EP4695384A2 - Compositions and methods for upregulation of reverse transcription and reduction of sequence bias in rna sequencing - Google Patents

Compositions and methods for upregulation of reverse transcription and reduction of sequence bias in rna sequencing

Info

Publication number
EP4695384A2
EP4695384A2 EP24789679.8A EP24789679A EP4695384A2 EP 4695384 A2 EP4695384 A2 EP 4695384A2 EP 24789679 A EP24789679 A EP 24789679A EP 4695384 A2 EP4695384 A2 EP 4695384A2
Authority
EP
European Patent Office
Prior art keywords
composition
concentration
reverse transcriptase
pcr
dna
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
EP24789679.8A
Other languages
German (de)
French (fr)
Inventor
Raj Chakrabarti
Anisha GHOSH
Xiangying GUAN
Gauthier ERRASTI
Thomas Delacroix
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
5prime Biosciences Inc
Original Assignee
5prime Biosciences Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 5prime Biosciences Inc filed Critical 5prime Biosciences Inc
Publication of EP4695384A2 publication Critical patent/EP4695384A2/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions

Definitions

  • thermostable reverse transcriptase (RT) enzymes have been also been discovered.
  • RT reverse transcriptase
  • genes cannot be effectively replicated or amplified in water irrespective of temperature, resulting in significant biases in RNA and DNA sequencing that limit the potentially transformative applications of these methods.
  • (RT) ⁇ PCR amplification of GC ⁇ rich nucleotide sequences is often accompanied by inadequate yield of the target DNA sequence and amplification of nonspecific products.
  • a recent analysis of intragenic regions reveals 773 sequences with more than 65% GC in the human genome.
  • PCR ⁇ enhancing compounds have been used to improve GC ⁇ rich gene amplification or reduce GC bias in amplification without target modification, and are components of some of the most commonly used PCR commercial products, because organic cosolvents and temperature represent the two primary means of denaturing macromolecules.
  • PCR ⁇ enhancing organic solvents are very effective in improving amplification due to their favorable effects on duplex nucleic acid melting and 2 single ⁇ stranded nucleic acid secondary structure alleviation – thus complementing the effects of the increased temperatures used in PCR, which alone are insufficient to amplify many GC ⁇ rich genes – their application is limited by the fact that they generally deleteriously affect the polymerase stability and activity.
  • polymerases used in PCR have evolved naturally to be thermostable, they have not evolved naturally to be optimally solvent ⁇ tolerant.
  • organic cosolvents belonged specifically to four chemical classes that we defined as low molecular weight amides, sulfoxides, sulfones and polyols (particularly diols) (Chakrabarti, 2002, 2004; Chakrabarti et al., 2001 Nucleic Acids Res, 2001 Gene, 2002 Biotechniques; US Patent 6,949,368; US Patent 7,276,357 B2; and US Patent 7,772,358 B2). Earlier, DMF, DMSO and Glycerol were also reported to have some beneficial effects in PCR amplification of high GC targets (Sarker et al., 1990, Pomp et al., 1991, Henkel et al., 1997).
  • Figs. 1A to 1D A comprehensive list of the more useful members among these low molecular weight organic cosolvents is provided below and the chemical structures of some of them are shown in Figs. 1A to 1D.
  • the members are: formamide, N ⁇ methyl formamide, N,N ⁇ dimethyl formamide (DMF), acetamide, N ⁇ methylacetamide, N,N ⁇ dimethylacetamide, propionamide, isobutyramide, 2 ⁇ pyrrolidone, N ⁇ methylpyrrolidone (NMP), N ⁇ hydroxyethyl pyrrolidone (HEP), N ⁇ formyl pyrrolidine, N ⁇ Formyl morpholine; delta ⁇ valerolactam, epsilon ⁇ caprolactam, 2 ⁇ azacyclooctanone (16 compounds); 3
  • the members are: dimethyl sulfoxide (DMSO), n ⁇ propyl sulfoxide, n ⁇ butyl sul
  • the members are: dimethyl sulfone, 10 diethyl sulfone, di (n ⁇ propyl) sulfone, tetramethylene sulfone (sulfolane), and 2,4 ⁇ dimethylsulfolane and butadiene sulfone (sulfolene) ⁇ (6 compounds: Fig.
  • the members are: 1,2 ⁇ propanediol, 1,3 ⁇ propanediol, 1,2 ⁇ butanediol, 1,3 ⁇ butanediol, 1,4 ⁇ butanediol, 1,2 ⁇ pentanediol, 2,4 ⁇ pentanediol, 1,5 ⁇ pentanediol, 1,2 ⁇ cyclopentanediol, 1,2 ⁇ hexanediol, 1,6 ⁇ hexanediol,and 2 ⁇ methyl ⁇ 2,4 ⁇ pentanediol (13 compounds; Fig. 1D).
  • triol namely, glycerol
  • betaine When used as a part of the PCR buffer, these cosolvents provide an aqueous ⁇ organic reaction medium that is predominantly aqueous in nature (as opposed to the common use of predominantly organic reaction media for small molecule enzymatic reactions described earlier).
  • the properties of a cosolvent in terms of its overall impact on a PCR reaction can be expressed in terms of effective range, potency, and specificity of each cosolvent that are different for different compounds (Chakrabarti R., 2004).
  • the effective range of a cosolvent 4 is defined as the range of concentration starting at the concentration at which amplification of a given target improved PCR yield and ending at the concentration above which amplification began to be inhibited. Put in a different way, the effective range of a cosolvent is the range of concentration outside which it does not exhibit any beneficial effect. This range was different for different compounds but also for the same compound for different targets.
  • the potency of a cosolvent is defined as the maximum densitometric volume of the target band amplification that could be obtained for any target amplification within the effective range of that cosolvent. It is the maximum effectiveness of the cosolvent at the most effective concentration within its effective range.
  • the specificity of a cosolvent at a particular concentration is defined as the ratio of the volume of the target band amplification to the total volume of all bands, including the undesired non ⁇ specific bands, expressed as a percent. False positives and false negatives in PCR ⁇ based disease diagnosis, for instance, are the result of poor reaction specificity. Use of cosolvent ⁇ based PCR is of significant value in this area. There are, however, important limitations of these solvent systems that have thwarted their more widespread application.
  • thermostabilities of DNA polymerases between 92 °C and 95 °C ⁇ the range within which the denaturation step of the PCR reaction is usually carried out ⁇ were greatly lowered by addition of the most potent and most specific cosolvents. 5 Notwithstanding the above results on DNA ⁇ dependent DNA polymerization and PCR in aqueous ⁇ organic media, reverse transcription activity (RNA ⁇ dependent DNA polymerization) has never been demonstrated to be improved by or even compatible with the aforementioned polar organic cosolvents.
  • RT ⁇ PCR reverse transcription PCR
  • a composition for performing a reverse transcriptase reaction comprises a thermostable reverse transcriptase or a fragment thereof, a reverse transcriptase (RT) buffer, one or more template RNAs and deoxyribonucleoside triphosphates (dNTPs), and one or more of the low molecular weight polar organic solvents.
  • RT reverse transcriptase
  • dNTPs deoxyribonucleoside triphosphates
  • low molecular weight polar organic solvents in some embodiments, are selected from the group consisting of an amide, a sulfoxide, a sulfone, and a diol.
  • Low molecular weight polar organic solvents in some embodiments, can have a molecular weight less than or equal to 150 g/mol. Additionally, the low molecular weight polar organics can be present at a concentration ranging between 0.05 molar and 7.5 molar, in some embodiments.
  • the thermostable reverse transcriptase or a fragment thereof has an optimal reverse transcriptase (RT) above 37 o C and preferably above 48 o C. As shown and described further herein, the presence of the one or more of the organic cosolvents, in some embodiments, increases RT activity (rate of nucleotide incorporation) of the thermostable reverse transcriptase or the fragment thereof.
  • the RT activity rate can be increased by at least 5%, in some embodiments.
  • the reverse transcriptase of compositions described herein comprises one or more amino acids alterations conferring stability and/or activity in the one or more polar organic solvents.
  • the reverse transcriptase is a modified or mutant Taq polymerase bearing at least 90% sequence similarity to wild ⁇ type Taq polymerase (SEQ ID NO: 1), wherein the amino acid modifications confer stability and/or activity in the one or more polar organic solvents.
  • a composition comprises a thermostable reverse transcriptase or a fragment thereof, a reverse transcriptase polymerase chain reaction (RT ⁇ PCR) buffer, one or more template RNAs and deoxyribonucleoside triphosphates (dNTPs), DNA ⁇ dependent DNA polymerase enzyme of a fragment thereof, and one or more low molecular weight polar organic solvents.
  • the thermostable reverse transcriptase of the composition can be any thermostable reverse transcriptase described herein.
  • the one or more low molecular weight solvents can have any identity described herein.
  • a composition for performing a reverse transcriptase reaction comprises a thermostable reverse transcriptase, a reverse transcriptase (RT) buffer, one or more template RNAs and deoxyribonucleoside triphosphates (dNTPs), and one or more low molecular weight polar organic solvents, wherein the thermostable reverse transcriptase is a mutant of Taq polymerase bearing at least 90% sequence similarity to wild ⁇ type Taq polymerase of SEQ ID NO:1 and comprises one or more amino acid alterations enhancing stability and/or activity of the reverse transcriptase in the one or more low molecular weight polar organic solvents.
  • modified Taq DNA polymerases are described herein.
  • a modified Taq DNA polymerase having an amino acid sequence that is at least 90% identical to an amino acid sequence comprised of the sequence of wild ⁇ type Taq DNA polymerase of SEQ ID NO:1, wherein the amino acid sequence comprises a first set of non ⁇ natural amino acid alterations stabilizing or improving the activity of the modified Taq DNA polymerase in an aqueous ⁇ organic medium, and a second set of non ⁇ natural amino acid alterations conferring reverse transcriptase activity to the modified Taq DNA polymerase. Any non ⁇ natural amino acid alterations consistent with the objectives of the first and second sets can be employed.
  • a composition comprises a modified Taq DNA polymerase suitable for RT or RT ⁇ PCR reactions in an aqueous ⁇ organic medium, wherein the aqueous ⁇ organic medium comprises one or more low molecular weight organic solvents selected from the group consisting of an amide, a sulfoxide, a sulfone, and a diol, and wherein the amino acid sequence of the modified Taq DNA polymerase is at least 90% identical to an amino acid sequence comprised of the sequence of wild ⁇ type Taq DNA polymerase of SEQ ID NO:1 with a first set of amino acid alterations selected to confer reverse transcriptase activity, and a second set of amino acid alterations selected from the group consisting of L30P, A54V, E434D, K206Q, S612R, V730I, and F749V of SEQ ID NO:1; P10S, A61V, T186I, D244V, K314R, E520G, V586A, S612R
  • the amino acid alterations conferring RT activity include one or more of E732N, E742K, E742R, M747K, M747R, E742N, E742N, E742Q, E742Y, E742M, E742A and M747N of SEQ ID NO:1.
  • the second set of amino acids above are paired with one of the E742 alterations and one of the E747 alterations of SEQ ID NO:1. Any desired pairing can be made. Non ⁇ limiting examples of such pairing are provided in Table 15 below.
  • kits are provided herein.
  • a kit comprises a composition for reverse transcription or a composition for reverse transcription ⁇ PCR described herein.
  • a kit comprises a composition for target enrichment for RNA sequencing by a reverse transcription or reverse transcription ⁇ PCR composition described herein.
  • Methods of reverse transcribing RNA into DNA and methods of administering reverse transcription ⁇ PCR are also described herein.
  • a method of reverse transcribing RNA into DNA comprises incubating a thermostable reverse transcriptase with a reverse transcriptase buffer, a RNA template, deoxyribonucleoside triphosphates (dNTPs), DNA primers, and at least one low molecular weight organic cosolvent.
  • the one or more low molecular weight organic cosolvents can have any identity described herein.
  • the reverse transcriptase is a modified Taq DNA polymerase bearing at least 90% sequence similarity to wild ⁇ type Taq polymerase of SEQ ID NO:1.
  • the temperature of reverse transcription is higher than its optimal value in the absence of the polar organic cosolvent, and less than or equal to the melting temperature of 9 the enzyme at that cosolvent concentration, minus 5 o C.
  • reaction yield of reaction efficiency can be enhanced in the presence of the at least one low molecular weight solvents.
  • reverse transcription and/or DNA amplification in some embodiments, is administered for target enrichment in next ⁇ generation sequencing of RNA, including wherein the copy number of RNA sequences are determined by next ⁇ generation sequencing.
  • the RNA sequencing is carried out with incorporation of unique molecular identifiers (UMI) in the adapter sequences.
  • UMI unique molecular identifiers
  • a method comprises a) incubating a clinical sample containing a virus or bacteria with RT ⁇ PCR reagents including a thermostable or solvostable reverse transcriptase (RT), one or more low molecular weight polar organic cosolvents, optionally a thermostable or solvostable DNA ⁇ dependent DNA polymerase enzyme, RT ⁇ PCR buffer, and primers complementary to the nucleic acid sequence to be detected, at a temperature exceeding 70 o C and preferably below 80 o C, to lyse the virus or bacteria and release RNA without degrading the RNA; b) incubating the lysed clinical sample at or near the optimal temperature for reverse transcription of the RT enzyme; c) thermal cycling of the reaction mixture to PCR amplify the resulting complementary DNA (cDNA); and d) quantifying of the PCR product.
  • RT thermostable or solvostable reverse transcriptase
  • RT ⁇ PCR buffer optionally a thermostable or solvostable DNA ⁇ dependent DNA polymerase enzyme
  • FIG. 3(A) Comparison of RT activity for commercial RT enzyme (50U [62.5ng] of ProtoScript II RT) with mutants of interest (including 25ng of WT, N ⁇ 7 ⁇ 3 ⁇ B07 ⁇ RT, L ⁇ 5 ⁇ 2 ⁇ F01 –RT1, L ⁇ 5 ⁇ 2 ⁇ F01 ⁇ RT2) under extension temperatures 55 o C and 68 o C.
  • the Poly(A) template concentration is 0.5ng/ul (2.82 nM).
  • Fig. 3(B) The contribution of 5% BD to fluorescence readout was also assessed. The addition of 5% BD does not change the RFU.
  • RT ⁇ qPCR efficiency of these two mutants were evaluated along with the efficiency of SFM4 ⁇ 6 and a thermostable MMLV enzyme, ProtoScript II, in absence and presence of BD (7%) at 55°C (I) or 68°C (J).
  • RT ⁇ qPCR was carried out in 3 steps as described in Materials and Methods.
  • K,L represent the melt peak traces of the respective qPCR products from 55°C to 95°C.
  • *PSII ⁇ ProtoScript II Table 2 herein presents quantitative peak area and T M results for panels K,L since Cq values can be affected by nonspecific amplification.
  • RT activity inducing mutations identified in our study such as E742K, M747K are represented as purple spheres. The two images are rotated by 180 degrees to enable visualization of all mutations. Predicted effects of subset combinations of these mutations on polymerase folding free energy are reported in Table 7.
  • Figs. 7A ⁇ 7J Microfluidic preparation of double emulsions and FACS sorting: We prepared primary water ⁇ in ⁇ oil emulsions Fig. 7(A) followed by PCR. A fraction of primary emulsion was used to isolate DNA and ran on 1% Agarose gel Fig. 7(B). Panel B: Lane 1 DNA marker, Lane 2 negative control, and lane 3 is positive control.
  • FIG. 7H A total 1.6 million events were randomly captured; a threshold of 5000 was applied to gate the parental DE (Fig. 7H, and Fig. 7I), followed by sorting SYBR positive double emulsion (J).
  • Fig. 7I depicts the gated population from P1 that is identified for further analysis as P2;
  • Fig. 7J depicts the sorted SYBR positive DEs that were collected.
  • Figs. 7K ⁇ 7L (K) FACS sorting of the L5 library; (L) Direct fluorescence detection of reverse transcription products within emulsion droplets.
  • 5 ⁇ g of brain total RNA was mixed with a BEGAIN gene ⁇ specific primer and processed through a dolomite microfluidic device to generate ⁇ 3 million droplets.
  • Half of the droplets underwent RT ⁇ PCR amplification, then were stained with Picogreen and imaged under a fluorescence microscope (upper right). Pre ⁇ PCR droplets are shown for comparison (upper left). A negative control with no RNA added is also provided (lower).
  • Figs. 8A ⁇ 8C Fig.
  • E742K The mutation K742 (right) forms one hydrogen bond (cutoff – 2.7 to 3.3 angstroms; represented as dashed lines) with one ribonucleotide (G5 ⁇ 794) of the bound RNA, whereas E742 (left) does not form any hydrogen bond with RNA.
  • S515N The mutation N515 (right) forms two hydrogen bonds (one shown) between the amide side chain N and one nucleotide (DA840) of the bound DNA, whereas S515 (left) forms only one hydrogen bond, with one nucleotide (DA845).
  • the binding affinity difference calculated using MM ⁇ GBSA was determined to be ⁇ 22.71 kcal/mole for the S515N mutation.
  • the numbers depict the average distance between the donor ⁇ acceptor atom pairs forming the hydrogen bonds as observed in the production run of MD simulation. (Wild type binding affinity difference for RNA vs DNA in the same MM ⁇ GBSA units was determined to be +278.37 kcal/mol.) Figs.
  • Fig. 9B Melting curves and peak traces of four templates in the absence of BD with WT ⁇ Taq and presence of 5% BD with 5 selected clones N ⁇ 7 ⁇ 3 ⁇ B07, N ⁇ 7 ⁇ 3 ⁇ C08, N ⁇ 7 ⁇ 2 ⁇ E02, L3 ⁇ D04 ⁇ 26 and L ⁇ 5 ⁇ 2 ⁇ F01.
  • Figs. 10A ⁇ 10C GC bias in coverage of GC ⁇ rich and poor genes in target enrichment for next ⁇ generation sequencing with engineered polymerases.
  • GC ⁇ rich templates cloned in plasmids were PCR amplified together with either WT or L ⁇ 5 ⁇ 2 ⁇ F01 or N ⁇ 7 ⁇ 3 ⁇ B07 enzyme.
  • Gene ⁇ specific primers (one set of FWD and REV for each template) were added in the PCR reactions.
  • the PCR mix contained 7.25U of each enzyme and 5 ng of each template.
  • the reaction mixture contained 0.75 mM dNTP, 1 mg/mL BSA, 3.5 mM MgCl 2 , 0.5 ⁇ M of each 16 primer and BD as specified.
  • Fig. 10(B) The PCR mix contained 1.25U of each enzyme and 5 ng of each template.
  • FIG. 12(A) ⁇ Taq template in 5% BD
  • FIG. 12(B) ⁇ c ⁇ Jun template in 0 ⁇ 8% BD with select clones from early screening rounds
  • Fig. 12(C) ⁇ c ⁇ Jun template in 0 ⁇ 10% BD with select clones from later screening rounds (higher denaturation temperature was applied to the later round clones).
  • Fig. 12(A) ⁇ Taq template in 5% BD
  • FIG. 12(B) ⁇ c ⁇ Jun template in 0 ⁇ 8% BD with select clones from early screening rounds
  • Fig. 12(C) ⁇ c ⁇ Jun template in 0 ⁇ 10% BD with select clones from later screening rounds (higher denaturation temperature was applied to the later round clones).
  • Fig. 12(A) ⁇ Taq template in 5% BD
  • Fig. 12(B) ⁇ c ⁇ Jun template in 0 ⁇ 8% BD with select clones from early screening rounds
  • Figs. 13A ⁇ 13E Effect of 1,4 ⁇ butanediol (BD) on DNA melting, polymerase stability and PCR efficiency.
  • Fig. 13(A) GC content plot of c ⁇ Jun template flanked by primers J1/J3 (376 bp) 17 was generated by online tool (http://www.endmemo.com/bio/gcdraw.php),
  • Fig. 13(B) In triplicate reaction, 5 ⁇ g of purified c ⁇ Jun amplicon was used to assess the effect of 0 ⁇ 10% BD on T M of the template in a 1X PCR buffer and
  • Fig. 13(C) change in T M of DNA was plotted against BD concentration, Fig.
  • A,B Fluorescence ⁇ based detection of RT products from lysed cells with and without organic cosolvent, for enzymes SFM 4 ⁇ 6 and L5 ⁇ RT1.
  • C Gel analysis of RT ⁇ PCR products from lysed cells with varying amounts of organic cosolvent. Synthesized partial KRAS RNA (119 nucleotides) was mixed with the following components: a ⁇ SFM4 ⁇ 6 (40 ng, positive control), B, C, D ⁇ 5 million bacterial cells of b (WT Taq), c (SFM4 ⁇ 6), and d (L ⁇ 5 ⁇ 2 ⁇ F01 ⁇ RT1), respectively. Four sets of these mixtures were assigned different concentrations of BD (0%, 5%, 10%, 20%).
  • the reverse transcription (RT) reaction volume was 20 ⁇ L for each sample.
  • the RT reaction was performed at 80°C for 10 minutes followed by 55°C for 60 minutes.
  • PCR was carried out using the NEB LUNA PCR mix on 0.5 ⁇ L of the completed RT reaction mixture.
  • the PCR results were analyzed on a 2.5% agarose gel. Notice that the bands in WT lanes are non ⁇ specific as demonstrated by their wrong molecular weight.
  • compositions and methods for the upregulation of reverse transcription (RT) reactions and the reduction of sequence bias in RNA sequencing are presented.
  • a composition for performing a reverse transcriptase reaction comprises a thermostable reverse transcriptase or a fragment thereof, a reverse transcriptase (RT) buffer, one or more template RNAs and deoxyribonucleoside triphosphates (dNTPs), and one or more low molecular weight polar organic solvents.
  • a composition comprises a thermostable reverse transcriptase or a fragment thereof, a reverse transcriptase polymerase chain reaction (RT ⁇ PCR) buffer, one or more template RNAs and deoxyribonucleoside triphosphates (dNTPs), DNA dependent DNA polymerase enzyme of a fragment thereof, and one or more low molecular weight polar organic solvents.
  • RT ⁇ PCR reverse transcriptase polymerase chain reaction
  • dNTPs deoxyribonucleoside triphosphates
  • DNA dependent DNA polymerase enzyme of a fragment thereof and one or more low molecular weight polar organic solvents.
  • the low molecular weight polar organic solvents are employed as cosolvents with water or aqueous solvent.
  • low molecular weight polar organic solvents are selected from the group consisting of an amide, a sulfoxide, a sulfone, and a diol.
  • Low molecular weight polar organic solvents in some embodiments, can have a molecular weight less than or equal to 150 g/mol.
  • Embodiments herein are not limited to a particular organic co ⁇ solvent. Examples include but are not limited to, a low molecular weight amide, a low molecular weight sulfoxide, a low molecular weight sulfone, or low molecular weight diol.
  • the amide is selected from, for example, formamide, N ⁇ methyl formamide, N,N ⁇ dimethyl formamide (DMF), acetamide, N ⁇ methylacetamide, N,N ⁇ dimethylacetamide, propionamide, isobutyramide, 2 ⁇ pyrrolidone, N ⁇ methylpyrrolidone (NMP), N ⁇ hydroxyethyl pyrrolidone(HEP), N ⁇ formyl pyrrolidine, N ⁇ Formyl morpholine; delta ⁇ valerolactam, epsilon ⁇ caprolactam, or 2 ⁇ azacyclooctanone;
  • the sulfoxide is selected from, for example, dimethyl sulfoxide (DMSO), n ⁇ propyl sulfoxide, n ⁇ butyl sulfoxide, methyl sec ⁇ butyl sulfoxide, or tetramethylene sulfoxide;
  • the sulfone is selected from, for example, dimethyl sulf
  • the amide solvent for RT ⁇ PCR reactions is N,N ⁇ Dimethylformamide (DMF) at a concentration of about 0.5 to about 1.5 molar concentration; isobutyramide at a concentration of about 0.1 to about 1.0 molar concentration; 2 ⁇ pyrrolidone at a concentration of about 0.1 to about 1.0 molar concentration; or N ⁇ methylpyrrolidone at a concentration of about 0.1 to about 1.0 molar.
  • DMF N,N ⁇ Dimethylformamide
  • the organic solvent is N,N ⁇ Dimethylformamide (DMF) at a concentration of about 0.5 to about 7.0 molar concentration; isobutyramide at a concentration of about 0.1 to about 4.5 molar concentration; 2 ⁇ pyrrolidone at a concentration of about 0.1 to about 4.5 molar concentration; or N ⁇ methylpyrrolidone at a concentration of about 0.1 to about 4.5 molar.
  • the sulfoxide for RT ⁇ PCR reactions is dimethylsulfoxide (DMSO) at a concentration of about 0.5 to about 3.0 molar concentration or tetramethylenesulfoxide at a concentration of about 0.1 to about 1.0 molar.
  • the sulfone is tetramethylenesulfone (sulfolane) at a concentration of about 0.1 to about 1.0 molar.
  • the sulfoxide is dimethylsulfoxide (DMSO) at a concentration of about 0.5 to about 7.5 molar concentration or tetramethylenesulfoxide at a concentration of about 0.1 to about 4.0 molar.
  • the sulfone is tetramethylenesulfone (sulfolane) at a concentration of about 0.1 to about 3.0 molar.
  • the diol for RT ⁇ PCR reactions is 1,3 ⁇ propanediol at a concentration of about 0.5 to about 3.0 molar concentration; 1,4 ⁇ butanediol at a concentration of about 0.5 to about 2.0 molar concentration; or 1,5 ⁇ pentanediol at a concentration of about 0.5 to about 1.0 molar concentration.
  • the diol for RT reactions is 1,3 ⁇ propanediol at a concentration of about 0.5 to about 7.5 molar concentration; 1,4 ⁇ butanediol at a concentration of about 0.5 to about 5.0 molar 20 concentration; or 1,5 ⁇ pentanediol at a concentration of about 0.5 to about 2.5 molar concentration.
  • the one or more polar organic solvents display a rate of change of duplex DNA, DNA secondary structure, or RNA secondary structure melting temperature with respect to cosolvent concentration (dTm/d[solvent]) between ⁇ 1 K/M and ⁇ 15 K/M.
  • the duplex DNA corresponds to the c ⁇ jun DNA segment flanked by primers with SEQ ID NOS: 92 and 94, and where the DNA and RNA secondary structures correspond to the most stable secondary structures in the single ⁇ stranded BEGAIN DNA and RNA fragments flanked by primers with SEQ ID NOS: 126 and 127, respectively.
  • the one or more low molecular weight polar organic cosolvents may also display rates of change of wild ⁇ type Taq polymerase melting temperature with respect to cosolvent concentration (dT M /d[solvent]) between ⁇ 1 K/M and ⁇ 15 K/M.
  • Low molecular weight cosolvents of compositions and methods described herein can be of the formula , R 1 is C or S; and when R 1 is C, X is ⁇ O, R 3 is N and R 6 is absent; when R 1 is S, X is ⁇ O or and R 3 is C; R 2 is H or CH 3 only when one or more of R 4 , R 5 and R 6 is not H, and otherwise R 2 is an unsubstituted or halogen ⁇ , hydroxy ⁇ or alkoxy ⁇ substituted alkyl or cycloalkyl of length m, wherein m is selected such that the total number of carbons in the compound is between 3 and 8 when R 1 is C and between 2 and 8 when R 1 is S; wherein any two of 21 R 2 , R 3 , R 4 , R 5 and R 6 optionally form a cyclic structure in which cyclization is effected through a bond between them; and R 4 , R 5 and R 6 each is H, alkyl, cycloalkyl or
  • the one or more polar organic solvents comprises a cyclic compound, wherein the cyclization is effected through a bond between any two of R 2 , R 3 , R 4 , R 5 and R 6 .
  • the cyclic portion for example, can comprises five, six or seven members.
  • cyclic structure of the compound is a five, six, or seven ⁇ membered ring formed by a bond between R 2 and either R 4 , R 5 or R 6 .
  • R 1 can be S and remainder of the compound is unsubstituted.
  • the low molecular weight polar organic solvent comprises a compound in which R 1 is S, X is ⁇ O or , and R 3 is C.
  • the low molecular weight polar organic solvent is is selected from the group consisting of tetramethylene sulfone and tetramethylene sulfoxide.
  • the low molecular weight polar organic solvent is acyclic.
  • R 2 or R 3 of the compound is lower alkyl or substituted lower alkyl.
  • the polar organic solvent is selected from the group consisting of methyl sulfone, ethyl sulfone, n ⁇ propyl sulfone, n ⁇ propyl sulfoxide and methyl sec ⁇ butyl sulfoxide. As described herein, embodiments are not limited to a particular organic co ⁇ solvent.
  • the amide is is selected from the group consisting of formamide, N ⁇ methyl formamide, N,N ⁇ dimethyl formamide (DMF), acetamide, N ⁇ methylacetamide, N,N ⁇ dimethylacetamide, propionamide, isobutyramide, 2 ⁇ pyrrolidone, N ⁇ methylpyrrolidone (NMP), N ⁇ hydroxyethyl pyrrolidone (HEP), N ⁇ formyl pyrrolidine, and N ⁇ Formyl morpholine.
  • DMF N ⁇ methyl formamide
  • acetamide N ⁇ methylacetamide
  • N,N ⁇ dimethylacetamide propionamide
  • isobutyramide 2 ⁇ pyrrolidone, N ⁇ methylpyrrolidone (NMP), N ⁇ hydroxyethyl pyrrolidone (HEP), N ⁇ formyl pyrrolidine, and N ⁇ Formyl morpholine.
  • the organic solvent can be selected from the group consisting of N,N ⁇ Dimethylformamide (DMF) at a concentration of about 0.5 to about 1.5 molar concentration, isobutyramide at a concentration of about 0.1 to about 1.0 molar concentration, 2 ⁇ 22 pyrrolidone at a concentration of about 0.1 to about 1.0 molar concentration, and N ⁇ methylpyrrolidone at a concentration of about 0.1 to about 1.0 molar.
  • DMF Dimethylformamide
  • isobutyramide at a concentration of about 0.1 to about 1.0 molar concentration
  • 2 ⁇ 22 pyrrolidone at a concentration of about 0.1 to about 1.0 molar concentration
  • N ⁇ methylpyrrolidone at a concentration of about 0.1 to about 1.0 molar.
  • the amide solvent is N,N ⁇ Dimethylformamide (DMF) at a concentration of about 0.5 molar to about the concentration at which the melting temperature (T M ) of the reverse transcriptase is 5 o C higher than the optimal activity temperature of the reverse transcriptase in the absence of DMF; isobutyramide at a concentration of about 0.1 molar to about the concentration at which the melting temperature (T M ) of the reverse transcriptase is 5 o C higher than the optimal activity temperature of the reverse transcriptase in the absence of isobutyramide; 2 ⁇ pyrrolidone at a concentration of about 0.1 molar to about the concentration at which the melting temperature (T M ) of the reverse transcriptase is 5 o C higher than the optimal activity temperature of the reverse transcriptase in the absence of 2 ⁇ pyrrolidone; or N ⁇ methylpyrrolidone at a concentration of about 0.1 molar to about the concentration at which the melting temperature (T M ) of the reverse transcript
  • DMF
  • sulfoxides are selected from the group consisting of dimethyl sulfoxide (DMSO), n ⁇ propyl sulfoxide, n ⁇ butyl sulfoxide, methyl sec ⁇ butyl sulfoxide, and tetramethylene sulfoxide;
  • the sulfone is selected from the group consisting of dimethyl sulfone, diethylsulfone, di(n ⁇ isopropyl) sulfone, tetramethylene sulfone (sulfolane), 2,4 ⁇ dimethylsulfolane, and butadienesulfone (sulfolene).
  • the organic solvent is selected from the group consisting of dimethylsulfoxide (DMSO) at a concentration of about 0.5 to about 3.0 molar concentration and tetramethylenesulfoxide at a concentration of about 0.1 to about 1.0 molar.
  • DMSO dimethylsulfoxide
  • the organic solvent is selected from the group consisting of dimethylsulfoxide (DMSO) at a concentration range of about 0.5 molar to about the concentration at which the melting temperature (T M ) of the reverse transcriptase is 5 o C higher than the optimal activity temperature of the reverse transcriptase in the absence of 23 DMSO, and tetramethylene sulfoxide at a concentration range of about 0.1 molar to about the concentration at which the melting temperature (T M ) of the reverse transcriptase is 5 o C higher than the optimal activity temperature of the reverse transcriptase in the absence of tetramethylene sulfoxide.
  • DMSO dimethylsulfoxide
  • the organic solvent is tetramethylenesulfone (sulfolane) at a concentration of about 0.1 molar to about the concentration at which the melting temperature (T M ) of the reverse transcriptase is 5 o C higher than the optimal activity temperature of the reverse transcriptase in the absence of sulfolane.
  • sulfolane tetramethylenesulfone
  • Diols are selected from the group consisting of1,2 ⁇ propanediol, 1,3 ⁇ propanediol, 1,2 ⁇ butanediol, 1,3 ⁇ butanediol, 1,4 ⁇ butanediol, 1,2 ⁇ pentanediol, 2,4 ⁇ pentanediol, 1,5 ⁇ pentanediol, 1,2 ⁇ cyclopentanediol, 1,2 ⁇ hexanediol, 1,6 ⁇ hexanediol, and 2 ⁇ methyl ⁇ 2,4 ⁇ pentanediol.
  • the organic cosolvent is selected from the group consisting of 1,3 ⁇ propanediol at a concentration of about 0.5 to about 3.0 molar concentration, 1,4 ⁇ butanediol at a concentration of about 0.5 to about 2.0 molar concentration, and 1,5 ⁇ pentanediol at a concentration of about 0.5 to about 1.0 molar concentration.
  • the organic solvent is selected from the group consisting of 1,3 ⁇ propanediol at a concentration of about 0.5 molar to about the concentration at which the melting temperature (T M ) of the reverse transcriptase is 5 o C higher than the optimal activity temperature of the reverse transcriptase in the absence of 1,3 ⁇ propanediol, 1,4 ⁇ butanediol at a concentration of about 0.5 molar to about the concentration at which the melting temperature (T M ) of the reverse transcriptase is 5 o C higher than the optimal activity temperature of the reverse transcriptase in the absence of 1,4 ⁇ butanediol, and 1,5 ⁇ pentanediol at a concentration of about 0.5 molar to about the concentration at which the melting temperature (T M ) of the reverse transcriptase is 5 o C higher than the optimal activity temperature of the reverse transcriptase in the absence of 1,5 ⁇ pentanediol.
  • thermostable reverse transcriptase or a fragment thereof. Any thermostable reverse transcriptase consistent with the technical 24 objectives described herein can be employed. In being thermostable, the reverse transcriptase can have an optimal RT temperature above 37 o C and preferably above 48 o C.
  • the thermostable reverse transcriptase in some embodiments, comprises one or more non ⁇ natural amino acid alterations conferring stability and/or activity in the one or more polar organic solvents.
  • the thermostable reverse transcriptase is a mutant or modified Taq polymerase bearing at least 90% sequence similarity to wild ⁇ type Taq polymerase (SEQ ID NO: 1).
  • the amino acid sequence comprises a first set of non ⁇ natural amino acid alterations stabilizing the modified Taq DNA polymerase in an aqueous ⁇ organic medium, and a second set of non ⁇ natural amino acid alterations conferring confer reverse transcriptase activity to the modified Taq DNA polymerase.
  • non ⁇ natural amino acid alterations of the first set stabilizing the modified Taq DNA polymerase in the low molecular weight polar organic solvents or aqueous ⁇ organic media comprising the low molecular weight polar organic solvents are selected from the group consisting of G3D, M4I, L5Q, F8L, E9V, P10S, V14A, L16P, H21R, A23P, L22M, F27S, A29T, G32D, G38D, K53N, A54V, L55P, A61V, D67G, P71L, R74L,R74H,R74C, K82N, G84D, A86V, P87Q, P89S, E90D, A97T, V103A, D104G, A109V, R110Q, P114S, G115D, E117D, A118V, A118T, K128R, V136A, L149P, L162P, K171T, A180V,
  • the solvostable first set of non ⁇ natural amino acid alterations are selected from the group consisting of L5Q, F8L, P10S, L16P, A23P, A29T, K31R, G38D,A61V, P89S, A97T, A118V, L162P, K171T, T186I, E201K, R205K, K206Q, G208S, K219E, N220D, I228V, M236T, D244E, D244V, R261H, D273G, L287Q, S290G, V310L, H333R, K346R, L351M, P382T, E388D, E434D, A454E, L461Q, L461R, V474I, F482I, I503T, E507K, S515N, A521V, Q534R, S543G, D551G, D551N, Q
  • the solvostable first set of non ⁇ natural amino acid alterations are selected from the group consisting of P10S, L16P, A29T, K31R, G38D, A61V, A118V, L162P, T186I, G208S, N220D, I228V, D244V, D273G, S290G, K346R, L351M, E388D, A454E, L461Q, L461R, F482I, I503T, S515N, A521V, Q534R, D551G, L606M, A608V, S612R, Q680R, E734G, S739G, F749V, F749I, L768M, and E832K of SEQ ID NO: 1.
  • the solvostable first set of non ⁇ natural amino acid alterations are selected from the group consisting of L5Q, P10S, A23P, A29T, T186I, L461R, E507K, A608V, S612R, E742K, F749L, F749I, K762R, K767R, and E832K of SEQ ID NO: 1.
  • the solvostable first set of non ⁇ natural amino acid alterations are selected from the group consisting of P10S, L16P, A29T, K31R, G38D, A61V, A118V, L162P, T186I, G208S, N220D, I228V, D244V, D273G, S290G, K346R, L351M, E388D, A454E, L461Q, L461R, F482I, I503T, S515N, A521V, Q534R, D551G, L606M, A608V, S612R, Q680R, E734G, S739G, F749V, F749I, L768M, and E832K of SEQ ID NO: 1.
  • quantifying the PCR product can be administered by qPCR.
  • the virus of the clinical sample for example, can be SARS ⁇ CoV virus or other respiratory virus.
  • kits for detection via RT ⁇ PCR of viral or bacterial pathogen RNA directly from clinical samples without sample preparation are provided.
  • such a kit comprises a thermostable or solvostable reverse transcriptase (RT) enzyme, one or more low molecular weight polar organic cosolvents, optionally a thermostable or solvostable DNA ⁇ dependent DNA polymerase enzyme, RT ⁇ PCR buffer, and primers complementary to the nucleic acid sequence to be detected.
  • RT thermostable or solvostable reverse transcriptase
  • kits including the solvostable reverse transcriptase (RT) enzyme and low molecular weight organic solvent can have any composition and/or properties described herein.
  • ddRT ⁇ PCR droplet digital reverse transcription PCR with enhanced RT and PCR efficiency are described herein.
  • a method for droplet digital reverse transcription PCR with enhanced RT and PCR efficiency, the method comprising: a) incubating RT ⁇ PCR reagents including a RT ⁇ PCR buffer, a thermostable or solvostable reverse transcriptase, a thermostable or solvostable DNA ⁇ dependent DNA polymerase, primers and/or probes for a sequence or mutation of interest, a polar organic cosolvent within emulsion droplets, and one or more RNA templates, at or near the optimal temperature for reverse transcription, such that the polar organic cosolvent at least doubles the reverse transcription yield compared to buffer lacking the cosolvent; b) thermal cycling of the reaction mixture to PCR amplify the resulting cDNA; and c) counting or sorting of the resulting positive droplets using a fluorescence ⁇ based counting or sorting device.
  • RT ⁇ PCR reagents including a RT ⁇ PCR buffer, a thermostable or solvostable reverse transcriptase, a thermostable or solv
  • a method for accelerating the in vitro evolution of reverse transcriptase (RT) enzymes comprising: a) preparation of a library of thermostable polymerase enzyme gene variants; 30 b) expression of the enzymes corresponding to these gene variants, for example through bacterial transformation and expression or in vitro transcription/translation of the library, in individual containers, the containers preferably being either droplets or microplate wells; c) incubation of the library of enzyme variants within individual containers, with one or more polar organic cosolvents at specified concentrations, RT ⁇ PCR buffer, primers and/or probes for an RNA sequence of interest, optionally a thermostable or solvostable DNA ⁇ dependent DNA polymerase enzyme, and the RNA template, at a temperature suitable for reverse transcription, the temperature preferably being between 48 o C and 80 o C; d) thermal cycling of the reaction mixtures to PCR amplify
  • the amino acid sequence comprises a first set of non ⁇ natural amino acid alterations stabilizing the modified Taq DNA polymerase in an aqueous ⁇ organic medium, and a second set of non ⁇ natural amino acid alterations conferring confer reverse transcriptase activity to the modified Taq DNA polymerase.
  • the temperature of reverse transcription is higher than its optimal value in the absence of the 31 polar organic cosolvent, and less than or equal to the melting temperature of the fully extended RNA:DNA heteroduplex at that cosolvent concentration, minus 5 o C.
  • RNA ⁇ seq next ⁇ generation RNA sequencing
  • reverse transcriptases especially those enzymes whose optimal temperatures for RNA ⁇ dependent DNA polymerization are significantly above 37 o C, preferably above 48 o C, which is not the case for the vast majority of RTs
  • reverse transcriptases can be solvophilic – with polar organic cosolvents increasing rather than decreasing their catalytic activity, and often increasing the activity of engineered solvostable reverse transcriptases over 5 ⁇ fold and in some cases over 15 ⁇ fold under conditions conducive to the elimination of secondary structure while maintaining the chemical integrity of RNA.
  • organic solvent ⁇ resistant reverse transcriptases thus expanding the repertoire of RTs to include those that are resistant to both high temperature and organic media.
  • compositions containing both RT enzyme(s) and certain polar organic cosolvent(s) within certain preferred ranges have never been anticipated nor reported to result in upregulation of the RT enzyme(s), and as such they constitute novel compositions.
  • RT reactions we conducted both RT and PCR steps of RT ⁇ PCR reactions in mixed aqueous ⁇ organic media using either a thermostable or engineered solvostable RT 33 enzyme and either a thermostable of engineered solvostable DNA ⁇ dependent DNA polymerase enzyme.
  • Engineered solvophilic reverse transcriptases are introduced that display activity at temperatures approaching 80 o C and over 400% upregulation of activity in the presence of organic cosolvents (up to 2000%), and overcome sequence ⁇ dependent RNA secondary structure more effectively than any other tested enzyme.
  • Preferred engineered solvophilic reverse transcriptase compositions display optimal temperatures for activity between 48 o C 34 and 76 o C and at least 100% upregulation of activity in the presence of appropriate concentrations of at least one polar organic cosolvent.
  • some of these enzymes are also solvostable DNA ⁇ dependent DNA polymerases, enabling their use in one enzyme, one pot RT ⁇ PCR reactions in mixed aqueous ⁇ organic media comprising certain polar organic solvents within specific concentration ranges.
  • RNA ⁇ Seq next ⁇ generation sequencing
  • solvophilic RT technology includes: a) infectious disease detection without sample preparation steps by RT ⁇ PCR using thermostable and/or solvostable RT enzymes in the presence of organic cosolvents, due to the ability to lyse bacteria and viruses at lower temperatures conducive to the chemical stability of RNA through the destabilizing effects of organic cosolvents on these microorganisms; b) droplet digital RT ⁇ PCR (ddRT ⁇ PCR) with improved detection of rare RNA mutations using thermostable and/or solvostable RT enzymes within droplets in the presence of organic cosolvents (exploiting the greatly enhanced RT enzyme activity in these cosolvents) and 36 droplet sorting/counting by methods such as FACS; and c) ultrahigh ⁇ throughput RT enzyme engineering with greatly enhance signal enhancement from rare active library variants due to the ability of organic cosolvents to multiply RT activity
  • thermostable reverse transcriptases i.e., reverse transcriptases whose optimal temperature for RNA ⁇ dependent DNA polymerization is above 37 o C and preferably significantly above that temperature – preferably above 48 o C
  • thermostable reverse transcriptases i.e., reverse transcriptases whose optimal temperature for RNA ⁇ dependent DNA polymerization is above 37 o C and preferably significantly above that temperature – preferably above 48 o C
  • RT activity assay DNA sequence conversion assay
  • SFM 4 ⁇ 6, SFM 4 ⁇ 3 DNA sequence conversion assay
  • Reverse transcriptase activities of highly thermostable RTs of interest were tested at different extension temperatures conducive to the reduction of RNA secondary structure (55 o C, 68 o C, 72 o C and 76 o C).
  • RT activity was observed in SFM 4 ⁇ 6, SFM 4 ⁇ 3 and Taq polymerase RT variants engineered for solvent tolerance [N ⁇ 7 ⁇ 3 ⁇ B07 ⁇ RT (SEQ ID NO: 4), L ⁇ 5 ⁇ 2 ⁇ F01 ⁇ RT1 (SEQ ID NO: 2), and L ⁇ 5 ⁇ 2 ⁇ F01 ⁇ RT2 (SEQ ID NO: 3)], and it was found that RT activities of tested mutants were dramatically enhanced in the presence of cosolvents up to over 20% v/v (Fig. 2).
  • Polar organic cosolvents from all the major aforementioned families – including 1,4 ⁇ butanediol for the diol family, sulfolane for the sulfone family, tetramethylene sulfoxide for 37 the sulfoxide family, and 2 ⁇ pyrrolidone for the amide family ⁇ were applied in reverse transcriptase activity assays (Fig. 2, Tables 1,2).
  • the RT activity decreased with increasing temperature (Fig. 2 (B,D)).
  • SFM4 ⁇ 6 lost its RT activity whereas L ⁇ 5 ⁇ 2 ⁇ F01 ⁇ RT1 was still RT active.
  • the RT activity of SFM4 ⁇ 6 was limited or undetectable on this template, while the RT activities of L ⁇ 5 ⁇ 2 ⁇ F01 ⁇ RT1 and N ⁇ 7 ⁇ 3 ⁇ B07 ⁇ RT were enhanced in 7% BD (Cq ⁇ 15; Fig. 5I, lanes 4&6) compared to 0% BD (Cq ⁇ 20; Fig. 5I, lanes 3&5). Since the expected PCR product contains 75% GC, the T M is around 90°C (Fig. 5K, peaks 4&6), while the non ⁇ specific bands generated by SFM4 ⁇ 6 led to lower temperature melt peaks in both 0% BD and 7% BD (Fig. 5K, peaks 1&2).
  • thermostable reverse transcriptases L ⁇ 5 ⁇ 2 ⁇ F01 ⁇ RT1, L ⁇ 5 ⁇ 2 ⁇ F01 ⁇ RT2, SFM4 ⁇ 6, SFM4 ⁇ 3
  • thermostable Taq polymerase based on variants of the thermostable Taq polymerase that these enzymes not only display resistance in their RT activity to organic cosolvents (including in the context of RT ⁇ PCR), but also show for the first time that the activity of highly thermostable RTs can be improved by the presence of organic cosolvents, with the RT activity of L ⁇ 5 ⁇ 2 ⁇ F01 ⁇ RT1 increasing almost 2000% in the presence of 20% BD (Fig.
  • thermostable RT enzyme activity upregulation by the aforementioned polar organic cosolvents motivated the engineering of such enzymes for further enhanced function in mixed aqueous ⁇ organic media.
  • thermostable polymerase mutant libraries wherein both RT and DNA ⁇ dependent DNA polymerase activity in organic cosolvents could be introduced and/or improved, through ultrahigh ⁇ throughput droplet ⁇ based selection, computational modeling and experimental screening and characterization.
  • the thermostable polymerase was chosen to be Taq polymerase, but other thermostable polymerases may be used as well.
  • Selections were typically carried out using DNA ⁇ dependent DNA polymerase activity in droplet ⁇ based PCR reactions because of the comparative simplicity of the protocol compared to direct selection for RT activity – including the ability to apply compartmentalized self ⁇ replication (CSR) of the polymerase gene – based on the underlying observations that a) polymerase stability in mixed aqueous ⁇ organic media is the same irrespective of whether the activity in question is DNA ⁇ dependent or RNA ⁇ dependent DNA polymerase activity; and b) the native DNA ⁇ dependent DNA polymerase catalytic activity in the presence of organic solvents and at elevated is a prerequisite (though not sufficient) for RT activity in organic media as well.
  • CSR compartmentalized self ⁇ replication
  • the Taq epPCR library was subjected to CSR selection in the presence of 5% BD.
  • NGS ⁇ guided CSR enrichment We followed genotype redundancy as a function of CSR round by NGS. We performed seven consecutive rounds of CSR on the epPCR library (generation 1) and five rounds on the shuffled library (generation 2).
  • mutants with improved stability contained mutations to lysine (e.g., E832K); such mutations have been reported to often improve protein stability through entropic stabilization.
  • the mutants that are present in the polymerase domain tend to cluster in and around the substrate binding site ⁇ e.g., V586 may be implicated in DNA binding in association with E742 and A743.
  • the residue S612 belongs to Motif A (605 ⁇ 617) of the polymerase domain. In general Motif A residues are mutatable, except for residue D610 which is part of the catalytic triad.
  • Residue F667 can tolerate only tyrosine substitution and has been implicated in nucleotide substrate discrimination enabling the polymerase to incorporate dNTPs.
  • mutants of F749 which 46 reside near the O and O1 helices of the fingers subdomain and indirectly affect the function of the enzyme.
  • Those in category 1) such as P10, L30, A54, A61, F73, T186 etc. (Table 3) primarily affect the stability, as deletion of the N ⁇ terminal 1 ⁇ 288 amino acids (as in the Stoffel fragment) leads to a more thermostable polymerase domain.
  • Protein purification and primer extension activity We added N ⁇ terminal His ⁇ tag to the screening positive mutants and purified the proteins to homogeneity. We determined the polymerase activities of the WT and its mutant derivatives using self ⁇ annealing template ⁇ primer (SATP) at 72 o C. We found that the specific activities of the mutants in aqueous buffer ranged from 12 ⁇ 210 mU/ng (Table 12). The wild ⁇ type specific activity in aqueous buffer was 119 mU/ng.
  • thermostability assay Although the thermostability assay described above is well ⁇ established and widely accepted to assess the thermal tolerance of polymerases, it is a kinetic denaturation assay that depends on the primer extension ability of the enzyme.
  • thermostability assays we conclude that evolved polymerases have improved thermostability especially in cosolvents.
  • protein melting temperatures of four thermostable and solvostable reverse transcriptases were also measured by nanoDSF (Table 6A).
  • the data demonstrate that the enzymes not specifically engineered for solvostability and activity in organic cosolvents display significantly lower melting temperatures — especially in the presence of organic cosolvents — than those that were engineered for function in mixed aqueous ⁇ organic media.
  • the introduction of RT activity ⁇ inducing mutations is also observed in some cases to result in a small reduction in protein T m as well (Table 6A).
  • the lysine (K) residue was observed to be involved in forming five hydrogen bonds (hydrogen bond cut ⁇ off: 2.7 ⁇ 3.3 ⁇ ) and one salt bridge with the bound RNA ligand (Fig. 8B).
  • the mutation Lysine (K) was observed to form one hydrogen bond with the bound RNA, compared to no hydrogen bond for the native E. 51 M742K is located near the active site and forms a salt bridge with the nucleic acid backbone.
  • the binding affinity energy evaluation for DNA was performed on E507K and S515N mutant complexes along with reference complex for relative comparison.
  • the binding affinity difference calculated using MM ⁇ GBSA was determined to be ⁇ 62.80 kcal/mol for the E507K mutation.
  • the binding affinity difference calculated using MM ⁇ GBSA was determined to be ⁇ 22.71 kcal/mole for the S515N mutation.
  • GC bias evaluation using NGS We applied the Illumina target enrichment protocol to genes of widely varying GC content from genomic DNA. As shown in Fig. 9, without BD, there was no effect of the engineered enzymes N ⁇ 7 ⁇ 3 ⁇ B07 and N ⁇ 7 ⁇ 3 ⁇ C08 on increasing the mean coverage of GC ⁇ rich genes B3GT6 and CDN1C relative to the lower GC content genes EGFR and KRAS (Fig. 9A), with the bias being consistent with the T m s depicted in Fig. 9C.
  • a concentration of 4% BD was added in the PCR pool when WT enzyme was used since there was no template amplification with WT over 5% BD under high denaturation temperature conditions.
  • a concentration of 10% BD was added in the PCR reactions 53 when L ⁇ 5 ⁇ 2 ⁇ F01 or N ⁇ 7 ⁇ 3 ⁇ B07 were used since as demonstrated in Fig. 5, L ⁇ 5 ⁇ 2 ⁇ F01 could amplify a number of GC ⁇ rich genes under these conditions.
  • Solvostable DNA polymerases reduce copy number estimation errors by orders of magnitude (Fig. 9, Table 8), and hence are expected to largely eliminate sequence bias when applied in conjunction with UMIs in genome sequencing applications.
  • Highly solvophilic RNA ⁇ dependent DNA polymerases L ⁇ 5 ⁇ 2 ⁇ F01 ⁇ RT1 and N ⁇ 7 ⁇ 3 ⁇ B07 ⁇ RT which can be combined with solvostable DNA ⁇ dependent DNA polymerases L ⁇ 5 ⁇ 2 ⁇ F01 and N ⁇ 7 ⁇ 3 ⁇ B07, display the ability to enrich targets for NGS sequencing / RNA ⁇ Seq with dramatically reduced bias and to amplify hitherto intractable genes. For example, their ability to synthesize and amplify cDNA from GC ⁇ rich RNA like BEGAIN with much higher efficiency (Fig.
  • RNA ⁇ seq RNA sequencing
  • qPCR traces are shown in Fig. 12A.
  • the synthesized polymerase clones SPC3, 4, 5 and 9 were able to tolerate up to 7% BD and were among the best performing mutants from the early rounds.
  • a GC ⁇ rich template, c ⁇ Jun qPCR was carried out for early round mutants with increasing concentrations of BD (Fig. 12), since both qPCR and the desired property of reverse transcription in such media benefit from solvent resistance.
  • the WT enzyme and the mutants were not able to amplify c ⁇ Jun template at 0% BD (Cq values were close to the end of the 55 total number of cycles).
  • the protein melting T M s of the WT and mutant polymerases respond to BD concentration negatively (Table 6) with a linear relationship and the % enzyme denatured is displayed for several mutants in 5% BD in Fig. 13D.
  • the melting temperature of the WT ⁇ Taq polymerase decreases more per unit 57 BD concentration, compared to the mutants, consistent with the fact that the engineered polymerases resist the denaturation effect of BD.
  • Enzyme activity data at 0 and 5% BD demonstrate differential rates of activity loss.
  • Fig. 13E depicts the net effect of these properties on Cq values as a function of BD concentration and the concentrations at which maximal PCR efficiency is achieved for each.
  • top hit clones mutants from N series 7 th round, mutants from L series 5 th round and synthetic sequences
  • properties of the top hit clones with the best performance in terms of specific activity, thermostability, and/or PCR efficiency in the presence of 1,4 ⁇ butanediol are summarized in Table 1. Due to their improved butanediol organic solvent ⁇ tolerance and high thermal stability, the top hit clones were next systematically evaluated for their ability to improve GC ⁇ rich template amplification and to reduce GC bias in next ⁇ generation sequencing.
  • Nonlinear (RT ⁇ )PCR amplification dynamical models relate polymerase activity and thermostability as well as nucleic acid secondary structure and duplex melting temperatures to (RT ⁇ )PCR product yield and Cq value.
  • the proposed model can be used to predict the Cq value as a function of cosolvent concentration, given the effects of cosolvent on each of these three properties, and thus to identify the optimal cosolvent concentration for amplification of a given template with a characterized polymerase enzyme.
  • activity decline of DNA ⁇ dependent DNA polymerases
  • thermal denaturation by cosolvent, increase the minimum extension time which in turn decreases product yield.
  • the cosolvent concentration at which activity is extinguished or half ⁇ life becomes negligible determines the effective range of cosolvent concentrations because of the greater effect of the cosolvent on the enzyme activity at those concentrations.
  • GC ⁇ rich template amplification with engineered polymerases In addition to c ⁇ Jun, a broad set of GC ⁇ rich templates from genomic DNA (Table 13) was PCR ⁇ amplified with WT and one engineered polymerase (L ⁇ 5 ⁇ 2 ⁇ F01; Table 3), in the presence of BD. Two types of PCR cycling conditions (high and moderate denaturation temperature) were employed, with several BD concentrations. Fig. 5B shows that even under high denaturation temperature, WT is incapable of amplifying the seven GC ⁇ rich templates even in the presence of 7% BD. Interestingly, by increasing the BD concentration to 10% (Fig.
  • the engineered polymerase variant is capable of amplifying all seven of the GC ⁇ rich templates (with some degree of nonspecificity for CD5R2 and DACT3, which have among the highest GC contents at 64% average/88% max and 79% average/ ⁇ 100% max, respectively, Table 13 and Fig. 11).
  • the BAIP3 template (GC%: 64% average/80% max) showed strong amplification, with only one nonspecific band, while KLF14 (GC%:72% average/90% max) showed significantly lower specificity (Table 13 and Fig. 11).
  • KLF14 GC%:72% average/90% max
  • Solvostabilizing mutations can broaden the window for effective high temperature catalytic activity of reverse transcriptases at these cosolvent concentrations (compare SFM4 ⁇ 3, 4 ⁇ 6 with L5 ⁇ 2 ⁇ F01 ⁇ RT1 and ⁇ RT2 in Fig. 2 as well as Table 6A). Protein stabilizing adjuvants like glycerol can also be helpful.
  • the protein melting temperatures of four thermostable reverse transcriptases measured by nanoDSF (Table 6A) demonstrate that the enzymes not specifically engineered for solvostability and activity in organic cosolvents display significantly lower melting temperatures — especially in the presence of organic cosolvents — than those that were engineered for function in mixed 61 aqueous ⁇ organic media.
  • RNA:DNA heteroduplex reverse transcriptase enzymes
  • T m of the RNA:DNA heteroduplex is reduced by cosolvents.
  • Such effects may play a role in limiting the effective range of RT activity ⁇ enhancing polar organic cosolvents.
  • RTs generally have lower fidelity than DNA ⁇ dependent DNA polymerases and Taq variant RTs have been engineered to achieve fidelities close to several of the highest fidelity RTs reported to date without the need for a proofreading domain.
  • Fidelity data on the engineered solvostable RTs show that they do not generally have lower fidelities than other Taq variants.
  • Fidelity of the mutants Polymerases with high normalized peak area at 5% and/or 7% BD, including those which ranked most highly in the above computational and experimental activity and stability analyses, were selected for further characterization. As shown in Table 11, the fidelity of the engineered polymerases is similar to that of the wild type enzyme with the exception of SPC9, a synthetic variant which has slightly lower fidelity.
  • Reverse transcription within droplets, and reverse transcription and RT ⁇ PCR assays from cells enhanced by organic cosolvents For illustration of reverse transcription within emulsion droplets, direct detection of pico ⁇ green fluorescence from emulsion droplets was applied. Droplets were generated after mixing EnzChek RT buffer with brain total mRNA and the BEGAIN primer. As shown in the upper panel of Fig. 7(L), a clear fluorescence signal could be detected by microscopy when the droplets were processed after PCR. Prior to the PCR reaction, all droplets appeared uniform, and no bright droplets were observed. As a negative control, both pre ⁇ PCR and post ⁇ PCR images of the droplets lacking brain total mRNA did not show any bright droplets, indicating the absence of DNA formation.
  • FACS fluorescence ⁇ activated cell sorting
  • the purified SFM4 ⁇ 6 RT generated the expected DNA band across all BD conditions. However, its activity decreased at high BD concentrations, as anticipated. While a non ⁇ specific band was observed in the negative control lanes containing the wild ⁇ type Taq cells, no KRAS ⁇ specific band was detected, confirming the validity of the negative control. The cells expressing the SFM4 ⁇ 6 RT produced faint bands, indicating that its RT activity was weaker than that of the L ⁇ 5 ⁇ 2 ⁇ F01 ⁇ RT1 enzyme under these experimental conditions.
  • thermostable reverse transcriptases are generally solvophilic, i.e. upregulated by polar organic cosolvents
  • droplet ⁇ based directed evolution to engineer solvostable polymerases even more suitable for RNA ⁇ dependent DNA polymerization (RT) and RT ⁇ PCR applications.
  • RT RNA ⁇ dependent DNA polymerization
  • cosolvent ⁇ resistant engineered polymerases ideally solve the longstanding sequence bias problem of nucleic acid polymerization.
  • compositions and methods, including cosolvents and polymerases are expected to work not only in standard RT and RT ⁇ PCR but in any related protocols such as NGS/RNA ⁇ seq, droplet digital RT ⁇ PCR (ddRT ⁇ PCR), and infectious pathogen RNA detection without sample preparation.
  • thermostable reverse transcriptases having properties described herein is provided in Table 15 below.
  • the codon ⁇ optimized WT ⁇ Taq gene was synthesized at Genscript (NJ, USA). The gene was cloned in pASK ⁇ IBA5C vector (IBA Lifesciences, Germany) between XbaI and SalI restriction sites to create the plasmid pASK ⁇ Taq. Restriction enzymes, Q5, Vent polymerase, T4 DNA ligase, Calf Intestinal Phosphatase (CIP), and M13 single stranded DNA were procured from New England Biolabs Inc (MA, USA). Diversify PCR random mutagenesis kits were purchased from Takara Bio USA Inc. (CA, USA). All primers were synthesized at Integrated DNA Technologies (Iowa, USA).
  • RT Reverse Transcriptase activity
  • a Stoffel fragment mutant of Taq polymerase (SFM 4 ⁇ 6) reported previously to have RT activity and ProtoScript II RT were used as positive controls. Equal activities of the enzymes were applied in the master mixture (total volume 30 ⁇ l) and the mixture was incubated at 55°C, and the same quantities of each enzyme were also incubated at 68°C and 76°C, for 30 min. The reactions were terminated by addition of 2 ⁇ l of 200mM EDTA. 68 ⁇ l of the PicoGreen solution (as recommended by the kit for solution preparation) was added into the solution and incubated for 5 min at room temperature.
  • the RT activity was measured as intensity of fluorescence using TeCan (Infinite 200Pro) microplate reader with excitation / emission wavelengths 480nm and 520 nm respectively.
  • the standard curve was measured at 37 o C using a commercially available reverse transcriptase (ProtoScript II RT, NEB) to calculate the relative activity.
  • the data were collected and analyzed using GraphPad Prism 7.
  • RT ⁇ qPCR assay RT ⁇ qPCR efficiencies of our two best mutants L ⁇ 5 ⁇ 2 ⁇ F01+E742K+M747K (L ⁇ 5 ⁇ 2 ⁇ F01 ⁇ RT1) and N ⁇ 7 ⁇ 3 ⁇ B07+E742K+M747K (N ⁇ 7 ⁇ 3 ⁇ B07 ⁇ RT) were tested in absence and presence of BD (7%) and compared with the SFM4 ⁇ 6.
  • step 1 0.2 ⁇ g of a synthesized RNA of human BEGAIN gene fragment (100 base) with 75% GC content (CCUGCGGGCCAAGCCGGGGACCGCCCGGCUCCCCGGGGAGGACAUGAGGGGCCAGUGGCGUCC CCUGAGCGUGGAGGACAUCGGCGCCUACUCCUACCCC) (SEQ ID NO: 146) was incubated with 0.5 ⁇ g of BEGAIN RT ⁇ REV at 80°C for 10 min in 100 uL H 2 O (RNase and Dnase free).
  • RT reaction mixture (a total volume of 20 ⁇ l) was prepared using 1X Taq buffer ( ⁇ Mg), 0.25 mM dNTP, 3.5 mM MgCl 2 , RNase inhibitor (NEB), 1X SYBR safe, BD (0% or 7%), template RNA ⁇ primer mix (10 ⁇ l) from step 1 and 30 ng of each enzyme.
  • RT reaction was carried out at 55 o C or 68°C for an hour followed by deactivation of the above enzymes at 98.3°C for 1 min + 95°C for 6 min.
  • step 3 qPCR reaction mixture (20 ⁇ l) was prepared using 1X Taq 65 buffer ( ⁇ Mg), 0.25 mM dNTP, 3.5 mM MgCl 2 , 1X SYBR safe, RT reaction mixture from step 2 (1 ⁇ l), BEGAIN RT ⁇ FWD, BD (7%) and L ⁇ 5 ⁇ 2 ⁇ F01 enzyme (3.55 ng/0.625U).
  • the Bio ⁇ Rad CFX96 TM Real ⁇ Time PCR Detection System was used to carry out the qPCRs using 1 min at 95 o C followed by 40 cycles of 30s at 95°C, 30 sec at 57°C, and 40 sec at 72 o C. The Cq values were determined to assess the efficiency of RT ⁇ qPCR.
  • the purified products were digested by XbaI and SalI and introduced into the pASK ⁇ IBA5C vector.
  • the ligated products were electroporated into E. coli TG1 cells. After an hour of recovery, 5 ⁇ L cells were serially diluted to spread on the LB ⁇ chloramphenicol (50 ⁇ g/ml) plates to assess the library size.
  • the remaining cultures were re ⁇ inoculated into 20 ml LB media supplemented with chloramphenicol in 50 ml conical flask overnight at 37 o C and shaking at 250 RPM to generate N ⁇ epPCR expresser cells.
  • N ⁇ epPCR expresser cells (1%) were inoculated into 50 ml of LB ⁇ chloramphenicol. The cells were induced by anhydrotetracycline (300 ng/ml) to express the Taq polymerase once the OD 600 reached between 0.4 ⁇ 0.5. After four hours, the cells were harvested by centrifugation, washed, and resuspended in 1X Taq buffer (10 mM Tris ⁇ HCl pH 8.5, 50 mM KCl, 1.5 mM MgCl 2 , and 0.1% Triton X ⁇ 100). The CSR was performed as described by to select for thermostable and BD resistant mutants in 5% BD.
  • the emulsions were pre ⁇ incubated at 95 o C for 6 min, followed by CSR PCR, 25 cycles at 94 o C for 1 min, 55 o C for 1 min, and 72 o C for 5 min.
  • the top hit clones were randomly recombined by StEP PCR.
  • the resulting library (generation 2, pre ⁇ 1 st CSR round) was subjected to higher selection pressure.
  • the CSR ⁇ PCR was performed in the presence of 7% BD.
  • the CSR ⁇ PCR cycle used was as follows: 98.3 o C for 1 min then 95 o C for 6 min, followed by 25 cycles at 94 o C for 1 min, 55 o C for 1 min, and 72 o C for 5 min.
  • the library series generated via error ⁇ prone PCR are referred to as the N ⁇ series (or epPCR libraries) for short.
  • the initial error ⁇ prone PCR ⁇ generated library is labeled N ⁇ epPCR.
  • Downstream CSR ⁇ treated libraries are labeled referring to the number of CSR rounds applied to this library.
  • CSR ⁇ treated libraries are referred to N ⁇ 1 st , N ⁇ 2 nd , N ⁇ 3 rd , N ⁇ 4 th , N ⁇ 5 th , N ⁇ 6 th , and N ⁇ 7 th corresponding to the total 7 rounds of CSR treatment applied to this library.
  • the initial StEP shuffling ⁇ generated library is labeled L ⁇ StEP.
  • Downstream CSR ⁇ treated libraries are labeled referring to the number of CSR rounds applied to this library.
  • CSR treated libraries are referred to L ⁇ 1 st , L ⁇ 2 nd , L ⁇ 3 rd , L ⁇ 4 th , and L ⁇ 5 th corresponding to the total 5 rounds of CSR treatment applied to this library series.
  • Library enrichment and next ⁇ generation sequencing To enrich and identify best ⁇ performing clones, we subjected the epPCR library series to seven consecutive rounds of CSR in the presence of 5% BD. After each cycle of the CSR enrichment rounds, the PCR product was re ⁇ amplified, cloned and then transformed in E.
  • the Taq gene ( ⁇ 2.5 kbp) was arbitrarily divided into six fragments (Fragments 1 ⁇ 6 and the amplicon size ranged from 450 bp ⁇ 468 bp) to make it compatible with Illumina sequencing platform.
  • PCR products were gel purified and then subjected to the Illumina NGS protocol at GENEWIZ. Forward and reverse sequence reads were merged and filtered with a sequence quality score cutoff of 33, using the PEAR assembler. Filtered and assembled sequences were then aligned to the reference gene sequence (WT ⁇ Taq gene) using sequence matcher and pairwise2 modules of the Biopython software suite. We used alignment parameters 2, ⁇ 1, ⁇ 35, ⁇ 0.1, for identical, non ⁇ identical, gap opening, and gap extending, respectively, for both alignment tools. Resulting unique merged sequences and alignment scores were recorded.
  • Non ⁇ target, large frameshifted, and truncated data were removed based on an alignment score as a sequence length cutoff of amplicon length ( ⁇ 6 to +1bp).
  • Final sequences were translated to their corresponding in ⁇ frame amino acid sequences by the Biopython translate module; sequence changes were recorded and logged in a tabular format.
  • SPC1 ⁇ 9 A total of nine clones (Synthesized polymerase clones; SPC1 ⁇ 9) were synthesized at Genscript. SPC1 ⁇ 9 were based on mutations identified from wet lab screening after one round of CSR. Microfluidic droplet preparation for CSR and polymerase screening by FACS: We noted one of the challenges with manual droplet emulsion preparation is the polydispersity.
  • PE water ⁇ in ⁇ oil
  • DE double emulsion
  • Dolomite ⁇ Encapsulator system and 30 ⁇ m fluorophilic chip to generate a 20 ⁇ m, monodispersed, primary emulsion (PE) following the manufacturer’s protocol.
  • PE monodispersed, primary emulsion
  • For double emulsion preparation we loaded one channel of the reservoir chip with PE, while the 70 other channel was loaded with FluoSurf as spacer fluid. All the three P ⁇ pumps were loaded with outer carrier phase driving the PE and spacer fluid into the 30 ⁇ m hydrophilic chip.
  • Typical flow rates for double emulsion preparation were as follows: 0.8 ul/min for P1 and P2 ⁇ pumps whereas 8 ul/min for P3 ⁇ pump, generating 30 ⁇ m DE. Droplet generation was monitored by an in ⁇ built, high ⁇ speed camera.
  • the primary emulsions were subjected to PCR. We employed the following PCR cycles ⁇ 95 o C for 6 minutes followed by 25 cycles of 95 o C for 1 min, 55 o C for 1 min, 72 o C for 5 min.
  • PCR cycles 100 o C for 6 minutes followed by 25 cycles of 95 o C for 1 min, 55 o C for 1 min, 72 o C for 5 min.
  • To prepare the double emulsion we used a 30 ⁇ m hydrophilic chip.
  • the samples were collected as SYBR HIGH , SYBR MEDIUM and SYBR LOW for downstream processing.
  • SYBR HIGH population 71 represents most of the droplets
  • SYBR MEDIUM contributes to the sorted population possibly because SYBR Green I binds to bacterial chromosomal DNA.
  • the excess sheath fluid was removed from SYBR HIGH sample then mixed with 2X volume of 1H, 1H, 2H, 2H ⁇ Perfluoro ⁇ 1 ⁇ octanol (PFO) to break the droplets, followed by Sanger sequencing to quantify enrichment of each clone.
  • Real ⁇ time qPCR screening assay A SYBR Green I assay based on real ⁇ time qPCR was used to screen the transformants obtained following CSR selection. Transformed colonies were picked and inoculated into a 96 ⁇ deep well culture plate containing 500 ⁇ L LB ⁇ chloramphenicol medium. Cells were grown and induced by anhydrotetracycline (300 ng/ml) once the OD 600 reached between 0.4 ⁇ 0.5. Then the cells were harvested and resuspended in 200 ⁇ L of 1X Taq buffer (10 mM Tris ⁇ HCl, pH 8.0, 50 mM KCl, 1.5 mM MgCl 2 , 0.1% Triton X ⁇ 100).
  • 1X Taq buffer 10 mM Tris ⁇ HCl, pH 8.0, 50 mM KCl, 1.5 mM MgCl 2 , 0.1% Triton X ⁇ 100).
  • the PCR mix contained 10 ⁇ L of cell suspension and 40 ⁇ L master mix 1,4 ⁇ Butanediol (5% (v/v), 0.25 mm dNTP, 1 mg/mL BSA, 3.5 mM MgCl 2 , 0.5 ⁇ M of primers ⁇ Taq Q1, Taq Q2 (Table 14), and 0.5X SYBR Green I.
  • Bio ⁇ Rad CFX96 TM Real ⁇ Time PCR Detection System to carryout PCR using the following program – 6 min at 95 o C followed by 16 cycles of 30 sec at 94°C, 30 sec at 57.8°C, and 30 sec at 72 o C.
  • N ⁇ 7 ⁇ 1 ⁇ E10 refers to a clone isolated from the epPCR library (N) after 7 CSR rounds on plate 1 in well E10; whereas L ⁇ 1 ⁇ 14 ⁇ H10 refers to a clone isolated from the shuffling library (L) after 1 CSR round on plate 14 in well H10.
  • Protein purification We introduced His ⁇ tag to the top ranked clones by PCR using Q5 site ⁇ directed mutagenesis kit (NEB). The primer (His ⁇ F and His ⁇ R) sequences are listed in Table 14. 72 Following transformation, we confirmed the His ⁇ tag by DNA sequencing. Single colonies expressing either WT polymerase or mutant derivatives were grown overnight at 37 o C in 5 ml LB ⁇ chloramphenicol.
  • the overnight grown cultures were re ⁇ inoculated into 200 ml of LB ⁇ chloramphenicol.
  • the protein expression was induced by anhydrotetracycline (300 ng/ml) once the OD 600 reached between 0.4 ⁇ 0.5.
  • the cells were harvested by centrifugation after 4 hours, washed once, and resuspended in 2.5 ml wash buffer (50 mM Tris ⁇ HCl, pH 7.9, 50 mM dextrose, 1 mM EDTA, 1 mM PMSF).
  • the cell suspensions were subjected to two cycles of freeze ⁇ thaw.
  • the partially lysed cells were incubated with 1 mg/ml lysozyme at room temperature for 15 min.
  • lysis buffer (10 mM Tris ⁇ HCl, pH 7.9, 50 mM KCl, 1 mM EDTA, 1 mM DTT, 1 mM PMSF, 0.5% Tween ⁇ 20, 0.5% Nonidet P40) was added; the sample was kept on ice for 30 min. The crude lysates were then incubated at 75 o C for 30 min followed by centrifugation to collect the supernatant. The nucleic acids were precipitated by streptomycin sulfate. The solution was centrifuged, and the supernatant was loaded onto an IMAC column.
  • the column was washed with equilibration buffer (10 mM Tris ⁇ HCl, pH 7.9, 50 mM KCl, 20 mM imidazole), and eluted with 10 mM Tris ⁇ HCl, pH 7.9, 50 mM KCl, 300 mM imidazole.
  • the proteins were dialyzed against dialysis buffer containing 20 mM Tris ⁇ HCl, pH 8.0, 1 mM DTT, 0.1 mM EDTA, 100 mM KCl, 0.5 % NP40, 0.5% Tween ⁇ 20 and 50% glycerol.
  • the polymerases were quantified using Bio ⁇ Rad’s DC protein assay.
  • 0.2 ng purified WT and its mutant derivatives were incubated with 100 nM SATP, 3 mM MgCl 2 , 250 ⁇ M dNTPs, 1x EvaGreen, and 0.5 ⁇ g/ ⁇ L BSA in 1x Taq buffer.
  • the primer extension reactions were carried out at 72 o C.
  • Half ⁇ lives of the enzymes were determined as described previously, except that we used EvaGreen based assay and utilized SATP to measure the remaining activity as described above.
  • Thermal unfolding analysis The thermal unfolding experiments of wild type polymerases as well as the variants (5 ⁇ M, in 20 mM Tris ⁇ HCl pH 8.0, 1 mM DTT, 0.1 mM EDTA, 100 mM KCl, and 5% glycerol) were performed using nano ⁇ scale Differential Scanning Fluorimetry (nanoDSF) on a Prometheus NT.48 instrument, with a high ⁇ temperature package and back ⁇ scatter optics, which allowed analysis of thermal unfolding and aggregation up to 110°C.
  • nanoDSF Nano ⁇ scale Differential Scanning Fluorimetry
  • Thermal denaturation of each protein was determined in triplicate by measuring changes in fluorescence at 330 and 350 nm over varying temperature, from 30°C to 110°C, with a heating speed of 1°C/min and with a 10% sensitivity setting (fluorescence excitation power). These measurements were completed in the presence of 5% BD. Experiments were performed, in triplicate, at 2Bind GmbH (https://2bind.com, Regensburg, Germany). The ratio of 350/330 nm and scattering data were analyzed using the PR. Stability Analysis software (v. 1.1, Nanotemper Technologies, Kunststoff Germany).
  • the minimization was performed for a total of 20,000 steps with the first 1000 steps of steepest descent followed by conjugate gradient algorithm for the remaining steps, within which the total energy of the complex was observed to become stable.
  • Two different DNA inputs were used in the NGS library preparation: a) using plasmid DNA ⁇ five high GC templates (c ⁇ Jun 63%, BEGAIN 71.3%, DACT3 79.2%, PO3F3 77.7%, and BAIP3 64.4%) were cloned into PUC18 plasmid and 5 ng of each prepared construct were pooled.
  • the five templates were coamplified with 7.25U of either WT, L ⁇ 5 ⁇ 2 ⁇ F01 or N ⁇ 7 ⁇ 3 ⁇ B07 mutant under the same conditions. 4% BD was used for WT enzyme and 10% BD was used for the mutants.
  • the reaction mixture contained 0.75 mM dNTP, 1 mg/mL BSA, 3.5 mM MgCl 2 , and 0.5 ⁇ M of each primer.
  • the following PCR programs were used: 98.3 o C for 1 min and 95 o C for 6 min, 25 cycles of 94 o C for 30 sec, 57.8 o C for 30 sec, 72 o C for 50 sec.
  • the PCR products were run on 1% agarose gel and purified using Qiagen DNA Gel Extraction and purification Kit. Purified PCR products were sent to GENEWIZ for sequencing and library preparation as described above.
  • the Fastq raw sequencing data from GENEWIZ on Illumina platform were aligned to the targeted templates and read frequencies were determined for each template; b) using genomic DNA ⁇
  • the mutant enzymes N ⁇ 7 ⁇ 3 ⁇ B07 and N ⁇ 7 ⁇ 3 ⁇ C08 and WT were tested in NGS library preparation using 150 ng genomic DNA in absence and presence of 5% BD.
  • Three high GC templates (B3GT6 72%, CDN1C 78%, EGFR 60% and one low GC template (KRAS 40 %) were coamplified using gene ⁇ specific PCR primers under the same conditions. The following PCR cycles were used: 98°C for 3 min followed by 30 cycles of 30 sec at 95°C, 30 sec at 58.5°C, and 30 sec at 72°C.
  • the PCR products were purified with Monarch DNA Gel Extraction Kit (New England BioLabs) and eluted with 10 ⁇ L elution buffer.
  • the purified products were mixed and prepared with the Nextera XT library 77 prep kit (Illumina) according to manufacturer’s instructions.
  • the indexed libraries were subsequently purified with Illumina Purification Beads included in Nextera XT library prep kit (Illumina), and quantified using the Qubit High Sensitivity dsDNA Assay (Thermo Fisher Scientific, Waltham, MA). The average fragment size, defined as insert length plus adapter length, for each sample was calculated prior to pooling.
  • the pooled libraries were sequenced on an Illumina iSeq100 using a 2 x 150 bp paired ⁇ end sequencing protocol.
  • the raw sequencing data were demultiplexed and converted to Fastq files by iSeq100 Local Run Manager DNA Enrichment Analysis Module v2.0.1.5.
  • the reads were then aligned to human genome assembly 37/hg19 reference sequence by BWA ⁇ MEM.
  • qPCR efficiency and amplification of GC ⁇ rich templates To confirm the screening rank obtained from library screening and characterize the ability of engineered polymerases to amplify GC ⁇ rich templates, we used purified enzymes and performed the qPCR assay.
  • the PCR mix contained 1.25U of each enzyme in the presence of different concentrations of cosolvents (1,4 ⁇ Butanediol, or Pyrrolidone or Sulfolane), and 5 ng of Taq or GC ⁇ rich template.
  • the reaction mixture contained, 0.25 mM dNTP, 1 mg/mL BSA, 3.5 mM MgCl 2 , 0.5 ⁇ M of each primer ⁇ (Q1 and Q2 for Taq template; primers listed in Table 14 for GC ⁇ rich templates), and 0.5X SYBR Green I.
  • PCR cycles were used: 95 o C for 6 min followed by 30 cycles of 30 sec at 94°C, 30 sec at 59°C, and 30 sec at 72 o C.
  • Fig. 5 High denaturation temperature (98.3 o C for 1 min + 95 o C for 6 min followed by 25 cycles of 94 o C for 30 sec, 57 o C for 30 sec, 72 o C for 50 sec).
  • Moderate denaturation temperature (94 o C for 2 min followed by 30 cycles of 95 o C for 30 sec, 57 o C for 30 sec, 72 o C for 50 sec).
  • a final extension was done at 72 o C for 2 min before holding at 4 o C.
  • the PCR mix included 1X PCR buffer (Invitrogen), 1.5 mM MgCl 2 , 0.25 mM dNTPs, 25 ng human gDNA (Promega #G1471), 0.5 ⁇ M each forward and reverse primers, and 2.5 U of the polymerase.
  • the PCR products were resolved on 1% agarose gel.
  • Reverse transcription within droplets Total RNA from brain tissue (ThermoFisher AM7962) 5 ⁇ g was mixed with forward and reverse primers targeting the BEGAIN gene in Enzchek RT buffer. The RNA ⁇ primer mixture was then subjected to a dolomite microfluidic device to generate water ⁇ in ⁇ oil emulsion droplets.
  • the device produced approximately 3 million droplets with an average diameter of 20 ⁇ m and a total input volume of 100 ⁇ L.
  • Half of the generated droplets (50 ⁇ L) were transferred to a thermocycler and underwent reverse transcription and PCR amplification using the following protocol: 55°C for 30 minutes, followed by 35 cycles of 95°C for 30 seconds, 55°C for 30 seconds, and 72°C for 40 seconds.
  • 2 ⁇ L of the post ⁇ PCR droplets were mixed with 2 ⁇ L of 2X concentrated Picogreen dye on a microscope slide. Following a 10 ⁇ minute incubation at room temperature, the sample was examined under a fluorescence microscope.
  • a 119 ⁇ nucleotide partial KRAS RNA (sequence: AGCUAAUUCAGAAUCAUUUUGUGGACGAAUAUGAUCCAACAAUAGAGGAUUCCUACAGGAAG 79 CAAGUAGUAAUUGAUGGAGAAACCUGUCUCUUGGAUAUUCUCGACACAGCAGGUCAA) was synthesized by Genscript. Fifty picomoles of the KRAS RNA were mixed with 50 pmol of forward and reverse primers, and 0.5 mM dNTPs in EnzChek RT buffer. Different reverse transcriptases, either purified enzymes or unpurified preparations, were then added to the reaction mixture.
  • a ⁇ SFM4 ⁇ 6 40 ng, positive control
  • B, C D ⁇ 5 million bacterial cells expressing wild ⁇ type Taq
  • SFM4 ⁇ 6, and L ⁇ 5 ⁇ 2 ⁇ F01 ⁇ RT1 were assigned different concentrations of 1,4 ⁇ butanediol (BD) (0%, 5%, 10%, 20%).
  • BD 1,4 ⁇ butanediol
  • the RT reaction mixture (final volume 20 ⁇ L) was then transferred to a PCR thermocycler and incubated at 80°C for 10 minutes followed by 55°C for 60 minutes. After the RT reaction, the samples were centrifuged before being used for the subsequent PCR step. PCR was carried out using the NEB LUNA PCR mix (Cat.
  • PCR was run in 5% BD ⁇ 95 o C for 6 min, followed by 16 cycles of 94 o C for 30 sec, 57.8 o C for 30 sec, 72 o C for 30 sec, or in 7% BD ⁇ 98.3 o C for 1 min, 95 o C for 6 min, followed by 16 cycles of 94 o C for 30 sec, 57.8 o C for 30 sec, 72 o C for 30 sec. In both cases, final extension was done at 72 o C for 2 min before holding at 4 o C.
  • Frequency of each unique mutation species within a region was calculated by dividing the number of reads of specific mutation by the total number of detected reads of sequences within that region and multiplying by 100 to yield percentage.
  • GC bias of GC ⁇ rich templates with engineered polymerases were PCR amplified together with either WT or L ⁇ 5 ⁇ 2 ⁇ F01 or N ⁇ 7 ⁇ 3 ⁇ B07 mutants under the same conditions.
  • Gene ⁇ specific primers (one set of FWD and REV for one template) were added in the PCR reactions.
  • A) The PCR mix contained 7.25U of each enzyme in the presence of BD and 5 ng of each template.
  • the reaction mixture contained 0.75 mM dNTP, 1 mg/mL BSA, 3.5 mM MgCl 2 , 0.5 ⁇ M of each primer.
  • B) The PCR mix contained 1.25U of each enzyme in the presence of BD and 5 ng of each template.
  • the reaction mixture contained 0.25 mM dNTP, 1 mg/mL BSA, 3.5 mM MgCl 2 , 0.5 ⁇ M of each primer.
  • the following PCR program were used for both Tables A and B: 98.3 o C for 1 min and 95 o C for 6 min, 25 cycles of 94 o C for 30 sec, 57.8 o C for 30 sec, 72 o C for 50 sec.
  • PCR products were isolated from 1% agarose gel electrophoresis and subjected to NGS analysis. Percent frequency of each gene in the PCR pool was calculated from the total number of read sequences. More details of GC content (%) is presented in Fig. 11.
  • the Cq values for the WT and the top clones selected from generation 1 library (one clone from 1 st enrichment and three clones from 7 th enrichment round), two clones from generation 2 after the 5 th enrichment, and a synthetic clone SPC9 (Table 3).
  • the following PCR programs were used to amplify (A) WT ⁇ Taq template: 95 o C for 6 min, 16 cycles of 94 o C for 30 sec, 57.8 o C for 30 sec, 72 o C for 60 sec, using Q1 and Q2 primers.
  • BD 1,4 ⁇ butanediol
  • Table 15 Reverse Transcriptases Developed Herein Table 15 provided non ⁇ limiting examples of reverse transcriptases having properties described herein. Sequence Listing Amino acid alterations/mutations SEQ ID NO: 1 WT ⁇ Taq DNA polymerase SEQ ID NO: 2 SEQ ID NO:1 incorporating the amino acid alterations amino acid alterations A97T, A608V, K702R, K762R, E742K, M747K SEQ ID NO: 3 SEQ ID NO:1 incorporating the amino acid alterations amino acid alterations A97T, A608V, K702R, K762R, and D732N SEQ ID NO: 4 SEQ ID NO:1 incorporating the amino acid alterations amino acid alterations A23P, L162P, 228V, L461R, A521V, E734G, F749I, L768M, E742K, and M747K SEQ ID NO: 5 SEQ ID NO:1 incorporating the amino acid alterations amino acid alterations L30
  • SEQ ID NO: 7 SEQ ID NO:1 incorporating the amino acid alterations amino acid alterations L30P, A54V, E434D, K206Q, S612R, V730I, F749V, E742R, and M747R.
  • SEQ ID NO: 8 SEQ ID NO:1 incorporating the amino acid alterations amino acid alterations L30P, A54V, E434D, K206Q, S612R, V730I, F749V, E742N, and M747N.
  • SEQ ID NO: 9 SEQ ID NO:1 incorporating the amino acid alterations amino acid alterations L30P, A54V, E434D, K206Q, S612R, V730I, F749V, E742K, and M747R.
  • SEQ ID NO: 10 SEQ ID NO:1 incorporating the amino acid alterations amino acid alterations L30P, A54V, E434D, K206Q, S612R, V730I, F749V, E742K, and M747N.
  • SEQ ID NO: 11 SEQ ID NO:1 incorporating the amino acid alterations amino acid alterations L30P, A54V, E434D, K206Q, S612R, V730I, F749V, E742R, and M747K.
  • SEQ ID NO: 12 SEQ ID NO:1 incorporating the amino acid alterations amino acid alterations L30P, A54V, E434D, K206Q, S612R, V730I, F749V, E742R, and M747N.
  • SEQ ID NO: 13 SEQ ID NO:1 incorporating the amino acid alterations amino acid alterations L30P, A54V, E434D, K206Q, S612R, V730I, F749V, E742N, and M747K.
  • SEQ ID NO: 14 SEQ ID NO:1 incorporating the amino acid alterations amino acid alterations L30P, A54V, E434D, K206Q, S612R, V730I, F749V, E742N, and E747R.
  • SEQ ID NO: 15 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, T186I, D244V, K314R, E520G, V586A, S612R, V730I, F749V, and D732N.
  • SEQ ID NO: 16 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, T186I, D244V, K314R, E520G, V586A, S612R, V730I, F749V, E742K, and M747K.
  • SEQ ID NO: 17 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, T186I, D244V, K314R, E520G, V586A, S612R, V730I, F749V, E742R, and M747R.
  • SEQ ID NO: 18 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, T186I, D244V, K314R, E520G, V586A, S612R, V730I, F749V, E742N, and M747N.
  • SEQ ID NO: 19 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, T186I, D244V, K314R, E520G, V586A, S612R, V730I, F749V, E742K, and M747R.
  • SEQ ID NO: 20 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, T186I, D244V, K314R, E520G, V586A, S612R, V730I, F749V, E742K, and M747N.
  • SEQ ID NO: 21 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, T186I, D244V, K314R, E520G, V586A, S612R, V730I, F749V, E742R, and M747K.
  • SEQ ID NO: 22 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, T186I, D244V, K314R, E520G, V586A, S612R, V730I, F749V, E742R, and M747N.
  • SEQ ID NO: 23 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, T186I, D244V, K314R, E520G, V586A, S612R, V730I, F749V, E742N, and M747K.
  • SEQ ID NO: 24 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, T186I, D244V, K314R, E520G, V586A, S612R, V730I, F749V, M742M, and E747R.
  • SEQ ID NO: 25 SEQ ID NO: 1 incorporating the amino acid alterations G12T, A54V, T186I, D244V, F667Y, F749V, and D732N.
  • SEQ ID NO: 26 SEQ ID NO: 1 incorporating the amino acid alterations G12T, A54V, T186I, D244V, F667Y, F749V, E742K, and M747K.
  • SEQ ID NO: 27 SEQ ID NO: 1 incorporating the amino acid alterations G12T, A54V, T186I, D244V, F667Y, F749V, E742R, and M747R.
  • SEQ ID NO: 28 SEQ ID NO: 1 incorporating the amino acid alterations G12T, A54V, T186I, D244V, F667Y, F749V, E742N, and M747N.
  • SEQ ID NO: 29 SEQ ID NO: 1 incorporating the amino acid alterations G12T, A54V, T186I, D244V, F667Y, F749V, E742K, and M747R.
  • SEQ ID NO: 30 SEQ ID NO: 1 incorporating the amino acid alterations G12T, A54V, T186I, D244V, F667Y, F749V, E742K, and M747N.
  • SEQ ID NO: 31 SEQ ID NO: 1 incorporating the amino acid alterations G12T, A54V, T186I, D244V, F667Y, F749V, E712R, and M747K.
  • SEQ ID NO: 32 SEQ ID NO: 1 incorporating the amino acid alterations G12T, A54V, T186I, D244V, F667Y, F749V, E742R, and M747N.
  • SEQ ID NO: 33 SEQ ID NO: 1 incorporating the amino acid alterations G12T, A54V, T186I, D244V, F667Y, F749V, E742N, and M747K.
  • SEQ ID NO: 34 SEQ ID NO: 1 incorporating the amino acid alterations G12T, A54V, T186I, D244V, F667Y, F749V, E742N, and E747R.
  • SEQ ID NO: 35 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, F73S, T186I, R205K, K219E, M236T, A608V, S612R, 2494 ⁇ G, and D732N.
  • SEQ ID NO: 36 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, F73S, T186I, R205K, K219E, M236T, A608V, S612R, 2494 ⁇ G, E742K and M747K.
  • SEQ ID NO: 37 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, F73S, T186I, R205K, K219E, M236T, A608V, S612R, 2494 ⁇ G, E742R, and M747R.
  • SEQ ID NO: 38 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, F73S, T186I, R205K, K219E, M236T, A608V, S612R, 2494 ⁇ G, and E742N, and M747N.
  • SEQ ID NO: 39 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, F73S, T186I, R205K, K219E, M236T, A608V, S612R, 2494 ⁇ G, E742K, and M747R.
  • SEQ ID NO: 40 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, F73S, T186I, R205K, K219E, M236T, A608V, S612R, 2494 ⁇ G, E742K, and M747N.
  • SEQ ID NO: 41 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, F73S, T186I, R205K, K219E, M236T, A608V, S612R, 2494 ⁇ G, E742R, and M747K.
  • SEQ ID NO: 42 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, F73S, T186I, R205K, K219E, M236T, A608V, S612R, 2494 ⁇ G, E742R, and M747N.
  • SEQ ID NO: 43 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, F73S, T186I, R205K, K219E, M236T, A608V, S612R, 2494 ⁇ G, E742N, and M747K.
  • SEQ ID NO: 45 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, F73S, T186I, R205K, K219E, M236T, A608V, S612R, 2494 ⁇ G, E742N and E747R.
  • SEQ ID NO: 46 SEQ ID NO: 1 incorporating the amino acid alterations P10S, L30P, A61V, L365P, V586A, S612R, E832K, and D732.
  • SEQ ID NO: 47 SEQ ID NO: 1 incorporating the amino acid alterations P10S, L30P, A61V, L365P, V586A, S612R, E832K, E742K, and M747K.
  • SEQ ID NO: 48 SEQ ID NO: 1 incorporating the amino acid alterations P10S, L30P, A61V, L365P, V586A, S612R, E832K, E742R, and M747R.
  • SEQ ID NO: 49 SEQ ID NO: 1 incorporating the amino acid alterations P10S, L30P, A61V, L365P, V586A, S612R, E832K, E742N, and M747N.
  • SEQ ID NO: 50 SEQ ID NO: 1 incorporating the amino acid alterations P10S, L30P, A61V, L365P, V586A, S612R, E832K, E742K, and M747R.
  • SEQ ID NO: 51 SEQ ID NO: 1 incorporating the amino acid alterations P10S, L30P, A61V, L365P, V586A, S612R, E832K, E742K, and M747N.
  • SEQ ID NO: 52 SEQ ID NO: 1 incorporating the amino acid alterations P10S, L30P, A61V, L365P, V586A, S612R, E832K, E742R, and M747K.
  • SEQ ID NO: 53 SEQ ID NO: 1 incorporating the amino acid alterations P10S, L30P, A61V, L365P, V586A, S612R, E832K, E742R, and M747N.
  • SEQ ID NO: 54 SEQ ID NO: 1 incorporating the amino acid alterations P10S, L30P, A61V, L365P, V586A, S612R, E832K, E742N, and M747K.
  • SEQ ID NO: 55 SEQ ID NO: 1 incorporating the amino acid alterations P10S, L30P, A61V, L365P, V586A, S612R, E832K, E742N, and E747R.
  • SEQ ID NO: 56 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, D244V, S612R, E832K, and D732N.
  • SEQ ID NO: 57 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, D244V, S612R, E832K, E742K, and M747K.
  • SEQ ID NO: 58 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, D244V, S612R, E832K, M742R, and M747R.
  • SEQ ID NO: 59 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, D244V, S612R, E832K, E742N, and M747N.
  • SEQ ID NO: 60 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, D244V, S612R, E832K, E742K, and M747R.
  • SEQ ID NO: 61 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, D244V, S612R, E832K, E742K, and M747N.
  • SEQ ID NO: 62 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, D244V, S612R, E832K, E742R, and M747K.
  • SEQ ID NO: 63 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, D244V, S612R, E832K, E742R, and M747N.
  • SEQ ID NO: 64 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, D244V, S612R, E832K, E742N, and M747K.
  • SEQ ID NO: 65 SEQ ID NO: 1 incorporating the amino acid alterations P10S, A61V, D244V, S612R, E832K, E742N, and E747R.
  • SEQ ID NO: 66 SEQ ID NO: 1 incorporating the amino acid alterations L30P, 2494 ⁇ G, and D732N.
  • SEQ ID NO: 67 SEQ ID NO: 1 incorporating the amino acid alterations L30P, 2494 ⁇ G, E742K, and M747K.
  • SEQ ID NO: 68 SEQ ID NO: 1 incorporating the amino acid alterations L30P, 2494 ⁇ G, E742R, and M747R.
  • SEQ ID NO: 69 SEQ ID NO: 1 incorporating the amino acid alterations L30P, 2494 ⁇ G, E742N, and M747N.
  • SEQ ID NO: 70 SEQ ID NO: 1 incorporating the amino acid alterations L30P, 2494 ⁇ G, E742K, and M747R.
  • SEQ ID NO: 71 SEQ ID NO: 1 incorporating the amino acid alterations L30P, 2494 ⁇ G, E742K, and M747N.
  • SEQ ID NO: 72 SEQ ID NO: 1 incorporating the amino acid alterations L30P, 2494 ⁇ G, E742R, and M747K.
  • SEQ ID NO: 73 SEQ ID NO: 1 incorporating the amino acid alterations L30P, 2494 ⁇ G, E742R and M747N.
  • SEQ ID NO: 74 SEQ ID NO: 1 incorporating the amino acid alterations L30P, 2494 ⁇ G, E742N, and M747K.
  • SEQ ID NO: 75 SEQ ID NO: 1 incorporating the amino acid alterations L30P, 2494 ⁇ G, E742N, and E747R.
  • SEQ ID NO: 76 SEQ ID NO: 1 incorporating the amino acid alterations A29T, G200S, D237G, F749I, and D732N.
  • SEQ ID NO: 77 SEQ ID NO: 1 incorporating the amino acid alterations A29T, G200S, D237G, F749I, E742K, and M747K.
  • SEQ ID NO: 78 SEQ ID NO: 1 incorporating the amino acid alterations A29T, G200S, D237G, F749I, E742R, and M747R.
  • SEQ ID NO: 79 SEQ ID NO: 1 incorporating the amino acid alterations A29T, G200S, D237G, F749I, E742N, and M747N.
  • SEQ ID NO: 80 SEQ ID NO: 1 incorporating the amino acid alterations A29T, G200S, D237G, F749I, E742K, and M747R.
  • SEQ ID NO: 81 SEQ ID NO: 1 incorporating the amino acid alterations A29T, G200S, D237G, F749I, E742K, and M747N.
  • SEQ ID NO: 82 SEQ ID NO: 1 incorporating the amino acid alterations A29T, G200S, D237G, F749I, E742R, and M747K.
  • SEQ ID NO: 83 SEQ ID NO: 1 incorporating the amino acid alterations A29T, G200S, D237G, F749I, E742R, and M747N.
  • SEQ ID NO: 84 SEQ ID NO: 1 incorporating the amino acid alterations A29T, G200S, D237G, F749I, E742N, and M747K.
  • SEQ ID NO: 85 SEQ ID NO: 1 incorporating the amino acid alterations A29T, G200S, D237G, F749I, E742N, and E747R.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Compositions and methods for the upregulation of reverse transcription (RT) reactions and the reduction of sequence bias in RNA sequencing are presented. The compositions and methods include the application of certain organic cosolvents to increase the enzymatic activity of RT enzymes above their activity in aqueous media in addition to reducing the secondary structure of RNA, and/or the introduction of amino acid mutations that render the enzymes even more active in the presence of the organic cosolvents.

Description

COMPOSITIONS AND METHODS FOR UPREGULATION OF   REVERSE TRANSCRIPTION AND REDUCTION OF SEQUENCE BIAS IN RNA SEQUENCING  BACKGROUND OF THE INVENTION  Enzymes in Organic Solvents & Aqueous‐Organic Media  Enzymes have evolved in nature for catalyzing reactions in water. Use of media that  deviate from water and enter into the domain of organic solvents is a human invention to fit  special  needs  of  in  vitro  application  of  enzymes  for  research,  clinical  and  industrial  applications.  Seen  from  this  angle,  the  study  of  enzymatic  reactions  in  aqueous‐organic  media is a field of inquiry unto itself.    Enzymatic reactions in the presence of organic solvents can span an entire spectrum  ranging from mostly organic to mostly aqueous. One can also include reactions in biphasic  mixtures composed of water and water‐immiscible organic solvents where  the  former  is  held in suspension in the latter or vice versa (Koskinen and Klibanov, 1996). When it comes  to organic media,  some  amount of water, even  if  it  is  in  trace  concentration,  is  always  necessary for enzymes to work. As Kuntz and Kauzmann put it, water is “enzymes’ molecular  lubricant” (Kuntz et al., 1974).  An important observation from prior extensive studies was  that  the  activity of  enzymes was  almost universally  if not universally  reduced  in mixed  aqueous‐organic  media.  For  improvements  in  activity  or  selectivity  against  specified  substrates, an enzyme must typically be placed in neat organic media with a residual water  layer surrounding the enzyme.     Most of  the enzymatic  reactions  that have been  studied  so  far  in  the presence of  organic  solvents are hydrolytic enzymes. Moreover,  the  reactions have been confined  to  small organic molecules as substrates as opposed to enzymes that carry out other types of  reactions upon biological macromolecules. Polymerase reactions (including but not limited  to transcription, reverse transcription and PCR) belong to the  latter class, and as such the  study of such reactions in the presence of organic solvents represents a significant deviation  from the prior art on enzymatic reactions in such media. In addition, only mixed aqueous‐ 1    organic media (and not neat organic media) can be compatible with polymerase‐catalyzed  reactions due to the requirement of water to dissolve nucleic acid substrates. Hence  it  is  expected based on all prior art  that  the application of organic  solvents  (mixed aqueous‐ organic media) will reduce the catalytic activity of all polymerase enzymes.    Polymerases in Aqueous‐Organic Media  Elevated temperature and organic cosolvents represent the two primary means for  achieving  denaturation  of  macromolecules.    DNA  polymerases,  which  catalyze  the  polymerization of DNA based on either RNA or DNA  templates, have been  classified  into  seven  families  (A, B, C, D, X, Y, and RT) based on  their amino acid sequences and specific  activities.  Thermostable  polymerase  enzymes,  which  evolved  naturally,  revolutionized  biotechnology by enabling the denaturation of nucleic acids at elevated temperatures while  maintaining polymerase enzyme structure and activity in the context of the polymerase chain  reaction (PCR).  Recently, thermostable reverse transcriptase (RT) enzymes have been also  been discovered. However, many genes cannot be effectively replicated or amplified in water  irrespective of temperature, resulting in significant biases in RNA and DNA sequencing that  limit the potentially transformative applications of these methods.  In  particular,  (RT)‐PCR  amplification  of  GC‐rich  nucleotide  sequences  is  often  accompanied  by  inadequate  yield  of  the  target  DNA  sequence  and  amplification  of  nonspecific products. A recent analysis of intragenic regions reveals 773 sequences with more  than 65% GC in the human genome. Due to high GC content, the amplification of the target  DNA requires special (RT)‐PCR protocols, organic solvent additives or addition of nucleotide  analogs. Organic solvent additives, also known as “PCR‐enhancing compounds”, have been  used to improve GC‐rich gene amplification or reduce GC bias  in amplification without target  modification, and are  components of  some of  the most  commonly used PCR  commercial  products, because organic cosolvents and temperature represent the two primary means of  denaturing macromolecules. Although PCR‐enhancing organic solvents are very effective in  improving amplification due  to  their  favorable effects on duplex nucleic acid melting and  2    single‐stranded nucleic acid secondary structure alleviation – thus complementing the effects  of the increased temperatures used in PCR, which alone are insufficient to amplify many GC‐ rich genes – their application is limited by the fact that they generally deleteriously affect the  polymerase stability and activity. Whereas polymerases used  in PCR (and  in some cases  in  reverse  transcription)  have  evolved naturally  to be  thermostable,  they have  not  evolved  naturally to be optimally solvent‐tolerant.     Despite the advent of methods like unique molecular identifiers (UMIs), the problem  of sequence bias in nucleic acid sequencing remains unsolved irrespective of the polymerase  enzyme  used,  since  while  base  calling  errors  are  easily  error‐corrected  by  consensus  sequencing,  differential  amplification  efficiencies  can  induce  over  100‐fold  changes  in  sequence  coverage  –  the  effects  of  which  cannot  be  eliminated  by  digital  barcoding,  especially for the most important problems of rare mutation quantification.   In our earlier work on DNA‐dependent DNA polymerases in aqueous‐organic media,  we identified certain organic cosolvents that in admixture with water proved superior for PCR  amplification  of many  substrates,  particularly  those with  high GC‐content.  These  organic  cosolvents belonged specifically to four chemical classes that we defined as  low molecular  weight amides, sulfoxides, sulfones and polyols (particularly diols) (Chakrabarti, 2002, 2004;  Chakrabarti  et  al.,  2001  Nucleic  Acids  Res,  2001  Gene,  2002  Biotechniques;  US  Patent  6,949,368; US Patent 7,276,357 B2; and US Patent 7,772,358 B2). Earlier, DMF, DMSO and  Glycerol were also reported to have some beneficial effects in PCR amplification of high GC  targets (Sarker et al., 1990, Pomp et al., 1991, Henkel et al., 1997). A comprehensive list of  the more useful members among these low molecular weight organic cosolvents is provided  below and the chemical structures of some of them are shown in Figs. 1A to 1D.   When chosen from  low molecular weight amides the members are: formamide, N‐ methyl  formamide, N,N‐dimethyl  formamide  (DMF), acetamide, N‐methylacetamide, N,N‐ dimethylacetamide,  propionamide,  isobutyramide,  2‐pyrrolidone,  N‐methylpyrrolidone  (NMP), N‐hydroxyethyl pyrrolidone (HEP), N‐formyl pyrrolidine, N‐Formyl morpholine; delta‐ valerolactam, epsilon‐caprolactam, 2‐azacyclooctanone (16 compounds);  3      When  chosen  from  low  molecular  weight  sulfoxides  the  members  are:  dimethyl  sulfoxide  (DMSO),  n‐propyl  sulfoxide,  n‐butyl  sulfoxide,  methyl  sec‐butyl  sulfoxide,  and  tetramethylene sulfoxide (5 compounds: Fig. 1B);     When chosen from low molecular weight sulfones the members are: dimethyl sulfone,  10  diethyl  sulfone,  di  (n‐propyl)  sulfone,  tetramethylene  sulfone  (sulfolane),  and  2,4‐ dimethylsulfolane and butadiene sulfone (sulfolene) ‐‐ (6 compounds: Fig. 1C);    When chosen from low molecular weight diols the members are: 1,2‐propanediol, 1,3‐ propanediol,  1,2‐butanediol,  1,3‐butanediol,  1,4‐butanediol,  1,2‐pentanediol,  2,4‐ pentanediol,  1,5‐pentanediol,  1,2‐cyclopentanediol,  1,2‐hexanediol,  1,6‐hexanediol,and  2‐ methyl‐2,4‐pentanediol  (13  compounds;  Fig.  1D).  Other  than  the  diols  a  triol,  namely,  glycerol, as mentioned has also been found to help in enhancing amplification of certain high‐ GC targets. Among the other organic compounds that can belong to the preferred organic  component is betaine.                When used as a part of the PCR buffer, these cosolvents provide an aqueous‐organic  reaction medium that is predominantly aqueous in nature (as opposed to the common use  of predominantly organic reaction media for small molecule enzymatic reactions described  earlier). They have been found to be especially effective  in amplifying high‐GC containing  polynucleotide  targets  by  providing  the  following  benefits:  a)  Lowering  the  melting  temperature of double stranded DNA: This meant better and more complete denaturation  of even the very high melting DNA targets at temperatures that do not cause DNA damage,  namely at or below 95 °C. Targets that could not be amplified in standard aqueous buffers  could  now  be  amplified  in  these modified  buffers.  b)  Better  specificity  of  the  products  especially in view of the facts that these mixed aqueous‐organic buffers readily opened up  secondary structures in the ssDNA strands that are primary causes of pauses in the extension  reactions and as such also of nonspecific product formation.              The properties of a cosolvent in terms of its overall impact on a PCR reaction can be  expressed  in terms of effective range, potency, and specificity of each cosolvent that are  different for different compounds (Chakrabarti R., 2004). The effective range of a cosolvent  4    is defined as the range of concentration starting at the concentration at which amplification  of  a  given  target  improved  PCR  yield  and  ending  at  the  concentration  above  which  amplification began to be inhibited. Put in a different way, the effective range of a cosolvent  is the range of concentration outside which  it does not exhibit any beneficial effect. This  range was different for different compounds but also for the same compound for different  targets. The potency of a cosolvent is defined as the maximum densitometric volume of the  target band amplification  that could be obtained  for any  target amplification within  the  effective range of that cosolvent. It is the maximum effectiveness of the cosolvent at the  most effective concentration within  its effective range. The specificity of a cosolvent at a  particular  concentration  is  defined  as  the  ratio  of  the  volume  of  the  target  band  amplification to the total volume of all bands, including the undesired non‐specific bands,  expressed as a percent. False positives and false negatives in PCR‐based disease diagnosis,  for  instance, are the result of poor reaction specificity. Use of cosolvent‐based PCR  is of  significant value in this area.    There  are,  however,  important  limitations  of  these  solvent  systems  that  have  thwarted  their more widespread application. Though most of  the polymerase‐compatible  cosolvents,  as  defined  above,  provided  superior  PCR  amplification  in  terms  of  extent  of  amplification and specificity of the amplified product for DNA targets ‐‐ especially those DNA  targets that had high GC content and defied amplification under standard conditions ‐‐ their  performance in many cases was severely limited by the narrow concentration ranges within  which  they were effective. Further  investigation  revealed  that  these deficiencies  resulted  from  decreased  polymerase  stability  (lower  half‐lives)  and  polymerase  activity  of  the  enzymes  in  the presence of  these cosolvents  (Chakrabarti, 2002, 2004). Both polymerase  half‐lives and specific enzymatic activities  (primer extension  rates) decreased  rapidly with  increasing cosolvent concentration. For example, the thermostabilities of DNA polymerases  between 92 °C and 95 °C ‐‐ the range within which the denaturation step of the PCR reaction  is usually carried out ‐‐ were greatly lowered by addition of the most potent and most specific  cosolvents.   5    Notwithstanding the above results on DNA‐dependent DNA polymerization and PCR  in  aqueous‐organic  media,  reverse  transcription  activity  (RNA‐dependent  DNA  polymerization) has never been demonstrated to be improved by or even compatible with  the aforementioned polar organic cosolvents. In fact, in the context of reverse transcription  PCR  (RT‐PCR), which produces DNA  from RNA using an RNA‐dependent DNA polymerase  followed  by  amplification  of  DNA  by  a  DNA‐dependent  DNA  polymerase,  even  if  the  aforementioned  organic  cosolvents  are  applied  in  the  PCR  reaction,  they  are  typically  excluded  from  the  reverse  transcription  reaction. Historically,  reverse  transcriptases  (RTs)  employed  in  biotechnology  were  exclusively  from  mesophilic  organisms  and  were  not  thermostable.  RTs  that  are  not  thermostable  generally  cannot  tolerate  the  presence  of  organic cosolvents, or even if they do, their activities are greatly diminished, rendering the  inclusion of organic cosolvents in such reactions deleterious. Finally, the foregoing primary  reason for use of organic solvents in PCR is inapplicable to reverse transcriptase reactions,  since reverse transcription does not involve double‐stranded nucleic acid denaturation prior  to polymerization.     SUMMARY  Compositions  and  methods  for  the  upregulation  of  reverse  transcription  (RT)  reactions  and  the  reduction  of  sequence  bias  in  RNA  sequencing  are  presented.  Notwithstanding  previously  understood  principles  regarding  the  function  of  enzymes  in  aqueous‐organic media, and  specifically  the  function of polymerase enzymes  in aqueous‐ organic media,  it has been  found  that  inclusion of certain polar organic cosolvents  in  the  reaction media of RT enzymes can significantly  increase  the activity of RT enzymes above  their  activity  in  aqueous media,  in  addition  to  reducing  the  secondary  structure of RNA.   Additionally, as described further herein, introduction of amino acid alterations can render  the reverse transcriptase enzymes even more active and/or stable  in the presence of such  organic cosolvents.  6    In  one  aspect,  a  composition  for  performing  a  reverse  transcriptase  reaction  comprises  a  thermostable  reverse  transcriptase  or  a  fragment  thereof,  a  reverse  transcriptase  (RT)  buffer,  one  or  more  template  RNAs  and  deoxyribonucleoside  triphosphates (dNTPs), and one or more of the low molecular weight polar organic solvents.   As  described  further  herein,  low  molecular  weight  polar  organic  solvents,  in  some  embodiments, are selected from the group consisting of an amide, a sulfoxide, a sulfone, and  a diol.    Low molecular weight polar organic  solvents,  in  some embodiments,  can have  a  molecular weight  less than or equal to 150 g/mol.   Additionally, the  low molecular weight  polar organics can be present at a concentration ranging between 0.05 molar and 7.5 molar,  in some embodiments.  In some embodiments, the thermostable reverse transcriptase or a  fragment thereof has an optimal reverse transcriptase (RT) above 37oC and preferably above  48oC.  As shown and described further herein, the presence of the one or more of the organic  cosolvents, in some embodiments, increases RT activity (rate of nucleotide incorporation) of  the thermostable reverse transcriptase or the fragment thereof.  For example, the RT activity  rate can be increased by at least 5%, in some embodiments.    The reverse transcriptase of compositions described herein,  in some embodiments,  comprises one or more amino acids alterations conferring stability and/or activity in the one  or more polar organic  solvents.    For  example,  the  reverse  transcriptase  is  a modified or  mutant Taq polymerase bearing at least 90% sequence similarity to wild‐type Taq polymerase  (SEQ ID NO: 1), wherein the amino acid modifications confer stability and/or activity in the  one or more polar organic solvents.    In another aspect, a composition comprises a thermostable reverse transcriptase or a  fragment thereof, a reverse transcriptase polymerase chain reaction (RT‐PCR) buffer, one or  more template RNAs and deoxyribonucleoside triphosphates (dNTPs), DNA‐dependent DNA  polymerase enzyme of a  fragment  thereof, and one or more  low molecular weight polar  organic  solvents.   The  thermostable  reverse  transcriptase of  the  composition  can be any  thermostable  reverse  transcriptase  described  herein.   Additionally,  the  one  or more  low  molecular weight solvents can have any identity described herein.  7      In  another  aspect,  a  composition  for  performing  a  reverse  transcriptase  reaction  comprises a thermostable reverse transcriptase, a reverse transcriptase (RT) buffer, one or  more template RNAs and deoxyribonucleoside triphosphates (dNTPs), and one or more low  molecular weight polar organic solvents, wherein the thermostable reverse transcriptase is a  mutant  of  Taq  polymerase  bearing  at  least  90%  sequence  similarity  to  wild‐type  Taq  polymerase of SEQ  ID NO:1 and comprises one or more amino acid alterations enhancing  stability and/or activity of the reverse transcriptase in the one or more low molecular weight  polar organic solvents.    In another  aspect, modified Taq DNA polymerases are described herein.    In  some  embodiments, a modified Taq DNA polymerase having an amino acid sequence that is at least  90% identical to an amino acid sequence comprised of the sequence of wild‐type Taq DNA  polymerase of SEQ ID NO:1, wherein the amino acid sequence comprises a first set of non‐ natural amino acid alterations stabilizing or improving the activity of the modified Taq DNA  polymerase  in  an  aqueous‐organic medium,  and  a  second  set of  non‐natural  amino  acid  alterations conferring  reverse  transcriptase activity  to  the modified Taq DNA polymerase.   Any non‐natural amino acid alterations consistent with the objectives of the first and second  sets can be employed.    In another aspect, a composition comprises a modified Taq DNA polymerase suitable  for RT or RT‐PCR  reactions  in an  aqueous‐organic medium, wherein  the aqueous‐organic  medium comprises one or more  low molecular weight organic solvents selected  from  the  group consisting of an amide, a sulfoxide, a sulfone, and a diol, and wherein the amino acid  sequence of  the modified Taq DNA polymerase  is at  least 90%  identical  to an amino acid  sequence comprised of the sequence of wild‐type Taq DNA polymerase of SEQ ID NO:1 with  a first set of amino acid alterations selected to confer reverse transcriptase activity, and a  second set of amino acid alterations selected from the group consisting of    L30P, A54V, E434D, K206Q, S612R, V730I, and F749V of SEQ ID NO:1;  P10S, A61V, T186I, D244V, K314R, E520G, V586A, S612R, V730I, and F749V of SEQ ID  NO:1;  8      G12T, A54V, T186I, D244V, F667Y, and F749V of SEQ ID NO:1;  P10S, A61V, F73S, T186I, R205K, K219E, M236T, A608V, S612R, and 2494ΔG of SEQ  ID NO:1;    P10S, L30P, A61V, L365P, V586A, S612R, and E832K of SEQ ID NO:1;    P10S, A61V, D244V, S612R, and E832 of SEQ ID NO:1;      L30P and 2494ΔG of SEQ ID NO:1; and     A29T, G200S, D237G, and F749I of SEQ ID NO:1.  In some embodiments, the amino acid alterations conferring RT activity include one or more  of E732N, E742K, E742R, M747K, M747R, E742N, E742N, E742Q, E742Y, E742M, E742A and  M747N of SEQ ID NO:1.  For example, in some embodiments, the second set of amino acids  above are paired with one of the E742 alterations and one of the E747 alterations of SEQ ID  NO:1.  Any desired pairing can be made.  Non‐limiting examples of such pairing are provided  in Table 15 below.    In another aspect, kits are provided herein.  In some embodiments, a kit comprises a  composition for reverse transcription or a composition for reverse transcription‐PCR  described herein.  In some embodiments a kit comprises a composition for target  enrichment for RNA sequencing by a reverse transcription or reverse transcription‐PCR  composition described herein.   Methods of reverse transcribing RNA into DNA and methods of administering reverse  transcription‐PCR are also described herein.    In some embodiments, a method of  reverse  transcribing RNA into DNA comprises incubating a thermostable reverse transcriptase with a  reverse  transcriptase buffer, a RNA  template, deoxyribonucleoside  triphosphates  (dNTPs),  DNA primers, and at least one low molecular weight organic cosolvent.  The one or more low  molecular  weight  organic  cosolvents  can  have  any  identity  described  herein.    In  some  embodiments, the reverse transcriptase is a modified Taq DNA polymerase bearing at least  90% sequence similarity to wild‐type Taq polymerase of SEQ  ID NO:1.   Moreover,  in some  embodiments, the temperature of reverse transcription is higher than its optimal value in the  absence of the polar organic cosolvent, and less than or equal to the melting temperature of  9    the enzyme at that cosolvent concentration, minus 5oC.  As detailed further herein, reaction  yield of reaction efficiency can be enhanced in the presence of the at least one low molecular  weight  solvents.    Additionally,  reverse  transcription  and/or  DNA  amplification,  in  some  embodiments, is administered for target enrichment in next‐generation sequencing of RNA,  including wherein the copy number of RNA sequences are determined by next‐generation  sequencing.  In some embodiments, the RNA sequencing is carried out with incorporation of  unique molecular identifiers (UMI) in the adapter sequences.  In another aspect, methods of detecting bacterial or viral pathogens without sample  preparation,  such  as  directly  from  clinical  samples,  are  described  herein.    In  some  embodiments, a method comprises   a)  incubating a clinical  sample containing a virus or bacteria with RT‐PCR  reagents  including  a  thermostable  or  solvostable  reverse  transcriptase  (RT),  one  or  more  low  molecular weight polar organic cosolvents, optionally a  thermostable or solvostable DNA‐ dependent DNA  polymerase  enzyme,  RT‐PCR  buffer,  and  primers  complementary  to  the  nucleic acid sequence to be detected, at a temperature exceeding 70oC and preferably below  80oC, to lyse the virus or bacteria and release RNA without degrading the RNA;  b) incubating the lysed clinical sample at or near the optimal temperature for reverse  transcription of the RT enzyme;  c) thermal cycling of the reaction mixture to PCR amplify the resulting complementary  DNA (cDNA); and   d) quantifying of the PCR product.  In some embodiments, quantifying the PCR product can be administered by qPCR.  The virus  of the clinical sample, for example, can be SARS‐CoV virus or other respiratory virus.    In another aspect, kits  for detection via RT‐PCR of viral or bacterial pathogen RNA  directly  from  clinical  samples  without  sample  preparation  are  provided.    In  some  embodiments, such a kit comprises a thermostable or solvostable reverse transcriptase (RT)  enzyme, one or more of  the  low molecular weight polar organic  cosolvents, optionally a  thermostable or solvostable DNA‐dependent DNA polymerase enzyme, RT‐PCR buffer, and  10    primers complementary to the nucleic acid sequence to be detected.  Components of the kit,  including  the  solvostable  reverse  transcriptase  (RT)  enzyme  and  low  molecular  weight  organic solvent can have any composition and/or properties described herein.    In another aspect, methods for droplet digital reverse transcription PCR (ddRT‐PCR)  with enhanced RT and PCR efficiency are described herein.  In some embodiments, a method  for droplet digital reverse transcription PCR (ddRT‐PCR) with enhanced RT and PCR efficiency,  the method comprising:  a)  incubating  RT‐PCR  reagents  including  a  RT‐PCR  buffer,  a  thermostable  or  solvostable  reverse  transcriptase,  a  thermostable  or  solvostable  DNA‐dependent  DNA  polymerase, primers and/or probes for a sequence or mutation of interest, a polar organic  cosolvent within emulsion droplets, and one or more RNA templates, at or near the optimal  temperature for reverse transcription, such that the polar organic cosolvent at least doubles  the reverse transcription yield compared to buffer lacking the cosolvent;  b) thermal cycling of the reaction mixture to PCR amplify the resulting cDNA; and  c) counting or sorting of  the  resulting positive droplets using a  fluorescence‐based  counting or sorting device.    In  another  aspect,  methods  for  accelerating  the  in  vitro  evolution  of  reverse  transcriptase (RT) enzymes are provided.  In some embodiments, A method for accelerating  the in vitro evolution of reverse transcriptase (RT) enzymes, the method comprises:  a) preparation of a library of thermostable polymerase enzyme gene variants;  b)  expression  of  the  enzymes  corresponding  to  these  gene  variants,  for  example  through bacterial transformation and expression or in vitro transcription/translation of the  library, in individual containers, the containers preferably being either droplets or microplate  wells;  c) incubation of the library of enzyme variants within individual containers, with one  or more polar organic cosolvents at specified concentrations, RT‐PCR buffer, primers and/or  probes  for  an  RNA  sequence  of  interest,  optionally  a  thermostable  or  solvostable DNA‐ 11    dependent DNA polymerase enzyme, and the RNA template, at a temperature suitable for  reverse transcription, the temperature preferably being between 48oC and 80oC;   d) thermal cycling of the reaction mixtures to PCR amplify the resulting cDNAs;  e) ranking of the resulting enzyme variants based on RT‐PCR yield, either by screening  or sorting, the screening or sorting preferably being done based on fluorescence; and   f) sequencing of the resulting top enzyme variants to identify the best RT enzymes,  wherein the presence of organic cosolvent(s) at the specified concentration(s) increase the  RT activity of at least one enzyme variant at least twofold above the activity in their absence.  In  some  embodiments,  at  least  one  of  the  enzyme  variants  is  a  rare  variant  whose  corresponding gene is present in the library with less than or equal to 1% frequency.    These  and  other  embodiments  are  further  described  in  the  following  detailed  description.    BRIEF DESCRIPTION OF THE DRAWINGS    Figs. 1A‐1D provide various low molecular weight solvents for use in compositions and  methods described herein.  Figs. 2A‐2D provide effects of organic solvents on reverse transcriptase (RT) activities  of polymerases.  RT activity was measured using enzymes of interest (WT, SFM 4‐6, SFM 4‐3,  N‐7‐3‐B07‐RT, L‐5‐2‐F01‐RT1, L‐5‐2‐F01‐RT2)  in the presence of different concentrations of  1,4‐butanediol, 2‐pyrrolidone, sulfolane, TMSO. At extension temperature (55oC) conducive  to  the  reduction  of  RNA  secondary  structure  (A),  equal  activities  of  each  enzyme were  applied,  and  no  heat  pre‐treatment  was  applied  on  tested  enzymes;  At  extension  temperature (68oC) (B), the same amount of each enzyme as in (A) was applied, and no heat  pre‐treatment was applied on tested enzymes; (C) The enzymes were pre‐heated at 95oC for  2 min  prior  RT  activity  assay  at  68oC;  (D) At  extension  temperature  (76oC)  no  heat  pre‐ treatment was applied on tested enzymes. Normalized fluorescence was applied for (A) and  (B) and relative AFU in (C, D).  12    Figs. 3A‐3B address reverse transcriptase activity measurement under low template  concentration and on GC‐rich templates.  Fig. 3(A) ‐ Comparison of RT activity for commercial  RT enzyme (50U [62.5ng] of ProtoScript II RT) with mutants of interest (including 25ng of WT,  N‐7‐3‐B07 ‐RT, L‐5‐2‐F01 –RT1, L‐5‐2‐F01‐RT2) under extension temperatures 55oC and 68oC.  The Poly(A) template concentration is 0.5ng/ul (2.82 nM). Fig. 3(B) ‐ The contribution of 5%  BD to fluorescence readout was also assessed. The addition of 5% BD does not change the  RFU.  The  green  curve  corresponds  to  addition  of  5%  BD  after  the  reaction  and  before  fluorescence readout.     Fig.  4  illustrates  BEGAIN  RNA  fragment  folding  into  robust  secondary  structure.  Sequence of the 100‐base synthesized.  Figs. 5A‐5L details performance of engineered polymerases in PCR and RT‐qPCR of GC‐ rich templates. Panels A‐H: amplification of GC‐rich genomic DNA targets by L‐5‐2‐F01 and  WT‐Taq were evaluated in presence of 7% and 10% BD, using two PCR cycling protocols (see  Materials and Methods). High denaturation temperature ‐‐ WT: (A) 0% BD (B) 7% BD; L‐5‐2‐ F01: (C) 0% BD (D) 10% BD. Moderate denaturation temperature ‐‐ WT: (E) 0% BD (F) 7% BD;  L‐5‐2‐F01: (G) 0% BD (H) 7% BD. Expected amplicon sizes are mentioned (in base pair) in the  Figure. M = 1 kb DNA ladder, numbers 0.5 and 1 are in kbp. Target properties are described  in Table 13.   Panels  I‐L: Effects of BD and  temperature on GC‐rich 100 base BEGAIN RNA  fragment RT‐qPCR by N‐7‐3‐B07‐RT = N‐7‐3‐B07+E742K+M747K and L‐5‐2‐F01‐RT1 = L‐5‐2‐ F01+E742K+M747K. RT‐qPCR efficiency of these two mutants were evaluated along with the  efficiency  of  SFM4‐6  and  a  thermostable MMLV  enzyme,  ProtoScript  II,  in  absence  and  presence of BD (7%) at 55°C (I) or 68°C (J).  RT‐qPCR was carried out in 3 steps as described  in Materials  and Methods.  (K,L)  represent  the melt  peak  traces  of  the  respective  qPCR  products from 55°C to 95°C. *PSII‐ ProtoScript II.  Table 2 herein presents quantitative peak  area and TM results for panels K,L since Cq values can be affected by nonspecific amplification.  Fig.  6  illustrates  distribution  of  selected  mutations  involved  in  enhancement  of  polymerase activity and induction of reverse transcriptase activity in the 3D structure of Taq  polymerase with nucleic acid (DNA/RNA) in open conformation. As reverse transcriptase (RT)  13    activity inducing mutations in our study were also discovered, it is suggested that RNA might  bind  in a similar conformation as DNA for catalytic activity.    Individual subdomains of Taq  polymerase  ternary  complex with DNA  in  open  conformation  (generated  using Modeller  based on PDBs ‐ 1TAU, 6Q4V, 1NK4, 3KTQ, 1BGX) are shaded magenta, grey, yellow, blue and  red  to  highlight  the  5’ ^3’  exonuclease,  inactive  3’ ^5’  endonuclease,  palm,  thumb,  and  finger  domains  respectively.  Bound  DNA  molecule  shown  as  cartoon  ribbon  (orange).  Mutations identified in five of our top performing mutants (N‐7‐3‐C08, N‐7‐2‐E02, N‐7‐3‐B07,  L‐5‐2‐F01, and L‐5‐3‐D04) and fastest enriching mutations from NGS convergence analysis are  depicted. Mutations such as P10S, A23P, L30P, A54V, A61V, F73S, A97T, A118V, L162P, T186I,  K206Q,  I228V, D244V, K314R, L365Q, E434D, L461R, F482I, E507K, A521V, Q534R, V586A,  A608V, S612R, F667Y, Q680R, K702R, E742K, V730I, E734G, F749I, F749V, K762R, L768M, and  E832K are represented as cyan spheres. The RT activity inducing mutations identified in our  study such as E742K, M747K are represented as purple spheres. The two images are rotated  by  180  degrees  to  enable  visualization  of  all  mutations.  Predicted  effects  of  subset  combinations of these mutations on polymerase folding free energy are reported in Table 7.   Figs.  7A‐7J:  Microfluidic  preparation  of  double  emulsions  and  FACS  sorting:  We  prepared primary water‐in‐oil emulsions  Fig. 7(A)  followed by PCR. A  fraction of primary  emulsion was used to isolate DNA and ran on 1% Agarose gel Fig. 7(B). Panel B: Lane 1 DNA  marker, Lane 2 negative control, and lane 3 is positive control. Post‐PCR on primary emulsions  containing WT and the SPC9 engineered polymerase respectively, primary emulsions were  collected  to  prepare  double  emulsions  Fig.  7(C)  as  described  in Materials  and Methods  section. Double emulsion (DE) is depicted in Fig. 7(D). Post‐PCR, positive control was stained  with SYBR Green I and visualized under a fluorescent microscope Fig. 7(E). DEs from WT and  SPC9 were mixed in 90:10 proportion for sorting. The mixed double emulsion was subjected  to  FACS  sorting.  Pre‐sort  and  post‐sort  images  are  shown  in  panel  Fig.  7F  and  Fig.  7G  respectively. A  total 1.6 million events were  randomly captured; a  threshold of 5000 was  applied to gate the parental DE (Fig. 7H, and Fig. 7I), followed by sorting SYBR positive double  emulsion  (J).  Panel  H  depicts  the  total  stained  DEs  and  gating  of  the  P1  population  14    (black=SYBR negative DEs); Fig. 7I depicts the gated population from P1 that is identified for  further  analysis  as  P2;  Fig.  7J  depicts  the  sorted  SYBR  positive DEs  that were  collected.  Orange=SYBRHIGH  (SPC9), purple=SYBRMEDIUM  (mixture of WT and SPC9), and blue=SYBRLOW  (WT). SSC: Side‐scattered light; FSC: Forward scattered light; A: Area; H: Height.  Figs. 7K‐7L:  (K)  FACS  sorting of  the  L5  library;  (L) Direct  fluorescence detection of  reverse transcription products within emulsion droplets. 5 μg of brain total RNA was mixed  with a BEGAIN gene‐specific primer and processed through a dolomite microfluidic device to  generate ~3 million droplets. Half of the droplets underwent RT‐PCR amplification, then were  stained with Picogreen and imaged under a fluorescence microscope (upper right). Pre‐PCR  droplets are shown for comparison (upper left). A negative control with no RNA added is also  provided (lower).   Figs. 8A‐8C: Fig. 8(A) Mapping of selected mutations in top polymerase variants. Fig.  8(B) Proximity of mutated  residues  relevant  to  reverse  transcriptase  activity  to RNA  and  depiction  of  H‐bonds  formed  with  RNA  in minimized  Taq  polymerase  ternary  complex.  Distances are in angstroms. Top) E742K: The mutation K742 (right) forms one hydrogen bond  (cutoff – 2.7 to 3.3 angstroms; represented as dashed lines) with one ribonucleotide (G5‐794)  of  the bound RNA, whereas E742  (left) does not  form any hydrogen bond with RNA. The  binding affinity difference calculated using MM‐GBSA was determined to be ‐52.86 kcal/mol  for  the E742K mutation. Bottom) M747K: The mutation K747  (right)  forms  five hydrogen  bonds between the Lys residue and two ribonucleotides (C‐795 and G‐796) of the bound RNA  and forms a salt bridge whereas M747 (left) does not form any hydrogen bond with the RNA.   The  binding  affinity  difference  calculated  using MM‐GBSA was  determined  to  be  ‐56.19  kcal/mole for the M747K mutation. The numbers depict the average distance between the  donor‐acceptor atom pairs forming the hydrogen bonds as observed in the production run of  MD simulation. Fig. 8(C) Proximity of mutated residues relevant to solvent tolerance to DNA  and depiction of H‐bonds  in minimized Taq polymerase  ternary complex. Distances are  in  angstroms. Top) E507K: The mutation K507  (right)  forms a  salt bridge and  five hydrogen  bonds  (cutoff – 2.7  to 3.3 angstroms;  represented as dashed  lines) with  two nucleotides  15    (DA846, DT848)  of  the  bound DNA, whereas  E507  (left)  forms  only  one  hydrogen  bond,  between  the  backbone  N  and  one  nucleotide  (DG839).  The  binding  affinity  difference  calculated using MM‐GBSA was determined to be ‐62.80 kcal/mol for the E507K mutation.  Bottom) S515N: The mutation N515 (right) forms two hydrogen bonds (one shown) between  the amide side chain N and one nucleotide (DA840) of the bound DNA, whereas S515 (left)  forms only one hydrogen bond, with one nucleotide (DA845). The binding affinity difference  calculated using MM‐GBSA was determined to be ‐22.71 kcal/mole for the S515N mutation.  The numbers depict the average distance between the donor‐acceptor atom pairs forming  the hydrogen bonds as observed in the production run of MD simulation. (Wild type binding  affinity difference for RNA vs DNA in the same MM‐GBSA units was determined to be +278.37  kcal/mol.)  Figs. 9A‐9C: GC bias in coverage of GC‐rich and poor genes in target enrichment for  next‐generation  sequencing with  engineered  polymerases.  PCR was  performed with  the  enzymes N‐7‐3‐B07, N‐7‐3‐C08 and WT with and without 5% BD to amplify four templates  with different GC content using gene‐specific PCR primers (GSP). The pooled libraries were  sequenced on an  Illumina  iSeq100 using a 2  x 150 bp paired‐end  sequencing protocol as  described in Methods. The template mean coverage data are presented as percent. Template  coverage of libraries made with the engineered enzymes in Fig. 9A) absence of BD; Fig. 9B)  presence of 5% BD, compared to WT enzyme with 0% BD (WT does not detectably amplify  these genes from genomic DNA in the presence of 5% BD). Fig. 9C ‐ Melting curves and peak  traces of four templates  in the absence of BD with WT‐Taq and presence of 5% BD with 5  selected clones N‐7‐3‐B07, N‐7‐3‐C08, N‐7‐2‐E02, L3‐D04‐26 and L‐5‐2‐F01.   Figs. 10A‐10C: GC bias in coverage of GC‐rich and poor genes in target enrichment for  next‐generation  sequencing  with  engineered  polymerases.  Fig.  10(A)  GC‐rich  templates  cloned  in plasmids were PCR amplified together with either WT or L‐5‐2‐F01 or N‐7‐3‐B07  enzyme. Gene‐specific primers (one set of FWD and REV for each template) were added in  the PCR reactions. The PCR mix contained 7.25U of each enzyme and 5 ng of each template.  The reaction mixture contained 0.75 mM dNTP, 1 mg/mL BSA, 3.5 mM MgCl2, 0.5 μM of each  16    primer and BD as specified. Fig. 10(B) The PCR mix contained 1.25U of each enzyme and 5 ng  of each  template. The  reaction mixture contained 0.25 mM dNTP, 1 mg/mL BSA, 3.5 mM  MgCl2, 0.5 μM of each primer and BD as specified. The following PCR programs were used for  both A and B: 98.3oC for 1 min and 95oC for 6 min, 25 cycles of 94oC for 30 sec, 57.8oC for 30  sec, 72oC for 50 sec. PCR products were  isolated from 1% agarose gel electrophoresis and  subjected to NGS analysis. The template mean coverage data are presented as percent. Fig.  10(C) ‐ Melt curve traces of Taq and c‐Jun in the absence and presence of 4% BD with WT and  two selected clones L‐5‐2‐F01 and N‐7‐3‐B07.  Fig. 11. Details of GC  content by  template  region  for GC‐rich  templates employed  herein.  Figs. 12A‐12E: Amplification efficiency of engineered polymerases in the presence of  cosolvent. Selected clones were used to assess the amplification efficiency of the Taq variants  in varying cosolvent concentrations with multiple different templates. Equal activities (1.25U)  of  each  polymerase  were  tested  in  identical  conditions  to  assess  the  efficiency.  Representative qPCR traces of the clones (A) or Cqs (B‐E) used in a real‐time PCR assay are  depicted. Fig. 12(A) ‐ Taq template in 5% BD; Fig. 12(B) ‐ c‐Jun template in 0‐8% BD with select  clones from early screening rounds; Fig. 12(C) ‐ c‐Jun template in 0‐10% BD with select clones  from later screening rounds (higher denaturation temperature was applied to the later round  clones). Fig. 12(D) ‐ Representative Cqs of templates with different GC contents (Taq, c‐Jun)  were used to assess GC bias  in the presence of 4% BD of WT and N‐7‐3‐B07 enzymes. Fig.  12(E) ‐  Representative Cq values of three templates with different GC content (CDN1C 78%,  EGFR 60% and KRAS 40%) were used  to assess GC bias  in  the presence of 5% BD with 2  selected clones N‐7‐3‐B07 and L‐5‐2‐F01. The genes were first amplified with gene specific  primers  and  then  equimolar  quantity  of  the  PCR  products were  amplified  in  qPCR with  universal  primers  (Table  14).  No  bars  illustrate  that  Cq  values  were  not  detected.  See  Materials and Methods for respective PCR protocols.  Figs. 13A‐13E: Effect of 1,4‐butanediol (BD) on DNA melting, polymerase stability and  PCR efficiency. Fig. 13(A) GC content plot of c‐Jun template flanked by primers J1/J3 (376 bp)  17    was  generated  by  online  tool  (http://www.endmemo.com/bio/gcdraw.php),  Fig.  13(B)  In  triplicate reaction, 5 µg of purified c‐Jun amplicon was used to assess the effect of 0‐10% BD  on TM of the template  in a 1X PCR buffer and Fig. 13(C) change  in TM   of DNA was plotted  against BD concentration, Fig. 13(D) effect of BD on denaturation (melt curve) of engineered  polymerase, and Fig. 13(E) purified polymerases after 7th round of CSR were employed  to  assess the amplification efficiency. After qPCR, the Cq values were plotted against the BD  concentration. In 0% BD, the observed Tm of the DNA template was 91.53±0.058 oC whereas  it reduced to 84.40±0.40 oC in 10% BD. One molar BD is equivalent to 8.86%.     Fig.  14A‐14C:  Enhancement  of  RT  directly  from  cells  using  solvophilic  reverse  transcriptases  in organic cosolvent 1,4‐butanediol (BD). A,B) Fluorescence‐based detection  of RT products from lysed cells with and without organic cosolvent, for enzymes SFM 4‐6 and  L5‐RT1. C) Gel analysis of RT‐PCR products from lysed cells with varying amounts of organic  cosolvent.  Synthesized partial KRAS RNA  (119 nucleotides) was mixed with  the  following  components: a ‐ SFM4‐6 (40 ng, positive control), B, C, D ‐ 5 million bacterial cells of b (WT  Taq),  c  (SFM4‐6),  and  d  (L‐5‐2‐F01‐RT1),  respectively.  Four  sets  of  these mixtures were  assigned different concentrations of BD (0%, 5%, 10%, 20%). The reverse transcription (RT)  reaction volume was 20 µL for each sample. The RT reaction was performed at 80°C for 10  minutes followed by 55°C for 60 minutes. PCR was carried out using the NEB LUNA PCR mix  on 0.5 µL of the completed RT reaction mixture. The PCR results were analyzed on a 2.5%  agarose gel. Notice  that  the bands  in WT  lanes are non‐specific as demonstrated by  their  wrong molecular weight.    DETAILED DESCRIPTION OF THE INVENTION  Embodiments described herein can be understood more readily by reference to the  following detailed description and examples and their previous and following descriptions.   Elements, apparatus and methods described herein, however, are not limited to the specific  embodiments presented in the detailed description and examples.  It should be recognized  that  these embodiments are merely  illustrative of  the principles of  the present  invention.   18    Numerous modifications and adaptations will be readily apparent to those of skill in the art  without departing from the spirit and scope of the invention.  Compositions  and  methods  for  the  upregulation  of  reverse  transcription  (RT)  reactions  and  the  reduction of  sequence bias  in RNA  sequencing  are presented.    In one  aspect,  a  composition  for  performing  a  reverse  transcriptase  reaction  comprises  a  thermostable reverse transcriptase or a fragment thereof, a reverse transcriptase (RT) buffer,  one or more  template RNAs and deoxyribonucleoside  triphosphates  (dNTPs),  and one or  more  low  molecular  weight  polar  organic  solvents.    In  another  aspect,  a  composition  comprises  a  thermostable  reverse  transcriptase  or  a  fragment  thereof,  a  reverse  transcriptase polymerase chain reaction  (RT‐PCR) buffer, one or more template RNAs and  deoxyribonucleoside triphosphates (dNTPs), DNA dependent DNA polymerase enzyme of a  fragment thereof, and one or more  low molecular weight polar organic solvents.    In some  embodiments  of  compositions  described  herein,  the  low molecular weight  polar  organic  solvents are employed as cosolvents with water or aqueous solvent.  Turning now to specific components, low molecular weight polar organic solvents, in  some  embodiments,  are  selected  from  the  group  consisting  of  an  amide,  a  sulfoxide,  a  sulfone, and a diol.  Low molecular weight polar organic solvents, in some embodiments, can  have a molecular weight less than or equal to 150 g/mol.  Embodiments herein are not limited  to a particular organic co‐solvent. Examples include but are not limited to, a low molecular  weight  amide,  a  low molecular weight  sulfoxide,  a  low molecular weight  sulfone, or  low  molecular weight  diol.  In  some  embodiments,  the  amide  is  selected  from,  for  example,  formamide,  N‐methyl  formamide,  N,N‐  dimethyl  formamide  (DMF),  acetamide,  N‐ methylacetamide, N,N‐dimethylacetamide, propionamide, isobutyramide, 2‐pyrrolidone, N‐ methylpyrrolidone (NMP), N‐hydroxyethyl pyrrolidone(HEP), N‐formyl pyrrolidine, N‐Formyl  morpholine; delta‐valerolactam, epsilon‐caprolactam, or 2‐ azacyclooctanone; the sulfoxide  is  selected  from,  for  example,  dimethyl  sulfoxide  (DMSO),  n‐propyl  sulfoxide,  n‐butyl  sulfoxide, methyl  sec‐butyl  sulfoxide, or  tetramethylene  sulfoxide;  the  sulfone  is  selected  from, for example, dimethyl sulfone, diethylsulfone, di(n‐isopropyl) sulfone, tetramethylene  19    sulfone  (sulfolane), 2,4‐dimethylsulfolane, or butadienesulfone  (sulfolene); and  the diol  is  selected  from,  for  example,  1,2‐propanediol,  1,3‐propanediol,  1,2‐butanediol,  1,3‐ butanediol,  1,4‐butanediol,  1,2‐pentanediol,  2,4‐pentanediol,  1,5‐pentanediol,  1,2‐ cyclopetanediol,  1,2‐hexanediol,  1,6‐hexanediol,  or  2‐methyl‐2,4‐pentanediol.  In  some  embodiments, the amide solvent for RT‐PCR reactions is N,N‐Dimethylformamide (DMF) at a  concentration  of  about  0.5  to  about  1.5  molar  concentration;  isobutyramide  at  a  concentration  of  about  0.1  to  about  1.0  molar  concentration;  2‐pyrrolidone  at  a  concentration of about 0.1 to about 1.0 molar concentration; or N‐methylpyrrolidone at a  concentration of about 0.1 to about 1.0 molar.  Alternatively, for RT reactions, the organic  solvent is N,N‐Dimethylformamide (DMF) at a concentration of about 0.5 to about 7.0 molar  concentration;  isobutyramide  at  a  concentration  of  about  0.1  to  about  4.5  molar  concentration;  2‐pyrrolidone  at  a  concentration  of  about  0.1  to  about  4.5  molar  concentration; or N‐methylpyrrolidone at a concentration of about 0.1 to about 4.5 molar.  In some embodiments, the sulfoxide for RT‐PCR reactions is dimethylsulfoxide (DMSO)  at a concentration of about 0.5 to about 3.0 molar concentration or tetramethylenesulfoxide  at a concentration of about 0.1  to about 1.0 molar.  In some embodiments,  the sulfone  is  tetramethylenesulfone  (sulfolane)  at  a  concentration  of  about  0.1  to  about  1.0  molar.   Additionally,  in  some  embodiments,  for  RT  reactions,  the  sulfoxide  is  dimethylsulfoxide  (DMSO)  at  a  concentration  of  about  0.5  to  about  7.5  molar  concentration  or  tetramethylenesulfoxide  at  a  concentration  of  about  0.1  to  about  4.0  molar.  In  some  embodiments, the sulfone is tetramethylenesulfone (sulfolane) at a concentration of about  0.1 to about 3.0 molar.    In  some  embodiments,  the  diol  for  RT‐PCR  reactions  is  1,3‐propanediol  at  a  concentration  of  about  0.5  to  about  3.0  molar  concentration;  1,4‐butanediol  at  a  concentration  of  about  0.5  to  about  2.0  molar  concentration;  or  1,5‐pentanediol  at  a  concentration of about 0.5 to about 1.0 molar concentration.  In some embodiments, the diol  for  RT  reactions  is  1,3‐propanediol  at  a  concentration  of  about  0.5  to  about  7.5 molar  concentration;  1,4‐butanediol  at  a  concentration  of  about  0.5  to  about  5.0  molar  20    concentration;  or  1,5‐pentanediol  at  a  concentration  of  about  0.5  to  about  2.5  molar  concentration.    In some embodiments, the one or more polar organic solvents display a rate of change  of duplex DNA, DNA secondary structure, or RNA secondary structure melting temperature  with respect to cosolvent concentration (dTm/d[solvent]) between ‐1 K/M and ‐15 K/M. In  such  embodiments,  the  duplex  DNA  corresponds  to  the  c‐jun  DNA  segment  flanked  by  primers with SEQ  ID NOS: 92 and 94, and where  the DNA and RNA  secondary  structures  correspond to the most stable secondary structures in the single‐stranded BEGAIN DNA and  RNA fragments flanked by primers with SEQ ID NOS: 126 and 127, respectively.   Moreover,  the one or more  low molecular weight polar organic cosolvents may also display  rates of  change  of  wild‐type  Taq  polymerase  melting  temperature  with  respect  to  cosolvent  concentration (dTM/d[solvent]) between ‐1 K/M and ‐15 K/M.  Low molecular weight cosolvents of compositions and methods described herein can be of  the formula   ,  R1 is C or S; and  when R1 is C, X is ═O, R3 is N and R6 is absent;  when R1 is S, X is ═O or    and R3 is C;  R2 is H or CH3 only when one or more of R4, R5 and R6 is not H, and otherwise R2 is an  unsubstituted or halogen‐, hydroxy‐ or alkoxy‐ substituted alkyl or cycloalkyl of length  m, wherein m is selected such that the total number of carbons in the compound is  between 3 and 8 when R1 is C and between 2 and 8 when R1 is S; wherein any two of  21    R2, R3, R4, R5 and R6 optionally form a cyclic structure in which cyclization is effected  through a bond between them; and R4, R5 and R6 each is H, alkyl, cycloalkyl or halogen,  hydroxy‐ or alkoxy‐ substituted alkyl or cycloalkyl of  length n, wherein n  is selected  such that the total number of carbons in the compound is between 3 and 8 when R1 is  C and between 2 and 8 when R1 is S and when R4 and R5 are CH3, R2 cannot be H or CH3.    In  some embodiments,  the one or more polar organic  solvents  comprises  a  cyclic  compound, wherein the cyclization is effected through a bond between any two of R2, R3, R4,  R5 and R6.  The cyclic portion, for example, can comprises five, six or seven members.  In some  embodiments, cyclic structure of the compound is a five, six, or seven‐membered ring formed  by a bond between R2 and either R4, R5 or R6.  In such cyclic embodiments, R1 can be S and  remainder of  the  compound  is unsubstituted.    In  some embodiments,  the  low molecular  weight polar organic solvent comprises a compound in which R1 is S, X is ═O or  , and R3 is C.  In some embodiments, the low molecular weight polar organic solvent is is  selected from the group consisting of tetramethylene sulfone and tetramethylene sulfoxide.    Alternatively,  the  low molecular weight  polar  organic  solvent  is  acyclic.    In  such  embodiments, R2 or R3 of the compound  is  lower alkyl or substituted  lower alkyl.    In some  embodiments,  the  polar  organic  solvent  is  selected  from  the  group  consisting  of methyl  sulfone, ethyl sulfone, n‐propyl sulfone, n‐propyl sulfoxide and methyl sec‐butyl sulfoxide.    As described herein, embodiments are not limited to a particular organic co‐solvent.  Examples  include but are not  limited  to, a  low molecular weight amide, a  low molecular  weight sulfoxide, a  low molecular weight sulfone, or  low molecular weight diol.    In some  embodiments, the amide  is  is selected  from the group consisting of  formamide, N‐methyl  formamide,  N,N‐  dimethyl  formamide  (DMF),  acetamide,  N‐methylacetamide,  N,N‐ dimethylacetamide,  propionamide,  isobutyramide,  2‐pyrrolidone,  N‐methylpyrrolidone  (NMP), N‐hydroxyethyl pyrrolidone (HEP), N‐formyl pyrrolidine, and N‐Formyl morpholine.   For  example,  the  organic  solvent  can  be  selected  from  the  group  consisting  of  N,N‐ Dimethylformamide (DMF) at a concentration of about 0.5 to about 1.5 molar concentration,  isobutyramide  at  a  concentration  of  about  0.1  to  about  1.0  molar  concentration,  2‐ 22    pyrrolidone  at  a  concentration  of  about  0.1  to  about  1.0 molar  concentration,  and  N‐ methylpyrrolidone at a concentration of about 0.1 to about 1.0 molar.  In some embodiments, the amide solvent is N,N‐Dimethylformamide (DMF) at a  concentration of about 0.5 molar to about the concentration at which the melting  temperature (TM) of the reverse transcriptase is 5oC higher than the optimal activity  temperature of the reverse transcriptase in the absence of DMF; isobutyramide at a  concentration of about 0.1 molar to about the concentration at which the melting  temperature (TM) of the reverse transcriptase is  5oC higher than the optimal activity  temperature of the reverse transcriptase in the absence of isobutyramide; 2‐pyrrolidone at  a concentration of about 0.1 molar to about the concentration at which the melting  temperature (TM) of the reverse transcriptase is 5oC higher than the optimal activity  temperature of the reverse transcriptase in the absence of 2‐pyrrolidone; or N‐ methylpyrrolidone at a concentration of about 0.1 molar to about the concentration at  which the melting temperature (TM) of the reverse transcriptase is 5oC higher than the  optimal activity temperature of the reverse transcriptase in the absence of N‐ methylpyrrolidone.    In some embodiments, sulfoxides are selected from the group consisting of dimethyl  sulfoxide  (DMSO),  n‐propyl  sulfoxide,  n‐butyl  sulfoxide,  methyl  sec‐butyl  sulfoxide,  and  tetramethylene  sulfoxide;  the  sulfone  is  selected  from  the  group  consisting  of  dimethyl  sulfone,  diethylsulfone,  di(n‐isopropyl)  sulfone,  tetramethylene  sulfone  (sulfolane),  2,4‐ dimethylsulfolane,  and  butadienesulfone  (sulfolene).    In  one  embodiment,  the  organic  solvent is selected from the group consisting of dimethylsulfoxide (DMSO) at a concentration  of  about  0.5  to  about  3.0  molar  concentration  and  tetramethylenesulfoxide  at  a  concentration of about 0.1 to about 1.0 molar.  In some embodiments, the organic solvent is selected from the group consisting of  dimethylsulfoxide (DMSO) at a concentration range of about 0.5 molar to about the  concentration at which the melting temperature (TM) of the reverse transcriptase is 5oC  higher than the optimal activity temperature of the reverse transcriptase in the absence of  23    DMSO, and tetramethylene sulfoxide at a concentration range of about 0.1 molar to about  the concentration at which the melting temperature (TM) of the reverse transcriptase is 5oC  higher than the optimal activity temperature of the reverse transcriptase in the absence of  tetramethylene sulfoxide.  In some embodiments, the organic solvent is  tetramethylenesulfone (sulfolane) at a concentration of about 0.1 molar to about the  concentration at which the melting temperature (TM) of the reverse transcriptase is 5oC  higher than the optimal activity temperature of the reverse transcriptase in the absence of  sulfolane.    Diols,  in  some  embodiments,  are  selected  from  the  group  consisting  of1,2‐ propanediol,  1,3‐propanediol,  1,2‐butanediol,  1,3‐butanediol,  1,4‐butanediol,  1,2‐ pentanediol,  2,4‐pentanediol,  1,5‐pentanediol,  1,2‐cyclopentanediol,  1,2‐hexanediol,  1,6‐ hexanediol, and 2‐methyl‐2,4‐pentanediol.  In some embodiments, for example, the organic  cosolvent  is  selected  from  the  group  consisting of  1,3‐propanediol  at  a  concentration of  about 0.5 to about 3.0 molar concentration, 1,4‐butanediol at a concentration of about 0.5  to about 2.0 molar concentration, and 1,5‐pentanediol at a concentration of about 0.5  to  about 1.0 molar concentration.  In some embodiments, the organic solvent  is selected from the group consisting of  1,3‐propanediol at a concentration of about 0.5 molar to about the concentration at which  the melting  temperature  (TM) of  the  reverse  transcriptase  is 5oC higher  than  the optimal  activity  temperature of  the  reverse  transcriptase  in  the  absence of  1,3‐propanediol,  1,4‐ butanediol at a concentration of about 0.5 molar to about the concentration at which the  melting temperature (TM) of the reverse transcriptase is 5oC higher than the optimal activity  temperature  of  the  reverse  transcriptase  in  the  absence  of  1,4‐butanediol,  and  1,5‐ pentanediol at a concentration of about 0.5 molar to about the concentration at which the  melting temperature (TM) of the reverse transcriptase is 5oC higher than the optimal activity  temperature of the reverse transcriptase in the absence of 1,5‐pentanediol.     Compositions described herein also comprise a thermostable reverse transcriptase or  a  fragment  thereof. Any  thermostable  reverse  transcriptase consistent with  the  technical  24    objectives  described  herein  can  be  employed.    In  being  thermostable,  the  reverse  transcriptase can have an optimal RT temperature above 37oC and preferably above 48oC.   The thermostable reverse transcriptase, in some embodiments, comprises one or more non‐ natural amino acid alterations conferring stability and/or activity  in the one or more polar  organic solvents.  In some embodiments, the thermostable reverse transcriptase is a mutant  or modified  Taq  polymerase  bearing  at  least  90%  sequence  similarity  to  wild‐type  Taq  polymerase (SEQ  ID NO: 1).    In some embodiments, the amino acid sequence comprises a  first set of non‐natural amino acid alterations stabilizing the modified Taq DNA polymerase  in  an  aqueous‐organic medium,  and  a  second  set  of  non‐natural  amino  acid  alterations  conferring confer reverse transcriptase activity to the modified Taq DNA polymerase.    In some embodiments, non‐natural amino acid alterations of the first set stabilizing  the modified Taq DNA polymerase  in  the  low molecular weight polar organic  solvents or  aqueous‐organic media  comprising  the  low molecular weight  polar  organic  solvents  are  selected from the group consisting of G3D, M4I, L5Q, F8L, E9V, P10S, V14A, L16P, H21R, A23P,  L22M,  F27S, A29T, G32D, G38D,  K53N, A54V,  L55P, A61V, D67G,  P71L, R74L,R74H,R74C,  K82N, G84D, A86V, P87Q, P89S, E90D, A97T, V103A, D104G, A109V, R110Q, P114S, G115D,  E117D, A118V, A118T, K128R, V136A, L149P, L162P, K171T, A180V, R183H, T186I, G187S,  D191N, L193R, G195S, G200S, E201K, K202R, R205H, K206Q, G212D, S213N, S213G, N220D,  L224Q, I228V, H235Y, D237G, W243R, D244E, D244V, L254P, K260N, F258S, R261H, P264S,  E267K, E277G, L287Q, S290G, K292N, P302L, P302S, V310L, L311M, D320N, A326V, R328H,  H333R, K346R, L351M, E363D, L365Q, P382T, N384D, E388D, T399A, A414S, A454E, A454L,  A454V, A458V,  L461Q,  F482I,  L461R, V474I, G499D A502T,  I503T,  E507K,  S515N,  S515G,  A516G, E520G, A521V, I528T, K531R, Q534R, T539A, S543G, D551N, D551G, V586A, V586M,  Q592R, L606M, A608T, S612R,  I665V, F667Y, H676L, H676R, H676Y, Q680R, E681K, K702R,  A705V, V720L, V730I, D732G, D732N, E734G, V737D, V737A, S739G, V740A, V740I, E742K,  F749V, F749I, F749L, K762R, K767R, L768M, E773K, L781P, E797G, E797Q, V799A, P812Q,  Q782H, A814V, L813M, E825Q, and E832K of SEQ ID NO: 1.  25      In some embodiments, the solvostable first set of non‐ natural amino acid alterations  are  selected  from  the  group  consisting  of  L5Q,  F8L,  P10S,  L16P,  A23P,  A29T,  K31R,  G38D,A61V, P89S, A97T, A118V, L162P, K171T, T186I, E201K, R205K, K206Q, G208S, K219E,  N220D, I228V, M236T, D244E, D244V, R261H, D273G, L287Q, S290G, V310L, H333R, K346R,  L351M,  P382T,  E388D,  E434D, A454E,  L461Q,  L461R, V474I,  F482I,  I503T,  E507K,  S515N,  A521V, Q534R, S543G, D551G, D551N, Q592R, L606M, A608V, S612R, H676L, Q680R, K702R,  D732N, E734G, S739G, E742K, F749I, F749V, F749L, K762R, K767R, L768M, Q782H, and E832K  of SEQ ID NO: 1.    In some embodiments, the solvostable first set of non‐ natural amino acid alterations  are selected from the group consisting of P10S, L16P, A29T, K31R, G38D, A61V, A118V, L162P,  T186I, G208S, N220D, I228V, D244V, D273G, S290G, K346R, L351M, E388D, A454E, L461Q,  L461R, F482I,  I503T, S515N, A521V, Q534R, D551G, L606M, A608V, S612R, Q680R, E734G,  S739G, F749V, F749I, L768M, and E832K of SEQ ID NO: 1.    In some embodiments, the solvostable first set of non‐ natural amino acid alterations  are selected from the group consisting of L5Q, P10S, A23P, A29T, T186I, L461R, E507K, A608V,  S612R, E742K, F749L, F749I, K762R, K767R, and E832K of SEQ ID NO: 1.    In some embodiments, the solvostable first set of non‐ natural amino acid alterations  are selected from the group consisting of P10S, L16P, A29T, K31R, G38D, A61V, A118V, L162P,  T186I, G208S, N220D, I228V, D244V, D273G, S290G, K346R, L351M, E388D, A454E, L461Q,  L461R, F482I,  I503T, S515N, A521V, Q534R, D551G, L606M, A608V, S612R, Q680R, E734G,  S739G, F749V, F749I, L768M, and E832K of SEQ ID NO: 1.    In some embodiments, the solvostable first set of non‐ natural amino acid alterations  are selected from the group consisting of F8L, P10S, L16P, A29T, K31R, G38D, A61V, A97T,  and L162P of SEQ ID NO: 1.    In some embodiments, the solvostable first set of non‐ natural amino acid alterations  are selected from the group consisting of A186I, D244V, R205K, G208S, K219E, N220D, I228V,  D273G,  S290G,  K346R, P382T,  E388D,  E434D, A454E,  L461Q,  L461R, V474I,  F482I,  I503T,  E507K, S515N, A521V, Q534R, D551G, and L606M of SED ID NO: 1.  26      In some embodiments, the solvostable first set of non‐ natural amino acid alterations  are selected from the group consisting of S612R, Q680R, K702R, S739G, E742K, L768M, F749I,  F749V, K762R, K767R, and Q782H.    In some embodiments, the solvostable first set of non‐ natural amino acid alterations  are selected from the group consisting of:    L30P, A54V, E434D, K206Q, S612R, V730I, and F749V of SEQ ID NO: 1;  P10S, A61V, T186I, D244V, K314R, E520G, V586A, S612R, V730I, and F749V of SEQ ID  NO:1;    G12T, A54V, T186I, D244V, F667Y, and F749V of SEQ ID NO: 1;  P10S, A61V, F73S, T186I, R205K, K219E, M236T, A608V, S612R, and 2494ΔG of  SEQ ID NO: 1;    P10S, L30P, A61V, L365P, V586A, S612R, and E832K of SEQ ID NO: 1;    P10S, A61V, D244V, S612R, and E832K of SEQ ID NO: 1;      L30P and 2494ΔG of SEQ ID NO: 1; and     A29T, G200S, D237G, and F749I of SEQ ID NO: 1.    In  some  embodiments,  non‐natural  amino  acid  alterations  of  the  second  set  conferring reverse transcriptase activity to the modified Taq DNA polymerase are selected  from the group consisting of E732N, E742K, E742R, M747K, M747R, E742N, E742N, E742Q,  E742Y, E742M, E742A and M747N of SED ID NO: 1.    Any  combination of non‐natural  amino  acid  alterations  selected  from  the  first  set  stabilizing  the modified  Taq DNA  polymerase  in  the  low molecular weight  polar  organic  solvents  or  aqueous‐organic  media  comprising  the  low  molecular  weight  polar  organic  solvents and the second set conferring reverse transcriptase activity to the modified Taq DNA  polymerase are contemplated herein.  For example, the thermostable reverse transcriptase  has non‐natural amino acid alterations A97T, A608V, K702R, K762R, E742K, and M747K. of  SEQ ID NO:1.  In some embodiments, the thermostable reverse transcriptase has non‐natural  amino acid alterations A97T, A608V, K702R, K762R, and E732N of SEQ  ID NO:1.    In some  embodiments, the thermostable reverse transcriptase has non‐natural amino acid alterations  27    A23P, L162P, 228V, L461R, A521V, E734G, F749I, L768M, E742K, and M747K of SEQ ID NO:1.   Additional  combinations  of  non‐natural  alterations  from  the  first  and  second  sets  are  provided in Table 15 herein.    In some embodiments, the one or more non‐natural amino‐acid alterations can confer  an increase in half‐life of the thermostable reverse transcriptase of at least 50 percent at 95oC  and/or  an  increase  in  reverse  transcriptase  activity  of  at  least  50%  at  72oC.   Moreover,  presence  of  the  one  or more  low molecular weight  polar  organic  solvents  can  increase  reverse  transcriptase  (RT)  activity  (rate  of  nucleotide  incorporation)  of  the  thermostable  reverse transcriptase or the fragment thereof.    In another aspect, kits are provided herein.  In some embodiments, a kit comprises a  composition  for  reverse  transcriptase  or  a  composition  for  reverse  transcriptase‐PCR  described herein.  Low molecular weight organic solvents and reverse transcriptases of the  kit can have any composition and/or properties described herein.  Kits can further comprise  one  or  more  adjuvants,  instructions  for  using  components  of  the  kit  to  optimize  polynucleotide  replication of a  selected polynucleotide, oligonucleotide primers, a known  template for use as a control, and one or more reaction vessels for performing the plurality  of polynucleotide  replication  reactions.    In  some embodiments,  the  kit prescribes use of  reverse transcription temperatures above 48oC and below the melting temperature of the  RNA:DNA heteroduplex  in  the presence of  the employed  concentration of  the  cosolvent.   Moreover, the kit can prescribe use of reverse transcription temperatures above 48oC and  below the melting temperature of the reverse transcriptase protein in the presence of the  employed  concentration  of  the  cosolvent.    A  kit,  in  some  embodiments,  prescribes  preincubation  at  a temperature  more  than  5oC  below  the  melting  temperature  of  the  primer:template complex.  Methods of reverse transcribing RNA into DNA and methods of administering reverse  transcriptase‐PCR are also described herein.    In some embodiments, a method of  reverse  transcribing RNA into DNA comprises incubating a thermostable reverse transcriptase with a  reverse  transcriptase buffer, a RNA  template, deoxyribonucleoside  triphosphates  (dNTPs),  28    DNA primers, and at least one low molecular weight organic cosolvent.  The one or more low  molecular  weight  organic  cosolvents  can  have  any  identity  described  herein.    In  some  embodiments, the reverse transcriptase is a modified Taq DNA polymerase bearing at least  90% sequence similarity to wild‐type Taq polymerase of SEQ  ID NO:1.   Moreover,  in some  embodiments, the temperature of reverse transcription is higher than its optimal value in the  absence of the polar organic cosolvent, and less than or equal to the melting temperature of  the enzyme at that cosolvent concentration, minus 5oC.  As detailed further herein, reaction  yield or reaction efficiency can be enhanced in the presence of the at least one low molecular  weight  polar  organic  cosolvents.    Additionally,  reverse  transcription  and/or  DNA  amplification,  in  some  embodiments,  is  administered  for  target  enrichment  in  next‐ generation sequencing of RNA,  including wherein the copy number of RNA sequences are  determined by next‐generation sequencing.  In some embodiments, the RNA sequencing is  carried  out  with  incorporation  of  unique  molecular  identifiers  (UMI)  in  the  adapter  sequences.  In another aspect, methods of detecting bacterial or viral pathogens without sample  preparation,  such  as  directly  from  clinical  samples,  are  described  herein.    In  some  embodiments, a method comprises   a)  incubating a clinical  sample containing a virus or bacteria with RT‐PCR  reagents  including  a  thermostable  or  solvostable  reverse  transcriptase  (RT),  one  or  more  low  molecular weight polar organic cosolvents, optionally a  thermostable or solvostable DNA‐ dependent DNA  polymerase  enzyme,  RT‐PCR  buffer,  and  primers  complementary  to  the  nucleic acid sequence to be detected, at a temperature exceeding 70oC and preferably below  80oC, to lyse the virus or bacteria and release RNA without degrading the RNA;  b) incubating the lysed clinical sample at or near the optimal temperature for reverse  transcription of the RT enzyme;  c) thermal cycling of the reaction mixture to PCR amplify the resulting complementary  DNA (cDNA); and   d) quantification of the PCR product.  29    In some embodiments, quantifying the PCR product can be administered by qPCR.  The virus  of the clinical sample, for example, can be SARS‐CoV virus or other respiratory virus.    In another aspect, kits  for detection via RT‐PCR of viral or bacterial pathogen RNA  directly  from  clinical  samples  without  sample  preparation  are  provided.    In  some  embodiments, such a kit comprises a thermostable or solvostable reverse transcriptase (RT)  enzyme,  one  or  more  low  molecular  weight  polar  organic  cosolvents,  optionally  a  thermostable or solvostable DNA‐dependent DNA polymerase enzyme, RT‐PCR buffer, and  primers complementary to the nucleic acid sequence to be detected.  Components of the kit,  including  the  solvostable  reverse  transcriptase  (RT)  enzyme  and  low  molecular  weight  organic solvent can have any composition and/or properties described herein.  In another  aspect, methods  for droplet digital  reverse  transcription PCR  (ddRT‐PCR) with  enhanced RT and PCR efficiency are described herein.  In some embodiments, a method for  droplet digital reverse transcription PCR (ddRT‐PCR) with enhanced RT and PCR efficiency,  the method comprising:  a)  incubating  RT‐PCR  reagents  including  a  RT‐PCR  buffer,  a  thermostable  or  solvostable  reverse  transcriptase,  a  thermostable  or  solvostable  DNA‐dependent  DNA  polymerase, primers and/or probes for a sequence or mutation of interest, a polar organic  cosolvent within emulsion droplets, and one or more RNA templates, at or near the optimal  temperature for reverse transcription, such that the polar organic cosolvent at least doubles  the reverse transcription yield compared to buffer lacking the cosolvent;  b) thermal cycling of the reaction mixture to PCR amplify the resulting cDNA; and  c) counting or sorting of  the  resulting positive droplets using a  fluorescence‐based  counting or sorting device.    In  another  aspect,  methods  for  accelerating  the  in  vitro  evolution  of  reverse  transcriptase (RT) enzymes are provided.  In some embodiments, a method for accelerating  the in vitro evolution of reverse transcriptase (RT) enzymes comprising:  a) preparation of a library of thermostable polymerase enzyme gene variants;  30    b)  expression  of  the  enzymes  corresponding  to  these  gene  variants,  for  example  through bacterial transformation and expression or in vitro transcription/translation of the  library, in individual containers, the containers preferably being either droplets or microplate  wells;  c) incubation of the library of enzyme variants within individual containers, with one  or more polar organic cosolvents at specified concentrations, RT‐PCR buffer, primers and/or  probes  for  an  RNA  sequence  of  interest,  optionally  a  thermostable  or  solvostable DNA‐ dependent DNA polymerase enzyme, and the RNA template, at a temperature suitable for  reverse transcription, the temperature preferably being between 48oC and 80oC;   d) thermal cycling of the reaction mixtures to PCR amplify the resulting cDNAs;  e) ranking of the resulting enzyme variants based on RT‐PCR yield, either by screening  or sorting, the screening or sorting preferably being done based on fluorescence; and   f) sequencing of the resulting top enzyme variants to identify the best RT enzymes,  wherein the presence of organic cosolvent(s) at the specified concentration(s) increase the  RT activity of at least one enzyme variant at least twofold above the activity in their absence.  In  some  embodiments,  at  least  one  of  the  enzyme  variants  is  a  rare  variant  whose  corresponding gene is present in the library with less than or equal to 1% frequency.    Any of  the methods described herein  can employ any  low molecular weight polar  organic solvent and reverse transcriptase enzyme described hereinabove, including modified  Taq polymerases bearing at least 90% sequence similarity to wild‐type Taq polymerase (SEQ  ID NO: 1) and including one or more non‐natural amino acids alterations conferring stability  and/or activity in the one or more polar organic solvents.  In some embodiments, the amino  acid  sequence  comprises  a  first  set  of  non‐natural  amino  acid  alterations  stabilizing  the  modified Taq DNA polymerase  in an aqueous‐organic medium, and a  second  set of non‐ natural amino acid alterations conferring confer reverse transcriptase activity to the modified  Taq DNA polymerase.  Additionally, in some embodiments of methods described herein, the  temperature of reverse transcription  is higher than  its optimal value  in the absence of the  31    polar  organic cosolvent,  and  less  than  or  equal  to  the melting  temperature  of  the  fully  extended RNA:DNA heteroduplex at that cosolvent  concentration, minus 5oC.    Reverse Transcriptases in Aqueous‐Organic Media  Reverse transcription (RT) ‐‐ a critical step in the amplification of RNA for diagnostic  (e.g.,  RNA  sequencing)  applications  –  is  particularly  prone  to  GC  bias  due  to  secondary  structure,  because  the  chemical  instability  of  RNA  restricts  polymerization  at  elevated  temperatures  that  can  facilitate  the  reduction of  secondary  structures  in  single‐stranded  DNA.  While  next‐generation  RNA  sequencing  (RNA‐seq)  provides  a  powerful  means  to  quantify differential gene expression patterns in high‐throughput, thus playing a central role  in  systems biology,  its  accuracy  is  fundamentally  limited by  sequence bias  for which  the  primary recourse to date has been normalization of NGS frequencies with spike‐in standards  and/or prior sequencing datasets. Polymerases with reverse transcriptase ability as well as  organic  solvent  resistance  could  therefore  be  transformative  in  RNA‐seq  by  enabling  significantly  reduced  sequence  bias  in  reverse  transcription.  Although  retroviral  reverse  transcriptases have been supplanted by thermostable enzymes for many RT‐PCR applications  (including, e.g. TaqMan RT‐qPCR with Taq polymerase for COVID testing), to date no solvent‐ resistant reverse transcriptases have been reported. We refer to DNA polymerases into which  artificial mutations have been engineered to increase solvent resistance ‐ by counteracting  the  deleterious  effects  of  organic  cosolvent  ‐  as  solvostable  DNA  polymerases.  (These  polymerases preferably display rates of decline of polymerase melting temperature (TM) and  enzyme activity with respect to cosolvent concentration that are less than 50% of those rates  for  the  corresponding  wild‐type  enzyme  without  any  solvent‐resistant  mutations,  with  enzyme  activity  persisting  at  cosolvent  concentrations  at  least  twice  as  high  as  those  tolerated by the wild‐type enzyme, for at least one of the aforementioned organic cosolvents.  They  also  preferably  display  a  greater margin  of  improvement  in  thermostability  and/or  activity to the parent enzyme in the presence of at least one organic cosolvent compared to  its absence.)  32    For the above reasons, we sought to study the effects of the aforementioned organic  cosolvents  on  thermostable  reverse  transcriptase  enzymes  and  to  introduce  reverse  transcriptase  activity  in  solvostable  DNA  polymerase  enzymes.  Thereupon  we  made  the  completely  unanticipated  discovery  that  reverse  transcriptases  (especially  those  enzymes  whose optimal temperatures for RNA‐dependent DNA polymerization are significantly above  37oC,  preferably  above  48oC, which  is  not  the  case  for  the  vast majority  of  RTs)  can  be  solvophilic – with polar organic cosolvents  increasing rather than decreasing their catalytic  activity, and often  increasing  the activity of engineered  solvostable  reverse  transcriptases  over 5‐fold and in some cases over 15‐fold under conditions conducive to the elimination of  secondary structure while maintaining the chemical integrity of RNA. This is the first study on  organic  solvent‐resistant  reverse  transcriptases,  thus  expanding  the  repertoire  of  RTs  to  include those that are resistant to both high temperature and organic media. More generally,  it is the first to demonstrate the unanticipated result that the activity of even thermostable  polymerases that have not been engineered for solvostability can be greatly upregulated by  polar organic cosolvents – i.e., that a broad spectrum of thermostable reverse transcriptases  are  in fact solvophilic and that the use of them  in polymerase‐compatible mixed aqueous‐ organic  media  can  greatly  improve  RT,  RT‐PCR  and  RNA  sequencing.  Upregulation  of  polymerase activity at or above the optimal extension temperature – such that both elevated  temperature  and  cosolvent  concentration  can  have  beneficial  effects  –  has  never  been  reported and is in fact contrary to previously understood principles of thermostable protein  biophysics.  Even more generally, it is one of the first studies to demonstrate that catalytic  activity  of  an  enzyme  can  be  significantly  upregulated,  rather  than  reduced,  by  mixed  aqueous‐organic media compared to aqueous media.  Additionally, compositions containing  both RT enzyme(s) and  certain polar organic  cosolvent(s) within  certain preferred  ranges  have never been anticipated nor reported to result in upregulation of the RT enzyme(s), and  as such they constitute novel compositions.  In addition to RT reactions, we conducted both RT and PCR steps of RT‐PCR reactions  in mixed aqueous‐organic media using either a thermostable or engineered solvostable RT  33    enzyme  and  either  a  thermostable  of  engineered  solvostable  DNA‐dependent  DNA  polymerase enzyme. We observed further improvements compared to conventional RT‐PCR  using thermostable RT and PCR enzymes in aqueous media.    Our  findings  demonstrate  high  performance  of  reverse  transcription  ‐‐  either  in  isolation or together with DNA polymerization/amplification  in the context of RT‐PCR  ‐‐  in  water‐miscible solvents through improvement of the enzyme stability and activity, enabling  dramatic reduction of sequence bias in nucleic acid polymerization not achievable through  thermal resistance alone, and showing that significant sequence biases in target enrichment  for  nucleic  acid  sequencing  ‐‐ which  have  been  considered  chemically  unavoidable  and  typically  addressed  primarily  through  normalization  of  sequencing  data  –  can  be  almost  entirely eliminated by the use of such organic cosolvents (instead of only temperature), with  either  thermostable  or  engineered  solvostable  polymerases,  as  a means  of  nucleic  acid  denaturation and secondary structure reduction.  In addition, it was found that since the rate  of change  in RT activity with respect to cosolvent concentration  is positive over typically a  broad  range  (in many  cases  exceeding  20%  cosolvent,  significantly  higher  than  for DNA‐ dependent DNA polymerases), such  that activity  increases while RNA secondary structure  decreases, the stability of the enzyme  in organic cosolvents at the extension temperature   becomes more  important  in  determining  the maximal  cosolvent  concentration  for  such  reverse  transcriptases.  Moreover,  since  thermostable  RTs  generally  have  melting  temperatures significantly above  their  temperatures of optimal activity, and since reverse  transcription  alone  does  not  require  high‐temperature  denaturation  of  duplex DNA,  this  allows  high  cosolvent  concentrations  to  be  used  for  maximal  upregulation  as  well  as  secondary structure denaturation.   Engineered solvophilic  reverse  transcriptases are  introduced  that display activity at  temperatures approaching 80oC and over 400% upregulation of activity  in the presence of  organic  cosolvents  (up  to  2000%),  and  overcome  sequence‐dependent  RNA  secondary  structure more effectively than any other tested enzyme. Preferred engineered solvophilic  reverse transcriptase compositions display optimal temperatures for activity between 48oC  34    and  76oC  and  at  least  100%  upregulation  of  activity  in  the  presence  of  appropriate  concentrations of at least one polar organic cosolvent. In addition, some of these enzymes  are also solvostable DNA‐dependent DNA polymerases, enabling  their use  in one enzyme,  one pot RT‐PCR reactions in mixed aqueous‐organic media comprising certain polar organic  solvents within  specific  concentration  ranges. By expanding  the  scope of  solvent  systems  compatible with nucleic acid polymerization, these inventions enable a dramatic reduction of  sequence bias, with significant  implications for a wide range of applications  including NGS  sequencing,  differential  gene  expression  analysis,  synthetic  biology  and  molecular  information processing.  We used ultrahigh‐throughput droplet‐based  selection and deep  sequencing along  with computational free energy and binding affinity calculations to evolve wild‐type (WT) Taq  polymerase (SEQ ID NO: 1) into solvophilic RNA‐dependent DNA polymerases that are highly  active in the presence of polar organic cosolvents, resulting in over 20% solvent resistance  and over 100‐fold higher stability (half‐life) in the presence of 1,4‐butanediol (BD), as well as  tolerance  to  10  times  higher  concentrations  of  the  potent  cosolvents  sulfolane  (sulfone  family) and 2‐pyrrolidone (amide family). DNA‐dependent DNA polymerase activity was used  as  a  screening  tool  to  identify  solvostable mutations  that would  be  compatible with  RT  activity.  These  engineered  solvostable  polymerases  can  successfully  RT‐PCR  a  broad  spectrum of recalcitrant GC‐rich templates containing regions with over 90% GC content and  demonstrate dramatically reduced sequence bias in the amplification of genes with varying  GC content in target enrichment for next‐generation sequencing (RNA‐Seq). RT‐PCR can be  carried out in one pot using a separate solvostable DNA‐dependent DNA polymerase, or even  in  some  cases with  a  single  enzyme  that  is  both  a  solvophilic  RT  and  solvostable  DNA‐ dependent DNA polymerase.  We  identified polymerase variants which can tolerate 30+% v/v of the most potent  organic cosolvents  including BD, thus enabling the use of higher concentrations of organic  cosolvents  to  destabilize  RNA  secondary  structures  (as  well  as  duplex  DNA  and  single‐ stranded DNA) while minimizing the negative effects on the polymerase’s thermostability and  35    DNA‐dependent  DNA  polymerase  activity,  and  in  fact  dramatically  improving  the  polymerase’s RNA‐dependent DNA polymerase  activity by over 5‐fold  and  in  some  cases  between 15‐20 fold. These variants can be used for amplification of GC‐rich templates that  routinely arise in biotechnological and diagnostic applications including next‐generation DNA  sequencing,  and  RNA‐seq    (where  carrying  out  reverse  transcription  in  the  presence  of  organic media can reduce secondary structure). We report herein engineered polymerases  that are solvostable (resistant to polar organic cosolvents) in DNA amplification reactions and  solvophilic (preferring polar organic cosolvents)  in reverse transcriptase reactions, with RT  activities at temperatures near 70oC in 10‐20% organic cosolvent that are equal to or greater  than those of state‐of‐the‐art thermostable RTs at 55oC in water, even on unstructured poly‐ A templates. Moreover, unlike all other RTs tested herein –  including previously reported,  highly thermostable Taq variants with RT activity – our engineered solvophilic RTs are able to  synthesize cDNA from GC‐rich templates in these media at elevated temperatures.           We employed microfluidics  to ensure highly monodisperse water‐in‐oil microemulsions  and to create water‐in‐oil‐in‐water microemulsions in the presence of organic cosolvents, for  fluorescence‐activated droplet/cell  (FACS) sorting of polymerase variant libraries and for a  secondary FACS‐based screen confirming the superior performance of the best polymerases  vs WT  (Fig. 7), prior  to purification  and  characterization. We  conducted  seven  rounds of  enrichment PCR within such droplets and followed each round by NGS library sequencing to  assess the enrichment of functional clones.     Additional  applications  of  solvophilic  RT  technology  include:  a)  infectious  disease  detection  without  sample  preparation  steps  by  RT‐PCR  using  thermostable  and/or  solvostable RT  enzymes  in  the  presence  of  organic  cosolvents,  due  to  the  ability  to  lyse  bacteria  and  viruses  at  lower  temperatures  conducive  to  the  chemical  stability  of  RNA  through the destabilizing effects of organic cosolvents on these microorganisms; b) droplet  digital  RT‐PCR  (ddRT‐PCR)  with  improved  detection  of  rare  RNA  mutations  using  thermostable  and/or  solvostable  RT  enzymes within  droplets  in  the  presence  of  organic  cosolvents  (exploiting  the  greatly  enhanced  RT  enzyme  activity  in  these  cosolvents)  and  36    droplet sorting/counting by methods such as FACS; and c) ultrahigh‐throughput RT enzyme  engineering with greatly enhance signal enhancement from rare active library variants due  to  the  ability  of  organic  cosolvents  to multiply  RT  activity many  fold.  The  present  data  demonstrate  that  the polymerases and/or cosolvents display  the necessary and sufficient  properties to enable these applications.     Organic  Cosolvent‐Induced  Upregulation  of  Reverse  Transcription  (RT)  and  RT‐PCR  by  Thermostable Reverse Transcriptases  Cosolvent‐induced activity enhancement of thermostable reverse transcriptases (i.e.,  reverse transcriptases whose optimal temperature for RNA‐dependent DNA polymerization  is above 37oC and preferably significantly above that temperature – preferably above 48oC)  is a powerful means of  reducing nucleic acid secondary structure without  reducing – and  instead  increasing  –  enzyme  catalytic  rates.  There  are  several  possible  reasons  for  the  dramatic improvement of RT activity in BD, including improved processivity as well as solvent‐ induced  enhancement of  enzyme  flexibility, but  these  are  entirely unprecedented  in  the  literature.    Reverse Transcriptase (RT) activity assay:  Stoffel fragment mutants of Taq polymerase (SFM  4‐6, SFM 4‐3) were previously reported to have RT activity. Reverse transcriptase activities of  highly  thermostable  RTs  of  interest  were  tested  at  different  extension  temperatures  conducive  to  the  reduction  of  RNA  secondary  structure  (55oC,  68oC,  72oC  and  76oC).  RT  activity was observed in SFM 4‐6, SFM 4‐3 and Taq polymerase RT variants engineered for  solvent tolerance [N‐7‐3‐B07‐RT (SEQ ID NO: 4), L‐5‐2‐F01‐RT1 (SEQ ID NO: 2), and L‐5‐2‐F01‐ RT2 (SEQ ID NO: 3)], and it was found that RT activities of tested mutants were dramatically  enhanced in the presence of cosolvents up to over 20% v/v (Fig. 2).   Polar organic cosolvents from all the major aforementioned families – including 1,4‐ butanediol for the diol family, sulfolane for the sulfone family, tetramethylene sulfoxide for  37    the  sulfoxide  family,  and  2‐pyrrolidone  for  the  amide  family  ‐‐ were  applied  in  reverse  transcriptase activity assays (Fig. 2, Tables 1,2).   The RT activity decreased with increasing temperature (Fig. 2 (B,D)). At 76oC (Fig.  2D), SFM4‐6 lost its RT activity whereas L‐5‐2‐F01‐RT1 was still RT active. Among all the  tested enzymes, L‐5‐2‐F01‐RT1 provided RT activity which increased the most in cosolvents  ‐‐ almost 20x in 20% BD at 68oC. Fig. 2 (C) depicts how after the pre‐heat treatment (95oC  for 2 min), SFM4‐6 lost its entire RT activity even in the presence of 10% BD. Our mutants  maintained some level of RT activity.  Even reverse transcriptases with very limited catalytic  activity in water can become highly active in mixed aqueous‐organic media (Fig. 2),  underscoring the important role of organic cosolvents in inducing optimal RT activity,  alongside RT activity‐conferring mutations.   The highest RT  temperature  tested  for L‐5‐2‐F01‐RT1  (76oC) exceeds  the maximum  temperature for activity of almost any other RT reported to date, with the exception of an  engineered Tgo RT. Higher temperatures are not as useful for RNA due to chemical instability;  as such, RT in organic cosolvents and slightly lower temperatures is optimal for the majority  of  applications,  including  RNA‐seq.  The  specific  RT  activities  of  our  top  mutants  are  summarized in Table 1 with additional details reported in Table 2.   The following important observations are to be noted based on the data in Fig. 2:    ‐‐Thermostable RTs (SFM 4‐3, SFM 4‐6):  ‐1,4‐butanediol strongly activates SFM enzymes including at high concentrations around 10%  v/v, especially SFM 4‐6;  ‐3% pyrrolidone and sulfolane activate the SFM enzymes;  ‐The extent of such activation is generally greater at 68oC than at 55oC;    —Solvostable RTs (L‐5‐2‐F01‐RT1 and L‐5‐F01‐RT2):   ‐Enhancement of RT activity by cosolvents  is generally significantly greater  for solvostable  RTs than for RTs that are only thermostable and not solvostable;  38    ‐Almost 20x activation L5‐RT1 is possible at 68oC (by 20% BD) and almost 10x activation of L5‐ RT2 is possible at 68oC (by 20% TMSO). 20% TMSO activates L5‐RT2 at 55oC by almost 14x;   ‐The maximum activations by 2‐pyrrolidone and for sulfolane are also much higher for L5‐RT1  at 68oC vs 55oC;  ‐While activities at 55oC in the absence of cosolvent are generally higher than at 68oC, in the  presence of cosolvent due  to  the greater extent of activation at higher  temperatures, RT  activities  at  68oC  can  routinely  exceed  those  at  55oC  in  the  absence  of  cosolvent  by  a  significant margin – thus enabling the use of higher RT activities together with reduced RNA  secondary structure.     In addition, we  found  that  the RT activity of all engineered polymerases  improved  dramatically at 0.1x the template concentration used in steady state RT activity assays (Fig.  3A) ‐‐ a condition relevant to cDNA synthesis from mRNA using gene‐specific primers ‐‐ with  N‐7‐3‐B07‐RT and L‐5‐2‐F01‐RT2 displaying activity nearly as high as L‐5‐2‐F01‐RT1.  We note  that RT activity at <= 50oC (e.g. 48oC for Protoscript II) is almost entirely unaffected (data not  shown) by cosolvent (5% BD); thus only highly thermostable RTs can fully exploit cosolvent‐ induced activity enhancement.    RT‐qPCR assay:  The most solvent‐resistant polymerases displaying RT activity, L‐5‐2‐F01‐RT1  and N‐7‐3‐B07‐RT, were  tested  in  RT‐qPCR  assays  on  a  100  base GC‐rich  RNA  fragment  (human gene BEGAIN, 75% GC; Fig. 4) and compared  to SFM4‐6. First, RT  reactions were  carried out with the respective enzymes  in the presence or absence of BD and second, to  directly compare the RT activities, the qPCRs were all carried out by L‐5‐2‐F01 in the presence  of 7% BD (Fig. 5 (I,K)). In 0% or 7% BD, the RT activity of SFM4‐6 was limited or undetectable  on this template, while the RT activities of L‐5‐2‐F01‐RT1 and N‐7‐3‐B07‐RT were enhanced  in 7% BD (Cq ~15; Fig. 5I, lanes 4&6) compared to 0% BD (Cq ~20; Fig. 5I, lanes 3&5). Since  the expected PCR product contains 75% GC, the TM is around 90°C (Fig. 5K, peaks 4&6), while  the non‐specific bands generated by SFM4‐6 led to lower temperature melt peaks in both 0%  BD and 7% BD (Fig. 5K, peaks 1&2). A comparable RT‐qPCR assay by the top mutant, L‐5‐2‐ 39    F01‐RT1, was also  tested against a commercial RT enzyme, ProtoScript  II  (a  thermostable  MMLV variant, like several modern RTs), at 55°C and at much higher temperature, 68°C. Fig.  5 (J,L) (band intensities, Cq values and melt peaks) clearly show that RT activity of L‐5‐2‐F01‐ RT1 with 7% BD is comparable (albeit with greater specificity, see Table 2) to ProtoScript II at  55°C (Cq ~13; lanes 7&8), but while L‐5‐2‐F01‐RT1 still retained RT activity at 68°C (Cq ~14;  lane 9), ProtoScript  II product was undetectable  (Table 2)  and  led  to  lower  temperature  nonspecific melt peaks  (Cq ~31;  lane 10). This  result demonstrates  the  advantage of  the  mutant L‐5‐2‐F01‐RT1 compared to a state‐of‐the‐art thermostable MMLV enzyme in reverse  transcription of a high GC gene RNA at much higher temperature while also exploiting the  advantages of cosolvent‐induced enzyme upregulation and secondary structure reduction.   The results in Fig. 5, Fig. 2 and Table 2 demonstrate for several tested thermostable  reverse transcriptases (L‐5‐2‐F01‐RT1, L‐5‐2‐F01‐RT2, SFM4‐6, SFM4‐3…), based on variants  of the thermostable Taq polymerase) that these enzymes not only display resistance in their  RT activity to organic cosolvents (including in the context of RT‐PCR),  but also show for the  first time that the activity of highly thermostable RTs can be  improved by the presence of  organic  cosolvents, with  the RT  activity of  L‐5‐2‐F01‐RT1  increasing  almost  2000%  in  the  presence of 20% BD (Fig. 2) (and even highly thermostable RTs which are not engineered for  solvostability, like SFM4‐6, also display solvophilicity in their RT activity).   Although the RT activity of L‐5‐2‐F01‐RT1 in water drops between 55oC and 68oC, due  to the rate enhancement  in BD that  increases with temperature the activity at 68oC  in the  presence of 10‐20% BD is far higher than that at 55oC in 0% BD, and moreover, is even higher  than that at 55oC in the presence of 10% BD (Fig. 2). The results in Fig. 5, Fig. 2 and Table 2  demonstrate that reverse transcriptases engineered for function in organic cosolvents (using  methods described in subsequent sections) display activity up to nearly 80oC in both aqueous  and mixed aqueous‐organic media, and even more significant enhancements of RT activity in  organic media compared to aqueous media. By contrast, almost none of the current state‐ of‐art RT enzymes display activity above 70oC even in aqueous media.  40    Thus,  with  additional  synthetically  introduced  mutations,  solvostable  and  thermostable DNA polymerases are also solvophilic and thermostable reverse transcriptases.  These  engineered enzymes were also successfully applied in RT‐PCR experiments as the RT  enzyme  in  first step  to produce cDNA and as  the DNA‐dependent DNA polymerase  in  the  second  step  to  complete  the amplification    (Fig. 5  (I‐L)). A  fragment of  the GC‐rich gene  BEGAIN  (75% GC), which  is  highly  structured  (Fig.  4), was  chosen  for  RT‐qPCR  in mixed  aqueous‐organic media in order to compare the efficiencies of our engineered polymerases  in RT‐PCR of such templates to those of others reported in the literature.  The results in Fig.  5  (I‐L)  show  that  the  L‐5‐2‐F01‐RT1 mutant  (which  is  also  engineered  for  solvostability)  conducts  reverse  transcription  of  this  template more  effectively  than  any  other  enzyme  tested. Consistent with the RT activity assay results in Fig. 2 and Table 2, the RT activities of  all thermostable RTs are significantly upregulated by 7% BD.   The  N‐7‐3‐B07‐RT  mutant  (also  an  engineered  solvostable  RT)  shows  reverse  transcription  of  BEGAIN  only  in  7%  BD.  Importantly,  SFM4‐6  cannot  carry  out  reverse  transcription of this structured GC‐rich template in the presence of 7% BD, even though its  activity on unstructured poly‐A  templates was upregulated by BD  (Table 1, Table 2)  and  despite the fact that its RT activity was optimized through saturation mutagenesis, unlike our  enzymes.  Thus the advantages of our engineered solvophilic reverse transcriptases – which  are  the  only  RTs  engineered  in  cosolvents  –  are  enhanced  for GC‐rich  template  reverse  transcription  in  the presence of  organic  cosolvents. Due  to  the  simultaneous benefits of  greatly  enhanced  activity  (instead  of  reduced  activity  at  high  temperatures),  reduced  secondary structure, and negligible effects of cosolvents on the chemical  integrity of RNA,  this  is a preferred means of reducing sequence bias  (compared to  increasing temperature  alone) that is likely to have widespread implications in RNA‐seq as well as RT‐PCR diagnostics,  and further demonstrates the importance of engineering solvostable DNA polymerases like  those reported herein for such reactions.   While the Stoffel fragment of Taq polymerase (which lacks the exonuclease domain)  has been reported to be more active and stable than full‐length enzyme, this is not always  41    the case in the presence of engineered mutations, and full‐length enzyme can importantly be  used  in  probe‐based  assays  like  TaqMan  assays.  Nonetheless,  such  fragment‐based  thermostable  reverse  transcriptases  (including  the  enzymes  SFM4‐3  and  SFM4‐6  studied  herein) are useful enzymes for organic solvent‐enhanced reverse transcription. In particular,  any of the engineered Taq polymerase‐based RTs studied herein can also be applied as the  corresponding Stoffel fragment.     Engineering of Solvophilic Reverse Transcriptases (RTs)  The  unanticipated  and  unprecedented  observations  of  thermostable  RT  enzyme  activity  upregulation  by  the  aforementioned  polar  organic  cosolvents  motivated  the  engineering of such enzymes for further enhanced function in mixed aqueous‐organic media.  This was achieved by the construction of highly diversified thermostable polymerase mutant  libraries wherein both RT and DNA‐dependent DNA polymerase activity in organic cosolvents  could  be  introduced  and/or  improved,  through  ultrahigh‐throughput  droplet‐based  selection, computational modeling and experimental screening and characterization. For this  purpose  and  proof  of  concept,  the  thermostable  polymerase  was  chosen  to  be  Taq  polymerase, but other thermostable polymerases may be used as well.     Selections were typically carried out using DNA‐dependent DNA polymerase activity  in  droplet‐based  PCR  reactions  because  of  the  comparative  simplicity  of  the  protocol  compared to direct selection for RT activity – including the ability to apply compartmentalized  self‐replication (CSR) of the polymerase gene – based on the underlying observations that a)  polymerase stability in mixed aqueous‐organic media is the same irrespective of whether the  activity  in question  is DNA‐dependent or RNA‐dependent DNA polymerase activity; and b)  the  native DNA‐dependent DNA  polymerase  catalytic  activity  in  the  presence  of  organic  solvents and at elevated  is a prerequisite  (though not sufficient)  for RT activity  in organic  media  as  well.  Subsequently,  the  enzymes  that  displayed  suitable  properties  in  mixed  aqueous‐organic media were subjected to additional mutagenesis guided by NGS data as well  42    as computational biophysics modeling  to  introduce RT activity  in  the presence of organic  media, and characterized for RT and RT‐PCR activity.    Polymerase  library  preparation,  microfluidic  droplet  encapsulation,  selection,  and  screening: We observed that wild type (WT) Taq polymerase (SEQ ID NO: 1) cannot amplify  GC‐rich  templates,  such  as  c‐Jun  (64%  GC),  in  the  absence  of  PCR‐enhancing  additives  (organic  cosolvents)  such  as  1,4‐butanediol  (BD).  However,  such  organic  cosolvents  deleteriously affect  the polymerase  itself. We used directed evolution and droplet‐based  selection to co‐evolve reverse transcriptases displaying both enhanced stability and activity  relative to Taq DNA polymerase in the presence of organic solvents.         In the initial library, we aimed to generate 3‐4 mutations per sequence by error prone  PCR (epPCR) to avoid any mutational overload. The epPCR mutant library was subjected to  compartmentalized  self‐replication  (CSR)  selection  in  the  presence  of  BD  at  elevated  temperatures. CSR  encapsulates polymerase‐expressing  cells within water‐in‐oil emulsion  droplets  and  challenges  these  polymerases  to  replicate  their  own  genes  via  PCR.  We  employed the microfluidic Dolomite µEncapsulator system to improve the monodispersity of  emulsion droplets. The Taq epPCR library was subjected to CSR selection in the presence of  5% BD. We pre‐treated the emulsions prior to CSR‐PCR at 95oC for 6 min to minimize the WT  activity  and  the  background. Under  this  condition,  the  activity  of  the WT  polymerase  is  negligible and cannot produce a CSR background signal. We established that a minimum of  16 PCR cycles are needed  for WT‐Taq polymerase  to show quantifiable amplification of a  shorter Taq gene fragment employed for screening. We screened several thousand individual  clones by real‐time PCR at lower denaturation temperature. We ranked the clones based on  their melt curve peak area. We observed a linear correlation between amount of dsDNA and  the peak area, thus concluding that the peak area is a good measure of the amount of PCR  product produced. Following screening, the mutations were confirmed by Sanger sequencing  (generation 1, round 1; Table 3).         Simultaneously, to identify the best combinations of mutations, the clones selected  from the first round of selection on the epPCR library were recombined by StEP PCR (shuffled  43    library) and subjected to increased selection pressure during CSR. First, we established a CSR‐ PCR  condition  sufficient  for  the  CSR  selection  in  the  presence  of  7%  BD  with  higher  denaturation temperatures.  We then ranked the clones based on melt‐curve peak area as  described above (Table 3). The screening positive clones were sequenced.  As shown in Table  3  and  Fig. 6, we  found  that  the mutations  are  scattered  in both  5’ ^3’ exonuclease  and  polymerase domains.         A  final method of diversity  generation was de novo  gene  synthesis of  sequences  (denoted SPC1‐9) containing several of the top mutants from the epPCR or StEP libraries. We  imposed  some  restrictions  on  the  selection  of  the  residue  combinations  such  as  surface  residues sufficiently away from each other, coupled to polymerase domain residues.   NGS‐guided CSR enrichment: We followed genotype redundancy as a function of CSR  round  by  NGS.  We  performed  seven  consecutive  rounds  of  CSR  on  the  epPCR  library  (generation 1) and five rounds on the shuffled library (generation 2). After the end of each  round, we analyzed  the  sequence diversity using NGS. We  found  that  the  frequencies of  certain unique amino acid mutations progressively increased across the CSR rounds and that  NGS  convergence  analysis  enabled  significant  reduction  in  screening  effort  (Table  4).  Convergence in terms of frequency occurred at the 7th round of enrichment for the epPCR  library (N‐7) and the 5th round of enrichment for the shuffled library (L‐5); we thus designated  these as the terminal libraries and carried out extensive screening on them. Our NGS data  show  that  in  the  epPCR  library,  the mutations  are  randomly  distributed,  but  after  CSR,  beneficial mutants are selected with high frequency, e.g., the initial frequency of F749I was  0.050 but  it culminated as the most frequent mutation (35.101) (Table 4A). Similar trends  were observed in the StEP libraries, e.g., amino acid position E434D has frequency 0.373 and  progressively increased to 13.091 at the end of 5th round (Table 4B). This variant was one of  the most frequent changes we observed after Sanger sequencing. Similarly, mutations E507K,  A608V,  F749I,  E742K were  seen  to  enrich  at  each  round  and were  present  in  the  final  screening.    44          We also observed that some amino acid mutants were carried over to the final round  but were absent in the initial epPCR library. This phenomenon can be easily identified in the  StEP  library. Some of  the mutants  in StEP  libraries acquired during enrichment CSR were  previously reported, such as R205K, E434D, A608V, and E507K. Some of the mutations were  enriched in the later rounds of CSR, e.g., F749I. Possibly, these mutations arose due to the  error‐prone nature of the Taq polymerase but enriched in the library due to their fitness to  counter the selection conditions.        To validate our NGS data toward the goal of establishing NGS‐based CSR convergence  analysis as a methodology for assessing the optimal number of CSR rounds, we cloned and  transformed the library at the end of the 1st, 3rd, 5th, and 7th CSR rounds for screening.  We  randomly selected ~250 clones and subjected them to screening for this analysis. We not only  observed a near  linear correspondence between NGS frequency and appearance of better  performing clones ‐‐ i.e., mutants which had the highest NGS frequencies in the 5th or 7th CSR  rounds appeared most frequently in the screening of the libraries ‐‐ but we also found that  these mutants had higher screening scores. We also compared the performance of 1st round  CSR hits to the N‐7th round top clones. Comparative data are presented in Table 3.  Top clones  from enriched CSR have better performance than the 1st round clones. These clones (epPCR‐ 7th CSR) not only performed better in 5% BD, but at least two of these clones (N‐7‐3‐C08, and  N‐7‐2‐E02)  also  showed  improvement  in  PCR  activity  in  7%  BD  at  higher  denaturation  temperature (98.3oC).    FACS‐based selection and secondary screening: As a further means of quantification of the  superiority of performance of polymerase variants over wild type on a common template, we  used  the microfluidic µEncapsulator  (Dolomite Microfluidics)  to prepare double emulsion  (DE) droplets containing selected clones followed by sorting based on PCR efficiency using  FACS.  This  enrichment  experiment was  designed  to measure,  using  highly monodisperse  droplets with  a  consistent  number  of  cells  per  droplet,  the  extent  to which  the  higher  performing polymerase clones enrich with respect to WT background, which is present in a  45    vast majority. As an example, we mixed 90% WT polymerase expressing cells with 10% SPC9  Taq  variant.  The WT‐Taq  polymerase  has  low  activity  in  the  presence  of  5%  butanediol  whereas  SPC9  performs  better  under  the  same  reaction  conditions. We  prepared  both  primary  and double emulsions using Dolomite’s µEncapsulator  system. Primary emulsion  image data shows that the droplet populations are monodisperse with total mean diameter  20±1.2 µm (Fig. 7A) whereas we recorded 30±3.4 µm for double emulsion (Fig. 7C). During  sorting, we captured approximately 1.6 million DE droplets, out of which approximately 3‐4%  droplets were sorted, based on SYBR Green I intensity, to identify SYBRHIGH, SYBRMEDIUM and  SYBRLOW populations. Based on number of events of sorted samples, we  recovered 72.9%  SYBRHIGH  whereas  23.8%  and  1.1%  SYBRMEDIUM  and  SYBRLOW,  respectively.  The  data  are  presented  in  Fig.  7(F‐J).  SYBRMEDIUM  corresponds  to  negative  control  whereas  SYBRLOW  represents empty droplets. We sequenced 24 clones and found that eight clones had WT ‐ Taq  genotype  (33%),  while  15  clones  had  SPC9  genotype  (64%),  corresponding  to  an  enrichment of ~18 fold (1:9 ^2:1) of the SPC9 mutant over WT‐Taq. FACS was also used as  alternative to CSR selection for selection of active clones from libraries, as shown in Fig. 7K  for the L5 library.  We identified mutants scattered across both the 5’ ^3’ exonuclease and polymerase  domains (Fig. 6). Many of the amino acid sites identified here are novel, and the role of F73  and E434 in the context of organic solvent resistance (including enzyme activity) also remains  to be elucidated. We note that several identified mutants with improved stability contained  mutations  to  lysine  (e.g.,  E832K);  such mutations  have  been  reported  to  often  improve  protein  stability  through  entropic  stabilization.  The  mutants  that  are  present  in  the  polymerase domain tend to cluster in and around the substrate binding site ‐ e.g., V586 may  be implicated in DNA binding in association with E742 and A743. The residue S612 belongs  to Motif A (605‐617) of the polymerase domain. In general Motif A residues are mutatable,  except for residue D610 which is part of the catalytic triad. Residue F667 can tolerate only  tyrosine substitution and has been implicated in nucleotide substrate discrimination enabling  the polymerase  to  incorporate dNTPs.  Interestingly, we  identified mutants of F749 which  46    reside near the O and O1 helices of the fingers subdomain and indirectly affect the function  of the enzyme.         We can hence divide our mutants into two groups: 1) those present in the 5’ ^3’ exo  domain; and 2) those belonging to the polymerase domain. Those in category 1) such as P10,  L30, A54, A61, F73, T186 etc.  (Table 3) primarily affect  the stability, as deletion of  the N‐ terminal  1‐288  amino  acids  (as  in  the  Stoffel  fragment)  leads  to  a more  thermostable  polymerase domain. In this regard, we note that whereas the Stoffel fragment was reported  to  have  a  half‐life  approximately  2x  that  of  WT  at  97.5oC  in  water,  our  engineered  polymerases displayed up to 100x higher half‐life in the presence of 5% BD at 97.5oC (Table  5B).  Even  in  the  exo‐domain,  the  stability  hotspot  is  not  defined. We  propose  that  our  mutants are part of a growing  list of the residue positions contributing to stability toward  cosolvent  concentration,  elevated  temperature,  or  both. On  the  other  hand, mutants  in  category 2) are often centered around the substrate binding pocket (Fig. 6). Residues in this  domain may play roles in both the stability of the polymerase and in catalysis through DNA  binding, dNTP discrimination etc. Reetz and co‐workers have shown that although a positive  correlation exists between thermostability and the organic solvent resistance of the  lipase   activity, the phenomena are distinct.     Protein  purification  and  primer  extension  activity: We  added N‐terminal His‐tag  to  the  screening positive mutants and purified the proteins to homogeneity. We determined the  polymerase activities of  the WT and  its mutant derivatives using  self‐annealing  template‐ primer (SATP) at 72oC. We found that the specific activities of the mutants in aqueous buffer  ranged from 12‐210 mU/ng (Table 12). The wild‐type specific activity in aqueous buffer was  119 mU/ng. In most cases we observed a loss of DNA‐dependent DNA polymerase activity in  5% BD at 72oC consistent with prior studies on wild type enzyme activity in BD, but for the  engineered mutants these reductions were generally moderate as compared to the WT. One  of the synthesized clones, SPC9, fully retained its activity in 5% cosolvent, demonstrating the  effectiveness of synthetic design. Overall, the reduction in DNA‐dependent DNA polymerase  47    activity  induced by organic cosolvents contrasts  starkly with  the enhancement of  reverse  transcriptase activity induced by the same cosolvents (Tables 1,2; Fig. 2).     Introduction  of  reverse  transcriptase  activity  into  engineered  solvostable  DNA  polymerases: We  synthetically  introduced mutations  in  our  best  performing mutants  to  make them RT‐active. Mutation A608V was previously  identified as being conducive to RT  activity, often in conjunction with F749 mutation. We observed (Table 3) A608V appearing  together with  E742K  and  F749I  in more  than  one  top  screened  clone  from  the  terminal  selection round of the L library (L‐5‐3‐D10 and L‐5‐3‐H08). The latter two mutations (often  coupled) were also among the fastest enriching mutations observed in the NGS data (Table  4). Therefore, for the purpose of generating reverse transcriptases we synthetically added  E742K  to  top  clones  L‐5‐2‐F01, which  also  contained  A608V,  and N‐7‐3‐B07, which  also  contained F749I. We also added M747K, which we observed through simulations to improve  RNA  binding  (Fig.  8),  together  with  E742K  to  these  clones  to  produce  the  reverse  transcriptases L‐5‐2‐F01‐RT1 and N‐7‐3‐B07‐RT. Separately, we added  the single mutation  D732N, which was reported to confer RT activity  in  isolation, to the top clone L‐5‐2‐F01 to  produce reverse transcriptase L‐5‐2‐F01‐RT2 (Table 1).       Polymerase Characterization  Denaturation kinetics assessment: For stability, we used two independent methods to assess  the thermal tolerance of the enzymes: 1) we calculated the t1/2 of the enzymes (denaturation  kinetics)  in an activity‐based assay; and 2) we profiled thermal denaturation temperatures  (TM) using nanoDSF. We carried out  t1/2 determination with His‐Tag enzymes  (WT and  its  mutant derivatives) at  two different  temperatures, 95oC and 97.5oC,  in  the presence and  absence of 5% BD by method 1. We found that the t1/2 of the WT in absence of organic solvent  is  about 41 min  at 95oC  (Table 5B) which  is  close  to  the  values  reported previously. We  observed  a  sharp  decrease  in  t1/2  of  the WT  in  presence  of  organic  solvent  at  both  the  48    temperatures tested i.e., around 6.5‐fold at 95oC and 4.5‐fold at 97.5oC. On the other hand,  the mutants displayed up to three‐fold higher t1/2 than WT at 95oC, in absence of BD, whereas  up to five‐fold change was recorded in the presence of BD (Table 5B).   Experimental  and  computational  protein  melting  thermodynamics:  Although  the  thermostability assay described above is well‐established and widely accepted to assess the  thermal  tolerance of polymerases,  it  is a kinetic denaturation assay  that depends on  the  primer extension ability of the enzyme. In order to assess the effect of the organic solvent on  the  thermodynamics  of  polymerase  stability, we  also  assayed  the  thermal  stability  using  nanoDSF. We determined the TM of the WT and mutant polymerases (Table 6). The data show  that the Taq polymerase unfolds in a two‐step fashion. Our data are in agreement with the  two‐domain unfolding pattern  reported previously  for Taq polymerases, where  the 5’ ^3’  exonuclease domain unfolds at lower temperature than the polymerase domain. As shown  in Table 6, the TMs of the engineered polymerases are overall higher than that of the WT, and  the margins  of  improvement  in  5%  BD  are  highly  significant.  Therefore,  based  on  two  independent thermostability assays, we conclude that evolved polymerases have improved  thermostability especially  in cosolvents.  In particular, the protein melting temperatures of  four thermostable and solvostable reverse transcriptases were also measured by nanoDSF  (Table  6A).  The  data  demonstrate  that  the  enzymes  not  specifically  engineered  for  solvostability  and  activity  in  organic  cosolvents  display  significantly  lower  melting  temperatures — especially  in  the presence of organic cosolvents —  than  those  that were  engineered  for  function  in mixed aqueous‐organic media. The  introduction of RT activity‐ inducing mutations is also observed in some cases to result in a small reduction in protein Tm  as well (Table 6A).  Using the MAESTROweb software, we predicted the functional consequence of the  mutations on protein dynamics and stability, as shown in  Table 7, which contains mutations  determined  to  have  enhanced  thermostability  and/or  specific  activity  in  1,4‐butanediol.  Results with FoldX software  were generally consistent (data not shown).  To assess our ability  to  guide  the  design  of  synthetic  solvostable  polymerases  via  computational  free  energy  49    calculations, we studied correlations between experimental TM and in silico  ^ ^G.  Since these  computational methods for folding free energy calculation assume a single unfolding step,  whereas the polymerase domains unfold in separate steps, two methods for the evaluation  of the predictive value of calculations were applied, to engineered polymerases from the final  rounds of selection (Table 7) for which the polymerase TMs were measured experimentally  (Table 6).  In method 1), the  ^ ^G was calculated for all mutations  in a sequence and then  compared to the TM of the polymerase domain, since the latter TMs are much closer to the  temperatures applied in the PCR denaturation step than the TMs of the exonuclease domain  are. In method 2), the  ^ ^G was calculated only for the mutations in the polymerase domain  under  the approximation  that  this provides an estimate  for  the  change  in  free energy of  folding  for  the  polymerase  domain.  The  Pearson  correlation  between  experiment  and  computation in method 1) was ‐0.57, whereas in method 2) it was ‐0.37 (both favorable). All  but one  ^ ^G  computed using method 2) was predicted  to be  stabilizing,  consistent with  experimental results. For those sequences where method 1) predicted positive  ^ ^Gs, two  predictions  had  statistically  insignificant  positive  ^ ^G  values  (0.06  and  0.07  kJ/mol  respectively,  Table  7),  and  two  such mutants  (N‐7‐1‐F06  and N‐7‐3‐B07) were  observed  experimentally to destabilize the exodomain (Table 6). For the latter two mutants, we also  calculated the  ^ ^G of the exodomain mutations only and consistently found highly positive  (unfavorable)  ^ ^Gs  for  that  domain  (2.92  kJ/mol  and  2.00  kJ/mol,  respectively).  The  correlation  between  experimentally  measured  exodomain  TMs  and  predicted  ^ ^Gs  for  exodomain  mutations  only  was  also  favorable  at  ‐0.42.  Thus  like  the  binding  affinity  calculations,  folding  free energy calculations display good predictive accuracy and can be  employed for rational library design.  Our stability data demonstrate that the selected mutations can affect thermostability  quite differently in the absence and presence of cosolvent (Table 5B). One of the most heat‐ resistant clones, L‐1‐17‐A09, which has mutations only  in  the 5’ ^3’ exonuclease domain,  does not perform well in the presence of 5% BD. On the other hand, the clones which have  moderate thermostability in 0% BD but contain mutations in the substrate binding area such  50    as L‐1‐14‐H10 performed better in presence of 5% BD. We observed this trend for many of  the mutant polymerases.   We note that since reverse transcriptase activity of such enzymes is upregulated by  organic cosolvents, the unfolding temperature of a polymerase sets an upper bound on the  optimal temperature for RT activity. For example, from Table 6 it is observed that in 5% BD  the melting temperature of the exodomain of Taq polymerases is around 80oC, whereas the  melting temperature of the polymerase domain is generally much higher. This is consistent  with the observation of highly effective RT activity at close to 80oC (Fig. 2).    Ligand binding affinity evaluation by MM‐GB(PB)SA:  The impact of mutations on binding  affinity to ligand (here, RNA or DNA) was evaluated by MM‐GB(PB)SA. It was understood that  mutations in close proximity to RNA or DNA are likely to influence ligand binding, hence all  mutations in screened clones were first screened in‐silico for their proximity to RNA or DNA.  Five mutations were  identified  that  had  <6  Å  distance  from DNA/RNA  ‐‐  S515N,  E507K,  A516G, and E742K, and M747K. We prioritized four mutations – E742K and M747K for RNA,  and S515N and E507K for DNA – based on proximity and nature of amino acid change.   The binding affinity energy evaluation for RNA was performed on E742K and M747K  mutant complexes along with reference complex for relative comparison. The binding affinity  difference calculated using MM‐GBSA was determined to be ‐52.86 kcal/mol for the E742K  mutation.  The binding affinity difference calculated using MM‐GBSA was determined to be ‐ 56.19 kcal/mole for the M747K mutation.  Within the minimized M747K mutant complex, the  lysine  (K)  residue was observed  to be  involved  in  forming  five hydrogen bonds  (hydrogen  bond cut‐off: 2.7‐3.3 Å) and one salt bridge with the  bound RNA ligand (Fig. 8B). In contrast,  within the minimized reference complex, no hydrogen bond could be visualized between the  reference Methionine (M) and the bound RNA ligand. In the minimized E742K complex, the  mutation Lysine (K) was observed to form one hydrogen bond with the bound RNA, compared  to no hydrogen bond for the native E.  51    M742K  is  located near the active site and  forms a salt bridge with the nucleic acid  backbone. The  calculated binding  affinity  energy  values  for mutations M747K  and  E742K  obtained by molecular dynamics and MM‐GB(PB)SA, which were improved compared to WT,  suggested  that  the  in‐silico evaluation was  in good agreement with wet‐lab  results, given  these mutations are found to improve RT activity by orders of magnitude. Along with M742K  and E742K, A608V is one of the most potent RT activity‐conferring mutations and near the  active site, adjacent to D610 which binds to Mg2+ ions. This may explain the particularly high  RT activity of L‐5‐2‐F01‐RT1, which contains both A608V and E742K mutations. Also, some of  the above mutations identified from our screens have been selected for solvent compatibility  in addition to their functions in polymerase activity; thus they may facilitate solvophilicity of  the resulting reverse transcriptases along with other novel mutations identified.    The binding affinity energy evaluation for DNA was performed on E507K and S515N  mutant complexes along with reference complex for relative comparison. The binding affinity  difference calculated using MM‐GBSA was determined to be ‐62.80 kcal/mol for the E507K  mutation.  The binding affinity difference calculated using MM‐GBSA was determined to be ‐ 22.71 kcal/mole for the S515N mutation.   Within the minimized S515N mutant complex, the  asparagine  (N)  residue  was  observed  to  be  involved  in  forming  two  hydrogen  bonds  (hydrogen bond cut‐off: 2.7‐3.3 Å) with the bound DNA ligand (Fig. 8C). In contrast, within  the minimized reference complex, only one hydrogen bond could be visualized between the  reference  Serine  (S)  and  the  bound  DNA  ligand.  In  the minimized  E507K  complex,  the  mutation Lysine  (K) was observed to  form a salt bridge and  five hydrogen bonds with the  bound DNA, compared to one hydrogen bond for the native E.  We  identified  mutant  S515N  that  has  strong  interactions  with  the  nucleic  acid  substrate  (Fig. 8C). The calculated binding affinity energy values  for mutations S515N and  E507K obtained by molecular dynamics and MM‐GB(PB)SA, which were improved compared  to WT, suggested that the in‐silico evaluation was in good agreement with wet‐lab results,  given a) the effect of E507K results in orders of magnitude improvement in the polymerase‐ DNA dissociation constant;  b) the mutation S515N was obtained in our mutant N‐7‐4‐D06  52    clone, a hit of the terminal selection round (N1‐7th) with among the highest specific activities  in  the  presence  of  5%  BD.  These  results  indicate  that  computational  binding  affinity  calculations can assist in the rational design of libraries and synthetic sequences that include  active site mutations.  (Wild type binding affinity difference for RNA vs DNA in the same MM‐GBSA units was  determined to be +278.37 kcal/mol.)      GC bias evaluation using NGS:  We applied the Illumina target enrichment protocol to genes  of widely varying GC content from genomic DNA.  As shown in Fig. 9, without BD, there was  no  effect  of  the  engineered  enzymes  N‐7‐3‐B07  and  N‐7‐3‐C08  on  increasing  the mean  coverage of GC‐rich genes B3GT6 and CDN1C relative to the  lower GC content genes EGFR  and KRAS (Fig. 9A), with the bias being consistent with the Tms depicted in Fig. 9C. However,  in the presence of 5% BD, while amplification efficiency of several of the genes from genomic  DNA  was  significantly  compromised  for WT  (data  not  shown),  the  engineered  enzymes  significantly  increased  the coverage of  the GC‐rich genes B3GT6 and CDN1C  (Fig. 9B)  in a  manner consistent with the TM reduction in 5% BD (Fig. 9C). This shows the effect of cosolvent  in reducing GC bias when applied with the engineered polymerases. The significant reduction  in GC bias is consistent with the similar Cqs reported in Fig. 12E for these genes using N‐7‐3‐ B07.      We further evaluated the GC bias of NGS target enrichment by our two best‐performing  mutants,  L‐5‐2‐F01  and  N‐7‐3‐B07,  and  compared  with  the  GC  bias  of  WT  under  high  denaturation temperature conditions using an equimolar mixture of plasmid DNA along with  gene specific FWD and REV primers corresponding to several of the aforementioned GC‐rich  genes. GC‐rich templates (plasmid clones) were PCR amplified together and the purified PCR  products were analyzed by NGS to see the frequency of each gene in the PCR pool (Table 8,  Fig. 10). A concentration of 4% BD was added in the PCR pool when WT enzyme was used  since  there was no  template amplification with WT over 5% BD under high denaturation  temperature conditions. However, a concentration of 10% BD was added in the PCR reactions  53    when  L‐5‐2‐F01 or N‐7‐3‐B07 were used  since as demonstrated  in Fig. 5,  L‐5‐2‐F01  could  amplify a number of GC‐rich genes under these conditions. As shown in Table 8A, WT had  difficulties (lower frequency) in amplifying the high GC genes (BEGAIN – the RNA for which  was also very efficiently reverse transcribed by solvophilic reverse transcriptases, DACT3 and  PO3F3), whereas both engineered mutants were able  to amplify  the  three high GC genes  much better (higher frequency) than the WT. The higher frequencies of these genes in the  PCR pool show that both engineered enzymes have the ability to lower the GC bias during  amplification of GC‐rich templates in applications including NGS. In a related experiment with  NGS target enrichment of just the c‐Jun and Taq genes (Table 8B), which have TMs differing  by several degrees (Fig. 10C) due to a 7% difference in max GC content (Fig. 11), N‐7‐3‐B07  achieves several fold lower (almost negligible) bias than the WT polymerase. The much lower  GC bias in NGS target enrichment for the engineered polymerases is consistent with the much  smaller difference in Cqs for plasmid templates of differing GC content for N‐7‐3‐B07 relative  to WT (Fig. 12D).      It  is well‐accepted that GC content  is the primary cause of sequence bias  in NGS target  enrichment by RT‐PCR  (in  the case of RNA  targets where  the sequencing  is referred  to as  RNA‐Seq) or PCR (for DNA targets)  . Most available methods for addressing sequence bias  correct  for  bias  computationally.  Use  of  organic  cosolvents  with  highly  thermostable  (solvophilic) RTs and  solvostable DNA‐dependent DNA polymerases is noteworthy in that it  corrects for GC bias chemically.  Since it is not possible to achieve 100% DNA denaturation  for many GC‐rich genes in water regardless of temperature, use of engineered polymerases  (including  thermostable  and  preferably  highly  solvophilic  RTs  and  solvostable  DNA‐ dependent DNA polymerases)  in the presence of cosolvents  is the preferred approach  for  reduction of GC bias  in NGS target enrichment using RT‐PCR protocols. We employed two  experimental methods, four mutants and a number of GC‐rich genes and showed a dramatic  reduction  in GC bias through the use of our engineered polymerases and mixed aqueous‐ organic media (Fig. 9, Table 8 and Fig. 10). A polymerase’s ability to reduce GC bias in NGS  target enrichment  is more  important  than high  fidelity, due  to error correction by unqiue  54    molecular identifiers (UMIs). While molecular barcoding through UMIs (which can added to  either RNA or DNA templates) is helpful for mitigating the effects of sequence bias by allowing  digital counting of the frequencies of nucleic acid sequences present prior to amplification,  without chemical bias correction sequence copy numbers can be incorrectly estimated by up  to two orders of magnitude.  Solvostable DNA polymerases reduce copy number estimation  errors by orders of magnitude (Fig. 9, Table 8), and hence are expected to largely eliminate  sequence bias when applied in conjunction with UMIs in genome sequencing applications.            Highly solvophilic RNA‐dependent DNA polymerases L‐5‐2‐F01‐RT1 and N‐7‐3‐B07‐RT,  which can be combined with solvostable DNA‐dependent DNA polymerases L‐5‐2‐F01 and N‐ 7‐3‐B07, display the ability to enrich targets for NGS sequencing / RNA‐Seq with dramatically  reduced  bias  and  to  amplify  hitherto  intractable  genes.  For  example,  their  ability  to  synthesize and amplify cDNA from GC‐rich RNA like BEGAIN with much higher efficiency (Fig.  5I‐L; Table 2) and the significantly lower sequencing bias against BEGAIN in NGS sequencing  (Fig.  10;  Table  8)  demonstrate  the  significant  utility  of  such  enzymes  and  polar  organic  cosolvents in reducing sequence bias in RNA sequencing (RNA‐seq).     PCR efficiency assays: Cq values obtained in a real‐time PCR assay were used as a measure  of PCR efficiency since they are unaffected by the choice of the total number of PCR cycles.   A mutant in the presence of cosolvent that has the same or lower Cq value compared to the  WT will  be  a  better‐performing  variant. Nineteen  variants  from  the  early  rounds  of  CSR  (round 4 or earlier) that have lower Cq values in the presence of 5% and or 7% BD than the  WT were  identified.  Representative  qPCR  traces  are  shown  in  Fig.  12A.  The  synthesized  polymerase clones SPC3, 4, 5 and 9 were able to tolerate up to 7% BD and were among the  best performing mutants from the early rounds.       For a GC‐rich template, c‐Jun, qPCR was carried out for early round mutants with increasing  concentrations  of  BD  (Fig.  12),  since  both  qPCR  and  the  desired  property  of  reverse  transcription in such media benefit from solvent resistance. The WT enzyme and the mutants  were not able to amplify c‐Jun template at 0% BD (Cq values were close to the end of the  55    total number of cycles). In the case of the WT enzyme, lower Cq values were seen up to 4‐5%  BD; however, Cq values with some earlier round mutants were high beyond 5% BD (Fig. 12B)  whereas some later round mutants were tolerant up to 7‐8% BD (Fig. 12C), indicating that  mutants  were  more  tolerant  to  BD.  Representative  data  are  presented  in  Table  9,  demonstrating further improvements in polymerases derived from later rounds compared to  WT. Cq values showed all engineered mutants had much higher BD tolerance than the WT  especially on the GC‐rich c‐Jun template with higher initial temperature treatment condition  (Table 9).      Fig. 12D directly compares the dependence of Cq on GC content in the presence of 4% BD  for WT and engineered polymerase N‐7‐3‐B07. N‐7‐3‐B07 showed very similar Cqs for Taq  and  c‐Jun  templates,  whereas  WT  did  not.  Additionally,  three  therapeutically  relevant  templates (Fig. 12E) were used to assess the dependence of Cq on GC content in the presence  of 5% BD with two of our high‐performing mutants (N‐7‐3‐B07 and L‐5‐2‐F01). The selected  mutants can amplify highly GC‐rich templates (CDN1C 78%) with very similar efficiencies (Cq)  as GC‐poor templates (EGFR 60% and KRAS 40%), whereas WT cannot.       To  test  the  efficacy  and  the  tolerance  limit  of  the  engineered  mutant  polymerases  (solvophilic reverse transcriptases and/or solvostable DNA polymerases) for cosolvents from  other polar organic compound families  in (RT‐)PCR, the qPCR assays were carried out with  one  of  the  best  performing  mutants,  L‐5‐2‐F01  (related  to  the  solvophilic  reverse  transcriptase L‐5‐2‐F01‐RT1)  in the presence of different concentrations of potent cosolvents  2‐pyrrolidone  (amide  family)  or  sulfolane  (sulfone  family)  (Table  10). WT  barely  showed  amplification of GC‐rich  c‐Jun  template  in  the presence of 2‐pyrrolidone or  sulfolane  (Cq  values were  close  to  the  cycle  threshold), whereas  L‐5‐2‐F01 was  found  to  have  higher  tolerance to both cosolvents (about 5% for 2‐pyrrolidone and about 8% for sulfolane in PCR,  representing enhancements of at least 7‐10 fold in maximum tolerated concentration). L‐5‐ 2‐F01‐RT1  (Table 1) has even higher DNA‐dependent DNA polymerase activity  than L‐5‐2‐ F01, as well as significant  reverse  transcriptase activity. Moreover, given  its solvophilicity,  56    reverse transcription with this enzyme  is possible at even higher cosolvent concentrations  than the maximum concentrations compatible with PCR (Fig. 2; Table 1).           In summary, we assessed the PCR efficiency based on Cq values in non‐optimized buffer in  a  limited  number  of  16  PCR  cycles  and  even  from  early  CSR  rounds  identified  nineteen  mutants which showed better efficiency than the wild type enzyme, in order to assess the  benefits of the solvostabilizing mutations  in the context of applications  including RT‐qPCR.  We demonstrated that some of our mutants can efficiently amplify the c‐Jun template ‐‐ ‐‐ a  template which  cannot  be  amplified  by  Taq  polymerase  in  the  absence  of  BD  ‐‐  in  the  presence of up to 10% BD (Fig. 12C and Table 9). Overall, the results on GC‐rich template  amplification (Figs. 5,  10, and Table 13) demonstrate that PCR using WT cannot be optimized  to amplify many GC‐rich genes, whereas the reported engineered polymerases are capable  of  amplifying  templates  of  nearly  any  GC  content.  Regardless  of  the  denaturation  temperature used, the much greater  inhibitory effect of cosolvent on WT enzyme activity  limits  the  maximum  %  BD  that  can  be  used.  In  contrast,  the  engineered  polymerases  overcome these limitations that prohibit robust GC‐rich template amplification.         To deconstruct the net effect of BD on amplification by our polymerase variants, we first  determined the reduction of DNA template Tm as a function of BD concentration. This analysis  also has implications for RT‐PCR using solvophilic RTs in the presence of the cosolvent(s). We  amplified the c‐Jun template. The average theoretical %GC was determined to be about 64%,  but some regions were over 70% GC (Fig. 13A). We added BD ranging from 0‐10% and ran  melt‐curve  cycles.  We  found  a  linear  correspondence  between  BD  concentration  and  reduction in DNA melting temperature (Tm). The melt curve traces are shown in Fig. 13B. The  slope of the plot (dTm/[BD]) is ‐5.9 K/M (Fig. 13C), which is within the range of the previously  reported  value  for  1,4‐butanediol.  Furthermore,  the  protein melting  TMs  of  the WT  and  mutant  polymerases  respond  to  BD  concentration  negatively  (Table  6)  with  a  linear  relationship and the % enzyme denatured  is displayed for several mutants  in 5% BD  in Fig.  13D. In general, the melting temperature of the WT‐Taq polymerase decreases more per unit  57    BD concentration, compared  to  the mutants, consistent with  the  fact  that  the engineered  polymerases  resist  the  denaturation  effect  of  BD.  Enzyme  activity  data  at  0  and  5%  BD,  demonstrate  differential  rates  of  activity  loss.  Fig.  13E  depicts  the  net  effect  of  these  properties on Cq values as a function of BD concentration and the concentrations at which  maximal PCR efficiency  is achieved for each. The properties of the top hit clones (mutants  from N series 7th round, mutants from L series 5th round and synthetic sequences) with the  best performance  in terms of specific activity, thermostability, and/or PCR efficiency  in the  presence of 1,4‐butanediol are  summarized  in Table 1. Due  to  their  improved butanediol  organic  solvent‐tolerance  and  high  thermal  stability,  the  top  hit  clones  were  next  systematically evaluated  for  their ability  to  improve GC‐rich  template amplification and  to  reduce GC bias in next‐generation sequencing.    Nonlinear  (RT‐)PCR  amplification  dynamical models  relate  polymerase  activity  and  thermostability as well as nucleic acid secondary structure and duplex melting temperatures  to (RT‐)PCR product yield and Cq value. The proposed model can be used to predict the Cq  value as a function of cosolvent concentration, given the effects of cosolvent on each of these  three properties, and thus to identify the optimal cosolvent concentration for amplification  of a given template with a characterized polymerase enzyme. Furthermore, activity decline  (of DNA‐dependent DNA polymerases) and thermal denaturation, by cosolvent, increase the  minimum extension time which in turn decreases product yield. In particular, the cosolvent  concentration at which activity is extinguished or half‐life becomes negligible determines the  effective range of cosolvent concentrations because of the greater effect of the cosolvent on  the enzyme activity at those concentrations.  In order to determine the overall effect of BD  on c‐Jun PCR amplification, we plotted the values of Cq over a range of BD concentrations and  interpreted  the concentration of maximal efficiency  (minimal Cq) – which depends on  the  DNA template ‐‐ in terms of the competing effects of BD on DNA melting, polymerase activity  and  thermostability  (Fig. 13). The measured Tm of c‐Jun  (which was chosen  for  illustrative  purposes and not because  it was  the highest GC  content  template)  reported  in Fig. 13  is  58    ~92oC,  which  is  very  close  to  the  predicted  Tm  of  90.5oC  (Table  13).  For more  GC‐rich  sequences, due to the higher template Tm, the optimal cosolvent concentration is higher. As  shown in Fig. 13B with the measured DNA melting curves for c‐Jun, and the fact that the Tm  only reduces by <1oC/% BD (Fig. 13C), very little of the template DNA will be denatured at BD  concentrations below the optimal BD concentration for WT. Since we engineered both more  thermostable (Tables 5B, 6 and 7) and more active polymerases (Table 12), these enzymes  show better product yield (as measured by Cq, Fig. 13E) and tolerate a wider range of solvent  concentrations, which is consistent with the PCR model. BD concentrations above the optimal  concentration  reduced  polymerase  thermostability  and  activity  to  an  extent  that  did  not  compensate for further marginal improvements in DNA melting for this template.    GC‐rich template amplification with engineered polymerases: In addition to c‐Jun, a broad  set of GC‐rich templates from genomic DNA (Table 13) was PCR‐amplified with WT and one  engineered polymerase (L‐5‐2‐F01; Table 3), in the presence of BD.  Two types of PCR cycling  conditions (high and moderate denaturation temperature) were employed, with several BD  concentrations.    Fig.  5B  shows  that  even  under  high  denaturation  temperature, WT  is  incapable  of  amplifying  the  seven  GC‐rich  templates  even  in  the  presence  of  7%  BD.  Interestingly,  by  increasing  the  BD  concentration  to  10%  (Fig.  5D),  the  engineered  polymerase variant  is capable of amplifying all seven of the GC‐rich templates (with some  degree of nonspecificity for CD5R2 and DACT3, which have among the highest GC contents  at 64% average/88% max and 79% average/~100% max, respectively,  Table 13 and  Fig. 11).  With  the engineered polymerase under  these  conditions,  the BAIP3  template  (GC%: 64%  average/80% max) showed strong amplification, with only one nonspecific band, while KLF14  (GC%:72% average/90% max) showed significantly lower specificity (Table 13 and Fig. 11).         Finally,  we  compared  PCR  amplification  using  these  polymerases  under  lower  denaturation temperatures (Fig. 5 (E‐G)), where four highly GC‐rich templates were studied,  including DACT3 and KLF14 and CDN1C and PO3F3 (GC contents 77% average/ 98% max and  78% average/93% max, respectively). Under these conditions, KLF14 was strongly amplified  59    with  high  specificity  using  the  engineered  polymerase.  CDN1C  and  PO3F3  were  also  effectively amplified with high specificity.  DACT3, containing the highest max GC content of  all templates studied, could not be amplified under  lower denaturation temperatures. WT  can produce some amplification of only one out of four templates (KLF14) under these cycling  conditions in 7% BD; for KLF14, the amplification yield was significantly less than that for the  engineered polymerase under the same conditions. Thus, all GC‐rich sequences studied were  effectively  amplified  using  the  engineered  polymerase,  but  almost  none  of  them  were  effectively amplified using WT.         The overall results on GC‐rich template amplification (Figs. 5, 10, and Table 13) are  also  fully  consistent  with  the  first‐principles  model  for  PCR  amplification  that  explains  amplification yield in terms of cosolvent effects on enzyme thermostability/activity and DNA  melting. This enables rational optimization of GC‐rich template amplification  including RT‐ PCR of GC‐rich templates. The DNA‐dependent DNA polymerase, which may or may not be  the same enzyme as the reverse  transcriptase, must be stable in the presence of both organic  cosolvent  concentrations  and  the  denaturation  temperatures  used with  such  templates.  Specifically,  in  Fig.  5  (high  denaturation  temperature),  it  is  not  possible  to  raise  the  BD  concentration  for  the  WT  polymerase  at  this  denaturation  temperature  to  achieve  a  reduction in template Tm sufficient to amplify most of the GC‐rich templates, whereas this is  possible for the engineered polymerase.  In this regard, note that 5% BD reduces the template  Tm about 3‐4oC (Fig. 13C), which may be sufficient for some templates  if the denaturation  temperature  is  set  to  97oC  or  higher  (due  to  the  fact  that  only  50%  of  the  template  is  denatured at the Tm), but the WT thermostability is negligible in 5% BD at these temperatures.  In  Fig.  5  (A‐D)  (high  denaturation  temperature,  high  %  BD)  and  Fig.  5  (E‐H)  (lower  denaturation  temperature,  high  %  BD),  it  is  not  possible  to  find  a  temperature/%  BD  combination  for WT  that  amplifies  DACT3  (or  other  GC‐rich  templates)  by  reducing  Tm  sufficiently without overly compromising stability at the chosen denaturation temperatures.  By contrast, DACT3 was successfully amplified using the engineered polymerase  in Fig. 5D  because template Tm could be reduced by ~6‐7oC by using 10% BD, which enables significant  60    template  denaturation  at  98oC  –  a  temperature  which  the  engineered  polymerase  can  withstand  in  concentrated  cosolvent. We  note  that while WT  thermostability  at  95oC  is  reasonable in 5% BD (Table 5B), given that 5‐7% BD reduces template Tm by only 4‐5oC, the  reduction in template sufficient Tm is not sufficient to amplify highly GC‐rich genes like PO3F3  and  DACT3.  Moreover,  WT  activity  is  significantly  reduced  at  5%  BD.  This  analysis  demonstrates that polymerase characterization can be used to predict optimal conditions to  enable  amplification  of  otherwise  intractable  GC‐rich  sequences.  The  principles  directly  extend to RT‐PCR of such templates (see for example the results presented herein for the RT  step  with  the  GC‐rich  RNA  template  for  the  BEGAIN  gene),  with  higher  cosolvent  concentrations  reducing  the  secondary  structure  of  structured  RNA  templates  and  also  enhancing activity of the enzyme.   With  respect  to  RT  reactions,  several  factors  besides  the  catalytic  activity  of  the  reverse transcriptase enzyme may play important roles in determining the effective range of  such  polar  organic  cosolvents:  a)  Due  to  primer‐template  destabilization  by  organic  cosolvents,  especially  at  higher  cosolvent  concentrations  an  initial  incubation  at  lower  temperature for cDNA primer annealing prior to high temperature reverse transcription to  fully extend the primer may further increase reverse transcription product yield; b) For the  higher molecular weight, potent polar organic cosolvents like BD, sulfolane, tetramethylene  sulfoxide or 2‐pyrrolidone at or above 20% v/v cosolvent, the melting temperature of the  reverse  transcriptase  may  begin  to  approach  optimal  extension  temperatures  of  thermostable reverse transcriptases. Solvostabilizing mutations can broaden the window for  effective  high  temperature  catalytic  activity  of  reverse  transcriptases  at  these  cosolvent  concentrations (compare SFM4‐3, 4‐6 with L5‐2‐F01‐RT1 and ‐RT2 in Fig. 2 as well as Table  6A).  Protein  stabilizing  adjuvants  like  glycerol  can  also  be  helpful.  The  protein melting  temperatures of four thermostable reverse transcriptases measured by nanoDSF (Table 6A)  demonstrate that the enzymes not specifically engineered for solvostability and activity  in  organic  cosolvents  display  significantly  lower melting  temperatures —  especially  in  the  presence of organic cosolvents —  than  those  that were engineered  for  function  in mixed  61    aqueous‐organic media. This  significant  reduction  in  stability may  limit  the utility of  such  enzymes  in  one  enzyme  RT‐PCR,  compared  to  certain  solvostable  reverse  transcriptase  enzymes; c) Finally, the Tm of the RNA:DNA heteroduplex (reverse transcription product) is  reduced by  cosolvents.  Such effects may play a  role  in  limiting  the effective  range of RT  activity‐enhancing polar organic cosolvents.   With respect to fidelity, RTs generally have lower fidelity than DNA‐dependent DNA  polymerases and Taq variant RTs have been engineered to achieve fidelities close to several  of  the highest  fidelity RTs  reported  to date without  the need  for a proofreading domain.  Fidelity data on the engineered solvostable RTs (Table 11) show that they do not generally  have lower fidelities than other Taq variants.   Fidelity of the mutants:  Polymerases with high normalized peak area at 5% and/or  7%  BD,  including  those  which  ranked  most  highly  in  the  above  computational  and  experimental activity and stability analyses, were selected  for  further characterization.  As  shown in Table 11, the fidelity of the engineered polymerases is similar to that of the wild  type enzyme with the exception of SPC9, a synthetic variant which has slightly lower fidelity.      Reverse transcription within droplets, and reverse transcription and RT‐PCR assays  from cells enhanced by organic cosolvents:  For illustration of reverse transcription within  emulsion droplets, direct detection of pico‐green fluorescence from emulsion droplets was  applied. Droplets were generated after mixing EnzChek RT buffer with brain total mRNA and  the BEGAIN primer. As shown in the upper panel of Fig. 7(L), a clear fluorescence signal could  be detected by microscopy when the droplets were processed after PCR. Prior to the PCR  reaction, all droplets appeared uniform, and no bright droplets were observed. As a negative  control, both pre‐PCR and post‐PCR images of the droplets lacking brain total mRNA did not  show any bright droplets, indicating the absence of DNA formation. This result suggests that  fluorescence‐activated  cell  sorting  (FACS)  could  be  used  to  sort  the  RT‐PCR  or  RT‐only  products within the droplets.  62    Reverse transcription and RT‐PCR assays were also carried out from cells, as follows.  As  shown  in  Fig.  14,  the  performance  of  the  reverse  transcriptases  (RTs)  from  induced  bacterial cells carrying wild‐type Taq, SFM4‐6, and L‐5‐2‐F01‐RT1 was evaluated using a two‐ step RT‐PCR assay in the presence of different concentrations of the organic cosolvent 1,4‐ butanediol. The results demonstrate that the activity of the L‐5‐2‐F01‐RT1 enzyme improved  at  higher  BD  concentrations,  except  at  the  highest  concentration  tested.  This  finding  is  consistent  with  the  results  previously  reported  in  Fig.  2  for  the  purified  L‐5‐2‐F01‐RT1  enzyme. As a positive control,  the purified SFM4‐6 RT generated  the expected DNA band  across  all  BD  conditions.  However,  its  activity  decreased  at  high  BD  concentrations,  as  anticipated. While a non‐specific band was observed in the negative control lanes containing  the wild‐type Taq cells, no KRAS‐specific band was detected, confirming the validity of the  negative control. The cells expressing the SFM4‐6 RT produced faint bands, indicating that its  RT activity was weaker  than  that of  the  L‐5‐2‐F01‐RT1 enzyme under  these experimental  conditions.    In  summary,  in  addition  to  making  the  unanticipated  discovery  that  highly  thermostable  reverse  transcriptases  are  generally  solvophilic,  i.e.  upregulated  by  polar  organic  cosolvents,  we  used  droplet‐based  directed  evolution  to  engineer  solvostable  polymerases even more suitable  for RNA‐dependent DNA polymerization  (RT) and RT‐PCR  applications.  These  cosolvent‐resistant  engineered  polymerases  arguably  solve  the  longstanding sequence bias problem of nucleic acid polymerization. These compositions and  methods, including cosolvents and polymerases, are expected to work not only in standard  RT and RT‐PCR but  in any  related protocols  such as NGS/RNA‐seq, droplet digital RT‐PCR  (ddRT‐PCR), and  infectious pathogen RNA detection without sample preparation. Our  top  mutants,  like  L‐5‐2‐F01‐RT1,  exhibited  exceptional  reverse  transcriptase  activity  at  high  temperatures  in  the presence of organic  cosolvents,  significantly higher  than  in  aqueous  media. Moreover, with  such  solvent‐tolerant  polymerases,  a  broader  range  of  cosolvent  concentrations and a broader spectrum of cosolvents may be compatible with nucleic acid  63    polymerization  and  amplification.    In  particular,  due  to  the  enhancement  of  reverse  transcriptase  catalytic  activity  by  polar  organic  cosolvents,  it  is  expected  that  higher  molecular weight cosolvents (in addition to higher concentrations of the same cosolvents, as  shown)  are  compatible  with  reverse  transcription  compared  to  DNA‐dependent  DNA  polymerization and PCR, even for thermostable RTs that are not engineered for performance  in aqueous‐organic media.     A  non‐limiting  listing  of  thermostable  reverse  transcriptases  having  properties  described herein is provided in Table 15 below.     Methods  Bacterial strains, plasmid, and chemicals: Electrocompetent Escherichia coli TG1 expression  hosts were  purchased  from  Lucigen  (WI,  USA).  The  codon‐optimized WT‐Taq  gene was  synthesized  at  Genscript  (NJ,  USA).  The  gene  was  cloned  in  pASK‐IBA5C  vector  (IBA  Lifesciences, Germany) between XbaI and SalI restriction sites to create the plasmid pASK‐ Taq. Restriction enzymes, Q5, Vent polymerase, T4 DNA ligase, Calf Intestinal Phosphatase  (CIP), and M13 single stranded DNA were procured from New England Biolabs Inc (MA, USA).  Diversify PCR random mutagenesis kits were purchased from Takara Bio USA Inc. (CA, USA).  All primers were synthesized at Integrated DNA Technologies (Iowa, USA). Primer sequences  used  in this study are given  in Table 14. DNA sequencing was carried out at GENEWIZ (NJ,  USA). Chloramphenicol and anhydrotetracycline were purchased  from Sigma‐Aldrich  (MO,  USA). All other  chemicals were of highest purity available, purchased either  from  Sigma‐ Aldrich or VWR International.    Reverse Transcriptase activity (RT) assay: We synthetically generated three mutant clones  (among others) by introducing three mutations E742K+M747K and D732N in two of our  best performing mutants. These clones were: 1) L‐5‐2‐F01+E742K+M747K (L‐5‐2‐F01‐RT1),  2) N‐7‐3‐B07+E742K+M747K (N‐7‐3‐B07‐RT), and 3) L‐5‐2‐F01+D732N (L‐5‐2‐F01‐RT2). The  64    enzymes of interest were tested for RT activity using EnzChek Reverse Transcriptase Assay  Kit (E‐22064) in the presence of varying concentrations of cosolvents (BD, 2‐pyrrolidone,  sulfolane and tetramethylene sulfoxide). WT‐Taq was used as negative control. A Stoffel  fragment mutant of Taq polymerase (SFM 4‐6) reported previously to have RT activity and  ProtoScript II RT were used as positive controls. Equal activities of the enzymes were  applied in the master mixture (total volume 30 µl) and the mixture was incubated at 55°C,  and the same quantities of each enzyme were also incubated at 68°C and 76°C, for 30 min.  The reactions were terminated by addition of 2 µl of 200mM EDTA. 68 µl of the PicoGreen  solution (as recommended by the kit for solution preparation) was added into the solution  and incubated for 5 min at room temperature. The RT activity was measured as intensity of  fluorescence using TeCan (Infinite 200Pro) microplate reader with excitation / emission  wavelengths 480nm and 520 nm respectively. The standard curve was measured at 37oC  using a commercially available reverse transcriptase (ProtoScript II RT, NEB) to calculate the  relative activity. The data were collected and analyzed using GraphPad Prism 7.    RT‐qPCR assay: RT‐qPCR efficiencies of our two best mutants L‐5‐2‐F01+E742K+M747K (L‐5‐ 2‐F01‐RT1) and N‐7‐3‐B07+E742K+M747K (N‐7‐3‐B07‐RT) were tested in absence and  presence of BD (7%) and compared with the SFM4‐6.       In step 1, 0.2 µg of a synthesized RNA of human BEGAIN gene fragment (100 base) with  75% GC content  (CCUGCGGGCCAAGCCGGGGACCGCCCGGCUCCCCGGGGAGGACAUGAGGGGCCAGUGGCGUCC CCUGAGCGUGGAGGACAUCGGCGCCUACUCCUACCCC) (SEQ ID NO: 146) was incubated with  0.5 µg of BEGAIN RT‐REV at 80°C for 10 min in 100 uL H2O (RNase and Dnase free). In step 2,  RT reaction mixture (a total volume of 20 µl) was prepared using 1X Taq buffer (‐Mg), 0.25  mM dNTP, 3.5 mM MgCl2, RNase inhibitor (NEB), 1X SYBR safe, BD (0% or 7%), template  RNA‐primer mix (10 µl) from step 1 and 30 ng of each enzyme. RT reaction was carried out  at 55oC or 68°C for an hour followed by deactivation of the above enzymes at 98.3°C for 1  min + 95°C for 6 min. In step 3, qPCR reaction mixture (20 µl) was prepared using 1X Taq  65    buffer (‐Mg), 0.25 mM dNTP, 3.5 mM MgCl2, 1X SYBR safe, RT reaction mixture from step 2  (1 µl),  BEGAIN RT‐FWD, BD (7%) and L‐5‐2‐F01 enzyme (3.55 ng/0.625U). The Bio‐Rad  CFX96TM Real‐Time PCR Detection System was used to carry out the qPCRs using 1 min at  95oC followed by 40 cycles of 30s at 95°C, 30 sec at 57°C, and 40 sec at 72oC. The Cq values  were determined to assess the efficiency of RT‐qPCR. The melt curves of the PCR samples  were run from 55°C to 95°C.    Library  construction:  We  generated  error‐prone  PCR  (epPCR)  Taq  library  (also  termed  generation 1, pre‐1st CSR round) using codon optimized WT‐Taq DNA sequence as a template.  We define “generation” in terms of how many times diversity was introduced in the original  epPCR  library  ‐‐ e.g., when WT‐Taq sequence was diversified by random mutagenesis first  time, it is called “generation 1” ‐‐ whereas the number “round” denotes the number of times  the  library  has  gone  through  CSR  ‐‐  e.g.,  post‐1st  CSR  round means  that  the  library was  selected after one  round of CSR. We used  the commercially available Diversify epPCR kit  (Takara). We performed epPCR using primer pair CSR‐Select‐F and AU‐Gen‐Taq‐R (Table 14)  to generate 3‐4 mutations per sequence. To assess the quality of the library, we subjected  the post‐epPCR  library to NGS and confirmed with  limited number of Sanger sequencings.  Both of our approaches confirmed that the library is of good quality and that we generated  an average 3‐4 mutations per sequence. Similar mutational  load has been used  in existing  literature  on  polymerase  evolution.  The  PCR  products  were  DpnI  digested  followed  by  column purification using Qiagen’s PCR purification kit. The purified products were digested  by  XbaI  and  SalI  and  introduced  into  the  pASK‐IBA5C  vector.  The  ligated  products were  electroporated into E. coli TG1 cells. After an hour of recovery, 5 µL cells were serially diluted  to  spread  on  the  LB‐chloramphenicol  (50  µg/ml)  plates  to  assess  the  library  size.  The  remaining  cultures  were  re‐inoculated  into  20  ml  LB  media  supplemented  with  chloramphenicol in 50 ml conical flask overnight at 37oC and shaking at 250 RPM to generate  N‐epPCR expresser cells.     66    We  first  established  that  during  CSR,  the water‐in‐oil  compartments  are  separate,  non‐ communicating, and unaffected by heat and organic solvent. Our data show that emulsion  droplets are stable after 30 cycles of thermal cycling in up to 10% BD. The efficiency of our  CSR procedure was assessed  through a selection experiment wherein we mixed 90% cells  expressing WT polymerase and 10% cells expressing a thermostable mutant T8, and following  CSR recovered several fold more thermostable clones than WT clones.     Generation  of  expresser  cells  and  compartmentalized  self‐replication:  To  generate  expresser cells, post‐transformation libraries were inoculated in 20 ml of LB‐chloramphenicol  in 50 ml conical  flask overnight at 37oC and shaking at 250 RPM. Following outgrowth, N‐ epPCR expresser cells (1%) were inoculated into 50 ml of LB‐chloramphenicol. The cells were  induced by anhydrotetracycline (300 ng/ml) to express the Taq polymerase once the OD600  reached between 0.4  ‐ 0.5. After  four hours,  the  cells were harvested by  centrifugation,  washed, and resuspended in 1X Taq buffer (10 mM Tris‐HCl pH 8.5, 50 mM KCl, 1.5 mM MgCl2,  and 0.1% Triton X‐100). The CSR was performed as described by to select for thermostable  and BD resistant mutants  in 5% BD. The emulsions were pre‐incubated at 95oC  for 6 min,  followed by CSR PCR, 25 cycles at 94oC for 1 min, 55oC for 1 min, and 72oC for 5 min. To add  further diversity, the top hit clones were randomly recombined by StEP PCR. The resulting  library (generation 2, pre‐1st CSR round) was subjected to higher selection pressure. The CSR‐ PCR was performed in the presence of 7% BD. The CSR‐PCR cycle used was as follows: 98.3oC  for 1 min then 95oC for 6 min, followed by 25 cycles at 94oC for 1 min, 55oC for 1 min, and  72oC for 5 min.    The  library series generated via error‐prone PCR are referred to as the N‐series (or epPCR  libraries)  for  short.  The  initial  error‐prone  PCR‐  generated  library  is  labeled  N‐epPCR.  Downstream CSR‐treated libraries are labeled referring to the number of CSR rounds applied  to this library. CSR‐treated libraries are referred to N‐1st, N‐2nd, N‐3rd, N‐4th, N‐5th, N‐6th, and  N‐7th corresponding to the total 7 rounds of CSR treatment applied to this library. We used  67    staggered extension process (StEP‐PCR) to generate diversity in top selected clones.  We used  high fidelity Vent polymerase for the StEP recombination as described previously. We isolated  plasmids  from  top  ranked clones after CSR, and  restriction digested with XbaI and SalI  to  generate the StEP template. The reaction consisted of an equimolar mixture of each fragment  (total 0.15 pmoles) supplemented with 25 pmoles of primers CSR‐select‐F and AU‐Gen‐Taq‐ R, 250 µM dNTP, and 1.5 units Vent polymerase in 1X Thermopol buffer. The PCR extension  protocol was as follows: initial denaturation at 95oC for 5 min; 150 cycles of 95oC for 1 sec;  55oC for 5 sec; 72oC for 2 sec; and final extension at 72oC for 2.5 min. The PCR product was  treated with DpnI, precipitated with sodium acetate, and digested with XbaI and SalI to clone  in to the pASK vector for the next round of the CSR. Even though we used high‐fidelity Vent  polymerase for StEP PCR, we noted extra mutations, possibly due to the abbreviated nature  of PCR in StEP PCR. The library series generated via StEP shuffling are referred to the L‐series,  StEP, or shuffled libraries within this document. The initial StEP shuffling‐generated library is  labeled L‐StEP. Downstream CSR‐treated libraries are labeled referring to the number of CSR  rounds applied to this library. CSR treated libraries are referred to L‐1st, L‐2nd, L‐3rd, L‐4th, and  L‐5th corresponding to the total 5 rounds of CSR treatment applied to this library series.     Library enrichment and next‐generation sequencing: To enrich and identify best‐performing  clones, we  subjected  the epPCR  library  series  to  seven  consecutive  rounds of CSR  in  the  presence of 5% BD. After each cycle of the CSR enrichment rounds, the PCR product was re‐ amplified, cloned and then transformed in E. coli TG1 cells as mentioned above. After the 1st,  3rd, 5th and 7th rounds of enrichment CSR for the epPCR library, a fraction of the library was  subjected to a screening protocol followed by Sanger sequencing (~1500 clones screened for  rounds 1 and 7 and ~250 clones screened for rounds 3 and 5).  A similar screening protocol  was carried out for L series (~1500 clones screened for rounds 1 and 5).  Overall, 0.37% of all  screened clones from the first round of CSR on the epPCR library performed better than the  WT whereas  this  ratio was 0.13% and 40%  for clones  from  the  first  round of CSR on  the  shuffled  library  and  synthesized  clones  (see  below),  respectively  –  demonstrating  the  68    effectiveness of synthetic recombination. We  isolated the plasmids after each enrichment  round for NGS analysis. The library plasmids were digested with XbaI and HindIII, generating  a slightly bigger fragment than the Taq ORF. The Taq gene (~2.5 kbp) was arbitrarily divided  into six fragments (Fragments 1‐6 and the amplicon size ranged from 450 bp‐468 bp) to make  it compatible with  Illumina  sequencing platform. We used high‐fidelity Q5 polymerase  to  amplify these fragments using six sets of overlapping primers, NGSR1_FWD and NGSR1_REV;  NGSR2_FWD and NGSR2_REV; NGSR3_FWD and NGSR3_REV; NGSR4_FWD and NGSR4_REV;  NGSR5_FWD and NGSR5_REV; NGSR6_FWD and NGSR6_REV (Table 14). The PCR products  were gel purified and then subjected to the Illumina NGS protocol at GENEWIZ. Forward and  reverse sequence reads were merged and filtered with a sequence quality score cutoff of 33,  using  the  PEAR  assembler.  Filtered  and  assembled  sequences were  then  aligned  to  the  reference gene sequence (WT‐Taq gene) using sequence matcher and pairwise2 modules of  the Biopython software suite. We used alignment parameters 2, ‐1, ‐35, ‐0.1, for identical,  non‐identical,  gap  opening,  and  gap  extending,  respectively,  for  both  alignment  tools.  Resulting unique merged sequences and alignment scores were recorded. Non‐target, large  frameshifted, and truncated data were removed based on an alignment score as a sequence  length  cutoff  of  amplicon  length  (‐6  to  +1bp).  Final  sequences were  translated  to  their  corresponding in‐frame amino acid sequences by the Biopython translate module; sequence  changes were recorded and logged in a tabular format. Frequency of any mutation found in  a read within a region was calculated with Equation 1: Dolomite    ^^ ^^ ^^ ^^ ^^ ^^ ^^ ^^ ^^ ^^ ^^ ^^ ^^ ^^ ^^ ^^ ^^ ^^ ^^ ൌ ௌ௨^^^ௗ ோ^^ௗ^ ^^ ௌ^^௨^^^^^ ௧^^௧ ^^^௧^^^ ெ௨௧^௧^^^ ௌ௨^^^ௗ ்^௧^^ ோ^^^^^ ோ^^ௗ^ ∗ 100              (1)    Equation 2:     ^^ ^^ ^^ ^^ ^^ ^^ ^^ ^^ ^^ℎ ^^ ^^ ^^ ^^ ൌ ி^^^௨^^^௬ ^^ ெ௨௧^௧^^^ ^^ைௌ்^ ி^^^௨^^^௬ ^^ ெ௨௧^௧^^^ ^ூேூ்ூ^^^                                                                     (2)  of CSR, possibly due to total number of reads acquired, we observed a general trend that the  69    most  fit mutants are highly represented  in  the  final  library. We  further observed  that  the  enriched positions do not cluster in a hotspot but are distributed in both the exonuclease and  polymerase domains.  Using one round of CSR followed by screening thousands of clones, we were unable  to  get  genotype  redundancy  in  Sanger  sequencing.  In  early  rounds  of  CSR,  genotype  redundancy and identification of highly performing mutants requires screening of a very large  number of clones.   FACS of droplets was also used as an alternative method  to enrich  for high‐fitness  library variants.    Synthesis of mutant clones: To generate further diversity, we generated synthetic clones by  recombining  the  top hits  from  the epPCR and StEP  libraries.  In general, we  restricted  the  number of mutations per  sequence  to 6‐10  to avoid mutational overload. A  total of nine  clones (Synthesized polymerase clones; SPC1‐9) were synthesized at Genscript.  SPC1‐9 were  based on mutations identified from wet lab screening after one round of CSR.     Microfluidic droplet preparation for CSR and polymerase screening by FACS: We noted one  of  the  challenges  with  manual  droplet  emulsion  preparation  is  the  polydispersity.  To  circumvent polydispersity and  further  improve  the selection of hit clones, we employed a  computer‐controlled microfluidics device to prepare a) water‐in‐oil (w/o) primary emulsion  (PE)  for use  in CSR and b) water‐oil‐water  (w/o/w) double emulsion  (DE) compatible with  FACS sorting, to sort mixtures of the best performing engineered polymerase clones obtained  from CSR selection, based on their PCR performance against arbitrary templates – and thus  validate their performance with a secondary screen using monodisperse droplets.   We prepared expresser cells as described above. We used FluoSurf (2% in HFE7500;) as the  oil phase. We used Dolomite’s µEncapsulator system and 30 µm fluorophilic chip to generate  a 20 µm, monodispersed, primary emulsion (PE) following the manufacturer’s protocol. For  double emulsion preparation, we loaded one channel of the reservoir chip with PE, while the  70    other channel was loaded with FluoSurf as spacer fluid. All the three P‐pumps were loaded  with outer carrier phase driving  the PE and  spacer  fluid  into  the 30 µm hydrophilic  chip.  Typical flow rates for double emulsion preparation were as follows: 0.8 ul/min for P1 and P2‐ pumps  whereas  8  ul/min  for  P3‐pump,  generating  30  µm  DE.  Droplet  generation  was  monitored by an in‐built, high‐speed camera.      For  CSR  experiments  (application  a)  above),  this  single  emulsion was  used  directly  in  terminal rounds of CSR experiments as described above. Three P‐pumps were connected to  the  reservoir  chip  driving  oil  phase  (P3‐pump)  and  two  (P1  and  P2  pumps)  to  push  the  samples into the sample chip. Typical flow rates, for PE generation, were 4 µL/min for P1 and  P2 pumps whereas it was fixed at 36 μL/min for P3‐pump.       To perform FACS‐based experiments (application b) above) for the purpose of a secondary  screen of polymerase performance, we mixed 90% WT polymerase expressing cells with 10%  engineered polymerase‐expressing cells. The mixed population of cells was used to generate  the  water‐in‐oil  primary  emulsion.  The  primary  emulsions  were  subjected  to  PCR.  We  employed the following PCR cycles‐ 95oC for 6 minutes followed by 25 cycles of 95oC for 1  min, 55oC  for 1 min, 72oC  for 5 min. To prepare  the double emulsion, we used a 30 µm  hydrophilic chip. We used an outer carrier phase containing 1% Tween‐20, 2% Pluronix F68  in  1X  PBS.  Double  emulsion  encapsulation  of  PEs  containing  single  bacterial  cells  was  separately verified using GFP expressing cells. Double emulsion  sorting was performed at  Flowmetric Inc. (Doylestown, PA). We used FACSAria II sorter (Becton Dickinson Biosciences)  to sort double emulsions. Prior to sorting, the double emulsions were diluted to 1:5 using  FACS diluent (1% Tween‐20 in PBS) and then stained with SYBR Green I. Using both positive  and  negative  controls,  the  FACS  machine  was  calibrated  on  forward  scatter,  FSC.  The  instrument was further calibrated to identify negative and positive droplets using negative  and positive controls, respectively. Droplets were first gated using FSC‐H and FSC‐A followed  by Alexa Fluor 488 to detect DNA‐SYBR complexes. Sorting data was analyzed using FACSDiva  software version 6.1.3. Based on SYBR  intensities, the samples were collected as SYBRHIGH,  SYBRMEDIUM  and  SYBRLOW  for  downstream  processing.  Although  the  SYBRHIGH  population  71    represents most of  the droplets, SYBRMEDIUM contributes  to  the sorted population possibly  because  SYBR Green  I binds  to bacterial  chromosomal DNA.  To  isolate DNA  from  sorted  samples,  the excess  sheath  fluid was  removed  from SYBRHIGH  sample  then mixed with 2X  volume of 1H, 1H, 2H, 2H‐Perfluoro‐1‐octanol (PFO) to break the droplets, followed by Sanger  sequencing to quantify enrichment of each clone.      Real‐time qPCR screening assay: A SYBR Green I assay based on real‐time qPCR was used to  screen  the  transformants  obtained  following  CSR  selection.  Transformed  colonies  were  picked  and  inoculated  into  a  96‐deep  well  culture  plate  containing  500  μL  LB‐ chloramphenicol medium. Cells were grown and induced by anhydrotetracycline (300 ng/ml)  once the OD600 reached between 0.4‐0.5. Then the cells were harvested and resuspended in  200 μL of 1X Taq buffer (10 mM Tris‐HCl, pH 8.0, 50 mM KCl, 1.5 mM MgCl2, 0.1% Triton X‐ 100). The PCR mix contained 10 μL of cell suspension and 40 µL master mix 1,4‐Butanediol  (5% (v/v), 0.25 mm dNTP, 1 mg/mL BSA, 3.5 mM MgCl2, 0.5 μM of primers‐Taq Q1, Taq Q2  (Table 14), and 0.5X SYBR Green I. We used Bio‐Rad CFX96TM Real‐Time PCR Detection System  to carryout PCR using the following program – 6 min at 95oC followed by 16 cycles of 30 sec  at 94°C, 30 sec at 57.8°C, and 30 sec at 72oC. Melting curve analysis was performed between  55  and  95°C  at  0.1oC/s melt  rate. Melting  peaks were  visualized  by  plotting  the  relative  fluorescent value (RFU) of the 1st derivative against the temperature. We calculated the peak  areas using GraphPad Prism software and normalized the peak area to cell number to rank  the clones.      Hit clones from screening were denoted using the following notation: Library # ‐ Round # ‐  Plate # ‐ Well #.  For example, N‐7‐1‐E10 refers to a clone isolated from the epPCR library (N)  after 7 CSR rounds on plate 1 in well E10; whereas L‐1‐14‐H10 refers to a clone isolated from  the shuffling library (L) after 1 CSR round on plate 14 in well H10.      Protein purification: We introduced His‐tag to the top ranked clones by PCR using Q5 site‐ directed mutagenesis kit (NEB). The primer (His‐F and His‐R) sequences are listed in Table 14.  72    Following  transformation, we  confirmed  the  His‐tag  by  DNA  sequencing.  Single  colonies  expressing either WT polymerase or mutant derivatives were grown overnight at 37oC in 5  ml LB‐chloramphenicol. The overnight grown cultures were re‐inoculated into 200 ml of LB‐ chloramphenicol. The protein expression was  induced by anhydrotetracycline  (300 ng/ml)  once the OD600 reached between 0.4‐0.5.  The cells were harvested by centrifugation after 4  hours, washed once, and resuspended in 2.5 ml wash buffer (50 mM Tris‐HCl, pH 7.9, 50 mM  dextrose, 1 mM EDTA, 1 mM PMSF). The cell suspensions were subjected to two cycles of  freeze‐thaw.  The  partially  lysed  cells  were  incubated  with  1  mg/ml  lysozyme  at  room  temperature for 15 min. Following incubation, an equal volume of lysis buffer (10 mM Tris‐ HCl, pH 7.9, 50 mM KCl, 1 mM EDTA, 1 mM DTT, 1 mM PMSF, 0.5% Tween‐20, 0.5% Nonidet  P40) was  added;  the  sample was  kept  on  ice  for  30 min.  The  crude  lysates were  then  incubated  at  75oC  for  30 min  followed  by  centrifugation  to  collect  the  supernatant.  The  nucleic acids were precipitated by streptomycin sulfate. The solution was centrifuged, and  the  supernatant  was  loaded  onto  an  IMAC  column.  The  column  was  washed  with  equilibration buffer (10 mM Tris‐HCl, pH 7.9, 50 mM KCl, 20 mM imidazole), and eluted with  10 mM Tris‐HCl, pH 7.9, 50 mM KCl, 300 mM imidazole. The proteins were dialyzed against  dialysis buffer containing 20 mM Tris‐HCl, pH 8.0, 1 mM DTT, 0.1 mM EDTA, 100 mM KCl, 0.5  % NP40, 0.5% Tween‐20 and 50% glycerol. The polymerases were quantified using Bio‐Rad’s  DC protein assay.   We  resolved purified proteins on SDS‐PAGE  to assess  the purity of  the  preparations. To produce non‐His‐tag proteins, we introduced a protease cleavable His‐tag  at the N‐terminus of the WT‐Taq using primer set 6His‐TEV‐R and 6His‐TEV‐Ser‐F (Table 14).  After PCR using Q5 DNA polymerase, we  transformed, and  then  sequenced  to  verify  the  cleavable  His‐tag.  Once  confirmed,  the  protein  was  expressed  as  described  above.  The  cleavable, purified protein was subjected to the TEV protease (NEB). The cleaved His‐tag was  removed by loading on to IMAC column, collecting the flow‐through followed by dialysis. We  confirmed the His‐tag removal by InVision His‐Tag In‐Gel Stain (Invitrogen).    73    Nucleotide  incorporation  and  denaturation  kinetics  assays:  Organic  cosolvents  affect  enzyme activity and thermostability via different mechanisms. To determine the activity of  the purified enzymes, we used EvaGreen‐based fluorescence assay. We used a 59 nucleotide  long self‐annealing template‐primer (SATP). Previously, SATP has been used for DNA binding  and  activity  assays.  The  SATP  used  in  this  study  has  25 nucleotide overhangs  for primer  extension (Table 14). Briefly, 0.2 ng purified WT and its mutant derivatives were incubated  with 100 nM SATP, 3 mM MgCl2, 250 µM dNTPs, 1x EvaGreen, and 0.5 µg/µL BSA in 1x Taq  buffer. The primer extension reactions were carried out at 72oC.     We used commercially  available Taq DNA polymerase (Invitrogen) to calculate the relative activity.      Half‐lives of the enzymes were determined as described previously, except that we used  EvaGreen  based  assay  and  utilized  SATP  to measure  the  remaining  activity  as  described  above. We used 10 mU (in 2µL) of either wild type or mutant enzymes, pre‐incubated in 1x  Taq buffer at either at 95oC or 97.5oC for a) 0, 1, 3, 5, 10, 20, 40, 60 min in the presence of 5%  BD , and b) 0, 2, 5, 10, 20, 40, 60, 90 min in the absence of BD. Heat treated samples were  kept on ice until the reaction was started by adding 18 µL of substrate mix containing 3 mM  MgCl2, 100 nM SATP, 250 µM of each the dNTPs, and 1x EvaGreen  in 1x Taq buffer. After  determining the remaining activity, the half‐life (t1/2) was calculated by plotting the percent  activity remaining versus heat exposure time at specific temperature.       Since it was suggested that the N‐terminal His‐tag reduces the thermostability of the Taq  polymerase by 5‐fold, both His‐tagged and non His‐tagged WT  were tested for t1/2. The half‐ life of His‐tagged and non His‐tagged WT was 3.7 and 3.6 min respectively at 97.5oC when  the protein alone was exposed to heat (method 1). The t1/2 of the His‐tagged and non His‐ tagged WT  was  3.9  and  4.2 min,  respectively  when  ternary  complex  was  heat  treated  (method 2). Based on our data Table 5A), we concluded that the differences between the t1/2  of the two proteins are insignificant. We found that the t1/2 of the WT in absence of organic  solvent is about 41 min at 95oC (Table 5B) which is close to the values reported previously.     74        In another variation of the assay we ensured that the enzyme is in a ternary complex [E‐ TP‐dNTP] prior to the heat treatment. 10 mU of enzymes were pre‐incubated in a reaction  mix containing 3 mM MgCl2, 100 nM SATP, 250 µM each of three dNTPs (dTTP, dGTP, and  dCTP) in 1x Taq buffer (18 µL) on ice followed by heat treatment protocol as described above.  After heat exposure for a specific time, samples were held on ice then incubated with 0.5 µL  of 40X EvaGreen for 15 min. In the SATP sequence, the first three incoming nucleotides are  dGTP followed by dATP. It is conceivable that the enzyme will form an active ternary complex  when incubated with correct incoming dNTP. This is an assay we used previously to assess  the  stability of  the polymerase  ternary complex. The polymerase  reaction was  started by  adding 1.5 µL of mix containing 250 µM dATP along with 0.5 µg/µL BSA at 72oC followed by  EvaGreen fluorescence quantification.    Thermal unfolding analysis: The thermal unfolding experiments of wild type polymerases as  well as the variants (5 µM, in 20 mM Tris‐HCl pH 8.0, 1 mM DTT, 0.1 mM EDTA, 100 mM KCl,  and  5%  glycerol)  were  performed  using  nano‐scale  Differential  Scanning  Fluorimetry  (nanoDSF) on a Prometheus NT.48 instrument, with a high‐temperature package and back‐ scatter optics, which allowed analysis of  thermal unfolding and aggregation up  to 110°C.  Thermal denaturation of each protein was determined in triplicate by measuring changes in  fluorescence at 330 and 350 nm over varying temperature, from 30°C to 110°C, with a heating  speed of 1°C/min and with a 10% sensitivity setting (fluorescence excitation power). These  measurements were completed in the presence of 5% BD. Experiments were performed, in  triplicate, at 2Bind GmbH (https://2bind.com, Regensburg, Germany). The ratio of 350/330  nm  and  scattering  data were  analyzed  using  the  PR.  Stability  Analysis  software  (v.  1.1,  Nanotemper Technologies, Munich Germany).      Computational prediction of mutational effects on protein stability and structure:           The mutations in screened clones were modelled in silico using in‐house written python  scripts and minimized by PyRosetta4 toolkit using default parameters. The closest centroid  75    distances  of  all‐atoms  and  sidechain  atoms  of  mutated  residues  to  DNA  or  RNA  were  calculated to find mutations in screened clones that are in close proximity to the DNA or RNA  ligand. The  initial threshold centroid distance‐cutoff was taken as 10 angstroms. Mutation  residues were selected for binding affinity evaluation based on proximity to DNA or RNA and  the nature of amino acid change to further apply stringency on the selection criteria and to  take into account the contribution of electrostatic interactions, if any, on DNA or RNA binding  affinity. Selected mutation  residues were modelled  in  silico. To perform MM‐GBSA‐based  binding affinity evaluation, an all‐atom molecular dynamics (MD) simulation was set‐up using  AmberTools22 package. The DOC residue was replaced with DC in the reference and mutated  complexes along with removal of ZN and EDO molecules. The reference and mutated model  complexes  were  loaded  in  tleap,  solvated  using  TIP3P  water model,  and  charges  were  neutralized followed by generation of parameter files  (prmtop,  inpcrd). An MD simulation  was performed as a three‐stage process – 1) minimization, 2) heating (NVT) and 3) production  run (NPT). The minimization was performed for a total of 20,000 steps with the first 1000  steps of steepest descent followed by conjugate gradient algorithm for the remaining steps,  within which the total energy of the complex was observed to become stable. The heating  run was performed for 20,000 steps, with gradual heating from 0K to 300K in first 8000 steps  and  continuing  the  remaining  steps  at  300K with  the  following  parameters  –  dt=0.0005,  ntf=1, ntc=1, ntb=1, ntt=3, gamma_ln=2.0.  The production run was performed  for 20,000  steps with the following parameters – dt=0.0005, ntf=1, ntc=1, temp0=300K, ntb=2, ntp=1,  ntt=3, gamma_ln=2.0. The total simulation time accounted for 20 ps. After the production  run, MM‐GBSA analysis was done on 101 frames of the production run (start frame =10, end  frame=110) using MMPBSA.py (of AmberTools22) and the binding affinity energy in terms of  Δ[complex –  (receptor+ligand)] was retrieved from the MMPBSA.py output file for further  analysis.       To assess the effect of mutations on the stability of hit clones, we calculated Gibbs folding  free  energy  change  (DDG)  as  an  indicator  of  protein  stability. We  used  freely  available  computational programs, FoldX v4.0,1 and MAESTROweb. The output is presented in kJ/mol.   76    Since  full  length Taq  ternary complex  (E‐DNA‐dNTP)  is unavailable, we  first modelled Taq  ternary complex to include 5’‐3’ exonuclease domain using MODELLER recommended DOPE‐ score profile and PROCHECK. We followed MAESTROweb execution protocols to calculate the  free energy change, whereas to calculate DDG for FoldX, we used the following formula:             ΔΔGMutant (FoldX) = ΔGMutant/Mutation combination – ΔGWT‐Taq Ternary complex                                  (3)          GC bias evaluation using NGS: To evaluate the mutant enzymes’ performance in the presence  of BD (1,4‐butanediol) in reducing GC bias, we used them for NGS library preparation of DNA  templates with different GC contents. Two different DNA inputs were used in the NGS library  preparation: a) using plasmid DNA ‐ five high GC templates (c‐Jun 63%, BEGAIN 71.3%, DACT3  79.2%, PO3F3 77.7%, and BAIP3 64.4%) were cloned  into PUC18 plasmid and 5 ng of each  prepared construct were pooled. The five templates were coamplified with 7.25U of either  WT,  L‐5‐2‐F01 or N‐7‐3‐B07 mutant under  the  same  conditions. 4% BD was used  for WT  enzyme and 10% BD was used  for  the mutants. The  reaction mixture contained 0.75 mM  dNTP, 1 mg/mL BSA, 3.5 mM MgCl2, and 0.5 μM of each primer. The following PCR programs  were used: 98.3oC for 1 min and 95oC for 6 min, 25 cycles of 94oC for 30 sec, 57.8oC for 30  sec, 72oC for 50 sec. The PCR products were run on 1% agarose gel and purified using Qiagen  DNA Gel Extraction and purification Kit. Purified PCR products were  sent  to GENEWIZ  for  sequencing and library preparation as described above. The Fastq raw sequencing data from  GENEWIZ on Illumina platform were aligned to the targeted templates and read frequencies  were determined for each template; b) using genomic DNA ‐ The mutant enzymes N‐7‐3‐B07  and N‐7‐3‐C08 and WT were tested in NGS library preparation using 150 ng genomic DNA in  absence and presence of 5% BD. Three high GC templates (B3GT6 72%, CDN1C 78%, EGFR  60% and one low GC template (KRAS 40 %) were coamplified using gene‐specific PCR primers  under the same conditions. The following PCR cycles were used: 98°C for 3 min followed by  30 cycles of 30 sec at 95°C, 30 sec at 58.5°C, and 30 sec at 72°C. The PCR products were  purified with Monarch DNA Gel Extraction Kit (New England BioLabs) and eluted with 10 μL  elution buffer. The purified products were mixed and prepared with the Nextera XT library  77    prep  kit  (Illumina)  according  to manufacturer’s  instructions.  The  indexed  libraries  were  subsequently purified with Illumina Purification Beads included in Nextera XT library prep kit  (Illumina),  and  quantified  using  the  Qubit  High  Sensitivity  dsDNA  Assay  (Thermo  Fisher  Scientific, Waltham, MA). The average fragment size, defined as  insert  length plus adapter  length, for each sample was calculated prior to pooling. The pooled libraries were sequenced  on  an  Illumina  iSeq100  using  a  2  x  150  bp  paired‐end  sequencing  protocol.  The  raw  sequencing  data were  demultiplexed  and  converted  to  Fastq  files  by  iSeq100  Local  Run  Manager DNA Enrichment Analysis Module v2.0.1.5. The reads were then aligned to human  genome assembly 37/hg19 reference sequence by BWA‐MEM.        qPCR  efficiency  and  amplification  of  GC‐rich  templates:  To  confirm  the  screening  rank  obtained from  library screening and characterize the ability of engineered polymerases to  amplify GC‐rich templates, we used purified enzymes and performed the qPCR assay. The  PCR mix  contained 1.25U of each enzyme  in  the presence of different  concentrations of  cosolvents (1,4‐Butanediol, or Pyrrolidone or Sulfolane), and 5 ng of Taq or GC‐rich template.  The reaction mixture contained, 0.25 mM dNTP, 1 mg/mL BSA, 3.5 mM MgCl2, 0.5 μM of each  primer‐ (Q1 and Q2 for Taq template; primers listed in Table 14 for GC‐rich templates), and  0.5X SYBR Green I. We used Bio‐Rad CFX96TM Real‐Time PCR Detection System to carry out  PCR using either 6 min at 95oC followed by 16 cycles of 30 sec at 94°C, 30 sec at 57.8°C, and  30 sec at 72oC or 98.3 oC for 1 min followed by 6 min at 95oC followed by 16 cycles of 30 sec  at 94°C, 30 sec at 57.8°C, and 30 sec at 72oC. We determined the Cq values to assess the  efficiency of the polymerases.      Fig. 12: (A,B) The following PCR cycles were used: 95oC for 6 min followed by 16 cycles of  30 sec at 94°C, 30 sec at 57.8°C, and 30 sec at 72oC;  (C) 98.3oC  for 1 min, 95oC  for 6 min  followed by 16 cycles of 30 sec at 94°C, 30 sec at 57.8°C, and 30 sec at 72oC; (D) The following  PCR cycles were used: 98.3oC for 1 min + 95oC for 6 min followed by 20 cycles of 30 sec at  94°C, 30 sec at 57.8°C, and 50 sec at 72oC. (E) Each enzyme (5U) was tested under identical  78    conditions. The following PCR cycles were used: 95oC for 6 min followed by 30 cycles of 30  sec at 94°C, 30 sec at 59°C, and 30 sec at 72oC.      Fig. 5: High denaturation temperature (98.3oC for 1 min + 95oC for 6 min followed by 25  cycles  of  94oC  for  30  sec,  57oC  for  30  sec,  72oC  for  50  sec).  Moderate  denaturation  temperature (94oC for 2 min followed by 30 cycles of 95oC for 30 sec, 57oC for 30 sec, 72oC  for 50  sec). A  final extension was done at 72oC  for 2 min before holding at 4oC.  In 50 µL  reaction volume, the PCR mix included 1X PCR buffer (Invitrogen), 1.5 mM MgCl2, 0.25 mM  dNTPs, 25 ng human gDNA (Promega #G1471), 0.5 µM each forward and reverse primers,  and 2.5 U of the polymerase. The PCR products were resolved on 1% agarose gel.    Reverse transcription within droplets: Total RNA from brain tissue (ThermoFisher AM7962)  5 μg was mixed with forward and reverse primers targeting the BEGAIN gene in Enzchek RT  buffer. The RNA‐primer mixture was  then  subjected  to  a dolomite microfluidic device  to  generate  water‐in‐oil  emulsion  droplets.  The  device  produced  approximately  3  million  droplets with an average diameter of 20 μm and a total input volume of 100 μL. Half of the  generated  droplets  (50  μL) were  transferred  to  a  thermocycler  and  underwent  reverse  transcription  and  PCR  amplification  using  the  following  protocol:  55°C  for  30  minutes,  followed by 35 cycles of 95°C for 30 seconds, 55°C for 30 seconds, and 72°C for 40 seconds.  After thermal cycling, 2 μL of the post‐PCR droplets were mixed with 2 μL of 2X concentrated  Picogreen dye on a microscope slide. Following a 10‐minute incubation at room temperature,  the sample was examined under a fluorescence microscope. The same microscopy procedure  was applied to pre‐PCR droplets as a comparison to highlight the reverse transcription and  amplification, with the post‐PCR droplets expected to exhibit fluorescence while the pre‐PCR  droplets would not. A negative control was also included, where everything was performed  the same but no brain total RNA was added from the beginning.  Reverse  transcription and RT‐PCR  from  cells  in organic  cosolvents: Two‐Step RT‐PCR on  Synthesized  Partial  KRAS  RNA.  A  119‐nucleotide  partial  KRAS  RNA  (sequence:  AGCUAAUUCAGAAUCAUUUUGUGGACGAAUAUGAUCCAACAAUAGAGGAUUCCUACAGGAAG 79    CAAGUAGUAAUUGAUGGAGAAACCUGUCUCUUGGAUAUUCUCGACACAGCAGGUCAA)  was  synthesized by Genscript.  Fifty picomoles of  the KRAS RNA were mixed with  50 pmol of  forward and  reverse primers, and 0.5 mM dNTPs  in EnzChek RT buffer. Different  reverse  transcriptases, either purified enzymes or unpurified preparations, were then added to the  reaction mixture. These reverse transcriptases included: A ‐ SFM4‐6 (40 ng, positive control),  B,  C,  D  ‐  5 million  bacterial  cells  expressing wild‐type  Taq,  SFM4‐6,  and  L‐5‐2‐F01‐RT1,  respectively. Four sets of the above mixtures were assigned different concentrations of 1,4‐ butanediol (BD) (0%, 5%, 10%, 20%). The RT reaction mixture (final volume 20 μL) was then  transferred to a PCR thermocycler and incubated at 80°C for 10 minutes followed by 55°C for  60 minutes. After the RT reaction, the samples were centrifuged before being used for the  subsequent PCR step. PCR was carried out using the NEB LUNA PCR mix (Cat. 3003S, 20 μL  final volume) with 0.5 μL of  the completed RT reaction mixture as  the  template. The PCR  products were analyzed on a 2.5% agarose gel.    Data Tables    Tables referenced in the specification hereinabove are provided below:          Thermostable and solvostable reverse transcriptases:  solvophilicity  80    e s g r n n ; d ‐2 %O S 1 A A A A A A A A A A . 3 D 4 . 1 e i v n o e ) s e r 0 u d 2 M N N N N N N N N N N 1 4 ) T 2 N 8 0 1 e r e q s n , r y c ti s C ( a s e a C m, 8 e 6 , O 2 . 0 %4 S A A A A A A A A A A 2 D 1 . N N 5 8 0 v d e e i c s n a 1 x 1 M T N N N N N N N N 8 1 N 3 i t c n i n a l l e w of o a b i e mc i ) l u m ^/ D B 6 . s a o f f 2 e s , U m A A A A A A A A A A 7 1 . % N N N N N N N N N N 0 D 7 N 0 7 0 r c e l b ) O ( yt 0 2 2 e m mo y r R l f C a o d P T , ( S i v i t ) y t M c D i T ( A T B A A A A A A A A A A 1 . 5 . 8 . p e t N N N 8 6 5 7 0 c B % N N N N N N N 5 vi t e R 0 7 7 4 d r a 1 A e N l D e e s l c b a i x l o a e s o f M t n e v 0 . 3 3 t e T a l u % 0 l o A A A A A A A A A A . . N 2 4 6 4 0 n r ( s N N N N N N N N N 5 3 e e e t f p i s r . o 1 C d w n e s il p e e n f l c e a s n s t n e a l y n e y c n ) 2 e s . 2 . 2 2 i e l n 2 u 0 0 . 0 . 1 D 0 D . 0 . 0 0 d ol ‐ c h , r t h t m i ci c f y c J- ± c 3 . ± 0 2 . ± ± 0 8 . N 0 D . ± ± 0 N N 9 . 2 . 2 D D D A > N N N NA ti y ti e s N h v i r e r f , m e p E 1 1 9 1 9 0 1 t e a r x n q oi C t ( D p c v t e a f o t c D B q 6 6 5 5 o e a e h c r e i f d t e g h i f t i a l T . 0 . 0 . 0 . 0 4 . 0 5 . 0 0 f p % 7 - ± ± ± D D D N ± N N ± ± 2 D D D A N mn T 7 . 8 4 . 8 4 . 8 1 . 0 . 3 . > N N Ns T i na n i o A i W 8 8 8 m r . e y c t c e n p , s ) 9 d u s e l n ni ei n l c b n o i i t i , % 5 2 . 0 . 5 . 6 . t ( , D 1 ± 2 ± 2 ± D 2 4 . 0 1 . D D 3 ± D 0 D D D 0 s c i e f o s f ) a T ,l l d n y C t ° B 8 i . 6 . 7 . N ± 1 N N 3 . N ± 8 N N N l 5 . 2 2 9 1 4 1 1 1 1 3 . 0 1 8 a e D r n B ( ( ) e o c i 7 b ) 9 e oi l s w e a t s n i m mt o e i t sa ht l a %t n 9 . 0 . 5 . 6 . 1 . 5 y l a c o i d a f e l p s r e mr 0 e , e C° v l 7 o ± 8 4 . ± 2 4 ± 6 D 4 1 D D 4 N ± N N ± . 0 D 1 D N ± D D N N N 0 p i l n a t m t e n d h e n T 5 . s 79 o c 7 . . 1 . 7 5 6 4 9 4 0 1 8 6 . 3 d p e mu t b v r ‐ n u l u o e l e a e d 4 , J 1 ‐ s c o b c a c yt i % v 5 , D 8 . n n 5 4 . 0 1 8 7 . 4 2 2 7 . 5 7 . 4 6 . 2 4 . 0 2 5 . 3 4 . 0 i a g , f d i l Ai Nt c C B 5 5 4 5 9 1 9 7 4 3 7 1 6 6 n y e t o il t n a r e p h DA ) g 2 7 i c t p a c i e s n / p b e f q o f a T o t o fi c a e r U p e m m ( %t 0 n e 7 . 3 . 4 . 8 . 8 . 6 . 1 . 8 . 1 5 . 6 . 6 9 . t at s e ‐ T n i n : S y l , v o Cl o 2 7 9 8 9 3 3 s 7 1 6 1 4 1 5 1 3 1 9 1 9 1 9 . 9 9 3 9 1 6 7 . 4 9 1 4 0 e l e d A P 2 1 1 1 7 o c h a h W t T ( . s e r N ; f m o r e s t n u s d e , , V I , G , R R R , , , G , I + + e h e c t i n , r e t a n e n i 9 0 9 V 4 I 2 2 a y a t r 6 4 7 8 2 3 7 9 4 0 7 6 2 7 6 R 7 0 I 8 6 0 0 3 6 8 2 5 7 K2 K 2 N 2 3 i b o c mm r s n A F 2 I E M8 7 K K K o , , , , 6 F, , R , , Q 1 , R T , E , V , 4 4 R 7 E K 7 7 E K D mv i r i l e t d C G r e t i e e t d a R R t 4 9 4 V 8 P 2 V 1 7 L P 3 V 8 2 K V 6 7 8 0 K 7 2 6 V R 1 4 1 2 V 1 9 4 + 7 4 + 7 4 + u 3 5 7 1 F 1 6 1 2 5 , I 9 2 A 0 6 7 0 K 5 E 6 A 0 5 7 K 6 A 3 K 6 S 7 F 1 0 7 7 0 7 1 0 F o c f r a el e ) f g w t o M Q, A I , L S , A P , 4 , R 7 A , , E , , , F MB- M - F Q , T D D , S V A - 2 3 - 2-p T f R u n i y s e i n : 2 8 3 3 4 7 F 2 1 5 7 4 A 6 4 L 9 3 4 S 4 3 4 0 0 1 1 4 6 P 4 2 8 - 5 5 - 7 5- L - L ( h s r a v t r D F L A E E P D V Ne e d f e p N h T s . a n t a o o r . e 1 8 2 7 9 1 8 8 4 T T 2 I R T I t 1 pi r R s e C e t p n l o d e 0 0 0 0 n C 0 0 0 0 - E- B- G - F- F- A- D- 9 q a R T - - 1 7 R 0 -1 p i r T l c b s P a l a r i l o l 3 C - 2 7 - 3 7 - 3 7 -7 2- 2 5 -5 3- 3 C 5 -5 P 0 S T F - B 2 - 0 3 F- c 2 S o Ra n p p e o r - N - N - N - - L - L - L - L W - -7 - t o T a r e mv r N 5- - 5 - r t f o e t e s y p L N L P q a ‐ T / 2 n o s s a n s d D i d e e n s o n ‐ o 2 i ‐ 5 e r B r a e e p s s w t i t i t e d i ‐ d L % s 3 . %4 e me r b n o n n n i i o o y b * * k a C ° 0 D D 1 . , D D 7 g c p 2 x M c c R t h e t e P 8 6 B B % N N % % , n n e e T c s i k R a C s a e C g P i e a H l c p i fi 7 c T 0 4 . 3 % 0 R T 8 e h o n t e P r * k me : R : t i i t w p e i h p q‐ T e h . d a e et p T II r H . g i N s n R‐ t e n i R w e n P R I A o N 1 0 p i r % %s t c l s ) u n T R h e k c . n L 5 , i C P G T m mr q‐ E , B t F e ‐ c s g C ° 2‐ 5 o 1 t . 0 6 . 1 D D 12 s a r ‐ 7 a e r . e e t 0 e t T R r a 5 5 ‐ L o r P , N N , %r B p t e g f i n i T % f F t e D 0 0 7 . 1 9 R e ‐ 3 ‐ e i d ni f i t 8 C P s r 7 q ‐ g r e s h s o N ‐ e T v R e N a r , T 1 . ht k s a n e w= * C C ° C ° ° 5 . n T ) 5 e t p o d D t h h g t i D B 0 ; 0 ; 7‐ D o t R‐ . g i o n y r a N . i e w e T % % 0 %2 ; . % N d a 1 e h t 0 F F ( e a II d d n d n T M H k t r a a l R 7 0 1 3 7 3 . 0 e p 3 s ‐ a 2 t m o B c a e P me m C ° .s d ‐ t e 5 p i T ^ . e s g n w t o e t g T n v ‐ r L ( r c s k d i n l r N ^ 5 5 t t a I T A n e C ° C ° C 5 ° 5 e e o a v l s D B t o e n e p a a R G E h t i v l 5 . 1 . 1 y d a k C P B w o s ‐ ‐ . 2‐ o % ; % ; D % N o b s o n i r P t s e r a o r a e q‐ T T R c 4 . 7 . 4 . o d b p R % 0 2 7 6 5 7 3 c e B E h g i m i c s r k y r i a r e N h p a e a n w e r a n o e d g i h ot p n e t r t o i g f t n D r r e g n i o c a l t e p n e v n e B of f e c i , u s m ) s e %0 e n r r et C ° l 6 . 9 5 o s D D 8 . 3 i s d o e g N I 5 o N N 2 8 A c 1 s e K s m a y t t , I z u l n b e s d n r r G % a p a l E 0 B 2 8 e T a b b y t i a p i r 5 c r R‐ – ci f ci g n s n . a g of 7 i 0 T d i r F d e B‐ / c fi i ) e c p e c e p u n d o d i e n 0 D l o a l O S 1 8 . 8 2 . 7 2 t d 3 ‐ U F s n s n o r 1 B x r o f %r y l u M T . 8 9 2 . 6 2 5 5 . 5 D . . 9 . 7 . N D N D N 4 8 0 0 D e e 7 s ; e ‐ R o o p l 0 p s % 6 7 2 7 5 8 7 1 4 5 3 1 3 0 4 N r e 6‐ c N ( d n n y t i o m C 1 ‐ 2 %4 4 1 1 1 v 4 c u , ‐ d e s 1 s n h ti ci f µ / ° r M U 8 % 1 6 4 1 e F l S e T b d R e t a i ‐ 1 o n t e w i k c e m , y a x 0 F e g r t , s T o fl ‐ d x a a T e p p s ti n vi o t c e ‐ ta o t c n e 9 v . 3 1 . l 1 4 . 6 9 D N o R‐ u s 2‐ A 5 a . r l o n T p %o 1 5 0 3 m 0 s m7 ‐ r e 0 B e L m ) r e K j 5 a h t i ) R L r a e l t A h ‐ t 3 n e f ‐ o 7 l o ‐ y f r e . h g i m w s 5 . o M y l e h D o n w F e o e ( l g k a g i P D d i l n a l O S y N t ti e B %, x a k a ni s e p F ( B o 1 r %r o fl M 6 0 y T . 2 7 . 3 1 . 6 1 . 4 1 8 . 3 2 D D D . 3 6 . 8 9 . 5 1 . 2 D v i , m t c 1 T a 7 r me p a o 0 p u s 4 t d e / ] F 1 ‐ 2 % %4 9 5 7 0 5 1 3 1 2 1 N N N 1 6 6 2 7 4 7 2 N 1 e t h o w t t ‐ 2 C ° 5 %0 0 1 a R‐ e y o n g o t ‐ 5 5 1 R C 1 T / l i l i e d e d ‐L P 0 F q ‐ e p me s a h l Ke l y ‐o t n 1 . 3 1 . 9 . ‐ 2 n T ‐ a l e II b x ‐ a , I L , b c e v l 5 0 . 1 6 4 9 1 R 5‐ o fl t p T m 5 J R % . 5 C 0 o s 4 8 4 4 d L ( n u a T s S i / r d e c / s ) e h t g i . F g P i * , , , , II o U F d n F * n ;) 1 T , R V 8 R K 2 7 4 T R , ‐ P , 2 R 1 G , K 4 M 8 7 , 4 6 G 5 M7 N t 2 pi r R e s n t o R ( n a i i K : a 2 r o d r P d‐ k d e d e 5 e ‐ 0 6 . n 1 o l 0 6 7 7 7 6 K M 0 1 6 4 3 7 E 6 7 7 ‐ M 4 1 6 5 6 4 L 7 E R 7 c s o C F ‐ A , , T R , B K ‐ 3 L , L P , , L V V ,I , E K M, E , N , K 4 7 t o r e e i l m l b y o r B [ E * a % e y p o y g l o l i F 2‐ 5‐ 7 9 2 0 2 ‐ 7 4 3 7 7‐ 2 8 2 1 2 9 2 F 5 4 7 4 S 4 1 5 5 1 8 M P a l o r y N 0 0 e p p ( 1 L A K E N A 2 A F 7 E 6 I 6 D 6 E B E N T p p o t 1 h t m e m e 0 F   Table 3. Combined screening of epPCR and shuffled libraries. Top hit clones from 1st, 7th CSR epPCR and  5th CSR of shuffled library clones were grown in a single 96‐well plate to compare the PCR performance in  two different conditions. Cells were grown as described in Methods. PCR was run in 5% BD ‐ 95oC for 6  min, followed by 16 cycles of 94oC for 30 sec, 57.8oC for 30 sec, 72oC for 30 sec, or in 7% BD‐ 98.3oC for 1  min, 95oC for 6 min, followed by 16 cycles of 94oC for 30 sec, 57.8oC for 30 sec, 72oC for 30 sec. In both  cases, final extension was done at 72oC for 2 min before holding at 4oC. We used 30 uL PCR product and  mixed with 1X SYBR Green I to run melt‐curve to determine the DNA product peak area. The melt‐curve  area was normalized by the total number of cells.     Clones  Mutation positions r Normalized peak  Normalized peak  CSR  elative to WT‐Taq  area (5% BD)  area (7% BD)  Rounds  WT  None  100.44 ± 23.59  21.99 ± 2.60  1 d N‐1‐1‐G09  A61V  197.18 ± 0.80  31.85 ± 8.50  n u o L‐1‐23‐H10  E520G, V586A, S612R  188.48 ± 6.24  25.81 ± 3.32  R‐ s e N‐1‐5‐E09  F749V  327.26 ± 41.38  38.40 ± 6.89  no l c L‐1‐14‐H10  V586A, S612R  195.06 ± 33.17  35.24 ± 0.62  po T L‐1‐17‐A09  L30P  189.54 ± 26.73  53.11 ± 23.79  )1 N‐7‐1‐E10  A29T, G200S, D237G, F749I  271.54 ± 15.71  33.03 ± 12.34  ne N‐7‐1‐F06  L16P, F73S, E388D, G396D, Q680R, F749I  282.03 ± 35.08  63.90 ± 3.93  G( R N‐7‐3‐C08  F482I, Q534R, A608V, F749I  295.32 ± 40.64  207.41 ± 19.39  CP 7 p d n N‐7‐2‐E02  F73S, A118V, F749I  313.65 ± 31.51  195.56 ± 3.13  e‐ u s o R N‐7‐4‐D06  F73S, N220D, I503T, S515N, F749V  275.38 ± 23.64  9.29 ± 11.84  en o l c N‐7‐4‐F04  A29T, S290G, L461R, D551G, L606M, S739G, F749I  321.12 ± 14.36  12.91 ± 15.39  po T N‐7‐3‐B07  A23P, L162P, I228V, L461R, A521V, E734G, F749I,  L768M  349.27 ± 0.00  14.94 ± 18.70  ) L‐5‐3‐A11  E434D, E507K, E742K, F749I  174.01 ± 27.44  177.24 ± 54.78  2 ne L‐5‐1‐C02  P10S, P382T, E434D, E507K  257.57 ± 1.33  245.31 ± 56.70  G( gn i L‐5‐3‐H08  R205K, K219E, E434D, V474I, A608V, INS661R,  256.17 ± 12.40  219.67 ± 16.54 l 5 E742K, F749I    f f u h d L‐5‐2‐F01  A97T, A608V, K702R, K762R  281.77 ± 6.32  297.06 ± 37.81 S n   ‐ u s o L‐5‐2‐A03  F8L, P10S, E434D, E507K, K762R, K767R  290.93 ± 24. e R 94  289.57 ± 12.38  no l L‐5‐3‐D04  P10S, E507K, Q680R, K762R  309.26 ± 27.01  297.72 ± 1.54  c po L‐5‐3‐E10  E507K, A608V, Q782H, F749I  276.52 ± 25.20  278.88 ± 11.69  T L‐5‐3‐D10  E434D, A608V, E742K, F749I  250.06 ± 34.69  233.10 ± 23.69  Synthetic  SPC9  P10S, A61V, T186I, D244V, K314R, E520G, V586A,  S612R, V730I, F749V  241.20 ± 2.11  75.62 ± 12.05            83    NGS‐based identification of Taq polymerase mutations that may confer reverse transcriptase activity  Table 4. Frequency of top 15 fragments as scored by next‐generation sequencing after each CSR round  of the (A) N‐epPCR libraries and (B) L‐StEP libraries. We conducted next‐generation sequencing after each  enrichment CSR round of the epPCR and StEP libraries. Frequency of each unique mutation species within  a  region was  calculated by dividing  the number of  reads of  specific mutation by  the  total number of  detected reads of sequences within that region and multiplying by 100 to yield percentage.  (A) N – epPCR libraries  MUTATIONS  N‐epPCR  1st CSR  2nd CSR  3rd CSR  4th CSR  5th CSR  6th CSR  7th CSR  (gen1)  Round  Round  Round  Round  Round  Round  Round  ['F749I']  0.0495  0.0542  1.4743  2.9412  13.3875  18.2843  10.8835  35.1010  ['F749V']  0.1551  0.1478  0.7399  3.0963  8.5384  8.4025  3.5531  8.0670  ['A29T']  0.0190  0.0253  0.1466  4.6592  2.9559  4.6426  1.4713  5.8463  ['F73S']  0.0705  1.8868  4.8544  4.0631  1.8668  2.5533  0.8363  3.3034  ['L5Q', 'A23P']  0.0000  0.0000  0.0000  0.2677  0.1393  0.4275  0.2286  1.7939  ['D320N']  1.1154  1.3776  0.8515  1.5723  1.1351  0.3776  0.1880  1.2802  ['E734G', 'F749I']  0.0000  0.0010  0.0011  0.0011  0.2149  0.3516  0.2810  1.2705  ['L461R']  0.0749  1.2154  1.2214  1.2582  0.8578  0.6414  0.3218  1.2198  ['E601D']  0.1238  0.0585  0.0219  0.1701  1.9568  0.1176  0.5816  1.1822  ['L287P']  0.0600  0.0174  0.0112  0.0336  0.4198  0.4972  0.5785  1.0236  ['A23P']  0.0054  0.0053  0.0036  0.0664  0.2631  0.2905  0.1327  0.9732  ['T509A']  0.0606  0.0123  0.0239  0.0223  0.5072  0.7204  0.2994  0.9730  ['R205K', 'K219E']  0.0000  0.0000  0.0020  0.1531  0.5036  0.5795  0.5224  0.8984  ['E465D']  0.7665  0.9061  0.0286  0.8826  1.1877  0.0638  0.6720  0.8788  ['E634A']  0.0413  0.0227  0.0360  0.0463  1.2159  0.1904  0.2747  0.8333  (B) L – StEP libraries  MUTATION  L‐StEP  1st CSR  2nd CSR  3rd CSR  4th CSR  5th CSR  Round  Round  Round  Round  Round  ['E434D', 'E507K']  0.0000  0.0012  0.1757  9.2082  29.4415  39.1755  ['A608V']  0.3715  1.0732  4.0182  16.1176  19.4364  19.0714  ['E742K', 'F749I']  0.0000  0.0000  0.0000  0.0320  1.6439  16.9840  ['F749L']  0.0274  0.0339  0.2103  6.5591  14.4111  16.9422  ['P10S']  6.4485  3.6107  4.1062  14.1814  18.6698  15.1147  ['E434D']  0.3730  2.3270  6.6165  28.7690  20.4126  13.0905  ['F73S']  0.2784  0.7479  3.5363  3.9523  4.6754  5.4740  ['R205K', 'K219E', M236T']  0.1439  0.5668  2.5233  4.4001  3.3920  3.7638  ['K767R']  0.0147  0.0882  0.6446  12.5791  12.7619  3.7321  ['K762R']  0.0105  0.0058  0.0869  0.0362  0.6161  3.7319  ['M236T']  0.0762  0.3506  0.7372  2.9340  2.7491  3.2943  ['P382T']  0.0080  0.0213  0.0335  0.0432  0.4291  2.3432  ['K219E', 'M236T']  0.0402  0.1655  0.6475  2.4056  1.9611  2.3004  ['R205K', 'K219E']  0.0572  0.1441  0.5579  1.7251  1.7519  2.1240  ['E507K']  0.1461  0.0121  0.8365  3.1618  3.7016  1.8211  84    Stability‐enhancing Taq polymerase mutations  Table 5. Stability of the WT and engineered Taq polymerases. (A): Comparison of half‐life between His‐ tagged WT  versus  cleaved  His‐wild  type  Taq  polymerase  (ND=  not  determined).  In method  1,  the  polymerase alone was heat treated whereas in method 2, we made Taq ternary complex (E‐TP‐dNTP) then  exposed to temperature. (B) shows the half‐lives of the engineered polymerases. (A)  Temp (oC)  t1/2 (min) Method 1  t1/2 (min) Method 2  His‐Taq  Non‐His Taq  His‐Taq  Non‐His Taq  95oC  41.2 ± 1.9  39.6  ND  ND  97.5oC  3.7 ± 1.5  3.6  3.9  4.2      (B) Half‐life of the WT and engineered Taq polymerases. We determined the thermostability (half‐life) of  wild type and its variants as described in Materials and Methods at 95oC and 97.5oC, in the presence and  absence of 5% BD. The half‐life (t1/2) of each variant was calculated using method 2; the binary complex  [E‐TP] was exposed to heat at specified time followed by activity assay at 72oC.   95 oC  97.5 oC  Rank 0% BD  t1/2, min  5% BD  t1/2, min  0% BD  t1/2, min  5% BD  t1/2, min  1  L‐5‐2‐F01  >300  L‐5‐2‐F01  ≥120  L‐5‐2‐F01  101.2 ± 14.6  L‐5‐2‐F01  111 ± 12.6  2  L‐5‐3‐D04  >300  L‐5‐3‐D04  113.8 ± 6.3  L‐5‐3‐D04  68.0 ± 4.1  L‐5‐3‐D04  31.3 ± 3.4  3  N‐7‐3‐C08  288 ± 9.5  N‐7‐3‐C08  68.5 ± 8.8  N‐7‐3‐C08  57.4 ± 7.9  N‐7‐3‐C08  22.8 ± 1.2  4  N‐7‐2‐E02  287.5 ± 20.8  N‐7‐2‐E02  66.2 ± 3.5  N‐7‐2‐E02  46.4 ± 8.0  N‐7‐2‐E02  19.6 ± 2.0  5  N‐7‐3‐B07  277.2 ± 7.5  N‐7‐3‐B07  61.9 ± 6.1  N‐7‐3‐B07  49.6 ± 2.5  N‐7‐3‐B07  14.7 ± 2.5  6  L‐1‐17‐A09  >120  SPC8  31.5 ± 3.5  L‐1‐17‐A09  30.4 ± 8.5  SPC8  5.8 ± 0.4  7  N‐1‐01‐D05  102.1 ± 19.2  L‐1‐15‐A07  27.8 ± 14.0  SPC8  26.8 ± 6.0  L‐1‐32‐D07  4.1 ± 2.0  8  N‐1‐05‐E09  99.4 ± 12.6  L‐1‐17‐A09  23.8 ± 11.9  L‐1‐36‐A08  19.5 ± 3.1  N‐1‐2‐G02  3.3 ± 0.6  9  L‐1‐15‐A07  91.3 ± 10.3  L‐1‐36‐A08  21.8 ± 5.0  L‐1‐23‐H10  15.2 ± 2.7  N‐1‐05‐E09  3.0 ± 1.8  10  L‐1‐36‐A08  89.0 ± 4.6  N‐1‐2‐G02  21.5 ± 6.5  L‐1‐15‐A07  14.4 ± 6.5  L‐1‐15‐A07  2.9 ± 1.4  11  L‐1‐23‐H10  88.8 ± 16.0  N‐1‐1‐D05  21.2 ± 2.7  N‐1‐01‐D05  13.5 ± 4.9  L‐1‐36‐A08  2.9 ± 0.3  12  L‐1‐22‐H02  82.3 ± 3.2  L‐1‐23‐H10  19.0 ± 6.1  N‐1‐1‐G11  11.7 ± 4.3  L‐1‐14‐H10  2.9 ± 1.5  13  L‐1‐32‐D07  77.7 ± 2.5  L‐1‐14‐H10  17.3 ± 1.8  L‐1‐32‐D07  10.7 ± 7.1  L‐1‐23‐H10  2.4 ± 1.6  14  N‐1‐1‐G09  76.4 ± 1.2  L‐1‐22‐H02  17.0 ± 1.5  N‐1‐2‐G02  10.2 ± 5.2  N‐1‐01‐D05  2.2 ± 0.4  15  SPC8  71.8 ± 23.0  L‐1‐32‐D07  16.7 ± 4.2  L‐1‐22‐H02  9.9 ± 3.0  N1‐01‐G11  2.1 ± 0.2  16  N‐1‐1‐G11  68.3 ± 17.1  N‐1‐5‐E09  15.8 ± 5.3  L‐1‐14‐H10  9.5 ± 3.7  L‐1‐22‐H02  2.0± 0.0  17  L‐1‐14‐H10  65.5 ± 9.8  N1‐1‐G11  15.4 ± 2.9  N‐1‐05‐E09  8.2 ± 2.8  L‐1‐17‐A09  2.0 ± 1.1  18  N‐1‐2‐G02  64.3 ± 9.8  N‐1‐1‐G09  13.8 ± 0.4  SPC4  6.8 ± 0.4  SPC4  1.9 ± 0.4  19  SPC4  44.8 ± 9.5  SPC4  11.0 ± 2.8  N‐1‐1‐G09  4.8 ± 3.0  N‐1‐01‐G09  1.9 ± 0.2  20  WT  41.2 ± 1.9  WT  6.4 ± 2.1  WT  3.7 ± 1.5  WT  0.8 ± 0.0  85    Table 6. (A) Melting temperature (TM) profile of the wild type and top clones. We tested the TM of His‐ tag WT and top hit clones from N1 series 1st, 7th round and L5 series enrichment in a buffer containing 20  mM Tris‐HCl pH 8.0, 100 mM KCl, 0.1 mM EDTA, 1 mM DTT and 5% glycerol. [BD=1,4‐butanediol]  Taq  Mutatio Exo‐domain  Pol‐Domain TM  Polymerase  ns  5% BD  TM (oC)  (oC)  His‐tag WT  NONE  No  88.86±1.29  96.49±0.07  Yes  81.84±0.60  94.45±0.03  N‐7‐1‐E10  A29T, G200S, D237G, F749I  Yes  86.36±0.17  96.66±0.03  N‐7‐1‐F06  L16P, F73S, E388D, Q680R, F749I  Yes  78.88±0.64  96.6±0.03  N‐7‐2‐E02  F73S, A118V, F749I  Yes  90.15±0.27  96.61±0.03  N‐7‐3‐B07  A23P, L162P, I228V, L461R, A521V, E734G, F749I, L768M  Yes  81.56±0.09  97.36±0.08  N‐7‐3‐C08  K31R, F482I, Q534R, A608V, F749I  Yes  86.53±0.21  96.81±0.02  N‐7‐4‐D06  N220D, I503T, S515N, F749V  Yes  87.00±0.85  96.45±0.11  N‐7‐4‐F04  A29T, F73S, S290G, L461R, D551G, L606M, S739G, F749I  Yes  88.46±0.39  96.14±0.05  L‐5‐2‐F01  A97T, A608V, K702R, K762R  Yes  82.33 ± 0.19  100.18 ±0.11  L‐5‐3‐D04  P10S, E507K, Q680R, K762R  Yes  82.72 ±0.08  96.32 ±0.03  N‐1‐5‐E09  F749V  Yes  101.45 ±0.19  ND  L‐5‐2‐F01‐RT1  A97T, A608V, K702R, K762R, E742K, M747K              No  ND  92.75±0.06  Yes  ND  91.61±0.00  L‐5‐2‐F01‐RT2  A97T, A608V, K702R, K762R, D732N  No  86.74±0.08    95.91±0.09  Yes  86.89±0.00    93.95±0.00  SFM4‐6  I614E, E615G, D655N, L657M, E681K, E742N, M747R  No  ND  87.47±0.06  (Stoffel)  Yes  ND  84.72±0.05  SFM4‐3  I614E, E615G, V518A, N583S, D655N, E681K, E742Q,  No  ND  87.20±0.04  M747R (Stoffel)  Yes  ND  84.93±0.01    (B) Polymerase melting temperature dependence on cosolvent concentration for wild type, early round  and selected synthetic clones.   Polymerase  0% BD  1% BD  2% BD  3% BD  5% BD  7.5% BD  10% BD  WT  102.96 ±0.12  102.30±0.01  101.78±0.18  101.13±0.15  99.75±0.40  99.04±0.24  97.75±0.19  His‐WT  103.40 ±0.2  102.48±0.14  101.70±0.06   101.11±0.17  99.96±0.04  98.91±0.11  97.31±0.15  N‐1‐1‐G9  104.05±0.21  103.18±0.03  102.49±0.09   102.17±0.15  101±0.25  99.92±0.22  98.98±0.41  N‐1‐5‐E9  105.03±0.33  104.04±0.06  103.19±0.08   102.85±0.23  101.45±0.19  100.3±0.29  99.23±0.19  N‐1‐1‐D5  104.48±0.20  103.7±0.13  103.02±0.08   102.39±0.17  101.36±0.05  100.2±0.07  99.53±0.41  L‐1‐14‐H10  103.86±0.11  103.27±0.30  102.11±0.65   101.9±0.06  100.85±0.06  99.66±0.06  98.38±0.23  L‐1‐17‐A09  104.75±0.08  103.78±0.19  101.96±0.77   102.27±0.18  101.22±0.27  99.67±0.12  98.06±0.07  L‐1‐23‐H10  104.89±0.57  103.75±0.09  102.86±0.06   102.14±0.08  101.18±0.28  99.94±0.28  98.4±0.03  SPC1  105.96±0.30  ND  ND  ND  103.31±0.12  ND  ND  SPC2  104.58±0.19  ND  ND  ND  101.87±0.13  ND  ND  SPC3  105.66±0.11  ND  ND  ND  103.12±0.06  ND  ND  SPC4  105.01±0.23  ND  ND  ND  102.26±0.25  ND  ND  SPC5  104.31±0.14  103.61±0.12  103.04±0.12  102.99±0.37  101.27±0.31  100.05±0.03  98.34±0.04  86    SPC6  106.61±1.10  ND  ND  ND  104.08±0.35  ND  ND  SPC7  104.51±0.39  ND  ND  ND  101.76±0.24  ND  ND  SPC8  105.53±0.22  ND  ND  ND  102.88±0.20  ND  ND  SPC9  103.76±51  103.46±0.21  101.91±0.00  100.78±1.33  101.52±0.08  99.88±0.12  98.7±0.11        Table 7. ΔΔG Calculation. Stability of mutant clones from the final rounds of selection were computed  using MAESTROweb software by introducing mutations into coordinate file PDB:1TAU.     ΔΔG  ΔΔG (kJ/mol),  Clone ID  Mutations Relative to WT‐Taq  (kJ/mol),  pol domain  all mutations  mutations  L‐5‐2‐F01  A97T, A608V, K702R, K762R  ‐2.22  ‐0.54  N‐7‐3‐C08  K31R, F482I, Q534R, A608V, F749I  ‐1.36  ‐0.51  L‐5‐3‐D04  P10S, E507K, Q680R, K762R  ‐0.64  ‐0.11  N‐7‐4‐F04  A29T, F73S, S290G, L461R, D551G, L606M, S739G, F749I  ‐0.17  ‐0.20  N‐7‐1‐E10  A29T, G200S, D237G, F749I  0.06  ‐0.40  N‐7‐1‐F06  L16P, F73S, E388D, Q680R, F749I  0.07  ‐0.14  N‐7‐4‐D06  N220D, I503T, S515N, F749V  0.30  ‐0.10  N‐7‐2‐E02  F73S, A118V, F749I  0.68  ‐0.40  N‐7‐3‐B07  A23P, L162P, I228V, L461R, A521V, E734G, F749I, L768M  1.43  0.20    Table 8. GC bias of GC‐rich templates with engineered polymerases.   GC‐rich templates were PCR amplified together with either WT or L‐5‐2‐F01 or N‐7‐3‐B07 mutants under  the same conditions. Gene‐specific primers (one set of FWD and REV for one template) were added in the  PCR reactions. A) The PCR mix contained 7.25U of each enzyme in the presence of BD and 5 ng of each  template. The reaction mixture contained 0.75 mM dNTP, 1 mg/mL BSA, 3.5 mM MgCl2, 0.5 μM of each  primer. B) The PCR mix contained 1.25U of each enzyme in the presence of BD and 5 ng of each template.  The reaction mixture contained 0.25 mM dNTP, 1 mg/mL BSA, 3.5 mM MgCl2, 0.5 μM of each primer. The  following PCR program were used for both Tables A and B: 98.3oC for 1 min and 95oC for 6 min, 25 cycles  of 94oC for 30 sec, 57.8oC for 30 sec, 72oC for 50 sec. PCR products were  isolated from 1% agarose gel  electrophoresis  and  subjected  to NGS  analysis. Percent  frequency of each  gene  in  the PCR pool was  calculated from the total number of read sequences. More details of GC content (%) is presented in Fig.  11.   GC content (%)  Frequency read sequence in percent (%)  Name of  Gene  size  WT‐Taq  L‐5‐2‐F01  N‐7‐3‐B07 polymerase  Gene  Ave  Max  (~)  polymerase 4% BD  polymerase 10%  BD  10% BD  4% BD    A   c‐Jun  64  77.5  375  57.09  3.77  9.39  ‐  BEGAIN  71.3  80  750  15.91  31.46  16.98  ‐  DACT3  79.2  100  750  0.02  13.4  24.66  ‐  87    PO3F3  77.7  92.5  750  0.07  2.19  13.56  ‐  BAIP3  64.4  80  750  26.91  49.17  35.42  ‐    B  pASK‐Taq  61  70  531  61  ‐  ‐  53  c‐Jun  64  77.5  375  39  ‐  ‐  47  Table 9: Efficiency of top‐ranked Taq mutants on templates of varying GC contents, in the presence of  varying  concentrations  of  1,4‐butanediol  (BD). We  used  equal  activities  of  the WT  and  engineered  polymerases to assess the amplification efficiencies of the enzymes. The Cq values for the WT and the top  clones  selected  from  generation  1  library  (one  clone  from  1st  enrichment  and  three  clones  from  7th  enrichment round), two clones from generation 2 after the 5th enrichment, and a synthetic clone SPC9  (Table 3). The following PCR programs were used to amplify (A) WT‐Taq template: 95oC for 6 min, 16  cycles of 94oC for 30 sec, 57.8oC for 30 sec, 72oC for 60 sec, using Q1 and Q2 primers. (B) c‐Jun template:  95oC for 6 min, 16 cycles of 94oC for 30 sec, 57.8oC for 30 sec, 72oC for 60 sec, using J1 and J3 primers. (C)  WT‐Taq template: 98.3oC for 1 min, 95oC for 6 min, 17 cycles of 94oC for 30 sec, 57.8oC for 30 sec, 72oC  for 60 sec, using Q1 and Q2 primers, and (D) c‐Jun template: 98.3oC for 1 min, 95oC for 6 min, 16 cycles  of 94oC for 30 sec, 57.8oC for 30 sec, 72oC for 60 sec, using J1 and J3 primers. Cq values are from triplicate  experiment. NA = we did not observe Cq value up to 16th PCR cycle.   (A) Template: WT‐Taq  % BD  WT enzyme  N‐7‐3‐C08  N‐7‐2‐E02  N‐7‐3‐B07  N‐1‐5‐E09  SPC‐9  L‐5‐2‐F01  L‐5‐3‐D04  0  9.46 ± 0.52  9.44 ± 0.57  9.39 ± 0.57  9.23 ± 0.68  9.38 ± 0.53  9.15 ± 0.50  9.35 ± 0.40  9.35 ± 0.39  2  8.36 ± 0.53  8.10 ± 0.49  7.93 ± 0.51  8.08 ± 0.52  8.19 ± 0.66  7.74 ± 0.49  7.62 ± 0.47  7.23 ± 0.45  4  8.48 ± 0.47  8.11 ± 0.37  7.84 ± 0.47  7.83 ± 0.43  8.03 ± 0.43  7.81 ± 0.46  7.56 ± 0.52  7.24 ± 0.39  5  8.84 ± 0.73  8.10 ±0.48  8.1 ± 0.48  8.07 ± 0.56  8.30 ± 0.50  7.92 ± 0.55  7.63 ± 0.44  7.52 ± 0.51  6  12.52 ± 1.59  8.34 ± 0.45  8.19 ± 0.52  8.13 ± 0.45  8.53 ± 0.40  8.08 ± 0.38  7.92 ± 0.41  7.64 ± 0.38  7  NA  8.66 ± 0.55  8.43 ± 0.61  8.39 ± 0.48  9.14 ± 0.57  8.30 ± 0.47  8.08 ± 0.51  8.00 ± 0.38  8  NA  8.91 ± 0.50  8.97 ± 0.43  8.70 ± 0.39  9.96 ± 0.92  8.73 ± 0.41  8.26 ± 0.41  8.32 ± 0.29  10  NA  10.12 ± 1.38  10.9 ± 0.10  10.03 ± 0.78  NA  9.53 ± 0.73  9.45 ± 0.16  8.72 ± 0.44  (B) Template: c‐Jun  % BD  WT enzyme  N‐7‐3‐C08  N‐7‐2‐E02  N‐7‐3‐B07  N‐1‐5‐E09  SPC9  L‐5‐2‐F01  L‐5‐3‐D04  0  NA  16.89 ± 0.04  15.68 ± 0.65  15.28 ± 0.56  NA  16.80 ± 0.05  NA  NA  2  13.36 ± 0.90  12.85 ± 1.34  11.99 ± 0.77  11.92 ± 0.55  12.51 ± 0.70  12.66 ± 1.23  13 ± 1.36  12.62 ± 1.30  4  10.21 ± 0.47  9.82 ± 0.41  9.28 ± 0.11  9.19 ± 0.05  9.78 ± 0.14  9.75 ± 0.47  9.76 ± 0.89  9.31 ± 0.52  5  10.53 ± 0.27  9.83 ± 0.22  9.49 ± 0.05  9.30 ± 0.09  10.02 ± 0.06  9.58 ± 0.22  9.51 ± 0.40  9.37 ± 0.40  6  13.99 ± 1.37  10.09 ± 0.22  9.60 ± 0.07  9.46 ± 0.09  10.28 ± 0.03  9.79 ± 0.26  9.84 ± 0.37  9.52 ± 0.44  7  NA  10.50 ± 0.21  10.00 ± 0.11  9.96 ± 0.18  11.36 ± 0.32  10.12 ± 0.11  9.99 ± 0.33  9.82 ± 0.39  8  NA  10.94 ± 0.12  10.90 ± 0.35  10.43 ± 0.13  14.56 ± 1.42  10.85 ± 0.19  10.21 ± 0.34  10.52 ± 0.53  10  NA  NA  14.21  16.47  NA  16.29  11.73 ± 0.83  12.73 ± 0.60  (C) Template: WT‐Taq  % BD  WT enzyme  N‐7‐3‐C08  N‐7‐2‐E02  N‐7‐3‐B07  N‐1‐5‐E09  SPC9  L‐5‐2‐F01  L‐5‐3‐D04  0  9.46 ± 0.52  9.44 ± 0.57  9.39 ± 0.57  9.23 ± 0.68  9.38 ± 0.53  9.15 ± 0.50  9.35 ± 0.40  9.35 ± 0.39  2  8.36 ± 0.53  8.10 ± 0.49  7.93 ± 0.51  8.08 ± 0.52  8.19 ± 0.66  7.74 ± 0.49  7.62 ± 0.47  7.23 ± 0.45  4  8.48 ± 0.47  8.11 ± 0.37  7.84 ± 0.47  7.83 ± 0.43  8.03 ± 0.43  7.81 ± 0.46  7.56 ± 0.52  7.24 ± 0.39  88    5  8.84 ± 0.73  8.10 ±0.48  8.1 ± 0.48  8.07 ± 0.56  8.30 ± 0.50  7.92 ± 0.55  7.63 ± 0.44  7.52 ± 0.51  6  12.52 ± 1.59  8.34 ± 0.45  8.19 ± 0.52  8.13 ± 0.45  8.53 ± 0.40  8.08 ± 0.38  7.92 ± 0.41  7.64 ± 0.38  7  NA  8.66 ± 0.55  8.43 ± 0.61  8.39 ± 0.48  9.14 ± 0.57  8.30 ± 0.47  8.08 ± 0.51  8.00 ± 0.38  8  NA  8.91 ± 0.50  8.97 ± 0.43  8.70 ± 0.39  9.96 ± 0.92  8.73 ± 0.41  8.26 ± 0.41  8.32 ± 0.29  10  NA  10.12 ± 1.38  10.9 ± 0.10  10.03 ± 0.78  NA  9.53 ± 0.73  9.45 ± 0.16  8.72 ± 0.44  (D) Template: c‐Jun  % BD  WT enzyme  N‐7‐3‐C08  N‐7‐2‐E02  N‐7‐3‐B07  N‐1‐5‐E09  SPC9  L‐5‐2‐F01  L‐5‐3‐D04  0  15.35 ± 0.95  15.71± 0.33  13.89 ± 0.53  13.55 ± 0.20  15.26 ± 1.64  15.99 ± 0.34  16.91  16.53  2  12.76 ± 0.48  13.21 ± 0.23  12.22 ± 0.07  12.28 ± 0.21  12.14 ± 0.06  13.28 ± 0.17  14.01 ± 0.15  13.7±0.06  4  12.23 ± 0.59  10.17 ± 0.13  9.44 ± 0.08  9.34 ± 0.02  10.06 ± 0.17  10.28 ± 0.17  10.02 ± 0.33  10.05 ± 0.29  5  NA  9.96 ± 0.15  9.45 ± 0.13  9.21 ± 0.14  10.15 ± 0.16  9.86 ± 0.21  9.67 ± 0.16  9.68 ± 0.18  6  NA  10.23 ± 0.14  9.81 ± 0.14  9.36 ± 0.19  11.70 ± 0.83  9.95 ± 0.18  10.03 ± 0.16  9.73 ± 0.14  7  NA  10.32 ± 0.21  10.23 ± 0.18  9.84 ± 0.19  NA  10.15 ± 0.17  10.02 ± 0.15  9.87 ± 0.14  8  NA  10.95 ± 0.13  11.95 ± 1.85  10.51 ± 0.35  NA  11.01 ± 0.37  10.38 ± 0.36  10.86 ± 0.55  10  NA  NA  NA  NA  NA  NA  11.32 ± 0.41  NA    Table  10:  Efficiency  of WT‐Taq  and  the mutant,  L‐5‐2‐F01  in  presence  of  varying  concentration  of  cosolvent 2‐pyrrolidone or sulfolane: We used equal activities of  the WT and a mutant, L‐5‐2‐F01  to  assess  the  amplification  efficiencies  of  the  enzymes.  Cq  values were  averaged  ±  SD  from  triplicate  experiment. NA = we did not observe Cq value above background. TOP: 2‐pyrrolidone; c‐Jun template.  BOTTOM: sulfolane; c‐Jun template. In both the cases, PCR was conducted either at 95oC for 6 min or  98.3oC for 1 min + 95oC for 6 min followed by 16 cycles of 94oC for 30 sec, 57.8oC for 30 sec, 72oC for 60  sec, using J1 and J3 primers.   2‐pyrrolidone  95⁰C for 6 min  98.3⁰C for 1 min, 95⁰C for 6  (%)  min  WT  L‐5‐2‐F01  WT  L‐5‐‐2‐F01  0  15.42 ± 0.17  16.25 + 0.11  13.26  14.73 + 0.06  0.5  14.45 + 0.19  14.92 + 0.22  NA  13.64 + 0.47  1  NA  12.21 + 0.13  NA  11.98 + 0.15  1.5  NA  12.01 + 0.16  NA  11.57 + 0.17  2  NA  10.59 + 0.06  NA  10.58 + 0.59  2.5  NA  10.55 + 0.14  NA  10.34 + 0.22  3  NA  10.65 + 0.15  NA  10.07 + 0.15  3.5  NA  10.66 + 0.07  NA  10.26 + 0.08  4  NA  10.60 + 0.06  NA  10.19 + 0.15  4.5  NA  10.45 + 0.23  NA  10.22 + 0.20  5  NA  10.73 + 0.07  NA  10.45 + 0.10  95⁰C for 6 min 98.3⁰C for 1 min, 95⁰C for 6  sulfolane (%)    min  WT   L‐5‐2‐F01  WT  L‐5‐2‐F01  0  NA  NA  15.35 + 0.79  16.36 + 0.11  1  12.93 + 0.30  13.81 + 0.25  NA  13.68 + 0.59  2  NA  11.64 + 0.18  NA  11.84 + 0.30  89    3  NA  11.44 + 0.10  NA  11.48 + 0.23  4  NA  11.69 + 0.17  NA  11.76 + 0.16  5  NA  12.07 + 0.13  NA  12.12 + 0.20  6  NA  12.6 + 0.39  NA  12.81 + 0.55  7  NA  13.77 + 0.28  NA  16.55  8  NA  15.9  NA  NA  9  NA  NA  NA  NA  10  NA  NA  NA  NA      Table 11: Fidelity of the WT polymerase and mutant derivatives. We determined the fidelity of the top  clones apparent error was calculated using the formula described in Materials and Methods. We used WT  and variant Taq polymerase to amplify the entire LacZ gene, followed by apparent error rate assessment.  T and W represents the number of total and white colonies respectively. Apparent error (Error app.)  is  given  in changes per base pair  incorporated e.g.,  in case of WT, one nucleotide change  is expected per  19173 nucleotides incorporated. Fidelity of the WT was assessed twice independently.      Clones  Total  Blue  White  (W/T)*100  Error app.  WT  2414  2016  398  16.5  1/19173  WT  4111  3654  457  12.5  1/14062  N‐1‐5‐E09  5927  5535  392  7.1  1/17802  SPC9  4578  3797  781  10.6  1/11006  N‐7‐3‐C08  5058  4671  387  8.3  1/18004  N‐7‐2‐E02  4259  3937  322  8.2  1/19697  N‐7‐3‐B07  5022  4599  423  9.2  1/16564  L‐5‐2‐F01  5027  4659  368  7.9  1/15522  L‐5‐3‐D04  5972  5550  422  7.6  1/16366                        90    Table 12. Effect of 1,4‐butanediol (BD) on specific activities of the WT and engineered Taq polymerases.  Proteins were purified and quantified as described. Equal amount of proteins were used  to assess the  primer extension activity of the enzymes in absence and in presence of 5% BD.  Libraries and  Specific Activity  enrichment rounds/  Unique Mutations  (mU/ng)  % Loss  CLONE ID  0% BD  5% BD  WT  NONE  119.5  30.39  74.57  1 N1‐1‐G11  K206Q  75.28  54.09  28.14  dn N‐1‐1‐G09  A61V  55.91  38.90  30.43  uo N‐1‐1‐G05  E832K  115.85  82.66  28.65  R, 1 N‐1‐1‐G07  L365Q  104.52  65.03  37.78  ne N‐1‐2‐G04  T186I  119.87  95.42  20.39  G N‐1‐2‐C11  P10S  58.47  46.19  21  N‐1‐1‐B01  A54V  86.24  69.29  19.66  N‐1‐5‐E09  F749V  67.97  54.70  19.52  N‐1‐2‐G02  D244V, K314R, V586A, S612R  62.13  44.98  27.6  N‐1‐5‐H7‐ M1  F667Y  69.07  45.59  34  N‐1‐5‐H7‐ M2  F749Y  66.51  46.19  30.55  L‐1‐36‐A08 E434D  42.39  33.43  21.14  Gen 2,  Round 1  L‐1‐15‐A07 P10S, V730I  65.78  40.11  39.02  L‐1‐22‐H02 A54V  82.60  62.22  23.46  L‐5‐2‐F01   A97T, A608V, K702R, K762R  139.80  94.70  32.26  Gen 2,  L‐5‐3‐D04  P10S, E507K, Q680R, K762R  99.80  74.70  25.15  Round 5   L‐5‐2‐F08  E434D, E507K, K762R  193.57  121.95  37.00  L‐5‐3‐A08  P10S, A608V, K762R  193.05  95.69  50.43  N‐7‐1‐E10  A29T, G200S, D237G, F749I  210.19  90.44  56.97  N‐7‐1‐F06  L16P, F73S, E388D, G396D, Q680R, F749I  121.45  38.79  68.04  7 N‐7‐3‐C08  F482I, Q534R, A608V, F749I  172.66  55.77  67.7  dn u N‐7‐2‐E02  F73S, A118V, F749I  167.29  50.41  69.87  oR N‐7‐4‐D06  F73S, N220D, I503T, S515N, F749V  99.65  57.92  41.88  ,1 A29T, S290G, L46 e N‐7‐ 1R, D551G, L606M, S739G,  n 4‐F04  F749I  84.23  37.55  55.42  G N‐7‐3‐B07  A23P, L162P, I228V, L461R, A521V, E734G,  F749I, L768M  149.42  41.03  72.54  N‐7‐3‐G09  L5Q, A23P, F749I        c SPC1  P10S, A61V, T186I, V586A, S612R, 2494ΔG  64.68  32.82  49.26  it e s SPC2  P10S, A61V, T186I, V586A, S612R  61.03  41.33  32.28  h e t n n ol SPC4  P10S, A61V, D244V, S612R, E832K  59.93  43.76  26.98  y S c SPC5  A54V, A61V, T186I, K314R, E520G, S612R  50.80  31.61  37.78  SPC6  G12T, A54V, T186I, D244V, F667Y, F749V  61.39  51.66  15.85  91    SPC7  P10S, L30P, A61V, L365P, V586A, S612R,  E832K  91.36  66.25  27.49  SPC8  L30P, A54V, E434D, K206Q, S612R, V730I,  F749V  43.85  40.72  7.14  SPC9  P10S, A61V, T186I, D244V, K314R, E520G,  V586A, S612R, V730I, F749V  39.10  42.55  ‐8.81          Table 13: Tm and GC contents of GC‐rich targets employed in the present work. Templates 12‐14, which  have lower GC contents than most of the other templates, were studied in reference4 without engineered  polymerases. *Taq polymerase from Thermus aquaticus.  No.  Human Gene  Ave GC content (%)  Predicted Tm (oC)  Gene size (bp)  1  B3GT6  72.8  93.8  742  2  BEGAIN  71.3  93.3  776  3  CD5R2  64.2  90.4  793  4  CDN1C  77.4  95.7  720  5  CECR6  69.6  92.5  774  6  DACT3  79.2  96  722  7  F8I2  77.9  96  735  8  JAG2  57.6  87.3  774  9  PO3F3  77.7  96  790  10  BAIP3  64.4  90.5  788  11  KLF14  71.6  93.5  777  12  FOLH1 (PSM)  52.4  85.1  511  13  c‐Jun  64.4  90.6  996  14  bovine GTP  58.4  87.8  661  15  WT‐Taq*  61  88.1  531                    92    Table 14: Oligonucleotides used in this study.   Name  Sequence (5’‐>3’)  Sequence Listing  Taq‐CSR‐P1  CAGGAAACAGCTATGACAAAAATCTAGATAA SEQ ID NO: 86  CGAGGGCAA  Taq‐CSR‐P2  GTAAAACGACGGCCAGTAGCTTAGTTAGATAT SEQ ID NO: 87  CAGAGACCATGGT  Taq‐ReAmp‐P3  CAGGAAACAGCTATGAC  SEQ ID NO: 88  Taq‐ReAmp‐P4  GTAAAACGACGGCCAGT  SEQ ID NO: 89  CSR‐Select‐F  GAATAGTTCGACAAAAATCTAGATAACGAGG SEQ ID NO: 90  GCAAAAAATG  AU‐Gen‐Taq‐R  CCTGCAGGTCGACTTATTCTTTCGCGCTCAGC SEQ ID NO: 91  CAGTC  Primer J1  ATGACTGCAAAGATGGAAACG  SEQ ID NO: 92  Primer J2  TCAAAATGTTTGCAACTGCTGCG  SEQ ID NO: 93  Primer J3  TGTTCTGGCTGTGCAGTT  SEQ ID NO: 94  His‐F  CACCACCACCGTGGTATGCTGCCGCTG  SEQ ID NO: 95  His‐R  ATGATGATGCATTTTTTGCCCTCGTTATCTAGA SEQ ID NO: 96  TTTTTGTC  6His‐TEV‐R  TCGTGGTGGTGATGATGATGCATTTTTTGCC SEQ ID NO: 97  CTCGTTATCTAGATTTTTGTC  6His‐TEV‐Ser‐F  GAACCTGTACTTCCAGTCCCGTGGTATGCTG SEQ ID NO: 98  CCGCTG  Taq‐Q1  GGTCACCCGTTCAACCTGAACAG  SEQ ID NO: 99  Taq‐Q2  GTCAACCGCCTTCACGCGGAAC  SEQ ID NO: 100  40M13LFF  FAM‐ SEQ ID NO: 101  GTTTTCCCAGTCACGACGTTGTAAAACGACG GCC  NGSR1_FWD  AAA TCT AGA TAA CGA GGG CAA AAA  SEQ ID NO: 102  NGSR1_REV  GTC TGC GGT CAG AAT ACG  SEQ ID NO: 103  NGSR2_FWD  GAG AAA GAA GGT TAC GAG GTT  SEQ ID NO: 104  NGSR2_REV  ACC GAA CTC CAG ACG TTC  SEQ ID NO: 105  NGSR3_FWD  CTG CGT GCG TTC CTG  SEQ ID NO: 106  NGSR3_REV  ACC CCA CAG GTT CGC  SEQ ID NO: 107  NGSR4_FWD  CTG AGC GAA CGT CTG TTC  SEQ ID NO: 108  NGSR4_REV  GGT ACG CGG GTG AAT CAG  SEQ ID NO: 109  NGSR5_FWD  GAC CCG CTG CCG GAC  SEQ ID NO: 110  NGSR5_REV  GTA ACG TTC GAT GAA CGC TTG  SEQ ID NO: 111  NGSR6_FWD  GCG ATT CCG TAC GAG GAA  SEQ ID NO: 112  NGSR6_REV  CCC CTG CAG GTC GAC  SEQ ID NO: 113  SATP*  tagcgaaggatgtgaacctaatcccTGCTCCCGCGGC SEQ ID NO: 114  CGatctgcCGGCCGCGGGAGCA  B3GT6_FWD  GACGCCTACGAAAACCTCAC  SEQ ID NO: 115  93    B3GT6_REV  CCGAGAAGAAGCCCCAGTAG  SEQ ID NO: 116  B3GT6_1_FW GCGACGCCTACGAAAACCTC  SEQ ID NO: 117  D  B3GT6_1_REV  GACGCAGCGACCACAAGC  SEQ ID NO: 118  EGFR_FWD  TCTGGCCACCATGCGAAGC  SEQ ID NO: 119  EGFR_REV  ACCAGTTGAGCAGGTACTGGG  SEQ ID NO: 120  CDN1C_FWD  CCGCAGCACATCCACGAT  SEQ ID NO: 121  CDN1C_REV  CGCAGCGGCATGTCCTGCT  SEQ ID NO: 122  CDN1C_1_REV  ATCCCCGAGTGCAGCTGG  SEQ ID NO: 123  KRAS_FWD  GTATTAAAAGGTACTGGTGGA  SEQ ID NO: 124  KRAS_REV  CTATTGTTGGATCATATTCGTCC  SEQ ID NO: 125  BEGAIN_FWD  CGTCCCCACCTGCGTCA  SEQ ID NO: 126  BEGAIN_REV  CAGCGCTCACGGGGTAGG  SEQ ID NO: 127  BEGAIN_RT‐ TGCGGGCCAAGCCGGGGA  SEQ ID NO: 128  FWD  BEGAIN_RT‐ GGTAGGAGTAGGCGCCGATGTCCT  SEQ ID NO: 129  REV                    CD5R2_FWD  TCGTGGAGCCCGACAAG  SEQ ID NO: 130  CD5R2_REV  GGCAGATGGGGACACAGGT  SEQ ID NO: 131  CECR6_FWD  GCTTATCTACTCCATCGCCTTCAC  SEQ ID NO: 132  CECR6_REV  GCCACAGCCAGGGTGTTGA  SEQ ID NO: 133  F812_FWD  GCTGGTATCGAACAAGCTGAAG  SEQ ID NO: 134  F812_REV  GACACCTCGCAGCGGACC  SEQ ID NO: 135  JAG2_FWD  CCCCAAAGTGGACAACCG  SEQ ID NO: 136  JAG2_REV  GCTGGAGCGGGCGTTCT  SEQ ID NO: 137  KLF14_FWD  GCAGGCTCGGAGGTGGG  SEQ ID NO: 138  KLF14_REV  GTCGATGCGGGGAGTTCG  SEQ ID NO: 139  BAIP3_FWD  AGTGCATGGAGGCGGACC  SEQ ID NO: 140  BAIP3_REV  GCCAAGAAGCCCCTTGTGAG  SEQ ID NO: 141  PO3F3_FWD  CGTCCTCTGTCAAGATGGTCC  SEQ ID NO: 142  PO3F3_REV  TTGAACTGCTTGGCGAACTG  SEQ ID NO: 143  DACT3_FWD  GTCGTCGTGGGAGTCGGA  SEQ ID NO: 144  DACT3_REV  CGCTGGAGGCAGAGCTGAA  SEQ ID NO: 145    * Underlined lowercase forms the overhang for the primer extension. 94    Table 15: Reverse Transcriptases Developed Herein  Table 15 provided non‐limiting examples of reverse transcriptases having properties described herein.  Sequence Listing  Amino acid alterations/mutations    SEQ ID NO: 1  WT‐Taq DNA polymerase   SEQ ID NO: 2  SEQ ID NO:1 incorporating the amino acid alterations amino  acid alterations A97T, A608V, K702R, K762R, E742K, M747K   SEQ ID NO: 3   SEQ ID NO:1 incorporating the amino acid alterations amino  acid alterations A97T, A608V, K702R, K762R, and D732N   SEQ ID NO: 4   SEQ ID NO:1 incorporating the amino acid alterations amino  acid alterations A23P, L162P, 228V, L461R, A521V, E734G,  F749I, L768M, E742K, and M747K   SEQ ID NO: 5  SEQ ID NO:1 incorporating the amino acid alterations amino  acid alterations L30P, A54V, E434D, K206Q, S612R, V730I,  F749V, and D732N  SEQ ID NO: 6  SEQ ID NO:1 incorporating the amino acid alterations amino  acid alterations L30P, A54V, E434D, K206Q, S612R, V730I,  F749V, E742K, and M747K.  SEQ ID NO: 7  SEQ ID NO:1 incorporating the amino acid alterations amino  acid alterations L30P, A54V, E434D, K206Q, S612R, V730I,  F749V, E742R, and M747R.  SEQ ID NO: 8  SEQ ID NO:1 incorporating the amino acid alterations amino  acid alterations L30P, A54V, E434D, K206Q, S612R, V730I,  F749V, E742N, and M747N.  SEQ ID NO: 9  SEQ ID NO:1 incorporating the amino acid alterations amino  acid alterations L30P, A54V, E434D, K206Q, S612R, V730I,  F749V, E742K, and M747R.  SEQ ID NO: 10  SEQ ID NO:1 incorporating the amino acid alterations amino  acid alterations L30P, A54V, E434D, K206Q, S612R, V730I,  F749V, E742K, and M747N.  SEQ ID NO: 11  SEQ ID NO:1 incorporating the amino acid alterations amino  acid alterations L30P, A54V, E434D, K206Q, S612R, V730I,  F749V, E742R, and M747K.  SEQ ID NO: 12  SEQ ID NO:1 incorporating the amino acid alterations amino  acid alterations L30P, A54V, E434D, K206Q, S612R, V730I,  F749V, E742R, and M747N.  SEQ ID NO: 13  SEQ ID NO:1 incorporating the amino acid alterations amino  acid alterations L30P, A54V, E434D, K206Q, S612R, V730I,  F749V, E742N, and M747K.  95    SEQ ID NO: 14  SEQ ID NO:1 incorporating the amino acid alterations amino  acid alterations L30P, A54V, E434D, K206Q, S612R, V730I,  F749V, E742N, and E747R.  SEQ ID NO: 15  SEQ ID NO: 1 incorporating the amino acid alterations P10S,  A61V, T186I, D244V, K314R, E520G, V586A, S612R, V730I,  F749V, and D732N.  SEQ ID NO: 16  SEQ ID NO: 1 incorporating the amino acid alterations P10S,  A61V, T186I, D244V, K314R, E520G, V586A, S612R, V730I,  F749V, E742K, and M747K.  SEQ ID NO: 17  SEQ ID NO: 1 incorporating the amino acid alterations P10S,  A61V, T186I, D244V, K314R, E520G, V586A, S612R, V730I,  F749V, E742R, and M747R.  SEQ ID NO: 18  SEQ ID NO: 1 incorporating the amino acid alterations P10S,  A61V, T186I, D244V, K314R, E520G, V586A, S612R, V730I,  F749V, E742N, and M747N.  SEQ ID NO: 19  SEQ ID NO: 1 incorporating the amino acid alterations P10S,  A61V, T186I, D244V, K314R, E520G, V586A, S612R, V730I,  F749V, E742K, and M747R.  SEQ ID NO: 20  SEQ ID NO: 1 incorporating the amino acid alterations P10S,  A61V, T186I, D244V, K314R, E520G, V586A, S612R, V730I,  F749V, E742K, and M747N.  SEQ ID NO: 21  SEQ ID NO: 1 incorporating the amino acid alterations P10S,  A61V, T186I, D244V, K314R, E520G, V586A, S612R, V730I,  F749V, E742R, and M747K.  SEQ ID NO: 22  SEQ ID NO: 1 incorporating the amino acid alterations P10S,  A61V, T186I, D244V, K314R, E520G, V586A, S612R, V730I,  F749V, E742R, and M747N.  SEQ ID NO: 23  SEQ ID NO: 1 incorporating the amino acid alterations P10S,  A61V, T186I, D244V, K314R, E520G, V586A, S612R, V730I,  F749V, E742N, and M747K.  SEQ ID NO: 24  SEQ ID NO: 1 incorporating the amino acid alterations P10S,  A61V, T186I, D244V, K314R, E520G, V586A, S612R, V730I,  F749V, M742M, and E747R.  SEQ ID NO: 25  SEQ ID NO: 1 incorporating the amino acid alterations G12T,  A54V, T186I, D244V, F667Y, F749V, and D732N.  SEQ ID NO: 26  SEQ ID NO: 1 incorporating the amino acid alterations G12T,  A54V, T186I, D244V, F667Y, F749V, E742K, and M747K.  SEQ ID NO: 27  SEQ ID NO: 1 incorporating the amino acid alterations G12T,  A54V, T186I, D244V, F667Y, F749V, E742R, and M747R.  SEQ ID NO: 28  SEQ ID NO: 1 incorporating the amino acid alterations G12T,  A54V, T186I, D244V, F667Y, F749V, E742N, and M747N.  SEQ ID NO: 29  SEQ ID NO: 1 incorporating the amino acid alterations G12T,  A54V, T186I, D244V, F667Y, F749V, E742K, and M747R.  SEQ ID NO: 30  SEQ ID NO: 1 incorporating the amino acid alterations G12T,  A54V, T186I, D244V, F667Y, F749V, E742K, and M747N.  SEQ ID NO: 31  SEQ ID NO: 1 incorporating the amino acid alterations G12T,  A54V, T186I, D244V, F667Y, F749V, E712R, and M747K.  SEQ ID NO: 32  SEQ ID NO: 1 incorporating the amino acid alterations G12T,  A54V, T186I, D244V, F667Y, F749V, E742R, and M747N.  SEQ ID NO: 33  SEQ ID NO: 1 incorporating the amino acid alterations G12T,  A54V, T186I, D244V, F667Y, F749V, E742N, and M747K.  SEQ ID NO: 34  SEQ ID NO: 1 incorporating the amino acid alterations G12T,  A54V, T186I, D244V, F667Y, F749V, E742N, and E747R.  SEQ ID NO: 35  SEQ ID NO: 1 incorporating the amino acid alterations P10S,  A61V, F73S, T186I, R205K, K219E, M236T, A608V, S612R,  2494ΔG, and D732N.  SEQ ID NO: 36  SEQ ID NO: 1 incorporating the amino acid alterations P10S,  A61V, F73S, T186I, R205K, K219E, M236T, A608V, S612R,  2494ΔG, E742K and M747K.  SEQ ID NO: 37  SEQ ID NO: 1 incorporating the amino acid alterations P10S,  A61V, F73S, T186I, R205K, K219E, M236T, A608V, S612R,  2494ΔG, E742R, and M747R.  SEQ ID NO: 38  SEQ ID NO: 1 incorporating the amino acid alterations P10S,  A61V, F73S, T186I, R205K, K219E, M236T, A608V, S612R,  2494ΔG, and E742N, and M747N.  SEQ ID NO: 39  SEQ ID NO: 1 incorporating the amino acid alterations P10S,  A61V, F73S, T186I, R205K, K219E, M236T, A608V, S612R,  2494ΔG, E742K, and M747R.  SEQ ID NO: 40  SEQ ID NO: 1 incorporating the amino acid alterations P10S,  A61V, F73S, T186I, R205K, K219E, M236T, A608V, S612R,  2494ΔG, E742K, and M747N.  SEQ ID NO: 41  SEQ ID NO: 1 incorporating the amino acid alterations P10S,  A61V, F73S, T186I, R205K, K219E, M236T, A608V, S612R,  2494ΔG, E742R, and M747K.  SEQ ID NO: 42  SEQ ID NO: 1 incorporating the amino acid alterations P10S,  A61V, F73S, T186I, R205K, K219E, M236T, A608V, S612R,  2494ΔG, E742R, and M747N.  SEQ ID NO: 43  SEQ ID NO: 1 incorporating the amino acid alterations P10S,  A61V, F73S, T186I, R205K, K219E, M236T, A608V, S612R,  2494ΔG, E742N, and M747K.  SEQ ID NO: 45  SEQ ID NO: 1 incorporating the amino acid alterations P10S,  A61V, F73S, T186I, R205K, K219E, M236T, A608V, S612R,  2494ΔG, E742N and E747R.  SEQ ID NO: 46  SEQ ID NO: 1 incorporating the amino acid alterations P10S,  L30P, A61V, L365P, V586A, S612R, E832K, and D732.  SEQ ID NO: 47  SEQ ID NO: 1 incorporating the amino acid alterations P10S,  L30P, A61V, L365P, V586A, S612R, E832K, E742K, and M747K.  SEQ ID NO: 48  SEQ ID NO: 1 incorporating the amino acid alterations P10S,  L30P, A61V, L365P, V586A, S612R, E832K, E742R, and M747R.  SEQ ID NO: 49  SEQ ID NO: 1 incorporating the amino acid alterations P10S,  L30P, A61V, L365P, V586A, S612R, E832K, E742N, and M747N.  SEQ ID NO: 50  SEQ ID NO: 1 incorporating the amino acid alterations P10S,  L30P, A61V, L365P, V586A, S612R, E832K, E742K, and M747R.  SEQ ID NO: 51  SEQ ID NO: 1 incorporating the amino acid alterations P10S,  L30P, A61V, L365P, V586A, S612R, E832K, E742K, and M747N.  SEQ ID NO: 52  SEQ ID NO: 1 incorporating the amino acid alterations P10S,  L30P, A61V, L365P, V586A, S612R, E832K, E742R, and M747K.  SEQ ID NO: 53  SEQ ID NO: 1 incorporating the amino acid alterations P10S,  L30P, A61V, L365P, V586A, S612R, E832K, E742R, and M747N.  SEQ ID NO: 54  SEQ ID NO: 1 incorporating the amino acid alterations P10S,  L30P, A61V, L365P, V586A, S612R, E832K, E742N, and M747K.  SEQ ID NO: 55  SEQ ID NO: 1 incorporating the amino acid alterations P10S,  L30P, A61V, L365P, V586A, S612R, E832K, E742N, and E747R.  SEQ ID NO: 56  SEQ ID NO: 1 incorporating the amino acid alterations P10S,  A61V, D244V, S612R, E832K, and D732N.  SEQ ID NO: 57  SEQ ID NO: 1 incorporating the amino acid alterations P10S,  A61V, D244V, S612R, E832K, E742K, and M747K.  SEQ ID NO: 58  SEQ ID NO: 1 incorporating the amino acid alterations P10S,  A61V, D244V, S612R, E832K, M742R, and M747R.  SEQ ID NO: 59  SEQ ID NO: 1 incorporating the amino acid alterations P10S,  A61V, D244V, S612R, E832K, E742N, and M747N.  SEQ ID NO: 60  SEQ ID NO: 1 incorporating the amino acid alterations P10S,  A61V, D244V, S612R, E832K, E742K, and M747R.  SEQ ID NO: 61  SEQ ID NO: 1 incorporating the amino acid alterations P10S,  A61V, D244V, S612R, E832K, E742K, and M747N.  SEQ ID NO: 62  SEQ ID NO: 1 incorporating the amino acid alterations P10S,  A61V, D244V, S612R, E832K, E742R, and M747K.  SEQ ID NO: 63  SEQ ID NO: 1 incorporating the amino acid alterations P10S,  A61V, D244V, S612R, E832K, E742R, and M747N.  SEQ ID NO: 64  SEQ ID NO: 1 incorporating the amino acid alterations P10S,  A61V, D244V, S612R, E832K, E742N, and M747K.  SEQ ID NO: 65  SEQ ID NO: 1 incorporating the amino acid alterations P10S,  A61V, D244V, S612R, E832K, E742N, and E747R.  SEQ ID NO: 66  SEQ ID NO: 1 incorporating the amino acid alterations L30P,  2494ΔG, and D732N.  SEQ ID NO: 67  SEQ ID NO: 1 incorporating the amino acid alterations L30P,  2494ΔG, E742K, and M747K.  SEQ ID NO: 68  SEQ ID NO: 1 incorporating the amino acid alterations L30P,  2494ΔG, E742R, and M747R.  SEQ ID NO: 69  SEQ ID NO: 1 incorporating the amino acid alterations L30P,  2494ΔG, E742N, and M747N.  SEQ ID NO: 70  SEQ ID NO: 1 incorporating the amino acid alterations L30P,  2494ΔG, E742K, and M747R.  SEQ ID NO: 71  SEQ ID NO: 1 incorporating the amino acid alterations L30P,  2494ΔG, E742K, and M747N.  SEQ ID NO: 72  SEQ ID NO: 1 incorporating the amino acid alterations L30P,  2494ΔG, E742R, and M747K.  SEQ ID NO: 73  SEQ ID NO: 1 incorporating the amino acid alterations L30P,  2494ΔG, E742R and M747N.  SEQ ID NO: 74  SEQ ID NO: 1 incorporating the amino acid alterations L30P,  2494ΔG, E742N, and M747K.  SEQ ID NO: 75  SEQ ID NO: 1 incorporating the amino acid alterations L30P,  2494ΔG, E742N, and E747R.  SEQ ID NO: 76  SEQ ID NO: 1 incorporating the amino acid alterations A29T,  G200S, D237G, F749I, and D732N.  SEQ ID NO: 77  SEQ ID NO: 1 incorporating the amino acid alterations A29T,  G200S, D237G, F749I, E742K, and M747K.  SEQ ID NO: 78  SEQ ID NO: 1 incorporating the amino acid alterations A29T,  G200S, D237G, F749I, E742R, and M747R.  SEQ ID NO: 79  SEQ ID NO: 1 incorporating the amino acid alterations A29T,  G200S, D237G, F749I, E742N, and M747N.  SEQ ID NO: 80  SEQ ID NO: 1 incorporating the amino acid alterations A29T,  G200S, D237G, F749I, E742K, and M747R.  SEQ ID NO: 81  SEQ ID NO: 1 incorporating the amino acid alterations A29T,  G200S, D237G, F749I, E742K, and M747N.  SEQ ID NO: 82  SEQ ID NO: 1 incorporating the amino acid alterations A29T,  G200S, D237G, F749I, E742R, and M747K.  SEQ ID NO: 83  SEQ ID NO: 1 incorporating the amino acid alterations A29T,  G200S, D237G, F749I, E742R, and M747N.  SEQ ID NO: 84  SEQ ID NO: 1 incorporating the amino acid alterations A29T,  G200S, D237G, F749I, E742N, and M747K.  SEQ ID NO: 85  SEQ ID NO: 1 incorporating the amino acid alterations A29T,    G200S, D237G, F749I, E742N, and E747R.   

Claims

CLAIMS  1.  A composition for performing a reverse transcriptase reaction comprising:    a thermostable reverse transcriptase or a fragment thereof;    a reverse transcriptase (RT) buffer;     one or more template RNAs and deoxyribonucleoside triphosphates (dNTPs); and    one or more low molecular weight polar organic solvents.   
2.  The composition of claim 1, wherein the low molecular weight polar organic solvents  are selected from the group consisting of an amide, a sulfoxide, a sulfone, and a diol, the  one or more low molecular weight organic solvents being present in the PCR buffer at a  concentration ranging between about 0.05 molar and 7.5 molar.   
3.  The composition of claims 1 or 2, wherein molecular weight of the polar organic  cosolvent is less than or equal to 150 g/mol.   
4.  The composition of claim 3, wherein the one or more polar organic solvents display a  rate of change of duplex DNA, DNA secondary structure or RNA secondary structure melting  temperature with respect to cosolvent concentration (dTm/d[solvent]) between ‐1 K/M and   ‐15 K/M.   
5.  The composition of claim 4, wherein the duplex DNA corresponds to the c‐jun DNA  segment flanked by primers with SEQ IDs 92 and 94, and where the DNA and RNA  secondary structures correspond to the most stable secondary structures in the single‐ stranded BEGAIN DNA and RNA fragments flanked by primers with SEQ IDs 126 and 127,  respectively.      100   
6.  The composition of claim 4, wherein the one or more polar organic solvents also  display rates of change of wild‐type Taq polymerase melting temperature with respect to  cosolvent concentration (dTM/d[solvent]) between ‐1 K/M and ‐15 K/M.   
7.  The composition of any of the preceding claims wherein the thermostable reverse  transcriptase enzyme has an optimal RT temperature above 37oC and preferably above  48oC.    
8.  The composition of any of the preceding claims, wherein presence of the one or  more organic cosolvents increases RT activity (rate of nucleotide incorporation) of the  thermostable reverse transcriptase or the fragment thereof.   
9.  The composition of claim 8, wherein the RT activity rate is increased by at least 5%.   
10.  The composition of any preceding claim, wherein the one or more low molecular  weight organic solvents is of the formula:  ,  wherein:  R1 is C or S; and  when R1 is C, X is ═O, R3 is N and R6 is absent;  when R1 is S, X is ═O or    and R3 is C;  R2 is H or CH3 only when one or more of R4, R5 and R6 is not H, and otherwise R2 is an  unsubstituted or halogen‐, hydroxy‐ or alkoxy‐ substituted alkyl or cycloalkyl of  101    length m, wherein m is selected such that the total number of carbons in the  compound is between 3 and 8 when R1 is C and between 2 and 8 when R1 is S;  wherein any two of R2, R3, R4, R5 and R6 optionally form a cyclic structure in which  cyclization is effected through a bond between them; and R4, R5 and R6 each is H,  alkyl, cycloalkyl or halogen‐, hydroxy‐ or alkoxy‐ substituted alkyl or cycloalkyl of  length n, wherein n is selected such that the total number of carbons in the  compound is between 3 and 8 when R1 is C and between 2 and 8 when R1 is S and  when R4 and R5 are CH3, R2 cannot be H or CH3 
11.  The composition of claim 10, wherein the one or more polar organic solvents  comprises a cyclic compound, wherein the cyclization is effected through a bond between  any two of R2, R3, R4, R5 and R6.   
12.  The composition of claim 11, wherein the cyclic portion of the compound comprises  five, six or seven members.   
13.  The composition of claim 12, wherein R1 is S and remainder of the compound is  unsubstituted.   
14.  The composition of claim 10, wherein the low molecular weight polar organic  solvent comprises a compound in which R1 is S, X is ═O or  , and R3 is C.   
15.  The composition of claim 14, wherein the compound is cyclic.   
16.  The composition of claim 15, wherein the cyclic structure of the compound is a five,  six, or seven‐membered ring formed by a bond between R2 and either R4, R5 or R6.    102   
17.  The composition of claim 16, wherein the ring is unsubstituted except in R1.   
18.  The composition of claim 17, wherein the compound is selected from the group  consisting of tetramethylene sulfone and tetramethylene sulfoxide.   
19.  The composition of claim 14, wherein the compound is acyclic.   
20.  The composition of claim 19, wherein R2 or R3 of the compound is lower alkyl or  substituted lower alkyl.   
21.  The composition of claim 20, wherein the compound is selected from the group  consisting of methyl sulfone, ethyl sulfone, n‐propyl sulfone, n‐propyl sulfoxide and methyl  sec‐butyl sulfoxide.   
22.  The composition of any of the preceding claims where the thermostable reverse  transcriptase is a mutant of Taq polymerase bearing at least 90% sequence similarity to  wild‐type Taq polymerase (SEQ ID NO: 1).    
23.  The composition of claim 22, wherein the thermostable reverse transcriptase  comprises one or more non‐natural amino acid alterations conferring stability and/or  activity in the one or more polar organic cosolvents.   
24.  The composition of claim 2, wherein the amide is selected from the group consisting  of formamide, N‐methyl formamide, N,N‐ dimethyl formamide (DMF), acetamide, N‐ methylacetamide, N,N‐dimethylacetamide, propionamide, isobutyramide, 2‐pyrrolidone, N‐ methylpyrrolidone (NMP), N‐hydroxyethyl pyrrolidone(HEP), N‐formyl pyrrolidine, and N‐ Formyl morpholine.    103   
25.  The composition of claim 1, wherein the organic cosolvent is selected from the  group consisting of N,N‐Dimethylformamide (DMF) at a concentration of about 0.5 to about  7.0 molar concentration, isobutyramide at a concentration of about 0.1 to about 4.5 molar  concentration, 2‐pyrrolidone at a concentration of about 0.1 to about 4.5 molar  concentration, and N‐methylpyrrolidone at a concentration of about 0.1 to about 4.5 molar.   
26.  The composition of claim 1, wherein the amide solvent is N,N‐Dimethylformamide  (DMF) at a concentration of about 0.5 molar to about the concentration at which the  melting temperature (TM) of the reverse transcriptase is 5oC higher than the optimal activity  temperature of the reverse transcriptase in the absence of DMF; isobutyramide at a  concentration of about 0.1 molar to about the concentration at which the melting  temperature (TM) of the reverse transcriptase is  5oC higher than the optimal activity  temperature of the reverse transcriptase in the absence of isobutyramide; 2‐pyrrolidone at  a concentration of about 0.1 molar to about the concentration at which the melting  temperature (TM) of the reverse transcriptase is 5oC higher than the optimal activity  temperature of the reverse transcriptase in the absence of 2‐pyrrolidone; or N‐ methylpyrrolidone at a concentration of about 0.1 molar to about the concentration at  which the melting temperature (TM) of the reverse transcriptase is 5oC higher than the  optimal activity temperature of the reverse transcriptase in the absence of N‐ methylpyrrolidone.   
27.  The composition of claim 2, wherein the sulfoxide is selected from the group  consisting of dimethyl sulfoxide (DMSO), n‐propyl sulfoxide, n‐butyl sulfoxide, methyl sec‐ butyl sulfoxide, and tetramethylene sulfoxide; the sulfone is selected from the group  consisting of dimethyl sulfone, diethylsulfone, di(n‐isopropyl) sulfone, tetramethylene  sulfone (sulfolane), 2,4‐dimethylsulfolane, and butadienesulfone (sulfolene).    104   
28.  The composition of claim 1, wherein the organic solvent is selected from the group  consisting of dimethylsulfoxide (DMSO) at a concentration of about 0.5 to about 7.5 molar  concentration and tetramethylenesulfoxide at a concentration of about 0.1 to about 4.0  molar.   
29.  The composition of claim 1, wherein the organic solvent is selected from the group  consisting of dimethylsulfoxide (DMSO) at a concentration range of about 0.5 molar to  about the concentration at which the melting temperature (TM) of the reverse transcriptase  is 5oC higher than the optimal activity temperature of the reverse transcriptase in the  absence of DMSO, and tetramethylene sulfoxide at a concentration range of about 0.1  molar to about the concentration at which the melting temperature (TM) of the reverse  transcriptase is 5oC higher than the optimal activity temperature of the reverse  transcriptase in the absence of tetramethylene sulfoxide.   
30.  The composition of claim 1, wherein the organic solvent is tetramethylenesulfone  (sulfolane) at a concentration of about 0.1 to about 3.0 molar.    
31.  The composition of claim 1, wherein the organic solvent is tetramethylenesulfone  (sulfolane) at a concentration of about 0.1 molar to about the concentration at which the  melting temperature (TM) of the reverse transcriptase is 5oC higher than the optimal activity  temperature of the reverse transcriptase in the absence of sulfolane.    
32.  The composition of claim 2, wherein the diol is selected from the group consisting  of1,2‐propanediol, 1,3‐propanediol, 1,2‐butanediol, 1,3‐butanediol, 1,4‐butanediol, 1,2‐ pentanediol, 2,4‐pentanediol, 1,5‐pentanediol, 1,2‐cyclopentanediol, 1,2‐hexanediol, 1,6‐ hexanediol, and 2‐methyl‐2,4‐pentanediol.    105   
33.  The composition of claim 1, wherein the organic solvent is selected from the group  consisting of 1,3‐propanediol at a concentration of about 0.5 to about 7.5 molar  concentration, 1,4‐butanediol at a concentration of about 0.5 to about 5.0 molar  concentration, and 1,5‐pentanediol at a concentration of about 0.5 to about 2.5 molar  concentration.   
34.  The composition of claim 1 wherein the organic solvent is selected from the group  consisting of 1,3‐propanediol at a concentration of about 0.5 molar to about the  concentration at which the melting temperature (TM) of the reverse transcriptase is 5oC  higher than the optimal activity temperature of the reverse transcriptase in the absence of  1,3‐propanediol, 1,4‐butanediol at a concentration of about 0.5 molar to about the  concentration at which the melting temperature (TM) of the reverse transcriptase is 5oC  higher than the optimal activity temperature of the reverse transcriptase in the absence of  1,4‐butanediol, and 1,5‐pentanediol at a concentration of about 0.5 molar to about the  concentration at which the melting temperature (TM) of the reverse transcriptase is 5oC  higher than the optimal activity temperature of the reverse transcriptase in the absence of  1,5‐pentanediol.    
35.  The composition of any of the preceding claims, wherein the thermostable reverse  transcriptase is a mutant of Taq polymerase bearing at least 90% sequence similarity to  wild‐type Taq polymerase of SEQ ID NO:1.   
36.  The composition of claim 35, wherein the thermostable reverse transcriptase  comprises one or more amino acids alterations conferring stability and/or activity in the  one or more polar organic solvents.   
37.  The composition of claim 35, wherein the thermostable reverse transcriptase has  amino acid alterations A97T, A608V, K702R, K762R, E742K, and M747K of SEQ ID NO:1.  106     
38.  The composition of claim 35, wherein the thermostable reverse transcriptase has  amino acid alterations A97T, A608V, K702R, K762R, and E732N of SEQ ID NO:1.   
39.  The composition of claim 51, wherein the thermostable reverse transcriptase has  amino acid alterations A23P, L162P, 228V, L461R, A521V, E734G, F749I, L768M, E742K, and  M747K of SEQ ID NO:1.   
40.  A composition comprising:    a thermostable reverse transcriptase or a fragment thereof;    a reverse transcriptase polymerase chain reaction (RT‐PCR) buffer;     one or more template RNAs and deoxyribonucleoside triphosphates (dNTPs);     DNA‐dependent DNA polymerase enzyme or a fragment thereof; and    one or more low molecular weight polar organic solvents.   
41.  The composition of claim 40, wherein the low molecular weight polar organic  solvents are selected from the group consisting of an amide, a sulfoxide, a sulfone, and a  diol, the one or more low molecular weight organic solvents being present in the PCR buffer  at a concentration ranging between about 0.05 molar and 3.0 molar.   
42.  The composition of claims 40 or 41, wherein molecular weight of the polar organic  cosolvent is less than or equal to 150 g/mol.   
43.  The composition of claim 42, wherein the one or more polar organic solvents display  a rate of change of DNA melting temperature with respect to cosolvent concentration  (dTm/d[solvent]) between ‐1 K/M and ‐15 K/M.    107   
44.  The composition of claim 43, wherein the DNA is duplex DNA corresponding to the c‐ jun DNA segment flanked by primers with SEQ IDs 92 and 94.   
45.  The composition of claim 43, wherein the one or more polar organic solvents also  display rates of change of wild‐type Taq polymerase melting temperature with respect to  cosolvent concentration (dTM/d[solvent]) between ‐1 K/M and ‐15 K/M.   
46.  The composition of claim 40, wherein the one or more low molecular weight organic  solvents are present in the PCR buffer in a concentration between about 0.1 and about 1.0  molar.   
47.  The composition of claim 40 wherein the thermostable reverse transcriptase enzyme  has an optimal RT temperature above 37oC and preferably above 48oC.    
48.  The composition of claim 40, wherein presence of the one or more organic  cosolvents increases RT activity (rate of nucleotide incorporation) of the thermostable  reverse transcriptase or the fragment thereof.   
49.  The composition of claim 40, wherein the RT activity rate is increased by at least 5%.   
50.  The composition of any preceding claim, wherein the one or more low molecular  weight organic solvents is of the formula:  ,  wherein:  R1 is C or S; and  108    when R1 is C, X is ═O, R3 is N and R6 is absent;  when R1 is S, X is ═O or    and R3 is C;  R2 is H or CH3 only when one or more of R4, R5 and R6 is not H, and otherwise R2 is an  unsubstituted or halogen‐, hydroxy‐ or alkoxy‐ substituted alkyl or cycloalkyl of  length m, wherein m is selected such that the total number of carbons in the  compound is between 3 and 8 when R1 is C and between 2 and 8 when R1 is S;  wherein any two of R2, R3, R4, R5 and R6 optionally form a cyclic structure in which  cyclization is effected through a bond between them; and R4, R5 and R6 each is H,  alkyl, cycloalkyl or halogen‐, hydroxy‐ or alkoxy‐ substituted alkyl or cycloalkyl of  length n, wherein n is selected such that the total number of carbons in the  compound is between 3 and 8 when R1 is C and between 2 and 8 when R1 is S and  when R4 and R5 are CH3, R2 cannot be H or CH3 
51.  The composition of claim 50, wherein the one or more polar organic solvents  comprises a cyclic compound, wherein the cyclization is effected through a bond between  any two of R2, R3, R4, R5 and R6.   
52.  The composition of claim 51, wherein the cyclic portion of the compound comprises  five, six or seven members.   
53.  The composition of claim 52, wherein R1 is S and remainder of the compound is  unsubstituted.   
54.  The composition of claim 50, wherein the low molecular weight polar organic  solvent comprises a compound in which R1 is S, X is ═O or     
55.  The composition of claim 54, wherein the compound is cyclic.   
56.  The composition of claim 55, wherein the cyclic structure of the compound is a five,  six, or seven‐membered ring formed by a bond between R2 and either R4, R5 or R6.   
57.  The composition of claim 56, wherein the ring is unsubstituted except in R1.   
58.  The composition of claim 57, wherein the compound is selected from the group  consisting of tetramethylene sulfone and tetramethylene sulfoxide.   
59.  The composition of claim 54, wherein the compound is acyclic.   
60.  The composition of claim 59, wherein R2 or R3 of the compound is lower alkyl or  substituted lower alkyl.   
61.  The composition of claim 60, wherein the compound is selected from the group  consisting of methyl sulfone, ethyl sulfone, n‐propyl sulfone, n‐propyl sulfoxide and methyl  sec‐butyl sulfoxide.   
62.  The composition of any of the preceding claims where the thermostable reverse  transcriptase is a mutant of Taq polymerase bearing at least 90% sequence similarity to  wild‐type Taq polymerase (SEQ ID NO: 1).    
63.  The composition of claim 62, wherein the thermostable reverse transcriptase  comprises one or more non‐natural amino acid alterations conferring stability and/or  activity in the one or more polar organic cosolvents.    110   
64.  The composition of claim 41, wherein the amide is selected from the group  consisting of formamide, N‐methyl formamide, N,N‐ dimethyl formamide (DMF),  acetamide, N‐methylacetamide, N,N‐dimethylacetamide, propionamide, isobutyramide, 2‐ pyrrolidone, N‐methylpyrrolidone (NMP), N‐hydroxyethyl pyrrolidone (HEP), N‐formyl  pyrrolidine, and N‐Formyl morpholine.   
65.  The composition of claim 40, wherein the organic cosolvent is selected from the  group consisting of N,N‐Dimethylformamide (DMF) at a concentration of about 0.5 to about  1.5 molar concentration, isobutyramide at a concentration of about 0.1 to about 1.0 molar  concentration, 2‐pyrrolidone at a concentration of about 0.1 to about 1.0 molar  concentration, and N‐methylpyrrolidone at a concentration of about 0.1 to about 1.0 molar. 
66.  The composition of claim 40, wherein the sulfoxide is selected from the group  consisting of dimethyl sulfoxide (DMSO), n‐propyl sulfoxide, n‐butyl sulfoxide, methyl sec‐ butyl sulfoxide, and tetramethylene sulfoxide; the sulfone is selected from the group  consisting of dimethyl sulfone, diethylsulfone, di(n‐isopropyl) sulfone, tetramethylene  sulfone (sulfolane), 2,4‐dimethylsulfolane, and butadienesulfone (sulfolene).   
67.  The composition of claim 40, wherein the organic solvent is selected from the group  consisting of dimethylsulfoxide (DMSO) at a concentration of about 0.5 to about 3.0 molar  concentration and tetramethylenesulfoxide at a concentration of about 0.1 to about 1.0  molar.   
68.  The composition of claim 40, wherein the organic solvent is tetramethylenesulfone  (sulfolane) at a concentration of about 0.1 to about 1.0 molar.    
69.  The composition of claim 40, wherein the diol is selected from the group consisting  of1,2‐propanediol, 1,3‐propanediol, 1,2‐butanediol, 1,3‐butanediol, 1,4‐butanediol, 1,2‐ 111    pentanediol, 2,4‐pentanediol, 1,5‐pentanediol, 1,2‐cyclopentanediol, 1,2‐hexanediol, 1,6‐ hexanediol, and 2‐methyl‐2,4‐pentanediol.   
70.  The composition of claim 40, wherein the organic solvent is selected from the group  consisting of 1,3‐propanediol at a concentration of about 0.5 to about 3.0 molar  concentration, 1,4‐butanediol at a concentration of about 0.5 to about 2.0 molar  concentration, and 1,5‐pentanediol at a concentration of about 0.5 to about 1.0 molar  concentration.   
71.  The composition of claim 40, wherein the thermostable reverse transcriptase is a  mutant of Taq polymerase bearing at least 90% sequence similarity to wild‐type Taq  polymerase of SEQ ID NO:1.   
72.  The composition of claim 71, wherein the thermostable reverse transcriptase  comprises one or more non‐natural amino acid alterations conferring stability and/or  activity in the one or more polar organic solvents.   
73.  The composition of claim 72, wherein one or more non‐natural amino acid  alterations confers an increase in half‐life of the thermostable reverse transcriptase of at  least 50 percent at 95oC.   
74.  The composition of claim 73, wherein one or more non‐natural amino acid  alterations confers an increase in reverse transcriptase activity of at least 50% at 72oC.   
75.  The composition of claim 71, wherein the thermostable reverse transcriptase has  amino acid alterations A97T, A608V, K702R, K762R, E742K, and M747K of SEQ ID NO:1.    112   
76.  The composition of claim 71, wherein the thermostable reverse transcriptase has  amino acid alterations A97T, A608V, K702R, K762R, and E732N of SEQ ID NO:1.   
77.  The composition of claim 71, wherein the thermostable reverse transcriptase has  amino acid alterations A23P, L162P, 228V, L461R, A521V, E734G, F749I, L768M, E742K, and  M747K of SEQ ID NO:1.   
78.  The composition of claim 40, wherein the reverse transcriptase enzyme or a  fragment thereof is a solvostable DNA polymerase which is active, and stable at greater  than 90oC, in the presence of at least one concentration between 1.0 molar to 3.0 molar of  the one or more polar organic solvents.   
79.  The composition of claim 78, wherein the solvostable DNA polymerase is a mutant of  Taq polymerase bearing at least 90% sequence similarity to wild‐type Taq polymerase of  SEQ ID NO:1.   
80.  The composition of claim 79, wherein the mutant Taq polymerase includes one or  more amino acid alterations conferring reverse transcriptase activity.   
81.  The composition as in any of claims 40 to 80, wherein the thermostable reverse  transcriptase and DNA‐dependent DNA polymerase enzyme are the same enzyme.   
82.  The composition of claims 40 to 81, wherein the DNA‐dependent DNA polymerase  enzyme is a solvostable DNA polymerase which is active, and stable at greater than 95oC,  at at least one concentration between 1.0 molar to 3.0 molar of the one or more polar  organic solvents.     113   
83.  The  composition  of  claim  82,  wherein  the  solvostable  DNA‐dependent  DNA  polymerase is a mutant of Taq DNA polymerase bearing at least 90% sequence similarity  to wild‐type.   
84.  The composition of claim 83, wherein the mutant Taq polymerase comprises one or  more amino acid alterations enhancing stability of the mutant Taq polymerase in the one or  more low molecular weight polar organic solvents.   
85.  A reverse transcription kit or reverse transcription‐PCR kit comprising the  composition in any of the preceding claims. 
86.  The composition of claim 85 wherein the kit prescribes use of reverse transcription  temperatures above 48oC and below the melting temperature of the RNA:DNA  heteroduplex in the presence of the employed concentration of the cosolvent. 
87.  The composition of claim 85 wherein the kit prescribes use of reverse transcription  temperatures above 48oC and below the melting temperature of the reverse transcriptase  protein in the presence of the employed concentration of the cosolvent. 
88.  The composition of claim 85 where the kit prescribes preincubation at  a temperature more than 5oC below the melting temperature of the primer:template  complex. 
89.  A composition for performing a reverse transcriptase reaction comprising:    a thermostable reverse transcriptase;     a reverse transcriptase (RT) buffer;     one or more template RNAs and deoxyribonucleoside triphosphates (dNTPs); and    one or more low molecular weight polar organic solvents, wherein the thermostable  reverse transcriptase is a mutant of Taq polymerase bearing at least 90% sequence  similarity to wild‐type Taq polymerase of SEQ ID NO:1 and comprises one or more amino  114    acid alterations enhancing stability and/or activity of the reverse transcriptase in the one or  more low molecular weight polar organic solvents.   
90.  The composition of claim 89, wherein the one or more amino acid alterations are  selected from the group consisting of L5Q, F8L, P10S, L16P, A23P, A29T, K31R, G38D,A61V,  P89S, A97T, A118V, L162P, K171T, T186I, E201K, R205K, K206Q, G208S, K219E, N220D,  I228V, M236T, D244E, D244V, R261H, D273G, L287Q, S290G, V310L, H333R, K346R, L351M,  P382T, E388D, E434D, A454E, L461Q, L461R, V474I, F482I, I503T, E507K, S515N, A521V,  Q534R, S543G, D551G, D551N, Q592R, L606M, A608V, S612R, H676L, Q680R, K702R,  D732N, E734G, S739G, E742K, F749I, F749V, F749L, K762R, K767R, L768M, Q782H, and  E832K of SEQ ID NO:1.   
91.  The composition of claim 89, wherein the one or more amino acid alterations are  selected from the group consisting of L5Q, F8L, P10S, L16P, A23P, A29T, T186I, K31R, G38D,  A97T, A118V, L162P, R205K, G208S, K219E, N220D, I228V, D273G, S290G, K346R, P382T,  E388D, E434D, A454E, L461Q, L461R, V474I, F482I, I503T, E507K, S515N, A521V, Q534R,  D551G, L606M, A608V, S612R, Q680R, K702R, E734G, S739G, E742K, F749V, F749I, F749L,  K762R, K767R, L768M, Q782H, and E832K of SEQ ID NO:1.   
92.  The composition of claim 89, wherein the one or more amino acid alterations are  selected from the group consisting of L5Q, P10S, A23P, A29T, T186I, L461R, E507K, A608V,  S612R, E742K, F749L, F749I, K762R, K767R, and E832K of SEQ ID NO:1.   
93.  The composition of claim 89, wherein the one or more amino acid alterations are  selected from the group consisting of P10S, L16P, A29T, K31R, G38D, A61V, A118V, L162P,  T186I, G208S, N220D, I228V, D244V, D273G, S290G, K346R, L351M, E388D, A454E, L461Q,  L461R, F482I, I503T, S515N, A521V, Q534R, D551G, L606M, A608V, S612R, Q680R, E734G,  S739G, F749V, F749I, L768M, and E832K of SEQ ID NO:1.  115     
94.  The composition of claim 89, wherein the one or more amino acid alterations are  selected from the group consisting of F8L, P10S, L16P, A29T, K31R, G38D, A61V, A97T, and  L162P of SEQ ID NO:1.   
95.  The composition of claim 89, wherein the one or more amino acid alterations are  selected from the group consisting of A186I, D244V, R205K, G208S, K219E, N220D, I228V,  D273G, S290G, K346R, P382T, E388D, E434D, A454E, L461Q, L461R, V474I, F482I, I503T,  E507K, S515N, A521V, Q534R, D551G, and L606M of SEQ ID NO:1.   
96.  The composition of claim 89, wherein the one or more amino acid alterations is  A608V of SEQ ID NO:1.   
97.  The composition of claim 89, wherein the one or more amino acid alterations are  selected from the group consisting of S612R, Q680R, K702R, S739G, E742K, L768M, F749I,  F749V, K762R, K767R, and Q782H of SEQ ID NO:1.   
98.  The composition of claim 89, wherein the amino acid alteration is E832K.   
99.  A composition comprising a modified Taq DNA polymerase suitable for RT or RT‐PCR  reactions in an aqueous‐organic medium, wherein the aqueous‐organic medium comprises  one or more low molecular weight organic solvents selected from the group consisting of an  amide, a sulfoxide, a sulfone, and a diol, and wherein the amino acid sequence of the  modified Taq DNA polymerase is at least 90% identical to an amino acid sequence  comprised of the sequence of wild‐type Taq DNA polymerase of SEQ ID NO:1 with a first set  of amino acid alterations selected to confer reverse transcriptase activity, and a second set  of amino acid alterations selected from the group consisting of    L30P, A54V, E434D, K206Q, S612R, V730I, and F749V of SEQ ID NO: 1;  116    P10S, A61V, T186I, D244V, K314R, E520G, V586A, S612R, V730I, and F749V of SEQ ID  NO:1;    G12T, A54V, T186I, D244V, F667Y, and F749V of SEQ ID NO: 1;  P10S, A61V, F73S, T186I, R205K, K219E, M236T, A608V, S612R, and 2494ΔG of  SEQ ID NO: 1;    P10S, L30P, A61V, L365P, V586A, S612R, and E832K of SEQ ID NO: 1;    P10S, A61V, D244V, S612R, and E832K of SEQ ID NO: 1;      L30P and 2494ΔG of SEQ ID NO: 1; and     A29T, G200S, D237G, and F749I of SEQ ID NO: 1.   
100.  The composition of claim 99, wherein the amino acid alterations conferring RT  activity are comprised of one or more of E732N, E742K, E742R, M747K, M747R, E742N,  E742N, E742Q, E742Y, E742M, E742A and M747N of SEQ ID NO: 1.   
101.  A modified Taq DNA polymerase having an amino acid sequence that is at least 90%  identical to an amino acid sequence comprised of the sequence of wild‐type Taq DNA  polymerase of SEQ ID NO:1, wherein the amino acid sequence comprises a first set of non‐ natural amino acid alterations stabilizing the modified Taq DNA polymerase in an aqueous‐ organic medium, and a second set of non‐natural amino acid alterations conferring confer  reverse transcriptase activity to the modified Taq DNA polymerase.   
102.  The modified Taq DNA polymerase of claim 101, wherein the first set of non‐ natural  amino acid alterations are selected from the group consisting of L5Q, F8L, P10S, L16P, A23P,  A29T, K31R, G38D,A61V, P89S, A97T, A118V, L162P, K171T, T186I, E201K, R205K, K206Q,  G208S, K219E, N220D, I228V, M236T, D244E, D244V, R261H, D273G, L287Q, S290G, V310L,  H333R, K346R, L351M, P382T, E388D, E434D, A454E, L461Q, L461R, V474I, F482I, I503T,  E507K, S515N, A521V, Q534R, S543G, D551G, D551N, Q592R, L606M, A608V, S612R,  117    H676L, Q680R, K702R, D732N, E734G, S739G, E742K, F749I, F749V, F749L, K762R, K767R,  L768M, Q782H, and E832K of SEQ ID NO: 1.   
103.  The modified Taq DNA polymerase of claim 101, wherein the first set of non‐ natural  amino acid alterations are selected from the group consisting of P10S, L16P, A29T, K31R,  G38D, A61V, A118V, L162P, T186I, G208S, N220D, I228V, D244V, D273G, S290G, K346R,  L351M, E388D, A454E, L461Q, L461R, F482I, I503T, S515N, A521V, Q534R, D551G, L606M,  A608V, S612R, Q680R, E734G, S739G, F749V, F749I, L768M, and E832K of SEQ ID NO: 1.   
104.  The modified Taq DNA polymerase of claim 101, wherein the first set of non‐ natural  amino acid alterations are selected from the group consisting of L5Q, P10S, A23P, A29T,  T186I, L461R, E507K, A608V, S612R, E742K, F749L, F749I, K762R, K767R, and E832K of SEQ  ID NO: 1.   
105.  The modified Taq DNA polymerase of claim 101, wherein the first set of non‐ natural  amino acid alterations are selected from the group consisting of P10S, L16P, A29T, K31R,  G38D, A61V, A118V, L162P, T186I, G208S, N220D, I228V, D244V, D273G, S290G, K346R,  L351M, E388D, A454E, L461Q, L461R, F482I, I503T, S515N, A521V, Q534R, D551G, L606M,  A608V, S612R, Q680R, E734G, S739G, F749V, F749I, L768M, and E832K of SEQ ID NO: 1.   
106.  The modified Taq DNA polymerase of claim 101, wherein the first set of non‐ natural  amino acid alterations are selected from the group consisting of F8L, P10S, L16P, A29T,  K31R, G38D, A61V, A97T, and L162P of SEQ ID NO: 1.   
107.  The modified Taq DNA polymerase of claim 101, wherein the first set of non‐ natural  amino acid alterations are selected from the group consisting of A186I, D244V, R205K,  G208S, K219E, N220D, I228V, D273G, S290G, K346R, P382T, E388D, E434D, A454E, L461Q,  118    L461R, V474I, F482I, I503T, E507K, S515N, A521V, Q534R, D551G, and L606M of SED ID NO:  1.   
108.  The modified Taq DNA polymerase of claim 101, wherein the first set of non‐ natural  amino acid alterations are selected from the group consisting of S612R, Q680R, K702R,  S739G, E742K, L768M, F749I, F749V, K762R, K767R, and Q782H.   
109.  The modified Taq DNA polymerase as in any of claims 101‐108, wherein the second  set of non‐natural amino acid alterations are selected from the group consisting of E732N,  E742K, E742R, M747K, M747R, E742N, E742N, E742Q, E742Y, E742M, E742A and M747N of  SED ID NO: 1.   
110.  A method of reverse transcribing RNA into DNA comprising:    incubating a thermostable reverse transcriptase with a reverse transcriptase buffer,  a RNA template, deoxyribonucleoside triphosphates (dNTPs), DNA primers, and at least one  low molecular weight organic cosolvent.   
111.  A method of administering reverse transcription‐PCR comprising:    incubating a thermostable reverse transcription and DNA‐dependent DNA  polymerase with a reverse transcription‐PCR buffer, a RNA template, deoxyribonucleoside  triphosphates (dNTPs), DNA primers, and at least one low molecular weight organic  cosolvent.   
112.  The method of claim 110 or 111, wherein the low molecular weight polar organic  solvents are selected from the group consisting of an amide, a sulfoxide, a sulfone, and a  diol, the one or more low molecular weight organic solvents being present at a  concentration ranging between about 0.05 molar and 3.0 molar.    119   
113.  The method of claim 110 or 111, wherein the RNA template has % GC content  exceeding 50%.   
114.  The method of claim 110 or 111, wherein the RNA template is comprised of a family  of molecules with distinct nucleotide sequences.    
115.  The method as in any of claims 110 to 114, wherein the temperature of reverse  transcription is higher than its optimal value in the absence of the polar organic cosolvent,  and less than or equal to the melting temperature of the enzyme at that cosolvent  concentration, minus 5oC.   
116.  The method as in any of claims 110 to 114, wherein the temperature of reverse  transcription is higher than its optimal value in the absence of the polar organic cosolvent,  and less than or equal to the melting temperature of the fully extended RNA:DNA  heteroduplex at that cosolvent  concentration, minus 5oC.   
117.  The method as in any of claims 110 to 114, wherein reaction yield or reaction  efficiency is enhanced in the presence of the at least one low molecular weight organic  cosolvent.   
118.  The method as in any of claims 110 to 114, wherein the reverse transcriptase is a  modified Taq DNA polymerase bearing at least 90% sequence similarity to wild‐type Taq  polymerase of SEQ ID NO:1.   
119.  The method of claim 110, wherein the reverse transcriptase has amino acid  alterations A97T, A608V, K702R, K762R, E742K, and M747K of SQ ID NO: 1.    120   
120.  The method of claim 110, wherein the thermostable reverse transcriptase has amino  acid alterations A97T, A608V, K702R, K762R, and E732N.   
121.  The method of claim 110, wherein the thermostable reverse transcriptase has amino  acid alterations A23P, L162P, 228V, L461R, A521V, E734G, F749I, L768M, E742K, and M747K  of SEQ ID NO: 1.   
122.  A method of next‐generation sequencing of RNA, wherein reverse transcription of  RNA and/or DNA amplification is administered according to the method as in any of claims  110‐122.   
123.  The method of claim 122, wherein the copy numbers of RNA sequences are  determined by the next‐generation sequencing.   
124.  The method of claim 123, wherein accuracy with which the copy numbers of  sequences are determined from RNA sequencing is improved due to the inclusion of the  polar organic cosolvent.    
125.  The method as in any of claims 122 to 124, wherein RNA sequencing is carried out  with incorporation of unique molecular identifiers (UMI) in the adapter sequences.   
126.  The method of claim 1 or claim 36, wherein the thermostable reverse transcriptase  fragment is a Taq polymerase enzyme Stoffel fragment.   
127.  A method for the detection via RT‐PCR of viral or bacterial pathogen RNA from a  clinical sample without preparation of the clinical sample comprising:    121    a) incubating the clinical sample containing the virus or bacteria with RT‐PCR  reagents including a thermostable or solvostable reverse transcriptase (RT) enzyme, one or  more polar organic cosolvents, optionally a thermostable or solvostable DNA‐dependent  DNA polymerase enzyme, RT‐PCR buffer, and primers complementary to the nucleic acid  sequence to be detected, at a temperature exceeding 70oC and preferably below 80oC, to  lyse the virus or bacteria and release RNA without degrading the RNA;  b) incubating the lysed clinical sample at or near the optimal temperature for  reverse transcription of the RT enzyme;  c) thermal cycling of the reaction mixture to PCR amplify the resulting  complementary DNA (cDNA); and   d) quantification of the PCR product.   
128.  The method of claim 127, wherein quantification of the PCR product is administered  by qPCR.   
129.  The method of claim 105, wherein the virus is SARS‐CoV.   
130.  A kit for the detection via RT‐PCR of viral or bacterial pathogen RNA directly from  clinical samples without sample preparation, the kit comprising: a thermostable or  solvostable reverse transcriptase (RT) enzyme, one or more polar organic cosolvents,  optionally a thermostable or solvostable DNA‐dependent DNA polymerase enzyme, RT‐PCR  buffer, and primers complementary to the nucleic acid sequence to be detected.   
131.  A method for droplet digital reverse transcription PCR (ddRT‐PCR) with enhanced RT  and PCR efficiency, the method comprising:  a) incubating RT‐PCR reagents including a RT‐PCR buffer, a thermostable or  solvostable reverse transcriptase, a thermostable or solvostable DNA‐dependent DNA  polymerase, primers and/or probes for a sequence or mutation of interest, a polar organic  122    cosolvent within emulsion droplets, and one or more RNA templates, at or near the optimal  temperature for reverse transcription, such that the polar organic cosolvent at least  doubles the reverse transcription yield compared to buffer lacking the cosolvent;  b) thermal cycling of the reaction mixture to PCR amplify the resulting cDNA; and  c) counting or sorting of the resulting positive droplets using a fluorescence‐based  counting or sorting device.   
132.  A method for accelerating the in vitro evolution of reverse transcriptase (RT)  enzymes, the method comprising:  a) preparation of a library of thermostable polymerase enzyme gene variants;  b) expression of the enzymes corresponding to these gene variants, for example  through bacterial transformation and expression or in vitro transcription/translation of the  library, in individual containers, the containers preferably being either droplets or  microplate wells;  c) incubation of the library of enzyme variants within individual containers, with one  or more polar organic cosolvents at specified concentrations, RT‐PCR buffer, primers and/or  probes for an RNA sequence of interest, optionally a thermostable or solvostable DNA‐ dependent DNA polymerase enzyme, and the RNA template, at a temperature suitable for  reverse transcription, the temperature preferably being between 48oC and 80oC;   d) thermal cycling of the reaction mixtures to PCR amplify the resulting cDNAs;  e) ranking of the resulting enzyme variants based on RT‐PCR yield, either by  screening or sorting, the screening or sorting preferably being done based on fluorescence;  and   f) sequencing of the resulting top enzyme variants to identify the best RT enzymes,  wherein the presence of organic cosolvent(s) at the specified concentration(s) increase the  RT activity of at least one enzyme variant at least twofold above the activity in their  absence.    123   
133.  The method of claim 132, wherein at least one of the enzyme variants is a rare  variant whose corresponding gene is present in the library with less than or equal to 1%  frequency.   
134.  A kit for target enrichment for RNA sequencing by reverse transcription or reverse  transcription‐PCR, the kit comprising the composition of any of claims 1 to 84 and 89 to  109.          124   
EP24789679.8A 2023-04-13 2024-04-15 Compositions and methods for upregulation of reverse transcription and reduction of sequence bias in rna sequencing Pending EP4695384A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202363459012P 2023-04-13 2023-04-13
PCT/US2024/024649 WO2024216275A2 (en) 2023-04-13 2024-04-15 Compositions and methods for upregulation of reverse transcription and reduction of sequence bias in rna sequencing

Publications (1)

Publication Number Publication Date
EP4695384A2 true EP4695384A2 (en) 2026-02-18

Family

ID=93060190

Family Applications (1)

Application Number Title Priority Date Filing Date
EP24789679.8A Pending EP4695384A2 (en) 2023-04-13 2024-04-15 Compositions and methods for upregulation of reverse transcription and reduction of sequence bias in rna sequencing

Country Status (3)

Country Link
EP (1) EP4695384A2 (en)
CN (1) CN121693563A (en)
WO (1) WO2024216275A2 (en)

Family Cites Families (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ATE299940T1 (en) * 1999-08-21 2005-08-15 Amersham Biosciences Corp TAQ DNA POLYMERASE WITH AN AMINO ACID SUBSTITUTION IN POSITION E681 AND CORRESPONDING HOMOLOGUES WITH IMPROVED SALT TOLERANCE, USEFUL FOR SEQUENCING DIFFICULT TEMPLATING SEQUENCES USING CHARGED OR UNCHARGED TERMINATORS
GB0022458D0 (en) * 2000-09-13 2000-11-01 Medical Res Council Directed evolution method
US20080171318A1 (en) * 2004-09-30 2008-07-17 Epigenomics Ag Epigenetic Methods and Nucleic Acids for the Detection of Lung Cell Proliferative Disorders
MX2008000345A (en) * 2005-07-08 2008-04-02 Univ Zuerich Phage display using cotranslational translocation of fusion polypeptides.
CA2692287A1 (en) * 2007-06-29 2009-01-08 Newsouth Innovations Pty Limited Treatment of rheumatoid arthritis
EP2699698B9 (en) * 2011-04-20 2020-07-15 Mesa Biotech, Inc. Oscillating amplification reaction for nucleic acids
CN108350087A (en) * 2015-11-27 2018-07-31 国立大学法人九州大学 Archaeal dna polymerase variant
WO2018148501A1 (en) * 2017-02-10 2018-08-16 The Rockefeller University Methods for cell-type specific profiling to identify drug targets
US10768173B1 (en) * 2019-09-06 2020-09-08 Element Biosciences, Inc. Multivalent binding composition for nucleic acid analysis
EP3914736B1 (en) * 2019-01-25 2023-12-20 Grail, LLC Detecting cancer, cancer tissue of origin, and/or a cancer cell type
WO2023059361A1 (en) * 2021-10-06 2023-04-13 5Prime Biosciences, Inc. Polymerases for mixed aqueous-organic media and uses thereof
CN116814583A (en) * 2022-06-29 2023-09-29 武汉爱博泰克生物科技有限公司 Taq DNA polymerase mutant and application thereof

Also Published As

Publication number Publication date
WO2024216275A3 (en) 2025-04-10
WO2024216275A2 (en) 2024-10-17
CN121693563A (en) 2026-03-17

Similar Documents

Publication Publication Date Title
JP7112456B2 (en) Methods for variant detection
US9796965B2 (en) Use of Taq polymerase mutant enzymes for nucleic acid amplification in the presence of PCR inhibitors
JP2008511327A (en) Single primer nucleic acid amplification method
US11118206B2 (en) Multiple stage isothermal enzymatic amplification
EP3167060B1 (en) Dna amplification technology
KR20120101278A (en) Methods for amplifying hepatitis c virus nucleic acids
US20220333183A1 (en) Assay methods and kits for detecting rare sequence variants
AU2025256175B2 (en) Oligonucleotides for use in determining the presence of trichomonas vaginalis in a sample
US20250388878A1 (en) Polymerases for mixed aqueous-organic media and uses thereof
Ballantyne et al. Molecular crowding increases the amplification success of multiple displacement amplification and short tandem repeat genotyping
US7074558B2 (en) Nucleic acid amplification using an RNA polymerase and DNA/RNA mixed polymer intermediate products
JP2024538743A5 (en)
CN105705660B (en) Detection of single nucleotide polymorphisms using overlapping primers and melting probes
WO2024216275A2 (en) Compositions and methods for upregulation of reverse transcription and reduction of sequence bias in rna sequencing
CN108291252B (en) General method for stabilizing specific RNA
JP4699384B2 (en) Compositions, methods and kits for detecting HIV-1 and HIV-2 nucleic acids
Jothikumar et al. Development and evaluation of a ligation-free sequence-independent, single-primer amplification (LF-SISPA) assay for whole genome characterization of viruses
Kawai et al. Sensitive detection of EGFR mutations using a competitive probe to suppress background in the SMart Amplification Process
WO2021262013A1 (en) Bst-nec dna fusion polymerase for use in isothermal replication of specific sars cov-2 virus sequences
US20250034659A1 (en) Detection of multidrug-resistant mycobacterium tuberculosis using superselective primer-based real-time pcr assays
Lezhava et al. Detection of SNP by the isothermal smart amplification method
JP2013042732A (en) Method for detecting rodentia coronavirus
Low et al. Development of an in-house, one-step RT-qPCR mix and optimized MS2 detection primers for hepatitis A virus and norovirus detection in berries
JP4658660B2 (en) Nucleic acid detection method
Schoenike et al. Quantitative sense-specific determination of murine coronavirus RNA by reverse transcription polymerase chain reaction

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20251111

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR