ES2351674T3 - MODIFIED BICYCLIC NUCLEIC ACID ANALOGUES IN POSITION 6. - Google Patents

Abstract

A bicyclic nucleoside having the formula: Bx is a heterocyclic alkaline radical; T1 is H or a hydroxyl protecting group; T2 is H, a hydroxyl protecting group or a reactive phosphorous group; Z is C1-C6 alkyl, C1-C6 alkenyl, C1-C6 alkynyl, substituted C1-C6 alkyl, substituted C2-C6 alkenyl, substituted C2-C6 alkynyl, acyl, substituted acyl, substituted amide, thiol or substituted thio; and where each of the substituted groups is independently mono or polysubstituted with optionally protected substituent groups independently selected from halogen, oxo, hydroxyl, OJ1, NJ1J2, SJ1, N3, OC (= X) J1, OC (= X) NJ1J2, NJ3C (= X) NJ1J2 and CN, where each of J1, J2, and J3 is independently H or C1-C6 alkyl, and X is O, S, or NJ1, where the reactive phosphorus group is a phosphoramidite, H -phosphonate, phosphate triester or a chiral phosphorus-containing auxiliary.

Description

CROSS REFERENCE TO RELATED REQUESTS

This application claims the priority benefits of the Provisional Application of the States

5 United States No. 60 / 762,722, filed January 27, 2006 and entitled, "Substituted Bicyclic Nucleic Acid Analog" and United States Provisional Application No. 60 / 805,660, filed June 23, 2006 and entitled, " 6-Substituted Bicyclic Nucleic Acid Analogs ".

10

FIELD OF THE INVENTION

The present invention provides 6-modified bicyclic nucleosides and oligomeric compounds and compositions prepared therefrom. More specifically, the present invention provides nucleosides having a 2'-O-C (H) (R) -4 'bridge and oligomers and compositions prepared therefrom. In a preferred embodiment, R is in a configuration

20 that provides the (R) or (S) isomer. In some embodiments, the oligomeric compounds and compositions of the present invention hybridize to a portion of a target RNA resulting in loss of normal function of the target RNA.

25

BACKGROUND OF THE INVENTION

Antisense technology is an effective means of reducing the expression of one or more specific gene products and therefore can be shown to be useful only in some therapeutic, diagnostic, and research applications. Chemically modified nucleosides are routinely used for incorporation into antisense sequences to enhance one or more properties such as, for example, resistance to

nucleases. One such group of chemical modifications includes bicyclic nucleosides where the furanose portion of the nucleoside includes a bridge connecting two atoms of the furanose ring thereby forming a bicyclic ring system. Such bicyclic nucleosides have various names including BNA and LNA for bicyclic nucleic acids or blocked nucleic acids respectively.

Some BNAs have been prepared and reported in the patent literature as well as in the scientific literature, see for example: Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. U. S. A., 2000, 97, 633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8.2219-2222; Wengel et al., PCT International Application WO 98-DK393 19980914; Singh et al., J. Org. Chem., 1998, 63, 10035-10039, the text of each being incorporated by reference herein, in its entirety. Examples of filed United States patents and published applications include for example: United States Patent Nos. 7,053,207, 6,770,748, 6,268,490 and 6,794,499 and United States Published Applications Nos. 20040219565, 20040014959, 20030207841, 20040192918, 20030224377, 20040143114 and 20030082807.

Many LNAs are toxic. See, p. eg, Swayze, E. E .; Siwkowski, A. M .; Wancewicz, E. V .; Migawa, M. T .; Wyrzykiewicz, T. K .; Hung, G .; Monia, B. P .; Bennett, C.

F. Antisense oligonucleotides containing locked nucleic acid improve potency but cause significant hepatotoxicity in animals. Nucl. Acids Res., Doi: 10,1093 / nar / gkl1071 (Dec. 2006, advanced online publication).

Consequently, a long-felt need persists for agents that specifically regulate gene expression via antisense mechanisms. Described herein are 6-substituted BNAs and antisense compounds prepared therein useful for modulating gene expression pathways, including those that depend on mechanisms of action such as RNaseH, RNAi, and dhRNA enzymes, as well as other antisense-based mechanisms. in degradation of the target or occupation of the target. One skilled in the art, once equipped with this disclosure, will be able, without undue experimentation, to identify, prepare, and exploit antisense compounds for these uses.

BRIEF SUMMARY OF THE INVENTION

The present invention provides a bicyclic nucleoside having the formula:

where: Bx is a heterocyclic alkaline radical; T1 is H or a hydroxyl protecting group; T2 is H, a hydroxyl protecting group or a reactive phosphorus group as defined in claim 1; Z is C1-C6 alkyl, C1-C6 alkenyl, C1-C6 alkynyl, substituted C1-C6 alkyl, substituted C2-C6 alkenyl, substituted C2-C6 alkynyl, acyl, substituted acyl,

or substituted amide.

In one embodiment, each of the substituted groups is independently mono or polysubstituted with optionally protected substituent groups independently selected from halogen, oxo, hydroxyl, OJ1, NJ1J2, SJ1, N3, OC (= X) J1, OC (= X) NJ1J2, NJ3C (= X) NJ1J2 and CN, where each of J1, J2 and J3 is independently H or C1-C6 alkyl, and X is O, S

or NJ1,

In one embodiment, each of the substituted groups is independently mono or polysubstituted with substituent groups independently selected from halogen, oxo, hydroxyl, OJ1, NJ1J2, SJ1, N3, OC (= X) J1, and NJ3C (= X ) NJ1J2, where J1, J2, and J3 are each independently H, C1-C6 alkyl, or substituted C1-C6 alkyl and X is O or NJ1,

In one embodiment, Z is C1-C6 alkyl or substituted C1-C6 alkyl. In another embodiment, Z is C1-C6 alkyl. In another embodiment, Z is methyl (CH3-). In another embodiment, Z is ethyl (CH3CH2-). In another embodiment, Z is substituted C1-C6 alkyl. In another embodiment, Z is substituted methyl. In another embodiment, Z is substituted ethyl.

In one embodiment, the substituent group is C1-C6 alkoxy (eg, Z is C1-C6 alkyl substituted with one or more C1-C6 alkoxy). In another embodiment, the C1-C6 alkoxy substituent group is CH3O- (eg, Z is CH3OCH2-). In another embodiment, the C1-C6 alkoxy substituent group may be further substituted such as N (J1J2) CH2O- (eg, Z is N (J1J2) CH2OCH2-). In another embodiment, the substituent group is halogen (eg, Z is C1-C6 alkyl substituted with one or more halogens). In another embodiment, the halogen substituent group is fluoro (eg, Z is CH2FCH2-, CHF2CH2-, or CF3CH2-). In another embodiment, the substituent group is hydroxyl (eg, Z is C1C6 alkyl substituted with one or more hydroxyl). In another embodiment, Z is HOCH2-. In another embodiment, Z is CH3-,

CH3CH2-, -CH2OCH3, -CH2F or HOOCH2-.

In one embodiment, the group Z is C1-C6 alkyl substituted with one or more Xx, where each of Xx is independently OJ1, NJ1J2, SJ1, N3, OC (= X) J1, OC (= X) NJ1J2, NJ3C (= X) NJ1J2 or CN; where J1, J2, and J3 are each independently H or C1-C6 alkyl, and X is O, S

or NI1, In another embodiment, the group Z is C1-C6 alkyl substituted with one or more Xx, where each of Xx is independently halo (eg, fluoro), hydroxyl,

15 alkoxy (eg CH3O-), substituted alkoxy or azido.

In one embodiment, the group Z is -CH2Xx, where Xx is OJ1, NJ1J2, SJ1, N3, OC (= X) J1, OC (= X) NJ1J2, NJ3C (= X) NJ1J2 or CN; where each of J1, J2, and J3 is, independently,

H or C1-C6 alkyl, and X is O, S, or NJ1, In another embodiment, the group Z is -CH2Xx, where Xx is halo (eg, fluorine), hydroxyl, alkoxy (eg, CH3O-) or azido.

In one embodiment, group Z is in the 25 (R) configuration:

In another embodiment, group Z is in configuration (S):

In one embodiment, each of T1 and T2 is a hydroxyl protecting group. A preferred list of hydroxyl protecting groups includes benzyl, benzoyl, 2,6-dichlorobenzyl, t-butyldimethylsilyl, t-butyldiphenylsilyl, mesylate, tosylate, dimethoxytrityl (DMT), 9-phenylxanthin-9-yl (Pixyl) and 9- (p-methoxyphenyl) -9-yl (MOX). In one embodiment T1 is

A hydroxyl protecting group selected from acetyl, benzyl, t-butyldimethylsilyl, t-butyldiphenylsilyl and dimethoxytrityl where a more preferred hydroxyl protecting group is T1 is 4,4'-dimethoxytrityl.

In one embodiment, T2 is a reactive phosphorus group where preferred reactive phosphorus groups include diisopropylcyanoethoxyphosphoramidite and H-phosphonate. In a preferred embodiment T1 is 4,4'-dimethoxytrityl and T2 is

Diisopropylcyanoethoxy-phosphoramidite.

The present invention also provides oligomeric compounds having at least one monomer of the formula:

25

or of formula: where Bx is a heterocyclic alkaline radical; T3 is H, a hydroxyl protecting group, a connected conjugated group, or an internucleoside connecting group attached to a nucleoside, a nucleotide, an oligonucleoside, an oligonucleotide, a monomeric subunit, or an oligomeric compound; T4 is H, a hydroxyl protecting group, a connected conjugated group, or an internucleoside connecting group attached to a nucleoside, a nucleotide, an oligonucleoside, an oligonucleotide, a monomeric subunit, or an oligomeric compound; wherein at least one of T3 and T4 is an internucleoside linking group attached to a nucleoside, a nucleotide, an oligonucleoside, an oligonucleotide, a monomeric subunit, or an oligomeric compound; and Z is C1-C6 alkyl, C1-C6 alkenyl, C1-C6 alkynyl, substituted C1-C6 alkyl, substituted C2-C6 alkenyl, substituted C2-C6 alkynyl, acyl, substituted acyl, or substituted amide.

In one embodiment, each of the substituted groups is independently mono or polysubstituted with optionally protected substituent groups independently selected from halogen, oxo, hydroxyl, OJ1, NJ1J2, SJ1, N3, OC (= X) J1, OC (= X) NJ1J2, NJ3C (= X) NJ1J2 and CN, where each of J1, J2 and J3 is independently H or C1-C6 alkyl, and X is O, S

or NJ1,

In one embodiment, each of the substituted groups is independently mono or polysubstituted with substituent groups independently selected from halogen, oxo, hydroxyl, OJ1, NJ1J2, SJ1, N3, OC (= X) J1, and NJ3C (= X ) NJ1J2, where J1, J2, and J3 are each independently H or C1-C6 alkyl, and X is O or NJ1,

In one embodiment, at least one Z is C1-C6 alkyl or substituted C1-C6 alkyl. In another embodiment, each Z is, independently, C1-C6 alkyl or substituted C1-C6 alkyl. In another embodiment, at least one Z is C1-C6 alkyl. In another embodiment, each Z is independently C1-C6 alkyl. In another embodiment, at least one Z is methyl. In another embodiment, each Z is methyl. In another embodiment, at least one Z is ethyl. In another embodiment, each Z is ethyl. In another embodiment, at least one Z is substituted C1-C6 alkyl. In another embodiment, each Z is, independently, substituted C1-C6 alkyl. In another embodiment, at least one Z is substituted methyl. In another embodiment, each Z is substituted methyl. In another embodiment, at least one Z is substituted ethyl. In another embodiment, each Z is substituted ethyl.

In one embodiment, at least one substituent group is C1-C6 alkoxy (eg, at least one Z is C1-C6 alkyl substituted with one or more C1-C6 alkoxy). In another embodiment, each substituent group is independently C1-C6 alkoxy (eg, each Z is independently C1-C6 alkyl substituted with one or more C1-C6 alkoxy).

In one embodiment, at least one C1-C6 alkoxy substituent group is CH3O- (eg, at least one Z is CH3OCH2-). In another embodiment, each C1-C6 alkoxy substituent group

is CH3O- (eg, each Z is CH3OCH2-).

In one embodiment, at least one substituent group is halogen (eg, at least one Z is C1-C6 alkyl substituted with one or more halogen). In another embodiment, each substituent group is independently halogen.

(p.

g., each Z is, independently, C1-C6 alkyl substituted with one or more halogen). In another embodiment, at least one halogen substituent group is fluoro (eg, at least one Z is CH2FCH2-, CHF2CH2-, or CF3CH2-). In another embodiment, each halo substituent group is fluoro (eg, each Z is, independently, CH2FCH2-, CHF2CH2-, or CF3CH2-).

In one embodiment, at least one substituent group is hydroxyl (eg, at least one Z is C1-C6 alkyl substituted with one or more hydroxyl). In another embodiment, each substituent group is, independently, hydroxyl.

(p.

g., each Z is, independently, C1-C6 alkyl substituted with one or more hydroxyl). In another embodiment, at least one Z is HOCH2-. In another embodiment, each Z is HOCH2-.

In one embodiment, at least one Z is CH3-, CH3CH2-, CH2OCH3-, CH2F-, or HOCH2-. In another embodiment, each Z is, independently, CH3-, CH3CH2-, CH2OCH3-, CH2F-, or HOCH2-.

In one embodiment, at least one group Z is C1-C6 alkyl substituted with one or more Xx, where each of Xx is, independently, OJ1, NJ1J2, SJ1, N3, OC (= X) J1, OC (= X) NJ1J2, NJ3C (= X) NJ1J2 or CN; where J1, J2, and J3 are each independently H or C1-C6 alkyl, and X is O, S

or NJ1, In another embodiment, at least one group Z is C1-C6 alkyl substituted with one or more Xx, where each of Xx is independently halo (eg, fluorine), hydroxyl, alkoxy (eg ., CH3O-) or azido.

In one embodiment, each Z group is independently C1-C6 alkyl substituted with one or more Xx, where each of Xx is independently OJ1, NJ1J2, SJ1, N3, OC (= X) J1, OC (= X) NJ1J2 , NJ3C (= X) NJ1J2 or CN; where J1, J2, and J3 are each independently H or C1-C6 alkyl, and X is O, S, or NJ1, In another embodiment, each Z group is, independently, C1-C6 alkyl substituted with one or more Xx , where each of Xx is independently halo (eg, fluorine), hydroxyl, alkoxy (eg, CH3O-), or azido.

In one embodiment, at least one Z group is -CH2Xx, where Xx is OJ1, NJ1J2, SJ1, N3, OC (= X) J1, OC (= X) NJ1J2, NJ3C (= X) NJ1J2 or CN; where J1, J2, and J3 are each independently H or C1-C6 alkyl, and X is O, S, or NJ1, In another embodiment, at least one group Z is -CH2Xx, where Xx is halo (e.g. ., fluorine), hydroxyl, alkoxy (eg CH3O-) or azido.

In one embodiment, each Z group is independently -CH2Xx, where each of Xx is independently OJ1, NJ1J2, SJ1, N3, OC (= X) J1, OC (= X) NJ1J2, NJ3C (= X) NJ1J2 or CN; where J1, J2, and J3 are each independently H or C1-C6 alkyl, and X is O, S

or NJ1, In another embodiment, each Z group is independently -CH2Xx, where each of Xx is independently halo (eg, fluorine), hydroxyl, alkoxy (eg, CH3O-), or azido .

In one embodiment, at least one Z is CH3-. In another embodiment, each Z is, CH3-.

In one embodiment, the Z group of at least one monomer is in the (R) configuration represented by the formula:

or the formula:

In another embodiment, the Z group of each monomer of the formula is in the (R) configuration.

In one embodiment, the Z group of at least one monomer is in the (S) configuration represented by the formula:

or the formula:

In another embodiment, the Z group of each monomer of formula is in the (S) configuration.

In one embodiment, T3 is H or a hydroxyl protecting group. In another embodiment T4 is H or a hydroxyl protecting group. In a further embodiment T3 is an internucleoside linking group attached to a

5 nucleoside, a nucleotide or a monomeric subunit. In another embodiment T4 is an internucleoside linking group attached to a nucleoside, nucleotide, or monomeric subunit. In another embodiment T3 is an internucleoside linking group attached to a

10 oligonucleoside or an oligonucleotide. In a further embodiment T4 is an internucleoside linking group attached to an oligonucleoside or an oligonucleotide. In one embodiment T3 is an internucleoside linking group attached to an oligomeric compound. In one embodiment

Additional T4 is an internucleoside linking group attached to an oligomeric compound. In a new embodiment at least one of T3 and T4 comprises an internucleoside linking group selected from phosphodiester or phosphorothioate.

In one embodiment, the oligomeric compounds have at least one region of at least two contiguous monomers of the formula:

25

or formula:

In another embodiment, the oligomeric compound

it comprises at least two regions of at least two contiguous monomers of the above formula. In a further embodiment the oligomeric compound comprises an oligomeric compound with spaces. In another embodiment the oligomeric compound comprises at least a region of about 8 to about 14 contiguous βD-2'-deoxyribofuranosyl nucleosides. In a further embodiment the oligomeric compound comprises at least a region of about 9 to about 12 contiguous β-D-2'-deoxyribofuranosyl nucleosides.

In one embodiment, the oligomeric compound comprises at least a region of 2 to three contiguous monomers of the formula above, an optional second region of 1 or 2 contiguous monomers of the formula above, and a third region of 8 to 14 nucleosides of βD-2 '-deoxyribofuranosyl where the third region is located between the first and second regions. In another embodiment the oligomeric compound comprises 8 to 10 β-D-2'-deoxyribofuranosyl nucleosides.

In another embodiment of the present invention, oligomeric compounds are provided that are from about 8 to about 40 nucleosides and / or modified nucleosides or mimetics in length. In a further embodiment the oligomeric compound comprises from about 8 to about 20 nucleosides and / or modified nucleosides or mimetics in length. In a new embodiment the oligomeric compounds comprise from about 10 to about 16 nucleosides and / or modified nucleosides or mimetics in length. In another embodiment the oligomeric compounds comprise from about 10 to about 14 nucleosides and / or modified nucleosides or mimetics in length.

Compounds are also provided for use in methods of inhibiting gene expression which comprise contacting one or more cells, a tissue, or an animal with an oligomeric compound of the invention.

DETAILED DESCRIPTION OF THE INVENTION

The present invention provides 6-modified bicyclic nucleosides, oligomeric compounds and compositions prepared therefrom, novel synthetic intermediates, and methods for preparing novel nucleosides, oligomeric compounds, compositions, and synthetic intermediates. More specifically, the present invention provides nucleosides bridging the 4 'and 2' positions of the ribose portion having the formula: 2'-OC (H) (Z) -4 'and oligomers and compositions prepared therefrom. In a preferred embodiment, Z is in a particular configuration that provides the (R) isomer or the (S) isomer. In some embodiments, the oligomeric compounds and compositions of the present invention are designed to hybridize to a portion of a target RNA. In another embodiment, the oligomeric compounds of the present invention can be used in the design of aptamers that are oligomeric compounds capable of binding aberrant proteins in an in vivo setting.

The bicyclic nucleosides of the present invention are useful in enhancing the desired properties of the oligomeric compounds into which they are incorporated. The oligomers of the present invention can also be useful as primers and probes in diagnostic applications. In a preferred embodiment the 6-modified bicyclic nucleosides of the present invention have the structure shown below:

In one aspect the present invention provides bicyclic nucleosides having formula I:

5

where: Bx is a heterocyclic alkaline radical; T1 is H or a hydroxyl protecting group; T2 is H, a hydroxyl protecting group or a group

10 reactive phosphorus; and Z is C1-C6 alkyl, C1-C6 alkenyl, C1-C6 alkynyl, C1-C6 alkylidenyl, C3-C6 alkylidenyl, substituted C1C6 alkyl, substituted C2-C6 alkenyl, substituted C2-C6 alkynyl, substituted C1-C6 alkylidenyl,

C3-C6 substituted alkylidenyl, acyl, substituted acyl, substituted amide, thiol, or substituted thio.

In one embodiment, each of the groups

20 substituted, is independently mono or polysubstituted with optionally protected substituent groups independently selected from halogen, oxo, hydroxyl, OJ1, NJ1J2, SJ1, N3, OC (= X) 1, OC (= X) NJ1J2, NJ3C (= X ) NJ1J2 and CN, where each of J1, J2 and

J3 is independently H or C1-C6 alkyl, and X is O, S

or NJ1,

In one aspect of the present invention bicyclic nucleosides are prepared having orthogonally protected reactive groups and additionally comprising a reactive phosphorus group. Such bicyclic nucleosides are useful as monomers for the synthesis of oligomers.

An illustrative example of such a bicyclic nucleoside monomer has the formula:

where the groups surrounded by the rectangles of lines

5 dashed are variable. The group of position 6 can also be prepared in S configuration (note that the designations R and S may vary depending on the groups of variable positions). Bicyclic nucleoside monomer shown is generically referenced

10 as dimethoxytrityl phosphoramidite or more formally using the IUPAC naming nomenclature as (1S, 3R, 4R, 6R, 7S) -7- [2-cyanoethoxy (diisopropylamino) phosphinoxy] -1- (4,4'-dimethoxytrityloxymethyl) -3- (uracil-1yl) -6-methyl-2,5-dioxa-bicyclo [2,2,1] heptane.

The 6-position modified bicyclic nucleosides of the present invention are useful for otherwise modifying unmodified oligomeric compounds at one or more positions. Such compounds

Modified oligomerics can be described as having a particular motif. The motifs susceptible to the present invention include but are not limited to an interrupted motif, a hemimeric motif, a blocameric motif, a completely modified motif, a modified motif

25 positionally and an alternating motif. A wide variety of linkages can be used in conjunction with these motifs including but not limited to phosphodiester and phosphorothioate linkages used uniformly or in combination. The positioning of modified bicyclic nucleosides at position 6 and the use of binding strategies can easily be optimized for the best activity for a particular target. Representative United States patents illustrating the preparation of representative motifs include, but are not limited to, 5,013,830; 5,149,797; 5,220,007; 5,256,775; 5,366,878; 5,403,711; 5,491,133; 5,565,350; 5,623,065; 5,052,355; 5,652,356; and 5,700,922, some of which are owned by the present application. The reasons are also described in International Applications PCT / US2005 / 019219, filed June 2, 2005 and published as WO 2005/121371 on December 22, 2005 and PCT / US2005 / 01920, filed June 2, 2005 and published as WO 2005/121372 on December 22, 2005.

The terms "stable compound" and "stable structure" are intended to indicate a compound that is sufficiently robust to overcome isolation to a useful degree of purity in a reaction mixture, and its formulation into an effective therapeutic agent. Only stable compounds are contemplated herein.

The selected substituent within the compounds described herein is present to a recursive degree. In this context, "recursive substituent" means that a substituent can list another example of itself. Due to the recursive nature of such substituents, theoretically, a large number may be present in any given claim. One of ordinary skill in the art of medical chemistry and organic chemistry understands that the total number of such substituents is reasonably limited by the desired properties of the intended compound. Such properties include, by way of example and not limitation, physical properties such as molecular weight, volubility, or log P, application properties such as activity against the intended target, and practical properties such as ease of synthesis.

Recursive substituents are an intended aspect of the invention. One of ordinary skill in the art of medical and organic chemistry understands the versatility of such substituents. To the extent that recursive substituents are present in a claim of the invention, the total number will be determined as shown above.

The term "alkyl" as used herein refers to a saturated straight or branched hydrocarbon radical containing up to twenty-four carbon atoms. Examples of alkyl groups include, but are not limited to, methyl, ethyl, propyl, butyl, isopropyl, n-hexyl, octyl, decyl, dodecyl, and the like. Alkyl groups typically include 1 to about 24 carbon atoms, more typically 1 to about 12 carbon atoms (C1-C12 alkyl) with 1 to about 6 carbon atoms being more preferred. The term "lower alkyl" as used herein includes from 1 to about 6 carbon atoms. Alkyl groups as used herein can optionally include one or more additional substituent groups.

The term "alkenyl" as used herein refers to a straight or branched hydrocarbon chain radical containing up to twenty-four carbon atoms and having at least one carbon-carbon double bond. Examples of alkenyl groups include, but are not limited to, ethenyl, propenyl, butenyl, 1-methyl-2-buten-1-yl, dienes such as 1,3-butadiene, and the like. Alkenyl groups typically include 2 to about 24 carbon atoms, more typically 2 to about 12 carbon atoms with 2 to about 6 carbon atoms more preferred. Alkenyl groups as used herein can optionally include one or more additional substituent groups.

The term "alkynyl" as used herein refers to a straight or branched hydrocarbon radical containing up to twenty-four carbon atoms and having at least one carbon-carbon triple bond. Examples of alkynyl groups include, but are not limited to, ethynyl, 1-propynyl, 1-butynyl, and the like. Alkynyl groups typically include 2 to about 24 carbon atoms, more typically 2 to about 12 carbon atoms with 2 to about 6 carbon atoms more preferred. Alkynyl groups as used herein may optionally include one or more additional substituent groups.

The term "aminoalkyl" as used herein refers to an amino substituted alkyl radical. This term is intended to include C1-C12 alkyl groups that have an amino substituent at any position and where the alkyl group joins the aminoalkyl group to the parent molecule. The alkyl and / or amino portions of the aminoalkyl group may be further substituted with substituent groups.

The term "aliphatic" as used herein refers to a linear or branched hydrocarbon radical containing up to twenty-four carbon atoms where the saturation between any two carbon atoms is a single, double, or triple bond. An aliphatic group preferably contains 1 to about 24 carbon atoms, more typically 1 to about 12 carbon atoms with 1 to about 6 carbon atoms more preferred. The straight or branched chain of an aliphatic group can be interrupted by one or more heteroatoms including nitrogen, oxygen, sulfur, and phosphorus. Such heteroatom-interrupted aliphatic groups include without limitation polyalkoxy groups, such as polyalkylene glycols, polyamines, and polyimines. Aliphatic groups as used herein can optionally include additional substituent groups.

The term "alicyclic" or "alicyclyl" refers to a cyclic ring system where the ring is aliphatic. The ring system can comprise one or more rings where at least one ring is aliphatic. Preferred alicyclic groups include rings having from about 5 to about 9 ring carbon atoms. Alicyclic as used herein can optionally include additional substituent groups.

The term "alkoxy" as used herein refers to a radical formed between an alkyl group and an oxygen atom where the oxygen atom is used to attach the alkoxy group to a parent molecule. Examples of alkoxy groups include, but are not limited to, methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, sec-butoxy, tert-butoxy, n-pentoxy, neopentoxy, n-hexoxy, and the like. Alkoxy groups as used herein can optionally include additional substituent groups.

The terms "halo" and "halogen", as used herein, refer to an atom selected from fluorine, chlorine, bromine and iodine.

The terms "aryl" and "aromatic", as used herein, refer to radicals of mono- or polycyclic carbocyclic ring systems having one or more aromatic rings. Examples of aryl groups include, but are not limited to, phenyl, naphthyl, tetrahydronaphthyl, indanyl, idenyl, and the like. Preferred aryl ring systems have from about 5 to about 20 carbon atoms in one or more rings. Aryl groups as used herein can optionally include additional substituent groups.

The terms "aralkyl" and "arylalkyl" as used herein refer to a radical formed between an alkyl group and an aryl group where the alkyl group is used to attach the aralkyl group to the parent molecule. Examples include, but are not limited to, benzyl, phenethyl, and the like. Aralkyl groups as used herein may optionally include additional substituent groups attached to the alkyl, aryl, or both groups that form the radical group.

The term "heterocyclic radical" as used herein refers to a mono-, or poly-cyclic ring system radical that includes at least one heteroatom and is unsaturated, partially saturated, or fully saturated, thereby including groups. heteroaryl. Heterocyclic is also intended to include fused ring systems where one or more of the fused rings contain at least one heteroatom and the other rings may contain one or more heteroatoms or optionally contain no heteroatoms. A heterocyclic group typically includes at least one atom selected from sulfur, nitrogen, or oxygen. Examples of heterocyclic groups include, [1,3] dioxolane, pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, and the like. Heterocyclic groups as used herein can optionally include additional substituent groups.

The terms "heteroaryl", and "heteroaromatic", as used herein, refer to a radical comprising a mono- or polycyclic aromatic ring system, or fused ring system where at least one of the rings it is aromatic and includes one or more heteroatoms. Heteroaryl is also intended to include fused ring systems including systems where one or more of the fused rings do not contain heteroatoms. Heteroaryl groups typically include a ring atom selected from sulfur, nitrogen, or oxygen. Examples of heteroaryl groups include, but are not limited to, pyridinyl, pyrazinyl, pyrimidinyl, pyrrolyl, pyrazolyl, imidazolyl, thiazolyl, oxazolyl, isoxazolyl, thiadiazolyl, oxadiazolyl, thiophenyl, furanyl, quinolinyl, isoquinolinyl, benzoximidazolyl, benzoinolinyl, benzoalinxazolyl, and the like. Heteroaryl radicals can be attached to the parent molecule directly or through a connecting radical such as an aliphatic or heteroatom group. Heteroaryl groups as used herein can optionally include additional substituent groups.

The term "heteroarylalkyl", as used herein, refers to a heteroaryl group as previously defined that has an alkyl radical that can link the heteroarylalkyl group to a parent molecule. Examples include, but are not limited to, pyridinylmethyl, pyrimidinylethyl, naphthyridinylpropyl, and the like. Heteroarylalkyl groups as used herein may optionally include additional substituent groups on one or both of the heteroaryl moieties.

or alkyl.

The term "mono- or poly-cyclic structure" as used in the present invention includes all ring systems that are single or polycyclic that have rings that are fused or linked and is intended to be inclusive of individually selected single and mixed ring systems. among aliphatic, alicyclic, aryl, heteroaryl, aralkyl, arylalkyl, heterocyclic, heteroaryl, heteroaromatic, heteroarylalkyl. Such mono and polycyclic structures can contain rings that are uniform or have varying degrees of saturation including fully saturated, partially saturated, or fully unsaturated. Each ring can comprise ring atoms selected from C, N, O and S to give rise to heterocyclic rings as well as rings comprising only ring C atoms that can be present in a mixed motif such as for example benzimidazole where a ring has only atoms ring carbon and the fused ring has two nitrogen atoms. Mono or polycyclic structures can be further substituted with substituent groups such as for example phthamimide having two = O groups attached to one of the rings. In another aspect, mono- or polycyclic structures can be attached to a parent molecule directly through a ring atom, through a substituent group or a bifunctional connecting moiety.

The term "acyl" as used herein refers to a radical formed by removing a hydroxyl group from an organic acid and has the general formula -C (O) -X where X is typically aliphatic, alicyclic, or aromatic. Examples include aliphatic carbonyls, aromatic carbonyls, aliphatic sulfonyls, aromatic sulfinyls, aliphatic sulfinyls, aromatic phosphates, aliphatic phosphates, and the like. Acyl groups as used herein can optionally include additional substituent groups.

The term "hydrocarbyl" includes groups comprising C, O and H. Linear, branched and cyclic groups having any degree of saturation are included. Such hydrocarbyl groups can include one

or more heteroatoms selected from N, O and S and may be additionally mono or polysubstituted with one or more substituent groups.

The terms "substituent" and "substituent group", as used herein, are intended to include groups that are typically added to other groups.

or parent compounds to enhance the desired properties or provide the desired effects. Substituent groups can be protected or unprotected and can be added to one available site or to many available sites in a parent compound. Substituent groups can also be further substituted with other substituent groups and can be attached directly or via a connecting group such as an alkyl or hydrocarbyl group to a parent compound. Such groups include, without limitation, halogen, hydroxyl, alkyl, alkenyl, alkynyl, acyl (-C (O) Raa), carboxyl (-C (O) O-Raa), aliphatic groups, alicyclic groups, alkoxy, substituted oxy (- O-Raa), aryl, aralkyl, heterocyclic, heteroaryl, heteroarylalkyl, amino (-NRbbRcc), imino (= NRbb), amido (-C (O) N-RbbRcc or -N (Rbb) C (O) Raa), azido (-N3), nitro (-NO2), cyano (-CN), carbamido (-OC (O) NRbbRcc or -N (Rbb) C (O) ORaa), ureido (-N (Rbb) C (O) NRbbRcc), thioureido (-N (Rbb) C (S) NRbbRcc), guanidinyl (-N (Rbb) C (= NRbb) NRbbRcc), amidinyl (-C (= NRbb) NRbbRcc or -N (Rbb) C (NRbb) ) Raa), thiol (-SRbb), sulfinyl (-S (O) Rbb), sulfonyl (-S (O) 2Rbb), sulfonamidyl (-S (O) 2NRbbRcc or -N (Rbb) -S (O) 2Rbb ) and conjugated groups. Wherein each Raa, Rbb and Rcc is independently H, an optionally attached chemical functional group or an additional substituent group with a preferred list including without limitation H, alkyl, alkenyl, alkynyl, aliphatic, alkoxy, acyl, aryl, aralkyl, heteroaryl , alicyclic, heterocyclic, and heteroarylalkyl.

The term "oxo" refers to the group (= O).

The compounds (eg, bicyclic nucleosides) described herein can be prepared by any of the applicable mechanisms of organic synthesis, as, for example, illustrated in the following examples. Many of such mechanisms are well known in the art. However, many of the known mechanisms are elaborated in Compendium of Organic Synthetic Methods (John Wiley & Sons, New York) Vol. 1, Ian T. Harrison and Shuyen Harrison (1971); Vol. 2, Ian T. Harrison and Shuyen Harrison (1974); Vol. 3, Louis S. Hegedus and Leroy Wade (1977); Vol. 4, Leroy G. Wade Jr., (1980); Vol. 5, Leroy G. Wade Jr. (1984); and Vol. 6, Michael B. Smith; as well as March, J., Advanced Organic Chemistry, 3rd Edition, John Wiley & Sons, New York (1985); Comprehensive Organic Synthesis. Selectivity, Strategy & Efficiency in Modern Organic Chemistry, In 9 Volumes, Barry M. Trost, Editor-in-Chief, Pergamon Press, New York (1993); Advanced Organic Chemistry, Part

B: Reactions and Synthesis, 4th Ed .; Carey and Sundberg; Kluwer Academic / Plenum Publishers: New York (2001); Advanced Organic Chemistry, Reactions, Mechanisms, and Structure, 2nd Edition, March, McGraw Hill (1977); Protecting Groups in Organic Synthesis, 2nd Edition, Greene, T.W., and Wutz, P.G.M., John Wiley & Sons, New York (1991); and Comprehensive Organic Transformations, 2nd Edition, Larock, R.C., John Wiley & Sons, New York (1999).

In one aspect of the present invention, oligomeric compounds are modified by covalently linking one or more conjugated groups. In general, the conjugated groups modify one or more properties of the bound oligomeric compound including but not limited to pharmacodynamics, pharmacokinetics, binding, absorption, cellular distribution, cellular absorption, loading, and clearance. Conjugated groups are routinely used in chemical arts and are attached directly or through an optional connecting moiety or connecting group to a parent compound such as an oligomeric compound. A preferred list of conjugated groups includes without limitation, intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid radicals, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, achemamine , fluoresceins, rhodamines, coumarins and dyes.

Linker groups or bifunctional linker radicals such as those known in the art are suitable for the present invention. Linker groups are useful for anchoring chemical functional groups, conjugated groups; reporter groups and other groups to selective sites on a parent compound such as for example an oligomeric compound. In general a bifunctional linking radical comprises a hydrocarbyl radical having two functional groups. One of the functional groups is selected to bind to a parent molecule or compound of interest and the other is selected to bind essentially any selected group such as a chemical functional group or a conjugated group. In some embodiments, the linker comprises a chain structure or an oligomer of repeating units such as ethylene glycol units or amino acids. Examples of functional groups that are routinely used in bifunctional linker radicals include, but are not limited to, electrophiles to react with nucleophilic groups and nucleophiles to react with electrophilic groups. In some embodiments, bifunctional linking radicals include amino, hydroxyl, carboxylic acid, thiol, unsaturations (e.g.

g., double or triple bonds), and the like. Some non-limiting examples of bifunctional linking radicals include 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4- (N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC), and 6-aminohexanoic acid (AHEX or AHA) . Other linking groups include, but are not limited to, substituted C1-C10 alkyl, substituted or unsubstituted C2-C10 alkenyl, or substituted or unsubstituted C2-C10 alkynyl, where a non-limiting list of preferred substituent groups includes hydroxyl, amino, alkoxy , carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl.

The term "protecting group", as used herein, refers to a labile chemical moiety that is known in the art to protect reactive groups including, without limitation, hydroxyl, amino, and thiol groups, from unwanted reactions during the procedures. synthetics. Protecting groups are typically used selectively and / or orthogonally to protect sites during reactions at other reactive sites and can then be removed to leave the unprotected group as is or available for further reactions. Protecting groups known in the art are generally described by Greene and Wuts, in Protective Groups in Organic Synthesis, 3rd edition, John Wiley & Sons, New York (1999).

The groups can be selectively incorporated into the oligomeric compounds of the invention as precursors. For example an amino group can be placed in a compound of the invention as an azido group that can be chemically converted to the amino group at a desired point in synthesis. Generally, the groups are protected or presented as precursors that will be inert to reactions that modify other areas of the parent molecule for conversion to end groups at the appropriate time. Illustrative protecting groups or precursors are discussed by Agrawal, et al., In Protocols for Oligonucleotide Conjugates, Eds, Humana Press; New Jersey, 1994; Vol. 26 pp. 1-72.

Examples of hydroxyl protecting groups include, but are not limited to, acetyl, t-butyl, t-butoxymethyl, methoxymethyl, tetrahydropyranyl, 1-ethoxyethyl, 1- (2-chloroethoxy) ethyl, p-chlorophenyl, 2,4-dinitrophenyl, benzyl , 2,6-dichlorobenzyl, diphenylmethyl, p-nitrobenzyl, bis (2-acetoxyethoxy) methyl (ACE), 2-trimethylsilylethyl, trimethylsilyl, triethylsilyl, t-butyldimethylsilyl, t-butyldiphenylsilyl, triphenylsilyl] methylsilyl () methylsilyl) methyldiphenylsilyl, [(triisopropyl) oxyOMM), triphenylsilyl] , benzoylformiate, chloroacetyl, trichloroacetyl, trifluoroacetyl, pivaloyl, benzoyl, p-phenylbenzoyl, 9-fluorenylmethyl carbonate, mesylate, tosylate, triphenylmethyl (trityl), monomethoxytrityl, dimethoxytrityl (DMX-nitrite-3-fluoride) 4yl (FPMP), 9-phenylxanthin-9-yl (Pixyl) and 9- (pmethoxyphenyl) xanthin-9-yl (MOX). Wherein the most preferred hydroxyl protecting groups include, but are not limited to, benzyl, 2,6-dichlorobenzyl, t-butyldimethylsilyl, t-butyl-diphenylsilyl, benzoyl, mesylate, tosylate, dimethoxytrityl (DMF), 9-phenylxanthin9-yl (Pixyl ) and 9- (p-methoxyphenyl) xanthin-9-yl (MOX).

Examples of amino protecting groups include, but are not limited to, carbamate protecting groups, such as 2-trimethylsilylethoxycarbonyl (Teoc), 1-methyl-1- (4-biphenylyl) -ethoxycarbonyl (Bpoc), t-butoxycarbonyl (BOC) , allyloxycarbonyl (Alloc), 9-fluorenylmethyloxycarbonyl (Fmoc), and benzyloxycarbonyl (Cbz); amide protecting groups, such as formyl, acetyl, trihaloacetyl, benzoyl, and nitrophenylacetyl; sulfonamide protecting groups, such as 2-nitrobenzenesulfonyl; cyclic imine and imide protecting groups, such as phthalimido and dithiasuccinoyl.

Examples of thiol protecting groups include, but are not limited to, triphenylmethyl (trityl), benzyl (Bn), and the like.

In some preferred embodiments, oligomeric compounds are prepared by linking nucleosides with optionally protected phosphorous-containing internucleoside linkages. Representative protecting groups for phosphorous-containing internucleoside linkages such as phosphodiester and phosphorothioate linkages include β-cyanoethyl, diphenylsilylethyl, δ-cyanobutenyl, cyano p-xylyl (CPX), W-methyl-N-trifluoroacetylethyl (META), acetoxyphenoxyethyl (META), acetoxyphenoxyethyl (META) groups. APE) and buten-4-yl. See for example US Patent Nos. 4,725,677 and Re. 34,069 (β-cyanoethyl); Beaucage, S.L. and lyer, R.P., Tetrahedron, 49 No. 10, pp. 1925-1963 (1993); Beaucage, S.L. and Iyer, R.P., Tetrahedron, 49 No. 46, pp. 10441-10488 (1993); Beaucage, S.L. and lyer, P.P., Tetrahedron, 48 No. 12, pp. 2223-2311 (1992).

As used herein, the term "orthogonally protected" refers to functional groups that are protected with different classes of protecting groups, where each of the classes of protecting group can be separated in any order and in the presence of all other classes (see, Barany, G. and Merrifield, RB, J. Am, Chem. Soc., 1977, 99, 7363; idem, 1980, 102, 3084). Orthogonal protection is widely used for example in automatic oligonucleotide synthesis. A functional group is unblocked in the presence of one or more other protected functional groups that are not affected by the deblocking procedure. This unblocked functional group is reacted in some way and at some point an additional orthogonal protecting group is removed under a different set of reaction conditions. This allows selective chemistry to reach a desired oligomeric compound or compounds.

The present invention provides compounds having reactive phosphorus groups useful for forming internucleoside linkages including for example phosphodiester and phosphorothioate internucleoside linkages. Such reactive phosphorus groups are known in the art and contain phosphorous atoms in the PIII or PV valence state and are limited to phosphoramidite, H-phosphonate, phosphate triesters and chiral phosphorus-containing auxiliaries. A preferred solid phase synthesis

PIII)

utilizes phosphoramidites (chemistry as reactive phosphites. Intermediate phosphite compounds are subsequently oxidized to the PV state using known methods to produce, in preferred embodiments, phosphodiester or phosphorothioate internucleotide linkages. Additional reactive phosphates and phosphites are described in Tetrahedron Report Number 309 (Beaucage and lyer, Tetrahedron, 1992, 48, 2223-2311).

Specific examples of oligomeric compounds useful in this invention include oligonucleotides containing non-naturally occurring internucleoside linkages, e.g. ex. modified. Two main classes of internucleoside linkages are defined by the presence or absence of a phosphorous atom. Modified internucleoside linkages having a phosphorous atom include, but are not limited to, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkyl phosphotriesters, methyl- and other alkyl phosphonates including 3'-alkylene phosphonates, 5'-alkylene phosphonates, and phosphorothioates, 5'-alkylene phosphonates. phosphinates, phosphoramidates including 3'-aminophosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, sclenophosphates and boranophosphates having normal 3'-5 'connections, analogs with 2'-5' connections where they have a polarity or reversed Most internucleotide linkages is a 3 'to 3', 5 'to 5' or 2 'to 2' link. Oligonucleotides having reverse polarity may comprise a single 3 'to 3' linkage at the 3 'plus internucleotide linkage that is a single reverse nucleoside residue that can be abasic (the nucleobase is lost or has a hydroxyl group in its place). Also included are various salts, mixed salts, and free acid forms.

Representative United States patents illustrating the preparation of the above phosphorous-containing linkages include, but are not limited to, U.S .: 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,102; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563,253; 5,571,799; 5,587,361; 5,194,599; 5,565,555; 5,527,899; 5,721,918;

5,672,697 and 5,625,050, some of which are owned by the same owner as this application.

Modified internucleoside linkages that do not have a phosphorous atom include, but are not limited to, those that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more heteroatomic internucleoside linkages or short chain heterocyclic. These include those that have siloxane backbones; sulfur, sulfoxide, and sulfone skeletons; formacetyl and thioformacetyl skeletons; ethylene formacetyl and thioformacetyl skeletons; riboacetyl skeleton; skeletons containing alkene; sulphamate skeletons; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide skeletons; amide skeletons; and others that have mixed N, O, S and CH2 component parts.

Representative United States patents illustrating the preparation of the above oligonucleosides include, but are not limited to, U.S .: 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; 5,792,608; 5,646,269 and 5,677,439, some of which are owned by the same owner as this application.

The compounds described herein contain one or more asymmetric centers and thus give rise to enantiomers, diastereomers, and other stereoisomeric forms that can be defined, in terms of absolute stereochemistry, as (R) -or (S) -, α or β, or as (D) -or (L) -as for amino acids. The present invention is intended to include all of these possible isomers, as well as their racemic and optically pure forms. Optical isomers can be prepared from their respective optically active precursors by the procedures described above, or by resolving the racemic mixtures. Resolution can be carried out in the presence of a resolving agent, by chromatography, or by repeated crystallization.

or by a combination of these mechanisms that are known to those of skill in the art. Additional details regarding resolutions can be found in Jacques, et al., Enantiomers, Racemates, and Resolutions (John Wiley & Sons, 1981). When the compounds described herein contain olefinic double bonds, other unsaturations, or other centers of geometric asymmetry, and unless otherwise specified, the compounds are intended to include both E and Z geometric isomers or cis and trans isomers. . Similarly, it is also intended to include all tautomeric forms. It is also intended to include the configuration of any carbon-carbon double bond. The configuration of any carbon-carbon double bond that appears herein is selected for convenience only and is not intended to designate a particular configuration unless the text so states; thus a carbon-carbon double bond or a carbon-heteroatom double bond arbitrarily represented herein as trans can be cis, trans, or a mixture of the two in any proportion.

In the context of the present invention, the term "oligomeric compound" refers to a polymer that has at least one region that is capable of hybridizing to a nucleic acid molecule. The term "oligomeric compound" includes oligonucleotides, oligonucleotide analogs and oligonucleosides as well as nucleotide mimetics and / or mixed polymers comprising nucleic acid and non-nucleic acid components. Oligomeric compounds are routinely prepared but can be pooled or otherwise prepared to be circular and can also include branches. The oligomeric compounds can form double-stranded constructs such as for example two-stranded hybridized to form double-stranded compositions. Double-stranded compositions may be connected or separate and may include protrusions at the ends. In general, an oligomeric compound comprises a backbone of connected monomeric subunits where each connected monomeric subunit is attached directly or indirectly to a radical of a heterocyclic base. Oligomeric compounds can also include monomeric subunits that are not connected to a radical of a heterocyclic base thereby providing baseless sites. The linkages linking monomeric subunits, sugar or substitute radicals, and heterocyclic base radicals can be independently modified. The connecting sugar unit, which may or may not include a heterocyclic base, may be substituted for a mimetic such as peptide nucleic acid monomers. The ability to modify or substitute portions or entire monomers at each position of an oligomeric compound gives rise to a large number of possible motifs.

As is known in the art, a nucleoside is a base-sugar combination. The base portion of the nucleoside is normally a radical of a heterocyclic base. The two most common classes of such heterocyclic bases are purines and pyrimidines. Nucleotides are nucleosides that additionally include a phosphate group covalently connected to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be connected to the 2 ', 3' or 5 'hydroxyl radical of the sugar. In oligonucleotide formation, phosphate groups are covalently connected to nucleosides adjacent to each other to form a linear polymeric compound. The respective ends of this linear polymeric structure can be joined to form a circular structure by hybridization or by formation of a covalent bond, however, open linear structures are generally desired. In oligonucleotide structure, the phosphate groups are commonly referred to as forming the internucleoside linkages of the oligonucleotide. The normal internucleoside linkage of RNA and DNA is a 3 'to 5' phosphodiester linkage.

In the context of this invention, the term "oligonucleotide" refers to an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA). This term includes oligonucleotides composed of naturally occurring nucleobases, sugars, and covalent internucleoside linkages. The term "oligonucleotide analog" refers to oligonucleotides that have one or more non-naturally occurring portions. Such non-naturally occurring oligonucleotides are often desired over natural forms because of desirable properties such as, for example, increased cellular uptake, increased affinity for nucleic acid targets, and increased stability in the presence of nucleases.

In the context of this invention, the term

"oligonucleoside" refers to a sequence of nucleosides that are joined by internucleoside bonds that do not have phosphorous atoms. Internucleoside linkages of this type include short chain alkyl, cycloalkyl, mixed alkyl heteroatoms, mixed cycloalkyl heteroatoms, one or more short chain heteroatoms, and one or more short chain heterocycles. These internucleoside linkages include, but are not limited to, siloxane, sulfide, sulfoxide, sulfone, acetyl, formacetyl, thioformacetyl, methylformacetyl, thioformacetyl, alkenyl, sulfamate, methyleneimino, methylenehydrazine, sulfonate, sulfonamide, amide, and others having N component parts. O, S and CH2 mixed.

Representative United States Patents illustrating the preparation of the above oligonucleosides include, but are not limited to, US Pat. Nos .: 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5.61 8,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; 5,792,608; 5,646,269 and 5,677,439, some of which are owned by the same owner as this application.

The term "nucleobase" or "heterocyclic base radical" as used herein is intended to be synonymous with "nucleic acid base or mimetic thereof." In general, a nucleobase is any substructure that contains one or more atoms or groups of atoms capable of hydrogen bonding with a nucleic acid base.

As used herein,

"Unmodified" or "natural" nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U). Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl derivatives and other alkyl derivatives of adenine and guanine, 2-propyl derivatives. and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothimine and 2-thiocytosine, 5-halouracil and cytosine, 5-propyl (-C = C-CH3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo- uracil, cytosine and -thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other adenines and guaines substituted at position 8, 5-halo specifically 5- Bromine, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-Phadenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-desazaguanine and 7-desazaadenine, 3-desazaadenine and 3-desazaadenine , universal bases, hydrophobic bases, promiscuous bases, enlarged bases, and fluorinated bases as defined herein. Further modified nucleobases include tricyclic pyrimidines such as fenoxazin-cytidin (1H-pyrimido [5,4-b] [1,4] benzoxazin-2 (3H) -one), phenothiazincitidin (1H-pyrimido [5,4-b] [1 , 4] benzothiazin-2 (3H) -one), G-clamps such as a substituted phenoxazin-cytidine (eg 9- (2-aminoethoxy) -H-pyrimido [5,4-b] - [1,4 ] benzoxazin2 (3H) -one), carbazole-cytidine (2H-pyrimido [4,5-b] indole-2one), pyridoindole-cytidine (H-pyrido [3 ', 2': 4.5] pyrrolo [2, 3-d] pyrimidin-2-one). Modified nucleobases can also include those in which the purine or pyrimidine base is replaced by other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine, and 2-pyridone. Additional bases include those described in US Patent No. 3,687,808, those described in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J.I., ed. John Wiley & Sons, 1990, those described by Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, and those described by Sanghvi, YS, Chapter 15, Antisense Research and Applications, pages 289-302, Crooke, ST and Lebleu, B., ed., CRC Press, 1993.

Modified nucleobases include, but are not limited to, universal bases, hydrophobic bases, promiscuous bases, enlarged bases, and fluorinated bases as defined herein. Some of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds of the invention. These include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and O-6 substituted purines, including 2-aminopropyladenine, the 5-propynyluracil and 5-propynyl-cytosine substitutions, 5-methylcytosine, have been shown to increase the stability of the nucleic acid duplex at 0.6-1.2 ° C (Sanghvi, YS, Crooke, ST and Lebleu, B., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and base substitutions are preferred today, even more particularly when combined with 2'-O-methoxyethyl Sugar modifications.

Representative United States patents illustrating the preparation of some of the modified nucleobases as well as other modified nucleobases include, but are not limited to, the documents listed above. 3,687,808. as well as the U.S documents; 4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121; 5,596,091; 5,614,617; 5,645,985; 5,830,653; 5,763,588; 6,005,096; and 5,681,941, some of which are owned by the present application, and US Patent 5,750,692, which is owned by the present application.

The oligomeric compounds of the present invention may also contain one or more nucleosides having modified sugar radicals. The furanosyl sugar ring can be modified in numerous ways including substitution with a substituent group, bridging to form a BNA, and substitution of the 4'-O group with a heteroatom such as S or N (R). Some representative United States patents illustrating the preparation of such modified sugars include, but are not limited to, U.S .: 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; 5,792,747; 5,100,920; 6,600,032 and International Application PCT / US2005 / 019219, filed June 2, 2005 and published as WO 2005/121371 on December 22, 2005, some of which are owned by the present application. A representative list of preferred modified sugars includes but is not limited to substituted sugars having a 2'-F, 2'-OCH2 or 2'-O (CH2) 2OCH3 substituent group; 4'-thio modified sugars and bicyclic modified sugars.

As used herein the term "nucleoside mimetic" is intended to include those structures used to replace the sugar or sugar and base, not the bond, at one or more positions of an oligomeric compound such as mimetics. of nucleosides having sugar mimetics with morpholino or bicyclo [3,1,0] hexyl p. ex. sugar units other than furanose with a phosphodiester bond. The term "sugar substitute" overlaps with the slightly broader term "nucleoside mimetic" but is only intended to indicate the substitution of the sugar unit (furanose ring). The term "nucleotide mimetic" is intended to include those structures used to substitute nucleoside and bond at one or more positions of an oligomeric compound such as for example peptides, nucleic acids or morpholinos (morpholinos connected by a -N (H ) -C (= O) -O or other non-phosphodiester bond).

The oligomeric compounds according to the present invention comprise from about 8 to about 80 nucleosides and / or modified nucleosides or mimetics in length. One of ordinary skill in the art will appreciate that the embodiment comprises oligomeric compounds of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 7S, 76, 77, 78, 79, or 80 nucleosides and / or modified nucleosides or mimetics in length, or any of their ranges.

In another embodiment the oligomeric compounds of the invention are 8 to 40 nucleosides and / or modified nucleosides or mimetics in length. One of ordinary skill in the art will appreciate that this encompasses oligomeric compounds of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, Z4, 25, 26 , 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 nucleosides and / or modified nucleosides or length mimetics, or any of their ranges.

In another embodiment, the oligomeric compounds of the invention are 8 to 20 nucleosides and / or modified nucleosides or mimetics in length. One of ordinary skill in the art will appreciate that it encompasses oligomeric compounds of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleosides and / or modified nucleosides or mimetics in length, or any of its intervals.

In another embodiment, the oligomeric compounds of the invention are 10 to 16 nucleosides and / or modified nucleosides or mimetics in length. One of ordinary skill in the art will appreciate that this encompasses oligomeric compounds of 10, 11, 12, 13, 14, 15 or 16 nucleosides and / or modified nucleosides or mimetics in length, or any of their ranges.

In another embodiment, the oligomeric compounds of the invention are 10-14 nucleosides and / or modified nucleosides or mimetics in length. One of ordinary skill in the art will appreciate that this encompasses oligomeric compounds of 10, 11, 12, 13 or 14 nucleosides and / or modified nucleosides or mimetics in length, or any of their ranges.

Chimeric oligomeric compounds have differentially modified nucleosides at two or more positions and are generally defined by having a motif. The chimeric oligomeric compounds of the invention can be formed as structures composed of two or more oligonucleotides, oligonucleotide analogs, oligonucleosides and / or oligonucleotide mimetics as described above. United States patents illustrating the preparation of such hybrid structures include, but are not limited to, U.S .: 5,013,830; 5,149,797; 5,220,007;

5,256,775. 5,366,878: 5,403,711; 5,491,133; 5,565,350; 5,623,065; 5,652,355; 5,652.:356; and 5,700,922, some of which are owned by the present application.

The oligomerization of nucleosides and their modified or unmodified mimetics, in one aspect of the present invention, is carried out according to the procedures of the publications for the synthesis of DNA (Protocols for Oligonucleotides and Analogs, Ed. Agrawal (1993), Humana Press) and / or RNA (Scaringe, Methods (2001), 23, 206-217; Gait et al., Applications of Chemically synthesized RNA in RNA: Protein Interactions, Ed. Smith (1998), 1-36; Gallo et al. ., Tetrahedron (2001), 57, 5707-5713) as appropriate. Additional methods for solid phase synthesis can be found in Caruthers US Patent Nos. 4,415,732; 4,458,066; 4,500,707; 4,668,777; 4,973,679; and 5,132,418; and in Koster US Patent Nos. 4,725,677 and Re. 34,069.

Commercially available equipment routinely used for the synthesis of oligomeric compounds and related compounds based on support media is available from various vendors including, for example, Applied Biosystems (Foster City, CA). Alternatively, any other method for such a synthesis known in the art may be employed.

Suitable solid phase mechanisms, including automated synthesis mechanisms, are described by F. Eckstein (ed.), Oligonucleotides and Analogues, a Practical Approach, Oxford University Press, New York (1991).

The synthesis of RNA and related analogs with respect to the synthesis of DNA and related analogs has been increasing in efforts to increase RNAi. Primary RNA synthesis strategies currently being used commercially include 5'-O-DMT-2'-Ot-butyldimethylsilyl (TBDMS), 5'O-DMT-2'-O- [1 (2-fluorophenyl ) -4-methoxopiperidin-4-yl] (FPMP), 2'-O - [(triisopropylsilyl) oxy] methyl (2'-O-CH2-OSi (iPr) 3 (TOM), and the 5'-O- Silyl ether-2'-ACE (5'-Obis (trimethylsiloxy) cyclododecyloxysilylether (DOD) -2'-Obis (2-acetoxyethoxy) methyl (ACE). A current list of some of the top companies currently offering RNA products includes Pierce Nucleic Acid Technologies, Dharmacon Research Inc., Ameri Biotechnologies Inc., and Integrated DNA Technologies, Inc. One company, Princeton Separations, is marketing an activator of RNA synthesis to reduce coupling times especially with TOM and TBDMS chemistries. Such an activator would be suitable for the present invention.

The primary groups that are being used for commercial RNA synthesis are: TBDMS = 5'-O-DMT-2'-O-t-butyldimethylsilyl; TOM = 2'-O - [(triisopropylsilyl) oxy] methyl; DOD / ACE = methyl ether-2'-O-bis (2-acetoxyethoxy) of (5'-O

bis (trimethylsiloxy) cyclododecyloxysilyl FPMP = 5'-O-DMT-2'-O- [1 (2-fluorophenyl) -4-methoxypiperidin-4-yl].

All the RNA synthesis strategies mentioned above are proposed for the present invention. The strategies that are a hybrid of the previous ones, p. g., using a 5 'protecting group from one strategy with a 2'-O protecting group from another strategy are also proposed for the present invention.

In the context of this invention, "hybridization" represents the pairing of complementary strands of oligomeric compounds. In the present invention, a pairing mechanism involves hydrogen bonds, which can be reverse Watson-Crick, Hoogsteen or Hoogsteen hydrogen bonds, between nucleoside bases.

or complementary nucleotides (nucleobases) of the strands of oligomeric compounds. For example, adenine and thymine are complementary nucleobases that pair through hydrogen bonding. Hybridization can occur under varying circumstances.

An oligomeric compound is specifically hybridizable when the binding of the compound to the target nucleic acid interferes with the normal function of the target nucleic acid causing a loss of activity, and there is a sufficient degree of complementarity to prevent non-specific binding of the oligomeric compound to acid sequences. non-target nucleic acid under conditions where specific binding is desired, that is, under physiological conditions in the case of in vivo analysis or therapeutic treatment, and under conditions where analyzes are performed in the case of analyzes

in vitro.

"Complementary", as used herein, refers to the precise pairing ability of two nucleobases regardless of where the two are located. For example, if a nucleobase at a certain position in an oligomeric compound is capable of hydrogen bonding with a nucleobase at a certain position in a target nucleic acid, the target nucleic acid being DNA, RNA, or an oligonucleotide molecule, considers that the position of the hydrogen bond between the oligonucleotide and the target nucleic acid are in a complementary position. The oligomeric compound and the additional DNA, RNA, or oligonucleotide molecule are complementary to each other when a sufficient number of complementary positions of each molecule are occupied by nucleobases that can be hydrogen bonded to each other. Thus, "specifically hybridizable" and "complementary" are terms that are used to indicate a sufficient degree of precise pairing or complementarity over a sufficient number of nucleobases so that a stable and specific binding occurs between the oligonucleotide and a target nucleic acid.

It is understood in the art that the sequence of an oligomeric compound need not be 100% complementary to that of its target nucleic acid to be specifically hybridizable. On the other hand, an oligonucleotide can hybridize along one or more segments such that intermediate or adjacent segments are not involved in the hybridization event (eg, a loop structure or a hairpin structure). The oligomeric compounds of the present invention may comprise at least about 70%, at least about 80%, at least about 90%, at least about 95%, or at least about 99% sequence complementarity with a target region within the nucleic acid sequence to which they are targeted. For example, an oligomeric compound in which 18 to 20 nucleobases of the oligomeric compound are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. In this example, the remaining non-complementary nucleobases can be grouped or interspersed with complementary nucleobases and need not be contiguous with each other or with the complementary nucleobases. As such, an oligomeric compound that is 18 nucleobases in length that is 4 (four) non-complementary nucleobases that are flanked by two regions of complete complementarity with the target nucleic acid would have a total complementarity of 77.8% with the target nucleic acid and therefore it would be within the scope of the present invention. The percent complementarity of an oligomeric compound with a region of a target nucleic acid can be routinely determined using BLAST programs (Basic Local Alignment Search Tools) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol ., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656).

Additionally included in the present invention are oligomeric compounds such as antisense oligomeric compounds, antisense oligonucleotides, ribozymes, oligonucleotides of external leader sequences (EGS), alternate splicers, primers, probes, and other oligomeric compounds that hybridize to at least a portion of the nucleic acid. Diana. As such, these oligomeric compounds can be introduced in the form of single-stranded, double-stranded, circular or hairpin oligomeric compounds and can contain structural elements such as bumps or loops. Once introduced into a system, the oligomeric compounds of the invention can achieve the action of one or more enzymes or structural proteins to effect modification of the target nucleic acid.

A non-limiting example of such an enzyme is RNase H, a cellular endonuclease that clears the RNA strand of an RNA: DNA duplex. Single-stranded oligomeric compounds that are "RNA-like" are known in the art to elicit RNase H. Activation of RNase H, therefore, results in cleavage of target RNA, thereby greatly enhancing efficacy. of the inhibition of oligonucleotide-mediated expression of gene expression. Similar roles have been postulated for other ribonucleases such as those of the RNase III family of enzymes and ribonuclease L.

Although one form of oligomeric compound is a single-stranded antisense oligonucleotide, in many species the introduction of double-stranded structures, such as double-stranded RNA (dhRNA) molecules, has been shown to induce potent and antisense-mediated reduction. specific to the function of a gene

or their associated gene products. This phenomenon occurs in both plants and animals and is believed to have an evolutionary connection with viral defense and transposon silencing.

In some embodiments, "suitable target segments" can be employed in a screen for additional oligomeric compounds that modulate the expression of a selected protein. "Modulators" are those oligomeric compounds that decrease or increase the expression of a nucleic acid molecule that encodes a protein and that comprise at least an 8-nucleobase portion that is complementary to a suitable target segment. The screening method comprises the steps of contacting a suitable target segment of a nucleic acid molecule encoding a protein with one or more candidate modulators, and selecting for one or more candidate modulators that decrease or increase the expression of a nucleic acid molecule that encodes a protein. Once it has been shown that the candidate modulator (s) are capable of modulating

(eg, decrease or increase) the expression of a nucleic acid molecule encoding a peptide, the modulator can be employed for further investigation of the function of the peptide, or for use as a search, diagnostic, or therapeutic according to the present invention.

Suitable target segments of the present invention can also be combined with their respective complementary antisense oligomeric compounds of the present invention to form stabilized double-stranded oligonucleotides (duplexes). Such double-stranded oligonucleotide moieties have been shown in the art to modulate target expression and regulate translation as well as RNA processing via an antisense mechanism. On the other hand, double-stranded radicals can be subjected to chemical modifications (Fire et al., Nature, 1998, 391, 806-811; Timmons and Fire, Nature 1998, 395, 854; Timmons et al., Gene, 2001 , 263, 103-112; Tabara et al., Science, 1998, 282, 430-431; Montgomery et al., Proc. Natl. Acad. Sci. USA, 1998, 95, 15502-15507; Tuschl et al., Genes Dev., 1999, 13, 3191-3197; Elbashir et al., Nature, 2001, 411, 494-498; Elbashir et al., Genes Dev. 2001, 15, 188-200). For example, such double-stranded radicals have been shown to inhibit the target by classical hybridization of the antisense strand of the duplex to the target, thereby triggering enzymatic degradation of the target (Tijsterman et al., Science, 2002, 295, 694697).

The oligomeric compounds of the present invention can also be applied in the areas of drug discovery and target validation. The present invention encompasses the use of the oligomeric compounds and targets identified herein in drug discovery efforts to elucidate the relationships that exist between proteins and a disease state, phenotype, or condition. These methods include the detection or modulation of a target peptide which comprises contacting a sample, tissue, cell or organism with the oligomeric compounds of the present invention, measuring the level of nucleic acid or protein of the target and / or a criterion of phenotypic or chemical titration sometime after treatment, and optionally comparing the measured value with an untreated sample or a sample treated with an additional oligomeric compound of the invention. These methods can also be performed in parallel or in combination with other experiments to determine the function of unknown genes for the target validation process or to determine the validity of a particular gene product as a target for the treatment or prevention of a disease. specific condition, or phenotype.

The effect of nucleoside modifications on RNAi activity is evaluated according to existing publications (Elbashir et al., Nature (2001), 411, 494-498; Nishikura et al., Cell (2001), 107, 415 -416; and Bass et al., Cell (2000), 101, 235-238.)

The oligomeric compounds of the present invention can be used for diagnosis, therapy, prophylaxis, and as search reagents and kits. Furthermore, antisense oligonucleotides, which are capable of inhibiting gene expression with exquisite specificity, are often used by those of skill in the art to elucidate the function of particular genes or to distinguish between the functions of different members of a biological pathway.

For use in kits and diagnostics, the oligomeric compounds of the present invention, either alone or in combination with other oligomeric compounds or therapeutic agents, can be used as tools in differential and / or combinatorial analysis to elucidate patterns of expression of a portion or of the full complement of genes expressed in cells and tissues.

As a non-limiting example, the expression patterns in cells or tissues treated with one or more oligomeric compounds are compared to control cells or tissues not treated with oligomeric compounds and the patterns produced are analyzed for differential levels of gene expression to belong , for example, to a disease association, a signaling pathway, a cellular location, an expression level, a size, a structure or a function of the genes examined. These analyzes can be performed on stimulated or unstimulated cells and in the presence or absence of other compounds and oligomeric compounds that affect expression patterns.

Examples of gene expression analysis methods known in the art include DNA arrays or microarrays (Brazma and Vilo, FEBS Lett., 2000, 480, 17-24; Celis, et al., FEBS Lett., 2000, 480, 2-16), SAGE (serial analysis of gene expression) (Madden, et al., Drug Discov. Today, 2000, 5, 415-425), READS (restriction enzyme amplification of digested cDNA) (Prashar and Weissman, Methods Enzymol., 1999, 303, 258-72), TOGA (Total Gene Expression Analysis) (Sutcliffe, et al., Proc. Natl. Acad. Sci. USA, 2000, 97, 1976-81) , Proteomics and Protein Arrays (Celis, et al., FEBS Lett., 2000, 480, 2-16; Jungblut, et al., Electrophoresis, 1999, 20, 2100-10), Expressed Sequence Tag Sequencing (EST ) (Celis, et al., FEBS Lett., 2000, 480, 2-16; Larsson, et al., J. Biotechnol., 2000, 80, 143-57), Subtractive RNA Fingerprinting (SuRF) ( Fuchs, et al., Anal. Biochem., 2000, 286, 91-98; Larson, et al., Cytometry, 2000, 41, 203-208), clonac subtractive ion, differential presentation (DD) (Jurecic and Belmont, Curr. Opin. Microbiol., 2000, 3, 316-21), comparative genomic hybridization (Carulli, et al., J. Cell Biochem. Suppl., 1998, 31, 286-96), FISH techniques (fluorescent in situ hybridization) (Going and Gusterson, Eur. J. Cancer, 1999, 35, 1895-904) and mass spectrometry methods (To, Comb. Chem. High Throughput Screen, 2000, 3, 235-41).

The oligomeric compounds of the invention are useful for research and diagnosis, because these oligomeric compounds hybridize to protein-encoding nucleic acids. For example, oligonucleotides that have been shown to hybridize with such efficiency and under said conditions described herein as being effective protein inhibitors will also be effective primers or probes under conditions that favor gene amplification or detection, respectively. These primers and probes are useful in methods that require the specific detection of nucleic acid molecules that encode proteins and in the amplification of nucleic acid molecules for detection or for use in further studies. Hybridization of the antisense oligonucleotides, particularly the primers and probes, of the invention with a nucleic acid can be detected by methods known in the art. Such methods may include conjugation of an enzyme to the oligonucleotide, radiolabelling of the oligonucleotide, or any other suitable detection method. Kits using such detection methods can also be prepared to detect the level of selected proteins in a sample.

While the present invention has been specifically described in accordance with some of its embodiments, the following examples serve only to illustrate the invention and are not intended to limit the invention.

Example 1

Preparation of uridin-6- (R) -methyl BNA phosphoramidite, (1S, 3R, 4R, 6R, 7S) -7- [2-cyanoethoxy (diisopropylamino) phosphinoxy] -1- (4,4'-dimethoxytrityloxymethyl) -3 - (uracil-1-yl) -6-methyl-2,5-dioxa-bicyclo [2,2,1] heptane (15)

Scheme 1 (a) TBSCl, Et3N, DMAP, CH2Cl2, rt, 16h, 50% para3; (b) Swern oxidation; (c) MeMgBr, CeCl3, THF, -78 ° C 80% from 3; (d) MsCl, Et3N, DMAP, CH2Cl2, rt, 16hy, 91%; (e) AcOH, Ac2O, H2SO4, rt, 16h, 88%; (f) Uracil, BSA, TMSOTf, CH3CN, reflux, 2h; (g) K2CO3, MeOH, rt, 16h;

(h) TBDPSCl, Et3N, DMAP, CH2Cl2, rt, 16h, 79% from

8; (i) BCl3, CH2Cl2, -15 ° C, 60%; (j) Et3N.3HF, Et3N, THF, 10 rt, 16h, DMTCl, Pyridine, rt, 16h, 89% from 12;

(l) CNCH2CH2OP (N-iPr2) 2, Tetrazole, NMI, DMF.

A) 5-O-tert-Butyldimethylsilyl) -3-O-benzyl-1,2-O

isopropylidene-4-C-hydroxymethyl-α-D-erythro-pentofuranose

15 (3)

A solution of tert-butyldimethylsilyl chloride

(6.24 g, 40.7 mmol) in dichloromethane (10 mL) was added over 10 min, via addition funnel, to a cooled (0 ° C) solution of diol 2 (12 g, 38.8 mmol, prepared according to the procedure of Moffatt et al, J. Org. Chem. 1979, 44, 1301, Ref. 1), triethylamine (11.44 mL, 81.5 mmol) and 4-dimethylaminoethylpyridine (0.47 g, 3.9 mmol) in CH2Cl2 (184 mL). After the addition was complete, the reaction was gradually warmed to rt and stirred for an additional 16h. The reaction was diluted with CH2Cl2 and washed successively with 5% aqueous HCl, saturated NaHCO3, brine, dried (Na2SO4), and concentrated in vacuo. Purification by column chromatography (SiO2, eluting with 10% to 30% EtOAc / hexanes) provided alcohol 3 (11.53g, 59%) and alcohol 4 (3.93g, 22%) as solids of White color.

B) Alcohol (6).

Dimethylsulfoxide (3.36 mL, 47.5 mmol) was added dropwise to a cooled (-78 ° C) solution of oxalyl chloride (2.08 mL, 23.7 mmol) in CH2Cl2 (130 mL). After stirring for 30 min, a solution of alcohol 3 (6.7 g, 15.8 mmol) in CH2Cl2 (20 mL) was added to the reaction. Stirring was continued for 45 min at -78 ° C and triethylamine (10.0 mL, 71.2 mmol) was added to the reaction. The reaction was stirred at -78 ° C for 15 min after which the ice bath was removed and the reaction was allowed to warm gradually over 45 min. The reaction was then poured into CH2Cl2 and the organic phase was washed successively with 5% aqueous HCl, saturated NaHCO3, brine, dried (Na2SO4) and concentrated in vacuo to provide aldehyde 5, which was used without any further purification.

A suspension of cerium III chloride (5.84 g, 23.7 mmol) in THF (130 mL) was stirred at rt for 90 min. The reaction was cooled in an ice bath and methyl magnesium bromide (17.0 mL of a 1 M solution in THF) was added over 5 min and stirring continued for another 90 min. A solution of the crude aldehyde 5 (above) in THF (20 mL) was added to the reaction. After stirring for another 90 min, the reaction was quenched with a sat. NH4Cl solution. and poured into EtOAc. The organic layer was washed successively with 5% aqueous HCl, saturated NaHCO3, brine, dried (Na2SO4), and concentrated in vacuo. Purification by column chromatography (SiO2, eluting with 15% EtOAc / hexanes) provided alcohol 6 (5.52 g, 80% from 3).

C) Mesylate (7)

Methanesulfonyl chloride (0.55 mL, 7.0 mmol) was added to a chilled solution (0 ° C) of alcohol 6 (2.77 g, 6.4 mmol), triethylamine (1.1 mL, 7.7 mmol) and 4-dimethylaminopyridine (84 mg, 0.7 mmol) in CH2Cl2 (14 mL). After stirring at rt for 1h, the reaction was poured into CHCl3 and the organic layer was washed successively with 5% aqueous HCl, saturated NaHCO3, brine, dried (Na2SO4), and concentrated in vacuo. Purification by column chromatography (SiO2, eluting with 15% EtOAc / hexanes provided mesylate 7 (2.97 g, 91%).

D) Triacetate (8)

Concentrated H2SO4 (3 drops) was added to a solution of mesylate 7 (2.97 g, 5.8 mmol) in glacial acetic acid (29 mL) and acetic anhydride (5.8 mL). After stirring at rt for 1h, the reaction was poured into EtOAc and the organic layer was washed with water, saturated NaHCO3, brine, dried (Na2SO4) and concentrated in vacuo. Purification by column chromatography (SiO2, eluting with EtOAc / hexanes from 33% to 50% gave triacetate 8 (2.48 g, 88%) .1 H NMR (CDCl3, anomeric β): δ 7.39-7, 30 (m, 5H), 6.23 (s, 1H), 5.37 (d, 1H), 5.19 (q, 1H), 4.62 (d, 1H), 4.52 (d, 1H ), 4.38 (s, 1H), 4.34 (d, 1H), 3.98 (d, 1H), 2.91 (s, 3H), 2.12 (s, 3H), 2.08 (s, 3H), 2.06 (s, 3H), 1.55 (d, 3H) LCMS: retention time 1.35 min, M + 23 calcd 511.1, found 511.0.

E) Nucleoside (11)

N, O-Bis (trimethylsilyl) acetamide (4.9 mL, 20.0 mmol) was added to a suspension of triacetate 8 (2.47 g, 5.0 mmol) and uracil (0.70 g, 6.3 mmol) in CH3CN (15 mL). After heating at 40 ° C for 15 min to obtain a clear solution, trimethylsilyl triflate (1.18 mL, 6.5 mmol) was added to the reaction. After refluxing for 2h, the reaction was cooled to rt and poured into EtOAc. The organic layer was washed with saturated NaHCO3, brine, dried (Na2SO4) and concentrated in vacuo to provide crude nucleoside 9, which was used without any purification.

K2CO3 (2.07 g, 15 mmol) was added to a solution of nucleoside 9 (above) in MeOH (50 mL). After stirring for 16h at rt, the solvent was removed in vacuo and the residue was partitioned between pyridine / 25% EtOAc and brine. The organic phase was collected, dried (Na2SO4) and concentrated in vacuo to provide 10, which was used without any further purification. 1H NMR (MeOD): δ 7.74 (d, 2H), 7.29-7.14 (m, 5H), 5.53 (d, 1H), 5.38 (s, 1H), 4.48 (s, 2H), 4.18 (s, 1H), 4.14 (sm, 1H), 3.92 (s, 1H), 3.66 (s, 2H), 1.08 (d, 3H) . LCMS: retention time

2.40 min; M + H calcd. 360.1, found 361.0.

Tert-Butyldiphenylsilyl chloride (1.73 mL, 6.7 mmol) was added to a chilled solution (0 ° C) of nucleoside 10 (above), triethylamine (1.4 mL, 10.0 mmol) and 4-dimethylaminopyridine (80 mg, 0.7 mmol) in CH2Cl2 (9 mL). After stirring for 16h at rt, the reaction was poured into EtOAc and the organic phase was washed successively with 5% aqueous HCl, saturated NaHCO3, dried (Na2SO4) and concentrated in vacuo. Purification by column chromatography (SiO2, eluting with 50% EtOAc / hexanes provided nucleoside 11 (2.02 g, 79% from 8) as a white solid.

F) Nucleoside (12)

Boron trichloride (16.7 mL of a 1 M solution in CH2Cl2) was carefully added to a chilled (-15 ° C) solution of nucleoside 11 (2.0 g, 3.3 mmol) in CH2Cl2 (40 mL). After stirring at -15 ° C for 1h, the reaction was cooled to -78 ° C and carefully quenched by the addition of MeOH / CH2Cl2 (1: 1, 10 mL). After stirring for an additional 10 min, the reaction was poured into CH2Cl2 and the organic phase was washed successively with 5% aqueous HCl, saturated NaHCO3, brine, dried (Na2SO4), and concentrated in vacuo. Purification by column chromatography (SiO2, eluting with 50% to 80% EtOAc / hexanes provided nucleoside 12 as a white solid (1.02 g, 60%).

G) Nucleoside (13)

Triethylamine trihydrofluoride (2.98 mL, 18.3 mmol) was added to a solution of nucleoside 12 (1.86 g, 3.7 mmol) and triethylamine (1.03 mL, 7.3 mmol) in THF (36 mL), in a polypropylene tube. After stirring at rt for 16h, the reaction was concentrated in vacuo and the residue was dissolved in EtOAc. The organic layer was washed successively with water, saturated NaHCO3, brine, dried (Na2SO4), and concentrated in vacuo. Purification by column chromatography (SiO2, 15% MeOH / CHCl3 provided nucleoside 13 (1.31 g, triethylamine contaminated product) as a white solid.

H) Nucleoside (14)

4,4'-Dimethoxytrityl chloride (DMTCI) (1.23 g, 3.7 mmol) was added to a solution of nucleoside 13 (above) in pyridine (18 mL). After stirring for 16 h at rt, additional DMTCl (0.12 g) was added to the reaction and stirring was continued for another 8 h. The reaction was then poured into EtOAc and the organic layer was successively extracted with brine, dried (Na2SO4), and concentrated. Purification by column chromatography (SiO2, eluting with 15% acetone / CHCl3 provided nucleoside 14 (1.85 g, 89%) as a white foam. 1 H NMR (CDCl3): δ 8.03 ( d, 1H), 7.44-2.28 (m, 14H), 6.86 (d, 4H), 5.63 (d, 1H), 5.60 (s, 1H), 4.32 (m , 1H), 4.13 (s, 1H), 3.81 (s, 6H), 3.49 (d, 1H), 3.37 (d, 1H), 1.18 (d, 3H).

I) Preparation of phosphoramidite, (1S, 3R, 4R, 6R, 7S) - [2cyanoethoxy- (diisopropylamino) phosphinoxy] -1- (4,4'-dimethoxytrityloxymethyl) -3- (uracil-1-yl) -6- methyl-2,5-dioxa-bicyclo [2,2,1] heptane (15)

2-Cyanoethyltetraisopropylphosphoramidite (0.69 mL, 2.2 mmol) was added to a solution of nucleoside 14

(0.83 g, 1.4 mmol), tetrazole (80 mg, 1.2 mmol) and N-methylimidazole (29 µL, 0.36 mmol) in DMF (7.2 mL). After stirring at rt for 8h, the reaction was poured into EtOAc and the organic layer was washed with 90% brine, brine, dried (Na2SO4), and concentrated. The residue was dissolved in a minimal amount of EtOAc and this solution was added to hexanes. The resulting precipitate was collected and further purified by column chromatography (SiO2, eluting with EtOAc / hexanes from 66% to 75%)

10 to provide phosphoramidite 15 as a white solid (1.04 g, 94%). 31 P NMR (CDCl3) δ: 149.21, 149.79.

Example 2

15 Preparation of uridin-N-Bz-cytosine-6- (R) -methyl-BNA phosphoramidite, (1S, 3R, 4R, 6R, 7S) -7- (2-cyanoethoxy (diisopropylamino) phosphinoxy] -1- (4 , 4'-dimethoxytrityloxymethyl) -3- (4-N-benzoylcytosin-1-yl) -6

20 methyl-2,5-dioxa-bicyclo [2,2,1] heptane (21)

Scheme 2 (a) TBSCl, imidazole, DMF, rt, 16h 99%; POCl3,1,2,4-triazole, Et3N, CH3CN, rt, 4h; (c) aqueous NH3, 1,4-dioxane, rt, 16h; (d) Bz2O, DMF, rt, 16h, 90% from 15; (e) Et3N.3HF, Et3N, THF, rt, 16h, 93%; (f) CNCH2CH2OP (N-iPr2) 2, Tetrazole, NMI, DMF, 95%.

A) Nucleoside (16)

Tert-Butyldimethylsilyl chloride (0.79 g, 5.2 mmol) was added to a solution of nucleoside 14 (1.0 g, 1.7 mmol) and imidazole (0.70 g, 10.4 mmol) in DMF ( 3.5 mL). After stirring for 16h, the reaction was poured into EtOAc and the organic phase was successively extracted with brine, dried (Na2SO4), and concentrated in vacuo. Purification by column chromatography (SiO2, eluting with 50% EtOAc / hexanes provided nucleoside 16 (1.17 g, 99%) as a white solid.

B) Nucleoside (19)

Phosphorous oxychloride (1.27 mL, 13.6 mmol) was added to a chilled suspension (0 ° C) of 1,2,4-triazole (4.0 g, 58.0 mmol) in CH3CN (21 mL). After stirring for 15 min, triethylamine (9.57 mL, 68 mmol) was added to the reaction and stirring was continued for 30 min. A solution of nucleoside 16 (1.17 g, 1.7 mmol) in CH3CN (10 mL) was added to the reaction at 0 ° C. After stirring for 10 min, the ice bath was removed and the reaction was stirred at rt for 4h. The solvent was then removed in vacuo and the residue was partitioned between EtOAc and water. The organic layer was then washed with saturated NaHCO3, brine, dried (Na2SO4) and concentrated in vacuo to provide crude 17, which was used without any further purification.

Aqueous ammonia (4 mL) was added to a solution of nucleoside 17 (above) in dioxane (20 mL). After stirring at rt for 16h, the reaction was concentrated in vacuo and dried under high vacuum for 8h to provide nucleoside 18, which was used without any further purification.

Benzoic anhydride (0.65 g, 2.9 mmol) was added to a solution of nucleoside 18 (above) in DMF (3 mL). After stirring at rt for 16h, the reaction was poured into EtOAc and the organic layer was extracted with saturated NaHCO3, brine, dried (Na2SO4), and concentrated in vacuo. Purification by column chromatography (SiO2, eluting with 50% EtOAc / hexanes provided nucleoside 19 (1.2 g, 90% of 16) as a white solid.

C) Nucleoside (20)

Triethylamine trihydrofluoride (1.48 mL, 9.1 mmol) was added to a solution of nucleoside 19 (1.86 g, 3.7 mmol) and triethylamine (1.03 mL, 7.3 mmol) in THF (15 mL) in a polypropylene tube. After stirring at rt for 16h, the reaction was concentrated in vacuo and the residue was dissolved in EtOAc and the organic layer was washed successively with water, saturated NaHCO3, brine, dried (Na2SO4), and concentrated in vacuo. Purification by column chromatography (SiO2, eluting with 5% MeOH / CHCl3 gave nucleoside 20 (0.91 g, 90%) as a white solid. 1 H NMR (MeOD) δ: 8.62 (d , 1H), 8.02 (d, 1H), 7.63 (m, 6H), 7.38 (m, 7H), 6.96 (d, 4H), 6.65 s, 1H); 4.49 (s, 1H), 4.36 (s, 1H), 4.25 (m, 1H), 3.53 (d, 1H), 3.41 (d, 1H), 1.18 (d , 3H).

D) (1S, 3R, 4R, 6R, 7S) -7- [2-Cyanoethoxy (diisopropylamino) phosphinoxy] -1- (4,4'-dimethoxytrityloxymethyl) -3- (4-Nbenzoylcytosin-1-yl) -6 -methyl-2,5-dioxa-bicyclo [2,2,1] heptane (21)

2-Cyanoethyl-tetraisopropylphosphoramidite (0.63 mL, 2.0 mmol) was added to a solution of nucleoside 20 (0.89 g, 1.3 mmol), tetrazole (73 mg, 1.1 mmol) and N-methylimidazole (26 µL, 0.33 mmol) in DMF (6.6 mL). After stirring at rt for 8h, the reaction was poured into EtOAc and the organic layer was washed with 90% brine, brine, dried (Na2SO4), and concentrated. The residue was dissolved in a minimal amount of EtOAc and this solution was added to hexanes. The resulting precipitate was collected and further purified by column chromatography (SiO2, eluting with EtOAc / hexanes from 75% to 90%) to provide phosphoramidite 21 as a white solid (1.1 g, 95%) . 31 P NMR (CDCl3) δ: 149.34, 149.77.

Example 3

Preparation of uridin-6- (S) -methyl-BNA phosphoramidite, (1S, 3R, 4R, 6S, 7S) -7- [2-cyanoethoxy (diisopropylamino) phosphinoxy] -1- (4,4'-dimethoxytrityloxymethyl) - 3- (uracil-1-yl) -6methyl-2,5-dioxa-bicyclo [2,2,1] heptane (38) Scheme 3 (a) NaH, naphthyl bromide, DMF, rt, 2h, 98%;

(b) Acetic acid, H2O, rt, 16h; (c) NaIO4, dioxane, H2O,

5 rt, 90 minutes; (d) HCHO, NaOH, THF, H2O, rt, 16h, 80% from 22; (e) TBDPSCl, Et3N, DMAP, CH2Cl2, rt, 16h, 61%; (f) Oxalyl chloride, DMSO, Et3N, -78 ° C; (g) MeMgBr, CeCl3, 89% from 26; (h) Deoxalyl chloride, DMSO, Et3N, -78 ° C; (i) DiBAL, CH2Cl2, -78 ° C; (j)

10 MsCl, Et3N, DMAP, CH2Cl2, rt, 1h; (k) Ac2O, AcOH, H2SO4.58% from 28; (l) BSA, Uracil, TMSOTf, MeCN, reflux, 2h; (m) K2CO3, MeOH, rt, 16h, 76% from 34; (n) DDQ, CH2Cl2, H2O, rt, 8h, 80%; (o) Et3N.3HF, Et3N, THF, quant .; (p) DMTCl, pyridine, rt, 16h, 86%; (q)

15 CN (CH2) 2OP (NiPr2) 2, tetrazole, NMI, DMF, 97%. A) Alcohol (22)

Sodium hydride (2.39 g, 59.8 mmol) was carefully added to a chilled (0 ° C) solution of 1.2: 5,6 Di-O-isopropylidene-α-D-allofuranose 1 (12.0g, 46 mmol) commercially available in DMF (75 mL). After stirring for 20 minutes, naphthyl bromide (11.12 g, 50.8 mmol) was added to the reaction and stirring was continued for another 2 h. The reaction was carefully quenched with H2O and then poured into EtOAc and the organic layer was washed with water, brine, dried, and concentrated. Purification by column chromatography (SiO2, EtOAc / hexanes 10% to 33%) provided alcohol 22 as a white solid (18.1 g, 98%).

B) Diol (25)

Alcohol 22 (18g, 46 mmol) was dissolved in glacial acetic acid (150 mL) and H2O (60 mL). The reaction was stirred at rt for 16h after which it was concentrated in vacuo. The residue was then dissolved in EtOAc and the organic layer was washed with saturated NaHCO3, brine, dried, and concentrated to provide crude 23, which was used without any further purification.

A solution of sodium periodate (48 mmol, 10 g) in water (350 mL) was added to a solution of the crude diol 23 obtained above, in 1,4-dioxane (140 mL). After stirring at rt for 90 minutes, the reaction was extracted with EtOAc and the organic layer was further washed with water, brine, dried (Na2SO4) and concentrated to provide aldehyde 24, which was used without any further purification.

The crude aldehyde 24 from above was dissolved in a mixture of THF: H2O (1: 1, 100 mL) and the reaction was cooled in an ice bath. Formaldehyde (25 mL, 35% w / w) and 1N NaOH (100 mL) were added to the reaction. After stirring at rt for 16h, formaldehyde (5 mL) was added to the reaction and stirring was continued for an additional 32h. The reaction was then concentrated to dryness and the residue was partitioned between EtOAc and water. The layers were separated and the organic layer was washed with additional 1N NaOH, water, brine, dried and concentrated to provide diol 25 (12.96 g, 80%, three steps) as a white solid.

C) Alcohol (26)

Tert-Butyldiphenylsilyl chloride (0.75 mL, 2.9 mmol) was added to a chilled solution (0 ° C) of diol 25 (1 g, 2.8 mmol) and triethylamine (0.45 mL, 3.2 mmol). After stirring at rt for 16h, the reaction was poured into EtOAc and washed successively with 5% HCl, saturated NaHCO3, brine, dried (Na2SO4), and concentrated. Purification by column chromatography (SiO2, eluting with EtOAc / hexanes from 10% to 40%) provided alcohol 26 (1.02 g, 61%) as an oil (0.42 g of the protected diol was also isolated with regioisomeric silyl).

D) Alcohol (28)

Dimethylsulfoxide (1.6 mL, 22.4 mmol) was added dropwise to a cooled (-78 ° C) solution of oxalyl chloride (0.98 mL, 11.2 mmol) in CH2Cl2 (70 mL). After stirring for 30 min, a solution of alcohol 26 (4.8 g, 8.0 mmol) in CH2Cl2 (20 mL) was added to the reaction. Stirring was continued for 45 min at -78 ° C and triethylamine (4.72 mL, 33.7 mmol) was added to the reaction. The reaction was stirred at -78 ° C for 15 min after which the ice bath was removed and the reaction was allowed to warm gradually over 45 min. The reaction was then poured into CH2Cl2 and the organic phase was washed successively with 5% aqueous HCl, saturated NaHCO3, brine, dried (Na2SO4) and concentrated in vacuo to provide aldehyde 27, which was used without any further purification.

A suspension of cerium III chloride (2.96 g, 12.0 mmol) in THF (50 mL) was stirred at rt for 90 min. The reaction was cooled in an ice bath and methyl magnesium bromide (8.6 mL of a 1.4 M solution in THF, 12 mmol) was added over 5 min and stirring continued for another 90 min after which the reaction was cooled to -78 ° C. A solution of the crude aldehyde 27 (above) in THF (20 mL) was added to the reaction. After stirring for another 90 min, the reaction was quenched with NH4Cl solution and poured into EtOAc. The organic layer was washed successively with 5% aqueous HCl, saturated NaHCO3, brine, dried (Na2SO4), and concentrated in vacuo. Purification by column chromatography (SiO2, eluting with 20% EtOAc / hexanes) provided alcohol 28 (4.37 g, 89% of 26).

E) Diacetate (32)

Dimethylsulfoxide (1.41 mL, 19.9 mmol) was added dropwise to a cooled (-78 ° C) solution of oxalyl chloride (0.87 mL, 10.0 mmol) in CH2Cl2 (70 mL). After stirring for 30 min, a solution of alcohol 28 (4.35 g, 7.1 mmol) in CH2Cl2 (20 mL) was added to the reaction. Stirring was continued for 45 min at -78 ° C and triethylamine (4.20 mL, 30.0 mmol) was added to the reaction. The reaction was stirred at -78 ° C for 15 min after which the ice bath was removed and the reaction was allowed to warm gradually over 45 min. The reaction was then poured into CH2Cl2 and the organic phase was washed successively with 5% aqueous HCl, saturated NaHCO3, brine, dried (Na2SO4) and concentrated in vacuo to provide ketone 29, which was used without any further purification.

Diisobutylaluminum hydride (13.7 mL of a 1 M solution in CH2Cl2, 13.7 mmol) was added to a chilled solution of 29 (above) in CH2Cl2 (15 mL). After stirring for 2h at -78 ° C, the reaction was quenched by the addition of saturated NH4Cl and poured into CHCl3, The organic layer was then washed successively with 5% aqueous HCl, saturated NaHCO3, brine, dried (Na2SO4 ) and concentrated in vacuo to provide alcohol 30 which was used without any further purification.

Methanesulfonyl chloride (0.11 mL, 1.4 mmol) was added to a chilled solution (0 ° C) of alcohol 30 (above), triethylamine (1.77 mL, 10.5 mmol) and 4-dimethylaminopyridine (85 mg, 0.7 mmol) in CH2Cl2 (21 mL). After stirring at rt for 1h, the reaction was poured into CHCl3 and the organic layer was washed successively with 5% aqueous HCl, saturated NaHCO3, brine, dried (Na2SO4) and concentrated in vacuo to provide mesylate 31, which it was used without any purification.

Concentrated H2SO4 (2 drops) was added to a solution of mesylate 31 (above) in glacial acetic acid (15 mL) and acetic anhydride (3.0 mL). After stirring at rt for 1h, the reaction was poured into EtOAc and the organic layer was washed with water, saturated NaHCO3, brine, dried (Na2SO4) and concentrated in vacuo. Purification by column chromatography (SiO2, eluting with 20% to 33% EtOAc / hexanes provided diacetate 32 (3.0 g, 58% of 28).

F) Nucleoside (34)

N, O-bis (trimethylsilyl) acetamide (3.45 mL, 14.0 mmol) was added to a suspension of diacetate 32 (3.0 g, 4.1 mmol) and uracil (0.57 g, 5.1 mmol) in CH3CN (20 mL). After heating at 40 ° C for 15 min to obtain a clear solution, trimethylsilyl triflate (0.95 mL, 5.3 mmol) was added to the reaction. After refluxing for 2h, the reaction was cooled to rt and poured into EtOAc. The organic layer was washed with saturated NaHCO3, brine, dried (Na2SO4) and concentrated in vacuo to provide crude nucleoside 33, which was used without any purification.

K2CO3 (1.66 g, 12.0 mmol) was added to a solution of nucleoside 33 (above) in MeOH (40 mL). After stirring at rt for 16h, the reaction was concentrated in vacuo and the residue was dissolved in 25% pyridine / EtOAc and extracted with brine, dried (Na2SO4), and concentrated in vacuo. Purification by column chromatography (SiO2, eluting with 40% EtOAc / hexanes provided nucleoside 34 (2.0 g, 76% from 32) as a white solid.

G) Nucleoside (35)

2,3-Dichloro-5,6-dicyano-1,4-benzoquinone (DDQ) (1.4 g, 6.2 mmol) was added to a solution of the nucleoside34 (2.0 g, 3.1 mmol) in dichloromethane (30 mL) and H2O (1.5 mL). After stirring for 3h at rt, additional DDQ (0.5g) was added to the reaction. After stirring for another 10 minutes, the reaction was concentrated in vacuo and the residue was dissolved in EtOAc. The organic layer was then washed successively with water, water: saturated NaHCO3 (1: 1), brine, dried (Na2SO4) and concentrated. Purification by column chromatography (SiO2, 80% EtOAc / hexanes provided nucleoside 35 (1.25 g, 80%) as a white solid.

H) Nucleoside (36)

Triethylamine trihydrofluoride (2.4 mL, 14.7 mmol) was added to a solution of nucleoside 35 (1.25 g, 2.5 mmol) and triethylamine (1.0 mL, 7.4 mmol) in THF (25 mL) in a polypropylene tube. After stirring at rt for 24h, the reaction was concentrated in vacuo and the residue was dissolved in EtOAc. The organic layer was then washed with water, saturated NaHCO3, brine, dried, and concentrated (Na2SO4). Purification by column chromatography (SiO2, eluting with 5% to 10% MeOH / CHCl3 provided nucleoside 36 (0.88 g) as a white solid (Et3N contaminated product).

I) Nucleoside (37)

Dimethoxytrityl chloride (0.91 g, 2.7 mmol) was added to a solution of nucleoside 36 (above) in pyridine (12 mL). After stirring at rt for 16h, the reaction was poured into EtOAc and the organic layer was washed with brine, dried, and concentrated. Purification by column chromatography (SiO2, eluting with 90% EtOAc / hexanes provided nucleoside 37 (1.28 g, 86% from 36) as a white solid.

J) (1S, 3R, 4R, 6S, 7S) -7- [2Cyanoethoxy (diisopropylamino) phosphinoxy] -1- (4,4'-dimethoxytrityloxymethyl) -3- (uracil-1-yl) -6-methyl-2, 5-dioxa-bicyclo [2,2,1] heptane (38)

5

2-Cyanoethyl-tetraisopropylphosphoramidite (0.46 mL, 1.5 mmol) was added to a solution of nucleoside 37 (0.59 g, 1.0 mmol), tetrazole (57 mg, 0.82 mmol) and N-methylimidazole (20 µL, 0.25 mmol) in DMF (5 mL). Later

After stirring at rt for 8h, the reaction was poured into EtOAc and the organic layer was washed with 90% brine, brine, dried (Na2SO4) and concentrated. Purification by column chromatography (SiO2, eluting with 66% to 75% EtOAc / hexanes provided phosphoramidite 38

15 as a white solid (0.75g, 97%). 31 P NMR (CDCl3) δ: 149.36, 149.53.

Example 4

20 Preparation of N-Bz-cytosine-6- (S) -methyl-BNAphosphoramidite, 2.2 Preparation of (1S, 3R, 4R, 6S, 7S) -7- [2cyanoethoxy (diisopropylamino) phosphinoxy] -1- (4.4 'dimethoxytrityloxymethyl) -3- (4-N-benzoylcytosin-1-yl) -6-methyl-2,5-dioxa-bicyclo [2,2,1] heptane (44)

25

Scheme 4 (a) TBSCl, Et3N, DMAP, CH2Cl2, rt, 16h, 97%; (b) 1,2,4-Triazole, CH3CN, rt, 4h; (c) aqueous NH3, 1,4-dioxane, rt, 16h; (d) Bz2O, DMF, rt, 16h, 91% from

5 39; (e) Et3N.3HF, Et3N, THF, rt, 16h, 87%; (f) CNCH2CH2OP (N-iPr2) 2, Tetrazole, NMI, DMF, 90%.

A) Nucleoside (39)

10 Tert-butyldimethylsilyl chloride (0.45 g, 3.0 mmol) was added to a solution of nucleoside 37 (0.59 g, 1.0 mmol) and imidazole (0.41 g, 6.0 mmol) in DMF (2 mL). After stirring at rt for 16h, the reaction was poured into EtOAc and the organic phase was extracted

Successively with brine, dried (Na2SO4) and concentrated in vacuo. Purification by column chromatography (SiO2, eluting with 50% EtOAc / hexanes provided nucleoside 39 (0.68 g, 97%) as a white solid.

twenty

B) Nucleoside (42)

Phosphorous oxychloride (0.74 mL, 8.0 mmol) was added to a refrigerated (0 ° C) suspension of 1,2,4-triazole (2.35 g, 34.0 mmol) in CH3CN (16 mL). After stirring for 15 min, triethylamine (5.6 mL, 40 mmol) was added to the reaction and stirring was continued for 30 min. A solution of nucleoside 39 (0.68 g, 1.0 mmol) in CH3CN (7 mL) was added to the reaction at 0 ° C. After stirring for 10 min, the ice bath was removed and the reaction was stirred at rt for 4h. The solvent was then removed in vacuo and the residue was partitioned between EtOAc and water. The organic layer was then washed with saturated NaHCO3, brine, dried (Na2SO4) and concentrated in vacuo to provide crude, which was used without any further purification.

Aqueous ammonia (2.5 mL) was added to a solution of nucleoside 40 (above) in dioxane (12 mL). After stirring at rt for 16h, the reaction was concentrated in vacuo and dried under high vacuum for 8h to provide nucleoside 41, which was used without any further purification.

Benzoic anhydride (0.38 g, 1.7 mmol) was added to a solution of nucleoside 41 (above) in DMF (2 mL). After stirring at rt for 16h, the reaction was poured into EtOAc and the organic layer was extracted with saturated NaHCO3, brine, dried (Na2SO4), and concentrated in vacuo. Purification by column chromatography (SiO2, eluting with 50% EtOAc / hexanes provided nucleoside 42 (0.72 g, 91% from 39) as a white solid.

C) Nucleoside (43)

Triethylamine trihydrofluoride (0.89 mL, 5.5 mmol) was added to a solution of nucleoside 42 (0.72 g, 0.91 mmol) and triethylamine (0.30 mL, 2.2 mmol) in THF (9 mL) in a polypropylene tube. After stirring at rt for 16h, the reaction was concentrated in vacuo and the residue was dissolved in EtOAc and the organic layer was washed successively with water, saturated NaHCO3, brine, dried (Na2SO4), and concentrated in vacuo. Purification by column chromatography (SiO2, eluting with 25% to 40% acetone / CHCl3 gave nucleoside 43 (0.53 g, 87%) as a white solid. 1H NMR (CDCl3): δ 8, 34 (s, broad, 1H), 8.33 (d, 1H), 7.83 (d, 1H), 7.57-7.26 (m, 16H), 6.89 (d, 4H), 5 , 72 (s, 1H), 4.75 (s, 1H), 4.22 (s, 1H), 4.14 (m, 1H), 3.83 (s, 6H), 3.63 (d, 1H), 3.46 (s, 1H), 1.20 (d, 3H).

D) (1S, 3R, 4R, 6S, 7S) -7- [2-Cyanoethoxy (diisopropylamino) phosphinoxy] -1- (4,4'-dimethoxytrityloxymethyl) -3- (4-NBenzoylcytosin-1-yl) -6 -methyl-2,5-dioxabicyclo [2,2,1] heptane (44)

2-Cyanoethyl-tetraisopropylphosphoramidite (0.37 mL, 1.2 mmol) was added to a solution of nucleoside 43 (0.89 g, 1.3 mmol), tetrazole (43 mg, 0.63 mmol) and N-methylimidazole (16 µL, 0.20 mmol) in DMF (4 mL). After stirring at rt for 8h, the reaction was poured into EtOAc and the organic layer was washed with 90% brine, brine, dried (Na2SO4), and concentrated. Purification by column chromatography (SiO2, eluting with EtOAc / hexanes from 75% to 90% provided phosphoramidite44 as a white solid (0.61 g, 90%).

Example 5

(1S, 3R, 4R, 6S, 7S) -7- [2-Cyanoethoxy (diisopropylamino) phosphinoxy] -1- (4,4'-dimethoxytrityloxymethyl) -3- (6-N-benzoyladenin-9-yl) -6-methyl -2,5-dioxabicyclo [2,2,1] heptane (51)

Scheme 5 (a) 6-N-Benzoyladenine, BSA, TMSOTf, DCE, reflux, 8h; (b) Bz2O, DMF, rt, (d) DDQ, CH2Cl2, H2O, rt; 10

16h, (e) Et3N.3HF, Et3N, THF, rt, 16h; (f) DMTCl, Pyridine, rt, 16h; (g) CNCH2CH2OP (N-iPr2) 2, Tetrazole, NMI, DMF.

15 A) Nucleoside (46)

N, O-bis (trimethylsilyl) acetamide (1.1 mL,

4.50 mmol) to a suspension of diacetate 32 (1.0 g,

1.4 mmol) and 6-N-benzoyladenine (0.48 g, 2.0 mmol) in

20 dichloroethane (14 mL). The reaction mixture turned clear after 45 minutes under reflux and was cooled in an ice bath and trimethylsilyl triflate (0.49 mL, 2.7 mmol) was added. After refluxing for 8 hours the reaction was cooled to room temperature and poured into EtOAc. The organic layer was washed with saturated NaHCO3 and brine then dried (Na2SO4) and concentrated in vacuo to provide crude nucleoside 45, which was used without purification.

K2CO3 (0.38 g, 2.7 mmol) was added to a solution of nucleoside 45 (above) in MeOH (14 mL). After stirring at room temperature for 24 hours the reaction was concentrated in vacuo. The residue was suspended in EtOAc, extracted with water and brine then dried (Na2SO4) and concentrated in vacuo. Purification by column chromatography (SiO2, eluting with 1 to 2.5% MeOH / CHCl3 provided nucleoside 46 as a white solid (0.69 g, 73% from 32).

B) Nucleoside 47

Nucleoside 47 is prepared from nucleoside 46 by reaction with benzoic anhydride (1.5-2 eq) in dry DMF. C) Phosphoramidite 51

Phosphoramidite 51 is prepared from nucleoside 47 using the procedures illustrated in Example 3 for phosphoramidite 38 from nucleoside 34.

Example 6

(1S, 3R, 4R, 6R, 7S) -7- [2-Cyanoethoxy (diisopropylamino) phosphinoxy] -1- (4,4'-dimethoxytrityloxymethyl) -3- (6-N-benzoyladenin-9-yl) -6-methyl -2,5-dioxabicyclo [2,2,1] heptane (60)

Scheme 6 (a) MsCl, Et3N, DMAP, CH2Cl2, rt, 4h; (b) Ac2O, AcOH, cat. H2SO4, rt, 3h, 87% from 28; (c) 6-Nbenzoyladenine, BSA, TMSOtf, DCE, reflux, 2h; (d) K2CO3,

5 MeOH, rt, 16h; (e) Bz2O, DMF, rt; (f) DDQ, CH2Cl2, H2O, rt; (g) Et3N.3HF, Et3N, THF, rt, 16h; (h) DMTCl, Pyridine, rt, 16h; (i) CNCH2CH2OP (N-iPr2) 2, Tetrazole, NMI, DMF.

10 A) Diacetate (52)

Methanesulfonyl chloride (1.33 mL, 16.8 mmol) was added dropwise to a chilled solution (0 ° C) of alcohol 28 (7.37 g, 12.0 mmol), triethylamine (2.82

15 mL, 20.2 mmol) and DMAP (0.20 g, 1.1 mmol) in dichloromethane (25 mL). After stirring for 2 hours at room temperature, the reaction was diluted with dichloromethane and the organic layer was washed with 5% HCl, a saturated sodium bicarbonate solution, brine,

20 dried (Na2SO4) and concentrated. The crude mesylate 52 thus obtained was used without further purification.

B) Diacetate (53)

Concentrated sulfuric acid (10 drops) was added to a solution of mesylate 52 (above) in acetic anhydride (7.2 mL) and acetic acid (36 mL). After stirring at room temperature for 2 hours the reaction was concentrated under high vacuum. The residue was dissolved in ethyl acetate and the organic layer was carefully washed with water, a saturated sodium bicarbonate solution (until pH> 8) and brine then dried (Na2SO4) and concentrated. The residue was purified by column chromatography (SiO2, eluting with EtOAc / hexanes from 25 to 35%) to provide diacetate53 (7.66 g, 87% of 28) as a viscous oil.

C) Phosphoramidite (60)

Phosphoramidite 60 is prepared from diacetate 53 using the procedures illustrated in Example 3 for phosphoramidite 51 from diacetate 32.

Example 7

(1S, 3R, 4R, 6S, 7S) -7- (2-Cyanoethoxy (diisopropylamino) phosphinoxy] -1- (4,4'-dimethoxytrityloxymethyl) -3- (2-NIsobutyrylguanin-9-yl) -6-methyl -2,5-dioxabicyclo [2,2,1] heptane (67)

Scheme 7 (a) 2-amino-6-chloropurine, BSA, TMSOTf, DCE, reflux, 2h; (b) 3-Hydroxypropionitrile, NaH, THF, 4h, 82% from 32; (c) Isobutyric anhydride, DMAP, DMF, 60C, 24h, 71%; (d) DDQ, CH2Cl2, H2O, rt, 16h, 91%; (e) Et3N.3HF, Et3N, THF, rt, 16h, 97%; (f) DMTCl, Pyridine, rt, 16h, 85%; (g) CNCH2CH2OP (N-iPr2) 2, Tetrazole, NMI, DMF.

A) Nucleoside (61)

10 N, O-bis (trimethylsilyl) acetamide (3.8 mL, 15.5 mmol) was added to a suspension of diacetate 32 (3.44 g, 4.7 mmol) and 2-amino-6-chloropurine (1 , 18 g, 7.0 mmol) in dichloroethane (46 mL). After refluxing

For 45 minutes to obtain a clear solution, the reaction was cooled in an ice bath and trimethylsilyl triflate (1.69 mL, 9.4 mmol) was added. After refluxing for 8 hours, the reaction was cooled to room temperature and poured into chloroform.

The organic layer was washed with saturated NaHCO3 and brine then dried (Na2SO4) and concentrated in vacuo to provide crude nucleoside 61, which was used without purification.

B) Nucleoside (62)

3-Hydroxypropionitrile (1.67 mL, 24.5 mmol) was added dropwise to a stirred suspension of sodium hydride (1.07 g, 27.0 mmol, 60% w / w) in dry THF (10 mL). After stirring for 20 minutes, a solution of crude nucleoside 61 (above) in dry THF (25 mL) was added. Stirring was continued for 5 hours at room temperature after which time the reaction was carefully quenched by the addition of a saturated ammonium chloride solution. The reaction was poured into ethyl acetate and the organic layer was extracted with brine, dried (Na2SO4), and concentrated. Purification of the residue by column chromatography (SiO2, eluting with CHCl3 to 2.5% MeOH / CHCl3 provided nucleoside 62 (3.18 g, 82% from 32) as a light brown solid.

C) Nucleoside (63)

Isobutyric anhydride (1.5 mL, 9.3 mmol) was added to a solution of nucleoside 62 (3.19 g, 4.6 mmol) and 4-dimethylaminomethylpyridine (0.11 g, 0.93 mmol) in DMF ( 27 mL). After stirring at 60 ° C for 14 hours an additional amount of isobutyric anhydride (1.5 mL, 9.3 mmol) was added to the reaction and stirring was continued at 60 ° C for another 12 hours. The reaction was then cooled to room temperature, diluted with EtOAc, and the organic layer was washed with water, saturated sodium bicarbonate solution, brine, dried (Na2SO4), and concentrated. Purification by column chromatography (SiO2, acetone / CHCl3 5% to 10%) provided nucleoside 63 (2.5 g, 71%) as a yellowish foam.

D) Nucleoside (64)

DDQ (1.12 g, 5.0 mmol) was added to a solution of nucleoside 63 (2.5 g, 3.3 mmol) in dichloromethane (33 mL) and H2O (1.7 mL). After stirring for 2 hours at room temperature additional DDQ (1.0 g) was added. Stirring was continued at room temperature for another 6 hours after which time the reaction was stored in the refrigerator (4 ° C) for 16 hours. The reaction was then concentrated in vacuo and the residue was dissolved in ethyl acetate. The organic layer was washed with water, 10% sodium bisulfite solution (2x), saturated sodium bicarbonate solution, and brine then dried (Na2SO4) and concentrated. Purification by column chromatography (SiO2, eluting with 5% MeOH / CHCl3 provided nucleoside 64 (1.84 g, 91%).

E) Nucleoside (65)

Triethylamine trihydrofluoride (2.88 mL, 17.9 mmol) was added to a solution of nucleoside 64 (1.84 g, 3.0 mmol) and triethylamine (1.25 mL, 8.9 mmol) in THF (30 mL) in a polypropylene tube. After stirring at room temperature for 24 hours the reaction was concentrated in vacuo and the residue was dissolved in EtOAc. The organic layer was then washed with water, saturated NaHCO3, and brine then dried (Na2SO4) and concentrated. Purification by column chromatography (SiO2, eluting with 5% to 10% MeOH / CHCl3 provided nucleoside 65 (1.05 g, 97%) as a white solid.

F) Nucleoside (66)

Dimethoxytrityl chloride (1.07 g, 3.2 mmol) was added to a solution of nucleoside 65 (1.00 g, 2.7 mmol) in pyridine (13 mL). After stirring at room temperature for 16 hours the reaction was poured into EtOAc and the organic layer was washed with brine, dried, and concentrated. Purification by column chromatography (SiO2, eluting with 2.5 to 5% MeOH / CHCl3 provided nucleoside 66 (1.52 g, 85%) as a white foam.

G) (1S, 3R, 4R, 6S, 7S) -7- [2Cyanoethoxy (diisopropylamino) phosphin-oxy] -1- (4,4'-dimethoxytrityloxymethyl) -3- (2-N-Isobutyrylguanin-9-yl) - 6-methyl-2,5-dioxa-bicyclo [2,2,1] heptane (67)

2-Cyanoethyl-tetraisopropylphosphoramidite (1.06 mL, 3.4 mmol) was added to a solution of nucleoside 66 (1.52 g, 2.2 mmol), tetrazole (0.12 g, 1.7 mmol) and N-methylimidazole (45 µL, 0.56 mmol) in DMF (11 mL). After stirring at room temperature for 8 hours the reaction was poured into EtOAc and the organic layer was washed with 90% brine, brine, dried (Na2SO4) and concentrated. Purification by column chromatography (SiO2, eluting with 2.5% MeOH / CHCl3 provided phosphoramidite 67 as a white solid (1.65 g, 84%) .31 P NMR (CDCl3) δ: 148, 70, 145.81.

Example 8

(1S, 3R, 4R, 6R, 7S) -7- [2-Cyanoethoxy (diisopropylamino) phosphinoxy] -1- (4,4'-dimethoxytrityloxymethyl) -3- (2-NIsobutyrylguanin-9-yl) -6-methyl -2,5-dioxabicyclo [2,2,1] heptane (74)

Scheme 8 (a) 2-amino-6-chloropurine, BSA, TMSOTf, DCE, reflux, 2h; (b) 3-Hydroxypropionitrile, NaH, THF, 4h;

(c) Isobutyric anhydride, DMAP, DMF, 60C, 24h; (d) DDQ, CH2Cl2, H2O, rt, 16h; (e) Et3N.3HF, Et3N, THF, rt, 16h;

(f) DMTCl, Pyridine, rt, 16h; (g) CNCH2CH2OP (N-iPr2) 2, Tetrazole, NMI, DMF.

Phosphoramidite 74 is prepared from

10 diacetate 53 using the same procedures illustrated for phosphoramidite 67 from diacetate 32.

Example 9

15 (1S, 3R, 4R, 6R, 7S) -7- [2-Cyanoethoxy (diisopropylamino) phosphinoxy] -1- (4,4'-dimethoxytrityloxymethyl) -3- (uracil-1-yl) -6methoxymethyl-2, 5-dioxa-bicyclo [2,2,1] heptane (83)

twenty

Scheme 9 (a) Oxalyl chloride, DMSO, Et3N, CH2Cl2, -78 ° C; (b) MeOHCH2Br, Mg, HgCl2, THF, -20 ° C,> 95% from 26; (c) MsCl, Et3N, DMAP, CH2Cl2, 85%; (d) Ac2O, AcOH,

5H2SO4, rt, 3h, 84%; (e) Uracil, BSA, TMSOTf, MeCN, reflux, 2h; (f) K2CO3, MeOH, 89% from 77a-b; (g) DDQ, CH2Cl2, H2O, 8h, rt, 98% combined yield for 80a and 80b; (h) Et3N.3HF, Et3N, THF, rt, 16h; (i) DMTCl, pyridine, 16h, rt, 90%; (j) CN (CH2) 2OP (N-iPr2) 2, Tetrazole,

10 NMI, DMF, 96%.

A) Alcohols (75a-b)

Dimethylsulfoxide (3.5 mL, 50.0 mmol) was added to

15 a solution of oxalyl chloride (2.2 mL, 25.0 mmol)

in dichloromethane (130 mL) at -78 ° C. After shaking

over 30 minutes a solution of alcohol 26 was added

(10.0 g, 16.7 mmol) in dichloromethane (30 mL) at

reaction over 10 minutes. After stirring for another 45 minutes, triethylamine (10.5 mL, 75.0 mmol) was slowly added to the reaction. After the addition was complete, the ice bath was removed and the reaction was allowed to gradually warm to 0 ° C (ca 1 hour) and transferred to a separatory funnel. The organic layer was washed successively with 5% HCl, saturated sodium bicarbonate solution, and brine then dried (Na2SO4) and concentrated to provide aldehyde 27, which was dried under high vacuum (18 hours) and used without additional purification.

A mixture of magnesium chips (2.5 g, 102.8 mmol) and mercury (II) chloride (93 mg, 0.34 mmol) was covered with dry THF (5 mL) and the reaction was cooled to -20 ° C. A few drops of pure methoxymethyl bromide were added to start the reaction. After waiting for a few minutes, a solution of methoxymethyl bromide (9.33 mL, 102.8 mmol) in THF (12 mL) (1 mL / 10 minutes via syringe) was added to the reaction over time. long about 3 hours. The temperature of the external bath was very carefully kept between -20 and -25 ° C during the addition. A small volume of dry THF (5 mL) was added intermittently (over 3 hours) to the reaction to facilitate stirring. After the bromide addition was complete, the reaction was stirred at -25 ° C for 100 minutes and a solution of the crude aldehyde (27) in THF (30 mL) was added. After stirring at -20 ° C for 45 minutes, no starting aldehyde 27 was detected by TLC. The reaction was carefully quenched with a saturated ammonium chloride solution and diluted with ethyl acetate. The organic layer was washed with 5% HCl, saturated sodium bicarbonate solution, and brine then dried (Na2SO4) and concentrated. Purification by column chromatography (SiO2, eluting with EtOAc / hexanes from 25 to 30%) provided the alcohols 75ab (quantitative) as a mixture (of isomers approximately 1: 1).

B) Mesylates (76a-b)

Methanesulfonyl chloride (2.3 mL, 29.2 mmol) was added to a chilled solution (0 ° C) of alcohols 75a-b (13.38 g, 20.8 mmol) dissolved in triethylamine (5.3 mL , 37.9 mmol) and DMAP (0.36 g, 2.9 mmol) in dichloromethane (42 mL). After stirring for 2 hours, additional methanesulfonyl chloride (0.5 mL) was added. Stirring was continued for 1 hour and the reaction was diluted with chloroform. The organic layer was washed successively with 5% HCl, saturated sodium bicarbonate solution, and brine then dried (Na2SO4) and concentrated. Purification by column chromatography (SiO2, eluting with 20% EtOAc / hexanes) gave the mesylates 76a-b (12.8 g, 85%) as a viscous oil.

C) Diacetates (77a-b)

Concentrated sulfuric acid (6 drops) was added to a solution of mesylates 76a-b (12.8 g, 17.8 mmol), acetic acid (50 mL) and acetic anhydride (10 mL). After stirring for 3 hours at room temperature the reaction was considered complete by LCMS and most of the solvent was evaporated under high vacuum. The concentrated mixture was diluted with ethyl acetate and the organic layer was washed with water, a saturated sodium bicarbonate solution (until pH> 10), and brine then dried (Na2SO4) and concentrated. Purification by column chromatography (SiO2, eluting with 20% EtOAc / hexanes provided an anomeric mixture of diacetates 77a-b (11.44 g, 84%) as a viscous oil.

D) Nucleosides (79a-b)

N, O-bis (trimethylsilyl) acetamide (14.76 mL, 59.9 mmol) was added to a suspension of diacetates 77a-b (11.44 g, 15.0 mmol) and uracil (3.35 g, 29.9 mmol) in CH3CN (75 mL). After heating at 40 ° C for 15 minutes to obtain a clear solution, the reaction was cooled in an ice bath and trimethylsilyl triflate (4.06 mL, 22.5 mmol) was added. After refluxing for 2 hours the reaction was cooled to room temperature and poured into EtOAc. The organic layer was washed with a semisaturated sodium bicarbonate solution and brine then dried (Na2SO4) and concentrated in vacuo to provide the crude nucleosides 78a-b, which were used without purification.

Potassium carbonate (5.30 g, 38.4 mmol) was added to a solution of nucleosides 78a-b (above) in methanol (130 mL). After stirring at room temperature for 16 hours the reaction was concentrated in vacuo. The residue was dissolved in ethyl acetate and extracted with water and brine then dried (Na2SO4) and concentrated in vacuo. Purification by column chromatography (SiO2, eluting with 5 to 7.5% acetone / chloroform provided nucleosides 79a-b (9.0 g, 89% from 77a-b) as a white solid .

E) Nucleosides (80a and 80b)

DDQ (20.0 mmol, 4.5 g) was added to a solution of nucleosides 79a-b (9.0 g, 13.3 mmol) in dichloromethane (130 mL) and water (6.5 mL). The biphasic reaction was stirred at room temperature for 2 hours after which additional DDQ (2.75 g) was added to the reaction. After another 2 hours additional DDQ (1.1 g) was added to the reaction and stirring was continued for another 4 hours after which the reaction was stored in a refrigerator for 16 hours. The next morning, LCMS showed traces of nucleosides 79ab, so additional DDQ (0.9 g) was added to the reaction and stirring continued for 2 hours, at which point no more nucleosides 79a-b were detected. by TLC and LCMS. The solvent was evaporated in vacuo and the residue was partitioned between ethyl acetate and water. The organic layer was washed with sodium bisulfite solution (2x), saturated sodium bicarbonate solution, and brine then dried (Na2SO4) and concentrated. Purification by column chromatography (SiO2, eluting 10-20% acetone / chloroform provided nucleosides 80a (slower run application) and 80b (faster run application) respectively (7.0 g combined yield, 98%) .

F) Nucleoside (81)

Triethylamine trihydrofluoride (12.2 mL, 74.8 mmol) was added to a solution of nucleoside 80a (6.7 g, 12.5 mmol) and triethylamine (5.2 mL, 37.4 mmol) in THF (120 mL). After stirring at room temperature for 16 hours the reaction was concentrated to dryness in vacuo. The residue was purified by column chromatography (SiO2, eluting with 7.5% to 12.5% MeOH / CHCl3) to provide nucleoside 81 (contaminated with triethylamine.hydrofluoride salt,> 100% yield), which was used without purification additional.

G) Nucleoside (82)

4,4'-Dimethoxytrityl chloride (DMTCI, 4.8 g, 14.3 mmol) was added to a solution of nucleoside 81 (12.5 mmol) in pyridine (75 mL). After stirring for 16 hours at room temperature, additional DMTCl (2.4 g) was added to the reaction. After stirring for another 4 hours MeOH (10 mL) was added. After stirring for 30 minutes, the reaction was diluted with ethyl acetate and the organic layer was washed with water and brine, then dried (Na2SO4) and concentrated. Purification by column chromatography (SiO2, 60-75% EtOAc / hexanes provided nucleoside 82 (6.73 g, 90%) as a white foam.

H) (1S, 3R, 4R, 6R, 7S) -7- [2Cyanoethoxy (diisopropylamino) phosphin-oxy] -1- (4,4'-dimethoxytrityloxymethyl) -3- (uracil-1-yl) -6-methoxymethyl2, 5-dioxa-bicyclo [2,2,1] heptane (83)

2-Cyanoethyl-tetraisopropylphosphoramidite (1.58 mL, 5.0 mmol) was added to a solution of nucleoside 82 (2.0 g, 3.3 mmol), tetrazole (0.19 g, 2.6 mmol) and N-methylimidazole (68 µL, 0.83 mmol) in DMF (16 mL). After stirring at room temperature for 8 hours the reaction was poured into EtOAc. The organic layer was washed with 90% brine followed by brine then dried (Na2SO4) and concentrated. Purification by column chromatography (SiO2, eluting with 66% to 75% EtOAc / hexanes provided phosphoramidite 83 as a white solid (2.54 g, 96%) .31 P NMR (CDCl3) δ: 149, 78, 149.44.

Example 10

(1S, 3R, 4R, 6S, 7S) -7- [2-Cyanoethoxy (diisopropylamino) phosphinoxy] -1- (4,4'-dimethoxytrityloxymethyl) -3- (uracil-1-yl) -6methoxymethyl-2,5 -dioxa-bicyclo- [2,2,1] heptane (86)

Scheme 10 (a) Et3N.3HF, Et3N, THF, rt, 16h; (i) DMTCl, pyridine, 16h, rt, 90%; (j) CN (CH2) 2OP (N-iPr2) 2, Tetrazole,

10 NMI, DMF, 96%.

A) Nucleoside (84)

Triethylamine trihydrofluoride (11.6 mL,

71.5 mmol) to a solution of nucleoside 80b (6.43 g, 12.0 mmol) and triethylamine (5.0 mL, 35.7 mmol) in THF (125 mL). After stirring at room temperature for 16 hours the reaction was concentrated to dryness in vacuo. The residue was purified by chromatography on

20 column (SiO2, eluting with MeOH / CHCl3 from 7.5% to 12.5%) to provide nucleoside 84 (contaminated with triethylamine hydrofluoride salt,> 100% yield), which was used without further purification.

25 B) Nucleoside (85)

4,4'-dimethoxytrityl chloride (DMTCI,

4.6 g, 13.8 mmol) to a solution of nucleoside 84

(12.0 mmol) in pyridine (72 mL). After shaking

30 for 16 hours at room temperature was added to the reaction additional DMTCl (2.3 g). After stirring for another 4 hours MeOH (10 mL) was added. After stirring for 30 minutes, the reaction was diluted with ethyl acetate and the organic layer was washed with water and brine then dried (Na2SO4) and concentrated. Purification by column chromatography (SiO2, 60-75% EtOAc / hexanes provided nucleoside 85 (6.52 g, 91%) as a white foam.

C) (1S, 3R, 4R, 6S, 7S) -7- [2Cyanoethoxy (diisopropylamino) phosphin-oxy] -1- (4,4'-dimethoxytrityloxymethyl) -3- (uracil-1-yl) -6-methoxymethyl2, 5-dioxa-bicyclo [2,2,1] heptane (86)

2-Cyanoethyl-tetraisopropylphosphoramidite (1.58 mL, 5.0 mmol) was added to a solution of nucleoside 85 (2.0 g, 3.3 mmol), tetrazole (0.19 g, 2.7 mmol) and N-methylimidazole (68 µL, 0.83 mmol) in DMF (17 mL). After stirring at room temperature for 8 hours the reaction was poured into EtOAc. The organic layer was washed with 90% brine then brine and dried (Na2SO4) and concentrated. Purification by column chromatography (SiO2, eluting with 66% to 75% EtOAc / hexanes provided phosphoramidite 86 as a white solid (2.55 g, 96%) .31 P NMR (CDCl3) δ: 149 , 97, 149.78.

Example 11

(1S, 3R, 4R, 6R, 7S) -7- [2-Cyanoethoxy (diisopropylamino) phosphinoxy] -1- (4,4'-dimethoxytrityloxymethyl) -3- (4-NBenzoylcytosin-1-yl) -6-methoxymethyl -2,5-dioxabicyclo [2,2,1] heptane (92) Scheme 11 (a) TBSCl, Et3N, DMAP, CH2CH2, rt, 16h, 98%;

(b) POCl3, 1,2,4-Triazole, Et3N, CH3CN, rt, 4h; (c) NH3

5 aqueous, 1,4-dioxane, rt, 16h; (d) Bz2O, DMF, rt, 16h, 91% from 82; (e) Et3N.3HF, Et3N, THF, rt, 16h, 94%;

(F)

CNCH2CH2OP (N-iPr2) 2, Tetrazole, NMI, DMF, 84%.

(TO)

Nucleoside (87)

10 Tert-butyldimethylsilyl chloride (2.40 g, 15.9 mmol) was added to a solution of nucleoside 82 (3.20 g, 5.3 mmol) and imidazole (2.16 g, 31.8 mmol) in DMF (10.6 mL). After stirring at room temperature for 16

15 hours the reaction was poured into EtOAc. The organic phase was successively extracted with brine, dried (Na2SO4) and concentrated in vacuo. Purification by column chromatography (SiO2, eluting with 50% EtOAc / hexanes provided nucleoside 87 (3.70 g, 98%) as a

20 white solid.

B) Nucleoside (90)

Phosphorous oxychloride (3.86 mL, 41.4 mmol) was added to a chilled suspension (0 ° C) of 1,2,4-triazole (12.15 g, 176.1 mmol) in CH3CN (80 mL). After stirring for 15 minutes, triethylamine (29.0 mL, 207.2 mmol) was added and stirring continued for 30 minutes. A solution of nucleoside 87 (3.70 g, 5.2 mmol) in CH3CN (20 mL) was added to the reaction mixture at 0 ° C. After stirring for 10 minutes the ice bath was removed and the reaction was stirred at room temperature for 4 hours. The solvent was removed in vacuo and the residue was partitioned between. EtOAc and water. The organic layer was then washed with saturated NaHCO3 and brine, then dried (Na2SO4) and concentrated in vacuo to provide crude 88, which was used without further purification.

Aqueous ammonia (10 mL) was added to a solution of nucleoside 88 (above) in dioxane (50 mL). After stirring at room temperature for 16 hours the reaction was concentrated in vacuo and dried in high vacuum for 8 hours to provide nucleoside 89, which was used without further purification.

Benzoic anhydride (1.99 g, 8.8 mmol) was added to a solution of nucleoside 89 (above) in DMF (10 mL). After stirring at room temperature for 16 hours the reaction was poured into EtOAc. The organic layer was extracted with saturated NaHCO3 and brine, then dried (Na2SO4) and concentrated in vacuo. Purification by column chromatography (SiO2, eluting with 50% EtOAc / hexanes provided nucleoside 90 (3.86 g, 91% from 87) as a white solid.

C) Nucleoside (91)

Triethylamine trihydrofluoride (4.54 mL, 27.9 mmol) was added to a solution of nucleoside 90 (3.81 g, 4.7 mmol) and triethylamine (1.56 mL, 11.2 mmol) in THF (46 mL) in a polypropylene tube. After stirring at room temperature for 16 hours the reaction was dried in vacuo and the residue was dissolved in EtOAc. The organic layer was washed successively with water, saturated NaHCO3, and brine, then dried (Na2SO4) and concentrated in vacuo. Purification by column chromatography (SiO2, eluting with 5% MeOH / CHCl3 provided nucleoside 91 (3.07 g, 94%) as a white solid.

D) (1S, 3R, 4R, 6R, 7S) -7- [2Cyanoethoxy (diisopropylamino) phosphin-oxy] -1- (4,4'-dimethoxytrityloxymethyl) -3- (4-N-Benzoylcytosin-l-yl) -6-methyl-2,5-dioxa-bicyclo [2,2,1] heptane (92)

2-Cyanoethyl-tetraisopropylphosphoramidite (0.90 mL, 4.3 mmol) was added to a solution of nucleoside 91 (2.0 g, 2.8 mmol), tetrazole (0.16 g, 2.3 mmol) and N-methylimidazole (58 µL, 0.71 mmol) in DMF (14 mL). After stirring at room temperature for 8 hours the reaction was poured into EtOAc. The organic layer was washed with 90% brine followed by brine then dried (Na2SO4) and concentrated. The residue was dissolved in a minimal amount of EtOAc and this solution was added to hexanes. The resulting precipitate was collected and further purified by column chromatography (SiO2, eluting with EtOAc / hexanes from 75% to 90%) to provide phosphoramidite 92 as a white solid (2.14 g, 84%) . NMR P31 (CDCl3) δ: 149.82.

Example 12 (1S, 3R, 4R, 6S, 7S) -7- [2-Cyanoethoxy (diisopropylamino) phosphinoxy] -1- (4,4'-dimethoxytrityloxymethyl) -3- (4-NBenzoylcytosin-1-yl) -6 -methoxymethyl-2,5-dioxabicyclo [2,2,1] heptane (98)

Scheme 12 (a) TBSCl, Et3N, DMAP, CH2CH2, rt, 16h, 97%;

(b) POCl3, 1,2,4-Triazole, Et3N, CH3CN, rt, 4h; (c) NH3

aqueous, 1,4-dioxane, rt, 16h; (d) Bz2O, DMF, rt, 16h, 89% from 93; (e) Et3N.3HF, Et3N, THF, rt, 16h, 89%;

(f) CNCH2CH2OP (N-iPr2) 2, Tetrazole, NMI, DMF, 84%.

A) Nucleoside (93)

Tert-Butyldimethylsilyl chloride (2.25 g, 15.0 mmol) was added to a solution of nucleoside 85 (3.0 g, 5.0 mmol) and imidazole (2.03 g, 29.9 mmol) in DMF (10 mL). After stirring at room temperature for 16 hours the reaction was poured into EtOAc. The organic phase is

20 successively extracted with brine, dried (Na2SO4) and concentrated in vacuo. Purification by column chromatography (SiO2, eluting with 50% EtOAc / hexanes provided nucleoside 93 (3.45 g, 97%) as a white solid.

B) Nucleoside (96)

Phosphorous oxychloride (3.59 mL, 38.5 mmol) was added to a chilled suspension (0 ° C) of 1,2,4-triazole (11.3 g, 163.9 mmol) in CH3CN (80 mL). After stirring for 15 minutes, triethylamine (27.0 mL, 192.8 mmol) was added to the reaction and stirring was continued for 30 minutes. A solution of nucleoside 93 (3.45 g, 4.82 mmol) in CH3CN (20 mL) was added to the reaction at 0 ° C. After stirring for 10 minutes the ice bath was removed and the reaction was stirred at room temperature for 4 hours. The solvent was then removed in vacuo and the residue was partitioned between EtOAc and water. The organic layer was then washed with saturated NaHCO3 solution and brine then dried (Na2SO4) and concentrated in vacuo to provide crude 94, which was used without further purification.

Aqueous ammonia (10 mL) was added to a solution of nucleoside 94 (above) in dioxane (50 mL). After stirring at room temperature for 16 hours the reaction was concentrated in vacuo and dried in high vacuum for 8 hours to provide nucleoside 95, which was used without further purification.

Benzoic anhydride (1.63 g, 7.2 mmol) was added to a solution of nucleoside 95 (above) in DMF (9 mL). After stirring at room temperature for 16 hours the reaction was poured into EtOAc. The organic layer was extracted with saturated NaHCO3 and brine then dried (Na2SO4) and concentrated in vacuo. Purification by column chromatography (SiO2, eluting with 50% EtOAc / hexanes provided nucleoside 96 (3.53 g, 89% from 93) as a white solid.

C) Nucleoside (97)

Triethylamine trihydrofluoride (4.20 mL, 25.8 mmol) was added to a solution of nucleoside 96 (3.53 g, 4.3 mmol) and triethylamine (1.43 mL, 10.3 mmol) in THF (43 mL) in a polypropylene tube. After stirring at room temperature for 16 hours the reaction was dried in vacuo and the residue was dissolved in EtOAc. The organic layer was washed successively with water, saturated NaHCO3, and brine then dried (Na2SO4) and concentrated in vacuo. Purification by column chromatography (SiO2, eluting with acetone / CHCl3 25% to 40% provided nucleoside 97 (2.87 g, 95%) as a white solid.

D) (1S, 3R, 4R, 6S, 7S) -7- [2Cyanoethoxy (diisopropylamino) phosphin-oxy] -1- (4,4'-dimethoxytrityloxymethyl) -3- (4-N-Benzoylcytosin-1-yl) - 6-methyl-2,5-dioxa-bicyclo (2,2,1) heptane (98)

2-Cyanoethyl-tetraisopropylphosphoramidite (1.35 mL, 4.3 mmol) was added to a solution of nucleoside 97 (2.0 g, 2.8 mmol), tetrazole (0.16 mg, 2.3 mmol) and N-methylimidazole (58 µL, 0.71 mmol) in DMF (1.4 mL). After stirring at room temperature for 8 hours the reaction was poured into EtOAc and the organic layer was washed with 90% brine followed by brine, then dried (Na2SO4) and concentrated. Purification by column chromatography (SiO2, eluting with 75% to 90% EtOAc / hexanes gave phosphoramidite 98 as a white solid (2.15 g, 84%) .31 P NMR (CDCl3) δ: 150, 33.

Example 13

(1S, 3R, 4R, 6R, 7S) -7- [2-Cyanoethoxy (diisopropylamino) phosphinoxy] -1- (4,4'-dimethoxytrityloxymethyl) -3- (6-NBenzoyladenin-9-yl) -6-methoxymethyl -2,5-dioxabicyclo [2,2,1] heptane (105)

10

Scheme 13 (a) 6-N-Benzoyladenine, BSA, TMSOTf, CH3CN, reflux, 8h; (b) K2CO3, MeOH, rt, 16h; (c) Bz2O, DMF, rt;

(d) DDQ, CH2Cl2, H2O, rt; (e) Et3N.3HF, Et3N, THF, rt,

15 16h; (f) DMTCl, Pyridine, rt, 16h; (g) CNCH2CH2OP (NiPr2) 2, Tetrazole, NMI, DMF.

Phosphoramidite 105 is prepared from

diacetate 77a-b using illustrated procedures

20 for the synthesis of phosphoramidite 83 from a mixture of diacetate 77a-b.

Example 14

5 (1S, 3R, 4R, 6S, 7S) -7- [2-Cyanoethoxy (diisopropylamino) phosphinoxy] -1- (4,4'-dimethoxytrityloxymethyl) -3- (6-NBenzoyladenin-9-yl) -6- methyl-2,5-dioxabicyclo [2,2,1] heptane (108)

Scheme 14 (a) Et3N.3HF, Et3N, THF, rt, 16h; (b) DMTCl, Pyridine, rt, 16h; (c) CNCH2CH2OP (N-iPr2) 2, Tetrazole, NMI, DMF.

Phosphoramidite 108 is prepared from nucleoside 102b using the procedures illustrated for the synthesis of phosphoramidite 86 from 80b.

Example 15

20 (1S, 3R, 4R, 6R, 7S) -7- [2-Cyanoethoxy (diisopropylamino) phosphinoxy] -1- (4,4'-dimethoxytrityloxymethyl) -3- (2-NIsobutyrylguanin-9-yl) -6- methoxymethyl-2,5-dioxabicyclo [2,2,1] heptane (114)

25

Scheme 15 (a) 2-amino-6-chloropurine, BSA, TMSOTf, CH3CN, reflux, 2h; (b) 3-Hydroxypropionitrile, NaH, THF, 4h;

5 (c) isobutyric anhydride, DMAP, DMF, 60 ° C, 24h; (d) DDQ, CH2Cl2, H2O, rt, 16h; (e) Et3N.3HF, Et3N, THF, rt; (f) DMTCl, Pyridine, rt; (g) CNCH2CH2OP (N-iPr2) 2, Tetrazole, NMI, DMF.

10 Phosphoramidite 114 is prepared from

diacetate 77a-b using illustrated procedures

for the synthesis of phosphoramidite 83 from the

diacetate mixture 77a-b.

Scheme 16 (a) Et3N.3HF, Et3N, THF, rt, 16h; (b) DMTCl, 10Pyridine, rt, 16h; (c) CNCH2CH2OP (N-iPr2) 2, Tetrazole, NMI, DMF.

Example 16

(1S, 3R, 4R, 6S, 7S) -7- [2-Cyanoethoxy (diisopropylamino) phosphinoxy] -1- (4,4'-dimethoxytrityloxymethyl) -3- (2-N5 Isobutyrylguanin-9-yl) -6- methoxymethyl-2,5-dioxabicyclo [2,2,1] heptane (117)

Phosphoramidite 117 is prepared from nucleoside 111b using the procedures illustrated for the synthesis of phosphoramidite 86 from 80b.

Example 17

20 Synthesis of 6-CH2OH BNA Scheme 17 (a) Oxalyl chloride, DMSO, Et3N, CH2Cl2, -78 ° C to 0 ° C; (b) Ph3PCH2Br, nBuLi, THF, -78 ° C at rt, 97% from 26; (c) TBAF, THF, rt, 16h, 97%; (d) NaH, BnBr,

5 DMF, rt, 1h, quantitative; (e) OsO4, NMO, acetone aq. 95%, rt, 48.87%; (f) TBScl, pyridine, 0, 4h, quantitative; (g) MsCl, Et3N, DMAP, CH2Cl2, rt, 16h; (h) Et3N.3HF, Et3N, THF, quantitative; (i) PivCl, DIPEA, DMAP, CH2Cl2, rt, 16h; (j) AcOH, Ac2O, catalytic H2SO4,

10 92% from 125; (k) BSA, uracil, TMSOTf, CH3CN reflux, 2h; K2CO3, MeOH, 74% from 127.

A) Nucleoside 118

15 Dimethylsulfoxide (1.77 mL,

25.0 mmol) to a refrigerated solution (-78 ° C) of

oxalyl chloride (1.10 mL, 12.5 mmol) in

dichloromethane (60 mL). After shaking for 30

minutes, a solution of alcohol 26 (5.0 g, 8.4 mmol)

20 in dichloromethane (20 mL) was added to the reaction. Stirring was continued at -78 ° C for another 45 minutes after which time, triethylamine (5.05 mL, 37.5 mmol) was added dropwise to the reaction. After stirring for 10 minutes, the ice bath was removed and the reaction was allowed to gradually warm to approx. 0 ° C, at which time, TLC analysis indicated no starting alcohol. The reaction was diluted with dichloromethane and the organic layer was washed successively with 10% HCl, saturated NaHCO3, brine, dried (Na2SO4) and concentrated to provide aldehyde 27, which was used for the next step without any purification.

B) Nucleoside 118

NBuLi (2.5 M, 4.34 mL, 10.9 mmol) was added dropwise to a chilled (0 ° C) stirred solution of triphenylphosphonium bromide (3.88 g, 10.9 mmol) in Dry THF (60 mL). After stirring for 1 hour, the red solution was cooled to -78 ° C and a solution of aldehyde 27 from above (8.4 mmol) in dry THF (15 mL) was added dropwise to the reaction. The reaction was allowed to gradually warm to room temperature and stirring was continued for another 16 hours. The reaction was then carefully quenched using saturated NH4Cl and partitioned between EtOAc and water. The organic layer was washed successively with brine, dried (Na2SO4), and concentrated. Purification by column chromatography (SiO2, eluting with 10% EtOAc in hexanes provided olefin 118 (4.84 g, 97% of 26) as a colorless oil.

C) Nucleoside 119

Tetrabutylammonium fluoride (1M in THF, 10.00 mL, 10.0 mmol) was added to a solution of olefin 118 (4.83 g, 8.1 mmol) in THF (35 mL). The reaction was stirred at room temperature for 16 hours after which the solvent was removed in vacuo and the residue was dissolved in EtOAc. The organic layer was washed with water, brine, dried (Na2SO4), and concentrated. Purification by column chromatography (SiO2, eluting with 40% EtOAc in hexanes) provided alcohol 119 (2.79 g, 97%) as a colorless oil.

D) Nucleoside 120.

Sodium hydride (60% w / w in mineral oil, 0.4 g, 10 mmol) was added to a chilled solution (0 ° C) of alcohol 119 (1.44 g, 4.1 mmol) and benzyl bromide (0.71 mL, 6.0 mmol) in DMF (16 mL). After stirring for 1 hour at 0 ° C, the reaction was carefully quenched with water and partitioned between EtOAc and water. The organic layer was separated and washed with brine, dried (Na2SO4), and concentrated. Purification by column chromatography (SiO2, eluting with 10 to 25% EtOAc in hexanes provided olefin 120 (1.84 g, quantitative) as a colorless oil.

E) Nucleoside 121

Osmium tetroxide (OsO4, 25% solution in iPrOH, 1 mL) was added to a solution of the olefin 120 (1.80 g, 4.0 mmol) and N-methylmorpholine N-oxide (NMO, 0.94 g, 8.0 mmol) in 95% acetone / water (25 mL). After stirring for 16h at room temperature, an additional OsO4 solution (0.5 mL) and NMO (0.40 g) were added to the reaction. After stirring for a total of 48 hours, the reaction was diluted with EtOAc and washed with 10% NaHSO3, brine, dried (Na2SO4), and concentrated.

Purification by column chromatography (SiO2, eluting with 40 to 50% EtOAc in hexanes provided diol 121 (1.68 g, 87%, isomer mixture approx. 1: 1) as a colorless oil.

F) Nucleosides 122 and 123

TBSCl (0.66 g, 4.4 mmol) was added to a chilled solution (0 ° C) of diol 121 (1.63 g, 3.4 mmol) in pyridine (17 mL). After stirring for 4 h at 0 ° C, the reaction was diluted with EtOAc and the organic layer was washed with water, brine, dried, and concentrated. Purification by column chromatography (SiO2, eluting with 10-20% EtOAc in hexanes) provided alcohols 122 and 123 (0.90 g and 1.17 g, unassigned absolute stereochemistry) as colorless oils.

G) Nucleoside 124

Methanesulfonyl chloride (0.24 mL, 3.0 mmol) was added dropwise to a chilled solution (0 ° C) of alcohol 123 (unassigned absolute stereochemistry, 0.9 g, 1.5 mmol), triethylamine ( 0.46 mL, 3.3 mmol) and dimethylaminopyridine (37 mg, 0.3 mmol) in dichloromethane (5 mL). After 7 hours at room temperature, additional methanesulfonyl chloride (0.12 mL) and triethylamine (0.23 mL) were added to the reaction. After stirring for another 9 hours at room temperature, the reaction was poured into EtOAc and the organic layer was washed with 10% HCl, saturated NaHCO3, brine, dried (Na2SO4), and concentrated. Purification by column chromatography (SiO2, eluting with 10-15% EtOAc in hexanes provided mesylate 124 (0.44g, 44%) and starting diol 123 (0.32g, 40%).

H) Nucleoside 125

Triethylamine trihydrofluoride (0.64 mL, 4.0 mmol) was added to a solution of mesylate 124 (0.44 g, 0.6 mmol) and triethylamine (0.23 mL, 1.7 mmol) in THF (7 mL). After stirring for 16 hours at room temperature, the reaction was diluted with EtOAc and the organic phase was washed with saturated NaHCO3, brine, dried (Na2SO4), and concentrated. Purification by column chromatography (SiO2, eluting with 50% EtOAc in hexanes) provided alcohol 125 (0.40 g, quantitative).

I) Nucleoside 127

Pivaloyl chloride (0.12 mL, 1.0 mmol) was added dropwise to a cold solution (0 ° C) of alcohol 125 (0.72 mmol, 0.4 g), diisopropylethylamine (DIPEA, 0.17 mL, 1.0 mmol) and dimethylaminopyridine (12 mg, 0.1 mmol) in dichloromethane (2 mL). The ice bath was then removed and the reaction was stirred at room temperature for 2 hours after which additional DIPEA (0.17 mL) and pivaloyl chloride (0.12 mL) were added and the reaction was stirred at room temperature. for 16 hours. The reaction was then diluted with EtOAc and the organic layer was washed with 10% HCl, saturated NaHCO3, brine, dried (Na2SO4) and concentrated to provide crude pivaloate 126, which was used without any further purification.

Concentrated sulfuric acid (2 drops) was added to a solution of crude pivaloate 126 (above) in glacial acetic acid (2.5 mL) and acetic anhydride (0.5 mL). After stirring at room temperature for 2 hours, the solvent was removed under high vacuum and the residue was dissolved in EtOAc and the organic layer was washed with saturated NaHCO3, brine, dried (Na2SO4), and concentrated. Purification by column chromatography (SiO2, eluting with 10-15% EtOAc in hexanes provided diacetate 127 (0.45 g, 92% of 125) as a colorless oil (anomeric mixture).

J) Nucleoside 129a

N, O-bis (trimethylsilyl) acetamide (0.8 mL, 3.3 mmol) was added to a suspension of diacetate 127 (0.45 g, 0.65 mmol) and uracil (0.15 g, 1.3 mmol) in CH3CN (3.5 mL). After heating at 40 ° C for 15 min to obtain a clear solution, trimethylsilyl triflate (0.24 mL, 1.3 mmol) was added to the reaction. After refluxing for 2 hours, the reaction was cooled to room temperature and poured into EtOAc. The organic layer was washed with saturated NaHCO3, brine, dried (Na2SO4), and concentrated in vacuo to provide crude nucleoside 128a, which was used without any purification.

K2CO3 (40 mg, 0.3 mmol) was added to a solution of nucleoside 128a (0.11 g, 0.15 mmol) in MeOH (1.5 mL). After stirring for 16h at room temperature, the solvent was removed in vacuo and the residue was partitioned between EtOAc and brine. The organic phase was collected, dried (Na2SO4) and concentrated, in vacuo to provide 129a (absolute stereochemistry not determined). Purification by column chromatography (SiO2, eluting with 35% acetone in CHCl3 provided nucleoside 129a (57 mg, 74% of 127) .1H NMR (CDCl3): δ 9.37 (s, 1H), 7.92 -7.61 (m, 5H), 7.55-7.23 (m, 9H), 5.58 (s, 1H), 5.43 (d, 1H, J = 8.1), 4.79 (d, 1H, J = 11.7), 4.66 (d, 1H, J = 11.7), 4.58 (m, 2H), 4.51 (s, 1H), 4.44 (m , 1H), 4.05 (s, 1H), 3.95-3.72 (m, 4H) LCMS: retention time 3.34 min, M + H calcd 517.19, found 517.1.

Example 18

Scheme 18. (a) N-Bz-Cytosine or 6-N-Bz-adenine or 2-amino

10 6-chloropurine, BSA, TMSOTf, MeCH, reflux; (b) K2CO3, MeOH, rt, 16h (for 129b-c); (c) NaH, 3-hydroxypropionitrile, rt, (para 129d); (d) TMSCl, pyridine, BzCl or Bz2O, DMF (for 130b-c); (e) TMSCl, pyridine, isobutyryl chloride (para 139d)

Nucleosides 128b, 128c and 128d are prepared from a precursor sugar 127 by a Vorbrugen reaction using N-Bz-cytosine, 6-N-Bz-adenine and 2-amino-6-chloropurine respectively (Scheme 18). The

Treatment of 128b and 128c with K2CO3 and MeOH provides nucleosides 129b and 129c respectively. Treatment of 128d with sodium hydride and 3-hydroxypropionitrile provides nucleoside 129d. Transient protection of the hydroxyl group with TMSCl

25 followed by reaction with benzoyl chloride provides nucleosides 130b and 130c respectively. Alternatively the above transformation can also be completed by reacting nucleosides 129b and 129c with benzoic anhydride using DMF as

5 solvent. Nucleoside 130d is prepared by transient protection with excess TMSCl in pyridine followed by reaction with isobutyryl chloride.

Example 19

10

Preparation of 6 'substituted analogs

R, R1, and R2 are each independently H, alkyl, alkenyl, alkynyl, substituted alkyl, substituted alkenyl, substituted alkynyl, or a protecting group

Nucleoside 131 is prepared from nucleoside 130 by treatment with a fluorinating agent such as DAST using dichloromethane as the solvent. Nucleoside 132 is prepared from 130 by first oxidizing the primary hydroxyl group with Dess-Martin periodinane or under Swern conditions followed by treatment of the resulting aldehyde with DAST. Nucleoside 133 is prepared from 130 by first oxidizing the primary hydroxyl group with Dess-Martin periodinane or under Swern conditions followed by reductive amination of the resulting aldehyde with a primary or secondary amine in the presence of glacial acetic acid and such a reducing agent. as sodium cyanoborohydride. Nucleoside 134 is prepared from 130 by converting the hydroxyl group to a removable group (mesylate, tosylate, halide) followed by heating with excess sodium azide. Nucleoside 135 is prepared from 130 by oxidation of the primary alcohol to a carboxylic acid followed by reaction with an amine in the presence of HATU or any other peptide coupling reagent. Nucleoside 136 is prepared from 130 by activating the hydroxyl group with carbonyldiimidazole followed by reaction with an amine. Nucleoside 137 is prepared from 130 by deprotonating the hydroxyl group with an appropriate base followed by quenching the anion with an alkylating reagent. Nucleoside 138 is prepared from 130 by converting the hydroxyl group to a removable group followed by displacement with a thiol nucleophile. Nucleoside 139 is prepared from 134 by reduction of the azide group followed by reaction with an isocyanate or an isothiocyanate. Nucleoside 140 is prepared from 134 by reduction of the azido group and reaction with FmocNCS to provide an activated thiourea. Further reaction of fmoc activated thiourea with an amine in the presence of EDC

5 provides the substituted guanidine. Removal of the fmoc protecting group releases nucleoside 140.

Example 20

10 Preparation of 6-substituted phosphoramidite BNA nucleosides

Scheme 20

fifteen

Nucleoside 142 is prepared from nucleoside 130-140 by catalytic hydrogenation to remove the 3'- and 5'-O protecting groups. Alternatively, 142

20 can be prepared from 130-140 by first removing the 3'O-Nap group with DDQ followed by catalytic hydrogenation to remove the 5'O-benzyl group. Subsequent protection of the 5 'hydroxyl group in the form of dimethoxytrityl ether followed by a reaction of

Phosphthylation provides phosphoramidite 143.

Example 21 Preparation of 6-CH2F nucleoside

Scheme 23 (a) DAST, CH2Cl2, -78 ° C to rt, 16h, 52%; (b) DDQ, CH2Cl2, H2O, rt, 8h, quant. (c) Pd / C 10%, H2 balloon,

10 50%; (d) DMTCl, pyridine, 55%; (e) (iPr2) 2NPOCH2CH2CN, tetrazole, NMI, DMF.

A) Nucleoside (131a).

Diethylamino sulfur trifluoride (DAST, 0.16 mL, 1.4 mmol) was added to a chilled solution (-50 ° C) 129a (0.1 g, 0.2 mmol) in dichloromethane (2 mL). The reaction was gradually warmed to room temperature and stirred for 16 hours after which it was quenched.

20 carefully with a saturated NaHCO3 solution. The reaction was then partitioned between EtOAc and brine, dried (Na2SO4), and concentrated. Purification by column chromatography (SiO2, 33% EtOAc in hexanes provided nucleoside 131a (51 mg, 52%, contaminated

25 with 15-20% of a ring-open impurity) as a mixture of isomers). 19 F NMR (CDCl3): δ -227.98 (m) and -231.07 (m). LCMS: retention time 3.84 min; M + H calcd. 519.19, found 519.1 and 3.89 min; M + H calcd. 519.19, found 519.1.

B) Nucleoside (141a).

DDQ (44 mg, 0.2 mmol) was added to a solution of nucleoside 131a (51 mg, 0.1 mmol) in dichloromethane (1 mL) and water (2 drops). After stirring at room temperature for 8 hours, the reaction was diluted with EtOAc and the organic phase was washed with 10% NaHSO3 solution, saturated NaHCO3 solution, brine, dried (Na2SO4) and concentrated. Purification by column chromatography (SiO2, 30% acetone in chloroform gave nucleoside 141a (41 mg, quantitative as a mixture of isomers) .19 F NMR (CDCl3): δ 229.3 (t) and -230, 97 (dt) LCMS: retention time 2.66 min, M + H calcd 379.12, found 379.0.

C) Nucleoside (142a).

A mixture of nucleoside 141a (41 mg, above) and 10% palladium on carbon (10 mg) in methanol (2 mL) was hydrogenated using a hydrogen balloon. After 3 hours, all of the starting nucleoside 141a was consumed (as indicated by LCMS analysis of the reaction mixture). The reaction was filtered through celite and the filtrate was concentrated under reduced pressure. Purification by column chromatography (SiO2, 10-20% methanol in chloroform provided nucleoside 142a (14 mg, 50%) as a mixture of isomers. 19 F NMR (CDCl3): δ -231.45 (t) and -232.88 (dt) LCMS: retention time 1.72 min, M + Na calcd 311.08, found 311.0.

D) Nucleoside (142aa).

DMTCI (24 mg, 0.07 mmol) was added to a solution

of nucleoside 142a (14 mg, 0.049 mmol) in pyridine (0.25 mL). After stirring at room temperature for 3 hours, the reaction was concentrated under reduced pressure. Purification by column chromatography (SiO2, 20 to 30% acetone in chloroform provided nucleoside 142aa (16 mg, 55%) as a mixture of isomers. 19 F NMR (CDCl3): δ -228.6 (t) and 230.91 (dt) LCMS: retention time 3.56 min, M + Na calcd 613.21, found 613.1.

E) Amidite (143a).

Amidite 143a is prepared from nucleoside 142a using a phosphorylation reaction as described in Example 1.

Example 22

Synthesis of Nucleoside Phosphoramidites

The preparation of the nucleoside phosphoramidites is performed following the procedures illustrated herein and in the art such as but not

limited to 6,426,220 and published PCT la la Patent Application WO 02/36743. from those of States Patent United Internac Ional no. Example 23

Synthesis of oligonucleotides and oligonucleosides

The oligomeric compounds used in accordance with this invention can be conveniently and routinely made through the well known solid phase synthesis technique. Equipment for such synthesis is sold by various vendors including, for example, Applied Biosystems (Foster City, CA). Any other means for such synthesis known in the art may be additionally or alternatively employed. It is well known to use similar techniques to prepare oligonucleotides such as phosphorothioates and alkylated derivatives.

Oligonucleotides: Unsubstituted and substituted phosphodiester (P = O) oligonucleotides can be synthesized on an automated DNA synthesizer (Applied Biosystems model 394) using standard phosphoramidite chemistry with iodine oxidation.

Phosphorothioates (P = S) are synthesized in a similar way to phosphodiester oligonucleotides with the following exceptions: thiation is carried out using a 10% w / v solution of 3,1-dioxide of 3, H-1,2benzodithiol -3-one in acetonitrile for the oxidation of phosphite bonds. The time of the thiation reaction step is increased to 180 sec and is preceded by the normal capping step. After cleavage of the CPG column and deblocking in concentrated ammonium hydroxide at 55 ° C (12-16 hr), the oligonucleotides are recovered by precipitation with more than 3 volumes of ethanol in a solution of NH4OAc 1

M. Phosphinated oligonucleotides can be prepared as described in US Patent No.

5,508,270.

Alkyl phosphonate oligonucleotides can be prepared as described in US Patent No. 4,469,863.

The 3'-deoxy-3'methylene phosphonate oligonucleotides can be prepared as described in US Patent Nos. 5,610,289 or

5,625,050.

Phosphoramidite oligonucleotides can be prepared as described in US Patent No. 5,256,775 or US Patent No. 5,366,878.

Alkylphosphonothioate oligonucleotides can be prepared as described in published PCT applications PCT / US94 / 00902 and PCT / US93 / 06976 (published as International Patent Application WO 94/17093 and WO 94/02499, respectively).

The 3'-deoxy-3'-amino phosphoramidate oligonucleotides can be prepared as described in US Patent No. 5,476,925.

Phosphotriester oligonucleotides can be prepared as described in US Patent No. 5,023,243.

Boranophosphate oligonucleotides can be prepared as described in US Patent Nos. 5,130,302 and 5,177,198.

Oligonucleosides: methylenemethylimino-linked oligonucleosides, also identified as MMI-linked oligonucleosides, methylenedimethylhydrazo-linked oligonucleosides, also identified as MDH-linked oligonucleosides, and methylenecarbonylamino-linked oligonucleosides, also identified as oligonucleosides-3-linked, methylenecarbonylamino-linked oligonucleosides, also identified as oligonucleosides-3 also identified as amide-4 linked oligonucleosides, as well as mixed backbone oligomeric compounds having, for example, alternate MMI and P = O or P = S linkages can be prepared as described in US Pat. Nos. 5,378,825; 5,386,023; 5,489,677;

5,602,240 and 5,610,289.

Formacetal and thioformacetal linked oligonucleosides can be prepared as described in US Patent Nos. 5,264,562 and

5,264,564.

Ethyleneoxy linked oligonucleosides can be prepared as described in US Patent No. 5,223,618.

Example 24

Isolation of Oligonucleotides

After cleavage of the controlled pore glass solid support and deblocking in concentrated ammonium hydroxide at 55 ° C for 12-16 hours, the oligonucleotides or oligonucleosides are recovered by precipitation in 1 M NH4OAc with> 3 volumes of ethanol. The synthesized oligonucleotides are analyzed by electrospray mass spectroscopy (determination of molecular weight) and by capillary gel electrophoresis. The relative amounts of phosphorothioate and phosphodiester linkages obtained in the synthesis are determined by the correct molecular weight ratio to the product -16 amu (+ / 32 +/- 48). For some studies the oligonucleotides are purified by HPLC, as described by Chiang et al., J.

Biol. Chem. 1991, 266, 18162-18171. The results obtained with the HPLC purified material are generally similar to those obtained with the non-HPLC purified material.

Example 25

Oligonucleotide Synthesis - 96 Well Plate Format

Oligonucleotides can be synthesized via solid phase phosphoramidite P (III) chemistry on an automated synthesizer capable of assembling 96 sequences simultaneously in a 96-well format. Phosphodiester internucleotide linkages are provided by oxidation with aqueous iodine. Phosphorothioate internucleotide linkages are generated by sulfidation using 3, H-1,2-benzodithiol-3-one 1,1-dioxide (Beaucage Reagent) in anhydrous acetonitrile. Standard protected base beta-cyanoethyl-diisopropyl-phosphoramidites are purchased from commercial vendors (eg, PE-Applied Biosystems, Foster City, CA, or Pharmacia, Piscataway, NJ). Unconventional nucleosides are synthesized by conventional or proprietary methods. They are used in the form of beta-cyanoethyldiisopropyl-phosphoramidites with the base protected.

The oligonucleotides are cleaved from the support and deprotected with concentrated NH4OH at elevated temperature (55-60 ° C) for 12-16 hours and the released product is then dried in vacuo. The dried product is then resuspended in sterile water to provide a master plate from which all assay and analytical plate samples are then diluted using robotic pipettors.

Example 26

Oligonucleotide Analysis Using a 96-Well Plate Format

The oligonucleotide concentration in each well is evaluated by dilution of the samples and UV absorption spectroscopy. The complete integrity of the individual products is evaluated by capillary electrophoresis (CE) in a 96-well format (Beckman P / ACE® MDQ) or, for individually prepared samples, on a commercial CE apparatus (e.g., Beckman P / ACE® 5000, ABI 270). The base and backbone composition is confirmed by mass analysis of the oligomeric compounds using electrospray-mass spectroscopy. All assay plates for analysis are diluted from the master plate using single and multi-channel robotic pipettors. Plates are considered acceptable if at least 85% of the oligomeric compounds on the plate are at least 85% complete.

Example 27

Cell culture and oligonucleotide treatment

The effect of oligomeric compounds on target nucleic acid expression in any of a variety of cell types can be tested as long as the target nucleic acid is present at measurable levels. This can be routinely determined using, for example, PCR or Northern blot analysis. Cell lines derived from multiple tissues and species can be obtained from the American Type Culture Collection (ATCC, Manassas, VA).

The following cell type is provided for illustrative purposes, but other routinely used cell types can be used, as long as the target is expressed in the chosen cell type. This can easily be determined by routine methods in the art, for example Northern blot analysis, ribonuclease protection analysis or RT-PCR.

B.END Cells: The mouse brain endothelial cell line b.END was obtained from Dr. Werner Risau of the Max Plank Institute (Bad Nauheim, Germany). B.END cells were routinely cultured in high glucose DMEM (Invitrogen Life Technologies, Carlsbad, CA) with a 10% fetal calf serum supplement (Invitrogen Life Technologies, Carlsbad, CA). Cells were routinely put through trypsination and dilution when they reached approximately 90% confluence. Cells were seeded in 96-well plates (Falcon-Primaria # 353872, BD Biosciences, Bedford, MA) at a density of approximately 3000 cells / well for uses including, but not limited to, oligomeric compound transfection experiments.

Experiments involving treatment of cells with oligomeric compounds:

When the cells reach an appropriate confluence, they are treated with oligomeric compounds using a transfection method as described.

LIPOFECTIN®

When the cells reach 6575% confluence, they are treated with oligonucleotide. The oligonucleotide is mixed with LIPOFECTIN® (Invitrogen Life Technologies, Carlsbad, CA) in Opti-MEM®-1 reduced serum medium (Invitrogen Life Technologies, Carlsbad, CA) to achieve the desired oligonucleotide concentration and a LIPOFECTIN® concentration of 2.5 or 3 µg / mL per 100 nM oligonucleotide. This transfection mix is incubated at room temperature for approximately 0.5 hours. For cells grown in 96-well plates, the wells are washed once with 100 µL of OPTI-MEM®-1 and then treated with 130 µL of the transfection mix. Cells grown on 24-well plates or other conventional tissue culture plates are treated in a similar manner, using appropriate volumes of medium and oligonucleotide. Cells are treated and data is obtained in duplicate or triplicate. After approximately 4-7 hours of treatment at 37 ° C, the medium containing the transfection mixture is replaced with fresh culture medium. Cells are harvested 16-24 hours after oligonucleotide treatment.

Other suitable transfection reagents known in the art include, but are not limited to, CYTOFECTIN®, LIPOFECTAMINE®, OLIGOFECTAMINE®, and FUGENE®. Other suitable transfection methods known in the art include, but are not limited to, electroporation.

Example 28

Oligonucleotide Inhibition Analysis of a Target Expression

Antisense modulation of a target expression can be analyzed in a variety of ways known in the art. For example, levels of target mRNA can be quantified, e.g. eg, by Northern blot analysis, competitive polymerase chain reaction (PCR), or real-time PCR. Quantitative real-time PCR is currently desired. PCR analysis can be performed on total cellular RNA or poly (A) + mRNA. One RNA analysis method of the present invention is the use of total cellular RNA as described in other examples herein. RNA isolation methods are well known in the art. Northern blot analysis is also routine in the art. Real-time quantitative (PCR) can be conveniently completed using the ABI PRISM® 7600, 7700, or 7900 Sequence Detection System, commercially available from PE-Applied Biosystems, Foster City, CA and used according to the manufacturer's instructions. .

Protein levels of a target can be quantified in a number of ways well known in the art, such as immunoprecipitation, Western analysis (immunoblotting), enzyme-linked immunosorbent analysis (ELISA), or fluorescence activated cell sorting (FACS). Targeted antibodies can be identified and obtained from a variety of sources, such as the MSRS antibody catalog (Aerie Corporation, Birmingham, MI), or they can be prepared by either conventional monoclonal or polyclonal antibody generation methods. known in the art. The methods of preparing polyclonal antisera are illustrated, for example, by Ausubel,

F.M.

et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.12.1-11.12.9, John Wiley & Sons, Inc., 1997. The preparation of monoclonal antibodies is illustrated, for example, by Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.4.111.11.5, John Wiley & Sons, Inc., 1997.

Immunoprecipitation methods are standard in the art and can be found, for example, in Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 10.16.1-10.16.11, John Wiley & Sons, Inc., 1998. Western blot analysis is standard in the art and can be found, for example, in Ausubel, F.M. et al., Current Protocols in Molecular Biology, Volume 2, pp. 10.8.1-10.8.21, John Wiley & Sons, Inc., 1997. Enzyme-linked immunosorbent assays (ELISA) are standard in the art and can be found, for example, in Ausubel,

F.M.

et al., Current Protocols in Molecular Biology, Volume 2, pp. 11.2.1-.11.2.22, John Wiley & Sons, Inc., 1991.

Example 29

Design of phenotypic analyzes and in vivo studies for the use of target inhibitors

Phenotypic Analysis

Once the target inhibitors have been identified by the methods described herein, the oligomeric compounds are further investigated in one or more phenotypic assays, each having measurable predictive endpoints of efficacy in treating a disease. or specific condition.

Phenotypic assays, kits and reagents for their use are well known to those of skill in the art and are used herein to investigate the role and / or association of a target in health and disease. Representative phenotypic assays, which can be purchased from any one of numerous commercial vendors, include those for determining cell viability, cytotoxicity, proliferation, or cell survival (Molecular Probes, Eugene, OR; Perkin Elmer, Boston, MA) , protein-based assays including enzymatic assays (Panvera, LLC, Madison, WI; BD Biosciences, Franklin Lakes, NJ; Oncogene Research Products, San Diego, CA),

regulation mobile, transduction from the sign, inflammation, processes oxidative Y apoptosis (Assay Designs Inc., Ann Arbor, ME), accumulation from

triglycerides (Sigma-Aldrich, St. Louis, MO), angiogenesis assay, tube formation assay, hormone and cytokine assay, and metabolic assay (Chemicon International Inc., Temecula, CA; Amersham Biosciences, Piscataway, NJ).

In a non-limiting example, cells determined to be appropriate for a particular phenotypic assay (i.e., MCF-7 cells selected for breast cancer studies; adipocytes for obesity studies) are treated with target inhibitors identified from of in vitro studies as well as control compounds at optimal concentrations that are determined by the methods described above. At the end of the treatment period, treated and untreated cells are analyzed by one or more specific analytical methods to determine phenotypic results and endpoints.

Phenotypic endpoints include changes in the levels of cellular components such as proteins, lipids, nucleic acids, hormones, saccharides, or metals. Cell status measures including pH, cell cycle phase, uptake or excretion of biological indicators by the cell, are also endpoints of interest.

Measurement of the expression of one or more of the cell's genes after treatment is also used as an indicator of the efficacy or potency of the target inhibitors. Distinctive genes, or those genes suspected of being associated with a specific disease, condition, or phenotype, are measured in both treated and untreated cells.

In vivo studies

The individual subjects of the in vivo studies described herein are warm-blooded vertebrate animals, including humans.

Example 30

RNA isolation

Isolation of poly (A) + mRNA

Poly (A) + mRNA is isolated according to Miura et al., (Clin. Chem., 1996, 42, 1758-1764). Other methods for the isolation of poly (A) + mRNA are routine in the art. Briefly, for cells grown on 96-well agar plates, the growth medium is removed from the cells and each well is washed with 200 µL of cold PBS. 60 µL of lysis buffer (10 mM Tris-HCl, pH 7.6, 1 mM EDTA, 0.5 M NaCl, 0.5% NP-40, 20 mM vanadyl-ribonucleoside complex) is added to each well , the plate is shaken gently and then incubated at room temperature for five minutes. 55 µL of lysate is transferred to Oligo d (T) coated 96-well plates (AGCT Inc., Irvine CA). The plates are incubated for 60 minutes at room temperature, washed 3 times with 200 µL of wash buffer (10 mM Tris-HCl pH 7.6, 1 mM EDTA, 0.3 M NaCl). After the final wash, the plate is transferred to paper towels to remove excess wash buffer and then air dried for 5 minutes. 60 µL of elution buffer (5 mM Tris-HCl pH 7.6) is added, preheated to 70 ° C, added to each well, the plate is incubated on a hot plate at 90 ° C for 5 minutes, and the eluate is then transferred to a fresh 96-well plate.

Cells grown on 100 mm or other conventional plates can be treated in a similar way, using appropriate volumes of all solutions.

Isolation of Total RNA

Total RNA is isolated using the RNEASY 96® kit and buffers purchased from Qiagen Inc. (Valencia, CA) following the manufacturer's recommended procedures. Briefly, for cells grown on 96-well plates, the growth medium is removed from the cells and each well is washed with 200 µL of cold PBS. 150 µL of BufferRLT is added to each well and the plate is shaken vigorously for 20 seconds. Then 150 µL of 70% ethanol is added to each well and the contents are mixed by pipetting up and down three times. The samples are then transferred to the RNEASY 96® well plate attached to a QIAVAC® manifold equipped with a debris collection tray and attached to a vacuum source. Vacuum is applied for 1 minute. 500 µL of Buffer RW1 is added to each well of the RNEASY 96® plate and incubated for 15 minutes and vacuum is applied again for 1 minute. An additional 500 µl of Buffer RW1 is added to each well of the RNEASY 96® plate and vacuum is applied for 2 minutes. Then 1 mL of Buffer RPE is added to each well of the RNEASY 96® plate and vacuum is applied for a period of 90 seconds. Then the wash with Buffer RPE is repeated and the vacuum is applied for a further 3 minutes. The plate is then removed from the QIAVAC® collector and dried on paper towels. The plate is then reattached to the QIAVAC® manifold equipped with a collection tube rack containing 1.2 mL collection tubes. The RNA is then eluted by pipetting 140 µL of RNase-free water into each well, incubating 1 minute, and then applying vacuum for 3 minutes.

Repetitive pipetting and elution steps can be automated using a QIAGEN Bio-Robot 9604 (Qiagen, Inc., Valencia CA). Essentially, after lysing the cells from the culture plate, the plate is transferred to the robot deck where the steps of pipetting, DNase treatment, and elution are carried out.

Example 31

Real-Time Quantitative PCR Analysis of Target mRNA Levels

Quantification of target mRNA levels was completed by quantitative real-time PCR using the ABI PRISM® 7600, 7700, or 7900 Sequence Detection System (PE-Applied Biosystems, Foster City, CA) according to the manufacturer's instructions. . This is a closed tube, non-gel-based fluorescence detection system that enables high-throughput quantitation of polymerase chain reaction (PCR) products in real time. As opposed to conventional PCR in which the amplification products are quantified after completion of the PCR, the products of real-time quantitative PCR are quantified as they accumulate. This is accomplished by including in the PCR reaction an oligonucleotide probe that specifically hybridizes between the forward and reverse PCR primers, and contains two fluorescent dyes. A reporter dye (eg, FAM or JOE, obtained from PE-Applied Biosystems, Foster City, CA, Operon Technologies Inc., Alameda, CA, or Integrated DNA Technologies Inc., Coralville, IA) is attached to the 5 'end of the probe, a quenching dye (eg, TAMRA, obtained from PE-Applied Biosystems, Foster City, CA, Operon Technologies Inc., Alameda, CA, or Integrated DNA Technologies Inc., Coralville, IA) is attached to the end 3 'from the probe. When the probe and the dyes are intact, the emission of the reporter dye is quenched by the proximity of the 3 'quenching dye. During amplification, hybridization of the probe to the target sequence creates a substrate that can be cleaved by the 5 'exonuclease activity of Taq polymerase. During the extension phase of the PCR amplification cycle, cleavage of the probe by Taq polymerase releases the reporter dye from the remainder of the probe (and thus the quencher moiety) and a sequence-specific fluorescence signal is generated. . With each cycle, more reporter dye molecules are cleaved from their respective probes, and fluorescence intensity is verified at regular intervals by laser optics mounted on the ABI PRISM® Detection System. In each run, a series of parallel reactions containing serial dilutions of mRNA from untreated control samples generates a standard curve that is used to quantify the percent inhibition after treatment of the test samples with antisense oligonucleotides.

Prior to quantitative PCR analysis, sets of primers-probes specific for the target gene whose ability to be "multiplexed" with a GAPDH amplification reaction are being measured are evaluated. In multiplexing, both the target gene and the GAPDH internal standard gene are concurrently amplified in a single sample. In this analysis, mRNA isolated from untreated cells is serially diluted. Each dilution is amplified in the presence of primer-probe sets specific for GAPDH only, target gene only ("uniplexing"), or both (multiplexing). After PCR amplification, GAPDH standard curves and target mRNA signal are generated as a function of dilution from both the uni-plexing and multiplexing samples. If both the slope and the correlation coefficient of GAPDH and the target signals generated from the multiplexing samples are within 10% of their corresponding values generated from the uni-plexing samples, the primer set is considered -Specific probe for that target is multiplexable. Other PCR methods are also known in the art.

Reagents for RT PCR were obtained from Invitrogen Life Technologies (Carlsbad, CA). RT real-time PCR was carried out by adding 20 µL of PCR cocktail (2.5 x PCR buffer minus MgCl2, 6.6 mM MgCl2, each of dATP, dCTP, dCTP and dGTP 375 µM each , each of the 375 nM forward and reverse primers, 125 nM probe, 4 Units of RNase inhibitor, 1.25 Units of PLATINUM® Taq, 5 Units of MuLV reverse transcriptase, and 2.5x ROX dye) to plates 96 wells containing 30 µL of total RNA solution (20-200 ng). The RT reaction was carried out by incubation for 30 minutes at 48 ° C. After a 10 minute incubation at 95 ° C to activate PLATINUM® Taq, 40 cycles of a two-step PCR protocol were performed: 95 ° C for 15 seconds (denaturation) followed by 60 ° C for 1.5 minutes (hybridization / extension).

The amounts of gene target obtained by real-time PCR, RT are normalized using any level of GAPDH expression; a gene whose expression is constant, or by quantifying total RNA using RIBOGREEN® (Molecular Probes, Inc. Eugene, OR). GAPDH expression is quantified by real-time RT-PCR, which is operated simultaneously with the target, by multiplexing, or separately. Total RNA is quantitated using RiboGreen® RNA Quantitation Reagent (Molecular Probes, Inc. Eugene, OR). RNA quantification methods by means of RIBOGREEN® are illustrated by Jones, L.J., et al, (Analytical Biochemistry, 1998, 265, 368-374).

In this analysis, 170 µL of RIBOGREEN® Working Reagent (RIBOGREEN® Reagent diluted 1: 350 in 10mM Tris-HCl, 1 mM EDTA, pH 7.5) is pipetted into a 96-well plate containing 30 µL of cellular RNA. , purified. The plate is read on a CytoFluor 4000 (PE Applied Biosystems) with excitation at 485 nm and emission at 530 nm.

Example 32

Target specific primers and probes

Probes and primers can be designed to hybridize to a target sequence, using information from published sequences.

For example, for human PTEN, the following primer-probe set was designed using published sequence information (accession number GENBANK® U92436.1, SEQ ID NO: 1). Forward primer: AATGGCTAAGTGAAGATGACAATCAT (SEQ ID NO: 2) Reverse primer: TGCACATATCATTACACCAGTTCGT (SEQ ID NO: 3) and the PCR probe: FAM-TTGCAGCAATTCACTGTAAAGCTGGAAAGG-TAMRA (SEQ ID NO: 4 is fluorescent dye), where the dye is FAM and TAMRA. the extinguishing dye.

Example 33

Western blot analysis of target protein levels

Western blot analysis (immunoblot analysis) is carried out using standard methods. Cells are harvested 16-20 h after oligonucleotide treatment, washed once with PBS, suspended in Laemmli buffer (100 µl / well), boiled for 5 minutes, and loaded onto a SDS-PAGE gel at 16%. The gels are run for 1.5 hours at 150 V, and transferred to a membrane for western blotting. The appropriate primary antibody directed at a target is used, with a radiolabeled or fluorescently labeled secondary antibody directed against the primary antibody species. Bands are visualized using a PHOSPHORIMAGER® (Molecular Dynamics, Sunnyvale CA).

Example 34

Oligomers with spaces 6- (R or S) -CH3 and 6- (R or SFCH2-O-CH3 BNA 2-10-2 targeting PTEN: in vitro study

In accordance with the present invention, oligomeric compounds were synthesized and tested for their ability to reduce PTEN expression over a range of dosages. The b.END cells were treated with the modified oligomers 6- (R or S) -CH3-BNA (392748 and 392749 respectively) and 6 (R or S) -CH2-O-CH3 (396004 and 396005 respectively) at concentrations of 0.3125, 0.0625, 1.25, 2.5, 5, 10, or 20 nM using the methods described herein. PTEN expression levels were determined using real-time PCR and normalized for RIBOGREEN® as described in other examples herein. The resulting dose-response curves were used to determine the EC50 as shown below. Tm were evaluated in 100 mM phosphate buffer, 0.1 mM EDTA, pH 7, at 260 nm using modified oligomers 6- (R or S) -CH3-BNA or 6- (R or S) -CH2-O-CH3 4 µM and 4 µM complementary RNA.

SEQ ID NO./ISIS NO. Composition (5 'to 3') EC50 Tm ° C 05/392748 CRURTAGCACTGGCCRUR 10.3 58.9 05/392749 CSUSTAGCACTGGCCSUS 6.4 59.1 05/396004 CRURTAGCACTGGCCRUR 6.0 56.9 05/396005 CSUSTAGCACTGGCCSUS 5.0 57.6 05/392745 CIUITAGCACTGGCCIUI 7.5 58.6

All internucleoside linkages are phosphorothioate,

nucleosides in bold are nucleosides 6- (R or S) -CH3

5 BNA, the underlined and bold nucleosides are

nucleosides 6- (R or S) -CH2-O-CH3 BNA and the subscripts R and

S indicate the configuration at carbon 6. It is

remarkable that BNA modified oligomeric compounds

in position 6 they show greater power despite the slight decrease in Tm.

Example 35

Oligomers with 6- (S) -CH3-BNA and 6- (R) -CH3-BNA 215 10-2 spaces targeting PTEN: in vivo study

Modified oligomers 6-CH3-BNA (6-S) were injected

or 6- (R)) targeted to PTEN at a dose of 0.5 or 2 µmol / kg in six week old Balb / c mice (Jackson Laboratory, Bar Harbor, ME) twice weekly for 3 weeks. The mice were sacrificed 48 hours after the final administration. Liver tissues were homogenized and mRNA levels were quantified using real-time PCR as described.

25 described herein for comparison to untreated control levels (% UTC).

SEQ ID NO./ISISNO. Composition (5 'a3') dose (µmol / kg) % UTC Saline solution 100 05/392748 CRURTAGCACTGGCCRUR 2.0 31 05/392748 CRURTAGCACTGGCCRUR 0.5 81 05/392749 CSUSTAGCACTGGCCSUS 2.0 2. 3 05/392749 CSUSTAGCACTGGCCSUS 0.5 73

All internucleoside linkages are phosphorothioate,

nucleosides in bold are nucleoside 6-CH3-BNA and nucleosides

Subscripts R and S indicate the configuration in the atom of

5 carbon 6.

Example 36

Oligomers with 6- (S) -CH3-BNA and 6- (R) -CH3-BNA 210 10-2 spaces targeting PTEN: in vivo study

Modified 6-CH3BNA (6- (S) or 6- (R)) oligomers targeting PTEN at a dose of 1, 2, 4, or 8 µmol / kg were injected once into six-week-old Balb / c mice

15 (Jackson Laboratory, Bar Harbor, ME). Mice were sacrificed 72 hours after administration. Liver tissues were homogenized and mRNA levels were quantified using real-time PCR as described herein for comparison.

20 with the untreated control levels (% UTC).

SEQ ID NO./ISISNO. Composition (5 'a3') dose (µmol / kg) % UTC Saline solution 100 05/392748 CRURTAGCACTGGCCRUR 1 89

SEQ ID NO./ISISNO. Composition (5 'a3') dose (µmol / kg) % UTC 05/392748 CRURTAGCACTGGCCRUR two 66 05/392748 CRURTAGCACTGGCCRUR 4 35 05/392748 CRURTAGCACTGGCCRUR 8 eleven 05/392749 CSUSTAGCACTGGCCSUS 1 75 05/392749 CSUSTAGCACTGGCCSUS two 51 05/392749 CSUSTAGCACTGGCCSUS 4 25 05/392749 CSUSTAGCACTGGCCSUS 8 9

All internucleoside linkages are phosphorothioate,

the nucleosides in bold are 6-CH3-BNA and the subscript

S and R indicate the configuration at carbon 6.

5

Example 37

Oligomers with 6- (S) -CH3-O-CH2-BNA and 6- (R) -CH3-OCH2-BNA 2-10-2 spaces targeting PTEN: in vivo study

10 Modified oligomers 6-CH3BNA (6- (S) or 6- (R)) targeting PTEN were injected once at a dose of 1, 2, 4, or 8 µmol / kg (only data for 8 µmol / kg) to six week old Balb / c mice

15 years old (Jackson Laboratory, Bar Harbor, ME). Mice were sacrificed 72 hours after administration. Liver tissues were homogenized and mRNA levels were quantified using real-time PCR as described herein for comparison.

20 with the untreated control levels (% UTC).

SEQ ID NO. / ISISNO. Composition (5 'a3') dose (µmol / kg) % UTC Saline solution 100 05/396004 CRURTAGCACTGGCCRUR 8 37 05/396005 CSUSTAGCACTGGCCSUS 8 37

All internucleoside linkages are phosphorothioate,

nucleosides in bold and underlined are nucleosides

5 6-CH3-O-CH2-BNA and the subscripts S and R indicate the

configuration at carbon 6.

Example 38

10 Stability to nuclease of modified oligomers6- (R or S) -CH3-BNA treated with SVPD

The nuclease stability of the modified oligomers 6- (R or S) -CH3-BNA (392748 and 392749 respectively) was determined using snake venom phosphodiesterase (SVPD). The study included the respective 6-unsubstituted spacer (4'-CH2-O-2 'bridged to BNA, 392745, subscript 1) and the 2'-O-MOE (2'-O- (CH2 ) 2-OCH3, 392753, 20 subscript e) for comparison. Each oligomer is prepared as a 500 µL mixture containing: 5 µL 100 µM oligomer, 50 µL - Phosphodiesterase I @ 0.5 Units / mL in SVPD buffer (50 mM Tris-HCL, pH 7.5, 8 mM MgCl2 ) final concentration 0.05 Units / mL, 445 µL of buffer 25 SVP. The samples were incubated at 37 ° C in a water bath. Aliquots (100 µL) were taken at days 0, 1, 2, and 4 with fresh enzyme added on days 1 and 2. EDTA was added to the aliquots immediately after separation to quench enzyme activity. The

samples were analyzed on IP HPLC / MS.

SEQ ID NO./ISISNO. Composition (5 'to 3') % complete on day 4 05/392748 CRURTAGCACTGGCCRUR > 90 05/392749 CSUSTAGCACTGGCCSUS > 70 05/392745 CIUITAGCACTGGCCIUI > 40 05/392753 CeUeTAGCACTGGCCeUe > 30

SEQ ID NO./ISIS NO. % Composition at 24 hours % Composition after 48 hours % Composition at 96 hours 05/392748 100% 89% 92% 05/392749 96% 84% 74% 05/392745 67% 56% 48% 05/392753 58% 46% 36%

5 All internucleoside linkages are phosphorothioate, nucleosides in bold are modified nucleosides, subscripts R and S indicate configuration at carbon 6 for nucleosides 6-CH3-BNA, subscript e indicates nucleosides 2'-O-MOE and the subscript 1 indicates

10 modified nucleosides 4'-CH2-O-2 '. Compounds containing 6-methyl substituted BNA (392748 and 392749) had a marked improvement over the compound containing unsubstituted BNA (392745).

15 Example 39

Stability to nuclease of modified oligomers 6- (R

or S) -CH3-BNA, 4'-CH2-O-2 'BNA and 2'-O-MOE treated with SVPD

twenty

The nuclease stability of the modified 6-CH3-BNA oligomers was determined using snake venom phosphodiesterase (SVPD). Each oligomer was prepared as a 90 µL mixture that

5 contained 5 µL of oligomer (2 µL of 5 µM oligomer and 3 µL of 5 'P32-labeled oligomer), 75 µL of H2O, and 10 µL of 10X buffer (500 mM Tris-HCl, 700 mM NaCl, and 140 MgCl2 mM at pH 8.6). At equal times of 0 min, 9 µL of the oligomer sample prepared above was separated and added

10 to 10 µL of stop buffer (6.67 M urea, 16.67% formamide and 83.3 mM EDTA) followed by 1 µL of H2O and heated at 100 ° C for 2.5 to 3 min. The kinetics of the analysis began with the addition of 9 µL of SVPD (0.5 Units / mL). The final enzyme concentration was 0.05

15 Units / mL. Each 10 µL aliquot of oligomer kinetics solution was added to 10 µL of stop buffer and heat inactivated as described above. The kinetic time points were taken at 1, 3, 9, 27, 80, 240 and 1290 min. The samples were analyzed

20 by one round of 12% acrylamide PAGE for 2 hours at 45 Watts / gel.

SEQ ID NO./ISIS NO. Composition (5 'to 3') modification 06/395421 TTTTTTTTTTTeTe Bold 2'-O-MOE 07/395423 TTTTTTTTTTUlUl Bold 4'-CH2-O-2 ' 07/395424 TTTTTTTTTTURUR Bold 6- (R) -CH3 07/395425 TTTTTTTTTTUSUS Bold 6- (S) -CH 06/7157 TTTTTTTTTTTT Unmodified (2'-H)

All internucleoside linkages are phosphorothioate,

nucleosides in bold are modified nucleosides,

the subscripts R and S indicate the configuration in the atom

carbon 6 for nucleosides 6-CH3-BNA, the subscript e indicates nucleosides 2'-O-MOE and the subscript 1 indicates modified nucleosides 4'-CH2-O-2 '.

SEQ ID NO. ISIS No. % Comp at 3 min. % Comp at 27 min. % Comp at 80 min. % Comp at 240 min. % Comp. At 1290 min. 06/395421 68.7 27.9 17.2 11.6 9.0 07/395423 32.6 4.7 2.5 2.2 2.2 07/395424 96.4 89.1 83.2 79.0 72.0 07/395425 96.0 86.3 83.7 82.3 82.7 06/7157 5.2 1.2 2.0 1.7 0.9,

5

Example 40

Oligomers with 6- (S) -CH3-BNA, 4'-CH2-O-2-BNA, and 2'-O-MOE spaces targeting PTEN in a study of multiples

10 doses, three weeks, in vivo

The modified oligomers 6- (S) -CH3 were injected

BNA (2-10-2, 14-unit oligomers), 4'-CH2-O-2'-BNA

(2-10-2, 14-unit oligomers) and 2'-O-MOE (5-10-5,

15 oligomers of 20 units) targeted to PTEN at a dose of 3.2, 1.0, 0.32 and 0.1 µmol / kg (only the data of 3.2 and 1 µmol / kg are shown below) at Six week old Balb / c mice (Jackson Laboratory, Bar Harbor, ME) twice weekly for three weeks.

The mice were sacrificed 48 hours after the last administration. Liver tissues were homogenized and mRNA levels were quantified using real-time PCR as described herein for comparison with non-control levels.

25 treated (% UTC). Plasma chemistry and weights

liver were determined after sacrifice.

SEQ ID NO./ISISNO. Composition (5 'to 3') dose % UTC (µmol / kg) ALT Saline solution 100 41.3 05/392749 CSUSTAGCACTGGCCSUS 3.2 4.3 29.8 05/392749 CSUSTAGCACTGGCCSUS 1 36 24.5 05/392063 ClUlTAGCACTGGCClUl 3.2 4.2 279.3 08/392063 MeClTlTAGCACTGGCMeClTl 1 26 41.0 09/116847 CeTeGeCeTeAGCCTCTGGATeTeTeGeAe 1 53 41.3

All internucleoside linkages are phosphorothioate,

5 the nucleosides in bold are modified positions, the subscript s indicates 6- (S) -CH3-BNA, the subscript I indicates 4'-CH2-O-2 'BNA, the subscript e indicates 2'-O-MOE and MeC indicates a nucleoside of 5'-methylcytosine.

10 At the conclusion of the study, the animals in the group that had been administered a high dose showed a significant increase in liver weights for the oligomers containing 4'-CH2-O-2 'BNA (392063, 3.2 µmol / Kg dosing group) (153% with

15 compared to saline). In contrast, liver weights for oligomers containing 6- (S) CH3 BNA (392749, 3.2 µmol / Kg dosing group) were 117% relative to saline. Liver weights for oligomers containing 2'O

20 MOE (116847, 1.0 µmol / Kg dosing group) were 116% with respect to the saline solution. This example demonstrates that the 6- (S) -CH3-BNA modification allows the design of antisense oligomers that maintain the potency conferred by 4'-CH2-O-2 'BNA with a dramatic improvement in ALT levels over the compounds. modified 4'-CH2-O-2 'BNA.

5 Example 41

Oligomers with spaces 6- (R or S) -CH3, 6- (R or S) -CH2-OCH3, 4'-CH2-O-2'BNA 2-10-2 targeting PTEN: in vivo study

10 The oligomers with modified spaces 6 (R or S) -CH3 (396568 and 396024 respectively), 6- (R or S) -CH2-OCH3 (396007 and 396008 respectively), 4'-CH2-O- 2 'BNA 2-10-2 targeting PTEN at a dose of 2.5, 5, 10 and 20 µmol / kg (only 5 and

10 µmol / Kg data not shown) in six week old Balb / c mice (Jackson Laboratory, Bar Harbor, ME). Mice were sacrificed 66 hours after administration. Liver tissues were homogenized.

SEQ ID NO./ISISNO. Composition (5 'a3') dose (µmol / kg) ALT Saline solution 41.3 05/396024 CSUSTAGCACTGGCCSUS 10 250.5 05/396024 CSUSTAGCACTGGCCSUS 5 72.0 05/396568 CRURTAGCACTGGCCRUR 10 234.3 05/396568 CRURTAGCACTGGCCRUR 5 62.0 05/396008 CSUSTAGCACTGGCCSUS 10 129.5 05/396008 CSUSTAGCACTGGCCSUS 5 49.0 05/396007 CRURTAGCACTGGCCRUR 10 49.0 05/396007 CRURTAGCACTGGCCRUR 5 36.3 08/392063 MeClTlTAGCACTGGCMeClTl 10 925.0

SEQ ID NO./ISISNO. Composition (5 'a3') dose (µmol / kg) ALT 08/392063 MeClTlTAGCACTGGCMeClTl 5 373.0

All internucleoside linkages are phosphorothioate,

nucleosides in bold are modified nucleosides,

the subscripts R and S indicate the configuration in the atom

5 of carbon 6 for the nucleosides 6-CH3-BNA (bold only) and 6-CH2-O-CH3-BNA (bold and underlined) indicated, the subscript 1 indicates nucleosides 4'-CH2-O-2 'and MeC indicates a nucleoside of 5'-methylcytosine.

10 For the oligonucleosides above, one (Isis No. 392063) does not include a nucleoside that is chiral at carbon 6, where the other four (Isis Nos. 396024, 396568, 396008, and 396007) do. Specifically, those four include one such

15 nucleosides in positions 1, 2, 13 and 14. The one that does not have a relatively higher toxicity in the liver compared to the four nucleosides that do.

Example 42

twenty

Oligomers with spaces 2-14-2 targeting PTEN: study

in vivo

Modified 6-CH3 oligomers were injected once

BNAs directed to PTEN at a dose of 2 or 10 µmol / kg to six week old Balb / c mice (Jackson Laboratory, Bar Harbor, ME). Mice were sacrificed 72 hours after administration. Liver tissues were homogenized and mRNA levels were quantified.

30 using real-time PCR as described herein for comparison with levels of the

untreated control (% UTC).

SEQ ID NO./ISISNO. Composition (5 'to 3') modification 10/394420 mCeTeGCTAGCCTCTGGATTeTe Bold 2'-O-MOE 11/400522 mCRURGCTAGCCTCTGGATURUR Bold 6- (R) -CH3 11/400523 mCSUSGCTAGCCTCTGGATUSUS Bold 6- (S) -CH3 11/400524 mCRURGCTAGCCTCTGGATURUR Bold 6- (R) -CH2O-CH3 11/400525 mCSUSGCTAGCCTCTGGATUSUS Bold 6- (S) -CH2O-CH3

ISIS NO. dose (µmol / kg) % UTC Typical deviation Saline solution 100% 12% 394420 two 79% two% 394420 10 26% eleven% 400522 two 18% 3% 400522 10 4% 0% 400523 two 17% two% 400523 10 4% 1% 400524 two 2. 3% 7% 400524 10 4% 0% 400525 two twenty-one% 3% 400525 10 3% 0%

All internucleoside linkages are phosphorothioate,

nucleosides in bold are modified nucleosides,

the subscripts R and S indicate the configuration in the atom

Carbon 6 for the indicated 6-CH3-BNA and 6-CH2-O-CH3BNA nucleosides, the subscript c indicates 2'-O-MOE nucleosides and McC indicates a 5'-methylcytosine nucleoside.

While this invention has been described in the foregoing specification in relation to some of its preferred embodiments, and many details have been set forth for illustrative purposes, it will be apparent to those skilled in the art that the invention is capable of embodiments.

Additional 10 and some of the details described herein can be varied considerably without departing from the basic principles of the invention.

fifteen

Claims (14)

1. A bicyclic nucleoside that has the formula: 5 where: Bx is a heterocyclic alkaline radical; T1 is H or a hydroxyl protecting group; T2 is H, a hydroxyl protecting group or a group 10 reactive phosphorus; Z is C1-C6 alkyl, C1-C6 alkenyl, C1-C6 alkynyl, substituted C1-C6 alkyl, substituted C2-C6 alkenyl, substituted C2-C6 alkynyl, acyl, substituted acyl, substituted amide, thiol or substituted thio; Y Where each of the substituted groups is independently mono or polysubstituted with optionally protected substituent groups independently selected from halogen, oxo, hydroxyl, OJ1, NJ1J2, SJ1, N3, OC (= X) J1, OC (= X) NJ1J2, 20 NJ3C (= X) NJ1J2 and CN, where each of J1, J2 and J3 is independently H or C1-C6 alkyl, and X is O, S or NJ1, where the reactive phosphorus group is a phosphoramidite, H- phosphonate, phosphate triester, or a chiral phosphorus-containing auxiliary. 25 2. The bicyclic nucleoside of claim 1, wherein Z is C1-C6 alkyl or substituted C1-C6 alkyl.

3.

The bicyclic nucleoside of claim 2, 30 where Z is methyl.

4. The bicyclic nucleoside of claim 2, wherein Z is substituted C1-C6 alkyl.

5.

The bicyclic nucleoside of claim 4, 5 wherein said substituent group is C1-C6 alkoxy.

6. The bicyclic nucleoside of claim 4, wherein Z is CH3OCH2-. The bicyclic nucleoside of any one of claims 1-6 having the configuration:

8.

The bicyclic nucleoside of any one of claims 1-6 having the configuration:

9.

The bicyclic nucleoside of any one of claims 1-8, wherein at least one of T1 and T2 is a

Hydroxyl protecting group where T1 is selected from acetyl, benzyl, t-butyldimethylsilyl, t-butyldiphenylsilyl, and dimethoxytrityl. 10. The bicyclic nucleoside of claim 9, 25 wherein said T1 is 4,4'-dimethoxytrityl.

eleven.

The bicyclic nucleoside of any one of claims 1-8, wherein T2 is a reactive phosphorus group, wherein said reactive phosphorous group is

diisopropylcyanoethoxy phosphoramidite or H-phosphonate.

12.

The bicyclic nucleoside of any one of claims 1-8, wherein T1 is 4,4'-dimethoxytrityl and T2 is diisopropylcyanoethoxy phosphoramidite.

13.

An oligomeric compound that has at least one monomer of the formula:

or formula: fifteen where Bx is a heterocyclic alkaline radical; T3 is H, a hydroxyl protecting group, a connected conjugated group or a connecting group of Internucleosides attached to a nucleoside, a nucleotide, an oligonucleoside, an oligonucleotide, a monomeric subunit, or an oligomeric compound; T4 is H, a hydroxyl protecting group, a connected conjugated group or a connecting group of Internucleosides attached to a nucleoside, a nucleotide, an oligonucleoside, an oligonucleotide, a monomeric subunit, or an oligomeric compound; where at least one of T3 and T4 is an internucleoside connecting group attached to a nucleoside, a nucleotide, 30 an oligonucleoside, an oligonucleotide, a subunit monomeric or an oligomeric compound; Y Z is C1-C6 alkyl, C1-C6 alkenyl, C1-C6 alkynyl, substituted C1-C6 alkyl, substituted C2-C6 alkenyl, C2-C6 substituted alkynyl, acyl, substituted acyl, substituted amide, thiol or substituted thio, where each of the substituted groups is, independently, mono or polysubstituted with groups optionally selected protected substituents independently from halogen, oxo, hydroxyl, OJ1, NJ1J2, SJ1, N3, OC (= X) J1, OC (= X) NJ1J2, NJ3C (= X) NJ1J2 and CN, where each of J1, J2, and J3 is independently H or C1-C6 alkyl, and X is O, S or NJ1, where, the term "oligomeric compound" refers to a polymer that has at least one region that is capable of hybridizing with an acid molecule nucleic, and where the oligomeric compound comprises from 8 to 80 nucleosides and / or modified nucleosides or mimetics.

14.

The oligomeric compound of claim 13, wherein each of Z is, independently, C1-C6 alkyl or substituted C1-C6 alkyl.

fifteen.

The oligomeric compound of claim 14, wherein at least one Z is methyl.

16.

The oligomeric compound of claim 14, wherein at least one Z is substituted C1-C6 alkyl.

17.

The oligomeric compound of claim 16, wherein each of said substituent groups is C1-C6 alkoxy.

18.

The oligomeric compound of claim 16, wherein at least one Z is CH3OCH2-.

19.

The oligomeric compound of any one of claims 13-18, wherein each of Z is methyl

or CH3OCH2-. 5 20. The oligomeric compound of any one of claims 13-19, wherein at least one monomer of said formula has the configuration represented by the formula: 10 or the formula: fifteen 21. The oligomeric compound of claim 20, wherein each Z group of each monomer of said formula is in the configuration represented by formulas V or VI. twenty 22. The oligomeric compound of any one of claims 13-19, wherein at least one monomer has the configuration represented by the formula: or the formula:

2. 3.

The oligomeric compound of claim 22, wherein each of the Z groups of each monomer of said formula is in the configuration represented by formulas V or VI.

24.

The oligomeric compound of any one of claims 13-23, wherein T3 and / or T4 is H or a hydroxyl protecting group.

25.

The oligomeric compound of any one of claims 13-23, wherein T3 and / or T4 is an internucleoside linking group attached to a nucleoside, a nucleotide or a monomeric subunit.

26.

The oligomeric compound of any one of claims 13-23, wherein T3 and / or T4 is an internucleoside connecting group attached to an oligonucleoside

or an oligonucleotide.

27.

The oligomeric compound of any one of claims 13-23, wherein T3 and / or T4 is an internucleoside connecting group attached to an oligomeric compound.

28.

The oligomeric compound of any one of claims 13-23, wherein at least one of T3 and T4 comprises an internucleoside connecting group selected from phosphodiester or phosphorothioate.

29.

The oligomeric compound of any one of claims 13-28 comprising at least one

region of at least two contiguous monomers of said formula.

30.

The oligomeric compound of claim 29, comprising at least two regions of at least two contiguous monomers of said formula.

31.

The oligomeric compound of claim 30, comprising an interrupted oligomeric compound.

32.

The oligomeric compound of any of claims 29 or 30, further comprising at least a region of about 8 to about 14 contiguous βD-2'-deoxyribofuranosyl nucleosides.

33.

The oligomeric compound of claim 32, further comprising at least a region of about 9 to about 12 contiguous βD2'-deoxyribofuaranosyl nucleosides.

3. 4.

The oligomeric compound of claim 29, comprising a region of 2 to three contiguous monomers of said formula, an optional second region of 1 or 2 contiguous monomers of said formula and a third region of 8 to 14 nucleosides of βD-2'deoxyribofuranosyl where said third region is located between said first and second regions.

35.

The oligomeric compound of claim 34, comprising 8 to 10 nucleosides of βD-2'deoxyribofuranosyl.

36.

The oligomeric compound of any one of claims 13-35, comprising from about 8 to about 40 nucleosides and / or modified nucleosides or mimetics in length.

37.

The oligomeric compound of any one of claims 13-35, comprising from about 8 to about 20 nucleosides and / or modified nucleosides or mimetics in length.

38.

The oligomeric compound of any one of claims 13-35, comprising from about 10 to about 16 nucleosides and / or modified nucleosides or mimetics in length.

39.

The oligomeric compound of any one of claims 13-35, comprising from about 10 to about 14 nucleosides and / or modified nucleosides or mimetics in length.

40.

an in vitro method of inhibiting gene expression comprising contacting one or more cells

or a fabric with an oligomeric compound of any of claims 13 to 39.

41.

An oligomeric compound of any one of claims 13 to 39, for use in an in vivo method of inhibiting gene expression, said method comprising contacting one or more cells, a tissue or an animal with an oligomeric compound of any one of the Claims 13 to 39.

42.

An oligomeric compound of any one of claims 13-39, for use in medical therapy.

43.

The use of an oligomeric compound of any one of claims 13-39, for the manufacture of a medicament for the inhibition of gene expression.