ES2334755B2 - PROCEDURE TO ISOLATE GENES INVOLVED IN THE BIOSYNTHESIS OF STREPTOLIDIGINE, DNA MOLECULES, GENETIC HANDLING OF THE ROUTE AND ITS USES. - Google Patents

Abstract

Procedure to isolate genes involved in the biosynthesis of streptolidigin, DNA molecules, genetic manipulation of the route and its uses. The invention provides a method of isolation and purification of a nucleic acid fragment that contains the streptolidigin biosynthesis pathway gene cluster. It also provides nucleic acid molecules, recombinant nucleic acid molecules, polypeptides encoded by these molecules, host cells containing these molecules and their uses. It also provides a process to increase the production of tetramic metabolites in a bacterial host, a process to generate streptolidigin derivatives or streptolidigin precursors and their uses. It is also object of the invention a recombinant strain of Streptomyces lydicus and derivatives streptolydigin produces. Application in obtaining super-producing strains of streptolidigin or streptolidigin derivatives for isolation and use, among others, in the pharmaceutical or chemical sector.

Description

Procedure to isolate genes involved in Streptolidigin biosynthesis, DNA molecules, manipulation genetics of the route and its uses.

The object of the present invention is a method of isolation and purification of a nucleic acid fragment containing the streptolidigin biosynthesis pathway gene cluster. The invention also provides nucleic acid molecules, recombinant nucleic acid molecules, polypeptides encoded by these molecules, host cells containing these molecules and their uses. The invention also provides a process for increasing the production of tetramic metabolites in a bacterial host, a process for generating streptolidigin derivatives or streptolidigin precursors and their uses. It is also object of the invention a recombinant strain of Streptomyces lydicus and derivatives streptolydigin produces.

The invention is applicable in the Obtaining streptoolidigin superproductive strains or derivatives of streptolidigine for its isolation and use, among others, in the pharmaceutical or chemical sector for, for example, its use as antibiotic in clinic or as a research reagent, or for the development of tetramic metabolites or metabolite derivatives tetramers by chemical synthesis.

State of the art

The streptolydigin (Fig. 1), produced by Streptomyces lydicus NRRL 2433 (Deboer et al., Antibiotic. Annual. 3, 886 to 892.1955) is part of the family of tetramic acids it includes compounds with a wide range of activities Biological including antibiotic, antiviral, cytotoxic and mycotoxic activity (Royles, Chem. Rev. 95, 1981-2001, 1995). Other members of this family are tyrandamycin, ikarugamycin, capsimycin, malonomicin, tyrandalidigine, lidicamycin, altiomycin, oleficin, α-lipomycin and thomycin, all of them produced by different microorganisms of the genus Streptomyces (Royles, Chem. Rev. 95, 1981- 2001,1995). Of all of them, only the gene pool is known for the α-lipomycin biosynthesis (Bihlmaier et al ., Antimicrob. Agents. Chemother. 50, 2113-2121, 2006).

Streptolidigine is a potent bacterial RNA polymerase inhibitor antibiotic, interfering with the process of elongation of the nascent RNA chain, in particular against Gram-positive microorganisms (Deboer et al ., Antibiotic. Annual. 3, 886-892, 1955; Siddhikol et al ., J. Bacteriol. 99, 151-155, 1969; von Meyenburg et al ., Antimicrob. Agents. Chemother. 13, 234-243, 1978). This activity has recently focused new efforts to unravel the structural basis of bacterial RNA polymerase inhibition since streptolidigin does not inhibit eukaryotic organisms polymerase RNA (Tuske et al ., Cell 122, 541-552, 2005; Temiakov et al ., Mol. Cell. 19, 655-666, 2005). In addition to its bacterial RNA polymerase inhibitory activity, streptolidigine and its structural analogues have been shown to be potent inhibitors of the terminal deoxy-nucleotidyl transferase (TdT) enzyme, an enzyme that is expressed in large quantities in leukocytes of patients with acute lymphoblastic leukemia and chronic myelocytic leukemia and which has been associated with poor prognosis in treatment with chemotherapeutic agents and low levels of survival (Dicioccio and Srivastava, Biochem. Biophys. Res. Commun. 72, 1343-1349, 1976; Dicioccio et al ., Biochem Pharmacol. 29, 2001-2008, 1980). This activity has led to consider streptolidigine and other related compounds, such as tyrandamycin, as potentials. treatments for leukemias with abnormal DTT activity (TdT +). This positive effect has been shown for the cordicipin antimetabolite (nucleoside analogue) that inhibits the activity of the TdT enzyme and also shows cytotoxic activity in vitro against TdT + leukemia cells and not on those TdT (Kodama et al ., Biochem. Pharmacol. 59, 273-281, 2000; Foss, Oncology, 14, 31-35, 2000). In addition to the above, antitumor activity data from the National Cancer Institute (Maryland, USA) show that tyrandamycin (a structural analogue of streptolidigin), has antitumor activity against human kidney cancer cell lines (RXF 393) and leukemia ( CCRF-CEM [TdT +]) at concentrations lower, in two orders of magnitude, to streptolidigin. The main structural differences between streptolidigin and tyrandamycin consist in the absence of an L-rhodinose radical and a side chain derived from glutamic acid in tyrandamycin that are present in streptolidigin. These structural differences make streptolidigine an appropriate candidate for obtaining non-glycosylated derivatives that may have a potential antitumor activity.

The development of DNA technology recombinant is becoming a powerful tool to the time to increase our knowledge about the genes that They participate in the biosynthesis of antibiotics. This technology can today be applied to the improvement in production levels of different antibiotics and to obtain new compounds with better pharmacokinetic properties through the combination of genes of different antibiotic biosynthetic pathways and their expression in antibiotic producing microorganisms, in which It has been called combinatorial biosynthesis. DNA technology recombinant has made it possible to isolate clusters of complete genes for the biosynthesis of different antibiotics using, among other cloning and selection strategies, the library analysis of microorganisms producing antibiotics using DNA probes. This strategy is based on the existence of previous genetic information on the route of biosynthesis or biosynthetically related routes, which allows use or design genetic probes from the total sequence or partial of a biosynthesis enzyme.

Different studies on the biosynthesis of streptolidigin have shown the incorporation of propionate, acetate, methionine and glutamic acid in the form of? -Methylaspartic acid in the structure of this compound (Chen et al ., Org. Left. 8, 5329-5332 , 2006; Chen and Harrison, Org. Lett. 6, 4033-4036, 2004; Pearce and Rinehart, J. Antibiot. 36, 1536-1538, 1993; Pearce et al ., J. Am. Chem. Soc. 102, 2510-2512, 1980). These studies already mention the possible involvement in the biosynthesis of streptolidigin of a hybrid system that would include the participation of a polyketide synthase (PCS) and a non-ribosomal peptide synthetase (NRPS), an implication that has been demonstrated for the biosynthesis of other tetramic acids. as a-lipomycin (Bihlmaier et al ., Antimicrob. Agents. Chemother. 50, 2113-2121, 2006). In the case of streptolydigin, speculation on the participation of a PCS-NRPS hybrid system in its biosynthesis has been partially confirmed by identification of Leute gene (accession number: DQ115803) encoding a thioesterase type II enzyme generally associated to type I PCSs (Rawlings, Nat. Prod. Rep. 18, 231-281, 2001), from streptomycesin producer Streptomyces lydicus AS 42501. This type II thioesterase has been demonstrated, by gene inactivation, involved in the biosynthesis of streptolidigine (Yu et al ., Appl. Biochem. Biotechnol. 135, 145-158, 2006). In addition, streptolidigin biosynthesis has recently been related to fatty acid biosynthesis by inactivation of the Streptomyces lydicus fabCF genes encoding an acyl group carrier protein (ACP) and a β-ketoacyl-ACP synthase II, respectively, involved in the synthesis of fatty acids. Inactivation of the aforementioned genes generated a non-producing streptolidigin mutant (Zhao et al ., Appl. Microbiol. Biotechnol. 83, 305-313, 2009). In the "Streptolydigin and production thereof" patent (US Patent No. 3,160,560) the production of streptolidigin from Streptomyces lydicus NRRL 2433 is described. On the other hand, no patent has been found regarding the identification of the genes involved in the Streptolidigin biosynthesis.

Description of the invention

This invention provides a sequence of genes involved in the biosynthesis of streptolidigine and its precursors The gene pool includes for example genes structural factors involved in the biosynthesis of the central structure of the antibiotic and sugar, and genes involved in regulation of gene pooling.

An aspect of this invention is a method of isolation and purification of a nucleic acid fragment that contains the streptolidigin biosynthesis pathway gene cluster comprising the following
stages:

to.

Obtaining a genomic nucleic acid library from the Streptomyces lydicus streptolidigin-producing microorganism.

b.

Transfection of said clones library in host cells.

C.

Oligonucleotide design for the isolation of the biosynthesis gene cluster of Streptolidigine

d.

Construction of a probe comprising a nucleotide sequence of a gene cluster of Streptolidigin biosynthesis.

and.

Use of heterologous probes for the isolation of the biosynthesis gene cluster of Streptolidigine

F.

Hybridization of said probes against the genomic nucleic acid library obtained from said microorganism.

g.

Isolation of said gene pool from clones with positive hybridization.

       \ vskip1.000000 \ baselineskip
    

Another aspect of the invention is a molecule of nucleic acid comprising a described nucleotide sequence as SEQ ID NO: 1 or a nucleotide sequence complementary to SEQ ID NO: 1 or a degenerate nucleotide sequence with respect to SEQ ID NO: 1 or a nucleotide sequence capable of hybridizing under restrictive conditions with SEQ ID No. 1, or with the strand complementary to SEQ ID NO: 1, or with a hybridization probe derived from SEQ ID NO: 1 or its complementary strand or a nucleotide sequence that has at least 65% identity of sequence with SED ID NO: 1 and that encodes or is complementary to a sequence that encodes at least one biosynthetic enzyme of Streptolidigine or a part of it.

In a preferred embodiment, the molecule of nucleic acid contains a part of the nucleotide sequence at least 15 nucleotides in length.

In another preferred embodiment, the molecule of nucleic acid encodes one or more polypeptides, or includes one or more genetic elements, which have a functional activity in the synthesis of a dienoyl-tetramic antibiotic or a precursor of a dienoyl-tetramic antibiotic. In a more preferred embodiment, said antibiotic dienoyl-tetrameric or precursor of an antibiotic dienoyl-tetramic is streptolidigin or a precursor of streptolidigine.

In another preferred embodiment, the molecule of nucleic acid encodes one or more polypeptides, or includes one or more genes and / or one or more regulatory sequences and / or one or more elements genetic encoders or non-encoders, which have activity functional in the synthesis of an antibiotic dienoyl-tetrameric or a precursor of an antibiotic dienoyl-tetram. In a more preferred embodiment, said dienoyl-tetramic antibiotic or precursor of a dienoyl-tetramic antibiotic is streptolidigin or a precursor of streptolidigin.

In a specific embodiment, the molecule of nucleic acid includes a nucleotide sequence that encodes one or more amino acid sequences of those described in SEQ ID NOs: 2 to 39, or a nucleotide sequence that is complementary or degenerated with respect to a nucleotide sequence that encodes one or more amino acid sequences that possess at least 60% of sequence identity with any of SEQ ID NOs: 2 to 39.

Another aspect of the invention is a molecule of nucleic acid obtained according to the previous procedure of isolation and purification of a nucleic acid fragment that it contains the biosynthesis pathway gene cluster of streptolidigin, which comprises a nucleotide sequence described as SEQ ID NO: 1 or a nucleotide sequence complementary to SEQ ID NO: 1 or a nucleotide sequence degenerated with respect to SEQ ID NO: 1 or a nucleotide sequence capable of hybridizing under restrictive conditions with SEQ ID No. 1, or with the complementary strand of SEQ ID NO: 1, or with a probe hybridization derived from SEQ ID NO: 1 or its complementary strand or a nucleotide sequence that has at least 65% identity sequence with SED ID NO: 1 and that encodes or is complementary to a sequence that encodes at least one biosynthetic enzyme of Streptolidigine or a part of it.

Another object of the invention is a polypeptide. encoded by a nucleic acid molecule comprising a nucleotide sequence described as SEQ ID NO: 1 or a sequence of nucleotides complementary to SEQ ID NO: 1 or a sequence of degenerated nucleotides with respect to SEQ ID NO: 1 or a sequence of nucleotides capable of hybridizing under restrictive conditions with SEQ ID No. 1, or with the complementary strand of SEQ ID NO: 1, or with a hybridization probe derived from SEQ ID NO: 1 or its strand complementary or a nucleotide sequence that has at least one 65% sequence identity with SEQ ID NO: 1 and that encodes or is complementary to a sequence that encodes at least one enzyme biosynthetic streptolidigine or a part of it; and that in addition includes a nucleotide sequence that encodes one or more amino acid sequences of those described in SEQ ID NOs: 2 to 39, or a nucleotide sequence that is complementary or degenerated with with respect to a nucleotide sequence encoding one or more amino acid sequences that have at least 60% identity sequence with any of SEQ ID NOs: 2 to 39, comprising a or more complete amino acid sequences, or parts thereof, described in SEQ ID NOs: 2 to 39 or one or more sequences complete amino acids, or parts thereof, that possess at least 60% sequence identity with any of SEQ ID NOs: 2 a 39.

In a preferred embodiment, the polypeptide It has a functional activity in the synthesis of an antibiotic dienoyl-tetramic or a tetrimic.

Another aspect of the invention is a recombinant nucleic acid molecule that includes a nucleic acid fragment, or a part with similar characteristics, cloned into a vector that replicates in Streptomyces or E. coli , of the nucleic acid molecule comprising a nucleotide sequence described as SEQ ID NO: 1 or a nucleotide sequence complementary to SEQ ID NO: 1 or a degenerate nucleotide sequence with respect to SEQ ID NO: 1 or a nucleotide sequence capable of hybridizing under restrictive conditions with SEQ ID No. 1, or with the complementary strand of SEQ ID NO: 1, or with a hybridization probe derived from SEQ ID NO: 1 or of its complementary strand or a nucleotide sequence that has at least 65% sequence identity with SED ID NO: 1 and that encodes or is complementary to a sequence that encodes at least one stiosolidine biosynthetic enzyme or a part thereof; and which also includes a nucleotide sequence that encodes one or more amino acid sequences of those described in SEQ ID NOs: 2 to 39, or a nucleotide sequence that is complementary or degenerated with respect to a nucleotide sequence that encodes one or more amino acid sequences that have at least 60% sequence identity with any of SEQ ID NOs: 2 to 39.

For the purposes of the present invention and its description a part of nucleic acid with similar characteristics is any portion of the nucleotide sequence described as SEQ ID NO: 1 or a nucleotide sequence complementary to SEQ ID NO: 1 that has been genetically modified in vitro or in vivo .

In a preferred embodiment, the molecule of Recombinant nucleic acid is the cosmid Slg6E5 that contains the nucleotides 1 to 6980 of the nucleotide sequence described as SEQ ID NO: 1.

In another preferred embodiment, the molecule of Recombinant nucleic acid is the cosmid Slg4A8 that contains the nucleotides 6000 to 45000 of the described nucleotide sequence as SEQ ID NO: 1.

In another preferred embodiment, the molecule of Recombinant nucleic acid is the cosmid Slg9C7 that contains the nucleotides 36000 to 73100 of the nucleotide sequence described as SEQ ID NO: 1.

In another preferred embodiment, the molecule of Recombinant nucleic acid is the cosmid Slg6G6 that contains the nucleotides 70200 to 80894 of the nucleotide sequence described as SEQ ID NO: 1.

Another aspect of the invention is a cell. host or transgenic organism that contains any molecule of anterior recombinant nucleic acid.

Another object of the invention is the use of previous cells or transgenic organisms thereof, in the production of tetramic metabolites.

       \ newpage
    

Another object of the invention is the use of previous cells or transgenic organisms thereof, in the Streptolidigine production, streptolidigine derivatives or streptolidigin precursors.

Another object of the invention is the use of the genes encoded by the fragment of a nucleic acid molecule comprising a nucleotide sequence described as SEQ ID NO: 1 or a nucleotide sequence complementary to SEQ ID NO: 1 or a sequence of degenerated nucleotides with respect to SEQ ID NO: 1 or a nucleotide sequence capable of hybridizing under restrictive conditions with SEQ ID No. 1, or with the complementary strand of SEQ ID NO: 1, or with a hybridization probe derived from SEQ ID NO : 1 or of its complementary strand or a nucleotide sequence that has at least 65% sequence identity with SED ID NO: 1 and that encodes or is complementary to a sequence that encodes at least one biosynthetic streptolidigin enzyme or a part of the; and which also includes a nucleotide sequence that encodes one or more amino acid sequences of those described in SEQ ID NOs: 2 to 39, or a nucleotide sequence that is complementary or degenerated with respect to a nucleotide sequence that encodes one or more amino acid sequences that have at least 60% sequence identity with any of SEQ ID NOs: 2 to 39, or the recombinant nucleic acid molecule cloned into a vector that replicates in Streptomyces or in E. coli , which includes the anterior nucleic acid fragment or a part with similar characteristics, in the production of tetramic metabolites.

Another object of the invention is the use of genes) encoded by the fragment of a nucleic acid molecule comprising; a nucleotide sequence described as SEQ ID NO: 1 or a nucleotide sequence complementary to SEQ ID NO: 1 or a degenerate nucleotide sequence with respect to SEQ ID NO: 1 or a nucleotide sequence capable of hybridizing under restrictive conditions with SEQ ID No. 1, or with the complementary strand of SEQ ID NO: 1, or with a hybridization probe derived from SEQ ID NO: 1 or of its complementary strand or a nucleotide sequence that has at least 65% sequence identity with SED ID NO: 1 and that encodes or is complementary to a sequence that encodes at least one stiosolidine biosynthetic enzyme or a part thereof; and which also includes a nucleotide sequence encoding one or more amino acid sequences of those described in SEQ ID NOs: 2 to 39; or a nucleotide sequence that is complementary or degenerated with respect to a nucleotide sequence encoding one or more amino acid sequences that. they own at least 60% sequence identity with any of SEQ ID NOs: 2 to 39, or the recombinant nucleic acid molecule cloned into a vector that replicates in Streptomyces or in E. coli , which includes the above nucleic acid fragment or a part with similar characteristics, in the production of streptolidigin, streptolidigin derivatives or streptolidigin precursors.

Another object of the invention is the use of the genes encoded by the fragment of a nucleic acid molecule comprising a nucleotide sequence described as SEQ ID NO: 1 or a nucleotide sequence complementary to SEQ ID NO: 1 or a sequence of degenerated nucleotides with respect to SEQ ID NO: 1 or a nucleotide sequence capable of hybridizing under restrictive conditions with SEQ ID No. 1, or with the complementary strand of SEQ ID NO: 1, or with a hybridization probe derived from SEQ ID NO : 1 or of its complementary strand or a nucleotide sequence that has at least 65% sequence identity with SED ID NO: 1 and that encodes or is complementary to a sequence that encodes at least one biosynthetic streptolidigin enzyme or a part of the; and which also includes a nucleotide sequence that encodes one or more amino acid sequences of those described in SEQ ID NOs: 2 to 39, or a nucleotide sequence that is complementary or degenerated with respect to a nucleotide sequence that encodes one or more amino acid sequences that have at least 60% sequence identity with any of SEQ ID NOs: 2 to 39, or the recombinant nucleic acid molecule cloned into a vector that replicates in Streptomyces or in E. coli , which includes the Anterior nucleic acid fragment or a part with similar characteristics, to increase the production of tetrameric metabolites or precursors of tetramic metabolites.

Another object of the invention is the use of the genes encoded by the fragment of a nucleic acid molecule comprising a nucleotide sequence described as SEQ ID NO: 1 or a nucleotide sequence complementary to SEQ ID NO: 1 or a sequence of degenerated nucleotides with respect to SEQ ID NO: 1 or a nucleotide sequence capable of hybridizing under restrictive conditions with SEQ ID No. 1, or with the complementary strand of SEQ ID NO: 1, or with a hybridization probe derived from SEQ ID NO : 1 or of its complementary strand or a nucleotide sequence that has at least 65% sequence identity with SED ID NO: 1 and that encodes or is complementary to a sequence that encodes at least one biosynthetic streptolidigin enzyme or a part of the; and which also includes a nucleotide sequence that encodes one or more amino acid sequences of those described in SEQ ID NOs: 2 to 39, or a nucleotide sequence that is complementary or degenerated with respect to a nucleotide sequence that encodes one or more amino acid sequences that have at least 60% sequence identity with any of SEQ ID NOs: 2 to 39, or the recombinant nucleic acid molecule cloned into a vector that replicates in Streptomyces or in E. coli , which includes the anterior nucleic acid fragment or a part with similar characteristics, to increase the production of streptolidigin, streptolidigin derivatives or streptolidigin precursors.

For the purposes of the present invention and its description, increasing the production of tetrameric metabolites or precursors of tetrameric metabolites refers to the use of structural or regulatory genes for cloning in Streptomyces lydicus or in any other Streptomyces producing metabolites. tetrameric or precursors of tetramic metabolites in such a way that increasing the gene dose increases the amount of streptolidigin, streptolidigin derivatives, streptolidigin precursors or any other tetramic metabolite or precursor of tetramal metabolites, produced by these microorganisms with respect to unmodified microorganisms.

Another object of the invention is the use of a nucleic acid molecule comprising a nucleotide sequence described as SEQ ID NO: 1 or a nucleotide sequence complementary to SEQ ID NO: 1 or a degenerate nucleotide sequence with respect to SEQ ID NO : 1 or a nucleotide sequence capable of hybridizing under restrictive conditions with SEQ ID No. 1, or with the complementary strand of SEQ ID NO: 1, or with a hybridization probe derived from SEQ ID NO: 1 or its complementary strand or a nucleotide sequence that has at least 65% sequence identity with SED ID NO: 1 and that encodes or is complementary to a sequence that encodes at least one biosynthetic streptolidigin enzyme or a portion thereof; and which also includes a nucleotide sequence that encodes one or more amino acid sequences of those described in SEQ ID NOs: 2 to 39, or a nucleotide sequence that is complementary or degenerated with respect to a nucleotide sequence that encodes one or more amino acid sequences that have at least 60% sequence identity with any of SEQ ID NOs: 2 to 39, or the recombinant nucleic acid molecule cloned into a vector that replicates in Streptomyces or in E. coli , which includes the anterior nucleic acid fragment or a part with similar characteristics, in the inactivation of genes involved in streptolidigin biosynthesis.

Another object of the invention is the use of a nucleic acid molecule comprising a nucleotide sequence described as SEQ ID NO: 1 or a nucleotide sequence complementary to SEQ ID NO: 1 or a degenerate nucleotide sequence with respect to SEQ ID NO : 1 or a nucleotide sequence capable of hybridizing under restrictive conditions with SEQ ID No. 1, or with the complementary strand of SEQ ID NO: 1, or with a hybridization probe derived from SEQ ID NO: 1 or its complementary strand or a nucleotide sequence that has at least 65% sequence identity with SED ID NO: 1 and that encodes or is complementary to a sequence that encodes at least one biosynthetic streptolidigin enzyme or a portion thereof; and which also includes a nucleotide sequence that encodes one or more amino acid sequences of those described in SEQ ID NOs: 2 to 39, or a nucleotide sequence that is complementary or degenerated with respect to a nucleotide sequence that encodes one or more amino acid sequences that have at least 60% sequence identity with any of SEQ ID NOs: 2 to 39, or the recombinant nucleic acid molecule cloned into a vector that replicates in
Streptomyces or in E. coli , which includes the above nucleic acid fragment or a part with similar characteristics, in PCR amplification techniques aimed at the isolation and / or use of genes involved in streptolidigin biosynthesis.

Another aspect of the invention is the use of Streptolidigine intermediates or streptolidigine derivatives above as starting compounds in the chemical synthesis of tetramic metabolites.

Another object of the invention is a process for increase the production of tetramic metabolites in a bacterial host, which comprises the following stages:

to.

Transfer of the nucleic acid fragment of claims 7 or 11 to a host of the genus Streptomyces .

b.

Culture of the recombinant strain obtained.

C.

Isolation of the tetramic metabolite produced.

       \ vskip1.000000 \ baselineskip
    

In a preferred embodiment, the host of the genus Streptomyces is Streptomyces lydicus . In a more preferred embodiment, the Streptomyces lydicus host is a mutant derived from S. lydicus NRRL 2433. In an even more preferred embodiment, the tetramic metabolite is streptolidigin, a streptolidigin derivative or a streptolidigin precursor.

Another object of the invention is the use of Streptolidigine intermediates or streptolidigine derivatives obtained from the previous process as starting compounds in the chemical synthesis of tetramic products.

Another aspect of the invention is a process for generating streptolidigin derivatives or streptolidigin precursors with the inactivation of genes encoded by the fragment of a nucleic acid molecule comprising a nucleotide sequence described as SEQ ID NO: 1 or a nucleotide sequence complementary to SEQ ID NO: 1 or a degenerated nucleotide sequence with respect to SEQ ID NO: 1 or a nucleotide sequence capable of hybridizing under restrictive conditions with SEQ ID No. 1, or with the complementary strand of SEQ ID NO: 1, or with a hybridization probe derived from SEQ ID NO: 1 6 of its complementary strand or a nucleotide sequence that has at least 65% sequence identity with SED ID NO: 1 and that encodes or is complementary to a sequence that encodes at least one biosynthetic streptolidigin enzyme or a part thereof; and which also includes a nucleotide sequence that encodes one or more amino acid sequences of those described in SEQ ID NOs: 2 to 39, or a nucleotide sequence that is complementary or degenerated with respect to a nucleotide sequence that encodes one or more amino acid sequences that have at least 60% sequence identity with any of SEQ ID NOs: 2 to 39, or the recombinant nucleic acid molecule cloned into a vector that replicates in Streptomyces or in E. coli , which includes the anterior nucleic acid fragment or a part with similar characteristics.

Another object of the invention is the use of Streptolidigine intermediates or streptolidigine derivatives obtained from the previous process as starting compounds in the chemical synthesis of tetramic products.

Another aspect of the invention is a recombinant strain of Streptomyces lydicus that lacks the genes encoding proteins described as SEQ ID NO: 8, 9, 10, 11 and 12.

In a specific embodiment, the recombinant strain of Streptomyces lydicus contains the plasmid pFL844T.

In another specific embodiment, the recombinant strain of Streptomyces lydicus contains the plasmid pFL845T.

In another specific embodiment, the recombinant strain of Streptomyces lydicus contains the plasmid pLNBIVT.

Another object of the invention are the streptolidigin derivatives produced any of the recombinant strains of Streptomyces lydicus above.

The recombinant strain of Streptomyces lydicus that lacks the genes that code for the proteins described as SEQ ID NO: 8, 9, 10, 11 and 12 and named S. lydicus 7H13 and the strains derived therefrom containing plasmids pFL844T, pFL845T or pLNBIVT and named S. lydicus 7H13 / p844T, S. lydicus 7H13 / p845T and S. lydicus 7H13 / pLNBIV were deposited in the Spanish Type Crops Collection (CECT), University of Valencia, Burjassot Campus, 46100 Burjassot (Valencia, Spain ) with deposit numbers CECT-7539, CECT-7540, CECT-7541 and CECT-7542, respectively.

The invention is applicable in the Obtaining streptoolidigin superproductive strains or derivatives of streptolidigine for isolation and use in, between others, the pharmaceutical or chemical sector for, for example, its use as an antibiotic in a clinic or as a reagent for research and development of tetramic metabolites or derivatives of tetramic metabolites by chemical synthesis.

Brief description of the figures

Fig. 1. Antibiotic structure Dienoyl-Tetramic Streptolidigin (I).

Fig. 2. Diagram showing a schematic representation of the restriction map, using the restriction enzyme BamHI (numbered positions in the scheme), of the gene pool for streptolidigin biosynthesis in Streptomyces lydicus NRRL 2433 contained in the sequence of nucleotides described as SEQ ID NO: 1. The scale is shown in kilobases (kb). Slg6E5, Slg4A8, Slg9C7 and Slg6G6 represent the cosmids in which the nucleotide sequence described as SEQ ID NO has been isolated: 1. The genes present in the gene pool are represented by italic letters and numbers on arrows. The genes that have been inactivated within the gene cluster are shown as gray arrows and the rest as black arrows. Genes not involved in streptolidigin biosynthesis are shown as white arrows.

Fig. 3. Analysis by very high resolution liquid chromatography (UPLC) and high performance liquid chromatography coupled to mass spectrometry (HPLC / MS). Fig. 3A shows the production of streptolidigin (I) in the wild strain Streptomyces lydicus analyzed by UPLC. The ordinates represent the time in minutes (min.) And the abscissa as arbitrary units (AU). Fig. 3B shows the absorption spectrum of streptolidigine (I). In the ordinates the wavelength is represented in nanometers (nm) and in the abscissa as arbitrary units. Fig. 3C shows the production of streptolidigin in the wild strain Streptomyces lydicus analyzed by HPLC / MS. In the ordinates the time is represented in minutes (min.) And in the abscissa as arbitrary units (AU). Fig. 3D shows the mass spectrum of streptolidigin, marking the value of masks (without units) at each peak.

Fig. 4. UPLC analysis of the streptomyces lydicus wild strain producing streptoligin is shown in Fig. 4A. The ordinates represent the time in minutes (min.) And the abscissa as arbitrary units (AU). In Fig. 4B, the UPLC analysis of the SLM961 mutant obtained by gene disruption, not producing streptolidigin, is shown. The ordinates represent the time in minutes (min.) And the abscissa as arbitrary units (AU). The UPLC analysis of the SLM4C1 mutant, obtained by gene disruption, not producing streptolidigin, is shown in Fig. 4C. The ordinates represent the time in minutes (min.) And the abscissa as arbitrary units (AU).

Fig. 5. UPLC analysis of streptolidigin production. The analysis in the wild strain Streptomyces lydicus is shown in Fig. 5A. The ordinates represent the time in minutes (min.) And the abscissa as arbitrary units (AU). The analysis of the SLM2A mutant obtained by gene disruption is shown in Fig. 5B. The ordinates represent the time in minutes (min.) And the abscissa as arbitrary units (AU). The analysis of the SLM3A mutant obtained by gene disruption is shown in Fig. 5C. The ordinates represent the time in minutes (min.) And the abscissa as arbitrary units (AU).

Fig. 6. Diagram showing a schematic representation of the restriction map, using the restriction enzyme Eco RV, of the gene pool for streptolidigin biosynthesis in Streptomyces lydicus NRRL 2433 contained in the nucleotide sequence described as SEQ ID NO: 1. The expected sizes of the EcoRV fragments and the probe (cosmid Slg4A8) used to confirm by Southern hybridization the deletion of the slgS3 to slgS7 genes (in gray) are shown in Fig. 6A. The scale is shown in kilobases (kb). The expected sizes of the EcoRV fragments are shown in Fig. 6B by Southern hybridization analysis of the mutant strain SLM7H13 with the Slg4A8 probe. The oval represents the ermE * promoter. Fig. 6C shows the Southern hybridization of the chromosomal DNAs of Streptomyces lydicus NRRL 2433 (I) and of the mutant strain SLM7H13 (II), using the cosmid Slg4A8 as a probe.

Fig. 7. Analysis of the production of non-glycosylated streptolidigins, compounds (II) and (III) by the mutant strain SLM7H13. The analysis by UPLC is shown in Fig. 7A.  The ordinates represent the time in minutes (min.) And in the abscissa as arbitrary units (AU). In Fig. 7B it is shown HPLC / MS analysis. The ordinates represent the time in minutes (min.) and in abscissa as arbitrary units (AU). The profile of MS corresponding to the peak is shown in Fig. 7C (II) marking at each peak the mass value (without units). In Fig. 7D shows the MS profile corresponding to the peak (III) marking at each peak the mass value (without units).

Fig. 8. Structure of the compounds (II), desmethyl-streptolidiginone, and (III), streptolidiginone, characterized by nuclear magnetic resonance (NMR)

Fig. 9. Analysis of the production of modified streptolidigin, compound (IV), by strain SLM7HI3 /
pFL844T. The analysis by UPLC is shown in Fig. 9A. The ordinates represent the time in minutes (min.) And the abscissa as arbitrary units (AU). The HPLC / MS analysis is shown in Fig. 9B. The ordinates represent the time in minutes (min.) And the abscissa as arbitrary units (AU). In Fig. 9C the profile of MS corresponding to the peak (IV) is shown, marking the mass value (without units) at each peak. The structure of compound (IV), streptolidigin LA, resolved by (NMR) is shown in Fig. 9D.

Fig. 10. Analysis of the production of modified streptolidigins, compounds (V) and (VI), by strain
SLM7H13 / pFL845T. The analysis by UPLC is shown in Fig. 10A. The ordinates represent the time in minutes (min.) And the abscissa as arbitrary units (AU). The HPLC / MS analysis is shown in Fig. 10B. The ordinates represent the time in minutes (min.) And the abscissa as arbitrary units (AU). The profile of MS corresponding to the peak (V) is shown in Fig. 10C, marking the mass value (without units) at each peak. In Fig. 10D the profile of MS corresponding to the peak (VI) is shown, marking the mass value (without units) at each peak. The proposed structure of compound (V), streptolidigin DA, is shown in Fig. 10E. The proposed structure of compound (VI), streptolidigin DO is shown in Fig. 10F.

Fig. 11. Analysis of the production of modified streptolidigins, compound (VII), by strain SLM7H13 /
pLNBIVT. The analysis by UPLC is shown in Fig. 11A. The ordinates represent the time in minutes (min.) And the abscissa as arbitrary units (AU). The analysis by HPLCIMS is shown in Fig. 11B. The ordinates represent the time in minutes (min.) And the abscissa as arbitrary units (AU). In Fig. 11C the profile of MS corresponding to the peak (VII) is shown, marking the mass value (without units) at each peak. The proposed structure of compound (VII), streptolidigin LD, is shown in Fig. 10D.

