EP4694674A1 - Plant dwarfing mutation - Google Patents

Plant dwarfing mutation

Info

Publication number
EP4694674A1
EP4694674A1 EP24789568.3A EP24789568A EP4694674A1 EP 4694674 A1 EP4694674 A1 EP 4694674A1 EP 24789568 A EP24789568 A EP 24789568A EP 4694674 A1 EP4694674 A1 EP 4694674A1
Authority
EP
European Patent Office
Prior art keywords
plant
seq
amino acid
dwarf
cell
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
EP24789568.3A
Other languages
German (de)
French (fr)
Inventor
Gurmukh S Johal
Rajdeep Singh KHANGURA
Akanksha Singh
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Purdue Research Foundation
Original Assignee
Purdue Research Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Purdue Research Foundation filed Critical Purdue Research Foundation
Publication of EP4694674A1 publication Critical patent/EP4694674A1/en
Pending legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01HNEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H1/00Processes for modifying genotypes ; Plants characterised by associated natural traits
    • A01H1/12Processes for modifying agronomic input traits, e.g. crop yield
    • A01H1/122Processes for modifying agronomic input traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • A01H1/1225Processes for modifying agronomic input traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold or salt resistance
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01HNEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H5/00Angiosperms, i.e. flowering plants, characterised by their plant parts; Angiosperms characterised otherwise than by their botanic taxonomy
    • A01H5/10Seeds
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01HNEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H6/00Angiosperms, i.e. flowering plants, characterised by their botanic taxonomy
    • A01H6/46Gramineae or Poaceae, e.g. ryegrass, rice, wheat or maize
    • A01H6/4684Zea mays [maize]
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A40/00Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
    • Y02A40/10Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
    • Y02A40/146Genetically Modified [GMO] plants, e.g. transgenic plants

Definitions

  • desirable traits can include, for example, heat tolerance, drought tolerance, disease resistance, pest resistance, increased yield, and earlier maturity.
  • Traits such as stand establishment, plant height, and ear height (e.g., in corn) are not only important for mechanical harvesting, but they can also provide sustained and even higher yields under various abiotic stresses such as wind damage.
  • Traditional plant breeding techniques can be used to develop new and improved commercial crops.
  • Dwarfing genes reduce plant height by altering the sensitivity to, or the molecular pathway involved in producing, growth-related hormones.
  • DELLA proteins are nuclear- localized negative regulators of gibberellin signaling found ubiquitously throughout higher plants. Accordingly, mutations in DELLA proteins can produce dwarf plants having a reduced height.
  • Maize contains two genetic loci encoding DELLA proteins, dwarf plant 8 (d8) and dwarf plant 9 (d9). The d8 gene and three of its dominant dwarfing alleles have been previously characterized at the molecular level.
  • plant cells, tissues, organs, seeds, and progeny thereof are provided with a novel partially dominant dwarfing mutation, representing a modification of the maize dwarf-8 and dwarf-9 genes, and DELLA domains.
  • a polynucleotide encodes a modified dwarf-8 (D8) polypeptide comprising a DELLA domain sequence of DELLAXeLXsYKVRXisSXisMAXisVAQKLEQLX ? (SEQ ID NO: 45), wherein
  • Xe is Ala or Vai
  • X 8 is Gly, Arg or Glu
  • X13 is Ala or Ser
  • X15 and Xis are independently Glu or Asp;
  • X27 is an amino acid other than glutamic acid or aspartic acid, optionally wherein X27 is Lys.
  • a plant comprising a polynucleotide that encodes a modified dwarf-8 (D8) polypeptide comprising a DELLA domain sequence of DELLAX 6 LX 8 YKVRXi3SXi 5 MAXi 8 VAQKLEQLX27 (SEQ ID NO: 45), wherein the plant exhibits a dwarf phenotype.
  • D8 modified dwarf-8
  • the DELLA domain of SEQ ID NO: 45 has Ala at position Xe, has Ser at position X13, Asp at positions X15 and Xis, Gly, Arg or Glu at position X 8 and Lys or Arg at position X27, optionally wherein X27 is Lys.
  • a plant comprising a polynucleotide that encodes a modified dwarf-8 (D8) polypeptide comprising a DELLA domain sequence of DELLAX6LX8YKVRX13SX15MAX1SVAQKLEQLX27 (SEQ ID NO: 45), wherein
  • Xe is Ala
  • X 8 is Arg or Glu
  • X13 is Ser
  • X15 and Xis are each Asp
  • X27 is Glu or Lys, wherein the plant exhibits a dwarf phenotype.
  • X 8 is Arg, optionally wherein X27 is Glu.
  • a plant exhibiting a dwarf phenotype wherein the plant is homozygous for a polynucleotide that encodes a modified dwarf-8 (D8) polypeptide comprising a DELLA domain sequence of DELLAX 6 LX 8 YKVRXI3SXI S MAXI 8 VAQKLEQLX 2 7 (SEQ ID NO: 45), wherein
  • Xf is Ala
  • Xs is Gly Arg or Glu; Xn is Ser;
  • Xu and Xis are each Asp
  • X27 is Glu or Lys, with the proviso that when X27 is Glu, Xs is not Gly.
  • a polynucleotide encodes a modified dwarf-8 (D8) protein comprising a DELLA domain sequence of DELLAX6LGYKVRXi3SXi 5 MAXi 8 VAQKLEQLX27 (SEQ ID NO: 1), wherein
  • Xe is Ala or Vai
  • X13 is Ala or Ser
  • X15 and Xis are independently Glu or Asp;
  • X27 is an amino acid other than glutamic acid or aspartic acid. In one embodiment X27 is an amino acid selected from Ala, Ser, Thr, Pro, Gly, His, Lys or Arg. In one embodiment X27 is a positively charged, polar amino acid, including for example His, Lys or Arg.
  • a polynucleotide that encodes a modified dwarf-8 (D8) protein comprising a DELLA domain sequence selected from the group consisting of DELLAALGYKVRSSDMADVAQKLEQLX27 (SEQ ID NO: 2), DELLAALGYKVRASDMADVAQKLEQLX27 (SEQ ID NO: 3) and
  • DELLA VLGYKVRSSDMADVAQKLEMLX27 (SEQ ID NO: 4), wherein X 27 of SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4 is Lys or Arg, optionally wherein X27 of SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4 is Lys.
  • a polynucleotide is provided that encodes a modified dwarf-8 (D8) protein wherein the polynucleotide comprises a sequence of SEQ ID NO: 43 or SEQ ID NO: 46.
  • the polynucleotide comprises a nucleic acid sequence having at least 85% sequence identity with SEQ ID NO: 7, or optionally having at least 90% sequence identity with SEQ ID NO: 7, wherein the polynucleotide includes the sequence of SEQ ID NO: 43 or SEQ ID NO: 46.
  • a plant or plant part comprising a polynucleotide that encodes a modified dwarf-8 (D8) protein comprising a DELLA domain sequence of DELLAX6LGYKVRX13SX15MAX18VAQKLEQLX27 (SEQ ID NO: 1), wherein Xe is Ala or Vai;
  • D8 modified dwarf-8
  • X13 is Ala or Ser
  • X15 and Xis are independently Glu or Asp; and X27 is an amino acid other than glutamic acid or aspartic acid. In one embodiment X27 is a positively charged, polar amino acid, including for example His, Lys or Arg.
  • the plant or plant part comprises the sequence of SEQ ID NO: 2, optionally wherein X27 is Lys or Arg, optionally wherein X27 is Lys.
  • the plant, or plant part thereof comprises the polynucleotide incorporated into the nuclear genome of the cells of the plant or plant part.
  • the plant or plant part is comprised of dicotyledonous cells, optionally selected from the group consisting of a cotton cell, a tobacco cell, a canola cell, a soybean cell, and an Arabidopsis cell.
  • the plant or plant part is comprised of monocotyledonous cells, optionally selected from the group consisting of a rice cell and a maize cell.
  • the plant or plant part is comprised of maize cells.
  • a plant or plant part thereof comprises in its genome at least one mutant allele of a dwarf-8 (D8) gene, or a homolog (also referred to as a syntelog) or an ortholog thereof.
  • a homolog also referred to as a syntelog
  • the plant or plant part is a maize plant or plant part.
  • the plant, or plant part thereof comprises a polynucleotide wherein the coding domain sequence (CDS) of the dwarf-8 (D8) gene comprises a nucleotide sequence encoding a modified DELLA domain, wherein the native DELLA domain having the amino acid sequence DELLAALGYKVRSSDMADVAQKLEQLE [SEQ ID NO: 5] is modified by a single nucleotide polymorphism (SNP) resulting in the substitution of the terminal E in the DELLA domain of SEQ ID NO: 5 with another amino acid in the encoded polypeptide. Plants harboring this modification exhibit a dwarf phenotype.
  • the terminal E of the DELLA domain is substituted with a positively charged, polar amino acid.
  • the positively charged, polar amino acid is K or R.
  • the positively charged polar amino acid is K.
  • the modified dwarf-8 (D8) gene of the present disclosure can encode the amino acid sequence of SEQ ID NO: 10 or an amino acid sequence that is at least about 75%, 80%, 90%, 95% or 99% identical to SEQ ID NO: 10, with the proviso that the amino acid at position 64 (relative to the numbering of SEQ ID NO: 10) is not E, and optionally wherein the amino acid at position 64 is H, K or R, optionally wherein the amino acid at position 64 is K or R, optionally wherein the amino acid at position 64 is K.
  • the modified dwarf- 8 (D8) CDS encodes the amino acid sequence of SEQ ID NO: 10 or an amino acid sequence that is at least about 80% identical to SEQ ID NO: 10, with the proviso that the amino acid at position 64 (relative to the numbering of SEQ ID NO: 10) is not E, and optionally wherein the amino acid at position 64 is H, K or R, optionally wherein the amino acid at position 64 is K or R, optionally wherein the amino acid at position 64 is K.
  • the modified dwarf-8 (D8) CDS encodes an amino acid sequence that is at least about 85% identical to SEQ ID NO: 10, with the proviso that the amino acid at position 64 (relative to the numbering of SEQ ID NO: 10) is not E, and optionally wherein the amino acid at position 64 is H, K or R, optionally wherein the amino acid at position 64 is K or R, optionally wherein the amino acid at position 64 is K.
  • the CDS encodes an amino acid sequence that is at least about 90% identical to SEQ ID NO: 10 with the proviso that the amino acid at position 64 (relative to the numbering of SEQ ID NO: 10) is not E, and optionally wherein the amino acid at position 64 is H, K or R, optionally wherein the amino acid at position 64 is K or R, optionally wherein the amino acid at position 64 is K.
  • the CDS encodes an amino acid sequence that is at least about 95% identical to SEQ ID NO: 10 with the proviso that the amino acid at position 64 (relative to the numbering of SEQ ID NO: 10) is not E, and optionally wherein the amino acid at position 64 is H, K or R, optionally wherein the amino acid at position 64 is K or R, optionally wherein the amino acid at position 64 is K.
  • the CDS encodes an amino acid sequence that is at least about 99% identical to SEQ ID NO: 10 with the proviso that the amino acid at position 64 (relative to the numbering of SEQ ID NO: 10) is not E, and optionally wherein the amino acid at position 64 is H, K or R, optionally wherein the amino acid at position 64 is K or R, optionally wherein the amino acid at position 64 is K.
  • the modified dwarf-8 (D8) gene of the present disclosure can encode the amino acid sequence of SEQ ID NO: 10 or an amino acid sequence that is at least about 75%, 80%, 90%, 95% or 99% identical to SEQ ID NO: 10, with the proviso that the amino acid at position 45 (relative to the numbering of SEQ ID NO: 10) is not Ala, and optionally wherein the amino acid at position 45 is E or R, optionally wherein the amino acid at position 45 is R.
  • the modified dwarf-8 (D8) CDS encodes the amino acid sequence of SEQ ID NO: 10 or an amino acid sequence that is at least about 80% identical to SEQ ID NO: 10, with the proviso that the amino acid at position 45 (relative to the numbering of SEQ ID NO: 10) is E or R, optionally wherein the amino acid at position 45 is R.
  • the modified dwarf-8 (D8) CDS encodes an amino acid sequence that is at least about 85% identical to SEQ ID NO: 10, with the proviso that the amino acid at position 45 (relative to the numbering of SEQ ID NO: 10) is E or R, optionally wherein the amino acid at position 45 is R.
  • the CDS encodes an amino acid sequence that is at least about 90% identical to SEQ ID NO: 10 with the proviso that the amino acid at position 45 (relative to the numbering of SEQ ID NO: 10) is E or R, optionally wherein the amino acid at position 45 is R. In one embodiment the CDS encodes an amino acid sequence that is at least about 95% identical to SEQ ID NO: 10 with the proviso that the amino acid at position 45 (relative to the numbering of SEQ ID NO: 10) is E or R, optionally wherein the amino acid at position 45 is R.
  • the CDS encodes an amino acid sequence that is at least about 99% identical to SEQ ID NO: 10 with the proviso that the amino acid at position 45 (relative to the numbering of SEQ ID NO: 10) is E or R, optionally wherein the amino acid at position 64 is R.
  • a cell, tissue, organ, seed or progeny of an abovedescribed plant that comprises modified dwarf-8 (D8) gene of the present disclosure or a progeny or hybrid thereof.
  • the plant, plant cell, plant tissue, plant seed or other plant part is a maize plant or maize plant part thereof.
  • nucleic acid molecule comprising (or consisting essentially of or consisting of) a nucleotide sequence encoding a CDS of the maize dwarf-8 (D8) gene, or a homolog (also referred to as a syntelog) or an ortholog thereof, wherein the CDS comprises a nucleotide sequence encoding a modified DELLA domain that differs from the native DELLA domain amino acid sequence of DELLAALGYKVRSSDMADVAQKLEQLE [SEQ ID NO: 5] by a substitution of the terminal E is with another amino acid, wherein a plant comprising the dwarf- 8 (D8) gene encoding the modified DELLA domain exhibits a dwarf phenotype.
  • the dwarf-8 (D8) gene encoding the modified DELLA domain comprises a sequence of SEQ ID NO: 7 modified by a SNP present at nucleotide position 190 of the maize D8 CDS or the corresponding nucleotide position encoding the last amino acid of the DELLA domain of the homolog or the ortholog thereof.
  • the SNP can be a substitution of guanine 190 of the native maize D8 gene (SEQ ID NO: 7) or the corresponding nucleotide position encoding the last amino acid of the DELLA domain of the homolog or the ortholog thereof with adenine (G190A for the maize D8 gene of SEQ ID NO: 7).
  • the SNP can result in the substitution of the glutamic acid residue at position 64 of the maize D8 protein or the corresponding last amino acid of the DELLA domain of the homolog or the ortholog thereof with lysine (E64K for the maize D8 protein).
  • the modified peptide of SEQ ID NO: 5 is encoded by the nucleotide sequence GATGAGCTGCTGGCCGCGCTCGGGTACAAGGTGCGTTCGTCGGATATG GCGGACGTCGCGCAGAAGCTGGAGCAGCTCAAG [SEQ ID NO: 43].
  • the CDS can encode the amino acid sequence of SEQ ID NO: 10 in Fig. 12 or an amino acid sequence that is at least about 75%, 80%, 90%, 95% or 99% identical to SEQ ID NO: 10, wherein the amino acid at position 63 is substituted with a positively charged polar amino acid, optionally Lys or Arg.
  • the dwarf-8 (D8) gene encoding the modified DELLA domain comprises a sequence of SEQ ID NO: 7 modified by a SNP present at nucleotide position 133 of the maize D8 CDS or the corresponding nucleotide position encoding the eighth amino acid of the DELLA domain of the homolog or the ortholog thereof.
  • the SNP can be a substitution of glycine 133 of the native maize D8 gene (SEQ ID NO: 7) or the corresponding nucleotide position encoding the eighth amino acid of the DELLA domain of the homolog or the ortholog thereof with adenine (G133A for the maize D8 gene of SEQ ID NO: 7).
  • the SNP can result in the substitution of the glycine acid residue at position 45 of the maize D8 protein or the corresponding eighth amino acid of the DELLA domain of the homolog or the ortholog thereof with arginine (G45R for the maize D8 protein).
  • the modified peptide of SEQ ID NO: 5 is encoded by the nucleotide sequence GATGAGCTGCTGGCCGCGCTCAGGTACAAGGTGCGTTCGTCGGATATG GCGGACGTCGCGCAGAAGCTGGAGCAGCTCGAG [SEQ ID NO: 46].
  • the CDS can encode the amino acid sequence of SEQ ID NO: 10 in Fig. 12 or an amino acid sequence that is at least about 75%, 80%, 90%, 95% or 99% identical to SEQ ID NO: 10, wherein the amino acid at position 45 is substituted with a glutamic acid or Arg.
  • an isolated or purified mutant maize D8 protein comprising (or consisting essentially of or consisting of) the amino acid sequence of SEQ ID NO: 10 or an amino acid sequence that is at least about 75% identical to SEQ ID NO: 10, wherein the amino acid sequence comprises a DELLA domain with the amino acid sequence DELLAALGYKVRSSDMADVAQKLEQLE [SEQ ID NO: 5] in which the terminal E is substituted with another amino acid.
  • the terminal E can be substituted with another positively charged, polar amino acid.
  • the positively charged, polar amino acid is K or R, optionally wherein the positively charged, polar amino acid is K.
  • the isolated or purified mutant maize D8 protein can comprise (or consist essentially of or consist of) an amino acid sequence that is at least about 80% identical to SEQ ID NO: 10.
  • the isolated or purified mutant maize D8 protein can comprise (or consist essentially of or consist of) an amino acid sequence that is at least about 85% identical to SEQ ID NO: 10.
  • the isolated or purified mutant maize D8 protein can comprise (or consist essentially of or consist of) an amino acid sequence that is at least about 90% identical to SEQ ID NO: 10.
  • the isolated or purified mutant maize dwarf-8 (D8) protein can comprise (or consist essentially of or consist of) an amino acid sequence that is at least about 95% identical to SEQ ID NO: 10.
  • a vector which can be introduced into a plant, a plant cell, a plant tissue, or a plant organ, and which comprises an abovedescribed isolated or purified nucleic acid molecule operably linked to a promoter that promotes expression of the CDS in the plant, the plant cell, the plant tissue, or the plant organ.
  • a plant, or a plant cell, plant tissue, or plant part thereof which comprises the above-described vector.
  • the plant is a monocot, including for example, a monocot selected from the group consisting of maize, wheat, rice, sorghum, rye, sugar cane, teff, millet, oats, barley, lawn grass, and turf grass.
  • the plant is a dicot, including for example a dicot selected from the group consisting of Arabidopsis, soybean, sunflower, safflower, alfalfa, Brassica (e.g., rape), cotton, and peanut.
  • the isolated or purified nucleic acid molecule operably linked to a promoter can be transfected into a plant cell and optionally stably integrated into the genome of the plant (or cell, tissue, or organ thereof) and plants can be generated from the transfected cell.
  • a seed comprising and expressing the isolated or purified nucleic acid molecule.
  • a method of producing a dwarf plant comprises introducing an above-described vector into a plant, or a cell, tissue, or organ thereof, whereupon the CDS is stably expressed therein, and, when the nucleic acid molecule or the vector is introduced into a cell, tissue or organ, the method further comprises regenerating a plant therefrom.
  • the method can further comprise sexually or asexually propagating the plant.
  • the plant can be sexually propagated using plant breeding techniques.
  • the plant can be sexually propagated as a male.
  • the plant comprising the D8 modified gene can be sexually propagated as a male or a female with a B16, B73, Mol7 or other inbred maize line as a male or a female to produce a dwarf plant comprising all of the characteristics of the inbred line but exhibiting a dwarf phenotype.
  • the modified D8 gene is introduced into a monocot.
  • the monocot is selected from the group consisting of maize, wheat, rice, sorghum, rye, sugar cane, teff, millet, oats, barley, lawn grass, and turf grass.
  • the modified D8 gene is introduced into a dicot.
  • the dicot is selected from the group consisting of Arabidopsis, soybean, sunflower, safflower, alfalfa, Brassica (e.g., rape), cotton, and peanut.
  • the modified D8 gene is introduced into an inbred monocot or dicot via recombinant techniques, wherein the modified D8 gene comprises a mutant allele of a dwarf-8 (D8) gene, or a homolog (also referred to as a syntelog) or an ortholog thereof, wherein the CDS of the gene comprises a nucleotide sequence encoding a DELLA domain that is modified relative to the native DELLA amino acid sequence of DELLAALGYKVRSSDMADVAQKLEQLE [SEQ ID NO: 5] by the substitution of the terminal glutamic acid residue with a positively charged polar amino acid.
  • the method comprises:
  • the method optionally further comprises:
  • the first plant can be crossed as a male or a female.
  • the first plant can be an above-described maize plant, and the second plant can be a maize hybrid.
  • the maize hybrid can be B16, B73 or Mol7 maize inbred lines or other inbred maize line.
  • the first plant can be as described above, and the second plant can be a plant of the same species as the first plant.
  • the method comprises introducing at least one nucleotide modification through a targeted site- directed modification at a genomic locus of a plant, or a cell, tissue, or organ thereof, wherein the genomic locus comprises an allele of a maize dwarf-8 (D8) gene, or a homolog (also referred to as a syntelog) or an ortholog thereof, wherein the CDS of the gene comprises a DELLA domain DELLAALGYKVRSSDMADVAQKLEQLE [SEQ ID NO: 5] and the first nucleotide of the codon encoding the terminal E is mutated from G to A (G190A in maize) resulting in the substitution of the terminal E with another amino acid (optionally the terminal E can be substituted with K (E64K in maize)) and the plant exhibiting a dwarf phenotype; or the first nucleotide of the codon encoding eighth amino acid of the DELLA domain is
  • the targeted site- directed modification can involve the use of CRISPR-Cas9 endonuclease, Cpf 1 endonuclease, Zn finger nuclease, meganuclease, or TALEN.
  • the method can further comprise regenerating a plant therefrom.
  • the plant can be sexually propagated using plant breeding techniques.
  • the plant can be sexually propagated as a male or a female.
  • the plant can be maize and sexually propagated as a male or a female with a B16, B73 or Mo 17 maize inbred lines or other maize line as a male or a female.
  • the plant can be a monocot.
  • the monocot can be selected from the group consisting of maize, wheat, rice, sorghum, rye, sugar cane, teff, millet, oats, barley, lawn grass, and turf grass.
  • the plant can be a dicot.
  • the dicot can be selected from the group consisting of Arabidopsis, soybean, sunflower, safflower, alfalfa, Brassica (e.g., rape), cotton, and peanut.
  • Fig. 1 shows heights of ears, flag leaves, and total plants for B73, heterozygous D16 (D16_het:B73), and homozygous D16 (D16_homo:B73).
  • Fig- 2 shows internode number (#) vs. internode length (cm) for B73, heterozygous D16 (D16_het:B73), and homozygous D16 (D16_homo:B73).
  • FIG. 3 shows photographs of DI 6 homozygous mutant plants at different stages of development.
  • Fig. 4 shows photographs of DI 6 homozygous mutant plants (D76/D76::B73) and B73 plants under drought conditions. Visual wilting was less pronounced in £>76 homozygous mutant plants compared to the wild-type B73 grown under same water regimes to simulate drought conditions.
  • FIG. 5 shows photographs of the roots of a DI 6 homozygous plant (Z)76/D76::B73) and a B73 plant evidencing that the roots of the D16 homozygous plant are comparable, if not longer, than the wild-type B73 plants.
  • Figs. 6A and 6B show photographs of a DI 6 homozygous plant ( 76/O76::B73) (Fig. 6A) and a B73 plant (Fig. 6B).
  • the roots of D16 homozygous plants reached the bottom of the rhizotron faster compared to the roots of wild-type B73 plants grown under same water regime.
  • Figs. 7A and 7B show photographs of B73/Mol7 hybrid plants with (D76/+:B73/Mol7) and without (B73/Mol7) D16 before (Fig. 7A) and after (Fig. 7B) flowering.
  • Fig. 8 shows primary ear height, flag leaf height, and total plant height for different DI 6 hybrids and their isogenic wild-type hybrids.
  • Fig. 9 shows internode number (#) vs. internode length (cm) for different D16 hybrids and their isogenic wild-type hybrids.
  • the seventh internode i.e., 7 on the x-axis is the primary ear internode.
  • Fig. 10 show flexural stiffness (N/m 2 ) of D16 hybrids and their isogenic wild-type hybrids. The stalk strength of D16 hybrids is similar to isogenic wildtype hybrids.
  • Fig. 11 shows the amino acid sequence alignment of Dwarf 8 [SEQ ID NO: 10] and Dwarfl6 [SEQ ID NO: 12] proteins.
  • the Dwarfl6 protein has an E64K missense mutation.
  • Fig. 12 shows the amino acid sequence alignment of Dwarf 8 [SEQ ID NO: 10], Dwarf9 [SEQ ID NO: 11], and Dwarfl6 [SEQ ID NO: 12] proteins.
  • the Dwarf 16 protein has an E64K mis sense mutation.
  • Fig. 13 shows the structure of the DWARF8 gene (B73v4 Zm00001d033680).
  • the solid gray box depicts the exon and an asterisk indicates the stop codon.
  • the first (+1) and last (+630) amino acid positions of DWARF8 are indicated.
  • the DELLA motif that includes E64K missense mutation in Dwarf 16 protein, is displayed along with the wildtype Dwarf 8 DELLA motif sequence.
  • Fig. 14 shows the nucleotide sequence of the dwarf8 gene [SEQ ID NO:
  • Fig. 15 shows the nucleotide sequence of the dwarf9 gene [SEQ ID NO:
  • Fig. 16 shows the nucleotide sequence of the dwarfl6 gene [SEQ ID NO:
  • Fig. 17 shows the nucleotide sequence [SEQ ID NO: 6], which encodes the DELLA domain having the amino acid sequence of SEQ ID NO: 5.
  • the term "substantially” can allow for a degree of variability in a value or range, for example, within 90%, within 95%, 99%, 99.5%, 99.9%, 99.99%, or at least about 99.999% or more of a stated value or of a stated limit of a range.
  • purified and like terms relate to the isolation of a molecule or compound in a form that is substantially free of contaminants normally associated with the molecule or compound in a native or natural environment. As used herein, the term “purified” does not require absolute purity; rather, it is intended as a relative definition.
  • purified polypeptide is used herein to describe a polypeptide which has been separated from other compounds including, but not limited to nucleic acid molecules, lipids and carbohydrates.
  • isolated requires that the referenced material be removed from its original environment (e.g., the natural environment if it is naturally occurring).
  • a naturally-occurring polynucleotide present in a living animal is not isolated, but the same polynucleotide, separated from some or all of the coexisting materials in the natural system, is isolated.
  • dwarf used in the context of plants encompasses plants that are atypically small relative to the corresponding wild type plant. Generally, a dwarf plant has a stature or height that is reduced from that of a typical wild-type plant by at least about 5%, 10%, 15%, 20%, 25% or more.
  • the present disclosure is based on the discovery of a partially dominant dwarfing mutant in maize.
  • the mutant (designated DI 6) was initially found segregating as a heterozygote in an M2 family of a mutant library of B73 generated by ethyl methanesulfonate (EMS).
  • the mutant library was generated using a modified version of a recurrent mutagenesis strategy referred to as NextGEM (for next generation mutagenesis) (see USPN 10,595,479, which is hereby incorporated by reference for its teachings regarding same).
  • Characteristic of the mutant is a single nucleotide polymorphism (SNP), which, to the best of the inventor’s knowledge, has not been previously reported in any plant species.
  • SNP single nucleotide polymorphism
  • a maize plant comprising in its genome at least one mutant allele of a dwarf-8 (D8) gene, or a homolog (also referred to as a syntelog) or an ortholog thereof.
  • the coding domain sequence (CDS) of the gene comprises a nucleotide sequence encoding a DELLA domain modified relative to the native the amino acid sequence DELLAALGYKVRSSDMADVAQKLEQLE [SEQ ID NO: 5] in which the codon encoding the native terminal E is mutated by a SNP resulting in the substitution of the terminal E with another amino acid and the plant exhibiting a dwarf phenotype.
  • the terminal E can be substituted with another positively charged, polar amino acid.
  • the positive charged, polar amino acid can be K or R.
  • the native terminal glutamic acid residue of the DELLA domain is substituted with a lysine residue.
  • An example of a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 5 is SEQ ID NO: 6.
  • the amino acid K can be encoded by the codon AAA or AAG.
  • the amino acid R can be encoded by the codon AGA, AGG, CGA, CGC, CGG, or CGT.
  • the codon is mutated from GAA or GAG to AAA or AAG, respectively.
  • the DELLA domain plays a regulatory role in gibberellin- (GA-) induced degradation of the repressor protein RGA. It is so named because of the short stretch of amino acids DELLA occurring at the N-terminal end of the domain.
  • the Arabidopsis gene which contains the DELLA domain and is involved in GA-signaling repression is the GA-insensitive (GAI) gene, which is an ortholog of the maize D8 and D9 (see, e.g., USPN 7,557,266 for D9; also see Lawit et al., Plant & Cell Physiol 51(11): 1854-1868 (2010)) and the wheat Rht- Bl/Dl genes (see, e.g., USPN 6,762,348). D8 and D9 are more than 92% identical at amino acid level.
  • Additional homologs of the maize D8 and D9 proteins have been described for other plant species including for example: wheat (SEQ ID NOs: 13- 15), rice (SEQ ID NO: 16), Sorghum (SEQ ID NO: 17), Barley (SEQ ID NO: 18), Sugarcane (SEQ ID NOs: 19-22), Arabidopsis (SEQ ID NOs: 23-27), Rapeseed (SEQ ID NOs: 28-30), cotton (SEQ ID NOs: 31-33), sunflower (SEQ ID NOs: 34- 36), soybean (SEQ ID NOs: 37-41) and tomato (SEQ ID NO: 42).
  • wheat SEQ ID NOs: 13- 15
  • rice SEQ ID NO: 16
  • Sorghum SEQ ID NO: 17
  • Barley SEQ ID NO: 18
  • Sugarcane SEQ ID NOs: 19-22
  • Arabidopsis SEQ ID NOs: 23-27
  • Rapeseed SEQ ID NOs: 28-30
  • cotton SEQ ID NOs: 31-33
  • Codons which can encode the amino acids, are set forth in the following table using A to indicate adenine, T to indicate thymine, G to indicate guanine, and C to indicate cytosine:
  • the CDS of the modified D8 gene of the present disclosure encodes the amino acid sequence of SEQ ID NO: 44 or SEQ ID NO: 47.
  • the CDS can encode an amino acid sequence that is at least about 75% identical to SEQ ID NO: 44 or SEQ ID NO: 47.
  • the CDS can encode an amino acid sequence that is at least about 80% identical to SEQ ID NO: 44 or SEQ ID NO: 47.
  • the CDS can encode an amino acid sequence that is at least about 85% identical to SEQ ID NO: 44 or SEQ ID NO: 47.
  • the CDS can encode an amino acid sequence that is at least about 90% identical to SEQ ID NO: 44 or SEQ ID NO: 47.
  • CDS can encode an amino acid sequence that is at least about 95% identical to SEQ ID NO: 44 or SEQ ID NO: 47.
  • a plant cell, tissue, organ, seed comprising the modified D8 encoding polypeptide of the present disclosure, or progeny of an abovedescribed maize plant or a hybrid thereof.
  • a maize plant, or maize plant part thereof is provided wherein the cells of the maize plant, or maize plant part thereof, comprise a polynucleotide that encodes a polypeptide comprising an amino acid sequence having at least 85% sequence identity to SEQ ID NO: 44 and comprising the peptide sequence of SEQ ID NO: 2.
  • a maize plant, or maize plant part thereof wherein the cells of the maize plant, or maize plant part thereof, comprise a polynucleotide that encodes a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 44 and comprising the peptide sequence of SEQ ID NO: 2.
  • nucleic acid molecule comprising (or consisting essentially of or consisting of) a nucleotide sequence encoding a CDS of the maize dwarf-8 (D8) gene, or a homolog (also referred to as a syntelog) or an ortholog thereof.
  • the CDS of the isolated or purified nucleic acid molecule comprises a nucleotide sequence encoding a modified DELLA domain with the amino acid sequence DELLAALGYKVRSSDMADVAQKLEQLE [SEQ ID NO: 5] in which the codon encoding the terminal E is mutated by a SNP resulting in the substitution of the terminal E with another amino acid, wherein upon introduction of said isolated or purified nucleic acid molecule into a plant cell will produce a plant exhibiting a dwarf phenotype.
  • the SNP occurs at nucleotide position 190 of the maize D8 CDS or the corresponding nucleotide position encoding the last amino acid of the DELLA domain of the homolog or the ortholog thereof.
  • the SNP can be a substitution of guanine 190 of the maize D8 CDS or the corresponding nucleotide position encoding the last amino acid of the DELLA domain of the homolog or the ortholog thereof with adenine (G190A for the maize D8 gene).
  • the SNP can result in the substitution of glutamate 64 of the maize D8 protein or the corresponding last amino acid of the DELLA domain of the homolog or the ortholog thereof with lysine (E64K for the maize D8 protein).
  • SEQ ID NO: 5 can be encoded by the nucleotide sequence GATGAGCTGCTGGCCGCGCTCGGGTACAAGGTGCGTTCGTCGGATATG GCGGACGTCGCGCAGAAGCTGGAGCAGCTCGAG [SEQ ID NO: 6], wherein the last codon is modified to encode for Lys or Arg.
  • the CDS can encode the amino acid sequence of SEQ ID NO: 10 in Fig. 12 or an amino acid sequence that is at least about 75% identical to SEQ ID NO: 10.
  • SEQ ID NO: 10 can be encoded by the nucleotide sequence SEQ ID NO: 7 in Fig. 14.
  • the CDS can encode the amino acid sequence of SEQ ID NO: 10 or an amino acid sequence that is at least about 80% identical to SEQ ID NO: 10.
  • the CDS can encode the amino acid sequence of SEQ ID NO: 10 or an amino acid sequence that is at least about 85% identical to SEQ ID NO: 10.
  • the CDS can encode the amino acid sequence of SEQ ID NO: 10 or an amino acid sequence that is at least about 90% identical to SEQ ID NO: 10.
  • the CDS can encode the amino acid sequence of SEQ ID NO: 10 or an amino acid sequence that is at least about 95% identical to SEQ ID NO: 10.
  • DNA shuffling can be used to shuffle the mutant DELLA domain described herein from the D8 gene to another gene, such as the D9 gene of maize (see, e.g., Stemmer, PNAS USA 91 : 10747-10751 (1994);
  • the nucleic acid molecules can be synthesized or isolated from a plant (or cells, tissue, organ or seeds thereof). Methods can involve mechanical, electrical and/or chemical disruption of the plant (or cells, tissue, organ or seeds thereof), contacting the disrupted plant (or cells, tissue, organ or seeds thereof) with a buffer or solvent to produce a solution or suspension comprising nucleic acids, optionally contacting the nucleic acids with a precipitating agent to precipitate the nucleic acids, optionally extracting the nucleic acids, and optionally separating the nucleic acids, such as by centrifugation or by binding to beads or a column, with subsequent elution. If DNA is being isolated, an RNase can be employed in one or more steps.
  • an isolated or purified mutant maize D8 protein comprising (or consisting essentially of or consisting of) the amino acid sequence of SEQ ID NO: 10 or an amino acid sequence that is at least about 75% identical to SEQ ID NO: 10, wherein the amino acid sequence comprises a DELLA domain with the amino acid sequence DELLAALGYKVRSSDMADVAQKLEQLE [SEQ ID NO: 5] in which the terminal E is substituted with another amino acid.
  • the terminal E can be substituted with another negatively charged, polar amino acid.
  • the negatively charged, polar amino acid can be K or R.
  • the negatively charged, polar amino acid can be K.
  • the isolated or purified mutant maize D8 protein can comprise (or consist essentially of or consist of) an amino acid sequence that is at least about 80% identical to SEQ ID NO: 10.
  • the isolated or purified mutant maize D8 protein can comprise (or consist essentially of or consist of) an amino acid sequence that is at least about 85% identical to SEQ ID NO: 10.
  • the isolated or purified mutant maize D8 protein can comprise (or consist essentially of or consist of) an amino acid sequence that is at least about 90% identical to SEQ ID NO: 10.
  • the isolated or purified mutant maize dwarf-8 (D8) protein can comprise (or consist essentially of or consist of) an amino acid sequence that is at least about 95% identical to SEQ ID NO: 10.
  • Sequence identity can be at the nucleotide level and/or the amino acid level as indicated above. Sequence identity refers to the residues in two sequences that are the same when aligned for maximum correspondence over a specified comparison window. When percentage of sequence identity is issued in reference to proteins, it is recognized that residue positions, which are not identical, often differ by conservative amino acid substitutions, where amino acid residues are substituted for other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity) and, therefore, do not change the functional properties of the molecule. When sequences differ in conservative substitutions, the percent sequence identity may be adjusted upwards to correct for the conservative nature of the substitutions.
  • Sequences that differ by such conservative substitutions are said to have “sequence similarity” or “similarity.”
  • Identity and similarity may be as defined and determined using readily available computer programs (see, e.g., CLUSTAL, GAP, BESTFIT, BLAST, FASTA, TFASTA, and ALIGN).
  • a vector which can be introduced into a plant, a plant cell, a plant tissue, or a plant organ, and which comprises an abovedescribed isolated or purified nucleic acid molecule operably linked to a promoter (and, if desired, other regulatory sequences) that promotes expression of the CDS in the plant, the plant cell, the plant tissue, or the plant organ.
  • a promoter and, if desired, other regulatory sequences
  • Two or more elements can be operably linked, i.e., functionally linked, yet contiguous or noncontiguous.
  • the promoter can be, and desirably is, one that is not naturally operably linked to the nucleic acid, being one isolated or derived from another gene.
  • the native promoter can be used.
  • the promoter can be inducible, tissue-preferred, tissue- specific, developmentally regulated, or constitutive.
  • promoters include, but are not limited to, the cauliflower mosaic virus 35S (CaMV 35S) promoter, the maize glutathione-S-transferase isoform IT (GST- 11-27) promoter, the cauliflower meri-5 promoter, the Arabidopsis thaliana LEAFY promoter, rice actin, and ubiquitin.
  • CaMV 35S cauliflower mosaic virus 35S
  • GST- 11-27 maize glutathione-S-transferase isoform IT
  • GST- 11-27 the cauliflower meri-5 promoter
  • the Arabidopsis thaliana LEAFY promoter the Arabidopsis thaliana LEAFY promoter
  • rice actin and ubiquitin.
  • Suitable vectors can be chosen, such as selected from commercially available sources, or constructed and can contain regulatory sequences, such as promoter sequences, terminator fragments, polyadenylation sequences, enhancer sequences, marker genes, and other sequences as appropriate. See, e.g., Molecular Cloning: A Laboratory Manual, 2 nd ed., Sambrook et al., Cold Spring Harbor Laboratory Press (1989). Plant preferred codons can be used to improve expression (see, e.g., Murray et al., Nucl Acids Res 17: 477-498 (1989)). Likewise, the G-C content of the nucleotide sequence can be adjusted to levels characteristic of a given host plant.
  • nucleic acids e.g., DNA
  • DNA nucleic acids
  • a plant, or a cell, tissue, or organ thereof, which comprises the abovedescribed vector is also provided.
  • the nucleotide sequence may be incorporated into the genome. Indeed, if the vector used to introduce an abovedescribed isolated or purified nucleic acid molecule will recombine with the genome, the vector need not necessarily comprise an operably linked promoter or other regulatory sequence(s). Alternatively, the vector can be extra-genomic.
  • Any appropriate method of plant transformation can be used to generate plant cells comprising a nucleic acid, construct, or vector. Following transformation, plants may be regenerated from transformed plant cells and tissues. DNA can be transformed into plant cells using Ti-plasmid carried by Agrobacterium, particle or microprojectile bombardment, microinjection (see, e.g., Green et al., Plant Tissue and Cell Culture, Academic Press (1987)), electroporation, other forms of direct DNA uptake, liposome-mediated DNA uptake (see, e.g., Freeman et al., Plant Cell Physiol 29: 1353 (1984)), or vortexing (see, e.g., Kindle, PNAS USA 87: 1228 (1990)).
  • a plant can be regenerated, for example, from single cells, callus tissue, or leaf discs. See, e.g., Vasil et al., Cell Culture and Somatic Cell Genetics of Plants (Vols. I-III); Laboratory Procedures and Their Applications, Academic Press (1984); and Weissbach and Weissbach, Methods for Plant Molecular Biology, Academic Press (1989).
  • the plant can be a monocot.
  • the monocot can be selected from the group consisting of maize, wheat, rice, sorghum, rye, sugar cane, teff, millet, oats, barley, lawn grass, and turf grass.
  • the plant can be a dicot.
  • the dicot can be selected from the group consisting of Arabidopsis, soybean, sunflower, safflower, alfalfa, Brassica (e.g., rape), cotton, and peanut.
  • the isolated or purified nucleic acid molecule operably linked to a promoter can be stably integrated into the genome of the plant (or cell, tissue, or organ thereof).
  • a seed comprising and expressing the isolated or purified nucleic acid molecule.
  • a method of producing a dwarf plant comprises introducing an above-described vector into a plant, or a cell, tissue, or organ thereof, whereupon the CDS is stably expressed therein, and, when the nucleic acid molecule or the vector is introduced into a cell, tissue or organ, the method further comprises regenerating a plant therefrom.
  • the method can further comprise sexually or asexually propagating the plant.
  • the plant can be sexually propagated using plant breeding techniques.
  • the plant can be sexually propagated as a male.
  • the plant When the plant is maize, the plant can be sexually propagated as a male with a B 16, B73 or Mol7 female.
  • the plant can be a monocot.
  • the monocot can be selected from the group consisting of maize, wheat, rice, sorghum, rye, sugar cane, teff, millet, oats, barley, lawn grass, and turf grass.
  • the plant can be a dicot.
  • the dicot can be selected from the group consisting of Arabidopsis, soybean, sunflower, safflower, alfalfa, Brassica (e.g., rape), cotton, and peanut.
  • the method comprises:
  • the method optionally further comprises:
  • the first plant is crossed as a male or a female.
  • the first plant a maize plant comprising the mutant allele of dwarf-8 (D8)
  • the second plant can be a maize hybrid that lacks the mutant allele of dwarf-8 (D8).
  • the maize hybrid lacking the mutant allele of dwarf-8 (D8) can be B16, B73 or Mol7.
  • the first plant can be as described above, and the second plant can be a plant of the same species as the first plant.
  • the method comprises introducing at least one nucleotide modification through a targeted site- directed modification at a genomic locus of a plant, or a cell, tissue, or organ thereof, wherein the genomic locus comprises an allele of a maize dwarf-8 (D8) gene, or a homolog (also referred to as a syntelog) or an ortholog thereof.
  • the dwarf- 8 (D8) gene is modified to encode a polypeptide comprising a DELLA sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4.
  • the native maize D8 gene is modified wherein the coding domain sequence (CDS) of the gene comprises a DELLA domain of DELLAALGYKVRSSDMADVAQKLEQLE [SEQ ID NO: 5] and the first nucleotide of the codon encoding the terminal E is mutated from G to A (G190A in maize) resulting in the substitution of the terminal E with another amino acid and resulting in a plant comprising the modified D8 gene exhibiting a dwarf phenotype.
  • the terminal E can be substituted with K (E64K in maize).
  • targeted site-directed modification can involve the use of CRISPR-Cas9 endonuclease, Cpfl endonuclease, Zn finger nuclease, meganuclease, or TALEN (see, e.g., USPAPN 2020/0181623 and USPAPN 2020/0199609, both of which are hereby incorporated by reference for their teachings regarding same).
  • the method can further comprise regenerating a plant therefrom.
  • the plant can be sexually propagated using plant breeding techniques.
  • the plant can be sexually propagated as a male or a female.
  • the plant can be maize and sexually propagated as a male or a female with a B16, B73 or Mol7 crossing partner.
  • the plant can be a monocot.
  • the monocot can be selected from the group consisting of maize, wheat, rice, sorghum, rye, sugar cane, teff, millet, oats, barley, lawn grass, and turf grass.
  • the plant can be a dicot.
  • the dicot can be selected from the group consisting of Arabidopsis, soybean, sunflower, safflower, alfalfa, Brassica (e.g., rape), cotton, and peanut.
  • the methods disclosed herein are useful in producing dwarf varieties of crop plants.
  • Dwarf crop plants can be obtained which have improved agronomic characteristics, such as reduced plant height, reduced ear height (in maize), drought tolerance, increased resilience to wind and storm, reduced potential for lodging, and increased accessibility for application of fertilizer and pesticides.
  • less fertilizer and pesticides can be required, and plants can be planted more densely, thereby increasing yield.
  • a maize plant comprising in its genome at least one mutant allele of a dwarf-8 (D8) gene, or a homolog (also referred to as a syntelog) or an ortholog thereof, wherein the coding domain sequence (CDS) of the gene comprises a nucleotide sequence encoding a DELLA domain with the amino acid sequence DELLAALGYKVRSSDMADVAQKLEQLE [SEQ ID NO: 5] in which the codon encoding the terminal E is mutated by a single nucleotide polymorphism (SNP) resulting in the substitution of the terminal E with another amino acid and the plant exhibiting a dwarf phenotype.
  • D8 dwarf-8
  • CDS coding domain sequence
  • the maize plant of embodiment 1 is provided, wherein the terminal E is substituted with another positively charged, polar amino acid.
  • a maize plant of embodiment 2 wherein the positively charged, polar amino acid is K or R, optionally wherein the positively charged polar amino acid is K.
  • a maize plant of any one of embodiments 1-3 wherein the CDS encodes the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence that is at least about 75% identical to SEQ ID NO: 10.
  • a maize plant of any one of embodiments 1-3 wherein the CDS encodes the amino acid sequence of SEQ ID NO: 10 or an amino acid sequence that is at least about 80% identical to SEQ ID NO: 10.
  • a maize plant of any one of embodiments 1-3 wherein the CDS encodes the amino acid sequence of SEQ ID NO: 10 or an amino acid sequence that is at least about 85% identical to SEQ ID NO: 10.
  • a maize plant of any one of embodiments 1-3 wherein the CDS encodes the amino acid sequence of SEQ ID NO: 10 or an amino acid sequence that is at least about 90% identical to SEQ ID NO: 10.
  • a maize plant of any one of embodiments 1-3 wherein the CDS encodes the amino acid sequence of SEQ ID NO: 10 or an amino acid sequence that is at least about 95% identical to SEQ ID NO: 10.
  • a maize plant, or a maize plant part thereof, of any one of embodiments 1-8 wherein the cells of the maize plant, or a maize plant part thereof, comprise a nucleic acid molecule comprising a coding domain sequence (CDS) of the maize dwarf-8 (D8) gene, or a homolog, wherein the CDS comprises a nucleotide sequence encoding a DELLA domain with the amino acid sequence DELLAALGYKVRSSDMADVAQKLEQLE [SEQ ID NO: 5] in which the codon encoding the terminal E is mutated by a single nucleotide polymorphism (SNP) resulting in the substitution of the terminal E with another amino acid.
  • CDS coding domain sequence
  • D8 maize dwarf-8
  • an isolated or purified nucleic acid molecule comprises (or consisting essentially of or consisting of) a nucleotide sequence encoding a coding domain sequence (CDS) of the maize dwarf-8 (D8) gene, or a homolog (also referred to as a syntelog) or an ortholog thereof, wherein the CDS comprises a nucleotide sequence encoding a DELLA domain with the amino acid sequence
  • DELLAALGYKVRSSDMADVAQKLEQLE [SEQ ID NO: 5] in which the codon encoding the terminal E is modified to result in the encoded DELLA domain comprising a substitution of the terminal E with another amino acid.
  • the isolated or purified nucleic acid molecule of embodiment 10 is provided, wherein the modification occurs at nucleotide position 190 of the maize D8 CDS or the corresponding nucleotide position encoding the last amino acid of the DELLA domain of the homolog or the ortholog thereof.
  • the isolated or purified nucleic acid molecule of embodiment 10 or 11 is provided wherein the modification is a substitution of guanine 190 of the maize D8 CDS or the corresponding nucleotide position encoding the last amino acid of the DELLA domain of the homolog or the ortholog thereof with adenine (G190A for the maize D8 gene).
  • the isolated or purified nucleic acid molecule of any one of embodiments 10-12 is provided, wherein the modification results in the substitution of the glutamic acid residue at position 64 of the maize D8 protein or the corresponding last amino acid of the DELLA domain of the homolog or the ortholog thereof with lysine (E64K for the maize D8 protein).
  • the isolated or purified nucleic acid molecule of any one of embodiments 10-13 is provided wherein said isolated or purified nucleic acid molecule comprises the nucleotide sequence GATGAGCTGCTGGCCGCGCTCGGGTACAAGGTGCGTTCGTCGGATATG GCGGACGTCGCGCAGAAGCTGGAGCAGCTCGAG [SEQ ID NO: 6].
  • the isolated or purified nucleic acid molecule of any one of embodiments 10-14 is provided, wherein the D8 CDS encodes the amino acid sequence of SEQ ID NO: 10 in Fig. 12 or an amino acid sequence that is at least about 75% identical to SEQ ID NO: 10.
  • the isolated or purified nucleic acid molecule of embodiment 15 is provided wherein the isolated or purified nucleic acid molecule comprises the sequence SEQ ID NO: 7 in Fig. 14.
  • the isolated or purified nucleic acid molecule of any one of embodiments 10-16 is provided, wherein the CDS encodes the amino acid sequence of SEQ ID NO: 10 or an amino acid sequence that is at least about 80% identical to SEQ ID NO: 10.
  • the isolated or purified nucleic acid molecule of any one of embodiments 10-14 is provided, wherein the CDS encodes the amino acid sequence of SEQ ID NO: 10 or an amino acid sequence that is at least about 85% identical to SEQ ID NO: 10.
  • the isolated or purified nucleic acid molecule of any one of embodiments 10-14 is provided, wherein the CDS encodes the amino acid sequence of SEQ ID NO: 10 or an amino acid sequence that is at least about 90% identical to SEQ ID NO: 10.
  • the isolated or purified nucleic acid molecule of any one of embodiments 10-14 is provided, wherein the CDS encodes the amino acid sequence of SEQ ID NO: 10 or an amino acid sequence that is at least about 95% identical to SEQ ID NO: 10.
  • an isolated or purified mutant maize dwarf- 8 (D8) protein comprising (or consisting essentially of or consisting of) the amino acid sequence of SEQ ID NO: 10 or an amino acid sequence that is at least about 75% identical to SEQ ID NO: 10 is provided, wherein the amino acid sequence comprises a DELLA domain with the amino acid sequence DELLAALGYKVRSSDMADVAQKLEQLE [SEQ ID NO: 5] in which the terminal E is substituted with another amino acid, optionally wherein the terminal E is substituted with another negatively charged, polar amino acid, optionally wherein the negatively charged, polar amino acid is K or R, optionally wherein the negatively charged, polar amino acid is K.
  • the isolated or purified mutant maize dwarf-8 (D8) protein of embodiment 21 comprises (or consists essentially of or consists of) an amino acid sequence that is at least about 80% identical to SEQ ID NO: 1, optionally comprises an amino acid sequence that is at least about 85% identical to SEQ ID NO: 1 , optionally comprises an amino acid sequence that is at least about 90% identical to SEQ ID NO: 1, optionally comprises an amino acid sequence that is at least about 95% identical to SEQ ID NO: 1.
  • a vector which can be introduced into a plant, a plant cell, a plant tissue, or a plant organ is provided, which comprises the isolated or purified nucleic acid molecule of any one of embodiments 10-22 operably linked to a promoter that promotes expression of the CDS in the plant, the plant cell, the plant tissue, or the plant organ.
  • a plant, or a plant cell, plant tissue, plant organ, seed or other plant part thereof is provided, wherein the a plant, or a plant cell, plant tissue, plant organ, seed or other plant part thereof comprises the vector of embodiment 23, optionally wherein nucleic acid molecule of any one of embodiments 10-22 is inserted into the genome of the host plant, or a plant cell, plant tissue, plant organ, seed or other plant part thereof.
  • a plant, or a plant cell, plant tissue, plant organ, seed, or other plant part thereof of embodiment 24 wherein said plant is a monocot, optionally wherein the monocot is selected from the group consisting of maize, wheat, rice, sorghum, rye, sugar cane, teff, millet, oats, barley, lawn grass, and turf grass.
  • a plant, or a plant cell, plant tissue, plant organ, seed, or other plant part thereof of embodiment 24 wherein said plant is a dicot, optionally wherein the dicot is selected from the group consisting of Arabidopsis, soybean, sunflower, safflower, alfalfa, Brassica (e.g., rape), cotton, and peanut.
  • a method of producing a dwarf plant comprises introducing a nucleic acid molecule of any one of embodiments 10-23 into a plant, or a cell, tissue, or organ thereof, whereupon the CDS is stably expressed therein, and, when the nucleic acid molecule is introduced into a cell, tissue or organ, the method further comprises regenerating a plant therefrom.
  • a method of producing a dwarf plant according to embodiment 27 is provided further comprising a step of sexually or asexually propagating the plant, optionally wherein the plant is sexually propagated using plant breeding techniques.
  • a method of producing a dwarf plant according to embodiment 28 wherein the plant is sexually propagated as a male or a female, optionally, wherein the plant is maize and is sexually propagated as a male or a female with a B16, B73 or Mol7 crossing partner.
  • a method of producing a dwarf plant according to any one of embodiments 27-29 wherein the plant is a monocot, optionally wherein the monocot is selected from the group consisting of maize, wheat, rice, sorghum, rye, sugar cane, teff, millet, oats, barley, lawn grass, and turf grass.
  • a method of producing a dwarf plant according to any one of embodiments 27-29 wherein the plant is a dicot, optionally wherein the dicot is selected from the group consisting of Arabidopsis, soybean, sunflower, safflower, alfalfa, Brassica (e.g., rape), cotton, and peanut.
  • the dicot is selected from the group consisting of Arabidopsis, soybean, sunflower, safflower, alfalfa, Brassica (e.g., rape), cotton, and peanut.
  • a method of transferring into a plant at least one mutant allele of a dwarf-8 (D8) gene, or a homolog (also referred to as a syntelog) or an ortholog thereof wherein the coding domain sequence (CDS) of the gene comprises a nucleotide sequence encoding a DELLA domain with the amino acid sequence DELLAALGYKVRSSDMADVAQKLEQLE [SEQ ID NO: 5] in which the codon encoding the terminal E is mutated by a single nucleotide polymorphism (SNP) resulting in the substitution of the terminal E with another amino acid and the plant exhibiting a dwarf phenotype, which method comprises:
  • the method of embodiment 32 or 33 wherein the first plant is the maize plant of any one of embodiments 1-9 and the second plant is a maize hybrid, optionally wherein the maize hybrid is B16, B73 or Mol7.
  • the method of embodiment 32 or 33 is provided, wherein the first plant is the plant of any one of embodiment 24-26, and the second plant is a plant of the same species as the first plant.
  • a method of dwarfing a plant comprises introducing at least one nucleotide modification through a targeted site-directed modification at a genomic locus of a plant, or a cell, tissue, or organ thereof, wherein the genomic locus comprises an allele of a maize dwarf-8 (D8) gene, or a homolog, an ortholog, or a syntelog thereof, wherein the coding domain sequence (CDS) of the gene comprises a DELLA domain DELLAALGYKVRSSDMADVAQKLEQLE [SEQ ID NO: 5] and the first nucleotide of the codon encoding the terminal E is mutated from G to A (G190A in maize) resulting in the substitution of the terminal E with another amino acid and the resulting plant exhibits a dwarf phenotype, optionally wherein the terminal E is substituted with K (E64K in maize).
  • D8 maize dwarf-8
  • the method of dwarfing a plant according to embodiment 36 wherein the targeted site-directed modification involves the use of CRISPR-Cas9 endonuclease, Cpfl endonuclease, Zn finger nuclease, meganuclease, or TALEN.
  • the method of dwarfing a plant according to embodiment 36 or 37 wherein, when the targeted site- directed modification is introduced into a cell, tissue or organ, the method further comprises regenerating a plant therefrom.
  • the method of dwarfing a plant according to any one of embodiments 36-38 wherein the plant is sexually propagated using plant breeding techniques, optionally wherein the plant is sexually propagated as a male or a female, optionally wherein the plant is maize and sexually propagated as a male or a female with a B16, B73 or Mol7 crossing partner.
  • the method of dwarfing a plant according to any one of embodiments 36-39 is provided, wherein the plant is a monocot, optionally wherein the monocot is selected from the group consisting of maize, wheat, rice, sorghum, rye, sugar cane, teff, millet, oats, barley, lawn grass, and turf grass.
  • the method of dwarfing a plant according to any one of embodiments 36-39 is provided, wherein the plant is a dicot, optionally wherein the dicot is selected from the group consisting of Arabidopsis, soybean, sunflower, safflower, alfalfa, Brassica (e.g., rape), cotton, and peanut.
  • the dicot is selected from the group consisting of Arabidopsis, soybean, sunflower, safflower, alfalfa, Brassica (e.g., rape), cotton, and peanut.
  • a polynucleotide encodes a modified dwarf-8 (D8) polypeptide comprising a DELLA domain sequence of DELLAXeLXsYKVRXnSXisMAXisVAQKLEQLXsr (SEQ ID NO: 45), wherein
  • Xe is Ala or Vai
  • Xs is Gly, Arg or Glu
  • X13 is Ala or Ser
  • X15 and Xis are independently Glu or Asp;
  • X27 is an amino acid other than glutamic acid.
  • a polynucleotide of embodiment 42 wherein X27 is a positively charged, polar amino acid.
  • a polynucleotide of embodiment 42 or 43 wherein X27 is Lys or Arg.
  • a polynucleotide of any one of embodiments 42-44 is provided wherein Xs is Arg or Glu
  • a polynucleotide encodes a modified dwarf-8 (D8) polypeptide comprising a DELLA domain sequence of DELLAX 6 LXsYKVRXi3SXi5MAXi 8 VAQKLEQLX27 (SEQ ID NO: 45), wherein
  • Xe is Ala or Vai
  • Xs is Arg or Glu
  • X13 is Ala or Ser
  • X15 and Xis are independently Glu or Asp; and X27 is Glu.
  • a polynucleotide of any one of embodiments 42-46 is provided wherein Xs is Arg.
  • Xg is Ala
  • Xs is Gly, Arg or Glu
  • X13 is Ser
  • X15 and Xis are each Asp
  • X27 is Lys.
  • Xe is Ala
  • Xs is Arg or Glu
  • X13 is Ser
  • X15 and Xis are each Asp
  • X27 is Glu or Lys.
  • a polynucleotide of any one of embodiments 43-49 wherein the polynucleotide encodes a modified dwarf-8 (D8) polypeptide comprising a DELLA domain sequence of DELLAX6LX8YKVRX13SX15MAX18VAQKLEQLX27 (SEQ ID NO: 45), wherein
  • X 6 is Vai
  • Xs is Arg
  • X13 is Ser
  • X15 and Xis are both Asp;
  • X27 is Glu
  • a polynucleotide of any one of embodiments 42-45 or 47-49 is provided wherein X27 is Lys.
  • a polynucleotide encodes a modified dwarf-8 (D8) polypeptide comprising a DELLA domain sequence of DELLAX6LGYKVRX13SX15MAX18VAQKLEQLX27 (SEQ ID NO: 1), wherein
  • X 6 is Ala or Vai
  • X13 is Ala or Ser
  • X15 and Xis are independently Glu or Asp; and X27 is an amino acid other than glutamic acid, wherein a plant regenerated from said cell exhibits a dwarf phenotype.
  • a polynucleotide according to embodiment 52 is provided wherein Xe is Ala.
  • a polynucleotide according to embodiment 52 or 53 is provided wherein X13 is Ser.
  • a polynucleotide according to any one of embodiments 52-54 is provided wherein X15 is Asp.
  • a polynucleotide according to any one of embodiments 52-55 is provided wherein Xis is Asp.
  • a polynucleotide according to any one of embodiments 52-57 wherein X27 is a positively charged, polar amino acid, optionally wherein X27 is Lys or Arg.
  • a polynucleotide according to any one of embodiments 52-58 wherein said modified dwarf-8 (D8) protein comprises a DELLA domain sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4, optionally wherein X 27 of SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4 is Lys or Arg.
  • D8 protein comprises a DELLA domain sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4, optionally wherein X 27 of SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4 is Lys or Arg.
  • a polynucleotide according to any one of embodiments 52-59 wherein said modified dwarf-8 (D8) protein comprises a DELLA domain sequence of SEQ ID NO: 2, wherein X27 is Lys or Arg.
  • a polynucleotide according to any one of embodiments 52-60 wherein said modified dwarf-8 (D8) protein comprises the sequence of SEQ ID NO: 44, optionally wherein the amino acid at position 64 is Lys.
  • a polynucleotide of any one of embodiments 52-61 wherein said polynucleotide comprises a nucleic acid sequence of SEQ ID NO: 43.
  • a polynucleotide of any one of embodiments 52-62 wherein said polynucleotide comprises a nucleic acid sequence having at least 85% sequence identity with SEQ ID NO: 7, or optionally having at least 90% sequence identity with SEQ ID NO: 7, optionally wherein the polypeptide includes the sequence of SEQ ID NO: 2, optionally wherein X27 is of SEQ ID NO: 2 is Lys.
  • a plant cell comprising a polynucleotide of any one of embodiments 1-63, wherein a plant regenerated from said cell exhibits a dwarf phenotype.
  • the plant cell of embodiment 64 is provided wherein the polynucleotide is incorporated into the nuclear genome of the plant.
  • the plant cell of embodiment 64 or 65 is provided wherein the plant cell is selected from the group consisting of dicotyledonous cells and monocotyledonous cells.
  • the plant cell of any one of embodiments 64-66 is provided wherein said plant cell is dicotyledonous and is selected from the group consisting of a cotton cell, a tobacco cell, a canola cell, a soybean cell, and an Arabidopsis cell.
  • the plant cell of any one of embodiments 64-66 is provided wherein said plant cell is a monocotyledonous cell selected from the group consisting of a rice cell and a maize cell.
  • the plant cell of any one of embodiments 64-68 is provided wherein said plant cell is a maize cell.
  • a plant comprising a plurality of the plant cell of any one of embodiments 64-69 is provided wherein said plant exhibits a dwarf phenotype.
  • a plant or plant part thereof wherein the cells of the plant or plant part thereof comprise a polynucleotide that encodes a modified dwarf-8 (D8) protein comprising a DELLA domain sequence of DELLAX6LX8YKVRXi 3 SXi 5 MAXi8VAQKLEQLX27 (SEQ ID NO: 45), wherein Xe is Ala or Vai;
  • D8 modified dwarf-8
  • Xs is Gly, Arg or Glu
  • X13 is Ala or Ser
  • X15 and Xis are independently Glu or Asp;
  • X27 is an amino acid other than glutamic acid, optionally wherein X27 is Glu or Lys, with the proviso that when X27 is Glu, Xs is not Gly, wherein said plant, or a plant regenerated from said plant part exhibits a dwarf phenotype.
  • a plant or plant part thereof is provided wherein the cells of the plant or plant part thereof comprise a polynucleotide that encodes a modified dwarf-8 (D8) protein comprising a DELLA domain sequence of DELLAX 6 LX8YKVRXi3SXi5MAXi 8 VAQKLEQLX 2 7 (SEQ ID NO: 45), wherein Xg is Ala;
  • X 8 is Gly, Arg or Glu
  • X13 is Ser
  • X15 and Xis are each Asp
  • X27 is Lys, wherein said plant or a plant regenerated from said plant part exhibits a dwarf phenotype
  • a plant or plant part thereof wherein the cells of the plant or plant part thereof comprise a polynucleotide that encodes a modified dwarf-8 (D8) protein comprising a DELLA domain sequence of DELLAX 6 LX 8 YKVRXi3SXi5MAXi 8 VAQKLEQLX27 (SEQ ID NO: 45), wherein Xe is Ala;
  • D8 modified dwarf-8
  • X 8 is Arg
  • X13 is Ser
  • X15 and Xis are each Asp
  • X27 is Glu, wherein said plant or a plant regenerated from said plant part exhibits a dwarf phenotype
  • a plant or plant part thereof wherein the cells of the plant or plant part thereof comprise a polynucleotide that encodes a modified dwarf-8 (D8) protein comprising a DELLA domain sequence of DELLAX 6 LGYKVRXI3SXI S MAXISVAQKLEQLX 2 7 (SEQ ID NO: 1), wherein Xg is Ala or Vai;
  • D8 modified dwarf-8
  • X13 is Ala or Ser
  • X15 and Xis are independently Glu or Asp;
  • X27 is an amino acid other than glutamic acid, wherein said plant or a plant regenerated from said plant part exhibits a dwarf phenotype, optionally wherein X 2 7 is a positively charged, polar amino acid, optionally wherein X 2 7 is Lys or Arg.
  • a plant or plant part thereof according to embodiment 74 wherein said modified dwarf-8 (D8) protein comprises a DELLA domain sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4, optionally wherein X 27 of SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4 is Lys or Arg.
  • D8 protein comprises a DELLA domain sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4, optionally wherein X 27 of SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4 is Lys or Arg.
  • a plant or plant part thereof according to embodiment 74 or 75 wherein said modified dwarf-8 (D8) protein comprises a DELLA domain sequence of SEQ ID NO: 2, wherein X27 is Lys.
  • a plant or plant part thereof according to any one of embodiments 74-75 is provided wherein said polynucleotide comprises a nucleic acid sequence of SEQ ID NO: 43.
  • a plant or plant part thereof according to any one of embodiments 74-77 is provided wherein said polynucleotide comprises a nucleic acid sequence having at least 85% sequence identity with SEQ ID NO: 7, or optionally having at least 90% sequence identity with SEQ ID NO: 7, optionally wherein said polypeptide includes the sequence of SEQ ID NO: 2, optionally wherein X27 is Lys.
  • a plant or plant part thereof according to any one of embodiments 74-78 is provided said plant or plant part thereof is dicotyledonous and is selected from the group consisting of a cotton cell, a tobacco cell, a canola cell, a soybean cell, and an Arabidopsis cell.
  • a plant or plant part thereof according to any one of embodiments 71-79 is provided said plant or plant part thereof is monocotyledonous and is selected from the group consisting of a rice cell and a maize cell, optionally wherein the plant or plant part thereof is a maize plant or plant part thereof.
  • a progeny, or asexual propagate of the plant according to any one of embodiments 71-80 wherein said progeny, or sexual propagate comprises said a polynucleotide that encodes a modified dwarf-8 (D8) protein comprising a DELLA domain sequence of DELLAALGYKVRSSDMADVAQKLEQLX27 (SEQ ID NO: 2), wherein X27 is a positively charged, polar amino acid.
  • D8 modified dwarf-8
  • a method of producing a dwarf plant comprises the step of introducing a polynucleotide of any one of embodiments 1-63 into the cells of a plant.
  • the method according to embodiment 82 is provided wherein said polynucleotide is introduced into the cell via transfection of a plant cell and a dwarf plant is regenerated from said transfected plant cell.
  • the method according to embodiment 82 is provided wherein said polynucleotide is introduced into the cell of a plant by traditional breeding by crossing a first plant comprising said polynucleotide with a second plant lacking said polynucleotide; identifying progeny plants comprising said polynucleotide; and selected progeny plants comprising said polynucleotide.
  • a method of detecting a polynucleotide that encodes a modified dwarf-8 (D8) protein in a sample comprising nucleic acids comprises contacting said sample with a polynucleotide of SEQ ID NO: 43 or the complement thereof, wherein detecting specific binding of the polynucleotide of SEQ ID NO: 6 to the sample identifies the presence of a modified dwarf-8 (D8) protein encoding sequence in said sample.
  • a method of detecting a polynucleotide that encodes a modified dwarf-8 (D8) protein in a sample comprising nucleic acids comprises contacting said sample with a. a first primer that binds to the sequence 5’ to the encoded DELLA domain of a polynucleotide that encodes a modified dwarf-8 (D8) protein; and b.
  • a second primer that binds to the sequence 3’ to the encoded DELLA domain of a polynucleotide that encodes a modified dwarf-8 (D8); subjecting said sample to polymerase chain reaction; and assaying for an amplicon generated between said primers that encodes the DELLA peptide sequence of SEQ ID NO 1 or SEQ ID NO: 45.
  • an expression vector comprising a nucleic acid sequence of any one of embodiments 1-61 is provided wherein the nucleic acid sequence is operably linked to a promoter that is functional in plants.
  • the expression vector of embodiment 87 comprises a nucleic acid sequence having at least 85% sequence identity with the sequence of SEQ ID NO: 7, wherein the nucleic acid sequence having at least 85% sequence identity with the sequence of SEQ ID NO: 7 is operably linked to a promoter that is functional in plants, optionally wherein the expression vector comprises a selectable marker.
  • a soybean, wheat or barley plant wherein the cells of the soybean, wheat or barley plant comprise a modified D8 gene encoding a DELLA domain having the sequence of SEQ ID NO: 3.
  • a cotton plant wherein the cells of the cotton plant comprise a modified D8 gene encoding a DELLA domain having the sequence of SEQ ID NO: 4.
  • a rice or tomato plant wherein the cells of the rice or tomato plant comprise a modified D8 gene encoding a DELLA domain having the sequence of SEQ ID NO: 2.
  • D16 homozygotes had the same number of leaves as their wild-type progenitor B73. The lengths of the leaves also appeared to be the same as B73, although the widths may have been slightly more in DI 6 homozygotes (Fig. 3). Homozygous D16 seed germinated at the same rate as B73, and the initial growth of the seedlings was also comparable. D16/D16 seedling and B73 seedlings looked very much alike during the first 3-4 weeks of growth. Differences started to manifest around the fourth week after planting and became more distinct as the stalks elongated. There was little difference, if any, in transition to flowering, and D16/D16 mutants started shedding within a day or two of B73.
  • the architecture of the D16ID16 tassels was the same as that of B73; both appeared to be equally fertile.
  • the size of the D16/D16 ears was shorter than those of B73, but they still produced hundreds of kernels per ear (Fig. 3), thereby allowing the dwarfing mutant to be propagated and maintained as a commercially viable, uniform stock.
  • DI 6 homozygotes also did not form anthers in their ears as do all known dominant and recessive gibberellin (GA) dwarfing mutants. Therefore, DI 6 has few pleiotropic effects, even as a homozygote.
  • D16 is more tolerant to water deficit or drought-like conditions
  • D16 homozygotes were crossed with several common and elite inbred lines from ex-PVP (Plant Variety Protection) resources.
  • One of the common inbred lines was Mo 17.
  • the elite inbred lines included the pollinators PHZ51, PHG35, PH207, PHPO2, and PHG47 and the female LH195.
  • the penetrance of D16 was complete in all hybrid combinations, and a single copy of the £>76 mutant allele reduced the height of each hybrid by 2-3 feet compared to the wild-type. See, e.g., Fig. 7, which compares D16 hybrids of B73/Mol7 with wild-type counterparts. The only change that is obvious between £> 6 and wild- type B73/Mol7 hybrids is plant height.
  • a single copy of D16 decreased the overall plant height from 8.7 feet (for wild-type B73/Mol7 hybrid) to 6.5 feet, i.e., about a 25% decrease (Fig. 8).
  • the ear height also decreased by about 25%, from 4.2 feet to 3.2 feet, in £>76 hybrids compared to the wild-type B73/Mol7 hybrids (Fig. 8).
  • the reduction in height caused by D16 was uniform throughout all stalk internodes, and the ear height did not drop below 2.0 feet above ground in any of the hybrids (Fig. 9).
  • Stalk strength of DI 6 hybrids almost always exceeded that of their wild-type comparators (Fig. 10) as determined by Darling, a device designed to assess resistance to lodging.
  • D16 is the result of a single base-pair change in the d8 gene of maize
  • the gene underlying DI 6 was cloned by a next generation sequence strategy.
  • D16 was found to contain one single nucleotide polymorphism (SNP) in the coding sequence of the gene D8 (B73v4 Zm00001d033680) compared to the B73 progenitor (Fig. 11).
  • D8 encodes a DELLA domain protein.
  • the dwarf-8 (c/8) gene in maize is an ortholog of the Arabidopsis gibberellin-insensitive (GAT) gene, as is the wheat reduced height- 1 (Rht-B 1/Rht-Dl) gene. Both these wheat genes have been used to produce dwarf grain varieties that have improved grain yield.
  • the genes encode proteins that resemble nuclear transcription factors and contain an SH2-like domain, which indicates that phosphotyrosine may participate in gibberellin signaling.
  • Transgenic rice plants containing a mutant GAI allele from Arabidopsis have been shown to produced reduced responses to gibberellin and are dwarfed, indicating that mutant GAI orthologs could be used to increase yield in a wide range of crop species (Peng et al., Nature 400: 256-261 (1999)).
  • the DI 6 mutant is the result of a single base pair change, G190A, which causes the missense mutation E64K.
  • Amino acid residue 64 happens to be the last amino acid in the DELLA domain (Fig. 13).
  • the SNP underlying DI 6 was found to be linked with the short-stature phenotype of DI 6, suggesting a causal relationship between the two.
  • the likelihood of D16 being a d8 mutant is supported by the observations that DI6 causes anthers to form in the ears of some hybrids, especially those made between D16::B73 and some popcorn inbred lines.
  • the anther-ear (anthers in ear) phenotype is a hallmark of GA-related mutations; however, DI 6 does not have this phenotype in most backgrounds, perhaps due to the weak nature of the E64K substitution, which also impairs stalk elongation in DI 6 only partially.
  • Example 8 D16 revertant D16 revertant was generated by EMS mutagenesis that exhibits normal height. Molecular analysis of the D8 gene of this mutant revealed a new G-to-A SNP at location 1194 of the nucleic acid encoding the D8 gene product. This SNP (G1194A) introduced a stop codon in place of the native tryptophan codon, thereby truncating the D8 protein by 233 amino acids. The truncated polypeptide comprising the E64K amino acid substitution is likely inactivated by the truncation, thus explaining the full tall phenotype of the revertant. Accordingly, this revertant validates the role of the mutant G190A SNP, as a genuine dwarfing mutation.
  • mapping population used for this linkage analysis was generated by crossing D16/+ heterozygotes from two separate advanced backcross families in a greenhouse. The resulting progeny were planted in a genetic nursery at ACRE. Genotyping of 185 progeny plants from this mapping population (MP1) with the Xhol CAPS marker found about half of the dwarf plants had this SNP, whereas the other half of the dwarf plants lacked it.
  • the d8 gene of the other half of the dwarf plants sustained any mutational SNP(s) was PCR amplified. Sequencing of the PCR amplicons showed that, instead of the G190A SNP, this set of dwarf mutants had a G-to-A SNP at nucleotide 133. This new SNP -G133A - causes a glycine to arginine change at residue 45 of the D8 protein. The same glycine residue, which is conserved in all plant species, was also found to be substituted in a dominant dwarfing mutant in barley (SlnlD), although the change was from glycine (G) to glutamic acid (E). Similar to the maize G45R mutation, the barley G to E mutant allele had a relatively weak dwarfing phenotype, which it also recapitulated as a transgene in Arabidopsis.
  • the G133A SNP was also present only in about half of the dwarfing plants upon crossing plants heterozygous for the G133A SNP. Except for a few dwarfing plants that were perhaps homozygous dwarf, most other G190A-containing dwarfs of the MP1 population lacked the G133A SNP. Accordingly, this surprising and unexpected result indicates that our EMS-induced mutant library contained two independent SNPs in the d8 gene, both capable of mediating dominant dwarfism. Given that dominant mutations are so rare to generate, the similar phenotype of these two mutants initially led applicants into thinking they were the same mutant allele.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Botany (AREA)
  • Chemical & Material Sciences (AREA)
  • Environmental Sciences (AREA)
  • Developmental Biology & Embryology (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Physiology (AREA)
  • Natural Medicines & Medicinal Plants (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)

Abstract

A maize plant or plant part comprising in its genome at least one mutant allele of a dwarf-8 (D8) gene, in which the coding domain sequence (CDS) of the gene comprises a nucleotide sequence encoding a DELLA domain with the amino acid sequence DELLAALGYKVRSSDMADVAQKLEQLE [SEQ ID NO: 5] in which the codon encoding the terminal E is mutated by a single nucleotide polymorphism (SNP) resulting in the substitution of the terminal E with another amino acid and the plant exhibiting a dwarf phenotype or the codon encoding the G at position 8 is mutated by a single nucleotide polymorphism (SNP) resulting in the substitution of the G at position 8 with an R and the plant exhibiting a dwarf phenotype.

Description

PLANT DWARFING MUTATION
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit under 35 USC § 119(e) of U.S. Provisional Patent Application No. 63/459,374 filed on April 14, 2023, the disclosure of which is expressly incorporated herein.
REFERENCE TO AN ELECTRONICALLY SUBMITTED SEQUENCE LISTING
[0002] The contents of the electronic sequence listing (file name: 3220404950R.xml; size: 73 kilobytes, created on April 11, 2024) is herein incorporated by reference in its entirety.
BACKGROUND
[0003] The goal of hybrid development is to combine various desirable traits into a single hybrid. For field crops, desirable traits can include, for example, heat tolerance, drought tolerance, disease resistance, pest resistance, increased yield, and earlier maturity. Traits such as stand establishment, plant height, and ear height (e.g., in corn) are not only important for mechanical harvesting, but they can also provide sustained and even higher yields under various abiotic stresses such as wind damage. Traditional plant breeding techniques can be used to develop new and improved commercial crops.
[0004] In view of the above, it is an object of the present disclosure to provide new inbred plant lines having desirable traits, such as shorter total plant height, shorter ear height, and drought tolerance. Other traits can include faster root growth rate and longer roots, while stalk strength is comparable to wild-type hybrid lines.
[0005] Dwarfing genes reduce plant height by altering the sensitivity to, or the molecular pathway involved in producing, growth-related hormones. DELLA proteins are nuclear- localized negative regulators of gibberellin signaling found ubiquitously throughout higher plants. Accordingly, mutations in DELLA proteins can produce dwarf plants having a reduced height. Maize contains two genetic loci encoding DELLA proteins, dwarf plant 8 (d8) and dwarf plant 9 (d9). The d8 gene and three of its dominant dwarfing alleles have been previously characterized at the molecular level. As disclosed herein plant cells, tissues, organs, seeds, and progeny thereof are provided with a novel partially dominant dwarfing mutation, representing a modification of the maize dwarf-8 and dwarf-9 genes, and DELLA domains.
SUMMARY
[0006] In accordance with one embodiment a polynucleotide is provided that encodes a modified dwarf-8 (D8) polypeptide comprising a DELLA domain sequence of DELLAXeLXsYKVRXisSXisMAXisVAQKLEQLX ? (SEQ ID NO: 45), wherein
Xe is Ala or Vai;
X8 is Gly, Arg or Glu;
X13 is Ala or Ser;
X15 and Xis are independently Glu or Asp; and
X27 is an amino acid other than glutamic acid or aspartic acid, optionally wherein X27 is Lys. In a further embodiment a plant is provided comprising a polynucleotide that encodes a modified dwarf-8 (D8) polypeptide comprising a DELLA domain sequence of DELLAX6LX8YKVRXi3SXi5MAXi8VAQKLEQLX27 (SEQ ID NO: 45), wherein the plant exhibits a dwarf phenotype. Optionally, the DELLA domain of SEQ ID NO: 45 has Ala at position Xe, has Ser at position X13, Asp at positions X15 and Xis, Gly, Arg or Glu at position X8 and Lys or Arg at position X27, optionally wherein X27 is Lys.
[0007] In a further embodiment a plant is provided comprising a polynucleotide that encodes a modified dwarf-8 (D8) polypeptide comprising a DELLA domain sequence of DELLAX6LX8YKVRX13SX15MAX1SVAQKLEQLX27 (SEQ ID NO: 45), wherein
Xe is Ala;
X8 is Arg or Glu;
X13 is Ser;
X15 and Xis are each Asp; and
X27 is Glu or Lys, wherein the plant exhibits a dwarf phenotype. In a further embodiment X8 is Arg, optionally wherein X27 is Glu.
In accordance with one embodiment a plant exhibiting a dwarf phenotype is provided wherein the plant is homozygous for a polynucleotide that encodes a modified dwarf-8 (D8) polypeptide comprising a DELLA domain sequence of DELLAX6LX8YKVRXI3SXISMAXI8VAQKLEQLX27 (SEQ ID NO: 45), wherein
Xf, is Ala;
Xs is Gly Arg or Glu; Xn is Ser;
Xu and Xis are each Asp; and
X27 is Glu or Lys, with the proviso that when X27 is Glu, Xs is not Gly.
[0008] In accordance with one embodiment a polynucleotide is provided that encodes a modified dwarf-8 (D8) protein comprising a DELLA domain sequence of DELLAX6LGYKVRXi3SXi5MAXi8VAQKLEQLX27 (SEQ ID NO: 1), wherein
Xe is Ala or Vai;
X13 is Ala or Ser;
X15 and Xis are independently Glu or Asp; and
X27 is an amino acid other than glutamic acid or aspartic acid. In one embodiment X27 is an amino acid selected from Ala, Ser, Thr, Pro, Gly, His, Lys or Arg. In one embodiment X27 is a positively charged, polar amino acid, including for example His, Lys or Arg.
[0009] In accordance with one embodiment a polynucleotide is provided that encodes a modified dwarf-8 (D8) protein comprising a DELLA domain sequence selected from the group consisting of DELLAALGYKVRSSDMADVAQKLEQLX27 (SEQ ID NO: 2), DELLAALGYKVRASDMADVAQKLEQLX27 (SEQ ID NO: 3) and
DELLA VLGYKVRSSDMADVAQKLEMLX27 (SEQ ID NO: 4), wherein X27 of SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4 is Lys or Arg, optionally wherein X27 of SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4 is Lys. In one embodiment a polynucleotide is provided that encodes a modified dwarf-8 (D8) protein wherein the polynucleotide comprises a sequence of SEQ ID NO: 43 or SEQ ID NO: 46. In one embodiment the polynucleotide comprises a nucleic acid sequence having at least 85% sequence identity with SEQ ID NO: 7, or optionally having at least 90% sequence identity with SEQ ID NO: 7, wherein the polynucleotide includes the sequence of SEQ ID NO: 43 or SEQ ID NO: 46.
[0010] In one embodiment a plant or plant part is provided wherein the plant or plant part comprises a polynucleotide that encodes a modified dwarf-8 (D8) protein comprising a DELLA domain sequence of DELLAX6LGYKVRX13SX15MAX18VAQKLEQLX27 (SEQ ID NO: 1), wherein Xe is Ala or Vai;
X13 is Ala or Ser;
X15 and Xis are independently Glu or Asp; and X27 is an amino acid other than glutamic acid or aspartic acid. In one embodiment X27 is a positively charged, polar amino acid, including for example His, Lys or Arg. In one embodiment the plant or plant part comprises the sequence of SEQ ID NO: 2, optionally wherein X27 is Lys or Arg, optionally wherein X27 is Lys. In one embodiment the plant, or plant part thereof, comprises the polynucleotide incorporated into the nuclear genome of the cells of the plant or plant part. In one embodiment the plant or plant part is comprised of dicotyledonous cells, optionally selected from the group consisting of a cotton cell, a tobacco cell, a canola cell, a soybean cell, and an Arabidopsis cell. In one embodiment the plant or plant part is comprised of monocotyledonous cells, optionally selected from the group consisting of a rice cell and a maize cell. In one embodiment the plant or plant part is comprised of maize cells.
[0011] In one embodiment a plant or plant part thereof is provided that comprises in its genome at least one mutant allele of a dwarf-8 (D8) gene, or a homolog (also referred to as a syntelog) or an ortholog thereof. In one embodiment the plant or plant part is a maize plant or plant part. In one embodiment the plant, or plant part thereof, comprises a polynucleotide wherein the coding domain sequence (CDS) of the dwarf-8 (D8) gene comprises a nucleotide sequence encoding a modified DELLA domain, wherein the native DELLA domain having the amino acid sequence DELLAALGYKVRSSDMADVAQKLEQLE [SEQ ID NO: 5] is modified by a single nucleotide polymorphism (SNP) resulting in the substitution of the terminal E in the DELLA domain of SEQ ID NO: 5 with another amino acid in the encoded polypeptide. Plants harboring this modification exhibit a dwarf phenotype. In one embodiment, the terminal E of the DELLA domain is substituted with a positively charged, polar amino acid. In one embodiment the positively charged, polar amino acid is K or R. In one embodiment the positively charged polar amino acid is K.
[0012] The modified dwarf-8 (D8) gene of the present disclosure can encode the amino acid sequence of SEQ ID NO: 10 or an amino acid sequence that is at least about 75%, 80%, 90%, 95% or 99% identical to SEQ ID NO: 10, with the proviso that the amino acid at position 64 (relative to the numbering of SEQ ID NO: 10) is not E, and optionally wherein the amino acid at position 64 is H, K or R, optionally wherein the amino acid at position 64 is K or R, optionally wherein the amino acid at position 64 is K. In one embodiment the modified dwarf- 8 (D8) CDS encodes the amino acid sequence of SEQ ID NO: 10 or an amino acid sequence that is at least about 80% identical to SEQ ID NO: 10, with the proviso that the amino acid at position 64 (relative to the numbering of SEQ ID NO: 10) is not E, and optionally wherein the amino acid at position 64 is H, K or R, optionally wherein the amino acid at position 64 is K or R, optionally wherein the amino acid at position 64 is K. In one embodiment the modified dwarf-8 (D8) CDS encodes an amino acid sequence that is at least about 85% identical to SEQ ID NO: 10, with the proviso that the amino acid at position 64 (relative to the numbering of SEQ ID NO: 10) is not E, and optionally wherein the amino acid at position 64 is H, K or R, optionally wherein the amino acid at position 64 is K or R, optionally wherein the amino acid at position 64 is K. In one embodiment the CDS encodes an amino acid sequence that is at least about 90% identical to SEQ ID NO: 10 with the proviso that the amino acid at position 64 (relative to the numbering of SEQ ID NO: 10) is not E, and optionally wherein the amino acid at position 64 is H, K or R, optionally wherein the amino acid at position 64 is K or R, optionally wherein the amino acid at position 64 is K. In one embodiment the CDS encodes an amino acid sequence that is at least about 95% identical to SEQ ID NO: 10 with the proviso that the amino acid at position 64 (relative to the numbering of SEQ ID NO: 10) is not E, and optionally wherein the amino acid at position 64 is H, K or R, optionally wherein the amino acid at position 64 is K or R, optionally wherein the amino acid at position 64 is K. In one embodiment the CDS encodes an amino acid sequence that is at least about 99% identical to SEQ ID NO: 10 with the proviso that the amino acid at position 64 (relative to the numbering of SEQ ID NO: 10) is not E, and optionally wherein the amino acid at position 64 is H, K or R, optionally wherein the amino acid at position 64 is K or R, optionally wherein the amino acid at position 64 is K.
|0013 | The modified dwarf-8 (D8) gene of the present disclosure can encode the amino acid sequence of SEQ ID NO: 10 or an amino acid sequence that is at least about 75%, 80%, 90%, 95% or 99% identical to SEQ ID NO: 10, with the proviso that the amino acid at position 45 (relative to the numbering of SEQ ID NO: 10) is not Ala, and optionally wherein the amino acid at position 45 is E or R, optionally wherein the amino acid at position 45 is R. In one embodiment the modified dwarf-8 (D8) CDS encodes the amino acid sequence of SEQ ID NO: 10 or an amino acid sequence that is at least about 80% identical to SEQ ID NO: 10, with the proviso that the amino acid at position 45 (relative to the numbering of SEQ ID NO: 10) is E or R, optionally wherein the amino acid at position 45 is R. In one embodiment the modified dwarf-8 (D8) CDS encodes an amino acid sequence that is at least about 85% identical to SEQ ID NO: 10, with the proviso that the amino acid at position 45 (relative to the numbering of SEQ ID NO: 10) is E or R, optionally wherein the amino acid at position 45 is R. In one embodiment the CDS encodes an amino acid sequence that is at least about 90% identical to SEQ ID NO: 10 with the proviso that the amino acid at position 45 (relative to the numbering of SEQ ID NO: 10) is E or R, optionally wherein the amino acid at position 45 is R. In one embodiment the CDS encodes an amino acid sequence that is at least about 95% identical to SEQ ID NO: 10 with the proviso that the amino acid at position 45 (relative to the numbering of SEQ ID NO: 10) is E or R, optionally wherein the amino acid at position 45 is R. In one embodiment the CDS encodes an amino acid sequence that is at least about 99% identical to SEQ ID NO: 10 with the proviso that the amino acid at position 45 (relative to the numbering of SEQ ID NO: 10) is E or R, optionally wherein the amino acid at position 64 is R.
[0014] Also provided is a cell, tissue, organ, seed or progeny of an abovedescribed plant that comprises modified dwarf-8 (D8) gene of the present disclosure or a progeny or hybrid thereof. In one embodiment the plant, plant cell, plant tissue, plant seed or other plant part is a maize plant or maize plant part thereof.
[0015] Further provided is an isolated or purified nucleic acid molecule comprising (or consisting essentially of or consisting of) a nucleotide sequence encoding a CDS of the maize dwarf-8 (D8) gene, or a homolog (also referred to as a syntelog) or an ortholog thereof, wherein the CDS comprises a nucleotide sequence encoding a modified DELLA domain that differs from the native DELLA domain amino acid sequence of DELLAALGYKVRSSDMADVAQKLEQLE [SEQ ID NO: 5] by a substitution of the terminal E is with another amino acid, wherein a plant comprising the dwarf- 8 (D8) gene encoding the modified DELLA domain exhibits a dwarf phenotype.
[0016] In one embodiment the dwarf-8 (D8) gene encoding the modified DELLA domain comprises a sequence of SEQ ID NO: 7 modified by a SNP present at nucleotide position 190 of the maize D8 CDS or the corresponding nucleotide position encoding the last amino acid of the DELLA domain of the homolog or the ortholog thereof. The SNP can be a substitution of guanine 190 of the native maize D8 gene (SEQ ID NO: 7) or the corresponding nucleotide position encoding the last amino acid of the DELLA domain of the homolog or the ortholog thereof with adenine (G190A for the maize D8 gene of SEQ ID NO: 7). The SNP can result in the substitution of the glutamic acid residue at position 64 of the maize D8 protein or the corresponding last amino acid of the DELLA domain of the homolog or the ortholog thereof with lysine (E64K for the maize D8 protein). In one embodiment, the modified peptide of SEQ ID NO: 5 is encoded by the nucleotide sequence GATGAGCTGCTGGCCGCGCTCGGGTACAAGGTGCGTTCGTCGGATATG GCGGACGTCGCGCAGAAGCTGGAGCAGCTCAAG [SEQ ID NO: 43]. The CDS can encode the amino acid sequence of SEQ ID NO: 10 in Fig. 12 or an amino acid sequence that is at least about 75%, 80%, 90%, 95% or 99% identical to SEQ ID NO: 10, wherein the amino acid at position 63 is substituted with a positively charged polar amino acid, optionally Lys or Arg.
[0017] In one embodiment the dwarf-8 (D8) gene encoding the modified DELLA domain comprises a sequence of SEQ ID NO: 7 modified by a SNP present at nucleotide position 133 of the maize D8 CDS or the corresponding nucleotide position encoding the eighth amino acid of the DELLA domain of the homolog or the ortholog thereof. The SNP can be a substitution of glycine 133 of the native maize D8 gene (SEQ ID NO: 7) or the corresponding nucleotide position encoding the eighth amino acid of the DELLA domain of the homolog or the ortholog thereof with adenine (G133A for the maize D8 gene of SEQ ID NO: 7). The SNP can result in the substitution of the glycine acid residue at position 45 of the maize D8 protein or the corresponding eighth amino acid of the DELLA domain of the homolog or the ortholog thereof with arginine (G45R for the maize D8 protein). In one embodiment, the modified peptide of SEQ ID NO: 5 is encoded by the nucleotide sequence GATGAGCTGCTGGCCGCGCTCAGGTACAAGGTGCGTTCGTCGGATATG GCGGACGTCGCGCAGAAGCTGGAGCAGCTCGAG [SEQ ID NO: 46]. The CDS can encode the amino acid sequence of SEQ ID NO: 10 in Fig. 12 or an amino acid sequence that is at least about 75%, 80%, 90%, 95% or 99% identical to SEQ ID NO: 10, wherein the amino acid at position 45 is substituted with a glutamic acid or Arg.
[0018] Still further provided is an isolated or purified mutant maize D8 protein comprising (or consisting essentially of or consisting of) the amino acid sequence of SEQ ID NO: 10 or an amino acid sequence that is at least about 75% identical to SEQ ID NO: 10, wherein the amino acid sequence comprises a DELLA domain with the amino acid sequence DELLAALGYKVRSSDMADVAQKLEQLE [SEQ ID NO: 5] in which the terminal E is substituted with another amino acid. The terminal E can be substituted with another positively charged, polar amino acid. In one embodiment the positively charged, polar amino acid is K or R, optionally wherein the positively charged, polar amino acid is K. The isolated or purified mutant maize D8 protein can comprise (or consist essentially of or consist of) an amino acid sequence that is at least about 80% identical to SEQ ID NO: 10. The isolated or purified mutant maize D8 protein can comprise (or consist essentially of or consist of) an amino acid sequence that is at least about 85% identical to SEQ ID NO: 10. The isolated or purified mutant maize D8 protein can comprise (or consist essentially of or consist of) an amino acid sequence that is at least about 90% identical to SEQ ID NO: 10. The isolated or purified mutant maize dwarf-8 (D8) protein can comprise (or consist essentially of or consist of) an amino acid sequence that is at least about 95% identical to SEQ ID NO: 10.
[0019] Even still further provided is a vector, which can be introduced into a plant, a plant cell, a plant tissue, or a plant organ, and which comprises an abovedescribed isolated or purified nucleic acid molecule operably linked to a promoter that promotes expression of the CDS in the plant, the plant cell, the plant tissue, or the plant organ.
[0020] In accordance with one embodiment a plant, or a plant cell, plant tissue, or plant part thereof is provided, which comprises the above-described vector. In one embodiment the plant is a monocot, including for example, a monocot selected from the group consisting of maize, wheat, rice, sorghum, rye, sugar cane, teff, millet, oats, barley, lawn grass, and turf grass. In one embodiment the plant is a dicot, including for example a dicot selected from the group consisting of Arabidopsis, soybean, sunflower, safflower, alfalfa, Brassica (e.g., rape), cotton, and peanut. The isolated or purified nucleic acid molecule operably linked to a promoter can be transfected into a plant cell and optionally stably integrated into the genome of the plant (or cell, tissue, or organ thereof) and plants can be generated from the transfected cell. In view of the foregoing, also provided is a seed comprising and expressing the isolated or purified nucleic acid molecule.
[0021] A method of producing a dwarf plant is further provided. The method comprises introducing an above-described vector into a plant, or a cell, tissue, or organ thereof, whereupon the CDS is stably expressed therein, and, when the nucleic acid molecule or the vector is introduced into a cell, tissue or organ, the method further comprises regenerating a plant therefrom. The method can further comprise sexually or asexually propagating the plant. The plant can be sexually propagated using plant breeding techniques. The plant can be sexually propagated as a male. In one embodiment when the plant is maize, the plant comprising the D8 modified gene can be sexually propagated as a male or a female with a B16, B73, Mol7 or other inbred maize line as a male or a female to produce a dwarf plant comprising all of the characteristics of the inbred line but exhibiting a dwarf phenotype. In one embodiment the modified D8 gene is introduced into a monocot. In one embodiment the monocot is selected from the group consisting of maize, wheat, rice, sorghum, rye, sugar cane, teff, millet, oats, barley, lawn grass, and turf grass. In one embodiment the modified D8 gene is introduced into a dicot. In one embodiment the dicot is selected from the group consisting of Arabidopsis, soybean, sunflower, safflower, alfalfa, Brassica (e.g., rape), cotton, and peanut.
[0022] In one embodiment the modified D8 gene is introduced into an inbred monocot or dicot via recombinant techniques, wherein the modified D8 gene comprises a mutant allele of a dwarf-8 (D8) gene, or a homolog (also referred to as a syntelog) or an ortholog thereof, wherein the CDS of the gene comprises a nucleotide sequence encoding a DELLA domain that is modified relative to the native DELLA amino acid sequence of DELLAALGYKVRSSDMADVAQKLEQLE [SEQ ID NO: 5] by the substitution of the terminal glutamic acid residue with a positively charged polar amino acid. In one embodiment the method comprises:
[0023] (a) providing or generating a first plant comprising at least one mutant
D8 allele; and
[0024] (b) crossing the first plant with a second plant, which does not comprise the mutant allele;
[0025] wherein the method optionally further comprises:
[0026] (c) identifying Fl plants comprising the at least one mutant allele;
[0027] (d) backcrossing Fl plants comprising the at least one mutant allele for at least one generation and collecting seeds from the backcrossed generation; and [0028] (e) identifying in every generation backcrossed plants comprising the at least one mutant allele. The first plant can be crossed as a male or a female. The first plant can be an above-described maize plant, and the second plant can be a maize hybrid. The maize hybrid can be B16, B73 or Mol7 maize inbred lines or other inbred maize line. The first plant can be as described above, and the second plant can be a plant of the same species as the first plant.
[0029] Even still further provided is a method of dwarfing a plant. The method comprises introducing at least one nucleotide modification through a targeted site- directed modification at a genomic locus of a plant, or a cell, tissue, or organ thereof, wherein the genomic locus comprises an allele of a maize dwarf-8 (D8) gene, or a homolog (also referred to as a syntelog) or an ortholog thereof, wherein the CDS of the gene comprises a DELLA domain DELLAALGYKVRSSDMADVAQKLEQLE [SEQ ID NO: 5] and the first nucleotide of the codon encoding the terminal E is mutated from G to A (G190A in maize) resulting in the substitution of the terminal E with another amino acid (optionally the terminal E can be substituted with K (E64K in maize)) and the plant exhibiting a dwarf phenotype; or the first nucleotide of the codon encoding eighth amino acid of the DELLA domain is mutated from G to A (G133A in maize) resulting in the substitution of the G at the eighth residue of the DELLA domain with an R, and the plant exhibiting a dwarf phenotype. The targeted site- directed modification can involve the use of CRISPR-Cas9 endonuclease, Cpf 1 endonuclease, Zn finger nuclease, meganuclease, or TALEN. When the targeted site-directed modification is introduced into a cell, tissue or organ, the method can further comprise regenerating a plant therefrom. The plant can be sexually propagated using plant breeding techniques. The plant can be sexually propagated as a male or a female. The plant can be maize and sexually propagated as a male or a female with a B16, B73 or Mo 17 maize inbred lines or other maize line as a male or a female. The plant can be a monocot. The monocot can be selected from the group consisting of maize, wheat, rice, sorghum, rye, sugar cane, teff, millet, oats, barley, lawn grass, and turf grass. The plant can be a dicot. The dicot can be selected from the group consisting of Arabidopsis, soybean, sunflower, safflower, alfalfa, Brassica (e.g., rape), cotton, and peanut.
BRIEF DESCRIPTION OF THE DRAWINGS
[0030] Fig. 1 shows heights of ears, flag leaves, and total plants for B73, heterozygous D16 (D16_het:B73), and homozygous D16 (D16_homo:B73). [0031] Fig- 2 shows internode number (#) vs. internode length (cm) for B73, heterozygous D16 (D16_het:B73), and homozygous D16 (D16_homo:B73).
[0032] Fig. 3 shows photographs of DI 6 homozygous mutant plants at different stages of development.
[0033] Fig. 4 shows photographs of DI 6 homozygous mutant plants (D76/D76::B73) and B73 plants under drought conditions. Visual wilting was less pronounced in £>76 homozygous mutant plants compared to the wild-type B73 grown under same water regimes to simulate drought conditions.
[0034] Fig. 5 shows photographs of the roots of a DI 6 homozygous plant (Z)76/D76::B73) and a B73 plant evidencing that the roots of the D16 homozygous plant are comparable, if not longer, than the wild-type B73 plants.
[0035] Figs. 6A and 6B show photographs of a DI 6 homozygous plant ( 76/O76::B73) (Fig. 6A) and a B73 plant (Fig. 6B). The roots of D16 homozygous plants reached the bottom of the rhizotron faster compared to the roots of wild-type B73 plants grown under same water regime.
[0036] Figs. 7A and 7B show photographs of B73/Mol7 hybrid plants with (D76/+:B73/Mol7) and without (B73/Mol7) D16 before (Fig. 7A) and after (Fig. 7B) flowering.
[0037] Fig. 8 shows primary ear height, flag leaf height, and total plant height for different DI 6 hybrids and their isogenic wild-type hybrids.
[0038] Fig. 9 shows internode number (#) vs. internode length (cm) for different D16 hybrids and their isogenic wild-type hybrids. The seventh internode (i.e., 7 on the x-axis) is the primary ear internode.
[0039] Fig. 10 show flexural stiffness (N/m2) of D16 hybrids and their isogenic wild-type hybrids. The stalk strength of D16 hybrids is similar to isogenic wildtype hybrids.
[0040] Fig. 11 shows the amino acid sequence alignment of Dwarf 8 [SEQ ID NO: 10] and Dwarfl6 [SEQ ID NO: 12] proteins. The Dwarfl6 protein has an E64K missense mutation.
[0041] Fig. 12 shows the amino acid sequence alignment of Dwarf 8 [SEQ ID NO: 10], Dwarf9 [SEQ ID NO: 11], and Dwarfl6 [SEQ ID NO: 12] proteins. The Dwarf 16 protein has an E64K mis sense mutation.
[0042] Fig. 13 shows the structure of the DWARF8 gene (B73v4 Zm00001d033680). The solid gray box depicts the exon and an asterisk indicates the stop codon. The first (+1) and last (+630) amino acid positions of DWARF8 are indicated. The DELLA motif, that includes E64K missense mutation in Dwarf 16 protein, is displayed along with the wildtype Dwarf 8 DELLA motif sequence.
[0043] Fig. 14 shows the nucleotide sequence of the dwarf8 gene [SEQ ID NO:
7].
[0044] Fig. 15 shows the nucleotide sequence of the dwarf9 gene [SEQ ID NO:
8].
[0045] Fig. 16 shows the nucleotide sequence of the dwarfl6 gene [SEQ ID NO:
9].
[0046] Fig. 17 shows the nucleotide sequence [SEQ ID NO: 6], which encodes the DELLA domain having the amino acid sequence of SEQ ID NO: 5.
DETAILED DESCRIPTION
DEFINITIONS
[0047] In describing and claiming the disclosed embodiments, the following terminology will be used in accordance with the definitions set forth below.
[0048] The term "about" as used herein means greater or lesser than the value or range of values stated by 10 percent but is not intended to limit any value or range of values to only this broader definition. Each value or range of values preceded by the term "about" is also intended to encompass the embodiment of the stated absolute value or range of values.
[0049] The term "substantially" can allow for a degree of variability in a value or range, for example, within 90%, within 95%, 99%, 99.5%, 99.9%, 99.99%, or at least about 99.999% or more of a stated value or of a stated limit of a range.
[0050] As used herein, the term "purified" and like terms relate to the isolation of a molecule or compound in a form that is substantially free of contaminants normally associated with the molecule or compound in a native or natural environment. As used herein, the term "purified" does not require absolute purity; rather, it is intended as a relative definition. The term "purified polypeptide" is used herein to describe a polypeptide which has been separated from other compounds including, but not limited to nucleic acid molecules, lipids and carbohydrates.
[0051] The term "isolated" requires that the referenced material be removed from its original environment (e.g., the natural environment if it is naturally occurring). For example, a naturally-occurring polynucleotide present in a living animal is not isolated, but the same polynucleotide, separated from some or all of the coexisting materials in the natural system, is isolated.
[0052] As used herein the term “dwarf” used in the context of plants encompasses plants that are atypically small relative to the corresponding wild type plant. Generally, a dwarf plant has a stature or height that is reduced from that of a typical wild-type plant by at least about 5%, 10%, 15%, 20%, 25% or more.
EMBODIMENTS
[0053] The present disclosure is based on the discovery of a partially dominant dwarfing mutant in maize. The mutant (designated DI 6) was initially found segregating as a heterozygote in an M2 family of a mutant library of B73 generated by ethyl methanesulfonate (EMS). The mutant library was generated using a modified version of a recurrent mutagenesis strategy referred to as NextGEM (for next generation mutagenesis) (see USPN 10,595,479, which is hereby incorporated by reference for its teachings regarding same). Characteristic of the mutant is a single nucleotide polymorphism (SNP), which, to the best of the inventor’s knowledge, has not been previously reported in any plant species.
[0054] In accordance with one embodiment of the present disclosure, a maize plant is provided comprising in its genome at least one mutant allele of a dwarf-8 (D8) gene, or a homolog (also referred to as a syntelog) or an ortholog thereof. The coding domain sequence (CDS) of the gene comprises a nucleotide sequence encoding a DELLA domain modified relative to the native the amino acid sequence DELLAALGYKVRSSDMADVAQKLEQLE [SEQ ID NO: 5] in which the codon encoding the native terminal E is mutated by a SNP resulting in the substitution of the terminal E with another amino acid and the plant exhibiting a dwarf phenotype. The terminal E can be substituted with another positively charged, polar amino acid. In one embodiment the positive charged, polar amino acid can be K or R. In one embodiment the native terminal glutamic acid residue of the DELLA domain is substituted with a lysine residue.
[0055] An example of a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 5 is SEQ ID NO: 6. The amino acid K can be encoded by the codon AAA or AAG. The amino acid R can be encoded by the codon AGA, AGG, CGA, CGC, CGG, or CGT. When an SNP results in the substitution of E with K, the codon is mutated from GAA or GAG to AAA or AAG, respectively. [0056] The DELLA domain plays a regulatory role in gibberellin- (GA-) induced degradation of the repressor protein RGA. It is so named because of the short stretch of amino acids DELLA occurring at the N-terminal end of the domain. The Arabidopsis gene, which contains the DELLA domain and is involved in GA-signaling repression is the GA-insensitive (GAI) gene, which is an ortholog of the maize D8 and D9 (see, e.g., USPN 7,557,266 for D9; also see Lawit et al., Plant & Cell Physiol 51(11): 1854-1868 (2010)) and the wheat Rht- Bl/Dl genes (see, e.g., USPN 6,762,348). D8 and D9 are more than 92% identical at amino acid level.
[0057] Additional homologs of the maize D8 and D9 proteins have been described for other plant species including for example: wheat (SEQ ID NOs: 13- 15), rice (SEQ ID NO: 16), Sorghum (SEQ ID NO: 17), Barley (SEQ ID NO: 18), Sugarcane (SEQ ID NOs: 19-22), Arabidopsis (SEQ ID NOs: 23-27), Rapeseed (SEQ ID NOs: 28-30), cotton (SEQ ID NOs: 31-33), sunflower (SEQ ID NOs: 34- 36), soybean (SEQ ID NOs: 37-41) and tomato (SEQ ID NO: 42).
[0058] Table 1 Sequence Identities of Maize D8 homologs [0059] Amino acids are indicated using the single-letter code in accordance with convention as set forth in Table 2:
[0060] Table 2: Amino Acid Codes
[0061] IUPAC-IUB Joint Commission on Biochemical Nomenclature.
Nomenclature and Symbolism for Amino Acids and Peptides, Eur J Biochem 138: 9-37 (1984)
[0062] Codons, which can encode the amino acids, are set forth in the following table using A to indicate adenine, T to indicate thymine, G to indicate guanine, and C to indicate cytosine:
[0063] Table 3: Possible Codons Encoding Amino Acids
[0064] Conservative amino acid substitutions include those set forth in the following Table 4:
[0065] Table 4: Similar Amino Acid Substitutions
[0066] In one embodiment, the CDS of the modified D8 gene of the present disclosure encodes the amino acid sequence of SEQ ID NO: 44 or SEQ ID NO: 47. In one embodiment the CDS can encode an amino acid sequence that is at least about 75% identical to SEQ ID NO: 44 or SEQ ID NO: 47. In one embodiment the CDS can encode an amino acid sequence that is at least about 80% identical to SEQ ID NO: 44 or SEQ ID NO: 47. In one embodiment the CDS can encode an amino acid sequence that is at least about 85% identical to SEQ ID NO: 44 or SEQ ID NO: 47. In one embodiment the CDS can encode an amino acid sequence that is at least about 90% identical to SEQ ID NO: 44 or SEQ ID NO: 47. In one embodiment CDS can encode an amino acid sequence that is at least about 95% identical to SEQ ID NO: 44 or SEQ ID NO: 47.
[0067] Also provided is a plant cell, tissue, organ, seed comprising the modified D8 encoding polypeptide of the present disclosure, or progeny of an abovedescribed maize plant or a hybrid thereof. In one embodiment a maize plant, or maize plant part thereof, is provided wherein the cells of the maize plant, or maize plant part thereof, comprise a polynucleotide that encodes a polypeptide comprising an amino acid sequence having at least 85% sequence identity to SEQ ID NO: 44 and comprising the peptide sequence of SEQ ID NO: 2. In one embodiment a maize plant, or maize plant part thereof, is provided wherein the cells of the maize plant, or maize plant part thereof, comprise a polynucleotide that encodes a polypeptide comprising an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 44 and comprising the peptide sequence of SEQ ID NO: 2.
[0068] Further provided is an isolated or purified nucleic acid molecule comprising (or consisting essentially of or consisting of) a nucleotide sequence encoding a CDS of the maize dwarf-8 (D8) gene, or a homolog (also referred to as a syntelog) or an ortholog thereof. In one embodiment the CDS of the isolated or purified nucleic acid molecule comprises a nucleotide sequence encoding a modified DELLA domain with the amino acid sequence DELLAALGYKVRSSDMADVAQKLEQLE [SEQ ID NO: 5] in which the codon encoding the terminal E is mutated by a SNP resulting in the substitution of the terminal E with another amino acid, wherein upon introduction of said isolated or purified nucleic acid molecule into a plant cell will produce a plant exhibiting a dwarf phenotype. The SNP occurs at nucleotide position 190 of the maize D8 CDS or the corresponding nucleotide position encoding the last amino acid of the DELLA domain of the homolog or the ortholog thereof. The SNP can be a substitution of guanine 190 of the maize D8 CDS or the corresponding nucleotide position encoding the last amino acid of the DELLA domain of the homolog or the ortholog thereof with adenine (G190A for the maize D8 gene). The SNP can result in the substitution of glutamate 64 of the maize D8 protein or the corresponding last amino acid of the DELLA domain of the homolog or the ortholog thereof with lysine (E64K for the maize D8 protein). SEQ ID NO: 5 can be encoded by the nucleotide sequence GATGAGCTGCTGGCCGCGCTCGGGTACAAGGTGCGTTCGTCGGATATG GCGGACGTCGCGCAGAAGCTGGAGCAGCTCGAG [SEQ ID NO: 6], wherein the last codon is modified to encode for Lys or Arg. The CDS can encode the amino acid sequence of SEQ ID NO: 10 in Fig. 12 or an amino acid sequence that is at least about 75% identical to SEQ ID NO: 10. SEQ ID NO: 10 can be encoded by the nucleotide sequence SEQ ID NO: 7 in Fig. 14. The CDS can encode the amino acid sequence of SEQ ID NO: 10 or an amino acid sequence that is at least about 80% identical to SEQ ID NO: 10. The CDS can encode the amino acid sequence of SEQ ID NO: 10 or an amino acid sequence that is at least about 85% identical to SEQ ID NO: 10. The CDS can encode the amino acid sequence of SEQ ID NO: 10 or an amino acid sequence that is at least about 90% identical to SEQ ID NO: 10. The CDS can encode the amino acid sequence of SEQ ID NO: 10 or an amino acid sequence that is at least about 95% identical to SEQ ID NO: 10.
[0069] In addition to the SNP discussed above, which results in the substitution of one amino acid for another in the DELLA domain, other mutations, such as amino acid substitutions, deletions, truncations, and insertions can be introduced. Desirably, such mutations do not diminish or negate, but can enhance, the dwarf phenotype. Such methods of manipulation are known in the art. See, e.g., Kunkel, PNAS USA 82: 488-492 (1985); Kunkel et al., Methods in Enzymol 154: 367-382 (1987); and Walker and Gaastra, eds., Techniques in Molecular Biology (MacMillan Pub Co, New York (1983)). Guidance regarding appropriate amino acid substitutions that do not affect biological activity can be found in Dayhoff et al., Atlas of Protein Sequence and Structure (Nat’l Biomed Res Found, Washington, DC (1978)). DNA shuffling can be used to shuffle the mutant DELLA domain described herein from the D8 gene to another gene, such as the D9 gene of maize (see, e.g., Stemmer, PNAS USA 91 : 10747-10751 (1994);
Stemmer, Nature 370: 389-391 (1994); Crameri et al., Nature Biotech 15: 436-438 (1997); Moore et al., J Mol Biol 272: 336-347 (1997); Zhang et al., PNAS USA 94: 4504-4509 (1997); and Crameri et al., Nature 391: 288-291 (1998)).
[0070] The nucleic acid molecules can be synthesized or isolated from a plant (or cells, tissue, organ or seeds thereof). Methods can involve mechanical, electrical and/or chemical disruption of the plant (or cells, tissue, organ or seeds thereof), contacting the disrupted plant (or cells, tissue, organ or seeds thereof) with a buffer or solvent to produce a solution or suspension comprising nucleic acids, optionally contacting the nucleic acids with a precipitating agent to precipitate the nucleic acids, optionally extracting the nucleic acids, and optionally separating the nucleic acids, such as by centrifugation or by binding to beads or a column, with subsequent elution. If DNA is being isolated, an RNase can be employed in one or more steps.
[0071] Still further provided is an isolated or purified mutant maize D8 protein comprising (or consisting essentially of or consisting of) the amino acid sequence of SEQ ID NO: 10 or an amino acid sequence that is at least about 75% identical to SEQ ID NO: 10, wherein the amino acid sequence comprises a DELLA domain with the amino acid sequence DELLAALGYKVRSSDMADVAQKLEQLE [SEQ ID NO: 5] in which the terminal E is substituted with another amino acid. The terminal E can be substituted with another negatively charged, polar amino acid. The negatively charged, polar amino acid can be K or R. The negatively charged, polar amino acid can be K. The isolated or purified mutant maize D8 protein can comprise (or consist essentially of or consist of) an amino acid sequence that is at least about 80% identical to SEQ ID NO: 10. The isolated or purified mutant maize D8 protein can comprise (or consist essentially of or consist of) an amino acid sequence that is at least about 85% identical to SEQ ID NO: 10. The isolated or purified mutant maize D8 protein can comprise (or consist essentially of or consist of) an amino acid sequence that is at least about 90% identical to SEQ ID NO: 10. The isolated or purified mutant maize dwarf-8 (D8) protein can comprise (or consist essentially of or consist of) an amino acid sequence that is at least about 95% identical to SEQ ID NO: 10.
[0072] Sequence identity can be at the nucleotide level and/or the amino acid level as indicated above. Sequence identity refers to the residues in two sequences that are the same when aligned for maximum correspondence over a specified comparison window. When percentage of sequence identity is issued in reference to proteins, it is recognized that residue positions, which are not identical, often differ by conservative amino acid substitutions, where amino acid residues are substituted for other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity) and, therefore, do not change the functional properties of the molecule. When sequences differ in conservative substitutions, the percent sequence identity may be adjusted upwards to correct for the conservative nature of the substitutions. Sequences that differ by such conservative substitutions are said to have “sequence similarity” or “similarity.” Identity and similarity may be as defined and determined using readily available computer programs (see, e.g., CLUSTAL, GAP, BESTFIT, BLAST, FASTA, TFASTA, and ALIGN).
[0073] Even still further provided is a vector, which can be introduced into a plant, a plant cell, a plant tissue, or a plant organ, and which comprises an abovedescribed isolated or purified nucleic acid molecule operably linked to a promoter (and, if desired, other regulatory sequences) that promotes expression of the CDS in the plant, the plant cell, the plant tissue, or the plant organ. Two or more elements can be operably linked, i.e., functionally linked, yet contiguous or noncontiguous. The promoter can be, and desirably is, one that is not naturally operably linked to the nucleic acid, being one isolated or derived from another gene. The native promoter, however, can be used. The promoter can be inducible, tissue-preferred, tissue- specific, developmentally regulated, or constitutive.
Examples of promoters include, but are not limited to, the cauliflower mosaic virus 35S (CaMV 35S) promoter, the maize glutathione-S-transferase isoform IT (GST- 11-27) promoter, the cauliflower meri-5 promoter, the Arabidopsis thaliana LEAFY promoter, rice actin, and ubiquitin.
[0074] Suitable vectors can be chosen, such as selected from commercially available sources, or constructed and can contain regulatory sequences, such as promoter sequences, terminator fragments, polyadenylation sequences, enhancer sequences, marker genes, and other sequences as appropriate. See, e.g., Molecular Cloning: A Laboratory Manual, 2nd ed., Sambrook et al., Cold Spring Harbor Laboratory Press (1989). Plant preferred codons can be used to improve expression (see, e.g., Murray et al., Nucl Acids Res 17: 477-498 (1989)). Likewise, the G-C content of the nucleotide sequence can be adjusted to levels characteristic of a given host plant.
[0075] There are many known techniques and protocols for manipulating nucleic acids, such as in the preparation of nucleic acid constructs/vectors, mutagenesis, sequencing, introduction of nucleic acids (e.g., DNA) into cells, gene expression, and protein analysis. See, e.g., Protocols in Molecular Biology, 2nd ed., Ausubel et al., eds. John Wiley & Sons (1992); Bevan, Nucl Acids Res 12: 8711-8721 (1984); and Guerineau and Mullineaux, “Plant transformation and expression vectors,” in Plant Molecular Biology Labfax (Croy RRD, Ed.), Oxford, BIOS Scientific Publishers, pp. 121-148 (1993), all of which are specifically incorporated by reference for their teachings regarding same.
|0076| A plant, or a cell, tissue, or organ thereof, which comprises the abovedescribed vector is also provided. There may be more than one heterologous nucleotide sequence per haploid genome. The nucleotide sequence may be incorporated into the genome. Indeed, if the vector used to introduce an abovedescribed isolated or purified nucleic acid molecule will recombine with the genome, the vector need not necessarily comprise an operably linked promoter or other regulatory sequence(s). Alternatively, the vector can be extra-genomic.
[0077] Any appropriate method of plant transformation can be used to generate plant cells comprising a nucleic acid, construct, or vector. Following transformation, plants may be regenerated from transformed plant cells and tissues. DNA can be transformed into plant cells using Ti-plasmid carried by Agrobacterium, particle or microprojectile bombardment, microinjection (see, e.g., Green et al., Plant Tissue and Cell Culture, Academic Press (1987)), electroporation, other forms of direct DNA uptake, liposome-mediated DNA uptake (see, e.g., Freeman et al., Plant Cell Physiol 29: 1353 (1984)), or vortexing (see, e.g., Kindle, PNAS USA 87: 1228 (1990)). See, also, Oard, Biotech Advn 9: 1-11 (1991), in re physical methods for plant transformation and Shimamoto, Curr Opi in Biotech 5: 158-162 (1994) in re a review of the generation of fertile transgenic plants in rice, maize, wheat, oat, and barley. A combination of different techniques can be employed to enhance the efficiency of transformation, e.g., bombardment with Agrobacterium-coated microparticles or microprojectile bombardment to induce wounding followed by co-cultivation with Agrobacterium. Transformation of Brassica is described in Moloney et al., Plant Cell Reports 8: 238-242 (1989)).
[0078] Following transformation, a plant can be regenerated, for example, from single cells, callus tissue, or leaf discs. See, e.g., Vasil et al., Cell Culture and Somatic Cell Genetics of Plants (Vols. I-III); Laboratory Procedures and Their Applications, Academic Press (1984); and Weissbach and Weissbach, Methods for Plant Molecular Biology, Academic Press (1989).
[0079] The plant can be a monocot. The monocot can be selected from the group consisting of maize, wheat, rice, sorghum, rye, sugar cane, teff, millet, oats, barley, lawn grass, and turf grass. The plant can be a dicot. The dicot can be selected from the group consisting of Arabidopsis, soybean, sunflower, safflower, alfalfa, Brassica (e.g., rape), cotton, and peanut. The isolated or purified nucleic acid molecule operably linked to a promoter can be stably integrated into the genome of the plant (or cell, tissue, or organ thereof). In view of the foregoing, also provided is a seed comprising and expressing the isolated or purified nucleic acid molecule.
[0080] In view of the above, a method of producing a dwarf plant is further provided. The method comprises introducing an above-described vector into a plant, or a cell, tissue, or organ thereof, whereupon the CDS is stably expressed therein, and, when the nucleic acid molecule or the vector is introduced into a cell, tissue or organ, the method further comprises regenerating a plant therefrom. The method can further comprise sexually or asexually propagating the plant. The plant can be sexually propagated using plant breeding techniques. The plant can be sexually propagated as a male. When the plant is maize, the plant can be sexually propagated as a male with a B 16, B73 or Mol7 female. The plant can be a monocot. The monocot can be selected from the group consisting of maize, wheat, rice, sorghum, rye, sugar cane, teff, millet, oats, barley, lawn grass, and turf grass. The plant can be a dicot. The dicot can be selected from the group consisting of Arabidopsis, soybean, sunflower, safflower, alfalfa, Brassica (e.g., rape), cotton, and peanut.
[0081] Still further provided is a method of transferring into a plant at least one mutant allele of a dwarf-8 (D8) gene, or a homolog (also referred to as a syntelog) or an ortholog thereof, wherein the CDS of the gene comprises a nucleotide sequence encoding a DELLA domain with a modified amino acid sequence of DELLAALGYKVRSSDMADVAQKLEQLE [SEQ ID NO: 5] in which the codon encoding the terminal E is substituted with another amino acid and the resulting plant comprising the mutant allele of dwarf-8 (D8) exhibits a dwarf phenotype. The method comprises:
[0082] (a) providing or generating a first plant comprising the mutant dwarf- 8
(D8) allele; and
[0083] (b) crossing the first plant with a second plant, which does not comprise the mutant allele;
[0084] wherein the method optionally further comprises:
[0085] (c) identifying Fl plants comprising the mutant allele;
[0086] (d) backcrossing Fl plants comprising the mutant allele for at least one generation and collecting seeds from the backcrossed generation; and
[0087] (e) identifying in every generation backcrossed, plants comprising the mutant allele. In one embodiment the first plant is crossed as a male or a female. In one embodiment the first plant a maize plant comprising the mutant allele of dwarf-8 (D8), and the second plant can be a maize hybrid that lacks the mutant allele of dwarf-8 (D8). In one embodiment the maize hybrid lacking the mutant allele of dwarf-8 (D8) can be B16, B73 or Mol7. The first plant can be as described above, and the second plant can be a plant of the same species as the first plant.
[0088] Even still further provided is a method of dwarfing a plant. The method comprises introducing at least one nucleotide modification through a targeted site- directed modification at a genomic locus of a plant, or a cell, tissue, or organ thereof, wherein the genomic locus comprises an allele of a maize dwarf-8 (D8) gene, or a homolog (also referred to as a syntelog) or an ortholog thereof. In one embodiment the dwarf- 8 (D8) gene is modified to encode a polypeptide comprising a DELLA sequence of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4. In one embodiment the native maize D8 gene is modified wherein the coding domain sequence (CDS) of the gene comprises a DELLA domain of DELLAALGYKVRSSDMADVAQKLEQLE [SEQ ID NO: 5] and the first nucleotide of the codon encoding the terminal E is mutated from G to A (G190A in maize) resulting in the substitution of the terminal E with another amino acid and resulting in a plant comprising the modified D8 gene exhibiting a dwarf phenotype. The terminal E can be substituted with K (E64K in maize). In one embodiment targeted site-directed modification can involve the use of CRISPR-Cas9 endonuclease, Cpfl endonuclease, Zn finger nuclease, meganuclease, or TALEN (see, e.g., USPAPN 2020/0181623 and USPAPN 2020/0199609, both of which are hereby incorporated by reference for their teachings regarding same). When the targeted site-directed modification is introduced into a cell, tissue or organ, the method can further comprise regenerating a plant therefrom. The plant can be sexually propagated using plant breeding techniques. The plant can be sexually propagated as a male or a female. The plant can be maize and sexually propagated as a male or a female with a B16, B73 or Mol7 crossing partner. The plant can be a monocot. The monocot can be selected from the group consisting of maize, wheat, rice, sorghum, rye, sugar cane, teff, millet, oats, barley, lawn grass, and turf grass. The plant can be a dicot. The dicot can be selected from the group consisting of Arabidopsis, soybean, sunflower, safflower, alfalfa, Brassica (e.g., rape), cotton, and peanut.
[0089] Thus, the methods disclosed herein are useful in producing dwarf varieties of crop plants. Dwarf crop plants can be obtained which have improved agronomic characteristics, such as reduced plant height, reduced ear height (in maize), drought tolerance, increased resilience to wind and storm, reduced potential for lodging, and increased accessibility for application of fertilizer and pesticides. In addition, less fertilizer and pesticides can be required, and plants can be planted more densely, thereby increasing yield.
EXEMPLIFIED EMBODIMENTS
[0090] In accordance with embodiment 1 a maize plant is provided comprising in its genome at least one mutant allele of a dwarf-8 (D8) gene, or a homolog (also referred to as a syntelog) or an ortholog thereof, wherein the coding domain sequence (CDS) of the gene comprises a nucleotide sequence encoding a DELLA domain with the amino acid sequence DELLAALGYKVRSSDMADVAQKLEQLE [SEQ ID NO: 5] in which the codon encoding the terminal E is mutated by a single nucleotide polymorphism (SNP) resulting in the substitution of the terminal E with another amino acid and the plant exhibiting a dwarf phenotype.
[0091] In accordance with embodiment 2 the maize plant of embodiment 1 is provided, wherein the terminal E is substituted with another positively charged, polar amino acid.
[0092] In accordance with embodiment 3, a maize plant of embodiment 2 is provided wherein the positively charged, polar amino acid is K or R, optionally wherein the positively charged polar amino acid is K.
[0093] In accordance with embodiment 4, a maize plant of any one of embodiments 1-3 is provided, wherein the CDS encodes the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence that is at least about 75% identical to SEQ ID NO: 10.
[0094] In accordance with embodiment 5, a maize plant of any one of embodiments 1-3 is provided, wherein the CDS encodes the amino acid sequence of SEQ ID NO: 10 or an amino acid sequence that is at least about 80% identical to SEQ ID NO: 10.
[0095] In accordance with embodiment 6, a maize plant of any one of embodiments 1-3 is provided, wherein the CDS encodes the amino acid sequence of SEQ ID NO: 10 or an amino acid sequence that is at least about 85% identical to SEQ ID NO: 10.
|0096| In accordance with embodiment 7, a maize plant of any one of embodiments 1-3 is provided, wherein the CDS encodes the amino acid sequence of SEQ ID NO: 10 or an amino acid sequence that is at least about 90% identical to SEQ ID NO: 10.
[0097] In accordance with embodiment 8, a maize plant of any one of embodiments 1-3 is provided, wherein the CDS encodes the amino acid sequence of SEQ ID NO: 10 or an amino acid sequence that is at least about 95% identical to SEQ ID NO: 10.
[0098] In accordance with embodiment 9, a maize plant, or a maize plant part thereof, of any one of embodiments 1-8 is provided, wherein the cells of the maize plant, or a maize plant part thereof, comprise a nucleic acid molecule comprising a coding domain sequence (CDS) of the maize dwarf-8 (D8) gene, or a homolog, wherein the CDS comprises a nucleotide sequence encoding a DELLA domain with the amino acid sequence DELLAALGYKVRSSDMADVAQKLEQLE [SEQ ID NO: 5] in which the codon encoding the terminal E is mutated by a single nucleotide polymorphism (SNP) resulting in the substitution of the terminal E with another amino acid.
[0099] In accordance with embodiment 10 an isolated or purified nucleic acid molecule is provided that comprises (or consisting essentially of or consisting of) a nucleotide sequence encoding a coding domain sequence (CDS) of the maize dwarf-8 (D8) gene, or a homolog (also referred to as a syntelog) or an ortholog thereof, wherein the CDS comprises a nucleotide sequence encoding a DELLA domain with the amino acid sequence
DELLAALGYKVRSSDMADVAQKLEQLE [SEQ ID NO: 5] in which the codon encoding the terminal E is modified to result in the encoded DELLA domain comprising a substitution of the terminal E with another amino acid.
[0100] In accordance with embodiment 11, the isolated or purified nucleic acid molecule of embodiment 10 is provided, wherein the modification occurs at nucleotide position 190 of the maize D8 CDS or the corresponding nucleotide position encoding the last amino acid of the DELLA domain of the homolog or the ortholog thereof.
[0101] In accordance with embodiment 12, the isolated or purified nucleic acid molecule of embodiment 10 or 11 is provided wherein the modification is a substitution of guanine 190 of the maize D8 CDS or the corresponding nucleotide position encoding the last amino acid of the DELLA domain of the homolog or the ortholog thereof with adenine (G190A for the maize D8 gene).
[0102] In accordance with embodiment 13, the isolated or purified nucleic acid molecule of any one of embodiments 10-12 is provided, wherein the modification results in the substitution of the glutamic acid residue at position 64 of the maize D8 protein or the corresponding last amino acid of the DELLA domain of the homolog or the ortholog thereof with lysine (E64K for the maize D8 protein).
[0103] In accordance with embodiment 14, the isolated or purified nucleic acid molecule of any one of embodiments 10-13 is provided wherein said isolated or purified nucleic acid molecule comprises the nucleotide sequence GATGAGCTGCTGGCCGCGCTCGGGTACAAGGTGCGTTCGTCGGATATG GCGGACGTCGCGCAGAAGCTGGAGCAGCTCGAG [SEQ ID NO: 6].
[0104] In accordance with embodiment 15, the isolated or purified nucleic acid molecule of any one of embodiments 10-14 is provided, wherein the D8 CDS encodes the amino acid sequence of SEQ ID NO: 10 in Fig. 12 or an amino acid sequence that is at least about 75% identical to SEQ ID NO: 10.
[0105] In accordance with embodiment 16, the isolated or purified nucleic acid molecule of embodiment 15 is provided wherein the isolated or purified nucleic acid molecule comprises the sequence SEQ ID NO: 7 in Fig. 14.
[0106] In accordance with embodiment 17, the isolated or purified nucleic acid molecule of any one of embodiments 10-16 is provided, wherein the CDS encodes the amino acid sequence of SEQ ID NO: 10 or an amino acid sequence that is at least about 80% identical to SEQ ID NO: 10.
[0107] In accordance with embodiment 18, the isolated or purified nucleic acid molecule of any one of embodiments 10-14 is provided, wherein the CDS encodes the amino acid sequence of SEQ ID NO: 10 or an amino acid sequence that is at least about 85% identical to SEQ ID NO: 10.
[0108] In accordance with embodiment 19, the isolated or purified nucleic acid molecule of any one of embodiments 10-14 is provided, wherein the CDS encodes the amino acid sequence of SEQ ID NO: 10 or an amino acid sequence that is at least about 90% identical to SEQ ID NO: 10.
[0109] In accordance with embodiment 20, the isolated or purified nucleic acid molecule of any one of embodiments 10-14 is provided, wherein the CDS encodes the amino acid sequence of SEQ ID NO: 10 or an amino acid sequence that is at least about 95% identical to SEQ ID NO: 10.
[ 01101 In accordance with embodiment 21, an isolated or purified mutant maize dwarf- 8 (D8) protein comprising (or consisting essentially of or consisting of) the amino acid sequence of SEQ ID NO: 10 or an amino acid sequence that is at least about 75% identical to SEQ ID NO: 10 is provided, wherein the amino acid sequence comprises a DELLA domain with the amino acid sequence DELLAALGYKVRSSDMADVAQKLEQLE [SEQ ID NO: 5] in which the terminal E is substituted with another amino acid, optionally wherein the terminal E is substituted with another negatively charged, polar amino acid, optionally wherein the negatively charged, polar amino acid is K or R, optionally wherein the negatively charged, polar amino acid is K. [0111] In accordance with embodiment 22, the isolated or purified mutant maize dwarf-8 (D8) protein of embodiment 21 is provided, which comprises (or consists essentially of or consists of) an amino acid sequence that is at least about 80% identical to SEQ ID NO: 1, optionally comprises an amino acid sequence that is at least about 85% identical to SEQ ID NO: 1 , optionally comprises an amino acid sequence that is at least about 90% identical to SEQ ID NO: 1, optionally comprises an amino acid sequence that is at least about 95% identical to SEQ ID NO: 1.
[0112] In accordance with embodiment 23, a vector, which can be introduced into a plant, a plant cell, a plant tissue, or a plant organ is provided, which comprises the isolated or purified nucleic acid molecule of any one of embodiments 10-22 operably linked to a promoter that promotes expression of the CDS in the plant, the plant cell, the plant tissue, or the plant organ.
[0113] In accordance with embodiment 24, a plant, or a plant cell, plant tissue, plant organ, seed or other plant part thereof is provided, wherein the a plant, or a plant cell, plant tissue, plant organ, seed or other plant part thereof comprises the vector of embodiment 23, optionally wherein nucleic acid molecule of any one of embodiments 10-22 is inserted into the genome of the host plant, or a plant cell, plant tissue, plant organ, seed or other plant part thereof.
[0114] In accordance with embodiment 25, a plant, or a plant cell, plant tissue, plant organ, seed, or other plant part thereof of embodiment 24 is provided wherein said plant is a monocot, optionally wherein the monocot is selected from the group consisting of maize, wheat, rice, sorghum, rye, sugar cane, teff, millet, oats, barley, lawn grass, and turf grass.
[0115] In accordance with embodiment 26, a plant, or a plant cell, plant tissue, plant organ, seed, or other plant part thereof of embodiment 24 is provided wherein said plant is a dicot, optionally wherein the dicot is selected from the group consisting of Arabidopsis, soybean, sunflower, safflower, alfalfa, Brassica (e.g., rape), cotton, and peanut.
[0116] In accordance with embodiment 27 a method of producing a dwarf plant is provided, wherein the method comprises introducing a nucleic acid molecule of any one of embodiments 10-23 into a plant, or a cell, tissue, or organ thereof, whereupon the CDS is stably expressed therein, and, when the nucleic acid molecule is introduced into a cell, tissue or organ, the method further comprises regenerating a plant therefrom. [0117] In accordance with embodiment 28 a method of producing a dwarf plant according to embodiment 27 is provided further comprising a step of sexually or asexually propagating the plant, optionally wherein the plant is sexually propagated using plant breeding techniques.
[01 18] In accordance with embodiment 29 a method of producing a dwarf plant according to embodiment 28 is provided, wherein the plant is sexually propagated as a male or a female, optionally, wherein the plant is maize and is sexually propagated as a male or a female with a B16, B73 or Mol7 crossing partner.
[0119] In accordance with embodiment 30 a method of producing a dwarf plant according to any one of embodiments 27-29 is provided, wherein the plant is a monocot, optionally wherein the monocot is selected from the group consisting of maize, wheat, rice, sorghum, rye, sugar cane, teff, millet, oats, barley, lawn grass, and turf grass.
[0120] In accordance with embodiment 31 a method of producing a dwarf plant according to any one of embodiments 27-29 is provided, wherein the plant is a dicot, optionally wherein the dicot is selected from the group consisting of Arabidopsis, soybean, sunflower, safflower, alfalfa, Brassica (e.g., rape), cotton, and peanut.
[0121] In accordance with embodiment 32 a method of transferring into a plant at least one mutant allele of a dwarf-8 (D8) gene, or a homolog (also referred to as a syntelog) or an ortholog thereof is provided, wherein the coding domain sequence (CDS) of the gene comprises a nucleotide sequence encoding a DELLA domain with the amino acid sequence DELLAALGYKVRSSDMADVAQKLEQLE [SEQ ID NO: 5] in which the codon encoding the terminal E is mutated by a single nucleotide polymorphism (SNP) resulting in the substitution of the terminal E with another amino acid and the plant exhibiting a dwarf phenotype, which method comprises:
(a) providing or generating a first plant comprising the at least one mutant allele; and
(b) crossing the first plant with a second plant, which does not comprise the mutant allele; wherein the method optionally further comprises:
(c) identifying Fl plants comprising the mutant allele;
(d) backcrossing Fl plants comprising the at least one mutant allele for at least one generation and collecting seeds from the backcrossed generation; and (e) identifying in every generation backcrossed plants comprising the at least one mutant allele.
[0122] In accordance with embodiment 33 the method of embodiment 32 is provided, wherein the first plant is crossed as a male or a female.
[0123] In accordance with embodiment 34 the method of embodiment 32 or 33 is provided, wherein the first plant is the maize plant of any one of embodiments 1-9 and the second plant is a maize hybrid, optionally wherein the maize hybrid is B16, B73 or Mol7.
[0124] In accordance with embodiment 35 the method of embodiment 32 or 33 is provided, wherein the first plant is the plant of any one of embodiment 24-26, and the second plant is a plant of the same species as the first plant.
[0125] In accordance with embodiment 36 a method of dwarfing a plant is provided, which method comprises introducing at least one nucleotide modification through a targeted site-directed modification at a genomic locus of a plant, or a cell, tissue, or organ thereof, wherein the genomic locus comprises an allele of a maize dwarf-8 (D8) gene, or a homolog, an ortholog, or a syntelog thereof, wherein the coding domain sequence (CDS) of the gene comprises a DELLA domain DELLAALGYKVRSSDMADVAQKLEQLE [SEQ ID NO: 5] and the first nucleotide of the codon encoding the terminal E is mutated from G to A (G190A in maize) resulting in the substitution of the terminal E with another amino acid and the resulting plant exhibits a dwarf phenotype, optionally wherein the terminal E is substituted with K (E64K in maize).
[0126] In accordance with embodiment 37 the method of dwarfing a plant according to embodiment 36 is provided, wherein the targeted site-directed modification involves the use of CRISPR-Cas9 endonuclease, Cpfl endonuclease, Zn finger nuclease, meganuclease, or TALEN.
[0127] In accordance with embodiment 38 the method of dwarfing a plant according to embodiment 36 or 37 is provided, wherein, when the targeted site- directed modification is introduced into a cell, tissue or organ, the method further comprises regenerating a plant therefrom.
[0128] In accordance with embodiment 39 the method of dwarfing a plant according to any one of embodiments 36-38 is provided, wherein the plant is sexually propagated using plant breeding techniques, optionally wherein the plant is sexually propagated as a male or a female, optionally wherein the plant is maize and sexually propagated as a male or a female with a B16, B73 or Mol7 crossing partner.
[0129] In accordance with embodiment 40 the method of dwarfing a plant according to any one of embodiments 36-39 is provided, wherein the plant is a monocot, optionally wherein the monocot is selected from the group consisting of maize, wheat, rice, sorghum, rye, sugar cane, teff, millet, oats, barley, lawn grass, and turf grass.
[0130] In accordance with embodiment 41 the method of dwarfing a plant according to any one of embodiments 36-39 is provided, wherein the plant is a dicot, optionally wherein the dicot is selected from the group consisting of Arabidopsis, soybean, sunflower, safflower, alfalfa, Brassica (e.g., rape), cotton, and peanut.
[0131] In accordance with embodiment 42 a polynucleotide is provided that encodes a modified dwarf-8 (D8) polypeptide comprising a DELLA domain sequence of DELLAXeLXsYKVRXnSXisMAXisVAQKLEQLXsr (SEQ ID NO: 45), wherein
Xe is Ala or Vai;
Xs is Gly, Arg or Glu;
X13 is Ala or Ser;
X15 and Xis are independently Glu or Asp; and
X27 is an amino acid other than glutamic acid.
[0132] In accordance with embodiment 43 a polynucleotide of embodiment 42 is provided wherein X27 is a positively charged, polar amino acid.
[0133] In accordance with embodiment 44 a polynucleotide of embodiment 42 or 43 is provided wherein X27 is Lys or Arg.
101341 In accordance with embodiment 45 a polynucleotide of any one of embodiments 42-44 is provided wherein Xs is Arg or Glu
[0135] In accordance with embodiment 46 a polynucleotide is provided that encodes a modified dwarf-8 (D8) polypeptide comprising a DELLA domain sequence of DELLAX6LXsYKVRXi3SXi5MAXi8VAQKLEQLX27 (SEQ ID NO: 45), wherein
Xe is Ala or Vai;
Xs is Arg or Glu;
X13 is Ala or Ser;
X15 and Xis are independently Glu or Asp; and X27 is Glu.
[0136] In accordance with embodiment 47 a polynucleotide of any one of embodiments 42-46 is provided wherein Xs is Arg.
[0137] In accordance with embodiment 48 a polynucleotide of any one of embodiments 42-45 is provided wherein
Xg is Ala;
Xs is Gly, Arg or Glu;
X13 is Ser;
X15 and Xis are each Asp; and
X27 is Lys.
[0138] In accordance with embodiment 49 a polynucleotide of any one of embodiments 42-45 is provided wherein
Xe is Ala;
Xs is Arg or Glu;
X13 is Ser;
X15 and Xis are each Asp; and
X27 is Glu or Lys.
[0139] In accordance with embodiment 50 a polynucleotide of any one of embodiments 43-49 is provided wherein the polynucleotide encodes a modified dwarf-8 (D8) polypeptide comprising a DELLA domain sequence of DELLAX6LX8YKVRX13SX15MAX18VAQKLEQLX27 (SEQ ID NO: 45), wherein
X6 is Vai;
Xs is Arg;
X13 is Ser;
X15 and Xis are both Asp; and
X27 is Glu.
[0140] In accordance with embodiment 51 a polynucleotide of any one of embodiments 42-45 or 47-49 is provided wherein X27 is Lys.
[0141] In accordance with embodiment 52 a polynucleotide is provided that encodes a modified dwarf-8 (D8) polypeptide comprising a DELLA domain sequence of DELLAX6LGYKVRX13SX15MAX18VAQKLEQLX27 (SEQ ID NO: 1), wherein
X6 is Ala or Vai;
X13 is Ala or Ser;
X15 and Xis are independently Glu or Asp; and X27 is an amino acid other than glutamic acid, wherein a plant regenerated from said cell exhibits a dwarf phenotype.
[0142] In accordance with embodiment 53 a polynucleotide according to embodiment 52 is provided wherein Xe is Ala.
[0143] In accordance with embodiment 54 a polynucleotide according to embodiment 52 or 53 is provided wherein X13 is Ser.
[0144] In accordance with embodiment 55 a polynucleotide according to any one of embodiments 52-54 is provided wherein X15 is Asp.
[0145] In accordance with embodiment 56 a polynucleotide according to any one of embodiments 52-55 is provided wherein Xis is Asp.
[0146] In accordance with embodiment 57 a polynucleotide according to any one of embodiments 52-56 is provided wherein
[0147] In accordance with embodiment 58 a polynucleotide according to any one of embodiments 52-57 is provided wherein X27 is a positively charged, polar amino acid, optionally wherein X27 is Lys or Arg.
[0148] In accordance with embodiment 59 a polynucleotide according to any one of embodiments 52-58 is provided wherein said modified dwarf-8 (D8) protein comprises a DELLA domain sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4, optionally wherein X27 of SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4 is Lys or Arg.
[0149] In accordance with embodiment 60 a polynucleotide according to any one of embodiments 52-59 is provided wherein said modified dwarf-8 (D8) protein comprises a DELLA domain sequence of SEQ ID NO: 2, wherein X27 is Lys or Arg.
[0150] In accordance with embodiment 61 a polynucleotide according to any one of embodiments 52-60 is provided wherein said modified dwarf-8 (D8) protein comprises the sequence of SEQ ID NO: 44, optionally wherein the amino acid at position 64 is Lys.
[0151] In accordance with embodiment 62 a polynucleotide of any one of embodiments 52-61 is provided wherein said polynucleotide comprises a nucleic acid sequence of SEQ ID NO: 43.
[0152] In accordance with embodiment 63 a polynucleotide of any one of embodiments 52-62 is provided wherein said polynucleotide comprises a nucleic acid sequence having at least 85% sequence identity with SEQ ID NO: 7, or optionally having at least 90% sequence identity with SEQ ID NO: 7, optionally wherein the polypeptide includes the sequence of SEQ ID NO: 2, optionally wherein X27 is of SEQ ID NO: 2 is Lys.
[0153] In accordance with embodiment 64 a plant cell is provided wherein the plant cell comprises a polynucleotide of any one of embodiments 1-63, wherein a plant regenerated from said cell exhibits a dwarf phenotype.
[0154] In accordance with embodiment 65 the plant cell of embodiment 64 is provided wherein the polynucleotide is incorporated into the nuclear genome of the plant.
[0155] In accordance with embodiment 66 the plant cell of embodiment 64 or 65 is provided wherein the plant cell is selected from the group consisting of dicotyledonous cells and monocotyledonous cells.
[0156] In accordance with embodiment 67 the plant cell of any one of embodiments 64-66 is provided wherein said plant cell is dicotyledonous and is selected from the group consisting of a cotton cell, a tobacco cell, a canola cell, a soybean cell, and an Arabidopsis cell.
[0157] In accordance with embodiment 68 the plant cell of any one of embodiments 64-66 is provided wherein said plant cell is a monocotyledonous cell selected from the group consisting of a rice cell and a maize cell.
[0158] In accordance with embodiment 69 the plant cell of any one of embodiments 64-68 is provided wherein said plant cell is a maize cell.
[0159] In accordance with embodiment 70 a plant comprising a plurality of the plant cell of any one of embodiments 64-69 is provided wherein said plant exhibits a dwarf phenotype.
[0160] In accordance with embodiment 71 a plant or plant part thereof is provided wherein the cells of the plant or plant part thereof comprise a polynucleotide that encodes a modified dwarf-8 (D8) protein comprising a DELLA domain sequence of DELLAX6LX8YKVRXi3SXi5MAXi8VAQKLEQLX27 (SEQ ID NO: 45), wherein Xe is Ala or Vai;
Xs is Gly, Arg or Glu;
X13 is Ala or Ser;
X15 and Xis are independently Glu or Asp; and
X27 is an amino acid other than glutamic acid, optionally wherein X27 is Glu or Lys, with the proviso that when X27 is Glu, Xs is not Gly, wherein said plant, or a plant regenerated from said plant part exhibits a dwarf phenotype. [0161] In accordance with embodiment 72 a plant or plant part thereof is provided wherein the cells of the plant or plant part thereof comprise a polynucleotide that encodes a modified dwarf-8 (D8) protein comprising a DELLA domain sequence of DELLAX6LX8YKVRXi3SXi5MAXi8VAQKLEQLX27 (SEQ ID NO: 45), wherein Xg is Ala;
X8 is Gly, Arg or Glu;
X13 is Ser;
X15 and Xis are each Asp; and
X27 is Lys, wherein said plant or a plant regenerated from said plant part exhibits a dwarf phenotype
[0162] In accordance with embodiment 73 a plant or plant part thereof is provided wherein the cells of the plant or plant part thereof comprise a polynucleotide that encodes a modified dwarf-8 (D8) protein comprising a DELLA domain sequence of DELLAX6LX8YKVRXi3SXi5MAXi8VAQKLEQLX27 (SEQ ID NO: 45), wherein Xe is Ala;
X8 is Arg;
X13 is Ser;
X15 and Xis are each Asp; and
X27 is Glu, wherein said plant or a plant regenerated from said plant part exhibits a dwarf phenotype
[0163] In accordance with embodiment 74 a plant or plant part thereof is provided wherein the cells of the plant or plant part thereof comprise a polynucleotide that encodes a modified dwarf-8 (D8) protein comprising a DELLA domain sequence of DELLAX6LGYKVRXI3SXISMAXISVAQKLEQLX27 (SEQ ID NO: 1), wherein Xg is Ala or Vai;
X13 is Ala or Ser;
X15 and Xis are independently Glu or Asp; and
X27 is an amino acid other than glutamic acid, wherein said plant or a plant regenerated from said plant part exhibits a dwarf phenotype, optionally wherein X27 is a positively charged, polar amino acid, optionally wherein X27 is Lys or Arg.
[0164] In accordance with embodiment 75 a plant or plant part thereof according to embodiment 74 is provided wherein said modified dwarf-8 (D8) protein comprises a DELLA domain sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4, optionally wherein X27 of SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4 is Lys or Arg.
[0165] In accordance with embodiment 76 a plant or plant part thereof according to embodiment 74 or 75 is provided wherein said modified dwarf-8 (D8) protein comprises a DELLA domain sequence of SEQ ID NO: 2, wherein X27 is Lys.
[0166] In accordance with embodiment 77 a plant or plant part thereof according to any one of embodiments 74-75 is provided wherein said polynucleotide comprises a nucleic acid sequence of SEQ ID NO: 43.
[0167] In accordance with embodiment 78 a plant or plant part thereof according to any one of embodiments 74-77 is provided wherein said polynucleotide comprises a nucleic acid sequence having at least 85% sequence identity with SEQ ID NO: 7, or optionally having at least 90% sequence identity with SEQ ID NO: 7, optionally wherein said polypeptide includes the sequence of SEQ ID NO: 2, optionally wherein X27 is Lys.
[0168] In accordance with embodiment 79 a plant or plant part thereof according to any one of embodiments 74-78 is provided said plant or plant part thereof is dicotyledonous and is selected from the group consisting of a cotton cell, a tobacco cell, a canola cell, a soybean cell, and an Arabidopsis cell.
[0169] In accordance with embodiment 80 a plant or plant part thereof according to any one of embodiments 71-79 is provided said plant or plant part thereof is monocotyledonous and is selected from the group consisting of a rice cell and a maize cell, optionally wherein the plant or plant part thereof is a maize plant or plant part thereof.
[0170] In accordance with embodiment 81 a progeny, or asexual propagate of the plant according to any one of embodiments 71-80 is provided wherein said progeny, or sexual propagate comprises said a polynucleotide that encodes a modified dwarf-8 (D8) protein comprising a DELLA domain sequence of DELLAALGYKVRSSDMADVAQKLEQLX27 (SEQ ID NO: 2), wherein X27 is a positively charged, polar amino acid.
[0171] In accordance with embodiment 82 a method of producing a dwarf plant is provided, wherein said method comprises the step of introducing a polynucleotide of any one of embodiments 1-63 into the cells of a plant.
[0172] In accordance with embodiment 83 the method according to embodiment 82 is provided wherein said polynucleotide is introduced into the cell via transfection of a plant cell and a dwarf plant is regenerated from said transfected plant cell.
[0173] In accordance with embodiment 84 the method according to embodiment 82 is provided wherein said polynucleotide is introduced into the cell of a plant by traditional breeding by crossing a first plant comprising said polynucleotide with a second plant lacking said polynucleotide; identifying progeny plants comprising said polynucleotide; and selected progeny plants comprising said polynucleotide.
[0174] In accordance with embodiment 85 a method of detecting a polynucleotide that encodes a modified dwarf-8 (D8) protein in a sample comprising nucleic acids is provided wherein said method comprises contacting said sample with a polynucleotide of SEQ ID NO: 43 or the complement thereof, wherein detecting specific binding of the polynucleotide of SEQ ID NO: 6 to the sample identifies the presence of a modified dwarf-8 (D8) protein encoding sequence in said sample.
[0175] In accordance with embodiment 86 a method of detecting a polynucleotide that encodes a modified dwarf-8 (D8) protein in a sample comprising nucleic acids is provided, wherein said method comprises contacting said sample with a. a first primer that binds to the sequence 5’ to the encoded DELLA domain of a polynucleotide that encodes a modified dwarf-8 (D8) protein; and b. a second primer that binds to the sequence 3’ to the encoded DELLA domain of a polynucleotide that encodes a modified dwarf-8 (D8); subjecting said sample to polymerase chain reaction; and assaying for an amplicon generated between said primers that encodes the DELLA peptide sequence of SEQ ID NO 1 or SEQ ID NO: 45.
[0176] In accordance with embodiment 87 an expression vector comprising a nucleic acid sequence of any one of embodiments 1-61 is provided wherein the nucleic acid sequence is operably linked to a promoter that is functional in plants.
[0177] In accordance with embodiment 88, the expression vector of embodiment 87 is provided wherein the expression vector comprises a nucleic acid sequence having at least 85% sequence identity with the sequence of SEQ ID NO: 7, wherein the nucleic acid sequence having at least 85% sequence identity with the sequence of SEQ ID NO: 7 is operably linked to a promoter that is functional in plants, optionally wherein the expression vector comprises a selectable marker.
[0178] In accordance with embodiment 89 a soybean, wheat or barley plant is provided wherein the cells of the soybean, wheat or barley plant comprise a modified D8 gene encoding a DELLA domain having the sequence of SEQ ID NO: 3.
[0179] In accordance with embodiment 90 a cotton plant is provided wherein the cells of the cotton plant comprise a modified D8 gene encoding a DELLA domain having the sequence of SEQ ID NO: 4.
[0180] In accordance with embodiment 91 a rice or tomato plant is provided wherein the cells of the rice or tomato plant comprise a modified D8 gene encoding a DELLA domain having the sequence of SEQ ID NO: 2.
EXAMPLES
[0181] The following examples serve to illustrate the present disclosure. The examples are not intended to limit the scope of the claimed invention in any way.
Example 1
[0182] V alidation of the heritability of DI 6
[0183] To validate the heritability of D16, it was backcrossed with the wild-type (WT) B73 progenitor. Semi-dwarf plants typical of D16 reappeared in the resulting first backcross population (BC1), clearly indicating the genetic nature of D16.
Example 2
[0184] Determination of partial dominance of DI 6
[ 0185] To determine if DI 6 was completely dominant or partially dominant, a few BC1 plants with the short-stature phenotype typical of D16 were selfpollinated. The F2 progenies were found to segregate for plants with three distinct height phenotypes: short, intermediate, and tall in a ratio of about 1:2:1, respectively. These results suggested that DI 6 was perhaps partially dominant, and that the plants with the shortest stature were DI 6 homozygotes. To confirm, a few of the shortest plants were self-pollinated. Their progeny were all short and of the same size as that of the short parent, confirming the partially dominant nature of D16. Example 3
[0186] Effect of DI 6 on maize plant and ear height
[0187] The height of DI 6 in homozygous (D16ID16) and heterozygous (D16ID16) conditions was compared with those of their progenitor B73. In the B73 background, D16 homozygotes were reduced in height by about 40-45% compared to B73, whereas D16 heterozygotes were reduced in height by about 25- 30% (Fig. 1). Ear placement was lower on D16 mutant plants compared to B73 plants. Ear height was reduced about 50% on D16 homozygotes and about 30% on DI 6 heterozygotes (Fig. 1).
[0188] The height reduction of the stalk internodes was more or less uniform throughout, especially on DI 6 heterozygotes (Fig. 2). This trait distinguishes the dwarfing trait underlying D16 from that of br2, which is another maize dwarfing mutant in which height reduction is confined mostly to the lowermost internodes, thereby causing ear height to be reduced disproportionately to the overall height of the br2 plant.
Example 4
[0189] Pleiotropic effects of D16 are minor
[0190] D16 homozygotes had the same number of leaves as their wild-type progenitor B73. The lengths of the leaves also appeared to be the same as B73, although the widths may have been slightly more in DI 6 homozygotes (Fig. 3). Homozygous D16 seed germinated at the same rate as B73, and the initial growth of the seedlings was also comparable. D16/D16 seedling and B73 seedlings looked very much alike during the first 3-4 weeks of growth. Differences started to manifest around the fourth week after planting and became more distinct as the stalks elongated. There was little difference, if any, in transition to flowering, and D16/D16 mutants started shedding within a day or two of B73. The architecture of the D16ID16 tassels was the same as that of B73; both appeared to be equally fertile. The size of the D16/D16 ears was shorter than those of B73, but they still produced hundreds of kernels per ear (Fig. 3), thereby allowing the dwarfing mutant to be propagated and maintained as a commercially viable, uniform stock. DI 6 homozygotes also did not form anthers in their ears as do all known dominant and recessive gibberellin (GA) dwarfing mutants. Therefore, DI 6 has few pleiotropic effects, even as a homozygote. Example 5
[0191] D16 is more tolerant to water deficit or drought-like conditions
[0192] When grown in sandbags in PVC pipes and watered sparingly, D16 homozygotes fared much better than B73. At moisture levels when B73 leaves showed clear signs of distress and underwent leaf droopiness, the leaves of D16 homozygotes remained turgid (Fig. 4). This may be due to the slightly improved architecture and growth of D16 roots compared to B73 roots, thereby allowing D16 roots to reach the bottom of the bag faster than B73 roots (Figs. 5 and 6).
Example 6
[0193] Phenotypic characterization of DI 6 hybrids
[0194] D16 homozygotes were crossed with several common and elite inbred lines from ex-PVP (Plant Variety Protection) resources. One of the common inbred lines was Mo 17. The elite inbred lines included the pollinators PHZ51, PHG35, PH207, PHPO2, and PHG47 and the female LH195. The penetrance of D16 was complete in all hybrid combinations, and a single copy of the £>76 mutant allele reduced the height of each hybrid by 2-3 feet compared to the wild-type. See, e.g., Fig. 7, which compares D16 hybrids of B73/Mol7 with wild-type counterparts. The only change that is obvious between £> 6 and wild- type B73/Mol7 hybrids is plant height. A single copy of D16 decreased the overall plant height from 8.7 feet (for wild-type B73/Mol7 hybrid) to 6.5 feet, i.e., about a 25% decrease (Fig. 8). Similarly, the ear height also decreased by about 25%, from 4.2 feet to 3.2 feet, in £>76 hybrids compared to the wild-type B73/Mol7 hybrids (Fig. 8). The reduction in height caused by D16 was uniform throughout all stalk internodes, and the ear height did not drop below 2.0 feet above ground in any of the hybrids (Fig. 9). Stalk strength of DI 6 hybrids almost always exceeded that of their wild-type comparators (Fig. 10) as determined by Darling, a device designed to assess resistance to lodging. There were no differences in maturity level of reproductive traits between DI 6 and wild-type hybrids. Ear shape and size was comparable between the mutant and wild-type hybrids. The yield of £>76 hybrids was almost as good as their wild-type comparators and, in the case of the B73/PHZ51 hybrid, the DI 6 mutants outperformed wild-type hybrids by more than 5% in yield. Example 7
[0195] D16 is the result of a single base-pair change in the d8 gene of maize
[0196] The gene underlying DI 6 was cloned by a next generation sequence strategy. D16 was found to contain one single nucleotide polymorphism (SNP) in the coding sequence of the gene D8 (B73v4 Zm00001d033680) compared to the B73 progenitor (Fig. 11). D8 encodes a DELLA domain protein. The dwarf-8 (c/8) gene in maize is an ortholog of the Arabidopsis gibberellin-insensitive (GAT) gene, as is the wheat reduced height- 1 (Rht-B 1/Rht-Dl) gene. Both these wheat genes have been used to produce dwarf grain varieties that have improved grain yield. The genes encode proteins that resemble nuclear transcription factors and contain an SH2-like domain, which indicates that phosphotyrosine may participate in gibberellin signaling. Transgenic rice plants containing a mutant GAI allele from Arabidopsis have been shown to produced reduced responses to gibberellin and are dwarfed, indicating that mutant GAI orthologs could be used to increase yield in a wide range of crop species (Peng et al., Nature 400: 256-261 (1999)).
[0197] In maize a duplicate (homeolog/syntelog) of d8 is 9; the proteins encoded by these two genes share 92.6% sequence identity (Fig. 12). Mutations in d.8 and d9 have been identified, and they all lead to dominant dwarfs. All these mutations result in severe structural changes due to either complete deletion of the DELLA domain or other changes. Consequently, all known mutant alleles of D8 and D9 are very severe, especially when homozygous.
[0198] In contrast to known mutations in d8 and d9. the DI 6 mutant is the result of a single base pair change, G190A, which causes the missense mutation E64K. Amino acid residue 64 happens to be the last amino acid in the DELLA domain (Fig. 13). The SNP underlying DI 6 was found to be linked with the short-stature phenotype of DI 6, suggesting a causal relationship between the two. The likelihood of D16 being a d8 mutant is supported by the observations that DI6 causes anthers to form in the ears of some hybrids, especially those made between D16::B73 and some popcorn inbred lines. The anther-ear (anthers in ear) phenotype is a hallmark of GA-related mutations; however, DI 6 does not have this phenotype in most backgrounds, perhaps due to the weak nature of the E64K substitution, which also impairs stalk elongation in DI 6 only partially.
Example 8 D16 revertant [0199] D16 revertant was generated by EMS mutagenesis that exhibits normal height. Molecular analysis of the D8 gene of this mutant revealed a new G-to-A SNP at location 1194 of the nucleic acid encoding the D8 gene product. This SNP (G1194A) introduced a stop codon in place of the native tryptophan codon, thereby truncating the D8 protein by 233 amino acids. The truncated polypeptide comprising the E64K amino acid substitution is likely inactivated by the truncation, thus explaining the full tall phenotype of the revertant. Accordingly, this revertant validates the role of the mutant G190A SNP, as a genuine dwarfing mutation.
Example 9 DI 6 alternative mutation
[0200] Additional linkage analysis was conducted on the DI 6 dwarf plants comprising the SNP G190A, which changes the last amino acid (# 64) in the DELLA motif of the D8 Della protein from glutamic acid (E) to lysine (K), abbreviated as E64K.
[0201] The mapping population used for this linkage analysis was generated by crossing D16/+ heterozygotes from two separate advanced backcross families in a greenhouse. The resulting progeny were planted in a genetic nursery at ACRE. Genotyping of 185 progeny plants from this mapping population (MP1) with the Xhol CAPS marker found about half of the dwarf plants had this SNP, whereas the other half of the dwarf plants lacked it.
[0202] To address if the d8 gene of the other half of the dwarf plants sustained any mutational SNP(s), the d8 gene was PCR amplified. Sequencing of the PCR amplicons showed that, instead of the G190A SNP, this set of dwarf mutants had a G-to-A SNP at nucleotide 133. This new SNP -G133A - causes a glycine to arginine change at residue 45 of the D8 protein. The same glycine residue, which is conserved in all plant species, was also found to be substituted in a dominant dwarfing mutant in barley (SlnlD), although the change was from glycine (G) to glutamic acid (E). Similar to the maize G45R mutation, the barley G to E mutant allele had a relatively weak dwarfing phenotype, which it also recapitulated as a transgene in Arabidopsis.
[0203] Like the G190A SNP, the G133A SNP was also present only in about half of the dwarfing plants upon crossing plants heterozygous for the G133A SNP. Except for a few dwarfing plants that were perhaps homozygous dwarf, most other G190A-containing dwarfs of the MP1 population lacked the G133A SNP. Accordingly, this surprising and unexpected result indicates that our EMS-induced mutant library contained two independent SNPs in the d8 gene, both capable of mediating dominant dwarfism. Given that dominant mutations are so rare to generate, the similar phenotype of these two mutants initially led applicants into thinking they were the same mutant allele.
[0204] All patents, patent application publications, journal articles, textbooks, and other publications mentioned in the specification are indicative of the level of skill of those in the art to which the disclosure pertains. All such publications are incorporated herein by reference to the same extent as if each individual publication were specifically and individually indicated to be incorporated by reference. In the event of inconsistent usages between this document and those documents so incorporated by reference, the usage in the incorporated reference should be considered supplementary to that of this document; for irreconcilable inconsistencies, the usage in this document controls.
[0205] The invention illustratively described herein may be suitably practiced in the absence of any element(s) or limitation(s), which is/are not specifically disclosed herein. Thus, for example, each instance herein of any of the terms "comprising," "consisting essentially of," and "consisting of" may be replaced with either of the other two terms. Likewise, the singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise. Thus, for example, references to "the method" includes one or more methods and/or steps of the type, which are described herein and/or which will become apparent to those ordinarily skilled in the art upon reading the disclosure. The term "or" is used to refer to a nonexclusive "or" unless otherwise indicated.
|0206| Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art. The following terms and phrases shall have the meaning indicated.
[0207] In addition, it is to be understood that the phraseology or terminology employed herein, and not otherwise defined, is for the purpose of description only and not of limitation. Any use of section headings is intended to aid reading of the document and is not to be interpreted as limiting. Further, information that is relevant to a section heading may occur within or outside of that particular section.

Claims

WHAT IS CLAIMED IS:
1. A plant cell comprising a polynucleotide that encodes a modified dwarf-8 (D8) protein comprising a DELLA domain sequence of DELLAX6LX8YKVRX13SX15MAX18VAQKLEQLX27 (SEQ ID NO: 45), wherein
X6 is Ala or Vai;
Xs is Gly, Arg or Glu;
X13 is Ala or Ser;
X15 and Xis are independently Glu or Asp; and
X27 is an amino acid other than glutamic acid, wherein a plant regenerated from said cell exhibits a dwarf phenotype.
2. The plant cell of claim 1 wherein X27 is a positively charged, polar amino acid.
3. The plant cell of claim 1 wherein X27 is Lys or Arg.
4. The plant cell of claim 1 wherein Xs is Arg or Glu.
5. The plant cell of claim 1 wherein
X& is Ala;
Xs is Gly, Arg or Glu;
X13 is Ser;
X15 and Xis are each Asp; and X27 is Lys.
6. The plant cell of claim 1 wherein
Xe is Ala;
Xs is Arg or Glu;
X13 is Ser;
X15 and Xis are each Asp; and X27 is Glu or Lys.
7. The plant cell of claim 6 wherein
X8 is Arg.
8. The plant cell of claim 7 wherein
X27 is Glu.
9. The plant cell of claim 7 wherein
X27 is Lys.
10. A plant cell homozygous for the polynucleotide of any one of claims 1-9.
11. The plant cell of claim 1 wherein said modified dwarf-8 (D8) protein comprises a DELLA domain sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4, optionally wherein X27 of SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4 is Lys.
12. The plant cell of claim 1 wherein said modified dwarf-8 (D8) protein comprises a DELLA domain sequence of SEQ ID NO: 2, wherein X27 is Lys.
13. The plant cell of claim 1 wherein said modified dwarf-8 (D8) protein comprises a DELLA domain sequence of SEQ ID NO: 44 or SEQ ID NO: 47.
14. The plant cell of any one of claims 1-6 wherein said polynucleotide comprises a nucleic acid sequence of SEQ ID NO: 43 or SEQ ID NO: 46.
15. The plant cell of any one of claims 1-6 wherein said polynucleotide comprises a nucleic acid sequence having at least 85% sequence identity with SEQ ID NO: 7, or optionally having at least 90% sequence identity with SEQ ID NO: 7.
16. The plant cell of claim 13 wherein said polypeptide includes the sequence of SEQ ID NO: 2, optionally wherein X27 is Lys.
17. The plant cell of any one of claims 1-6 wherein X27 is Lys.
18. The plant cell of any one of claims 1-17 wherein said plant cell is selected from the group consisting of dicotyledonous cells and monocotyledonous cells.
19. The plant cell of claim 18 wherein said plant cell is dicotyledonous and is selected from the group consisting of a cotton cell, a tobacco cell, a canola cell, a soybean cell, and an Arabidopsis cell.
20. The plant cell of any one of claims 1-17 wherein said plant cell is a monocotyledonous cell selected from the group consisting of a rice cell and a maize cell.
21. The plant cell of claim 20 wherein said plant cell is a maize cell.
22. A plant comprising a plurality of the plant cell of any one of claims 1-21 wherein said plant exhibits a dwarf phenotype.
23. A seed comprising the plant cell of any one of claims 1-21 wherein a plant geminated from said seed exhibits a dwarf phenotype.
24. A part, progeny, or asexual propagate of the plant of claim 22, wherein said part, progeny, or sexual propagate comprises said a polynucleotide that encodes a modified dwarf- 8 (D8) protein comprising a DELLA domain sequence of DELLAALGYKVRSSDMADVAQKLEQLX27 (SEQ ID NO: 2), wherein X27 is a positively charged, polar amino acid, wherein said progeny plant exhibits a dwarf phenotype.
25. A method of producing a dwarf plant, said method comprising the step of introducing a polynucleotide that encodes a modified dwarf-8 (D8) protein into the cells of a plant, wherein the modified D8 protein comprises a DELLA domain sequence of DELLAX6LX8YKVRX13SX15MAX18VAQKLEQLX27 (SEQ ID NO: 45), wherein
Xe is Ala or Vai;
Xs is Gly, Arg or Glu;
X13 is Ala or Ser;
X15 and Xis are independently Glu or Asp; and
X27 is an amino acid other than glutamic acid, optionally wherein X27 is Lys.
26. The method of claim 25 wherein said polynucleotide is introduced into the cell via transfection of a plant cell and regeneration of a plant from the transfected cell.
27. The method of claim 25 wherein said polynucleotide is introduced into the cell of a plant by traditional breeding by crossing a first plant comprising said polynucleotide with a second plant lacking said polynucleotide; identifying progeny plants comprising said polynucleotide; and selecting progeny plants comprising said polynucleotide.
28. The method of any one of claims 25 to 27 wherein said polynucleotide encodes a modified dwarf-8 (D8) protein comprising a DELLA domain sequence of DELLAALGYKVRSSDMADVAQKLEQLX27 (SEQ ID NO: 2), wherein X27 is a positively charged, polar amino acid.
29. An isolated polynucleotide molecule encoding a modified dwarf-8 (D8) protein comprising a DELLA domain sequence of DELLAX6LX8YKVRX13SX15MAX18VAQKLEQLX27 (SEQ ID NO: 45), wherein
Xe is Ala or Vai;
Xs is Gly, Arg or Glu;
X13 is Ala or Ser;
X15 and Xis are independently Glu or Asp; and
X27 is an amino acid other than glutamic acid.
30. An isolated polynucleotide molecule encoding a modified dwarf-8 (D8) protein comprising a DELLA domain sequence of DELLAX6LGYKVRXi3SXi5MAXi8VAQKLEQLX27 (SEQ ID NO: 1), wherein
Xe is Ala or Vai;
X13 is Ala or Ser;
X15 and Xis are independently Glu or Asp; and X27 is positively charge polar amino acid.
31. An expression vector comprising a polynucleotide that encodes a modified dwarf-8 (D8) protein comprising a DELLA domain sequence of DELLAX6LGYKVRX13SX15MAX18VAQKLEQLX27 (SEQ ID NO: 1), wherein
Xe is Ala or Vai;
X13 is Ala or Ser;
X15 and Xi8 are independently Glu or Asp; and
X27 is positively charge polar amino acid, wherein said polynucleotide is operably linked to a promoter that is functional in plants.
32. The expression vector of clam 31 wherein the vector comprises a nucleic acid sequence having at least 85% sequence identity with the sequence of SEQ ID NO: 7, wherein the nucleic acid sequence having at least 85% sequence identity with the sequence of SEQ ID NO: 7 is operably linked to a promoter that is functional in plants.
33. The expression vector of claim 32 wherein the vector comprises a selectable marker.
EP24789568.3A 2023-04-14 2024-04-12 Plant dwarfing mutation Pending EP4694674A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202363459374P 2023-04-14 2023-04-14
PCT/US2024/024367 WO2024216103A1 (en) 2023-04-14 2024-04-12 Plant dwarfing mutation

Publications (1)

Publication Number Publication Date
EP4694674A1 true EP4694674A1 (en) 2026-02-18

Family

ID=93060280

Family Applications (1)

Application Number Title Priority Date Filing Date
EP24789568.3A Pending EP4694674A1 (en) 2023-04-14 2024-04-12 Plant dwarfing mutation

Country Status (4)

Country Link
EP (1) EP4694674A1 (en)
CN (1) CN121218870A (en)
MX (1) MX2025011991A (en)
WO (1) WO2024216103A1 (en)

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB9717192D0 (en) * 1997-08-13 1997-10-22 Innes John Centre Innov Ltd Genetic control of plant growth and development
IN2015DN01474A (en) * 2012-08-24 2015-07-03 Commw Scient Ind Res Org
BR112018013532A2 (en) * 2016-12-29 2018-12-04 Univ Estadual Campinas Unicamp method for accelerating plant growth and transgenic plants
ES2983336T3 (en) * 2017-09-18 2024-10-22 Futuragene Israel Ltd Control of DELLA polypeptide expression in specific tissues
WO2022150489A1 (en) * 2021-01-07 2022-07-14 Montana State University Optimization of small grain cereal forage and grain production via mutation of the tb1 and rht genes

Also Published As

Publication number Publication date
WO2024216103A1 (en) 2024-10-17
CN121218870A (en) 2025-12-26
MX2025011991A (en) 2025-11-03

Similar Documents

Publication Publication Date Title
US10301642B2 (en) Genes and uses for plant enhancement
US9290773B2 (en) Transgenic plants with enhanced agronomic traits
US12234467B2 (en) Diplospory gene
US20230407325A1 (en) Isolated Novel Nucleic Acid and Protein Molecules from Corn and Methods of Using Those Molecules to Generate Transgenic Plants with Enhanced Agronomic Traits
US20150197765A1 (en) Isolated novel nucleic acid and protein molecules from soybeans and methods of using those molecules to generate transgenic plants with enhanced agronomic traits
WO2009009142A2 (en) Transgenic plants with enhanced agronomic traits
WO2009073069A2 (en) Genes and uses for plant enhancement
CN103124738B (en) Glucosinolate transporter protein and application thereof
WO2009014665A2 (en) Transgenic plants with enhanced agronomic traits
EP2321412A2 (en) Stress tolerant transgenic crop plants
WO2019129145A1 (en) Flowering time-regulating gene cmp1 and related constructs and applications thereof
CN111826391B (en) Application of NHX2-GCD1 double gene or protein thereof
CN119978084B (en) Protein that reduces maize plant height and leaf angle
CN113754746B (en) Rice male fertility regulatory genes, their applications and methods of regulating rice fertility using CRISPR-Cas9
CN111295445A (en) Plants having increased abiotic stress tolerance and polynucleotides and methods for increasing abiotic stress tolerance in plants
CN106164273A (en) Drought tolerance plant and relate to the compositions related and method of gene of encoding D N DTP1 polypeptide
CN114525277B (en) Nucleic acid sequence for detecting 17L397-1 in cotton and detection method thereof
WO2024216103A1 (en) Plant dwarfing mutation
CN110799526A (en) Plant growth and yield enhancement by use of ABC transporter sequences
EP4702150A1 (en) Methods for providing a plant having increased resistance to a virus of the luteoviridae family
EP4646098A1 (en) Nal1 in rice
AU2015203134A1 (en) Glucosinolate transporter protein and uses thereof
BR112018004300B1 (en) CHIMERIC GENE, GENETIC CONSTRUCT, VECTOR, USE AND METHOD TO CONFER DIPLOSPORIA IN A PLANT

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20251029

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR