ES2335489T3 - PROMOTER OF II-18BP, ITS PREPARATION AND EMPLOYMENT. - Google Patents

Abstract

The present invention relates to the promoter of interleukin-18 binding protein (IL-18BP), to its preparation and use.

Description

Promoter of IL-18BP, your Preparation and employment

Field of the Invention

The present invention relates to the promoter of interleukin-18 binding protein (IL-18BP), its preparation and its use.

Foundation of the invention

Cytokine binding proteins (soluble cytokine receptors) are normally the extracellular ligand binding domains of their corresponding cell surface cytokine receptors. They are produced either by alternative support or by proteolytic segmentation of the cell surface receptor. These soluble receptors have been described in the past: for example, the receptors for IL-6 and IFNγ (Novick et al . 1989), TNF (Engelmann et al . 1989 and Engelmann et al . 1990), IL-1 and IL-4 (Maliszewski et al . 1990) and IFN? /? (Novick et al . 1994, Novick et al . 1992). A cytokine binding protein called osteoprotegerin (OPG, also known as an OCIF osteoclast inhibitor factor), a member of the TNFR / Fas family, appears to be the first example of a soluble receptor that exists only as a secreted protein (Anderson et al. 1997, Simonet et al . 1997, Yasuda et al . 1998).

An interleukin-18 binding protein (IL-18BP) was affinity purified, on an IL-18 column, from urine (Novick et al . 1999). IL-18BP cancels the induction of IL-18 from IFNγ, and the activation of IL-18 from NF-kB in vitro . In addition, IL-18-BP inhibits the induction of IFNγ in mice injected with LPS. The IL-18BP gene was located on human chromosome 11, and no exon could be found that encodes a transmembrane domain in the 8.3 kb genomic sequence comprising the IL-18BP gene. Four isoforms of IL-18BP generated by alternative mRNA support have been found so far in humans. They were named IL-18BP a, b, c, and d, all of them sharing the same term N and differing in the term C (Novick et al . 1999). These isoforms vary in their ability to bind IL-18 (Kim et al . 2000). Of the four, it is known that human isoforms IL-18BP (hIL-18BP) a and c have a neutralizing capacity for IL-18. The IL-18BP isoform most abundant isoform variant spliced to, a high affinity for IL18 with a rapid on-rate and off-rate slow, and a dissociation constant (Kd) of approximately 0.4 nM (Kim et al . 2000). IL-18BP is constitutively expressed in the spleen (Novick 1999), and circulates at plasma concentrations of 2.5 ng / ml (Novick et al . 2001). The residues involved in the interaction of IL-18 with IL-18BP have been described by the use of computerized models (Kim et al . 2000) and based on the interaction between similar protein IL-1? With IL- 1R type I (Vigers et al . 1997). In accordance with the IL-18 binding model to IL-18BP, it has been proposed that the Glu residue at position 42 and the Lys residue at position 89 of IL-18 bind to Lys-130 and Glu-114 of IL-18BP, respectively (Kim et al . 2000).

As indicated, IL-18 induces IFNγ which, in turn, has recently been published that induces in vitro generation of IL-18BPa mRNA (Muhl et al 2000). Therefore, IL-18BPa could serve as a "stop" signal, ending the inflammatory response.

IL-18BP is significantly homologous with respect to a family of proteins encoded by several smallpox viruses (Novick et al . 1999, Xiang and Moss 1999). Inhibition of IL-18 by this putative viral IL-18BP may attenuate the inflammatory Th1 antiviral response.

Serum IL-18BP is significantly elevated in sepsis, indicating its role in the regulation of immune responses in vivo (Novick et al . 2001). Actually, IL-18BP is induced by IFNγ in several cells, suggesting that it serves as an inhibitor of negative feedback of the IL-18-mediated immune response (Mughl et al . 2000).

Preliminary results indicate that IL-18BP mRNA is detected in leukocytes, colon, small intestine, prostate and, in a particular way, in spleen cells (Novick et al . 1999). The spleen component cells consist of macrophages, lymphocytes and plasma cells with additional cells derived from the circulation.

The activity of elements that control transcription, promoters and enhancers , varies considerably between different cell types. Promoters and enhancers consist of brief arrays of DNA sequences that interact specifically with cellular proteins involved in transcription (reviewed in Dynan and Tjian 1985, McKnight and Tjian 1986, Sassone-Corsi and Borreli 1986 and Maniatis et al . 1987). The combination of different recognition sequences and the amounts of related transcription factors determine the efficiency with which a given gene is transcribed in a particular cell type. Many eukaryotic promoters contain two types of recognition sequences: the TATA sequence ("TATA box") and the promoter elements upstream. It is believed that the TATA box, located 25-30 bp upstream of the transcription initiation site, is involved in directing RNA polymerase II to begin RNA synthesis at the correct site. Instead, the promoter elements upstream determine the rate at which transcription begins. Enhancer elements can stimulate transcription up to 1000 times from homologous or heterologous promoters linked. However, unlike the upstream promoter elements, the enhancers are active when placed downstream of the transcription initiation site or at a considerable distance from the promoter. Many cell gene enhancers work exclusively on a particular tissue or cell type (reviewed by Voss et al . 1986, Maniatis et al . 1987). In addition, some enhancers become active only under specific conditions that are generated by the presence of an inducer, such as a hormone or a metal ion (reviewed by Sassone-Corsi and Borrelli 1986 and Maniatis 1987). Because of these differences in the cell specificities of cell enhancers, the choice of promoter and enhancer elements to be incorporated into a eukaryotic expression vector will be determined by the types of cells in which the recombinant gene is to be expressed. In contrast, the use of a prefabricated vector containing a specific promoter and cell enhancer can severely limit the types of cells in which expression can be obtained.

Many virus-derived enhancing elements have a wider host range and are active in a variety of tissues, even when significant quantitative differences are observed between different cell types. For example, the SV40 early enhancer is promiscuously active in many cell types derived from a variety of mammalian species, and consequently vectors incorporating this enhancer have been used (Dijkema et al . 1985). Two other promoter and promoter combinations that are active in a wide range of cells are derived from the long repeat (LTR) of the Rous sarcoma virus genome (Gorman et al . 1982b) and the human cytomegalovirus (Boshart et al . 1985 ).

Summary of the invention

The invention relates to a DNA sequence. encoding the human IL-18BP promoter (SEQ ID NO: 1), or a fragment such as those of SEQ ID NOS 2 or 3, or a functional derivative thereof, wherein the 3 'end of said DNA sequence or fragment thereof comprises SEQ ID NO: 5.

More specifically, a derivative according to the present invention may be the DNA of the invention mutated in one or more AP1 sites present in a silencer element present in the sequence, and the DNA sequence may also contain a gene operatively linked to the IL-18BP promoter.

In one aspect of the invention, the gene can encode p. ex. IL-18BP or a heterologous protein such as luciferase, interferon beta, TNF, erythropoietin, tissue plasminogen activator, colony stimulating factor  of granulocytes, manganese superoxide dismutase, a immunoglobulin, or a fragment thereof, growth, and binding proteins with the FSH receptor, hCG, IL-18, hsLDLR and TNF.

The invention provides a vector comprising a DNA sequence encoding the promoter of Human IL-18BP, a host cell that comprises the vector p. ex. CHO, WISH, HepG2, Cos cells, CV-1, HeLA, and Hakat U937, and a method for production of a recombinant protein, which comprises cultivating the host cell and isolate the recombinant protein produced.

In addition, the invention provides a vector of recombinant virus comprising a portion of the virus genome, a DNA fragment encoding a gene of interest and a fragment of DNA comprising a DNA sequence encoding the promoter of Human IL-18BP. More specifically, the portion of virus can be p. ex. an adeno-associated virus, and a retrovirus such as HIV, HFV, MLV, IVF and VSV.

Also the present invention provides a method to regulate the specific expression of a gene cell of interest, which comprises transducing a target mammalian cell with the virus vector of the invention in a target cell such as a hematopoietic stem cell, and a monocyte. The gene of interest can be p. ex. a protein that confers resistance to HIV infection The regulation of the specific expression of the cell of a gene of interest can be used in the treatment p. ex. from HIV infection, treatment of disorders hematopoietic such as SCID, chronic granulomatous disease and thalassemia.

A method of gene therapy is also described. for the treatment of a disease in an individual who shows High IFNγ in a body tissue, which comprises the administration of an effective amount of the virus vector of the invention, which optionally further comprises the administration of IL-6 and / or TNF-? and / or factors IRF and / or C / EBP?

In another aspect, the invention relates to transgenic mice that harbor the DNA sequence that encodes a DNA sequence of the invention.

In addition the invention teaches the use of a DNA sequence encoding the IL-18BP promoter human (SEQ ID NO: 1), or a fragment or functional derivative of the same, wherein the 3 'end of said DNA sequence or fragment It includes SEQ ID NO: 5, in the preparation of a medicine to treat a disease

Also, the invention provides a pharmaceutical composition comprising a therapeutically amount  effective of a DNA sequence encoding the promoter of the Human IL-18BP (SEQ ID NO: 1), or a fragment or a functional derivative thereof, wherein the 3 'end of said DNA sequence or fragment thereof comprises SEQ ID NO: 5.

Brief description of the figures

Figure 1 shows a representation schematic of the gene promoter region IL-18BP, including the 5 elements regulators

Figure 2 shows the kinetics of induction of IL-18BP and synergism with TNFα and IL-6. ( A ) IFNγ induces IL-18BP in a dose and time dependent manner in human WISH cells. The cells are incubated with the indicated concentrations of IFNγ for 24 and 48 h. ( B ) Synergistic effects of TNFα IL-6 and its combination in IFNγ-induced IL-18BP. HepG2 cells were incubated with the indicated combinations of IFNγ (100 U / ml), TNFα (20 ng / ml) and IL-6 (300 U / ml). The induction of IL-18BP for each combination was significantly higher (p <0.05) than the induction by IFNγ only. Data are means ± SD (n = 3, for A ; n = 4, for B ).

Figure 3 shows a representation schematic of the exon-intron organization conserved of human IL-18BP genes and of mouse. The human IL-18BPa gene was compared with the mouse IL-18BPd gene. The exons are indicated. The transcription initiation site, the site of Start of translation (ATG), stop codon (Stop) and signal Polyadenylation (PAS) are indicated for the human gene of IL-18BPa.

Figure 4 shows that the induction of IL-18BP by IFNγ is transcriptional and depends on de novo protein synthesis . (A) Semi-quantitative RT-PCR of IL-18BP mRNA from HepG2 cells that were pre-incubated with actinomycin D (1 µg / ml, 30 min), washed and incubated with IFNγ (100 U / ml) during the indicated times. RT-PCR of β-actin mRNA is shown as a control (B) semi-quantitative RT-PCR of IL-18BP mRNA from HepG2 cells that were pre-incubated with cycloheximide (20 µg / ml) and IFN γ (100 U / ml) during the indicated times.

Figure 5 shows the basal and IFNγ-induced activity of luciferase reporter vectors carrying the human IL-18BP promoter. The size of the insert, which extends from the transcription start site (+1), is given in parentheses. The numbers in circles represent the various response elements: 1. GAS. 2. IRF-E. 3. C / EBP-E (2 sites). 4. Silencer 5. Distal improver. Filled squares represent mutation in a specific response element. HepG2 cells were co-transfected with the indicated reporter vector and pSV40? GAL. All luciferase values were normalized to β-galactosidase activity. ( A ) Luciferase activity in non-induced cell extracts relative to that of cells transfected with pGL3-Basic vector. (B) Luciferase activity in cells transfected with the vectors selected and induced with IFNγ. The number of times of induction is about the basal activity as given in (A).

Figure 6 shows that IRF-1 It is essential for the expression of IL-18BP in mice. Serum IL-18BP, from C57BI / 6 mice IRF-1 - / - and control C57 BI / 6 that were injected intraperitoneally with murine IFNγ (53,000 u / mouse). The mice were bled before injection and 24 h after the injection. Serum IL-18BP is determined by ELISA. Data are mean ± SE (n = 6 for each group). The differences between IL-18BP in serum in the control and in IRF-deficient mice, as well as the induction of IL-18BP in control mice, were statistically significant (p <0.05).

Figure 7 shows the role of IRF-1 and C / EBP? In the induction of the IL-18BP gene and its association. ( A ) electrophoretic mobility shift test (EMSA Example 18) of ds DNA probes (double stranded DNA) corresponding to bases -33 to -75 (IRF-E, left panel) and -8 to -55 ( GAS, right panel). HepG2 cells were treated with IFNγ during the indicated times and the nuclear extracts were allowed to react with the IRF-E or GAS probes. Shifted bands are also indicated by filled arrowheads. The GAS complex was also subjected to super displacement with the indicated antibodies. The super displaced band is indicated by an open arrowhead. ( B ) Semi-quantitative RT-PCR of IL-18BP mRNA of HepG2 cells that were transfected with the indicated combinations of IRF-1 or C / EBP? Expression vectors. When indicated, IFNγ was added and the cells were harvested 5 h later. Values were normalized to β actin mRNA. (C) Luciferase activity in cells transfected with the luciferase reporter vector pGL3 (1272), which contains the complete IL-18BP promoter, together with the indicated concentration of pCDNA3-IRF-1 (circles) and 1 / mug / 10 6 pCDNA3-C / EBP? Cells. Alternatively, the cells were transfected with the indicated concentration of pCDNA3-C / EBPβ (squares) and 0.1 µg / 10 6 cells of pCDNA3-IRF-1. Luciferase activity was normalized by β Gal activity. ( D ) immunoblotting of nuclear and cytoplasmic extracts (see Example 17 for the preparation of extracts) of IFNγ-treated cells (100 U / ml, 2 h). The extracts were immunoprecipitated (IP) and immunoblotted (IB: ImmunoBlotted) with the indicated antibodies.

Figure 8 shows the factors that bind to IL-18BP promoter in induction with IFNγ (A) EMSA with the proximal C / EBP? E and cell extracts complete after treatment with IFNγ. When indicates, the extracts were super displaced with the antibodies indicated. (B) EMSA with a probe corresponding to the improver distal and whole cell extracts after treatment with IFNγ. When indicated, the extracts were super displaced with the indicated antibodies, with or without competition with ds DNA corresponding to the proximal half of the probe. Shifted bands are indicated by arrowheads filled and super displaced band are indicated by tips empty arrow

Detailed description of the invention

The present invention relates to the promoter of the human IL-18BP. This promoter drives the constitutive expression of IL-18BP in cells concrete, for example in monocytes and induction mediated by IFNγ of IL-18BP expression in many cells. The human IL-18BP promoter is capable of direct constitutive and IFNγ-induced expression of a heterologous protein

The invention relates to a DNA sequence. encoding the human IL-18BP promoter (SEC ID No.: 1), or a fragment or a functional derivative thereof, in wherein the 3 'end of said DNA sequence or fragment of the It comprises SEQ ID N: 5.

IL-18BP mRNA is detected in leukocytes, colon, small intestine, prostate and mainly in spleen cells (Novick et al . 1999). In one of the examples set forth below, it is shown that the IL-18 protein is constitutively expressed in monocytes. It has been found that the expression of IL-18BP is induced by IFNγ, not only in monocytes but also in many different cells, and that this induction could be improved by the addition of IL-6 and TNFα.

It was found that de novo protein synthesis is essential for activation of the IL-18BP gene by IFNγ.

The mRNA transcription initiation site of human IL-18BPa was determined by 5 ' RACE

The 3 'mRNA of the zinc finger protein ( Zn finger ) located upstream of the IL-8BP gene was thus found by limiting the potential regulatory sequence upstream of IL-18BPa to 1601 bases upstream of base 1.

Six regulatory elements have been identified (Figure 1) within this region (from transcription proximal to the distal transcription): 1- activated gamma sequences (GAS; Gamma Activated Sequences) in the bases -24 to -32, 2- An element of IRF-1.2 response (IRF-E) covering the bases -57 to -69, 3- and 4- two response elements C / EBP? In the bases -309 to -322 and -621 to- 634, 5- a silencer in the remains -625 to -1106 and 6- an improvement element covering bases -1106 to -1272. A series of vectors Luciferase reporters with progressive truncation in the 5 'end of the 1601 bp fragment were tested in cells HepG2 (a line of human hepatocellular carcinoma). The region of 1272 kb set forth in SEQ ID NO: 1 addresses both a basal expression observed in some tissues and cell types, such as induction by IFNγ. The promoter's activity tests in DNA fragments truncated successively within this region demonstrated that a 122 bp DNA fragment, proximal to the site of initiation of transcription set forth in SEQ ID NO: 3 It comprises the minimum promoter. This minimum promoter is also inducible However, other sequence regulatory sequences above this minimum promoter yes they contributed to the amount of induction It was found that a 635 bp DNA fragment that contains, in addition to the IRF-1 and GAS elements, two C / EBPp elements, set out in SEQ ID NO: 2, confers induction Maximum expression of luciferase by IFNγ.

In-vivo experiments carried out with mice deficient in IRF-1, confirmed the importance of IRF-1 as a mediator of basal expression of IL 18BP, as well as that of IFN-induced.

It has been found that, in induction by IFNγ, expression of the IRF-1 factor is induced and the factor is complexed with C / EBP? which is constitutively present in the cells. The complex binds to the promoter element GAS proximal and its adjacent promoter element IRF-E.

It was found that the improver present in the distal end of the transcription site interacts with the basal promoter through IRF-1.

The present invention relates to the promoter of IL18BP of SEQ ID NO: 1 or a fragment thereof and to methods for regulate gene expression. More particularly, the present invention relates to DNA sequences isolated from IL-18BP 1272 bp (SEQ ID NO: 1) or a fragment of the same as 635 bp (SEQ ID NO: 2) and 122 bp (SEQ ID NO: 3) that They are capable of directing gene expression.

This region of the promoter of IL-18BP has been cloned and sequenced and corresponds to nucleotides at 1272 bp upstream of the start site of the transcription of IL-18BP (SEQ. ID. NO: 1).

The present invention includes the promoter of Whole IL-18BP (SEQ ID NO: 1), but also the DNA sequences comprising a fragment thereof (SEQ ID NO: 2, SEQ ID NO: 3), capable of directing transcription, and therefore finally gene expression, and can be used with other portions from the IL-18BP promoter region, or alternatively with heterologous promoters or promoter elements heterologists to control gene transcription. This promoter or fragment thereof is capable of induction by IFNγ. Such induction can be further enhanced by overexpression of IRF-1 and / or C / EBP? And / or by treatment with IL-6 and / or TNFα.

The functional derivatives of the promoter exposed in SEQ ID NO: 1, or the fragment thereof such as SEQ ID NO: 2 or SEQ ID NO: 3, are mutants in which from 1 to 10, preferably 1 to 5, more preferably 1 nucleotide, is replaced with another, or it is deleted, and they are able to direct the gene expression and induction by IFNγ.

The DNA sequences of the present invention comprising an IL-18BP promoter (SEQ ID NO: 1) or a fragment thereof such as that of SEQ ID NO: 2 or SEQ ID No.: 3, can be isolated using various methods known in the technique. At least three main methods can be used alternatives:

(1) DNA sequence isolation a starting from genomic DNA containing the sequence; (2) the synthesis DNA sequence chemistry; and (3) the synthesis of the sequence of DNA by polymerase chain reaction (PCR).

In the first method, a library can be screened of human genomic DNA in order to identify a sequence of DNA comprising an IL-18BP promoter or element IL-18BP promoter.

In the second method, it can be synthesized chemically a DNA sequence comprising a promoter of IL-18BP or a promoter element of IL-18BP. For example, one can synthesize a DNA sequence comprising a promoter region of IL-18BP or an IL-18BP promoter as a series of 100 base oligonucleotides that can be sequentially linked (through the appropriate sites of terminal restriction) to form the linear sequence of correct nucleotides

In the third method, a DNA sequence comprising a promoter region of IL-18BP or an IL-18BP promoter using PCR. In summary, pairs of DNA oligonucleotides synthetic, at least 15 bases in length (PCR primers), that hybridize with opposite strands of the DNA target sequence, can be used to amplify or enzymatically multiply the interposed region of DNA in the target sequence. Repeated cycles of denaturation by the heat of the mold, mating of the primers and elongation of the 3 'terms of the primers paired, with a DNA polymerase, result in segment amplification defined by the 5 'ends of the PCR primers. See US patents. No. 4,683,195 and 4,683,202.

It was shown that the promoter of IL-18BP of the invention is capable of conferring basal expression and also IFNγ-induced expression of a heterologous gene Thus, the IL-18BP promoter has both activities, basal and inducible.

Although the nucleotide sequence of the promoter is set forth in SEQ. ID. NO. 1 or fragments thereof that have promoter activities and such sequence is referred to in the specification, it is recognized that nucleotide derivatives that do not affect the function of the promoter or the promoter element can be prepared. These modified nucleotide sequences can be prepared, for example, by mutating the nucleotide sequence so that the mutation results in deletion (deletion), substitution, insertion, inversion or addition of one or more nucleotides using several known methods. in the technique For example, the site directed mutagenesis methods described in Taylor, JW et al ., Nucl. Acids Res. 13, 8749-8764 (1985) and Kunkel, JA, Proc. Natl Acad. Sci. USA 82, 482-492 (1985). In addition, kits for site-directed mutagenesis can be purchased at commercial firms. For example, a kit for performing site-directed mutagenesis can be purchased from Amersham Corp. (Arlington Heights, Ils.). The present invention includes DNA containing at least 50% identical sequences and preferably 75% identical and more preferably 90% identical to SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3 respectively, with the condition that the promoter's activity be retained and / or improved. One such derivative, e.g. ex. in SEQ ID NO: 1, it is the mutated at one or all three API sites present in the muffler region.

The nucleotide sequence comprising the IL-18BP promoter, a fragment thereof and / or a derivative thereof can be operatively linked to the region coding of any gene of interest to express that gene in an appropriate host cell. By operationally linked it understood operatively linked to promoter and elements. For the expression of a gene of interest, it is preferred that the promoter of Whole IL-18BP in SEQ. ID. Nº: 1 or a fragment of same as in SEQ ID NO: 2 or SEQ ID NO: 3 or a derivative of It is operatively linked to the gene of interest. How I know shown later in the example section, the promoter of IL-18BP, or a fragment thereof such as that of the SEQ ID NO: 2 or SEQ ID NO: 3 is capable of directing the expression of heterologous genes Gene expression is also contemplated homologues with the promoter of the invention.

The promoter may also contain an intron, for example the first intron of IL-18BP.

An "operably linked" IL-18BP promoter or promoter element will direct the transcription of a coupled nucleic acid molecule into the appropriate reading frame. With respect to heterologous promoters, the promoters and elements of the invention are operatively linked when they control the function of such promoters.
heterologists

As noted above, the promoter of IL-18BP, a fragment thereof and sequences derived therefrom from the present invention, can be used to express any gene of interest. Typically, it is used for This purpose an expression vector. So, the present invention further concerns expression vectors comprising an isolated DNA sequence capable of directing gene expression, comprising an IL-18BP promoter or fragment of the same or a derivative thereof. Expression vectors preferably contain an IL-18BP promoter a fragment thereof or a derivative thereof, which has a sequence nucleotide corresponding to SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3, respectively, or fragments thereof and / or derivatives. Expression vectors are also preferred which comprise also a homologous or heterologous gene operatively linked to IL-18BP promoter or a fragment thereof and / or a derived from the same modified nucleotide sequence of same.

Expression vectors useful in the present invention are frequently in the form of "plasmids", which refer to circular double stranded DNAs which, in their vector form, are not attached to the chromosome. Without However, it is understood that the invention includes these other forms of expression vectors that serve equivalent functions and that subsequently they become known in the art.

Expression vectors useful herein invention typically contain an origin of replication, a IL-18BP promoter located opposite (i. e., sequence above) of the gene of interest, termination sequences of the transcript and the remaining vector. Expression vectors they can also include other DNA sequences known in the technique, for example, stability conducting sequences that provide stability of the expression product, sequences excretory conductors that provide product secretion from  expression, sequences that allow the expression of the structural gene to be modulated (e.g., by the presence or absence of nutrients or other inducers in the growth medium), marker sequences that are capable of providing selection phenotypic in transformed host cells, and sequences that provide sites for endonuclease segmentation of restriction. The characteristics of the current expression vector used must be compatible with the host cell that is going to use. An expression vector as contemplated herein. invention is at least capable of directing transcription, and preferably the expression of the gene of interest dictated by the IL-18BP promoter region or promoter of IL-18BP or a modified nucleotide sequence Of the same. Suitable origins of replication include, by example, that of simian virus 40 (SV40). The sequences of Suitable termination include, for example, that of the ape virus 40 (SV40). The promoter of the invention can be used for the expression of virtually any gene of interest, for example, those encoding therapeutic products such as interferon-beta, TNF, erythropoietin, activator of tissue plasminogen, colony stimulating factor of granulocytes, manganese superoxide dismutase, a immunoglobulin, or fragment thereof, growth hormone, hsLDLR, FSH, hCG, IL-18, protein binding TNF receptor and IL-18 binding proteins. Everybody these materials are known in the art and many of them are commercially available.

Suitable expression vectors containing the appropriate coding and control sequences can be constructed using standard recombinant DNA techniques known in the art, many of which are described in Sambrook, et al ., Molecular Cloning: A Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989).

The present invention further concerns host cells that contain an expression vector that comprises an isolated DNA sequence capable of directing expression gene, which comprises a promoter region of IL-18BP or an IL-18BP promoter or modified nucleotide sequence thereof. Preferably, the IL-18BP promoter region has the sequence of nucleotides corresponding to 1272 bp upstream of the site of start of transcription of IL-18BP exposed in the SEQ ID NO: 1, or a fragment thereof such as the sequence of nucleotides corresponding to 635 bp upstream of the site of commencement of the transcript set forth in SEQ ID NO: 2 or a fragment thereof such as the 122 bp nucleotide sequence sequence above the start site of the exposed transcript in SEQ ID NO: 3. Host cells are also preferred which they contain an expression vector, which also comprise a gene homologous or heterologous operatively linked to the region of the IL-18BP promoter or IL-18BP set forth in SEQ ID NO: 1 or a fragment thereof. The cells Suitable hosts include, for example, human HeLa cells or CV-1 African green monkey cells and COS-1, CHO cells, HepG2, WISH cells, Hakat U937, etc.

Host cells containing IFNγ receptors, which allow promoter induction of IL-18BP and therefore improved expression of the gene of interest.

Expression vectors can be introduced into host cells by various methods known in the art. For example, the transfection of host cells with expression vectors by the calcium phosphate precipitation method. But nevertheless, other methods can also be used to introduce vectors of expression in host cells, for example, electroporation, biolistic fusion, liposomal fusion, nuclear injection and infection viral or phage.

Once an expression vector has been introduced into an appropriate host cell, the cell host can be cultured and the polypeptide encoded by the gene of interest can be isolated. Alternatively, once you have an expression vector has been introduced into a host cell appropriate, the cell can be cultured and, after reaching the desired cell density, cells can be stimulated with IFNγ and the polypeptide encoded by the gene of interest

Host cells that contain a vector expression that contains a DNA sequence that encodes a gene of interest can be identified using several known methods in the technique For example, DNA-DNA hybridization, establishment of the presence or absence of gene functions marker, setting the level of transcription measured by the mRNA transcript production of the gene of interest in the cell host, and detection of the gene product immunologically.

       \ newpage
    

The DNA sequences of the expression vectors, plasmids or DNA molecules of the present invention can be determined by several methods known in the art. For example, the dideoxy chain termination method described in Sanger et al ., Proc. Natl Acad. Sci. USA 74, 5463-5467 (1977), or the Maxam-Gilbert method described in Proc. Natl Acad. Sci. USA 74, 560-564 (1977).

It is to be understood that specific nucleotides or regions within the IL-18BP promoter can be identified as necessary for regulation. These regions or nucleotides can be located by fine structural dissection of the elements, and can be studied by experiments that analyze the functional capacity of promoter mutants. For example, they can generate mutations of a single base pair of elements of the promoter or progressive deletions, such as those used in the Example section below, using PCR. In this way, it amplify several mutated promoter regions or constructs of deletion, and then cloned back into constructions informants and are evaluated with transfection and testing techniques of luciferase (as discussed in the example section below) ahead). These amplified fragments can be cloned from new in the context of the IL-18BP promoter and also in the constructions of the heterologous promoter. This form the exact nucleotide sequences that are important to direct gene transcription.

This analysis will also identify changes in nucleotides that do not affect the function of the promoter, or that may Increase the function of the promoter. Thus, they can also be built. functional derivative promoters and promoter elements.

Functional analysis of the promoter or promoter region can be facilitated by footprint and gel displacement studies. Knowledge of the exact base pairs important for mediating protein binding provides evidence of the important bases for mediating the transcriptional response.

The invention, therefore, further comprises the base pairs important in the DNA-protein interaction. Such base pairs can be explained. Genomic fragments containing the areas of interest in obtaining footprint experiments (footprinting) in vitro [Galas et al, Nucleic Acids Res. 9, 6505-6525 (1981).] Can be used. The isolated restriction fragment can be radiolabeled and subsequently incubated with nuclear extracts made with established techniques from cells that are expected to contain DNA binding proteins, which will bind to the fragment [eg, Dignam et al ., Nucleic Acids Res 11, 1475-1489 (1983)]. The labeled DNA fragments are incubated with the nuclear extracts, digested with DNAse I, and electrophoresed in a denaturing polyacrylamide gel. The DNA-binding proteins in the cell extract bind to their recognition sequence contained in the labeled restriction fragment, and protects the DNA from DNAse digestion. Protection regions delineate the binding site. Sequencing reactions of the Maxam and Gilbert fragment can be used as a marker to define the nucleotides protected from digestion by DNase.

The invention is also directed to the identification and characterization of trans performance factors that interact with the promoter or promoter elements. The cis-acting regulatory sequences serve as binding sites for proteins called transaction factors (TAF) [Dynan WS, Tjian T. Nature 316, 774-778 (1985); Maniatis, T. et al ., Science 236, 1237-1245 (1987)]. It is assumed that each gene binds to one or more proteins in each of its regulatory sequences, and these proteins interact with another and RNA polymerase II in a manner that controls transcription.

TAFs in nuclear extracts have been identified for their ability to bind to DNA fragments of cis-acting sequence and delay their electrophoretic mobility. [Dignam, JD et al ., Nucleic Acids Res. 11, 1475-1489 (1983); Dynan, W., Cell 58, 1-4 (1989); Fletcher, C. et al ., Cell 773-781 (1987); Scheidereit, C. et al ., Cell 51, 783-793 (1987)].

The cis actuation sequences are useful in gel retardation assays to determine binding activity in nuclear extracts. The technology for gel displacement assays is described in the literature and includes many of the same reagents used in footprinting or genetic fingerprint experiments [Fried, M. et al . , Nucleic Acids Res. 9, 6505-6525 (1981); Revzin, A., Biotechniques 7,346-355 (1989); Strauss, FA et al ., Cell 37, 889-901 (1984)]. Restriction fragments labeled with 32 P, or aligned pairs of complementary oligos, are incubated with nuclear extracts and poly d (IC) in a binding buffer, and the products of this reaction are electrophoresed in a non-denaturing polyacrylamide gel . The position of the DNA fragment in the gel, determined with autoradiography, is delayed in cases where the protein has bound to the DNA. The amount of the delay is a relative function of the protein size.

The binding proteins so identified can then be purified and finally cloned using techniques known.

The IL-18BP promoter also finds use in transgenic studies. Transgenic mice provide a powerful genetic model for the study of several human diseases, including cancer. They have also provided an important in vivo method for gene regulation studies that have confirmed and expanded observations made with transfection reporter gene experiments (eg luciferase) [Palmiter, FL et al ., Ann. Rev. Genet. 20, 465-499 (1986)]. Studies with the intention of dissecting the signals that allow the relationship in terms of the development of gene expression can rarely be performed in cell culture models and are probably best studied with a transgenic model. This type of experiment is possible due to the remarkable conservation of regulatory sequences between species, so that human regulatory signals are accurately interpreted by the transcription machinery of mice.

The constructs expressed in mice GMOs could therefore provide a lot of information about  of the regulation of the IL-18BP gene.

Transgenic mice can be obtained by methods known in the art. The most widely used method by which transgenic animals have been produced involves injecting a DNA molecule into the male pronucleus of a fertilized egg [Brinster et al ., Cell 27, 223 (1981); Costantini et al ., Nature 294, 982 (1981); Harpers et al ., Nature 293, 540 (1981); Wagner et al ., Proc. Natl Acad. Sci. USA 78, 5016 (1981); Gordon et al ., Proc. Natl Acad. Sci. USA 73, 1260 (1976)].

Once the DNA molecule has been injected in the fertilized egg cell, the cell is implanted in the uterus of the recipient female and allowed to develop in an animal. Thus, all cells of the resulting animal must contain the gene sequence introduced.

The resulting or founding transgenic mice can be bred and the progeny can be analyzed to establish lines from the founders, which express the transgene. In transgenic animals, multiple tissues can be screened to observe the existence of gene expression. RNA studies in the various mouse lines will allow the evaluation of site integration independence for transgene expression levels. See Hogan, B. et al . Manipulating the mouse embryo: a laboratory manual , Cold Spring Harbor Press, Cold Spring Harbor, NY (1986).

The IL-18BP promoter and promoter elements can also provide a useful means of carry out gene therapy.

"Gene therapy" is the administration of genetic material to modify or manipulate the expression of a gene product to alter the biological properties of cells live for therapeutic use.

The cells can be allogeneic or autologous. Cells can be modified ex-vivo for subsequent administration to the subject, or altered in vivo by gene therapy products given directly to the subject.

For the most part, constructs comprising the IL-18BP promoter or a fragment thereof and / or a derivative thereof will be used to direct gene expression in those cells when the IL-18BP gene is normally expressed, for example cells. mononuclear Any means available in the art can be used for the transfer of the constructions to animals, including humans. This includes viral vectors, in particular retroviral vectors (see, for example, Zweibel et al , Science 243, 220 (1989), and references cited therein), as well as other methods.

Recombinant AAV vectors have shown quite promise for the delivery of therapeutic genes in liver and skeletal muscles (Snyder et al . 1997, Murphy et al . 1997, Song et al . 1998, Snyder et al . 1999, Herzog et al . 1997 ). Mice generated by rupture of the clotting factor IX gene show severe bleeding disorders and closely resemble the phenotype observed in hemophilia B patients. A single intraportal injection of a adeno virus vector has been published (Wang et al . 1999). Recombinant associated (AAV) encoding canine factor IX cDNA under the control of a specific liver enhancer / promoter, leads to a long-term and complete correction of the bleeding disorder.

Retroviral vectors, derived from oncorretroviruses such as murine leukemia virus (MVL), have been the most widely used vectors to transfer genes, because the vector genome is integrated into the chromosomes of the target cells, resulting in stable expression of the transgenes (IM Verma and N. Somia. Nature 389, 239 (1997)) even when it was proved that these vectors are good especially for dividing cells. Lentivirus vectors, such as HIV vectors, are currently being used for non-dividing cells (Mioshi et al . Science 1999 283: 682-686). The ability of lentiviruses to infect non-dividing cells, such as macrophages, makes them good candidates for use as gene transfer tools. HIV vectors facilitate the transduction of resting human hematopoietic stem cells (HSCs: hematopoietic stem cells).

Hematopoietic stem cells (HSC) are an attractive target for gene therapy of disorders inherited hematopoietic, as well as other acquired disorders, because these cells have the power to regenerate the system complete hematopoietic. For example stem cells hematopoietic can regenerate monolithic cells that is known that are involved in the pathogenesis of the virus human immunodeficiency 1 (HIV-1).

Despite more than 15 years of research in the field of gene therapy using hematopoietic stem cells,  the biggest obstacle remains the inability to insert genes efficiently and stably in these cells. Vectors retrovirals based on Moloney murine leukemia virus (MLV) have been the most widely used, but give a relatively low gene transfer to pluripotential HSCs human and a gene expression that is often unsatisfactory

Recently, attempts have been made to genetically modify hematopoietic stem cells with genes that inhibit HIV-1 replication, for the development of monocytes resistant to HIV-1 infection (Kohn et al . 1999).

Theoretically, the insertion of a gene capable of confer resistance to HIV-1 in stem cells hematopoietic would result in that gene would be present in mature monocytes of offspring and other cells susceptible to HIV-1. Thus, the use of a promoter which is active in monolithic cells, such as the promoter of IL-18BP or a fragment thereof, for therapy HIV-1 gene is advantageous.

Gene therapy of most genetic disorders of the blood (eg chronic granulomatous disease SCID, thalassemia etc.) requires transfer of ex vivo genes to transplantable cell lineages, self-renewing HSCs, and regulation of transgenic expression in one or more cell lineages. Correction of disorders that affect a specific progeny of HSCs (eg hemoglobinopathies or thalassemias, HIV-1 infection) requires restricting the expression of therapeutic genes in a specific way of the cell lineage (Iotti et al . 2002) . In these cases, the transcriptional addressing of the transferred gene is required. The expression of the gene in different types of cells is dependent on the relative strength of the promoter used.

However, most of the studies Preclinical carried out so far have relied on the use of constitutive viral promoters to boost expression transgenic For example in the HIV-1 vector use CMV internal promoter and CMV promoter murine the vector murine retroviral LTR. The appropriate transgenic regulation in the frame of a retroviral vector is a difficult task due to the transcriptional interference between long terminal repetition (LTR) and internal promoters-promoters and the genetic instability of complex regulatory sequences. In the present invention the IL-18BP promoter, which is knows that it drives transcription in mononuclear cells, it used to boost transgenic expression in HSCs, the precursor of such mononuclear cells.

Genetic modification of hematopoietic stem cells with "anti HIV genes" could lead to the development of lymphocytes and monocytes resistant to HIV infection after transplantation. HSC can be recovered from HIV-1 infected patients, CD34 + cells can be isolated, transduced in vitro with a retroviral vector carrying an HIV-1 inhibitor protein under the control of the IL-18BP promoter (instead of the retroviral promoter) and reinfuse these cells in these patients (Kohn et al . 1999).

The most commonly used source of HSC are peripheral blood stem cells hematopoietic stem cells (PBSC), which have largely replaced the bone marrow in the context of autologous transplantation (Gale et al . 1992 and Kessinger et al . 1991). The PBSC are mobilized from the bone marrow to the peripheral circulation by administering factors such as G-CSF or GM-CSF for 3 to 5 days and can then be collected by leukoapheresis. Several studies have indicated that grafting occurs more quickly when peripheral blood stem cells are transplanted instead of bone marrow cells (Henon et al . 1992 and Chao et al . 1993).

Clonogenic progenitor cells contained in PBSC mobilized with the G-CSF factor are quite susceptible to retrovirus-mediated gene transfer, while the transduction rate of stem cells with long-term reconstitution in PBSC is no better than in the bone marrow. (Breni et al . 1992, Cassel et al . 1993, Dunbar et al . 1995). It has been observed that HIV-1 infected subjects can have a successful mobilization and collection of PBSC mobilized with G-CSF without any increase in endogenous HIV-1 levels, at least during the early stages of the disease (Junker et al . 1997 and Slobod et al . 1996).

Another source of hematopoietic stem cells is umbilical cord blood (UCB) which has been shown to be susceptible to retroviral transduction, potentially even more than bone marrow cells (Moritz et al . 1993 and Hao et al . 1995) . The use of UCB HSC cells could be particularly beneficial for infants infected with HIV-1. Since transmission is mostly perinatal, umbilical cord blood must contain normal numbers and function of hematopoietic stem cells, which may be diminished in the bone marrow of HIV-1 infected children and adults (Kearns et al . 1997) .

A large number of synthetic genes have been developed that can suppress HIV-1 replication ("anti-HIV-1 genes"), including: antisense, ribozymes, dominant-negative mutants (eg RevMIO) , RNA decoys , intracellular antibodies to prevent the expression of viral proteins or cellular co-receptors, etc. (Veres et al . 1996, Zhou et al . 1994, Couture et al 1996, Malim et al . 1989, Bahner et al 1993 and Sullenger et al . 1990, Lee et al . 1994, Marasco et al . 1997 and Chen et al. . 1997). In many cases, it has been demonstrated in model systems that these anti-HIV-1 genes are capable of significantly suppressing HIV-1 replication and in some cases even limiting the entry of the virus into cells (36, 39-44) . If essentially 100% of a patient's HSC and the resulting monocytic cells could become unable to support HIV-1 replication, it is likely that decreased viral loads would result. Theoretically, active inhibition of HIV-1 replication in 99.9% of susceptible cells would be required to produce a 3-log reduction in virus load, an effect often produced by highly effective anti-retroviral therapy. . However, with the limited capabilities to effectively transduce high percentages of human hematopoietic stem cells, it is currently not possible to protect most susceptible cells. An alternative mechanism for efficacy is based on the possibility that genetically engineered cells so that they are unable to support the active replication of HIV-1 can be protected from virally induced cytopaticity, and therefore have a selective survival advantage in comparison With unprotected cells. In that case, a modest number of protected cells may comprise an increased percentage of all monocytes, leading to some preservation of immune function.

The present invention also relates to pharmaceutical compositions comprising an acceptable vehicle pharmaceutically and a virus comprising a sequence of the present invention corresponding to the promoter region of IL-18BP or promoter operably linked to a gene of interest that encodes a suitable drug. These compositions they can preferably be used to direct a drug to tissues in which IFNγ levels are high.

Having now described the invention, understand more easily by referring to the examples that continue, which are provided by way of illustration and not It is intended to be limiting of the present invention.

Examples Example 1 Basal expression of IL-18BP in monocytes

The IL-18BP mRNA is detected in leukocytes, colon, small intestine, prostate and in particular in splenic cells (Novick et al . 1999). Spleen cells consist of macrophages, lymphocytes and plasma cells with additional cells derived from the circulation.

In order to determine the expression of the IL-18BP protein in cells, a test was used Specific ELISA (Example 12). It was found that the cells human peripheral blood mononuclear (PBMC peripheral blood mononuclear cells) constitutively produce IL-18BP (0.7-1.5 ng / ml). The cells U-937, a cell line derived from cells malignancies obtained from pleural effusion of a lymphoma patient histiocytic, they expressed no IL-18BP. The U-937 cells can be induced to differentiation terminal monolithic treatment with forbol esters. A baseline expression of IL-18BP of 0.07 ± 0.01 ng / ml was detected only after cell differentiation in macrophage-like cells by stimulation with TPA (10 ng / ml). These results indicate that IL-18BP is produced constitutively in monocytes and macrophages.

       \ vskip1.000000 \ baselineskip
    

Example 2 Induction of IL-18BP expression in several different cells

It has been previously reported that IFNγ induced L-18BP mRNA and protein in several cell lines such as the keratinocyte cell line, a colon carcinoma cell line, and in primary renal mesangial cells (Muhl et al . 2000). The induction of IL-18BP in several human cell lines and in peripheral blood mononuclear cells (PBMC) by IFNγ and other cytokines was studied. IFNγ-induced IL-18BP expression (see Example 11 for mRNA monitoring and Example 12 for ELISA) in a dose-dependent manner, showing an EC50 value at 50 U / ml in WISH cells and HepG2 (Figure 2 A and B). IL-18BP apparently accumulated in the supernatants of the WISH cell culture, since its concentration was higher at 48 hours compared to 24 hours (Figure 2A).

Mononuclear blood cells Human peripheral (PBMC) constitutively produced IL-18BP (0.7-1.5 ng / ml), and the IFNγ treatment (100 U / ml) increased the level of IL-18BP at 1.7 ± 0.1 and 2.1 ± 0.3 times at 24 and 48 h, respectively (p <0.05, n = 4). No observed effect on the production of IL-18BP when doing the pre-treatment of PBMC with TPA.

The induction of IL-18BP by IFNγ was assayed in the U937 cell line. IFNγ did not induce IL-18BP in undifferentiated U937 cells, however, after differentiation with forbol ester (TPA, 10 ng / ml) in macrophage-like cells, a baseline level of IL-18BP (0.07 ± 0.01 ng / ml), and increased by 4.6 ± 0.05 times when inducing with IFNγ (100 U / ml, 24 h), increasing more at 96 h (not shown).

The effect of other cytokines, such as IFNα2, IFNβ, IL-1, IL-6, IL-12, IL-18 and TNFα, on the expression of IL-18BP, was tested in HepG2 cells (Figure 2B). The results obtained after incubation of the cells with the different cytokines in the presence or absence of IFNγ (Fig. 1 on the PNAS website) shows that IFN? 2, IFN?, IL-1, IL-6, IL-12, IL-18 and TNFα did not induce IL-18BP alone. Without However, in HepG2 cells IL-6 and TNF? acted synergistically with IFNγ, providing an increase of statistically significant IL-18BP.

These results indicate that the IL-18BP can be induced by IFNγ, in monocytes and in many different cells. Induction of IL-18BP by IFNγ is further enhanced by the addition of IL-6 and TNFα.

       \ vskip1.000000 \ baselineskip
    

Example 3 The IL-18BP gene is transcriptionally regulated by IFNγ, requiring de novo protein synthesis

In order to verify whether the induction of IL-18BP mRNA by IFNγ is at the level of transcription, the effect of interferon on HepG2 and Wish cells was measured in the presence of a translation inhibitor, actinomycin D (Fig. 3A). The increase in IL-18BP mRNA levels was detectable by semi-quantitative RT-PCR after 3 h of treatment with IFNγ in HepG2 cells, and only after 5 h in Hakat and WISH cells. Pretreatment of HepG2 and WISH cells with actinomycin D before stimulation with IFNγ suppressed the MRNA expression of IL-18BP at various time values, indicating that IFNγ stimulates de novo mRNA synthesis .

The accumulation of IL-18BP was evident at 24 h, and more, after treatment with IFNγ, which supports a dependence on IL-18BP expression on the preceding protein induction, e.g. ex. transcription factors, by IFNγ. Therefore, in order to confirm such a hypothesis, a protein inhibitor, cycloheximide, was also used to check whether the induction of the IL-18BP mRNA by IFNγ requires de novo protein synthesis . The results summarized in Figure 3B indicate that pretreatment of cells with cycloheximide canceled out the induction of the IL-18BP mRNA. This result indicates that de novo protein synthesis is essential for the activation of the IL-18BP gene by IFNγ.

       \ vskip1.000000 \ baselineskip
    

Example 4 Define the transcription start site of IL-18BPa and its promoter region, in order to map the IL-18BP promoter

To study the promoter region of IL-18BP, it is first required to locate specifically the transcription start site.

The mRNA transcription initiation site of human IL-18BPa was determined by 5 'RACE (RACE Example 14). Only one product of the corresponding PCR to IL-18BPa, the most abundant ayuste variant, was  obtained by 5 'RACE. The DNA sequence analysis of this product revealed the transcription start site and an exon additional 50 bp after transcription start site at the 5 'end of the human IL-18BPa mRNA, corresponding to positions 785-835 of the DNA genomic of IL-18BP (can be found in the base of nucleotide data Entrez pubmed, registration number AF110798). In consequently, a new exon-intron map was generated comparing the genomic DNA with the mRNA to which the new one was added exon 5 '(see Fig. 4).

Having the transcription start site of IL-18BPa (base 1), human genomic DNA could be analyzed more intensely upstream of base 1 (chromosome llq clone: RP11-757C15, registration number AP000719.4 nucleotides upstream of base 152,178) corresponding to the region of the IL-18BP promoter. Comparison of this DNA with the database of the expressed sequence tag (EST: Expressed Sequence Tag) in NCBI by the BLAST program, revealed a gene upstream in the + chain, which encodes a zinc finger protein ( Zinc- finger ) (registration number AK001961). The deposited mRNA sequence of this zinc finger protein was further extended by the "Instant RACE" program (www. LabOnWeb.com), which scanned an extensive collection of human ESTs. The program placed the 3 'end mRNA of the Zn finger protein in nucleotide 150,517 of genomic clone RP11-757C15, thereby limiting the upstream potential regulatory sequence of IL-18BPa to 1661 bases upstream of base 1.

       \ vskip1.000000 \ baselineskip
    

Example 5 Explore the minimum promoter, sequence up the gene from IL-18BP, capable of promoting constitutive expression of a heterolologous gene

In order to find the minimum fragment of DNA, upstream of the IL-18BP gene, capable of direct the expression of an exogenous gene such as the reporter gene from luciferase, a vector containing up to 1601 bp corresponding to the DNA sequence upstream of the base 1 and that includes 50 bp downstream of the start site of transcription (SEQ ID NO: 5), and vectors that have shapes truncated from this DNA (Fig. 5A) fused with the gene of the Luciferase (Example 15). Luciferase activity in cells Human HepG2 (a line of human hepatocellular carcinoma) transfected with a vector (pGL3 (1601)) comprising that of 1601 upstream bp, was 10.3 ± 0.9 times higher than the activity obtained with the empty pGL3 vector. Such activity was not observed when the same DNA was inserted into the orientation opposite (pGL3 (-1601)). This result showed that DNA 1601 bp upstream of base 1 has basal promoter activity. He sequence examination of this 1601 bp DNA fragment of 1601 bp revealed that it does not include an item from the TATA box, but had several GC-rich domains near the start site of the transcription in the bases -3 to -9, -39 to -48 and -122 to -132. He DNA sequence analysis of 1601 bp by the program TFSEARCH identified a gamma-activated sequence (GAS) in the bases -24 to -32 (Fig. 1). A deeper analysis revealed a response element (IRF-E) IRF 1.2 that covers the bases -57 to -69 and two response elements C / EBP? (C / EBP-E) on bases -309 to -322 and -621 to -634.

A series of reporter vectors of Luciferase with progressive truncation at the 5 'end of the 1601 bp fragment. The results summarized in Figure 5A indicate that all constructions, including pGL3 (122), that they contain only the IRF and GAS elements, they were at least as effective as pGL3 (1601) in supporting promoter activity basal.

These results revealed that the fragment of 122 bp (SEQ ID NO: 3) comprising the IRF and GAS elements are sufficient to promote the basal activity of a heterologous gene (Fig. 5A).

       \ vskip1.000000 \ baselineskip
    

Example 6 Explore the minimum promoter, sequence up the gene from IL-18BP, capable of promoting the inducible expression of a heterologous gene

In order to identify the DNA fragment minimum, upstream region of the promoter of IL-18BP capable of promoting the expression of IFNγ-induced luciferase, the vectors of Truncated DNA from the preceding example in transfected HepG2 cells in the presence of IFNγ (Figure 5B, for transfections see example 16).

The results summarized in Figure 5B indicate that after 24 h IFN? increased the activity of the luciferase 33 times above the level of basal expression in the vector that includes only the IRF-E elements and GAS (vector pGL3 (122)). This result shows that the pair IRF-E-GAS can only mediate the heterologous gene induction by IFNγ. The inclusion of Elements C / EBP-E1 and 2 (pGL3 (656)) increased significantly inducing luciferase activity by IFNγ at 88 times over baseline activity, which demonstrates the importance of these elements in inductivity by IFNγ. Instead, the inclusion of a DNA sequence up additional to such an insert (pGL3 (1106) canceled the induction of the Luciferase activity above its baseline level. This result suggested that within the bases -656 to -1106 (sequence above the second element C / EBP-E1) resides a silencer element. It was shown that three response elements AP1 are present within the silencer region and that c-Jun joins and is involved in silencing of the IL-18BP gene through the three elements of AP-1 answer.

The deepest extent of the promoter in 88 bases upstream of the silencer (pGL3 (1272)) restored the response to IFNγ, suggesting that in bases -1106 to -1272 an improving element resides, and its activation by IFN? suppress the effect of the neighbor silencer. More extension of the sequence did not affect basal or induced activity IFNγ, suggesting that all regulatory sequences sequence above were located within bases -1 to -1272 (SEQ ID NO: 1).

Of all the constructions tested, the inductance of pGL3 (656) is the highest, indicating that this DNA fragment contains the optimal inducible promoter of IL-18BP.

The results indicate that the inducible promoter minimum is located 122 bp upstream of the start site of the transcript (SEQ ID NO: 3) that contains the elements IRF-E and GAS, where the maximum inducible promoter and optimal is located 656bp upstream of the start site of the transcript (SEQ ID NO: 2) that contains, in addition to the IRF-E and GAS elements, two C / EBPp elements.

       \ vskip1.000000 \ baselineskip
    

Example 7 Participation of IRF-1 in the expression of IL-18BP in-vivo

To explore the participation of IFR-1, whose binding site was found to be in the IL-18BP promoter, in the expression of IL-18BP, the expression of IL-18BP in mice deficient in IRF-1

IL-18BP levels are measured in mice deficient in IRF-1 (Jackson Laboratories, Bar Harbor ME) before and after administration of IFNγ murinay, and were compared with those of control mice C57B1 / 6 (Fig. 6). Basal serum IL-18BP in C57B1 / 6 control mice was 9.1 ± 1.9 ng / ml and was increased significantly by IFNγ at 22.4 ± 2.2 ng / ml. In change, serum IL-18BP in deficient mice in IRF-1 it was below the detection limit and increased to only 0.7 ± 1.15 ng / ml with IFNγ. This result confirmed the importance of IRF-1 as mediator of IL 18BP expression both basal and induced IFNγ.

       \ vskip1.000000 \ baselineskip
    

Example 8 Detection of transcription factors that bind to IL-18BP promoter under inductive conditions

Displacement tests of the electrophoretic mobility (EMSA: Electrophoretic Mobility Shift Assays, Example 18) to identify interactions protein-DNA between the various elements of response within the IL-18BP promoter. Probes labeled ds DNA (double strand) corresponding to the bases -33 to -75 (containing IRF-E) and -8 to -55 (which contain the GAS) were allowed to bind with nuclear extracts of control cells and cells treated with IFNγ. A complex of the probe containing IRF-E and protein or nuclear proteins was evident after incubation of the cells for 1 h with IFNγ and the response was observed maximum at 3 o'clock (Fig. 7 A, tracks 1-5). How I know I expected, the addition of antibodies against IRF-E caused a "super-displacement" while anti signal transducer and activator antibodies Transcript 1 (STAT1) had no effect (data not shown). To the contrary to IRF-E, the probe containing GAS it was constitutively associated with a protein (Fig. 7 A, lane 6), and this complex was improved in cell induction IFNγ for 3 to 6 h (lanes 7.8). Hopefully, GAS will one to the STAT1 dimer induced by IFNγ. However the complex was not affected by antibodies against STAT1 (lane 10), suggesting that the IFNγ-induced STAT1 dimer does not I was associated with this GAS. The same negative result was obtained with nuclear extracts from IFNγ treated cells during only 15 or 30 min (data not shown). Surprisingly, this complex was canceled by antibodies against C / EBP? (lane 9) and was super displaced with antibodies against IRF-1 (track 10). This is why the DNA probe containing GAS seems to bind to C / EBP? despite the lack of a C / EBP? E of consensus.

The results obtained with EMSA indicate that, in induction with IFNγ, IRF-1 binds to IRF-E element in the promoter of IL-18BP. In addition, a complex is formed comprising IRF-1 and C / EBP? And binds to the GAS element.

       \ vskip1.000000 \ baselineskip
    

Example 9 Explore the role of the complex IRF-1-C / EBPp in the induction of IL-18BP

To better study the role of IRF-1 and C / EBP? In the induction of the gene of IL-18BP, the mRNA of IL-18BPa by PT-PCR semiquantitative after overexpression of IRF-1 and C / EBP? Using transfection of expression vectors (Example 14, Fig. 7 B). The overexpression of transcription factor or a combination of both factors HepG2 cells did not induce IL-18BP mRNA. This result suggested that factors induced by Additional IFNγ for gene activation of IL-18BP. The transfection of cells with one any of the expression vectors followed by its induction with IFNγ actually reduced the mRNA of IL-18BP in comparison with IFNγ only. Instead, the co-expression of two transcription factors increased mRNA induction of IL-18BP by IFNγ. This result suggested that IRF-1 and C / EBP? Must be present in a certain relationship, possibly forming a complex within the transcription initiation complex. To better study the possible interaction between IRF-1 and C / EBP led to perform a titration of luciferase activity by transfecting cells with pGL3 (1272), a fixed amount of a vector of IRF-1 expression and variable amounts of vector of C / EBPR expression. Similarly, the activity of the luciferase when the C / EBP? vector was kept constant and with varying amounts of IRF-1 vector. In both cases a dose response curve was obtained in the form of bell, suggesting that the induction of IL-18BP optimal requires a fixed molar relationship between these two factors of transcription (Fig. 7 C).

Immunoprecipitation studies were performed in order to confirm the physical association between IRF-1 and C / EBP? (Example 19, Fig. 7 D). Immunoprecipitation (ip) followed by immunoblotting (ib: i mmuno b lotting) of nuclear and cytoplasmic proteins (Example 15) from cells treated with IFN?, With antibodies against CfEBP? Revealed that C / EBP? Is expressed constitutively in HepG2 cells and translocates to the nucleus in response to IFNγ (upper panel). In contrast to C / EBP? That is not induced by IFN?, The ip and ib of cell extracts with antibodies against IRF-1 revealed that IFN? Induces the expression of IRF-1. But like C / EBP?, In the induction by IFN?, IRF-1 translocates to the nucleus (intermediate panel). The ip with antibodies against C / EBP?, Followed by the ib with antibodies against IRF-1, revealed the presence of a stable IRF-1-C / EBP? Complex in the nuclear fraction (lower panel). These results confirm the formation of IRF-1-C / EBP? In induction with IFN? And is the first demonstration of the existence of such a complex between these two transcription factors. Thus, upon induction by IFN?, The proximal sequence containing GAS and its adjacent IRF-E bind to the C / EBP? And IRF-1 complex.

       \ vskip1.000000 \ baselineskip
    

Example 10 Explore the role of C / EBP-Es in the promoter of IL-18BP activity

The two C / EBP? Sites in positions -309 to -322 and -621 to -634 do not have an IRF-E adjacent. Actually, the EMSA (displacement test of the electrophoretic mobility) (Example 18) of a corresponding probe  to the C / EBP? sites at positions -309 to -322 revealed a delayed band (filled arrowhead) that was super-displaced with antibodies against C / EBP? (arrowhead empty) but not with antibodies against IRF-1 (Fig. 8 TO). Therefore, the conclusion that this site joins C / EBP? And not its complex with IRF-1. Further, this band was generated with a nuclear extract of HepG2 cells not induced constitutively expressing C / EBP?, but which They lack IRF-1. In fact, the IFN? Did not increase the expression of C / EBP? in these cells (Fig. 8 D) and consequently it did not increase the intensity of the delayed band (Fig. 8 A). Similar results were obtained with the site more distal C / EBP? (data not shown).

The results indicate that the factor of C / EBP transcription, unlike IRF-1, is constitutively expresses and is not induced by IFNγ, and that In addition to joining IRF-1 and GAS, it joins the two C / EBP elements present in the promoter of IL-18BP.

       \ vskip1.000000 \ baselineskip
    

       \ global \ parskip0.950000 \ baselineskip
    

Example 11 Study the role of the improver in the expression of IL-18BP

The regulatory role of the distal improver was studied by EMSA (Example 18) with a 192 bp DNA probe, corresponding to nucleotides -1081 to -1272. The extract Nuclear control HepG2 cell formed a complex with this probe (Fig. 8 B, filled arrowhead). In the treatment of IFNγ cells, the complex was more intense and somewhat more delayed. Then there was a super shift of this complex with antibodies directed against IRF-1, C / EBP? And cFos. Of these, only the anti IRF-1 caused an over displacement (Fig. 8 B, empty arrowhead). An unlabeled ds DNA corresponding to the nucleotides -1083 to -1174 did not compete with the radiolabeled probe, which which indicates that nuclear proteins were bound to the remains -1175 to -1272. How IRF-E was identified only in the proximal region, this result suggests that the distal improver was probably associated with the IRF-E proximal.

These results indicate that the distal improver interacts with the basal promoter through IRF-1

       \ vskip1.000000 \ baselineskip
    

Example 12 ELISA for IL-18BP

Human IL-18BP was measured by a double antibody ELISA as described (Novick et al 2001). Mouse IL-18BP was measured by a double antibody ELISA using rabbit polygon affinity purified polyclonal antibody against murine IL-18BP and biotinylated antibody, which were obtained from Cytolab, Israel.

       \ vskip1.000000 \ baselineskip
    

Example 13 Isolation and PCR with Reverse Transcription (RT) of RNA

After treatment in serum-free medium, HepG2 and WISH cells (10 6) were collected at the indicated times and the total RNA was extracted using TRI reagent. The cDNA was prepared using random hexamers and SuperscriptII (Invitrogen ™, Leek, The Netherlands) according to the manufacturer's instructions. PCR was carried out with the following primers: human IL-18BP, 5'CACGTCGTCACTCTCCTGG and 5'CGACGTGACGCTG
GACAAC; Human IRF-1 5'GACCCTGGCTAGAGATGCAG and 5'GAGCTGCTGAGTCCATCAG; human? Actin 5'GTGGGGCGCCCCAGGCACCA and 5'CTCCTTAATGTCACGCACGATTTC. The amplifications were made by initial denaturation (92 ° C, 2 min), 28 cycles of denaturation (92 ° C, 45 sec.), Mating (annealing) (62 ° C, 1 min) and elongation (extension) (72 ° C, 1.5 min), and final elongation (72 ° C, 10 min). The resulting PCR products were resolved by agarose gel electrophoresis (1%).

       \ vskip1.000000 \ baselineskip
    

Example 14 Rapid amplification (multiplication) of the 5 'cDNA ends (5'RACE)

5'RACE was carried out with a 5'RACE system (GIBCO BRL) according to the manufacturer's instructions. In summary, the total RNA of the WISH cells treated with IFNγ was subjected to reverse transcription (Example 13) with a complementary primer of nucleotides 89 to 70 of the IL-18BPa mRNA (GenBank registration No. AF110799) followed by the tailing (addition of nucleotide tail) of the newly synthesized ends, with an anchor DNA. The PCR was then performed with a direct primer complementary to the anchor DNA and a nested reverse primer complementary to nucleotides 31 to 11 of the IL-18BPa mRNA. The PCR products were then subcloned and subjected to DNA sequence analysis.

       \ vskip1.000000 \ baselineskip
    

Example 15 Plasmids and cloning

The complete putative IL-18BPa promoter region of 1601 bp was obtained by PCR of the genomic DNA using a sense primer (S4753.pgl) containing a Kpn I site (5 'CTATATGGTACCCACCCTTCCTTTTACTTTTTCC) and a reverse primer (R1exA) containing a NHe I site (5'TATCGCTAGCCAGTCACACAGGGAGGCAGT). The PCR product was cloned into the pGEM-T Easy vector (Promega, Madison, WI) and checked by DNA sequence analysis. A Kpn I-Nhe I fragment was isolated from the pGEM-T Easy clone and ligated into the pGL3-Basic vector (Promega) using the rapid DNA ligation kit (Roche) to give pGL3 (1601). A series of 5 'truncated reporters (pGL3 (1454), pGL3 (1274), pGL3 (1106), pGL3 (656), pGL3 (280) and pGL3 (122) were also prepared with the same reverse primer and with the following primers sense, respectively:

S334 pgl 5 ':

CTATATGGTACCCATGAACTAGACACCTAGAG;

       \ global \ parskip1.000000 \ baselineskip
    

S415 pgl 5 ':

CTATATGGTACCCTACAAGAAGTTTGAGATCA;

S501. pgl 5 ':

CTATATGGTACCCAGCCGTTGCACCCTCCCAATCAC;

lexD pgl 5 ':

CTATATGGTACCGTCTTGGAGCTCCTAGAGG;

S504 pgl 5 ':

CTATATGGTACCCACCAAAGTCCTGACACTTG and

Sl39 pgl 5 ':

TTGGTACCCACTGAACTTTGGCTAAAGC.

All PCR products were also cloned into the pGL3-Basic vector in orientation opposite to serve as witnesses.

       \ vskip1.000000 \ baselineskip
    

Example 16 Transient transfection assays

HepG2 or WISH cells in 6-well plates (0.5 x 10 6 / well) were transfected using FuGENE 6 and the Luciferase reporter vector indicated (0.5 µg / well) and pSV40 (3GAL (0.2 pg / well, Promega) according to the manufacturer's instructions In some cases the co-transfection was done with the following vectors Expression: pcDNA3-IRF-1 (0.07-1.5 µg / well, kindly provided by Dr. B. Levy, Technion, Israel); pcDNA3-C / EBP? (0.5-2.5 pg / well, kindly provided by Dr. D. Zipori, Weizmann Institute of Science). After 16 h the cells were treated with IFNγ (100 U / ml), IL-6 (150 U / ml), or TNFα (10 ng / ml), or their indicated combinations, in serum free medium, for 24 h. The cells were after collected and lysed, and luciferase activity was measured. All results were normalized against the activity of p-galactosidase.

       \ vskip1.000000 \ baselineskip
    

Example 17 Preparation of nuclear and cytoplasmic extracts

The cells were washed 3x with saline. Buffered with phosphate (PBS) cooled with ice and immediately They frozen in liquid nitrogen. The cell sediments were resuspended in four times the volume of cells packaged, cytoplasmic buffer (10 mM Hepes, pH 7.9, NaCl 10 mM, 0.1 mM EDTA, 5% (in vol.) of glycerol, 1.5 mM MgCl2, 1 mM dithiothreitol (DTT), 0.5 mM PMSF, 50 mM NaF, Na 3 VO 4 0.1 mM, 2 mM EGTA, 10 mM EDTA, 10 mM Na 2 Mo 4, 2 mug / ml of each of the products leupeptin, pepstatin and aprotinin). The lysate was centrifuged (3000 x g, 10 min.) And the supernatant containing cytoplasmic proteins. Sediment it was resuspended in 2.5 times the volume of the cells packaged, nuclear buffer (identical to cytoplasmic buffer except that NaCl was increased to 0.42 M). Waste from nuclei will be removed by centrifugation (15,000 x g, 20 min., 4 ° C), aliquots of the freeze were frozen in liquid nitrogen supernatant and stored at -80 ° C.

Protein concentration was determined by a kit of BCA protein assay reagents (Pierce, Rockford USA) using bovine serum albumin as a standard.

       \ vskip1.000000 \ baselineskip
    

Example 18 Testing of electrophoretic mobility displacement

Oligonucleotides ds (double chain) corresponding to selected response elements (10 pmol) were labeled with [32 P] 3 ATP by polynucleotide kinase (New England Biolabs). The nuclear extracts (5 \ mug of protein) were pre-incubated (15 min., 0 ° C) together with poly (dI-dC) (Amersham Pharmacia Biotechnology) in 20 µL of EMSA buffer (20 mM Hepes pH 7.5; 5 mM MgCl2, EDTA 2 mM, 5 mM DTT and 5% (in vol.) of glycerol). Then one was added labeled probe (3 x 10 4 cpm) and incubation continued for 30 min. more at room temperature. For the trials of super displacement, samples were incubated with antibodies indicated (4 µg, 1 h at 0 ° C) before probe addition. Be added an excess of 200 times of wild-type competitors and mutated, along with the probe of interest. Reaction mixtures were then subjected to electrophoresis in polyacrylamide gels  5% non-denaturing. The gels were dried under vacuum and autoradiographed overnight at -80 ° C.

       \ vskip1.000000 \ baselineskip
    

Example 19 Immunoprecipitation (ip) and immunoblot analysis (ib)

Nuclear or cytoplasmic protein extracts (80 µg) were incubated with 6 µl of the indicated polyclonal antibodies, overnight, at 4 ° C, and immunoprecipitated with Protein G Sepharose balls (Pharmacia) for 1 h at room temperature. The balls were then boiled in sample buffer for SDS-PAGE containing 10% DTT, and the supernatant was resolved by SDS-PAGE (10% acrylamide) under reducing conditions. The gel was then transferred to a nitrocellulose membrane and the proteins were detected with the indicated antibodies. Immune complexes were identified by the Super Signal ™ detection kit (Pierce).

       \ vskip1.000000 \ baselineskip
    

Example 20 Preparation of CHO r-hsLDLR using the IL-18BP promoter

Stable recombinant CHO cells expressing soluble human LDLRs are generated by cotransfection of CHO-DUKX cells lacking the dihydrofolate reductase (DHFR) gene (Urlaub, G. et al ., 1980) with two expression vectors: one containing the domain binding to the N-terminal ligand of the LDLR, which begins in the rest of amino acid Asp (+4) to Glu 291 (+291), and pDHFR, which contains the murine gene for DHFR, DHFR controlled by the SV40 early promoter and sLDLR gene by the IL-18BP promoter (SEQ ID NO: 2) and transcription termination elements of the SV40 early region. Transfection is carried out by cationic liposomes using LipofectAmine (Gibco BRL), according to the protocol described by the manufacturer. Seventy-two hours after transfection, the cells are transferred to a selective medium devoid of deoxy and ribonucleosides and supplemented with 10% dialyzed FCS. Cells that express DHFR activity are capable of forming colonies, which are isolated by lifting the cells with trypsin-soaked paper discs. The cells develop and are selected for their activity of r-hsLDLR. Transfected cells are then subjected to gene amplification by MTX, followed by subcloning and selection of stable producing clones.

References

Bahner 1993 J Virol 67: 3199.

Breni et al. 1992 Blood 80: 1418.

Boshart et al . 1985 Cell 41: 521.

Brinster et al . (1981) Cell 27: 233.

Cassel 1993 Exp Hematol . 21: 585.

Chao 1993 Blood 81: 2031.

Chen 1997 Nat Med 3: 1110.

Costantini et al . ( 1981 ) Nature 294: 982.

Couture 1996 Trends Genet 12: 510.

Dignam et al . 1983 Nucleic Acid Res . 11: 1475.

Dijkema et al . 1985 EMBO J 4: 761.

Dunbar 1995 Blood 85: 3048.

Dynan and Tjian 1985 Nature 316: 774.

Dynan W 1989 Cell 58: 1-4.

Fletcher et al . 1987 Cell 51: 773-781.

Fried et al . 1981 Nucleic Acids Res . 9, 6505.

Gale et al . 1992 Transplant 9: 151.

Gordon et al . ( 1976 ) PNAS 73: 1260.

Gorman et al 1982 b PNAS 79: 6777.

Henon et al . 1992 Transplant 9: 285.

Herzog , RW, Hagstrom , JN, Kung , SH, Tai , SJ, Wilson , JM, Fisher , KJ and High , KA ( 1997 ) Proc. Natl Acad. Sci. USA 94 , 5804-5809.

Harpers et al . ( 1981 ) Nature 293: 540.

Hao et al . 1995 Blood 86: 3745.

Junker 1997 Blood 89: 4299.

Kearns 1997 Human Gene Ther 8: 310.

Kohn et al. ( 1999 ) Blood 94: 368.

Read 1994 J. Virol 68: 8254.

Lili Wang *, Kazuaki Takabe ^ {\ dagger}, Scott M. Bidlingmaier ^ {\ ddagger}, Charles R. III ^ {\ ddagger}, and Inder M. Verma * Vol. 96, edition 7, 3906-3910, 30 March, 1999 Sustained correction of bleeding disorder in hemophilia B mice by gene therapy Lotti et al . 2002 J of Virol . 76: 3996.

Malim 1989 Cell 58: 205.

Maniatis et al 1987 Science 236: -1237.

Marasco 1997 Gene Ther 4: 11.

Muhl , H., Kampfer , H., Bosmann , M., Frank , S., Radeke , H. and Pfeilschifter , J. ( 2000 ) Biochem. Biophys Common Res. 267, 960-963.

Murphy , JE, Zhou , S., Giese , K., Williams , LT, Escobedo , JA and Dwarki , VJ ( 1997 ) Proc. Natl Acad. Sci. USA 94, 13921-13926.

Neighbors , M., Xu , X., Barrat , FJ, Ruuls , SR, Churakova , T., Debets , R., Bazan , JF, Kastelein , RA, Abrams , JS and O'Garra , A. ( 2001 ) J Exp. Med. 194, 343-354.

Novick , D., Schwartsburd , B., Pinkus , R., Suissa , D., Belzer , I., Sthoeger , Z., Keane , WF, Chvatchko , Y., Kim , SH, Fantuzzi , G., Dinarello , CA and Rubinstein , M. ( 2001 ) Cytokine 14, 334-342.

Novick D, Kim SH, Fantuzzi G, Reznikov LL, Dinarello CA, Rubinstein M. Immunity 1999 Jan; 10 (1): 127-36.

Novick D, Schwartsburd B, Pinkus R, Suissa D, Belzer I, Sthoeger Z, Keane WF, Chvatchko Y, Kim SH, Fantuzzi G, Dinarello CA, Rubinstein M. Cytokine 21 Jun 2001; 14 (6): 334-42.

McKnight and Tjian 1986 Cell 46: 795.

Mioshi et al . 1999 Science 283: 682.

Moritz 1993 J Exp Med 178: 529.

Palmiter et al . 1986 Ann Rev. Genet . 20: 465.

Revzin 1989 Biotechniques 7: 346.

Sassone-Corsi and Borreli 1986 Trends Genet 2: 215

Scheidereit et al . 1987 Cell 51: 783-793.

Slobod 1996 Blood 88, 3329.

Snyder , RO, Miao , CH, Patijn , GA, Spratt , SK, Danos , O., Nagy , D., Gown , AM, Winther , B., Meuse , L., Cohen , LK, et al . ( 1997 ) Nat. Genet. 16 , 270-276.

Snyder , RO, Miao , C., Meuse , L., Tubb , J., Donahue , BA, Lin , HF, Stafford , DW, Patel , S., Thompson , AR, Nichols , T., et al . ( 1999 ) Nat. Med . 5, 64-70.

Song , S., Morgan , M., Ellis , T., Poirier , A., Chesnut , K., Wang , J., Brantly , M., Muzyczka , N., Byrne , BJ, Atkinson , M., et al . ( 1998 ) Proc. Natl Acad. Sci. USA 95, 14384-14388.

Sullenger 1990 Cell 63: 601.

Veres et al . 1996 J Virol 70: 8792.

Verma et al . 1997 Nature 389: 239.

Voss et al . 1986 Trends Biochem Sci. 11: 287.

Wagner et al . ( 1981 ) PNAS 78: 5016.

Xiao , W., Berta , SC, Lu , MM, Moscioni , AD, Tazelaar , J. and Wilson , JM ( 1998 ) J. Virol. 72, 10222-10226.

Zecchina G, Novick D, Rubinstein M, Barak V, Dinarello C, Nagler A. J Hematother Stem Cell Res . 2001 Dec; 10 (6): 769-76.

Zhou 1994 Gene 149: 33.

Zweibel et al. 1989 Science 243: 220.

       \ global \ parskip0.000000 \ baselineskip
    

<110> Yeda Research and Development Co. Ltd.

\hskip1cm

Rubinstein, Menachem

 \ hskip1cm 

Rubinstein, Menachem

\hskip1cm

Novick, Daniela

 \ hskip1cm 

Novick, Daniela

\hskip1cm

Hurgin, Vladimir

 \ hskip1cm 

Hurgin, Vladimir

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<120> PROMOTER FOR IL-18BP, ITS PREPARATION AND ITS USE

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<130> 596PCT

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<150> 152232

         \ vskip0.400000 \ baselineskip
      

<151> 10-10-2002

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<160> 5

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<170> PatentIn version 3.1

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 1

         \ vskip0.400000 \ baselineskip
      

<211> 1272

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Homo sapiens

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 1

one

         \ vskip0.400000 \ baselineskip
      

<210> 2

         \ vskip0.400000 \ baselineskip
      

<211> 634

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Homo sapiens

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 2

         \ vskip1.000000 \ baselineskip
      

3

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 3

         \ vskip0.400000 \ baselineskip
      

<211> 122

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Homo sapiens

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 3

         \ vskip1.000000 \ baselineskip
      

4

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 4

         \ vskip0.400000 \ baselineskip
      

<211> 1061

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Homo sapiens

         \ newpage
      

         \ vskip0.400000 \ baselineskip
      

<400> 4

         \ vskip1.000000 \ baselineskip
      

5

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 5

         \ vskip0.400000 \ baselineskip
      

<211> 51

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Homo sapiens

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 5

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

\hskip-.1em\dddseqskip

cccagaagca gctctggtgc tgaagagagc actgcctccc tgtgtgactg g

\hfill

51

 \ hskip-.1em \ dddseqskip 

cccagaagca gctctggtgc tgaagagagc actgcctccc tgtgtgactg g

 \ hfill 

51

Claims (31)

1. A DNA sequence encoding the promoter of human IL-18BP (SEQ. ID NO: 1), or a fragment functional thereof, or a functional derivative thereof, in wherein the 3 'end of said DNA sequence or fragment of the It comprises SEQ ID No. 5. 2. The DNA sequence according to claim 1st, in which the derivative is mutated in one or more of the sites AP1 present in a silencer element present in the sequence. 3. The DNA sequence according to claim 1st, in which the fragment comprises SEQ ID NO: 2. 4. The DNA sequence according to claim 1st, in which the fragment comprises SEQ ID NO: 3. 5. The DNA sequence according to any one of claims 1 to 4, further comprising an intron. 6. The DNA sequence according to claim 5th, in which the intron consists of the first intron of IL-18BP. 7. The DNA sequence according to any one of the preceding claims, further containing a linked gene Operationally to the IL-18BP promoter. 8. The DNA sequence according to claim 7th, in which the gene encodes IL-18BP. 9. The DNA sequence according to claim 7th, in which the gene encodes a heterologous protein. 10. The DNA sequence according to claim 9th, in which the heterologous gene encodes the gene of the Luciferase 11. The DNA sequence according to claim 9th, in which the heterologous gene encodes a protein chosen from interferon-beta, TNF, erythropoietin, activator of tissue plasminogen, colony stimulating factor of granulocytes, manganese superoxide dismutase, an immunoglobulin or a fragment thereof, growth hormone, FSH, hCG, IL-18, hsLDLR and receptor binding proteins of TNF. 12. A vector comprising a DNA sequence according to any one of the preceding claims. 13. A host cell comprising a vector according to claim 12. 14. A host cell according to the claim 13, which is a mammalian cell. 15. A host cell according to the claim 14, selected from CHO, WISH, HepG2, Cos, cells CV-1, HeLA, and Hakat U937. 16. A method for the production of a protein recombinant, which comprises culturing a host cell according to any one of claims 13 to 15, and isolate the recombinant protein produced. 17. A recombinant virus vector that it comprises a portion of the virus genome, a DNA fragment that encodes a gene of interest and a DNA fragment comprising a DNA sequence encoding the promoter of Human IL-18BP according to any one of the claims 1 to 6, operatively linked to the gene of interest. 18. A recombinant virus vector according to the claim 17, wherein the gene of interest is chosen from interferon-beta, TNF, erythropoietin, activator of tissue plasminogen, colony stimulating factor of granulocytes, manganese superoxide dismutase, an immunoglobulin or a fragment thereof, growth hormone, FSH, hCG, IL-18, hsLDLR and receptor binding proteins of TNF. 19. A recombinant virus vector according to the claim 17, wherein the portion of the virus genome It belongs to an adeno-associated virus. 20. A recombinant virus vector according to the claim 17, wherein the portion of the virus genome It belongs to a retrovirus. 21. A recombinant virus vector according to the claim 20, wherein the retrovirus is chosen from HIV, HFV, MLV, IVF and VSV. 22. An in vitro method of regulating the specific expression of the cell of a gene of interest, which comprises transducing a mammalian target cell with a vector according to any one of claims 17 to 21. 23. A method according to claim 22, in the that the target cell is a hematopoietic stem cell. 24. A method according to claim 22, in the that the target cell is a monocyte. 25. A method according to claim 24, in the that the target cell is a macrophage. 26. A method according to any one of the claims 22 to 25, wherein the gene of interest encodes a protein that confers resistance to HIV infection. 27. The use of the recombinant virus vector according to any one of claims 17 to 21 for the development of a medication for the treatment of infection by HIV, hematopoietic disorders such as SCID, disease chronic granulomatous and thalassemia, and / or a disease in a individual showing elevated IFNγ in a tissue bodily. 28. The use according to claim 27, in the that the medicine is for the treatment of a disease in a individual showing elevated IFNγ in body tissue, and further comprises IL-6 and / or TNFα factors and / or IRF and / or C / EBP?. 29. Transgenic mice that house the DNA sequence encoding a DNA sequence according to a any of claims 1 to 11. 30. The use of a DNA sequence that encodes the human IL-18BP promoter (SEQ ID NO: 1), or a fragment or a functional derivative thereof, wherein the 3 'end of said DNA sequence or fragment thereof comprises SEQ ID NO: 5, in the preparation of a medicament for the treatment of an HIV infection, hematopoietic disorders such as SCID, chronic granulomatous disease and thalassemia, and / or of a disease in an individual showing an INF? elevated in body tissue. 31. A pharmaceutical composition comprising a therapeutically effective amount of a DNA sequence that encodes the human IL-18BP promoter (SEQ ID NO: 1) or a functional fragment or a functional derivative of the same, wherein the 3 'end of said DNA sequence or fragment It comprises SEQ ID NO: 5.