Fig. 12. Analysis of the antibiotic activity of streptolidigin (I), streptolidiginone compound (III) and streptolidigin LA compound (IV) against S. albus . Each paper disc contains 2 µg of the corresponding antibiotic dissolved in 15 µl of methanol. The negative control (C) contains 15 µl of methanol without antibiotic.

       \ vskip1.000000 \ baselineskip
    

Explanation of a preferred embodiment

For a better understanding of this invention, the following embodiments are set forth preferred, described in detail, which should be understood without character limiting the scope of the invention.

       \ vskip1.000000 \ baselineskip
    

Example 1 Cloning of the gene pool involved in the biosynthesis of streptolidigine 1.1. Microorganisms, plasmids and conditions of culture

The microorganisms and plasmids used are described in Table 1. Streptomyces lydicus NRRL 2433 and the mutants generated from it were cultured for sporulation in medium A (Fernández et al ., J. Bacteriol., 180, 4929-4937, 1998 ); for antibiotic production was grown in liquid medium R5A (Fernandez et al, J. Bacteriol, 180, 4929-4937, 1998..); using an inoculum previously cultured in TSB liquid medium. Intergeneric conjugation from E. coli ET12567 (pUB307) (Kieser et al ., Practical Streptomyces Genetics. The John Iones Foundation. Norwich, 2000) to S. lydicus was performed according to Sambrook et al ., Molecular cloning: a laboratory manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory press (1989). E. coli strains were grown and transformed as described by Sambrook et al ., (1989). Culture media were supplemented with appropriate antibiotics to each resistance marker at the following concentrations: 100 µg / ml ampicillin, 20 µg / ml tobramycin, 25 µg / ml apramycin, 50 µg / ml thiostreptone, 50 mug / ml hygromycin, 10 µm / ml tetracycline, 25 µg / ml chloramphenicol and 50 µg / ml nalidixic acid.

TABLE 1 Bacterial strains and plasmids used in this example

one

       \ vskip1.000000 \ baselineskip
    

1.2. Streptolidigin production analysis

Streptolidigine production was routinely performed in 1.5 ml of solid R5A medium (Fernández et al ., J. Bacteriol., 180, 4929-4937, 1998) in 25-well plates. For its inoculum, S. lydicus spores were used and the cultures were maintained for 7 days at 30 ° C, after which time they were extracted with 1 ml of ethyl acetate. Streptolidigin production was also performed in liquid cultures of 5 to 7 days grown on an orbital shaker at 30 ° C and 250 rpm. For this purpose, 250 ml Erlenmeyer flasks containing 50 ml of liquid R5A medium were used (Fernández et al ., J Bacteriol, 180: 4929-4937, 1998). For its inoculum, a volume of 2% of a pre-inoculum of S. lydicus made in TSB medium (50 ml in 250 ml flasks) was used, which was collected after two days of incubation in an orbital shaker at 30 ° C and 250 rpm. The streptolidigin present in the liquid cultures was extracted with varying volumes of ethyl acetate. The ethyl acetate extracts were evaporated using a vacuum coupled centrifuge and once evaporated the samples were resuspended in methanol for analysis.

       \ newpage
    

The identification and quantitative analysis of Streptolidigine was carried out by phase chromatography reverse on an UPLC device using a BEH C18 column (2.1 x 100 mm) and using acetonitrile and 0.05% TFA as solvents. The samples were eluted with 10% acetronitrile for 1 min followed by a linear gradient of acetonitrile from 10% to 80% for 7 min. The flow used was 0.5 ml / min and the column temperature of 30 ° C. For mass analysis coupled to HPLC (HPLC / MS) a coupled chromatographic system was used to a mass spectrometer and a C18 column (2.1 x 150 mm). The solvents used were the same as those described previously and elution was performed with an isocratic gradient initial 10% acetonitrile maintained for 4 min and followed by a linear gradient of acetonitrile from 10% to 88% during 26 min, using a flow of 0.25 ml / min. The analysis Mass was performed by electrospray ionization in positive mode, with a capillary voltage of 3 kV and a cone voltage of 20 V. The Peak detection and characterization of its spectrum of Absorption were performed in both cases with a photodiode system in line extracting two-dimensional chromatograms to a length 360 nm wave

Streptolidigine analyzed at UPLC presents a retention of 6.48 min and a maximum in the absorption spectrum 600 nm Streptolidigine analyzed in HPLCIMS has a 25.87 min mobility and shows two ions in positive mode with masses of 487 m / z [M + H] +, corresponding to the aglycone and 601 m / z [M + H] + corresponding to the compound without fragment (Fig. 3C).

For the structural characterization of the streptolidigin derivatives mentioned in this patent, cultures of the corresponding S. lydicus strains were carried out and the extracts were dissolved in 5 ml of a mixture of DMSO and methanol in equal parts. They were then centrifuged and the upper layer corresponding to the lipid fraction was removed. The first purification step was performed by chromatography on an XTerra PrepRP18 column (19 x 300 mm) using acetonitrile and 0.05% trifluoroacetic acid (TFA) as solvents dissolved in water. A linear gradient from 30% to 100% acetonitrile was used for 7 min followed by 3 min of 100% acetonitrile. The flow used was 15 ml / min. The peaks of interest were collected on 0.1 M phosphate buffer, pH 7.0. The solutions obtained were partially evaporated in a rotary evaporator to reduce the concentration of acetonitrile and subsequently applied to a solid phase extraction cartridge (Sep-Pak C18), subsequently washed with water to remove salts and eluted with methanol. Subsequent purifications were performed under isocratic conditions, optimized for each peak, using a Symmetry C18 column (7.8 x 300 mm) and mixtures of acetonitrile and 0.05% TFA dissolved in water, using a flow of 7 ml / min. . As mentioned above, the peaks were always collected on 0.1 M phosphate buffer, pH 7.0, desalted using solid phase extraction and finally
lyophilized

       \ vskip1.000000 \ baselineskip
    

1.3. DNA manipulation

The preparation of plasmids, total DNA, restriction enzyme digestions, DNA linkages, etc., was carried out following standardized methods previously described (Sambrook et al ., Molecular cloning: a laboratory manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory press, 1989; Kieser et al ., Practical Streptomyces Genetics. The John limes Foundation. Norwich, 2000). The DNA fragments were isolated from agarose gels, labeled using dioxigenin-labeled nucleotides and used for Southern hybridization analysis. Sequencing was performed on double stranded DNA using the method described by Sanger et al ., Proc. Natl Acad. Sci. USA. 74, 5463-5467 (1977). The sequences obtained were analyzed using the programs described by Devereux et al ., Nucleic Acids Res. 12, 387-395, 1984 and Altschul et al ., J. Mol. Biol. 215, 403-410, 1990. The analysis of the transmembrane regions of possible transmembrane proteins was performed using the program described by Krogh et al ., J. Mol. Biol. 305, 567-580, 2001. The analysis of PCS and NRPS was performed using the programs described by Tae et al ., BMC Bioinformatics. 8, 327-335, 2007 and Rausch et al ., Nucleic Acids Res. 33, 5799-5808, 2005.

       \ vskip1.000000 \ baselineskip
    

1.4. Amplification of DNA fragments by PCR and donation of a DNA fragment encoding part of a thioesterase type II of the genome of Streptomyces lydicus NRRL 2433

The strategy used to donate the streptolidigine biosynthesis gene pooling was the use of genetic homology with some proteins encoded by genes previously characterized and participating in the biosynthesis of streptolidigine, borrelidine and urdamicin A.

The available information on the biosynthetic enzyme thioesterase II from Streptomyces lydicus AS 42501 (Yu et al ., Appl. Biochem. Biotechnol. 135, 145-158, 2006) encoded by the leuTE gene ( accession number: DQ115803), has been used to design oligonucleotides and construct a homologous genetic probe. The synthetic oligonucleotides used were SLTEIII (5'-A GAATTC GGACGTCAGGAGCGGTACG-3 '; SEQ ID NO: 40) which included an EcoRI restriction site to facilitate subcloning (underlining) and SLTEII2 (5'-AAA AAGCTT GTGTGGT
CGGACCAGGCC-3 '; SEQ ID NO: 41) which included a HindIII restriction site to facilitate subcloning (underlining) and were used as primers for amplification by means of the polymerase chain reaction (PCR) and using as a template DNA the chromosomal DNA of Streptomyces lydicus .

Two heterologous probes were also used. The first one contains the genes that encode the PCS enzyme of Streptomyces parvulus Tú4055 involved in the biosynthesis of borrelidine macrolide (Olano et al ., Chem. Biol. 11, 87-97. 2004). The second one contains the genes that code for the Stdptomyces fradiae UrdZ3 and UrdQ enzymes involved in the biosynthesis of L-rhodinous deoxia sugar in angucycline urdamicin A (Hoffineister et al ., Chem. Biol. 7, 821-831, 2000).

To obtain the total DNA of S. lydicus NRRL 2433 the microorganism was cultured in liquid medium TSB (Tryptone Soya Broth) and the total DNA was isolated as described by Kieser et al ., Practical Streptomyces Genetics. The John limes Foundation. Norwich, 2000. The total DNA of S. lydicus NRRL 2433 was used as a template for the polymerase chain reaction using primers SLTEII1 and SLTEII2. It was assumed that, as a consequence of the amplification, a DNA fragment of approximately 0.5 kb would be obtained that would contain the inner part of the leuTE gene. The polymerase chain reaction was performed in a total volume of 50 \ mul and the reaction mixture contained 0.1 \ mug of total DNA from S. lydicus NRRL 2433, 2.5% dimethylsulfoxide (DMSO), 200 pmoles of each primer, dNTPs (final concentration 200 µM), 1xPCR of the enzyme DNA polymerase. The chain reaction was performed with the following program: 1 cycle of denaturation at 98 ° C (5 min), 30 cycles of denaturation / banding / synthesis at 94 ° C (1 min) / 50 ° C (1 min) / 72 ° C (1 min) and 1 final extension cycle at 72 ° C (5 min). The DNA fragment obtained with this procedure was cloned into the Escherichia coli vector pOJ260 (using the EcoRI and HindIII restriction sites present in the primers) and was subjected to sequencing using standardized techniques. Sequence analysis of the PCR amplified fragment revealed that it contained part of a protein identical to leuTE ( accession number: DQ115803). Once it was confirmed that the amplified fragment was part of the thioesterase II coding region involved in streptolidigin biosynthesis (Yu et al ., Appl. Biochem. Biotechnol. 135, 145-158, 2006) this fragment was used as a genetic probe for the analysis of a S. lydicus NRRL 2433 chromosomal DNA library.

       \ vskip1.000000 \ baselineskip
    

1.5. Construction and analysis of the S. lydicus NRRL 2433 chromosomal DNA library

The S. lydicus NRRL 2433 chromosomal DNA library was built on the cosmid pWE15 that is capable of replicating in Escherichia coli . The genomic DNA of S. lydicus NRRL 2433 isolated as described above, was partially digested with MboI and the fragments obtained, approximately 35 kb in size, were dephosphorylated by treatment with alkaline phosphatase. The cosmid pWE15, used as a vector, was linearized with BamHI. The DNA fragments and the vector were ligated and packaged in vitro . The recombinant DNA particles were used to infect E. coli XLI Blue MR cells and the transductants were selected on plates with LA medium (Luria agar) containing as an ampicillin selection antibiotic. Approximately 1000 transducer colonies were cultured in microtiter plates containing LB medium (Luria broth) and the selection antibiotic. After incubation at 37 ° C for 24 h, they were maintained in the presence of 25% glycerol at -70 ° C for preservation.

In order to clone the streptolidigin biosynthesis gene cluster, the analysis of the S. lydicus NRRL 2433 library was carried out by in situ hybridization of colonies with the probes mentioned above. The transductants were transferred from the microtiter plates to LA medium plates containing as an ampicillin antibiotic and after a night of growth at 37 ° C the colonies were transferred to nylon filters for in situ hybridization following the protocols described by Sambrook et al . , (1989). The filters were analyzed with the labeled probes. In this way the cosmids Slg6E5, Slg4A8, Slg9C7 and Slg6G6 were isolated
(Fig. 2).

       \ vskip1.000000 \ baselineskip
    

Example 2 Obtaining and analyzing the nucleotide sequence of the gene pool responsible for the biosynthesis of streptolidigine and deduction of gene functions

The cosmids Slg4A8 and Slg9C7 were sequenced in their entirety. From the Slg6E5 cosmid a 6980 bp BamHI fragment was sequenced and the 10720 bp EcoRI-BgIII fragment, both identified by partial sequencing as containing genes involved in streptolidigin biosynthesis, were sequenced from the Slg6G6 cosmid. Sequencing was performed on double stranded DNA using the method described by Sanger et al ., Proc. Natl Acad. Sci. USA. 74, 5463-5467 (1977). Sequence data obtained were analyzed using the computer programs described by Devereux et al ., Nucleic Acids Res. 12, 387-395, 1984) and Altschul et al ., J. Mol. Biol. 215, 403-410, 1990. The analysis of the transmembrane regions of possible transmembrane proteins was performed using the program described by Krogh et al ., J. Mol. Biol. 305, 567-580, 2001. The analysis of PCS and NRPS was performed using the programs described by Tae et al ., BMC Bioinformatics. 8, 327-335, 2007 and Rausch et al ., Nucleic Acids Res. 33, 5799-5808, 2005.

Computer analysis of the 80894 bp DNA sequence (SEQ ID NO: 1) showed the presence of 38 open reading patterns (ORFs) (Fig. 2 and Table 1) with a high G + C content characteristic of the DNA of Streptomyces In addition, a particularly high content in high G + C is shown in the third position of the codons characteristic of Streptomyces genes. The gene functions were deduced by comparison of the amino acid sequences, conceptually translated from the nucleotide sequence, with known sequences available in databases. The results obtained are shown in Table 2 referring to the sequence data included in the application. Of the 38 ORFS found 29 of them, which occupy a region of 74.5 kb, are probably involved in the biosynthesis of streptolidigin. This region is flanked by 9 ORFS probably involved in primary metabolism (blank in Fig. 2). Of these ORFs, orf1, orf2 and orf3-6 showed great similarity with proteins of S. coelicolor A3 (2) (SCO1090, SCO1092 and SCO1100-SCO1103) and S. avermitilis MA-4680 (SAV1492, SAV1494 and SAV 1499-SAV 1502 ), also showing the same organization in all three microorganisms. The products deduced from orf7, orf8 and orf9 did not show significant similarities with proteins deposited in the databases which suggests that they may not be involved in the biosynthesis of streptolidigin. Of the 29 proposed ORFs involved in streptolidigin biosynthesis: 7 of them ( slgA1 to slgA3, slgB, slgN1, slgL and slgN2 ) code for PKS and NRPS-type enzymes, involved in the biosynthesis of streptolidigin aglycone, 8 ORFs ( slgS1, slgS2, slgG , and slgS3-slgS7 ) encode enzymes involved in the biosynthesis of L-rhodilose deoxycarbon sugar and its binding to streptolidigin aglycone, 3 ORFs ( slgE1, slgE2 and slgE3 ) are involved in the contribution of the necessary amino acid precursor for Streptolidigin biosynthesis, 4 ORFs ( slgO1, slgO2, slgZ and slgM ) are involved in different modifications of the foral structure of the antibiotic or its amino acid precursor, 2 ORFs ( slgR1 and slgR2 ) are involved in regulatory processes, 1 ORF ( slgT ) is involved in the transport of streptolidigin and finally there are 4 ORFs ( slgC1, slgC2, slgX , and slgY ) without a clearly defined function in streptolidigin biosynthesis.

       \ vskip1.000000 \ baselineskip
    

TABLE 2 Genes identified in the chromosome region of S. lydicus NRRI 2433 involved in streptolidigin biosynthesis

3

4

5

       \ vskip1.000000 \ baselineskip
    

Example 3 Inactivation of the biosynthesis gene cluster of streptolidigine by gene disruption

In order to demonstrate the involvement of cloned gene clustering in streptolidigin biosynthesis, inactivation of the slgA1 and slgA3 genes was carried out using BamHI fragments isolated from two cosmids. The first of these fragments, of 1191 bp, comes from the cosmid Slg9C7 and is also present in the cosmid Slg6G6. This fragment is internal to slgA1 (BamHI sites 30-31, Fig. 2) and was cloned into plasmid pOJ260 digested with BamHI. The resulting construct, pOJ961, was used for gene disruption in S. lydicus generating the SLM961 mutant. The second fragment used, 627 bp, comes from the cosmid Slg4A8 and is also present in the cosmid Slg9C7. This fragment is internal to slgA3 (BamHI sites 30-31, Fig. 2) and was cloned into plasmid pOJ260 digested with BamHI. The resulting construct was used pOJ4C1 for gene disruption mutant S. lydicus generating SLM4C1.

The SLM961 and SLM4C1 mutants were selected for their resistance to apramycin. The disruption of each of the genes was verified by Southern analysis using in each case the labeled BamHI fragment. Both mutants were shown not to produce streptolidigin by UPLC analysis of samples of cultures of S. lydicus NRRL 2433, SLM961 and SLM4C1 extracted with ethyl acetate (Fig. 4A, Fig. 4B and Fig. 4C), thus confirming the involvement of gene clustering in streptolidigin biosynthesis.

       \ vskip1.000000 \ baselineskip
    

Example 4 Setting the limits of gene clustering of Streptolidigine biosynthesis by gene replacement

To establish the limits of the gene pooling involved in the biosynthesis of streptolidigin, two mutants were made by gene disruption in the ORFs orf2 (mutant SLM2A) and orf3 (mutant SLM3A). In both cases the ORF is interrupted by the introduction of an apramycin resistance gene.

To obtain the SLM2A mutant, a BamHI-PstI fragment of 1580 bp, from the cosmid Slg6E5 and containing the orf2 , is cloned in the digested pHyg vector BamHI-PstI. The resulting construct was digested with BglII enzyme (internal to the orf2) and blunt ends were obtained subsequently cloned SmaI-EcoRV one 1600pb fragment containing the apramycin resistance gene from plasmid pEFBA. Thus, in the resulting construct, pHyg2A, the gene has been interrupted with the resistance gene, this being in the same reading orientation as the orf2 .

To obtain the SLM3A mutant, a 1915 bp StuI-PstI fragment, from the cosmid Slg6G6 and containing the orf3 , was cloned into the digested pHyg vector EcoRV-PstI. The resulting construct was digested with the enzyme BamHI (internal to orf3 ) and blunt ends were obtained, subsequently cloning a 1600 bp SmaI-EcoRV fragment containing the apramycin resistance gene from plasmid pEFBA. Thus in the resulting construction, pHyg3A, the gene was interrupted with the resistance gene, the latter being in the same reading orientation that orf3.

Plasmids pHyg2A and pHyg3A were digested with the XbaI enzyme and in them a 1kb XbaI-SpeI fragment from plasmid pOJ260 was cloned and containing the origin of oriT transfer. In this way the pHyg2AT and pHyg3AT constructs were obtained which were introduced in S. lydicus by intergener conjugation from E. coli ET12567 (pUB307). To obtain the replacement of the wild copy of the gene by the mutated version, double overcrossing is necessary. The transconjugants in which a double overcrossing event had occurred were selected for their resistance to apramycin and their sensitivity to hygromycin. The chromosome replacement of the wild copy of the gene by the mutated was confirmed in the transconjugants by Southern analysis using in each case the initial labeled fragment.

Each of the mutants was analyzed for streptolidigin production, in parallel with the parental strain S. lydicus NRRL 2433 by UPLC. Both mutants, SLM2A and SLM3A, were shown as streptolidigin producers (Fig. 5), indicating that the mutated genes do not participate in streptolidigin biosynthesis and thus confirming the limits of the gene pool involved in streptolidigin biosynthesis.

       \ vskip1.000000 \ baselineskip
    

Example 5 Generation of mutants producing streptolidigins no glycosylated by gene replacement

To generate S. lydicus NRRL 2433 mutants capable of producing non-glycosylated streptolidigins, the slgS3 genes were deleted from slgS7 (Fig. 2), all of them possibly involved in the biosynthesis of L-rhodinose deoxy sugar. To this plasmid was constructed pOJ7H 13. First the PCR amplified gene fragment slgO2 1240 bp using the synthetic oligonucleotides CRIS 13 (5'-GAT G AA GCT GCC CGA G CC GCG TGA AG-3 ', SEQ ID NO: 42) that included a BamHI restriction site to facilitate subcloning (underlined) and CRIS14 (5'-A GA ATT C AT GCA TGG TGG TCA TCC GCC GCC-3 ', SEQ ID NO: 43) that included an EcoRI restriction site to facilitate subcloning (underlined). The slgM gene was then PCR amplified on a 1279 bp fragment using the oligonucleotides CRIS17 (5'-AA G GAT CC A CCG AAC CCG GAG GGT CG-3 ', SEQ ID NO: 44) which included a BamHI restriction site to facilitate subcloning (underlining) and CRIS18 (5'-A GA ATT C AC TAG T TC CTC GCC GGG CGT CAC-3 'SEQ ID NO: 45) which included an EcoRI restriction site to facilitate subcloning (underlining) and a SpeI site (bold). The PCR conditions for both amplifications were the same as previously described. Both amplified fragments were cloned in pCR-BLUNT and sequenced to verify their correct amplification.

The fragment containing the slgM gene was subsequently cloned as a BamHI-EcoRI fragment into the vector pOJ260P digested with the same restriction enzymes to generate the plasmid pOJPM. In this plasmid the slgM gene is placed under the control of the constitutive promoter ennE *. The slgO2 gene was cloned as a BamHI- NsiI fragment into the pLHyg vector digested with the BamHI-PstI enzymes, thereby obtaining plasmid pL7H. Plasmid pL7H was digested HindIII-SpeI to clone therein a 1479 bp HindIII-SpeI fragment obtained from plasmid pOJPM and containing the slgM gene under the control of the ermE * promoter. In this way the construction pL7H13 was obtained, in which the hygromycin resistance gene is flanked by the slgO and slgM genes, with slgM being under the control of the ermE * promoter to avoid polar effects on the mutant. Finally, plasmid pL7H13 was digested NheI-SpeI releasing a 4319 bp fragment that was cloned into the digested pOJ260 vector XbaI generating the construction pOJ7HI3 that was introduced in S. lydicus by intergener conjugation from E. coli ET12567 (pUB307) to generate the strain SLM7H13 mutant. To obtain the replacement of the slgS3 to slgS7 genes of the wild copy by the hygromycin resistance gene, double overcrossing is necessary. The transconjugants in which a double overcrossing event had occurred were selected for their resistance to hygromycin and their sensitivity to apramycin. Chromosome replacement was confirmed in transconjugants by Southern analysis using the labeled S14A8 cosmid as a probe (Fig. 6).

The analysis of cultures of strain SLM7H13 by UPLC showed two peaks with characteristic absorbance of streptolidigine but with 5.68 min and 5.88 min mobilities that they were called compounds (II) and (III) (Fig. 7). The analysis subsequent HPLC / MS determined that compound (II) has a mobility of 24.18 min and an ion of 473 m / z [M + H] +. He compound (III) has a mobility of 24.96 min and an ion of 487 m / z [M + H] +. The compound (III), once characterized its structure by NMR, corresponds to a derivative of non-glycosylated streptolidigine, of formula C 26 H 34 N 2 O 7, which was called streptolidiginone (compound (III), Fig. 8 and Table 3). Structural characterization of compound (II) showed that it has the same structure as compound (III) at the level of the polyketide region but lacks the resonance signals corresponding to the methyl group located in the side chain of the tetramic acid unit. These data allow determining that compound (II) is corresponds to desmethyl-streptolidiginone of formula C 25 H 32 N 2 O 7 (compound (II), Fig. 8 and Table 4).

       \ vskip1.000000 \ baselineskip
    

       \ vskip1.000000 \ baselineskip
    

       \ vskip1.000000 \ baselineskip
    

(Table goes to page next)

TABLE 3 NMR spectra data of streptolidiginone (III) in DMSO- d 6 to 300 K (1 H at 600 MHz, 13 C at 150 MHz)

6

       \ vskip1.000000 \ baselineskip
    

7

8

       \ vskip1.000000 \ baselineskip
    

       \ vskip1.000000 \ baselineskip
    

TABLE 4 NMR spectra data of desmethyl-streptolidiginone (II) in DMSO- d 6 to 300 K (1 H at 600 MHz, 13 C at 150 MHz)

9

10

eleven

To verify that indeed estreptolidiginona production and epoxy estreptolidiginona is due to the deletion of genes slgS3 slgS7, the SLM7H13 strain was complemented with slgS3 slgS7 genes expressed in trans under the control of the constitutive ermE * promoter. For this, plasmid pEM4T8-12 was constructed, cloning a 698 bp NruI-MfeI fragment, from the Slg4A8 cosmid and containing the slgS3 to slgS7 genes, in the SmaI-MfeI digested plasmid pSL1180. The resulting construct (pSL8-12) was EcoRI-MfeI digested to rescue the original fragment and was cloned in the proper orientation in the plasmid pEM4T digested EcoRI.

Plasmid pEM4T8-12 was introduced into S. lydicus SLM7H13 by intergener conjugation from E. coli ET12567 (pUB307) and the transconjugants were selected for their resistance to thioestreptone. In these transconjugants, the streptolidigin production capacity was analyzed and it was found that it had recovered, which shows that the production of the non-glycosylated streptolidigin derivatives is due to the absence of the slgS3 to slgS7 genes.

       \ vskip1.000000 \ baselineskip
    

Example 6 Generation of new streptolidigins with different deoxy sugars

Strain SLM7H13 was used to obtain streptolidigin derivatives containing different deoxy sugars. For this, plasmids pFL844T, pFL845T and pLNBIVT were generated, which are the integrative versions of plasmids pFL844 (Pérez et al ., Chem. Comm. 12, 1604-1606, 2005), pFL845 (Pérez et al ., Chem. Comm. 12, 1604-1606, 2005) and pLNBIV (Fischer et al ., J. Nat. Prod. 65, 1685-1689, 2002) that direct the biosynthesis of the deoxyazúcares L-amicetosa, D-amicetosa and L-digitoxosa, respectively .

The integrative versions of the aforementioned plasmids were obtained by donating a 6200 Spe I fragment from plasmid pAR15AT (Lombó et al ., ChemBioChem. 7, 366-376, 2006) that were unique to each XbaI site it contains the apramycin aac3 ( IV ) resistance gene, the int integrase gene, the attB integration site and the origin of oriT conjugation. Prior to Spe I digestion, the region containing the oripI5A replication origin of plasmid pAR15AT was deleted by removing a 700 bp PstI-BglII fragment followed by vector religation after treatment to obtain blunt ends.

Plasmids pFL844T, pFL845T and pLNBIVT were introduced into S. lydicus SLM7H13 by intergener conjugation from E. coli ET12567 (pUB307) and the transconjugants were selected for their resistance to apramycin, obtaining strains SLM7H13 / pFL844T, SLM7H13 / SLM7H13TH / SLM7H13 / PL7B13 / SLM7H13 / PM7T13 / SLM7H13 / PMN03 / SLM7H13 .

The analysis of the products accumulated by the strain SLM7H13 / pFL844T showed the presence of the peaks (II) 2 and 3 (III) mentioned above and corresponding to non-glycosylated derivatives of streptolidigin, and a new peak with retention of 6.48 min in UPLC and 26.98 min in HPLC / MS (Fig. 9A and Fig. 9B). The MS analysis of peak (IV) shows two ions in positive mode with masses of 487 m / z [M + H] +, corresponding to aglycone and 601 m / z [M + H] +
corresponding to the compound without fragmentation (Fig. 9C). This compound was characterized by NMR and its structure corresponds to a streptolidigine, of the formula C 32 H 44 N 2 O 9, containing L-amicetosa instead of L-rhodinose. This compound was called streptolidigin LA (Fig. 9D and Table 5).

TABLE 5 NMR spectra data of streptolidigin LA (IV) in DMSO- d 6 to 300 K (1 H at 600 MHz, 13 C at 150 MHz)

12

       \ vskip1.000000 \ baselineskip
    

13

14

The analysis of the products accumulated by the strain SLM7H13 / pFL845T showed the presence of peaks (II) and (III) previously mentioned and corresponding to derivatives not glycosylates of streptolidigin, and two new peaks with retentions of 5.73 and 6.48 min in UPLC and 24.50 and 26.98 min in HPLC / MS (Fig. 10A and Fig. 10B). The MS analysis of the peak (V) shows two ions in positive mode with masses of 487 m / z [M + H] +, corresponding to aglycone and 601 m / z [M + H] + corresponding to the compound without fragmentation (Fig. 10C). This compound is presumed to correspond to a streptolidigine, of formula C 32 H 44 N 2 O 9, containing D-amicetosa instead of L-rhodine, since plasmid pFL845T directs the Biosynthesis of this deoxia sugar. This compound was called streptolidigin DA (Fig. 10E). The MS analysis of peak 6 (VI) shows two ions in positive mode with masses of 487 m / z [M + H] +, corresponding to aglycone and 617 m / z [M + H] + corresponding to the compound without fragmentation (Fig. 10D). This compound is presumed to correspond to a streptolidigine, of formula C 32 H 44 N 2 O 10, containing D-olive tree instead of L-rhodine, since plasmid pFL845T that directs the biosynthesis of 2,3,6-trideoxy sugar generates 2,6-dideoxy sugar as intermediary D-olive tree that can be used by the SlgG glycosyltransferase for introduction into the aglycone of Streptolidigine This compound was called streptolidigin. DO (Fig. 10F).

The analysis of the products accumulated by the strain SLM7H13 / pLNBIVT showed the presence of peaks (II) and (III) previously mentioned both in the analyzes by UPLC and by HPLCIMS (Fig. 11A and Fig. 11B). Notwithstanding the MS analysis of peak (II) revealed the presence of an additional compound, (VII), which it has the same retention time as peak (II) and that it presents two ions in positive mode with masses of 487 m / z [M + H] +, corresponding to aglycone and 617 m / z [M + H] + corresponding to the compound without fragmentation (Fig. 11C). The ion of 473 m / z [M + H] + corresponds to the compound of the peak (II) (Fig. 11C). Compound 7 (VII) is presumed corresponds to a streptolidigine, of formula and C_ {32} H_ {44} N_ {O} {2}, containing L-digitoxose instead of L-rodinous, since plasmid pLNBIVT directs the biosynthesis of 2,6-dideoxy sugar L-digitoxose. TO This compound was called streptolidigin LD (Fig. 11D).

       \ vskip1.000000 \ baselineskip
    

Example 7 Antibiotic activity of the new compounds generated

After the structural characterization of streptolidiginone (compound (III)) and streptolidigin LA (compound (IV)) its antibiotic activity was analyzed using streptolidigin (I) as the reference compound that was used as a positive control. This analysis was performed by the diffusion method on paper discs. For this, a Petri dish containing TSA medium (Tryptone Soy Agar) was inoculated with a spore suspension of S. albus . 5 mm diameter paper discs were placed on this plate. A solution containing 2 µg of each compound dissolved in 15 µl of methanol was added to each disk. As a negative control, a disk containing 15 µl of methanol without antibiotic was used. The plate was held for 2 hours at 4 ° C to allow diffusion of antibiotics and then incubated for 24 h at 30 ° C.

As can be seen in Fig. 12, streptolidiginone (compound (III)) showed an activity moderate antibiotic observing an inhibition halo of 14 mm of diameter. On the contrary the antibiotic activity of Streptolidigin LA (compound (IV)) showed a halo of inhibition 30 mm in diameter, similar to that generated by streptolidigin (I) 32 mm Therefore it can be stated that streptolidigine and  Streptolidigin LA have antibiotic activities equivalent to despite presenting in its structures two different sugars (L-rhodine and L-amycetosus, respectively) in which the hydroxyl group present in the C4 position of sugar shows divergent orientations (Fig. 1 and Fig. 9D). Clearly, the absence of sugar in the structure of Streptolidiginone (Fig. 8) has a negative effect on the Antibiotic activity of this compound.

       \ vskip1.000000 \ baselineskip
    

Free text from the sequence list Alphabetical translation

?

Artificial Sequence: Sequence artificial

?

DNA: DNA

?

Synthetic oligonucleotide: Synthetic oligonucleotide

       \ global \ parskip0.000000 \ baselineskip
    

<110> University of Oviedo

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<120> Procedure to isolate genes involved in the biosynthesis of streptolidigin, DNA molecules, genetic manipulation of the route and its uses

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<130> PII-2009-0007

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<160> 45

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 1

         \ vskip0.400000 \ baselineskip
      

<211> 80894

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Streptomyces lydicus

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 1

         \ vskip1.000000 \ baselineskip
      

fifteen

16

17

18

19

twenty

twenty-one

22

2. 3

24

25

26

27

28

29

30

31

32

33

3. 4

35

36

37

38

39

40

41

42

43

44

Four. Five

46

47

48

49

fifty

51

52

53

54

55

56

57

58

59

60

61

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 2

         \ vskip0.400000 \ baselineskip
      

<211> 145

         \ vskip0.400000 \ baselineskip
      

<212> PRT

         \ vskip0.400000 \ baselineskip
      

<213> Streptomyces lydicus

         \ newpage
      

         \ vskip0.400000 \ baselineskip
      

<400> 2

         \ vskip1.000000 \ baselineskip
      

62

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 3

         \ vskip0.400000 \ baselineskip
      

<211> 128

         \ vskip0.400000 \ baselineskip
      

<212> PRT

         \ vskip0.400000 \ baselineskip
      

<213> Streptomyces lydicus

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 3

         \ vskip1.000000 \ baselineskip
      

63

64

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 4

         \ vskip0.400000 \ baselineskip
      

<211> 943

         \ vskip0.400000 \ baselineskip
      

<212> PRT

         \ vskip0.400000 \ baselineskip
      

<213> Streptomyces lydicus

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 4

         \ vskip1.000000 \ baselineskip
      

65

66

67

68

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 5

         \ vskip0.400000 \ baselineskip
      

<211> 707

         \ vskip0.400000 \ baselineskip
      

<212> PRT

         \ vskip0.400000 \ baselineskip
      

<213> Streptomyces lydicus

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 5

         \ vskip1.000000 \ baselineskip
      

69

70

71

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 6

         \ vskip0.400000 \ baselineskip
      

<211> 280

         \ vskip0.400000 \ baselineskip
      

<212> PRT

         \ vskip0.400000 \ baselineskip
      

<213> Streptomyces lydicus

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 6

         \ vskip1.000000 \ baselineskip
      

72

73

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 7

         \ vskip0.400000 \ baselineskip
      

<211> 426

         \ vskip0.400000 \ baselineskip
      

<212> PRT

         \ vskip0.400000 \ baselineskip
      

<213> Streptomyces lydicus

         \ newpage
      

         \ vskip0.400000 \ baselineskip
      

<400> 7

         \ vskip1.000000 \ baselineskip
      

74

75

         \ vskip0.400000 \ baselineskip
      

<210> 8

         \ vskip0.400000 \ baselineskip
      

<211> 218

         \ vskip0.400000 \ baselineskip
      

<212> PRT

         \ vskip0.400000 \ baselineskip
      

<213> Streptomyces lydicus

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 8

         \ vskip1.000000 \ baselineskip
      

76

77

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 9

         \ vskip0.400000 \ baselineskip
      

<211> 434

         \ vskip0.400000 \ baselineskip
      

<212> PRT

         \ vskip0.400000 \ baselineskip
      

<213> Streptomyces lydicus

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 9

         \ vskip1.000000 \ baselineskip
      

78

79

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 10

         \ vskip0.400000 \ baselineskip
      

<211> 340

         \ vskip0.400000 \ baselineskip
      

<212> PRT

         \ vskip0.400000 \ baselineskip
      

<213> Streptomyces lydicus

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 10

80

81

82

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 11

         \ vskip0.400000 \ baselineskip
      

<211> 338

         \ vskip0.400000 \ baselineskip
      

<212> PRT

         \ vskip0.400000 \ baselineskip
      

<213> Streptomyces lydicus

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 11

         \ vskip1.000000 \ baselineskip
      

83

84

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 12

         \ vskip0.400000 \ baselineskip
      

<211> 450

         \ vskip0.400000 \ baselineskip
      

<212> PRT

         \ vskip0.400000 \ baselineskip
      

<213> Streptomyces lydicus

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 12

         \ vskip1.000000 \ baselineskip
      

85

86

         \ newpage
      

         \ vskip0.400000 \ baselineskip
      

<210> 13

         \ vskip0.400000 \ baselineskip
      

<211> 413

         \ vskip0.400000 \ baselineskip
      

<212> PRT

         \ vskip0.400000 \ baselineskip
      

<213> Streptomyces lydicus

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 13

         \ vskip1.000000 \ baselineskip
      

87

88

         \ vskip0.400000 \ baselineskip
      

<210> 14

         \ vskip0.400000 \ baselineskip
      

<211> 284

         \ vskip0.400000 \ baselineskip
      

<212> PRT

         \ vskip0.400000 \ baselineskip
      

<213> Streptomyces lydicus

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 14

89

90

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 15

         \ vskip0.400000 \ baselineskip
      

<211> 391

         \ vskip0.400000 \ baselineskip
      

<212> PRT

         \ vskip0.400000 \ baselineskip
      

<213> Streptomyces lydicus

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 15

         \ vskip1.000000 \ baselineskip
      

91

92

         \ vskip0.400000 \ baselineskip
      

<210> 16

         \ vskip0.400000 \ baselineskip
      

<211> 326

         \ vskip0.400000 \ baselineskip
      

<212> PRT

         \ vskip0.400000 \ baselineskip
      

<213> Streptomyces lydicus

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 16

         \ vskip1.000000 \ baselineskip
      

93

94

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 17

         \ vskip0.400000 \ baselineskip
      

<211> 440

         \ vskip0.400000 \ baselineskip
      

<212> PRT

         \ vskip0.400000 \ baselineskip
      

<213> Streptomyces lydicus

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 17

         \ vskip1.000000 \ baselineskip
      

95

96

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 18

         \ vskip0.400000 \ baselineskip
      

<211> 567

         \ vskip0.400000 \ baselineskip
      

<212> PRT

         \ vskip0.400000 \ baselineskip
      

<213> Streptomyces lydicus

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 18

         \ vskip1.000000 \ baselineskip
      

97

98

99

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 19

         \ vskip0.400000 \ baselineskip
      

<211> 328

         \ vskip0.400000 \ baselineskip
      

<212> PRT

         \ vskip0.400000 \ baselineskip
      

<213> Streptomyces lydicus

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 19

         \ vskip1.000000 \ baselineskip
      

100

101

         \ hskip1.5cm
      

102

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 20

         \ vskip0.400000 \ baselineskip
      

<211> 355

         \ vskip0.400000 \ baselineskip
      

<212> PRT

         \ vskip0.400000 \ baselineskip
      

<213> Streptomyces lydicus

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 20

         \ vskip1.000000 \ baselineskip
      

103

104

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 21

         \ vskip0.400000 \ baselineskip
      

<211> 449

         \ vskip0.400000 \ baselineskip
      

<212> PRT

         \ vskip0.400000 \ baselineskip
      

<213> Streptomyces lydicus

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 21

         \ vskip1.000000 \ baselineskip
      

105

106

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 22

         \ vskip0.400000 \ baselineskip
      

<211> 153

         \ vskip0.400000 \ baselineskip
      

<212> PRT

         \ vskip0.400000 \ baselineskip
      

<213> Streptomyces lydicus

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 22

         \ vskip1.000000 \ baselineskip
      

108

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 23

         \ vskip0.400000 \ baselineskip
      

<211> 699

         \ vskip0.400000 \ baselineskip
      

<212> PRT

         \ vskip0.400000 \ baselineskip
      

<213> Streptomyces lydicus

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 23

         \ vskip1.000000 \ baselineskip
      

109

110

111

112

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 24

         \ vskip0.400000 \ baselineskip
      

<211> 220

         \ vskip0.400000 \ baselineskip
      

<212> PRT

         \ vskip0.400000 \ baselineskip
      

<213> Streptomyces lydicus

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 24

         \ vskip1.000000 \ baselineskip
      

113

         \ newpage
      

         \ vskip0.400000 \ baselineskip
      

<210> 25

         \ vskip0.400000 \ baselineskip
      

<211> 515

         \ vskip0.400000 \ baselineskip
      

<212> PRT

         \ vskip0.400000 \ baselineskip
      

<213> Streptomyces lydicus

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 25

         \ vskip1.000000 \ baselineskip
      

115

116

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 26

         \ vskip0.400000 \ baselineskip
      

<211> 414

         \ vskip0.400000 \ baselineskip
      

<212> PRT

         \ vskip0.400000 \ baselineskip
      

<213> Streptomyces lydicus

         \ newpage
      

         \ vskip0.400000 \ baselineskip
      

<400> 26

117

118

         \ vskip0.400000 \ baselineskip
      

<210> 27

         \ vskip0.400000 \ baselineskip
      

<211> 515

         \ vskip0.400000 \ baselineskip
      

<212> PRT

         \ vskip0.400000 \ baselineskip
      

<213> Streptomyces lydicus

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 27

         \ vskip1.000000 \ baselineskip
      

119

120

121

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 28

         \ vskip0.400000 \ baselineskip
      

<211> 300

         \ vskip0.400000 \ baselineskip
      

<212> PRT

         \ vskip0.400000 \ baselineskip
      

<213> Streptomyces lydicus

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 28

         \ vskip1.000000 \ baselineskip
      

122

123

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 29

         \ vskip0.400000 \ baselineskip
      

<211> 260

         \ vskip0.400000 \ baselineskip
      

<212> PRT

         \ vskip0.400000 \ baselineskip
      

<213> Streptomyces lydicus

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 29

         \ vskip1.000000 \ baselineskip
      

124

125

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 30

         \ vskip0.400000 \ baselineskip
      

<211> 3477

         \ vskip0.400000 \ baselineskip
      

<212> PRT

         \ vskip0.400000 \ baselineskip
      

<213> Streptomyces lydicus

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 30

         \ vskip1.000000 \ baselineskip
      

126

127

128

129

130

131

132

133

134

135

136

137

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 31

         \ vskip0.400000 \ baselineskip
      

<211> 3509

         \ vskip0.400000 \ baselineskip
      

<212> PRT

         \ vskip0.400000 \ baselineskip
      

<213> Streptomyces lydicus

         \ newpage
      

         \ vskip0.400000 \ baselineskip
      

<400> 31

         \ vskip1.000000 \ baselineskip
      

138

139

140

141

142

143

144

145

146

147

148

149

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 32

         \ vskip0.400000 \ baselineskip
      

<211> 6171

         \ vskip0.400000 \ baselineskip
      

<212> PRT

         \ vskip0.400000 \ baselineskip
      

<213> Streptomyces lydicus

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 32

         \ vskip1.000000 \ baselineskip
      

150

151

152

153

154

155

156

157

158

159

160

161

162

163

164

165

166

167

168

169

170

         \ vskip0.400000 \ baselineskip
      

<210> 33

         \ vskip0.400000 \ baselineskip
      

<211> 246

         \ vskip0.400000 \ baselineskip
      

<212> PRT

         \ vskip0.400000 \ baselineskip
      

<213> Streptomyces lydicus

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 33

         \ vskip1.000000 \ baselineskip
      

171

172

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 34

         \ vskip0.400000 \ baselineskip
      

<211> 311

         \ vskip0.400000 \ baselineskip
      

<212> PRT

         \ vskip0.400000 \ baselineskip
      

<213> Streptomyces lydicus

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 34

         \ vskip1.000000 \ baselineskip
      

173

174

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 35

         \ vskip0.400000 \ baselineskip
      

<211> 220

         \ vskip0.400000 \ baselineskip
      

<212> PRT

         \ vskip0.400000 \ baselineskip
      

<213> Streptomyces lydicus

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 35

         \ vskip1.000000 \ baselineskip
      

175

176

         \ vskip0.400000 \ baselineskip
      

<210> 36

         \ vskip0.400000 \ baselineskip
      

<211> 242

         \ vskip0.400000 \ baselineskip
      

<212> PRT

         \ vskip0.400000 \ baselineskip
      

<213> Streptomyces lydicus

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 36

         \ vskip1.000000 \ baselineskip
      

177

178

         \ vskip0.400000 \ baselineskip
      

<210> 37

         \ vskip0.400000 \ baselineskip
      

<211> 132

         \ vskip0.400000 \ baselineskip
      

<212> PRT

         \ vskip0.400000 \ baselineskip
      

<213> Streptomyces lydicus

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 37

         \ vskip1.000000 \ baselineskip
      

179

         \ vskip0.400000 \ baselineskip
      

<210> 38

         \ vskip0.400000 \ baselineskip
      

<211> 205

         \ vskip0.400000 \ baselineskip
      

<212> PRT

         \ vskip0.400000 \ baselineskip
      

<213> Streptomyces lydicus

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 38

         \ vskip1.000000 \ baselineskip
      

181

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 39

         \ vskip0.400000 \ baselineskip
      

<211> 142

         \ vskip0.400000 \ baselineskip
      

<212> PRT

         \ vskip0.400000 \ baselineskip
      

<213> Streptomyces lydicus

         \ newpage
      

         \ vskip0.400000 \ baselineskip
      

<400> 39

         \ vskip1.000000 \ baselineskip
      

182

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 40

         \ vskip0.400000 \ baselineskip
      

<211> 26

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial Sequence

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<220>

         \ vskip0.400000 \ baselineskip
      

<223> synthetic oligonucleotide SLTEII1

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 40

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

\hskip-.1em\dddseqskip

AGAATTCGGACGTCAGGAGCGGTACG

\hfill

 \ hskip-.1em \ dddseqskip 

AGAATTCGGACGTCAGGAGCGGTACG

 \ hfill 

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 41

         \ vskip0.400000 \ baselineskip
      

<211> 27

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial Sequence

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<220>

         \ vskip0.400000 \ baselineskip
      

<223> synthetic oligonucleotide SLTEII2

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 41

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

\hskip-.1em\dddseqskip

AAAAAGCTTGTGTGGTCGGACCAGGCC

\hfill

 \ hskip-.1em \ dddseqskip 

AAAAAGCTTGTGTGGTCGGACCAGGCC

 \ hfill 

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 42

         \ vskip0.400000 \ baselineskip
      

<211> 26

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial Sequence

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<220>

         \ vskip0.400000 \ baselineskip
      

<223> synthetic oligonucleotide CRIS13

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 42

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

\hskip-.1em\dddseqskip

AAGGATCCGGCTCCGCGATGAGCGAG

\hfill

 \ hskip-.1em \ dddseqskip 

AAGGATCCGGCTCCGCGATGAGCGAG

 \ hfill 

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 43

         \ vskip0.400000 \ baselineskip
      

<211> 27

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial Sequence

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<220>

         \ vskip0.400000 \ baselineskip
      

<223> synthetic oligonucleotide CRIS14

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 43

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

\hskip-.1em\dddseqskip

AGAATTCATGCATGGTGGTCATCCGCCGCC

\hfill

 \ hskip-.1em \ dddseqskip 

AGAATTCATGCATGGTGGTCATCCGCCGCC

 \ hfill 

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 44

         \ vskip0.400000 \ baselineskip
      

<211> 26

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial Sequence

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<220>

         \ vskip0.400000 \ baselineskip
      

<223> synthetic oligonucleotide CRIS17

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 44

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

\hskip-.1em\dddseqskip

AAGGATCCACCGAACCCGGAGGGTCG

\hfill

 \ hskip-.1em \ dddseqskip 

AAGGATCCACCGAACCCGGAGGGTCG

 \ hfill 

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<210> 45

         \ vskip0.400000 \ baselineskip
      

<211> 30

         \ vskip0.400000 \ baselineskip
      

<212> DNA

         \ vskip0.400000 \ baselineskip
      

<213> Artificial Sequence

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<220>

         \ vskip0.400000 \ baselineskip
      

<223> synthetic oligonucleotide CRIS18

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

<400> 45

         \ vskip1.000000 \ baselineskip
      

         \ vskip0.400000 \ baselineskip
      

\hskip-.1em\dddseqskip

AGAATTCACTAGTTCCTCGCCGGGCGTCAC

\hfill

 \ hskip-.1em \ dddseqskip 

AGAATTCACTAGTTCCTCGCCGGGCGTCAC

 \ hfill 

Claims (36)

1. Isolation and purification procedure of a nucleic acid fragment containing the grouping of genes of the streptolidigin biosynthesis pathway comprising the following stages:

to.

obtaining a genomic nucleic acid library from the Streptomyces lydicus streptolidigin-producing microorganism;

b.

transfection of clones of said library in host cells;

C.

oligonucleotide design for the isolation of the biosynthesis gene cluster of streptolidigine;

d.

construction of a probe comprising a nucleotide sequence of a gene cluster of Streptolidigine biosynthesis;

and.

use of heterologous probes for the isolation of the biosynthesis gene cluster of streptolidigine;

F.

hybridization of said probes against the genomic nucleic acid library obtained from said microorganism;

g.

isolation of said gene pool from clones with positive hybridization.

         \ vskip1.000000 \ baselineskip
      

2. A nucleic acid molecule that understands:

a sequence of nucleotides described as SEQ ID NO: 1;

or a sequence of nucleotides complementary to SEQ ID NO: 1;

or a sequence of degenerated nucleotides with respect to SEQ ID NO: 1;

or a sequence of nucleotides capable of hybridizing under restrictive conditions with SEQ ID No. 1, or with the complementary strand of SEQ ID NO: 1, or with a hybridization probe derived from SEQ ID NO: 1 or its strand complementary;

or a sequence of nucleotides that have at least 65% sequence identity with SED ID NO: 1 and that encodes or is complementary to a sequence which encodes at least one biosynthetic enzyme of streptolidigine;

or a part of he.

         \ vskip1.000000 \ baselineskip
      

3. A nucleic acid molecule according to claim 2, characterized in that it contains a part of the nucleotide sequence at least 15 nucleotides in length. 4. A nucleic acid molecule according to the claim 2 encoding one or more polypeptides, or including one or more genetic elements, which have a functional activity in the synthesis of a dienoyl-tetramic antibiotic or a precursor of an antibiotic dienoyl-tetram. 5. A nucleic acid molecule according to the claim 2 encoding one or more polypeptides, or includes one or more genes and / or one or more regulatory sequences and / or one or more genetic elements encoders or noncoders, which have functional activity in the synthesis of an antibiotic dienoyl-tetrameric or a precursor of an antibiotic dienoyl-tetram. 6. A nucleic acid molecule according to claim 4 or 5, wherein said dienoyl-tetramic antibiotic or a precursor dienoyl-tetramic streptolydigin antibiotic or a precursor streptolydigin. 7. A nucleic acid molecule according to claim 2 characterized by comprising a nucleotide sequence encoding one or more amino acid sequences described in SEQ ID NOs: 2-39, or a nucleotide sequence that is complementary or degenerate with respect to a nucleotide sequence encoding one or more amino acid sequences that have at least 60% sequence identity with any of SEQ ID NOs: 2 to 39. 8. A nucleic acid molecule obtained according to the method of claim 1 comprising:

a sequence of nucleotides described as SEQ ID NO: 1;

or a sequence of nucleotides complementary to SEQ ID NO: 1;

or a sequence of degenerated nucleotides with respect to SEQ ID NO: 1;

or a sequence of nucleotides capable of hybridizing under restrictive conditions with SEQ ID No. 1, or with the complementary strand of SEQ ID NO: 1, or with a hybridization probe derived from SEQ ID NO: 1 6 of its strand complementary;

or a sequence of nucleotides that have at least 65% sequence identity with SED ID NO: 1 and that encodes or is complementary to a sequence which encodes at least one biosynthetic enzyme of streptolidigine;

or a part of he.

         \ vskip1.000000 \ baselineskip
      

9. A polypeptide encoded by a molecule of nucleic acid according to claim 7 comprising:

one or more complete amino acid sequences, or parts thereof, described in SEQ ID NOs: 2 to 39;

or one or more complete amino acid sequences, or parts thereof, that they have at least 60% sequence identity with any of SEQ ID NOs: 2 to 39.

         \ vskip1.000000 \ baselineskip
      

10. A polypeptide according to claim 9 characterized in that it possesses a functional activity in the synthesis of a dienoyl-tetram antibiotic or a tetram antibiotic. 11. A recombinant nucleic acid molecule characterized in that it includes the nucleic acid fragment of claim 7, or a portion with similar characteristics, cloned into a vector that replicates in Streptomyces or E. coli . 12. Recombinant nucleic acid molecule according to claim 11 characterized in that it is the cosmid Slg6E5. 13. Recombinant nucleic acid molecule according to claim 11 characterized in that it is the cosmid Slg4A8. 14. Recombinant nucleic acid molecule according to claim 11 characterized in that it is the cosmid Slg9C7. 15. Recombinant nucleic acid molecule according to claim 11 characterized in that it is the cosmid Slg6G6. 16. Host cell or transgenic organism characterized in that it contains a recombinant nucleic acid molecule of claims 11, 12, 13, 14 or 15. 17. Use of genes encoded by the nucleic acid fragment of claims 7 or 11 in the production of tetramic metabolites. 18. Use of genes encoded by the nucleic acid fragment of claims 7 or 11 in the Streptolidigine production, streptolidigine derivatives or streptolidigin precursors. 19. Use of genes encoded by the nucleic acid fragment of claims 7 or 11 for increase the production of tetrameric metabolites or precursors of tetramic metabolites. 20. Use of genes encoded by the nucleic acid fragment of claims 7 or 11 for increase the production of streptolidigin, derived from streptolidigine or streptolidigine precursors. 21. Use of an acid molecule nucleic according to any of claims 7 or 11, in the inactivation of genes involved in the biosynthesis of Streptolidigine 22. Use of an acid molecule nucleic according to any of claims 7 or 11, in PCR amplification techniques aimed at isolation and / or use of genes involved in the biosynthesis of Streptolidigine 23. Use of host cells or transgenic organisms of claim 16, in the production of tetramic metabolites.

         \ newpage
      

24. Use of host cells or transgenic organisms, of claim 16, in the production of streptolidigine, streptolidigine derivatives or precursors of Streptolidigine 25. Use of intermediaries of streptolidigine or streptolidigine derivatives of claims 17, 18, 19, 20, 21, 22, 23 or 24 as compounds of heading in the chemical synthesis of tetramic metabolites. 26. Process to increase the production of tetramic metabolites in a bacterial host, which comprises the following stages:

to.

transfer of the nucleic acid fragment of claims 7 or 11 to a host of the genus Streptomyces ;

b.

recombinant strain culture obtained;

C.

tetramic metabolite isolation produced.

         \ vskip1.000000 \ baselineskip
      

27. Process according to claim 26 characterized in that the host of the genus Streptomyces is
Streptomyces lydicus . 28. Process according to claim 27 characterized in that the host Streptomyces lydicus is a mutant derived from S. lydicus NRRL 2433. 29. Process according to claims 28, characterized in that the tetramic metabolite is streptolidigin, a streptolidigin derivative or a precursor of streptolidigin. 30. Process for generating streptolidigin derivatives or streptolidigin precursors characterized by the inactivation of genes encoded by the nucleic acid fragment of claims 7 or 11. 31. Use of intermediaries of streptolidigine or streptolidigine derivatives obtained from claims 26, 27, 28 29 6 30 as starting compounds in The chemical synthesis of tetramic products. 32. Recombinant strain of Streptomyces lydicus characterized in that it lacks the genes that code for the proteins described as SEQ ID NO: 8, 9, 10, 11 and 12. 33. Recombinant Streptomyces lydicus strain of claim 32 characterized in that it contains plasmid pFL844T. 34. Streptomyces lydicus recombinant strain of claim 32 characterized in that it contains plasmid pFL845T. 35. Streptomyces lydicus recombinant strain of claim 32 characterized in that it contains plasmid pLNBIVT. 36. Streptolidigine derivatives characterized in that they are produced by the strain of claim 32, 33, 34 or 35.