EP4677112A2 - Verfahren zur anreicherung und zum nachweis eines zielpolynukleotids in einer probe - Google Patents
Verfahren zur anreicherung und zum nachweis eines zielpolynukleotids in einer probeInfo
- Publication number
- EP4677112A2 EP4677112A2 EP24771474.4A EP24771474A EP4677112A2 EP 4677112 A2 EP4677112 A2 EP 4677112A2 EP 24771474 A EP24771474 A EP 24771474A EP 4677112 A2 EP4677112 A2 EP 4677112A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- polynucleotide
- target polynucleotide
- sample
- blocking oligonucleotide
- reference polynucleotide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
Definitions
- the field of the invention relates to methods for detecting a target polynucleotide in a sample comprising a mixture of the target polynucleotide and a reference (non-target) polynucleotide.
- the field of the invention relates to methods for detecting a target polynucleotide that comprises a genetic alteration relative to a reference polynucleotide in a sample comprising a mixture of the target polynucleotide and the reference polynucleotide, where the target polynucleotide represents a relatively small percentage of the mixture.
- the methods may be adapted for diagnosing, prognosing, and treating subjects having a disease or disorder associated with the genetic alteration.
- Genetic mutations and epigenetic modifications are known to be associated with cancer and other diseases.
- the ability to detect genetic mutations epigenetic modifications in cell-free DNA using a minimally invasive sample can be used in many different diagnostic areas, such as companion diagnostics, monitoring minimum residual disease, monitoring cancer recurrence, or as a prospective aid in diagnosing cancer.
- Improving accuracy encompasses both specificity (reducing false-positives), and sensitivity (reducing false-negatives).
- a threshold is used to define the barrier between a negative sample in which a mutation is absent and a positive sample where a mutation is present. This threshold is used to calculate the specificity and sensitivity of the method being used to detect the mutation.
- the signal to noise ratio can be used to assess the accuracy of a method, where the signal represents the result when the mutation is present, and the noise represents the result when a mutation is absent.
- a method is more accurate as the separation between the signal and the noise becomes greater.
- Enrichment may involve preferentially inhibiting or preventing the replication of wild type DNA relative to mutant DNA during polymerase chain reaction (PCR). In such enrichment, each cycle of PCR results in the mutant being present at a higher percentage compared to the previous cycle.
- PCR polymerase chain reaction
- PNA peptide nucleic acid
- LNA locked nucleic acid
- COLD-PCR Co-amplification at lower denaturation temperature PCR
- the present inventor has discovered a method for enriching a target polynucleotide a target polynucleotide in a sample comprising a mixture of the target polynucleotide and a nontarget polynucleotide, where the target polynucleotide represents a relatively small percentage of the mixture.
- the inventor's method can be utilized to selectively enrich a target polynucleotide via amplification relative to the non-target polynucleotide, and to accurately detect the target polynucleotide via sequencing when the target polynucleotide is present at a copy number lower than 10 and when the target polynucleotide represents less than about 0.05% of the mixture comprising the target polynucleotide and the non-target polynucleotide.
- the inventor's method achieves an enrichment in which the target polynucleotide represents greater than about 99% of the sequenced amplification product (i.e., greater than about 99% of sequencing reads), representing a > 1800-fold enrichment, after the sample has been subjected to the inventor's amplification method and sequenced.
- the disclosed methods may be performed for detecting a target polynucleotide comprising a genetic alteration relative to a reference polynucleotide in a sample comprising a mixture of the target polynucleotide and the reference polynucleotide, where the reference polynucleotide is a non-target polynucleotide in the disclosed methods.
- the methods may be utilized for detecting with high sensitivity and high selectivity a target polynucleotide in a mixture of the target polynucleotide and the reference polynucleotide in which the target polynucleotide is present at a relatively low concentration in the sample (e.g., less than about 10 copies) and the target polynucleotide represents a low percentage of the mixture comprising the target polynucleotide and the reference polynucleotide (e.g., less than about 0.05% of the mixture).
- the methods may be adapted for diagnosing, prognosing, and treating subjects having a disease or disorder associated with the detected genetic alteration.
- the disclosed method includes performing a polymerase chain reaction (PCR) amplification product which is subsequently sequenced in order to detect the target polynucleotide.
- the PCR reaction typically includes: (i) the sample or a fraction of the sample; (ii) a thermostable DNA polymerase that lacks 5 '- 3 ' nuclease activity and comprises 3 '- 5' nuclease activity (i.e., 3 '- 5' proofreading activity) and preferably has an error rate that is less than about 10‘ 6 (i.e., a high fidelity DNA polymerase); (iii) a pair of primers that flank the genetic alteration to be detected in the method; and (iv) a blocking oligonucleotide that hybridizes selectively to the reference polynucleotide lacking the genetic alteration to form a blocking duplex (where the reference polynucleotide is a non-target polynucleotide) at a hybridization site that does
- the blocker hybridizes at hybridization site that is located at a position that is greater than 5, 10, 15, 20, 25, 30, 40, 50, 60, or 70 base pairs from the terminal nucleotide of the oligonucleotide that is being extended.
- the amplification product thereby obtained may be subjected to sequencing in order to detect the target polynucleotide.
- the disclosed methods achieve a remarkable level of enrichment where the target polynucleotide may represent greater than 99% of sequenced amplification product (i.e., greater than about 99% of sequencing reads), representing a > 700-fold enrichment.
- kits for performing the disclosed methods may comprise one or more components for performing the disclosed methods selected from: (i) a thermostable DNA polymerase that lacks 5'- 3 ' nuclease activity and comprises 3 '- 5' nuclease activity (i.e., 3 '- 5' proofreading activity) and preferably has an error rate that is less than about 1 O’ 6 (i.e., a high fidelity DNA polymerase); (iii) a pair of primers that flank a genetic alteration to be detected in the methods; and (iv) a blocking oligonucleotide that hybridizes selectively to the reference polynucleotide lacking the genetic alteration to form a blocking duplex (where the reference polynucleotide is a non-target polynucleotide), thereby selective blocking amplification of the reference polynucleotide and enriching amplification of the target polynucleotide.
- a thermostable DNA polymerase that lacks 5'-
- the disclosed methods and kits may be utilized for diagnosing, prognosing, and treating a subject in need thereof, such as a subject having or suspected of having a disease or disorder.
- the disclosed methods and kits may be utilized for diagnosing, prognosing, and treating a subject having cancer or suspected of having cancer.
- Suitable subjects for the disclosed methods may include cancer patients that currently are in remission.
- FIG. 1A illustrates the results of the agarose gel. Samples 1 through 6 are in lanes 1 to 6 respectively.
- FIG. IB illustrates the results of the Sanger sequencing run for Sample 3, which contained approximately 0.05% KRAS G12C.
- FIG. 1C illustrates the results of the Amplicon EZ sequencing run for Sample 3, which contained approximately 0.05% KRAS G12C.
- FIG. 2A illustrates the results of the agarose gel. Samples 7 through 12 are in lanes 1 to 6 respectively.
- FIG. 2B illustrates the results of the Sanger sequencing run for Sample 10, which contained approximately 0.005% KRAS G13D.
- FIG. 2C illustrates the results of the Amplicon EZ sequencing run for Sample 9, which contained approximately 0.05% KRAS G13D.
- FIG. 3A illustrates the results of the agarose gel. Samples 13 through 18 are in lanes 1 to 6 respectively.
- FIG. 3B illustrates Sample 13 Sanger sequencing results, which contains 100% KRAS wild-type.
- FIG. 3C illustrates Sample 15 Sanger sequencing results, which contains approximately 0.05% KRAS G12C.
- FIG. 4A illustrates the results of the agarose gel. Samples 19 through 24 are in lanes 1 to 6 respectively.
- FIG. 4B illustrates Sample 19 Sanger sequencing results, which contains 100% KRAS wild-type.
- FIG. 4C illustrates Sample 21 Sanger sequencing results, which contains approximately 0.05% KRAS G13D.
- Profiling tumors generally involves obtaining resected tumor samples by invasive surgeries.
- the limitations to such invasive procedures include difficulty in acquiring tumor samples for both tumor quantity and quality.
- Another drawback is that acquiring biopsy samples by invasive methods throughout treatment to monitor tumor response and relapse pose major challenges in tumor profiling.
- a further limitation to invasive sampling methods is the heterogeneity of resected tumor samples as a whole. Further, in the case of metastasis, where tumors have spread and constantly evolve both spatially and temporally in response to treatment over time, multiple biopsies may be required. These challenges make it difficult to obtain a holistic image of a tumor.
