EP4702145A2 - Modified guide rna - Google Patents

Modified guide rna

Info

Publication number
EP4702145A2
EP4702145A2 EP24730119.5A EP24730119A EP4702145A2 EP 4702145 A2 EP4702145 A2 EP 4702145A2 EP 24730119 A EP24730119 A EP 24730119A EP 4702145 A2 EP4702145 A2 EP 4702145A2
Authority
EP
European Patent Office
Prior art keywords
sgrna
nucleotides
sequence
modified
upper stem
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
EP24730119.5A
Other languages
German (de)
French (fr)
Inventor
Brian CAFFERTY
Ho YAU
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Beam Therapeutics Inc
Original Assignee
Beam Therapeutics Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Beam Therapeutics Inc filed Critical Beam Therapeutics Inc
Publication of EP4702145A2 publication Critical patent/EP4702145A2/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102—Mutagenizing nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases [RNase]; Deoxyribonucleases [DNase]
    • C12N9/222—Clustered regularly interspaced short palindromic repeats [CRISPR]-associated [CAS] enzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/315—Phosphorothioates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/34—Spatial arrangement of the modifications
    • C12N2310/344—Position-specific modifications, e.g. on every purine, at the 3'-end
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/50—Methods for regulating/modulating their activity
    • C12N2320/52—Methods for regulating/modulating their activity modulating the physical stability, e.g. GC-content

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The present invention relates to modified gRNA molecules, compositions and methods for site specific gene editing and genomic modification, such as DNA cleavage, and gene activation or repression. The present modified guide RNAs have modified secondary structure (e.g., long upper stem and a modified hairpin structure), which target the target DNA sequence specifically with reduced off-target activity.

Description

Attorney Docket No. BEM-020WO1 Modified Guide RNA CROSS REFERENCE TO RELATED APPLICATIONS [0001] The present application claims priority to U.S. Provisional Application No. 63/462,873, entitled “Modified guide RNA”, filed on April 28, 2023; the contents of which are incorporated herein by reference in their entirety. CROSS REFERENCE TO SEQUENCE LISTING [0002] The present application is being filed with an electronically filed Sequence Listing in XML format. The sequence listing file entitled “BEM_020WO1_SL_xml” was created on April 26, 2024, and is 63,829 bytes in size; the information in electronic format of the Sequence Listing is incorporated herein by reference in its entirety. BACKGROUND [0003] Nuclease, Cas9 is guided to specific DNA sequences, i.e., targeting sequences by small RNA molecules termed guide RNA (gRNA) for genetic modification. CRISPR-Cas9 activity is dependent on the sequence and structure of the gRNA. A complete guide RNA comprises tracrRNA (trRNA) and crisprRNA (crRNA). A crRNA comprising a guide region which can form a complete gRNA when being associated covalently or noncovalently with a trRNA. The trRNA and crRNA may be contained within a single guide RNA (sgRNA) or in two separate RNA molecules. [0004] Guide RNA, either a single guide RNA (sgRNA) or as two separate crRNA and tracRNA molecules, forms common secondary structures, particularly the scaffold sequence of a guide RNA. However, the formation of unwanted secondary structures within the guide RNA (gRNA) can inhibit CRISPR-Cas9 system. [0005] Modifications of guide RNAs that increase stability and on-target specificity would be useful. SUMMARY OF THE INVENTION [0006] The present the application provides, among other things, modified gRNA molecules, compositions and methods for site specific gene editing and genomic modification, such as DNA cleavage, and gene activation or repression. The present modified guide RNAs have modified secondary structure (e.g., long upper stem and a modified hairpin Attorney Docket No. BEM-020WO1 structure). Modified gRNAs, provided herein, result in decreased of off-target activity, all while maintaining the ability to target a DNA sequence specifically. [0007] In one aspect, the invention includes using modified single guide RNAs (sgRNAs) that enhance genome editing, e.g., editing of a target nucleic acid in a primary cell (e.g., cultured in vitro for use in ex vivo therapy) or in a cell in a subject such as a human. The present invention also provides methods for treating a disease in a subject by enhancing precise genome editing to correct a mutation in a target gene associated with the disease. The present invention can be used with any cell type and at any gene locus that is amenable to nuclease-mediated genome editing technology. [0008] In one aspect, the present invention provides a modified guide RNA (gRNA) comprising a long (or extended) upper stem including more than 4 base pairs formed by complementary nucleotides, wherein one or more or all nucleotides of the upper stem are chemically modified nucleotides. In some embodiments, the long (or extended) upper stem includes 4-8 base pairs formed by complementary nucleotides, wherein one or more or all nucleotides of the upper stem are modified nucleotides. In one embodiment, the nucleotides of the extended upper stem are all chemically modified. [0009] In some embodiments, the modified gRNA comprises a long upper stem region comprising 5-15 base pairs formed by complementary nucleotides. In one embodiment, the long upper stem region comprises 5 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the long upper stem region comprises 6 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the long upper stem region comprises 7 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the long upper stem region comprises 8 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the long upper stem region comprises 9 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the long upper stem region comprises 10 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the long upper stem region comprises 11 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the long upper stem region comprises 12 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the long upper stem region comprises 13 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the Attorney Docket No. BEM-020WO1 long upper stem region comprises 14 base pairs formed by complementary nucleotides. In one embodiment, the long upper stem region comprises 15 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the long upper stem region comprises 15-20 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the long upper stem region comprises 20-200 base pairs formed by complementary nucleotides ((e.g., chemically modified nucleotides). In one embodiment, the long upper stem region comprises 20-40, 40- 80, 80-120, 120-160 or 160-200 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). [0010] In some embodiments, all the nucleotides of the upper stem of the modified gRNA described herein are chemically modified nucleotides. In other embodiments, at least 80%, at least 85%, at least 90%, or at least 95% of the nucleotides of the upper stem of the modified gRNA are chemically modified nucleotides. [0011] In some embodiments, the modified gRNA described herein further comprises one or more modified nucleotides within the hairpin 1 and hairpin 2 regions. In some embodiments, all the nucleotides within the hairpins 1 and 2 regions are modified nucleotides. In other embodiments, at least 80%, at least 85%, at least 90%, or at least 95% of the nucleotides within the hairpins 1 and 2 regions of the modified gRNA are modified nucleotides. [0012] In some embodiments, the modified gRNA described herein further comprises a modified stable hairpin 1 region, wherein the modified stable hairpin 1 region comprises an extended stem region comprising more than 4 base pairs and wherein the loop of hairpin 1 comprises locked nucleic acid. In some embodiments, the extended stem region of the modified stable hairpin comprises 8 base pairs. [0013] In one embodiment, the present invention provides a single guide RNA (sgRNA) comprising a sequence of GUUUUAGA NxnGAAA NynAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGU CGGUGCUUUU (SEQ ID NO: 23), wherein Nxn and Nyn have the same number of nucleotides and are complementary nucleotides to form base pairs, and wherein the nucleotides of Nxn and Nyn are backbone modified nucleotides, and wherein n is an integral number from 5-15. In some embodiments, GAAA is the GNRA tetraloop that is used to lock the structure of the hairpin. Other GNRA tetraloops include but are not limited to GUGA, Attorney Docket No. BEM-020WO1 GCAA, GAGA, GUAA, GGGA, GCGA, and GGAA. In some embodiments, another RNA tetraloop UNCG is incorporated to the sgRNA to lock the structure of the hairpin. Exemplary UNCG tetraloops include but are not limited to UUCG, UACG, UCCG and UGCG. In some embodiments, the 5’ and 3’ end nucleotides of the sgRNA are backbone modified nucleotides. As a non-limiting example, the sgRNA comprises a sequence of GUUUUAGA m(Nxn)mGmAmAmA m(Nyn)AAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAm AmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmUmUmUmU (SEQ ID NO: 24) , wherein “m” stands for 2’-OMe modification. [0014] In some examples, the Nx and Ny include 5 nucleotides respectively that are complementary nucleotides and that form the upper stem region of the sgRNA, and wherein the sgRNA comprises the sequence of GUUUUAGANxNxNxNxNxGAAANyNyNyNyNyAAGUUAAAAUAAGGCUAGUCCGUUA UCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 2). In some examples, each of the Nx and Ny nucleotides is backbone modified. As a non-limiting example, the sgRNA comprises a sequence of GUUUUAGAmNxmNxmNxmNxmNxmGmAmAmAmNymNymNymNymNyAAGUUAAA AUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCm AmCmCmGmAmGmUmCmGmGmUmGmCmUmUmUmU (SEQ ID NO: 25), wherein “m” stands for 2’-OMe modification. [0015] In some examples, the Nx and Ny include 6 nucleotides respectively that are complementary nucleotides and that form the upper stem region of the sgRNA, and wherein the sgRNA comprises the sequence of GUUUUAGANxNxNxNxNxNxGAAANyNyNyNyNyNyAAGUUAAAAUAAGGCUAGUCCG UUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO:3). In some examples, each of the Nx and Ny nucleotides is backbone modified. As a non-limiting example, the sgRNA comprises a sequence of GUUUUAGAmNxmNxmNxmNxmNxmNxmGmAmAmAmNymNymNymNymNymNyAAGUU AAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmG mCmAmCmCmGmAmGmUmCmGmGmUmGmCmUmUmUmU (SEQ ID NO: 26), wherein “m” stands for 2’-OMe modification. [0016] In some examples, the Nx and Ny include 7 nucleotides respectively that are complementary nucleotides and that form the upper stem region of the sgRNA, and wherein Attorney Docket No. BEM-020WO1 the sgRNA comprises the sequence of GUUUUAGANxNxNxNxNxNxNxGAAANyNyNyNyNyNyNyAAGUUAAAAUAAGGCUAGU CCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 4). In some examples, each of the Nx and Ny nucleotides is backbone modified. As a non-limiting example, the sgRNA comprises a sequence of GUUUUAGAmNxmNxmNxmNxmNxmNxmNxmGmAmAmAmNymNymNymNymNymNymNy AAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGm UmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmUmUmUmU (SEQ ID NO: 27), wherein “m” stands for 2’-OMe modification. [0017] In some examples, the Nx and Ny include 8 nucleotides respectively that are complementary nucleotides and that form the upper stem region of the sgRNA, and wherein the sgRNA comprises the sequence of GUUUUAGANxNxNxNxNxNxNxNxGAAANyNyNyNyNyNyNyNyAAGUUAAAAUAAGGCU AGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 5). In some examples, each of the Nx and Ny nucleotides is backbone modified. As a non- limiting example, the sgRNA comprises a sequence of GUUUUAGAmNxmNxmNxmNxmNxmNxmNxmNxmGmAmAmAmNymNymNymNymNymNy mNymNyAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmA mAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCUmUmUmU (SEQ ID NO: 28), wherein “m” stands for 2’-OMe modification. [0018] In some examples, the Nx and Ny include 9 nucleotides respectively that are complementary nucleotides and that form the upper stem region of the sgRNA, and wherein the sgRNA comprises the sequence of GUUUUAGANxNxNxNxNxNxNxNxNxGAAANyNyNyNyNyNyNyNyNyAAGUUAAAAUAAG GCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 6). In some examples, each of the Nx and Ny nucleotides is backbone modified. As a non-limiting example, the sgRNA comprises a sequence of GUUUUAGAmNxmNxmNxmNxmNxmNxmNxmNxmNxmGmAmAmAmNymNymNymNymNy mNymNymNymNyAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAm AmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmUmUmUm U (SEQ ID NO: 29), wherein “m” stands for 2’-OMe modification. [0019] In some examples, the Nx and Ny include 10 nucleotides respectively that are complementary nucleotides and that form the upper stem region of the sgRNA, and wherein Attorney Docket No. BEM-020WO1 the sgRNA comprises the sequence of GUUUUAGANxNxNxNxNxNxNxNxNxNxGAAANyNyNyNyNyNyNyNyNyNyAAGUUAAAAU AAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 7). In some examples, each of the Nx and Ny nucleotides is backbone modified. As a non-limiting example, the sgRNA comprises a sequence of GUUUUAGAmNxmNxmNxmNxmNxmNxmNxmNxmNxmNxmGmAmAmAmNymNymNymNy mNymNymNymNymNymNyAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmU mGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU mUmUmU (SEQ ID NO: 30), wherein “m” stands for 2’-OMe modification. [0020] In one embodiment, the present invention provides a sgRNA comprising the sequence of GUUUUAGAGCGCGGAAACGCGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAC UUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 8). In one embodiment, the present invention provides a sgRNA comprising the sequence of GUUUUAGAmGmCmGmCmGmGmAmAmAmCmGmCmGmCAAGUUAAAAUAAGGC UAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmG mAmGmUmCmGmGmUmGmCmUmUmUmU (SEQ ID NO: 31), wherein “m” stands for 2’-OMe modification. [0021] In another embodiment, the sgRNA of the present invention comprise the sequence of GUUUUAGAGCCGGCGGAAACGCCGGCAAGUUAAAAUAAGGCUAGUCCGUUAU CAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 9). In another embodiment, the sgRNA of the present invention comprise the sequence of GUUUUAGAmGmCmCmGmGmCmGmGmAmAmAmCmGmCmCmGmGmCAAGUUAA AAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmC mAmCmCmGmAmGmUmCmGmGmUmGmCmUmUmUmU (SEQ ID NO: 32), wherein “m” stands for 2’-OMe modification. [0022] In some embodiments, one or more nucleotides within the hairpin 1 and hairpin 2 regions of the sgRNA described herein are modified nucleotides. In other embodiments, all the nucleotides within the hairpin 1 and hairpin 2 regions of the sgRNA described herein are modified nucleotides. In some embodiments, the loop of hairpin 1 of the sgRNA described herein comprises 2′-O-methyl modified nucleotides (e.g., 2′-O-methyl 3′-phosphorothioate (MS) nucleotide, 2′-O-methyl 3′-thioPACE (MSP) nucleotide), 2’-F modified nucleotides, Attorney Docket No. BEM-020WO1 locked nucleic acid, MOE (methoxyethyl), DNA nucleotides functionalized for conjugation, and a combination thereof. [0023] In some embodiments, the present invention provides a single guide RNA (sgRNA) comprising a sequence of GUUUUAGANxnGAAANynAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGGAC UUUGGUCCAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 10), wherein Nxn and Nyn have the same number of nucleotides and are complementary nucleotides to form base pairs, and wherein the nucleotides of Nxn and Nyn are modified nucleotides and wherein n is an integral number from 5-15, e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, and 15. In some embodiments, the nucleotides of Nxn and Nyn are 2′-O-methyl modified nucleotides. In one example, the sgRNA comprises a sequence of GUUUUAGAm(Nxn)mGmAmAmAm(Nyn)AAGUUAAAAUAAGGCUAGUCCGUUAUC mAmAmCmUmUmGmGmAmCmUmUmUmGmGmUmCmCmAmAmGmUmGmGmCmA mCmCmGmAmGmUmCmGmGmUmGmCmUmUmUmU (SEQ ID NO: 33), wherein “m” stands for 2’-OMe modification. [0024] In some examples, the Nx and Ny include 5 nucleotides respectively that are complementary nucleotides and that form the upper stem region of the sgRNA, and wherein the sgRNA comprises the sequence of GUUUUAGANxNxNxNxNxGAAANyNyNyNyNy AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGGACUUUGGUCCAAGUGGCA CCGAGUCGGUGCUUUU (SEQ ID NO: 11). In some embodiments, each of the Nx and Ny nucleotides is backbone modified. As a non-limiting example, the sgRNA comprises a sequence of GUUUUAGAmNxmNxmNxmNxmNxmGmAmAmAmNymNymNymNymNy AAGUUAAAAUAAGGCUAGUCCGUUAUCmAmAmCmUmUmGmGmAmCmUmUmU mGmGmUmCmCmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmC mUmUmUmU (SEQ ID NO: 34), wherein “m” stands for 2’-O-methyl modification. [0025] In some examples, the Nx and Ny include 6 nucleotides respectively that are complementary nucleotides and that form the upper stem region of the sgRNA, and wherein the sgRNA comprises the sequence of GUUUUAGANxNxNxNxNxNxGAAANyNyNyNyNyNy AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGGACUUUGGUCCAAGUGGCA CCGAGUCGGUGCUUUU (SEQ ID NO.12). In some embodiments, each of the Nx and Ny nucleotides is backbone modified. As a non-limiting example, the sgRNA comprises a sequence of GUUUUAGAmNxmNxmNxmNxmNxmNxmGmAmAmAmNymNymNymNymNymNy Attorney Docket No. BEM-020WO1 AAGUUAAAAUAAGGCUAGUCCGUUAUCmAmAmCmUmUmGmGmAmCmUmUmU mGmGmUmCmCmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmC mUmUmUmU (SEQ ID NO: 35), wherein “m” stands for 2’-OMe modification. [0026] In some examples, the Nx and Ny include 7 nucleotides respectively that are complementary nucleotides and that form the upper stem region of the sgRNA, and wherein the sgRNA comprises the sequence of GUUUUAGANxNxNxNxNxNxNxGAAANyNyNyNyNyNyNyAAGUUAAAAUAAGGCUAGU CCGUUAUCAACUUGGACUUUGGUCCAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 13). In some embodiments, each of the Nx and Ny nucleotides is backbone modified. As a non-limiting example, the sgRNA comprises a sequence of GUUUUAGAmNxmNxmNxmNxmNxmNxmNxmGmAmAmAmNymNymNymNymNymNymNy AAGUUAAAAUAAGGCUAGUCCGUUAUCmAmAmCmUmUmGmGmAmCmUmUmU mGmGmUmCmCmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmC mUmUmUmU (SEQ ID NO: 36), wherein “m” stands for 2’-OMe modification. [0027] In some examples, the Nx and Ny include 8 nucleotides respectively that are complementary nucleotides and that form the upper stem region of the sgRNA, wherein the sgRNA comprises the sequence of GUUUUAGANxNxNxNxNxNxNxNxGAAANyNyNyNyNyNyNyNyAAGUUAAAAUAAGGCU AGUCCGUUAUCAACUUGGACUUUGGUCCAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 14). In some embodiments, each of the Nx and Ny nucleotides is backbone modified. As a non-limiting example, the sgRNA comprises a sequence of GUUUUAGAmNxmNxmNxmNxmNxmNxmNxmNxmGmAmAmAmNymNymNymNymNymNy mNymNyAAGUUAAAAUAAGGCUAGUCCGUUAUCmAmAmCmUmUmGmGmAmCm UmUmUmGmGmUmCmCmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGm UmGmCmUmUmUmU (SEQ ID NO: 37), wherein “m” stands for 2’-OMe modification. [0028] In some examples, the Nx and Ny include 9 nucleotides respectively that are complementary nucleotides and that form the upper stem region of the sgRNA, and wherein the sgRNA comprises the sequence of GUUUUAGANxNxNxNxNxNxNxNxNxGAAANyNyNyNyNyNyNyNyNyAAGUUAAAAUAAG GCUAGUCCGUUAUCAACUUGGACUUUGGUCCAAGUGGCACCGAGUCGGUGCUU UU (SEQ ID NO: 15). In some embodiments, each of the Nx and Ny nucleotides is backbone modified. As a non-limiting example, the sgRNA comprises a sequence of GUUUUAGAmNxmNxmNxmNxmNxmNxmNxmNxmNxmGmAmAmAmNymNymNymNymNy Attorney Docket No. BEM-020WO1 mNymNymNymNyAAGUUAAAAUAAGGCUAGUCCGUUAUCmAmAmCmUmUmGmG mAmCmUmUmUmGmGmUmCmCmAmAmGmUmGmGmCmAmCmCmGmAmGmUmC mGmGmUmGmCmUmUmUmU (SEQ ID NO: 38), wherein “m” stands for 2’-OMe modification. [0029] In some examples, the Nx and Ny include 10 nucleotides respectively that are complementary nucleotides and that form the upper stem region of the sgRNA, and wherein the sgRNA comprises the sequence of GUUUUAGANxNxNxNxNxNxNxNxNxNxGAAANyNyNyNyNy NyNyNyNyNyAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGGACUUUGGUCCA AGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 16). In some embodiments, each of the Nx and Ny nucleotides is backbone modified. As a non-limiting example, the sgRNA comprises a sequence of GUUUUAGAmNxmNxmNxmNxmNxmNxmNxmNxmNxmNxmGmAmAmAmNymNymNymNy mNymNymNymNymNyAAGUUAAAAUAAGGCUAGUCCGUUAUCmAmmNyAmCmUm UmGmGmAmCmUmUmUmGmGmUmCmCmAmAmGmUmGmGmCmAmCmCmGmAm GmUmCmGmGmUmGmCmUmUmUmU (SEQ ID NO: 39), wherein “m” stands for 2’- OMe modification. [0030] In one embodiment, the sgRNA described herein comprises the sequence of GUUUUAGAGCCGGCGGAAACGCCGGCAAGUUAAAAUAAGGCUAGUCCGUUAU CAACUUGGACUUUGGUCCAAGUUUUU (SEQ ID NO: 17). In some embodiments, the sgRNA comprises backbone modified nucleotides. As a non-limiting example, the sgRNA comprises GUUUUAGAmGmCmCmGmGmCmGmGmAmAmAmCmGmCmCmGmGmCAAGUUAA AAUAAGGCUAGUCCGUUAUCmAmAmCmUmUmGmGmAmCmUmUmUmGmGmUm CmCmAmAmGmUmUmUmUmU (SEQ ID NO:40) (m = 2’-OMe modification). [0031] In some embodiments, the present invention provides a single guide RNA (sgRNA) comprising a sequence of GUUUUAGANxnGAAANynAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGGAC NzNzNzNzGUCCAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 41), wherein Nxn and Nyn have the same number of nucleotides and are complementary nucleotides to form base pairs, and wherein the nucleotides of Nxn and Nyn are modified nucleotides and wherein n is an integral number from 5-15, and wherein the 4 nucleotides of the loop of hairpin 1 (NzNzNzNz) comprises a sequence of UUCG, CUUG or GCAA. Attorney Docket No. BEM-020WO1 [0032] In some embodiments, the sgRNA comprising a longer upper stem and a stable hair pin includes one or more modified nucleotides within the hairpin 1 and hairpin 2 regions. In other examples, the sgRNA comprising a longer upper stem and a stable hair pin includes the modified nucleotides within the hairpin 1 and hairpin 2 regions. The modifications include 2′-O-methyl modified nucleotides (e.g., 2′-O-methyl 3′-phosphorothioate (MS) nucleotide, 2′-O-methyl 3′-thioPACE (MSP) nucleotide), 2’-F modified nucleotides and a combination thereof. [0033] In one example, at least one modification comprises a 2’-O’methyl (2’-O-Me) modified nucleotide. [0034] In some embodiments, the loop of hairpin 1 comprises locked nucleic acid. [0035] In some embodiments, the gRNA described herein further comprises a spacer sequence at the 5′′′ end of the sgRNA; the spacer sequence comprises a sequence complementary to a target sequence of interest. In some embodiments, the spacer sequence comprises about 18-25, or 18-30, or 20-25, 20-30, 15-50, 20-50, or 20-40 nucleotides. As non-limiting examples, the spacer sequence comprises 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45 or 50 nucleotides. [0036] In some embodiments, the 3’ end of the sgRNA described herein is modified. [0037] In some embodiments, the 5′ end of the sgRNA described herein is modified. [0038] In some embodiments, the 3’ and 5′ ends of the sgRNA described herein are modified. [0039] In some embodiments, at least the first three nucleotides at the 5′ end of the sgRNA described herein are modified nucleotides. [0040] In one embodiment, the sgRNA described herein comprises a modification at the 5′ end of the sequence and a modification at the 3’ end of the sequence. [0041] In some embodiments, about 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 75%, 80%, 90% or 100% of the nucleotides of the sgRNA described herein are modified nucleotides. [0042] In one example, a gRNA described herein comprises a sequence as set forth in SEQ ID NO: 20. In one example, a gRNA described herein comprises a sequence as set forth in SEQ ID NO: 21. In one example, a gRNA described herein comprises a sequence as set Attorney Docket No. BEM-020WO1 forth in SEQ ID NO: 51. In one example, a gRNA described herein comprises a sequence as set forth in SEQ ID NO: 52. [0043] In some embodiments, the sgRNA described herein further comprises a nuclear localization sequence (NLS). [0044] In some embodiments, the sgRNA described herein comprises about 102-150 nucleotides, about 102-120 nucleotides, or about 100-180 nucleotides. [0045] In some embodiments, the sgRNA of the present invention increases the gene modification efficacy about 2 to1000-fold, or about 2 to 100-fold, or about 2 to10-fold. As non limiting examples, the sgRNA described herein increases the gene modification efficacy about 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 550,, 600, 650, 700, 750, 800, 900 or 1000 fold. [0046] In another aspect of the present invention, provide includes a gene modification system comprising, (a) a CRISPR-associated protein (Cas) polypeptide, or variant thereof; and (b) a single guide RNA (sgRNA) described herein. [0047] In some embodiments, the Cas polypeptide is a Cas9 protein, including but not limited to an S. pyogenes Cas9 and an S. aureus Cas9. [0048] In some embodiment, the Cas9 polypeptide is a nickase or a dCas9. [0049] In some embodiments, provided also includes a composition comprising a single guide RNA described herein. The composition may further comprise a Cas9 polypeptide, or variant thereof. In some examples, the Cas polypeptide is a Cas9 protein, dCas9 or a nickase. [0050] In some embodiments, the composition described herein is formulated in a lipid nanoparticle. [0051] In another aspect, the present invention provides a method for modifying a target gene in a cell comprising introducing into the cell a gene editing system comprising a single guide RNA (sgRNA) of the present invention. [0052] In some embodiments, the method comprises introducing into the cell a modified single guide RNA (sgRNA) comprising a first nucleotide sequence that is complementary to the target nucleic acid and a second nucleotide sequence that interacts with a CRISPR- associated protein (Cas) polypeptide, wherein one or more of the nucleotides in the first nucleotide sequence and/or the second nucleotide sequence are modified nucleotides; and a Attorney Docket No. BEM-020WO1 Cas polypeptide, an mRNA encoding a Cas polypeptide, and/or a recombinant expression vector comprising a nucleotide sequence encoding a Cas polypeptide. BRIEF DESCRIPTON OF THE DRAWINGS [0053] FIG.1A shows the hairpin structures of exemplary end-modified sgRNA, standard heavily modified sgRNA modification and a LONGEST gRNA design including 5 base pair in the upper stem of the gRNA. The chemical modified sgRNAs (end mod. and heavily mod.) include only 4 base pairs in the upper stem. [0054] FIG.1B shows an exemplary ALAS1 targeted editing in liver demonstrated that the editing potency decreased when the hairpin of the gRNA was extended without nucleotide modification. The editing potency increased when extended in combination with nucleotide modification. gRNA9 comprises an extended upper stem (LONGEST 1) without modifications internally including the upper stem of the extended hairpin. sgRNA 10 comprises another extended upper stem (LONGEST 2) without modifications internally including the upper stem of the extended hairpin. sgRNA3 is LONGEST1 including 2’OMe modified nucleotides (the sequence as set forth in SEQ ID NO: 51). The ALAS1 editing was with base editor ABE8.8. [0055] FIG.2A shows the hairpin structures of an ALAS1 targeting gRNA with end- modifications (gRNA 1, or standard-heavy modifications (gRNA 2) or LONGEST 1 with nucleotide modifications (gRNA 3). [0056] FIG.2B shows the ALAS1 targeting gRNA editing potency in Lipid 1 at different doses . [0057] FIG.2C shows the ALAS1 targeting gRNA editing potency in Lipid 2 at different dose. [0058] FIG.3A shows the hairpin structures of a gRNA with end-modifications (EM), LONGEST-modifications, GOLD modifications, or LONGEST_GOLD combination modifications. [0059] FIG.3B shows in vitro editing potencies of different gRNA modifications at three different target sites (TSBTx3228, TSBTx3215 and TSBTx3222). [0060] FIG.4A shows the hairpin structures of gRNA 4 (standard end-modifications), gRNA 5 (GOLD modification) and gRNA 6(LONGEST-GOLD modifications). Attorney Docket No. BEM-020WO1 [0061] FIG.4B shows the editing potencies of gRNA 4, gRNA 5 and gRNA 6 after 5 days. [0062] FIG.5 shows the editing potencies of three new hairpin extensions in ALAS1 targeting gRNAs: LONGEST 3, LONGEST 4 and unmodified LONGEST 4, as compared to the same gRNA with standard heavy modifications (Heavy-mod), end-modifications, or LONGEST modifications. DETAILED DESCRIPTION Definitions [0063] In order for the present invention to be more readily understood, certain terms are first defined below. Additional definitions for the following terms and other terms are set forth throughout the specification. [0064] The articles “a” and “an” are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element. [0065] The term “approximately” or “about,” as used herein, as applied to one or more values of interest, refers to a value that is similar to a stated reference value. In certain embodiments, the term “approximately” or “about” refers to a range of values that fall within 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value). [0066] For the recitation of numeric ranges herein, each intervening number there between with the same degree of precision is explicitly contemplated. For example, for the range of 6-9, the numbers 7 and 8 are contemplated in addition to 6 and 9, and for the range 6.0-7.0, the number 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 are explicitly contemplated. [0067] As used herein, when used to define products, compositions and methods, the term “comprising” is intended to mean that the products, compositions and methods include the referenced components or steps, but not excluding others. The terms “comprise(s),” “include(s),” “having,” “has,” “can,” “contain(s),” and variants thereof, as used herein, are Attorney Docket No. BEM-020WO1 intended to be open-ended transitional phrases, terms, or words that do not preclude the possibility of additional acts or structures. The term “consisting essentially of” shall mean excluding other components or steps of any essential significance. Thus, a composition consisting essentially of the recited components would not exclude trace contaminants and pharmaceutically acceptable carriers. “Consisting of” shall mean excluding more than trace elements of other components or steps. [0068] Administering: As used herein, the term “administering” includes oral administration, topical contact, administration as a suppository, intravenous, intraperitoneal, intramuscular, intralesional, intrathecal, intranasal, or subcutaneous administration to a subject. Administration is by any route, including parenteral and transmucosal (e.g., buccal, sublingual, palatal, gingival, nasal, vaginal, rectal, or transdermal). Parenteral administration includes, e.g., intravenous, intramuscular, intra-arteriole, intradermal, subcutaneous, intraperitoneal, intraventricular, and intracranial. Other modes of delivery include, but are not limited to, the use of liposomal formulations, intravenous infusion, transdermal patches, etc. [0069] Binding region: The term “binding region”, as used herein refers to the region within a nuclease target region that is recognized and bound by the nuclease, such as Cas9. [0070] Complementary: The term “complementarity” as used herein refers to the ability of a nucleic acid to form hydrogen bond(s) with another nucleic acid sequence by either traditional Watson-Crick or other non-traditional types. A percent complementarity indicates the percentage of residues in a nucleic acid molecule which can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 being 50%, 60%, 70%, 80%, 90%, and 100% complementary). “Perfectly complementary” means that all the contiguous residues of a nucleic acid sequence will hydrogen bond with the same number of contiguous residues in a second nucleic acid sequence. “Substantially complementary” as used herein refers to a degree of complementarity that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%.97%, 98%, 99%, or 100% over a region of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, or more nucleotides, or refers to two nucleic acids that hybridize under stringent conditions. [0071] Effective amount: The term “effective amount” as used herein refers to the amount of an agent (e.g., Cas nuclease, modified single guide RNA, etc.) that is sufficient to effect beneficial or desired results. The therapeutically effective amount may vary depending upon one or more of: the subject and disease condition being treated, the weight and age of the Attorney Docket No. BEM-020WO1 subject, the severity of the disease condition, the manner of administration and the like, which can readily be determined by one of ordinary skill in the art. The specific amount may vary depending on one or more of: the particular agent chosen, the target cell type, the location of the target cell in the subject, the dosing regimen to be followed, whether it is administered in combination with other agents, timing of administration, and the physical delivery system in which it is carried. [0072] Efficiency: The term “efficiency” as used herein refers to the editing efficiency, or editing percentage; that is the total number of sequence reads with insertions or deletions of nucleotides into the target region of interest over the total number of sequence reads following cleavage by a gene editing system of the present disclosure. [0073] Genome: The term “genome” as used herein refers to the complete set of genes or genetic material present in a cell or organism. The genome includes DNA or RNA in RNA viruses. The genome includes both the genes, (the coding regions), the noncoding DNA and the genomes of the mitochondria and chloroplasts. [0074] Genome editing: The term “genome editing” as used herein refers to changing a gene. Genome editing may include correcting or restoring a mutant gene. Genome editing may include knocking out a gene, such as a mutant gene or a normal gene. Genome editing may be used to treat disease or enhance muscle repair by changing the gene of interest. [0075] Guide RNA or gRNA: As used herein, the terms “guide RNA” and ‘gRNA” are used interchangeably. “guide RNA”, ‘gRNA,” “single gRNA,” and “sgRNA” as used interchangeably herein refer to a short synthetic RNA composed of a “scaffold” sequence necessary for Cas9-binding or Cpf1-binding and a user-defined “spacer” or “targeting sequence” (also referred to herein as a protospacer-targeting sequence or segment) which defines the genomic target to be modified. “Modified gRNA” as used herein refers to a gRNA that has additional nucleotides or nucleotide modifications. [0076] Hybridization: As used herein, “hybridization” means the pairing or annealing of complementary oligonucleotides and/or nucleic acids. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases. [0077] crRNA: As used herein, the term“crRNA” refers to an RNA sequence comprising a sequence that is complementary to and recognizes a targeting nucleic acid sequence and a tracrRNA recognition sequence that is bound to or is capable of binding to tracrRNA. The Attorney Docket No. BEM-020WO1 tracRNA recognition portion of crRNA may bind to tracrRNA via hybridization or covalent attachment. [0078] tracRNA: As used herein, the term “tracrRNA” means a nucleic acid sequence that can non-covalently bind to a Cas9 protein and that can bind to a crRNA sequence via hybridization or covalent attachment. In some embodiments, the tracrRNA and crRNA sequences can form a single guide RNA. [0079] Hairpin: The term “Hairpin” as used herein describes a duplex of nucleic acids that is created when a nucleic acid strand folds and forms base pairs with another section of the same strand. A hairpin may form a structure that comprises a loop or a U-shape. In some embodiments, a hairpin may be comprised of an RNA loop. Hairpins can be formed with two complementary sequences in a single nucleic acid molecule bind together, with a folding or wrinkling of the molecule. In some embodiments, hairpins comprise stem or stem loop structures. In the context of the modified gRNA described herein, a “hairpin region” refers to hairpin 1 and hairpin 2 from the 5′ end to the 3’ end of the gRNA. A conserved portion of a gRNA locates between hairpin 1 and hairpin 2 of the gRNA. [0080] Stem loop: As used herein, the term “stem loop” describes a secondary structure of nucleotides that form a base-paired “stem” that ends in a loop of unpaired nucleic acids. A stem may be formed when two regions of the same nucleic acid strand are at least partially complementary in sequence when read in opposite directions. [0081] Loop: the term “loop” as used herein describes a region of nucleotides that do not base pair (i.e., are not complementary) that may cap a stem. For example, a “tetraloop” describes a loop of 4 nucleotides. In some embodiments, the upper stem of a modified gRNA may comprise a tetraloop. In some embodiments, GAAA is the GNRA tetraloop that is used to lock the structure of the hairpin. In some embodiments, the tetraloop is ANYA, CUYG, GNRA, UNAC, or UNCG. [0082] Pharmaceutically acceptable carrier: The term “pharmaceutically acceptable carrier” refers to a substance that aids the administration of an agent (e.g., Cas nuclease, modified single guide RNA, etc.) to a cell, an organism, or a subject. “Pharmaceutically acceptable carrier” refers to a carrier or excipient that can be included in a composition or formulation and that causes no significant adverse toxicological effect on the patient. Non- limiting examples of pharmaceutically acceptable carrier include water, NaCl, normal saline solutions, lactated Ringer's, normal sucrose, normal glucose, binders, fillers, disintegrants, Attorney Docket No. BEM-020WO1 lubricants, coatings, sweeteners, flavors and colors, and the like. One of skill in the art will recognize that other pharmaceutical carriers are useful in the present invention. [0083] Modified or modification: As used herein, the term “modified” or “modification” refers to, in the context of guide RNA, various modifications, e.g., 2′-O-methyl modified nucleotides (e.g., 2′-O-methyl 3′-phosphorothioate (MS) nucleotide, 2′-O-methyl 3′- thioPACE (MSP) nucleotide), 2’-F modified nucleotides, locked nucleic acid, MOE (methoxyethyl), DNA nucleotides functionalized for conjugation, and a combination thereof. [0084] Nucleic acid: As used herein, the terms “nucleic acid” or “oligonucleotide” or “polynucleotide” as used herein means at least two nucleotides covalently linked together. The depiction of a single strand also defines the sequence of the complementary strand. Thus, a nucleic acid also encompasses the complementary strand of a depicted single strand. Many variants of a nucleic acid may be used for the same purpose as a given nucleic acid. Thus, a nucleic acid also encompasses substantially identical nucleic acids and complements thereof. A single strand provides a probe that may hybridize to a target sequence under stringent hybridization conditions. Thus, a nucleic acid also encompasses a probe that hybridizes under stringent hybridization conditions. Nucleic acids may be single stranded or double stranded, or may contain portions of both double stranded and single stranded sequence. The nucleic acid may be DNA, both genomic and cDNA, RNA, or a hybrid, where the nucleic acid may contain combinations of deoxyribo- and ribo-nucleotides, and combinations of bases including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine hypoxanthine, isocytosine and isoguanine. Nucleic acids may be produced by chemical synthesis methods or by recombinant methods. [0085] On-target site: The term “on-target site” as used herein refers to the target region or sequence in a genome to which the gRNA is intended to target. Ideally, the on-target site has perfect homology (100% identity or homology) to the target DNA sequence with no homology elsewhere in the genome. [0086] Off-target site: The term “off-target site” as used herein refers to a region of the genome which has partial homology or partial identity to the on-target site or target region of the gRNA, but which the gRNA is not intended or designed to target. [0087] Subject: The terms “subject,” “patient,” and “individual” are used herein interchangeably to include a human or animal. For example, the animal subject may be a mammal, a primate (e.g., a monkey), a livestock animal (e.g., a horse, a cow, a sheep, a pig, or a goat), a companion animal (e.g., a dog, a cat), a laboratory test animal (e.g., a mouse, a Attorney Docket No. BEM-020WO1 rat, a guinea pig, a bird), an animal of veterinary significance, or an animal of economic significance. [0088] Treat: The term “treating” as used herein refers to an approach for obtaining beneficial or desired results including but not limited to a therapeutic benefit and/or a prophylactic benefit. By therapeutic benefit is meant any therapeutically relevant improvement in or effect on one or more diseases, conditions, or symptoms under treatment. For prophylactic benefit, the compositions may be administered to a subject at risk of developing a particular disease, condition, or symptom, or to a subject reporting one or more of the physiological symptoms of a disease, even though the disease, condition, or symptom may not have yet been manifested. Modified guide RNA (gRNA) [0089] Provided herein are modified guide RNAs (gRNAs) for use in gene editing methods. In accordance with the present disclosure, modified gRNAs provided herein comprise a long or extended upper stem structure . Modified guide RNAs provided herein may comprise an extended upper stem and a stable locked hairpin structure. In some aspects, modified guide RNAs provided herein are single guide RNAs (sgRNAs). The modified sgRNAs of the present disclosure are more stable and show improved efficacy in gene editing as compared to the non-modified sgRNAs. Long/extended upper stem [0090] In one aspect, modified gRNAs provided herein are modified single guide RNAs (sgRNAs) comprising a long (or extended) upper stem including more than 4 base pairs formed by complementary nucleotides, wherein one or more nucleotides of the upper stem are chemically modified. Exemplary modifications include 2’OMe modification, such as 2′- O-methyl (M) nucleotides, 2′-O-methyl 3′-phosphorothioate (MS) nucleotides, 2′-O-methyl 3′-thioPACE (MSP) nucleotides, or combinations thereof. [0091] In some embodiments, the modified sgRNA described herein comprises a long upper stem region comprising 5-15 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the long upper stem region comprises 5 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the long upper stem region comprises 6 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the Attorney Docket No. BEM-020WO1 long upper stem region comprises 7 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the long upper stem region comprises 8 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the long upper stem region comprises 9 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the long upper stem region comprises 10 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the long upper stem region comprises 11 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the long upper stem region comprises 12 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the long upper stem region comprises 13 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the long upper stem region comprises 14 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). In one embodiment, the long upper stem region comprises 15 base pairs formed by complementary nucleotides (e.g., chemically modified nucleotides). [0092] In some embodiments, the nucleotides of the upper stem of the modified sgRNA described herein are all modified nucleotides. In other embodiments, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of the nucleotides of the upper stem of the modified sgRNA are chemically modified nucleotides. [0093] In some embodiments, the sgRNA described herein comprises an upper stem modification, wherein the upper stem modification comprises a modification to any one or more of nucleotides in the upper stem region. [0094] In some embodiments, the sgRNA comprises an upper stem modification, wherein the upper stem modification comprises a modification of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in the upper stem region. [0095] In some embodiments, the gRNA comprises an upper stem modification, wherein the upper stem modification comprises a modification of about 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, 1- 10, 1-12, 1-14, 1-16, 2-4, 2-6, 2-8, 2-10, 2-12, 2-16, 2-18, 2-20, 4-8, 4-10, 6-12, 6-18, 6-20, 8-10, 8-18, 8-20, or 10-20 nucleotides in the upper stem region. [0096] In some embodiments, the modified nucleotides within the upper stem region of the sgRNA comprise the same chemical modifications. In other embodiments, the modified Attorney Docket No. BEM-020WO1 nucleotides within the upper stem region of the sgRNA comprise different chemical modifications. [0097] In some embodiments, the sgRNA comprises an upper stem modification, wherein the upper stem modification comprises a 2’-OMe modified nucleotide. In some embodiments, the upper stem modification comprises a 2’-O-MOE modified nucleotide. In some embodiments, the upper stem modification comprises a 2’-F modified nucleotide. In some embodiments, the upper stem modification comprises a 2’-Ome modified nucleotide, a 2’-O- MOE modified nucleotide, a 2’-F modified nucleotide, and/or combinations thereof. Stable hairpins [0098] In some embodiments, the sgRNA described herein is further modified to comprise highly stable hairpin structures. The modified sgRNA described herein further comprises one or more modified nucleotides within the hairpin 1 and hairpin 2 regions. In some embodiments, all the nucleotides within the hairpins 1 and 2 regions are modified nucleotides. In other embodiments, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of the nucleotides within the hairpins 1 and 2 regions of the modified sgRNA are chemically modified nucleotides. In some embodiments, all the nucleotides within the hairpins 1 are 2 are chemically modified. [0099] In some embodiments, the modified sgRNA described herein further comprises a modified stable hairpin 1 region, wherein the modified stable hairpin 1 region comprises an extended stem region comprising more than 4 base pairs and wherein the loop of hairpin 1 comprises locked nucleic acids. In some embodiments, the extended stem region of the modified stable hairpin comprises 8 base pairs. In some embodiments, the extended stem region of the modified stable hairpin comprises 8 base pairs formed by chemically modified nucleotides. As a non-limiting example, all the nucleotides of the hairpin comprises comprise 2’-O-methyl modification. [0100] The highly stable hairpin of a sgRNA refers to a “locked” hairpin. The locked hairpin comprises a locked backbone, e.g., by incorporating one or more locked nucleic acid. As used herein, the term “locked nucleic acid” refers to a bicyclic RNA analogue in which the ribose is locked in a C3′-endo conformation by introduction of a 2′-O,4′-C methylene bridge. Desirable LNA monomers and their method of synthesis also are disclosed in U.S. Pat. Nos.6,043,060, 6,268,490, PCT Publications WO 01/07455, WO 01/00641, WO Attorney Docket No. BEM-020WO1 98/39352, WO 00/56746, WO 00/56748 and WO 00/66604 as well as in the following papers: Morita et al., Bioorg. Med. Chem. Lett.12(1):73-76, 2002; Hakansson et al., Bioorg. Med. Chem. Lett.11(7):935-938, 2001; Koshkin et al., J. Org. Chem.66(25):8504-8512, 2001; Kvaerno et al., J. Org. Chem.66(16):5498-5503, 2001; Halkansson et al., J. Org. Chem.65(17):5161-5166, 2000; Kvaerno et al., J. Org. Chem.65(17):5167-5176, 2000; Pfundheller et al., Nucleosides Nucleotides 18(9):2017-2030, 1999; and Kumar et al, Bioorg. Med. Chem. Lett.8(16):2219-2222, 1998. [0101] In some examples, the hairpin region comprises locked nucleic acids or LNAs containing the 2′-O, 4′-C-methylene ribonucleoside (structure A) wherein the ribose sugar moiety is in a “locked” conformation. The hairpin region comprises at least one 2′,4′-C- bridged 2′ deoxyribonucleoside (CDNA, structure B). See, e.g., U.S. Pat. No.6,403,566 and Wang et al. (1999) Bioorganic and Medicinal Chemistry Letters, Vol.9: 1147-1150, both of which are herein incorporated by reference in their entireties. Locked nucleic acids (LNA™) are a class of high-affinity RNA analogs in which the ribose ring is “locked” in the ideal conformation for Watson-Crick binding. LNA™ oligonucleotides exhibit high thermal stability when hybridized to a complementary DNA or RNA strand. In addition, LNA™ oligonucleotides can be made shorter than traditional DNA or RNA oligonucleotides and still retain a high Tm. LNA™ oligonucleotides can consist of a mixture of LNA™ and DNA or RNA. Incorporation of LNA™ into oligonucleotides has been shown to improve sensitivity and specificity for many hybridization-based technologies including PCR, microarray and in situ hybridization. Chemical modifications [0102] In some embodiments, the modified gRNA further comprises one or more chemically modified nucleotides. In some embodiments, such modified nucleosides comprise a modified sugar moiety or a modified nucleobase or both a modified sugar moiety and a modified nucleobase. [0103] In some embodiments, the modified sgRNA comprise one or more modified nucleosides comprising a modified sugar moiety. Such modified sgRNA comprising one or more sugar-modified nucleosides may have desirable properties, such as enhanced nuclease stability or increased binding affinity with a target nucleic acid relative to guide RNA lacking such sugar-modified nucleosides. In certain embodiments, modified sugar moieties are linearly modified sugar moieties. In certain embodiments, modified sugar moieties are bicyclic or tricyclic sugar moieties. In certain embodiments, modified sugar moieties are Attorney Docket No. BEM-020WO1 sugar surrogates. Such sugar surrogates may comprise one or more substitutions corresponding to those of substituted sugar moieties. [0104] In certain embodiments, modified sugar moieties are linearly modified sugar moieties comprising a furanosyl ring with one or more acyclic substituent, including but not limited to substituents at the 2′ and/or 5′ positions. Examples of 2′-substituent groups suitable for linearly modified sugar moieties include but are not limited to: 2′-F, 2′-OCH3 (“Ome” or “O-methyl”), and 2′-O(CH2)2OCH3 (“MOE”). In certain embodiments, 2′-substituent groups are selected from among: halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, O—C1- C10 alkoxy, O—C1-C10 substituted alkoxy, O—C1-C10 alkyl, O—C1-C10 substituted alkyl, S- alkyl, N(Rm)-alkyl, O-alkenyl, S-alkenyl, N(Rm)-alkenyl, O-alkynyl, S-alkynyl, N(Rm)- alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2ON(Rm)(Rn) or OCH2C(═O)—N(Rm)(Rn), where each Rm and Rn is, independently, H, an amino protecting group, or substituted or unsubstituted C1-C10 alkyl. Certain embodiments of these 2′-substituent groups can be further substituted with one or more substituent groups independently selected from among: hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl and alkynyl. Examples of 5′-substituent groups suitable for linearly modified sugar moieties include but are not limited to: 5′-methyl (R or S), 5′-vinyl, and 5′-methoxy. In certain embodiments, linearly modified sugars comprise more than one non-bridging sugar substituent, for example, 2′-F-5′-methyl sugar moieties (see, e.g., PCT International Application WO 2008/101157, for additional 2′, 5′-bis substituted sugar moieties and nucleosides). [0105] In certain embodiments, a 2′-substituted nucleoside or 2′-linearly modified nucleoside comprises a sugar moiety comprising a linear 2′-substituent group selected from: F, NH, N, OCF, OCH, O(CH)NH, CHCH═CH, OCHCH═CH, OCHCHOCH, O(CH)SCH, O(CH)ON(R )(R), O(CH)O(CH)N(CH), and N-substituted acetamide (OCHC(═O)—N(R )(R)), where each R and R is, independently, H, an amino protecting group, or substituted or unsubstituted C-C alkyl. [0106] In certain embodiments, a 2′-substituted nucleoside or 2′-linearly modified nucleoside comprises a sugar moiety comprising a linear 2′-substituent group selected from: F, OCF, OCH, OCHCHOCH, O(CH)SCH, O(CH) N(CH), O(CH)O(CH)N(CH), and OCHC(═O)—N(H)CH (“NMA”). Attorney Docket No. BEM-020WO1 [0107] In certain embodiments, a 2′-substituted nucleoside or 2′-linearly modified nucleoside comprises a sugar moiety comprising a linear 2′-substituent group selected from: F, OCH, and OCHCHOCH. [0108] Certain modified sugar moieties comprise a bridging sugar substituent that forms a second ring resulting in a bicyclic sugar moiety. In certain such embodiments, the bicyclic sugar moiety comprises a bridge between the 4′ and the 2′ furanose ring atoms. Examples of such 4′ to 2′ bridging sugar substituents include but are not limited to: 4′-CH-2′, 4′-(CH)-2′, 4′-(CH)-2′, 4′-CH—O-2′ (“LNA”), 4′-CH—S-2′, 4′-(CH)—O-2′ (“ENA”), 4′-CH(CH)— O-2′ (referred to as “constrained ethyl” or “cEt” when in the S configuration), 4′-CH—O— CH-2′, 4′-CH—NI-2′, 4′-CH(CHOCH)—O-2′ (“constrained MOE” or “cMOE”) and analogs thereof (see, e.g., U.S. Pat. No.7,399,845), 4′-C(CH)(CH)—O-2′ and analogs thereof (see, e.g., WO2009/006478), 4′-CH—N(OCH)-2′ and analogs thereof (see, e.g., WO2008/150729), 4′-CH—O—N(CH)-2′ (see, e.g., US2004/0171570), 4′-CH— C(H)(CH)-2′ (see, e.g., Chattopadhyaya, et al., J. Org. Chem., 2009, 74, 118-134), 4′-CH— C(═CH)-2′ and analogs thereof (see, published PCT International Application WO 2008/154401), 4′-C(RRI(R)—O-2′, 4′-C(RRO—N(R)-2′, 4IH—O—N(R)-2′, I 4′-CH— N(R)—O-2′, wherein each R, R, and R is, independently, H, a protecting group, or C- C alkyl (see, e.g. U.S. Pat. No.7,427,672). [0109] In certain embodiments, such 4′ to 2′ bridges independently comprise from 1 to 4 linked groups independently selected from: —[C(R)(R)]—, —[C(R)(R)]—O—, — C(R)═C(R)—, —C(R)═N—, —C(═NR)—, —C(═O)—, —C(═S)—, —O—, —Si(R)—, —S(═O)—, and —N(R)—; wherein X is 0, 1 or 2 and n is 1, 2, 3 or 4. [0110] In some embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration. For example, an LNA nucleoside (described above) may be in the α-L configuration or in the β-D configuration. In other embodiments, modified sugar moieties are sugar surrogates. In certain such embodiments, the oxygen atom of the sugar moiety is replaced, e.g., with a sulfur, carbon or nitrogen atom. In certain such embodiments, such modified sugar moieties also comprise bridging and/or non-bridging substituents as described above. For example, certain sugar surrogates comprise a 4′-sulfur atom and a substitution at the 2′-position (see, e.g., US2005/0130923) and/or the 5′ position. Attorney Docket No. BEM-020WO1 [0111] In some embodiments, the modification in the sugar group can be a modification at the 2′ position of the ribose group. In some instances, the modification at the 2′ position of the ribose group is selected from the group consisting of 2′-O-methyl, 2′-fluoro, 2′-deoxy, and 2′-O-(2-methoxyethyl). [0112] In one embodiment, the one or more modifications in the modified gRNa comprises 2’OMe modification, such as 2′-O-methyl (M) nucleotides, 2′-O-methyl 3′- phosphorothioate (MS) nucleotides, 2′-O-methyl 3′-thioPACE (MSP) nucleotides, or combinations thereof. [0113] In some embodiments, the modified sgRNA comprise one or more nucleoside comprising a modified nucleobase. In certain embodiments, the modified sgRNA comprise one or more nucleoside that does not comprise a nucleobase, referred to as an abasic nucleoside. [0114] In some embodiments, modified nucleobases are selected from: 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and O-6 substituted purines. In certain embodiments, modified nucleobases are selected from: 2-aminopropyladenine, 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2- thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (—C≡C—CH3) uracil, 5- propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, particularly 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7- methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7- deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N- benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines, such as 1,3-diazaphenoxazine-2-one, 1,3-diazaphenothiazine-2-one and 9-(2-aminoethoxy)-1,3- diazaphenoxazine-2-one (G-clamp). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example, 7-deaza- adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. [0115] In some embodiments, nucleosides of modified sgRNAs described herein, may be linked together using any internucleoside linkage. The two main classes of internucleoside linking groups are defined by the presence or absence of a phosphorus atom. Representative Attorney Docket No. BEM-020WO1 phosphorus-containing internucleoside linkages include but are not limited to phosphates, which contain a phosphodiester bond (“P═O”) (also referred to as unmodified or naturally occurring linkages), phosphotriesters, methylphosphonates, phosphoramidates, and phosphorothioates (“P═S”), and phosphorodithioates (“HS—P═S”). Representative non- phosphorus containing internucleoside linking groups include but are not limited to methylenemethylimino (—CH2—N(CH3)—O—CH2—), thiodiester (—O—C(═O)—S—), thionocarbamate (—O—C(═O)(NH)—S—); siloxane (—O—SiH2—O—); and N,N′- dimethylhydrazine (—CH2—N(CH3)—N(CH3)—). Modified internucleoside linkages, compared to naturally occurring phosphate linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide. In certain embodiments, internucleoside linkages having a chiral atom can be prepared as a racemic mixture, or as separate enantiomers. Representative chiral internucleoside linkages include but are not limited to alkylphosphonates and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous-containing internucleoside linkages are well known to those skilled in the art. [0116] Neutral internucleoside linkages include, without limitation, phosphotriesters, methylphosphonates, MMI (3′-CH2—N(CH3)—O-5′), amide-3 (3′-CH2—C(═O)—N(H)-5′), amide-4 (3′-CH2—N(H)—C(═O)-5′), formacetal (3′-O—CH2—O-5′), methoxypropyl, and thioformacetal (3′-S—CH2—O-5′). Further neutral internucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research; Y. S. Sanghvi and P. D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral internucleoside linkages include nonionic linkages comprising mixed N, O, S and CH2 component parts. [0117] In some embodiments, the one or more chemical modification in the phosphate group can be a phosphorothioate modification. [0118] In some embodiments, the modified sgRNA comprises one modified nucleotide at the 5′-end (e.g., the terminal nucleotide at the 5′-end) or near the 5′-end (e.g., within 1, 2, 3, 4, or 5 nucleotides of the terminal nucleotide at the 5′-end) of the modified gRNA nucleotide sequence and/or one modified nucleotide at the 3′-end (e.g., the terminal nucleotide at the 3′- end) or near the 3′-end (e.g., within 1, 2, 3, 4, or 5 nucleotides of the 3′-end) of the modified gRNA nucleotide sequence. Attorney Docket No. BEM-020WO1 [0119] In some embodiments, the modified sgRNA comprises two consecutive or non- consecutive modified nucleotides starting at the 5′-end (e.g., the terminal nucleotide at the 5′- end) or near the 5′-end (e.g., within 1, 2, 3, 4, or 5 nucleotides of the terminal nucleotide at the 5′-end) of the modified gRNA nucleotide sequence and/or two consecutive or non- consecutive modified nucleotides starting at the 3′-end (e.g., the terminal nucleotide at the 3′- end) or near the 3′-end (e.g., within 1, 2, 3, 4, or 5 nucleotides of the 3′-end) of the modified gRNA nucleotide sequence. Other regions and modifications [0120] In some embodiments, the modified gRNA comprises modified nucleotides at the 5′ terminus. In some embodiments, the 5′ terminus of the sgRNA comprises a spacer or guide region that functions to direct a Cas protein, e.g., a Cas9 protein, to a target nucleotide sequence. In some embodiments, the 5′ terminus does not comprise a guide region. In some embodiments, the 5′ terminus comprises a spacer and additional nucleotides that do not function to direct a Cas protein to a target nucleotide region. [0121] The sgRNA has a 3’ end, which is the last nucleotide of the sgRNA. The 3’ terminus region includes the last 1-7 nucleotides from the 3’ end. In some embodiments, the 3’ end is the end of hairpin 2. In some embodiments, the sgRNA comprises nucleotides after the hairpin region(s). In some embodiments, the sgRNA includes a 3’ tail region, in which case the last nucleotide of the 3’ tail is the 3’ terminus. In some embodiments, the 3’ tail comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15 or 20 or more nucleotides, e.g., that are not associated with the secondary structure of a hairpin. In some embodiments, the 3’ tail region comprises 1, 2, 3, or 4 nucleotides that are not associated with the secondary structure of a hairpin. In some embodiments, the 3’ tail region comprises 4 nucleotides that are not associated with the secondary structure of a hairpin. In some embodiments, the 3’ tail region comprises 1, 2, or 3 nucleotides that are not associated with the secondary structure of a hairpin. [0122] In some embodiments, the modified gRNA further comprises a targeting nucleic acid sequence that is complementary to a sequence of a target nucleic acid. The complementary sequence is about 20 nucleotides in length. In some embodiments, at least two, three, four, five, six, seven, eight, nine, ten, or more of the nucleotides in the complementary nucleotide sequence are modified nucleotides. In certain instances, about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 of the nucleotides in the Attorney Docket No. BEM-020WO1 complementary nucleotide sequence (e.g., a first nucleotide sequence of about 20 nucleotides in length) are modified nucleotides. In other instances, all the nucleotides in the complementary nucleotide sequence (e.g., a complementary nucleotide sequence of about 20 nucleotides in length) are modified nucleotides. In some instances, the modified nucleotides are located at the 5′-end (e.g., the terminal nucleotide at the 5′-end) or near the 5′-end (e.g., within 1, 2, 3, 4, or 5 nucleotides of the terminal nucleotide at the 5′-end) of the complementary nucleotide sequence and/or at internal positions within the complementary nucleotide sequence. In other instances, from about 10% to about 30% of the nucleotides in the first nucleotide sequence are modified nucleotides. Exemplary gRNA sequences [0123] In some embodiments, the present disclosure provides a LONGEST gRNA. Table 1 includes some exemplary LONGEST gRNAs with chemical modification. Table 1. Exemplary LONGEST designs with chemical modified nucleotides Na Sequence me U A G C A m C Attorney Docket No. BEM-020WO1 ES T 4 Table 2: Exemplary guide RNA sequences Sequence (5′-3’) GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA m A : U A m C G Attorney Docket No. BEM-020WO1 GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAU(AAGGCUAGUC CGUUAUCmAmAmCmUmUmGmGmAmCmUmUmUmGmGmUmCmCmAmAmGmUmGm C C A Synthesis of modified guide RNA [0124] Described in the present disclosure also include methods for synthesizing a modified gRNA described herein. In some embodiments, a first RNA sequence that is a tran- activating RNA (tracrRNA) and a second RNA sequence that encompasses a clustered regularly interspersed short palindromic repeats (CRISPR) RNA (crRNA) comprising a sequence complementary to a target sequence are provided for synthesizing a modified sgRNA as described herein. [0125] In some embodiments, a first RNA sequence and a second RNA sequence are litigated together. The ligation strategies described herein differ from previously reported chemical ligation strategies used to synthesize synthetic RNAs including guide RNAs. The advantage of using the present segmented synthetic approach is that short sections of RNA can be produced with greater purity post-purification compared to full length gRNA. In this approach the 5′ acceptor is the smallest RNA fragment (about 30-50 nts) and can thus be purified to a high level before ligation. The 3′ donor is terminated with a phosphate that is required for synthesis and thus only the full-length fragment will be incorporated into the full-length product (i.e., truncations are not substrates. [0126] In some embodiments, the present modified gRNA is synthesized using a self- templating approach. The method for synthesizing a modified gRNA comprises providing a first RNA sequence and a second RNA sequence having complementarity, wherein the complementarity allows for base pairing and the creation of a stem loop between the first and Attorney Docket No. BEM-020WO1 the second RNA; ligating the first and second RNA with a ligating enzyme within the stem loop, thus producing a modified gRNA. This allows for the use of a helix, or other structure, which is formed between the first RNA and the second RNA to template an enzymatic ligation of the two RNAs. In some embodiments, the length and sequence composition of the structure formed between the first and the second RNA is modified to promote non-covalent assembly and to create optimal ligation sites for enzymes compatible with RNA ligation. [0127] The complementarity can either be partial or perfect among a stretch of nucleotides of the first and the second RNA sequences. The complementarity allows for base pairing between the complementary nucleotides. In regions where there is partial complementarity, the mismatched nucleotides would result in the formation of a bulge or a loop structure between the first and the second RNA sequences. Various structures of the modified gRNA, such the longest upper stem, a stem loop, a lower stem, hairpins, overhang, blunt end or a bulge can be formed between the first and the second RNA sequences based on hybridization between the two RNA sequences. [0128] Various ligases can be used with the methods described herein. For example, one or more of T4 RNA ligase 1, T4 RNA Ligase 2, RtcB Ligase, Thermo-stable 5′ App DNA/RNA Ligase, ElectroLigase, T4 DNA Ligase, T3 DNA Ligase, T7 DNA Ligase, Taq DNA Ligase, SplintR Ligase E. coli DNA Ligase, 9°N DNA Ligase, CircLigase, CircLigase II, DNA Ligase I, DNA Ligase III, and DNA Ligase IV can be used. In some embodiments, T4 RNA ligase 1 is used to ligate the first RNA and the second RNA at the terminal loop. In some embodiments, T4 RNA ligase 2 is used for ligating the first RNA sequence and the second RNA sequence within the stem formed between the first RNA and the second RNA sequences. [0129] Various kinds of ligation are possible using this approach, such as ligation within a terminal loop of a hairpin formed between the first RNA sequence and the second RNA sequence. Various ligases are suitable for ligation at the terminal loop of a hairpin formed, such as T4 RNA ligase 1. Another kind of ligation that is possible with this approach is ligation within the duplex formed between the first RNA and the second RNA. Various ligases are suitable for ligating at the duplex formed between the two RNAs, such as T4 RNA ligase 2 and DNA ligases. [0130] In some embodiments, a modified gRNA of the present disclosure may be synthesized using a splint templating approach. In some embodiments, a splint is used in the production of the synthetic RNAs. The use of a splint allows for one or more RNA Attorney Docket No. BEM-020WO1 molecules to be brought into physical proximity for the reaction using a splint as a template. When more than two RNAs are to be joined, the use of splints facilitates the production of the synthetic RNAs such as modified sgRNAs described herein. In some embodiments, the splints can be any suitable polymer that is capable of bringing the one or more RNA molecules in close proximity can be used. For example, in some embodiments, the splint is an RNA molecule or a DNA molecule. [0131] In some embodiments, the splint has complementarity to sections of the first RNA sequence and the second RNA sequence. The complementarity can either be partial or perfect. Accordingly, in some embodiments, the method of producing a modified gRNA, is provided comprising providing a first RNA comprising a 5′ phophate; providing a second RNA comprising a free 3′-hydoxyl; providing an oligonucleotide that has partial complementarity to the first RNA and the second RNA, wherein the complementarity of the oligonucleotide allows for base pairing with the first and the second RNA; and providing a ligase to catalyze ligation between the first and the second RNA, thus producing a gRNA. [0132] In some embodiments, a non-templated approach is used to produce a modified sgRNA described herein. In some embodiments of the non-templated approach, a first RNA is provided that has a 5′ phosphate (such as a 5′ monophosphate), and a second RNA is provided that comprises a blocked 3′ end (such as a blocked 3′ OH). The purpose of blocking the 3′ OH of the second RNA is so that the second RNA cannot cyclize through an untemplated mechanism when ligation occurs. For example, using this non-templated approach can comprise a second RNA comprising 3′ hydroxyl of the 3′ terminal end of the donor molecule which is chemically blocked or removed (e.g., dideoxynucleotide) and an enzyme (particularly by T4 RNA Ligase 1) would catalyze proper ligation between the first RNA and the second RNA. In some embodiments, this ligation strategy is carried out at a high concentration. [0133] In some aspects, the non-templating approach of producing a synthetic RNA comprises providing a first RNA comprising a 5′ –monophosphate; providing a second RNA comprising a blocked 3′ end; and providing a ligase to catalyze ligation between the first and the second RNA, thus producing a modified sgRNA described herein. Gene editing system [0134] In accordance with the present disclosure, a gene editing system comprising one or more modified sgRNAs described herein is provided. In some embodiment, the system comprises a CRISPR-Cas9 nuclease or variant thereof. Attorney Docket No. BEM-020WO1 [0135] Various Cas9 nuclease variants, both naturally occurring and genetically engineered, can be included in the preset gene editing system. [0136] In some embodiments, the present invention provides an gene editing system comprising one or modified sgRNAs described herein and a CRISPR-Cas9 nuclease or variant thereof. [0137] In some embodiments, the present invention provides an gene editing system comprising one or modified sgRNAs described herein and a base editor. The base editor may comprise an adenosine deaminase domain or a cytidine deaminase domain. For example, the one or more modified guide RNAs target the base editor to effect an A»T to G*C alteration in a target polynucleotide (e.g., a target gene). In one embodiment, the base editor is a fusion protein comprising one or more domains having base editing activity. [0138] In another embodiment, the protein domains having base editing activity are linked to the guide RNA (e.g., via an RNA binding motif on the guide RNA and an RNA binding domain fused to the deaminase). In some embodiments, the domains having base editing activity are capable of deaminating a base within a nucleic acid molecule. In some embodiments, the base editor is capable of deaminating one or more bases within a DNA molecule. In some embodiments, the base editor is capable of deaminating a cytosine (C) or an adenosine (A) within DNA. In some embodiments, the base editor is capable of deaminating a cytosine (C) and an adenosine (A) within DNA. In some embodiments, the base editor is a cytidine base editor (CBE). In some embodiments, the base editor is an adenosine base editor (ABE). In some embodiments, the base editor is an adenosine base editor (ABE) or variant thereof. For example, the ABE includes but are not limited to ABE8.8, an editor variant ABEV1 (pNMG-B2000(ABE8.20 w/ F149Y “v1”) + S82T) or ABEV2 (pNMG-B2001(ABE8.20 w/ Y147D,F149Y,T166I,D167N “v2”) + S82T). In some embodiments, the base editor is a cytidine base editor (CBE). In some embodiments, the base editor is a nuclease-inactive Cas9 (dCas9) fused to an adenosine deaminase. The base editor, in some cases, may be fused to an inhibitor of base excision repair, for example, a UGI domain, or a dISN domain. In other embodiments the base editor is an abasic base editor. [0139] Detailed descriptions of base editors can be found in PCT patent application publications WO2018/027078, WO2017/070632, WO 2022/204268 and WO2023/114953; the contents of each of which are incorporated herein by reference for all purpose. Formulations and compositions Attorney Docket No. BEM-020WO1 [0140] Modified sgRNAs and gene editing systems of the present disclosure may be formulated in a carrier for delivery and administrations. In some embodiments, the pharmaceutical formulation comprises a lipid nanoparticle (LNP). In some embodiments, the pharmaceutical formulation comprises at least one modified gRNA of the present disclosure. In another embodiment, the pharmaceutical formulation comprises at least one modified gRNA and a Cas9 protein, a polynucleotide encoding a Cas9 protein, or an mRNA encoding a Cas9 protein. [0141] Lipid nanoparticles (LNPs) are a well-known means for delivery of nucleotide and protein cargo, and may be used for delivery of the gRNAs, gene editing systems, compositions, or pharmaceutical formulations disclosed herein. In some embodiments, the LNPs deliver nucleic acid, protein, or nucleic acid together with protein. Accordingly, the present disclosure provides a method for delivering any one of the gRNAs, gene editing systems, compositions, or pharmaceutical formulations disclosed herein to a subject, wherein the gRNA is associated with an LNP. In some embodiments, the gRNA/LNP is also associated with a Cas9 or an mRNA encoding Cas9. In some embodiments, the gRNA/LNP is also associated with a base editor or an mRNA encoding the base editor. [0142] In some embodiments, the invention comprises a composition comprising any one of the gRNAs disclosed and an LNP. In some embodiments, the composition further comprises a Cas9 protein or variant thereof, or an mRNA encoding Cas9 protein or variant thereof. [0143] In some embodiments, the LNP comprises one or more cationic lipids, one or more helper lipids, one or more PEGylated lipids and one or more cholesterol derived lipids. [0144] In some embodiments, compositions comprising modified gRNA, gene editing systems described herein are provided. In some embodiments, the composition is a pharmaceutical composition. In some embodiments, the pharmaceutical composition comprises one or more modified sgRNAs described herein. [0145] Compositions comprising any of the gRNAs and/or gene editing systems described herein and a carrier, excipient, diluent, or the like are encompassed. [0146] In some embodiments. Modified gRNAs, gene editing systems, compositions and formulations disclosed herein are for use in preparing a medicament for treating a disease or disorder. Attorney Docket No. BEM-020WO1 Methods of use [0147] The present disclosure further provides uses of the modified gRNAs described herein to alter the genome of a target nucleic acid in vitro (e.g., cells cultured in vitro for use in ex vivo therapy or other uses of genetically edited cells) or in a cell in a subject such as a human (e.g., for use in in vivo therapy). [0148] In some embodiments, the present invention comprises a method or use of modifying a target nucleic acid molecule comprising, administering or delivering any one or more of the gRNAs gene editing systems compositions, or pharmaceutical formulations described herein. [0149] In some embodiments, the present invention comprises a method or use for modulation of a target gene comprising, administering or delivering any one or more of the gRNAs, gene editing systems, compositions, or pharmaceutical formulations described herein. In some embodiments, the modulation is editing the target gene. In some embodiments, the modulation is a change in expression of the protein encoded by the target gene. [0150] In some embodiments, the method or use results in gene editing. In some embodiments, the method or use results in a double-stranded break within the target gene. In some embodiments, the method or use results in an insertion or deletion of nucleotides in a target gene. In some embodiments, the insertion or deletion of nucleotides in a target gene leads to a frameshift mutation or premature stop codon that results in a non-functional protein. In some embodiments, the insertion or deletion of nucleotides in a target gene leads to a knockdown or elimination of target gene expression. In some embodiments, the method or use further comprises delivering to the cell a template, wherein at least a part of the template incorporates into a target DNA at or near a double strand break site induced by the nuclease. In some embodiments, the method or use results in substitutions. In some embodiments, the gene modulation is an increase or decrease in gene expression, a change in methylation state of DNA, or modification of a histone subunit. In some embodiments, the method or use results in increased or decreased expression of the protein encoded by the target gene. [0151] The efficacy of gRNAs, and/or gene editing systems can be tested in vitro and in vivo. In some embodiments, the invention comprises one or more of the gRNAs, gene editing systems, compositions, or pharmaceutical formulations described herein, wherein the gRNA Attorney Docket No. BEM-020WO1 results in gene modulation when provided to a cell together with Cas9 or mRNA encoding Cas9. In some embodiments, the efficacy of gRNA can be measured in vitro or in vivo. [0152] In some embodiments, the efficiency of a gRNA in increasing or decreasing target protein expression is determined by measuring the amount of target protein. [0153] In some embodiments, the efficiency of editing with specific gRNAs is determined by the editing present at the target location in the genome following delivery of Cas9 and the gRNA. In some embodiments, the efficiency of editing with specific gRNAs is measured by next-generation sequencing. In some embodiments, the editing percentage of the target region of interest is determined. In some embodiments, the total number of sequence reads with insertions or deletions of nucleotides into the target region of interest over the total number of sequence reads is measured following delivery of a modified gRNA, and/or a system or composition comprising a modified gRNA. [0154] In some embodiments, the activity of modified gRNAs is measured after in vivo dosing of LNPs comprising modified gRNAs. [0155] In some embodiments, in vivo efficacy of a gRNA or composition provided herein is determined by editing efficacy measured in DNA extracted from tissue (e.g., liver tissue) after administration of gRNA. [0156] In some embodiments, the method for modulating a target nucleic acid sequence in a cell comprises contacting the cell with a composition comprising a modified sgRNA described herein. Methods of therapeutic uses [0157] In some embodiments, any one or more of the gRNAs, gene editing systems, compositions, or pharmaceutical formulations described herein is for use in preparing a medicament for treating or preventing a disease or disorder in a subject. [0158] In some embodiments, the present invention comprises a method of treating or preventing a disease or disorder in subject comprising administering any one or more of the gRNAs, gene editing systems, compositions, or pharmaceutical formulations described herein. [0159] In some embodiments, the gRNAs, gene editing systems, and compositions increases the editing potency at targeting sites. In some embodiments, the editing potency increases about 10% to 100% as compared to a gRNA without modification. In some embodiments, the Attorney Docket No. BEM-020WO1 editing potency increases 2 to 1000-fold as compared to a gRNA without modification. In some embodiments, the sgRNA of the present invention increases the gene modification efficacy about 2 to1000-fold, or about 2 to100-fold, or about 2 to 50- fold, or about 10 to 50- fold, or about 10 to 20- fold or about 2 to10-fold, or about 2 to 5- fold, or about 3 to 8 fold, or about 2 to 5 fold. As non limiting examples, the sgRNA described herein increases the gene modification efficacy about 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 550,, 600, 650, 700, 750, 800, 900 or 1000-fold. Kits [0160] In another aspect of the present disclosure, provided are kits comprising one or more gRNAs, compositions, or pharmaceutical formulations described herein. In some embodiments, a kit further comprises one or more of a solvent, solution, buffer, each separate from the composition or pharmaceutical formulation, instructions, or desiccant. EXAMPLES [0161] The following examples illustrate certain embodiments of the present invention and are not limiting. Example 1: Editing potency of modified gRNAs [0162] In this example, an ALAS1 (Delta-aminolevulinate synthase 1) gene site was used to evaluate the influence of different hairpin designs on the editing potency of a guide RNA. [0163] As measured for in vivo liver editing (FIG.1A), when the hairpin was extended without modification, the editing potency decreased. However, when the hairpin was extended with modifications, i.e., heavy modifications including all nucleotides, the editing potency increased. [0164] Three different gRNAs targeting ALAS1: gRNA1 (end-modifications), gRNA2 (standard heavy modifications ) and gRNA3 (a heavily modified LONGEST hairpin design) were synthesized (FIG.2A). The editing potency in liver of each gRNA was measured in in both Lipid 1 (FIG.2B) and Lipid 2 (FIG.2C). gRNA3 with the LONGEST design was found to be 2 to 5-fold more potent at sub-saturating dose (8% editing at 0.005 mpk) over gRNA2 with standard heavy modification design for ALAS1. The targeting sequence for ALAS1: CAGGATCCGCACAGACTCCAGGG (SEQ ID NO: 59), and the protospacer sequence: CAGGAUCCGCACAGACUCCA (SEQ ID NO: 60) were used in the study. Attorney Docket No. BEM-020WO1 Table 3: Examples of gRNA designs used in the study Na Sequence me A G m s A m U N [0165] The end modified gRNA is standard design for gRNA used in the prior art (Hendel, Ayal, et al. Nature biotechnology 33.9 (2015):- 3290). The standard heavily modified gRNA without extension of the upper stem region is also used for comparison (Finn, Jonathan D., et al. Cell reports 22.9 (2018): 2227-2235). Both the end modified and heavily modified gRNAs comprises 100 nucleotides in length. In the LONGEST1 design, the hairpin was extended with an additional 3 base pairs compared to end modified gRNA. The unmodified LONGEST1 has the same sequence as LONGEST 1 (SEQ ID NO: 51) but is not modified with 2’OMe internally. It has 106 nts in length. [0166] Riesenberg, et al (Riesenberg, et al, Improved gRNA secondary structures allow editing of target sites resistant to CRISPR-Cas9 cleavage." Nature Communications 13.1 (2022): 1-8) recently reported an engineered gRNA with “locked” hairpins can increase the Attorney Docket No. BEM-020WO1 stability of the engineered gRNA and its editing potency. The LONGEST hairpin and Riesenberg’s GOLD (Genome-Editing Locked Design) hairpin were compared. In vitro editing potencies of each gRNA design (regular end-modifications (EM), LONGEST, GOLD, and combination of LONGEST and GOLD) were measured at three different target sites (TSBTx3288, TSBTx3215, and TSBTx3222), see FIG.3A. The bold nucleotides in each design indicate backbone modified nucleotides (FIG.3A). FIG.3B shows that both the LONGEST design and the GOLD design outperformed the gRNA with end-modifications (EM shown in FIG.3A). About 7-fold increase was observed for the GOLD design as compared to the end-modification design. About 3-fold increase was observed for the LONGEST design as compared to the end-modification design. [0167] A gRNA with both the LONGEST and GOLD designs (LONGEST-GOLD),was synthesized and evaluated for its editing potency (gRNA 6 in FIG.4A). The GOLD- LONGEST design and the GOLD design were evaluated with the current lead guide for the 102 compatible C-kit conditioning program with three different adenine base editors (ABEs) (ABE8.8, ABE9V1 and ABE9V2). As used herein, ABEV1 is an editor variant pNMG-B2000(ABE8.20 w/ F149Y “v1”) + S82T. ABEV2 is an editor variant pNMG- B2001(ABE8.20 w/ Y147D,F149Y,T166I,D167N “v2”) + S82T. [0168] The editing efficacy after 5 days shows that the hairpin extensions increase overall editing of gRNAs at saturating conditions (FIG.4B). Example 2: New extension designs [0169] This study further tested different hairpin extensions in gRNA. Three new hairpin extensions that have less GC content than LONGEST modifications promote the stability of the hairpin. The sequences and modifications of the three gRNA designs are shown in Table 4. LONGEST 3 has 3 additional base pairs with full modification of the upper stem loop. LONGEST 4 has 5 additional base pairs with full modification. unmodified LONGEST 4 has the same extension as LONGEST 4 but is unmodified. Table 4 Name Sequence A A Attorney Docket No. BEM-020WO1 LONGEST 4 mNsmNsmNsNNNNNNNNNNNNNNNNNGUUUUAGAmGmCmUmAmU mGmCmUmGmGmAmAmAmCmAmGmCmAmUmAmGmCAAGUUAAA m U A G potency in vivo against the standard heavy modified and end modified designs and the LONGEST design targeting ALAS1. The results show that LONGEST 4 showed higher potency than the standard heavy modification and end modification designs (FIG.5). The unmodified LONGEST 4 showed lower potency, which demonstrates that extension alone is enough and modification is needed for increasing potency. Similar findings are also observed for LONGEST design. EQUIVALENTS AND SCOPE [0171] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. The scope of the present invention is not intended to be limited to the above description, but rather is as set forth in the following claims:

Claims

Attorney Docket No. BEM-020WO1 CLAIMS 1. A single guide RNA (sgRNA) comprising a long (or extended) upper stem including more than 4 base pairs formed by complementary nucleotides, wherein one or more nucleotides of the upper stem are modified nucleotides. 2. The sgRNA of claim 1, wherein the long upper stem region comprises 5-15 base pairs formed by complementary nucleotides. 3. The sgRNA of claim 2, wherein the long upper stem region comprises 5 base pairs formed by complementary nucleotides. 4. The sgRNA of claim 2, wherein the long upper stem region comprises 6 base pairs formed by complementary nucleotides. 5. The sgRNA of claim 2, wherein the long upper stem region comprises 7 base pairs formed by complementary nucleotides. 6. The sgRNA of claim 2, wherein the long upper stem region comprises 8 base pairs formed by complementary nucleotides. 7. The sgRNA of claim 2, wherein the long upper stem region comprises 9 base pairs formed by complementary nucleotides. 8. The sgRNA of claim 2, wherein the long upper stem region comprises 10 base pairs formed by complementary nucleotides. 9. The sgRNA of any one of the preceding claims, wherein all the nucleotides of the upper stem are modified nucleotides. 10. The sgRNA of any one of the preceding claims, wherein one or more nucleotides within the hairpin 1 and hairpin 2 regions are modified nucleotides. 11. The sgRNA of claim 10, wherein all of the nucleotides within the hairpins 1 and 2 regions are modified nucleotides. Attorney Docket No. BEM-020WO1 12. The sgRNA of any one of the preceding claims, wherein the sgRNA further comprises a modified stable hairpin 1 region. 13. The sgRNA of claim 12, wherein the modified stable hairpin 1 region comprises an extended stem region comprising more than 4 base pairs and wherein the loop of hairpin 1 comprises locked nucleic acid. 14. A guide RNA comprising an extended upper stem including more than 4 base pairs formed by complementary nucleotides, wherein the nucleotides within the upper stem comprise 2’-O methyl modification. 15. A single guide RNA (sgRNA) comprising a sequence of GUUUUAGA NxnGAAA NynAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGU CGGUGCUUUU (SEQ ID NO.1), wherein Nxn and Nyn have the same number of nucleotides and are complementary nucleotides to form base pairs, and wherein the nucleotides of Nxn and Nyn are modified nucleotides, and wherein n is an integral number from 5-15. 16. The sgRNA of claim 15, wherein the Nx and Ny include 5 nucleotides respectively that are complementary nucleotides and that form the upper stem region of the sgRNA, and wherein the sgRNA comprises the sequence of GUUUUAGANxNxNxNxNxGAAANyNyNyNyNyAAGUUAAAAUAAGGCUAGUCCGUUA UCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO:2) 17. The sgRNA of claim 15, wherein the Nx and Ny include 6 nucleotides respectively that are complementary nucleotides and that form the upper stem region of the sgRNA, and wherein the sgRNA comprises the sequence of GUUUUAGANxNxNxNxNxNxGAAANyNyNyNyNyNyAAGUUAAAAUAAGGCUAGUCCG UUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO:3) 18. The sgRNA of claim 15, wherein the Nx and Ny include 7 nucleotides respectively that are complementary nucleotides and that form the upper stem region of the sgRNA, and wherein the sgRNA comprises the sequence of GUUUUAGANxNxNxNxNxNxNxGAAANyNyNyNyNyNyNyAAGUUAAAAUAAGGCUAGU CCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO:4) 19. The sgRNA of claim 15, wherein the Nx and Ny include 8 nucleotides respectively that are complementary nucleotides and that form the upper stem region of the sgRNA, and Attorney Docket No. BEM-020WO1 wherein the sgRNA comprises the sequence of GUUUUAGANxNxNxNxNxNxNxNxGAAANyNyNyNyNyNyNyNyAAGUUAAAAUAAGGCU AGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO:5) 20. The sgRNA of claim 15, wherein the Nx and Ny include 9 nucleotides respectively that are complementary nucleotides and that form the upper stem region of the sgRNA, and wherein the sgRNA comprises the sequence of GUUUUAGANxNxNxNxNxNxNxNxNxGAAANyNyNyNyNyNyNyNyNyAAGUUAAAAUAAG GCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 6). 21. The sgRNA of claim 15, wherein the Nx and Ny include 10 nucleotides respectively that are complementary nucleotides and that form the upper stem region of the sgRNA, and wherein the sgRNA comprises the sequence of GUUUUAGANxNxNxNxNxNxNxNxNxNxGAAANyNyNyNyNyNyNyNyNyNyAAGUUAAAAU AAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 7). 22. The sgRNA of claim 15, wherein the sgRNA comprising the sequence of GUUUUAGAGCGCGGAAACGCGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAC UUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 8). 23. The sgRNA of claim 14, wherein the sgRNA comprising the sequence of GUUUUAGAGCCGGCGGAAACGCCGGCAAGUUAAAAUAAGGCUAGUCCGUUAU CAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 9). 24. The sgRNA of any one of claims 14-23, wherein all the nucleotides within the upper stem comprise 2’O-methyl modification. 25. The sgRNA of claim 24, wherein the sgRNA comprises a sequence as set forth in any one of SEQ ID NOs: 20-32 and 51-52. 26. The sgRNA of any one of claims 14-25, wherein one or more nucleotides within the hairpin 1 and hairpin 2 regions are modified nucleotides. Attorney Docket No. BEM-020WO1 27. The sgRNA of claim 26, wherein all of the nucleotides within the hairpin 1 and hairpin 2 regions are modified nucleotides. 28. The sgRNA of any one of claims 14-27, wherein the loop of hairpin 1 comprises 2′-O- methyl modified nucleotides (e.g., 2′-O-methyl 3′-phosphorothioate (MS) nucleotide, 2′-O- methyl 3′-thioPACE (MSP) nucleotide), 2’-F modified nucleotides, locked nucleic acid, MOE (methoxyethyl), DNA nucleotides functionalized for conjugation, and a combination thereof.29. A single guide RNA (sgRNA) comprising a sequence of GUUUUAGANxnGAAANynAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGGAC UUUGGUCCAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 10), wherein Nxn and Nyn have the same number of nucleotides and are complementary nucleotides to form base pairs, and wherein the nucleotides of Nxn and Nyn are modified nucleotides and wherein n is an integral number from 5-15. 30. The sgRNA of claim 29, wherein the Nx and Ny include 5 nucleotides respectively that are complementary nucleotides and that form the upper stem region of the sgRNA, and wherein the sgRNA comprises the sequence of GUUUUAGANxNxNxNxNxGAAANyNyNyNyNy AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGGACUUUGGUCCAAGUGGCA CCGAGUCGGUGCUUUU (SEQ ID NO: 11). 31. The sgRNA of claim 29, wherein the Nx and Ny include 6 nucleotides respectively that are complementary nucleotides and that form the upper stem region of the sgRNA, and wherein the sgRNA comprises the sequence of GUUUUAGANxNxNxNxNxNxGAAANyNyNyNyNyNy AAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGGACUUUGGUCCAAGUGGCA CCGAGUCGGUGCUUUU (SEQ ID NO: 12). 32. The sgRNA of claim 29, wherein the Nx and Ny include 7 nucleotides respectively that are complementary nucleotides and that form the upper stem region of the sgRNA, and wherein the sgRNA comprises the sequence of GUUUUAGANxNxNxNxNxNxNxGAAANyNyNyNyNyNyNyAAGUUAAAAUAAGGCUAGU CCGUUAUCAACUUGGACUUUGGUCCAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 13). Attorney Docket No. BEM-020WO1 33. The sgRNA of claim 29, wherein the Nx and Ny include 8 nucleotides respectively that are complementary nucleotides and that form the upper stem region of the sgRNA, wherein the sgRNA comprises the sequence of GUUUUAGANxNxNxNxNxNxNxNxGAAANyNyNyNyNyNyNyNyAAGUUAAAAUAAGGCU AGUCCGUUAUCAACUUGGACUUUGGUCCAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 14). 34. The sgRNA of claim 29, wherein the Nx and Ny include 9 nucleotides respectively that are complementary nucleotides and that form the upper stem region of the sgRNA, and wherein the sgRNA comprises the sequence of GUUUUAGANxNxNxNxNxNxNxNxNxGAAANyNyNyNyNyNyNyNyNyAAGUUAAAAUAAG GCUAGUCCGUUAUCAACUUGGACUUUGGUCCAAGUGGCACCGAGUCGGUGCUU UU (SEQ ID NO: 15). 35. The sgRNA of claim 29, wherein the Nx and Ny include 10 nucleotides respectively that are complementary nucleotides and that form the upper stem region of the sgRNA, and wherein the sgRNA comprises the sequence of GUUUUAGANxNxNxNxNxNxNxNxNxNxGAAANyNyNyNyNy NyNyNyNyNyAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGGACUUUGGUCCA AGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 16). 36. The sgRNA of claim 29, wherein the sgRNA comprises the sequence of GUUUUAGAGCCGGCGGAAACGCCGGCAAGUUAAAAUAAGGCUAGUCCGUUAU CAACUUGGACUUCGGUCCAAGUUUUU (SEQ ID NO: 17). 37. A single guide RNA (sgRNA) comprising a sequence of GUUUUAGANxnGAAANynAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGGAC NzNzNzNzGUCCAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 18), wherein Nxn and Nyn have the same number of nucleotides and are complementary nucleotides to form base pairs, and wherein the nucleotides of Nxn and Nyn are modified nucleotides and wherein n is an integral number from 5-15, and wherein the 4 nucleotides of the loop of hairpin 1 (NzNzNzNz) comprises a sequence of UUCG, CUUG or GCAA. 38. The sgRNA of any one of claims 29-37, wherein one or more nucleotides within the hairpin 1 and hairpin 2 regions are chemically modified nucleotides. Attorney Docket No. BEM-020WO1 39. The sgRNA of claim 38, wherein all of the nucleotides within the hairpin 1 and hairpin 2 regions are modified nucleotides. 40. The sgRNA of any one of claims 29-39, wherein the loop of hairpin 1 comprises locked nucleic acid. 41. The sgRNA of any one of the preceding claims, wherein the modifications include 2′-O- methyl modified nucleotides (e.g., 2′-O-methyl 3′-phosphorothioate (MS) nucleotide, 2′-O- methyl 3′-thioPACE (MSP) nucleotide), 2’-F modified nucleotides, locked nucleic acid, MOE (methoxyethyl), DNA nucleotides functionalized for conjugation, and a combination thereof. 42. The sgRNA of any one of the preceding claims, wherein at least one modification comprises a 2’-O’methyl (2’-O-Me) modified nucleotide. 43. The sgRNA of any one of claims 29-42, wherein all the nucleotides within the upper stem comprise 2’O-methyl modification. 44. The sgRNA of claim 43, wherein the sgRNA comprises a sequence as set forth in any one of SEQ ID NOs: 33 – 40. 45. The sgRNA of any one of the preceding claims, wherein the gRNA further comprises a spacer sequence at the 5′ end of the sgRNA; the spacer sequence comprises a sequence complementary to a target sequence of interest. 46. The sgRNA of claim 45, wherein the spacer sequence comprises about 18-25, or 18-30, or 20-25, or 20-30 nucleotides. 47. The sgRNA of any one of the preceding claims, wherein the 3’ end of the sgRNA is modified. 48. The sgRNA of any one of the preceding claims, wherein the 5′ end of the sgRNA is modified. 49. The sgRNA of claim 48, wherein at least the first three nucleotides at the 5′ end of the sgRNA is modified nucleotides. Attorney Docket No. BEM-020WO1 50. The sgRNA of any one of claims 1-46, wherein the sgRNA comprises a modification at the 5′ end of the sequence and a modification at the 3’ end of the sequence. 51. The sgRNA of any one of the preceding claims, wherein about 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 75%, 80%, 90% or 100% of the nucleotides of the sgRNA are modified nucleotides. 52. The sgRNA of any one of the preceding claims, wherein the sgRNA further comprises a nuclear localization sequence (NLS). 53. The sgRNA of any one of the preceding claims, wherein the sgRNA comprises about 102-150 nucleotides. 54. The sgRNA of claim 53, wherein the sgRNA comprises about 102-120 nucleotides. 55. The sgRNA of any one of the preceding claims, wherein the sgRNA increases the gene modification efficacy about 2 to 1000-fold. 56. The sgRNA of claim 55, wherein the sgRNA increases the gene modification efficacy about 2 to 100-fold, 2 to 50 fold, 2 to 20- fold or 10 to 50-fold. 57. The sgRNA of claim 56, wherein the sgRNA increases the gene modification efficacy about 2 to10-fold, 2 to5-fold, 3 to 8- fold, or 5 to10 fold. 58. A gene modification system comprising, (a) a CRISPR-associated protein (Cas) polypeptide, or variant thereof; and (b) a single guide RNA(sgRNA) of any one of the preceding claims. 59. The gene modification system of claim 58, wherein the Cas polypeptide is a Cas9 protein. 60. The gene modification system of claim 59, wherein the Cas9 is an S. pyogenes Cas9 or an S. aureus Cas9. 61. The gene modification system of claim 60, wherein the Cas9 polypeptide is a nickase or a dCas9. Attorney Docket No. BEM-020WO1 62. The gene modification system of any one of claims 58-61, wherein the gene modification efficacy is increased about 2 to 1000 fold. 63. The gene modification system of claim 62, wherein the gene modification efficacy is increased about 2 to 100 fold, or 2 to 50 fold, or 2 to 20 fold, or 10-50 fold. 64. The gene modification system of claim 63, wherein the gene modification efficacy is increased about 2 to10 fold, or 2 to 5 fold, or 3 to 8 fold, or 5-10 fold . 65. A composition comprising a single guide RNA of any one of claims 1-59. 66. The composition of claim 65, further comprising a Cas9 polypeptide, or variant thereof. 67. The composition of 66, wherein the Cas polypeptide is a Cas9 protein, dCas9 or a nickase. 68. The composition of any one of claims 65-67 is formulated in a lipid nanoparticle. 69. A method for modifying a target gene in a cell comprising introducing into the cell a gene editing system comprising a single guide RNA (sgRNA) of any one of claims 1-59. 70. The method of claim 66further comprising introducing into the cell a CRISPR-associated protein (Cas) polypeptide or variant thereof. wherein the sgRNA guides the Cas polypeptide to the target gene, and wherein the sgRNA induces modification of the target gene with an enhanced activity relative to a corresponding unmodified sgRNA comprising 5’GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAA CUUGAAAAAGUGGCACCGAGUCGGUGCUUUU 3’(SEQ ID NO: 19) 71. The method of claim 70, wherein the cell is a Cas9 expressing cell. 72. The method of any one of claims70-71, wherein the cell is a mammalian cell. 73. The method of any one of claims70-72, wherein the cell is an immune cell. 74. A kit comprising the sgRNA of any one of claims 1-57, the gene modification system of any one of claims 58-64, or the composition of any one of claims65-68. Attorney Docket No. BEM-020WO1 75. A single guide RNA comprising a sequence as set forth in any one of SEQ ID NOs: 20-21 and 51-52.
EP24730119.5A 2023-04-28 2024-04-26 Modified guide rna Pending EP4702145A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202363462873P 2023-04-28 2023-04-28
PCT/US2024/026601 WO2024227047A2 (en) 2023-04-28 2024-04-26 Modified guide rna

Publications (1)

Publication Number Publication Date
EP4702145A2 true EP4702145A2 (en) 2026-03-04

Family

ID=91334660

Family Applications (1)

Application Number Title Priority Date Filing Date
EP24730119.5A Pending EP4702145A2 (en) 2023-04-28 2024-04-26 Modified guide rna

Country Status (5)

Country Link
EP (1) EP4702145A2 (en)
KR (1) KR20260007576A (en)
CN (1) CN121079412A (en)
AU (1) AU2024261906A1 (en)
WO (1) WO2024227047A2 (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12529041B2 (en) 2018-09-07 2026-01-20 Beam Therapeutics Inc. Compositions and methods for delivering a nucleobase editing system
US12454694B2 (en) 2018-09-07 2025-10-28 Beam Therapeutics Inc. Compositions and methods for improving base editing
WO2022067089A1 (en) 2020-09-25 2022-03-31 Beam Therapeutics Inc. Fratricide resistant modified immune cells and methods of using the same

Family Cites Families (31)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ATE232880T1 (en) 1996-11-18 2003-03-15 Takeshi Imanishi NEW NUCLEOTIDE ANALOGUES
JP3756313B2 (en) 1997-03-07 2006-03-15 武 今西 Novel bicyclonucleosides and oligonucleotide analogues
WO1999060855A1 (en) 1998-05-26 1999-12-02 Icn Pharmaceuticals, Inc. Novel nucleosides having bicyclic sugar moiety
HK1048639A1 (en) 1999-03-18 2003-04-11 埃克西库恩公司 Xylo-lna analogues
AU3418800A (en) 1999-03-24 2000-10-09 Exiqon A/S Improved synthesis of (2.2.1)bicyclo nucleosides
AU776362B2 (en) 1999-05-04 2004-09-09 Roche Innovation Center Copenhagen A/S L-ribo-LNA analogues
WO2001000641A1 (en) 1999-06-25 2001-01-04 Sankyo Company, Limited Novel bicyclonucleoside derivatives
JP4151751B2 (en) 1999-07-22 2008-09-17 第一三共株式会社 New bicyclonucleoside analogues
EP1562971B1 (en) 2002-11-05 2014-02-12 Isis Pharmaceuticals, Inc. Polycyclic sugar surrogate-containing oligomeric compounds and compositions for use in gene modulation
DK1661905T3 (en) 2003-08-28 2012-07-23 Takeshi Imanishi Novel N-O cross-linking synthetic nucleic acids
AU2004274021B2 (en) 2003-09-18 2009-08-13 Isis Pharmaceuticals, Inc. 4'-thionucleosides and oligomeric compounds
CA2640171C (en) 2006-01-27 2014-10-28 Isis Pharmaceuticals, Inc. 6-modified bicyclic nucleic acid analogs
WO2008101157A1 (en) 2007-02-15 2008-08-21 Isis Pharmaceuticals, Inc. 5'-substituted-2'-f modified nucleosides and oligomeric compounds prepared therefrom
EP2170917B1 (en) 2007-05-30 2012-06-27 Isis Pharmaceuticals, Inc. N-substituted-aminomethylene bridged bicyclic nucleic acid analogs
ES2386492T3 (en) 2007-06-08 2012-08-21 Isis Pharmaceuticals, Inc. Carbocyclic bicyclic nucleic acid analogs
CN101796062B (en) 2007-07-05 2014-07-30 Isis制药公司 6-disubstituted bicyclic nucleic acid analogs
US10900034B2 (en) * 2014-12-03 2021-01-26 Agilent Technologies, Inc. Guide RNA with chemical modifications
WO2017044776A1 (en) * 2015-09-10 2017-03-16 Texas Tech University System Single-guide rna (sgrna) with improved knockout efficiency
EP3159407A1 (en) * 2015-10-23 2017-04-26 Silence Therapeutics (London) Ltd Guide rnas, methods and uses
EP4434589A3 (en) 2015-10-23 2025-05-14 President and Fellows of Harvard College Evolved cas9 proteins for gene editing
JP7231935B2 (en) 2016-08-03 2023-03-08 プレジデント アンド フェローズ オブ ハーバード カレッジ Adenosine nucleobase editors and their uses
IL267024B2 (en) * 2016-12-08 2023-12-01 Intellia Therapeutics Inc MODIFIED GUIDE RNAs FOR GENOMIC EDITING
US11939575B2 (en) * 2017-12-19 2024-03-26 City Of Hope Modified tracrRNAs gRNAs, and uses thereof
CA3092148A1 (en) * 2018-03-19 2019-09-26 University Of Massachusetts Modified guide rnas for crispr genome editing
US20230055682A1 (en) * 2019-12-03 2023-02-23 Beam Therapeutics lnc. Synthetic guide rna, compositions, methods, and uses thereof
CA3211495A1 (en) 2021-03-23 2022-09-29 Bernd ZETSCHE Novel crispr enzymes, methods, systems and uses thereof
EP4095246A1 (en) * 2021-05-27 2022-11-30 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Novel crispr grnas
JP2024546841A (en) 2021-12-17 2024-12-26 ビーム セラピューティクス インク． Novel CRISPR enzymes, methods, systems, and uses thereof
WO2023245141A2 (en) * 2022-06-15 2023-12-21 Beam Therapeutics Inc. Compositions and methods for reducing complement activation
EP4544035A2 (en) * 2022-06-27 2025-04-30 Beam Therapeutics Inc. Adenosine deaminase base editors and methods for use thereof
CN120322549A (en) * 2022-08-25 2025-07-15 生命编辑治疗股份有限公司 Chemical modification of guide RNA using locked nucleic acids for RNA-guided nuclease-mediated gene editing

Also Published As

Publication number Publication date
WO2024227047A3 (en) 2024-12-19
CN121079412A (en) 2025-12-05
WO2024227047A2 (en) 2024-10-31
AU2024261906A1 (en) 2025-10-23
KR20260007576A (en) 2026-01-14

Similar Documents

Publication Publication Date Title
CN113994000A (en) Antisense RNA editing oligonucleotides including cytidine analogs
EP4702145A2 (en) Modified guide rna
US20250319114A1 (en) NUCLEIC ACID MOLECULE FOR REDUCTION OF PAPD5 AND PAPD7 mRNA FOR TREATING HEPATITIS B INFECTION
JP7515400B2 (en) Use of FUBP1 inhibitors for treating hepatitis B virus infection - Patents.com
EP4555086A1 (en) Oligonucleotides for adar-mediated rna editing and use thereof
JP2025039668A (en) Oligonucleotides for modulating RTEL1 expression
CA3234478A1 (en) Pharmaceutical combinations for treatment of hbv
EP4630553A1 (en) Antisense oligonucleotides for the treatment of cardiovascular disease
JP2025536808A (en) Antisense oligonucleotides for the treatment of hereditary hfe hemochromatosis
JP7813254B2 (en) Enhanced oligonucleotides for modulating FUBP1 expression
WO2025056059A1 (en) Antisense oligonucleotide for inhibiting trpv1 gene expression and use thereof
WO2026022136A1 (en) Antisense oligonucleotides for the treatment of metabolic disorders
HK40117347A (en) Combination of oligonucleotides for modulating rtel1 and fubp1
WO2024222766A1 (en) Method, composition for editing rna, and application thereof
WO2024115635A1 (en) Antisense oligonucleotides for the treatment of aldehyde dehydrogenase 2 deficiency
WO2024256620A1 (en) Antisense oligonucleotides for the treatment of neurodegenerative disease
JP2024546993A (en) Oligonucleotide Combinations for Modulating RTEL1 and FUBP1
CN111201319A (en) Regulation of expression of nucleic acid molecules
HK40033074A (en) Nucleic acid molecule for reduction of papd5 and papd7 mrna for treating hepatitis b infection

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: UNKNOWN

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20251121

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR