 1 H); 5.08 (d, J = 17 Hz, 1 HOUR); 4.91 (d, J = 17 Hz, 1H); 3.87 (s, 3 H); 3.87 (s, 3H). 13 C NMR (DMSO-d6) ppm: 159.9, 156.2, 155.4, 152.9, 150.0, 149.7, 149.4, 143.0, 141.9, 133.7, 132.1, 131.9, 131.2, 130.8, 129.3, 118.4, 113.6, 108.4, 105.8, 56.5, 56.1, 44.7. MS (ES): m / z 464.1 (M +). Anal, calcd. for C_ {22} H_ {18} ClN_ {O} {3} \ cdot0.1C_ {2} H_ {6} \ \ cdot0.05KCl: C, 56.47; H, 3.97; Cl, 7.88; N, 20.76. Found: C, 56.54; H 4.05; Cl, 7.77; N, 20.55.

       \ vskip1.000000 \ baselineskip
    

Compound D-002

2- (6-aminopurin-o-ylmethyl) -6-bromo-3- (2-chlorophenyl) -3H-quinazolin-4-one

Prepared according to Procedure C using Intermediate 2b (100 mg, 0.260 mmol), adenine (39 mg, 0.286 mmol), K 2 CO 3 (40 mg, 0.286 mmol), and DMF (2 mL). The product in crude was recrystallized from EtOH to provide 52 mg of a off-white solid (41%), mp 284.2-284.7 ° C (se decomposes). 1 H NMR (DMSO-d 6) δ: 8.24 (d, J = 2.0 Hz, 1 H); 8.05 (s, 1 H); 8.03 (s, 1 H); 7.98 (dd, J = 1.9, 8.6 Hz, 1H); 7.74-7.83 (m, 2H); 7.59-7.68 (m, 2H); 7.46 (d, J = 8.7 Hz, 1H); 7.22 (s, 2H); 5.12 (d, J = 17 Hz, 1H); 4.94 (d, J = 17 Hz, 1H). 13 C NMR (DMSO-d6) ppm: 159.5, 156.2, 152.9, 152.0, 150.1, 145.8, 141.8, 138.4, 133.1, 132.2, 131.9, 131.1, 130.9, 130.1, 129.4, 128.9, 122.4, 120.4, 118.4, 45.0, MS (ES): m / z 482.0 (M +). Anal, calcd. for C 20 H 13 ClBrN 7 O \ Kd0.1.KCl: C, 49.01; H, 2.67; Cl, 7.96; N, 20.00. Found: C, 48.82; H 2.82; Cl, 8.00; N, 19.79.

       \ vskip1.000000 \ baselineskip
    

Compound D-003

2- (6-aminopurin-o-ylmethyl) -3- (2-chlorophenyl) -7-fluoro-3H-quinazolin-4-one

Prepared according to Procedure C using Intermediate 2c (100 mg, 0.310 mmol), adenine (46 mg, 0.340 mmol), K 2 CO 3 (47 mg, 0.340 mmol), and DMF (1 mL). The product in crude was recrystallized from EtOH to provide 57 mg of a beige solid (44%), mp 216.8-217.2 ° C. 1 H NMR (DMSO-d_ {6}) δ: 8.22 (dd, J = 6.3, 8.7 Hz, 1 HOUR); 8.05 (s, 1 H); 8.03 (s, 1 H); 7.78-7.80 (m, 2H); 7.61-7.64 (m, 2H); 7.46 (dt, J = 2.1, 8.6 Hz, 1H); 7.32 (d, J = 9.8 Hz, 1H); 7.22 (s, 2H); 5.13 (d, J = 17 Hz, 1H); 4.95 (d, J = 17 Hz, 1H). 13 C NMR (DMSO-d 6) ppm: 166.1 (d, J = 253 Hz), 159.6, 155.8, 152.5, 149.7, 148.6 (d, J = 14 Hz), 141.4, 132.8, 131.8, 131.6, 130.8, 130.5, 129.8, (d, J = 11 Hz), 129.0 118.1, 117.4, 116.2 (d, J = 24 Hz), 112.7 (d, J = 22 Hz), 44.6. MS (ES): m / z 422 0 (M +). Anal. calcd. for C 20 H 13 ClFN 7 O 2 H (0.15KCl: C, 55.25; H, 3.06; Cl, 9.38; N, 22.55. Found: C, 55.13; H, 2.92; Cl, 9.12; N, 22.30.

       \ vskip1.000000 \ baselineskip
    

Compound D-004

2- (6-aminopurin-9-ylmethyl) -6-chloro-3- (2-chlorophenyl) -3H-quinazolin-4-one

Prepared according to Procedure C using Intermediate 2d (100 mg, 0.294 mmol), adenine (44 mg, 0.323 mmol), K 2 CO 3 (45 mg, 0.323 mmol), and DMF (1 mL). The product in crude was recrystallized from EtOH to provide 50 mg of a yellow solid (39%), mp 294.5-294.8 ° C (se decomposes) 1 H NMR (DMSO-d 6) δ: 8.10 (d, J = 2.2 Hz, 1H); 8.05 (s, 1 H); 8.03 (s, 1 H); 7.86 (dd, J = 2.4, 8.8 Hz, 1H); 7.75-7.82 (m, 2H); 7.59-7.67 (m, 2H); 7.53 (d, J = 8.7 Hz, 1H); 7.22 (br s, 2H); 5.13 (d, J = 17 Hz, 1H); 4.95 (d, J = 17 Hz, 1H). 13 C NMR (DMSO-d6) ppm: 159.7, 156.2, 152.9, 151.9, 150.1, 145.5, 141.8, 135.7, 133.1, 132.3, 132.2, 131.9, 131.1, 130.9, 130.0, 129.4, 125.9, 122.0, 118.4, 44.9. MS (ES): m / z 438.0 (M +). Anal. calcd. for C 20 H 13 Cl 2 N 7 O: C, 54.81; H, 2.99; N, 22.37. Found: C, 54.72; H, 2.87; N, 22.18.

       \ newpage
    

       \ global \ parskip0.900000 \ baselineskip
    

Compound D-005

2- (6-aminopurin-9-ylmethyl) -3- (2-chlorophenyl) -5-fluoro-3H-quinazolin-4-one

Prepared according to Procedure C using Intermediate 2e (200 mg, 0.619 mmol), adenine (92 mg, 0.681 mmol), K 2 CO 3 (94 mg, 0.680 mmol), and DMF (4 mL). The crude product was chromatographed on MeOH / CH 2 Cl 2 to provide 168 mg of an off-white solid (64%), mp 159-172 ° C (gradually decomposes). 1 H NMR
(DMSO-d_ {6}) δ: 8.10 (s, 1H); 8.08 (s, 1 H); 7.73-7.89 (m, 3H); 7.57-7.71 (m, 2H); 7.37-7.48 (m, 2H); 7.34 (d, J = 11 Hz, 1H); 7.30 (d, J = 8.3 Hz, 1H); 5.14 (d, J = 17 Hz, 1H); 4.94 (d, J = 17Hz, 1H). 13 C NMR (DMSO-d 6) ppm: 160.8 (d, J = 264 Hz), 157.5 (d, J = 4.2 Hz), 155.8, 152.4, 152.4, 150.0, 148.7, 142.1, 136.4 ( d, J = 11 Hz), 133.0, 132.2, 132.1, 131.2, 130.9, 129.4, 123.8 (d, J = 3.6 Hz), 118.4, 114.5 (d, J = 20 Hz), 110.2 (d, J = 6.0 Hz), 44.9, MS (ES): m / z 422.0 (M +). Anal. calcd. for C 20 H 13 ClFN 7 O; C, 56.95; H, 3.11; Cl, 8.40; N, 23.24. Found: C, 54.62; H, 3.32; Cl, 9.40; M, 21.29.

       \ vskip1.000000 \ baselineskip
    

Compound D-006

2- (6-aminopurin-o-ylmethyl) -5-chloro-3- (2-chlorophenyl) -3H-quinazolin-4-one

Prepared according to Procedure C using Intermediate 2f (300 mg, 0.883 mmol), adenine (131 mg, 0.972 mmol), K 2 CO 3 (134 mg, 0.972 mmol), and DMF (4 mL). The product in crude was chromatographed on MeOH / CH2Cl2 and recrystallized of EtOH to provide 188 mg of an orange crystalline solid clear (49%), mp 245.7-246.0 ° C (begins to perspire at 220 ° C). 1 H NMR <DMSO-d 6) δ: 8.06 (s, 1 H); 8.04 (s, 1 H); 7.76-7.81 (m, 2H); 7.72 (d, J = 8., 0 Hz, 1H); 7.59-7.66 (m, 3H); 7.41 (d, J = 8.1 Hz, 1H); 7.26 (br S, 2H); 5.11 (d, J = 17 Hz, 1H); 4.93 (d, J = 17 Hz, 1H), 13 C NMR (DMSO-6) pmm: 158.5, 156.2, 152.9, 152.2, 150.1, 149.2, 141.8, 135.4, 133.3, 133.2, 132.1, 132.0, 131.2, 130.4, 129.4, 127.3, 118.4, 117.7, 44.9. MS (ES): m / z 438.0 (M +). Anal. calcd. for C_ {20} H_ {13} Cl_ {2} N_ {7} O \ cdot0.1C_ {2} H_ {6} O \ cdot0.05H_ {2} O: C, 54.67; H, 3.11; Cl, 15.98; N, 22.09. Found: C, 54.35; H 3.00; Cl, 15.82; N, 22.31.

       \ vskip1.000000 \ baselineskip
    

Compound D-007

2- (6-aminopurin-9-ylmethyl) -3- (2-chlorophenyl) -5-methyl-3H-quinazolin-4-one

Prepared according to Procedure C using Intermediate 2g (250 mg, 0.783 mmol), adenine (116 mg, 0.862 mmol), K 2 CO 3 (119 mg, 0.862 mmol), and DMF (4 mL). The product in crude was recrystallized from EtOH to provide 93 mg of a light yellow solid (28%), mp 190.7-190.9 ° C. 1 H NMR (DMSO-d 6) δ: 8.05 (s, 1H); 8.03 (s, 1 H); 7.76-7.79 (m, 1H), 7.71-7.74 (m, 1 H); 7.59-7.67 (m, 1 HOUR); 7.34 (d, J = 7.4 Hz, 1H); 7.28 (d, J = 8.2 Hz, 1H); 7.24 (br s, 2H); 5.07 (d, J = 17 Hz, 1H); 4.92 (d, J = 17 Hz, 1H); 2.73 (s, 3H), 13 C NMR (DMSO-d 6) ppm: 161.1, 156.2, 152.8, 150.9, 150.1, 148.3, 141.9, 141.0, 134.6, 133.6, 132.2, 131.9, 131.3, 130.8, 130.3, 129.3, 125.9, 119.1, 118.4, 44.8, 22.8. MS (ES): m / z 418.1 (M +). Anal, calcd, for C 21 H 16 ClN 7 O • H 2 O: C, 57.87; H, 4.16; Cl, 8.13; N, 22.49. Found: C, 57.78; H, 3.99; Cl, 8.38; N, 22.32.

       \ vskip1.000000 \ baselineskip
    

Compound D-008

2- (6-aminopurin-9-ylmethyl) -8-chloro-3- (2-chlorophenyl) -3H-quinazolin-4-one

Prepared according to Procedure C using Intermediate 2h (100 mg, 0.294 mmol), adenine (44 mg, 0.324 mmol), K 2 CO 3 (45 mg, 0.324 mmol), and DMF (1 mL). The product in crude was chromatographed on MeOH / CH 2 Cl 2 to provide 50 mg of a light yellow solid (39%), mp 273.3-273.5 ° C (discolors). 1 H NMR (DMSO-d_ {6}) δ: 8.11 (dd, J = 1.3, 8.0 Hz, 1 HOUR); 8.08 (s, 1 H); 8.05 (s, 1 H); 8.00 (dd, J = 1.3, 7.8Hz, 1H); 7.79-7.83 (m, 2H); 7.63-7.66 (m, 2H); 7.56 (t, J = 7.9Kz, 1H); 7.21 (br s, 2H); 5.17 (d, J = 17 Hz, 1H); 4.97 (d, J = 17 Hz, 1H). 13 C NMR (DMSO-d 6) ppm: 160.2, 156.1, 152.8, 152.2, 150.2, 143.3, 142.0, 135.6, 133.1, 132.3, 131.9, 131.1, 131.0, 130.9, 129.4, 128.4, 126.0, 122.5, 118.4, 45.0. MS (ES): m / z 438.0 (M +). Anal. calcd. for C_ {20} H_ {13} Cl_ {2} N_ {7} O \ cdot0.1CH_ {4} O \ cdot0.6H_ {2} (0.15KCl: C, 52.09; H, 3.18; N, 21.15. Found: C, 51.85; H, 2.93; N, 21.01.

       \ vskip1.000000 \ baselineskip
    

Compound D-009

2- (6-aminopurin-9-ylmethyl) -3-biphenyl-2-yl-5-chloro-3H-quinazolin-4-one

Prepared according to Procedure C using Intermediate 2i (400 mg, 1.05 mmol), adenine (155 mg, 1.15 mmol), K 2 CO 3 (159 mg, 1.15 mmol), and DMF (5 mL). The product in crude was recrystallized from EtOH to provide 344 mg of a white solid (68%), mp 299.9-300.1 ° C (discolors). 1 H NMR (DMSO-d 6) δ: 8.08 (s, 1H); 7.89 (s, 1 H); 7.58-7.73 (m, 5H); 7.51 (d, J = 7.9 Hz, 1 HOUR); 7.46 (d, J = 1.5 Hz, 2H); 7.27-7.41 (m, 3H); 7.14-7.27 (m, 3H); 5.14 (d, J = 17 Hz, 1H); 4.82 (d, J = 17 Hz, 1H). 13 C NMR (DMSO-d 6) ppm: 159.6, 156.2, 152.8, 152.5, 150.0, 149.0, 141.7, 140.2, 137.7, 135.0, 133.3, 133.2, 131.8, 130.7, 130.1, 129.8, 129.5, 128.8, 128.6, 128.4, 127.1, 118.4, 117.6, 45.3. MS (ES): m / z 480.1 (M +). Anal. calcd. for C 26 H 18 ClN 7 O: C, 65.07; H, 3.78; Cl, 7.39; N, 20.43. Found: C, 64.77; H, 3.75; Cl, 7.43; N, 20.35.

       \ global \ parskip1.000000 \ baselineskip
    

Compound D-010

5-Chloro-2- (9H-purin-6-ylsulfanylmethyl) -3-o-tolyl-3H-quinazolin-4-one

Prepared according to Procedure C using Intermediate 2j (200 mg, 0.626 mmol), 6-mercaptopurine monohydrate (93 mg, 0.546 mmol), K 2 CO 3 (95 mg, 0.689 mmol), and DMF (4 mL). The product in crude was recrystallized from EtOH to provide 125 mg of a off-white solid (46%), mp 213.9 ° C. 1 H NMR (DMSO-d_ {6}) δ: 13.53 (br s, 1H); 8.49 (s, 1 HOUR); 8.44 (s, 1 H); 7.78 (t, J = 7.9 Hz, 1.H); 7.63 (d, J = 8.2 Hz, 1H); 7.59 (d, J = 7.7 Hz, 1H); 7.49 (d, J = 6.9 Hz, 1H); 7.24-7.41 (m, 3H); 4: 32-4.45 (m, 2H); 2.14 (s, 3H). 13 C NMR (DMSO-d 6) ppm: 158.9, 157.2, 154.2, 151.5, 149.6, 143.5, 136.1, 135.9, 135.1, 133.2, 131.3, 130.3, 130.0, 129.9, 129.1, 127.6, 127.1, 32.4, 17.5. MS (ES): m / z 438.0 (M +). Anal. calcd. for C_ {21} H_ {15} ClN_ {OS}. -C, 58.00; H, 3.48; Cl, 8.15; N, 19.32; S, 1.31. Found: C, 58.05; H, 3.38; Cl, 8.89; N, 18.38; S, 7.00

       \ vskip1.000000 \ baselineskip
    

Compound D-011

5-Chloro-3- (2-fluorophenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one

Prepared according to Procedure C using Intermediate 2k (210 mg, 0.650 mmol), 6-mercaptopurine monohydrate (122 mg, 0.715 mmol), K 2 CO 3 (99 mg, 0.715 mmol), and DMF (4 mL). The product in crude was recrystallized from EtOH to provide 240 mg of a off-white solid (84%), mp 244.0 ° C. 1 H NMR (DMSO-d_ {6}) δ: 13.56 (br s, 1H); 8.50 (s, 1 HOUR); 8.45 (s, 1 H); 7.81 (t, J = 8.0 Hz, 1H); 7.74 (t, J = 7.7 Hz, 1H); 7.67 (d, J = 8.1 Hz, 1H); 7.62 (d, J = 7.7 Hz, 1H); 7.46-7.55 (m, 1 H); 7.29-7.42 (m, 2H); 4.47-4.59 (m, 2H). 13 C NMR (DMSO-d6) ppm: 158.4, 157.3 (d, J = 249 Hz), 156.4, 153.8, 151.0, 149.1, 143.2, 135.0, 132.9, 131.8 (d, J = 8.0 Hz), 130.8, 129.9, 126.7, 125.3 (d, J = 3.5 Hz), 123.6 (d, J = 13 Hz), 117.0, 116.2 (d, J = 19 Hz), 31.7. MS (ES): m / z 439.0 (M +). Anal. calcd. for C 20 H 12 ClFN 6 OS; C, 54.74; H, 2.76; Cl, 8.08; N, 19.15; S, 7.31. Found: C, 54.42; H, 2.88; Cl, 8.08; N, 18.87; S, 7.08.

       \ vskip1.000000 \ baselineskip
    

Compound D-012

2- (6-aminopurin-9-ylmethyl) -5-chloro-3- (2-fluorophenyl) -3H-quinazolin-4-one

Prepared according to Procedure C using Intermediate 2k (210 mg, 0.650 mmol), adenine (97 mg, 0.715 mmol), K 2 CO 3 (99 mg, 0.715 mmol), and DMF (4 mL). The product in crude was recrystallized from EtOH to provide 137 mg of a light brown solid (50%), mp 295.6-295.8 ° C (se decomposes). 1 H NMR (DMSO-d 6) δ: 8.05 (s, 1 H); 8.04 (s, 1 H); 7.75 (t, J = 7.6 Hz, 1H); 7.74 (t, J = 7.9 Hz, 1H); 7.62-7.69 (m, 1 H); 7.61 (d, J = 7.6 Hz, 1H); 7.47-7.55 (m, 1 H); 7.48 (d, J = 7.8 Hz, 1H); 7.41 (d, J = 8.0 Hz, 1H); 7.24 (br S, 2H); 5.19 (d, J = 17 Hz, 1H); 5.03 (d, J = 17 Hz, 1H); 13 C NMR (DMSO-d 6) ppm: 158.7, 157.6 (d, J = 250 Hz), 156.2, 152.8, 152.4, 150.0, 149.2, 141.8, 135.4, 133.3, 132.5 (d, J = 8.0 Hz), 131.0, 130.4, 127.3, 126.2 (d, J = 3.5 Hz), 123.1 (d, J = 14 Hz), 118.4, 117.6, 117.2 (d, J = 19 Hz), 45.1. MS (ES): m / z 422.0 (M +). Anal. calcd. for C 20 H 13 ClFN 7 O 0.05C 2 H 6 O: C, 56.92; H 3.16; Cl, 8.36; N, 23.12. Found: C, 56.79; H, 3.20; Cl, 8.46; N, 22.79.

       \ vskip1.000000 \ baselineskip
    

Compound D-013

3-biphenyl-2-yl-5-chloro-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one

Prepared according to Procedure C using Intermediate 2i (400 mg, 1.05 mmol), 6-mercaptopurine monohydrate (196 mg, 1.15 mmol), K 2 CO 3 (159 mg, 1.15 mmol), and DMF (5 mL). The product in crude was chromatographed on MeOH / CH2Cl2 and subsequently recrystallized from EtOH to provide 439 mg of a solid light yellow crystalline lens (84%), mp 222.0-222.5 ° C (dec.). 1 H NMR (DMSO-d 6) δ: 13.56 (br s, 1H); 8.55 (s, 1 H); 8.45 (s, 1 H); 7.73 (t, J = 8.0 Hz, 1H); 7.64 (d, J = 7.7 Hz, 1H); 7.50-7.59 (m, 4H); 7.41-7.48 (m, 1 H); 7.25-7.38 (m, 5H); 4.41 (d, J = 16 Hz, 1H); 4.16 (d, J = 16 Hz, 1H). 13 C NMR (DMSO-d6) ppm: 160.2, 157.0, 153.7, 151.5, 149.7, 149.3, 143.5, 139.9, 137.8, 135.1, 134.1, 133.3, 131.5, 130.5, 130.3, 129.1, 128.9, 128.4, 128.4, 126.9, 117.5, 32.3. MS (ES): m / z 497.0 (M +). Anal. calcd. For C 26 H 17 ClN 6 OS: C, 62.84; H, 3.45; Cl, 7.13; N, 16.91; S, 6.45. Found: C, 62.60; H, 3.47; Cl, 7.15; N, 16.65; S, 6.41.

       \ vskip1.000000 \ baselineskip
    

Compound D-014

5-Chloro-3- (2-methoxyphenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one

Prepared according to Procedure C using Intermediate 21 (250 mg, 0.746 mmol), 6-mercaptopurine monohydrate (140 mg, 0.821 mmol), K 2 CO 3 (113 mg, 0.821 mmol), and DMF (4 mL). The product in crude was recrystallized from EtOH to provide 254 mg of a off-white solid (76%), mp 237.0 ° C (dec .; discolors at 154.6 ° C). 1 H NMR (DMSO-d 6) δ: 13.53 (br s, 1 HOUR); 8.52 (s, 1 H); 8.45 (s, 1 H); 7.78 (t, J = 7.9 Hz, 1H); 7.64 (d, J = 8.0 Hz, 1H); 7.59 (d, J = 7.7 Hz, 1H); 7.48 (d, J = 7.3 Hz, 1H); 7.42 (t, J = 7.7 Hz, 1H); 7.15 (d, J = 8.2 Hz, 1H); 7.03 (t, J = 7.5 Hz, 1H); 4.45 (s, 2H); 3.76 (s, 3H). 13 C NMR (DMSO-d6) ppm: 158.9, 157.1, 154.8, 154.7, 151.5, 149.6, 143.6, 135.1, 133.2, 131.3, 130.4, 130.0, 127.0, 124.8, 121.2, 117.8, 112.7, 56.1, 32.0. MS (ES): m / z 451.0 (M +). Anal. calcd. for C_ {21} H_ {15} ClN_ {6} O_ {2} S \ cdot0.15C_ {2} H_ {6} O \ cdot0.05KCl: C, 55.43; H, 3.47; Cl, 8.07; N, 18.21; S, 6.95. Found: C, 55.49; H, 3.68; Cl, 7.95; N, 17.82; S, 6.82.

       \ vskip1.000000 \ baselineskip
    

Compound D-015

3- (2-Chlorophenyl) -5-fluoro-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one

Prepared according to Procedure C using Intermediate 2e (200 mg, 0.619 mmol), 6-mercaptopurine monohydrate (116 mg, 0.681 mmol), K 2 CO 3 (94 mg, 0.681 mmol), and DMF (5 mL). The product in crude was recrystallized from EtOH to provide 152 mg of a white solid (56%), mp 222.7-223.8 ° C (discolors). 1 H NMR (DMSO-d 6) δ: 13.56 (br s, 1 HOUR); 8.48 (s, 1 H); 8.44 (s, 1 H); 7.89 (dt, J = 5.6, 8.1 Hz, 1H); 7.76 (dd, J = 1.6, 7.3 Hz, 1H); 7.67 (d, J = 7.4 Hz, 1H); 7.56 (d, J = 8.1 Hz, 1 HOUR); 7.47 (t, J = 7.1 Hz, 1H), 7.41-7.53 (m, 2H); 7.37 (dd, J = 8.7, 11 Hz, 1H); 4.38-4.52 (m, 2H). 13 C NMR (DMSO-d6) ppm: 160.9 (d, J = 264 Hz), 157.6, 156.8, 154.1, 151.5, 149.6, 149.0, 143.6, 136.4 (d, J = 11 Hz), 133.9, 132.2, 131.7, 131.6, 130.5, 130.2, 128.8, 123.6, 114.4 (d, J = 20 Hz), 110.2, 32.0. MS (ES): m / z 439.0 (M +). Anal. calcd. for C 20 H 12 ClFN 6 OS C 0.5 H 6 O: C, 54.61; H 3.27; Cl, 7.68; N, 18.19; S, 6.94. Found: C, 54.37; H, 3.26; Cl, 7.89; N, 18.26; S, 6.55.

       \ vskip1.000000 \ baselineskip
    

Compound D-016

3- (2-Chlorophenyl) -6,7-dimethoxy-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one

Prepared according to Procedure C using Intermediate 2a (200 mg, 0.546 mmol), 6-mercaptopurine monohydrate (102 mg, 0.601 mmol), K 2 CO 3 (83 mg, 0.601 mmol), and DMF (5 mL). The product in crude was recrystallized from EtOH to provide 172 mg of a off-white solid (65%), mp 160-180 ° C (se decomposes gradually). 1 H NMR (DMSO-d 6) δ: 13.55 (br s, 1H); 8.49 (s, 1 H); 8.44 (s, 1 H); 7.72 (d, J = 6.9 Hz, 1H); 7.66 (d, J = 6.9 Hz, 1H) 7.38-7.54 (m, 3H); 7.22 (s, 1 H); 4.36-4.52 (m, 2H); 3.94 (s, 3 H); 3.89 (s, 3H). 13 C NMR (DMSO-d 6) ppm: 160.1, 155.4, 151.5, 151.1, 149.4, 143.2, 134.6, 132.3, 131.6, 131.5, 130.4, 128.7, 113.6, 108.4, 105.8, 56.5, 56.1, 32.0. MS (ES): m / z 481.1 (M +). Anal. calcd. for C_ {22} H_ {17} ClN_ {O} {3} S \ cdot0.5C_ {2} H_ {6} O \ cdot0.05KCl: C, 54.41; H, 3.97; Cl, 7.33; N, 16.55; S, 6.32. Found: C, 54.43; H, 3.94; Cl, 7.69; N, 16.69; S, 6.52.

       \ vskip1.000000 \ baselineskip
    

Compound D-017

6-Bromo-3- (2-chlorophenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one

Prepared according to Procedure C using Intermediate 2b (200 mg, 0.519 mmol), 6-mercaptopurine monohydrate (97 mg, 0.570 mmol), K 2 CO 3 (79 mg, 0.572 mmol), and DMF (5 mL). The product in crude was recrystallized from EtOH to provide 123 mg of a off-white solid (47%), mp 212-242 ° C (se decomposes gradually). 1 H NMR (DMSO-d 6) δ: 13.07 (br s, 1H); 8.48 (s, 1 H); 8.44 (s, 1 H); 8.24 (d, J = 2.3 Hz, 1H); 8.06 (dd, J = 2.3, 8.7 Hz, 1H); 7.76 (dd, J = 1.9, 7.4 Hz, 1H); 7.70 (d, J = 8.7 Hz, 1H); 7.66 (d, J = 8.1 Hz, 1H); 7.51 (dd, J = 2.1, 7.9 Hz, 1H); 7.46 (dd, J = 1.9, 7.9 Hz, 1H); 4.47 (a, 2H). 13 C NMR (DMSO-d 6) ppm: 159.7, 156.8, 153.6, 151.5, 146.1, 143.6, 138.5, 134.0, 132.1, 131.8, 131.5, 130.5, 130.2, 129.9, 128.9, 128.8, 122.2, 120.3, 32.0. MS (ES): m / z 499.0 (M +). Anal. calcd. for C_ {20} H_ {12} ClBrN_ {6} OS \ cdot0.2C_ {2} H_ {6} O \ cdot0.05KCl: C, 47.79; H, 2.59; N, 16.39; S, 6.25. Found: C, 47.56; H, 2.54; N, 16.25; S, 6.58.

       \ vskip1.000000 \ baselineskip
    

Compound D-018

3- (2-Chlorophenyl) - (9H-purin-6-ylsulfanylmethyl) -trifluoromethyl-3H-quinazolin-4-one

Prepared according to Procedure C using Intermediate 2m (200 mg, 0.536 mmol), 6-mercaptopurine monohydrate (100 mg, 0.588 mmol), K 2 CO 3 (82 mg, 0.593 mmol), and DMF (4 mL). The product in crude was recrystallized from EtOH to provide 148 mg of a white solid (56%), mp 218.5-219.4 ° C. 1 H NMR (DMSO-d_ {6}) δ: 13.52 (br S, 1H); 8.48 (s, 1 HOUR); 8.44 (s, 1 H); 8.43 (d, J = 6.0 Hz, 1H); 8.26 (d, J = 7.5 Hz, 1H); 7.84 (dd, J = 2.5, 6.7 Hz, 1H); 7.70-7.75 (m, 2H); 7.51-7.59 (m, 2H); 4.40-4.55 (m, 2H). 13 C NMR (DMSO-d 6) ppm: 160.0, 157.2, 154.2, 151.4, 149.6, 144.4, 143.4, 133.8, 133.0 (q, J = 5.1 Hz), 132.0, 131.9, 131.6, 131.4, 130.6, 129.0, 127.3, 125.2 (q, J = 30 Hz), 123.6 (q, J = 273 Hz), 121.8, 32.6. MS (ES): m / z 489.0 (M +). Anal. calcd. for C 21 H 12 ClF 3 N 6 OS: C, 51.59; H, 2.47; Cl, 7.25; N, 17.19; S, 6.56. Found: C, 51.51; H, 2.55; Cl, 7.37; N, 17.05; S, 6.38.

       \ newpage
    

Compound D-019

3- (2-Chlorophenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-benzo [g] quinazolin-4-one

Prepared according to Procedure C using Intermediate 2n (200 mg, 0.563 mmol), 6-mercaptopurine monohydrate (105 mg, 0.619 mmol), K 2 CO 3 (86 mg, 0.619 mmol), and DMF (4 mL). The product in crude was recrystallized from EtOH to provide 128 mg of a dark yellow solid (48%), mp 247.8-254.4 ° C (se decomposes). 1 H NMR (DMSO-d 6) δ: 13.56 (br s, 1 H); 8.90 (S, 1H); 8.50 (s, 1 H); 8.46 (s, 1 H); 8.34 (s, 1 HOUR); 8.27 (d, J = 8.2 Hz, 1H); 8.16 (d, J = 8.2 Hz, 1H); 7.81 (dd, J = 1.6, 7.3 Hz, 1H); 7.70 (t, J = 7.5 Hz, 1H); 7.61-7.74 (m, 2H); 7.49 (t, J = 7.5 Hz, 1H); 7.44-7.53 (m, 1 H); 4.44-4.56 (m, 2H). 13 C NMR (DMSO-d 6) ppm: 161.3, 151.6, 151.5, 143.9, 142.2, 136.7, 134.4, 131.8, 131.6, 130.5, 129.7, 129.3, 128.8, 128.6, 128.3, 127.1, 125.2, 119.5, 32.4. MS (ES): m / z 471.0 (M +). Anal. calcd. for C_ {24} H_ {15} ClN_ {6} OS \ cdot0.2C_ {2} H_ {6} O \ cdot0.05KCl: C, 60.57; H, 3.37; Cl, 7.69; N, 17.37; S, 6.63. Found: C, 60.24; H, 3.46; CL, 7.50; N, 17.34; S, 6.69.

       \ vskip1.000000 \ baselineskip
    

Compound D-020

6-Chloro-3- (2-chlorophenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one

Prepared according to Procedure C using Intermediate 2d (200 mg, 0.587 mmol), 6-mercaptopurine monohydrate (110 mg, 0.646 mmol), K 2 CO 3 (90 mg, 0.651 mmol), and DMF (5 mL). The product in crude was recrystallized from EtOH to provide 113 mg of a yellow crystalline solid (42%), mp 237.1-238.2 ° C (It decomposes). 1 H NMR (DMSO-d 6) δ: 13.55 (br s, 1H); 8.48 (s, 1 H); 8.44 (s, 1 H); 8.11 (s, 1 HOUR); 7.94 (d, J = 8.3 Hz, 1H); 7.78 (d, J = 8.1 Hz, 2H); 7.66 (d, J = 6.7 Hz, 1H); 7.48-7.56 (m, 2H); 4.48 (s, 2H). 13 C NMR (DMSO-d6) ppm: 159.8, 156.8, 153.5, 151.5, 149.6, 145.8, 143.6, 135.7, 134.0, 132.2, 132.1, 131.7, 131.5, 130.5, 130.2, 129.8, 128.8, 125.8, 121.9, 32.0. MS (ES): m / z 455.0 (M +). Anal. calcd. for C_ {20} H_ {12} Cl_ {2} N_ {6} OS \ cdot0.1C_ {2} H_ {6} \ \ cdot0.6H_ {2} (0.15KCl: C, 50.34; H, 2.89; Cl, 15.82; N, 17.44; S, 6.65 = Found; C, 50.02; H, 2.63; Cl, 15.51; N, 17.39; S, 6.81.

       \ vskip1.000000 \ baselineskip
    

Compound D-021

8-Chloro-3- (2-chlorophenyl) 2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one

Prepared according to Procedure C using Intermediate 2h (200 mg, 0.589 mmol), 6-mercaptopurine monohydrate (124 mg, 0.726 mmol), K 2 CO 3 (100 mg, 0.726 mmol), and DMF (4 mL). The product in crude was recrystallized from EtOH to provide 202 mg of a white solid (75%), mp 211.9-212.7 ° C (se decomposes). 1 H NMR (DMSO-d 6) δ: 13.54 (br s, 1 H); 8.47 (s, 1 H); 8.44 (s, 1 H); 8.12 (d, J = 7.9 Hz, 1 HOUR); 8.07 (d, J = 7.6 Hz, 1H); 7.78 (d, J = 7.5 Hz, 1H); 7.67 (d, J = 7.1 Hz, 1H); 7.58 (t, J = 7.9 Hz, 1H); 7.42-7.54 (m, 2H); 4.52 (s, 2H). 13 C NMR (DMSO-d 6) ppm: 160.3, 156.9, 153.9, 151.5, 149.7, 143.5, 135.7, 134.0, 132.1, 131.8, 131.4, 131.1, 130.5, 130.3, 128.9, 128.3, 126.1, 122.4, 32.5. MS (ES): m / z 455.0 (M +). Anal. calcd. for C 20 H 12 Cl 2 N 6 OS: C, 52.76; H, 2.66; Cl, 15.57; N, 18.46; S, 7.04: Found: C, 52.65; H, 2.79; Cl, 15.32; N, 18.47; S, 7.18.

       \ vskip1.000000 \ baselineskip
    

Compound D-022

3- (2-chlorophenyl) -7-fluoro-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one

Prepared according to Procedure C using Intermediate 2c (200 mg, 0.619 mmol), 6-mercaptopurine monohydrate (116 mg, 0.681 mmol), K 2 CO 3 (95 mg, 0.687 mmol), and DMF (4 mL). The product in crude was recrystallized from EtOH to provide 143 mg of a white crystalline solid (53%), mp 151.4-154.2 ° C (se discolored) 1 H NMR (DMSO-d 6) δ: 13.55 (br s, 1 H); 8.48 (s, 1 H); 8.44 (s, 1 H); 8.23 (dd, J = 6.3, 8.7 Hz, 1H); 7.77 (dd, J = 1.7, 7.4 Hz, 1H); 7.64 (d, J = 74 Hz, 1H); 7.57 (d, J = 9.8 Hz, 1H); 7.45-7.52 (m, 3H); 4.48 (s, 2H). 13 C NMR (DMSO-d 6) ppm: 169.0 (d, J = 253 Hz), 162.6, 159.3, 157.0, 154.0, 152.2, 151.7 (d, J = 13 Hz), 146.1, 136.5, 134.7, 134.2, 134.0, 133.0, 132.6 (d, J = 11 Hz), 131.3, 120.2, 118.9 (d, J = 24 Hz), 115.3 (d, J = 22 Hz), 34.6, MS (ES): m / z 439.0 (M +). Anal. calcd. for C_20 H12 {ClFN_ {6} OS \ cdot0.4-C_2H_ {6} O \ cdot0.4H_ {2} (0.15KCl: C, 52.52; H, 3.22; Cl, 8.57; N, 17.67. Found: C, 52.25; H 3.11; Cl, 8.20; N, 17.69.

       \ vskip1.000000 \ baselineskip
    

Compound D-023

3- (2-Chlorophenyl) -7-nitro-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one

Prepared according to Procedure C using Intermediate 2nd (216 mg, 0.617 mmol), 6-mercaptopurine monohydrate (116 mg, 0.681 mmol), K 2 CO 3 (94 mg, 0.680 mmol), and DMF (4 mL). The product in crude was recrystallized from EtOH to provide 212 mg of a yellow crystalline solid (74%), mp 218.0-218.3 ° C (It decomposes). 1 H NMR (DMSO-d 6) δ: 13.56 (br s, 1H); 8.49 (s, 1 H); 8.42 (s, 1 H); 8.38-8.45 (m, 2H); 8.31 (d, J = 8.4 Hz, 1H); 7.81 (d, J = 6.5 Hz, 1H); 7.68 (d, J = 6.7 Hz, 1H); 7.43-7.58 (m, 2H); 4.53 (s, 2H). 13 C NMR (DMSO-d 6) ppm: 157.7, 154.4, 153.3, 149.8, 149.3, 147.6, 145.2, 141.4, 131.5, 129.8, 129.7, 129.2, 1.28.4, 127.1, 126.7, 122.7, 120.3, 119.4, 29.9. MS (ES): m / z 466.0 (M +). Anal. calcd. for C_ {20} H_ {12} ClN_ {O} {3} S \ cdot0.4C_ {2} H_ {6} O \ cdot0.05KCl: C, 51.19; H, 2.97; Cl, 7.63; N, 20.09; S, 6.57. Found: C, 51.27; H, 2.88; Cl, 7.40; N, 20.04; S, 6.52.

       \ vskip1.000000 \ baselineskip
    

Compound D-024

3- (2-Chlorophenyl) -6-hydroxy-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one

Prepared according to Procedure C using Intermediate 2p (200 mg, 0.552 mmol), 6-mercaptopurine monohydrate (117 mg, 0.685 mmol), K2CO3 (95 mg, 0.687 mmol), and DMF (4 mL ). The crude product was recrystallized from EtOH to provide 182 mg of a white solid, a mixture of the desired product and the acetyl derivative. A portion of this material (120 mg) was suspended in a mixture of MeOH (2 mL) and aqueous NaHCO3 (satd., 1 mL) and stirred rapidly for 4 hours. The mixture was concentrated in vacuo , suspended in H2O (10 mL), and stored at 4 ° C overnight. The white solid was collected and dried at 103 mg (66%), mp 186-214 ° C (gradually decomposes). 1 H NMR (DMSO-d 6) δ: 8.48 (s, 1H); 8.45 (s, 1 H); 7.71 (d, J = 6.8 Hz, 1H); 7.62-7.64 (m, 2H); 7.43-7.51 (m, 2H); 7.40-7.43 (m, 1 H); 7.35 (d, J = 8.8 Hz, 1H); 4.39-4.52 (m, 2H). 13 C NMR (DMSO-d 6) ppm: 160.6, 157.1, 156.2, 151.4, 150.8, 149.3, 144.1, 140.2, 134.5, 132.2, 131.6, 131.4, 130.4, 129.3, 128.7, 124.8, 121.7, 109.8, 32.0. MS (ES): m / z 437.0 (M +). Anal. calcd. for (2 C 20 H 13 ClN 6 O 2 S 2 0.1C 2 H 6 O 6 H 2 O: C, 49.68; H, 3.88; Cl, 7.26 ; N, 17.21 / S, 6.57. Found: C, 49.43; H, 3.62; Cl, 7.32; N, 17.07; S, 6.58.

       \ vskip1.000000 \ baselineskip
    

Compound D-025

5-Chloro-3- (2-chlorophenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one

Prepared according to Procedure C using Intermediate 2f (300 mg, 0.883 mmol), 6-mercaptopurine monohydrate (165 mg, 0.972 mmol), K 2 CO 3 (134 mg, 0.972 mmol), and DMF (4 mL). The product in crude was recrystallized from EtOH to provide 341 mg of a light orange crystalline solid (85%), mp 233.7-234.4 ° C (decomposes). 1 H NMR (DMSO-d_ {6}) δ: 13.58 (br s, 1H); 8.50 (s, 1 HOUR); 8.47 (s, 1 H); 7.77-7.85 (m, 2H); 7.68 (d, J = 8.1 Hz, 2H); 7.65 (d, J = 7.7 Hz, 1H); 7.41-7.56 (m, 2H); 4.45 (d, J = 1.2 Hz, 2H). 13 C NMR (DMSO-d 6) ppm: 158.7, 156.8, 153.8, 151.5, 149.6, 149.5, 143.5, 135.4, 134.1, 133.3, 132.2, 131.6, 131.6, 130.5, 130.2, 128.8, 127.1, 117.6, 32.0. MS (ES): m / z 455.0 (M +). Anal. calcd. for C_20 H_ {12} Cl_ {2} N_ {6} -OS \ c2 {2} H_ {6} \ \ cdot0.3H_ {2}: C, 52.14; H, 3.70; Cl, 13.99; N, 16.58; S, 6.33. Found: C, 52.07; H, 3.37; Cl, 13.40; N, 16.65; S, 6.42.

       \ vskip1.000000 \ baselineskip
    

Compound D-026

3- (2-Chlorophenyl) -5-methyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one

Prepared according to Procedure C using Intermediate 2g (300 mg, 0.940 mmol), 6-mercaptopurine monohydrate (176 mg, 1.03 mmol), K 2 CO 3 (142 mg, 1.03 mmol), and DMF (5 mL). The product in crude was recrystallized from EtOH to provide 324 mg of a white crystalline solid (79%), mp 227.8-230.1 ° C (se decomposes). 1 H NMR (DMSO-d 6) δ: 13.57 (br s, 1 H); 8.49 (s, 1 H); 8.47 (s, 1 H); 7.69-7.78 (m, 2H); 7.66 (d, J = 7.3 Hz, 1H); 7.55 (d, J = 7.9 Hz, 1H); 7.39-7.52 (m, 2H); 7.36 (d, J = 6.9 Hz, 1 HOUR); 4.38-4.50 (m, 2H); 2.74 (s, 3H). 13 C NMR. (DMSO-d6) ppm: 161.2, 156.3, 152.4, 151.5, 148.6, 143.9, 141.0, 134.6, 134.5, 132.3, 131.7, 131.4, 130.4, 130.2, 128.7, 125.7, 119.0, 32.0, 22.8. MS (ES): m / z: 435.0 (M +). Anal. calcd. for C_ {21} H_ {15} ClN_ {6} OS \ cdot0.65C_ {2} H_ {6} O \ cdot0.1H_ {2} O: C, 57.40; H, 4.13; Cl, 7.60; N, 18.01; S, 6.87. Found: C, 57.11; H, 3.96; Cl, 7.45; N, 17.79; S, 6.90.

       \ vskip1.000000 \ baselineskip
    

Compound D-027

3- (2-chlorophenyl) -6,7-difluor-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one

Prepared according to Procedure C using Intermediate 2q (200 mg, 0.586 mmol), 6-mercaptopurine monohydrate (110 mg, 0.645 mmol), K 2 CO 3 (89 mg, 0.645 mmol), and DMF (4 mL). The product in crude was recrystallized from EtOH to provide 143 mg of a light yellow crystalline solid (53%), mp 207.8 ° C (discolors; transpires at 136 ° C). 1 H NMR (DMSO-d 6) δ: 13.57 (br S, 1H); 8.49 (s, 1 H); 8.46 (s, 1 H); 8.11 (t, J = 9.4 Hz, 1H); 7.88 (dd, J = 7.3, 11 Hz, 1H); 7.77 (dd, J = 1.7, 7.3 Hz, 1 HOUR); 7.67 (d, J = 7.4 Hz, 1H); 7.42-7.55 (m, 2H); 4.48 (s, 2H), 13 C NMR (DMSO-d 6) ppm: 159.5 (d, J = 2.5 Hz), 154.6 (dd, J = 14, 255 Hz), 154.0 (d, J = 1.5Hz), 151.5, 149.3 (dd, J = 14, 250 Hz), 145.1 (d, J = 12 Hz), 143.9, 133.9, 132.1, 131.8, 131.4, 130.5, 128.9, 118.0 (d, J = 4.9Hz), 115.8 (d, J = 18 Hz), 114.6 (d, J = 20 Hz), 32.0, MS (ES): m / z 457.0 (M +). Anal. calcd. for C 20 H 11 ClF 2 N 6 OS: C, 52.58; H, 2.43; Cl, 7.76; N, 18.40; S, 7.02. Found: C, 51.81; H, 2.37; Cl, 7.49; N, 18.04; S, 7.55.

       \ newpage
    

Compound D-028

3- (2-chlorophenyl) -6-fluoro-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one

Prepared according to Procedure C using Intermediate 2r (118 mg, 0.365 mmol), 6-mercaptopurine monohydrate (68 mg, 0.402 mmol), K 2 CO 3 (56 mg, 0.402 mmol), and DMF (2 mL ). The crude product was recrystallized from EtOH to provide 103 mg of an off-white crystalline solid (64%), mp 232.8-233.0 ° C (decolorized), 1 H NMR (DMSO-d 6) \ delta: 13.56 (br s, 1H); 8.48 (s, 1 H); 8.44 (s, 1 H); 7.81-7.86 (m, 3H); 7.76 (d, J = 7.5 Hz, 1H); 7.67 (d, J = 7.5 Hz, 1H); 7.40-7.54 (m, 2H); 4.48 (br s, 2H). 13 C NMR (DMSO-d 6) ppm: 160.8 (d, J = 247 Hz), 160.2 (d, J = 3.3 Hz), 156.9, 152.3 (d, J = 1.9Hz), 151.5, 149.7, 144.0, 143.6, 134.1, 132.1, 131.7, 131.5, 130.5, 130.4, 130.2, 128.8, 124.0 (d, J = 24 Hz), 122.0 (d, J = 8.7 Hz), 111.7 (d, J = 24 Hz ), 32.0, MS (ES): m / z 439.0 (M +). Anal. calcd. for C 20 H 12
ClFN_ {6} OS • 2C_H2 {6} \ 0d0.1H_2 O: C, 54.46; H, 3.00; Cl, 7.88; N, 18.68. Found: C, 54.09; H, 2.73; Cl, 7.80; N, 18.77.

       \ vskip1.000000 \ baselineskip
    

Compound D-029

2- (6-aminopurin-9-ylmethyl) -3- (2-isopropylphenyl) -5-methyl-3H-quinazolin-4-one

Thionyl chloride (2.2 mL, 30 mmol) was added to a stirred solution of 2-amino-6-methylbenzoic acid (1.51 g, 10 mmol) in benzene (50 mL) and the mixture was heated under reflux for 18 hours. Once cooled, the solvent was removed in vacuo and removed twice with benzene (25 mL). The residue was dissolved in CHCl3 (50 mL) and treated with 2-isopropylaniline (2.83 mL, 20 mmol). The aqueous solution was subsequently heated under reflux for 3 hours. Then TLC (50% EtOAc / hexane) indicated that the reaction was complete. After cooling to room temperature, the reaction mixture was poured onto a 4 cm silica gel plug and passed through 20% EtOAc / hexane. The fractions with the product were combined and concentrated in vacuo . The residue was dissolved in HOAc (50 mL) and treated with chloroacetyl chloride (1.6 mL, 20 mmol) and the mixture was heated under reflux for 18 hours. The reaction was cooled and concentrated in vacuo . The HOAc residues were removed by azeotropic distillation with toluene (25 mL) three times. The residue was dissolved in toluene (10 mL) and poured through a plug of 4 cm silica gel, passing through 20% EtOAc / hexane. Fractions with the product were identified by LCMS (MS (ES): m / z 327 (M +)), and concentrated in vacuo to provide 975 mg (30%) as a white foam. The white foam chloride (450 mg, 1.36 mmol) was dissolved in DMF (10 mL) and treated with adenine (275 mg, 2.04 mmol) and K 2 CO 3 (281 mg, 2, 04 mmol) and the mixture was stirred overnight at room temperature. The suspension was then poured into 200 mL of water, stirred at room temperature for 30 min. and then cooled in the refrigerator for 30 minutes. The resulting solid was collected by vacuum filtration and recrystallized with EtOH to provide 285 mg (49%) of an off-white solid. mp 258.0-258.2 ° C. 1 H NMR (DMSO-d 6) δ: 8.19 (S, 1H), 8.09 (s, 1H), 7.60 (m, 3H), 7.45 (m, 2H), 7.23 (m, 3H ), 5.11 (d, J = 17.5 Hz, 1H), 4.71 (d, J = 17.5 Hz, 1H), 2.68 (s, 3H), 2.73 (q, J = 6.9 Hz, 1H), 1.34 (d, J = 6.8 Hz, 3H), 1.13 (d, J = 6.8 Hz, 3H). 13 C NMR (DMSO-d 6) ppm: 161.9, 156.2, 152.8, 151.6, 150.1, 148.4, 146.1, 142.2, 140.8, 134.3, 133.7, 130.6, 130.0, 129.0, 127.7, 127.6, 125.8, 119.2, 118.4, 44.8, 28.3, 24.4, 23.3, 22.9. MS (ES): m / z 426.4 (M +). Anal. calcd. for C 24 H 23 N 7 O: C, 67.75; H, 5.45; N, 23.04. Found: C, 67.60; H, 5.45; N, 22.82.

       \ vskip1.000000 \ baselineskip
    

Compound D-030

2- (6-aminopurin-9-ylmethyl) -5-methyl-3-o-tolyl-3H-quinazolin-4-one

Thionyl chloride (2.2 mL, 30 mmol) was added to a stirred solution of 2-amino-6-methylbenzoic acid (1.51 g, 10 mmol) in benzene (50 mL) and the mixture was heated under reflux for 18 hours. Once cooled, the solvent was removed in vacuo and removed twice with benzene (25 mL). The residue was dissolved in CHCl3 (50 mL) and treated with o-toluidine (2.13 mL, 20 mmol). The aqueous solution was subsequently heated under reflux for 3 hours. Then TLC (50% EtOAc / hexane) indicated that the reaction was complete. After cooling to room temperature, the reaction mixture was poured onto a 4 cm silica gel plug and passed through 20% EtOAc / hexane. The fractions with the product were combined and concentrated in vacuo . The residue was dissolved in HOAc (50 mL) and treated with chloroacetyl chloride (1.6 mL, 20 mmol) and the mixture was heated under reflux for 18 hours. The reaction was cooled and concentrated in vacuo . The HOAc residues were removed by azeotropic distillation with toluene (25 mL) three times. The residue was dissolved in toluene (10 mL) and poured through a plug of 4 cm silica gel, passing through 20% EtOAc / hexane. Fractions with the product were identified by LCMS [MS (ES): m / z 299 (M +)), and concentrated in vacuo to provide 476 mg (16%) as a white foam. The white foam chloride (470 mg, 1.57 mmol) was dissolved in DMF (10 mL) and treated with adenine (423 mg, 3.14 mmol) and K 2 CO 3 (433 mg, 3, 14 mmol) and the mixture was stirred overnight at room temperature. The suspension was then poured into 200 mL of H2O, stirred at room temperature for 30 min. and then cooled in the refrigerator for 30 minutes. The resulting solid was collected by vacuum filtration and recrystallized with EtOH to provide 123 mg (20%) of an off-white solid. mp 281.5-282.7 ° C (decomposes). 1 H NMR (DMSO-d 6) δ: 8.07 (s, 1H); 8.05 (s, 1 H); 7.61 (t, J = 7.8 Hz, 1H), 7.48 (m, 4H), 7.25 (m, 3H), 5.09 (d, J = 17.4 Hz, 1H), 4.76 (d, J = 17.4 Hz, 1H ), 2.73 (s, 3H), 2.18 (s, 3H). 13 C NMR (DMSO-d 6) ppm: 161.3, 156.2, 152.8, 151.4, 150.0, 148.5, 142.2, 140.9, 136.1, 135.4, 134.3, 131.7, 130.1, 130.6, 129.0, 128.0, 125.8, 119.2, 118.5, 44.8; 22.9, 17.4, MS (ES): m / z 398.2 (M +). Anal. calcd. for C 22 H 19 N 7 O: C, 66.49; H, 4.82; N, 24.67. Found: C, 66.29; H, 4.78; N, 24.72.

       \ vskip1.000000 \ baselineskip
    

Compound D-031

3- (2-fluorophenyl) -5-methyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one

Thionyl chloride (2.2 mL, 30 mmol) was added to a stirred solution of 2-amino-6-methyl-benzoic acid (1.51 g, 10 mmol) in benzene (50 mL) and the mixture was heated under reflux for 18 hours. Once cooled, the solvent was removed in vacuo and removed twice with benzene (25 mL). The residue was dissolved in CHCl3 (50 mL) and treated with 2-fluoroaniline (1.93 mL, 20 mmol). The aqueous solution was subsequently heated under reflux for 3 hours. Then TLC (50% EtOAc / hexane) indicated that the reaction was complete. After cooling to room temperature, the reaction mixture was poured onto a 4 cm silica gel plug and passed through 20% EtOAc / hexane.

The fractions with the product were combined and concentrated in vacuo . The residue was dissolved in HOAc (50 mL) and treated with chloroacetyl chloride (1.6 mL, 20 mmol) and the mixture was heated under reflux for 18 hours. The reaction was cooled and concentrated in vacuo . The HOAc residues were removed by azeotropic distillation with toluene (25 mL) three times. The residue was dissolved in toluene (10 mL) and poured through a plug of 4 cm silica gel, passing through 20% EtOAc / hexane. Fractions with the product were identified by LCMS [MS (ES): m / z 303 (M +)), and concentrated in vacuo to provide 1.12 g (37%) as a white foam. The white foam chloride (455 mg, 1.50 mmol) was dissolved in DMF (10 mL) and treated with 6-mercaptopurine monohydrate (510 mg, 3.0 mmol) and K2CO3 (414 mg , 3.0 mmol) and the mixture was stirred overnight at room temperature. The suspension was then poured into 200 mL of water, stirred at room temperature for 30 min. and then cooled in the refrigerator for 30 minutes. The resulting solid was collected by vacuum filtration and recrystallized with EtOH to provide 487 mg (77%) of an off-white solid. mp 151.9-152.2 ° C. 1 H NMR (DMSO-d 6) δ: 8.48 (s, 1H0, 8.44 (s, 1H), 7.70 (m, 2H), 7.48 (m, 2H), 7.33 (m, 3H) , 4.55 (d, J = 15.1 Hz, 1H), 4.48 (d, J = 15.1, Hz, 1H), 2.73 (s, 3H) .13 C NMR (DMSO-d6) ppm: 161.3 , 157.8 (d, J = 249.1 Hz), 156.9, 152.8, 151.5, 149.6, 148.6, 143.6, 140.9, 134.7, 131.9 (d, J = 8.0Hz), 131.4, 130.2, 125.6 (d, J = 3.6Hz) , 125.5, 124.4 (d, J = 13.5Hz), 118.8, 116.6 (d, J = 19.6 Hz), 56.4, 22.9. MS (ES): m / z 419.5 (M +). Anal. Calcd. For C_ {21 } H 15 FN 6 OS • 0.15 C 2 H 6 O: C, 60.14; H, 3.77; F, 4.47; N, 19.76; S, 7.54. Found: C, 59.89; H, 3.88; F, 4.42; N, 19.42; S, 7.23.

       \ vskip1.000000 \ baselineskip
    

Compound D-032

2- (6-aminopurin-9-ylmethyl) -5-chloro-3-o-tolyl-3H-quinazolin-4-one

Prepared according to Procedure C using 2j (200 mg, 0.626 mmol), adenine (93 mg, 0.689 mmol), K 2 CO 3 (95 mg, 0.689 mmol), and DMF (3 mL). The product in crude was chromatographed on MeOH / CH 2 Cl 2 to provide 101 mg of an off-white solid (39%), mp 262.0-266.5 ° C. 1 H NMR (DMSO-d_ {6}) δ: 8.08 (s, 1H); 8.07 (s, 1 H); 7.70 (t, J = 8.0 Hz, 1H); 7.58 (dd, J = 0.6, 7.9 Hz, 1H); 7.43-7.57 (m, 4H); 7.36 (dd, J = 0.7, 8.0 Hz, 1H); 7.26 (br s, 2H); 5.12 (d, J = 18 Hz 1H); 4.78 (d, J = 18 Hz, 1H); 2.20 (s, 3H). 13 C NMR (DMSO-d 6) ppm: 158.7, 156.2, 152.9, 152.7, 150.0, 149.4, 142.1, 136.1, 135.1, 135.0, 133.2, 131.8, 130.3, 130.1, 128.9, 128.1, 127.2, 118.5, 117.9, 44.9, 17.4. MS (ES): m / z 418.1 (M +). Anal. calcd. for C_ {21} H_ {16} ClN_ {O} O \ dd0.1H_ {2} O \ c00.05KCl: C, 59.57; H, 3.86; Cl, 8.79; N, 23.16. Found: C, 59.65; H, 3.80; Cl, 8.70; N, 22.80.

       \ vskip1.000000 \ baselineskip
    

Compound D-033

2- (6-aminopurin-9-ylmethyl) -5-chloro-3- (2-methoxyphenyl) -3H-quinazolin-4-one

Prepared according to Procedure C using 21 (250 mg, 0.746 mmol), adenine (111 mg, 0.821 mmol), K 2 CO 3 (113 mg, 0.821 mmol), and DMF (4 mL). The product in crude was chromatographed on MeOH / CH2Cl3 and recrystallized with EtOH to provide 124 mg of a brown solid (38%), mp 257.0-257.1 ° C. 1 H NMR (DMSO-d_ {6}) δ: 8.06 (s, 1H); 8.01 (s, 1 H); 7.71 (t, J = 8.0 Hz, 1H); 7.57 (dd, J = 0.9, 7.9 Hz, 1H); 7.52-7.59 (m, 1 H); 7.50 (dd, J = 1.6, 7.8 Hz, 1H); 7.38 (dd, J = 1.1, 8.2 Hz, 1H); 7.27 (dd, J = 0.6, 8.3 Hz, 1H); 7.24 (br s, 2H); 7.17 (dt, J = 0.9, 7.6 Hz, 1H); 5.07 (d, J = 17 Hz, 1H); 4.97 (d, J = 17Hz, 1H); 3.79 (s, 3H). 13 C NMR (DMSO-d6) ppm: 158.8, 156.2, 154.7, 153.2, 152.8, 150.1, 149.3, 142.0, 135.1, 133.2, 131.8, 130.1, 130.1, 127.2, 123.8, 121.6, 118.4, 117.9, 113.1, 56.2, 44.8. MS (ES): m / z 434.0 (M +). Anal. calcd. for C_ {21} H_ {16} ClN_ {O} {2} \ cdot0.5H_ {2} O \ cdot0.04KCl: C, 56.57; H, 3.84; Cl, 8.27; N, 21.99. Found: C, 56.29; H, 3.75; Cl, 8.21; N, 21.61.

In general, the following compounds are performed according to the methods described and serve to better illustrate the specific embodiments of the compounds of the invention:

3- (2,6-Dichlorophenyl) -5-methyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one (D-034) 3- (2-Isopropylphenyl) -5-methyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one (D-035) 3- (2-methoxyphenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one (D-036)

       \ newpage
    

3-benzyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one (D-037) 3-Butyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one (D-038) 3-morpholin-4-yl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one, acetate salt (D-039) 3- (3-methoxyphenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one (D-040) 3- (3-chlorophenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one (D-041) 2- (9H-purin-6-ylsulfanylmethyl) -J3-pyridin-4-yl-3H-quinazolin-4-one (D-042) 3-benzyl-5-fluoro-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one (D-043) 3- (4-methylpiperazin-1-yl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one, acetate salt (D-044) [5-fluoro-4-oxo-2- (9H-purin-6-ylsulfanylmethyl) -4H-quinazolin-3-yl] acetic acid ethyl ester (D-045) 3- (2-methoxyphenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one (D-046) 3- (2-Methoxyphenyl) -5-methyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one (D-047) 2- (6-aminopurin-9-ylmethyl) -3- (2-fluorophenyl) -5-methyl-3H-quinazolin-4-one (D-048) 2- (6-aminopurin-9-ylmethyl) -3-benzyl-5-fluoro-3H-quinazolin-4-one (D-049) 2- (6-aminopurin-9-ylmethyl) -3-butyl-3H-quinazolin-4-one (D-050) 2- (6-aminopurin-9-ylmethyl) -3-morpholin-4-yl-3H-quinazolin-4-one, acetate salt (D-051) 3- (4-chlorophenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one (D-052).

       \ vskip1.000000 \ baselineskip
    

Additional compounds of the present invention by the following procedures synthetic

The following intermediate compounds are prepared with Procedure A described above.

twenty-one

3rd R = cyclopropyl

3b R = cyclopropylmethyl

3c R = phenethyl

3d R = cyclopentyl

3e R = 3- (2-chloro) pyridyl

3f R = acid 4- (2-methyl) benzoic

3g R = 4-nitrobenzyl

3h R-cyclohexyl

3i R = E- (2-phenyl) cyclopropyl

       \ vskip1.000000 \ baselineskip
    

Other compounds of the present invention (D-053 to D-070) with the following Central structure are discussed in the following Experimental Section. All were prepared following Procedure C.

Central Structure:

22

2. 3

24

       \ vskip1.000000 \ baselineskip
    

25

       \ vskip1.000000 \ baselineskip
    

2- (2-amino-9H-purin-6-ylsulfanylmethyl) -3-cyclopropyl-5-methyl-3H-quinazolin-4-one (D-053)

Prepared according to procedure C using 3a (100mg, 0.4 mmol), 2-amino-6-mercaptopurine (80 mg, 0.48 mmol), and K 2 CO 3 (77 mg, 0.56 mmol). He product was purified by trituration with H2O. 1 H NMR (DMSO-d 6) δ: 7.89 (d, J = 0.9 Hz, 1H); 7.54 (t, J = 7.4 Hz, 1H); 7.34 (d, J = 8.1 Hz, 1H); 7.19 (d, J = 7.2 Hz, 1 HOUR); 6.28 (S, 2H); 4.94 (s, 2 H); 2.70 (s, 3 H); 1.24 (d, J = 6.5 Hz, 2H); 0.91 (s, 2H), MS (ES): m / z 380 (M + H), 190.

       \ vskip1.000000 \ baselineskip
    

3-cyclopropylmethyl-5-methyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one

Prepared according to procedure C using 3b (300 mg, 1.14 mmol), 6-mercaptopurine monohydrate (214 mg, 1.26 mmol), and K 2 CO 3 (189 mg, 1.37 mmol). The product was purified by trituration with H2O, followed by recrystallization with MeOH. 1 H NMR (DMSO-d_6) δ: 13.60 (br S, 1H); 8.72 (s, 1 HOUR); 8.48 (s, 1 H); 7.63 (t, J = 7.8 Hz, 1H); 7.42 (d, J = 8.0 Hz, 1H); 7.28 (d, J = 7.3 Hz, 1H); 5.01 (s, 2H), -4.11 (d, J = 6.8 Hz, 2H); 2.78 (s, 3H); 1.35 (quint, J = 6.2 Hz, 1H); 0.44-0.59 (m, 4H). MS (ES): m / z 379 (M + H), 325.

       \ vskip1.000000 \ baselineskip
    

2- (6-aminopurin-9-ylmethyl) -3-cyclopropylmethyl-5-methyl-30-quinazolin-4-one (D-055)

Prepared according to procedure C using 3b (300 mg, 1.14 mmol), adenine (170 mg, 1.26 mmol), and K 2 CO 3 (189 mg, 1.37 mmol). The product was purified by crushing with H2O, followed by recrystallization with MeOH 1 H NMR (DMSO-d 6) δ: 8.21 (s, 1 HOUR); 8.10 (s, 1 H); 7.52 (t, J = 7.7 Hz, 1H); 7.18-7.31 (m, 3H); 7.06 (d, J = 8.1 Hz, 1H); 5.68 (s, 2H); 4.14 (d, J = 6.8 Hz, 2H); 2.77 (s, 3 H); 1.34 (quint, J = 6.4 Hz, 1H); 0.45-0.60 (m, 4H). MS (ES): m / z 362 (M + H), 308.

       \ vskip1.000000 \ baselineskip
    

2- (2-amino-9H-purin-6-ylsulfanylmethyl) -3-cyclopropylmethyl-5-methyl-3H-quinazolin-4-one (D-056)

Prepared according to procedure C using 3b (280 mg, 1.1 mmol), 2-amino-6-mercaptopurine (200 mg, 1.2 mmol), and K2CO3 (180 mg, 1.3 mmol). He product was purified by trituration with MeOH. 1 H NMR (DMSO-d_ {6}) δ: 12.70 (br s, 1H); 7.95 (s, 1 HOUR); 7.64 (t, J = 7.8 Hz, 1H); 7.44 (d, J = 7.9 Hz, 1H); 7.28 (d, J = 7.4 Hz, 1H); 6.41 (s, 2H); 4.91 (s, 2H); 4.05 (d, J = 6.8 HZ, 2H); 2.78 (s, 3H); 1.26-1.43 (m, 1H); 0.36-0.56 (m, 4H). MS (ES): m / z 394 (M + H), 340.

       \ vskip1.000000 \ baselineskip
    

5-methyl-3-phenethyl-2- (90-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one (D-057)

Prepared according to procedure C using 3c (750 mg, 2.4 mmol), 6-mercaptopurine monohydrate (442 mg, 2.6 mmol), and K 2 CO 3 (398 mg, 2.9 mmol). The product was purified by trituration with H2O, 1 H NMR (DMSO-d 6) δ: 13.61 (s, 1H); 8.71 (s, 1 H); 8.48 (s, 1 H); 7.65 (t, J = 7.7 Hz, 1H); 7.44 (d, J = 7.9 Hz, 1H); 7.16-7.35 (m, 6H); 4.89 (s, 2H); 4.29 (br t, J = 7.9 Hz, 2H); 3.08 (br t, J = 7.8 Hz, 2H); 2.81 (s, 3H). MS (ES): m / z 429 (M + H), 105.

       \ vskip1.000000 \ baselineskip
    

2- (2-amino-9H-purin-6-ylsulfanylmethyl) -5-methyl-3-phenethyl-3H-quinazolin-4-one (D-058)

Prepared according to procedure C using 3c (750 mg, 2.4 mmol), 2-amino-6-mercaptopurine (435 mg, 2.6 mmol), and K2CO3 (398 mg, 2.9 mmol). He product was purified by trituration with H2O. 1 H NMR (DMSO-d6) δ: 12.61 (s, 1H); 7.95 (s, 1 HOUR); 7.65 (t, J = 7.7 Hz, 1H); 7.45 (d, J = 7.9Hz, 1H); 7.14-7.32 (m, 6H); 6.44 (s, 2H); 4.81 (s, 2H); 4.24 (br t, J = 7.9 Hz, 2H); 3.04 (br t, J = 7.8 Hz, 2H); 2.81 (s, 3H). MS (ES): m / z 444 (M + H), 340.

       \ vskip1.000000 \ baselineskip
    

3-cyclopentyl-5-methyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one (D-059)

Prepared according to procedure C using 3d (100mg, 0.36 mmol), 6-mercaptopurine monohydrate (73 mg, 0.43 mmol), and K 2 CO 3 (100 mg, 0.72 mmol). The product was purified by recrystallization with MeOH 1 H NMR, (DMSO-d 6) δ: 13.62 (br s, 1H); 8.77 (s, 1 H); 8.48 (s, 1 H); 7.62 (t, J = 7.7 Hz ,: 1H); 7.42 (d, J = 7.8 Hz, 2H); 7.26 (d, J = 7.4 Hz, 1H); 5.03 (s, 2H); 4.80 (quint, J = 8.0 Hz, 1H); 2.76 (s, 3H), 2.12-2.31 (m, 2H); 1.79-2.04 (m, 4H); 1.44-1.58 (m, 2H). MS (ES): m / z 393 (M + H), 325.

       \ vskip1.000000 \ baselineskip
    

2- (6-aminopurin-9-ylmethyl) -3-cyclopentyl-5-methyl-3H-quinazolin-4-one (D-060)

Prepared according to procedure C using 3d (100 mg, 0.36 mmol), adenine (58 mg, 0.43 mmol), and K 2 CO 3 (100 mg, 0.72 mmol). The product was purified by recrystallization with MeOH. 1 H NMR (DMSO-d_ {6}) δ: 8.15 (S, 1H); 8.11 (s, 1 H); 7.52 (t, J = 7.7 Hz, 1H); 7.16-7.31 (m, 3H); 7.10 (d, J = 8.0 Hz, 2H); 5.68 (s, 2H); 4.78 (quint, J = 8.3 Hz, 1H); 2.74 (s, 3H); 2.09-2.32 (m, 2H); 1.86-2.04 (m, 2H); 1.68-1.86 (m, 2H); 1.43-1.67 (m, 2H). MS (ES): m / z 376 (M + H), 308, 154

       \ vskip1.000000 \ baselineskip
    

       \ global \ parskip0.900000 \ baselineskip
    

3- (2-Chloro-pyridin-3-yl) -5-methyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one (D-061)

Prepared according to procedure C using 3e (500 mg, 1.6 mmol), 6-mercaptopurine monohydrate (289 mg, 1.7 mmol), and K 2 CO 3 (262 mg, 1.9 mmol). The product was purified by trituration with H2O. MS (ES): m / z 436 (M + H), 200.

       \ vskip1.000000 \ baselineskip
    

2- (6-aminopurin-9-ylmethyl) -3- (2-chloro-pyridin-3-yl) -5-methyl-3H-quinazolin-4-one (D-062)

Prepared according to procedure C using 3e (500 mg, 1.6 mmol), adenine (230 mg, 1.7 mmol), and K 2 CO 3 (262 mg, 1.9 mmol). The product was purified by crushing with H2O. 1 H NMR (DMSO-d_ {6}) δ: 8.59 (dd, J = 1.7, 4.8 Hz, 1 HOUR); 8.22 (dd, J = 1.7, 7.8 Hz, 1H): 8.025 (s, 1H); 8,017 (s, 1 H); 7.60-7.72 (m, 2H); 7.35 (t, J = 8.2 Hz, 2H); 7.22 (s, 2H); 5.12 (d, J = 17.0 Hz, 1H); 5.02 (d, J = 17.0 Hz, 1H); 2.72 (s, 3H). MS (ES): m / z 419 (M + H).

       \ vskip1.000000 \ baselineskip
    

3-methyl-4- [5-methyl-4-oxo-2- (9H-purin-6-ylsulfanylmethyl) -4H-quinazolin-3-yl] -acid benzoic (D-063)

Prepared according to procedure C using 3f (400 mg, 1.17 mmol), 6-mercaptopurine monohydrate (219 mg, 1.29 mmol), and K 2 CO 3 (226 mg, 1.64 mmol). The product was purified by recrystallization with MeOH 1 H NMR (DMSO-d 6) δ: 13.54 (br S, 1H); 8.44 (s, 1 H); 8.42 (s, 1 H); 7.80 (s, 2H); 7.71 (t, J = 7.7 Hz, 1 HOUR); 7.59 (d, J = 8.6 Hz, 1H); 7.52 (d, J = 7.9 Hz, 1H); 7.34 (d, J = 7.4 Hz, 1H); 4.46 (d, J = 15.4 Hz, 1H); 4.34 (d, J = 15.7 Hz, 1H); 3.17 (d, J = 4. 4 Hz, 1H); 2.73 (s, 3 H); 2.17 (s, 3H). MS (ES): m / z 459 (M + H).

       \ vskip1.000000 \ baselineskip
    

3-cyclopropyl-5-methyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one (D-064)

Prepared according to procedure C using 3a (100 mg, 0.40 mmol), 6-mercaptopurine monohydrate (90 mg, 0.53 mmol), and K 2 CO 3 (97 mg, 0.7 mmol). The product was purified by trituration with H2O. 1 H NMR (DMSO-d 6) δ: 8.69 (d, J = 0.8 Hz, 1H); 8.47 (s, 1 H); 7.57 (d, J = 7.9 Hz, 1H); 7.37 (d, J = 8.1 Hz, 1 HOUR); 7.23 (d, J = 7.3 Hz, 1H); 5.08 (s, 2H); 3.06-3.18 (m, 1 H); 2.74 (s, 3 H); 1.14-1.36 (m, 2H); 0.92-1.06 (m, 2H).

       \ vskip1.000000 \ baselineskip
    

2- (6-aminopurin-9-ylmethyl) -3-cyclopropyl-5-methyl-3H-quinazolin-4-one (D-065)

Prepared according to procedure C using 3a (100 mg, 0.40 mmol), adenine (94 mg, 0.7 mmol), and K 2 CO 3 (121 mg, 0.88 mmol). The product was purified by crushing with H2O. 1 H NMR (DMSO-d_ {6}) δ: 8.19 (d, J = 0.9 Hz, 1H); 8.09 (d, J = 1.0 Hz, 1H); 7.48 (t, J = 7.8 Hz, 1H); 7.13-7.29 (m, 3H); 7.04 (d, J = 8.1 Hz, 1H); 5.74 (s, 2H); 300-3.13 (m, 1H); 2.73 (s, 3 H); 1.18-1.38 (m, 2H); 0.94-1.09 (m, 2H).

       \ vskip1.000000 \ baselineskip
    

5-methyl-3- (4-nitro-benzyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one (D-066)

Prepared according to procedure C using 3g (200 mg, 0.58 mmol), 6-mercaptopurine monohydrate (148 mg, 0.87 mmol), and K 2 CO 3 (160 mg, 1.16 mmol). The product was purified by trituration with MeOH, 1 H NMR (DMSO-d 6) δ: 13.44 (br s, 1 HOUR); 8.50 (s, 1 H); 8.31 (s, 1 H); 8.03 (d, J = 8.6 Hz, 2H); 7.58 (t, J = 7.9 Hz, 1H); 7.37 (d, J = 8.3 Hz, 3H); 7.22 (d, J = 7.5Hz, 1H); 5.44 (s, 2H); 4.70 (s, 2H); 2.66 (s, 3H). MS (ES): m / z 460 (M + H).

       \ vskip1.000000 \ baselineskip
    

3-cyclohexyl-5-methyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one (D-067)

Prepared according to procedure C using 3h (150 mg, 0.52 mmol), 6-mercaptopurine monohydrate (97 mg, 0.57 mmol), and K 2 CO 3 (86 mg, 0.62 mmol). The product was purified by trituration with MeOH. 1 H NMR (DMSO-d 6) δ: 13.66 (br s, 1 HOUR); 8.82 (s, 1 H); 8.50 (s, 1 H); 7.62 (t, J = 7.7 Hz, 1H); 7.42 (d, J = 8.0 Hz, 1H); 7.26 (d, J = 7.3 Hz, 1H); 5.01 (s, 2H); 4.11 (br s, 1 HOUR); 2.75 (s, 3 H); 2.38-2.65: (m, 2H); 1.58-1.90 (m, 4H); 1.37-1.57 (m, 1 HOUR); 0.71-1.26 (m, 3H). MS (ES): m / z 407 (M + H), 325.

       \ vskip1.000000 \ baselineskip
    

2- (6-aminopurin-9-ylmethyl) -3-cyclohexyl-5-methyl-3H-quinazolin-4-one (D-068)

Prepared according to procedure C using 3h (150 mg, 0.52 mmol), adenine (77 mg, 0.57 mmol), and K 2 CO 3 (86 mg, 0.62 mmol). The product was purified by crushing with MeOH. 1 H NMR (DMSO-d_ {6}) δ: 8.15 (s, 2H); 7.54 (t, J = 7.9Hz, 1H); 7.06-7.35 (m, 4H); 5.65 (S, 2H); 4.09 (br s, 1H); 2.73 (s, 3 H); 1.41-1.90 (m, 6H); 0.99-1.34 (m, 4H). MS (ES): m / z 390 (M + H), 308.

       \ vskip1.000000 \ baselineskip
    

2- (2-amino-9H-purin-6-ylsulfanylmethyl) -3-cyclo-hexyl-5-methyl-3H-quinazolin-4-one (D-069)

Prepared according to procedure C using 3h (150 mg, 0.52 mmol), 2-amino-6-mercaptopurine (95 mg, 0.57 mmol), and K 2 CO 3 (86 mg, 0.62 mmol). He product was purified by inverted phase HPLC (column C18 Luna, 4.6 x 250 mm, 4.7 mL / min, 10-75% acetonitrile / water for 15 min., 100% acetonitrile at: 18 min., detector at 220). MS (ES): m / z 422 (M + H), 340, 170.

       \ global \ parskip1.000000 \ baselineskip
    

       \ vskip1.000000 \ baselineskip
    

5-methyl-3- (E-2-phenyl-cyclopropyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one (D-070)

Prepared according to procedure C using 3i and 6-mercaptopurine monohydrate. He product was purified by inverted phase HPLC (column C18 Luna, 4.6 x 250 mm, 4.7 mL / min, 10-75% acetonitrile / water for 15 min., 100% acetonitrile at 18 min., detector at 220). MS (ES): m / z 441.

       \ vskip1.000000 \ baselineskip
    

Other compounds of the invention, together with the synthetic route to the compounds D-071 to D118.

26

260

Procedure D: A mixture of amide 4a or 4b, FMOC-glycol chloride, and glacial acetic acid was heated at 120 ° C for 1 to 4 hours. The resulting mixture was concentrated in vacuo and purified by flash chromatography to provide a protected cyclized amine. This material was combined with 10 equivalents of octanetiol and a catalytic amount of DBU in THF, and stirred at room temperature until the LCMS indicated that the stirring material had been consumed. The reaction was poured directly into a flash column (equilibrated in CH 2 Cl 2) and eluted with 0-5% MeOH / CH 2 Cl 2 to provide the free amine, 5a or 5b. Compound 5c was prepared similarly using (±) FMOC-alanyl chloride instead of FMOC-glycol chloride.

Procedure E: Amounts were combined equimolar of 5a or 5b, the appropriate amount of 6-chloropurine, and DIEA with EtOH in a small vial and They were heated to 80 ° C. The reaction was monitored regularly. by LCMS and purified as indicated.

Procedure F: A mixture of amide 4b, acetoxyacetyl chloride and glacial acetic acid was heated at 120 ° C and stirred for two hours. The cooled reaction was filtered and the solids washed with CH2Cl2 to give the cyclic acetate as a white solid. This material was combined with K2CO3 in aqueous methanol and stirred for one hour. He subsequently concentrated in vacuo . The resulting solids were triturated with H2O to provide 6a as a white solid.

27

3- (2-chlorophenyl) -5-fluoro-2 - [(9H-purin-6-ylamino) -methyl] -3H-quinazolin-4-one (D-072)

Prepared according to procedure E using 5b (50 mg, 0.165 mmol) and 6-chloropurine (26 mg, 0.165 mmol) in 1 mL EtOH. After five days, the reaction purified by HPLC (C18 Luna column, 4.6 x 250 mm, 4.7 mL / min, 10-75% acetonitrile / water for 15 min., 100% acetonitrile at 18 min., detector at 220A). 1 H NMR (DMSO-d_ {6}) δ: 12.99 (br s, 1H); 8.14 (br s, 1H); 8.12 (s, 1 H); 7.85 (dt, J = 5.7, 8.1 Hz., 1H); 7.68-7.79 (m, 3H); 7.57 (t, J = 6.2 Hz., 1H); 7.57 (d, J = 7.7 Hz., 1H); 7.50 (d, J = 8.1 Hz., 1H); 7.35 (dd, J = 8.4, 10.7 Hz., 1 HOUR); 4.15-4.55 (m, 2H). MS (ES): m / z 422 (M + H), 21.1.

28

2 - [(2-amino-9H-purin-6-ylamino) methyl] -3- (2-chlorophenyl) -5-fluoro-3H-quinazolin-4-one (D-074)

Prepared according to procedure E using 5b (50 mg, 0.165 mmol) and 2-amino-6-chloropurine (28 mg, 0.165 mmol) in 1 ml EtOH. After five days, the reaction HPLC purified (C18 Luna column, 4.6 x 250 mm, 4.7 mL / min, 10-75% acetonitrile / water for 15 min., 100% acetonitrile at 18 min., detector at 220A). 1 H NMR. (DMSO-d_ {6}) δ: 12.13 (br s, 1H); 7.86 (dt, J = 5.6, 8.2 Hz., 1H); 7.76-7.83 (m, 2H); 7.68 (br s, 1 HOUR); 7.61. (t, J = 5.7 Hz., 1H); 7.61 (d, J = 7.2 Hz., 1H); 7.53 (d, J = 8.2 Hz., 1H); 7.35 (dd, J = 8.2, 10.9 Hz., 1H); 5.66 (br s, 2 H); 4.16-4.50 (m, 1 H); 4.09 (q, J = 5.3 Hz., 2H). MS (ES): m / z 437 (M + H), 219.

29

       \ vskip1.000000 \ baselineskip
    

5-methyl-2 - [(9H-purin-6-ylamino) methyl] -3-o-tolyl-3H-quinazolin-4-one (D-071)

Prepared according to procedure E using 6-chloropurine (11 mg, 0.072 mmol) and 5a (20 mg, 0.072 mmol). After five days, the reaction was cooled with water and filtered the resulting suspension. The solids were purified by HPLC (C18 Luna column, 4.6 x 250 mm, 4.7 mL / min, 10-75% acetonitrile / water for 15 min., 100% acetonitrile at 18 min., detector at 220A). 1 H NMR (DMSO-d_6) δ: 12.98 (br s, 1H); 8.14 (br s, 1H); 8.10 (s, 1 H); 7.58-7.79 (m, 2H); 7.37-7.48 (m, 4H); 7.26-7.36 (m, 2H); 3.93-4.39 (m, 2H); 2.75 (s, 3 H); 2.18 (s, 3H) MS (ES): m / z 398 (M + H), 199.

       \ vskip1.000000 \ baselineskip
    

30

       \ vskip1.000000 \ baselineskip
    

2 - [(2-amino-9H-purin-6-ylamino) methyl] -5-methyl-3-o-tolyl-3H-quinazolin-4-one (D-073)

Prepared according to procedure E using 5th (189 mg, 0.677 mmol) and 2-amino-6-chloropurine (115 mg, 0.677 mmol) in 3 ml EtOH. After three days, the reaction was filtered to remove excess purine and the filtrate HPLC purified (C18 Luna column, 4.6 x 250 mm, 4.7 mL / min, 10-75% acetonitrile / water for 15 min., 100% acetonitrile at 18 min., Detector at 220ë) to provide 7 mg of the product as TFA salt. 1 H NMR (DMSO-d6) δ: 8.88 (br s, 1H); 8.21 (s, 1 HOUR); 7.71 (t, J = 7.7 Hz., 1H); 7.45-7.56 (m, 2H); 7.38-7.44 (m, 3H); 7.35 (d, J = 7.5 Hz., 1H); 7.30 (br s, 1H); 4.40 (dd, J = 4.5, 17.5 Hz., 1H); 4.27 (dd, J = 5.3, 17.4 Hz., 1 HOUR); 2.75 (s, 3 H); 2.09 (s, 3H). MS (ES): m / z 413 (M + H), 207, 163.

       \ vskip1.000000 \ baselineskip
    

31

       \ vskip1.000000 \ baselineskip
    

2 - [(2-Fluoro-9H-purin-6-ylamino) methyl] -5-methyl-3-o-tolyl-3H-quinazolin-4-one (D-076)

Prepared according to procedure E using 5a (20 mg, 0.072 mmol) and 2-fluoro-6-chloropurine (16 mg, 0.094 mmol) in 1 ml EtOH. After 18 hours, the reaction was purified by HPLC (C18 Luna column, 4.6 x 250 mm, 4.7 mL / min, 10-75% acetonitrile / water for 1.5 min, 100% acetonitrile at 18 min., Detector at 220 [lambda] and subsequently recrystallized with EtOH to provide 1.4 mg of product in the form of a yellow solid, 1 H NMR (DMSO-d 6) δ: 13.12 (br s, 1H); 8.40 (br s, 1 H); 8.15 (s, 1 H); 7.66 (t, J = 7.7Hz, 1H); 7.35-7.49 (m, 4H); 7.31 (d, J = 7.2 Hz., 1H); 400-4.22 (m, 2H); 3.17 (s, 1 H); 2.74 (s, 3 H); 2.18 (s, 3H). MS (ES): m / z 416 (M + H), 208.

32

(2-Chlorophenyl) -dimethylamino- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one (D-075)

D-015 (100 mg, 0.228 mmol) is combined with ammonium hydroxide (28-30%, 1 mL) in DMF (2 mL) and heated to 80 ° C. After 2 days, the reaction was purified by HPLC (C18 Luna column, 4.6 x 250 mm, 47 mL / min, 10-75% acetonitrile / water for 15 min., 100% 18 min acetonitrile, 220 λ detector) to provide the product in the form of a yellow solid,? 2 mg. 1 H NMR (DMSO-d_ {6}) δ: 13.52 (br s, 1H); 8.46 (s, 1 HOUR); 8.42 (s, 1 H); 7.69 (dd, J = 2.1, 7.3 Hz, 1H); 7.62 (dd, J = 1.6, 7.6 Hz., 1H); 7.61 (t, J = 8.0 Hz., 1H); 7.37-7.48 (m, 2H); 7.05 (d, J = 7.9 Hz., 1H); 6.96 (d, J = 7.8 Hz., 1H); 4.32-4.45 (m, 2H); 2.80 (s, 6H). MS (ES): m / z 464 (M + H), 232.

33

5- (2-Benzyloxyethoxy) -3- (2-chlorophenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one (D-078)

To a solution of 2-benzyloxyethanol (0.3 mL) in DMF (1.0 mL) was added NaH (50 mg, 2.08 mmol). After stirring for 5 minutes, 0.5 mL were added to a solution of IC-87185 (50 mg, 0.114 mmol) in anhydrous DMF (0.75 mL). The reaction was heated to 50 ° C. and stirred for 3 days. HPLC purification (column C18 Luna, 4.6 x 250 mm, 4.7 mL / min, 10-75% acetonitrile / water for 15 min., 100% acetonitrile at 18 min., detector at 220 [lambda] provided the product as a solid heterogeneous, 150 \ mug. MS (ES): m / z 571 (M + H), 481.

3. 4

6-Aminopurine-9-acid ester carboxylic 3- (2-chlorophenyl) -5-fluoro-4-oxo-3,4-dihydro-quinazolin-2-ylmethyl (D-079)

To a solution of 3b (20 mg, 0.066 mmol) in CH 2 Cl 2 (500 µL) at 0 ° C phosgene (2M / toluene, 36 µL, 0.072 mmol), followed by adenine (10 mg, 0.072 mmol), and DIEA (25 µL, 0.145 mmol). The reaction was allowed to reach room temperature and stirred for eight days. Purification by HPLC (C18 Luna column, 4.6 x 250 mm, 4.7 mL / min, 10-75% acetonitrile / water for 15 min., 100% acetonitrile at 18 min., detector at 220 [lambda] provided the product in the form of a mixture. 1 H NMR (DMSO-d_ {6}) δ: 11.04 (br s, 1H); 8.61 (s, 1 HOUR); 8.40 (s, 1 H); 7.85-7.95 (m, 1 H); 7.76 (dd, J = 5.4, 9.6 Hz, 1H); 7.70-7.78 (m, 1 H); 7.52-7.63 (m, 3H); 7.38 (dt, J = 8.3, 10.6 Hz., 1H); 4.76-4.89 (m, 2H). MS (ES): m / z 466 (M + H), 331, 305

35

N- [3- (2-Chlorophenyl) -5-fluoro-4-oxo-3,4-dihydro-quinazolin-2-ylmethyl] -2- (9H-purin-6-ylsulfanyl) -acetamide (D-077)

Combined (9H-purin-6-ylsulfanyl) -acetic acid (63 mg, 0.296 mmol), 5b (108 mg, 0.355 mmol), EDC (68 mg, 0.355 mmol), HOBT (48 mg, 0.355 mmol), DIEA (62 µL, 0.355 mmol), and DMF (1 mL) in a vessel and stirred at room temperature for one hour. The reaction was diluted with EtOAc (20 mL) and washed with dilute brine (2 x 13 mL). The organic phase was concentrated in vacuo and chromatographed on 5% MeOH / CH2Cl2 to provide 91 mg of the product as a viscous orange foam. 1 H NMR (DMSO-d 6) δ: 12.88 (br s, 1H); 8.72 (s, 1 H); 8.62 (t, J = 5.0 Hz, 1H); 8.49 (s, 1 H); 7.88 (dt, J = 5.6, 8.2 Hz, 1H); 7.73-7.78 (m, 1 H); 7.67-7.72 (m, 1 H); 7.57-7.65 (m, 2H); 7.38 (d, J = 8.1 Hz., 1H); 7.36 (dd, J = 8.3, 11.1 Hz., 1H); 4.11-4.24 (m, 2H); 3.96 (dd. J = 5.0, 17.4 Hz, 1H); 3.78 (dd, J = 5.2, 17.4 Hz, 1H). MS (ES): m / z 496 (M + H), 248.

36

2- [1- (2-Fluoro-9H-purin-6-ylamino) ethyl] -5-methyl-3-o-tolyl-3H-quinazolin-4-one (D-080)

Prepared according to procedure E using 5c (50 mg, 0.17 mmol) and 2-fluoro-6-chloropurine (35 mg, 0.204 mmol) in 1.2 ml EtOH. HPLC purification (C18 Luna column, 4.6 x 250 mm, 4.7 mL / min, 10-75% acetonitrile / water for 15 min., 100% acetonitrile at 18 min., detector at 220 [lambda]) provided two atropisomers in the form of white solids The data of one of them are the following: 1 H NMR (DMSO-d 6) δ: 8.48 (br d, J = 6.4 Hz, 1H); 8.17 (s, 1 H); 7.69 (t, J = 7.8 Hz, 1H); 7.53 (d, J = 7.8 Hz, 1H); 7.44 (d, J = 7.8 Hz, 2H); 7.33 (d, J = 7.2 Hz, 2H); 7.07 (br t, J = 7.2 Hz, 1H); 4.80 (br t, J = 6.8 Hz, 1H); 2.74 (s, 3H), -2.09 (s, 3H); 1.38 (d, J = 6.7 Hz, 3H. MS (ES): m / z 430 (M + H), 215.

37

5-methyl-2- [1- (9H-purin-6-ylamino) ethyl] -3-o-tolyl-3H-quinazolin-4-one (D-081)

Prepared according to procedure E using 5c (50 mg, 0.17 mmol) and 6-chloropurine (32 mg, 0.204 mmol) in 1.2 mL EtOH. HPLC purification (column C18 Luna, 4.6 x 250 mm, 4.7 mL / min, 10-75% acetonitrile / water for 15 min., 100% acetonitrile at 18 min., detector at 220 [lambda]) provided two atropisomers in the form of yellow solids The data of one of them are the following: 1 H NMR (DMSO-d 6) δ: 8.39 (br s, 1 HOUR); 8.34 (s, 1 H); 8.18 (s, 1 H); 7.71 (t, J = 7.7 Hz, 1H); 7.56 (d, J = 7.9 Hz, 1H); 7.49 (d, J = 6.9 Hz, 1H); 7.28-7.43 (m, 3H), -7.20 (br s, 1H); 5.06 (br s, 1 H); 2.73 (s, 3 H); 2.04 (S, 3H); 1.51 (d, J = 6.6 Hz, 3H), MS (ES): m / z 412 (M + H), 206.

38

The following compounds of the present invention (D-082 to D-109) were prepared as indicated in Procedure C, using 2-chloromethyl-5-methyl-3-o-tolyl-3H-quinazolin-4-one (10 mg), the corresponding nucleophile XH (20 mg, excess), and potassium carbonate (10 mg) in DMF (0.25mL). The reaction mixture was stirred for 16 hours at room temperature, cooled with water, and the crude solid product was collected by filtration and air dried. The crude material was dissolved in 0.5 ml of DMSO and purified by inverted phase HPLC (C18 Luna column, 4.6 x 250 mm, 4.7 mL / min, 10-75% acetonitrile / water for 15 min. , 100% acetonitrile at 18 min., Detector at 220 [lambda]). Appropriate fractions were concentrated in vacuo to generate the final products.

       \ global \ parskip0.900000 \ baselineskip
    

       \ vskip1.000000 \ baselineskip
    

2- (6-dimethylaminopurin-9-ylmethyl) -5-methyl-3-o-tolyl-3H-quinazolin-4-one (D-082)

39

Yield: 8.1 mg.

1 H NMR (300 MHz, d_ {6} -DMSO) δ: 8.13 (s, 1H), 8.11 (s, 1H), 7.60 (t, J = 7.8 Hz, 1H), 7.54-7.38 (m, 4H), 7.30 (d, J = 7.4 Hz, 1H), 7.20 (d, J = 8.1 Hz, 1H), 5.11 (d, J = 17.4 Hz, 1H), 4.76 (d, J = 17.4 Hz, 1H), 3.33 (s, 6H), 2.73 (s, 3H), 2.20 (s, 3H). LRMS (ES pos.) M / z = 426 (M + 1).

       \ vskip1.000000 \ baselineskip
    

5-methyl-2- (2-methyl-6-oxo-1,6-dihydro-purin-7-ylmethyl) -3-o-tolyl-3H-quinazolin-4-one (D-083)

40

Yield: 3.3 mg

1 H NMR (300 MHz, d_ {6} -DMSO) δ: 12.06 (s, 1H), 8.12 (s, 1H), 7.60 (t, J = 7.8 Hz, 1H), 7.55-7.38 (m, 4H), 7.30 (d, J = 7.4 Hz, 1H), 7.15 (d, J = 7.9 Hz, 1H), 5.26 (d, J = 17.4 Hz, 1H), 4.94 (d, J = 17.4 Hz, 1H), 2.73 (s, 3H), 2.32 (s, 3H), 2.24 (s, 3H). Alkylation in purine N7 {arbitrarily assigned based in the downward movement of methylene protons due to the carbonyl group.

LRMS (ES pos.) M / z = 413 (M + 1).

       \ vskip1.000000 \ baselineskip
    

5-methyl-2- (2-methyl-6-oxo-1,6-dihydro-purin-9-ylmethyl) -3-o-tolyl-3H-quinazolin-4-one (D-084)

41

Purified from the same reaction mixture as D-083, Yield: 3.6 mg.

1 H NMR (300 MHz, d_ {6} -DMSO) 12.17 (s, 1H), 7.96 (s, 1H) 7.63 (t, J = 7.8 Hz, 1H), 7.57-7.39 (m, 4H), 7.32 (d, J = 7.4 Hz, 1H), 7.26 (d, J = 8.1 Hz, 1H), 5.08 (d, J = 17.2 Hz, 1H), 4.70 (d, J = 17.2 Hz, 1H), 2.73 (5, 3H), 2.27 (s, 3H), 2.17 (s, 3H). LRMS (ES pos.) m / z = 413 (M + 1).

       \ global \ parskip1.000000 \ baselineskip
    

2- (amino-dimethylaminopurin-9-ylmethyl) -5-methyl-3-o-tolyl-3H-quinazolin-4-one (D-085)

42

Yield: 6.7 mg.

1 H NMR (300 MHz, d_ {6} -DMSO) δ: 7.66 (s, 1H0, 7.61 (d, J = 7.8 Hz, 1H), 7.55-7.40 (m, 4H), 7.32-7.26 (m, 2H), 6.74 (S, 2H), 4.94 (d, J = 17.2 Hz, 1H), 4.63 (d, J = 17.2 Hz, 1H), 4.63 (d, J = 17.2 Hz, 1H), 2.97 (s, 6H), 2.73 (s, 3H), 2.17 (s, 3H), 2.08 (s, 3H). LRMS (ES pos.) M / z = 441 (M + 1).

       \ vskip1.000000 \ baselineskip
    

2- (2-amino-9H-purin-6-ylsulfanylmethyl) -5-methyl-3-o-tolyl-3H-quinazolin-4-one (D-086)

43

Yield: 9.5 mg.

1 H NMR (300 MHz, d_ {6} -DMSO) δ: 12.54 (s, 1H), 7.89 (s, 1H), 7.69 (t, J = 7.8 Hz, 1H), 7.51 (d, J = 8.0 Hz, 1H), 7.51 (d, J = 8.0 Hz, 1H), 7.43 (t, J = 3.9 Hz, 1H), 7.34 = 7.26 (m, 4H), 6.16 (s, 2H), 4.32 (AB quartet, J_ {AB} = 14.8 Hz, \ Deltan = 23.7), 2.74 (s, 3H), 2.09 (s, 3H). LRMS (ES pos.) M / z = 430 (M + 1).

       \ vskip1.000000 \ baselineskip
    

2- (4-amino-1,3,5-triazin-2-ylsulfanylmethyl) -5-methyl-3-o-tolyl-3H-quinazolin-4-one (D-087)

44

Yield: 5.8 mg.

1 H NMR (300 MHz, d_ {6} -DMSO) δ: 8.10 (s, 1H), 7.70 (t, J = 7.8 Hz, 1H), 7.58 (s, 1H), 7.52 (d, J = 8.0 Hz, 1H), 7.48-7.26 (m, 6H), 4.08 (s, 2H), 2.73 (s, 3H), 2.09 (s, 3H).

LRMS (ES pos.) M / z = 391 (M + 1).

       \ vskip1.000000 \ baselineskip
    

5-methyl-2- (7-methyl-7H-purin-6-ylsulfanylmethyl) -3-o-tolyl-3H-quinazolin-4-one (D-088)

Four. Five

Yield: 3.1 mg.

1 H NMR (300 MHz, d_ {6} -DMSO) δ: 8.52 (s, 1H), 8.49 (s, 1H), 7.70 (t, J = 7.8 Hz, 1H), 7.50 (d, J = 7.8 Hz, 1H), 7.45 (d, J = 7.1 Hz, 1H), 7.35-7.20 (m, 4H), 4.41 (AB quartet, J_ {AB} = 15.3 Hz, Δv = 19.2 Hz), 4.08 (s, 3H), 2.73 (s, 3H), 2.12 (s, 3H).

LRMS (ES pos.) M / z = 406 (M + 1).

       \ newpage
    

5-methyl-2- (2-oxo-1,2-dihydro-pyrimidin-4-ylsulfanylmethyl) -3-o-tolyl-3H-quinazolin-4-one (D-089)

46

Yield: 2.4 mg.

1 H NMR (300 MHz, d_ {6} -DMSO) δ: 11.49 (s, 1H), 7.70 (t, J = 7.8 Hz, 1H), 7.60 (brt, J = 6.0 Hz, 1H), 7.53-7.48 (m, 2H), 7.46-7.28 (m, 4H), 6.31 (d, J = 6.7Hz, 1H), 4.05 (s, 2H), 2.73 (s, 3H), 2.12 (s, 3H).

LRMS (ES pos.) M / z = 391 (M + 1).

       \ vskip1.000000 \ baselineskip
    

5-methyl-2-purin-7-ylmethyl-3-o-tolyl-3H-quinazolin-4-one (D-090)

47

1 H NMR (300 MHz, d_ {6} -DMSO) δ: 9.04 (s, 1H), 8.97 (s, 1H), 8.48 (s, 1H), 7.65.-7.54 (m, 2H), 7.53-7.39 (m, 3H), 7.31 (d, J = 7.4 Hz, 1H), 7.13 (d, J = 8.0 Hz, 1H), 5.31 (d, J = 17.6 Hz, 1H), 5.16 (d, J = 17.6 Hz, 1H), 2.73 (s, 3H), 2.09 (s, 3H). The alkylation in purine N7 wine determined by the increase in NOE between the position 6 proton of the purine and the protons of methylene in the link between purine and quinazolinone groups. LRMS (ES pos.) M / z = 383 (M + 1).

       \ vskip1.000000 \ baselineskip
    

5-methyl-2-purin-9-ylmethyl-3-o-tolyl-3H-quinazolin-4-one (D-091)

48

Of the same reaction that produced D-090 1 H NMR (300 MHz, d_ {6} -DMSO) δ: 9.17 (s, 1H), 8.86 (s, 1H), 8.55 (S, 1H), 7.59 (t, J = 7.8 Hz, 1H), 7.55-7.42 (m, 4H), 7.30 (d, J = 7.4 Hz, 1H), 7.13 (d, J = 8.0 Hz, 1H), 5.26 (d, J = 17.5 Hz, 1H), 4.92 (d, J = 17.5 Hz, 1H), 2.73 (s, 3H), 2.19 (s, 3H). Alkylation in purine N9 suggested by the absence of increased NOE between the position 6 protons of the purine and the protons of methylene bond.

LRMS (ES pos.) M / z = 383 (M + 1).

       \ vskip1.000000 \ baselineskip
    

5-methyl-2- (9-methyl-7H-purin-6-ylsulfanylmethyl) -3-o-tolyl-3H-quinazolin-4-one (D-092)

49

1 H NMR (300 MHz, d_ {6} -DMSO) δ: 8.52 (s, 1H), 8.42 (s, 1H), 7.69 (t, J = 7, 7 Hz, 1H), 7.50 (d, J = 8.0 Hz, 1H), 7.44 (d, J = 7.6 Hz, 1H), 7.36-7.27 (m, 4H), 4.38 (AB quartet, J_ {AB} = 15.5 Hz, Δv = 21.0 Hz), 3.80 (s, 3H), 2.73 (s, 3H), 2.12 (s, 3H).

LRMS (ES pos.) M / z = 429 (M + 1).

       \ newpage
    

2- (2,6-Diamino-pyrimidin-4-ylsulfanylmethyl) -5-methyl-3-o-tolyl-3H-quinazolin-4-one (D-093)

fifty

1 H NMR (300 MHz, d_ {6} -DMSO) δ: 7.70 (t, J = 7.7 Hz, 1H), 7.54 (d, J = 8.0 Hz, 1H), 7.45-7.27 (m, 5H), 6.22 (br s, 1H), 5.80 (br s, 1H), 3.99 (AB quartet, J_ {AB} = 14.6 Hz, Δv = 26.9 Hz, 2H), 2.73 (s, 3H), 2.08 (s, 3H).

LRMS (ES pos.) M / z = 405 (M + 1).

       \ vskip1.000000 \ baselineskip
    

5-methyl-2- (5-methyl- [1,2,4] triazolo [1,5-a] pyrimidin-7-ylsulfanylmethyl) -3-o-tolyl-3H-quinazolin-4-one (D-094)

51

1 H NMR (300 MHz, d_ {6} -DMSO) δ: 8.57 (s, 1H), 7.73 (t, J = 7.8 Hz, 1H), 7.55-7.35 (m, 4H), 7.18 (s, 1H), 4.27 (s, 2H), 2.74 (s, 3H0, 2.55 (s, 3H), 2.08 (s, 3H).

LRMS (ES pos.) M / z = 429 (M + 1).

       \ vskip1.000000 \ baselineskip
    

5-methyl-2- (2-methylsulfanyl-9H-purin-6-ylsulfanylmethyl) -3-o-tolyl-3H-quinazolin-4-one (D-095)

52

1 H NMR (300 MHz, d_ {6} -DMSO) δ: 13.30 (s, 1H), 8.29 (s, 1H), 7.72 (t, J = 7.8 Hz, 1H), 7.54 (d, J = 7.8 Hz, 1H), 7.47 9d, J = 6.3 Hz, 1H), 7.38-7.26 (m, 4H), 4.34 (AB quartet, J_ {AB} = 16.1 Hz, Δv = 23.6 Hz, 2H), 2.74 (s, 3H), 2.32 (s, 3H), 2.10 (s, 3H).

LRMS (ES pos.) M / z = 461 (M + 1).

       \ vskip1.000000 \ baselineskip
    

2- (2-Hydroxy-9H-purin-6-ylsulfanylmethyl) -5-methyl-3-o-tolyl-3H-quinazolin-4-one (D-096)

53

1 H NMR (300 MHz, d_ {6} -DMSO) δ: 8.08 (s, 1H), 7.69 (t, J = 7.8 Hz, 1H), 7.50 (brd, J = t 8 Hz, 2H), 7.33-7.50 (m, 4H), 4.28 (AB quartet, J_ {AB} = 15.5 Hz, Δv = 21.3 Hz, 2H), 2.74 (s, 3H), 2.12 (a, 3H).

LRMS (ES pos.) M / z = 431 (M + 1).

       \ vskip1.000000 \ baselineskip
    

5-methyl-2- (1-methyl-1H-imidazol-2-ylsulfanylmethyl) -3-o-tolyl-3H-quinazolin-4-one (D-097)

54

1 H NMR (300 MHz, d_ {6} -DMSO) δ: 7.69 t, J = 7.8 Hz, 1H), 7.46-7.37 (m, 5H), 7.32 (d, J = 7.3 Hz, 1H), 7.20 (d, J = 1.0 Hz, 1H), 6.48 (d, J = 1.0 Hz), 3.83 (AB quartet, 0 Hz, Av = 18.8 Hz, 1H), 3.55 (s, 3H), 2.73 (s, 3H), 2.09 (s, 3H).

LRMS (ES pos.) M / z = 364 (M + 1).

       \ vskip1.000000 \ baselineskip
    

5-methyl-3-o-tolyl-2- (1H- [1,2,4] triazol-3-ylsulfanylmethyl) -3H-quinazolin-4-one (D-098)

55

1 H NMR (300 MHz, d_ {6} -DMSO) δ: 13.98 (s, 1H), 8.47 (s, 1H), 7.70 (t, J = 7.8 Hz, 1H), 7.49 (d, J = 7.9 Hz, 1H), 7.44-7.31 (m, 5H), 4.04 (AB quartet, J_ {AB} = 15.5 Hz, Δv = 19.1 Hz, 1H), 2.74 (s, 3H), 2.10 (s, 3H).

LRMS (ES pos.) M / z = 364 (M + 1).

LRMS (ES pos.) 432 (M + 1).

       \ vskip1.000000 \ baselineskip
    

2- (2-amino-6-chloro-purin-9-ylmethyl) -5-methyl-3-o-tolyl-3H-quinazolin-4-one (D-099)

56

LRMS (ES pos.) 432 (M + 1).

       \ vskip1.000000 \ baselineskip
    

2- (6-aminopurin-7-ylmethyl) -5-methyl-3-o-tolyl-3H-quinazolin-4-one (D-100)

57

1 H NMR (300 MHz, d_ {6} -DMSO) δ: 8.19 (s, 3H), 7.66 (t, J = 7.8 Hz, 1H), 7.59-7.43 (m, 5H), 7.34 9d, J = 7.4 Hz, 1H), 7.23 (d, J = 8.0 Hz, 1H), 6.90 (s, 2H), 5.21 (AB quartet, J_ {AB} 17.4 Hz, Δv = 22.1 Hz, 2H), 2.72 (s, 3H), 1.93 (s, 3H). The alkylation in purine N7 was confirmed by the increase in NOE between the following protons: 1) methylene and amine protons exocyclics; 2) protons of amine and methyl tolyl.

LRMS (ES pos.) M / z = 398 (M + 1).

       \ vskip1.000000 \ baselineskip
    

2- (7-amino-1,2,3-triazolo [4,5-d] pyrimidine-3-ylmethyl) -5-methyl-3-o-tolyl-3H-quinazolin-4-one (D-101)

58

1 H NMR (300 MHz, d_ {6} -DMSO) δ: 8.43 (br s, 1H), 8.19 (s, 1H), 8.10 (br s, 1H), 7.62 (t, J = 7.8 Hz, 1H), 7.49-7.28 (m, 5H), 7.22 (d, J = 8.1 Hz, 1H), 5.49 (d, J = 17.0 Hz, 1H), 5.19 (d, J = 17.0 Hz, 1H), 2.73 (s, 3H), 2.11 (s, 3H). Alkylation in purine N7 determined by similarity to the spectrum nmr of D-030.

LRMS (ES pos.) M / z = 399 (M + 1).

       \ vskip1.000000 \ baselineskip
    

2- (7-amino-1,2,3-triazolo [4,5-d] pyrimidine-3-ylmethyl) -5-methyl-3-o-tolyl-3H-quinazolin-4-one (D-102)

59

From the same reaction mixture as D-101

1 H NMR (300 MHz, d_ {6} -DMSO) δ: 8.27 (s, 1H), 8.20 (br s, 1H), 8.05 (br s. 1H), 7.70 (t, J = 7.8 Hz, 1H), 7.47-7.26 (m, 6H), 5.61 (AB quartet, J_ {AB} = 16.0 Hz, Δv = 20.7 HZ, 2H), 2.75 (s, 3H), 1.98 (s, 3H)). Alkylation in purine N7 determined by similarity to the nmr spectrum of D-100

LRMS (ES pos.) M / z = 399 (M + 1).

       \ vskip1.000000 \ baselineskip
    

2- (6-amino-9H-purin-2-ylsulfanylmethyl) -5-methyl-3-o-tolyl-3H-quinazolin-4-one (D-103)

60

1 H NMR (300 MHz, d_ {6} -DMSO) δ: 12.62 (s, 1H), 7.93 (s, 1H), 7.69 (t, J = 7.7 Hz, 1H), 7.51 (d, J = 8.1 Hz, 1H), 7.42 (dd, J = 7.6.1.7 Hz, 1H), 7.35-7.15 (m, 6H), 4.12 (AB quartet, J_ {AB} = 1.45 Hz, Δv = 18.2 Hz, 2H), 2.73 (s, 3H), 2.10 (s, 3H).

LRMS (ES pos.) M / z = 430 (M + 1).

       \ vskip1.000000 \ baselineskip
    

2- (2-Amino-ethylamino-pyrimidine-4-ylsulfanylmethyl) -5-methyl-3-o-tolyl-3H-quinazolin-4-one (D-104)

61

1 H NMR (300 MHz, d_ {6} -DMSO) δ: 7.70 (T, J = 7.8 Hz, 1H), 7.53 (d, J = 8.0 Hz, 1H), 7.44-7.31 (m, 5H), 6.69 (br s, 1H), 5.83, (br s, 2H), 5.61 (s, 1H), 4.03 (d, J = 14.6 Hz, 1H), 3.95 (d, J = 1.4.6 Hz, 1H), 3.22-3.11 (m, 2H), 2.73 (s, 3H), 2.08 (s, 3H), 1.06 (t, J = 7.1 Hz, 3H).

LRMS (ES pos.) M / z = 433 (M + 1).

       \ vskip1.000000 \ baselineskip
    

2- (3-amino-5-methylsulfanyl-1,2,4-triazol-1-ylmethyl) -5-methyl-3-o-tolyl-3H-quinazolin-4-one (D-105)

62

Yield: 5.0 mg.

1 H NMR (300 MHz, d_ {4} -MeOH) δ: 7.67 (t, J = 7.8 Hz, 1H), 7.55-7.37 (m, 4H), 7.35-7.27 (m, 2H), 4.77 (d, J = 17.1 Hz, 1H), 4.60 (d, J = 17.1 Hz, 1H), 2.80 (s, 3H), 2.43 (s, 3H), 2.14 (s, 3H).

LRMS (ES pos.) M / z = 393 (M + 1).

       \ vskip1.000000 \ baselineskip
    

2- (5-amino-3-methylsulfanyl-1,2,4-triazol-1-ylmethyl) -5-methyl-3-o-tolyl-3H-quinazolin-4-one (D-106)

63

Yield: 0.6 mg.

Purified from the same reaction mixture as D-105 1 H NMR (300 MHz, d_ {4} -MeOH) δ: 7.67 (t, J = 7.8 Hz, 1H), 7.50-7.24 (m, 6H), 4.83 (d, J = 16.5 Hz, 1H), 4.70 (d, J = 16.5 Hz, 1H), 2.79 (s, 3H), 2.47 (s, 3H), 2.14 (s, 3H).

LRMS (ES pos.) M / z = 393 (M + 1).

       \ vskip1.000000 \ baselineskip
    

5-methyl-2- (6-methylaminopurin-9-ylmethyl) -3-o-tolyl-3H-quinazolin-4-one (D-107)

64

Yield: 5.0 mg

1 H NMR (300 MHz, d_ {4} -MeOH) δ: 8.17 (s, 1H), 8.03 (s, 1H), 7.54-7.43 (m 4H), 7.31-7.23 (m, 2H), 5.14 (d, J = 17.5 Hz, 1.H), 4.90 (d, J = 17.5 Hz, 1H), 3.14 (br s, 3H), 2.79 (a, 3H), 2.22 (s, 3H).

LRMS (ES pos.) M / z = 412 (M + 1).

       \ vskip1.000000 \ baselineskip
    

2- (6-benzylaminopurin-9-ylmethyl) -5-methyl-3-o-tolyl-3H-quinazolin-4-one (D-108)

65

Yield: 6.7 mg.

1 H NMR (300 MHz, d_ {4} -MeOH) δ: 8.13 (s, 1H), 8.04 (s, 1H), 7.58 (t, J = 7.8 Hz, 1H), 7.51-7.21 (m, 11H), 5.15 (d, J = 17.5 Hz, 1H), 4.91 (d, J = 17.5 Hz, 1H), 4.83 (s, 2H, under H2O Peak), 2.79 (s, 3H), 2.22 (s, 3H).

LRMS (ES pos.) M / z = 488 (M + 1).

       \ vskip1.000000 \ baselineskip
    

2- (2,6-Diaminopuryl-9-ylmethyl) -5-methyl-3-o-tolyl-3H-quinazolin-4-one (D-109)

66

Double the quantities of all reactants Yield: 14 mg.

1 H NMR (300 MHz, d_ {6} -DMSO) δ: 8.53 (br s, 2H), 8.01 (s, 1H), 7.64 (t, J = 7.8 Hz, 1H), 7.53-7.40 (m, 4H), 7.33 (d, J = 7.4 Hz, 1H), 7.27 9d, J = 7.9 Hz, 1H), 4.96 (d, J = 17.5 Hz, 1H), 4.64 (d, J = 17.5 Hz, 1H), 2.74 (s, 3H), 2.17 (s, 3H).

LRMS (ES pos.) M / z = 413 (M + 1).

       \ vskip1.000000 \ baselineskip
    

D-110 compounds a D-115 of the following general structure is made from the following compounds E-1 to E-3.

67

       \ vskip1.000000 \ baselineskip
    

Intermediate E-1

5-methyl-2- (9H-purin-6-ylsulfanylmethyl) -3,1-benzoxazin-4-one

68

Step 1. A suspension of 6-methylantranilic acid (2 g, 13.2 mmol) in chloroacetyl chloride (12 mL, large excess) was stirred at 115 ° C in a sealed vial for 30 minutes. The resulting solution was cooled to room temperature and treated with ether (-5 mL). After cooling to 4 ° C overnight, the resulting brown precipitate was collected by filtration, washing with ether and drying in vacuo to obtain the chlorine intermediate (1.39 g, 50%).

1 H NMR (300 MHz, CDCl 3) δ: 7.67 (t, J = 7.8 Hz, 1H), 7.46 (d, J = 7.9 Hz, 1H), 7.35 (d, J = 7.6 Hz, 1H), 4.39 (s, 2H), 2.81 (s, 3H).

LRMS (ES pos.) M / z = 210, (M + 1).

       \ vskip1.000000 \ baselineskip
    

Step 2. A mixture of the chlorine intermediate (50 mg, 0.25 mmol), 6-mercaptopurine monohydrate (43 mg, 0.25 mmol), and potassium carbonate (25 mg, 0.25 mmol) in dry DMF ( 0.5 mL) was stirred at room temperature for 30 minutes. The mixture was poured into ethyl acetate (20 mL) and all insoluble material was filtered and discarded. The filtrate was concentrated in vacuo to remove all ethyl acetate and the residue was treated with ether, resulting in a light orange precipitate. The precipitate was collected by filtration, washed with ether and dried in vacuo to obtain Intermediate E-1 (41 mg, 51%).

1 H NMR (300 MHz, d_ {6} -DMSO) δ: 8.64 (s, 1H), 8.39 (s, 1H), 7.73 (t, J = 7.8 Hz, 1H), 7.44-7.37 (m, 2H), 4.69 (s, 2H), 2.69 (s, 3H).

LRMS (ES pos.) M / z = 326 (M + 1).

       \ vskip1.000000 \ baselineskip
    

Intermediate E-2

69

A solution of 2-nitroacetanilide (1.0 g, 5.6 mmol) in EtOH was purged with nitrogen, treated with Pd (OH) 2 (20% by weight in C, 200 mg, cat.), And stirred for two hours under H2 (20 psi). The catalyst was removed by filtration through a 0.22 um cellulose acetate membrane (Corning), and the filtrate was concentrated in vacuo to obtain a white crystalline solid product (800 mg, 96%).

1 H NMR (300 MHz, d_ {6} -DMSO) δ: 9.12 (s, 1H), 7.14 (dd, J = 7.8, 1.3 Hz, 1H), 6.88 (dt, J = 7.6, 1.5 Hz, 1H), 6.70 (dd, J = 8.0, 1.3 Hz, 1H), 6.52 (dt, J = 7.5, 1.4 Hz, 1H), 4.85 (br s, 2H), 2.03 (s, 3H).

LRMS (ES pos.) M / z = 151 (M + 1).

       \ vskip1.000000 \ baselineskip
    

Intermediate E-3

70

A mixture of 2-fluoro-nitrobenzene (1.41 g, 10 mmol) and NaHCO 3 in EtOH (20 mL) was treated with (N, N, N'-trimethyl) -1,2-diaminoethane (1, 1 g, 11 mmol) and stirred for 16 hours at 80 ° C. The solvent was removed in vacuo , the residue was treated with 0.1 M NaOH (120 mL), and the mixture was extracted with ethyl acetate (2 x 50 mL).

The organic layers were combined and washed with 20 mL of water (1x) and brine (2x), dried with sodium sulfate and concentrated in vacuo to obtain an orange liquid (2.2 g, 100%; ESMS: m / z = 224, M + 1).

This intermediate was dissolved in EtOH, the solution was purged with nitrogen, treated with Pd (OH) 2 (20% by weight in C, 180 mg, cat.), And stirred for two hours under H2 (50 psi) . The catalyst was removed by filtration through a 0.22 um cellulose acetate membrane (Corning), and the filtrate was concentrated in vacuo to obtain the red liquid product E-3 (1.8 g, 95%).

1 H NMR (300 MHz, CDCl 3) δ: 8.64 (s, 1H), 7.03 (dd, J = 8.3, 1.4 Hz, 1H), 6.91 (ddd, J = 7.6, 7.2, 1.4 Hz, 1H), 6.73-6.67 (m, 2H), 4.20 (br s, 2H), 2.95 (t, J = 6.7 Hz, 2H), 2.68 (s, 3H), 2.41 (t, J = 6.7 Hz, 1H), 2.26 (s, 6H).

LRMS (ES pos,) m / z = 194 (M + 1).

       \ vskip1.000000 \ baselineskip
    

D-110 compounds a D-115 were prepared as follows:

5-methyl-2- (9H-purin-6-ylsulfanylmethyl) -3-o-tolyl-3H-quinazolin-4-one (D-110)

71

A mixture of Intermediate E-1, (40 mg) and o-toluidine (0.3 mL, large excess) was heated at 100 ° C in a sealed vial for 16 hours. The reaction mixture was cooled, treated with 1N HCl (2 mL) and ether (2 mL), and the resulting gray precipitate was collected by filtration, washed with ether and air dried (19 mg crude). The crude solid was dissolved in 0.5 mL DMSO and purified by HPLC (C18 Luna column, 4.6 x 250 mm, 4.7 mL / min, 10-75% acetonitrile / water for 15 min., 100% acetonitrile at 18 min., detector at 220A). The appropriate fractions were concentrated in vacuo to obtain the final product as a white solid (4 mg).

1 H NMR (300 MHz, d_ {6} -DMSO) δ: 13.52 (s, 1H), 8.47 (s, 1H), 8.43 (s, 1H), 7.69 (t, J = 7: 8 Hz, 1H), 7.50 (d, J = 7.9 Hz, 1H), 7.46-7.43 (m, 1H), 7.37-7.25 (m, 4H), 4.37 (AB quartet, J_ {AB} = 15.4 Hz, Δv = 22.4 Hz, 2H), 2.74 (5, 3H), 2.12 (5, 3H).

LRMS (ES pos.) M / z = 415 (M + 1).

       \ vskip1.000000 \ baselineskip
    

3-isobutyl-5-methyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one (D-111)

72

A mixture of Intermediate E-1 (40 mg) and isobutylamine (0.4 mL, large excess) was heated at 120 ° C in a sealed vial for 16 hours. The excess isobutylamine was allowed to evaporate and the residue was dissolved in 1 mL DMSO and purified by HPLC (C18 Luna column, 4.6 x 250 mm, 4.7 mL / min, 10-75% acetonitrile / water for 15 min ., 100% acetonitrile at 18 min., Detector at 220 [lambda]. The appropriate fractions were concentrated in vacuo to obtain the final product as a white solid (4 mg).

1 H NMR (300 MHz, d_ {6} -DMSO) δ: 13.75 (br s, 1H), 8.73 (s, 1H), 8.50 (s, 1H), 7.63 (t, J = 7.7 Hz, 1H), 7.42 (d, J = 8.0 Hz, 1H), 7.28 (d, J = 7.3 Hz, 1H), 4.96 (s, 2H), 4.00 (d, J = 7.5 Hz, 2H), 2.77 (s, 3H), 2.30-2.15 (m, 1H), 0.98 (d, J = 6.7 Hz, 1 HOUR).

LRMS (ES pos.) M / z = 381 (M + 1).

       \ vskip1.000000 \ baselineskip
    

N- {2- [5-methyl-4-oxo-2- (9H-purin-6-ylsulfanylmethyl) -4H-quinazolin-3-yl] -phenyl} -acetamide (D-112)

73

A mixture of Intermediate E-1 (80 mg, 0.25 mmol) and Intermediate E-2 (75 mg, 0.5 mmol, 2 eq) was heated to melt in a sealed vial using a heat gun. The reaction mixture was triturated with ether and the solids were collected by filtration. The crude material was dissolved in 1 mL DMSO and purified in two portions by HPLC (C18 Luna column, 4.6 x 250 mm, 4.7 mL / min, 10-75% acetonitrile / water for 15 min., 100 % acetonitrile at 18 min., detector at 220 [lambda]. The appropriate fractions were concentrated in vacuo to obtain the final product as a white solid.

1 H NMR (300 MHz, d_ {6} -DMSO) δ: 13.52 (s, 1H), 9.52 (s, 1H), 8.48 (s, 3H), 8.42 (s, 3H), 8.02 (d, J = 8.0Hz, 1H), 7.69 (t, J = 7.8 Hz, 1H), 7.51 (d, J = 7.9 Hz, 1H), 7.45-7.37 (m, 2H), 7.31 (d, J = 7.3 Hz, 1H), 7.19 (t, J = 7.5 Hz, 1H), 4.38 (s, 2H), 2.74 (s, 3H), 1.93 (s, 3H).

LRMS (ES pos.) M / z = 458 (M + 1).

       \ vskip1.000000 \ baselineskip
    

5-methyl-3- (E-2-methyl-cyclohexyl) -2- (9H-purin-5-ylsulfanylmethyl) -3H-quinazolin-4-one (D-113)

74

A mixture of intermediate E-1 (80 mg, 0.25 mmol) and trans-2-methyl-1-aminocyclohexane (0.25 mL, large excess) was heated in a sealed vial at 100 ° C for 16 hours. The reaction mixture was triturated with ether and the solids were collected by filtration. The crude material was dissolved in 0.5 mL DMSO and purified by HPLC (C18 Luna column, 4.6 x 250 mm, 4.7 mL / min, 10-75% acetonitrile / water for 15 min., 100% acetonitrile at 18 min., detector at 220 λ). The appropriate fractions were concentrated in vacuo to obtain the final product as a white solid (1.5 mg).

1 H NMR (300 MHz, d_ {6} -DMSO) δ: 13.5 (br s, 1H), 8.82 (s, 1H), 8.51 (3, 1H), 7.63 (t, J = 7.7 Hz, 1H), 7.43 (d, J = 7.9 Hz, 1H), 7.27 (d, J = 7.4 Hz, 1H), 5.11 (d, J = 14.5 Hz, 1H), 3.78-3.69 (m, 1H), 2.73 (s, 3H), 2.55-2.40 (m, 3H), 1.88-1.46 (m, 4H), 1.31-1.11 (m, 1H), 0.90-0.65 (m, 1H), 0.74 (d, J = 6.7 Hz, 3H).

LRMS (ES pos.) M / z = 421 (M + 1).

       \ vskip1.000000 \ baselineskip
    

2- [5-methyl-4-oxo-2- (9H-purin-6-ylsulfanylmethyl) -4H-quinazolin-3-yl] -acid benzoic (D-114)

75

A mixture of intermediate E-1 (80 mg, 0.25 mmol) and methyl anthranilate (0.25 mL, large excess) was heated in a sealed vial at 100 ° C for 16 hours. The reaction mixture was triturated with ether and the solids were collected by filtration. The crude material was dissolved in 0.5 mL DMSO and purified by HPLC (C18 Luna column, 4.6 x -250 mm, 4.7 mL / min, 10-75% acetonitrile / water for 15 min., 100 % acetonitrile at 18 min., detector at 220 [lambda]. The appropriate fractions were concentrated in vacuo to obtain the final product as a white solid (8 mg).

1 H NMR (300 MHz, d_ {6} -DMSO) δ: 13.51 (s, 1H), 8.51 (s, 1H), 8.42 (s, 1H), 8.11 (dd, J = 7.4, 1.1 Hz, 1H), 7.88 (dt, J = 7.7, 1.4 Hz, 1H), 7.70 (d, J = 8.0 Hz, 1H), 7.57 (t, J = 7.2 Hz, 1H), 7.49-7.35 (m, 3H), 4.58 (d, J = 15.5 Hz, 1H), 4.35 (d, J = 15.5 Hz, 1H), 2.44 (s, 3H).

LRMS (ES pos.) M / z = 445 (M + 1).

       \ vskip1.000000 \ baselineskip
    

3- {2 - [(2-dimethylamino-ethyl) -methyl-amino] -phenyl} -5-methyl-2- (90-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one (D-115)

76

A mixture of intermediate E-1 (40 mg, 0.25 mmol) and Intermediate E-3 (0.2 mL, large excess) was heated in a sealed vial at 100 ° C for 16 hours. The reaction mixture was triturated with ether and the solids were collected by filtration. The crude material was dissolved in 1 mL DMSO and purified by HPLC in two portions (C18 Luna column, 4.6 x 250 mm, 4.7 mL / min, 10-75% acetonitrile / water for 15 min., 100 % acetonitrile at 18 min., 0.05% TFA in all solvents, detector at 220 [lambda]. The appropriate fractions were concentrated in vacuo to obtain the final product as a TFA salt (11 mg).

1 H NMR (300 MHz, d_ {6} -DMSO) δ: 13.4 (br s, 1H), 9.27 (s, 1H), 8.52 (S, 1H), 8.44 (s, 1H), 7.72 (t, J = 7.8 Hz, 1H), 7.53 (d, J = 7.9 Hz, 1H), 7.40-7.33 (m, 4H), 7.10-7.04 (m, 1H), 4.42 (s, 3H), 3.5 (m, 2H), 3.23-3.03 (m, 3H), 2.75 (s, 3H), 2.68-2.56 (m, 8H).

LRMS (ES pos.) M / z = 501 (M + 1).

       \ vskip1.000000 \ baselineskip
    

Compounds D-116 a D-118 were prepared as follows:

77

       \ vskip1.000000 \ baselineskip
    

3- (2-Chlorophenyl) -5-methoxy-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one (D-116)

(R = Me, X = O)

A mixture of D-015 (25 mg) in 0.5 M NaOMe (2 mL in MeOH; large excess) was stirred at 50 ° C for 16 hours in a sealed vial. The reaction mixture was cooled to room temperature, treated with water (5 mL) and the resulting precipitate was collected by filtration, washed with water and air dried. The crude material was dissolved in 0.5 mL DMSO and purified by HPLC (C18 Luna column, 4.6 x 250 mm, 4.6 mL / min, 10-75% acetonitrile / water for 15 min., 100% acetonitrile at 18 min., detector at 220 λ). The appropriate fractions were concentrated in vacuo to obtain the final product as a white solid (5.3 mg).

1 H NMR (300 MHz, d_ {6} -DMSO) δ: 13.52 (s, 1H), 8.48 (s, 1H), 8.44 (br s, 1H), 7.77 (t, J = 8.2 Hz, 1H), 7.71-7.60 (m, 2H), 7.51-7.34 (m, 2H), 7.23 (d, J = 8.2Hz, 1H), 7.10 (d, J = 8.4 Hz, 1H), 4.39 (AB quartet, J_ {AB} = 5.2 Hz, Δ = 23.2 Hz, 2H), 3.85 (s, 3H).

LRMS (ES positive) m / z = 451 (M + 1).

       \ vskip1.000000 \ baselineskip
    

3- (2-Chlorophenyl) -5- (2-morpholin-4-yl-ethylamino) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one (D-117)

       \ vskip1.000000 \ baselineskip
    

78

A mixture of D-015 (25 mg) and 4- (aminoet-2-yl) -morpholine (650 mg, large excess) was stirred at 50 ° C for 16 hours. The crude reaction mixture was purified by HPLC (C18 Luna column, 4.6 x 250 mm, 4.7 mL / min, 10-75% acetonitrile / water for 15 min, 100% acetonitrile at 18 min., Detector at 220 λ). Appropriate fractions were concentrated in vacuo to generate the final product.

1 H NMR (300 MHz, d_ {6} -acetone) δ: 8.57 (br s, 1H), 8.47 (s, 1H), 8.37 (s, 1H), 7.72 (dd, J = 7.7, 1.6 Hz, 1H), 7.65 (dd, J = 8.0, 1.2 Hz, 1H), 7.57 (t, J = 8, l Hz, 1H), 7.49 (dt, J = 7.7.1.6 Hz, 1H), 7:40 (dt, J = 7.7.1.5 Hz, 1.H), 6.86 (d, 0 = 7.4 Hz, 1H), 6.82 (d, J = 8.3 Hz, 1H), 4.55 (d, J = 15.0 Hz, 1H), 4.42 (d, J = 15.1 Hz, 1H), 4.05-3.90 (m, 4H), 3.90 (t, J = 6.9 Hz, 2H), 3.75-3.4 (m, 4H), 3.54 (t, J = 6.9 Hz, 2H).

LRMS (ES positive) m / z = 549 (M + 1).

       \ vskip1.000000 \ baselineskip
    

3-benzyl-5-methoxy-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one (D-118)

       \ vskip1.000000 \ baselineskip
    

79

A mixture of D-043 (25 mg) in 0.5 M NaOMe (2 mL in MeOH; large excess) was stirred at 50 ° C for 16 hours in a sealed vial. The reaction mixture was treated with 1 N HCl (1 mL) and aliquots of this solution (0.5 mL each) were purified by HPLC (C18 Luna column, 4.6 x 250 mm, 4.7 mL / min, 10-75% acetonitrile / water for 15 min., 100% acetonitrile at 18 min., detector at 220 [lambda]). The appropriate fractions were concentrated in vacuo to obtain the final product as a white solid (6.6 mg).

1 H NMR (300 MHz, d_ {6} -DMSO) δ: 13.57 (s, 1H), 8.60 (S, 1H), 8.45 (S, 1H), 7.72 (t, J = 8.1 Hz, 1H), 7.42-7.30 (m, 2H), 7.30-7.19 (m, 3H), 7.15 (d, J = 8.0 Hz, 1H), 7.06 (d, J = 8.3 Hz, 1H), 5.43 (s, 2H), 4.80 (s, 2H), 3.87 (s, 3H).

LRMS (ES positive) m / z = 431 (M + 1).

       \ vskip1.000000 \ baselineskip
    

Compound D-999 (comparative)

3- (2-Chlorophenyl) -2- (1H-pyrazolo [3,4-d] pyrimidin-4-ylsulfanylmethyl) -3H-quinazolin-4-one

An analogous compound, 3- (2-Chlorophenyl) -2- (1H-pyrazolo [3,4-d] pyrimidin-4-ylsulfanylmethyl) -3H-quinazolin-4-one, it was also synthesized in general according to the methods described, except because a 4-mercapto-1H-pyrazolo [3,4-d] pyrimidine It was replaced by mercaptopurine in the final step.

       \ vskip1.000000 \ baselineskip
    

Example 11 Biochemical tests of the selectivity and potency of PI3K A. Biochemical assay using 20 µM ATP

Using the method described in Example 2, above, the compounds of the invention were tested for check its inhibitory activity and its potency against PI3K?, As well as its selectivity for PI3K? Versus other class I PI3K isoenzymes. In Table 2, the values of IC 50 are provided for PI3Kα ("Alpha"), PI3K? ("Beta") / PI3? ("Gamma"), and PI3K? ("Delta"). To illustrate the selectivity of compounds, the ratios of the IC50 values of the compounds for PI3Kα, PI3Kβ, and PX3Kγ in relationship with PI3K \ delta, respectively, as "Ratio Alpha / Delta "," Beta / Delta Ratio "and" Ratio Gamma / Delta. "

The initial selectivity tests are performed identically to the selectivity test protocol of Example 2, except that 100 µL of Ecoscint was used for Radiolabelled detection The subsequent selectivity tests they were performed similarly, using the same stocks of 3X substrate, except that they contained 0.05 mCi / mL γ [32 P] ATP and 3 mM PIP 2.

The subsequent selectivity tests also they used the same stocks of 3X enzymes, except because now They contained 3 nM of any given PI3K isoform.

For all selectivity tests, test compounds were weighed and dissolved in stocks of 10-50 mM in 100% DMSO (depending on your respective solubilities) and stored at -20 ° C. The compounds were thawed (up to room temperature or 37 ° C), diluted up to 300 µM in water, with which a triple was performed water dilution series. With these dilutions, 20 were added µL in the test wells along with water targets used for enzymatic control (positive) and no control enzymatic (reference). The rest of the trial was performed essentially according to the protocol of the selectivity test of Example 2

In those cases where the maximum concentration used in the assay, ie 100 µM, no inhibited enzyme activity in at least 50% of the table indicates the percentage of activity remaining at that concentration (it is say at 100 µM): In these cases, the true ratio or ratios of activity for the compounds cannot be calculated, since it is missing one of the necessary IC50 values. However, to give an idea of the characteristics of these compounds, a ratio of hypothetical activity using 100 µM instead of value missing. In fact, in these cases, the selectivity ratio must be greater than the hypothetical value, and this is indicated by the use of a symbol greater than (>).

80

81

82

83

       \ newpage
    

B. Biochemical assay using 200 µM ATP

In Part A above, the compounds of the invention were tested to establish their IC_ {50} for the inhibition of the alpha, beta, delta and gamma isoforms of PI3K using 20 µM ATP. Another study was conducted to establish the IC 50 for the inhibition of the four isoforms of PI3K at a final concentration of 200 µM ATP, 10 times higher, and substantially closer to the normal physiological concentration of ATP in the cells. This selectivity protocol is identical to described above, except that the concentration of ATP in the 3X inventory was 600 µM. The data of this essay is summarized in Table 3, below. The sensitivity observed to the ATP concentration suggests that these compounds inhibitory PI3K? Act as competitors of ATP.

84

85

       \ newpage
    

Example 12 Data from the cell test for inhibitors of PI3K \ delta activity

Using the methods described in the Examples 3-5 above, the compounds of the invention were tested to check potency and inhibitory activity in stimulation assays for T and B cell proliferation, Neutrophil migration (PMN) and elastase release from neutrophils (PMN). The data of these tests are collected in the Table 4, below. In Table 4, the values shown are effective concentrations of the compound (EC50; µM). When no value is provided means no was performed test.

86

       \ vskip1.000000 \ baselineskip
    

Example 13 Inhibitor assay of PI3K? Activity in cells carcinogenic

The effect of the compounds of the invention on the proliferation of cancer cells was evaluated by testing one of the compounds against a group of cell lines of chronic myeloid leukemia (CML), including KU812, RWLeu4, K562, and MEG-01.

The inhibitory activity of the compound (D-000, dissolved in DMSO) was determined as follows. The tested compound was added in a series of concentrations (0.001 µM to 20 µM) to 96-well microtiter plates with cells (1000 to 5000 cells / well). The plates were incubated for five days at 37 ° C during which cultures of control without the test compound could undergo at least two cycles of cell division. Cell growth was measured by incorporating [3 H] -thymidine for eighteen hours, added on days three, four and five. The cells were transferred to a filter, washed and the Radioactivity was measured using a Matrix 96 beta counter (Packard) The percentage of cell growth was measured as follow:

87

The EC50 value in these experiments is determined by the concentration of the test compound that resulted in a radioactivity count 50% lower than that obtained using the control without inhibitor. The compound D-000 demonstrated an inhibitory activity with a EC 50 of approximately 2 µM for lines KU812 and RWLeu4. The compound showed no effect on the K562 lines and MEG-01.

The PI3K? Inhibitors of the invention they seem to inhibit CML cell growth and therefore could be useful for the treatment of benign tumors or malignant The expression of PI3K? Has been demonstrated so far mainly in cells of hematopoietic origin. However, could be present in a wider variety of cells in proliferation. Thus, the compounds of the invention could be use to induce tumor regression and prevent formation of tumor metastases in both leukemia and solid tumor or in the proliferation of non-tumor origin. On the other hand, the compounds could be used alone or in combination with others pharmacologically active compounds or together with radiation as sensitizing agent

       \ vskip1.000000 \ baselineskip
    

Example 14 Measurement of elastase exocytosis with the air pouch model in mouse

The effect of D-030 on leukocyte influx and exocytosis of neutrophil elastase in animal models was tested. The six-day air pouch model is an in vivo inflammation model that histologically resembles an articular synovium. A film of organized fibroblasts and mononuclear cells is developed that is reminiscent of a synovial cavity. The model represents an "acute" model of a chronic disease (such as rheumatoid arthritis). This model allows the evaluation in vivo of agents to block the cellular influence in the air bag (air pouch) under the influence of an inflammatory stimulus.

88

The test was performed as follows: day zero, shaved groups of rats and injected 10 ml of air simultaneously on the back of each one, forming a bag. The day three, another 10 ml of air was injected. Six hours before the TNF test on day six, a group of rats (n = 6) received D-030 (100 mg / kg in a PEG 400 vehicle) by route orally, and another group (n = 12) received only the vehicle via oral. Six hours after the dose, the air pockets of both groups received 2.5 ng of TNF. Twelve hours after the dose, the bags were washed with saline, and the washing fluid resulting was analyzed to check white blood cell counts and neutrophil elastase activity. They were also extracted blood to determine D-030 levels in circulation. The results were as follows: the rats that they received D-030 for twelve hours they had a mean of 8.7 µM of the compound in circulation and had a reduction 82% of total leukocytes in the wash fluid in comparison with vehicle controls. The reductions in Specific white blood cell counts were as follows: neutrophils (90%), eosinophils (66%), and lymphocytes (70%). The Quantification of neutrophil elastase showed that rats treated with D-030 had elastase levels slightly reduced (15%) compared to the controls of the vehicle.

In another test, a mouse loin area is shaved using a shearer and an airbag was created by injecting 3 ml of air subcutaneously. On day three, the air injection. On day six, the animals were administered D-030 (32 mg / kg in LABRAFIL®) or LABRAFIL® only one hour before and two hours after the test with TNF-? (0.5 ng in 1 ml PBS), or PBS only. PBS is phosphate buffer saline. Four hours after TNF test, the animals were anesthetized and the bags were washed with 2 mL of 0.9% saline solution with 2 mM EDTA. Washes They were centrifuged at 14,000 rpm in a microcentrifuge.

50 microliters of the supernatant were used to measure elastase exocytosis according to the procedure previously described.

As shown in Figure 9, the TNF test induced a high level of elastase exocytosis compared to PBS animals. However, when the animals of the TNF test were treated with D-030, a significant decrease in elastase activity in washes of the air bag.

Although the present invention has been described with specific reference to certain embodiments preferable in order to clarity and knowledge, will result obvious to the qualified professional that can be practiced other changes and modifications within the scope of the invention, as defined in the claims set forth in continuation. Therefore, no limit to the invention except for those specifically included in the claims.

Claims (38)

1. A compound with a structure 89 where Y is selected from the group composed of none and NH; R 4 is selected from the group consisting of H, halogen, NO 2, OH, OCH 3, CH 3, and CF 3; R 5 is selected from the group consisting of H, OCH 3, and halo; or R 4 and R 5 together with C-6 and C-7 ring system Quinazoline defines a 5 or 6-membered aromatic ring that optionally contains one or more atoms of O, N, or S; R 6 is selected from the group consisting of C 1 -C 6 alkyl, phenyl, halophenyl, alkoxyphenyl, alkylphenyl, biphenyl, benzyl, pyridinyl, 4-methylpiperazinyl, C (= O) OC 2 H 5, and morpholinyl; R d, independently, is selected from group consisting of NH2, halo, C 1-3 alkyl, S (C 1-3) alkyl, OH, NH (C 1-3) alkyl, N (C 1-3 alkyl) 2, NH (C 1-3 alkylene phenyl); Y 90 q is 1 or 2; and salts and solvates of the same pharmaceutically acceptable, provided that at least one of R 4 and R 5 is different from H when R 6 is phenyl or 2-chlorophenyl.

         \ vskip1.000000 \ baselineskip
      

2. The compound of claim 1 selected from the group consisting of: 2- (6-aminopurin-9-ylmethyl) -3- (2-isopropylphenyl) -5-methyl-3H-quinazolin-4-one; 2- (6-aminopurin-9-ylmethyl) -5-methyl-3-o-tolyl-3H-quinazolin-4-one; 2- (6-aminopurin-9-ylmethyl) -3-biphenyl-2-yl-5-chloro-3H-quinazolin-4-one; 2- (6-aminopurin-9-ylmethyl) -3- (2-fluorophenyl) -5-methyl-3H-quinazolin-4-one; 2- (6-aminopurin-9-ylmethyl) -5-chloro-3- (2-fluorophenyl) -3H-quinazolin-4-one; 2- (6-aminopurin-9-ylmethyl) -8-chloro-3- (2-chlorophenyl) -3H-quinazolin-4-one; 2- (6-aminopurin-9-ylmethyl) -5-chloro-3- (2-chlorophenyl) -3H-quinazolin-4-one; 2- (6-aminopurin-9-ylmethyl) -3- (2-chlorophenyl) -5-methyl-3H-quinazolin-4-one; 2- (6-aminopurin-9-ylmethyl) -3- (2-chlorophenyl) -5-fluoro-3H-quinazolin-4-one; 2- (6-aminopurin-9-ylmethyl) -3-benzyl-5-fluoro-3H-quinazolin-4-one; 2- (6-aminopurin-9-ylmethyl) -3-butyl-3H-quinazolin-4-one; 2- (6-aminopurin-9-ylmethyl) -3-morpholin-4-yl-3H-quinazolin-4-one; 2- (6-aminopurin-9-ylmethyl) -3- (2-chlorophenyl) -7-fluoro-3H-quinazolin-4-one; 2- (6-aminopurin-9-ylmethyl) -6-chloro-3- (2-chlorophenyl) -3H-quinazolin-4-one; 2- (6-aminopurin-9-ylmethyl) -6-bromo-3- (2-chlorophenyl) -3H-quinazolin-4-one; 2- (6-aminopurin-9-ylmethyl) -3- (2-chlorophenyl) -6,7-dimethoxy-3H-quinazolin-4-one; 2- (6-aminopurin-9-ylmethyl) -5-chloro-3-o-tolyl-3H-quinazolin-4-one; Y 2- (6-Aminopurin-9-ylmethyl) -5-chloro-3- (2-methoxy-phenyl) -3H-quinazolin-4-one.

         \ vskip1.000000 \ baselineskip
      

3. The compound of claim 1, wherein R 4 is selected from the group consisting of H, halo, OH, OCH 3, CH 3, and CF 3; R 6 is selected from the group consisting of C 1 -C 6 alkyl, phenyl, halophenyl, alkylphenyl, biphenyl, benzyl, pyridinyl, 4-methylpiperazinyl, C (= O) OC 2 H 5, and morpholinyl; where (a) R 4 and R 5, independently, are different from the 6-halo groups or 6,7-dimethoxy; Y (b) R 6 is different from 4-chlorophenyl. (c) at least one of R 4 and R 5 is different from H when R 6 is phenyl or 2-chlorophenyl and Y is S.

         \ vskip1.000000 \ baselineskip
      

4. The compound of claim 1 is select from the group consisting of: 2- (6-aminopurin-9-ylmethyl) -3- (2-isopropylphenyl) -5-methyl-3H-quinazolin-4-one; 2- (6-aminopurin-9-ylmethyl) -5-methyl-3-o-tolyl-3H-quinazolin-4-one; 2- (6-aminopurin-9-ylmethyl) -3-biphenyl-2-yl-5-chloro-3H-quinazolin-4-one; 2- (6-aminopurin-9-ylmethyl) -3- (2-fluorophenyl) -5-methyl-3H-quinazolin-4-one; 2- (6-aminopurin-9-ylmethyl) -5-chloro-3- (2-fluorophenyl) -3H-quinazolin-4-one; 2- (6-aminopurin-9-ylmethyl) -8-chloro-3- (2-chlorophenyl) -3H-quinazolin-4-one; 2- (6-aminopurin-9-ylmethyl) -5-chloro-3- (2-chlorophenyl) -3H-quinazolin-4-one; 2- (6-aminopurin-9-ylmethyl) -3- (2-chlorophenyl) -5-methyl-3H-quinazolin-4-one; 2- (6-aminopurin-9-ylmethyl) -3- (2-chlorophenyl) -5-fluoro-3H-quinazolin-4-one; 2- (6-aminopurin-9-ylmethyl) -3-benzyl-5-fluoro-3H-quinazolin-4-one; 2- (6-aminopurin-9-ylmethyl) -3-butyl-3H-quinazolin-4-one; 2- (6-aminopurin-9-ylmethyl) -3-morpholin-4-yl-3H-quinazolin-4-one; 2- (6-aminopurin-9-ylmethyl) -3- (2-chlorophenyl) -7-fluoro-3H-quinazolin-4-one; Y 2- (6-aminopurin-9-ylmethyl) -5-chloro-3-o-tolyl-3H-quinazolin-4-one.

         \ vskip1.000000 \ baselineskip
      

5. A compound with a structural formula general 91 where A is 1000 substituted or unsubstituted by one to three substituents selected from the group consisting of N (R a) 2, halo, C 1-3 alkyl, S (C 1-3 alkyl), OR ^ {a}, halo, and 92 X is selected from the group consisting of CHR b, CH 2 CHR b, and CH = C (R b);

         \ global \ parskip0.850000 \ baselineskip
      

And it is selected from the group consisting of none, NH, O, C (= O), OC (= O), C (= O) O, and NHC (= O) CH 2 S; R 1 and R 2, independently, are selected from the group consisting of hydrogen, C 1-6 alkyl, aryl, heteroaryl, halo, NHC (= O) C 1-3 alkylene N (R a) 2, NO 2, OR a, OCF 3, N (R a) 2, CN, OC (= O) R a , C (= O) R a, C (= O) OR a, arilOR b, Het, NR a C (= O) C 1-3 C alkylene ( = O) OR a, arylOC 1-3 alkylene-N (R a) 2, arylOC (= O) R a, C 1-4 alkylene C (= O) OR a, OC 1-4 alky
lenoC (= O) OR a, C 1-4 alkyleneOC 1-4 alkylene C (= O) OR a, C (= O) -NR a SO 2 R a, C 1-4 alkylene N (R a) 2, C 2-6 alkenylene N (R a) 2, C (= O) -NR a C 1-4 alkyleneOR a, C (= O) NR a C 1-4 alkylene Het, OC 2-4 alkylene N (R a) 2, OC 1-4 alkylene CH (OR b)
CH 2 N (R a) 2, OC 1-4 alkyleneHet, OC 2-4 alkyleneOR a, OC 2-4 alkylene-NR a C (= O) OR a, NR a C 1-4 alkylene N (R a) 2, NR a
C (= O) R a, NR a C (= O) N (R a) 2, N (SO 2 C 1-4 alkyl) 2, NR a (SO 2 C 1-4 alkyl), SO 2 N (R a) 2, OSO 2 CF 3, C_ { 1-3} alkylenearyl, C 1-4 alkylene Het, C 1-6 alkyleneOR b, C 1-3 alkylene N (R a) 2, C (= O) N (R a) 2, NHC (= O) C 1 -C 3 alkylenearyl, C 3-8 cycloal-
chyl, C 3-8 heterocycloalkyl, arylOC 1-3 alkylene N (R a) 2, arylOC (= O) R b, NHC (= O) C 1-3 C 3-8 alkylene heterocycloalkyl
lo, NHC (= O) C 1-3 -alkyleneHet, OC 1-4 alkyleneOC 1-4 alkylene C (= O) OR b, C (= O) C 1-4 alkyleneHet, and NHC (= O) halo
C 1-6 alkyl; or R 1 and R 2 join to form a component with an alkenylene or alkylene chain of 3 or 4 members of a ring of 5 or 6 members, which contains at least one heteroatom; R 3 is selected from the group consisting of optionally substituted hydrogen, C 1-6 alkyl, C 3-8 cycloalkyl, C 3-8 heterocycloalkyl, C 1-4 alkylenecycloalkyl, C_ {2-6 alkenyl, C 1-3 alkylenearyl, arylC 1-3 alkyl, C (= O) R a, aryl, heteroaryl, C (= O) OR a, C (= O) N (R a) 2, C (= S) N (R a) 2, SO 2 R a, SO 2 N (R a) 2, S (= O) R a, S (= O) N (R a) 2, C (= O) NR a } C_4-4
lenoOR a, C (O) NR a C 1-4 alkyleneHet, C (= O) C 1-4 alkylenearyl, C (= O) C 1-4 alkyleneheteroaryl, C_ {1-4 alkylenearyl optionally substituted by one or more halos, SO 2 N (R a) 2, N (R a) 2, C (= O) OR a, NR a SO 2 CF 3, CN, NO 2, C (= O) R a, OR a, C 1-4 alkylene N (R a) 2, and OC 1-4 alkylene N (R a) 2, C 1-4 -alkyleneheteroaryl, C 1-4 alkyleneHet, C_ {1-4} alkylene C (= O) -C 1-4}
alkyleneoaryl, C 1-4 alkylene C (= O) C 1-4 alkylenehetero-aryl, C 1-4 alkylene C (= O) Het, C 1-4 alkylene C (= O) N (R a) 2,
C 1-4 alkyleneOR a, C 1-4 alkylene NR a C (= O) R a, C 1-4 alkylene O-C 1-4 alkyleneOR ^ {a}, C 1-4 alkylene N (R a) 2, C 1-4 alkyl
lenoC (= O) -OR a, and C 1-4 alkyleneOC 1-4 alkylene C (= O) OR a; R a is selected from the group consisting of hydrogen, C 1-6 alkyl, C 3-8 cycloalkyl, C 3-8 heterocycloalkyl, C 1-3 alkylene N (R a) 2, aryl, arylC 1-3 alkyl, C 1-3 alkylenearyl, heteroaryl, C1-3 alkyl heteroaryl, and C 1-3 alkyleneheteroaryl; or join two groups R a to form a 5 or 6 member ring, which may optionally contain at least a heteroatom; R b is selected from the group consisting of hydrogen, C 1-6 alkyl, aryl, heteroaryl, arylC 1-3 alkyl, heteroaryl
C 1-3 alkyl, C 1-3 alkylenearyl, and C 1-2 alkyleneheteroaryl; Het is a 5 or 6 heterocyclic ring members, saturated or partially or totally unsaturated that contains the minus a heteroatom selected from the group consisting of oxygen, nitrogen and sulfur, and optionally substituted by C 1-4 alkyl or C (= O) OR a; and salts and solvates thereof pharmaceutically acceptable, with the proviso that if X-Y is CH 2 S, then R 3 is different from 93 and if X-Y is CH 2 S, then R 3 is different from phenyl substituted -CH2CH (OH) CH2OH, where "aryl" is defined as a monocyclic aromatic group or bicyclic, which can be substituted or not substituted by one or more of The following elements: halo, alkyl, phenyl, hydroxyalkyl, alkoxy, alxyalkyl, haloalkyl, nitro, amino, alkylamino, acylamino, alkylthio, alkylsulfinyl and alkylsulfonyl and where "heteroaryl" is defined as a monocyclic ring system or bicyclic containing one or two aromatic rings and at least one nitrogen, oxygen or sulfur atom, and that may or may not be substituted by one or more of the following elements: halo, alkyl, hydroxy, hydroxyalkyl, alkoxy, alkoxyalkyl, haloalkyl, nitro, amino, alkylamino, acylamino, alkylthio, alkylsulfinyl and alkylsulfonyl.

         \ global \ parskip1.000000 \ baselineskip
      

         \ vskip1.000000 \ baselineskip
      

6. The compound of claim 5 wherein X is selected from the group consisting of CH2, CH2CH2, CH = CH, CH (CH 3), CH 2 CH (CH 3), and C (CH 3) 2. 7. The compound of claim 5, wherein Y is selected from the group consisting of none and NH. 8. The compound of claim 5 wherein the Ring A system is replaced by one to three substituents selected from the group consisting of NH2, NH (CH3), N (CH 3) 2, NHCH 2 C 6 H 5, NH (C 2 H 5), Cl, F, CH 3, SCH 3, OH, and 94 9. The compound of claim 5 wherein R1 and R2, independently, are selected from the group composed of hydrogen, OR a, halo, C 1-6 alkyl, CF 3, NO 2, N (R a) 2, NR a C 1-3 alkylene N (R a) 2, and OC_ 1-3 alkyleneOR a. 10. The compound of claim 8 wherein R1 and R2 are independently selected from H, OCH3, Cl, Br, F, CH3, CF3, NO2 , OH, N (CH3) 2, 95 Y

 \ hskip0.5cm 

O (CH 2) 2 OCH 2 C 6 H 5. 11. The compound of claim 5 wherein R 1 and R 2 join to form a ring of five or six members. 12. The compound of claim 5 wherein R3 is selected from the group consisting of C1-6 alkyl, aryl, heteroaryl, C3-8 cycloalkyl, C3-8 heterocycloalkyl, C ( = O) OR a, C 1-4 alkyleneHet, C 1-4 alkylenecycloalkyl, C 1-4 alkylene-
aryl, C 1-4 alkylene C (= O) C 1-4 alkylenearyl, C 1-4 alkylene C (= O) OR a, C 1-4 alkylene C (= O) N (R a) 2, C 1-4 alkylene
C (= O) Het, C 1-4 alkylene N (R a) 2, and C 1-4 alkylene NR a C (= O) R a. 13. The compound of claim 5 wherein R 3 is selected from the group consisting of OR a, C 1-6 alkyl, aryl, heteroaryl, NO 2, N (R a) 2, NR a C (= O) R a, C (= O) OC 2 H 5, CH 2 CH (CH 3) 2, 96 14. The compound of claim 5 wherein R3 is substituted by a substituent selected from the group consisting of halo, ORa, C1-6 alkyl, aryl, heteroaryl, NO2, N (R a) 2, NR a SO 2 CF 3, NR a C (= O) R a, C (= O) OR a, SO 2 N (R a) 2,
CN, C (= O) R a, C 1-4 alkylene N (R a) 2, OC 1-4 alkylene N (R a) 2 , and N (R a) C 1-4 alkylene N (R a) 2. 15. The compound of claim 5 wherein R3 is replaced by a substituent selected from the group composed of Cl, F, CH 3, CH (CH 3) 2, OCH 3, C 6 H 5, NO 2, NH 2, NHC (= O) CH 3, CO 2 H, and N (CH 3) CH 2 CH 2 N (CH 3) 2. 16. A pharmaceutical composition composed of a compound according to any one of Claims 1 to 15 and a pharmaceutically acceptable carrier. 17. A compound according to any of the Claims 1 to 15 or a composition according to the Claim 16 for therapeutic use. 18. An in vitro or ex vivo method for altering leukocyte function consisting of contacting leukocytes with a compound that selectively inhibits the activity of phosphatidylinositol 3-kinase delta (PI3K?) In said leukocytes with respect to other phosphatidylinositol isoforms 3-kinase (PI3K) type I in a cell test, where said compound has the structure: 97 where Y is selected from the group composed of none, S, and NH; R 7 is selected from the group consisting of H, halo, OH, OCH 3, CH 3, and CF 3; R 8 is selected from the group consisting of H, OCH 3, and halogen; or R 7 and R 8 together with C-6 and C-7 ring system Quinazoline defines a 5 or 6-membered aromatic ring that optionally contains one or more atoms of O, N, or S; R 9 is selected from the group consisting of C 1 -C 6 alkyl, phenyl, halophenyl, alkylphenyl, biphenyl, benzyl, pyridinyl, 4-methylpiperazinyl, C (= O) OC 2 H 5, and morpholinyl; R d, independently, is selected from group consisting of NH2, halo, C 1-3 alkyl, S (C 1-3) alkyl, OH, NH (C 1-3) alkyl, N (C 1-3 alkyl) 2, NH (C 1-3 alkylene phenyl); which is 1 or 2, and salts and solvates thereof pharmaceutically acceptable, provided that at least one of R 7 and R 8 be different from 6-halo groups or 6,7-dimethoxy, and that R 9 is different from 4-chlorophenyl.

         \ vskip1.000000 \ baselineskip
      

19. The method of claim 18 wherein mentioned leukocytes comprise cells selected from the group composed of neutrophils, B lymphocytes, T lymphocytes and basophils 20. The method of claim 18, wherein said leukocytes comprise neutrophils, and where said method it consists of the alteration of at least one neutrophil function selected from the group consisting of the stimulation of the superoxide release, exocytosis stimulation and chemotactic migration. 21. The method of claim 18 wherein the phagocytosis or elimination of bacteria by said Neutrophils are not substantially affected. 22. The method of claim 18 wherein said leukocytes comprise B lymphocytes and where said method it consists of the alteration of the proliferation of said B lymphocytes or of the production of antibodies by said lymphocytes B. 23. The method of claim 19 wherein said method consists in the alteration of the proliferation of said T lymphocytes.

         \ newpage
      

24. The method of claim 18 wherein said leukocytes comprise basophils and where said method consists in the alteration of histamine release by basophils 25. The method of claim 18 wherein said compound demonstrates at least 10 times greater selectivity for the inhibition of PI3K? with respect to the others PI3K isoforms of type I in a cell test. 26. The method of claim 18 wherein said compound demonstrates at least 20 times greater selectivity for the inhibition of PI3K? with respect to the others PI3K isoforms of type I in a cell test. 27. The method of claim 18 wherein said compound demonstrates at least 50 times greater selectivity for the inhibition of PI3K? with respect to the others PI3K isoforms of type I in a cell test. 28. The method of claim 18 wherein the compound is selected from the group consisting of: 3- (2-Isopropylphenyl) -5-methyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one; 5-Chloro-2- (9H-purin-6-ylsulfanylmethyl) -3-o-tolyl-3H-quinazolin-4-one; 5-Chloro-3- (2-fluorophenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one; 3- (2-fluorophenyl) -5-methyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one; 3- (2-Methoxyphenyl) -5-methyl-2- (9H-purin-yl-ylsulfanylmethyl-3H-quinazolin-4-one; 3- (2,6-Dichlorophenyl) -5-methyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one; 3- (2-chlorophenyl) -6-fluoro-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one; 5-Chloro-3- (2-chlorophenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one; 3- (2-Chlorophenyl) -5-methyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one; 3- (3-methoxyphenyl-2- (9H-purin-6-ylsulfanylmethyl-3H-quinazolin-4-one; 3- (2-chlorophenyl) -5-fluoro-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one; 3-benzyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one; 3-butyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one; 3- (2-chlorophenyl) -7-fluoro-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one; 3-morpholin-4-yl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one, acetate salt; 8-Chloro-3- (2-chlorophenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one; 3- (2-Chlorophenyl) -6,7-difluor-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one; 3- (2-methoxyphenyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one; 6-Chloro-3- (2-chlorophenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one; 3- (3-chlorophenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one; 2- (9H-purin-6-ylsulfanylmethyl) -3-pyridin-4-yl-3H-quinazolin-4-one; 3- (2-Chlorophenyl) -2- (9H-purin-6-ylsulfanylmethyl) -trifluoromethyl-3H-quinazolin-4-one; 3-benzyl-5-fluoro-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one; 3- (4-methylpiperazin-1-yl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one, acetate salt; 3- (2-Chlorophenyl) -6-hydroxy-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one; [5-fluoro-4-oxo-2- (9H-purin-6-ylsulfanylmethyl) -4H-quinazolin-3-yl] ethyl ester of acetic acid; 3- (2,4-dimethoxyphenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one; 3-biphenyl-2-yl-5-chloro-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one; 2- (6-aminopurin-9-ylmethyl) -3- (2-isopropylphenyl) -5-methyl-3H-quinazolin-4-one; 2- (6-aminopurin-9-ylmethyl) -5-methyl-3-o-tolyl-3H-quinazolin-4-one; 2- (6-aminopurin-9-ylmethyl) -3-biphenyl-2-yl-5-chloro-3H-quinazolin-4-one; 5-Chloro-3- (2-methoxyphenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one; 2- (6-aminopurin-9-ylmethyl) -3- (2-fluorophenyl) -5-methyl-3H-quinazolin-4-one; 2- (6-aminopurin-9-ylmethyl) -5-chloro-3- (2-fluorophenyl) -3H-quinazolin-4-one; 2- (6-aminopurin-9-ylmethyl) -8-chloro-3- (2-chlorophenyl) -3H-quinazolin-4-one; 2- (6-aminopurin-9-ylmethyl) -5-chloro-3- (2-chlorophenyl) -3H-quinazolin-4-one; 2- (6-aminopurin-9-ylmethyl) -3- (2-chlorophenyl) -5-methyl-3H-quinazolin-4-one; 2- (6-aminopurin-9-ylmethyl) -3- (2-chlorophenyl) -5-fluoro-3H-quinazolin-4-one; 2- (6-aminopurin-9-ylmethyl) -3-benzyl-5-fluoro-3H-quinazolin-4-one; 2- (6-aminopurin-9-ylmethyl) -3-butyl-3H-quinazolin-4-one; 2- (6-aminopurin-9-ylmethyl) -3-morpholin-4-yl-3H-quinazolin-4-one; 2- (6-aminopurin-9-ylmethyl) -3- (2-chlorophenyl) -7-fluoro-3H-quinazolin-4-one; 3- (2-Chlorophenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one; 3-phenyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one; 2- (6-aminopurin-9-ylmethyl) -5-chloro-3- (2-isopropylphenyl) -3H-quinazolin-4-one; Y 2- (6-aminopurin-9-ylmethyl) -5-chloro-3-o-tolyl-3H-quinazolin-4-one.

         \ vskip1.000000 \ baselineskip
      

29. An in vitro or ex vivo method for the alteration of leukocyte function which consists in bringing the leukocytes into contact with a compound with the structure 98 where A is 2000 substituted or unsubstituted by one to three substituents selected from the group consisting of N (R a) 2, halo, C 1-3 alkyl, S (C 1-3 alkyl), OR ^ {a}, halo, and 99 X is selected from the group consisting of CHR b, CH 2 CHR b, and CH = C (R b);

         \ newpage
      

And it is selected from the group consisting of none, S, SO, SO2, NH, O, C (= O), OC (= O), C (= O) O, and NHC (= O) CH2 S; R 1 and R 2, independently, are selected from the group consisting of hydrogen, C 1-6 alkyl, aryl, heteroaryl, halo, NHC (= O) C 1-3 alkylene N (R a) 2, NO 2, OR a, OCF 3, N (R a) 2, CN, OC (= O) R a , C (= O) R a, C (= O) OR a, arilOR b, Het, NR a C (= O) C 1-3 C alkylene ( = O) OR a, arylOC 1-3 alkylene-N (R a) 2, arylOC (= O) R a, C 1-4 alkylene C (= O) OR a, OC 1-4 alky
lenoC (= O) OR a, C 1-4 alkyleneOC 1-4 alkylene C (= O) OR a, C (= O) -NR a SO 2 R a, C 1-4 alkylene N (R a) 2, C 2-6 alkenylene N (R a) 2, C (= O) -NR a C 1-4 alkyleneOR a, C (= O) NR a C 1-4 alkylene Het, OC 2-4 alkylene N (R a) 2, OC 1-4 alkylene CH (OR b)
CH 2 N (R a) 2, OC 1-4 alkyleneHet, OC 2-4 alkyleneOR a, OC 2-4 alkylene-NR a C (= O) OR a, NR a C 1-4 alkylene N (R a) 2, NR a
C (= O) R a, NR a C (= O) N (R a) 2, N (SO 2 C 1-4 alkyl) 2, NR a (SO 2 C 1-4 alkyl), SO 2 N (R a) 2, OSO 2 CF 3, C_ { 1-3} alkylenearyl, C 1-4 alkylene-Het, C 1-6 alkyleneOR b, C 1-3 alkylene N (R a) 2, C (= O) N (R a) 2, NHC (= O) C 1 -C 3 alkylenearyl, C 3-8 cyclo-
alkyl, C 3-8 heterocycloalkyl, arylOC 1-3 alkylene N (R a) 2, arylOC (= O) R b, NHC (= O) C 1-3 C 3-8 alkylene heterocycloal-
chyl, NHC (= O) C 1-3 -alkyleneHet, OC 1-4 alkyleneOC 1-4 alkylene C (= O) OR b, C (= O) C 1-4 alkyleneHet, and NHC (= O) haloC 1-6 alkyl; or R 1 and R 2 join to form a component with an alkenylene or alkylene chain of 3 or 4 members of a ring of 5 or 6 members, which contains at least one heteroatom; R 3 is selected from the group consisting of optionally substituted hydrogen, C 1-6 alkyl, C 3-8 cycloalkyl, C 3-8 heterocycloalkyl, C 1-4 alkylenecycloalkyl, C_ {2-6 alkenyl, C 1-3 alkylenearyl, arylC 1-3 alkyl, C (= O) R a, aryl, heteroaryl, C (= O) OR a, C (= O) N (R a) 2, C (= S) N (R a) 2, SO 2 R a, SO 2 N (R a) 2, S (= O) R a, S (= O) N (R a) 2, C (= O) NR a } C_4-4
lenoOR a, C (O) NR a C 1-4 alkyleneHet, C (= O) C 1-4 alkylenearyl, C (= O) C 1-4 alkyleneheteroaryl, C_ {1-4 alkylenearyl optionally substituted by one or more halos, SO 2 N (R a) 2, N (R a) 2, C (= O) OR a, NR a SO 2 CF 3, CN, NO 2, C (= O) R a, OR a, C 1-4 alkylene N (R a) 2, and OC 1-4 alkylene N (R a) 2, C 1-4 -alkyleneheteroaryl, C 1-4 alkyleneHet, C_ {1-4} alkylene C (= O) -C 1-4}
alkyleneoaryl, C 1-4 alkylene C (= O) C 1-4 alkylenehetero-aryl, C 1-4 alkylene C (= O) Het, C 1-4 alkylene C (= O) N (R a) 2,
C 1-4 alkyleneOR a, C 1-4 alkylene NR a C (= O) R a, C 1-4 alkylene O-C 1-4 alkyleneOR ^ {a}, C 1-4 alkylene N (R a) 2, C 1-4 alkylene
C (= O) -OR a, and C 1-4 alkyleneOC 1-4 alkylene C (= O) OR a; R a is selected from the group consisting of hydrogen, C 1-6 alkyl, C 3-8 cycloalkyl, C 3-8 heterocycloalkyl, C 1-3
alkylene N (R a) 2, aryl, arylC 1-3 alkyl, C 1-3 alkylenearyl, heteroaryl, heteroaryl C 1-3 alkyl, and C 1-3 alkylenehetero- aryl; or join two groups R a to form a 5 or 6 member ring, which may optionally contain at least a heteroatom; R b is selected from the group consisting of hydrogen, C 1-6 alkyl, aryl, heteroaryl, arylC 1-3 alkyl, heteroaryl
C 1-3 alkyl, C 1-3 alkylenearyl, and C 1-2 alkyleneheteroaryl; Het is a 5 or 6 heterocyclic ring members, saturated or partially or totally unsaturated that contains the minus a heteroatom selected from the group consisting of oxygen, nitrogen and sulfur, and optionally substituted by C 1-4 alkyl or C (= O) OR a; where "aryl" is defined as a monocyclic aromatic group or bicyclic, which can be substituted or not substituted by one or more of The following elements: halo, alkyl, phenyl, hydroxyalkyl, alkoxy, alxyalkyl, haloalkyl, nitro, amino, alkylamino, acylamino, alkylthio, alkylsulfinyl and alkylsulfonyl; Y and where "heteroaryl" is defined as a monocyclic or bicyclic ring system containing one or two aromatic rings and at least one atom of nitrogen, oxygen or sulfur in an aromatic ring, and that may or may not be substituted by one or more of the following elements: halo, alkyl, hydroxy, hydroxyalkyl, alkoxy, alkoxyalkyl, haloalkyl, nitro, amino, alkylamino, acylamino, alkylthio, alkylsulfinyl and alkylsulfonyl, and pharmaceutically active salts and solvates acceptable, in an amount sufficient to inhibit the phosphatidylinositol 3-kinase delta activity in said leukocytes.

         \ vskip1.000000 \ baselineskip
      

30. The method according to claim 29 where the compound is selected from the group consisting of: 2- (6-aminopurin-9-ylmethyl) -3- (2-chlorophenyl) -6,7-dimethoxy-3H-quinazolin-4-one 2- (6-aminopurin-o-ylmethyl) -6-bromo-3- (2-chlorophenyl) -3H-quinazolin-4-one 2- (6-aminopurin-o-ylmethyl) -3- (2-chlorophenyl) -7-fluoro-3H-quinazolin-4-one 2- (6-aminopurin-9-ylmethyl) -6-chloro-3- (2-chlorophenyl) -3H-quinazolin-4-one 2- (6-aminopurin-9-ylmethyl) -3- (2-chlorophenyl) -5-fluoro-3H-quinazolin-4-one 2- (6-aminopurin-o-ylmethyl) -5-chloro-3- (2-chlorophenyl) -3H-quinazolin-4-one 2- (6-aminopurin-9-ylmethyl) -3- (2-chlorophenyl) -5-methyl-3H-quinazolin-4-one 2- (6-aminopurin-9-ylmethyl) -8-chloro-3- (2-chlorophenyl) -3H-quinazolin-4-one 2- (6-aminopurin-9-ylmethyl) -3-biphenyl-2-yl-5-chloro-3H-quinazolin-4-one 5-Chloro-2- (9H-purin-6-ylsulfanylmethyl) -3-o-tolyl-3H-quinazolin-4-one 5-Chloro-3- (2-fluorophenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one 2- (6-aminopurin-9-ylmethyl) -5-chloro-3- (2-fluorophenyl) -3H-quinazolin-4-one 3-biphenyl-2-yl-5-chloro-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one 5-Chloro-3- (2-methoxyphenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one 3- (2-Chlorophenyl) -5-fluoro-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one 3- (2-Chlorophenyl) -6,7-dimethoxy-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one 6-Bromo-3- (2-chlorophenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one; 3- (2-Chlorophenyl) -8-trifluoromethyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one; 3- (2-chlorophenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-benzo [g] quinazolin-4-one; 6-Chloro-3- (2-chlorophenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one 8-Chloro-3- (2-chlorophenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one 3- (2-chlorophenyl) -7-fluoro-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one 3- (2-Chlorophenyl) -7-nitro-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one; 3- (2-Chlorophenyl) -6-hydroxy-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one; 5-Chloro-3- (2-chlorophenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one 3- (2-Chlorophenyl) -5-methyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one 3- (2-Chlorophenyl) -6,7-difluor-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one; 3- (2-chlorophenyl) -6-fluoro-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one 2- (6-aminopurin-9-ylmethyl) -3- (2-isopropylphenyl) -5-methyl-3H-quinazolin-4-one 2- (6-aminopurin-9-ylmethyl) -5-methyl-3-o-tolyl-3H-quinazolin-4-one 3- (2-fluorophenyl) -5-methyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one 2- (6-aminopurin-9-ylmethyl) -5-chloro-3-o-tolyl-3H-quinazolin-4-one 2- (6-aminopurin-9-ylmethyl) -5-chloro-3- (2-methoxy-phenyl) -3H-quinazolin-4-one 2- (2-amino-9H-purin-6-ylsulfanylmethyl) -3-cyclopropyl-5-methyl-3H-quinazolin-4-one 3-cyclopropylmethyl-5-methyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one 2- (6-aminopurin-9-ylmethyl) -3-cyclopropylmethyl-5-methyl-3H-quinazolin-4-one 2- (2-amino-9H-purin-6-ylsulfanylmethyl) -3-cyclopropylmethyl-5-methyl-3H-quinazolin-4-one 5-methyl-3-phenethyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one 2- (2-amino-9H-purin-6-ylsulfanylmethyl) -5-methyl-3-phenethyl-3H-quinazolin-4-one 3-cyclopentyl-5-methyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one 2- (6-aminopurin-9-ylmethyl) -3-cyclopentyl-5-methyl-3H-quinazolin-4-one 3- (2-Chloropyridin-3-yl) -5-methyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one 2- (6-aminopurin-9-ylmethyl) -3- (2-chloropyridin-3-yl) -5-methyl-3H-quinazolin-4-one 3-methyl-4- [5-methyl-4-oxo-2- (9H-purin-6-ylsulfanylmethyl) -4H-quinazolin-3-yl] -acid benzoic 3-cyclopropyl-5-methyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one 2- (6-aminopurin-9-ylmethyl) -3-cyclopropyl-5-methyl-3H-quinazolin-4-one 5-methyl-3- (4-nitrobenzyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one 3-cyclohexyl-5-methyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one 2- (6-aminopurin-9-ylmethyl) -3-cyclohexyl-5-methyl-3H-quinazolin-4-one 2- (2-amino-9H-purin-6-ylsulfanylmethyl) -3-cyclohexyl-5-methyl-3H-quinazolin-4-one 5-methyl-3- (E-2-phenylcyclopropyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one 3- (2-chlorophenyl) -5-fluoro-2 - [(9H-purin-6-ylamino) -methyl] -3H-quinazolin-4-one 2 - [(2-amino-9H-purin-6-ylamino) methyl] -3- (2-chlorophenyl) -5-fluoro-3H-quinazolin-4-one 5-methyl-2 - [(9H-purin-6-ylamino) methyl] -3-o-tolyl-3H-quinazolin-4-one 2 - [(2-amino-9H-purin-6-ylamino) methyl] -5-methyl-3-o-tolyl-3H-quinazolin-4-one 2 - [(2-Fluoro-9H-purin-6-ylamino) methyl] -5-methyl-3-o-tolyl-3H-quinazolin-4-one (2-Chlorophenyl) -dimethylamino- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one 5- (2-Benzyloxyethoxy) -3- (2-chlorophenyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one Ester of 6-aminopurine-9-carboxylic acid 3- (2-chlorophenyl) -5-fluoro-4-oxo-3,4-dihydro-quinazolin-2-ylmethyl N- [3- (2-Chlorophenyl) -5-fluoro-4-oxo-3,4-dihydro-quinazolin-2-ylmethyl] -2- (9H-purin-6-ylsulfanyl) -acetamide 2- [1- (2-Fluoro-9H-purin-6-ylamino) ethyl] -5-methyl-3-o-tolyl-3H-quinazolin-4-one 5-methyl-2- [1- (9H-purin-6-ylamino) ethyl] -3-o-tolyl-3H-quinazolin-4-one 2- (6-dimethylaminopurin-9-ylmethyl) -5-methyl-3-o-tolyl-3H-quinazolin-4-one 5-methyl-2- (2-methyl-6-oxo-1,6-dihydro-purin-7-ylmethyl) -3-o-tolyl-3H-quinazolin-4-one 5-methyl-2- (2-methyl-6-oxo-1,6-dihydro-purin-9-ylmethyl) -3-o-tolyl-3H-quinazolin-4-one 2- (amino-dimethylaminopurin-9-ylmethyl) -5-methyl-3-o-tolyl-3H-quinazolin-4-one 2- (2-amino-9H-purin-6-ylsulfanylmethyl) -5-methyl-3-o-tolyl-3H-quinazolin-4-one 5-methyl-2- (7-methyl-7H-purin-6-ylsulfanylmethyl) -3-o-tolyl-3H-quinazolin-4-one 5-methyl-2-purin-7-ylmethyl-3-o-tolyl-3H-quinazolin-4-one 5-methyl-2-purin-9-ylmethyl-3-o-tolyl-3H-quinazolin-4-one 5-methyl-2- (9-methyl-9H-purin-6-ylsulfanylmethyl) -3-o-tolyl-3H-quinazolin-4-one 5-methyl-2- (1-methyl-1H-imidazol-2-ylsulfanylmethyl) -3-o-tolyl-3H-quinazolin-4-one 5-methyl-3-o-tolyl-2- (1H- [1,2,4] triazol-3-ylsulfanylmethyl) -3H-quinazolin-4-one 2- (2-amino-6-chloro-purin-9-ylmethyl) -5-methyl-3-o-tolyl-3H-quinazolin-4-one 2- (6-aminopurin-7-ylmethyl) -5-methyl-3-o-tolyl-3H-quinazolin-4-one 2- (6-amino-9H-purin-2-ylsulfanylmethyl) -5-methyl-3-o-tolyl-3H-quinazolin-4-one 5-methyl-2- (6-methylaminopurin-9-ylmethyl) -3-o-tolyl-3H-quinazolin-4-one 2- (6-benzylaminopurin-9-ylmethyl) -5-methyl-3-o-tolyl-3H-quinazolin-4-one 2- (2,6-Diaminopurin-9-ylmethyl) -5-methyl-3-o-tolyl-3H-quinazolin-4-one 5-methyl-2- (9H-purin-6-ylsulfanylmethyl) -3-o-tolyl-3H-quinazolin-4-one 3-isobutyl-5-methyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one N- {2- [5-methyl-4-oxo-2- (9H-purin-6-ylsulfanylmethyl) -4H-quinazolin-3-yl] -phenyl} -acetamide 5-methyl-3- (E-2-methyl-cyclohexyl) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one 2- [5-methyl-4-oxo-2- (9H-purin-6-ylsulfanylmethyl) -4H-quinazolin-3-yl] -acid benzoic 3- {2 - [(2-dimethylaminoethyl) methylamino] phenyl} -5-methyl-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one 3- (2-Chlorophenyl) -5-methoxy-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one 3- (2-Chlorophenyl) -5- (2-morpholin-4-yl-ethylamino) -2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one 3-benzyl-5-methoxy-2- (9H-purin-6-ylsulfanylmethyl) -3H-quinazolin-4-one.

         \ vskip1.000000 \ baselineskip
      

31. An in vitro or ex vivo method to alter an osteoclast function consisting of contacting the osteoclasts with a compound that selectively inhibits the activity of phosphatidylinositol 3-kinase delta (PI3K?) In said osteoclasts with respect to other isoforms. of phosphatidylinositol 3-kinase (PI3K) type I in a test performed-
with cells, wherein said compound has the structure of formula (III) as defined in Claim 18. 32. An in vitro or ex vivo method for inhibiting the growth or proliferation of chronic myelogenous leukemia cells that involves contacting the cells with a compound that selectively inhibits the activity of phosphatidylinositol 3-kinase delta in cancer cells with respect to to the other isoforms of type I PI3K in a cell test, where said compound has a structure 100 where R 7 is selected from group consisting of H, halogen, OH, OCH 3, CH 3, and CF 3; R 8 is selected from the group consisting of H, OCH 3, and halogen; or R 7 and R 8 together with C-6 and C-7 ring system Quinazoline defines a 5 or 6-membered aromatic ring that optionally contains one or more atoms of O, N, or S; R 9 is selected from the group consisting of C 1 -C 6 alkyl, phenyl, halophenyl, alkylphenyl, biphenyl, benzyl, pyridinyl, 4-methylpiperazinyl, ethyl acetate and morpholinyl; X is NH or S; Y salts and solvates thereof pharmaceutically acceptable, provided that at least one of R 7 and R 8 be different from 6-halo groups or 6,7-dimethoxy, and that R 9 is different from 4-chlorophenyl.

         \ vskip1.000000 \ baselineskip
      

33. An in vitro or ex vivo method for inhibiting the kinase activity of a phosphatidylinositol 3-kinase delta polypeptide consisting of contacting the polypeptide with a compound with the structure 101 where A is 3000 substituted or unsubstituted by one to three substituents selected from the group consisting of N (R a) 2, halo, C 1-3 alkyl, S (C 1-3 alkyl), OR ^ {a}, halo, and 102 X is selected from the group consisting of CHR b, CH 2 CHR b, and CH = C (R b); And it is selected from the group consisting of none, S, SO, SO2, NH, O, C (= O), OC (= O), C (= O) O, and NHC (= O) CH2 S; R 1 and R 2, independently, are selected from the group consisting of hydrogen, C 1-6 alkyl, aryl, heteroaryl, halo, NHC (= O) C 1-3 alkylene N (R a) 2, NO 2, OR a, OCF 3, N (R a) 2, CN, OC (= O) R a , C (= O) R a, C (= O) OR a, arilOR b, Het, NR a C (= O) C 1-3 C alkylene ( = O) OR a, arylOC 1-3 alkylene-N (R a) 2, arylOC (= O) R a, C 1-4 alkylene C (= O) OR a, OC 1-4 alky
lenoC (= O) OR a, C 1-4 alkyleneOC 1-4 alkylene C (= O) OR a, C (= O) -NR a SO 2 R a, C 1-4 alkylene N (R a) 2, C 2-6 alkenylene N (R a) 2, C (= O) -NR a C 1-4 alkyleneOR a, C (= O) NR a C 1-4 alkylene Het, OC 2-4 alkylene N (R a) 2, OC 1-4 alkylene CH (OR b)
CH 2 N (R a) 2, OC 1-4 alkyleneHet, OC 2-4 alkyleneOR a, OC 2-4 alkylene-NR a C (= O) OR a, NR a C 1-4 alkylene N (R a) 2, NR a
C (= O) R a, NR a C (= O) N (R a) 2, N (SO 2 C 1-4 alkyl) 2, NR a (SO 2 C 1-4 alkyl), SO 2 N (R a) 2, OSO 2 CF 3, C_ { 1-3} alkylenearyl, C 1-4 alkylene Het, C 1-6 alkyleneOR b, C 1-3 alkylene N (R a) 2, C (= O) N (R a) 2, NHC (= O) C 1 -C 3 alkyleneoaryl, C 3-8 cyclo-
alkyl, C 3-8 heterocycloalkyl, arylOC 1-3 alkylene N (R a) 2, arylOC (= O) R b, NHC (= O) C 1-3 C 3-8 alkylene heterocycloal-
chyl, NHC (= O) C 1-3 -alkyleneHet, OC 1-4 alkyleneOC 1-4 alkylene C (= O) OR b, C (= O) C 1-4 alkyleneHet, and NHC (= O) haloC 1-6 alkyl; or R 1 and R 2 join to form a component with an alkenylene or alkylene chain of 3 or 4 members of a ring of 5 or 6 members, which contains at least one heteroatom; R 3 is selected from the group consisting of optionally substituted hydrogen, C 1-6 alkyl, C 3-8 cycloalkyl, C 3-8 heterocycloalkyl, C 1-4 alkylenecycloalkyl, C_ {2-6 alkenyl, C 1-3 alkylenearyl, arylC 1-3 alkyl, C (= O) R a, aryl, heteroaryl, C (= O) OR a, C (= O) N (R a) 2, C (= S) N (R a) 2, SO 2 R a, SO 2 N (R a) 2, S (= O) R a, S (= O) N (R a) 2, C (= O) NR a } C_4-4
lenoOR a, C (O) NR a C 1-4 alkyleneHet, C (= O) C 1-4 alkylenearyl, C (= O) C 1-4 alkyleneheteroaryl, C_ {1-4 alkylenearyl optionally substituted by one or more halos, SO 2 N (R a) 2, N (R a) 2, C (= O) OR a, NR a SO 2 CF 3, CN, NO 2, C (= O) R a, OR a, C 1-4 alkylene N (R a) 2, and OC 1-4 alkylene N (R a) 2, C 1-4 -alkyleneheteroaryl, C 1-4 alkyleneHet, C_ {1-4} alkylene C (= O) -C 1-4}
alkyleneoaryl, C 1-4 alkylene C (= O) C 1-4 alkylenehetero-aryl, C 1-4 alkylene C (= O) Het, C 1-4 alkylene C (= O) N (R a) 2,
C 1-4 alkyleneOR a, C 1-4 alkylene NR a C (= O) R a, C 1-4 alkylene O-C 1-4 alkyleneOR ^ {a}, C 1-4 alkylene N (R a) 2, C 1-4 alkylene
C (= O) -OR a, and C 1-4 alkyleneOC 1-4 alkylene C (= O) OR a; R a is selected from the group consisting of hydrogen, C 1-6 alkyl, C 3-8 cycloalkyl, C 3-8 heterocycloalkyl, C 1-3
alkylene N (R a) 2, aryl, arylC 1-3 alkyl, C 1-3 alkylenearyl, heteroaryl, heteroaryl C 1-3 alkyl, and C 1-3 alkylenehetero-
aryl; or join two groups R a to form a 5 or 6 member ring, which may optionally contain at least a heteroatom; R b is selected from the group consisting of hydrogen, C 1-6 alkyl, aryl, heteroaryl, arylC 1-3 alkyl, heteroaryl
C 1-3 alkyl, C 1-3 alkylenearyl, and C 1-2 alkyleneheteroaryl; Het is a 5 or 6 heterocyclic ring members, saturated or partially or totally unsaturated that contains the minus a heteroatom selected from the group consisting of oxygen, nitrogen and sulfur, and optionally substituted by C 1-4 alkyl or C (= O) OR a; where "aryl" is defined as a monocyclic aromatic group or bicyclic, which can be substituted or not substituted by one or more of The following elements: halo, alkyl, phenyl, hydroxyalkyl, alkoxy, alxyalkyl, haloalkyl, nitro, amino, alkylamino, acylamino, alkylthio, alkylsulfinyl and alkylsulfonyl; Y and where "heteroaryl" is defined as a monocyclic or bicyclic ring system containing one or two aromatic rings and at least one atom of nitrogen, oxygen or sulfur in an aromatic ring, and that may or may not be substituted by one or more of the following elements: halo, alkyl, hydroxy, hydroxyalkyl, alkoxy, alkoxyalkyl, haloalkyl, nitro, amino, alkylamino, acylamino, alkylthio, alkylsulfinyl and alkylsulfonyl, and salts and solvates thereof pharmaceutically acceptable.

         \ vskip1.000000 \ baselineskip
      

34. The method of claim 33, wherein R1 is selected from the group consisting of H, halo, OH, OCH 3, CH 3, and CF 3; Y R 3 is selected from the group consisting of C 1 -C 6 alkyl, phenyl, halophenyl, alkylphenyl, biphenyl, benzyl, pyridinyl, 4-methylpiperazinyl, C (= O) C 2 H 5, and morpholinyl; where at least one of R1 and R2 is different from those 6-halo or 6,7-dimethoxy groups, and R3 is other than 4-chlorophenyl.

         \ vskip1.000000 \ baselineskip
      

35. A compound with the structure of the formula (III) according to the definition of Claim 18 that inhibits the phosphatidylinositol 3-kinase delta activity (PI3K?) In osteoclasts of an animal with respect to other isoforms of PI3K type I in an assay conducted with cells, to improve an alteration of bone resorption in a animal. 36. A use according to Claim 35 wherein said alteration of bone resorption is osteoporosis. 37. A compound with a structure 103 where R 7 is selected from group consisting of H, halogen, OH, OCH 3, CH 3, and CF 3; R 8 is selected from the group consisting of H, OCH 3, and halogen; or R 7 and R 8 together with C-6 and C-7 ring system Quinazoline defines a 5 or 6-membered aromatic ring that optionally contains one or more atoms of O, N, or S; R 9 is selected from the group consisting of C 1 -C 6 alkyl, phenyl, halophenyl, alkylphenyl, biphenyl, benzyl, pyridinyl, 4-methylpiperazinyl, ethyl acetate and morpholinyl; X is NH or S; Y salts and solvates thereof pharmaceutically acceptable, provided that at least one of R 7 and R 8 be different from 6-halo groups or 6,7-dimethoxy, and that R 9 is different from 4-chlorophenyl, that selectively inhibits the activity of phosphatidylinositol 3-kinase delta in cells carcinogenic to other isoforms of type I PI3K in a cell test, to inhibit growth or proliferation of chronic myelogenous leukemia cells.

         \ vskip1.000000 \ baselineskip
      

38. A compound with the structure of the formula (III) according to the definition of Claim 18 for the treatment of a disease selected from:

i)

ischemia, preferably resulting from a failure heart, myocardial infarction, coronary artery obstruction, thromboembolic occlusion of a cerebral vessel, trauma craniocerebral, edema and brain tumor,

ii)

reperfusion injury, preferably associated with vascular accident, hemorrhagic shock, myocardial ischemia or heart attack, organ transplant and cerebral vasospasm,

iii)

bone diseases, preferably selected between osteoporosis, Paget diseases and alterations of related bone resorption;

iv)

hematopoietic cancer, preferably:

to)

lymphomas, preferably selected from Burkitt lymphoma, Hodgkins lymphoma, non-Hodgkins lymphoma, lymphocytic lymphoma;

b)

multiple myelomas;

C)

leukemias, preferably selected from lymphocytic leukemias, myeloid (myelogenous) leukemias Chronicles,

v)

diseases related to the release of histamine, preferably selected from lung disease chronic obstructive (COPD), asthma, ARDS and emphysema,

saw)

arthritic diseases, preferably selected from rheumatoid arthritis, monoarticular arthritis, osteoarthritis, gouty arthritis, spondylitis,

vii)

Behcet's disease,

viii)

sepsis, septic shock, endotoxic shock, sepsis gram-negative sepsis by gram-positive and shock syndrome toxic,

ix)

secondary multiple organ dysfunction syndrome to septicemia, trauma or hemorrhage,

x)

ophthalmic abnormalities, preferably selected among allergic conjunctivitis, vernal conjunctivitis, uveitis and ophthalmopathy associated with the thyroid,

xi)

esinophilic granuloma,

xii)

pulmonary or respiratory disorders, preferably selected from asthma, chronic bronchitis, allergic rhinitis, ARDS, chronic inflammatory lung disease, chronic obstructive pulmonary disease, silicosis, sarcoidosis pulmonary, pleurisy, alveolitis, vasculitis, emphysema, pneumonia, bronchiectasis and toxicity of pulmonary oxygen,

xiii)

fibrosis, preferably fibrosis cystic,

xiv)

keloid formation or tissue formation of scar,

xv)

atherosclerosis,

xvi)

autoimmune diseases, preferably selected among systemic lupus erythematosus (SLE), thyroiditis autoimmune, multiple sclerosis, some forms of diabetes and Reynaud's syndrome

xvii)

transplant rejection disorders, preferably selected from graft disease against host (GVHD) and allograft rejection,

xviii)

chronic glomerulonephritis,

xix)

inflammatory bowel diseases, preferably selected from bowel disease Chronic inflammatory (CIBD), Crohn's disease, ulcerative colitis and necrotizing enterocolitis,

xx)

inflammatory dermatosis, preferably selected from contact dermatitis, atopic dermatitis, psoriasis and hives,

xxi)

fever and myalgia as a result of a infection,

xxii)

inflammatory disorders of the nervous system central or peripheral, preferably selected from meningitis, encephalitis and brain or spinal cord injuries caused by mild trauma,

xxiii)

Sjögren's disease,

xxiv)

diseases that involve a diapédesis leukocyte,

xxv)

alcoholic hepatitis,

xxvi)

bacterial pneumonia,

xxvii)

complex-mediated diseases antigen-antibody,

xxviii)

hypovolemic shock,

xxix)

type I diabetes mellitus

xxx)

acute and delayed hypersensitivity,

xxxi)

diseases caused by leukocyte dyscrasia and metastasis,

xxxii)

thermal injuries,

xxxiii)

syndromes associated with transfusion of granulocytes, and

xxxiv)

cytokine induced toxicity.