ES2354811T3 - NUCLEAR FACTOR INDUCTOR FACTOR KB. - Google Patents

Abstract

A nucleic acid encoding the NFIF polypeptide (nuclear factor inducing factor) -14b comprising an amino acid sequence of SEQ ID NO: 1.

Description

Field of the Invention

The nuclear factor B (NFB) comprises a family of eukaryotic transcription factors involved in the regulation of genes involved in immune responses and other cellular functions. In certain cases, the activation of NFB leads to an inflammatory response that ultimately results in a disease. Therefore, it would be desirable to develop means to control the induction of NFB. The present invention provides polypeptides that are involved in the induction of NFB and that can be used to increase the expression or activation of NFB or to identify and prepare inhibitors of the expression or activation of NFB.

Advances Indicated

The nuclear factor B (NFB) comprises a family of transcription factors found in almost all eukaryotic cells. NFB plays a role in the regulation of genes involved in tissue inflammation, cell proliferation, and cell differentiation.

Several studies have examined the relationship between diseases and the expression of subunit proteins that constitute NFB or the activation of NFB already present in a cell. Li et al. He studied the regulation of NFB by the HTLV-1 Tax protein, which demonstrated that Tax's ability to activate the NFB pathway plays an essential role in HTLV-1-induced cell transformation (Li et al. , Gene Expr., 7, 4-6, 233-245 (1999)). Lentsch and Ward studied the activation and regulation of NFB during acute inflammation and described the relationship between NFB and the inhibitor proteins of the IKappaB family (Lentsch et al., Clin. Chem. Lab. Med., 37, 3, 205-208 (1999)). Visconti et al. investigated the role of NFB in thyroid carcinogenesis by analyzing thyroid carcinoma cell lines. Their studies indicated that the activation of the NFB complex by overexpression of the p65 protein played a critical role in the process of thyroid cell transformation (Visconti et al., Oncogene, 15, 16, 1987-1994 (1997)) . Mukhopadhyay et al. investigated the expression of the p50 subunit of the NFB transcription factor complex in non-small cell lung carcinoma tissues, which showed that 81% of recent non-small cell lung cancer tissues express levels two to twenty times higher of the p50 subunit than normal lung tissue (Mukhopadhyay et al., Oncogene, 11,5,999-1003 (1995)). Khaled et al. He targeted the gene expression of p50 with phosphorothioate modified antisense oligodeoxynucleotides in specific 3 'and was able to reduce the expression of NFB. Their results showed that p50 antisense molecules could reduce NFB expression and could inhibit the immune response by providing a possible treatment for autoimmune disorders (Khaled et al., Clin. Immunol. Immunopathol., 83, 3, 254- 263 (1997)).

Pahl (Oncogene, Vol. 18, No. 49, 1999, pp. 6853-6866) describes activators and target genes for Rel / NF-kappa B transcription factors. In addition, Mukhopadhyay (J. Biol. Chem., Vol. 274 , No. 23, 1999, pp. 15978-15981) describes a cytokine called THANK that activates the nuclear factor B.

Summary of the Invention

In accordance with the present invention, the nucleic acid sequences encoding the nuclear factor inducing factor B (NFIF) 14b and 7a are provided. Also included are cDNAs encoding NFIF-14b and NFIF-7a and isolated and purified NFIF-14b and NFIF-7a polypeptides that induce NF

B. The present invention further includes expression vectors expressing the NFIF14b and NFIF-7a polypeptides. Examples of preferred expression vectors are retroviral vectors, adenoviral vectors, adeno-associated vectors, herpes, herpesvirus vectors and naked DNA vectors. The present invention also provides compositions comprising an NFIF-14b or NFIF-7a polypeptide and a pharmaceutically acceptable carrier.

Another aspect of the present invention is compositions for decreasing the expression of the NFIF gene comprising an antisense nucleic acid. Yet another aspect of the present invention is a composition for decreasing the activity of an NFIF polypeptide comprising a neutralizing antibody that binds to an NFIF polypeptide and that decreases its activity.

Yet another embodiment of the present invention is a composition for decreasing the expression of NFIF in a patient comprising a ribozyme that cuts the RNA encoding an NFIF polypeptide.

The present invention provides methods for determining whether a test compound is effective for inhibiting the activity of NFIF-14b polypeptides comprising (A) comparing the level of expression of the NFB regulated gene in a first sample comprising: ( 1) NFIF-14b; (2) the indicator gene regulated by NFB; and (3) the test compound with the level of gene expression in a second sample comprising (4) NFIF-14b; and (5) the indicator gene regulated by NFB; and (B) determine if the expression of the indicator gene is lower in the first sample than in the second sample.

Yet another aspect of the present invention provides methods for determining whether a test compound is effective in inhibiting the activity of NFIF-7a polypeptides comprising (A) comparing the level of expression of the NFB regulated gene in a first sample comprising: (1) NFIF-7a; (2) the indicator gene regulated by NFB; and (3) the test compound with the level of gene expression in a second sample comprising (4) NFIF-7a; and (5) the indicator gene regulated by NFB; and (B) determine if the expression of the indicator gene is lower in the first sample than in the second sample.

Yet another aspect of the present invention provides a method to identify whether a test compound can stimulate NFIF-14b activity based on the expression of an NFB regulated reporter gene comprising (A) comparing the level of gene expression regulated by NFB in a first sample comprising (1) NFIF-14b; (2) the indicator gene regulated by NFB; Y

(3)

 the test compound with the level of expression of the gene in a second sample comprising:

(4)

 NFIF-14b; and (5) the indicator gene regulated by NFB; and (B) determine if the expression of the indicator gene is greater in the first sample than in the second sample.

Another aspect of the present invention provides a method for identifying whether a test compound can stimulate NFIF-7a activity based on the expression of an NFB regulated reporter gene comprising (A) comparing the expression level of the regulated gene by NFB in a first sample comprising (1) NFIF-7a; (2) the indicator gene regulated by NFB; and (3) the test compound with the level of gene expression in a second sample comprising: (4) NFIF-7a; and (5) the indicator gene regulated by NFB; and (B) determine if the expression of the indicator gene is greater in said first sample with respect to the second sample.

Another aspect of the present invention relates to the use of an NFIF polypeptide for the manufacture of a medicament intended for the treatment and / or prevention of an inflammatory response regulated by NFB. Yet another aspect of the present invention relates to the use of a nucleic acid encoding an NFIF polypeptide, for the manufacture of a medicament intended for the treatment and / or prevention of an inflammatory response regulated by NFB.

Another aspect of the present invention relates to the use of a recombinant vector comprising a nucleic acid encoding an NFIF polypeptide, for the manufacture of a medicament intended for the treatment and / or prevention of an inflammatory response regulated by NFB. Yet another aspect of the present invention relates to the use of a recombinant viral vector deficient for the manufacture of a medicament intended for the treatment and / or the prevention of a response regulated by NFB.

Two sequences showing similarities with the polypeptides of the present invention are available in the GenBank library of nucleic acid sequences. The first sequence, which has accession number Y08135, encodes a peptide identified as phosphodiesterase 3a similar to full-size mouse acid sphingomyelinase. The second sequence, which has accession number Y08136, encodes a partial human clone (863 bp of which 536 are encoders) of a protein sequence identified as phosphodiesterase 3a similar to human acid sphingomyelinase. Both sequences were presented on September 17, 1996 by K. Hofmann. Although it was identified that both sequences encoded acid sphingomyelinase-like phosphodiesterase, there has been no confirmation of this type of enzymatic activity. These sequences may have been identified as acid sphingomyelinase-like phosphodiesterases due to the similarities between the 3 'sequences of these proteins and the 3' sequences of the members of the sphingomyelinase family.

Brief Description of the Drawings

Figure 1 is the amino acid sequence of NFIF-14b.

Figure 2 is the amino acid sequence of NFIF-7a.

Figure 3 is the NFIF-14b and NFIF-7a cDNA sequence aligned for comparison.

Figure 4 is a schematic representation of NFIF-14b and NFIF-7a.

Figure 5 is a bar graph depicting the luminometer counts per second observed in HeK 293 cells at 48 hours.

Figure 6 is a bar graph depicting the luminometer counts per second observed in Cos-7 cells at 48 hours.

Figure 7 is the amino acid sequence of a sequence of residues used to prepare antibodies directed towards NFIF.

Figure 8 is a Northern blot using a NFIF probe.

Detailed description of the invention

The present invention provides polypeptides that are capable of inducing NFB, as well as compounds and compositions that are capable of inhibiting the induction of NFB.

The present invention is based in part on the discovery of the NFB inducing factor protein (NFIF). Two functional variants of the NFIF protein have been identified. A variant, NFIF-14b, comprises full-size NFIF. The second variant, NFIF-7a, is believed to be a splice variant of NFIF-14b. Both NFIF-14b and NFIF-7a have the ability to induce NFB.

NFB comprises a family of eukaryotic transcription factors that regulate the genes involved in immune responses and other cellular activities. In certain situations, it may be desirable to induce NFB to initiate or increase the degree of the immune response. In other situations, it may be desirable to reduce or prevent the induction of NFB to reduce or prevent an immune response regulated by NFB. For example, it has been found that NFIF is associated with a variety of pathologies associated with immune responses regulated by NFB, which include atherosclerosis. By inhibiting the expression of the NFIF gene, or by otherwise interfering with the activity of the NFIF protein, it is possible to inhibit the induction of NFB, whereby NF-regulated inflammatory responses are inhibited or prevented. B which result in atherosclerosis and other diseases.

The discovery of the gene encoding NFIF and the ability to prepare NFIF proteins facilitates the identification and preparation of compounds and compositions that are capable of inhibiting the activity of NFIF proteins and therefore inhibiting the induction of NFB.

The following description begins with a Definitions section, followed by background information related to NFB. This is followed by a discussion of the NFIF polypeptides of the present invention, as well as information on the isolation of the DNA encoding such polypeptides and the methods for preparing variants of the polypeptides. The expression vectors capable of expressing the DNAs encoding the NFIF polypeptides are then discussed, including information on promoters suitable for expression systems, methods for introducing expression vectors into suitable host cells and vector systems. viral. Following this discussion about NFIF polypeptides and their variants, there is a discussion about the therapeutic uses of NFIF polypeptides. This discussion is followed by a description of the compositions useful in the practice of the present invention. This is followed by a discussion that summarizes the various compositions and therapeutic compounds, which include NFIF-based polypeptides, antisense nucleic acids, ribozymes and antibodies. Finally, the methods of the present invention using the compounds and compositions described are described.

Definitions

The term "NFIF" is used to designate the "nuclear factor inducing factor B".

The terms "induce" or "induction", when used when describing the activity of NFIF, include within its scope the ability to cause the expression of the proteins of the subunits that constitute NFB directly or indirectly, as well as the ability of activating the NFB that is already present in a cell. This activation can be direct or indirect, and results in NFB functioning as a transcription factor.

For the purposes of the present description, the term "nucleotide sequence" may be used to designate a polynucleotide or a nucleic acid. The term "nucleotide sequence" covers the genetic material itself, and therefore is not limited to information related to its sequence.

The terms "nucleic acid", "polynucleotide", "oligonucleotide" or "nucleotide sequence" covers the RNA, DNA, gDNA or cDNA sequences or alternatively the hybrid RNA / DNA sequences of more than one nucleotide, in the single stranded form or in the double stranded form, double molecule.

A "nucleic acid" is a polymeric compound comprising covalently linked subunits called nucleotides. The nucleic acid includes ribonucleic acid (RNA) and deoxyribonucleic acid (DNA), both being single stranded or double stranded. DNA includes cDNA, genomic DNA, synthetic DNA, and semi-synthetic DNA. The nucleotide sequence that encodes a protein is called a direct sequence or coding sequence.

The term "nucleotide" designates both natural nucleotides (A, T, G, C) and modified nucleotides that comprise at least one modification such as (1) a purine analogue, (2) a pyrimidine analogue, or (3 ) a carbohydrate analog, and examples of such modified nucleotides are described, for example, in PCT application No. WO 95/04064.

For the purposes of the present invention, a first nucleotide is considered to be "complementary" to a second polynucleotide when each base of the first nucleotide is matched with the complementary base of the second polynucleotide, whose orientation is reversed. The complementary bases are A and T (or A and U), or C and G.

A "heterologous" DNA refers to DNA that is not found naturally in the cell or at a chromosomal site of the cell. Preferably, the heterologous DNA includes a foreign cell gene.

As used herein, the term "homologous", in all its grammatical forms and spelling variations, refers to the relationship between proteins that have a "common evolutionary origin", which includes proteins from superfamilies ( eg, the immunoglobulin superfamily) and homologous proteins from different species (eg, the myosin light chain, etc.) (Reeck et al., Cell, 50: 667 (1987)). These proteins (and their coding genes) have sequence homology, as reflected by their high degree of sequence similarity.

Therefore, the expression "sequence similarity", in all its grammatical forms, refers to the degree of identity or correspondence between nucleic acid or amino acid protein sequences that may or may not share a common evolutionary origin (see Reeck et al. , previously mentioned). However, in common use and in the present application, the term "homologue", when modified with an adverb such as "very", can refer to the similarity of the sequence and not to a common evolutionary origin.

In a specific embodiment, two DNA sequences are "substantially homologous" or "substantially similar" when at least about 50% (preferably at least about 75%, and more preferably at least about 90 or 95%) of the nucleotides they correspond to each other along the defined length of the DNA sequences. Sequences that are substantially homologous can be identified by comparing the sequences using conventional computer programs available in sequence data banks, or in a Southern type hybridization experiment, for example, under stringent conditions such as those defined for that particular system. The definition of appropriate hybridization conditions is within the scope of the art. See, eg, Maniatis et al., Molecular cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring, NY (1982); Glover et al., DNA Cloning: A Practical Approach, Volumes I and II Oligonucleotide Synthesis, MRL Press, Ltd., Oxford, R.U. (1985); Hames and Higgins, Hames BD and Higgins SJ, 1985. Nucleic acid hybridization: a practical approach, Hames and Higgins Ed., IRL Press, Oxford (1985)).

Similarly, in a particular embodiment, two nucleic acid sequences are "substantially homologous" or "substantially similar" when more than 30% of the amino acids are identical or more than about 60% are similar (functionally identical). Preferably, similar or homologous sequences are identified by alignment using, for example, the GCG stacking program (Genetics Computer Group, GCG Package Program Manual, Version 7, Madison, Wisconsin).

The "percent identity" between the nucleotide or amino acid sequences, for the purposes of the present invention, can be determined by comparing two optimally aligned sequences, by means of a comparison window.

The portion of the nucleotide or polypeptide sequence in the comparison window may thus comprise additions or deletions (eg "gaps") with respect to the reference sequence (which does not comprise these additions or these deletions) to obtain an optimal alignment of The two sequences.

The percentage is calculated by determining the number of positions in which an identical nucleic acid base or an identical amino acid residue is observed for the two sequences (of nucleic acid or peptide) compared, and then dividing the number of positions in which it exists. identity between the two bases or amino acid residues divided by the total number of positions in the comparison window, and then multiplying the result by 100 to obtain the percentage of sequence identity.

Optimal sequence alignment for comparison can be achieved by using a computer with the help of known algorithms included in the WISCONSIN GENETICS SOFTWARE PACKAGE, GENETICS COMPUTER GROUP (GCG), 575 Science Doctor, Madison, WISCONSIN computer package .

As an illustration, it will be possible to produce the percentage of sequence identity with the help of the BLAST software (BLAST versions 1.4.9 of March 1996, BLAST 2.0.4 of February 1998 and BLAST 2.0.6 of September 1998) , by using exclusively the default parameters (Altschul et al, J. Mol. Biol., 215: 403-410 (1990); Altschul et al, Nucleic Acids Res., 25: 3389-3402 (1997)). Blast searches for sequences similar / homologous to a reference "search" sequence, with the help of the algorithm of Altschul et al. The search sequence and the databases used can be peptide or nucleic acid, and any combination is possible.

The term "corresponding to" is used herein to refer to similar or homologous sequences, if the exact position of the molecule with which the homology or similarity is measured is both identical and different. An alignment of the nucleic acid or amino acid sequences may include spaces. Thus, the expression "corresponding to" refers to the sequence similarity and not to the numbering of amino acid residues or nucleotide bases.

It will be understood that a "variant" of a nucleic acid according to the invention means a nucleic acid that differs in one or more bases from the reference polynucleotide. A variant nucleic acid can be of natural origin, such as an allelic variant that exists naturally, or it can also be an unnatural variant obtained, for example, by mutagenesis techniques.

In general, the differences between the reference nucleic acid (in general, wild-type) and the variant nucleic acid are small, so that the nucleotide sequences of the reference nucleic acid and the variant nucleic acid are very similar and, in Many regions, identical. The nucleotide modifications present in a variant nucleic acid can be silent, which means that they do not alter the amino acid sequences encoded by said variant nucleic acid.

However, changes in the nucleotides of a variant nucleic acid can also result in substitutions, additions or deletions in the polypeptide encoded by the variant nucleic acid with respect to the polypeptides encoded by the reference nucleic acid. In addition, nucleotide modifications in the coding regions can produce conservative or non-conservative substitutions in the amino acid sequence of the polypeptide.

Preferably, the variant nucleic acids according to the invention encode polypeptides that retain substantially the same function or biological activity of the reference nucleic acid polypeptide, or alternatively the ability to be recognized by antibodies directed against the polypeptides encoded by the initial reference nucleic acid.

Certain variant nucleic acids will thus encode mutated forms of the polypeptides, whose systematic study will make it possible to deduce the structure-activity relationships of the proteins in question. The knowledge of these variants with respect to the disease studied is essential, since it makes it possible to understand the molecular cause of the pathology.

It will be understood that "fragment" means a nucleotide sequence of a reduced length with respect to the reference nucleic acid and which, along the common portion, comprises a nucleotide sequence identical to the reference nucleic acid. Such a "fragment" of nucleic acid according to the invention may be included, when appropriate, in a larger polynucleotide of which it is a constituent. Such fragments comprise, or alternatively consist of, oligonucleotides whose length ranges from 8, 10, 12, 15, 18, 20 to 25, 30, 40, 50, 70, 80, 100, 200, 500, 1000 or 1500 consecutive nucleotides of a nucleic acid according to the invention.

A "nucleic acid molecule" refers to the polymeric form of the phosphate ester of ribonucleosides (adenosine, guanosine, uridine or cytidine; "RNA molecules") or deoxyribonucleosides (deoxydenosine, deoxyguanosine, deoxythymidine or deoxycytidine; "molecules of DNA ") or any of its phosphoester analogs, such as phosphorothioates and thioesters, either in single stranded form or in a double stranded helix. Double-stranded DNA-DNA, ADNRNA and RNA-RNA helices are possible. The term "nucleic acid molecule" and, in particular, a DNA or RNA molecule, refers only to the primary and secondary structure of the molecule, and is not limited to any particular tertiary form. Therefore, this expression comprises the double stranded DNA found, among others, in linear or circular DNA molecules (eg restriction fragments), plasmids and chromosomes. In the exposure of the structure of certain double-stranded DNA molecules, the sequences can be described herein according to the normal agreement to provide only the sequence in the 5 'to 3' direction along the non-transcribed DNA chain (it is ie, the chain that presents a sequence homologous to that of the mRNA). A "recombinant DNA molecule" is a DNA molecule that has undergone manipulation by molecular biology.

A nucleic acid molecule is "hybridizable" with another nucleic acid molecule, such as cDNA, genomic DNA or RNA, when a single-stranded form of the nucleic acid molecule can hybridize with the other nucleic acid molecule under appropriate temperature conditions. and ionic strength of the solution (see Sambrook et al., Molecular cloning: a laboratory manual. 2 ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. (1989)). Temperature conditions and ionic intensity determine the "stringency" of hybridization. For preliminary screening of homologous nucleic acids, low stringency conditions corresponding to a Tm of 55 ° can be used, eg, 5x SSC, 0.1% SDS, 0.25% milk, and no formamide; or 30% formamide, 5x SSC, 0.5% SDS. Hybridization conditions of moderate stringency correspond to a higher Tm, for example, 40% formamide, with 5x or 6x SCC. The conditions of high stringency in hybridization correspond to the highest Tm, for example, 50% formamide, 5x or 6x SCC. Hybridization requires that the two nucleic acids contain complementary sequences, although depending on the rigor of the hybridization, erroneous bonds between the bases are possible. The appropriate stringency for nucleic acid hybridization depends on the length of the nucleic acids and the degree of complementation, variables well known in the art. The greater the degree of similarity or homology between two nucleotide sequences, the greater the Tm value for the nucleic acid hybrids that have those sequences. The relative stability (corresponding to the highest Tm) of nucleic acid hybridizations decreases in the following order: RNA: RNA, DNA: RNA, DNA: DNA. In the case of hybrids with a length greater than 100 nucleotides, equations have been obtained to calculate the Tm (see Sambrook et al., Mentioned above, 9.50-0.51). For hybridization with shorter nucleic acids, that is, oligonucleotides, the position of the decoupling is more important, and the length of the oligonucleotide determines its specificity (see Sambrook et al., Previously mentioned, 11.7-11.8). Preferably, a minimum length for a hybridizable nucleic acid is at least about 10 nucleotides; preferably at least about 15 nucleotides; and, more preferably, the length is at least about 20 nucleotides;

In a specific embodiment, the term "usual hybridization conditions" refers to a Tm of 55 ° C, and uses the conditions set forth above. In a preferred embodiment, the Tm is 60 ° C; In a more preferred embodiment, the Tm is 65 ° C.

It will be understood that "high stringency hybridization conditions" for the purposes of the present invention mean the following conditions:

1-Membrane competition and PREHIBRIDATION:

-Mixing: 40 µl of salmon sperm DNA (10 mg / ml)

+ 40 µl human placenta DNA (10 mg / ml)

-Naturalize for 5 minutes at 96 ° C, then immerse the mixture in ice.

-Remove the 2X SSC and pour 4 ml of formamide mixture into the hybridization tube containing the membranes.

-Add the mixture of the two denatured DNAs.

- Incubation at 42ºC for 5 to 6 hours, with rotation. 2-Competition with the marked probe:

-Add to the labeled and purified probe 10 to 50 µl of Cot I DNA, depending on the number of repetitions.

-Naturalize for 7 to 10 minutes at 95 ° C.

-Incubate at 65 ° C for 2 to 5 hours. 3-HYBRIDIZATION:

-Remove the prehybridization mixture.

-Mix 40 µl of salmon sperm DNA + 40 µl of human placenta DNA; denature for 5 min at 96 ° C, then immerse in ice.

-Add 4 ml of formamide mixture, the mixture of the two DNAs and the denatured labeled probe / Cot I DNA to the hybridization tube.

-Include 15 to 20 hours at 42 ° C, with rotation. 4-Washing and Exhibition:

-A wash at room temperature in SSC 2X, to clarify.

-

Twice 5 minutes at room temperature SSC 2X and 0.1% SDS at 65 ° C.

-

Twice 15 minutes at 65 ° C 1X SSC and 0.1% SDS at 65 ° C.

-Wrap the membranes in clear wrap plastic and make the exposure.

The hybridization conditions described above are adapted to the hybridization, under conditions of high stringency, of a nucleic acid molecule of variable length from 20 nucleotides to several hundred nucleotides. Of course, the hybridization conditions described above can be adjusted depending on the length of the nucleic acid whose hybridization is desired, or the type of label chosen, according to the methods known to one skilled in the art. Suitable hybridization conditions can be adjusted, for example, according to the teachings contained in the Hames and Higgins manual (1985), mentioned above, or in the manual of F. Ausubel et al., Current Protocols in Molecular Biology, Green Publishing Associates and Wiley Interscience, NY (1989).

Nuclear Factor B

The nuclear factor B (NFB) comprises a family of eukaryotic transcription factors. The NFB transcription factors were first identified as factors that bound enhancer elements in the  light chain gene in murine B lymphocytes. Subsequent studies showed that NFB is found in almost all cells and regulates genes involved in tissue inflammation, cell proliferation and cell differentiation.

NFB comprises at least five subunits: p50, p52, p65 (RelA), c-Rel, and RelB which can form homo- and heterodimers in various combinations. The active forms of NFB are normally heterodimers composed of p65 (RelA) and p50.

In most cells, NFB exists in the form of an inactive heterodimer that is sequestered in the cytosol due to the association with an I-B inhibitor protein. In response to stimuli such as inflammatory stimuli, the I-B protein phosphorylates and degrades, resulting in the dissociation of the I-B-NFB complex and the translocation of NFB to the nucleus. Once in the nucleus, NFB recognizes specific enhancer sites that contain the NFB DNA binding motif and interacts with basal transcription factors to initiate RNA polymerase II mediated transcription along with the protein binding protein. TATA box. As mentioned earlier, this results in the transcription of a wide variety of genes, in particular the genes involved in immune and inflammatory responses.

As mentioned above, the present invention is based in part on the discovery of nuclear factor inducing factor proteins B (NFIF). These proteins are involved in the induction of NFB. The discovery of these NFIF proteins provides different approaches to the treatment of conditions that involve inflammatory responses regulated by NFB. NFB-regulated inflammatory responses are associated with a variety of diseases that include, but are not limited to, rheumatoid arthritis, atherosclerosis, autoimmune diseases, viral diseases, NSAID-induced gastropathy, neurodegenerative diseases, scrapie, septicemia, apoptosis, Crohn's disease. , kidney disease, restenosis, brain injury / inflammation, Alzheimer's disease, asthma, and incorrectly regulated expression of pleiotropic cytokines. In situations where it is desirable to increase the induction of NFB in order to result in an increased immune response, the NFIF proteins of the present invention can be introduced or expressed in a patient to induce NFB. If, on the other hand, it is desirable to inhibit the induction of NFB to inhibit or prevent an immune response, the provision according to the present invention of the genetic sequences encoding NFIF proteins and of how to prepare these proteins to identify compounds can be used and compositions that inhibit or prevent the expression of NFIF proteins or that interact with NFIF proteins to inhibit or prevent their activity.

B Nuclear Factor Inductor Factor Proteins (NFIF)

The polypeptides and proteins described herein include recombinant polypeptides, natural polypeptides, or synthetic polypeptides, and may be of human, rabbit, or other animal origin.

The polypeptides can be isolated from natural sources, such as placental extracts, human plasma, or conditioned media from cultured cells through the use of purification procedures known to one skilled in the art.

Alternatively, the polypeptides of the present invention can be prepared by the use of recombinant DNA techniques, which comprise combining a nucleic acid encoding the polypeptide thereof into a suitable vector, inserting the resulting vector into a suitable host cell, recovering the polypeptide produced by the resulting host cell, and purify the recovered polypeptide.

Polypeptides are characterized by a single reproducible molecular weight and / or a multiple group of molecular weights, chromatographic properties and elution profiles, amino acid composition and sequence, and biological activity.

Isolation of Nucleotide Sequences Encoding NFIF Polypeptides

The embodiments of NFIF-14b and NFIF-7a of the present invention can be prepared by a variety of suitable methods known to those skilled in the art. The teachings on general molecular biology, microbiology, and recombinant DNA techniques within the knowledge of the art are fully explained in the literature. See, eg, Sambrook, Fritsch and Maniatis, Molecular Cloning: A Laboratory Manual, second edition (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York ("Sambrook et al., 1989" ); DNA Cloning: A Practical Approach, volumes I and II (D.N. Glover ed. 1985); F.M. Ausubel et al. (eds.), Current Protocols in Molecular Biology, John Wiley & Sons, Inc. (1994).

The cDNA sequences for NFIF-14b and NFIF-7a are presented in Figure 3. NFIF-7a is a splice variant of NFIF-14b. The term "splice variant" refers to a polypeptide encoded by a mRNA produced by alternative processing of the full-size mRNA encoded by a gene or genes that results in a mRNA containing one or more deletions with respect to the mRNA of full size of genes. As shown in Figure 4, with respect to NFIF-14b, NFIF-7a has an internal deletion of base pairs 473 to 739. Given the information in the description herein about the DNA sequence of NFIF-14b and NFIF-7a and methods known in the art to obtain cDNA, the nucleotide sequences encoding NFIF-14b and NFIF-7a can be easily cloned and inserted into a vector suitable for the expression of these proteins in vitro or in vivo. For a description of the methods related to cDNA cloning and expression vectors, see Sambrook et al., 1989, mentioned above. A "cloning vector" is a replicon, for example a plasmid, a phage or a cosmid, to which another segment of DNA can be attached to achieve replication of the fixed segment. A "replicon" is any genetic element (eg, plasmid, chromosome, virus) that functions as an autonomous unit of DNA replication in vivo, that is, capable of replicating under its own control. A cloning vector may be able to replicate in one cell type and express itself in another ("shuttle vector"). In preferred embodiments of the present invention, the cloning vector is capable of expressing itself in a host cell and the "expression vector" is capable of expressing NFIF at levels sufficient to have an effect on a NFB regulated pathway in the cell. .

A gene encoding NFIF-14b and NFIF-7a, either genomic DNA or cDNA, can be isolated from a human genomic library or a cDNA library. A "coding sequence" of DNA is a double stranded DNA sequence that is transcribed and translated into a polypeptide in an in vitro cell

or in vivo when placed under the control of appropriate regulatory sequences. The DNA coding sequences and appropriate regulatory sequences are preferably provided in an expression vector. The limits of the coding sequence are determined by a start codon at the 5 'end (amino) and a translation stop codon at the 3' end (carboxyl). A coding sequence may include, but is not limited to, prokaryotic sequences, cDNA from eukaryotic mRNA, genomic DNA sequences from eukaryotic (eg, mammalian) DNA and even synthetic DNA sequences. If the coding sequence is to be used for expression in a eukaryotic cell, a polyadenylation signal and a transcription termination sequence will normally be located at the 3 'position, relative to the coding sequence. Methods for obtaining a gene are well known in the art given the DNA sequence information set forth herein. The DNA can be obtained by usual procedures known in the art from cloned DNA (eg, a DNA "library"). It is preferably obtained from a cDNA library prepared from tissues with a high level of protein expression. The DNA can also be obtained by cloning the genomic DNA, or fragments thereof, purified from the desired cell (see, for example, Sambrook et al., 1989, mentioned above; Glover, DM (ed.) , 1985, DNA Cloning: A Practical Approach, MRL Press, Ltd., Oxford,

R.U. Vol. I, II) or by chemical synthesis. Clones obtained from genomic DNA may contain regulatory DNA regions and introns, in addition to the coding regions.

Methods for obtaining cDNA are well known in the art. Briefly, these methods include isolating a mixture of messenger RNA (mRNAs) from eukaryotic cells and employing a series of enzymatic reactions to synthesize copies of double stranded DNA (cDNAs) complementary to isolated mRNAs. "Polymerase chain reaction" (PCR) refers to in vitro methods for amplifying specific DNA sequences through the use of methods well known in the art.

Regardless of the method used to obtain the desired cDNA, the double stranded cDNA mixture is inserted into the cloning vehicles by any of many known techniques, depending at least in part on the particular vehicle used. Various insertion methods are discussed in Sambrook et al., 1989, mentioned above, and are well known in the art. A "cassette" refers to a segment of DNA that can be inserted into a vector at one or more specific restriction sites. The DNA segment encodes a polypeptide of interest and the cassette and restriction sites are designed to ensure insertion of the cassette into the appropriate reading frame for transcription and translation.

Once the DNA segments are inserted into a cloning vehicle, the cloning vehicle is used to transform a suitable host. A cell has been "transfected" with exogenous or heterologous DNA when said DNA has been introduced into the cell. A cell has been "transformed" with exogenous or heterologous DNA when the DNA used to transfect the cell causes a phenotypic change. The transforming DNA can be integrated (covalently linked) into the chromosomal DNA, constituting the genome of the cell. These cloning vehicles usually confer an antibiotic resistance trait on the host. Such hosts are generally prokaryotic cells, and only a few host cells contain the desired cDNA. Transfected host cells constitute a "library" of genes, which provides a representative sample of the mRNAs present in the cell from which the mRNAs were isolated.

Given the information on the sequence of NFIF-14b and NFIF-7a provided herein, a suitable oligonucleotide, preferably synthesized as discussed above, can be prepared and can be used to identify the clones containing the NFIF sequences. The oligonucleotide preferably includes at least about 18 nucleotides, and is hybridizable to a genomic DNA molecule, a cDNA molecule, or a mRNA molecule encoding NFIF. The oligonucleotides can be labeled, e.g. eg, with 32P-nucleotides or with nucleotides to which a label, such as biotin, has been covalently conjugated.

In one embodiment, a labeled oligonucleotide can be used as a probe to detect the presence of a nucleic acid encoding NFIF. In another embodiment, oligonucleotides (of which one or both may be labeled) can be used as PCR primers, for cloning the full length or a fragment of NFIF, or to detect the presence of nucleic acids encoding NFIF. In a further embodiment, an oligonucleotide can form a triple helix with an NFIF DNA molecule.

Generally, oligonucleotides are prepared synthetically, preferably in a nucleic acid synthesizer. Therefore, oligonucleotides can be prepared with phosphoester-like links that do not occur naturally, such as thioester bonds, etc. To identify the clones containing the NFIF sequences, individual transformed or transfected cells are grown in the form of colonies on a nitrocellulose filter paper. The colonies are lysed and the DNA is firmly attached to the filter paper by heating. The filter paper is then incubated with a labeled oligonucleotide probe that is complementary to NFIF. DNA fragments that have substantial homology with NFIF will hybridize with the probe.

As discussed earlier, temperature and ionic strength conditions determine the "stringency" of hybridization. Hybridization requires that the two nucleic acids contain complementary sequences, although depending on the rigor of the hybridization, erroneous bonds between the bases are possible. The appropriate stringency for nucleic acid hybridization depends on the length of the nucleic acids and the degree of complementation, variables well known in the art.

The probe hybridized with the cDNA for which it is complementary. It can be identified by autoradiography or by chemical reactions that identify the presence of the probe. The corresponding clones are characterized to identify one or a combination of clones that contain all the structural information for the desired protein. The nucleic acid sequence encoding the protein of interest is isolated and reinserted into an expression vector. The expression vector puts the cloned gene under the regulatory control of specific prokaryotic or eukaryotic control elements that allow effective expression (transcription and translation) of the ds-cDNA. Transcription and translation control sequences are DNA regulatory sequences, such as, for example, promoters, enhancers, and terminators, which enable the expression of a coding sequence in a host cell. In eukaryotic cells, polyadenylation signals are control sequences. A coding sequence is "under the control" of transcription and translation control sequences in a cell, when RNA polymerase transcribes the mRNA coding sequence, which is then cut and spliced (if the coding sequence contains introns) and translates to the protein encoded by the coding sequence.

An additional selection can be carried out based on the properties of the gene. For example, the presence of the desired gene in a clone can be detected by tests based on the physical, chemical or immunological properties of its expressed protein product. For example, cDNA clones or DNA clones that produce a protein having properties similar or identical to those of NFIF can be selected with respect to electrophoretic migration, isoelectric focusing, gel electrophoresis with pH gradient, proteolytic digestion, or antigenicity.

Preparation of NFIF Polypeptide Variants

The present invention describes allelic variants, mutant variants by substitution, addition and deletion, analogs, and derivatives of NFIF and homologues of other species having the same functional activity or a functional activity homologous to NFIF. In preferred embodiments, genes that have deletions or substitutions that increase the ability to induce NF NB are used. The preparation or isolation of NFIF variants is described. Therefore, the present invention describes variants of NFIF that are functionally active, that is, capable of exhibiting one or more functional activities associated with NFIF.

NFIF variants can be produced by altering the coding nucleic acid sequences by substitutions, additions or deletions that provide functionally equivalent molecules. Preferably, NFIF embodiments are made that have enhanced or enhanced functional activity with respect to NFIF-14b or NFIF-7a.

Due to the degeneracy of the coding nucleotide sequences, other DNA sequences encoding substantially the same amino acid sequence as NFIF can be used in the practice of the present invention, including an amino acid sequence containing a single amino acid variant. These include, but are not limited to, allelic genes, homologous genes from other species and nucleotide sequences that comprise all or parts of NFIF that have been altered by the substitution of different codons that encode the same amino acid residue within the sequence, producing This way a silent change. Similarly, the NFIF variants of the invention include, but are not limited to, those that contain, as a primary amino acid sequence, all or part of the amino acid sequence of an NFIF protein including altered sequences in which residues within the sequence they are replaced by functionally equivalent amino acid residues, resulting in a conservative amino acid substitution. For example, one or more amino acid residues within the sequence may be substituted for another amino acid of similar polarity, which acts as a functional equivalent, resulting in a silent alteration. Substituents for an amino acid within the sequence may be selected from among other members of the class to which the amino acid belongs. For example, non-polar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan and methionine. Amino acids that contain aromatic ring structures are phenylalanine, tryptophan and tyrosine. Polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine and glutamine. Positively charged (basic) amino acids include arginine, lysine and histidine. Negatively charged amino acids (acids) include aspartic acid and glutamic acid. It is not expected that these alterations affect the apparent molecular weight determined by polyacrylamide gel electrophoresis or the isoelectric point.

Particularly preferred substitutions are:

-

 Arg for Lys and vice versa so that the positive charge can be maintained;

-

 Asp by Glu and vice versa so that the negative charge can be maintained;

-

 Thr for Being in such a way that a free -OH can be maintained; Y

-

 Asn for Gln so that a free CONH2 can be maintained.

Amino acid substitutions can also be introduced to replace one amino acid with another with a particularly preferred feature. For example, a Cys can be introduced as a potential site for disulfide bridges with another Cys. A His can be introduced as a particularly "catalytic" site (ie, His can act as an acid or base and is the most common amino acid in biochemical catalysis). Pro can be introduced due to its particularly flat structure, which induces β turns in the protein structure.

The genes encoding the NFIF variants can be produced by various methods known in the art. Manipulations that result in their production can be performed at the gene level or at the protein level. For example, the cloned NFIF gene sequence can be modified by any of numerous strategies known in the art (Sambrook et al., 1989, mentioned above). The sequence can be cleaved at appropriate sites with one or more restriction endonucleases, followed by additional enzymatic modification, and if desired, isolated and bound in vitro. In the production of the gene encoding an embodiment of NFIF, care should be taken to ensure that the modified gene remains within the same translation reading frame as the NFIF gene, without being interrupted by translation stop signals, in the region of the gene in which the desired activity is encoded.

In addition, the nucleic acid sequence encoding NFIF can be mutated in vitro or in vivo, to create and / or destroy translation, initiation and / or termination sequences, or to create variations in the coding regions and / or form new sites. for restriction endonucleases or destroy existing ones, to facilitate further modification in vitro. Preferably, such mutations enhance the functional activity of the mutated NFIF gene product. Any mutagenesis technique known in the art can be used, including, for example, in vitro directed mutagenesis (Hutchinson, C., et al., 1978, J. Biol. Chem. 253: 6551; Zoller and Smith, 1984, DNA 3: 479-488; Oliphant et al., 1986, Gene 44: 177; Hutchinson et al., 1986, Proc. Natl. Acad. Sci. USA 83: 710), and the use of "TAB" linkers (Pharmacia) , etc. For directed mutagenesis, PCR techniques are preferred (see Higuchi, 1989, "Using PCR to Engineer DNA", in PCR Technology: Principles and Applications for DNA Amplification. H. Erlich, ed., Stockton Press, Chapter 6, p. 61-70).

NFIF Based Polypeptides

A therapeutically useful variant of NFIF can be identified by a variety of methods, including in vitro assays that can be used to identify the level of expression of a NFB regulated gene or of a gene whose expression is regulated by regulatory elements. of NFB in the presence of the NFIF variant. One method of identifying polypeptides that are capable of stimulating (or inhibiting) the induction of NFB is to use a system with an indicator gene. These systems use expression vectors with reporter genes that include a cloning site in which a given promoter can be cloned in a 5 'position with respect to an "indicator gene" that can be easily detected and quantified. One skilled in the art could easily identify and subclone the promoter for NFB, as well as other control sequences in a commercially available indicator gene expression vector. The expression vector is transferred to host cells and the cells are exposed to a variant of NFIF (or a supposedly inhibitory or stimulatory molecule) to determine the effect on product expression of the reporter gene. In particular, the presence in the cells of the indicator gene product is tested directly by measuring the amount of indicator mRNA, the indicator protein itself or the enzymatic activity of the indicator protein. Ideally, the reporter gene is not expressed endogenously in the cell type of interest, and lends itself to selective, quantitative and rapid assays. A variety of constructs for assays with indicator molecules are commercially available, and several indicator genes and assays have been developed, and those skilled in the art can easily prepare them. The most popular systems for monitoring genetic activity in eukaryotic cells include chloramphenicol acetyltransferase (CAT), βgalactosidase, firefly luciferase, growth hormone (GH), β-glucuronidase (GUS), alkaline phosphatase (AP), green fluorescent protein ( GFP) and Renilla luciferase. Constructions for assays with indicator molecules can be purchased from a variety of sources, including Promega and Invitrogen.

As mentioned earlier, the activity of the indicator gene can be detected by analyzing the indicator mRNA or the indicator protein. The indicator mRNA can be detected by northern blot analysis, ribonuclease protection assays or RT-PCR. Although these assays are more direct than measuring protein expression, many assays have been developed to measure the presence of the indicator protein instead of the mRNA present in a cell. Indicator proteins can be assayed by spectrophotometry or by detecting enzymatic activity. Indicator protein levels can also be measured with antibody-based assays. In general, enzymatic assays are very sensitive and are a preferred method of monitoring expression of the reporter gene. A commercially available NFB-reporter gene construct is the vector with the pNFB-Luc (luciferase) reporter gene available from Stratagene. An example is provided on how to use this indicator system to quantify the activity of the NFIF protein in Example 4.

Experiments of the type indicated herein can be used to determine to what extent a given disease can be treated by using the compositions of the present invention.

The following discussion concerns the manipulation and expression of the DNA encoding the polypeptides of the present invention.

Expression Vectors Encoding NFIF Polypeptides

The identified and isolated DNA sequence can be inserted into a cloning / expression vector (hereinafter "vector") to facilitate modifications of the protein sequence or expression. These vectors generally include multiple cloning sites, promoters, sequences that facilitate replication in a host cell and selectable markers.

Any suitable vector can be used. Many are known in the art. Examples of vectors that can be used include, for example, modified plasmids or viruses. The vector is generally compatible with a given host cell into which the vector is introduced to facilitate replication of the vector and expression of the encoded proteins. The insertion of a DNA sequence into a given vector can be carried out, for example, by ligating the DNA fragment into a cloning vector having complementary cohesive ends. However, if the complementary restriction sites used to cut the DNA are not present in the cloning vector, the ends of the DNA molecules can be enzymatically modified. Alternatively, any desired site can be produced by linking nucleotide sequences (linkers) to the ends of the DNA; the linked linkers may comprise chemically synthesized specific oligonucleotides encoding restriction endonuclease recognition sequences. Useful vectors may consist of segments of chromosomal, non-chromosomal and synthetic DNA sequences. Examples of specific vectors useful in the practice of the present invention are E. coli bacteriophages, for example, lambda derivatives, or plasmids, for example, derivatives of pBR322

or derivatives of plasmid pUC, eg, pmal-c, pFLAG, derivatives of SV40 and known bacterial plasmids, eg, plasmids of E. coli col El, pCR1, pMal-C2, pET, pGEX (Smith et al., 1988, Gene 67: 31-40), pMB9 and its derivatives, plasmids such as RP4; Phage DNAs, eg, the numerous derivatives of phage 1, eg, NM989, and other phage DNAs, eg, single stranded phage M13 and filamentous DNA; yeast vectors such as the 2 µm plasmid or derivatives thereof; vectors useful in eukaryotic cells, for example, vectors useful in insect cells, such as baculovirus vectors, vectors useful in mammalian cells; vectors derived from combinations of plasmids and phage DNAs, plasmids that have been modified to employ phage DNA or other expression control sequences; and the like

Examples of yeast vectors that can be used according to the invention are the pYES2 (Invitrogen) fusion vector or the pYESHisA, B, C (Invitrogen) fusion vector.

Baculovirus vectors that can be used in the practice of the invention include a variety of vectors, including both non-fusion transfer vectors, for example, pVL941 (Summers), pVL1393 (Invitrogen), pVL1392 (Summers and Invitrogen), and pBlueBacIII (Invitrogen), as fusion transfer vectors, for example, pAc700 (Summers), pAc701 and pAc702, pAc360 (Invitrogen), and pBlueBacHisA, B, C (Invitrogen).

Mammalian vectors contemplated for use in the invention include, for example, vectors with inducible promoters, for example, the dihydrofolate reductase (DHFR) promoter, e.g., any expression vector with a DHFR expression vector, or a DHFR / methotrexate co-amplification vector, for example, pED (see Kaufman, Current Protocols in Molecular Biology, 16.12 (1991)). Alternatively, a glutamine synthetase / methionine sulfoximin co-amplification vector can be used, for example, pEE14 (Celltech). In another embodiment, a vector that directs episomal expression can be used under the control of Epstein Barr virus (EBV), for example, pREP4 (Invitrogen), pCEP4 (Invitrogen), pMEP4 (Invitrogen), pREP8 (Invitrogen), pREP9 (Invitrogen), and pEBVHis (Invitrogen). Selectable mammalian expression vectors for use in the invention include pRc / CMV (Invitrogen), pRc / RSV (Invitrogen), pcDNA3 (Invitrogen) and others. Vaccinia virus mammalian expression vectors (see, Kaufman, 1991, mentioned above) for use according to the invention include, but are not limited to, pSC11, pMJ601, and pTKgptF1S.

A variety of methods can be used to confirm that the desired DNA sequence encoding NFIF-14b, NFIF-7a, or another variant of NFIF, has been cloned into a vector. In general, a

or more of the following approaches: (a) PCR amplification of the desired plasmid DNA or specific mRNA, (b) nucleic acid hybridization, (c) presence or absence of marker gene selection functions, (d) endonuclease analysis appropriate restriction, and (e) expression of inserted sequences. In the first strategy, nucleic acids can be amplified with PCR to provide detection of the amplified product. In the second strategy, the presence of a foreign gene inserted in an expression vector can be detected with nucleic acid hybridization, using probes comprising sequences that are homologous to an inserted marker gene. In the third strategy, the recombinant vector / host system can be identified and selected based on the presence or absence of certain "marker selection" functions of the gene (eg, β-galactosidase activity, thymidine kinase activity, Antibiotic resistance, transformation phenotype, formation of occlusion bodies in baculovirus, etc.) due to the insertion of exogenous genes into the vector. In another example, if the nucleic acid encoding NFIF is inserted into the gene sequence of the "selection marker" of the vector, recombinants containing the NFIF insert can be identified by the absence of the gene function of the selection marker. In the fourth strategy, recombinant expression vectors are identified by digestion with suitable restriction enzymes. In the fifth strategy, recombinant expression vectors can be identified by testing the activity, biochemical or immunological characteristics of the gene product expressed by the recombinant, with the proviso that the expressed protein assumes a functionally active conformation.

Promoters

The nucleotide sequence encoding NFIF-14b or NFIF-7a or an NFIF variant thereof can be inserted into an expression vector containing the elements necessary for transcription and translation of the sequence encoding the inserted protein. These elements are referred to herein as "promoter."

A promoter is a regulatory region of DNA, capable of binding to RNA polymerase in a cell and initiating the transcription of a subsequent coding sequence (in the 3 'direction). To define the present invention, the promoter sequence is attached to its 3 'end by the transcription start site and extends upstream (in the 5' direction) to include the minimum number of bases or elements necessary to initiate the transcription with detectable levels above baseline levels. Within the promoter sequence will be a transcription initiation site (conveniently defined, for example, by mapping with nuclease S1), as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase.

Thus, the nucleic acid encoding the polypeptides of the invention is operably associated with a promoter in an expression vector of the invention. Both cDNA sequences and genomic sequences can be cloned and expressed under the control of these regulatory sequences. An expression vector preferably also includes an origin of replication. The necessary transcription and translation signals can be provided in a recombinant expression vector, or they can be supplied by the native gene encoding NFIF and / or its flanking regions. To construct expression vectors containing a gene consisting of the appropriate transcription / translation control signals and protein coding sequences, any of the methods previously described for inserting DNA fragments into a cloning vector can be used. . These methods may include synthetic techniques and in vitro recombinant DNA techniques and in vivo recombination (genetic recombination).

Expression can be controlled by any promoter / enhancer element known in the art, but these regulatory elements must be functional in the host selected for expression. Examples of promoters that can be used to control NFIF gene expression include the SV40 early promoter region (Benoist and Chambon, 1981, Nature 290: 304-310), the promoter contained in the 3 'long terminal repeat of the virus. Rous sarcoma (Yamamoto, et al., 1980, Cell 22: 787-797), the herpes thymidine kinase promoter (Wagner et al., 1981, Proc. Natl. Acad. Sci. USA 78: 1441-1445) , the regulatory sequences of the metallothionein gene (Brinster et al., 1982, Nature 296: 39-42); prokaryotic expression vectors, for example, the β-lactamase promoter (Villa-Kamaroff, et al., 1978, Proc. Natl. Acad. Sci. USA 75: 3727-3731), or the tac promoter (DeBoer, et al., 1983, Proc. Natl. Acad. Sci. USA 80: 21-25); promoter elements of yeast or other fungi, for example, the Gal 4 promoter, the ADC promoter (alcohol dehydrogenase), the PGK promoter (phosphoglycerol kinase), the alkaline phosphatase promoter; and animal transcription control regions, which have tissue specificity and have been used in transgenic animals: the elastase gene I control region that is active in pancreatic acinar cells (Swift et al., 1984, Cell , 38: 639-646; Ornitz et al., 1986, Cold Spring Harbor Symp. Quant. Biol., 50: 399-409; MacDonald, 1987, Hepatology 7: 425-515); the control region of the insulin gene that is active in pancreatic beta cells (Hanahan, 1985, Nature, 315: 115-122), the control region of the immunoglobulin gene that is active in lymphoid cells (Grosschedl et al ., 1984, Cell, 38: 647-658; Adames et al., 1985, Nature 318: 533-538; Alexander et al., 1987, Mol. Cell. Biol. 7: 1436-1444), control region of Mouse mammary tumor virus that is active in testis, breast, lymphoid cells and mast cells (Leder et al., 1986, Cell, 45: 485-495), control region of the albumin gene that is active in the liver (Pinkert et al., 1987, Genes and Devel., 1: 268-276), the control region of the alphafetoprotein gene that is active in the liver (Krumlauf et al., 1985, Mol. Cell. Biol., 5: 1639 -1648; Hammer et al., 1987, Science, 235: 53-58), control region of the alpha-1-antitrypsin gene that is active in the liver (Kelsey et al., 1987, Genes and Devel., 1 : 161-171), beta-globi gene control region na which is active in myeloid cells (Mogram et al., 1985, Nature, 315: 338-340; Kollias et al., 1986, Cell, 46: 8994), the control region of the myelin basic protein gene that is active in oligodendrocytic brain cells (Readhead et al., 1987, Cell, 48: 703-712 ), the control region of the myosin light-2 chain gene that is active in skeletal muscle (Sani, 1985, Nature, 314: 283286) and the control region of the gonadotropic release hormone gene that is active in the hypothalamus (Mason et al., 1986, Science, 234: 1372-1378).

A preferred promoter used in the constructs of the expression vectors discussed hereinafter is the cytomegalovirus (CMV) promoter, which is capable of providing a high level of expression in a variety of mammalian cell lines.

Introduction of Vectors in Hosting Cells

Vectors can be introduced into the host cells by any suitable method, including, for example, transfection, electroporation, microinjection, transduction, cell fusion, DEAE dextran, calcium phosphate precipitation, lipofection (lysosome fusion), use of a gene gun or a DNA vector transporter (see, eg, Wu et al., 1992, J. Biol. Chem. 267: 963967; Wu and Wu, 1988, J. Biol. Chem. 263: 14621-14624; Hartmut et al., Canadian Patent Application No. 2,012,311, filed March 15, 1990), so that many copies of the gene sequence are generated. In a preferred method, cells are transfected in vitro by using Lipfectamine® available from Gibco-BRL. Preferably, the cloned gene is contained in a shuttle vector plasmid that enables expansion into a cloning cell, eg, E. coli, and facilitates purification for subsequent insertion into an appropriate expression cell line. For example, a shuttle vector, which is a vector that can replicate in more than one type of organism, can be prepared for replication in both E. coli and Saccharomyces cerevisiae by binding sequences of an E. coli plasmid. to plasmid sequences 2 µm of the yeast.

Hosting Cell Systems

Host cell systems include mammalian host cell systems, insect host cell systems and microorganisms such as yeasts or bacteria. Depending on the host cell system used, any of several suitable transcription and translation elements can be used.

In addition, a host cell strain that modulates the expression of the inserted sequences or that modifies and processes the gene product in the specific desired form can be chosen. Different host cells have characteristic and specific mechanisms for translational and post-translational processing and protein modification. Appropriate cell lines or host systems can be chosen to ensure the desired modification and processing of the expressed foreign protein. Expression in yeasts can produce a biologically active product. Expression in eukaryotic cells can increase the likelihood of "natural" folding. In addition, expression in mammalian cells can provide a tool to reconstitute or constitute the NFIF inhibitory activity. In addition, different vector / host expression systems can affect processing reactions, such as proteolytic cleavages, to a different extent. Expression vectors of the invention can be used, as indicated above, to transfect cells for screening or to perform biological assays of modulators of NFIF activity.

Examples of acceptable mammalian host cells are HEK 293 cells and COS-7 cells.

A recombinant NFIF-14b, or NFIF-7a of the invention or variant of NFIF can be expressed chromosomally, after integration of the coding sequence by recombination. In this regard, any of the various amplification systems can be used to achieve high levels of stable gene expression (see Sambrook et al., 1989, mentioned above).

The cell into which the recombinant vector comprising the nucleic acid encoding NFIF is introduced is grown in a suitable cell culture medium under conditions that enable the expression of an NFIF polypeptide in the cell.

Once a host system and the appropriate growth conditions have been established, large amounts of recombinant expression vectors can be propagated and prepared. Soluble forms of the protein can be obtained by collecting the culture fluid or solubilizing inclusion bodies, for example, by detergent treatment, and if it is desired to undergo ultrasound or other mechanical processes, such as those described above. The solubilized or soluble protein can be isolated using various techniques, including polyacrylamide gel electrophoresis (PAGE), isoelectric focusing, two-dimensional gel electrophoresis, chromatography (e.g., ion exchange, affinity, immunoaffinity, and chromatography column size), centrifugation, differential solubility, immunoprecipitation or any other conventional protein purification technique.

As described above, a "vector" is any means for transferring a nucleic acid according to the invention, into a host cell. Preferred vectors are viral vectors, for example, retroviruses, herpes viruses, adenoviruses, and adeno-associated viruses. Thus, a gene encoding a protein or a fragment of a polypeptide domain is introduced in vivo, ex vivo, or in vitro using a viral vector or by direct introduction of DNA. Expression in selected target tissues can be accomplished by directing the transgenic vector to specific cells, such as with a viral vector or a receptor ligand, or using a tissue specific promoter, or both.

The following discussion summarizes various viral and non-viral systems that can be used to introduce DNA into a host cell in vivo or in vitro.

Viral Vector Systems

NFIF polypeptides, as well as antisense nucleic acids, ribozymes and antibodies discussed hereinbelow can be prepared in vitro or ex vivo, or designed to be expressed in vivo in a patient by the use of a Appropriate expression system introduced by means of a viral vector system.

The viral vectors commonly used for target selection in vivo or ex vivo and the therapy procedures are DNA-based vectors and retroviral vectors. Methods for the construction and use of viral vectors are known in the art [see, eg, Miller and Rosman; BioTechniques 7: 980-990 (1992)]. Preferably, viral vectors are replication deficient, that is, they are not able to replicate autonomously in the target cell selected. In general, the genome of replication-deficient viral vectors that are used within the scope of the present invention lacks at least one region that is necessary for virus replication in the infected cell. These regions can be removed (in whole or in part), or become nonfunctional by any technique known to those skilled in the art. These techniques include total removal, substitution (by other sequences, in particular by the inserted nucleic acid), deletion or partial addition of one or more bases in an essential region (for replication). Such techniques can be performed in vitro (on isolated DNA) or in situ, using genetic manipulation techniques or by treatment with mutagenic agents. Preferably, the replication-deficient virus preserves the sequences of its genome that are necessary to encapsulate the viral particles.

Viral DNA vectors include an attenuated or deficient DNA virus, such as, but not limited to, herpes simplex virus (HSV), papillomavirus, Epstein Barr virus (EBV), adenovirus, adeno-associated virus (AAV), vaccinia virus and the like. Deficient viruses, which completely or almost completely lack viral genes, are preferred. A deficient virus is not competent for replication after introduction into a cell, and therefore does not lead to a productive viral infection. The use of deficient viral vectors allows administration to cells in a specific and localized area, without problems that the vector can infect other cells. Therefore, a specific tissue can be specifically targeted. Examples of particular vectors include, but are not limited to, a herpes virus 1 (HSV1) deficient vector (Kaplitt et al., Molec. Cell. Neurosci. 2: 320-330 (1991)), a herpes virus vector deficient that it lacks a glycoprotein L gene (Patent Publication RD 371005 A), or other deficient herpes virus vectors (International Patent Publication No. WO 94/21807, published September 29, 1994; International Patent Publication No. WO 92 / 05263, published April 2, 1994); an attenuated adenovirus vector such as the vector described by Stratford-Perricaudet et al. (J. Clin. Invest. 90: 626630 (1992); see also La Salle et al., Science 259: 988-990 (1993)); and a deficient adeno-associated virus vector (Samulski et al., J. Virol. 61: 3096-3101 (1987); Samulski et al., J. Virol. 63: 3822-3828 (1989); Lebkowski et al., Mol Cell Biol. 8: 3988-3996 (1988)])

Preferably, for in vivo administration, an appropriate immunosuppressive treatment is employed in conjunction with the viral vector, eg, an adenovirus vector, to prevent immuno-deactivation of the viral vector and the transfected cells. For example, immunosuppressive cytokines, such as interleukin-12 (IL-12), interferon- (IFN-), or anti-CD4 antibody, can be administered to block humoral or cellular immune responses to viral vectors. In addition, it is advantageous to employ a viral vector that is genetically modified to express a minimum amount of antigens.

Naturally, the administration of a vector that will express a therapeutically effective amount of NFIF for gene therapy applications is contemplated. The phrase "therapeutically effective amount" is used herein to refer to an amount sufficient to cause an improvement in a clinically significant condition in the host.

Adenoviral Vector Systems

In a preferred embodiment, the vector is an adenoviral vector. Adenoviruses are eukaryotic DNA viruses that can be modified to effectively deliver a nucleic acid of the invention to a variety of cell types. There are various adenovirus serotypes. Of these serotypes, preference is given, within the scope of the present invention, to the use of human adenovirus type 2 or type 5 (Ad 2 or Ad 5) or adenovirus of animal origin (see WO94 / 26914). Adenoviruses of animal origin that can be used within the scope of the present invention include adenoviruses of canine, bovine, murine origin (example: Mav1, Beard et al., Virology 75 (1990) 81), bovine, porcine, avian, and ape (example: SAV).

Preferably, the replication deficient adenoviral vectors of the invention comprise the ITRs, an encapsulation sequence and the nucleic acid of interest. Even more preferably, at least the E1 region of the adenoviral vector is not functional. The deletion in the E1 region preferably extends from nucleotides 455 to 3329 in the Ad5 adenovirus sequence (PvuII-BglII fragment) or 382 to 3446 (HinfII-Sau3A fragment). Other regions, in particular the E3 region (WO95 / 02697), the E2 region (WO94 / 28938), the E4 region (WO94 / 28152, WO94 / 12649 and WO95 / 02697), or in any of the late genes L1-L5.

In a preferred embodiment, the adenoviral vector has a deletion in the E1 region (Ad 1.0). Examples of adenovirus with E1 deletion are described in patent document EP 185,573. In another preferred embodiment, the adenoviral vector has a deletion in regions E1 and E4 (Ad 3.0). Examples of adenovirus with E1 / E4 deletion are described in WO95 / 02697 and WO96 / 22378. In yet another preferred embodiment, the adenoviral vector has a deletion in the E1 region into which the E4 region and the nucleic acid sequence is inserted (see FR94 13355).

Replication-deficient recombinant adenoviruses according to the invention can be prepared by any method known to those skilled in the art (Levrero et al., Gene 101 (1991) 195, EP 185,573; Graham, EMBO J. 3 (1984) 2917 ). In particular, they can be prepared by homologous recombination between an adenovirus and a plasmid that carries, among others, the DNA sequence of interest. Homologous recombination is carried out after co-transfection of the adenovirus and plasmid in an appropriate cell line. The cell line that is used should preferably (i) be transformable by said elements, and (ii) contain the sequences that are capable of complementing the replication-deficient adenovirus genome, preferably in an integrated manner, to avoid the risks of recombination. . Examples of cell lines that can be used are human embryonic renal cell line 293 (Graham et al., J. Gen. Virol. 36 (1977) 59) containing the left genome portion of an Ad5 adenovirus (12% ) integrated into its genome and cell lines that are capable of complementing functions E1 and E4, as described in patent application documents WO94 / 26914 and WO95 / 02697. Recombinant adenoviruses are recovered and purified using conventional molecular biology techniques, which are well known to those skilled in the art.

Adeno-associated Virus Vector Systems

Adeno-associated viruses (AAV) are relatively small-sized DNA viruses that can be stably integrated and site specific in the genome of the cells they infect. They are capable of infecting a broad spectrum of cells without inducing any effect on cell growth, morphology or differentiation, and do not appear to be involved in human pathologies. The AAV genome has been cloned, sequenced and characterized. It includes approximately 4700 bases and contains an inverted terminal repeated region (ITR) of approximately 145 bases at each end, which acts as the origin of replication for the virus. The rest of the genome is divided into two essential regions that carry the encapsulation functions: the left part of the genome, which contains the rep gene involved in viral replication and the expression of viral genes; and the right part of the genome, which contains the cap gene that encodes the virus capsid proteins.

The use of vectors obtained from AAVs to transfer genes in vitro and in vivo has been described (see WO 91/18088; WO 93/09239; US 4,797,368, US 5,139,941, EP 488 528). These publications describe various AAV-derived constructs in which the rep and / or cap genes are deleted and replaced by a gene of interest, and the use of these constructs to transfer the gene of interest in vitro (in cultured cells) or in vivo. (directly in an organism). Replication-deficient recombinant AAVs according to the invention can be prepared by co-transfecting a plasmid containing the nucleic acid sequence of interest, flanked by two inverted terminal repeat regions (ITR) of AAV, and a plasmid carrying the encapsulation genes of AAV (rep and cap genes), in a cell line that is infected with a human helper virus (for example an adenovirus). The recombinant AAVs that are produced afterwards are purified by conventional techniques.

Therefore, a AAV-derived recombinant virus is described whose genome encompasses a sequence encoding a nucleic acid encoding NFIF or its variants flanked by AAV ITRs. The invention also relates to a plasmid comprising a sequence encoding a nucleic acid encoding NFIF or its variants flanked by two ITRs of an AAV. Said plasmid can be used as such to transfer the nucleic acid sequence, with the plasmid, when appropriate, incorporated into a liposomal vector (pseudo-virus).

Retroviral Vector Systems

 In another embodiment, the gene can be introduced into a retroviral vector, e.g. eg, as described in the document of Anderson et al., US Pat. . 5,399,346; Mann et al., 1983, Cell 33: 153; Temin et al., U.S. Patent No. 4,650,764; Temin et al., U.S. Patent No. 4,980,289; Markowitz et al., 1988, J. Virol. 62: 1120; Temin et al., U.S. Patent No. 5,124,263; EP 453242, EP178220; Bernstein et al. Genet Eng. 7 (1985) 235; McCormick, BioTechnology 3 (1985) 689; International Patent Publication No. WO 95/07358, published March 16, 1995, by Dougherty et al .; and Kuo et al., 1993, Blood 82: 845. Retroviruses are integral viruses that infect dividing cells. The retroviral genome includes two LTRs, an encapsulation sequence and three coding regions (gag, pol and env). In recombinant retroviral vectors, the gag, pol and env genes are generally completely or partially deleted, and substituted by a heterologous nucleic acid sequence of interest. These vectors can be constructed from different types of retroviruses, such as HIV, MoMuLV ("murine Moloney leukemia virus" MSV ("murine Moloney sarcoma virus"), HaSV ("Harvey sarcoma virus"); SNV ("spleen necrosis virus"); RSV ("Rous sarcoma virus") and the Friend virus. Retroviral vectors deficient are described in WO95 / 02697.

In general, to construct recombinant retroviruses containing a nucleic acid sequence, a plasmid is constructed, which contains the LTRs, the encapsulation sequence and the coding sequence. This artificial structure is used to transfect a packaging cell line, said cell line being able to provide retroviral functions that are deficient in the plasmid in trans. In general, encapsulation cell lines are, therefore, capable of expressing the gag, pol and env genes. Said encapsulation cell lines have been described in the prior art, in particular the PA317 cell line (US 4,861,719); the PsiCRIP cell line (WO90 / 02806) and the GP + envAm-12 cell line (WO89 / 07150). In addition, recombinant retroviral vectors may contain modifications in the LTRs to suppress transcriptional activity as well as extensive encapsulation sequences that may include a part of the gag gene (Bender et al., J. Virol. 61 (1987) 1639). Recombinant retroviral vectors are purified by conventional techniques known to those skilled in the art.

Retroviral vectors can be constructed that act as infectious particles or to undergo a single round of transfection. In the first case, the virus is modified to conserve all its genes, except those responsible for the oncogenic transformation properties and to express the heterologous gene. Non-infectious viral vectors are prepared to destroy the viral packaging signal, but retain the structural genes necessary to package the genetically modified co-introduced virus to contain the heterologous gene and the packaging signals. Therefore, the viral particles that are produced are not capable of producing additional viruses.

Non-viral Systems

Certain non-viral systems have been used in the art, and can facilitate the introduction of DNA encoding NFIF polypeptides, antisense nucleic acids, ribozymes and antibodies.

Management Systems Through Lipofection

A vector can be introduced in vivo by lipofection. Over the past decade, the use of liposomes for encapsulation and transfection of nucleic acids in vitro has been increasing. Synthetic cationic lipids designed to limit the difficulties and risks encountered with liposome-mediated transfection can be used to prepare liposomes for in vivo transfection of a gene encoding a marker (Felgner, et al., Proc. Natl. Acad. Sci. USA 84: 7413-7417 (1987); see Mackey, et al., Proc. Natl. Acad. Sci. USA 85: 8027-8031 (1988); Ulmer et al., Science 259: 1745-1748 (1993)) . The use of cationic lipids may favor encapsulation of negatively charged nucleic acids, and may also favor fusion with negatively charged cell membranes (Felgner and Ringold, Science 337: 387-388 (1989)). Particularly useful compounds and lipid compositions for transferring nucleic acids are described in International Patent Publications WO95 / 18863 and WO96 / 17823, and in US Patent No. 5,459,127. The use of lipofection to introduce exogenous genes into specific organisms in vivo has certain practical advantages. Targeted molecular transport of liposomes to specific cells represents an area of benefit. It is evident that directing the transfection to particular cell types would be particularly advantageous in a tissue with cellular heterogeneity, for example, pancreas, liver, kidney, and brain. Lipids can be chemically bound to other molecules for the purpose of directing them (see Mackey, et al.,

previously mentioned). Targeted peptides, eg, hormones or neurotransmitters, and proteins, for example, antibodies, or non-peptide molecules, could be chemically coupled to liposomes.

Other molecules are also useful for facilitating the transfection of a nucleic acid in vivo, such as a cationic oligopeptide (eg, International Patent Publication Document WO95 / 21931), peptides obtained from proteins that bind to DNA ( eg, International Patent Publication document WO96 / 25508), or a cationic polymer (eg, International Patent Publication document WO95 / 21931).

Naked DNA Management Systems

It is also possible to introduce the vector in vivo as a naked plasmid (see U.S. Patent Documents 5,693,622, 5,589,466 and 5,580,859). Naked DNA vectors for gene therapy can be introduced into the desired host cells by methods known in the art, e.g., transfection, electroporation, microinjection, transduction, cell fusion, DEAE dextran, precipitation with calcium phosphate, the use of a gene gun, or the use of a DNA vector transporter (see, eg, Wu et al., J. Biol. Chem, 267: 963-967 (1992); Wu and Wu, J. Biol. Chem ., 263: 14621-14624 (1988); Hartmut et al., Canadian Patent Application No. 2,012,311, filed March 15, 1990; Williams et al., Proc. Natl. Acad. Sci. USA, 88: 2726-2730 (1991)). Receptor-mediated DNA transport strategies can also be used (Curiel et al., Hum. Gene Ther., 3: 147-154 (1992); Wu and Wu, J. Biol. Chem., 262: 4429-4432 (1987 )).

Uses of NFIF Polypeptides

As mentioned earlier, in certain situations it is desirable to induce NFB to initiate or increase the range of an immune response. To induce NFB, the NFIF polypeptides of the present invention can be introduced into a patient's body by a variety of methods.

The methods used to introduce NFIF into a patient's body include the direct administration of purified NFIF polypeptides or the introduction of the nucleic acid encoding NFIF polypeptides into expression vectors expressing the polypeptides in the patient's body.

In embodiments that involve direct administration of NFIF polypeptides, NFIF polypeptides are prepared by the use of host cell expression systems such as those described above. The polypeptides are purified by the use of conventional purification methods, and then combined with a suitable biologically compatible solution as described in detail below. The solution containing the polypeptide is introduced into the patient topically, orally, parenterally, intranasally, subcutaneously or intraocularly. Once in the body, the polypeptide is capable of exerting its effect, by inducing NFB and therefore resulting in an increase in the activity of NFB regulated pathways, which include immune responses.

In embodiments that involve the administration of nucleic acids encoding NFIF polypeptides, viral or non-viral systems that use expression vectors capable of expressing NFIF polypeptides can be introduced into the patient's body. Any of the viral or non-viral transfection systems described above can be used. Viral and non-viral vector systems are also combined with a suitable biologically compatible solution to facilitate their introduction into the body. Once the viral or non-viral vector is introduced into the body, the nucleic acid encoding the NFIF polypeptide can be integrated into the host genome, which enables stable long-term expression of the NFIF polypeptides that exert their effect as described above. Transient expression can be provided by systems that introduce nucleic acid into cells, but that do not integrate it into the genome.

The NFIF-14b and NFIF-7a polypeptides contain signaling sequences, which indicate that these polypeptides are capable of expressing themselves in one cell while exerting their effect in another cell. Therefore, NFIF polypeptides can be expressed by cells that then release the NFIF polypeptide into the bloodstream or other transport system (lymph, etc.) where they are transported to the tissues in which they exert their effect on induction. of NFB.

The following discussion describes how to identify the compositions and methods to regulate the induction of NFB based on the current discovery of NFIF polypeptides.

Compositions

The present invention provides compositions in a biologically compatible (biocompatible) solution comprising the polypeptides, nucleic acids, and vectors of the invention. A biologically compatible solution is a solution in which the polypeptide, nucleic acid or vector of the invention is maintained in an active form, eg, in a form capable of carrying out a biological activity. For example, a polypeptide of the invention could have NFB activation or deactivation activity; an antibody (which is itself a polypeptide) could bind to a polypeptide of the invention; a nucleic acid would be able to replicate, translate to a message, or hybridize with a complementary nucleic acid; and a vector would be able to transfect a selected cell as a target. In general, such a biologically compatible solution will be an aqueous buffer, eg, a Tris, phosphate, or HEPES buffer, which contains saline ions. Normally, the concentration of saline ions will be similar to physiological levels. In a specific embodiment, the biocompatible solution is a pharmaceutically acceptable composition. Biologically compatible solutions may include stabilizing agents and preservatives.

Such compositions can be formulated for topical, oral, parenteral, intranasal, subcutaneous and intraocular administration. Parenteral administration is intended to include intravenous injection, intramuscular injection, intraarterial injection or infusion techniques. The composition can be administered parenterally in unit dosage formulations containing well known, nontoxic and physiologically acceptable conventional carriers, adjuvants and carriers as desired.

Preferred sterile injectable preparations may be a solution or suspension in a non-toxic parenterally acceptable solvent or diluent. Examples of pharmaceutically acceptable carriers are saline solution, buffered saline solution, isotonic saline solution (for example, monosodium or disodium phosphate, sodium chloride, potassium, calcium or magnesium, or mixtures of these salts), Ringer's solution, dextrose, water, sterile water, glycerol, ethanol and their combinations. Conveniently, 1,3-butanediol and sterile nonvolatile oils are used as solvents or suspending media. Any mild nonvolatile oil, including synthetic mono- or diglycerides, can be used. Fatty acids, such as oleic acid, can also be used in the preparation of injectables.

The medium of the composition may also be a hydrogel that is prepared from any biocompatible or non-cytotoxic (homo or hetero) polymer, such as a hydrophilic poly (acrylic acid) polymer that can act as an absorbent sponge for the drug. Such polymers have been described, for example, in WO93 / 08845. Some of them, such as, in particular, those obtained from ethylene oxide and / or propylene, are commercially available. A hydrogel can be deposited directly on the surface of the tissue to be treated, for example, during a surgical intervention.

Another preferred embodiment of the present invention relates to a pharmaceutical composition comprising a recombinant replication deficient virus and poloxamer. More specifically, the invention relates to a composition comprising a recombinant replication-deficient virus comprising a nucleic acid encoding an NFIF polypeptide and poloxamer. A preferred poloxamer is Poloxamer 407, which is commercially available (BASF, Parsippany, NJ) and is a non-toxic, biocompatible polyol, and is the most preferred. A poloxamer impregnated with recombinant viruses can be deposited directly on the surface of the tissue to be treated, for example during a surgical intervention. The poloxamer has basically the same advantages as a hydrogel, although it has a lower viscosity.

The present invention also relates to compositions useful in the manufacture of medicaments intended for the treatment of subjects affected by an inflammatory response regulated by NFH and compositions useful in the manufacture of medicaments intended to prevent subjects from being affected by an inflammatory response. regulated by NFB. Therefore, the present invention includes the use of an NFIF polypeptide according to the invention for the manufacture of a medicament intended for the treatment and / or prevention of an inflammatory response regulated by NFB. The present invention also includes the use of a nucleic acid according to the invention, which encodes an NFIF polypeptide, for the manufacture of a medicament for the treatment and / or prevention of an inflammatory response regulated by NFB. The present invention also includes the use of a recombinant vector according to the invention, comprising a nucleic acid encoding an NFIF polypeptide, for the manufacture of a medicament for the treatment and / or prevention of an inflammatory response regulated by NFB. The present invention also includes the use of a recombinant viral vector deficient according to the invention for the manufacture of a medicament for the treatment and / or the prevention of an inflammatory response regulated by NFB.

Also described herein is the use of compositions comprising genetically modified cells ex vivo with a recombinant virus and compositions comprising cells containing such recombinant viruses that are implanted in the body, and facilitate prolonged and effective in vivo expression of a NFIF polypeptide according to the invention.

NFIF-Based Therapeutic Compounds that Inhibit NFB Activation

As explained above, in certain situations, it is desirable to reduce or inhibit NFB regulated immune responses. By inhibiting the expression of the NFIF gene or interfering with the activity of the NFIF polypeptides, it is possible to inhibit the induction of NFB and therefore inhibit or prevent immune responses regulated by NFB that result in atherosclerosis and other diseases.

There is a variety of therapeutic compounds that can be used to inhibit the expression or activity of NFIF. These therapeutic compounds may be nucleic acids, polypeptides, peptides.

or small non-peptide molecules. In one embodiment, antisense nucleic acids are used to decrease the expression of the NFIF gene by inhibiting the processing (splicing) of the primary NFIF transcript. In another embodiment, ribozymes that can cleave the NFIF mRNA are used, which prevents the synthesis of NFIF. Polypeptides include antibodies or other binding proteins that bind to NFIF polypeptides and interfere with their ability to activate NF NB induction. In addition, compounds such as small molecule inhibitors that inhibit NFIF gene expression

or the activity of NFIF polypeptides can be identified in assays with reporter genes as described above, and administered to patients to inhibit the expression / activity of NFIF. The same methods described above are used to introduce the NFIF polypeptides and nucleic acids encoding the NFIF polypeptides into a patient's body to administer the various anti-NFIF compositions.

Nucleic Acids Antisense

Inhibition of gene expression through the use of antisense nucleic acids can be carried out at the translational or transcriptional level. Antisense nucleic acids are preferably fragments of nucleic acids capable of hybridizing specifically with all or part of a nucleic acid encoding NFIF or with the corresponding messenger RNA. In addition, antisense nucleic acids that decrease NFIF gene expression can be designed or identified by inhibiting splicing of its primary transcript. Knowing the structure and partial sequence of the NFIF gene, said antisense nucleic acids can be designed and their efficacy analyzed.

The antisense nucleic acids are preferably oligonucleotides, and may consist entirely of deoxyribonucleotides, modified deoxyribonucleotides, or a certain combination of both. The antisense nucleic acids can be synthetic oligonucleotides. The oligonucleotides can be chemically modified, if desired, to improve stability and / or selectivity. Because oligonucleotides are susceptible to degradation by intracellular nucleases, modifications may include, for example, the use of a sulfur group to replace free oxygen in the phosphodiester bond. This modification is called phosphorothioate binding. Phosphorothioate antisense oligonucleotides are water soluble, polyanionic and resistant to endogenous nucleases. In addition, when a phosphorothioate antisense oligonucleotide hybridizes with its selected target site, the double RNA-DNA molecule activates the endogenous ribonuclease enzyme (Rnase) H, which cleaves the mRNA component of the hybrid molecule.

In addition, antisense oligonucleotides can be synthesized with phosphoramidite and polyamide (peptide) bonds. These molecules should be very resistant to degradation by nucleases.

In addition, chemical groups can be added to the 2 'carbon of the remaining carbohydrate and the 5 (C-5) carbon of the pyrimidines to increase stability and facilitate the binding of the antisense oligonucleotide to its selected target site. Modifications may include 2'-deoxy, O-pentoxy, O-propoxy, Omethoxy, fluoro, methoxyethoxyphosphorothioates, modified bases, as well as other modifications known to those skilled in the art.

The antisense nucleic acids can also be DNA sequences whose expression in the cell produces RNA complementary to all or part of the NFIF mRNA. Antisense nucleic acids can be prepared by expressing all or part of a sequence selected from the group consisting of the sequence of Figure 3, in the opposite orientation, as described in EP 140308. Any sequence length is suitable. antisense for the practice of the invention, provided it is capable of inhibiting or blocking the expression of NFIF. Preferably, the antisense sequence is at least 20 nucleotides in length. The preparation and use of antisense nucleic acids, of DNA encoding antisense RNAs and the use of oligonucleotide and genetic antisense molecules is described in WO92 / 15680.

An approach to determine the optimal NFIF fragment to be used in an antisense nucleic acid treatment method involves preparing random fragments of NFIF cDNA by mechanical cutting, enzymatic treatment, and cloning of the fragment into any of the vector systems described herein. memory. Individual clones or mixtures of clones are used to infect NFIF-expressing cells, and effective antisense NFIF cDNA fragments are identified by monitoring NFIF expression at the RNA or protein level.

The retroviral, adeno-associated viral, and adenoviral vector systems discussed above herein can be used to introduce and express antisense nucleic acids in cells. Synthetic antisense oligonucleotides may be introduced in a variety of ways, including the methods discussed hereinbelow.

Ribozymes

Reductions in NFIF polypeptide levels can be achieved through the use of ribozymes. Ribozymes are catalytic RNA molecules (RNA enzymes) that have distinct catalytic and substrate binding domains. The substrate binding sequence combines the complementarity of nucleotides and possibly interactions other than hydrogen bonds with their target sequence. The catalytic portion cleaves the target RNA at a specific site. The substrate domain of a ribozyme can be modified to direct it towards a specific mRNA sequence. The ribozyme recognizes and then binds to an objective mRNA by pairing complementary bases. Once it has bound to the correct target site, the ribozyme acts enzymatically to cut the target mRNA. Excision of the NFIF mRNA by a ribozyme destroys its ability to direct the synthesis of the NFIF polypeptide. Once the ribozyme has cleaved its target sequence, it is released and can repeatedly bind and cleave other NFIF mRNAs.

Examples of ribozymes for use in the practice of the present invention include a variety of reasons, for example, a hammerhead motif, hairpin motif, a hepatitis delta virus, group I intron or an RNA motif of RnasaP (in association with an RNA guide sequence) or the Neurospora VS RNA motif. Hammerhead motifs have been described by Rossi et al., 1992, Aids Research and Human Retroviruses, 8, 183. Fork motifs have been described by Hampel and Tritz, 1989, Biochemistry, 28, 4929, and Hampel et al., 1990, Nucleic Acids Res., 18, 299. The reason for the hepatitis delta virus has been described by Perrotta and Been, 1992, Biochemistry, 31, 16, the reason for RnasaP has been described by Guerrier-Takada et al., 1983, Cell, 35, 849, the motive of the RNA ribozyme VS of Neurospora has been described by Collins (Saville and Collins, 1990, Cell, 61, 685696; Saville and Collins, 1991, Proc. Natl. Acad Sci. USA, 88, 8826-8830; Collins and Olive, 1993, Biochemistry, 32, 2795-2799), and the intron motif of Group I has been described by Cech et al., US Pat. No. 4,987,071.

An approach in the preparation of a ribozyme is to chemically synthesize an oligodeoxyribonucleotide with a catalytic domain of ribozyme (~ 20 nucleotides) flanked by sequences that hybridize with the NFIF mRNA selected as a target after transcription. The oligodeoxyribonucleotide is amplified using substrate binding sequences as primers. The amplification product is cloned into a eukaryotic expression vector.

Ribozymes that have a hammerhead or hairpin structure are easily prepared, since these catalytic RNA molecules can be expressed within cells from eukaryotic promoters (eg, Scanlon et al., 1991, Proc Natl. Acad. Sci. USA, 88, 10591-5; Kashani-Sabet et al., 1992, Antisense Res. Dev., 2, 3-15; Dropulic et al., 1992, J. Virol., 66, 1432-41; Weerasinghe et al., 1991, J. Virol., 65, 5531-4; Ojwang et al., 1992, Proc. Natl. Acad. Sci. USA, 89, 10802-6; Chen et al., 1992, Nucleic Acids Res., 20, 4581-9; Sarver et al., 1990, Science, 247, 12221225)). A ribozyme can be expressed in eukaryotic cells from the appropriate DNA vector. If desired, ribozyme activity can be increased by releasing the primary transcript by a second ribozyme (Ohkawa et al., 1992, Nucleic Acids Symp. Ser., 27, 15-6; Taira et al., 1991, Nucleic Acids Res., 19, 5125-30; Ventura et al., 1993, Nucleic Acids Res., 21, 3249-55).

In an approach to prepare ribozymes, ribozymes are expressed from transcription units inserted in DNA, RNA, or viral vectors. The transcription of ribozyme sequences is controlled from a promoter for a eukaryotic RNA polymerase I (pol I), RNA polymerase II (pol II), or RNA polymerase III (pol III). Transcripts of pol II or pol III promoters will be expressed at elevated levels in all cells; The levels of a given pol II promoter in a given cell type will depend on the regulatory sequences of nearby genes. Prokaryotic RNA polymerase promoters are also used, as long as the prokaryotic RNA polymerase enzyme is expressed in the appropriate cells (Elroy-Stein and Moss, 1990, Proc. Natl. Acad. Sci. USA, 87, 6743-7; Gao and Huang 1993, Nucleic Acids Res., 21, 2867-72; Lieber et al., 1993, Methods Enzymol., 217, 47-66; Zhou et al., 1990, Mol. Cell. Biol., 10, 4529 -37). It has been shown that ribozymes expressed from these promoters can function in mammalian cells (Kashani-Sabet et al., 1992, Antisense Res. Dev., 2, 3-15; Ojwang et al., 1992, Proc. Natl Acad. Sci. USA, 89, 10802-6; Chen et al., 1992 Nucleic Acids Res., 20, 4581-9; Yu et al., 1993, Proc. Natl. Acad. Sci. USA, 90, 6340 -4; L'Huillier et al., 1992, EMBO J., 11, 4411-8; Lisziewicz et al., 1993, Proc. Natl. Acad. Sci. USA, 90, 8000-4).

In one embodiment, a transcription unit that expresses a ribozyme that cleaves NFIF RNA into a plasmid DNA vector, a retroviral vector, an adenovirus DNA viral vector or an adeno-associated virus vector is inserted. The recombinant vectors are preferably DNA plasmids or adenoviral vectors. However, other vectors for mammalian cells that direct RNA expression can be used for this purpose. Vectors are administered in the form of recombinant viral particles. DNA can be administered alone or complexed with various vehicles. DNA, DNA / vehicle complexes, or recombinant virus particles are administered locally at the treatment site, as discussed below. Preferably, recombinant vectors capable of expressing ribozymes are administered locally as described below, and persist in the selected target cells. Once expressed, ribozymes cleave the selected NFIF mRNA as the target.

Ribozymes can be administered to a patient by a variety of methods. They can be added directly to target selected tissues, complexed with cationic lipids, packaged within liposomes, or selected target cells can be administered by other methods known in the art. Localized administration in the desired tissues can be performed by a catheter, an infusion pump or mesh, with or without the incorporation of ribozyme in the biopolymers, as discussed hereinbelow. Alternative routes of administration include, but are not limited to, intravenous injection, intramuscular injection, subcutaneous injection, aerosol inhalation, oral administration (in tablet or pill form), topical, systemic, ocular, intraperitoneal and / or intrathecal. More detailed descriptions of ribozyme administration are provided in Sullivan et al., PCT document WO94 / 02595 and Draper et al., PCT document WO93 / 23569.

Antibodies

Antibodies to the NFIF polypeptide are described herein. These antibodies can be monoclonal antibodies or polyclonal antibodies. Chimeric, single chain, and humanized antibodies are included, as well as Fab fragments and products of a Fab expression library, and Fv fragments and products of an Fv expression library.

Polyclonal antibodies to an antigenic fragment of an NFIF polypeptide can be prepared. Antibodies can also be generated towards the intact NFIF protein or polypeptide, or against a fragment, derivative or epitope of the protein or polypeptide. Antibodies can be obtained after administration of the protein, polypeptide, fragment, derivative or epitope to an animal, using the methods and procedures known in the art.

Monoclonal antibodies can be prepared using the method of Mishell, B. B., et al., Selected Methods In Cellular Immunology, (W.H. Freeman, ed.) San Francisco (1980). Briefly, a polypeptide of the present invention is used to immunize spleen cells of Balb / C mice. Immunized spleen cells fuse with myeloma cells. Fused cells that contain the characteristics of spleen and myeloma cells are isolated by culturing in HAT medium, a medium that destroys both native cells, but allows the fused products to survive and proliferate.

Monoclonal antibodies can be "humanized" to prevent the host from generating an immune response to the antibodies. A "humanized antibody" is one in which the complementarity determining regions (CDR) and / or other portions of the light and / or heavy variable domain structure come from a non-human immunoglobulin, and the rest of the portions of the molecule come from one or more human immunoglobulins. Humanized antibodies also include antibodies that are characterized by a humanized heavy chain associated with an unmodified donor or acceptor light chain or a chimeric light chain, or vice versa. The humanization of antibodies can be carried out by methods known in the art (see, eg GE Mark and EA Padlan, "Chapter 4. Humanization of Monoclonal Antibodies", The Handbook of Experimental Pharmacology, vol. 113, Springer- Verlag, New York, 1994). Transgenic animals can be used to express humanized antibodies.

The methods known in the art for the production of single chain antibodies can be adapted to produce single chain antibodies to the polypeptides and immunogenic proteins of the present invention.

In a preferred embodiment, an anti-NFIF antibody is used to bind and inhibit NFIF activity in a patient.

Anti-NFIF antibodies are also useful in assays to detect or quantify NFIF levels. In one embodiment, these trials provide a clinical diagnosis and an assessment of NFIF in various diseases, and a method to monitor the efficacy of the treatment. An example of an anti-NFIF antibody used to bind NFIF and identify its presence in tissues is provided in Example 5. These anti-NFIF antibodies can also be used to quantify NFIF in a tissue sample.

Treatment Methods

The present invention is useful in treatment methods comprising administering to an human or other animal an effective amount of a composition of the invention.

Effective amounts may vary, depending on the age, type and severity of the disorder to be treated, body weight, desired duration of treatment, route of administration and other parameters. The doctor or other qualified medical professional will determine the effective amounts. In most cases, dose levels can be adjusted, so that the desired levels of NFIF or other therapeutic compounds can be achieved and maintained.

The polypeptides according to the invention are generally administered in doses of about 0.01 mg / kg to about 100 mg / kg, more preferably about 0.1 mg / kg to about 50 mg / kg, and even more preferably around 1 mg / kg to about 10 mg / kg body weight per day.

Neutralizing antibodies can be administered in the form of a rapid injection only, they can be infused over time or they can be administered both in the form of a rapid injection and an infusion over time. Although the dose will vary based on the above parameters, and on the antibody binding capacity, a dose of 0.2 to 0.6 mg / kg may be administered in the form of a rapid injection followed by an infusion period of 2 to 12 hours. Alternatively, multiple rapid injections are administered every two days or every three days or every four days, as needed. The dose levels can be adjusted as determined by the NFIF levels and / or the NFB induction levels.

As discussed herein above, recombinant viruses can be used to introduce both the DNA encoding NFIF and subfragments of NFIF, as well as antisense nucleic acids. Recombinant viruses are formulated in general and administered as a dose between about 104 and about 1014 pfu. In the case of AAVs and adenovirus, doses of about 106 to about 1011 pfu are preferably used. The term pfu ("plaque forming unit") corresponds to the infectious power of a virion suspension, and is determined by infecting an appropriate cell culture and measuring the number of plaques formed. The techniques for determining the pfu title of a viral solution are well documented in the prior art.

Ribozymes can be administered in amounts ranging from about 5 to about 50 mg / kg / day in a pharmaceutically acceptable vehicle. The dose levels can be adjusted based on the measured therapeutic efficacy.

Appropriate levels of inhibitory or stimulatory molecules can be determined by qualified medical personnel through the use of the parameters discussed above.

Methods to Increase the Activity Level of the NFIF Polypeptide

Methods for increasing the expression or activity of the NFIF polypeptide include, but are not limited to, the administration of a composition comprising the NFIF polypeptide, the administration of a composition comprising an expression vector encoding the NFIF polypeptide, the administration of a A composition comprising a stimulatory molecule that stimulates the activity of the NFIF polypeptide and the administration of a stimulatory molecule that increases the expression of the NFIF gene.

Methods that use NFIF polypeptides

In one embodiment, the level of NFIF activity is increased by administration of a composition comprising the NFIF polypeptide. This composition can be administered in a convenient manner, such as orally, topically, intravenously, intraperitoneally, intramuscularly, subcutaneously, intranasally or intradermally. The composition can be administered directly or encapsulated (eg in a lipid system, in amino acid microspheres, or in globular dendrimers). The polypeptide may be bound, in certain cases, to another polymer such as serum albumin or polyvinyl pyrrolidone.

Methods that use vectors that express NFIF

In another embodiment, the level of NFIF is increased by the use of gene therapy, that is, by the administration of a composition comprising a nucleic acid that encodes and directs the expression of the NFIF polypeptide. In this embodiment, the NFIF polypeptide is cloned into an appropriate expression vector. Possible vector systems and promoters were discussed extensively above. The expression vector is transferred to the selected target tissue through the use of one of the administration systems with vectors discussed above. This transfer is carried out ex vivo in a procedure in which the nucleic acid is transferred to the cells in the laboratory and the modified cells are then administered to the human or other animal, or in vivo in a procedure in which the acid Nucleic is transferred directly to human or other animal cells. In preferred embodiments, an adenoviral vector system is used to administer the expression vector. If desired, a tissue specific promoter is used in the expression vector as described above.

Non-viral vectors can be transferred to cells by using any of the methods known in the art, including coprecipitation with calcium phosphate, lipofection (synthetic anionic and cationic liposomes), receptor-mediated gene administration, DNA injection. naked, electroporation and biobalistics or particle acceleration.

Methods that use a Stimulatory Molecule that Stimulates NFIF Activity

In another embodiment, the activity of NFIF is stimulated by stimulating molecules that increase the activity of NFIF or increase its proper recognition by cellular binding sites. These stimulatory molecules can be introduced by the same methods discussed above for the administration of the polypeptides.

Methods that use a Stimulatory Molecule that Increases NFIF Gene Expression

In another embodiment, the level of NFIF is increased through the use of low molecular weight compounds, which can stimulate the expression of NFIF at the level of transcription, translation, or post-translation. These compounds can be administered by the same methods discussed above for the administration of the polypeptides.

Methods to Treat or Prevent an Inflammatory Response Regulated by NFB

Treatment methods in which the present invention is useful include the treatment or prevention of NFB-regulated inflammatory responses that include, but are not limited to, rheumatoid arthritis, atherosclerosis, autoimmune diseases, viral diseases, NSAID-induced gastropathy, diseases neurodegenerative, scrapie, septicemia, apoptosis, Crohn's disease, kidney disease, restenosis, brain injury / inflammation, Alzheimer's disease, asthma, and inadequately regulated expression of pleiotropic cytokines.

These methods include, but are not limited to, the administration of a composition comprising an antisense nucleic acid, the administration of a composition comprising an intracellular binding protein such as an antibody, the administration of an inhibitory molecule that inhibits NFIF activity, for example, a composition comprising an expression vector encoding a subfragment of NFIF or a low molecular weight molecule, which includes the administration of a low molecular weight compound that inhibits the expression of NFIF at the level of transcription, translation or post-translation, the administration of a ribozyme that cleaves the mRNA encoding NFIF, the administration of a medicament manufactured by the use of an NFIF polypeptide, the administration of a medicament manufactured by the use of a nucleic acid encoding an NFIF polypeptide, the administration of a medicament manufactured by using a recombinant vector It includes a nucleic acid encoding an NFIF polypeptide and the administration of a medicament manufactured by the use of a deficient recombinant viral vector that includes a nucleic acid encoding an NFIF polypeptide.

Methods to Decrease NFIF Polypeptide Activity Levels

Methods for decreasing the expression of the NFIF polypeptide to decrease the induction of NFB include, but are not limited to, the administration of a composition comprising an antisense nucleic acid, the administration of a composition comprising an intracellular binding protein such as a antibody, the administration of an inhibitory molecule that inhibits NFIF activity, for example, a composition comprising an expression vector encoding an NFIF subfragment or a low molecular weight molecule, which includes the administration of a low weight compound molecular that inhibits the expression of NFIF at the level of transcription, translation

or post-translation, and the administration of a ribozyme that cleaves the mRNA encoding NFIF.

Methods that use Nucleic Acids Antisense

In one embodiment, a composition comprising an antisense nucleic acid is used to inhibit or block the expression of NFIF. In a preferred embodiment, the nucleic acid encodes antisense RNA molecules. In this embodiment, the nucleic acid is operably linked to signals that allow the expression of the nucleic acid sequence and is introduced into a cell by using, preferably, recombinant vector constructs, which will express the antisense nucleic acid once The vector is introduced into the cell. Examples of suitable vectors include plasmids, adenoviruses, adeno-associated viruses, retroviruses, and herpes viruses. Preferably, the vector is an adenovirus. Most preferably, the vector is a replication deficient adenovirus comprising a deletion in the E1 and / or E3 regions of the virus.

In another embodiment, the antisense nucleic acid is synthesized and can be chemically modified to resist degradation by intracellular nucleases, as discussed above. Synthetic antisense oligonucleotides can be introduced into a cell through the use of liposomes. Cellular uptake occurs when an antisense oligonucleotide is encapsulated within a liposome. With an efficient administration system, low non-toxic concentrations of the antisense molecule can be used to inhibit translation of the selected mRNA as a target. In addition, liposomes that are conjugated to specific cell binding sites direct the antisense oligonucleotide into a particular tissue.

Methods that Use Neutralizing Antibodies and Other Binding Proteins

In another embodiment, the expression of NFIF is inhibited or blocked by the expression of a nucleic acid sequence encoding an intracellular binding protein that is capable of selectively interacting with NFIF. WO 94/29446 and WO 94/02610 describe cellular transfection with genes encoding an intracellular binding protein. An intracellular binding protein includes any protein capable of interacting, or binding, selectively with NFIF in the cell in which it is expressed, and neutralizing the function of the bound NFIF. Preferably, the intracellular binding protein is a neutralizing antibody or a fragment of a neutralizing antibody. More preferably, the intracellular binding protein is a single chain antibody.

WO 94/02610 describes the preparation of antibodies and the identification of the nucleic acid encoding a particular antibody. By using NFIF or a fragment thereof, a specific monoclonal antibody is prepared by methods known to those skilled in the art. A vector is subsequently prepared comprising the nucleic acid encoding an intracellular binding protein, or a portion thereof, and which is capable of being expressed in a host cell for use in the method described herein.

Alternatively, the activity of NFIF can be blocked by the administration of a neutralizing antibody in the circulation. Such neutralizing antibody can be administered directly in the form of a protein, or it can be expressed from a vector (with a secretory signal).

Methods that Use an Inhibitory Molecule that Prevents Expression of the NFIF Gene

In another embodiment, the inhibitory molecules, which include low molecular weight compounds, are capable of inhibiting the expression of NFIF at the level of transcription, translation or post-translation. To identify such inhibitory molecules, the indicator gene systems described above can be used. These inhibitor molecules can be combined with a pharmaceutically acceptable carrier and administered by the use of conventional methods known in the art.

Methods that use Ribozymes

Ribozymes can be administered to cells by encapsulation in liposomes, by iontophoresis, by incorporation into hydrogels, cyclodextrins, biodegradable nanocapsules, and bioadhesive microspheres or by any of a variety of other methods discussed above. Ribozyme can be administered to a selected target tissue by direct injection or by using a catheter, infusion pump or mesh. Alternative routes of administration include intravenous injection, intramuscular injection, subcutaneous injection, aerosol inhalation, oral administration (in the form of tablets or pills), topical, systemic, ocular, intraperitoneal and / or intrathecal.

In preferred embodiments, it is cloned into a sequence encoding a ribozyme in a DNA expression vector. The transcription of the ribozyme sequence is controlled from a promoter of RNA polymerase II (pol II), or eukaryotic RNA polymerase III (pol III). The expression vector can be incorporated into a variety of vectors that include viral DNA vectors such as adenovirus or adeno-associated virus vectors discussed above.

In a preferred embodiment of the invention, a transcription unit expressing a ribozyme that cleaves NFIF RNA into an adenovirus DNA viral vector is inserted. The vector is administered in the form of recombinant viral particles, and is administered locally at the treatment site, through the use of an infusion catheter, mesh or pump.

Examples

Example 1 - Method for Cloning NFIF-14b and NFIF-7a

To isolate the DNA encoding NFIF-14b and NFIF-7a, a cDNA library was prepared from total vascular human smooth muscle cell (SMC) RNA by using a Clontech Marathon ™ cDNA library synthesis kit. . The cDNA synthesis team also includes a human placenta DNA control library. The libraries are linear and amplifiable by PCR.

The NFIF-14b and NFIF-7a genes were obtained by PCR carried out with the human vascular SMC and human placenta cDNA libraries of Marathon.

To carry out the PCR reactions, standard PCR components [10X buffer of Perkin Elmer and Taq Gold polymerase] were used, and the reaction was carried out as follows. The reaction mixtures were heated at 94 ° C for 10 minutes, then subjected to thermal cycles 10 times with a denaturation stage of 94 ° C for 30 seconds, a renaturation stage of 65 ° C for 30 seconds, and an extension stage of 72 ° C for 1 ,5 minutes. After these ten cycles, the reaction was subjected to thermal cycles 30 times with a denaturation stage of 94 ° C for 30 seconds, a renaturation stage of 46 ° C for 30 seconds, and an extension stage of 72 ° C for 1.5 minutes. After these 30 cycles, the reactions were incubated at 72 ° C for 7 minutes and stored at 4 ° C. The PCR reactions were carried out in a Perkin Elmer 9600 thermal cycler.

The PCR product of each PCR was ligated into pCR2.1 (Invitrogen) and transformed into DH5α-E. coli The clones were chosen and grown in 5 ml of LB-amp; the plasmids were then isolated and digested with EcoRI to check the size of the insert released. Five clones of fifteen provided bands of a size of 1.2-1.3 Kb, indicative of the selected target gene, and were sequenced.

The alleged NFIF clones were identified based on an open reading frame, and sequence alignment of the sequence with respect to a predicted 5 'sequence. Clones No. 14b and 7a were chosen for subsequent characterization.

Large plasmid preparations were cultured from the original glycerol reserves of clone 7 and 14, and isolated by using a Qiagen MaxiPrep kit.

Example 2 - Subcloning of clone 7a and 14b into a eukaryotic expression vector

Clones 14b and 7a were subsequently subcloned into the pcDNA3.1mychis plasmid vector available from Invitrogen. This expression vector includes a strong promoter for high level expression in mammalian cells, and a selectable marker to generate stable cell lines. A C-terminal position fusion tag in the vector offers a polyhistidine sequence for rapid purification and an myc epitope for convenient detection with an anti-myc antibody.

PCR reactions were carried out using the PCR primers.

5'hasm - 5'-tccaccatggcgctggtgcgcgcactc-3 '(SEQ ID NO .: 6) and

fushasm3 '- 3'-ctggatatcgtaattgtgctttatataaagctg-5' (SEQ ID NO .: 7) and construction pCR2.1 for each full-size clone as a mold. The PCR conditions by using 475 pg of pCR2.1 clone 7a or 500 pg of pCR2.1 clone 14b were as follows: the reaction mixtures were heated at 95 ° C for 10 minutes, then subjected to thermal cycles 30 times with a denaturation stage of 95 ° C for 30 seconds, a renaturation stage of 52 ° C for 30 seconds, and then an extension stage of 72 ° C for 1.5 minutes. After these 30 cycles, the reactions were incubated at 72 ° C for 7 minutes, and stored at 4 ° C.

The PCR product was ligated into pCR2.1 and the DNA insert was sequenced using a Big Dye Terminator Cycle Sequencing Ready Reaction device and an ABI Prism 377 DNA sequencer from Perkin Elmer Applied Biosystems. Sequencing demonstrated that the PCR primer removed the natural stop codon (TAG) and introduced an EcoRV site.

The positive constructs of NFIF-14b and -7a were digested with EcoRI and EcoRV and subcloned into pcDNA3.1 mychis (Invitrogen) cut with EcoRI and EcoRV. This resulted in the myc tag being fused to the 3 'end of the NFIF cDNAs. These constructions were called pcDNA3.1mychasm7a and pcDNA3.1hasm14bmyc.

Example 3 - Preparation of NFTF Deletion Variants

Deletion mutants of NFIF-14b and NFIF-7a were prepared by PCR reactions using the plasmids pcDNA3.1mychasm7a and pcDNA3.1hasm14bmyc described above. Two groups of PCR primers were used to prepare the deletion mutants:

hasm313mut + hasm3'mut:

5 'gctccaccatgatatggacaggggatag 3' (SEQ ID NO .: 8)

5 'gccactgtgctggatatcgtaattaac 3' (SEQ ID NO .: 9)

hasm396mut + hasm3'mut:

5 'gctccaccatgacaaccaccatccagagtc 3' (SEQ ID NO .: 10)

5 'gccactgtgctggatatcgtaattaac 3' (SEQ ID NO .: 9)

The hasm313 + hasm3'mut primer pair produced an identical sequence of the cDNAs of the full-size clones of 14b or 7a, but in an open reading frame initiated in the 3 'direction on pb 313 (ATG). (The numbering is from the ATG of the full size clone). The Kozak consensus sequence was included in the direct primer to optimize translation.

The hasm396 + hasm3'mut primer pair produced an identical sequence of full-size cDNAs but in an open reading frame initiated in the 3 'direction on bp 394 (ATG).

The PCR products were ligated into pCR2.1 and the DNA insert was sequenced. Each deletion mutant was cut with EcoRI / EcoRV and subcloned into pcDNA3.1mychis cut with EcoRI and EcoRV. Deletion clones of NFIF-14b with the correct sequence were called pcDNAmychis 14-313 and pcDNAmychis 14-396. Deletion clones of NFIF-7a with the correct sequence were called pcDNAmychis 7-313, and pcDNAmychis 7-396.

The analysis of the above clones through the use of in vitro transcription / translation incorporating [35S methionine] in the reaction [TnT Quick Coupled Transcription Translation of Promega # L1170] produced bands of the expected sizes (NFIF 14b = 51 kDa; NFIF 14 -313 = 40 kDa; NFIF 14-396 = 37 kDa; NFIF 7a = 41 kDa; NFIF 7-313 = 30 kDa; and NFIF 7-396 = 27 kDa) for shortened open reading frames. The ease of translation was important to determine before studying functional activity and to determine which domains were important for the activity.

Example 4 - Method for transfecting cells with NFIF-14b or NFIF-7a to produce stable cell lines containing plasmids

To prepare stable cell lines containing NFIF-14b, NFIF-7a and deletion mutants, 6-well 2 x 105 HEK293 or COS-7 cells, seeded NFIF cDNA constructs, seeded PCDNAmychis7, pcDNAmychis7-313 , pcDNAmychis7-396; pcDNAmychis14, pcDNAmychis14-313, pcDNAmychis14-396 (0.8 ug) together with the Stratagene vector pNFB-Luc indicator gene (0.1 ug) and the Clontech EGFP vector (0.1 ug), were transfected by using 6 ul of Lipofectamine and 200 ul of Optimem in the 6-well plates (with 800 ul of recent Optimem / well). The transfection was incubated for 4 hr at 37 ° C and then the plates were filled with complete medium (3 ml).

At 24, 48 and 72 hours after transfection, lysates were made using 200 ul of a 1X Indicator Lysis Buffer solution (E397A-Promega). The lysates were incubated for 20 minutes on ice, vortexed, then centrifuged at 12,000 rpm for 5 minutes. He

Supernatant was used to determine luciferase activity following the instructions of the pNFB-Stratagene luc indicator gene team.

To prepare stable cell lines, duplicates of the previous 48 hr cultures were divided into a 1: 100 ratio in complete culture media together with G418 for the selection of the cells that incorporated the plasmids into their DNA. Clones were isolated from a single cell and transferred to 48-well culture plates for cultivation. The clones were chosen according to their activity in the NFB luciferase indicator assay.

Luciferase activity of cell lysates of all transiently infected cell lines was measured. 20 µl of lysate was added to a white 96-well round bottom plate Serocluster by Costar (No. 3789). 100 µl of luciferase reagent (Promega E1501) was added directly before reading the sample in a Walko Jet 1450 Microbeta reader.

The analysis of the results at 24 hours, 48 hours, 72 hours identified that 48 hours was the most optimal time to determine the activity. The positive control for the trial was a 24-hour tumor necrosis factor (α) (TNFα) stimulation of the cells one day posttransfection with the pcDNA3.1mychis vector. In HEK293 cells, transient transfections with full-size pcDNAmychis 7, pcDNAmychis14 cDNAs demonstrated a luminometer count per second at ~ 3.1 times and ~ 2.1 times respectively, above the vector alone (Figure 5) and In COS-7 cells (Figure 6) the full-size clone pcDNAmychis 7 provided a 2.4-fold signal and the pcDNAmychis14 2.3 times higher in the luminometer count per second above the vector alone.

Deletion mutants (pcDNAmychis 7-313, pcDNAmychis 7-396, pcDNAmychis 14-313 and pcDNAmychis 14-396) showed reduced activity. The tests carried out on alternate days by using the 48-hour interval provided variability in responses, ranging from an increase of 2-5 times for clone 7 (full size) and 2-4 times for clone 14.

Example 5 - Identification of Tissues that Express or Contain NFIF Proteins

To determine which human tissues express the NFIF proteins, a prefabricated Northern blot of Clontech (Human 12 Lane # 7780-1) was analyzed with p32 labeled probes made with random primers prepared from NFIF. The results can be seen in Figure 8. As Figure 8 illustrates, the expression of NFIF is evident in particular in skeletal muscle, kidney, liver and placental tissue.

To determine if the NFIF protein was associated with pathologies that include atherosclerosis that involve inflammation, and to identify the tissues that can be treated by using the methods described herein, an immunocytochemical study was carried out by using a rabbit monoclonal antibody called 99-06 directed against a peptide antigen (SKGANASNPGPFGDV) (SEQ ID NO .: 5) derived from residues 65 to 79 of the NFIF protein. The peptide was synthesized on a 0.25 mmol scale using the solid phase methodology with a protection scheme with FMOC (9-fluorenylmethyloxycarbonyl) together with activation chemistry using HOBT / HBTU (Fields et al., Peptide Research, 4: 95-101 (1991)). An Applied Biosystems 433 peptide synthesizer was used that worked with an Applied Biosystems Fast-Moc coupling cycle for peptide synthesis.

The peptide was cleaved for 1.5 hours at room temperature by using an 82.5% trifluoroacetic acid (TFA) cleavage reagent, 5% phenol, 5% H2O, 5% thioanisole, and 2 , 5% ethanedithiol (King et al., Intl. J. Peptide and Protein Research, 36, 255-266 (1990)). After cleavage, the peptide was precipitated with tert-butyl ether; washed, then dried for 1 hour under vacuum. The peptide was then solubilized in 0.1% TFA / water and purified by the use of C18 reverse phase HPLC. A level of purity of> 95% was reached for the peptide, together with correct molecular weight data by MALDI-TOF.

10-30 mg of purified peptide was conjugated to California limpet hemocyanin using 1-ethyl-3- (3-dimethylaminopropyl) carbodiimide (EDC). The preparation was extensively dialyzed with PBS at 4 ° C. The hapten / carrier preparation was mixed 1: 1 with Freund's complete adjuvant and used to inject it into rabbits for the production of antisera against the peptide. The 15 residue peptide was used to prepare anti-NFIF antibodies in rabbits by the use of customary methods known in the art. Rabbits were immunized by subcutaneous injection with a Freund complete antigen / adjuvant emulsion (50% antigen solution / 50% Freund complete adjuvant). Freund's complete adjuvant (CFA) was used for initial immunization because this adjuvant has been used very successfully in the production of antibody responses to a wide variety of protein and peptide antigens, and the incidence of adverse reactions is minimal. or nonexistent The injection schedule described below has been optimized for use with Freund's adjuvant. The injection area was shaved to allow visual estimation of any reaction to the emulsion. Prior to injection, the injection sites were cleaned with a diluted Nolvasan cleaning solution. The injection sites were in the back, starting between the shoulder blades. The injection sites were widely separated and kept close to the midline to reduce the possibility of the animal scratching at the injection sites. In general, 100 µl containing 20 µg of antigen were injected into 5 subcutaneous sites per rabbit for a total of 100 µg / rabbit. Subsequently, booster injections were administered at 4-week intervals with an incomplete Freund's adjuvant antigen / adjuvant emulsion. After six weeks, 530 mls of blood was collected to determine the antibody titer. If antibody titer was not sufficient, additional booster injections were given at weekly intervals and blood samples were collected every 2-4 weeks. Before each antigen injection, the state of the previous injection sites was studied for adverse reactions. Animals that gave a positive antibody response were maintained and reinforced, and blood was taken periodically to generate a large pool of antisera.

Antibody titration experiments were carried out with the 99-06 antibody to establish the concentrations that produced a minimum background signal and maximum signal detection. A serial dilution study showed that the highest signal to noise ratio was at a dilution of 1: 500 and 1: 1,000, and the slides incubated with these antibody concentrations were analyzed by pathologists. The 99-06 antibody was used as the primary antibody, and the main detection system consisted of a Vector ABC-AP device (AK5002) with a Vector Red substrate kit that produced a red-fuchsia deposit (SK-5100). The tissues were also stained with a positive control antibody (CD31) directed against the human leukocyte antigen (Stockinger et al., J. Immunol., 145 (11): 3889-97 (1990)) to ensure that tissue antigens They were preserved and were accessible for immunocytochemical analysis. In addition to coronary artery samples, additional tissues that were stained and underwent imaging during phase II of this study were normal spleen, thymus, and lymph node. Staining was carried out in the spleen, thymus and lymph nodes to help identify inflammatory subgroups of cells expressing this protein.

Within the spleen, thymus and lymph nodes, antibody 99-06 showed intense positive staining within the lymphocytes of the periarterial lymph sheath, Billroth cord, thymic lymphocytes, germ center cells of the lymph node, and within the endothelium vascular and smooth muscle. Other cell types that stained moderately to intensively with this antibody included Schwann cells and cardiomyocytes. The signal was predominantly nuclear in the cell types examined, except for the cytoplasmic granularity that was observed within the smooth muscle cells, and in the macrophages that were filled with cell debris in regions of plaques or thrombi in formation.

Within normal coronary arteries, the antibody was largely negative in the endothelium of the intimate tunic except for occasional cells that showed a nuclear signal, and myo-intimate smooth muscle cells that showed weak nuclear signals. Within the middle tunic, the antibody was moderately positive evenly within the smooth muscle cells. In the adventitia, the endothelium, vascular smooth muscle and inflammatory cells were moderately positive for staining. The internal and external elastic sheets were negative for staining.

Within the minimum atherosclerosis samples, the endothelium showed only occasional weak signals even in those that covered the atheroma. Within the superficial atheroma, myointimal smooth muscle cells showed only weak signals. In the deepest regions of atheroma, proliferating fibroblast forms and foamy macrophages showed an increased level of staining. In certain samples that showed plaques containing cholesterol and areas of calcification, smooth muscle cells and foamy histiocytes surrounding the plates loaded with cholesterol and calcified material showed increased levels of staining.

5

10

fifteen

twenty

25

30

In the samples of moderate atherosclerosis, the endothelium, both in the intimate tunic and in the areas of neovascularization, showed an increased staining with the 99-06 antibody. Marginalized inflammatory cells along or underlying the endothelium were intensely positive for staining. The endothelium that covered the new vessels was moderately to intensely positive for staining, and in certain areas, subendothelial myofibroblasts were less positive than the associated endothelium. In general, the fibroblastic forms of myointimal cells were much less positive than the proliferating or histiocytic forms of smooth muscle cells. In addition, macrophages associated with cholesterol, calcification, or foamy macrophages within the plates showed an increased level of staining. The smooth muscle of the middle tunic was moderately positive fairly uniformly within all the samples in which the medium was intact, and the smooth muscle within the adventitious vessels was similarly positive.

In cases of severe atherosclerosis, much of the endothelium that covered the intimate tunic was bare, or the residual endothelium was weakly to moderately positive for staining. The inflammatory infiltrate associated with plaques showed a very strong positive staining within macrophages and lymphocytes, which included the regions of neovascularization. An increased staining was also observed within macrophages and adjacent lymphocytes or surrounding calcifications and cholesterol and within the areas of thrombi in formation. The endothelium that covered the new vessels was intensely positive in these areas. Again an increased signal intensity was observed within the histiocytic and proliferating forms compared to the fibroblastic forms of smooth muscle cells. In these cases, inflammatory cells such as a subset of lymphocytes, plasma cells and macrophages within the adventitia were also intensely positive for staining.

In areas at a late stage of severe atherosclerosis with minimal inflammation and inactive plaques, there was much less staining. In these samples, the endothelium was less intensively positive for staining, although the residual lymphocytes and macrophages surrounding the calcified material showed positive staining.

Useful Biological Material in the Practice of the Invention

A deposit of human NFB inducing factor 7a (NFIF-7a) was cloned from a cDNA library of human vascular smooth muscle cells subcloned into a plasmid vector pCR2.1, and a deposit of NF inducing factor B human 14b (NFIF-146) cloned from a cDNA library of human vascular smooth muscle cells subcloned into a pCR2.1 plasmid vector in the American Type Culture Collection, 10801 University Boulevard, Manassas, Virginia 20110-2209, such as follows.

Strain / plasmid

 ATCC No. Deposit date

Inductor factor of human NfB 14B

cloned from a cDNA library

of vascular smooth muscle cells

Human subcloned in the vector pCR2.1:

NFIF14B

PTA-1596 March 29, 2000

Human NfB inducing factor 7A cloned from a cDNA library of human vascular smooth muscle cells subcloned into the vector pCR2.1: NFIF7A PTA-1597 March 29, 2000

SEQUENCE LIST

<110> Aventis Pharmaceuticals Inc

<120> FACTOR INDUCTOR FACTOR B

<130> 40/604 / P / EP

<140> 01920925.3 (PCT / US01 / 10719)

<141> 03-31-2000

<160> 10

<170> PatentIn Ver. 2.0

<210> 1

<211> 453

<212> PRT

<213> Homo sapiens

<400> 1

image 1

35

image 1

36

image 1

<210> 2

<211> 364

<212> PRT

<213> Homo sapiens

<400> 2

image 1

37

image 1

38

image 1

<210> 3

<211> 1362

<212> DNA

<213> Homo sapiens

<400> 3

image 1

39

image 1

<210> 4

<211> 1095

<212> DNA

<213> Homo sapiens

<400> 4

image 1

40

image 1

<210> 5

<211> 15

<212> PRT

<213> Homo sapiens

<400> 5

image 1

<210> 6

<211> 27

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of the Artificial Sequence: Based on NFIF-14b and NFIF-7a but with the Kozak sequence 5 'to ATG

<400> 6 tccaccatgg cgctggtgcg cgcactc 27

<210> 7

<211> 33

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of the Artificial Sequence: Based on NFIF-14b and NFIF-7a but with an ECORV site added at the end

<400> 7 gtcgaaatat atttcgtgtt aatgctatag gtc 33

<210> 8

<211> 28

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of the Artificial Sequence: Based on NFIF-14b and NFIF-7a but with the Kozak sequence 5 'to ATG

<400> 8 gctccaccat gatatggaca ggggatag 28

<210> 9

41

<211> 27

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of Artificial Sequence: Based on NFIF-14b and NFIF-7a but with an ECORV site added at the end

<400> 9 gccactgtgc tggatatcgt aattaac 27

<210> 10

<211> 30

<212> DNA

<213> Artificial Sequence

<220>

<223> Description of the Artificial Sequence: Based on NFIF-14b and NFIF-7a but with the Kozak sequence 5 'to ATG

<400> 10 gctccaccat gacaaccacc atccagagtc 30

42

Claims (32)

one.

A nucleic acid encoding the NFIF polypeptide (nuclear factor inducing factor) -14b comprising an amino acid sequence of SEQ ID NO: 1.

2.

A nucleic acid encoding the NFIF polypeptide (nuclear factor inducing factor) -7a comprising an amino acid sequence of SEQ ID NO: 2.

3.

The nucleic acid of claim 1, wherein said nucleic acid is a cDNA.

Four.

The nucleic acid of claim 2, wherein said nucleic acid is a cDNA.

5.

An isolated and purified NFIF (nuclear factor inducing factor) -14b polypeptide that induces NFB and comprising an amino acid sequence of SEQ ID NO: 1.

6.

An isolated and purified NFIF (nuclear factor inducing factor) -7a polypeptide that induces NFB and comprising an amino acid sequence of SEQ ID NO: 2.

7.

An expression vector comprising a nucleic acid of claim 1 operably linked to a control sequence.

8.

The expression vector of claim 7, wherein said expression vector is selected from the group consisting of retroviral vectors, adenoviral vectors, adeno-associated virus vectors, herpesvirus vectors, and naked DNA vectors.

9.

An expression vector comprising a nucleic acid of claim 2 operably linked to a control sequence.

10.

The expression vector of claim 9, wherein said expression vector is selected from the group consisting of retroviral vectors, adenoviral vectors, adeno-associated virus vectors, herpesvirus vectors, and naked DNA vectors.

eleven.

A composition comprising an NFIF polypeptide (nuclear factor inducing factor) -14b in which said polypeptide induces NFB and comprises an amino acid sequence of SEQ ID NO: 1 and a pharmaceutically acceptable carrier.

12.

A composition comprising an NFIF polypeptide (nuclear factor inducing factor) -7a in which said polypeptide induces NFB and comprises an amino acid sequence of SEQ ID NO: 2 and a pharmaceutically acceptable carrier.

13.

A composition comprising an antisense nucleic acid complementary to a nucleic acid encoding an NFIF polypeptide (nuclear factor inducing factor) -14b and / or NFIF-7a selected from the group consisting of SEQ ID NO: 1 and 2.

14.

A composition comprising a neutralizing antibody that binds to the NFIF polypeptide (nuclear factor inducing factor) -14b and / or NFIF-7a selected from the group consisting of SEQ ID NO: 1 and 2 and that decreases its activity.

fifteen.

A composition comprising a ribozyme that cuts the RNA encoding an NFIF polypeptide (nuclear factor inducing factor) -14b and / or NFIF-7a selected from the group consisting of SEQ ID NO: 1 and 2.

16.

A method for determining whether a test compound is effective in inhibiting the activity of NFIF (nuclear factor inducing factor) -14b based on the expression of an NFKB-regulated indicator gene comprising:

43

(TO)

 comparing the expression level of the NFB regulated gene in a first sample comprising: (1) an amino acid sequence comprising SEQ ID NO: 1; (2) said indicator gene regulated by NFB; and (3) said test compound with the level of expression of the NFB-regulated indicator gene in a second sample comprising (4) an amino acid sequence comprising SEQ ID NO: 1; and (5) said indicator gene regulated by NFB; Y

(B)

 determining whether the expression of said indicator gene regulated by NFB is lower in said first sample with respect to said second sample.

17. A method for determining whether a test compound is effective in inhibiting the activity of NFIF (nuclear factor inducing factor) -7a based on the expression of an NFB regulated reporter gene comprising:

(TO)

 comparing the expression level of the NFB regulated gene in a first sample comprising: (1) an amino acid sequence comprising SEQ ID NO: 2; (2) said indicator gene regulated by NFB; and (3) said test compound with the expression level of the NF genB-regulated indicator gene in a second sample comprising: (4) an amino acid sequence comprising SEQ ID NO: 2; and (5) said indicator gene regulated by NFB; Y

(B)

 determining whether the expression of said indicator gene regulated by NFB is lower in said first sample with respect to said second sample.

18. A method for identifying whether a test compound can stimulate the activity of NFIF (nuclear factor inducing factor) -14b based on the expression of an NFB-regulated indicator gene comprising:

(TO)

 comparing the expression level of the NFB regulated gene in a first sample comprising (1) an amino acid sequence comprising SEQ ID NO: 1; (2) said indicator gene regulated by NFB; and (3) said test compound with the level of expression of the NFB-regulated indicator gene in a second sample comprising: (4) an amino acid sequence comprising SEQ ID NO: 1; and (5) said indicator gene regulated by NFB; Y

(B)

 determining whether the expression of said indicator gene regulated by NFB is greater in said first sample with respect to said second sample.

19. A method for identifying compounds that stimulate the activity of NFIF (nuclear factor inducing factor) -7a based on the expression of an NFB-regulated indicator gene comprising:

(TO)

 comparing the expression level of the NFB regulated gene in a first sample comprising: (1) an amino acid sequence comprising SEQ ID NO: 2; (2) said indicator gene regulated by NFB; and (3) said test compound with the expression level of the NF genB-regulated indicator gene in a second sample comprising: (4) an amino acid sequence comprising SEQ ID NO: 2; and (5) said indicator gene regulated by NFB; Y

(B)

 determining whether the expression of said indicator gene regulated by NFB is greater in said first sample with respect to said second sample.

twenty.

The use of an isolated NFIF polypeptide (nuclear factor inducing factor) comprising an amino acid sequence of SEQ ID NO: 1 for the manufacture of a medicament intended for the treatment and / or prevention of an inflammatory response regulated by NFB.

twenty-one.

The use of a nucleic acid encoding an NFIF polypeptide (nuclear factor inducing factor) comprising an amino acid sequence of SEQ ID NO: 1 for the manufacture of a medicament intended for the treatment and / or prevention of an inflammatory response regulated by NFB.

22

The use of a recombinant vector comprising a nucleic acid encoding an NFIF polypeptide (nuclear factor inducing factor) comprising a sequence

44 of amino acids of SEQ ID NO: 1 for the manufacture of a medicament intended for the treatment and / or prevention of an inflammatory response regulated by NFB.

2. 3.

The use of a deficient recombinant viral vector comprising a nucleic acid encoding an NFIF polypeptide (nuclear factor inducing factor) comprising an amino acid sequence of SEQ ID NO: 1 for the manufacture of a medicament intended for treatment and / or prevention of an inflammatory response regulated by NFB.

24.

The use of an isolated NFIF polypeptide (nuclear factor inducing factor) comprising an amino acid sequence of SEQ ID NO: 2 for the manufacture of a medicament intended for the treatment and / or prevention of an inflammatory response regulated by NFB.

25.

The use of a nucleic acid encoding an NFIF polypeptide (nuclear factor inducing factor) comprising an amino acid sequence of SEQ ID NO: 2 for the manufacture of a medicament intended for the treatment and / or prevention of an inflammatory response regulated by NFB.

26.

The use of a recombinant vector comprising a nucleic acid encoding an NFIF polypeptide (nuclear factor inducing factor) comprising an amino acid sequence of SEQ ID NO: 2 for the manufacture of a medicament intended for the treatment and / or prevention of an inflammatory response regulated by NFB.

27.

The use of a deficient recombinant viral vector comprising a nucleic acid encoding an NFIF polypeptide (nuclear factor inducing factor) comprising an amino acid sequence of SEQ ID NO: 2 for the manufacture of a medicament intended for treatment and / or prevention of an inflammatory response regulated by NFB.

28. A cultured cell comprising the vector of claim 8 or 10.

29.

A cultured cell transfected with the vector of claim 8 or 10, wherein the cell expresses said polypeptide comprising an amino acid sequence of SEQ ID NO: 1 or 2.

30

A pharmaceutical composition comprising a therapeutically effective amount of an isolated expressible nucleic acid sequence encoding an amino acid sequence of SEQ ID NO: 1 or 2, and a pharmaceutically acceptable carrier.

31.

A pharmaceutical composition comprising a therapeutically effective amount of a recombinant vector comprising an expressible nucleic acid sequence encoding an amino acid sequence of SEQ ID NO: 1 or 2, and a pharmaceutically acceptable carrier.

32

A pharmaceutical composition comprising a therapeutically effective amount of a deficient recombinant viral vector comprising an expressible nucleic acid sequence encoding an amino acid sequence of SEQ ID NO: 1 or 2, and a pharmaceutically acceptable carrier.