EP4669114A1 - METHOD FOR THE TREATMENT AND/OR PREVENTION OF BED BUG INFESTATION - Google Patents

METHOD FOR THE TREATMENT AND/OR PREVENTION OF BED BUG INFESTATION

Info

Publication number
EP4669114A1
EP4669114A1 EP24706427.2A EP24706427A EP4669114A1 EP 4669114 A1 EP4669114 A1 EP 4669114A1 EP 24706427 A EP24706427 A EP 24706427A EP 4669114 A1 EP4669114 A1 EP 4669114A1
Authority
EP
European Patent Office
Prior art keywords
metarhizium
bed bugs
entomopathogenic
strain
sample
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
EP24706427.2A
Other languages
German (de)
French (fr)
Inventor
Emeline LEMARIÉ
Mireille Haon
Michael Lafond
Lucile RAMETTI
Romain Lasseur
Jean-Guy BERRIN
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Izinovation
Aix Marseille Universite
Centre National de la Recherche Scientifique CNRS
Ecole Centrale de Marseille
Institut National de Recherche pour lAgriculture lAlimentation et lEnvironnement
Original Assignee
Izinovation
Aix Marseille Universite
Centre National de la Recherche Scientifique CNRS
Ecole Centrale de Marseille
Institut National de Recherche pour lAgriculture lAlimentation et lEnvironnement
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Izinovation, Aix Marseille Universite, Centre National de la Recherche Scientifique CNRS, Ecole Centrale de Marseille, Institut National de Recherche pour lAgriculture lAlimentation et lEnvironnement filed Critical Izinovation
Publication of EP4669114A1 publication Critical patent/EP4669114A1/en
Pending legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01NPRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N63/00Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
    • A01N63/30Microbial fungi; Substances produced thereby or obtained therefrom
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01PBIOCIDAL, PEST REPELLANT, PEST ATTRACTANT OR PLANT GROWTH REGULATORY ACTIVITY OF CHEMICAL COMPOUNDS OR PREPARATIONS
    • A01P7/00Arthropodicides
    • A01P7/04Insecticides
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/14Fungi; Culture media therefor
    • C12N1/145Fungi isolates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12RINDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00Microorganisms ; Processes using microorganisms
    • C12R2001/645Fungi ; Processes using fungi

Definitions

  • the present invention relates to a method of treating and/or preventing infestations of bed bugs which involves the use of entomopathogenic fungi or compositions comprising entomopathogenic fungi.
  • Bed bugs infestation is a common problem in households which is particularly difficult to eradicate. Dwellings (such as homes and hotels) become infested with bed bugs in a variety of ways. Bed bugs and their eggs can be transmitted from other infested dwellings by pets, person's clothing or luggages. Bed bugs often lodge themselves unnoticed in dark crevices, and eggs are nestled in fabric seams.
  • bed bugs feed on the blood of their host, bed bugs usually remain close to places where potential hosts reside commonly in or near beds or couches of human hosts. Moreover, bed bugs are elusive and usually nocturnal making them hard to spot. [3] Mechanical approaches to eliminate bed bugs have been explored and include vacuuming up the insects and heat treating or wrapping mattresses. [4] Moreover, well-known solutions for controlling bed bugs may involve a combination of insecticide and non-insecticide approaches. Nevertheless, bed bugs have become increasingly resistant to insecticides and negative health effects from their use are of concern. [5] Thus, there is a need to find out new solutions to be used to treat and/or prevent infestations of bed bugs.
  • the term “treating and/or preventing infestations of bed bugs” refers to preventing infestation, reducing the population of already infested areas, killing or eliminating the bed bugs.
  • "entomopathogenic fungi” are fungi that are capable of growing, developing, colonizing, destroying, attacking, infecting, killing, disabling, causing disease, and/or causing injury /damage to an insect (i.e., the bed bugs for the present invention), and are thus able to be used in the control insect infestation by adversely affecting the viability or growth of the target insect (i.e., the bed bugs for the present invention).
  • WO 2014/117118 A1 discloses a method for controlling bed bugs comprising: contacting one or more bed bugs with a first fungal pesticide and a second fungal pesticide.
  • the first fungal pesticide and the second fungal pesticide may be different strains of Metarhizium anisopliae, for example the strain Metarhizium anisopliae F52.
  • the name of the species Metarhizium anisopliae of the strain Metarhizium anisopliae F52 has been changed to Metarhizium brunneum and thus, may be referred to in the art under both names.
  • the present invention relates to a method for treating and/or preventing bed bug infestations which comprises a step of applying at least one entomopathogenic fungus belonging to the species Metarhizium robertsii or a composition containing at least one entomopathogenic fungus belonging to the species Metarhizium robertsii to a bed bug habitat.
  • the species of Metarhizium robertsii is a different species from the species of Metarhizium anisopliae. [15] Indeed, as explained in the publication entitled “The genome sequence of biocontrol fungus Metarhizium anisopliae and comparative genomics of Metarhizium species”, Julie A. Pattemore et al.; BMC Genomics 2014, 15:660, the species of Metarhizium robertsii is different from the species Metarhizium anisopliae.
  • a “bed bug habitat” may be a surface of any article.
  • Examples of article are furniture (such as beds, bed box springs, futon box springs, mattresses, chair mattresses, cushions, sofas, futons generally, tables and benches, clothing dressers, lighting fixtures, television), wall material (such as plaster, sheet rock, brick, wood), floor (such as tile, parquet, carpet), drapery windows, temperature regulating devices (such as air-conditioning units, radiators, thermostats, heat pumps, heating units), toilets, sinks, tubs, shower rods, shower basins, doors, any relevant parts of vehicles (such as airplanes, ships) for bed bug habitat.
  • furniture such as beds, bed box springs, futon box springs, mattresses, chair mattresses, cushions, sofas, futons generally, tables and benches, clothing dressers, lighting fixtures, television
  • wall material such as plaster, sheet rock, brick, wood
  • floor such as tile, parquet, carpet
  • drapery windows such as air-conditioning units, radiators, thermostats, heat pumps, heating units
  • toilets sinks, tubs, shower rods, shower basins
  • bed bug habitat includes areas where bed bugs are known to congregate (i.e., cracks and crevices in wall material, spaces between floor and wall adjacencies).
  • bed bugs are known to congregate (i.e., cracks and crevices in wall material, spaces between floor and wall adjacencies).
  • the above detailed entomopathogenic fungus or the above detailed composition containing said entomopathogenic fungus may be applied directly to a bed bug habitat or via a bed bug control device. Appropriate bed bug control devices are well-known for a skilled man in the art.
  • the at least one entomopathogenic fungus may be identical or different strains of Metarhizium robertsii.
  • the entomopathogenic fungus is a strain of Metarhizium robertsii which comprises both : - the internal transcribed spacer (“ITS”) ribosomal sequence as set forth in SEQ ID NO: 1 and - the translation elongation factor 1-alpha sequence as set forth in SEQ ID NO: 2.
  • ITS internal transcribed spacer
  • the entomopathogenic fungus is a strain of Metarhizium robertsii CIRM- BRFM 2512 (deposited under the Budapest treaty on May 11, 2022 at Collection Nationale de Cultures de Micro-organismes (CNCM) Institut Pasteur, 25 rue du Dondel Roux, Paris, France, as CNCM I-5850).
  • CNCM Collection Nationale de Cultures de Micro-organismes
  • at least one entomopathogenic fungus belonging to the species Metarhizium robertsii is in a spore or mycelium form.
  • the method of the present invention is carried out by contacting one or more bed bugs with the spores or mycelium of the at least one entomopathogenic fungus belonging to the species Metarhizium robertsii.
  • the amount of the at least one entomopathogenic fungus belonging to the species Metarhizium robertsii may be globally comprised between 10 6 spores/mL and 10 8 spores/mL of composition.
  • the entomopathogenic fungus belonging to the species Metarhizium robertsii is horizontally transmissible across a population of bed bugs.
  • the entomopathogenic fungus belonging to the species Metarhizium robertsii may treat and/or prevent bed bugs infestations in at least one life stage of bed bugs. More precisely, the entomopathogenic fungus belonging to the species Metarhizium robertsii may treat and/or prevent bed bugs at the egg stage, the nymph stage, the instar stage, the adult stage, or any combinations thereof.
  • the method for treating and/or preventing bed bug infestations comprises : - a step of applying the at least one entomopathogenic fungus belonging to the species Metarhizium robertsii in combination with at least one another entomopathogenic fungus, or - a step of applying a composition containing the at least one entomopathogenic fungus belonging to the species Metarhizium robertsii in combination with at least one another entomopathogenic fungus, to the bed bug habitat.
  • the at least one another entomopathogenic fungus may be identical or different strains of said another entomopathogenic fungus.
  • the at least one another entomopathogenic fungus may be selected in the group consisting of species of Aegerita, Ascophaera, Aschersonia, Akanthomyces, Aspergillus, Beauveria, Blastodendrion, Calonectria, Coelomycidium, Coelemomyces, Conidiobolus, Cordyceps, Couchia, Culicinomyces, Engyodontium, Entomophaga, Entomophthora, Erynia, Eryniopsis, Filariomyces, Filobasidiella, Fusarium, Gibellula, Hesperomyces, Hirsutella, Hymenostilbe, Hypocrella, Isaria, Lagenidium, Leptolegnia, Nectria, Neozygites, Nomuraea, Massospora, Meristacrum, Metacordyceps, Metarhizium, Metschnikowia, Mycoderma
  • the at least one another entomopathogenic fungus is Isaria farinosa.
  • the at least one another entomopathogenic fungus is a strain of Isaria farinosa CIRM- BRFM 1607 (deposited under the Budapest treaty on May 11, 2022 at Collection Nationale de Cultures de Micro-organismes (CNCM) Institut Pasteur, 25 rue du Dondel Roux, Paris, France, as CNCM I-5849).
  • the at least one another entomopathogenic fungus is in a spore or mycelium form.
  • the method of the present invention may be carried out by further contacting one or more bed bugs with the spores or mycelium of the at least one another entomopathogenic fungus.
  • the amount of the at least one another entomopathogenic fungus may be globally comprised between 10 6 spores/mL and 10 8 spores/mL of composition.
  • the above detailed entomopathogenic fungi i.e., the at least one entomopathogenic fungus belonging to the species Metarhizium robertsii and optionally the at least one another entomopathogenic fungus
  • Fermentation processes may be conducted using conventional fermentation processes in laboratory or industrial fermenters. Such fermentation processes are well known in the art.
  • Methods for producing spores or mycelium commonly use solid media. For example, entomopathogenic fungi are grown on as potato dextrose agar (PDA) for two-three weeks at room temperatures.
  • PDA potato dextrose agar
  • the media may have high carbon and nitrogen concentrations to facilitate higher yields.
  • suitable nitrogen sources include hydrolyzed casein, yeast extract, hydrolyzed soy protein, hydrolyzed cottonseed protein, and hydrolyzed corn gluten protein.
  • suitable carbon sources include carbohydrates, including cellulose, chitin, glucose, fructose, sucrose, and/or glycerol and/or plant biomass such as rice, wheat or barley.
  • the spores or mycelium of the entomopathogenic fungi may be recovered using conventional techniques (for example by filtration, centrifugation), and then they may be used directly from the liquid culture media or they may be subject to a step of purification and/or further processing steps (for example a drying process: air-drying, freeze drying, or spray drying to a low moisture level). After these steps, the entomopathogenic fungi are stored at a suitable temperature (for example room temperature).
  • a suitable temperature for example room temperature
  • the at least one another entomopathogenic fungus is horizontally transmissible across a population of bed bugs.
  • the at least one another entomopathogenic fungus may treat and/or prevent bed bugs in at least one life stage of bed bugs. More precisely, the at least one another entomopathogenic fungus may treat and/or prevent the bed bugs infestations at the egg stage, the nymph stage, the instar stage, the adult stage, or any combinations thereof.
  • the at least one entomopathogenic fungus belonging to the species Metarhizium robertsii and the at least one another entomopathogenic fungus may contact the bed bugs sequentially or simultaneously.
  • the at least one entomopathogenic fungus belonging to the species Metarhizium robertsii and the at least one another entomopathogenic fungus are applied sequentially to the bed bug habitat.
  • the at least one entomopathogenic fungus belonging to the species Metarhizium robertsii and the at least one another entomopathogenic fungus are included in separate compositions which are applied sequentially to the bed bug habitat.
  • the at least one entomopathogenic fungus belonging to the species Metarhizium robertsii and the at least one another entomopathogenic fungus are applied simultaneously to the bed bug habitat.
  • the at least one entomopathogenic fungus belonging to the species Metarhizium robertsii and the at least one another entomopathogenic fungus may be included in a single composition which is applied to the bed bug habitat.
  • the composition may be of any forms. More precisely, the composition may be in the form of a gel, a foam, a solid (for example a powder, granule or particle) or a liquid.
  • the composition can be of any form so long as the composition is able to support the desired activity of the entomopathogenic fungi, regardless of their form (i.e., vegetative state or dormant state).
  • the composition may comprise : - the at least one entomopathogenic fungus belonging to the species Metarhizium robertsii; - optionally the at least one another entomopathogenic fungus (as described above); - a carrier; - optionally at least one additional ingredient.
  • the composition may comprise, based on the total weight of said composition: - between 85.00 wt. % and 99.98 wt. %, preferably 85.00 wt. % to 95.00 wt. %, of the carrier; - between 0.02 wt. % and 15.00 wt. %, preferably between 5.00 wt. % to 15.00 wt.
  • the carrier may be a suspension medium capable of supporting the entomopathogenic fungi as described above. Indeed, the entomopathogenic fungi as described above may be transferable from the carrier to the body of the target bed bugs.
  • the carrier may be used to provide an environment to support the viability of the entomopathogenic fungi as described above, including by providing the proper environmental conditions and protecting the entomopathogenic fungi from harmful environmental conditions (for example excess oxygen, moisture and/or ultraviolet radiation).
  • the carrier may also be used to maintain the activity of the entomopathogenic fungi after said entomopathogenic fungi have been applied to the bed bug habitat.
  • the carrier will be configured to allow the entomopathogenic fungi as described above to remain efficient (i.e., able to be transferred to the body of the bed bug with a degree of lethality).
  • the carrier may be used to maintain the activity of the above detailed entomopathogenic fungi during storage (i.e., for example in a container for the entire shelf-life of the formulated product).
  • the carrier may be a liquid.
  • the carrier is a non-aqueous liquid carrier as bed bugs are hydrophobic and therefore, have a relatively low critical surface tension.
  • the non-aqueous liquid is a biodegradable non-aqueous liquid.
  • the non-aqueous liquids may be selected in the group consisting of silicone oils, mineral oils, hexylene glycol, glycerol, linoleic acid, oleic acid, and any combinations thereof.
  • the carrier may be a gel comprising at least one liquid and at least one gelling agent.
  • the liquid may be an aqueous or non-aqueous liquid. As explained above, given of the hydrophobicity of the bed bugs, the liquid is preferably a non-aqueous liquid, and more preferably a biodegradable non-aqueous liquid. The non-aqueous liquid may be selected amongst the above detailed non-aqueous liquids.
  • the gelling agent of the gel may be any agent capable of dissolving in the liquid phase as a colloid mixture to form a weakly cohesive internal structure.
  • the gelling agent may be selected in the group consisting of polyvinyl acetate, polyvinyl alcohols, polyvinylpyrrolidones, polyacrylates, copolymers of two or more monomers such as acrylic acid, methacrylic acid, maleic acid, fumaric acid, vinylpyrrolidone, ethylenically unsaturated monomers (ethylene, butadiene, isoprene, chloroprene, styrene, divinylbenzene), vinyl halides, vinyl esters, vinyl methyl ketone or esters of acrylic acid or methacrylic acid with monohydric alcohols or polyols (for example methyl acrylate, methyl methacrylate, ethyl acrylate, ethylene methacrylate, lauryl acrylate, lauryl methacrylate, decyl acrylate, ⁇ , ⁇ -dimethylamino-ethyl methacrylate, 2- hydroxyethyl methacrylate,
  • the gelling agent may further include hydrophobically-modified clays, surface modified silicas, fumed silicas, and any combinations thereof.
  • the gel may comprise, based of the total weight of the gel: - between 80 wt. % and 99.99 wt. % of the liquid; - between 0.01 wt. % and 20.00 wt. % of the gelling agent.
  • the carrier may be an emulsifiable suspension.
  • the additional ingredient is physically and/or chemically compatible with the composition.
  • the additional ingredient may be selected in the group consisting of biologically active ingredients, chemical insecticides, insect growth regulators, rheology modifying agents (for example thickeners), preservatives, colorants, opacifiers, fragrances, fillers, pH adjusting agents, stabilizers, antioxidants, oxygen scavenger, wetting agents UV protectants, fillers, nutritive additives, and any combinations thereof.
  • biologically active ingredients may be selected in the group consisting of enzymes and microorganisms other than the above described entomopathogenic fungi.
  • the composition comprises at least one enzyme.
  • the composition comprises at least one cuticle degrading enzyme.
  • the biologically active ingredient is a cuticle degrading enzyme.
  • a "cuticle degrading enzyme” is an enzyme that is able to at least partially degrade a cuticle of a pest (i.e., a bed bug for the present invention), the epicuticle and/or the procuticle.
  • the cuticle degrading enzyme increases the efficacy of the above described entomopathogenic fungi by increasing the ability of the entomopathogenic fungi to colonize and/or or bore through the bed bug's cuticle to reach the bed bug's body cavity.
  • the cuticle degrading enzyme may be selected in the group consisting of proteases, peptidases, chitinases, chitosanases, cutinases, lipases, esterases, catalases, oxidases, oxygenases, dehydrogenases, and any combinations thereof.
  • the composition may further comprise at least one microorganism, other than the above described entomopathogenic fungi.
  • the microorganism can have a variety of beneficial properties for the method of the present invention.
  • the microorganism may be used to : - reduce odors associated with dead or decaying bed bugs, - produce enzymes to enhance the activity of the above described entomopathogenic fungi, - produce or express toxins which supplement and/or enhance the activity of the above described entomopathogenic fungi (for example ⁇ -endotoxin, a- exotoxin, ⁇ -exotoxin, and any combinations thereof produced by Bacillus thuringiensis), - produce or express CO2 to attract bed bugs.
  • the microorganism is a bacterium, and more preferably an insecticide bacterium.
  • the insecticide bacterium may be selected in the group consisting of Enterobacteriaceae, Proteobacteria, Actinobacteria, Firmicutes, Bacteroidetes, Rickettsiae, Mollicutes, and any combinations thereof.
  • the microorganism capable of producing CO2 may be selected in the group consisting of CO2 producing yeasts, preferably in the group consisting of the yeasts of Saccharomyces, and more preferably the yeasts of Saccharomyces cerevisiae.
  • the composition may further comprise at least one rheology modifying agent.
  • the rheology modifying agent may comprise a thickener.
  • the thickener may be selected in the group consisting of polyacrylic acids, polyvinylpyrrolidone homo- or copolymers, polyethylene glycols, ethylene oxide/propylene oxide copolymers, polyvinyl alcohols and non-ionically or ionically modified celluloses, thixotropic xanthan-based thickeners, precipitated or pyrogenic silicas, kaolins, bentonites, aluminum/silicon mixed oxides, silicates, and any combinations thereof.
  • the composition may further comprise at least one preservative.
  • the preservative may be selected in the group consisting of sodium azide, thimerosol, 2-bromo-2-nitro-1,3- propanadiol, 1-(3-chloroallyl)-3,5,7-triaza-1-azoniaadamantane chloride, dibromonitrilopropionamide, 1,2-benzisothiazolin-3-one, 5-chloro-2-methyl-4- isosthiazolin-3-one, 2-methyl-4-isosthiazolin-3-one, diazolidinyl urea, tris(hydroxymethyl)nitromethane, sodium o-phenylphenate, copper arsenates, and any combinations thereof.
  • the composition may further comprise at least one antioxidant.
  • the antioxidant may be selected in the group consisting of Vitamin E, ⁇ -tocopherol, and any combinations thereof.
  • the composition may further comprise at least one filler.
  • the filler may be selected in the group consisting of calcium carbonate, ground quartz, and any combinations thereof.
  • the composition may further comprise at least one chemical insecticide.
  • the chemical insecticide may be selected in the group consisting of pyrethroids (such as permetherin, resmethrin, phenothrin, deltamethrin, bioallethrin, D- allethrin, esfenvalerate, tetramethrin, cyphenothrin, imiprothrin, alkyl dimethyl benzyl ammonium chloride, beta-cyfluthrin, prallethrin, bifenthrin, lambda-cyhalothrin, zeta- cypermethrin, gamma-cyhalothrin), organophosphates (such as dichlorvos), pyrethrins, neonicotinoids (such as imidacloprid, acetamiprid, dinotefuran), carbamates (such as propoxur), pyroles (for example chlorfenapyr), and any combinations thereof.
  • the chemical insecticide is selected so that it will not immediately kill the bed bugs to ensure the at least one entomopathogenic fungus belonging to the species Metarhizium robertsii and optionally the at least one another entomopathogenic fungus will be subsequently horizontally transmitted across the bed bug population.
  • the chemical insecticide is selected so that it will immediately kill the bed bugs and the at least one entomopathogenic fungus belonging to the species Metarhizium robertsii and optionally the at least one another entomopathogenic fungus will be horizontally transmitted across the bed bug population by the surviving bed bugs.
  • the chemical insecticide is applied to the bed bug habitat during a separate treatment of the method for treating and/or preventing bed bugs infestations of the present invention.
  • This separate treatment which involves the use of at least one chemical insecticide may be carried out before or after the method for treating and/or preventing bed bugs infestations of the present invention.
  • the chemical insecticide is not included in the above- described composition but included in a separate composition.
  • another object of the invention is a method for treating and/or preventing bed bugs infestations which comprises : - the carrying out of the above described method for treating and/or preventing bed bugs infestations, and - a separate treatment which involves the use of at least one chemical insecticide to be applied to the bed bug habitat, said separate treatment being carried out before or after said above described method for treating and/or preventing bed bugs infestations.
  • the composition of the above-described method for treating and/or preventing bed bugs infestations may comprise or not some chemical insecticides.
  • some chemical insecticides will be used in the composition of the above-described method for treating and/or preventing bed bugs infestations and for the separate treatment too.
  • the at least one chemical insecticide may be applied either simultaneously or sequentially, with the at least one entomopathogenic fungus belonging to the species Metarhizium robertsii and optionally the at least one another entomopathogenic fungus as described above.
  • Figure 1 is a graph showing the profile of the percentage of viability of fungal spores per day of storage at room temperature for 3 strains of entomopathogenic fungus.
  • EXAMPLES [92] I - Mortality of adult bed bugs when exposed to different entomopathogenic fungi: [93] In this example, the mortality of adult bed bugs when exposed to 13 different strains of entomapathogenic fungi which were : - sample 1 : strain of Beauveria bassiana ; - samples 2 to 4 : 3 differents strains of Metarhizium robertsii ; - sample 5 : strain of Isaria farinosa; - sample 6 : strain of Metacordyceps chlamydosporia; - sample 7: strain of Fusarium proliferatum; - sample 8: strain of Cordyceps militaris; - sample 9 : strain of Trichothecium rose
  • the sample 2 of the 1 st strain of Metarhizium robertsii CIRM-BRFM 2512 was deposited as CNCM I-5850 as mentioned above.
  • the sample 5 of the strain of Isaria farinosa CIRM-BRFM 1607 was deposited as CNCM I-5849 as mentioned above.
  • the samples 2 to 4 were samples according to the invention and the other samples were comparative samples.
  • the above detailed strains of entomopathogenic fungi were grown and allowed to sporulate on potato dextrose agar medium plates in closed petri dishes at 25°C for 10 days without controlling the humidity and were stored at 4°C before use.
  • Inoculum were prepared by recovering the spores from the surface of the mycelium by adding 15 mL of water-Tween 80 and scraping the surface of the mycelium with a rake to the content of 145-mm petri dish cultures of the entomopathogenic fungus (containing fungal biomass [i.e., both mycelia and spores] and potato dextrose agar medium). [99] 300 ⁇ L at 10 7 spores/mL of this homogenate was used to inoculate by spraying the piece of cotton fabric where 10 live adult bed bugs were added (forced contact) for one condition (glass jar with sterile breathable film).
  • the table 1 here below details the average percentage of death of the bed bugs per day for the 13 tested strains of filamentous fungi.
  • the first line of the table 1 represents a negative control, i.e., the result obtained with the above detailed 15 mL mixture of water and Tween 80 at a concentration of 0.01 %(v/v) without any entomopathogenic fungus.
  • the sample 1a was the strain of Metarhizium robertsii CIRM-BRFM 2512 which was deposited as CNCM I-5850 as mentioned above.
  • the sample 2a was the strain Metarhizium brunneum 90448 F52, (strain designation : M.a. 43 [HRI 275.86] F52 - It is the strain disclosed in the above mentioned patent application WO 2014/117118 A1).
  • the sample 3a was the strain of Metarhizium frigidum Bischoff et Rehner 200614® (strain designation F-001 [DAT F-001]).
  • the sample 4a was the strain of Metarhizium anisopliae DSM n°: 21704.
  • the sample 1a was a sample according to the invention and the other samples were comparative examples.
  • Inoculum were prepared by recovering the spores from the surface of the mycelium by adding 15 mL of water-Tween 80 and scraping the surface of the mycelium with a rake to the content of 145-mm petri dish cultures of the entomopathogenic fungus (containing fungal biomass [i.e., both mycelia and spores] and potato dextrose agar medium).
  • 300 ⁇ L at 10 7 spores/mL of this homogenate was used to inoculate by spraying a piece of cotton fabric.
  • the table 2 here below details the mortality rate of the insecticide-resistant female bed bugs (i.e. average of triplicate independent experiments) per day for the 4 samples.
  • the first line of the table 2 represents a negative control, i.e., the result obtained with the above detailed 15 mL mixture of water and Tween 80 at a concentration of 0.01 %(v/v) without any entomopathogenic fungus.
  • strain of Metarhizium robertsii results in higer mortality rates than the exposure to the comparative samples, e.g. the strains of the tested filamentous fungi: sample 3a (Metarhizium frigidum) and sample 4a (Metarhizium anisopliae).
  • sample 3a Metalarhizium frigidum
  • sample 4a Metalarhizium anisopliae
  • the strain of Metarhizium brunneum allows 100% mortality but slower than the strain of Metarhizium robertsii. Indeed, Metarhizium robertsii shows 100% efficacy two days earlier than the strain of Metarhizium brunneum. [120] In conclusion, the strain of Metarhizium robertsii has better results than known entomopathogenic fungus used for eradicating bed bugs on insecticide-resistant female bed bugs. The strain of Metarhizium robertsii shows a 100% efficacy on insecticide- resistant female bed bugs and acted faster than the other tested fungus even the sample 2a (Metarhizium brunneum).
  • the table 3 here below details the mortality rate of the insecticide-sensible larvae bed bugs (i.e. average of triplicate independent experiments) per day for the 4 samples.
  • the first line of table 3 represents a negative control, i.e., the result obtained with the above detailed 15 mL mixture of water and Tween 80 at a concentration of 0.01 %(v/v) without any entomopathogenic fungus.
  • sample 3a Metalellazium frigidum
  • sample 4a Metalellazium anisopliae
  • the strain of Metarhizium brunneum also does not reach 100% efficacy, its maximal mortality rate is 97% and it was reached only after 8 days of treatment, i.e.3 days later than the strain of Metarhizium robertsii.
  • the strain of Metarhizium robertsii is more efficient and acts faster than the strains of Metarhizium brunneum, Metarhizium frigidum and Metarhizium anisopliae.
  • the strain of Metarhizium robertsii has better results than known entomopathogenic fungus used for eradicating bed bugs on insecticide-sensible larvae of bed bugs.
  • the strain of Metarhizium robertsii shows a 100% efficacy and acted faster than the other tested fungi even the sample 2a (i.e. the strain of Metarhizium brunneum).
  • F52 - It is the strain disclosed in the above mentioned patent application WO 2014/117118 A1).
  • the sample 3b was the strain of Metarhizium frigidum Bischoff et Rehner 200614® (strain designation F-001 [DAT F-001]).
  • Viability was assessed daily between the 4th and 10th days of storage at room temperature.
  • fungal spores of each strain were first harvested from plates and filtration using Miracloth and the filtrates were diluted to obtain suspensions at a concentration of 10 3 spores/mL.
  • the table 4 here below details the percentage of viability of the fungal spores per day of storage at room temperature for the 3 samples 1b to 3b. Percentage of viability of the fungal spores per day of storage at room temperature Experiment 0 4 5 6 7 8 9 10 Sample 1b : M. robertsii 100 85.2 78.9 69.5 63.7 58.4 45.0 35.6 Sample 2b : M.
  • Figure 1 is a graph showing the profile of the percentage of viability of fungal spores per day of storage at room temperature for the samples 1b to 3b.
  • CLAIMS A method for treating and/or preventing bed bug infestations which comprises a step of applying at least one entomopathogenic fungus belonging to the species Metarhizium robertsii or a composition containing at least one entomopathogenic fungus belonging to the species Metarhizium robertsii to a bed bug habitat. 2.
  • the entomopathogenic fungus is a strain of Metarhizium robertsii which comprises both : - the internal transcribed spacer (“ITS”) ribosomal sequence as set forth in SEQ ID NO: 1 and - the translation elongation factor 1-alpha sequence as set forth in SEQ ID NO: 2.
  • ITS internal transcribed spacer
  • the method according to claim 1 or 2 characterized in that the entomopathogenic fungus is a strain of Metarhizium robertsii CIRM- BRFM 2512 (deposited under the Budapest treaty as CNCM I-5850). 4.
  • At least one another entomopathogenic fungus is selected in the group consisting of Isaria, Metacordyceps, Fusarium, Cordyceps, Beauveria, Metarhizium, Hirsutella, Aschersonia, Ophiocordyceps, Paecilomyces and Pochonia.
  • the composition comprises : - the at least one entomopathogenic fungus belonging to the species Metarhizium robertsii; - optionally the at least one another entomopathogenic fungus; - a carrier; - optionally at least one additional ingredient.
  • the composition comprises, based on the total weight of said composition: - between 85.00 wt. % and 99.98 wt. %, preferably 85.00 wt. % to 95.00 wt. %, of the carrier; - between 0.02 wt. % and 15.00 wt. %, preferably between 5.00 wt. % to 15.00 wt. %, of the at least one entomopathogenic fungus belonging to the species Metarhizium robertsii and optionally the at least one another entomopathogenic fungus.
  • the additional ingredient is selected in the group consisting of biologically active ingredients, chemical insecticides, insect growth regulators, rheology modifying agents, preservatives, colorants, opacifiers, fragrances, fillers, pH adjusting agents, stabilizers, antioxidants, oxygen scavenger, wetting agents UV protectants, fillers, nutritive additives, and any combinations thereof.
  • the biologically active ingredient is a cuticle degrading enzyme.
  • the cuticle degrading enzyme is selected in the group consisting of proteases, peptidases, chitinases, chitosanases, cutinases, lipases, esterases, catalases, oxidases, oxygenases, dehydrogenases, and any combinations thereof.
  • the chemical insecticide is selected in the group consisting of pyrethroids, organophosphates, pyrethrins, neonicotinoids, carbamates, pyroles, and any combinations thereof.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Plant Pathology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Pest Control & Pesticides (AREA)
  • Genetics & Genomics (AREA)
  • Virology (AREA)
  • Mycology (AREA)
  • Environmental Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Insects & Arthropods (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Botany (AREA)
  • Agronomy & Crop Science (AREA)
  • Dentistry (AREA)
  • Agricultural Chemicals And Associated Chemicals (AREA)

Abstract

The present invention relates to a method for treating and/or preventing bed bug infestations which comprises a step of applying at least one entomopathogenic fungus belonging to the species Metarhizium robertsii or a composition containing at least one entomopathogenic fungus belonging to the species Metarhizium robertsii to a bed bug habitat.

Description

Method for treating and/or preventing bed bug infestations [1] The present invention relates to a method of treating and/or preventing infestations of bed bugs which involves the use of entomopathogenic fungi or compositions comprising entomopathogenic fungi. [2] Bed bugs infestation is a common problem in households which is particularly difficult to eradicate. Dwellings (such as homes and hotels) become infested with bed bugs in a variety of ways. Bed bugs and their eggs can be transmitted from other infested dwellings by pets, person's clothing or luggages. Bed bugs often lodge themselves unnoticed in dark crevices, and eggs are nestled in fabric seams. As bed bugs feed on the blood of their host, bed bugs usually remain close to places where potential hosts reside commonly in or near beds or couches of human hosts. Moreover, bed bugs are elusive and usually nocturnal making them hard to spot. [3] Mechanical approaches to eliminate bed bugs have been explored and include vacuuming up the insects and heat treating or wrapping mattresses. [4] Moreover, well-known solutions for controlling bed bugs may involve a combination of insecticide and non-insecticide approaches. Nevertheless, bed bugs have become increasingly resistant to insecticides and negative health effects from their use are of concern. [5] Thus, there is a need to find out new solutions to be used to treat and/or prevent infestations of bed bugs. [6] Another solution to treat and/or prevent infestations of bed bugs deals with the use of some selected species entomopathogenic fungi. [7] Indeed it offers a very efficient solution for treating and/or preventing infestations of bed bugs, in the lodging industry as well as in the residential home, by taking advantage of entomopathogenic fungi which can be horizontally transmitted across bed bugs populations. [8] In context of the present invention, “horizontal transmission across the bed bugs population” means that the infection by the entomopathogenic fungi will be propagated to not only adult bed bugs but bed bugs of all life stages (i.e., eggs, nymphs, instars and adults) and thus the infestation will be resolved. [9] In the context of the present invention, the term "treating and/or preventing infestations of bed bugs" refers to preventing infestation, reducing the population of already infested areas, killing or eliminating the bed bugs. [10] In the context of the present invention, "entomopathogenic fungi" are fungi that are capable of growing, developing, colonizing, destroying, attacking, infecting, killing, disabling, causing disease, and/or causing injury /damage to an insect (i.e., the bed bugs for the present invention), and are thus able to be used in the control insect infestation by adversely affecting the viability or growth of the target insect (i.e., the bed bugs for the present invention). [11] WO 2014/117118 A1 discloses a method for controlling bed bugs comprising: contacting one or more bed bugs with a first fungal pesticide and a second fungal pesticide. The first fungal pesticide and the second fungal pesticide may be different strains of Metarhizium anisopliae, for example the strain Metarhizium anisopliae F52. As explained in this PCT application, the name of the species Metarhizium anisopliae of the strain Metarhizium anisopliae F52 has been changed to Metarhizium brunneum and thus, may be referred to in the art under both names. [12] The inventors surpringly found another species of entomopathogenic fungus which has proven to be more effective for treating and/or preventing bed bugs infestations than the species of Metarhizium anisopliae and Metarhizium brunneum and other well-known entomopathogenic fungal species for such application such as Beauveria bassiana. [13] Therefore, the present invention relates to a method for treating and/or preventing bed bug infestations which comprises a step of applying at least one entomopathogenic fungus belonging to the species Metarhizium robertsii or a composition containing at least one entomopathogenic fungus belonging to the species Metarhizium robertsii to a bed bug habitat. [14] The species of Metarhizium robertsii is a different species from the species of Metarhizium anisopliae. [15] Indeed, as explained in the publication entitled “The genome sequence of biocontrol fungus Metarhizium anisopliae and comparative genomics of Metarhizium species”, Julie A. Pattemore et al.; BMC Genomics 2014, 15:660, the species of Metarhizium robertsii is different from the species Metarhizium anisopliae. Indeed, in the study disclosed in this publication, a suite of effector-like genes that are predicted to be specific to Metarhizium anisopliae, significant differences in the repetitive DNA complements, repeat-induced point mutations and mating type gene composition between the species of Metarhizium anisopliae, Metarhizium robertsii and Metarhizium acridum were identified. In particular, a total of 11415 protein-encoding genes were predicted within the Metarhizium anisopliae Ma69 genome assembly, compared with 10582 and 9489 from Metarhizium robertsii and Metarhizium acridum, respectively. A total of 127 proteins from Metarhizium anisopliae were predicted to have no orthologs in either Metarhizium robertsii or Metarhizium acridum. In this publication, it is concluded that the nomenclature of the species Metarhizium robertsii needs to be widely adopted immediately to prevent further confusion with Metarhizium anisopliae, therefore the publication of the genome reference of Metarhizium anisopliae will serve as a valuable reference to differentiate it from Metarhizium robertsii. [16] In the context of the present invention, a “bed bug habitat” may be a surface of any article. Examples of article are furniture (such as beds, bed box springs, futon box springs, mattresses, chair mattresses, cushions, sofas, futons generally, tables and benches, clothing dressers, lighting fixtures, television), wall material (such as plaster, sheet rock, brick, wood), floor (such as tile, parquet, carpet), drapery windows, temperature regulating devices (such as air-conditioning units, radiators, thermostats, heat pumps, heating units), toilets, sinks, tubs, shower rods, shower basins, doors, any relevant parts of vehicles (such as airplanes, ships) for bed bug habitat. Thus, it means any surface of any article which is a bed bug habitat and where it would be advantageous to apply the above detailed entomopathogenic fungus or the above detailed composition containing said entomopathogenic fungus to treat and/or prevent bed bug infestations. [17] Preferably, bed bug habitat includes areas where bed bugs are known to congregate (i.e., cracks and crevices in wall material, spaces between floor and wall adjacencies). [18] The above detailed entomopathogenic fungus or the above detailed composition containing said entomopathogenic fungus may be applied directly to a bed bug habitat or via a bed bug control device. Appropriate bed bug control devices are well-known for a skilled man in the art. [19] The at least one entomopathogenic fungus may be identical or different strains of Metarhizium robertsii. [20] Preferably, the entomopathogenic fungus is a strain of Metarhizium robertsii which comprises both : - the internal transcribed spacer (“ITS”) ribosomal sequence as set forth in SEQ ID NO: 1 and - the translation elongation factor 1-alpha sequence as set forth in SEQ ID NO: 2. [21] Preferably, the entomopathogenic fungus is a strain of Metarhizium robertsii CIRM- BRFM 2512 (deposited under the Budapest treaty on May 11, 2022 at Collection Nationale de Cultures de Micro-organismes (CNCM) Institut Pasteur, 25 rue du Docteur Roux, Paris, France, as CNCM I-5850). [22] Preferably, at least one entomopathogenic fungus belonging to the species Metarhizium robertsii is in a spore or mycelium form. It means that the method of the present invention is carried out by contacting one or more bed bugs with the spores or mycelium of the at least one entomopathogenic fungus belonging to the species Metarhizium robertsii. [23] The amount of the at least one entomopathogenic fungus belonging to the species Metarhizium robertsii may be globally comprised between 106 spores/mL and 108 spores/mL of composition. [24] Preferably, the entomopathogenic fungus belonging to the species Metarhizium robertsii is horizontally transmissible across a population of bed bugs. [25] The entomopathogenic fungus belonging to the species Metarhizium robertsii may treat and/or prevent bed bugs infestations in at least one life stage of bed bugs. More precisely, the entomopathogenic fungus belonging to the species Metarhizium robertsii may treat and/or prevent bed bugs at the egg stage, the nymph stage, the instar stage, the adult stage, or any combinations thereof. In embodiments of the invention, the method for treating and/or preventing bed bug infestations comprises : - a step of applying the at least one entomopathogenic fungus belonging to the species Metarhizium robertsii in combination with at least one another entomopathogenic fungus, or - a step of applying a composition containing the at least one entomopathogenic fungus belonging to the species Metarhizium robertsii in combination with at least one another entomopathogenic fungus, to the bed bug habitat. [26] The at least one another entomopathogenic fungus may be identical or different strains of said another entomopathogenic fungus. [27] The at least one another entomopathogenic fungus may be selected in the group consisting of species of Aegerita, Ascophaera, Aschersonia, Akanthomyces, Aspergillus, Beauveria, Blastodendrion, Calonectria, Coelomycidium, Coelemomyces, Conidiobolus, Cordyceps, Couchia, Culicinomyces, Engyodontium, Entomophaga, Entomophthora, Erynia, Eryniopsis, Filariomyces, Filobasidiella, Fusarium, Gibellula, Hesperomyces, Hirsutella, Hymenostilbe, Hypocrella, Isaria, Lagenidium, Leptolegnia, Nectria, Neozygites, Nomuraea, Massospora, Meristacrum, Metacordyceps, Metarhizium, Metschnikowia, Mycoderma, Myiophagus, Myriangium, Ophiocordyceps, Paecilomyces, Pandora, Paraisaria, Pleurodesmospora, Pochonia Podonectria, Polycephalomyces, Pseudogibellula, Septobasidium, Sorosporella, Sporodiniella, Stillbella, Trenomyces, Tetranacrium, Tilachlidium, Tolypocladium, Torrubiella, Uredinella, Verticillium, Zoophthora, [28] Preferably, the at least one another entomopathogenic fungus may be selected in the group consisting of Isaria, Metacordyceps, Fusarium, Cordyceps, Beauveria, Metarhizium, Hirsutella, Aschersonia, Ophiocordyceps, Paecilomyces and Pochonia. [29] More preferably, the at least one another entomopathogenic fungus is Isaria farinosa. [30] Most preferably, the at least one another entomopathogenic fungus is a strain of Isaria farinosa CIRM- BRFM 1607 (deposited under the Budapest treaty on May 11, 2022 at Collection Nationale de Cultures de Micro-organismes (CNCM) Institut Pasteur, 25 rue du Docteur Roux, Paris, France, as CNCM I-5849). [31] Preferably, the at least one another entomopathogenic fungus is in a spore or mycelium form. It means that the method of the present invention may be carried out by further contacting one or more bed bugs with the spores or mycelium of the at least one another entomopathogenic fungus. [32] The amount of the at least one another entomopathogenic fungus may be globally comprised between 106 spores/mL and 108 spores/mL of composition. [33] The above detailed entomopathogenic fungi (i.e., the at least one entomopathogenic fungus belonging to the species Metarhizium robertsii and optionally the at least one another entomopathogenic fungus) may be produced in a liquid culture media or a solid culture media fermentation process. [34] Fermentation processes may be conducted using conventional fermentation processes in laboratory or industrial fermenters. Such fermentation processes are well known in the art. [35] Methods for producing spores or mycelium commonly use solid media. For example, entomopathogenic fungi are grown on as potato dextrose agar (PDA) for two-three weeks at room temperatures. [36] The media may have high carbon and nitrogen concentrations to facilitate higher yields. Not-limiting examples of suitable nitrogen sources include hydrolyzed casein, yeast extract, hydrolyzed soy protein, hydrolyzed cottonseed protein, and hydrolyzed corn gluten protein. Not-limiting examples of suitable carbon sources include carbohydrates, including cellulose, chitin, glucose, fructose, sucrose, and/or glycerol and/or plant biomass such as rice, wheat or barley. Following the fermentation process, the spores or mycelium of the entomopathogenic fungi may be recovered using conventional techniques (for example by filtration, centrifugation), and then they may be used directly from the liquid culture media or they may be subject to a step of purification and/or further processing steps (for example a drying process: air-drying, freeze drying, or spray drying to a low moisture level). After these steps, the entomopathogenic fungi are stored at a suitable temperature (for example room temperature). [37] The production of the above detailed entomopathogenic fungi is well-known for a skilled man in the art. [38] Preferably, the at least one another entomopathogenic fungus is horizontally transmissible across a population of bed bugs. [39] The at least one another entomopathogenic fungus may treat and/or prevent bed bugs in at least one life stage of bed bugs. More precisely, the at least one another entomopathogenic fungus may treat and/or prevent the bed bugs infestations at the egg stage, the nymph stage, the instar stage, the adult stage, or any combinations thereof. [40] The at least one entomopathogenic fungus belonging to the species Metarhizium robertsii and the at least one another entomopathogenic fungus may contact the bed bugs sequentially or simultaneously. [41] In embodiments of the invention, the at least one entomopathogenic fungus belonging to the species Metarhizium robertsii and the at least one another entomopathogenic fungus are applied sequentially to the bed bug habitat. [42] In embodiments of the invention, the at least one entomopathogenic fungus belonging to the species Metarhizium robertsii and the at least one another entomopathogenic fungus are included in separate compositions which are applied sequentially to the bed bug habitat. [43] In another embodiments of the invention, the at least one entomopathogenic fungus belonging to the species Metarhizium robertsii and the at least one another entomopathogenic fungus are applied simultaneously to the bed bug habitat. The at least one entomopathogenic fungus belonging to the species Metarhizium robertsii and the at least one another entomopathogenic fungus may be included in a single composition which is applied to the bed bug habitat. [44] The composition may be of any forms. More precisely, the composition may be in the form of a gel, a foam, a solid (for example a powder, granule or particle) or a liquid. [45] The composition can be of any form so long as the composition is able to support the desired activity of the entomopathogenic fungi, regardless of their form (i.e., vegetative state or dormant state). [46] In embodiments of the invention, the composition may comprise : - the at least one entomopathogenic fungus belonging to the species Metarhizium robertsii; - optionally the at least one another entomopathogenic fungus (as described above); - a carrier; - optionally at least one additional ingredient. [47] The composition may comprise, based on the total weight of said composition: - between 85.00 wt. % and 99.98 wt. %, preferably 85.00 wt. % to 95.00 wt. %, of the carrier; - between 0.02 wt. % and 15.00 wt. %, preferably between 5.00 wt. % to 15.00 wt. %, of the at least one entomopathogenic fungus belonging to the species Metarhizium robertsii and optionally the at least one another entomopathogenic fungus. [48] The carrier may be a suspension medium capable of supporting the entomopathogenic fungi as described above. Indeed, the entomopathogenic fungi as described above may be transferable from the carrier to the body of the target bed bugs. [49] The carrier may be used to provide an environment to support the viability of the entomopathogenic fungi as described above, including by providing the proper environmental conditions and protecting the entomopathogenic fungi from harmful environmental conditions (for example excess oxygen, moisture and/or ultraviolet radiation). [50] The carrier may also be used to maintain the activity of the entomopathogenic fungi after said entomopathogenic fungi have been applied to the bed bug habitat. [51] The carrier will be configured to allow the entomopathogenic fungi as described above to remain efficient (i.e., able to be transferred to the body of the bed bug with a degree of lethality). [52] Unless the composition is generated immediately prior to use, the carrier may be used to maintain the activity of the above detailed entomopathogenic fungi during storage (i.e., for example in a container for the entire shelf-life of the formulated product). [53] In embodiments of the invention, the carrier may be a liquid. More precisely, it may be an aqueous or a non-aqueous liquid. [54] In preferred embodiments of the invention, the carrier is a non-aqueous liquid carrier as bed bugs are hydrophobic and therefore, have a relatively low critical surface tension. Thus, the low surface tension of the non-aqueous liquid will make it more likely that the composition will adhere to the body of the bed bugs. [55] Preferably, the non-aqueous liquid is a biodegradable non-aqueous liquid. [56] The non-aqueous liquids may be selected in the group consisting of silicone oils, mineral oils, hexylene glycol, glycerol, linoleic acid, oleic acid, and any combinations thereof. [57] In another embodiments of the composition, the carrier may be a gel comprising at least one liquid and at least one gelling agent. [58] The liquid may be an aqueous or non-aqueous liquid. As explained above, given of the hydrophobicity of the bed bugs, the liquid is preferably a non-aqueous liquid, and more preferably a biodegradable non-aqueous liquid. The non-aqueous liquid may be selected amongst the above detailed non-aqueous liquids. [59] The gelling agent of the gel may be any agent capable of dissolving in the liquid phase as a colloid mixture to form a weakly cohesive internal structure. [60] The gelling agent may be selected in the group consisting of polyvinyl acetate, polyvinyl alcohols, polyvinylpyrrolidones, polyacrylates, copolymers of two or more monomers such as acrylic acid, methacrylic acid, maleic acid, fumaric acid, vinylpyrrolidone, ethylenically unsaturated monomers (ethylene, butadiene, isoprene, chloroprene, styrene, divinylbenzene), vinyl halides, vinyl esters, vinyl methyl ketone or esters of acrylic acid or methacrylic acid with monohydric alcohols or polyols (for example methyl acrylate, methyl methacrylate, ethyl acrylate, ethylene methacrylate, lauryl acrylate, lauryl methacrylate, decyl acrylate, Ν,Ν-dimethylamino-ethyl methacrylate, 2- hydroxyethyl methacrylate, 2-hydroxypropyl methacrylate or glycidyl methacrylate), diethyl esters or monoesters of unsaturated dicarboxylic acids, (meth)acrylamido-N- methylol methyl ether, amides or nitriles (for example acrylamide, methacrylamide, N- methylol(meth)acrylamide, acrylonitrile, methacrylonitrile), ethers (for example vinyl butyl ether, vinyl isobutyl ether or vinyl phenyl ether) and combinations thereof. [61] The gelling agent may further include hydrophobically-modified clays, surface modified silicas, fumed silicas, and any combinations thereof. [62] For these embodiments of the invention, the gel may comprise, based of the total weight of the gel: - between 80 wt. % and 99.99 wt. % of the liquid; - between 0.01 wt. % and 20.00 wt. % of the gelling agent. [63] In embodiments of the invention, the carrier may be an emulsifiable suspension. [64] The additional ingredient is physically and/or chemically compatible with the composition. [65] The additional ingredient may be selected in the group consisting of biologically active ingredients, chemical insecticides, insect growth regulators, rheology modifying agents (for example thickeners), preservatives, colorants, opacifiers, fragrances, fillers, pH adjusting agents, stabilizers, antioxidants, oxygen scavenger, wetting agents UV protectants, fillers, nutritive additives, and any combinations thereof. [66] Such additional ingredients are known to those skilled in the art. [67] The biologically active ingredients may be selected in the group consisting of enzymes and microorganisms other than the above described entomopathogenic fungi. [68] Preferably, the composition comprises at least one enzyme. [69] In preferred embodiments of the invention, the composition comprises at least one cuticle degrading enzyme. Thus, in these embodiments, the biologically active ingredient is a cuticle degrading enzyme. [70] In the context of the present invention, a "cuticle degrading enzyme" is an enzyme that is able to at least partially degrade a cuticle of a pest (i.e., a bed bug for the present invention), the epicuticle and/or the procuticle. The cuticle degrading enzyme increases the efficacy of the above described entomopathogenic fungi by increasing the ability of the entomopathogenic fungi to colonize and/or or bore through the bed bug's cuticle to reach the bed bug's body cavity. [71] The cuticle degrading enzyme may be selected in the group consisting of proteases, peptidases, chitinases, chitosanases, cutinases, lipases, esterases, catalases, oxidases, oxygenases, dehydrogenases, and any combinations thereof. [72] The composition may further comprise at least one microorganism, other than the above described entomopathogenic fungi. The microorganism can have a variety of beneficial properties for the method of the present invention. For example, the microorganism may be used to : - reduce odors associated with dead or decaying bed bugs, - produce enzymes to enhance the activity of the above described entomopathogenic fungi, - produce or express toxins which supplement and/or enhance the activity of the above described entomopathogenic fungi (for example δ-endotoxin, a- exotoxin, β-exotoxin, and any combinations thereof produced by Bacillus thuringiensis), - produce or express CO2 to attract bed bugs. [73] Preferably, the microorganism is a bacterium, and more preferably an insecticide bacterium. The insecticide bacterium may be selected in the group consisting of Enterobacteriaceae, Proteobacteria, Actinobacteria, Firmicutes, Bacteroidetes, Rickettsiae, Mollicutes, and any combinations thereof. [74] The microorganism capable of producing CO2 may be selected in the group consisting of CO2 producing yeasts, preferably in the group consisting of the yeasts of Saccharomyces, and more preferably the yeasts of Saccharomyces cerevisiae. [75] The composition may further comprise at least one rheology modifying agent. Preferably, the rheology modifying agent may comprise a thickener. The thickener may be selected in the group consisting of polyacrylic acids, polyvinylpyrrolidone homo- or copolymers, polyethylene glycols, ethylene oxide/propylene oxide copolymers, polyvinyl alcohols and non-ionically or ionically modified celluloses, thixotropic xanthan-based thickeners, precipitated or pyrogenic silicas, kaolins, bentonites, aluminum/silicon mixed oxides, silicates, and any combinations thereof. [76] The composition may further comprise at least one preservative. The preservative may be selected in the group consisting of sodium azide, thimerosol, 2-bromo-2-nitro-1,3- propanadiol, 1-(3-chloroallyl)-3,5,7-triaza-1-azoniaadamantane chloride, dibromonitrilopropionamide, 1,2-benzisothiazolin-3-one, 5-chloro-2-methyl-4- isosthiazolin-3-one, 2-methyl-4-isosthiazolin-3-one, diazolidinyl urea, tris(hydroxymethyl)nitromethane, sodium o-phenylphenate, copper arsenates, and any combinations thereof. [77] The composition may further comprise at least one antioxidant. For example, the antioxidant may be selected in the group consisting of Vitamin E, ^-tocopherol, and any combinations thereof. [78] The composition may further comprise at least one filler. The filler may be selected in the group consisting of calcium carbonate, ground quartz, and any combinations thereof. [79] In embodiments of the invention, the composition may further comprise at least one chemical insecticide. [80] For example, the chemical insecticide may be selected in the group consisting of pyrethroids (such as permetherin, resmethrin, phenothrin, deltamethrin, bioallethrin, D- allethrin, esfenvalerate, tetramethrin, cyphenothrin, imiprothrin, alkyl dimethyl benzyl ammonium chloride, beta-cyfluthrin, prallethrin, bifenthrin, lambda-cyhalothrin, zeta- cypermethrin, gamma-cyhalothrin), organophosphates (such as dichlorvos), pyrethrins, neonicotinoids (such as imidacloprid, acetamiprid, dinotefuran), carbamates (such as propoxur), pyroles (for example chlorfenapyr), and any combinations thereof. [81] In embodiments of the invention, the chemical insecticide is selected so that it will not immediately kill the bed bugs to ensure the at least one entomopathogenic fungus belonging to the species Metarhizium robertsii and optionally the at least one another entomopathogenic fungus will be subsequently horizontally transmitted across the bed bug population. [82] In other embodiments of the invention, the chemical insecticide is selected so that it will immediately kill the bed bugs and the at least one entomopathogenic fungus belonging to the species Metarhizium robertsii and optionally the at least one another entomopathogenic fungus will be horizontally transmitted across the bed bug population by the surviving bed bugs. [83] In embodiments of the invention, the chemical insecticide is applied to the bed bug habitat during a separate treatment of the method for treating and/or preventing bed bugs infestations of the present invention. This separate treatment which involves the use of at least one chemical insecticide may be carried out before or after the method for treating and/or preventing bed bugs infestations of the present invention. For these embodiments of the invention, the chemical insecticide is not included in the above- described composition but included in a separate composition. [84] Thus, another object of the invention is a method for treating and/or preventing bed bugs infestations which comprises : - the carrying out of the above described method for treating and/or preventing bed bugs infestations, and - a separate treatment which involves the use of at least one chemical insecticide to be applied to the bed bug habitat, said separate treatment being carried out before or after said above described method for treating and/or preventing bed bugs infestations. [85] As explained, the composition of the above-described method for treating and/or preventing bed bugs infestations may comprise or not some chemical insecticides. Thus, in some embodiments of the invention, some chemical insecticides will be used in the composition of the above-described method for treating and/or preventing bed bugs infestations and for the separate treatment too. [86] To sum up, in the context of the present invention, the at least one chemical insecticide may be applied either simultaneously or sequentially, with the at least one entomopathogenic fungus belonging to the species Metarhizium robertsii and optionally the at least one another entomopathogenic fungus as described above. [87] DESCRIPTION OF THE SEQUENCES Taxonomy SEQ ID Sequence NO Metarhizium 1 GTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGAT robertsii CATTACCGAGTTATCCAACTCCCAACCCCTG TGAATTATACCTTTAATTGTTGCTTCGGCGGGACTTCGCG CCCGCCGGGGACCCAAACCTTCTGAATTTT TTAATAAGTATCTTCTGAGTGGTTAAAAAAATGAATCAAA ACTTTCAACAACGGATCTCTTGGTTCTGGC ATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTG AATTGCAGAATTCAGTGAATCATCGAATCTTT GAACGCACATTGCGCCCGTCAGTATTCTGGCGGGCATGC CTGTTCGAGCGTCATTACGCCCCTCAAGTCC CCTGTGGACTTGGTGTTGGGGATCGGCGAGGCTGGTTTT CCAGCACAGCCGTCCCTTAAATTAATTGGCG GTCTCGCCGTGGCCCTCCTCTGCGCAGTAGTAAAACACTC GCAACAGGAGCCCGGCGCGGTCCACTGCCG TAAAACCCCCCAACTTTTTATAGTTGACCTCGAATCAGGT AGGACTACCCGCTGAACTTAAGCATATCAA T Metarhizium 2 TGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCTCT robertsii CCTCGCCTACACCCTGGGTGTCAAGCAGCTCATTGTCGCC ATCAACAAGATGGACACCACCAAGTGGTCCGAGGCCCGT TACCAGGAAATCATCAAGGAGACTTCCAACTTCATCAAG AAGGTCGGCTACAACCCCAAGACCGTCGCCTTCGTCCCC ATCTCCGGTTTCCACGGTGACAACATGCTTCAGGCCTCCA CCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACC AAGGCTGGCAAGTCCACCGGCAAGACCCTCCTCGAGGCC ATTGACGCCATTGAGCCCCCCAAGCGTCCCACCGACAAG CCCCTCCGTCTTCCCCTCCAGGATGTGTACAAGATTGGCG GTATTGGAACTGTCCCTGTCGGCCGTATCGAGACTGGTG TCCTCAAGCCCGGTATGGTCGTTACCTTCGCTCCCTCCAA CGTCACCACTGAAGTCAAGTCCGTGGAAATGCACCACGA GCAGCTTACCGAGGGTGTCCCCGGTGACAACGTTGGTTT CAACGTGAAGAACGTTTCCGTCAAGGAAATCCGCCGTGG TAACGTTGCTGGTGACTCCAAGAACGACCCCCCCATGGG TGCCGCTTCCTTCGATGCCCAGGTCATCGTTCTCAACCAC CCCGGCCAGGTCGGTGCTGGTTACGCTCCCGTCCTCGATT GCCACACCGCCCACATTGCCTGCAAGTTCTCTGAGATCAA GGAGAAGATTGACCGACGTACCGGTAAGGCTGTTGAGT CTGCCCCCAAGTTCATCAAGTCTGGTGACTCTGCCATCGT CAAGATGGTTCCCTCCAAGCCTATGTGC [88] The present invention is illustrated with the aid of the following examples. [89] Brief description of the figure : [90] Figure 1 is a graph showing the profile of the percentage of viability of fungal spores per day of storage at room temperature for 3 strains of entomopathogenic fungus. [91] EXAMPLES [92] I - Mortality of adult bed bugs when exposed to different entomopathogenic fungi: [93] In this example, the mortality of adult bed bugs when exposed to 13 different strains of entomapathogenic fungi which were : - sample 1 : strain of Beauveria bassiana ; - samples 2 to 4 : 3 differents strains of Metarhizium robertsii ; - sample 5 : strain of Isaria farinosa; - sample 6 : strain of Metacordyceps chlamydosporia; - sample 7: strain of Fusarium proliferatum; - sample 8: strain of Cordyceps militaris; - sample 9 : strain of Trichothecium roseum; - sample 10 : strain of Gibberella pulicaris; - sample 11: strain of Trichoderma viride; - sample 12: strain of Gibberella pulicaris; - sample 13: strain of Trichothecium sp., has been studied. [94] The sample 2 of the 1st strain of Metarhizium robertsii CIRM-BRFM 2512 was deposited as CNCM I-5850 as mentioned above. [95] The sample 5 of the strain of Isaria farinosa CIRM-BRFM 1607 was deposited as CNCM I-5849 as mentioned above. [96] The samples 2 to 4 were samples according to the invention and the other samples were comparative samples. [97] The above detailed strains of entomopathogenic fungi were grown and allowed to sporulate on potato dextrose agar medium plates in closed petri dishes at 25°C for 10 days without controlling the humidity and were stored at 4°C before use. [98] Inoculum were prepared by recovering the spores from the surface of the mycelium by adding 15 mL of water-Tween 80 and scraping the surface of the mycelium with a rake to the content of 145-mm petri dish cultures of the entomopathogenic fungus (containing fungal biomass [i.e., both mycelia and spores] and potato dextrose agar medium). [99] 300 μL at 107 spores/mL of this homogenate was used to inoculate by spraying the piece of cotton fabric where 10 live adult bed bugs were added (forced contact) for one condition (glass jar with sterile breathable film). Every condition was duplicated and incubated 14 days at room temperature (25°C) with 50-70 % of humidity. Mortality was monitored every day. [100] The table 1 here below details the average percentage of death of the bed bugs per day for the 13 tested strains of filamentous fungi. The first line of the table 1 represents a negative control, i.e., the result obtained with the above detailed 15 mL mixture of water and Tween 80 at a concentration of 0.01 %(v/v) without any entomopathogenic fungus. [101] Average % of death/day Experiment 2 3 4 5 6 7 8 9 10 11 12 13 14 Negative control: 0 0 0 0 20 30 30 30 30 30 30 30 30 H2O-Tween 80 Sample 1: Beauveria 0 0 0 0 75 80 90 90 90 100 100 100 100 bassiana Sample 2: 1st strain of Metarhizium robertsii CIRM- 0 0 0 63 100 100 100 100 100 100 100 100 100 BRFM 2512 (i.e. deposited as CNCM I-5850) Sample 3: 2nd strain of 0 0 5 75 100 100 100 100 100 100 100 100 100 Metarhizium robertsii Sample 4: 3rd strain of 0 0 0 55 100 100 100 100 100 100 100 100 100 Metarhizium robertsii Sample 5: 0 0 10 30 90 95 95 100 100 100 100 100 100 Isaria farinosa CIRM-BRFM 1607 (i.e. deposited as CNCM I-5849) Sample 6: Metacordyceps 0 0 0 10 10 15 25 30 55 65 80 85 100 chlamydosporia Sample 7: Fusarium 0 0 0 5 15 20 40 45 55 55 60 65 90 proliferatum Sample 8: Cordyceps 0 0 10 15 15 20 20 25 30 50 70 75 85 militaris Sample 9: Trichothecium 0 0 0 0 15 20 25 30 30 35 40 45 60 roseum Sample 10: Gibberella 0 0 0 0 10 10 15 20 20 20 20 20 25 pulicaris Sample 11: Trichoderma 0 0 0 0 0 0 0 0 0 0 10 10 20 viride Sample 12: Gibberella 0 0 0 0 0 0 0 0 0 0 6 13 13 pulicaris Sample 13: Trichothecium 0 0 0 0 5 5 5 5 5 5 5 5 5 sp Table 1: Average percentages of death of the bed bugs per day [102] In view of the table 1, we note that the exposure of bed bugs to the strains of Metarhizium robertsii results in higher mortality rates than the exposure to the strains of the other tested filamentous fungi. Indeed, for the strains of Metarhizium robertsii, a mortality of 100% of the bed bugs is reached only after 6 days. In particular, these results obtained with the four different strains of Metarhizium robertsii are clearly better than the results obtained with the strain of Beauveria bassiana, which is a known entomopathogenic fungus used for eradicating bed bugs (i.e., 6 days versus 11 days, respectively). Moreover, other well-known entomopathogenic fungi (e.g., Metacordyceps chlamydosporia and Cordyceps militaris) are much less efficient on bedbugs than Metarhizium robertsii. [103] II - Mortality of insecticide-resistant female bed bugs and insecticide-sensible larvae of bed bugs when exposed to different entomopathogenic fungi: [104] In this 2nd example, the mortality of insecticide-resistant female bed bugs and insecticide-sensible larvae of bed bugs when exposed to the following strains of entomapathogenic fungi which were : - sample 1a : strain of Metarhizium robertsii, - sample 2a : strain of Metarhizium brunneum, - sample 3a : strain of Metarhizium frigidum, - sample 4a : strain of Metarhizium anisopliae, has been studied. [105] The sample 1a was the strain of Metarhizium robertsii CIRM-BRFM 2512 which was deposited as CNCM I-5850 as mentioned above. [106] The sample 2a was the strain Metarhizium brunneum 90448 F52, (strain designation : M.a. 43 [HRI 275.86] F52 - It is the strain disclosed in the above mentioned patent application WO 2014/117118 A1). [107] The sample 3a was the strain of Metarhizium frigidum Bischoff et Rehner 200614® (strain designation F-001 [DAT F-001]). [108] The sample 4a was the strain of Metarhizium anisopliae DSM n°: 21704. [109] The sample 1a was a sample according to the invention and the other samples were comparative examples. [110] Inoculum were prepared by recovering the spores from the surface of the mycelium by adding 15 mL of water-Tween 80 and scraping the surface of the mycelium with a rake to the content of 145-mm petri dish cultures of the entomopathogenic fungus (containing fungal biomass [i.e., both mycelia and spores] and potato dextrose agar medium). [111] 300 μL at 107 spores/mL of this homogenate was used to inoculate by spraying a piece of cotton fabric. [112] Each sample was tested 3 times on these 2 categories of bed bugs which were: - insecticide-resistant female bed bugs and - insecticide-sensible larvae of bed bugs. [113] Moreover, a negative control was made 3 times for these 2 categories of bed bugs. [114] For each replicate, the treated cotton fabric was put in a glass jar and 10 live bed bugs (of the above-mentioned categories) were added (forced contact). Then, the glass jar was sealed with sterile breathable film. Glass jars were incubated 10 days in an incubator at constant temperature 25°C ± 0,5°C with a relative humidity of 90% ± 6%. Mortality was monitored every day from day 1 to day 10 after this treatment. [115] The table 2 here below details the mortality rate of the insecticide-resistant female bed bugs (i.e. average of triplicate independent experiments) per day for the 4 samples. The first line of the table 2 represents a negative control, i.e., the result obtained with the above detailed 15 mL mixture of water and Tween 80 at a concentration of 0.01 %(v/v) without any entomopathogenic fungus. [116] Mortality rate of the insecticide-resistant female bed bugs per day Experiment 1 2 3 4 5 6 7 8 9 10 Negative Control Water + Tween 3% 3% 3% 3% 3% 3% 3% 10% 10% 10% 80 Sample 1a : Metarhizium 20% 33% 33% 93% 100 100 100 100 100 100% robertsii % % % % % Sample 2a : 100 100 100 Metarhizium 13% 17% 17% 27% 70% 93% % % % 100% brunneum Sample 3a : Metarhizium 3% 13% 13% 13% 23% 48% 65% 71% 71% 71% frigidum Sample 4a : Metarhizium 0% 3% 3% 3% 3% 17% 59% 86% 86% 86% anisopliae Table 2: Mortality rate of the insecticide-resistant female bed bugs per day [117] In view of the table 2, we note that the exposure of insecticide-resistant female bed bugs to the sample 1a according to the invention (i.e. strain of Metarhizium robertsii) results in higer mortality rates than the exposure to the comparative samples, e.g. the strains of the tested filamentous fungi: sample 3a (Metarhizium frigidum) and sample 4a (Metarhizium anisopliae). [118] Indeed, for the strain of Metarhizium robertsii, a mortality of 100% of the bed bugs is reached 5 days after treatment. While the strains of Metarhizium frigidum and Metarhizium anisopliae do not reach the 100% efficacy and only show respectively 71% and 86% of mortality 10 days after treatment. [119] The comparative sample 2a, i.e. the strain of Metarhizium brunneum, allows 100% mortality but slower than the strain of Metarhizium robertsii. Indeed, Metarhizium robertsii shows 100% efficacy two days earlier than the strain of Metarhizium brunneum. [120] In conclusion, the strain of Metarhizium robertsii has better results than known entomopathogenic fungus used for eradicating bed bugs on insecticide-resistant female bed bugs. The strain of Metarhizium robertsii shows a 100% efficacy on insecticide- resistant female bed bugs and acted faster than the other tested fungus even the sample 2a (Metarhizium brunneum). Moreover, other well-known entomopathogenic fungi (Metarhizium frigidum and Metarhizium anisopliae) are much less efficient on bed bugs than Metarhizium robertsii on insecticide-resistant female bed bugs. [121] The table 3 here below details the mortality rate of the insecticide-sensible larvae bed bugs (i.e. average of triplicate independent experiments) per day for the 4 samples. The first line of table 3 represents a negative control, i.e., the result obtained with the above detailed 15 mL mixture of water and Tween 80 at a concentration of 0.01 %(v/v) without any entomopathogenic fungus. Mortality rate of the insecticide-sensible larvae bed bugs per Experiment day 1 2 3 4 5 6 7 8 9 10 Negative Control Water + Tween 14% 17% 17% 21% 21% 21% 21% 21% 21% 21% 80 Sample 1a : 14% 21% 21% 62% 100 100 100 100 100 100 % % % % % % Metarhizium robertsii Sample 2a : Metarhizium 17% 17% 17% 20% 63% 80% 90% 97% 97% 97% brunneum Sample 3a : Metarhizium 16% 35% 35% 35% 39% 39% 52% 65% 65% 65% frigidum Sample 4a : Metarhizium 6% 13% 13% 13% 19% 32% 32% 58% 58% 58% anisopliae Table 3: Mortality rate of the insecticide-sensible larvae bed bugs per day [122] In view of the table 3, we note that the exposure of insecticide-sensible larvae of bed bugs to the strain of Metarhizium robertsii results in higher mortality rates than the exposure to the comparative samples; e.g. the strains of the other tested filamentous fungi: sample 3a (Metarhizium frigidum) and sample 4a (Metarhizium anisopliae). Indeed, for the strain of Metarhizium robertsii, a mortality of 100% of the bed bugs is reached 5 days after treatment, while the strains Metarhizium frigidum and Metarhizium anisopliae do not reach 100% efficacy and only show respectively 65% and 58% of mortality after 10 days of treatment. [123] The sample 2a, i.e. the strain of Metarhizium brunneum, also does not reach 100% efficacy, its maximal mortality rate is 97% and it was reached only after 8 days of treatment, i.e.3 days later than the strain of Metarhizium robertsii. [124] In conclusion, regarding mortality on insecticide-sensible larvae of bed bugs, the strain of Metarhizium robertsii is more efficient and acts faster than the strains of Metarhizium brunneum, Metarhizium frigidum and Metarhizium anisopliae. [125] In conclusion, the strain of Metarhizium robertsii has better results than known entomopathogenic fungus used for eradicating bed bugs on insecticide-sensible larvae of bed bugs. The strain of Metarhizium robertsii shows a 100% efficacy and acted faster than the other tested fungi even the sample 2a (i.e. the strain of Metarhizium brunneum). [126] III - Viability of fungal spores after storage at room temperature: [127] For industrial and general use purposes, it may be necessary to store the entomopathogenic fungus at room temperature for a few days before its use. This storage can have an impact on the viability of infectious spores, thereby influencing the effectiveness of the treatment against bed bug infestations. In addition, a reduction in the viability of spores at room temperature during treatment leads to a reduction in the efficacy of the enthomopathogenic fungus. Conversely, treatment effectiveness at room temperature will be maintained if spore viability remains high. [128] The viability of spores from the following strains of the entomopathogenic fungus which were: - sample 1b : strain of Metarhizium robertsii, - sample 2b : strain of Metarhizium brunneum, - sample 3b : strain of Metarhizium frigidum, was tested after various durations of storage at room temperature. [129] The sample 1b was the strain of Metarhizium robertsii CIRM-BRFM 2512 which was deposited as CNCM I-5850 as mentioned above. [130] The sample 2b was the strain Metarhizium brunneum 90448 F52, (strain designation : M.a. 43 [HRI 275.86] F52 - It is the strain disclosed in the above mentioned patent application WO 2014/117118 A1). [131] The sample 3b was the strain of Metarhizium frigidum Bischoff et Rehner 200614® (strain designation F-001 [DAT F-001]). [132] Viability was assessed daily between the 4th and 10th days of storage at room temperature. [133] To study the viability of fungal spores after storage at room temperature, fungal spores of each strain were first harvested from plates and filtration using Miracloth and the filtrates were diluted to obtain suspensions at a concentration of 103 spores/mL. [134] From these suspensions, the controls were established by spreading 100 µL of each suspension on PDA (Potato Dextrose Agar) plates, which were incubated at 25°C (3 replicates for each species). Falcon tubes containing 30 mL of spore suspensions at the concentration of 103 spores/mL were incubated at room temperature (19°C) for 10 days. Samples of 100 µL were taken 4, 5, 6, 7, 8, 9 and 10 days and spread (3 replicates per strain). After incubation at 25°C, the CFU (colony-forming unit) were determined. The viability percentage was then calculated for each strain over the incubation period. [135] The table 4 here below details the percentage of viability of the fungal spores per day of storage at room temperature for the 3 samples 1b to 3b. Percentage of viability of the fungal spores per day of storage at room temperature Experiment 0 4 5 6 7 8 9 10 Sample 1b : M. robertsii 100 85.2 78.9 69.5 63.7 58.4 45.0 35.6 Sample 2b : M. brunneum 100 50.4 29.5 16.1 7.3 5.3 3.2 1.3 Sample 3b : 100 94.3 75.1 45.7 29.9 15.8 13.5 9.0 M.frigidum Table 4 : Percentage of viability of the fungal spores per day of storage at room temperature [136] Figure 1 is a graph showing the profile of the percentage of viability of fungal spores per day of storage at room temperature for the samples 1b to 3b. [137] In view of the table 4 and the graph of the figure 1: - at 8 days of incubation, there is almost no viability with Metarhizium brunneum (5.3%) while 58.4% of Metarhizium robertsii spores were still viable ; - after 10 days of incubation at room temperature the spore’s viability of Metarhizium robertsii is greater than the spore’s viability of Metarhizium brunneum and Metarhizium frigidum (i.e., 35.6% versus 1.3% and 9%). [138] This example confirms that the strain of Metarhizium robertsii is more stable and efficient than the strains of Metarhizium brunneum and Metarhizium frigidum for treating bed bugs infestations. CLAIMS 1. A method for treating and/or preventing bed bug infestations which comprises a step of applying at least one entomopathogenic fungus belonging to the species Metarhizium robertsii or a composition containing at least one entomopathogenic fungus belonging to the species Metarhizium robertsii to a bed bug habitat. 2. The method according to claim 1, characterized in that the entomopathogenic fungus is a strain of Metarhizium robertsii which comprises both : - the internal transcribed spacer (“ITS”) ribosomal sequence as set forth in SEQ ID NO: 1 and - the translation elongation factor 1-alpha sequence as set forth in SEQ ID NO: 2. 3. The method according to claim 1 or 2, characterized in that the entomopathogenic fungus is a strain of Metarhizium robertsii CIRM- BRFM 2512 (deposited under the Budapest treaty as CNCM I-5850). 4. The method according to any one of claims 1 to 3, characterized in that the at least one entomopathogenic fungus belonging to the species Metarhizium robertsii is in a spore or mycelium form. 5. The method according to any one of the preceding claims, characterized in that said method comprises : - a step of applying the at least one entomopathogenic fungus belonging to the species Metarhizium robertsii in combination with at least one another entomopathogenic fungus, or - a step of applying a composition containing the at least one entomopathogenic fungus belonging to the species Metarhizium robertsii in combination with at least one another entomopathogenic fungus, to the bed bug habitat. 6. The method according to the preceding claim, characterized in that at least one another entomopathogenic fungus is selected in the group consisting of Isaria, Metacordyceps, Fusarium, Cordyceps, Beauveria, Metarhizium, Hirsutella, Aschersonia, Ophiocordyceps, Paecilomyces and Pochonia. 7. The method according to any one of the claims 5 to 6, characterized in that the composition comprises : - the at least one entomopathogenic fungus belonging to the species Metarhizium robertsii; - optionally the at least one another entomopathogenic fungus; - a carrier; - optionally at least one additional ingredient. 8. The method according to the claim 7, characterized in that the composition comprises, based on the total weight of said composition: - between 85.00 wt. % and 99.98 wt. %, preferably 85.00 wt. % to 95.00 wt. %, of the carrier; - between 0.02 wt. % and 15.00 wt. %, preferably between 5.00 wt. % to 15.00 wt. %, of the at least one entomopathogenic fungus belonging to the species Metarhizium robertsii and optionally the at least one another entomopathogenic fungus. 9. The method according to any one of the claims 7 to 8, characterized in that the additional ingredient is selected in the group consisting of biologically active ingredients, chemical insecticides, insect growth regulators, rheology modifying agents, preservatives, colorants, opacifiers, fragrances, fillers, pH adjusting agents, stabilizers, antioxidants, oxygen scavenger, wetting agents UV protectants, fillers, nutritive additives, and any combinations thereof. 10. The method according to the preceding claim, characterized in that the biologically active ingredient is a cuticle degrading enzyme. 11. The method according to the preceding claim, characterized in that the cuticle degrading enzyme is selected in the group consisting of proteases, peptidases, chitinases, chitosanases, cutinases, lipases, esterases, catalases, oxidases, oxygenases, dehydrogenases, and any combinations thereof. 12. The method according to any one of the claims 9 to 11, characterized in that the chemical insecticide is selected in the group consisting of pyrethroids, organophosphates, pyrethrins, neonicotinoids, carbamates, pyroles, and any combinations thereof.

Claims

13. A method for treating and/or preventing bed bugs infestations which comprises : - the carrying out of the method for treating and/or preventing bed bugs infestations according to any one of claims 1 to 12, and - a separate treatment which involves the use of at least one chemical insecticide to be applied to the bed bug habitat, said separate treatment being carried out before or after said method for treating and/or preventing bed bugs infestations according to any one of claims 1 to 12.
ABSTRACT Method for treating and/or preventing bed bug infestations The present invention relates to a method for treating and/or preventing bed bug infestations which comprises a step of applying at least one entomopathogenic fungus belonging to the species Metarhizium robertsii or a composition containing at least one entomopathogenic fungus belonging to the species Metarhizium robertsii to a bed bug habitat.
13. A method for treating and/or preventing bed bugs infestations which comprises :
- the carrying out of the method for treating and/or preventing bed bugs infestations according to any one of claims 1 to 12, and
- a separate treatment which involves the use of at least one chemical insecticide to be applied to the bed bug habitat, said separate treatment being carried out before or after said method for treating and/or preventing bed bugs infestations according to any one of claims 1 to 12.
EP24706427.2A 2023-02-21 2024-02-20 METHOD FOR THE TREATMENT AND/OR PREVENTION OF BED BUG INFESTATION Pending EP4669114A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP23305223.2A EP4420519A1 (en) 2023-02-21 2023-02-21 Method for treating and/or preventing bed bug infestations
PCT/EP2024/054231 WO2024175567A1 (en) 2023-02-21 2024-02-20 Method for treating and/or preventing bed bug infestations

Publications (1)

Publication Number Publication Date
EP4669114A1 true EP4669114A1 (en) 2025-12-31

Family

ID=85382763

Family Applications (2)

Application Number Title Priority Date Filing Date
EP23305223.2A Withdrawn EP4420519A1 (en) 2023-02-21 2023-02-21 Method for treating and/or preventing bed bug infestations
EP24706427.2A Pending EP4669114A1 (en) 2023-02-21 2024-02-20 METHOD FOR THE TREATMENT AND/OR PREVENTION OF BED BUG INFESTATION

Family Applications Before (1)

Application Number Title Priority Date Filing Date
EP23305223.2A Withdrawn EP4420519A1 (en) 2023-02-21 2023-02-21 Method for treating and/or preventing bed bug infestations

Country Status (2)

Country Link
EP (2) EP4420519A1 (en)
WO (1) WO2024175567A1 (en)

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9399050B2 (en) * 2000-10-04 2016-07-26 Paul Edward Stamets Controlling insects and arthropods using preconidial mycelium and extracts of preconidial mycelium from entomopathogenic fungi
WO2013116454A1 (en) * 2012-01-31 2013-08-08 The Penn State Research Foundation Compositions and methods for bed bug control using entomopathogenic fungi
MX2015009651A (en) * 2013-01-28 2016-05-31 Novozymes Bioag As Compositions and methods for treating pests.
CN109561693A (en) * 2016-07-13 2019-04-02 诺维信公司 Method for controlling the insect pest on poultry

Also Published As

Publication number Publication date
EP4420519A1 (en) 2024-08-28
WO2024175567A1 (en) 2024-08-29

Similar Documents

Publication Publication Date Title
Bhattacharjee et al. An overview of fungal and bacterial biopesticides to control plant pathogens/diseases
Kerry et al. Growth and survival of Verticillium chlamydosporium Goddard, a parasite of nematodes, in soil
CN1351652A (en) Strain of i(bacillus) pumilus for controlling plant diseases
Knudsen et al. Alginate pellet formulation of a Beauveria bassiana (Fungi: Hyphomycetes) isolate pathogenic to cereal aphids
CN104955336A (en) Compositions and methods for treating pests
Kim et al. Correlation of the aphicidal activity of Beauveria bassiana SFB-205 supernatant with enzymes
CN107418899B (en) A strain of Beauveria bassiana BbL25 for the control of red fire ants and its application
JP7607338B2 (en) Plant disease control agent and plant disease control method
JP4181638B2 (en) Biological control method
JP2006265226A (en) Insecticidal oil-based preparation containing insecticidal fungi
JP3454999B2 (en) Termite control agent and termite control method using the same
CN107384841A (en) A kind of microbial inoculum prevented and treated lepidoptera pest and preparation method thereof
US9526240B2 (en) Sprayable dispersed starch-based bioplastic formulation to control pests
CN108739804A (en) The preparation method of beauveria bassiana wettable powder
CN107258823A (en) A kind of beauveria bassiana granular formulation preparation method and applications of control of grubs
WO2024175567A1 (en) Method for treating and/or preventing bed bug infestations
US7790151B1 (en) Strain of the fungus Metarhizium anisopliae for controlling subterranean termites
JP4581410B2 (en) Insecticide oil
JP2020147540A (en) Pest control materials using insect parasites and pest control methods using them
KR102754253B1 (en) Novel trichoderma erinaceum jp2301 strain for antifungal activity, and industrial uses thereof
Whipps Department of Plant Pathology and Microbiology, Horticulture Research International, Wellesbourne, Warwick CV35 9EF, UK
CN1448502A (en) Green muscardine and use thereof
Myles Isolation of Metarhizium anisopliae (Deuteromycotina: Hyphomycetes) from Reticulitermes flavipes (Isoptera: Rhinotermitidae) with convenient methods for its culture and collection of conidia
Jones et al. Conidial quality of the biocontrol agent Coniothyrium minitans produced by solid-state cultivation in a packed-bed reactor
Bennett et al. Effect of combined treatment of pasteurisation and Coniothyrium minitans on sclerotia of Sclerotinia sclerotiorum in soil

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: UNKNOWN

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20250725

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR