ES2257895B1 - OPTIMIZATION PROCEDURE FOR OLIGONUCLEOTIDES AND AMPLIFICATION CONDITIONS BY PCR FOR RACE (5 'AND 3'-RAPID AMPLIFICATION OF CDNA ENDS). - Google Patents

OPTIMIZATION PROCEDURE FOR OLIGONUCLEOTIDES AND AMPLIFICATION CONDITIONS BY PCR FOR RACE (5 'AND 3'-RAPID AMPLIFICATION OF CDNA ENDS). Download PDF

Info

Publication number
ES2257895B1
ES2257895B1 ES200301290A ES200301290A ES2257895B1 ES 2257895 B1 ES2257895 B1 ES 2257895B1 ES 200301290 A ES200301290 A ES 200301290A ES 200301290 A ES200301290 A ES 200301290A ES 2257895 B1 ES2257895 B1 ES 2257895B1
Authority
ES
Spain
Prior art keywords
race
oligonucleotides
interest
gene
cloning
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
ES200301290A
Other languages
Spanish (es)
Other versions
ES2257895A1 (en
Inventor
Jose Maria Frade Lopez
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Consejo Superior de Investigaciones Cientificas CSIC
Original Assignee
Consejo Superior de Investigaciones Cientificas CSIC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Consejo Superior de Investigaciones Cientificas CSIC filed Critical Consejo Superior de Investigaciones Cientificas CSIC
Priority to ES200301290A priority Critical patent/ES2257895B1/en
Publication of ES2257895A1 publication Critical patent/ES2257895A1/en
Application granted granted Critical
Publication of ES2257895B1 publication Critical patent/ES2257895B1/en
Anticipated expiration legal-status Critical
Expired - Fee Related legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Procedimiento de optimización de los oligonucleótidos y de las condiciones de amplificación mediante PCR para RACE (5'' and 3''-rapid amplification of cDNA ends). La presente invención describe un procedimiento para optimizar los oligonucleótidos y las condiciones de amplificación mediante PCR usadas para RACE, al clonar un gen de interés/fragmento de cDNA problema en una construcción genética que incluye las secuencias correspondientes a los oligonucleótidos 5''-RACE y 3''-RACE flanqueando el sitio de clonación del gen de interés/fragmento de cDNA problema. Este procedimiento permite comprobar así la compatibilidad de los oligonucleótidos necesarios para la amplificación del gen de interés/fragmento de cDNA problema con los oligonucleótidos 5''-RACE and 3''-RACE y las condiciones óptimas de la reacción de PCR; actuando de esta forma como un proceso de control previo al experimento RACE propiamente dicho.Optimization procedure for oligonucleotides and amplification conditions by PCR for RACE (5 '' and 3 '' - rapid amplification of cDNA ends). The present invention describes a method for optimizing oligonucleotides and PCR amplification conditions used for RACE, by cloning a gene of interest / problem cDNA fragment into a genetic construct that includes the sequences corresponding to the 5''-RACE oligonucleotides and 3 '' - RACE flanking the cloning site of the gene of interest / problem cDNA fragment. This procedure makes it possible to check the compatibility of the oligonucleotides necessary for the amplification of the gene of interest / fragment of the problem cDNA with the oligonucleotides 5 '' - RACE and 3 '' - RACE and the optimal conditions of the PCR reaction; acting in this way as a control process prior to the RACE experiment itself.

Description

Procedimiento de optimización de los oligonucleótidos y de las condiciones de amplificación mediante PCR para RACE (5' and 3'-rapid amplification of cDNA ends).Procedure for optimization of oligonucleotides and amplification conditions by PCR for RACE (5 'and 3'-rapid amplification of cDNA ends).

Sector de la técnicaTechnical sector

La presente invención, que describe un procedimiento de optimización de oligonucleótidos y de las condiciones de amplificación mediante PCR para RACE, se encuadra en el sector Biotecnológico, con aplicación a la investigación básica y aplicada en biología molecular y biotecnología en general.The present invention, which describes a oligonucleotide optimization procedure and the PCR amplification conditions for RACE, is framed in the Biotechnology sector, with application to basic research and applied in molecular biology and biotechnology in general.

Estado de la técnicaState of the art

La obtención de la secuencia completa de un ácido desoxirribonucleico complementario (cDNA) correspondiente a un determinado ácido ribonucleico mensajero (mRNA) es muchas veces difícil utilizando el método tradicional basado en protocolos de hibridación con sondas específicas en librerías de expresión. Sin embargo, la técnica del RACE (del inglés "Rapid Amplification of cDNA Ends"), es un método efectivo para obviar esta dificultad.Obtaining the complete sequence of a complementary deoxyribonucleic acid (cDNA) corresponding to a certain messenger ribonucleic acid (mRNA) is many times difficult using the traditional protocol-based method of hybridization with specific probes in expression libraries. Without However, the technique of the RACE (of the English "Rapid Amplification of cDNA Ends "), is an effective method to avoid this difficulty.

La técnica del RACE es un procedimiento usual para la clonación de la secuencia completa de un cDNA a partir de una secuencia parcial conocida previamente (secuencia problema), utilizando tecnología basada en la reacción en cadena de la polimerasa (PCR). El RACE puede emplearse para la clonación de la región 5' ó 3' del cDNA completo. Ambos procedimientos son muy similares conceptualmente. El 5'- RACE se inicia a partir del mRNA que sirve de molde para la síntesis de una hebra de cDNA, en cuyo extremo 3' (equivalente al extremo 5' del RNA original) se inserta una secuencia de DNA específica. La región 5' de interés es entonces amplificada usando una pareja de oligonucleótidos que hibriden con esta secuencia específica y otra contenida en el fragmento del cDNA problema. El 3'-RACE se basa en un procedimiento similar al descrito anteriormente, pero la incorporación de la secuencia de DNA extra se realiza en este caso en el extremo del cDNA correspondiente al 3' del mRNA de partida. La amplificación de la región 3' se realiza usando una pareja de oligonucleótidos que hibriden con la secuencia de DNA extra y otra contenida en el fragmento del cDNA problema. Existen protocolos concretos que usan varias secuencias contenidas en el cDNA para realizar amplificaciones sucesivas con oligonucleótidos internos (o "nested oligonucleotides") y aumentar así la especificidad. El RACE fue descrito inicialmente por el grupo de Martín (Frohman MA, Dush MK y Martín GR. 1988. Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide oligonucleótido. Proc Natl Acad Sci U S A 85: 8998-9002), y en la actualidad se cuentan por miles los artículos publicados que emplean dicha técnica. Asimismo, existen múltiples protocolos en manuales de consulta de biología molecular tales como Molecular Cloning, a Laboratory Manual (Sambrook J y Russell DW (2001) Molecular cloning, a laboratory manual. CSHL Press, New York. Volumen 2, Páginas 8.54-8.65) y Current Protocols in Molecular Biology (Current Protocols
in Molecular Biology (1998). John Wiley & Sons. Páginas 15.6.1-15.6.10).The RACE technique is a usual procedure for cloning the complete sequence of a cDNA from a previously known partial sequence (problem sequence), using technology based on polymerase chain reaction (PCR). The RACE can be used for cloning the 5 'or 3' region of the complete cDNA. Both procedures are very similar conceptually. 5'-RACE is initiated from the mRNA that serves as a template for the synthesis of a cDNA strand, at whose 3 'end (equivalent to the 5' end of the original RNA) a specific DNA sequence is inserted. The 5 'region of interest is then amplified using a pair of oligonucleotides that hybridize with this specific sequence and another contained in the fragment of the problem cDNA. 3'-RACE is based on a procedure similar to that described above, but the incorporation of the extra DNA sequence is carried out in this case at the end of the cDNA corresponding to the 3 'of the starting mRNA. The amplification of the 3 'region is performed using a pair of oligonucleotides that hybridize with the extra DNA sequence and another contained in the fragment of the problem cDNA. There are specific protocols that use several sequences contained in the cDNA to perform successive amplifications with internal oligonucleotides (or "nested oligonucleotides") and thus increase specificity. The RACE was initially described by Martín's group (Frohman MA, Dush MK and Martín GR. 1988. Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide oligonucleotide. Proc Natl Acad Sci USA 85 : 8998-9002), and currently there are thousands of published articles that use this technique. There are also multiple protocols in molecular biology consultation manuals such as Molecular Cloning, a Laboratory Manual (Sambrook J and Russell DW (2001) Molecular cloning, a laboratory manual. CSHL Press, New York. Volume 2, Pages 8.54-8.65) and Current Protocols in Molecular Biology (Current Protocols
in Molecular Biology (1998). John Wiley & Sons. Pages 15.6.1-15.6.10).

En Internet, existen más de 4000 páginas que se refieren a esta técnica. También existen diversos sistemas comerciales de RACE. Por ejemplo, GibcoBRL dispone de un sistema 3'-RACE (3'RACE system for rapid amplification of cDNA ends; Cat. No. 18373-019), y un sistema 5'-RACE (5'RACE system for rapid amplification of cDNA ends, versión 2.0; Cat. No. 18374-058). Estos sistemas de GibcoBRL se basan en la extensión de una cola poli-C en el extremo 3' de la primera hebra de cDNA. Esta cola poli-C sirve entonces de molde para la unión de un oligonucleótido con una secuencia de DNA específica "upstream" a una región poli-G. El sistema de 3'-RACE de GibcoBRL usa como cebador para la síntesis de la primera hebra de cDNA un oligonucleótido oligodT que contiene una secuencia específica de DNA.On the Internet, there are more than 4000 pages that Refer to this technique. There are also various systems RACE commercials. For example, GibcoBRL has a system 3'-RACE (3'RACE system for rapid amplification of cDNA ends; Cat. No. 18373-019), and a system 5'-RACE (5'RACE system for rapid amplification of cDNA ends, version 2.0; Cat. No. 18374-058). These GibcoBRL systems are based on the extension of a queue poly-C at the 3 'end of the first strand of cDNA. This poly-C tail then serves as a mold for the binding of an oligonucleotide with a specific DNA sequence "upstream" to a poly-G region. System 3'-RACE by GibcoBRL used as a primer for synthesis of the first strand of cDNA an oligodot oligonucleotide that It contains a specific DNA sequence.

Invitrogen dispone de sistemas 3'-RACE y 5'-RACE englobados en su GeneRacer Kit (Cat No. L1502-01). Su tecnología se basa en el tratamiento del mRNA de partida con una fosfatasa que elimina los grupos fosfato presentes en el extremo 5' de los mensajeros parcialmente degradados, de modo que sólo aquellos con secuencia completa son susceptibles de mantener su extremo 5' modificado covalentemente ("cap"). Después, el mRNA se trata con una pirofosfatasa que elimina este "cap" del mRNA íntegro dejando un grupo fosfato en posición 5' al cual se le puede ligar un oligo de RNA con una secuencia específica que servirá para el proceso de amplificación propio de la técnica RACE. El mRNA así tratado se usa finalmente como molde para la síntesis de una hebra de cDNA usando un oligo poli-T con una secuencia específica en su extremo 5' (que servirá para realizar el 3'-RACE).Invitrogen has systems 3'-RACE and 5'-RACE encompassed in its GeneRacer Kit (Cat No. L1502-01). Your technology is based on the treatment of the starting mRNA with a phosphatase that eliminates the phosphate groups present at the 5 'end of the partially degraded messengers, so that only those with full sequence are likely to maintain their 5 'end covalently modified ("cap"). Next, the mRNA is treated with a pyrophosphatase that eliminates this "cap" of the entire mRNA leaving a phosphate group in position 5 'to which a RNA oligo with a specific sequence that will serve for the amplification process of the RACE technique. The mRNA as well treated is finally used as a template for the synthesis of a strand of cDNA using a poly-T oligo with a sequence specific at its 5 'end (which will be used to perform the 3'-RACE).

El sistema de RACE que Ambion posee está basado en la misma estrategia usada por Invitrogen (First Choice^{TM}
RLM-RACE Kit; Cat. No. 1700).The RACE system that Ambion owns is based on the same strategy used by Invitrogen (First Choice?
RLM-RACE Kit; Cat. No. 1700).

Por su parte, Clontech dispone de un sistema para 5'-RACE y 3'-RACE (SMART^{TM} RACE cDNA amplification kit; Cat. No. K1811-1) que emplea una transcriptasa reversa modificada que añade varios Cs en el extremo 3' de la primera hebra del cDNA (el cual se sintetiza usando un oligonucleótido oligodT con una secuencia conocida en su región 5'). De este modo, la región poli-C así generada sirve de molde para un oligonucleótido de secuencia conocida con un extremo poli-G en su cola 3' que confiere la secuencia específica para el RACE.For its part, Clontech has a system for 5'-RACE and 3'-RACE (SMART? RACE cDNA amplification kit; Cat. No. K1811-1) that employs a reverse transcriptase modified that adds several Cs at the 3 'end of the first strand of the cDNA (which is synthesized using an oligodot oligonucleotide with a sequence known in its 5 'region). In this way, the region poly-C thus generated serves as a mold for a oligonucleotide of known sequence with one end poly-G in its 3 'tail that confers the sequence specific to the RACE.

Por último, Roche usa un sistema para 5'-RACE y 3'-RACE (5'13' RACE Kit; Cat. No. 1 734 792) basado en la adición de una cola poli-A en el extremo 3' de la primera hebra de cDNA, que se emplea como secuencia específica para el RACE.Finally, Roche uses a system to 5'-RACE and 3'-RACE (5'13 'RACE Kit; Cat. No. 1 734 792) based on the addition of a tail poly-A at the 3 'end of the first strand of cDNA, which is used as a specific sequence for RACE.

La técnica del RACE no siempre permite amplificar correctamente una secuencia de mRNA y obtener las bandas correspondientes al amplificón esperado. Este hecho puede tener distintas explicaciones. Una de ellas es que la muestra problema inicial utilizada no presente mRNA. Otras explicaciones son que el mRNA puede estar degradado o formar una estructura secundaria que impide la unión de los oligonucleótidos con el mismo, que los oligonucleótidos diseñados no sean específicos para la zona en cuestión para la cual fueron diseñados, que los oligonucleótidos utilizados no son compatibles entre sí. La posible incompatibilidad entre los oligonucleótidos específicos de nuestra secuencia problema y los oligonucleótidos RACE, se puede deber a que las condiciones óptimas para el proceso de hibridación entre los oligonucleótidos y el cDNA problema sean distintas, entre otros, que la temperatura óptima de annealing no sea la misma, que la concentración óptima de magnesio necesaria para el funcionamiento de la enzima Taq DNA polymerasa sea distinta, que formen oligonucleótidos-dimers entre sí, etc.The RACE technique does not always allow to correctly amplify an mRNA sequence and obtain the bands corresponding to the expected amplification. This fact may have different explanations. One of them is that the initial problem sample used does not present mRNA. Other explanations are that the mRNA may be degraded or form a secondary structure that prevents oligonucleotide binding with it, that the designed oligonucleotides are not specific to the area in question for which they were designed, that the oligonucleotides used are not compatible each. The possible incompatibility between the specific oligonucleotides of our problem sequence and the RACE oligonucleotides, may be due to the fact that the optimal conditions for the hybridization process between the oligonucleotides and the problem cDNA are different, among others, that the optimal annealing temperature is not the same, that the optimal concentration of magnesium necessary for the functioning of the enzyme Taq DNA polymerase is different, that they form oligonucleotides-dimers with each other, etc.

Los vectores que se encuentran disponibles en el mercado para la clonación de DNA presentan en su estructura, entre otras características, un origen de replicación, resistencia a antibióticos y un polylinker. En el polylinker encuentran los sitios de reconocimiento para enzimas de restricción y es donde se inserta la secuencia de DNA que se quiere clonar. Para insertar la secuencia de DNA problema en el vector, éste es cortado con una de las enzimas de restricción presentes en el polylinker, así como la secuencia de DNA problema, que también es previamente tratada con la misma enzima. De este modo, las extremidades de ambas estructuras son compatibles y es posible la hibridación de las mismas (vector-DNA problema) y la posterior ligación de las mismas (Sambrook J y Russell DW (2001) Molecular cloning, a laboratory manual. CSHL Press, New York. Volumen 1, Páginas 1.1-1.170).The vectors that are available in the market for DNA cloning present in its structure, between other characteristics, an origin of replication, resistance to Antibiotics and a polylinker. In the polylinker find the sites recognition for restriction enzymes and is where it is inserted the DNA sequence that you want to clone. To insert the sequence DNA problem in the vector, this is cut with one of the restriction enzymes present in the polylinker, as well as the DNA sequence problem, which is also previously treated with the same enzyme. In this way, the extremities of both structures they are compatible and hybridization is possible (vector-DNA problem) and the subsequent ligation of  themselves (Sambrook J and Russell DW (2001) Molecular cloning, a laboratory manual. CSHL Press, New York. Volume 1, Pages 1.1-1.170).

Otro tipo de vectores comercializados son los que se caracterizan por estar cortados con extremos romos a los cuales se les ha añadido un nucleótido timina (T) en posición 3', y que permiten clonar directamente el DNA problema proveniente de bandas de PCR. Esto se debe al hecho de que en una reacción de PCR, la enzima DNA polimerasa al copiar una cadena de DNA siempre añade al extremo 3' de la cadena recién formada un nucleótido adenina (A). De esta forma, al adicionar la cadena de DNA problema proveniente de una reacción de PCR, que contiene una adenina en las extremidades 3', al vector cortado que presenta una timina en las extremidades 3', estos se unen dando origen a un vector circular. Este tipo de vector comercializado puede contener los sitios de reconocimiento para enzimas de restricción, que se encontrarían en los extremos del mismo, y que permitirían la rápida subclonación del DNA problema (Papp et al. (1995) Cloning of PCR fragments with a modified M13mp18 T-vector. Trends Genet 11: 169).Other types of marketed vectors are those that are characterized by being cut with blunt ends to which a thymine nucleotide (T) has been added at 3 'position, and which allow the problem DNA from PCR bands to be directly cloned. This is due to the fact that in a PCR reaction, the DNA polymerase enzyme when copying a DNA chain always adds an adenine nucleotide (A) to the 3 'end of the newly formed chain. Thus, by adding the problem DNA chain from a PCR reaction, which contains an adenine at the 3 'extremities, to the cut vector that has a thymine at the 3' extremities, they are joined giving rise to a circular vector . This type of commercialized vector may contain the recognition sites for restriction enzymes, which would be found at the ends thereof, and that would allow rapid subcloning of the problem DNA (Papp et al . (1995) Cloning of PCR fragments with a modified M13mp18 T-vector Trends Genet 11: 169).

Descripción de la invenciónDescription of the invention Descripción brevebrief description

La presente invención tiene como objetivo buscar soluciones para un problema que se plantea con relativa frecuencia al emplear la técnica de RACE. Este problema se basa en que los oligonucleótidos que se diseñan a partir de la secuencia del gen de interés/fragmento de cDNA problema, utilizados para la amplificación, pueden no ser compatibles con los oligonucleótidos 5' o 3' usados para la amplificación del cDNA completo (oligonucleótidos 5'-RACE y 3'-RACE), impidiéndose así la amplificación del cDNA de interés. Hasta la actualidad no se ha descrito un modo para comprobar la compatibilidad de estos oligonucleótidos.The present invention aims to seek solutions for a problem that arises with relative frequency when using the RACE technique. This problem is based on the fact that oligonucleotides that are designed from the gene sequence of interest / fragment of cDNA problem, used for the amplification, may not be compatible with oligonucleotides 5 'or 3' used for full cDNA amplification (5'-RACE oligonucleotides and 3'-RACE), thus preventing amplification of the cDNA of interest. Until now, no mode has been described for Check the compatibility of these oligonucleotides.

Esta invención se basa en un procedimiento propuesto por el inventor, para optimizar los oligonucleótidos y las condiciones de amplificación mediante PCR usadas en RACE. Este procedimiento se basa en el hecho de que un vector de clonaje/expresión que contiene los oligonucleótidos 5'-RACE y 3'-RACE flanqueando el gen de interés/fragmento de cDNA problema, permite generar un amplificón específico cuando los oligonucleótidos diseñados son compatibles con los oligonucleótidos RACE y las condiciones de amplificación mediante PCR son óptimas. De esta forma es posible optimizar las condiciones de amplificación mediante PCR que originan una banda específica, evitando la inespecificidad de hibridación entre los oligonucleótidos, y asegurándose así el éxito cuando se pretenda llevar a cabo el experimento de RACE.This invention is based on a procedure. proposed by the inventor, to optimize oligonucleotides and PCR amplification conditions used in RACE. This procedure is based on the fact that a vector of cloning / expression containing oligonucleotides 5'-RACE and 3'-RACE flanking the gene of interest / fragment of cDNA problem, allows to generate a specific amplification when the designed oligonucleotides are compatible with RACE oligonucleotides and the conditions of PCR amplification are optimal. In this way it is possible optimize the amplification conditions by PCR that originate a specific band, avoiding the non-specificity of hybridization between oligonucleotides, and thus ensuring success when intend to carry out the RACE experiment.

Un objeto de la presente invención lo constituye un procedimiento para optimizar los oligonucleótidos y las condiciones de amplificación mediante PCR, usadas para RACE, al clonar un gen de interés/fragmento de cDNA problema en una construcción genética que incluye los oligonucleótidos 5'-RACE y 3'-RACE flanqueando las extremidades del gen de interés/fragmento de cDNA problema.An object of the present invention constitutes it a procedure to optimize oligonucleotides and PCR amplification conditions, used for RACE, at clone a gene of interest / problem cDNA fragment into a genetic construction that includes oligonucleotides 5'-RACE and 3'-RACE flanking the limbs of the gene of interest / fragment of cDNA problem.

Un objeto de la presente invención lo constituye un procedimiento para optimizar los oligonucleótidos y las condiciones de amplificación mediante PCR, usadas para RACE, que engloba los siguientes pasos:An object of the present invention constitutes it a procedure to optimize oligonucleotides and PCR amplification conditions, used for RACE, which It includes the following steps:

a)to)
clonaje del gen de interés/fragmento de cDNA problema en una construcción genética que comprende los oligonucleótidos 5'-RACE y 3'-RACE flanqueando las extremidades del gen de interés/fragmento de cDNA problema;cloning of the gene of interest / fragment of cDNA problem in a genetic construct that includes the 5'-RACE and 3'-RACE oligonucleotides flanking the extremities of the gene of interest / cDNA fragment trouble;

b)b)
amplificación de fragmentos de DNA mediante PCR a partir del vector citado en el apartado a), usando un oligonucleótido de secuencia conocida del gen de interés/fragmento de cDNA problema y otro correspondiente al 5'-RACE o al 3'- RACE;amplification of DNA fragments by PCR from the vector cited in section a), using an oligonucleotide of known sequence of the gene from interest / fragment of cDNA problem and other corresponding to 5'-RACE or 3'-RACE;

c)C)
determinación del tamaño de los amplificones obtenidos.size determination amplifications obtained.

Un objeto adicional de la presente invención lo constituye una construcción genética de la presente invención que es constituida por una secuencia de nucleótidos, en el cual se puede clonar cualquier gen de interés/fragmento de cDNA problema, y cuyas extremidades están flanqueadas por los oligonucleótidos 5'-RACE y 3'-RACE y que permite comprobar la compatibilidad entre los oligonucleótidos necesarios para la amplificación del gen de interés/fragmento de cDNA problema y las condiciones óptimas de amplificación mediante PCR.A further object of the present invention is constitutes a genetic construct of the present invention that it is constituted by a nucleotide sequence, in which it can clone any gene of interest / problem cDNA fragment, and whose limbs are flanked by oligonucleotides 5'-RACE and 3'-RACE and that allows check compatibility between the necessary oligonucleotides for the amplification of the gene of interest / problem cDNA fragment and optimal amplification conditions by PCR.

Un objeto particular de la presente invención lo constituye una construcción genética en que la secuencia de nucleótidos, en la cual se puede clonar cualquier gen de interés/fragmento de cDNA problema, y que se encuentra flanqueada por los oligonucleótidos 5'-RACE y 3'-RACE usados para la amplificación por PCR, corresponde a un polylinker.A particular object of the present invention is constitutes a genetic construction in which the sequence of nucleotides, in which any gene from interest / fragment of cDNA problem, and that is flanked for the 5'-RACE oligonucleotides and 3'-RACE used for PCR amplification, It corresponds to a polylinker.

Un objeto particular de la presente invención lo constituye un vector de clonaje/expresión de estructura circular y cerrada que comprende la construcción genética de la presente invención, descrita anteriormente, y que ha sido denominado vector "sense" de tipo A.A particular object of the present invention is constitutes a cloning / expression vector of circular structure and closed comprising the genetic construction of the present invention, described above, and which has been called a vector "sense" of type A.

Otro objeto particular de la presente invención lo constituye un vector de clonaje/expresión similar al vector de tipo A pero con el polylinker en orientación antisentido, para minimizar la posibilidad de que el gen de interés/fragmento de cDNA problema sea clonado en orientación antisentido. Este tipo de vector se denomina vector "antisense" de tipo A.Another particular object of the present invention it is a cloning / expression vector similar to the vector of type A but with the polylinker in antisense orientation, for minimize the possibility of the gene of interest / cDNA fragment problem be cloned in antisense orientation. This type of vector It is called an "antisense" vector of type A.

Otro objeto particular de la presente invención es una construcción genética en que las secuencias de oligonucleótidos 5'-RACE y 3'-RACE y los sitios de restricción están flanqueando una zona de clonaje cortada con extremos romos a los que se añade una T en posición 3'.Another particular object of the present invention it is a genetic construction in which the sequences of 5'-RACE and 3'-RACE oligonucleotides and restriction sites are flanking a cloning zone cut with blunt ends to which a T is added in position 3'.

Otro objeto de la presente invención es un vector de clonaje/expresión de estructura linear y abierta que comprenda la anterior construcción genética y que el sistema formado permita clonar directamente el gen de interés/fragmento de cDNA problema, obtenido mediante PCR, en el vector y realizar los ensayos para optimizar la amplificación y asegurar el éxito de la técnica RACE. Este tipo de vector "sense" lo denominamos de tipo B.Another object of the present invention is a linear and open structure cloning / expression vector that understand the previous genetic construction and that the system formed allows to directly clone the gene of interest / fragment of cDNA problem, obtained by PCR, in the vector and perform the trials to optimize amplification and ensure the success of the RACE technique. We call this type of vector "sense" type B.

Otro objeto particular de la presente invención es un vector de clonaje/expresión similar al vector de tipo B descrito anteriormente pero con dianas de restricción únicas flanqueando el sitio de donación en orientación antisentido, para de esta forma minimizar la posibilidad de que el gen de interés/fragmento de cDNA problema sea donado en orientación antisentido. Este tipo de vector se denomina vector "antisense" de tipo B.Another particular object of the present invention it is a cloning / expression vector similar to the type B vector described above but with unique restriction targets flanking the donation site in antisense orientation, to stop this way minimize the possibility that the gene of interest / fragment of cDNA problem be donated in orientation antisense This type of vector is called an "antisense" vector.  type B.

Un objeto particular de la presente invención lo constituye un vector de clonaje/expresión de la presente invención que incluye, entre otros, a un plásmido, aunque podrían ser también cósmicos, fagos, y derivados.A particular object of the present invention is constitutes a cloning / expression vector of the present invention which includes, among others, a plasmid, although they could also be Cosmic, phage, and derivatives.

Un objeto adicional de la presente invención lo constituye el uso de la construcción genética de la presente invención para el chequeo del grado de compatibilidad de diversos oligonucleótidos, diseñados a partir de la secuencia del gen de interés/fragmento de cDNA problema, con los oligonucleótidos 5'-RACE y 3'- RACE. De esta forma, es posible optimizar los oligonucleótidos y las condiciones de amplificación mediante PCR usadas para RACE.A further object of the present invention is constitutes the use of the genetic construction of the present invention for checking the degree of compatibility of various oligonucleotides, designed from the gene sequence of interest / fragment of cDNA problem, with oligonucleotides 5'-RACE and 3'- RACE. In this way, it is possible optimize oligonucleotides and amplification conditions by PCR used for RACE.

Otro objeto adicional de la presente invención lo constituye el uso del vector de clonaje/expresión, que comprende la construcción genética de la presente invención, para el chequeo del grado de compatibilidad de diversos oligonucleótidos, diseñados a partir de la secuencia del gen de interés/fragmento de cDNA problema, con los oligonucleótidos 5'-RACE y 3'-RACE. De esta forma, es posible optimizar los oligonucleótidos y las condiciones de amplificación mediante PCR usadas para RACE.Another additional object of the present invention it is the use of the cloning / expression vector, which comprises the genetic construction of the present invention, for the checkup of the degree of compatibility of various oligonucleotides, designed from the sequence of the gene of interest / cDNA fragment problem, with the 5'-RACE oligonucleotides and 3'-RACE. In this way, it is possible to optimize the oligonucleotides and amplification conditions by PCR used for RACE.

Descripción detalladaDetailed description

Esta invención se basa en un procedimiento propuesto por el inventor, de chequear las combinaciones de oligonucleótidos utilizados para la amplificación de un gen de interés/fragmento de cDNA problema, para de esta forma evitar incompatibilidades entre los mismos. Para esto, el inventor ha introducido el gen de interés/fragmento de cDNA problema en una construcción genética cuyas extremidades están flanqueadas por las secuencias de oligonucleótidos 5'-RACE y 3'-RACE, utilizados en el proceso de amplificación. De esta forma es posible estudiar si los oligonucleótidos específicos del gen de interés/fragmento de cDNA problema son compatibles con los oligonucleótidos 5'-RACE y 3'-RACE, optimizando las condiciones de PCR capaces de generar un amplificón específico. La obtención de un amplificón con el tamaño esperado, cuando se utilizan oligonucleótidos compatibles, garantiza el éxito cuando se pretenda llevar a cabo el experimento de RACE. La posible incompatibilidad entre los oligonucleótidos específicos de nuestra secuencia problema y los oligonucleótidos RACE, se puede deber a que las condiciones óptimas para el proceso de hibridación entre los oligonucleótidos y el cDNA problema sean distintas.This invention is based on a procedure. proposed by the inventor, to check the combinations of oligonucleotides used for the amplification of a gene from interest / fragment of cDNA problem, to avoid incompatibilities between them. For this, the inventor has introduced the gene of interest / problem cDNA fragment into a genetic construction whose limbs are flanked by the 5'-RACE oligonucleotide sequences and 3'-RACE, used in the amplification process. In this way it is possible to study whether oligonucleotides Specific gene of interest / cDNA fragment problem are compatible with 5'-RACE oligonucleotides and 3'-RACE, optimizing capable PCR conditions of generating a specific amplifier. Obtaining an amplifier with the expected size, when oligonucleotides are used compatible, guarantees success when it is intended to carry out the RACE experiment. The possible incompatibility between oligonucleotides specific to our problem sequence and the RACE oligonucleotides, it may be because the optimal conditions for the hybridization process between oligonucleotides and cDNA problem be different.

Algunos de los parámetros que pueden influir en el proceso de hibridación son la secuencia de los oligonucleótidos diseñados específicos del DNA, la temperatura óptima de hibridación del oligonucleótido al cDNA, la concentración óptima de magnesio necesaria para el funcionamiento de la enzima Taq DNA polymerasa, entre otros. La amplificación del cDNA en las condiciones óptimas de estos parámetros evita inespecificidad de hibridación entre los oligonucleótidos. La inespecificidad de hibridación puede dar origen a dímeros de oligonucleótidos, o inespecificidad en la unión de los oligonucleótidos con el cDNA.Some of the parameters that can influence the hybridization process are the sequence of the specific designed oligonucleotides of the DNA, the optimal temperature of hybridization of the oligonucleotide to the cDNA, the optimal concentration of magnesium necessary for the functioning of the enzyme Taq DNA polymerase, between others. The amplification of the cDNA under the optimal conditions of these parameters prevents non-specificity of hybridization between the oligonucleotides. The non-specificity of hybridization can give rise to oligonucleotide dimers, or non-specificity in the binding of the oligonucleotides with the cDNA.

La presente invención proporciona un procedimiento para optimizar los oligonucleótidos y las condiciones de amplificación mediante PCR usadas para RACE, al clonar un gen de interés/fragmento de cDNA problema en una construcción genética que incluye los oligonucleótidos 5'-RACE y 3'-RACE flanqueando las extremidades del gen de interés/fragmento de cDNA problema. Este procedimiento permite así, comprobar la compatibilidad entre los oligonucleótidos necesarios para la amplificación del gen de interés/fragmento de cDNA problema, actuando de esta forma como un proceso de control previo al experimento RACE propiamente dicho.The present invention provides a procedure to optimize oligonucleotides and conditions PCR amplification used for RACE, when cloning a gene from interest / fragment of cDNA problem in a genetic construct that includes 5'-RACE oligonucleotides and 3'-RACE flanking the extremities of the gene of interest / fragment of cDNA problem. This procedure thus allows, check compatibility between the necessary oligonucleotides for amplification of the gene of interest / cDNA fragment problem, acting in this way as a prior control process to the RACE experiment itself.

Tal como se utiliza en la presente invención, la expresión "optimizar los oligonucleótidos y las condiciones de amplificación mediante PCR usadas para RACE" se refiere al diseño de las secuencias de oligonucleótidos y condiciones experimentales idóneas para obtener el amplificón específico deseado. Entre estas condiciones idóneas se encuentra la compatibilidad entre los diversos oligonucleótidos diseñados a partir de la secuencia del gen de interés/fragmento de cDNA problema, con los oligonucleótidos 5'-RACE y 3'-RACE. Como oligonucleótidos diseñados se entiende: un par de cadenas de nucleótidos, la primera (oligonucleótido upstream) con secuencia idéntica a una región de un DNA concreto, y la otra (oligonucleótido downstream) complementaria a otra secuencia del mismo DNA localizada en una región en dirección 3' del primer oligonucleótido. (Kleppe et al. (1971) Studies on polynucleotides. XCVI. Repair replications of short synthetic DNA's as catalyzed by DNA polymerases. J. Mol. Biol. 56: 341-361; Mullis KB, Faloona FA.
(1987) Specific synthesis of DNA in vitro vía a polymerase-catalyzed chain reaction. Methods Enzymol. 155:335-350).As used in the present invention, the term "optimize oligonucleotides and amplification conditions by PCR used for RACE" refers to the design of oligonucleotide sequences and experimental conditions suitable for obtaining the specific amplification desired. Among these suitable conditions is the compatibility between the various oligonucleotides designed from the sequence of the gene of interest / fragment of the cDNA problem, with the oligonucleotides 5'-RACE and 3'-RACE. As oligonucleotides designed are: a pair of nucleotide chains, the first (upstream oligonucleotide) with sequence identical to a region of a specific DNA, and the other (downstream oligonucleotide) complementary to another sequence of the same DNA located in a region in the direction 3 'of the first oligonucleotide. (Kleppe et al . (1971) Studies on polynucleotides. XCVI. Repair replications of short synthetic DNA's as catalyzed by DNA polymerases. J. Mol. Biol. 56: 341-361; Mullis KB, Faloona FA.
(1987) Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction. Methods Enzymol. 155: 335-350).

Tal como se utiliza en la presente invención, el término "clonar" se refiere a la inserción de una secuencia de DNA en un vector que puede ser propagado en un organismo huésped, generando un elevado numero de copias de la secuencia (Sambrook J y Russell DW (2001) Molecular cloning, a laboratory manual. CSHL Press, New York. Volumen 2, Páginas 1.1-1.133).As used in the present invention, the term "clone" refers to the insertion of a sequence of DNA in a vector that can be propagated in a host organism, generating a large number of copies of the sequence (Sambrook J and Russell DW (2001) Molecular cloning, a laboratory manual. CSHL Press, New York. Volume 2, Pages 1.1-1.133).

Por "gen de interés" se entiende cualquier unidad de transcripción que codifique para una proteína cuya actividad sea biológica, terapéutica o biotecnológicamente interesante y relevante para la sociedad.By "gene of interest" is meant any transcription unit encoding a protein whose activity whether biologically, therapeutically or biotechnologically Interesting and relevant to society.

Tal como se utiliza en esta invención, el término "fragmento de cDNA" se refiere a una doble cadena de DNA obtenida a partir de una cadena de mRNA mediante el uso de una transcriptasa reversa, primero, y la subsiguiente copia de esta cadena mediante distintos procedimientos que usen una DNA polimerasa (Sambrook J y Russell DW (2001) Molecular cloning, a laboratory manual. CSHL Press, New York. Volumen 2, Páginas 11.3.-11.5).As used in this invention, the term "cDNA fragment" refers to a double chain of DNA obtained from an mRNA chain by using a reverse transcriptase, first, and the subsequent copy of this chain using different procedures that use a DNA polymerase (Sambrook J and Russell DW (2001) Molecular cloning, a laboratory manual. CSHL Press, New York. Volume 2, Pages 11.3.-11.5).

Tal como se utiliza en la presente invención, el término "construcción genética" se refiere a una secuencia de DNA que puede ser utilizada para transferir otras secuencias de DNA de un organismo a otro. (Sambrook J y Russell DW (2001) Molecular cloning, a laboratory manual. CSHL Press, New York. Volumen 2, Páginas 1.1-1.170)As used in the present invention, the term "genetic construction" refers to a sequence of DNA that can be used to transfer other DNA sequences from one organism to another. (Sambrook J and Russell DW (2001) Molecular cloning, a laboratory manual. CSHL Press, New York. Volume 2 Pages 1.1-1.170)

Por "oligonucleótido 5'-RACE" se entiende una cadena sintética de oligonucleótidos diseñada para hibridar en la región extra añadida al cDNA en su región 5' (Sambrook J y Russell DW (2001) Molecular cloning, a laboratory manual. CSHL Press, New York. Volumen 2, Páginas 8.54-8.60).By "oligonucleotide 5'-RACE "means a synthetic chain of oligonucleotides designed to hybridize in the extra added region to the cDNA in its 5 'region (Sambrook J and Russell DW (2001) Molecular cloning, a laboratory manual. CSHL Press, New York. Volume 2 Pages 8.54-8.60).

Por "oligonucleótido 3'-RACE" se entiende una cadena sintética de oligonucleótidos diseñada para hibridar en la región extra añadida al cDNA en su región 3' (Sambrook J y Russell DW (2001) Molecular cloning, a laboratory manual. CSHL Press, New York. Volumen 2, Páginas 8.61-8.65).By "oligonucleotide 3'-RACE "means a synthetic chain of oligonucleotides designed to hybridize in the extra added region to the cDNA in its 3 'region (Sambrook J and Russell DW (2001) Molecular cloning, a laboratory manual. CSHL Press, New York. Volume 2 Pages 8.61-8.65).

Un objeto de la presente invención lo constituye un procedimiento para optimizar los oligonucleótidos y las condiciones de amplificación mediante PCR, usadas para RACE, que engloba los siguientes pasos:An object of the present invention constitutes it a procedure to optimize oligonucleotides and PCR amplification conditions, used for RACE, which It includes the following steps:

a)to)
clonaje del gen de interés/fragmento de cDNA problema en una construcción genética que comprende los oligonucleótidos 5'-RACE y 3'-RACE flanqueando las extremidades del gen de interés/fragmento de cDNA problema;cloning of the gene of interest / fragment of cDNA problem in a genetic construct that includes the 5'-RACE and 3'-RACE oligonucleotides flanking the extremities of the gene of interest / cDNA fragment trouble;

b)b)
amplificación de fragmentos de DNA mediante PCR a partir del vector citado en el apartado a), usando un oligonucleótido de secuencia conocida del gen de interés/fragmento de cDNA problema y otro correspondiente al 5'-RACE o al 3'-RACE;amplification of DNA fragments by PCR from the vector cited in section a), using an oligonucleotide of known sequence of the gene from interest / fragment of cDNA problem and other corresponding to 5'-RACE or 3'-RACE;

c)C)
determinación del tamaño de los amplificones obtenidos. Un objeto particular de la presente invención es una construcción genética de la presente invención que es constituida por un secuencia de nucleótidos, en el cual se puede clonar cualquier gen de interés/fragmento de cDNA problema, y cuyas extremidades están flanqueadas por los oligonucleótidos 5'-RACE y 3'-RACE y que permite comprobar la compatibilidad entre los oligonucleótidos necesarios para la amplificación del gen de interés/fragmento de cDNA problema.size determination amplifications obtained. A particular object of the present invention is a genetic construct of the present invention that it is constituted by a nucleotide sequence, in which you can clone any gene of interest / problem cDNA fragment, and whose limbs are flanked by oligonucleotides 5'-RACE and 3'-RACE and that allows check compatibility between the necessary oligonucleotides for amplification of the gene of interest / cDNA fragment trouble.

Un objeto particular de la presente invención lo constituye una construcción genética en que la secuencia de nucleótidos, en el cual se puede clonar cualquier gen de interés/fragmento de cDNA problema, y que se encuentra flanqueada por los oligonucleótidos 5'-RACE y 3'-RACE usados para la amplificación por PCR, corresponde a un polylinker.A particular object of the present invention is constitutes a genetic construction in which the sequence of nucleotides, in which any gene from interest / fragment of cDNA problem, and that is flanked for the 5'-RACE oligonucleotides and 3'-RACE used for PCR amplification, It corresponds to a polylinker.

Tal como se utiliza en la presente invención, el término "polylinker" se refiere a una secuencia de DNA relativamente corta que contiene un número elevado de dianas para enzimas de restricción (Sambrook J y Russell DW (2001) Molecular cloning, a laboratory manual. CSHL Press, New York. Volumen 2, Páginas 1.84-1.87).As used in the present invention, the term "polylinker" refers to a DNA sequence relatively short containing a high number of targets for restriction enzymes (Sambrook J and Russell DW (2001) Molecular cloning, a laboratory manual. CSHL Press, New York. Volume 2 Pages 1.84-1.87).

Un objeto particular de la presente invención lo constituye un vector de clonaje/expresión de estructura circular y cerrada que comprende la construcción genética de la presente invención, descrita anteriormente, y que ha sido denominado vector "sense" de tipo A (ver esquema Apartado 7). De esta forma, es posible realizar los ensayos para optimizar la amplificación y asegurar el éxito de la técnica RACE.A particular object of the present invention is constitutes a cloning / expression vector of circular structure and closed comprising the genetic construction of the present invention, described above, and which has been called a vector "sense" of type A (see scheme Section 7). In this way, it is possible to perform the tests to optimize the amplification and ensure the success of the RACE technique.

Tal como se utiliza en la presente invención, el término "vector de clonaje" se refiere a una secuencia de nucleótidos que permite clonar un gen de interés/fragmento de cDNA problema y que presentan en su estructura, entre otros, un origen de replicación, resistencia a antibióticos y una zona de clonaje donde es insertado la secuencia del gen de interés/fragmento de cDNA problema del que se quiere amplificar su secuencia completa. Como "vector de expresión" nos referimos a una secuencia de nucleótidos que presenta en su estructura, entre otros, un origen de replicación, resistencia a antibióticos y una zona de clonaje, donde es insertado la secuencia del gen de interés/fragmento de cDNA problema, flanqueada por una región promotora en posición upstream y una secuencia de poliadenilación en posición downstream. El vector de clonaje/expresión puede ser, entre otros, una estructura circular y cerrada que presenta un polylinker donde se encuentran los sitios de reconocimiento para enzimas de restricción y donde se clona el gen de interés/fragmento de cDNA problema, o también puede ser una estructura linear y abierta con extremos romos a los cuales se les ha añadido un nucleótido T en posición 3', y donde se clona el gen de interés/fragmento de cDNA problema (Sambrook J y Russell DW (2001) Molecular cloning, a laboratory manual. CSHL Press, New York. Volumen 2, Páginas 1.1-1.170; Papp et al. (1995) Cloning of PCR fragments with a modified M13mp18 T-vector. Trends Genet 11:169).As used in the present invention, the term "cloning vector" refers to a nucleotide sequence that allows to clone a gene of interest / problem cDNA fragment and which have in its structure, among others, an origin of replication, Antibiotic resistance and a cloning zone where the sequence of the gene of interest / problem cDNA fragment is inserted from which its complete sequence is to be amplified. As an "expression vector" we refer to a nucleotide sequence that presents in its structure, among others, an origin of replication, antibiotic resistance and a cloning zone, where the sequence of the gene of interest / problem cDNA fragment is inserted , flanked by a promoter region in the upstream position and a polyadenylation sequence in the downstream position. The cloning / expression vector can be, among others, a circular and closed structure that has a polylinker where the recognition sites for restriction enzymes are located and where the gene of interest / problem cDNA fragment is cloned, or it can also be a linear and open structure with blunt ends to which a T nucleotide in 3 'position has been added, and where the gene of interest / problem cDNA fragment is cloned (Sambrook J and Russell DW (2001) Molecular cloning, a laboratory manual, CSHL Press, New York, Volume 2, Pages 1.1-1.170; Papp et al . (1995) Cloning of PCR fragments with a modified M13mp18 T-vector. Trends Genet 11: 169).

Tal como se utiliza en la presente invención, el término "vector sense" se refiere a una de las dos posibles disposiciones en las que se encuentran los dos sitios de restricción únicos que flanquean el lugar de clonación (polylinker o secuencia cortada con una T en su extremo 3') con respecto a las secuencias reconocidas por los oligonucleótidos RACE.As used in the present invention, the term "vector sense" refers to one of the two possible provisions in which the two sites of unique constraints that flank the cloning site (polylinker or sequence cut with a T at its 3 'end) with respect to the sequences recognized by the RACE oligonucleotides.

Otro objeto particular de la presente invención lo constituye un vector de clonaje/expresión similar al vector de tipo A pero con el polylinker en orientación antisentido, para minimizar la posibilidad de que el gen de interés/fragmento de
cDNA problema sea clonado en orientación antisentido. Este tipo de vector se denomina vector "antisense" de tipo A.Another particular object of the present invention is a cloning / expression vector similar to the type A vector but with the polylinker in antisense orientation, to minimize the possibility of the gene of interest / fragment of
cDNA problem is cloned in antisense orientation. This type of vector is called an "antisense" type A vector.

Tal como se utiliza en la presente invención, el término "orientación antisentido" se refiere a aquella en la que la hebra complementaria de una cadena de DNA adquiere la posición que ocupaba esta última. (Lewin (2000) Genes VII Oxford University Press).As used in the present invention, the term "antisense orientation" refers to that in the that the complementary strand of a DNA chain acquires the position occupied by the latter. (Lewin (2000) Genes VII Oxford University Press).

Tal como se utiliza en la presente invención, el término "vector antisense" se refiere al que posee los dos sitios de restricción únicos que flanquean el lugar de clonación (polylinker o secuencia cortada con una T en su extremo 3') en disposición alternativa a la del "vector sense"con respecto a las secuencias reconocidas por los oligonucleótidos RACE.As used in the present invention, the term "antisense vector" refers to the one that has both unique restriction sites that flank the cloning site (polylinker or sequence cut with a T at its 3 'end) in alternative provision to that of the "vector sense" with respect to the sequences recognized by the RACE oligonucleotides.

Otro objeto particular de la presente invención es una construcción genética en que las secuencias de oligonucleótidos 5'-RACE y 3'-RACE y los sitios de restricción están flanqueando una zona de clonaje cortada con extremos romos a los que se añade una T en posición 3'. Esta construcción genética dispone de, al menos, una diana de restricción entre la zona de clonaje y cada una de las secuencias de oligonucleótidos 5'- RACE y 3'-RACE. El tipo de construcción genética con extremos romos a los que se añade una T en posición 3' está presente normalmente en vectores para clonación de DNA obtenido mediante PCR, pues la enzima DNA polimerasa usada en este tipo de reacción incorpora una A en el extremo 3' de la cadena de DNA recién formada.Another particular object of the present invention it is a genetic construction in which the sequences of 5'-RACE and 3'-RACE oligonucleotides and restriction sites are flanking a cloning zone cut with blunt ends to which a T in position 3 'is added. This genetic construction has at least one target of restriction between the cloning zone and each of the sequences of 5'-RACE and 3'-RACE oligonucleotides. The kind of genetic construction with blunt ends to which a T is added in position 3 'it is normally present in vectors for cloning of DNA obtained by PCR, as the enzyme DNA polymerase used in this type of reaction it incorporates an A at the 3 'end of the newly formed DNA chain.

Otro objeto de la presente invención es un vector de clonaje/expresión de estructura linear y abierta que comprenda la anterior construcción genética y que el sistema formado permita clonar directamente el gen de interés/fragmento de cDNA problema, obtenido mediante PCR, en el vector y realizar los ensayos para optimizar la amplificación y asegurar el éxito de la técnica RACE. Este tipo de vector "sense" lo denominamos de tipo B.Another object of the present invention is a linear and open structure cloning / expression vector that understand the previous genetic construction and that the system formed allows to directly clone the gene of interest / fragment of cDNA problem, obtained by PCR, in the vector and perform the trials to optimize amplification and ensure the success of the RACE technique. We call this type of vector "sense" type B.

Otro objeto particular de la presente invención es un vector de clonaje/expresión similar al vector de tipo B descrito anteriormente pero con dianas de restricción únicas flanqueando el sitio de clonación en orientación antisentido, para de esta forma minimizar la posibilidad de que el gen de interés/fragmento de cDNA problema sea clonado en orientación antisentido. Este tipo de vector se denomina vector "antisense" de tipo B.Another particular object of the present invention it is a cloning / expression vector similar to the type B vector described above but with unique restriction targets flanking the cloning site in antisense orientation, to in this way minimize the possibility that the gene of interest / fragment of cDNA problem be cloned in orientation antisense This type of vector is called an "antisense" vector.  type B.

Un objeto particular de la presente invención lo constituye un vector de clonaje/expresión de la presente invención que puede ser, entre otros, un plásmido; aunque podría tratarse también de un fago, un cósmico u otro vector derivado de todos estos.A particular object of the present invention is constitutes a cloning / expression vector of the present invention which may be, among others, a plasmid; although it could be treated also from a phage, a cosmic or other vector derived from all these.

Tal como se utiliza en esta invención, el término "plásmido" se refiere a cualquier molécula de DNA circular que, al ser introducida en una bacteria, es capaz de replicarse de manera independiente al propio cromosoma bacteriano. (Lewin (2000) Genes VII Oxford University Press).As used in this invention, the term "plasmid" refers to any DNA molecule circular which, when introduced into a bacterium, is capable of replicate independently to the bacterial chromosome itself. (Lewin (2000) Genes VII Oxford University Press).

Otro objeto adicional de la presente invención lo constituye el uso de la construcción genética de la presente invención para el chequeo del grado de compatibilidad de diversos oligonucleótidos, diseñados a partir de la secuencia del gen de interés/fragmento de cDNA problema, con los oligonucleótidos 5'-RACE y 3'-RACE. De esta forma, es posible optimizar los oligonucleótidos y las condiciones de amplificación mediante PCR usadas para RACE.Another additional object of the present invention it is the use of the genetic construction of the present invention for checking the degree of compatibility of various oligonucleotides, designed from the gene sequence of interest / fragment of cDNA problem, with oligonucleotides 5'-RACE and 3'-RACE. Thus, it is possible to optimize the oligonucleotides and the conditions of PCR amplification used for RACE.

Un objeto adicional de la presente invención lo constituye el uso del vector de clonaje/expresión, que comprende la construcción genética de la presente invención, para el chequeo del grado de compatibilidad de diversos oligonucleótidos, diseñados a partir de la secuencia del gen de interés/fragmento de cDNA problema, con los oligonucleótidos 5'-RACE y 3'-RACE. De esta forma, es posible optimizar los oligonucleótidos y las condiciones de amplificación mediante PCR usadas para RACE.A further object of the present invention is constitutes the use of the cloning / expression vector, which comprises the genetic construction of the present invention, for checking the degree of compatibility of various oligonucleotides, designed to from the sequence of the gene of interest / cDNA fragment problem, with the 5'-RACE oligonucleotides and 3'-RACE. In this way, it is possible to optimize the oligonucleotides and amplification conditions by PCR used for RACE.

Descripción de las figurasDescription of the figures

En las figuras incluidas en este apartado se incluyen cuatro esquemas relativos a los cuatro tipos de vectores que se describen en esta Memoria.In the figures included in this section, they include four schemes related to the four types of vectors described in this report.

Figura 1Figure one

Esquema de un vector de tipo A con orientación sentido (vector "sense")Scheme of a vector of type A with direction orientation (vector "sense")

Los vectores tipo A contienen un polylinker con un número variable de sitios de reconocimiento para enzimas de restricción (que por motivos de simplicidad se representan en el esquema mediante las letras a y b). Flanqueando este polylinker se encuentran dos secuencias específicas de los oligonucleótidos 5'-RACE (5'oligonucleótido) y 3'-RACE (3'oligonucleótido).Type A vectors contain a polylinker with a variable number of recognition sites for enzymes of restriction (which for reasons of simplicity are represented in the scheme by letters a and b). Flanking this polylinker is find two specific sequences of oligonucleotides 5'-RACE (5'oligonucleotide) and 3'-RACE (3'oligonucleotide).

Figura 2Figure 2

Esquema de un vector de tipo A con orientación antisentido (vector "antisense")Scheme of a type A vector with antisense orientation (vector "antisense")

Los vectores tipo A denominados "antisense" contienen un polylinker en orientación inversa, con un número variable de sitios de reconocimiento para enzimas de restricción (que por motivos de simplicidad se representan en el esquema mediante las letras a y b). Flanqueando el polylinker se encuentran dos secuencias específicas de los oligonucleótidos 5'-RACE (5'oligonucleótido) y 3'-RACE (3'oligonucleótido).Type A vectors called "antisense" contain a polylinker in reverse orientation, with a number recognition site variable for restriction enzymes (which for reasons of simplicity are represented in the scheme through the letters a and b). Flanking the polylinker meet two specific oligonucleotide sequences 5'-RACE (5'oligonucleotide) and 3'-RACE (3'oligonucleotide).

Figura 3Figure 3

Esquema de un vector de tipo B con orientación sentido (vector "sense")Scheme of a type B vector with direction orientation (vector "sense")

Los vectores de tipo B se caracterizan por estar cortados con extremos romos a los cuales se les ha añadido una T en posición 3'. Este tipo de vectores se usan habitualmente para clonar bandas de PCR pues la enzima usada para este tipo de reacción incorpora una A en el extremo 3' de la cadena de DNA que se forma. Flanqueando este sitio de clonación se encuentran sendos sitios de restricción (indicados con a y b) y dos secuencias específicas de los oligonucleótidos 5'-RACE (5'oligonucleótido) y 3'-RACE (3'oligonucleótido).Type B vectors are characterized by being cut with blunt ends to which a T has been added in 3 'position. These types of vectors are commonly used to clone PCR bands as the enzyme used for this type of reaction incorporates an A at the 3 'end of the DNA chain that forms. Flanking this cloning site are two sites of restriction (indicated with a and b) and two specific sequences of the 5'-RACE oligonucleotides (5'oligonucleotide) and 3'-RACE (3'oligonucleotide).

Figura 4Figure 4

Esquema de un vector de tipo B con orientación antisentido (vector "antisense")Scheme of a type B vector with antisense orientation (vector "antisense")

Los vectores de tipo B denominados "antisense" se caracterizan por estar cortados con extremos romos a los cuales se les ha añadido una T en posición 3', y por tener los sitios de restricción a y b en orientación inversa. Este tipo de vectores se usan habitualmente para clonar bandas de PCR pues la enzima usada para este tipo de reacción incorpora una A en el extremo 3'. Flanqueando este sitio de clonación se encuentran sendos sitios de restricción (indicados con a y b) y dos secuencias específicas de los oligonucleótidos 5'-RACE (5'oligonucleótido) y 3'-RACE (3'oligonucleótido).Type B vectors called "antisense" are characterized by being cut with ends blunt to which a T in position 3 'has been added, and by have restriction sites a and b in reverse orientation. This type of vectors are commonly used to clone PCR bands because the enzyme used for this type of reaction incorporates an A in the 3 'end. Flanking this cloning site are found two restriction sites (indicated with a and b) and two sequences specific for 5'-RACE oligonucleotides (5'oligonucleotide) and 3'-RACE (3'oligonucleotide).

Ejemplos de realización de la invenciónExamples of embodiment of the invention

En la presente invención se ha propuesto por primera vez un procedimiento para optimizar los oligonucleótidos y las condiciones de amplificación mediante PCR, usadas para RACE. En este procedimiento se utiliza una construcción genética con características particulares, que insertada en un vector podría ser utilizada para comprobar las combinaciones de oligonucleótidos usados para la amplificación de un gen de interés/fragmento de cDNA. Este tipo de construcción genética permitiría asegurar la compatibilidad de los oligonucleótidos con el gen de interés/fragmento de cDNA problema y optimizar las condiciones de amplificación mediante PCR capaces de generar un amplificón específico. Para este efecto, esta construcción genética debe permitir la clonación de cualquier gen de interés/fragmento de cDNA problema, estando ésta flanqueada por las secuencias de los oligonucleótidos 5'-RACE y 3'-RACE. Dos tipos de construcciones genéticas son descritas en esta invención, que se encuentran insertadas en vectores de clonaje/expresión. El vector de tipo A que dispone de las secuencias de oligonucleótidos 5'-RACE y 3'-RACE, usadas para la amplificación por PCR, flanqueando un polylinker, donde es clonado el gen de interés/fragmento de cDNA problema (Figura 1). Alternativamente, también es descrito el vector de tipo B que presenta las secuencias de oligonucleótidos 5-RACE' y 3'-RACE flanqueando un sitio cortado con extremos romos a los que se ha añadido una T en posición en 3', y donde es clonado el gen de interés/fragmento de cDNA problema (Figura 3). El vector de tipo B permite así, clonar directamente el gen de interés/fragmento de cDNA problema que ha sido obtenido por PCR. Para salvaguardar la posibilidad de que el gen de interés/fragmento de cDNA problema sea clonado en orientación inversa es necesario disponer de vectores similares a los vectores de tipo A y B pero con orientación antisentido. En el caso de vectores "antisense" de tipo A, el polylinker se encuentra en disposición antisentido (Figura 2). En los vectores de tipo B denominados "antisense", los sitios de reconocimiento para enzimas de restricción se encuentran en orientación antisentido (Figura 4).In the present invention it has been proposed by first time a procedure to optimize oligonucleotides and PCR amplification conditions, used for RACE. In This procedure uses a genetic construct with particular characteristics, which inserted into a vector could be used to check oligonucleotide combinations used for the amplification of a gene of interest / fragment of cDNA This type of genetic construction would ensure the oligonucleotide compatibility with the gene of interest / fragment of cDNA problem and optimize the conditions of PCR amplification capable of generating an amplifier specific. For this purpose, this genetic construction must allow cloning of any gene of interest / cDNA fragment problem, being flanked by the sequences of the 5'-RACE and 3'-RACE oligonucleotides. Two types of genetic constructs are described in this invention, which are inserted into vectors of cloning / expression The type A vector that has the 5'-RACE oligonucleotide sequences and 3'-RACE, used for PCR amplification, flanking a polylinker, where the gene of is cloned interest / fragment of cDNA problem (Figure 1). Alternatively, the type B vector presenting the sequences is also described of 5-RACE 'oligonucleotides and 3'-RACE flanking a site cut with ends blunt to which a T in position in 3 'has been added, and where it is cloned the gene of interest / problem cDNA fragment (Figure 3). He Type B vector thus allows you to directly clone the gene from interest / fragment of cDNA problem that has been obtained by PCR. To safeguard the possibility that the gene of interest / fragment of cDNA problem being cloned in reverse orientation is necessary have vectors similar to vectors of type A and B but with  antisense orientation. In the case of "antisense" vectors of type A, the polylinker is in antisense arrangement (Figure 2). In type B vectors called "antisense", recognition sites for restriction enzymes are found in antisense orientation (Figure 4).

Supongamos que disponemos de la siguiente secuencia parcial de un cDNA problema:Suppose we have the following partial sequence of a problem cDNA:

ctg ggtacc aaccccagaactttccttcctgagcagagtcaggacatccagtcgcacatgcaaacagcgagctcttccttccct ctgcagggctatccctatcagtcc
cctggtcttcccagtcccccctat cagctg atgctg ggtacc aaccccagaa ctttccttcctgagcagagt caggacatccagtcgcacatg caaacagcgagctcttcctt ccct ctgcagggctatccctatcagtcc
cctggtcttcccagtcccccctat cagctg atg

en donde las secuencias en negrita representan de izquierda a derecha los sitios de reconocimiento de las enzimas de restricción Kpnl y PvuII, respectivamente. Las secuencias subrayadas, denominadas "1" y "2" de izquierda a derecha, son las correspondientes a los oligonucleótidos usados para llevar a cabo la técnica RACE. En este ejemplo se citan sólo dos secuencias, pero en principio podrían ser más. Se pueden diseñar dos oligonucleótidos (sense y antisense) en cada una de las regiones mencionadas, que denominamos sensel (ctttccttcctgagcagagt), antisensel (actctgctcaggaaggaaag), sense2 (caaacagcgagctcttcctt), antisense2 (aaggaagagctcgctgtttg).where the sequences in bold represent from left to right the recognition sites of the restriction enzymes Kpnl and PvuII, respectively. The underlined sequences, called "1" and "2" on the left on the right, they correspond to the oligonucleotides used to carry out the RACE technique. In this example, only two sequences, but in principle they could be more. Can be design two oligonucleotides (sense and antisense) in each of the mentioned regions, which we call sensel (ctttccttcctgagcagagt), antisensel (actctgctcaggaaggaaag), sense2 (caaacagcgagctcttcctt), antisense2 (aaggaagagctcgctgtttg).

Supongamos también que los oligonucleótidos 5'-RACE y 3'-RACE son respectivamente: atcgtgtccatcgatgtctg y acgaacaatgcaacgtcgag.Assume also that oligonucleotides 5'-RACE and 3'-RACE are respectively: atcgtgtccatcgatgtctg and acgaacaatgcaacgtcgag.

Queremos estudiar el grado de compatibilidad de los oligonucleótidos diseñados sensel, sense2, antisensel y antisense2 con los oligonucleótidos 5'-RACE y 3'-RACE.We want to study the degree of compatibility of the designed oligonucleotides sensel, sense2, antisensel and antisense2 with the 5'-RACE oligonucleotides and 3'-RACE.

Ejemplo 1Example one

Uso del vector con polylinker (vector de tipo A) para determinar la compatibilidad entre oligonucleótidosUse of the vector with polylinker (type A vector) to determine oligonucleotide compatibility

El vector de tipo A dispone de un polylinker (que en este caso concreto vamos a suponer constituido por los sitios EcoRI, Kpnl, Pvull y SanI), flanqueado por las secuencias específicas de los oligonucleótidos 5'-RACE y 3'-RACE.Type A vector has a polylinker (which in this specific case we will assume constituted by the EcoRI, Kpnl, Pvull and SanI sites), flanked by sequences specific for the 5'-RACE oligonucleotides and 3'-RACE.

La secuencia en esta zona del vector "sense" de tipo A sería, por ejemplo, la siguiente:The sequence in this area of the vector "sense" of type A would be, for example, the following:

...TGT ATCGTGTCCATCGATGTCTG TCG....(100 bases)...CCT GAATTC TA GGTACC GA CAGCTG CG GTC
GAC CTA...(100 bases)...GCG CTCGACGTTGCATTGTTCGT CA...... TGT ATCGTGTCCATCGATGTCTG TCG .... (100 bases) ... CCT GAATTC TA GGTACC GA CAGCTG CG GTC
GAC CTA ... (100 bases) ... GCG CTCGACGTTGCATTGTTCGT CA ...

cuyas regiones en negrita se corresponden, de izquierda a derecha, con el oligonucleótido 5'-RACE, los sitios EcoRI, KpnI, PvuII y SalI, y el oligonucleótido 3'-RACE. El resto de secuencia representada con puntos suspensivos corresponde a aquella propia del vector con su origen de replicación, resistencia a antibióticos, etc.whose regions in bold are correspond, from left to right, with the oligonucleotide 5'-RACE, the EcoRI, KpnI, PvuII and SalI sites, and the 3'-RACE oligonucleotide. The rest of the sequence represented with ellipses corresponds to that own of the vector with its origin of replication, resistance to antibiotics, etc.

La región adyacente al polylinker en la modalidad antisense estaría dispuesta del modo siguiente:The region adjacent to the polylinker in the Antisense modality would be arranged as follows:

...TGT ATCGTGTCCATCGATGTCTG TCG.... (100 bases)...CCT GTCGAC CG CAGCTG TC GG TACC TA GA
ATTC CTA...(100 bases)...GCG CTCGACGTTGCATTGTTCGT CA...... TGT ATCGTGTCCATCGATGTCTG TCG .... (100 bases) ... CCT GTCGAC CG CAGCTG TC GG TACC TA GA
ATTC CTA ... (100 bases) ... GCG CTCGACGTTGCATTGTTCGT CA ...

cuyas regiones en negrita se corresponden, de izquierda a derecha, con el oligonucleótido 5'-RACE, los sitios SalI, PvuII, KpnI y EcoRI, y el oligonucleótido 3'-RACE. La región representada con puntos suspensivos sería idéntica a aquella mencionada para el caso sense.whose regions in bold are correspond, from left to right, with the oligonucleotide 5'-RACE, the SalI, PvuII, KpnI and EcoRI sites, and the 3'-RACE oligonucleotide. The region represented with ellipsis would be identical to that mentioned for that matter sense.

El fragmento de cDNA problema puede ser clonado en el polylinker de un vector tipo A sense en los sitios KpnI (ggtacc) y PvuII (cagctg) del plásmido:The problem cDNA fragment can be cloned in the polylinker of a vector type A sense in the KpnI sites (ggtacc) and PvuII (cagctg) of the plasmid:

...TGT ATCGTGTCCATCGATGTCTG TCG....(100 bases)...CCT GAATTC TA GGTACC aacccc agaactttccttcctg
agcagagtcaggacatccagtcgcacatgcaaacagcgagctcttccttccctctgcagggctatccctatc agtcccctggtcttcccagtcccccctat CAGCTG
CG GTCGAC CTA... (100 bases)...GCG CTCGACGTT GATTGTTCGT CA...... TGT ATCGTGTCCATCGATGTCTG TCG .... (100 bases) ... CCT GAATTC TA GGTACC aacccc agaactttccttcctg
agcagagtcaggacatccagtcgcacatgcaaacagcgagctcttccttccctctgcagggctatccctatc agtcccctggtcttcccagtcccccctat CAGCTG
CG GTCGAC CTA ... (100 bases) ... GCG CTCGACGTT GATTGTTCGT CA ...

En caso de necesidad se puede insertar en sentido antiparalelo mediante su clonación en el plásmido tipo A antisense, usando las dianas EcoRI y SalI, del siguiente modo:If necessary, it can be inserted in antiparallel sense by cloning in plasmid type A antisense, using the EcoRI and SalI targets, as follows:

...TGT ATCGTGTCCATCGATGTCTG TCG....(100 bases)...CCT GTCGAC CG CAGCTG ataggggggactgggaaga
ccaggggactgatagggatagccctgcagagggaaggaagagctcgctgtttgcatgtgcgactggatgtcctgactctgctcaggaaggaaagttctggggtt GGTA
CC TA GAATTC CTA...(100 bases)...GCG CTCG ACGTTGCATTGTTCGT CA...... TGT ATCGTGTCCATCGATGTCTG TCG .... (100 bases) ... CCT GTCGAC CG CAGCTG ataggggggactgggaaga
ccaggggactgatagggatagccctgcagagggaaggaagagctcgctgtttgcatgtgcgactggatgtcctgactctgctcaggaaggaaagttctggggtt GGTA
CC TA GAATTC CTA ... (100 bases) ... GCG CTCG ACGTTGCATTGTTCGT CA ...

Con estas construcciones es posible llevar a cabo reacciones de PCR para optimizar las reacciones que usan todas las posibles combinaciones de oligonucleótidos. Seguidamente se muestra una tabla con los tamaños de amplificón esperados cuando se usan estas combinaciones de oligonucleótidos en los dos tipos de vectores:With these constructions it is possible to carry conduct PCR reactions to optimize the reactions that all use the possible combinations of oligonucleotides. Then it shows a table with the expected amplification sizes when use these combinations of oligonucleotides in the two types of vectors: 

       \newpage\ newpage

Vector sense de tipo AVector sense of type A Vector antisense de tipo AAntisense vector of type A 5'-RACE/sensel5'-RACE / sensel no aplicableno applicable 253 pb253 bp 5'-RACE/antisensel5'-RACE / antisensel 170 pb170 bp no aplicableno applicable 5'-RACE/sense25'-RACE / sense2 no aplicableno applicable 212 pb212 bp 5'-RACE/antisense25'-RACE / antisense2 211 pb211 bp no aplicableno applicable 3'-RACE/sensel3'-RACE / sensel 253 pb253 bp no aplicableno applicable 3'-RACE/antisensel3'-RACE / antisensel no aplicableno applicable 170 pb170 bp 3'-RACE/sense23'-RACE / sense2 212 pb212 bp no aplicableno applicable 3'-RACE/antisense23'-RACE / antisense2 no aplicableno applicable 211 pb211 bp

Ejemplo 2Example 2

Uso de vector con extremos T-protuberantes (vector de tipo B) para determinar la compatibilidad entre oligonucleótidosUse of vector with T-protruding ends (type B vector) to determine compatibility between oligonucleotides

El vector de tipo B dispone de un sitio de clonación con extremos T-protuberantes para clonar DNA amplificado por PCR. Este sitio esta flanqueado por dianas de restricción y las secuencias específicas de los oligonucleótidos 5'-RACE y 3'-RACE.Type B vector has a site of cloning with T-protuberant ends to clone DNA amplified by PCR. This site is flanked by targets of restriction and oligonucleotide specific sequences 5'-RACE and 3'-RACE.

En este ejemplo, la secuencia en esta zona del vector sense de tipo B podría ser la siguiente:In this example, the sequence in this area of the Type B vector sense could be as follows:

...TGT ATCGTGTCCATCGATGTCTG TCG....(100 bases)...CCT GAATTC TAT [*] CG GTCGA C TA...(100 ba-
ses)...GCG CTCGACGTTGCATTGTTCGT CA...... TGT ATCGTGTCCATCGATGTCTG TCG .... (100 bases) ... CCT GAATTC TA T [*] CG GTCGA C TA ... (100 ba-
ses) ... GCG CTCGACGTTGCATTGTTCGT CA ...

cuyas regiones en negrita se corresponden, de izquierda a derecha, con el oligonucleótido 5'-RACE, el sitio EcoRI, la T protuberante usada para clonar bandas de PCR, el sitio SalI y el oligonucleótido 3'-RACE. El asterisco incluido entre corchetes representa el sitio de clonación cortado. El resto de secuencia representada con puntos suspensivos corresponde a aquella propia del vector con su origen de replicación, resistencia a antibióticos, etc.whose regions in bold are correspond, from left to right, with the oligonucleotide 5'-RACE, the EcoRI site, the protruding T used to clone PCR bands, the SalI site and the oligonucleotide 3'-RACE. The asterisk included in square brackets represents the cloning site cut. The rest of the sequence represented with ellipses corresponds to that own of the vector with its origin of replication, resistance to antibiotics, etc.

La región adyacente al polylinker en la modalidad antisense estaría dispuesta del modo siguiente:The region adjacent to the polylinker in the Antisense modality would be arranged as follows:

...TGT ATCGTGTCCATCGATGTCTG TCG....(100 bases)...CCT GTCG CGT [*] TA GAATT C CTA...(100 ba-
ses)...GCG CTCGACGTTGCATTGTTCGT CA... cuyas regiones en negrita se corresponden, de izquierda a derecha, con el oligonucleótido 5'-RACE, el sitio SalI, la T protuberante usada para clonar bandas de PCR, el sitio EcoRI, y el oligonucleótido 3'-RACE. El asterisco incluido entre corchetes representa el sitio de clonación cortado. La región representada con puntos suspensivos sería idéntica a aquella mencionada para el caso sense.... TGT ATCGTGTCCATCGATGTCTG TCG .... (100 bases) ... CCT GTCG CG T [*] TA GAATT C CTA ... (100 ba-
ses) ... GCG CTCGACGTTGCATTGTTCGT CA ... whose regions in bold correspond, from left to right, with the 5'-RACE oligonucleotide, the SalI site, the protuberant T used to clone PCR bands, the EcoRI site, and the 3'-RACE oligonucleotide. The asterisk included in square brackets represents the cloning site cut. The region represented with ellipses would be identical to that mentioned for the sense case.

El fragmento de cDNA problema puede ser clonado directamente en el vector sense de tipo B:The problem cDNA fragment can be cloned directly in the sense vector of type B:

...TGT ATCGTGTCCATCGATGTCTG TCG....(100 bases)...CCT GAATTC TATctgggtaccaaccccagaactttccttcct
gagcagagtcaggacatccagtcgcacatgcaaacagcgagctcttccttccctctgcagggctatccctatcagtcccctggtcttcccagtcccccctatcagctgatga
CG GTCGAC CTA...(100 bases)...GCG CTCGAC GTTGCATTGTTCGT CA...... TGT ATCGTGTCCATCGATGTCTG TCG .... (100 bases) ... CCT GAATTC TA T ctgggtaccaaccccagaactttccttcct
gagcagagtcaggacatccagtcgcacatgcaaacagcgagctcttccttccctctgcagggctatccctatcagtcccctggtcttcccagtcccccctatcagctgatga
CG GTCGAC CTA ... (100 bases) ... GCG CTCGAC GTTGCATTGTTCGT CA ...

En caso de necesidad se puede insertar en sentido antiparalelo mediante su clonación en el plásmido antisense de tipo B empleando para ello las dianas de restricción EcoRI y Sall dando por resultado:If necessary, it can be inserted in antiparallel sense by cloning in the antisense plasmid Type B using the EcoRI restriction targets and Sall resulting in:

...TGT ATCGTGTCCATCGATGTCTG TCG....(100 bases)...CCT GTCGAC CGTcatcagctgataggggggactgggaag
accaggggactgatagggatagccctgcagagggaaggaagagctcgctgtttgcatgtgcgactggatgtcctgactctgctcaggaaggaaagttctggggttggtac
ccagaTA GAATTC CTA...(100 bases)...GCG CTC GACGTTGCATTGTTCGT CA...... TGT ATCGTGTCCATCGATGTCTG TCG .... (100 bases) ... CCT GTCGAC CG T catcagctgataggggggactgggaag
accaggggactgatagggatagccctgcagagggaaggaagagctcgctgtttgcatgtgcgactggatgtcctgactctgctcaggaaggaaagttctggggttggtac
GAATTC CTA ... (100 bases) ... GCG CTC GACGTTGCATTGTTCGT CA ...

Con estas construcciones es posible llevar a cabo reacciones de PCR para optimizar las reacciones que usan todas las posibles combinaciones de oligonucleótidos. Seguidamente se muestra una tabla con los tamaños de amplificón esperados cuando se usan estas combinaciones de oligonucleótidos en los dos tipos de vectores:With these constructions it is possible to carry conduct PCR reactions to optimize the reactions that all use the possible combinations of oligonucleotides. Then it shows a table with the expected amplification sizes when use these combinations of oligonucleotides in the two types of vectors: 

       \newpage\ newpage

Vector sense de tipo BVector sense of type B Vector antisense de tipo BAntisense vector of type B 5'-RACE/sensel5'-RACE / sensel no aplicableno applicable 257 pb257 bp 5'-RACE/antisensel5'-RACE / antisensel 174 pb174 bp no aplicableno applicable 5'-RACE/sense25'-RACE / sense2 no aplicableno applicable 216 pb216 bp 5'-RACE/antisense25'-RACE / antisense2 215 pb215 bp no aplicableno applicable 3'-RACE/sensel3'-RACE / sensel 257 pb257 bp no aplicableno applicable 3'-RACE/antisense13'-RACE / antisense1 no aplicableno applicable 174 pb174 bp 3'-RACE/sense23'-RACE / sense2 216 pb216 bp no aplicableno applicable 3'-RACE/antisense23'-RACE / antisense2 no aplicableno applicable 215 pb215 bp

Claims (22)

1. Procedimiento para optimizar los oligonucleótidos y las condiciones de amplificación mediante PCR usadas para RACE, caracterizado porque el gen de interés/fragmento de cDNA problema es clonado en una construcción genética, que comprende los oligonucleótidos 5'-RACE y 3'-RACE flanqueando las extremidades del gen de interés/fragmento de cDNA problema.1. Method for optimizing oligonucleotides and PCR amplification conditions used for RACE, characterized in that the gene of interest / fragment of the cDNA problem is cloned into a genetic construct, comprising oligonucleotides 5'-RACE and 3'-RACE flanking the limbs of the gene of interest / fragment of cDNA problem. 2. Procedimiento para optimizar los oligonucleótidos y las condiciones de amplificación mediante PCR usadas para RACE, según reivindicación 1, caracterizado porque incluye los siguientes pasos:2. Method for optimizing oligonucleotides and PCR amplification conditions used for RACE, according to claim 1, characterized in that it includes the following steps:
a)to)
clonaje del gen de interés/fragmento de cDNA problema en una construcción genética que comprende los oligonucleótidos 5'-RACE y 3'-RACE flanqueando las extremidades del gen de interés/fragmento de cDNA problema;cloning of the gene of interest / fragment of cDNA problem in a genetic construct that includes the 5'-RACE and 3'-RACE oligonucleotides flanking the extremities of the gene of interest / cDNA fragment trouble;
b)b)
amplificación de fragmentos de DNA mediante PCR a partir del vector citado en el apartado a), usando un oligonucleótido de secuencia conocida del gen de interés/fragmento de cDNA problema y otro correspondiente al 5'-RACE o al 3'-RACE;amplification of DNA fragments by PCR from the vector cited in section a), using an oligonucleotide of known sequence of the gene from interest / fragment of cDNA problem and other corresponding to 5'-RACE or 3'-RACE;
c)C)
determinación del tamaño de los amplificones obtenidos.size determination amplifications obtained.
3. Construcción genética utilizada en el procedimiento de las reivindicaciones 1 y 2, caracterizada porque comprende una secuencia de nucleótidos en el cual se puede clonar cualquier gen de interés/fragmento de cDNA problema, y cuyas extremidades están flanqueadas por los oligonucleótidos 5'-RACE y 3'-RACE.3. Genetic construction used in the method of claims 1 and 2, characterized in that it comprises a nucleotide sequence in which any gene of interest / problem cDNA fragment can be cloned, and whose limbs are flanked by the 5'-RACE oligonucleotides and 3'-RACE. 4. Construcción genética utilizada en el procedimiento de las reivindicaciones 1 y 2, según la reivindicación 3, caracterizada porque comprende un polylinker flanqueado por los oligonucleótidos 5'-RACE y 3'-RACE.4. Genetic construction used in the method of claims 1 and 2, according to claim 3, characterized in that it comprises a polylinker flanked by the 5'-RACE and 3'-RACE oligonucleotides. 5. Construcción genética utilizada en el procedimiento de las reivindicaciones 1 y 2, según las reivindicaciones 3 y 4, caracterizada porque el gen de interés/fragmento de cDNA problema se clona en un polylinker.5. Genetic construction used in the method of claims 1 and 2, according to claims 3 and 4, characterized in that the gene of interest / problem cDNA fragment is cloned into a polylinker. 6. Vector de clonaje/expresión utilizado en el procedimiento de las reivindicaciones 1 y 2, caracterizado porque es una estructura circular cerrada y comprende la construcción genética según las reivindicaciones 3 a 5.6. Cloning / expression vector used in the process of claims 1 and 2, characterized in that it is a closed circular structure and comprises the genetic construction according to claims 3 to 5. 7. Vector de clonaje/expresión utilizado en el procedimiento de las reivindicaciones 1 y 2, según reivindicación 6, caracterizado porque ha sido denominado por vector "sense" de tipo A.7. Cloning / expression vector used in the method of claims 1 and 2, according to claim 6, characterized in that it has been referred to as a "sense" vector of type A. 8. Construcción genética utilizada en el procedimiento de las reivindicaciones 1 y 2, según la reivindicación 3 y 4, caracterizada porque el gen de interés/fragmento de cDNA problema se clona en un polylinker en orientación antisentido, permitiendo el clonaje en orientación antisentido.8. Genetic construction used in the method of claims 1 and 2, according to claim 3 and 4, characterized in that the gene of interest / fragment of the problem cDNA is cloned in a polylinker in antisense orientation, allowing cloning in antisense orientation. 9. Vector de clonaje/expresión utilizado en el procedimiento de las reivindicaciones 1 y 2, caracterizado porque es una estructura circular cerrada y comprende la construcción genética según la reivindicación 8.9. Cloning / expression vector used in the method of claims 1 and 2, characterized in that it is a closed circular structure and comprises the genetic construction according to claim 8. 10. Vector de clonaje/expresión utilizado en el procedimiento de las reivindicaciones 1 y 2, según reivindicación 9, caracterizado porque ha sido denominado por vector "antisense" de tipo A.10. Cloning / expression vector used in the method of claims 1 and 2, according to claim 9, characterized in that it has been referred to as an "antisense" type A vector. 11. Construcción genética utilizada en el procedimiento de las reivindicaciones 1 y 2, según la reivindicación 3, caracterizada porque comprende una zona de clonaje con extremos T protuberantes flanqueado por los oligonucleótidos 5'-RACE y 3'-RACE, y que dispone de, al menos, una diana de restricción entre la zona de clonaje y cada una de las secuencias de oligonucleótidos 5'-RACE y 3'-RACE.11. Genetic construction used in the method of claims 1 and 2, according to claim 3, characterized in that it comprises a cloning zone with protruding T-ends flanked by the 5'-RACE and 3'-RACE oligonucleotides, and having, at least one restriction target between the cloning zone and each of the 5'-RACE and 3'-RACE oligonucleotide sequences. 12. Construcción genética utilizada en el procedimiento de las reivindicaciones 1 y 2, según la reivindicación 11, caracterizada porque el gen de interés/fragmento de cDNA problema se clona en la zona con extremos T protuberantes.12. Genetic construction used in the method of claims 1 and 2, according to claim 11, characterized in that the gene of interest / problem cDNA fragment is cloned in the area with protruding T-ends. 13. Construcción genética utilizada en el procedimiento de las reivindicaciones 1 y 2, según las reivindicaciones 11 y 12, caracterizada porque el gen de interés/fragmento de cDNA problema se obtiene necesariamente por PCR.13. Genetic construction used in the process of claims 1 and 2, according to claims 11 and 12, characterized in that the gene of interest / problem cDNA fragment is necessarily obtained by PCR. 14. Vector de clonaje/expresión utilizado en el procedimiento de las reivindicaciones 1 y 2, caracterizado porque es una estructura linear abierta y comprende la construcción genética según las reivindicaciones 11 a 13.14. Cloning / expression vector used in the process of claims 1 and 2, characterized in that it is an open linear structure and comprises the genetic construction according to claims 11 to 13. 15. Vector de clonaje/expresión utilizado en el procedimiento de las reivindicaciones 1 y 2, según reivindicación 14, caracterizado porque ha sido denominado por vector "sense" de tipo B.15. Cloning / expression vector used in the method of claims 1 and 2, according to claim 14, characterized in that it has been referred to as a "sense" vector of type B. 16. Construcción genética utilizada en el procedimiento de las reivindicaciones 1 y 2, según la reivindicación 11, caracterizada porque el gen de interés/fragmento de cDNA problema se clona en la zona con extremos T protuberantes y las dianas de restricción se disponen en orientación antisentido con respecto a las secuencias de oligonucleótidos 5'-RACE y 3'-RACE, permitiendo el clonaje en orientación antisentido.16. Genetic construction used in the method of claims 1 and 2, according to claim 11, characterized in that the gene of interest / problem cDNA fragment is cloned in the area with protruding T-ends and the restriction targets are arranged in antisense orientation. with respect to the 5'-RACE and 3'-RACE oligonucleotide sequences, allowing cloning in antisense orientation. 17. Construcción genética utilizada en el procedimiento de las reivindicaciones 1 y 2, según la reivindicación 16, caracterizada porque el gen de interés/fragmento de cDNA problema se obtiene necesariamente por PCR.17. Genetic construction used in the method of claims 1 and 2, according to claim 16, characterized in that the gene of interest / problem cDNA fragment is necessarily obtained by PCR. 18. Vector de clonaje/expresión utilizado en el procedimiento de las reivindicaciones 1 y 2, caracterizado porque es una estructura linear abierta y comprende la construcción genética según la reivindicación 16 y 17.18. Cloning / expression vector used in the process of claims 1 and 2, characterized in that it is an open linear structure and comprises the genetic construction according to claim 16 and 17. 19. Vector de clonaje/expresión utilizado en el procedimiento de las reivindicaciones 1 y 2, según reivindicación 18, caracterizado porque ha sido denominado por vector "antisense" de tipo B.19. Cloning / expression vector used in the method of claims 1 and 2, according to claim 18, characterized in that it has been referred to as an "antisense" type B vector. 20. Vector de clonaje/expresión utilizado en el procedimiento de las reivindicaciones 1 y 2, según reivindicaciones 6, 7, 9, 10, 14, 15, 18 y 19 caracterizado porque pertenece, entre otros, al grupo de plásmidos, fagos, cósmidos y derivados.20. Cloning / expression vector used in the process of claims 1 and 2, according to claims 6, 7, 9, 10, 14, 15, 18 and 19 characterized in that it belongs, inter alia, to the group of plasmids, phages, cosmids and derivatives. 21. Uso de la construcción genética utilizada en el procedimiento de las reivindicaciones 1 y 2, según las reivindicaciones 3, 4, 5, 8, 11, 12, 13, 16 y 17 para el chequeo del grado de compatibilidad de diversos oligonucleótidos diseñados a partir de la secuencia de dicho gen de interés/fragmento de cDNA problema, con los oligonucleótidos 5'-RACE y 3'-RACE y que permita optimizar las condiciones de amplificación mediante PCR adecuadas para obtener el amplificón específico.21. Use of genetic construction used in the method of claims 1 and 2, according to the claims 3, 4, 5, 8, 11, 12, 13, 16 and 17 for the check of the degree of compatibility of various oligonucleotides designed to from the sequence of said gene of interest / cDNA fragment problem, with the 5'-RACE oligonucleotides and 3'-RACE and that allows to optimize the conditions of PCR amplification suitable for obtaining amplification specific. 22. Uso del vector de clonaje/expresión utilizado en el procedimiento de las reivindicaciones 1 y 2, según las reivindicaciones 6, 7, 9, 10, 14, 15, 18, 19 y 20 para el chequeo del grado de compatibilidad de diversos oligonucleótidos diseñados a partir de la secuencia de dicho gen de interés/fragmento de cDNA problema, con los oligonucleótidos 5'-RACE y 3'-RACE y que permita optimizar las condiciones de amplificación mediante PCR adecuadas para obtener el amplificón específico.22. Use of the cloning / expression vector used in the process of claims 1 and 2, according to claims 6, 7, 9, 10, 14, 15, 18, 19 and 20 for the compatibility check of various oligonucleotides designed from the sequence of said gene of interest / fragment of cDNA problem, with oligonucleotides 5'-RACE and 3'-RACE and allow optimize amplification conditions by appropriate PCR to get the specific amplifier.
ES200301290A 2003-05-30 2003-05-30 OPTIMIZATION PROCEDURE FOR OLIGONUCLEOTIDES AND AMPLIFICATION CONDITIONS BY PCR FOR RACE (5 'AND 3'-RAPID AMPLIFICATION OF CDNA ENDS). Expired - Fee Related ES2257895B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
ES200301290A ES2257895B1 (en) 2003-05-30 2003-05-30 OPTIMIZATION PROCEDURE FOR OLIGONUCLEOTIDES AND AMPLIFICATION CONDITIONS BY PCR FOR RACE (5 'AND 3'-RAPID AMPLIFICATION OF CDNA ENDS).

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
ES200301290A ES2257895B1 (en) 2003-05-30 2003-05-30 OPTIMIZATION PROCEDURE FOR OLIGONUCLEOTIDES AND AMPLIFICATION CONDITIONS BY PCR FOR RACE (5 'AND 3'-RAPID AMPLIFICATION OF CDNA ENDS).

Publications (2)

Publication Number Publication Date
ES2257895A1 ES2257895A1 (en) 2006-08-01
ES2257895B1 true ES2257895B1 (en) 2008-03-16

Family

ID=36829490

Family Applications (1)

Application Number Title Priority Date Filing Date
ES200301290A Expired - Fee Related ES2257895B1 (en) 2003-05-30 2003-05-30 OPTIMIZATION PROCEDURE FOR OLIGONUCLEOTIDES AND AMPLIFICATION CONDITIONS BY PCR FOR RACE (5 'AND 3'-RAPID AMPLIFICATION OF CDNA ENDS).

Country Status (1)

Country Link
ES (1) ES2257895B1 (en)

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2246623A1 (en) * 1998-10-07 2000-04-07 Manjula Das Oligonucleotide primers that destabilize non-specific duplex formation and reduce mispriming during cdna library construction and uses thereof
AU4609301A (en) * 1999-11-02 2001-05-14 Curagen Corporation Method of identifying a nucleic acid sequence

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
YE Z. et al. "cDNA cloning by amplification of circularized first strand cDNAs reveals non-IRE-regulated iron-responsive mRNAs." Biochem. Biophys. Res. Commun. 2000, Agosto 18; 275 (1): 223-227. *

Also Published As

Publication number Publication date
ES2257895A1 (en) 2006-08-01

Similar Documents

Publication Publication Date Title
JP7431891B2 (en) High-specificity genome editing using chemically modified guide RNAs
Lehmann et al. The importance of internal loops within RNA substrates of ADAR1
Van Dijk et al. Library preparation methods for next-generation sequencing: tone down the bias
ES2550237T3 (en) Transposon end compositions and methods for modifying nucleic acids
US20030049616A1 (en) Enzymatic synthesis of oligonucleotide tags
JP2020188812A (en) Novel processes for production of oligonucleotides
ES2914591T3 (en) Novel procedures for the production of oligonucleotides
JP7432521B2 (en) Novel small molecule activating RNA
Beaudry et al. An efficient strategy for the synthesis of circular RNA molecules.
CN106192019A (en) For preparing compositions and the method for sequencing library
JPH06510669A (en) Nucleic acid extension assay
Kumar et al. Locked nucleic acid (LNA) enhances binding affinity of triazole-linked DNA towards RNA
CN114981426A (en) Synthetic guide RNA, compositions, methods and uses thereof
KR20140027814A (en) Method for amplifying dna from rna in a sample
US9695417B2 (en) Method for large-scale synthesis of long-chain nucleic acid molecule
ES2257895B1 (en) OPTIMIZATION PROCEDURE FOR OLIGONUCLEOTIDES AND AMPLIFICATION CONDITIONS BY PCR FOR RACE (5 'AND 3'-RAPID AMPLIFICATION OF CDNA ENDS).
Rivera et al. Expression of bacteriophage M13 DNA in vivo. Localization of the transcription initiation and termination signal of the mRNA coding for the major capsid protein
Balke et al. In vitro repair of a defective EGFP transcript and translation into a functional protein
JP5129498B2 (en) Nucleic acid cloning method
US20210180053A1 (en) Synthetic rnas and methods of use
JP2021151200A (en) Methods for producing linked dna and vector combinations for use therein
Eremeeva et al. Enzymatic synthesis using polymerases of modified nucleic acids and genes
EP3375876A1 (en) Method for producing double stranded polynucleotides based on oligonucleotides with selected and different melting temperatures
Stevenson et al. Universal CG cloning of polymerase chain reaction products
US6653108B2 (en) Process for selective amplification of a full-length cDNA involving an anchor nucleic acid

Legal Events

Date Code Title Description
EC2A Search report published

Date of ref document: 20060801

Kind code of ref document: A1

FG2A Definitive protection

Ref document number: 2257895B1

Country of ref document: ES

FD2A Announcement of lapse in spain

Effective date: 20180808