- Liquid biopsies consist of isolating tumor-derived entities like circulating tumor cells, circulating tumor DNA, tumor extracellular vesicles, etc., present in the body fluids of patients with cancer, followed by an analysis of genomic and proteomic data contained within them. Liquid biopsies methods permit continuous monitoring by repeated sampling. Further, LB provides enhanced sensitivity in diagnosis and ease of repeated sampling throughout treatment much more conveniently and non-invasively.
- biological fluid refers to a liquid taken from a biological source and includes, for example, blood, serum, plasma, sputum, lavage fluid, cerebrospinal fluid, urine, semen, sweat, tears, saliva, and the like.
- blood serum
- plasma sputum
- lavage fluid cerebrospinal fluid
- urine semen
- sweat tears
- saliva saliva
- the terms "blood,” “plasma” and “serum” expressly encompass fractions or processed portions thereof.
- sample expressly encompasses a processed fraction or portion derived from the biopsy, swab, smear, etc.
- Circulating tumor cells are initially released from primary tumors in the tissue, travel through the circulatory system and account for the development of metastatic (or secondary) tumors at distant sites in the body. The percentage in the blood is quite low, with nearly one CTC found per million leukocytes.
- Various technologies have been used to selectively detect viable CTCs to obtain information regarding tumors.
- EPISPOT epithelial cell adhesion molecule
- the assay involves the use of membrane-bound antibodies against the epithelial cell adhesion molecule (EpCAM, or CD326) present on tumor cells and their subsequent culturing/expansion in both in vivo and in vivo conditions.
- AdnaTest Another positive selection/enrichment technology for CTCs obtained from LB samples is the CellSearch system. This technology uses antibody- labeled magnetic beads to pull down CTCs with epithelial lineage markers (like EpCAM). Another immunomagnetic-based enrichment assay of CTCs from LBs is the AdnaTest. In addition to the EpCAM-labeled ferromagnetic beads used in the CellSearch system, AdnaTest includes a polymerase chain reaction (PCR) step to detect tumor-specific mRNA transcripts.
- PCR polymerase chain reaction
- CTC-Chip which contains thousands of small antibody -labeled microposts, have been used to capture CTCs bearing specific tumor antigens from LB blood samples.
- Certain designs of “CTC-Chips” have been demonstrated to employ patterns of microgrooves, which seem to increase the contact time between antibody -lab eled microposts and CTCs, improving cellular entrapment.
- CTCs filtered off from LB samples by the chip are then imaged and analyzed.
- Functional assays like the Metastasis-Initiating-Cells (MIC) assay analyze the invasive properties of CTCs obtained from LB into the surrounding matrix in vivo, assisting in their further characterization. These analyses aid in providing a detailed picture of tumor staging/subtypes and in designing novel personalized therapeutic drugs against tumors.
- counterstain markers that target cells in exclusion to CTCs such as white blood cells (WBCs), platelets, red blood cells (RBCs), etc., can also be used to enrich CTCs from blood samples.
- WBCs white blood cells
- RBCs red blood cells
- the prominent markers selected for counterstains include CD45/CD66b (granulocytes), CD235a (RBCs), CD41/CD61 (platelets), CD4/CD8 (lymphocytes), CDl lb/CD14 (macrophages) and CD34 (hematopoietic progenitors/endothelial cells).
- Technologies like the EasySep Depletion Kit (StemCell Technologies) use CD45-labeled magnetic beads to negatively select WBCs, depleting them from the LB samples.
- Other examples like the RosetteSep (StemCell Technologies) method, use an additional density gradient centrifugation step for further CTC enrichment.
- NGS Next-generation sequencing
- Ion Torrent PGMTM system composed of the Ion AmpliSeqTM Cancer Hotspot Panel, which provides enhanced mutational analysis and avoids the use of error-prone methods like whole genome amplification (WGA), thus improving screening accuracy.
- WGA whole genome amplification
- circulating tumor cells are present in the liquid biopsy; i.e., whole tumor cells are present, and not just DNA fragments.
- circulating tumor DNA is present in the liquid biopsy. Over time, fragments of DNA from the tumor cells can enter a patient’s bloodstream, and this DNA is called circulating tumor DNA (ctDNA). This ctDNA can be from dying tumor cells or as the cancer cells turnover. Circulating tumor DNA (ctDNA) is single- or double-stranded DNA released by the tumor cells into the blood and it thus harbors the mutations of the original tumor. Circulating tumor DNA (ctDNA) is distinguishable from cell-free DNA (cfDNA), in that DNA fragments shed from non-tumor cells are cfDNA, whereas DNA fragments shed from tumors are ctDNA. ctDNA accounts for about 0.01-10% of the total circulating cell-free DNA (cfDNA). ctDNA levels in plasma, however, can vary depending on tumor load, tumor stage, and therapeutic response.
- ctDNA analysis Two major types of approaches have been considered for ctDNA analysis: targeted approaches that focus on specific gene rearrangements or gene mutations in particular genomic regions that act as “hotspots” for variation in a given tumor type, or untargeted approaches that offer a broader analysis and monitoring of the tumor genome, providing information on nucleotide alterations, copy number aberrations, chromosomal alterations, etc., independent of any prior data on molecular alterations.
- Targeted approaches include PCR-based methods such as droplet digital PCR and BEAMing that have shown remarkable sensitivity of 1 to 0.001% in detecting somatic point mutations.
- Droplet digital PCR involves partitioning the sample DNA (target and background DNA) into numerous independent partitions or droplets. The target sequence is then amplified by end point PCR in each droplet and relative fractions of positive and negative droplets counted (fluorescent probes) that provide relative quantification of target samples.
- BEAMing (beads, emulsions, amplification, and magnetics), on the other hand, is a modification of emulsion PCR where several different templates are amplified within a single tube, each in different compartments (or emulsion droplets) but along with primer bound beads that are recovered with the help of a magnetic field or centrifugal force.
- BEAMing and droplet digital PCR do not provide a high enough signal to noise ratio to meet the sensitivity and specificity standards required for regulatory approval as an independent diagnostic of cancer. Diagnosing cancer has a high regulatory threshold because a false positive would result in a healthy patient receiving cancer treatment, such as chemotherapy. Chemotherapy is known to shorten people’s life expectancy along with other serious side effects. BEAMing and droplet digital PCR both have the same short-coming of DNA mismatch hybridization resulting in false positive signal.
- the use of blocking oligonucleotides overcomes this short-coming because blocking oligonucleotides hybridize to reference DNA, instead of target DNA. Blocking oligonucleotides still mismatch hybridize, but the outcome from this is blocking of the target DNA, instead of the false positive signal in BEAMing or droplet digital PCR.
- Blocking methods have been used most in peptide nucleic acids (PNAs) but also in locked nucleic acids (LNAs) and co-amplification at lower denaturation temperature PCR (COLD-PCR). These methods have not been able to sufficiently enrich low frequency target mutations. Versions of COLD-PCR have reported increasing a target sample from 0.1% to 10.4%, but the reference only sample showed 3.4% mutant, representing a signal to noise ratio of 3.1. A higher signal to noise ratio is required to prevent false positives.
- Xeno nucleic acids (XNAs) similar to PNAs, enriched on average from a target sample of 0.25% to only 7.5%, with a reference sample showing near 0% mutant. The XNA method demonstrated a high signal to noise ratio, but lacked the sensitivity for detecting ctDNA, which can be below 0.1%.
- a target nucleic acid should be interpreted to mean “one or more target nucleic acids.”
- the terms “include” and “including” have the same meaning as the terms “comprise” and “comprising.” For example, “a method that includes a step” should be interpreted to mean “a method that comprises a step.”
- the terms “comprise” and “comprising” should be interpreted as being “open” transitional terms that permit the inclusion of additional components further to those components recited in the claims.
- the terms “consist” and “consisting of' should be interpreted as being “closed” transitional terms that do not permit the inclusion of additional components other than the components recited in the claims.
- the term “consisting essentially of' should be interpreted to be partially closed and permitting the inclusion only of additional components that do not fundamentally alter the nature of the claimed subject matter.
- the modal verb "may” refers to the preferred use or selection of one or more options or choices among the several described embodiments or features contained within the same. Where no options or choices are disclosed regarding a particular embodiment or feature contained in the same, the modal verb "may” refers to an affirmative act regarding how to make or use an aspect of a described embodiment or feature contained in the same, or a definitive decision to use a specific skill regarding a described embodiment or feature contained in the same. In this latter context, the modal verb "may” has the same meaning and connotation as the auxiliary verb "can.”
- the term “subject” is meant to encompass a person having and/or at risk for developing a disease or disorder characterized by a nucleic acid alteration in one or more genetic loci that are associated with the disease or disorder, such as a mutation in a gene that is associated with the disease or disorder.
- the term “subject” is meant to encompass a person having and/or at risk for developing a cell proliferative disease or disorder such as cancer.
- subject is meant to encompass a person having been diagnosed with cancer and currently diagnosed as being in remission, that results in methylation status of one or more genes associated with the disease or disorder or characterized by genetic mutations associated with the disease or disorder.
- the "methylation status" of a gene may include the "methylation status" of the promoter of the gene, for example, relative to a control gene.
- a subject in need thereof may include a subject having or at risk for developing a disease or disorder including, but not limited to, a cell proliferative disease or disorder (e.g., cancers such as breast cancer, prostate cancer, colon cancer, lung cancer, gall bladder cancer, brain cancer, uterine cancer, ovarian cancer, head and neck cancer, gastric cancer, liver cancer, leukemias, and lymphomas), a neurodegenerative disease or disorder (e.g., Alzheimer’s disease, Parkinson’s disease, and Huntington’s disease), a psychiatric disease or disorder (e.g., schizophrenia and depression), a metabolic disease or disorder (e.g., type 1 or type 2 diabetes), a cardiovascular disease or disorder (e.g, myocardial infarction or stroke), inflammatory diseases or disorders (e.g. arthritis), and immune diseases or disorders.
- a cell proliferative disease or disorder e.g., cancers such as breast cancer, prostate cancer, colon cancer, lung cancer, gall bladder cancer, brain cancer, uterine cancer
- the disclosed methods may be utilized to diagnose or prognose a subject in need thereof based on detecting an alteration in one or more genetic loci associated with the disease or disorder in a sample obtained from the subject.
- diagnosis or “diagnosis” or “diagnosing” refer to distinguishing or identifying a disease, syndrome or condition or distinguishing or identifying a subject having or at risk for developing a particular disease, syndrome or condition.
- prognose or “prognosis” or “prognosing” refer to predicting an outcome of a disease, syndrome, condition, or treatment regimen in a subject.
- the disclosed methods may be utilized to treat a subject in need thereof.
- the disclosed methods may be utilized to diagnose or prognose a subject in need thereof based on methylation status of the promoter region of one or more genes associated with the disease or disorder or characterized by one or more mutations associated with the disease or disorder.
- the subject may be administered a suitable treatment based on the diagnosis or prognosis of the disease or disorder.
- sample or “subject sample” is meant to include biological samples such as tissues (e.g., tissues obtained from biopsies) and bodily fluids.
- Bodily fluids may include, but are not limited to, blood, serum, plasma, saliva, cerebral spinal fluid, pleural fluid, tears, lactal duct fluid, lymph, sputum, and semen.
- a sample may include nucleic acid, protein, or both.
- the methods disclosed herein may be applied when performing DNA amplification of a nucleotide sample.
- the methods disclosed herein may be applied when performing DNA amplification of a sample comprising a mixture of a target polynucleotide comprising a genetic alteration and a reference polynucleotide lacking the genetic alteration (where the reference polynucleotide is a non-target polynucleotide).
- Samples that are analyzed in the disclosed amplification methods may include a mixture comprising a target polynucleotide having one or more genetic alterations at one or more positions as compared to a wild-type polynucleotide (i.e., a mutant polynucleotide) and the wild-type polynucleotide (where the wildtype polynucleotide is a non-target polynucleotide).
- a target polynucleotide having one or more genetic alterations at one or more positions as compared to a wild-type polynucleotide (i.e., a mutant polynucleotide) and the wild-type polynucleotide (where the wildtype polynucleotide is a non-target polynucleotide).
- the methods disclosed herein may be applied when performing DNA sequence analysis of a nucleotide sample.
- the methods disclosed herein may be applied when performing DNA sequence analysis of a sample comprising a mixture of a target polynucleotide comprising a genetic alteration and a reference polynucleotide lacking the genetic alteration (where the reference polynucleotide is a non-target polynucleotide).
- Samples that are analyzed in the disclosed amplification methods may include a mixture comprising a target polynucleotide having one or more genetic alterations at one or more positions as compared to a wild-type polynucleotide (i.e., a mutant polynucleotide) and the wild-type polynucleotide (where the wild-type polynucleotide is a non-target polynucleotide).
- a target polynucleotide having one or more genetic alterations at one or more positions as compared to a wild-type polynucleotide (i.e., a mutant polynucleotide) and the wild-type polynucleotide (where the wild-type polynucleotide is a non-target polynucleotide).
- the methods disclosed herein may be applied when performing methylation analysis.
- the methods disclosed herein may be applied when amplifying and sequencing a polynucleotide sample after the sample has been treated with an agent that selectively modifies unmethylated cytosine residues and not methylated cytosine residues, such as a bisulfite agent.
- Bisulfite treatment commonly is performed to convert unmethylated cytosine residues to uracil residues in a polynucleotide sample.
- the treated polynucleotide sample then can be utilized as a template for DNA synthesis (e.g., in a PCR amplification or in a sequencing reaction) where uracil residues ultimately are converted to thymidine residues.
- samples that are analyzed in the disclosed amplification methods may include a mixture comprising a target polynucleotide having a C or T/U at one or more positions as compared to a non-target polynucleotide having a T/U or C at one or more respective positions.
- Sequencing methods may include high-throughput or ultra-high-throughput sequencing methods.
- DNA sequencing processes suitable or adaptable for the disclosed methods may include, but are not limited to, sequencing by synthesis, single-molecule real-time sequencing, ion semiconductor sequencing, pyrosequencing, sequencing by ligation, chain termination sequencing, massively parallel signature sequencing, Polony sequencing, DNA nanoball sequencing, Heliscope single molecule sequencing, Nanopore DNA sequencing, sequencing by hybridization, sequencing with mass spectrometry, microfluidic Sanger sequencing, and microscopy -based sequencing techniques.
- the disclosed methods may be applied to tradition DNA sequencing methods based on the Sanger sequencing method or the Maxam and Gilbert sequencing method, so-called “first-generation” DNA sequencing techniques, as well as methods that are more amenable to high-throughput analysis, so-called “second generation” and “third generation” DNA sequencing techniques.”
- first-generation DNA sequencing techniques as well as methods that are more amenable to high-throughput analysis, so-called “second generation” and “third generation” DNA sequencing techniques.”
- nucleic acid and the use of nucleic acid for diagnosing, prognosing, and/or treating diseases and disorders.
- nucleic acid and oligonucleotide and “polynucleotide” as used herein, refer to polydeoxyribonucleotides (containing 2-deoxy-ribose), polyribonucleotides (containing ribose), and to any other type of polynucleotide that is an N glycoside of a purine or pyrimidine base.
- oligonucleotide refers to adenine, thymine, cytosine, guanine, uracil as a nucleotide base, respectively.
- nucleic acid refers only to the primary structure of the molecule. Thus, these terms include double- and single-stranded DNA, as well as double- and single-stranded RNA.
- an oligonucleotide also can comprise nucleotide analogs in which the base, sugar or phosphate backbone is modified as well as non-purine or non-pyrimidine nucleotide analogs.
- Oligonucleotides utilized in the disclosed methods may include one or more modified nucleotides.
- Nucleotide modifications may include, but are not limited to, locked nucleic acids (LNAs) or bridged nucleic acids (BNAs), peptide nucleic acids, glycol nucleic acids, and threose nucleic acids.
- LNAs locked nucleic acids
- BNAs bridged nucleic acids
- peptide nucleic acids glycol nucleic acids
- threose nucleic acids threose nucleic acids
- nucleic acids disclosed herein may be “substantially isolated or purified.”
- the term “substantially isolated or purified” refers to a nucleic acid that is removed from its natural environment, and is at least 60% free, preferably at least 75% free, and more preferably at least 90% free, even more preferably at least 95% free from other components with which it is naturally associated.
- the samples utilized in the disclosed methods may comprise a nucleic acid sample that has been substantially isolated or purified.
- the disclosed methods may utilize a sample comprising nucleic acid from any source, including a source from an animal and/or a source from the environment.
- the polynucleotide sample comprises genomic DNA.
- the genomic DNA is treated prior to sequencing with a reagent that selectively modifies nonmethylated cytosine residues in the DNA to produce detectable modified residues, but which does not modify methylated cytosine residues.
- the nucleotide at the nucleotide position of the polynucleotide sample is a methylated cytosine or a modified residue and the set of polynucleotide fragments comprises two or more different polynucleotide fragments having a cytosine or a thymine at the nucleotide position of the polynucleotide sample.
- the term "complementary" in reference to a first polynucleotide sequence and a second polynucleotide sequence means that the first polynucleotide sequence will base-pair exactly with the second polynucleotide sequence throughout a stretch of nucleotides without mismatch.
- the term “cognate” may in reference to a first polynucleotide sequence and a second polynucleotide sequence means that the first polynucleotide sequence will base-pair with the second polynucleotide sequence throughout a stretch of nucleotides but may include one or more mismatches within the stretch of nucleotides.
- the term "complementary" may refer to the ability of a first polynucleotide to hybridize with a second polynucleotide due to base-pair interactions between the nucleotide pairs of the first polynucleotide and the second polynucleotide (e.g., A:T, A:U, C:G, G:C, G:U, T:A, U:A, and U:G).
- a “blocking oligonucleotide” as utilized herein may hybridize to a target polynucleotide and/or a non-target polynucleotide at a hybridization site that does not overlap with the hybridization sites to which the primer pairs hybridize.
- the blocking oligonucleotide hybridizes at a hybridization site on a target and/or a non-target polynucleotide which is located at a position that is greater than 5, 10, 15, 20, 25, 30, 40, 50, 60, or 70 base pairs from the terminal nucleotide of the oligonucleotide that is being extended, which may be the forward primer of the primer pair.
- hybridization refers to the formation of a duplex structure by two single-stranded nucleic acids due to complementary base pairing. Hybridization can occur between fully complementary nucleic acid strands or between "substantially complementary” nucleic acid strands that contain minor regions of mismatch. Conditions under which hybridization of fully complementary nucleic acid strands is strongly preferred are referred to as “stringent hybridization conditions” or “sequence-specific hybridization conditions.” Stable duplexes of substantially complementary sequences can be achieved under less stringent hybridization conditions; the degree of mismatch tolerated can be controlled by suitable adjustment of the hybridization conditions.
- nucleic acid technology can determine duplex stability empirically considering a number of variables including, for example, the length and base pair composition of the oligonucleotides, ionic strength, and incidence of mismatched base pairs, following the guidance provided by the art (see, e.g., Sambrook et al., 1989, Molecular Cloning-A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York; Wetmur, 1991, Critical Review in Biochem. and Mol. Biol. 26(3/4):227-259; and Owczarzy et al., 2008, Biochemistry, 47: 5336-5353, which are incorporated herein by reference). Those skilled in the art of nucleic acid technology can determine melting temperature for duplexes.
- the sensitivity is as low as 0.005% with the sample enriched to >99%.
- the signal to noise ratio is high because a 100% reference sample does not result in a measurable signal.
- the disclosed subject matter relates to methods for enriching a target polynucleotide comprising a genetic alteration relative to a reference polynucleotide lacking the genetic alteration in a sample comprising a mixture of the target polynucleotide and the reference polynucleotide, for example, where the reference polynucleotide is a non-target polynucleotide in the sample.
- the methods may be utilized for detecting with high sensitivity and high specificity the target polynucleotide in the mixture of the reference polynucleotide and the target polynucleotide in which the target polynucleotide is present at a low copy number (e.g., less than about 10 copies) and the target polynucleotide represents a low percentage of the mixture of the target polynucleotide and the reference polynucleotide (e.g., less than about 0.05%).
- the methods may be adapted for diagnosing, prognosing, and treating subjects having a disease or disorder associated with the detected genetic alteration.
- the disclosed methods typically include an amplification step that produces an amplification product, such as a polymerase chain reaction (PCR) amplification.
- the PCR amplification typically is configured to selectively amplify a genetic alteration present in a target polynucleotide relative to a reference polynucleotide lacking the genetic alteration, where the reference polynucleotide is a non-target polynucleotide.
- the disclosed methods also typically include a sequencing step in which the amplification product is sequenced, and the genetic alteration of the target polynucleotide is identified.
- the disclosed methods comprise: (a) performing a polymerase chain reaction (PCR) amplification in a reaction mixture to obtain an amplification product, the reaction mixture comprising: (i) the sample or a fraction of the sample; (ii) a DNA polymerase that lacks 5'- 3 ' nuclease activity and that comprises proofreading activity such as 3 '- 5' nuclease activity, preferably where the DNA polymerase is a high fidelity polymerase (e.g., a polymerase having an error rate of less than about 1 O’ 6 ); (iii) a pair of primers that flank the genetic alteration that does not overlap with the blocking oligonucleotide; and (iv) a blocking oligonucleotide that hybridizes selectively to the reference polynucleotide lacking the genetic alteration to form a blocking duplex and obtaining an amplified fragment sample; (b) increasing the temperature of the reaction mixture above the melting temperature of the double stranded
- PCR
- DNA polymerase 5 '- 3 ' nuclease activity is commonly used is diagnostic assays for generating signal through the cleavage of a fluorophore.
- a DNA polymerase lacking this feature may have less diagnostic utility.
- 5 '->3 ' nuclease activity could also cleave or otherwise remove the blocking oligonucleotide. Removing this feature may increases the effectiveness of the blocking oligonucleotide. Adding 3 '- 5' nuclease activity increases the fidelity of the polymerase, which can also increase the signal to noise ratio in highly sensitive diagnostics assays.
- the primer and blocker do not overlap. Not having the primer and blocker overlap improves blocking efficiency through a variety of mechanisms, such as the blocker (RNA, or RNA-like) nucleotide and the target (DNA) hybridizing in A- form, while the primer (DNA) and target (DNA) hybridize in B-form. In B-form the nucleotides are in the center of the helix, while in A-form the nucleotides are displaced away from the helix. This creates a competing conformation situation. Also, the primer and blocker are not competing exclusively, the polymerase is bound to the primer as well.
- the binding of the polymerase may dislodge the blocker in a variety of mechanisms, such as (1) increasing the stability of the primer and target DNA duplex above the blocker and target DNA duplex (2) using the finger and thumb domains to force the DNA into a B-form conformation (3) strand displacement ability of DNA polymerase, which is separate and distinct from the nuclease activity. Increasing the nucleotide separation between the primer and blocker may also allow more time for the blocker to hybridize and prevent the extension of the primer.
- the temperature of the PCR reaction mixture is increased to melt the target polynucleotide and reference polynucleotide in order to form single-stranded DNA. Reducing the temperature of the reaction mixture to the “blocker annealing temperature,” which is below the melting temperature of the blocking oligonucleotide to the reference polynucleotide and above the melting temperature of the primer oligonucleotide, which hybridizes to the same strand of the reference polynucleotide as the blocking oligonucleotide. Further reducing the temperature of the reaction mixture to allow the primer pair to hybridize to the reference polynucleotide or target polynucleotide.
- the blocker annealing temperature allows time for the hybridization reaction to approach equilibrium. Melting temperature is commonly used in PCR, but melting temperature describes the hybridization equilibrium. At the melting temperature of a primer, the primer binds 50% of the reference polynucleotides and the blocker binds to >99% of the reference polynucleotides. However, both reactions still occur at a rate that allows for the primer to bind before the blocker on some reference polynucleotides. A primer that binds before the blocker can be extended prevents blocking from occurring.
- the disclosed methods are performed in order to detect a target polynucleotide that represents no more than about 3%, 2%, 1%, 0.5%, 0.25%, 0.125%, or less of the mixture of the target polynucleotide and the reference polynucleotide in the sample.
- the target polynucleotide represents no more than about 0.05% of the mixture of the target polynucleotide and the reference polynucleotide in the sample.
- the disclosed methods utilize a polymerase that has a relatively low error rate.
- the polymerase has an error rate which is less than about 10’ 5 , IO’ 6 , or IO’ 7
- the disclosed methods typically include an amplification step comprising a number of amplification cycles. In some embodiments of the disclosed methods, the methods include a PCR amplification step in which PCR amplification is performed for more than 30, 40, 50, or 60 cycles.
- the genetic alteration of the target nucleotide is selectively amplified or enriched. In some embodiments of the disclosed methods, the genetic alteration is detected in at least about 90%, 95%, 96%, 97%, 98%, or 99% of the sequenced amplified product. In some embodiments of the disclosed methods, the amplification product is sequenced from multiple reads and the genetic alteration is detected in at least about 90%, 95%, 96%, 97%, 98%, or 99% of the multiple reads.
- the genetic alteration of the target polynucleotide is selectively enriched and detected.
- the target polynucleotide comprising the generic alteration represents no more than about 0.05% of the mixture of the target polynucleotide and the reference polynucleotide lacking the genetic alteration in the sample.
- the disclosed methods typically include sequencing an amplification product.
- the blocking oligonucleotide is removed from the amplification product prior to sequencing the amplification product.
- the method detects a target nucleotide that is present in a mixed sample comprising the target nucleotide and a reference polynucleotide.
- the disclosed methods include a step of determining the minimum number of PCR cycles necessary for detecting the target polynucleotide when the target polynucleotide is present in the mixture at a relative low percentage (e.g., when the target polynucleotide is present in the mixture at a percentage of no more than 0.1%, 0.05%, 0.02%, or 0.01%).
- the target polynucleotide may be present at a relative low concentration in the sample. In some embodiments, the target nucleotide may be present in a sample at a copy number of less than about 10000, 1000, 100, 10 or less. In some embodiments, the disclosed methods include a step of determining the minimum number of PCR cycles necessary for detecting the target polynucleotide when the target polynucleotide is present in the sample at a copy number of less than about 10000, 1000, 100, 10 or less.
- the genetic alteration of the target nucleotide is selectively amplified or enriched.
- the genetic alteration may be selectively amplified or enriched by configuring the PCR amplification reaction to include a blocking oligonucleotide that selectively hybridizes to the reference polynucleotide to form a blocking duplex, where the reference polynucleotide lacks the generic alteration, and the reference polynucleotide is a non-target polynucleotide.
- the blocking oligonucleotide comprises one or more modified nucleotides that enhance the stability of the duplex formed by the blocking oligonucleotide and the reference polynucleotide.
- the blocking oligonucleotide comprises one or more modified nucleotides that enhance the selectivity of the blocking oligonucleotide for hybridizing to the reference polynucleotide relative to the target polynucleotide.
- the blocking oligonucleotide forms a first duplex with the reference polynucleotide lacking the genetic alteration (i.e., where the reference polynucleotide is a non-target polynucleotide), where the first duplex has a first melting temperature T1.
- the blocking oligonucleotide may form a second duplex with the target polynucleotide comprising the genetic alteration, where the second duplex has a first melting temperature T2. In certain embodiments, T1 > T2.
- the blocking oligonucleotide is configured such that T1 is at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 °C higher than T2 (i.e., T1 - T2 > than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 °C).
- extension during amplification is performed at a temperature at which the blocking oligonucleotide is hybridized to a relatively high percentage of the reference polynucleotide (which is a non-target polynucleotide) in the sample, such as a temperature at which the blocking oligonucleotide is hybridized to greater than about 50%, 60%, 70%, 80%, 90%, 95%, or greater of the reference polynucleotide (which is a non-target polynucleotide) in the sample.
- the extension during amplification is performed at a temperature at which the blocking oligonucleotide is hybridized to a relatively low percentage of the target polynucleotide in the sample, such as a temperature at which the blocking oligonucleotide is hybridized to less than about 50%, 40%, 30%, 30%, or lower of the target polynucleotide in the sample.
- the blocking oligonucleotides include locked nucleic acid (LNA), also known as bridged nucleic acid (BNA).
- LNA locked nucleic acid
- BNA bridged nucleic acid
- An LNA is a modified nucleotide in which the sugar moiety (e.g., ribose) is modified with a bridge connecting the 2' oxygen and 4' carbon (i.e., where the 2'-0 and 4'-C are conjugated via a bridging moiety).
- the bridge "locks" the sugar moiety in the 3'- endo (North) conformation, which is often found in A-form duplexes. This structure provides for increased stability against enzymatic degradation, and also offers improved specificity and affinity in base-pairing as a constituent of an oligonucleotide.
- LNA nucleotides can be mixed with DNA or RNA residues in an oligonucleotide.
- Bridging moi eties of LNA may include alkylene moi eties (e.g., a methylene bridging moiety) and amino alkylene moi eties (e.g., amino methylene bridging moiety).
- An LNA may be referred to with the following designation: +A, +G, +C, or +T.
- all of the nucleotides of the blocking oligonucleotide are LNAs, i.e., the nucleotides of the blocking oligonucleotides may consist of LNAs.
- the methods utilize a blocking oligonucleotide that is relatively short in length.
- the blocking oligonucleotide has a length that is no more than about 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, or 10 nucleotides.
- the method is performed to detect a target polynucleotide comprising a genetic alteration relative to a reference polynucleotide, where the reference polynucleotide is a non-target polynucleotide.
- the genetic alteration may include a mutation relative to a wild-type sequence, for example, where the target polynucleotide comprises the mutation and the reference polynucleotide comprises the wild-type sequence and the reference polynucleotide is a non-target wild-type polynucleotide.
- Genetic alterations that are detected in the disclosed methods may include substitutions, deletions, insertions, or a combination thereof.
- the genetic alterations detected in the disclosed methods are present at selected genetic loci.
- the genetic alteration is present in a genetic loci selected from one or more of PIK3CA, KRAS, APC, FAT4, KMT2D, KMT2C, and BRAF.
- the methods utilize a an additional pair of primers that amplify a control sequence as an internal control.
- An internal control may be utilized to demonstrate that steps of the disclosed methods are occurring as intended and/or if a blocking oligonucleotide is blocking exponential amplification of the reference polynucleotide as intended.
- the disclosed methods may be configured in order to detect multiple target polynucleotides comprising different genetic alterations relative to a reference polynucleotide. In some embodiments, the disclosed methods are configured for performing a multiplex analysis.
- Example 1 and Example 2 Enriching a low-frequency target mutation is needed for diagnosing cancer.
- a major short-coming of the method used in Example 1 and Example 2 is that the 100% reference sample failed to generate a result.
- the 100% reference sample (lane 1) is not readily discernable from the sample lacking DNA (lane 6). This is a regulatory and quality control issue if a negative sample cannot be distinguished from an improperly processed sampled.
- a traditional internal control such as amplifying another polynucleotide can prevent the detection of very low-frequency target polynucleotides by consuming critical reagents.
- Example 1 and Example 2 the blocker annealing temperature is used to increase efficiency of the blocking.
- Example 3 and Example 4 after the enrichment PCR cycling, another round of PCR cycling is performed lacking the blocker annealing temperature. This reduction in blocker efficiency allows samples containing 100% reference polynucleotides to be detected (FIG. 3 A and FIG. 4A). Therefore, this method allows for the enrichment and low-frequency target polynucleotides, while still allowing 100% reference polynucleotide samples to be detected.
- the disclosed methods comprise: (a) performing a polymerase chain reaction (PCR) amplification in a reaction mixture to obtain an amplification product, the reaction mixture comprising: (a) performing a polymerase chain reaction (PCR) amplification in a reaction mixture to obtain an amplification product, the reaction mixture comprising: (i) the sample or a fraction of the sample; (ii) a DNA polymerase that lacks 5 '- 3 ' nuclease activity and that comprises proofreading activity such as 3 '- 5' nuclease activity, preferably where the DNA polymerase is a high fidelity polymerase (e.g., a polymerase having an error rate of less than about 10‘ 6 ); (iii) a pair of primers that flank the genetic alteration; and (iv) a blocking oligonucleotide that hybridizes selectively to the reference polynucleotide lacking the genetic alteration to form a blocking duplex and obtaining an amplified fragment sample;
- PCR
- the temperature of the PCR reaction mixture is increased to melt the target polynucleotide and reference polynucleotide in order to form single-stranded DNA.
- the temperature then is lowered to the point where the blocking oligonucleotide hybridizes to the reference polynucleotide selectively because the blocking oligonucleotide is configured to have a lower melting temperature when hybridized to the target polynucleotide.
- a higher percentage of reference polynucleotides are hybridized with the blocking oligonucleotide as compared to the percentage of target polynucleotides.
- Primer oligonucleotides that flank the position where the blocking oligonucleotide hybridizes then are used to amplify the target oligonucleotide and the reference oligonucleotide.
- the hybridization of the blocking oligonucleotide to the reference polynucleotide inhibits the extension of the polymerase. Therefore, it is crucial the blocking oligonucleotide hybridizes to the reference polynucleotide prior to the primer hybridizing to the reference polynucleotide.
- the PCR cycle contains a step below the melting temperature of the blocking oligonucleotide and above the primer melting temperature.
- Holding at this temperature allows the blocking oligonucleotide to approach hybridization equilibrium.
- the target polynucleotide is amplified to a higher extent as compared to the reference polynucleotide.
- the amplification product of the target polynucleotide is enriched.
- Multiple PCR cycles may be performed to increase the total number of copies of the amplification product of the target polynucleotide to a point where sequencing may be performed in order to detect the genetic alteration of the target polynucleotide. After high efficiency enrichment, reducing the efficiency of the enrichment is beneficial.
- the efficiency of the enrichment can be modulated through removing the blocker oligonucleotide hybridization step in the PCR cycling conditions, such that the PCR cycling conditions do not contain a temperature below the blocker oligonucleotide melting temperature and above the primer melting temperature. Reduced blocking efficiency allows the reference oligonucleotide to replicate at an increased rate. This method allows for both the enrichment of the target polynucleotide and the replication of the reference polynucleotide.
- the disclosed methods are performed to detect a target polynucleotide in a sample.
- the samples include, but are not limited to, biological samples or environmental samples.
- the sample is a blood sample or a blood product sample (e.g., plasma or serum).
- the sample is a cell-free sample, such as a cell-free blood sample, for example, wherein the blood sample has been treated to remove cells prior to performing the disclosed methods.
- the disclosed methods are performed in order to detect a genetic alteration in a target polynucleotide relative to a reference polynucleotide. In some embodiments, the disclosed methods are performed in order to detect methylation in a target polynucleotide relative to a reference polynucleotide. In some embodiments of the disclosed methods, prior to the methods being performed the sample is treated with a reagent that selectively modifies non-methylated cytosine residues to produce detectable modified residues (e.g., uracil residues) but which does not modify methylated cytosine residues, such as a bisulfite reagent.
- a reagent that selectively modifies non-methylated cytosine residues to produce detectable modified residues (e.g., uracil residues) but which does not modify methylated cytosine residues, such as a bisulfite reagent.
- the target polynucleotide and the reference polynucleotide differ based on the presence of a detectable modified residue (e.g., uracil or thymidine) versus a methylated cytosine residue.
- a detectable modified residue e.g., uracil or thymidine
- the disclosed methods are performed in order to detect a genetic alteration in a target polynucleotide relative to a reference polynucleotide.
- the genetic alteration is associated with cancer in a subject, such as a mutation associated with cancer in a subject.
- the methods prior to performing the initial step of the disclosed methods, comprise sequencing a cancer sample from the subject and detecting the genetic alteration in the cancer sample and determining that the cancer is associated with the genetic alteration.
- the disclosed methods then are performed in order to monitor the presence of the genetic alteration in the subject, where the presence of the genetic alteration indicates the progression of cancer in the subject.
- the sample is obtained from a subject that has cancer or is at risk for developing cancer.
- the subject has been diagnosed with cancer and currently is in remission, for example, after the subject has been treated for the diagnosed cancer.
- the disclosed methods are performed in order to monitor for cancer recurrence in a subject, where detection of the genetic alteration in the subject indicates that the cancer has recurred.
- the disclosed methods and kits are utilized for diagnosing, prognosing, and treating a subject in need thereof, such as a subject having or suspected of having a disease or disorder.
- the disclosed methods include diagnosing and/or prognosing a subject in need thereof and further may include subsequently administering treatment to the subject in need thereof after diagnosing and/or prognosing the subject.
- the methods herein include: (a) requesting an analysis that detects a target polynucleotide comprising a genetic alteration; and (b) subsequently administering a treatment to a subject based on the results of the analysis.
- a method for enriching a double-stranded target polynucleotide in a sample by performing a polymerase chain reaction (PCR) amplification to obtain an amplification product comprising the steps of: (a) preparing a reaction mixture comprising:
- the primer pair hybridizes to a position flanking the target mutation.
- the primer pair has the same affinity to the target and the reference polynucleotide because the primers hybridize to a region where the target and the reference have 100% homology. Only the blocking oligonucleotide hybridizes to the region where the target and reference are different.
- the DNA polymerase is a high-fidelity DNA polymerase that lacks 5 '->3' nuclease activity and comprises 3 '- 5' nuclease activity.
- the DNA polymerase has an error rate of less than 10‘ 5 , less than 10‘ 6 , or less than 10‘ 7 .
- the blocking oligonucleotide comprises one or more modified nucleotides that enhance the selectivity of the blocking oligonucleotide for hybridizing to the reference polynucleotide relative to the target polynucleotide.
- the blocking oligonucleotide comprises one or more locked nucleic acids (LNAs) comprising a sugar moiety having a 2'-0 conjugated to 4'-C via a methylene group.
- LNAs locked nucleic acids
- tall of the nucleotides of the blocking oligonucleotide are LNAs.
- the blocking oligonucleotide has a length of between 8 and 20 nucleotides, such as 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 nucleotides.
- the blocking oligonucleotide has a length of between 10 and 15 nucleotides.
- An optimal range is the shortest blocking oligonucleotide with a melting temperature of more than 10°C above the primer melting temperature.
- a shorter blocking oligonucleotide will give a larger melting temperature difference between the target oligonucleotide and the reference oligonucleotide. This in turn gives the blocking oligonucleotide a maximum efficiency, because a lower percentage of target oligonucleotide is hybridized when the reference oligonucleotide is greater than 90% hybridized.
- the blocking oligonucleotide melting temperature is optimally more than 10°C above the melting temperature of the primers.
- the blocking oligonucleotide is designed to have an annealing temperature at the mid-point.
- a blocking oligonucleotide is designed to have a Tm of 70°C and the primer a Tm of 60°C. In this example, at 65°C the primer does not significantly bind ( ⁇ 1%) but the blocking oligonucleotide does bind (>90%). It is desired to have the blocking oligonucleotide annealing temperature to optimally be 5°C above the primer melting temperature, and to have the blocking oligonucleotide annealing temperature to be 5°C below the blocking oligonucleotide melting temperature.
- the genetic alteration comprises a substitution, a deletion, and/or an insertion.
- the sample is a liquid biopsy (LB).
- the liquid biopsy is a biological fluid.
- a method for detecting a double-stranded target polynucleotide in a sample comprising the steps of :
- the detection agent is a DNA binding fluorophore or a probe.
- kits for enriching a double-stranded target polynucleotide comprising a genetic alteration in a sample comprising:
- a method for replicating a reference polynucleotide after enriching a double-stranded target polynucleotide in a sample by performing a polymerase chain reaction (PCR) amplification to obtain an amplification product comprising the steps of:
- step (g) repeating steps (b), (d) and (e) in order for two or more cycles so as to replicate the reference polynucleotide and the target polynucleotide.
- the DNA polymerase is a high-fidelity DNA polymerase which that lacks 5'- 3 ' nuclease activity and comprises 3 '- 5' nuclease activity.
- a DNA polymerase has an error rate of less than 1 O’ 5 , less than 1 O’ 6 or less than IO" 7
- the blocking oligonucleotide comprises one or more modified nucleotides that enhance the selectivity of the blocking oligonucleotide for hybridizing to the reference polynucleotide relative to the target polynucleotide.
- a blocking oligonucleotide comprises one or more locked nucleic acids (LNAs) comprising a sugar moiety having a 2'-0 conjugated to 4'-C via a methylene group.
- LNAs locked nucleic acids
- all of the nucleotides of the blocking oligonucleotide are LNAs.
- a DNA binding fluorophore is added to the mixture.
- the DNA binding fluorophore is sybr green.
- an oligonucleotide probe is added to the mixture.
- the low frequency variant is the KRAS G12C mutation, known to be associated with or present in some cancers.
- KRAS wild-type (catalog HD710) and KRAS G12C (catalog HD269) were purchased from Horizon Discovery.
- KRAS G12C (catalog HD269) is heterozygous for the KRAS G12C mutation, so only 50% of the DNA copies contain the KRAS G12C mutation.
- Q5 High-Fidelity 2X Master Mix (catalog M0492S).
- the KRAS wild-type sequence is provided by SEQ ID NO:1 :
- the KRAS G12C sequence is provided by SEQ ID NO:2 and includes a G ⁇ >t transversion: GACTGAATATAAACTTGTGGTAGTTGGAGCTtGTGGCGTAGGCAAGAGTGCC TTGACGATACAGCTAATTCAGAATCATTTTGTGGACGAATATGATCCAAC (SEQ ID NO:2)
- the oligonucleotide blocker consisted of LNAs (designated as +A, +G, +C, or +T) as follows:
- Oligonucleotide Blocker (SEQ ID NO: 5):
- the total reaction volume of 50 pl was prepared as follows:
- Sample 1 contained 1 pl of 50 ng/pl KRAS wild-type (catalog HD710) and 1 pl of water. Sample 1 was 100% KRAS wild-type.
- Sample 2 contained 1 pl of 50 ng/pl KRAS wild-type (catalog HD710) and 1 pl of 0.5 ng/pl KRAS G12C (catalog HD269). Sample 2 was approximately 0.5% KRAS G12C.
- Sample 3 contained 1 pl of 50 ng/pl KRAS wild-type (catalog HD710) and 1 pl of 0.05 ng/pl KRAS G12C (catalog HD269). Sample 3 was approximately 0.05% KRAS G12C.
- Sample 4 contained 1 pl of 50 ng/pl KRAS wild-type (catalog HD710) and 1 pl of 0.005 ng/pl KRAS G12C (catalog HD269). Sample 4 was approximately 0.005% KRAS G12C.
- Sample 5 contained 1 pl of 50 ng/pl KRAS wild-type (catalog HD710) and 1 pl of 0.0005 ng/pl KRAS G12C (catalog HD269). Sample 5 was approximately 0.0005% KRAS G12C.
- Sample 6 contained 2 pl of water.
- a PCR protocol was performed as follows: 95 °C for 60 seconds, 55 cycles of (95 °C for 10 seconds, 75 °C for 5 seconds, and 62 °C for 15 seconds), 72 °C for 60 seconds.
- the PCR product was run on a 1.5% agarose gel (Sigma A5093) (FIG. 1A). 10 pl of PCR product was mixed with 3 pl of NEB loading dye (catalog B7024S).
- the PCR product was purified using AMPure XP SPRI Reagent (catalog A63881).
- Samples 1, 4, 5 and 6 contained less than the lower limit of DNA quantification using the Qubit 4 lx dsDNA BR (catalog Q33262).
- Samples 2 and 3 contained enough DNA for quantification using Qubit 4 lx dsDNA BR (catalog Q33262).
- a second PCR was performed on the amplified first PCR product.
- the total reaction volume of 50 pl was prepared as follows:
- the PCR product was purified using AMPure XP SPRI Reagent (catalog A63881).
- Sample 3 was sequenced using Azenta Genewiz Amplicon EZ and analysis was performed with CRISPResso2 (FIG. 1C).
- FIG. 1 A illustrates the results of the agarose gel. Samples 1 to 6 were in lanes 1 to 6 respectively.
- FIG. IB illustrates the results of the Sanger sequencing run for Sample 3, which contained approximately 0.05% KRAS G12C.
- FIG. 1C illustrates the results of the Amplicon EZ sequencing run for Sample 3, which contained approximately 0.05% KRAS G12C.
- This example describes how a low frequency variant was enriched and detected.
- the low frequency variant was the KRAS G13D mutation, known to be associated with or present in some cancers.
- KRAS wild-type (catalog HD710) and KRAS G13D (catalog HD270) were purchased from Horizon Discovery.
- KRAS G13D (catalog HD270) is heterozygous for the KRAS G13D mutation, so only 50% of the DNA copies contain the KRAS G13D mutation.
- Q5 High-Fidelity 2X Master Mix (catalog M0492S).
- the KRAS wild-type sequence is provided by SEQ ID NO: 1.
- the KRAS G13D sequence is provided by SEQ ID NO:8 and includes a G- a transition: GACTGAATATAAACTTGTGGTAGTTGGAGCTGGTGaCGTAGGCAAGAGTGCC TTGACGATACAGCTAATTCAGAATCATTTTGTGGACGAATATGATCCAAC (SEQ ID NO: 8)
- the total reaction volume of 50 pl was prepared as follows:
- 1 st Forward primer (SEQ ID NO:3): 0.1 pM working concentration (1 pl of 5 pM stock)
- 1 st Reverse primer (SEQ ID NO:4): 0.1 pM working concentration (1 pl of 5 pM stock)
- Oligonucleotide Blocker (SEQ ID NO:5): 0.1 pM (working concentration (1 pl of 5 pM stock)
- Sample 7 contained 1 pl of 50 ng/pl KRAS wild-type (catalog HD710) and 1 pl of water. Sample 7 contained 100% KRAS wild-type.
- Sample 8 contained 1 pl of 50 ng/pl KRAS wild-type (catalog HD710) and 1 pl of 0.5 ng/pl KRAS G13D (catalog HD270). Sample 8 was approximately 0.5% KRAS G13D.
- Sample 9 contained 1 pl of 50 ng/pl KRAS wild-type (catalog HD710) and 1 pl of 0.05 ng/pl KRAS G13D (catalog HD270). Sample 9 was approximately 0.05% KRAS G13D.
- Sample 10 contained 1 pl of 50 ng/pl KRAS wild-type (catalog HD710) and 1 pl of 0.005 ng/pl KRAS G13D (catalog HD270). Sample 10 was approximately 0.005% KRAS G13D.
- Sample 11 contained 1 pl of 50 ng/pl KRAS wild-type (catalog HD710) and 1 pl of 0.0005 ng/pl KRAS G13D (catalog HD270). Sample 11 was approximately 0.0005% KRAS G13D.
- Sample 12 contained 2 pl of water.
- a PCR protocol was performed as follows: 95 °C for 60 seconds, 55 cycles of (95 °C for 10 seconds, 75 °C for 5 seconds, and 62 °C for 15 seconds), 72 °C for 60 seconds.
- the PCR product was run on a 1.5% agarose gel (Sigma A5093) (FIG. 2A). 10 pl of PCR product was mixed with 3 pl of NEB loading dye (catalog B7024S).
- the PCR product was purified using AMPure XP SPRI Reagent (catalog A63881).
- Samples 7, 11 and 12 contained less than the lower limit of DNA quantification using the Qubit 4 lx dsDNA BR (catalog Q33262).
- Samples 8, 9 and 10 contained enough DNA for quantification using Qubit 4 lx dsDNA BR (catalog Q33262).
- a second PCR was performed on the amplified first PCR product.
- the total reaction volume of 50 pl was prepared as follows:
- 2 nd Forward primer (SEQ ID NO:6): 0.1 pM working concentration (1 pl of 5 pM stock)
- 2 nd Reverse primer (SEQ ID NO:7): 0.1 pM working concentration (1 pl of 5 pM stock) Purified PCR product (2 pl)
- Sample 9 was sequenced using Azenta Genewiz Amplicon EZ and analysis was performed with CRISPResso2 (FIG. 2C).
- FIG. 2A illustrates the results of the agarose gel. Samples 7 to 12 were in lanes 1 to 6 respectively.
- FIG. 2B illustrates the results of the Sanger sequencing run for Sample 10, which contained approximately 0.005% KRAS G13D.
- FIG. 2C illustrates the results of the Amplicon EZ sequencing run for Sample 9, which contained approximately 0.05% KRAS G13D.
- This example describes how altering the PCR protocol allowed a sample containing only reference DNA (KRAS wild-type) to be amplified enough to allow for sequencing while still maintaining high enrichment of a low frequency variant (KRAS G12C).
- the low frequency variant is the KRAS G12C mutation, known to be associated with or present in some cancers.
- the setup was the same as described in Example 1, with only a modification to the first PCR protocol.
- a PCR protocol was performed as follows: 95 °C for 60 seconds, 55 cycles of (95 °C for 10 seconds, 75 °C for 5 seconds, and 62 °C for 15 seconds), 15 cycles of (95 °C for 10 seconds, and 55 °C for 20 seconds), 72 °C for 60 seconds.
- Sample 13 contained 1 pl of 50 ng/pl KRAS wild-type (catalog HD710) and 1 pl of water. Sample 13 was 100% KRAS wild-type. Sample 14 contained 1 pl of 50 ng/pl KRAS wild-type (catalog HD710) and 1 pl of 0.5 ng/pl KRAS G12C (catalog HD269). Sample 14 was approximately 0.5% KRAS G12C.
- Sample 15 contained 1 pl of 50 ng/pl KRAS wild-type (catalog HD710) and 1 pl of 0.05 ng/pl KRAS G12C (catalog HD269). Sample 15 was approximately 0.05% KRAS G12C.
- Sample 16 contained 1 pl of 50 ng/pl KRAS wild-type (catalog HD710) and 1 pl of 0.005 ng/pl KRAS G12C (catalog HD269). Sample 16 was approximately 0.005% KRAS G12C.
- Sample 17 contained 1 pl of 50 ng/pl KRAS wild-type (catalog HD710) and 1 pl of 0.0005 ng/pl KRAS G12C (catalog HD269). Sample 17 was approximately 0.0005% KRAS G12C.
- Sample 18 contained 2 pl of water.
- Samples 13, 14, 15, 16 and 17 contained enough DNA for Sanger sequencing.
- Samples 13, 16 and 17 contained the wild-type sequence.
- Samples 14 and 15 contained the target KRAS G12C sequence.
- FIG. 3A illustrates the results of the agarose gel. Sample 13 to 18 were in lanes 1 to 6 respectively.
- FIG. 3B illustrates Sample 13 Sanger sequencing results, which contains 100% KRAS wild-type.
- FIG. 3C illustrates Sample 15 Sanger sequencing results, which contains approximately 0.05% KRAS G12C.
- This example describes how altering the PCR protocol allowed a sample containing only reference DNA (KRAS wild-type) to be amplified enough to allow for sequencing while still maintaining high enrichment of a low frequency variant (KRAS G13D).
- the low frequency variant is the KRAS G13D mutation, known to be associated with or present in some cancers.
- the setup was the same as described in Example 2, with only a modification to the first PCR protocol.
- a PCR protocol was performed as follows: 95 °C for 60 seconds, 55 cycles of (95 °C for 10 seconds, 75 °C for 5 seconds, and 62 °C for 15 seconds), 15 cycles of (95 °C for 10 seconds, and 55 °C for 20 seconds), 72 °C for 60 seconds.
- Sample 19 contained 1 pl of 50 ng/pl KRAS wild-type (catalog HD710) and 1 pl of water. Sample 19 contained 100% KRAS wild-type.
- Sample 20 contained 1 pl of 50 ng/pl KRAS wild-type (catalog HD710) and 1 pl of 0.5 ng/pl KRAS G13D (catalog HD270). Sample 20 was approximately 0.5% KRAS G13D.
- Sample 21 contained 1 pl of 50 ng/pl KRAS wild-type (catalog HD710) and 1 pl of 0.05 ng/pl KRAS G13D (catalog HD270). Sample 21 was approximately 0.05% KRAS G13D.
- Sample 22 contained 1 pl of 50 ng/pl KRAS wild-type (catalog HD710) and 1 pl of 0.005 ng/pl KRAS G13D (catalog HD270). Sample 22 was approximately 0.005% KRAS G13D.
- Sample 23 contained 1 pl of 50 ng/pl KRAS wild-type (catalog HD710) and 1 pl of 0.0005 ng/pl KRAS G13D (catalog HD270). Sample 23 was approximately 0.0005% KRAS G13D.
- Sample 24 contained 2 pl of water.
- Samples 19, 20, 21, 22 and 23 contained enough DNA for Sanger sequencing.
- Samples 19, 22 and 23 contained the wild-type sequence.
- Samples 20 and 21 contained the target KRAS G13D sequence.
- FIG. 4A illustrates the results of the agarose gel. Samples 19 to 24 were in lanes 1 to 6 respectively.
- FIG. 4B illustrates Sample 19 Sanger sequencing results, which contains 100% KRAS wild-type.
- FIG. 4C illustrates Sample 21 Sanger sequencing results, which contains approximately 0.05% KRAS G13D.
- the invention has been described as “comprising” certain steps and/or elements, which those of skill in the art also “consist of’ or “consist essentially of’ those steps and/or elements.
- the transitional term “comprising” is synonymous with “including,” “containing,” or “characterized by,” is inclusive or open-ended and does not exclude additional, unrecited elements or method steps. Where the invention is intended to be more narrowly defined, the terms “consisting of’ or “consisting essentially of’ also are used to describe the invention.
- the transitional phrase “consisting of’ excludes any element, step, or ingredient not specified in the claim.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202363489426P | 2023-03-10 | 2023-03-10 | |
| PCT/US2024/019110 WO2024191817A2 (en) | 2023-03-10 | 2024-03-08 | Methods for enriching and detecting a target polynucleotide in a sample |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP4677112A2 true EP4677112A2 (de) | 2026-01-14 |
Family
ID=92755676
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP24771474.4A Pending EP4677112A2 (de) | 2023-03-10 | 2024-03-08 | Verfahren zur anreicherung und zum nachweis eines zielpolynukleotids in einer probe |
Country Status (2)
| Country | Link |
|---|---|
| EP (1) | EP4677112A2 (de) |
| WO (1) | WO2024191817A2 (de) |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20200208224A1 (en) * | 2014-09-26 | 2020-07-02 | Janssen Pharmaceutica Nv | Use Of FGFR Mutant Gene Panels In Identifying Cancer Patients That Will Be Responsive To Treatment With An FGFR Inhibitor |
| CN115335701A (zh) * | 2019-09-09 | 2022-11-11 | 泽普托生命技术有限责任公司 | 用于检测核酸中基因变异的系统和方法 |
-
2024
- 2024-03-08 EP EP24771474.4A patent/EP4677112A2/de active Pending
- 2024-03-08 WO PCT/US2024/019110 patent/WO2024191817A2/en not_active Ceased
Also Published As
| Publication number | Publication date |
|---|---|
| WO2024191817A2 (en) | 2024-09-19 |
| WO2024191817A3 (en) | 2024-10-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US12305241B2 (en) | EML4-ALK translocations in lung cancer | |
| EP3334834B1 (de) | Verfahren zur herstellung zellfreier nukleinsäuremoleküle durch in-situ-amplifizierung | |
| Arcila et al. | Detection of KRAS and BRAF mutations in colorectal carcinoma: Roles for high-sensitivity locked nucleic acid-PCR sequencing and broad-spectrum mass spectrometry genotyping | |
| CN108699553B (zh) | 用于筛选甲状腺癌中突变的组合物和方法 | |
| US20130149695A1 (en) | Method for detecting genetic mutation by using a blocking primer | |
| Jancik et al. | A comparison of Direct sequencing, Pyrosequencing, High resolution melting analysis, TheraScreen DxS, and the K-ras StripAssay for detecting KRAS mutations in non small cell lung carcinomas | |
| Ondraskova et al. | Electrochemical biosensors for analysis of DNA point mutations in cancer research | |
| JP2014526892A (ja) | 対立遺伝子多型を検出するための組成物及び方法 | |
| WO2018069450A1 (en) | Methylation biomarkers for lung cancer | |
| CN114807367A (zh) | 用于筛选实体瘤的组合物和方法 | |
| WO2012118802A9 (en) | Kit and method for sequencing a target dna in a mixed population | |
| Dekaliuk et al. | Discrimination of the V600E mutation in BRAF by rolling circle amplification and forster resonance energy transfer | |
| BR112019013391A2 (pt) | Adaptador de ácido nucleico, e, método para detecção de uma mutação em uma molécula de dna circulante tumoral (ctdna) de fita dupla. | |
| WO2015023433A1 (en) | Compositions and methods for multiplex analysis of nras and braf nucleic acids | |
| US8377657B1 (en) | Primers for analyzing methylated sequences and methods of use thereof | |
| WO2024191817A2 (en) | Methods for enriching and detecting a target polynucleotide in a sample | |
| WO2013173475A2 (en) | Primers for analyzing methylated sequences and methods of use thereof | |
| WO2026055623A1 (en) | Improvement to methods for enriching and detecting a target polynucleotide in a sample | |
| EP2586875A1 (de) | Nichtinvasives Verfahren zur Diagnose und Überwachung eines Glioms | |
| US12291744B2 (en) | Methods for enriching a target polynucleotide in a sample | |
| US10563267B2 (en) | Polymorphism biomarkers predict clinical outcomes of cancer patients receiving regorafenib | |
| Su et al. | Sensitive and selective detections of codon 12 and 13 KRAS mutations in a single tube using modified wild-type blocker | |
| WO2011130636A2 (en) | Methods and compositions for identifying mutations in cancer related genes | |
| US20130310550A1 (en) | Primers for analyzing methylated sequences and methods of use thereof | |
| EP4294944A1 (de) | Verfahren zum nachweis von polynukleotiden |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE |
|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE |
|
| 17P | Request for examination filed |
Effective date: 20251004 |
|
| AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR |