COMPOUNDS AND METHODS FOR MODULATING ALPHA-SYNUCLEIN EXPRESSION
Sequence Listing
The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled BIOL0468SEQ.xml, created on February 2, 2024, which is 3,338 KB in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.
Field
Provided are compounds, pharmaceutical compositions, and methods for reducing the amount or activity of alpha-synuclcin (SNCA) RNA in a cell or subject, and in certain instances reducing the amount of alpha-synuclcin protein in a cell or subject. Such compounds, pharmaceutical compositions, and methods are useful to ameliorate at least one symptom or hallmark of a synucleinopathy (or alpha-synucleinopathy). Such symptoms and hallmarks include motor dysfunction, aggregation of alpha-synuclein, neurodegeneration, cognitive decline, dementia, sleep disorders, hyposmia, autonomic failure, ataxia, hallucination, and seizures. Such synucleinopathies include Parkinson’s disease, dementia with Lewy bodies (DLB), diffuse Lewy body disease, Parkinson’s disease dementia (PDD), pure autonomic failure, multiple system atrophy (MSA), neuronopathic Gaucher's disease, and Alzheimer’s disease.
Background
Alpha-synuclein is a small, highly charged 140-amino acid residue protein, predominantly expressed in central nervous system (CNS) neurons, where it is localized at presynaptic terminals in close proximity to synaptic vesicles (Iwai, et al., Neuron. 1995. 14: 467-475). Alpha-synuclein is encoded by the SNCA gene. Alpha-synuclein can associate with lipid membranes by forming amphipathic a-helices, as shown in vitro (Davidson, et al., J. Biol. Chem. 1998. 273: 9443-9449). Several studies suggest that alpha-synuclein is involved in modulating synaptic transmission, the density of synaptic vesicles, and neuronal plasticity (Cabin et al., J. Neurosci. 2002. 22: 8797-8807; Burre et al., Science. 2010. 329: 1663-1667; and Burre et al., J. Neurosci. 2015. 35: 5221-5232). It has been shown that SNCA inhibits synaptic vesicle release and disrupts the SNARE complex-mediated lipid membrane fusion (DeWitt et al., Biochemistry. 2013. 52: 2385-2387; Abeliovich et al., Neuron. 2000. 25: 239-252). Decreased SNARE-complex assembly is associated with neurological impairment, thus, indicating a link between presynaptic alpha-synuclein aggregates and neurodegeneration (Kramer and Schulz-Schaeffer, J. Neurosci. 2007. 27: 1405-1410). Knockout mouse models of alpha-synuclein are not lethal, and brain morphology is intact, suggesting that alpha-synuclein is not required for neuronal development and/or that compensatory pathways are present (Abeliovich et al.. Neuron. 2000. 25: 239-252).
Misfolding, aggregation, and fibrillation of alpha-synuclein are implicated as critical factors in several neurodegenerative diseases, including, Parkinson's disease, Lewy body variant of Alzheimer's disease, diffuse Lewy body disease, dementia with Lewy bodies, and multiple system atrophy (Schulz-Schaeffer, Acta Neuropathol. 2010. 120: 131-143; Yoshida. Neuropathology. 2007. 27: 484-493). In each of these cases, alpha-synuclein protein is misfolded and assembles in aggregates in Lewy bodies and Lewy neurites (Uversky. J. Neurochem. 2007. 103: 17-37).
Point mutations, genomic duplications, or genomic triplications in SNCA have been associated with Parkinson’s disease and other synucleinopathies. For example, six missense mutations in the SNCA gene have been
associated with autosomal dominant Parkinson’s disease ( A53T. A30P. E46K, H50Q, G5 ID. and A53E). The mutations are clustered within the membrane-binding domain, suggesting a contribution of this region to SNCA dysfunction. See. e.g., Bras et al., Cells. 2021. 10: 375.
Currently there is a lack of acceptable options for treating synucleinopathies such as Parkinson’s disease, dementia with Lewy bodies (DLB), diffuse Lewy body disease, Parkinson’s disease dementia (PDD), pure autonomic failure, multiple system atrophy (MSA), neuronopathic Gaucher's disease, and Alzheimer’s disease. It is therefore an objective herein to provide compounds, pharmaceutical compositions, and methods of use for the treatment of such synucleinopathies.
Summary
Provided herein are compounds, pharmaceutical compositions, and methods of use for reducing the amount or activity of SNCA RNA, and in certain embodiments reducing the amount of alpha-synuclein protein in a cell or subject. In certain embodiments, the subject has a synucleinopathy. In certain embodiments, the subject has Parkinson’s disease, dementia with Lewy bodies (DLB). diffuse Lewy body disease, Parkinson’s disease dementia (PDD). pure autonomic failure, multiple system atrophy (MSA), neuronopathic Gaucher's disease, or Alzheimer’s disease. In certain embodiments, compounds useful for reducing the amount or activity of SNCA RNA are oligomeric compounds. In certain embodiments, compounds useful for reducing the amount or activity of SNCA RNA are modified oligonucleotides. In certain embodiments, compounds useful for reducing tire amount of alpha-synuclein protein are oligomeric compounds. In certain embodiments, compounds useful for reducing tire amount of alpha-synuclein protein are modified oligonucleotides.
Also provided are methods useful for ameliorating at least one symptom or hallmark of a synucleinopathy. In certain embodiments, tire synucleinopathy is Parkinson’s disease, dementia with Lewy bodies (DLB). diffuse Lewy body disease, Parkinson's disease dementia (PDD), pure autonomic failure, multiple system atrophy (MSA), neuronopathic Gaucher's disease, or Alzheimer’s disease. In certain embodiments, the symptom or hallmark includes motor dysfunction, aggregation of alpha-synuclein, neurodegeneration, cognitive decline, dementia, sleep disorders, hyposmia, autonomic failure, ataxia, hallucination, or seizures. In certain embodiments, amelioration of one or more of these symptoms or hallmarks result in improved motor function, reduction of alpha-synuclein aggregates, slowed ncurodcgcncration, slowed cognitive decline, reduced dementia, improved sleep, improved sense of smell, slowed autonomic failure, slowed ataxia, reduced hallucination, and/or reduced seizures.
BRIEF DESCRIPTION OF THE DRAWINGS
Various aspects of the disclosure are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present disclosure will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the disclosure are utilized, and the accompanying drawings below.
FIG. 1 illustrates a duration of action study using illustrative modified oligonucleotides described herein.
FIG. 2 illustrates tissue concentration of exemplary modified oligonucleotides described herein.
FIG. 3 illustrates ASO concentration using illustrative modified oligonucleotides described herein.
Detailed Description
It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive. Herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of “or” means “and/or” unless stated otherwise. Furthermore, the use of the term “including” as well as other forms, such as “includes” and “included”, is not limiting. Also, terms such as “element” or “component” encompass both elements and components comprising one unit and elements and components that comprise more than one subunit, unless specifically stated otherwise.
The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, and treatises, are hereby expressly incorporated by reference for the portions of the document discussed herein, as well as in their entirety.
DEFINITIONS
Unless specific definitions are provided, the nomenclature used in coimection with, and the procedures and techniques of. analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well-known and commonly used in the art. Where permitted, all patents, applications, published applications and other publications and other data referred to throughout the disclosure are incorporated by reference herein in their entirety.
Unless otherwise indicated, the follow ing terms have the following meanings:
As used herein, “2’-deoxynucleoside" means a nucleoside comprising a 2’-H(H) deoxyribosyl sugar moiety. In certain embodiments, a 2’-deoxynucleoside is a 2’-p-D-deoxynucleoside and comprises a 2’-p-D-deoxyribosyl sugar moiety, which has the P-D ribosyl configuration as found in naturally occurring deoxyribonucleic acids (DNA). In certain embodiments, a 2 ’-deoxy nucleoside or a nucleoside comprising an unmodified 2’-deoxyribosyl sugar moiety may comprise a modified nucleobase or may comprise an RNA nucleobase (uracil).
As used herein, “2’-M0E” means a 2’-OCH2CH2OCH3 group in place of the 2'-OH group of a ribosyl sugar moiety . A “2 ’-MOE sugar moiety ” means a sugar moiety with a 2’-OCH2CH2OCH3 group in place of the 2’ -OH group of a ribosyl sugar moiety . Unless otherwise indicated, a 2’-M0E sugar moiety' is in the P-D configuration. “MOE” means O-mcthoxy ethyl.
As used herein, “2’-M0E nucleoside” or “2‘- O(CH2)2OCH3 nucleoside” means a nucleoside comprising a 2’- MOE sugar moiety' (or 2’-OCH2 CH2OCH3 ribosyl sugar moiety).
As used herein, “2’-0Me” means a 2’-OCH3 group in place of the 2’-OH group of a ribosyl sugar moiety'. A “2’-O-methyl sugar moiety” means a sugar moiety' with a 2’-OCH3 group in place of the 2’-OH group of a ribosyl sugar moiety. Unless otherwise indicated, a 2’-0Me has the P-D ribosyl stereochemical configuration.
As used herein, “2’-0Me nucleoside” means a nucleoside comprising a 2’-OMe sugar moiety.
As used herein, “2’-F” means a 2’-fluoro group in place of the 2’-OH group of a furanosyl sugar moiety. A “2’- F sugar moiety” means a sugar moiety' with a 2’-F group in place of the 2 ’-OH group of a furanosyl sugar moiety. Unless otherwise indicated, a 2’-F sugar moiety is in the P-D-ribosyl configuration.
As used herein, “2’-F nucleoside” means a nucleoside comprising a 2’-F modified sugar moiety.
As used herein, “2 ’-substituted nucleoside” means a nucleoside comprising a 2 ’-substituted furanosyl sugar moiety. As used herein, “2 ’-substituted” in reference to a sugar moiety means a sugar moiety comprising at least one 2'- substituent group other than H or OH.
As used herein, "5-melhylcylosine" means a cytosine modified with a methyl group attached to the 5 position. A 5-methylcytosine is a modified nucleobase.
As used herein, “abasic sugar moiety” means a sugar moiety that is not attached to a nucleobase. Such abasic sugar moieties are sometimes referred to in the art as “abasic nucleosides.”
As used herein, “administration” or “administering” means providing a pharmaceutical agent or composition to a subject.
As used herein, "ameliorate” in reference to a treatment means improvement in at least one symptom or hallmark relative to the same symptom or hallmark in tire absence of the treatment. In certain embodiments, amelioration is the reduction in the severity or frequency of a symptom or hallmark or the delayed onset or slowing of progression in the severity or frequency of a symptom or hallmark. In certain embodiments, the symptom or hallmark is motor dysfunction, aggregation of alpha-synuclein. neurodegeneration, cognitive decline, dementia, sleep disorders, hyposmia, autonomic failure, ataxia, hallucination, or seizures. The progression or severity of indicators may be determined by subjective or objective measures, which are known to those skilled in tire art.
As used herein, “antisense activity” means any detectable and/or measurable change attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or protein encoded by such target nucleic acid compared to target nucleic acid levels or target protein levels in the absence of tire antisense compound.
As used herein, “antisense agent” means an antisense compound and optionally one or more additional features, such as a sense compound.
As used herein, “antisense compound” means an antisense oligonucleotide and optionally one or more additional features, such as a conjugate group.
As used herein, “sense compound” means a sense oligonucleotide and optionally one or more additional features, such as a conjugate group.
As used herein, “antisense oligonucleotide” means an oligonucleotide, including the oligonucleotide portion of an antisense compound, that is capable of hybridizing to a target nucleic acid and is capable of at least one antisense activity. Antisense oligonucleotides include but are not limited to antisense RNAi oligonucleotides and antisense RNase H oligonucleotides.
As used herein, “sense oligonucleotide” means an oligonucleotide, including the oligonucleotide portion of a sense compound, that is capable of hybridizing to an antisense oligonucleotide. Sense oligonucleotides include, but are not limited to, sense RNAi oligonucleotides.
As used herein, “bicyclic nucleoside” or “BNA” means a nucleoside comprising a bicyclic sugar moiety.
As used herein, “bicyclic sugar” or “bicyclic sugar moiety” means a modified sugar moiety comprising two rings, wherein the second ring is formed via a bridge connecting two of the atoms in the first ring thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl sugar moiety. In certain embodiments, the furanosyl sugar moiety is a ribosyl sugar moiety. In certain embodiments, the bicyclic sugar moiety does not comprise a furanosyl sugar moiety.
As used herein, “blunt” or “blunt ended” in reference to an oligomeric duplex formed by two oligonucleotides means that there are no terminal unpaired nucleotides (i.e. no overhanging nucleotides). One or both ends of a doublestranded RNAi agent can be blunt.
As used herein, “cell-targeting moiety” means a conjugate moiety or portion of a conjugate moiety that is capable of binding to a particular cell type or particular cell types.
As used herein, “cerebrospinal fluid” or “CSF” means the fluid filling the space around the brain and spinal cord. “Artificial cerebrospinal fluid” or “aCSF” means a prepared or manufactured fluid that has certain properties (e.g., osmolarity. pH. and/or electrolytes) similar to cerebrospinal fluid and is biocompatible with CSF.
As used herein, “chirally enriched” in reference to a population means a plurality of molecules of identical molecular formula, wherein the number or percentage of molecules within the population that contain a particular stereochemical configuration at a particular chiral center is greater than tire number or percentage of molecules expected to contain tire same particular stereochemical configuration at the same particular chiral center within the population if the particular chiral center were stereorandom as defined herein. Chirally enriched populations of molecules having multiple chiral centers within each molecule may contain one or more stereorandom chiral centers. In certain embodiments, the molecules are modified oligonucleotides. In certain embodiments, the molecules are oligomeric compounds comprising modified oligonucleotides. In certain embodiments, the chiral center is at the phosphorous atom of a phosphorothioate intemucleoside linkage. In certain embodiments, the chiral center is at the phosphorous atom of a mesyl phosphoramidate intemucleoside linkage.
As used herein, “cleavable moiety” means a bond or group of atoms that is cleaved upon administration to a subject, for example, inside a cell, a subject, or a human.
As used herein, “complementary” in reference to an oligonucleotide means that at least 70% of the nucleobases of tire oligonucleotide or one or more portions thereof and the nucleobases of another nucleic acid or one or more portions thereof are capable of hydrogen bonding with one another when tire nucleobase sequence of the oligonucleotide and the other nucleic acid are aligned in opposing directions. As used herein, “complementary nucleobases” means nucleobases that are capable of forming hydrogen bonds with one another. Complementary' nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cy tosine (C) and guanine (G), 5 -methylcy tosine (mC) and guanine (G). Certain modified nucleobases that pair with unmodified nucleobases or with other modified nucleobases arc known in the art. For example, inosine can pair with adenosine, cytosine, or uracil. Complementary oligonucleotides and/or nucleic acids need not have nucleobase complementarity at each nucleoside. Rather, some mismatches are tolerated. As used herein, “fully complementary ” or “100% complementary ” in reference to an oligonucleotide, or a portion thereof, means that the oligonucleotide, or portion thereof, is complementary to another oligonucleotide or nucleic acid at each nucleobase of the shorter of the two oligonucleotides, or at each nucleoside if the oligonucleotides are the same length.
As used herein, “complementary region” in reference to an oligonucleotide is the range of nucleobases of the oligonucleotide that is complementary with a second oligonucleotide or target nucleic acid.
As used herein, “conjugate group” means a group of atoms directly attached to an oligonucleotide that confers at least one property to the resulting conjugated oligonucleotide. Conjugate groups comprise a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide.
As used herein, “conjugate linker” means a single bond or a group of atoms comprising at least one bond that connects a conjugate moiety to an oligonucleotide.
As used herein, “conjugate moiety” means a group of atoms that when covalently bound to a molecule modifies one or more properties of such molecule compared to the identical molecule lacking the conjugate moiety, wherein such properties include, but are not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance.
As used herein, "contiguous" in the context of an oligonucleotide refers to nucleosides, nucleobases, sugar moieties. or intemucleoside linkages that are immediately adjacent to each other. For example, “contiguous nucleobases” means nucleobases that are immediately adjacent to each other in a sequence.
As used herein, "constrained ethyl” or “cEf ’ or “cEt sugar moiety” means a 0-D ribosyl bicyclic sugar moiety wherein the second ring of the bicyclic sugar is fonned via a bridge connecting the 4 ’-carbon and the 2 ’-carbon of the |3- D ribosyl sugar moiety, wherein the bridge has the formula 4'-CH(CH3)-O-2'. and wherein the methyl group of the bridge is in the S configuration.
As used herein, “cEt nucleoside” means a nucleoside comprising a cEt sugar moiety.
As used herein, “deoxy region” means a region of 5-12 contiguous nucleotides, wherein at least 70% of the nucleosides comprise a 2 ’-deoxy sugar moiety. In certain embodiments, each nucleoside is selected from a 2’-p-D- deoxynucleoside, a bicyclic nucleoside, and a 2 ’-substituted nucleoside. In certain embodiments, a deoxy region supports RNase H activity. In certain embodiments, a deoxy region is tire gap or internal region of a gapmer.
As used herein, “diluent” means an ingredient in a composition that lacks pharmacological activity, but is pharmaceutically necessary' or desirable. For example, the diluent in an injected composition can be a liquid, e.g., aCSF, PBS, or saline solution.
As used herein, “double-stranded” in reference to a region or an oligonucleotide means a duplex formed by complementary strands of nucleic acids (including, but not limited to oligonucleotides) hybridized to one another. In certain embodiments, the two strands of a double-stranded region are separate molecules. In certain embodiments, the two strands are regions of the same molecule that lias folded onto itself (e.g., a hairpin structure).
As used herein, “duplex” or “duplex region” means the structure formed by two oligonucleotides or portions thereof that arc hybridized to one another.
As used herein, “gapmer” means a modified oligonucleotide comprising an internal region having a plurality of nucleosides that support RNase H cleavage positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions. The internal region may be referred to as the “gap” and the external regions may be referred to as the “wings” or “wing segments.” In certain embodiments, the internal region is a deoxy region. The positions of the internal region or gap refer to the order of tire nucleosides of the internal region and are counted starting from the 5 ’-end of tire internal region. Unless otherw ise indicated, “gapmef’ refers to a sugar motif. In certain embodiments, each nucleoside of the gap is a 2’-P-D-deoxynucleoside. In certain embodiments, the gap comprises one 2’-substituted nucleoside at position 1. 2, 3, 4, or 5 of the gap, and the remainder of the nucleosides of the gap are 2’-0- D-deoxynucleosides. As used herein, the term “MOE gapmer” indicates a gapmer having a gap comprising 2’-0-D- deoxynucleosides and wings comprising 2 ’-MOE nucleosides. As used herein, the term “mixed wing gapmer” indicates a gapmer having wings comprising modified nucleosides comprising at least two different sugar modifications. Unless
otherwise indicated, a gapmer may comprise one or more modified intemucleoside linkages and/or modified nucleobases and such modifications do not necessarily follow the gapmer pattern of the sugar modifications.
As used herein, “hotspot region” is a range of nucleobases on a target nucleic acid that is amenable to reduction of the amount or activity of the target nucleic acid by the action of an oligomeric agent, oligomeric compound, antisense compound, or antisense agent. Hotspot regions comprise at least one portion that is complementary to an active antisense oligonucleotide.
As used herein, "hybridization" means the annealing of oligonucleotides and/or nucleic acids. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an antisense compound and a nucleic acid target. In certain embodiments, complementary nucleic acid molecules include, but are not limited to. an oligonucleotide and a nucleic acid target.
As used herein, “intemucleoside linkage” means the covalent linkage between contiguous nucleosides in an oligonucleotide. As used herein, “modified intemucleoside linkage” means any intemucleoside linkage other than a phosphodiester intemucleoside linkage. “Phosphorothioate intemucleoside linkage” or "PS intemucleoside linkage” is a modified intemucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester intemucleoside linkage is replaced with a sulfur atom.
As used herein, “inverted nucleoside” means a nucleotide having a 3’ to 3’ and/or 5’ to 5’ intemucleoside linkage, as shown herein.
As used herein, “inverted sugar moiety" means the sugar moiety of an inverted nucleoside or an abasic sugar moiety having a 3’ to 3’ and/or 5 ‘ to 5’ intemucleoside linkage.
As used herein, “linked nucleosides” are nucleosides that are coimected in a contiguous sequence (i.e. , no additional nucleosides are presented between those that are linked).
As used herein, “linker-nucleoside” means a nucleoside that links, either directly or indirectly, an oligonucleotide to a conjugate moiety. Linker-nucleosides are located within the conjugate linker of an oligomeric compound. Linker-nucleosides are not considered part of the oligonucleotide portion of an oligomeric compound even if they arc contiguous with the oligonucleotide.
As used herein, “mismatch” or “non-complcmcntaiy” means a nuclcobasc of a first nucleic acid sequence that is not complementary with the corresponding nucleobase of a second nucleic acid sequence or target nucleic acid when the first and second nucleic acid sequences are aligned in opposing directions.
As used herein, “motif’ means the pattern of unmodified and/or modified sugar moieties, nucleobases, and/or intemucleoside linkages, in an oligonucleotide.
As used herein, “non-bicyclic modified sugar moiety” means a modified sugar moiety that comprises a modification, such as a substituent, that does not fomi a bridge betw een tw o atoms of the sugar to form a second ring.
As used herein, "nucleobase" means an unmodified nucleobase or a modified nucleobase. As used herein an “unmodified nucleobase” is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, a “modified nucleobase” is a group of atoms other than unmodified A, T. C, U, or G capable of pairing w ith at least one unmodified nucleobase. A “5-methylcytosine” is a modified nucleobase. A universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases.
As used herein, “nucleobase sequence” means the order of contiguous nucleobases in a nucleic acid or oligonucleotide independent of any sugar or intemucleoside linkage modification.
As used herein, “the nucleobase sequence of’ a reference SEQ ID NO, refers only to the nucleobase sequence provided in such SEQ ID NO and therefore, unless otherwise indicated, includes compounds wherein each sugar moiety and each intemucleoside linkage, independently, may be modified or unmodified, irrespective of the presence or absence of modifications, indicated in the referenced SEQ ID NO.
As used herein, “nucleoside” means a compound, or fragment of a compound, comprising a nucleobase and a sugar moiety. The nucleobase and sugar moiety are each, independently, unmodified or modified.
As used herein, “modified nucleoside” means a nucleoside comprising a modified nucleobase and/or a modified sugar moiety. “Linked nucleosides” are nucleosides that are connected in a contiguous sequence (i.e. , no additional nucleosides are presented between those that are linked).
As used herein, "oligomeric agent" means an oligomeric compound and optionally one or more additional features, such as a second oligomeric compound. An oligomeric agent may be a single-stranded oligomeric compound or may be an oligomeric duplex formed by two complementary oligomeric compounds.
As used herein, "oligomeric compound" means an oligonucleotide and optionally one or more additional features, such as a conjugate group or terminal group. An oligomeric compound may be paired with a second oligomeric compound that is complementary to the first oligomeric compound or may be unpaired. A “singled-stranded oligomeric compound” is an unpaired oligomeric compound.
The tern “oligomeric duplex” means a duplex fomred by two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound of an oligomeric duplex may be referred to as a “duplexed oligomeric compound.”
As used herein, "oligonucleotide" means a polymer of linked nucleosides comiected via intemucleoside linkages, wherein each nucleoside and intemucleoside linkage may be modified or unmodified. Unless otherwise indicated, oligonucleotides consist of 8-50 linked nucleosides.
As used herein, “modified oligonucleotide” means an oligonucleotide, wherein at least one nucleoside or intemucleoside linkage is modified. As used herein, “unmodified oligonucleotide” means an oligonucleotide that does not comprise any nucleoside modifications or intemucleoside modifications. An oligonucleotide may be paired with a second oligonucleotide that is complementary’ to the oligonucleotide or it may be unpaired. A “single-stranded oligonucleotide” is an unpaired oligonucleotide. A “double-stranded oligonucleotide” is an oligonucleotide that is paired with a second oligonucleotide.
As used herein, “pharmaceutically acceptable carrier or diluent” means any substance suitable for use in administering to a subject. Certain such carriers enable pharmaceutical compositions to be formulated as, for example, tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspension and lozenges for the oral ingestion by a subject. In certain embodiments, a pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer solution or sterile artificial cerebrospinal fluid.
As used herein “pharmaceutically acceptable salts” means physiologically and pharmaceutically acceptable salts of compounds. Pharmaceutically’ acceptable salts retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.
As used herein ‘"pharmaceutical composition” means a mixture of substances suitable for administering to a subject. For example, a pharmaceutical composition may comprise an oligomeric compound and a sterile aqueous solution. In certain embodiments, a pharmaceutical composition shows activity in free uptake assay in certain cell lines.
As used herein “prodrag” means an inactive or less active form of a compound which, when administered to a subject, is metabolized to form the active, or more active, compound. In certain embodiments, a prodrag comprises a cell-targeting moiety and at least one active compound.
As used herein, "reducing or inhibiting the amount or activity" refers to a reduction or blockade of the transcriptional expression or activity relative to the transcriptional expression or activity in an untreated or control sample and does not necessarily indicate a total elimination of transcriptional expression or activity.
As used herein. "RNA” means an RNA transcript and includes pre-mRNA and mature mRNA unless otherwise specified.
As used herein, "RNAi agent” means an antisense agent that acts, at least in part, through RISC or Ago2 to modulate a target nucleic acid and/or protein encoded by a target nucleic acid. RNAi agents include, but are not limited to double-stranded siRNA, single-stranded RNA (ssRNAi), and microRNA, including microRNA mimics. RNAi agents may comprise conjugate groups and/or terminal groups. In certain embodiments, an RNAi agent modulates the amount, activity, and/or splicing of a target nucleic acid. The tenn RNAi agent excludes antisense agents that act principally through RNase H.
As used herein, “RNase H agent” means an antisense agent that acts through RNase H to modulate a target nucleic acid and/or protein encoded by a target nucleic acid. In certain embodiments, RNase H agents are singlestranded. In certain embodiments, RNase H agents are double-stranded. RNase H agents may comprise conjugate groups and/or terminal groups. In certain embodiments, an RNase H agent modulates the amount and/or activity of a target nucleic acid. The tenn RNase H agent excludes antisense agents that act principally through RISC/Ago2.
As used herein, “antisense RNase H oligonucleotide” means an oligonucleotide comprising a region that is complementary to a target sequence, and which includes at least one chemical modification suitable for RNase Id- mediated nucleic acid reduction.
As used herein, “antisense RNAi oligonucleotide” means an oligonucleotide comprising a region that is complementary to a target sequence, and which includes at least one chemical modification suitable for RNAi-mcdiatcd nucleic acid reduction.
As used herein, “self-complementary” in reference to an oligonucleotide means an oligonucleotide that at least partially hybridizes to itself.
As used herein, “single-stranded” means a nucleic acid (including but not limited to an oligonucleotide) that is unpaired and is not part of a duplex. Single-stranded compounds are capable of hybridizing with complementary nucleic acids to form duplexes, at which point they are no longer single-stranded.
As used herein, “stabilized phosphate group” means a 5 ’-phosphate analog that is metabolically more stable than a 5 ’ -phosphate as naturally occurs on DNA or RNA.
As used herein, “standard in vitro assay” means the assay described in Example 1, 2, 3, 4, 5, 6, 7. or 8, and reasonable variations thereof.
As used herein, “standard in vivo assay” means the assay described in Example 10,11, 12, 13, 14. or 15. and reasonable variations thereof.
As used herein, “stereorandom” or “stereorandom chiral center” in the context of a population of molecules of identical molecular formula means a chiral center that is not controlled during synthesis, or enriched following synthesis, for a particular absolute stereochemical configuration. The stereochemical configuration of a chiral center is random when it is the result of a synthetic method that is not designed to control the stereochemical configuration. For example, in a population of molecules comprising a stereorandom chiral center, the number of molecules having the (S) configuration of the stereorandom chiral center may be the same as the number of molecules having the (R) configuration of the stereorandom chiral center (“racemic”). The stereochemical configuration of a chiral center is random when it is the result of a synthetic method that is not designed to control the stereochemical configuration. In certain embodiments, the stereorandom chiral center is at the phosphorous atom of a stereorandom phosphorothioate or mesyl phosphoramidate intemucleoside linkage.
As used herein, "subject” means a human or non-human animal. In certain embodiments, the subject is a human.
As used herein, “sugar moiety” means an unmodified sugar moiety or a modified sugar moiety. As used herein, “unmodified sugar moiety” means a 2’-0H(H) p-D-ribosyl sugar moiety, as found in RNA (an “unmodified RNA sugar moiety”), or a 2’-H(H) p-D-deoxyribosyl sugar moiety, as found in DNA (an “unmodified DNA sugar moiety”). Unmodified sugar moieties have one hydrogen at each of the 1’. 3 ’, and 4 ’ positions, an oxygen at the 3 ’ position, and two hydrogens at the 5’ position. As used herein, “modified sugar moiety” or “modified sugar” means a modified furanosyl sugar moiety or a sugar surrogate.
As used herein, "sugar surrogate" means a modified sugar moiety having other than a furanosyl moiety that can link a nucleobase to another group, such as an intemucleoside linkage, conjugate group, or terminal group in an oligonucleotide. Modified nucleosides comprising sugar surrogates can be incorporated into one or more positions within an oligonucleotide and such oligonucleotides are capable of hybridizing to complementary oligomeric compounds or target nucleic acids.
As used herein, “symptom or hallmark" means any physical feature or test result that indicates tire existence or extent of a disease or disorder. In certain embodiments, a symptom is apparent to a subject or to a medical professional examining or testing said subject. In certain embodiments, a hallmark is apparent upon invasive diagnostic testing, including, but not limited to, post-mortem tests. In certain embodiments, sy mptoms and hallmarks include motor dysfunction, aggregation of alpha-synuclcin, ncurodcgcncration, cognitive decline, dementia, sleep disorders, hyposmia, autonomic failure, ataxia, hallucination, or seizures.
As used herein, “target nucleic acid” and “target RNA” mean a nucleic acid that an antisense compound is designed to affect. Target RNA means an RNA transcript and includes pre-mRNA and mature mRNA unless otherwise specified.
As used herein, “target region” means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.
As used herein, “terminal group” means a chemical group or group of atoms that is covalently linked to a terminus of an oligonucleotide.
As used herein, “treating” means improving a subject’s disease or condition by administering an oligomeric agent or oligomeric compound described herein. In certain embodiments, treating a subject improves a symptom relative to the same symptom in the absence of the treatment. Tn certain embodiments, treatment reduces in the severity or
frequency of a symptom, or delays the onset of a symptom, slows the progression of a symptom, or slows the severity or frequency of a symptom.
As used herein, “therapeutically effective amount” means an amount of a pharmaceutical agent or composition that provides a therapeutic benefit to a subject. For example, a therapeutically effective amount improves a symptom of a disease.
CERTAIN EMBODIMENTS
The present disclosure provides the following non-limiting numbered embodiments:
Embodiment 1. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion of a SNCA nucleic acid, and wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar and a modified intemucleoside linkage.
Embodiment 2. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 12, at least 13, at least 14. at least 15, at least 16, at least 17, at least 18, at least 19, or 20 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 13- 3334, wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified intemucleoside linkage.
Embodiment 3. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11. at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18. at least 19, or 20 contiguous nucleobases complementary to: an equal length portion of nucleobases 16,692-16,716 of SEQ ID NO: 1 or nucleobases 18,758-18,782 of SEQ ID NO: 2; an equal length portion of nucleobases 18,568-18,593 of SEQ ID NO: 1 or nucleobases 20,634-20,659 of SEQ ID NO: 2; an equal length portion of nucleobases 18,621-18,649 of SEQ ID NO: 1 or nucleobases 20,687-20,715 of SEQ ID NO: 2; an equal length portion of nucleobases 18,721-18,752 of SEQ ID NO: 1 or nucleobases 20,787-20,818 of SEQ ID NO: 2; an equal length portion of nucleobases 19.423-19,443 of SEQ ID NO: 1 or nucleobases 21,489-21,509 of SEQ ID NO: 2; an equal length portion of nucleobases 19.555-19,575 of SEQ ID NO: 1 or nucleobases 21,621-21,641 of SEQ ID NO: 2; an equal length portion of nucleobases 21.457-21,501 of SEQ ID NO: 1 or nucleobases 23,523-23,567 of SEQ ID NO: 2; an equal length portion of nucleobases 22.008-22,030 of SEQ ID NO: 1 or nucleobases 24,074-24,096 of SEQ ID NO: 2; an equal length portion of nucleobases 22.507-22,529 of SEQ ID NO: 1 or nucleobases 24,573-24,595 of SEQ ID NO: 2;
an equal length portion of nucleobases 22.614-22,637 of SEQ ID NO: 1 or nucleobases 24,680-24,703 of SEQ ID NO: 2; an equal length portion of nucleobases 25.049-25,090 of SEQ ID NO: 1 or nucleobases 27, 115-27,156 of SEQ ID NO: 2; an equal length portion of nucleobases 26.367-26,388 of SEQ ID NO: 1 or nucleobases 28.433-28,454 of SEQ ID NO: 2; an equal length portion of nucleobases 26.508-26,531 of SEQ ID NO: 1 or nucleobases 28.574-28,597 of SEQ ID NO: 2; an equal length portion of nucleobases 30,207-30,226 of SEQ ID NO: 1 or nucleobases 32,273-32.292 of SEQ ID NO: 2; an equal length portion of nucleobases 31,412-31,438 of SEQ ID NO: 1 or nucleobases 33,478-33.504 of SEQ ID NO: 2; an equal length portion of nucleobases 33,027-33,057 of SEQ ID NO: 1 or nucleobases 35,093-35.123 of SEQ ID NO: 2; or an equal length portion of nucleobases 48,460-48,489 of SEQ ID NO: 1 or nucleobases 50,526-50.555 of SEQ ID NO: 2; wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified intemucleoside linkage.
Embodiment 4. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11. at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18. at least 19, or 20 contiguous nucleobases of:
SEQ ID NO: 78, 2564, 2697, 2747, 2789, 2936, 3063, 3081, 3142, 3189, or 3271;
SEQ ID NO: 206, 231, 270, 316, 2486, 2558, 3041, 3076, 3137, 3184, or 3266;
SEQ ID NO: 64, 128, 289, 921, 2744, 2853, 2922, 3031, 3057, 3099, 3123, 3132, 3160, 3207, 3231, 3289, or 3313;
SEQ ID NO: 227, 427, 545, 1214, 1279, 1385, 1401, 1476, 1616, 3048, 3115, 3176, or 3305;
SEQ ID NO: 203, 285, 1974, 2044, 2949, 3021, 3090, 3151, 3198, or 3280;
SEQ ID NO: 205, 2594, 2686, 3028, 3097, 3158, 3205, or 3287;
SEQ ID NO: 214, 247, 865, 1887, 1948, 3067, 3085, 3146, 3193, or 3275;
SEQ ID NO: 167, 208, 248, 304, 1930, 3054, 3120, 3129, 3228. or 3310;
SEQ ID NO: 196, 1814, 1909, 3042, 3109, 3170, 3217. or 3299;
SEQ ID NO: 171, 207, 245, 489, 2390, 3053, 3119, 3128, 3227. or 3309;
SEQ ID NO: 24, 133, 199, 228, 230, 276, 314. 946, 2759, 2818. 2873, 3069, 3087, 3148, 3195, or 3277;
SEQ ID NO: 168, 193, 236, 313, 2446, 3049, 3116, 3177, 3224. or 3306;
SEQ ID NO: 210, 223. 272, 273, 274. 1026, 1143, 3020, 3089, 3150, 3197, or 3279;
SEQ ID NO: 287, 964. 1040. 1154, 3050, 3117, 3178, 3225, or 3307;
SEQ ID NO: 119, 980. 1085. 1166, 3051, 3118, 3127, 3226, or 3308;
SEQ ID NO: 194, 277. 11 13. 1185, 1309, 3024, 3093, 3154, 3201. or 3283; or
SEQ ID NO: 310, 803. 919, 1582, 1674. 3032. 3032, 3032, 3100, 3161, 3208, 3290. or 3290; wherein the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified intemucleoside linkage.
Embodiment 5. The oligomeric compound of any of embodiments 1-4. wherein the modified oligonucleotide has a nucleobase sequence that is at least 85%, at least 90%, at least 95%. or 100% complementary to the nucleobase sequence of any one of SEQ ID NOs: 1-9 when measured across the entire nucleobase sequence of the modified oligonucleotide.
Embodiment 6. The oligomeric compound of any of embodiments 1-5, wherein the modified oligonucleotide consists of 12 to 20. 12 to 25. 12 to 30, 12 to 50. 13 to 20. 13 to 25, 13 to 30, 13 to 50. 14 to 20, 14 to 25, 14 to 30. 14 to 50. 15 to 20, 15 to 25, 15 to 30. 15 to 50, 16 to 18,16 to 20, 16 to 25. 16 to 30, 16 to 50, 17 to 20. 17 to 25, 17 to 30, 17 to 50, 18 to 20, 18 to 25. 18 to 30, 18 to 50, 19 to 20. 19 to 25, 19 to 30, 19 to 50. 20 to 25, 20 to 30, or 20 to 50 linked nucleosides.
Embodiment 7. The oligomeric compound of any of embodiments 1-6, wherein at least one nucleoside of the modified oligonucleotide is a modified nucleoside.
Embodiment 8. The oligomeric compound of embodiment 7, wherein the modified nucleoside comprises a modified sugar moiety.
Embodiment 9. The oligomeric compound of embodiment 8, wherein the modified sugar moiety comprises a bicyclic sugar moiety.
Embodiment 10. The oligomeric compound of embodiment 9, wherein the bicyclic sugar moiety comprises a 2’-4‘ bridge selected from -O-CH2-; and -O-CH(CH3)-.
Embodiment 11. The oligomeric compound of any of embodiments 7-10, wherein the modified nucleoside comprises a non-bicyclic modified sugar moiety.
Embodiment 12. The oligomeric compound of embodiment 11, wherein the non-bicyclic modified sugar moiety is a 2’-MOE sugar moiety, a 2’-OMe sugar moiety, a 2’-p-D-deoxyxylosyl sugar moiety, or a 2‘-a-L- dco.wribosyl sugar moiety.
Embodiment 13. The oligomeric compound of any of embodiments 7-12, wherein the modified nucleoside comprises a sugar surrogate.
Embodiment 14. The oligomeric compound of embodiment 13, wherein the sugar surrogate is any of morpholino, modified morpholino, glycol nucleic acid (GNA), six-membered tetrahydropyran (THP), and F-hexitol nucleic acid (F-HNA).
Embodiment 15. The oligomeric compound of any of embodiments 1-14, wherein the modified oligonucleotide is a gapmer.
Embodiment 16. The oligomeric compound of any of embodiments 1-15, wherein the modified oligonucleotide comprises at least one modified intemucleoside linkage.
Embodiment 17. The oligomeric compound of embodiment 16, wherein at least one intemucleoside linkage is a phosphodiester intemucleoside linkage.
Embodiment 18. The oligomeric compound of embodiment 16 or embodiment 17, wherein at least one modified intemucleoside linkage is a phosphorothioate intemucleoside linkage.
Embodiment 19. The oligomeric compound of any of embodiments 16-18, wherein at least one modified intemucleoside linkage is a mesyl phosphoramidate intemucleoside linkage.
Embodiment 20. The oligomeric compound of any of embodiments 16-19, wherein each intemucleoside linkage is independently selected from a phosphodiester intemucleoside linkage, a phosphorothioate intemucleoside linkage, and a mesyl phosphoramidate intemucleoside linkage.
Embodiment 21. The oligomeric compound of any of embodiments 16. 18, or 19, wherein each intemucleoside linkage is independently selected from a phosphorothioate intemucleoside linkage and a mesyl phosphoramidate intemucleoside linkage.
Embodiment 22. The oligomeric compound of any of embodiments 16-18. wherein each intemucleoside linkage is independently selected from a phosphodiester intemucleoside linkage and a phosphorothioate intemucleoside linkage.
Embodiment 23. The oligomeric compound of any of embodiments 16-22. wherein at least 4, at least 5. at least 6, at least 7. at least 8, at least 9, at least 10, at least 11, at least 12. at least 13, at least 14, at least 15, at least 16, at least 17. at least 18, or 19 intemucleoside linkages of the modified oligonucleotide are phosphorothioate intemucleoside linkages.
Embodiment 24. The oligomeric compound of any of embodiments 16-21, wherein at least 1, at least 2. at least 3, at least 4. at least 5, at least 6, at least 7. or at least 8 intemucleoside linkages of tire modified oligonucleotide are mesyl phosphoramidate intemucleoside linkages.
Embodiment 25. The oligomeric compound of any of embodiments 16-20, wherein the modified oligonucleotide lias an intemucleoside linkage motif selected from 5’- soossssssssssos -3’, 5’- soossssssssssoos -3‘, 5’- sooossssssssssos -3‘, 5’- sooossssssssssoos -3‘, 5’- soooossssssssssooos -3‘, 5’- soossssssssssooos -3‘, 5’- soossssssssssssss -3‘, 5’- sssssssssssssssssss -3’, 5’- sooooossssssssssoss -3’, 5‘- ssssszzzzssssssssss -3‘, 5’- soooszzzzssssssooss -3’, 5‘- sooosssssssssssooss -3’, 5‘- sosssssssssssssooss -3‘, 5’- sooosszzsssssoss -3’, 5’- sossssssssssssssoss -3‘, 5’- soosszzzzssssssooss -3‘, 5’- sossszzzzssssssooss -3’, 5’- sossszzzzsssssssoss -3’, 5’- sssssszsszzszssssss -3‘, 5’- ssssssssszzsssssoss -3’, 5‘- ssooszsssssszsssoss -3’, 5’- ssosszsssssszzssoss -3’, 5’- sssoszzzsssssssssss -3‘, 5’- ssoosszzsssssssosss -3’, 5’- ssssszzsssszzssssss -3’, 5’- sssssszssssszsssoss -3’, 5’- soossssssssssssooss -3’, 5’- sossszzsssszzssosss -3’, 5’- sossszzsssszzsssoss -3’, 5’- sossszzsssszzssssss -3’, 5’- ssssszzsssszzssooss -3’, 5’- ssssszssssszzssssss -3’, 5’- sssssszsssszzssssss -3‘, 5’- ssssszzssssszssssss -3’, 5‘- ssssszzsssszsssssss -3’, 5’- sossszssssszzssosss -3’, 5‘- sosssszsssszzssosss -3’, 5’- sossszzssssszssosss -3’, 5’- sossszzsssszsssosss -3‘, 5’- sossszssssszzsssoss -3’, 5’- sosssszsssszzsssoss -3’, 5‘- sossszzssssszsssoss -3’, 5’- sossszzsssszssssoss -3‘, 5’- szssszzsssszzsszzss -3’, 5’- zzssszzsssszzsssszz -3’, 5‘- zsssszzsssszzsssssz -3’, 5’- ssooszsssssszzssoss -3’, 5’- sssoszsssssszzssoss -3’. 5’- ssooszsssssszzsssss -3’, 5’- ssssszsssssszzssoss -3’, 5’- sssszzsssssszzsssss -3’. 5’- soooszzssssszssooss -3’, 5’- soooszzssssszzsooss -3’, 5’- ssooszzssssszssooss -3‘, 5’- ssooszzssssszzsooss -3’, 5’- sssoszzssssszssooss -3’, 5’- sssoszzssssszzsooss -3’, 5’- sssoszzssssszssosss -3’, and 5’- sssoszzssssszzsosss -3’, wherein each “s” represents a phosphorothioate intemucleoside linkage, each “o” represents a phosphodiester intemucleoside linkage, and each “z” represents a mesyl phosphoramidate intemucleoside linkage.
Embodiment 26. The oligomeric compound of any of embodiments 1-25. wherein at least one nucleoside of the modified oligonucleotide comprises a modified nucleobase.
Embodiment 27. The oligomeric compound of embodiment 26, wherein the modified nucleobase is a 5- methylcytosine.
Embodiment 28. The oligomeric compound of embodiment 27, wherein each cytosine is a 5-methylcytosine.
Embodiment 29. The oligomeric compound of any of embodiments 1-28. wherein each nucleoside of the modified oligonucleotide is unmodified adenine, unmodified guanine, unmodified thymine, unmodified cytosine, or 5- methylcytosine.
Embodiment 30. The oligomeric compound of any of embodiments 1-29, wherein the modified oligonucleotide comprises a deoxy region.
Embodiment 31. The oligomeric compound of embodiment 30. wherein each nucleoside of the deoxy region is a 2’-P-D-deoxynucleoside.
Embodiment 32. The oligomeric compound of embodiment 30 or embodiment 31, wherein the deoxy region consists of 6, 7, 8. 9. 10, or 6-10 linked nucleosides.
Embodiment 33. The oligomeric compound of any of embodiments 30-32. wherein each nucleoside immediately adjacent to the deoxy region comprises a modified sugar moiety.
Embodiment 34. The oligomeric compound of any of embodiments 30-33, wherein the deoxy region is flanked on the 5’-side by a 5’-region consisting of 1-6 linked 5’-region nucleosides and on the 3’-side by a 3’-region consisting of 1-6 linked 3 ’-region nucleosides: wherein at least one nucleoside of the 5’-region comprises a modified sugar moiety; and at least one nucleoside of the 3 ’-region comprises a modified sugar moiety.
Embodiment 35. The oligomeric compound of embodiment 34, wherein each nucleoside of the 5’-region comprises a modified sugar moiety.
Embodiment 36. The oligomeric compound of embodiment 34 or embodiment 35, wherein each nucleoside of the 3 ’-region comprises a modified sugar moiety.
Embodiment 37. The oligomeric compound of any of embodiments 1-36, wherein the modified oligonucleotide consists of 12-30, 12-22, 12-20,14-18, 14-20, 15-17, 15-25, 16-20, 18-22 or 18-20 linked nucleosides.
Embodiment 38. The oligomeric compound of any of embodiments 1-37, wherein the modified oligonucleotide consists of 20 linked nucleosides.
Embodiment 39. The oligomeric compound of any of embodiments 1-38, wherein the modified oligonucleotide comprises: a 5 ’-region consisting of 1-6 linked 5 ’-region nucleosides; a central region consisting of 6-10 linked central region nucleosides; and a 3 ’-region consisting of 1-6 linked 3 ’-region nucleosides; wherein each of tire 5’-region nucleosides and each of the 3’-region nucleosides comprises a modified sugar moiety and each of the central region nucleosides comprises a 2 ’-P-D-deoxy ribosyl sugar moiety.
Embodiment 40. The oligomeric compound of any of embodiments 1-39, wherein the modified oligonucleotide has a sugar motif comprising: a 5 ’-region consisting of 5 linked 5 ’-region nucleosides; a central region consisting of 10 linked central region nucleosides: and a 3 ’-region consisting of 5 linked 3 ’-region nucleosides; wherein
each of the 5’-region nucleosides and each of the 3’-region nucleosides comprises a modified sugar moiety and each of the central region nucleosides comprises a 2 ’-P-D-deoxy ribosyl sugar moiety.
Embodiment 41. The oligomeric compound of embodiment 40, wherein the modified oligonucleotide has a 5 ’-region consisting of 5 linked 5 ’-region nucleosides; a central region consisting of 10 linked central region nucleosides; and a 3 ’-region consisting of 5 linked 3 ’-region nucleosides; wherein each of the 5’-region nucleosides and each of the 3’-region nucleosides comprises a 2’-M0E sugar moiety and each of the central region nucleosides comprises a 2’-P-D-deoxyribosyl sugar moiety.
Embodiment 42. The oligomeric compound of any of embodiments 1-39, wherein the modified oligonucleotide has a sugar motif comprising: a 5 ’-region consisting of 6 linked 5 ’-region nucleosides; a central region consisting of 10 linked central region nucleosides; and a 3 ’-region consisting of 4 linked 3 ’-region nucleosides; wherein each of the 5’-region nucleosides and each of the 3’-region nucleosides comprises a modified sugar moiety and each of the central region nucleosides comprises a 2’-p-D-deoxyribosyl sugar moiety.
Embodiment 43. The oligomeric compound of embodiment 42, wherein the modified oligonucleotide has a 5 ’-region consisting of 6 linked 5 ’-region nucleosides; a central region consisting of 10 linked central region nucleosides; and a 3 ’ -region consisting of 4 linked 3 ’ -region nucleosides; wherein each of the 5‘-region nucleosides and each of tire 3’-region nucleosides comprises a 2’-MOE sugar moiety and each of the central region nucleosides comprises a 2 ’-p-D-deoxy ribosyl sugar moiety.
Embodiment 44. The oligomeric compound of any of embodiments 1-43, consisting of tire modified oligonucleotide.
Embodiment 45. The oligomeric compound of any of embodiments 1-43, wherein the oligomeric compound comprises a conjugate group.
Embodiment 46. The oligomeric compound of embodiment 45, wherein the conjugate group comprises a conjugate moiety’ and a conjugate linker.
Embodiment 47. The oligomeric compound of embodiment 46, wherein the conjugate linker is a phosphodiester linker.
Embodiment 48. The oligomeric compound of embodiment 46, wherein the conjugate linker consists of a single bond.
Embodiment 49. The oligomeric compound of any of embodiments 46 - 48, wherein the conjugate linker is cleavable.
Embodiment 50. The oligomeric compound of any of embodiments 46, 47, or 49, wherein the conjugate linker comprises 1-3 linker-nucleosides, wherein at least one linker nucleoside is linked to the conjugate moiety, to the modified oligonucleotide, or to another linker-nucleoside by a phosphodiester bond.
Embodiment 51. The oligomeric compound of any of embodiments 45-50, wherein the conjugate group is attached to the modified oligonucleotide at the 5 ’-end of the modified oligonucleotide.
Embodiment 52. The oligomeric compound of any of embodiments 45-50, wherein the conjugate group is attached to the modified oligonucleotide at the 3 ’-end of the modified oligonucleotide.
Embodiment 53. The oligomeric compound of any of embodiments 1-49 or 51 -52, wherein the oligomeric compound does not comprise linker-nucleosides.
Embodiment 54. The oligomeric compound of any of embodiments 1-53. comprising a terminal group.
Embodiment 55. The oligomeric compound of embodiment 54, wherein the terminal group is an abasic sugar moiety.
Embodiment 56. The oligomeric compound of any of embodiments 1-55, wherein the oligomeric compound is an RNase H agent.
Embodiment 57. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: AeS mCeSAeSGeSAeSTdzAdzTdzTdzTdsTdsTdsGdsTdsTds mCeSTesGeS mCeS mCe (SEQ ID NO: 3335), wherein:
A = an adenine nucleobase. mC = a 5-methylcytosine nucleobase,
G = a guanine nucleobase,
T = a thymine nucleobase, e = a 2 ’-MOE sugar moiety, d = a 2’-p-D-deoxyribosyl sugar moiety, s = a phosphorothioate intemucleoside linkage, and z = a mesyl phosphoramidate intemucleoside linkage; and wherein the oligomeric compound optionally comprises a conjugate group or a terminal group.
Embodiment 58. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: AeS ,nCeSGeOAeo,nCesAdzTdsTdsTdsTds mCdsTcisTdzGds mCcis mCeSTeomCeSTeSTe (SEQ ID NO: 3336), wherein:
A = an adenine nucleobase,
mC = a 5-methylcytosine nucleobase. G = a guanine nucleobase.
T = a thymine nucleobase. e = a 2’-MOE sugar moiety,
mC = a 5-methylcytosine nucleobase.
G = a guanine nucleobase.
T = a thymine nucleobase.
N1 = an adenine nucleobase. a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent, wherein when N1 is absent its sugar and intemucleoside linkage are also absent,
N3 = a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent, wherein when N3 is absent its sugar is also absent, e = a 2’-M0E sugar moiety. d = a 2’-P-D-deoxyribosyl sugar moiety. s = a phosphorothioate intemucleoside linkage. z = a mesyl phosphoramidate intemucleoside linkage, and o = a phosphodiester intemucleoside linkage; and wherein the oligomeric compound optionally comprises a conjugate group.
Embodiment 66. An oligomeric compound according to the following chemical notation:
N1eS mCesAeSGeSAesTcizAdzTcisTdsTdsTcisTdzGdzTdsTc|s mCeSTeSGeS mCeSN2e (SEQ ID NO: 3348), wherein:
A = an adenine nucleobase, mC = a 5-methylcytosine nucleobase,
G = a guanine nucleobase,
T = a thymine nucleobase,
N1 = an adenine nucleobase, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent, wherein when N1 is absent its sugar and intemucleoside linkage are also absent,
N2 = a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent, wherein when N2 is absent its sugar is also absent, e = a 2 ’-MOE sugar moiety, d = a 2’-p-D-deoxyribosyl sugar moiety, s = a phosphorothioate intemucleoside linkage, and z = a mesyl phosphoramidate intemucleoside linkage; and wherein the oligomeric compound optionally comprises a conjugate group.
Embodiment 67. An oligomeric compound according to the following chemical notation:
N1eSTeo,nCeoAeO n'CeOGeoAdS lnCdsAdSTdSTdSTdSTdS lnCdSTdSTdSGeomCes nlCesN3e (SEQ ID NO: 3349), wherein:
A = an adenine nucleobase, mC = a 5-methylcytosine nucleobase.
G = a guanine nucleobase,
T = a thymine nucleobase,
N1 = an adenine nucleobase. a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent, wherein when N1 is absent its sugar and intemucleoside linkage are also absent,
N3 = a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent, wherein when N3 is absent its sugar is also absent, e = a 2’-MOE sugar moiety,
d = a 2 ’-P-D-deoxj ribosyl sugar moiety, s = a phosphorothioate intemucleoside linkage, and o = a phosphodiester intemucleoside linkage; and wherein the oligomeric compound optionally comprises a conjugate group.
Embodiment 68. The oligomeric compound of any of embodiments 64-67, wherein N1 is an adenine nucleobase.
Embodiment 69. The oligomeric compound of any of embodiments 64-67, wherein N1 is an unmodified adenine.
Embodiment 70. The oligomeric compound of any of embodiments 64-67. wherein N1 is a modified adenine.
Embodiment 71. The oligomeric compound of any of embodiments 64-67. wherein N1 is a hypoxanthine.
Embodiment 72. The oligomeric compound of any of embodiments 64-67. wherein N1 is an abasic sugar moiety.
Embodiment 73. The oligomeric compound of any of embodiments 64-67. wherein N1 is a terminal group.
Embodiment 74. The oligomeric compound of any of embodiments 64-67. wherein N1 is absent.
Embodiment 75. The oligomeric compound of any of embodiments 64-74, wherein N2 is a modified cytosine.
Embodiment 76. The oligomeric compound of any of embodiments 64-74, wherein N2 is 5-methylcytosine.
Embodiment 77. The oligomeric compound of any of embodiments 64-74, wherein N2 is an unmodified cytosine.
Embodiment 78. The oligomeric compound of any of embodiments 64-74, wherein N2 is an abasic sugar moiety.
Embodiment 79. The oligomeric compound of any of embodiments 64-74, wherein N2 is a terminal group.
Embodiment 80. The oligomeric compound of any of embodiments 64-74, wherein N2 is absent.
Embodiment 81. The oligomeric compound of any of embodiments 64-74, wherein N3 is a modified thymine.
Embodiment 82. The oligomeric compound of any of embodiments 64-74, wherein N3 is an unmodified thymine.
Embodiment 83. The oligomeric compound of any of embodiments 64-74, wherein N3 is an abasic sugar moiety.
Embodiment 84. The oligomeric compound of any of embodiments 64-74, wherein N3 is a terminal group.
Embodiment 85. The oligomeric compound of any of embodiments 64-74, wherein N3 is absent.
Embodiment 86. The oligomeric compound of any of embodiments 64-80, wherein N1 is an adenine nucleobase and N2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent.
Embodiment 87. The oligomeric compound of any of embodiments 64-80 or 86, wherein N1 is an adenine nucleobase and N2 is a modified cytosine.
Embodiment 88. The oligomeric compound of any of embodiments 64-80 or 86, wherein N1 is an adenine nucleobase and N2 is an abasic sugar moiety.
Embodiment 89. The oligomeric compound of any of embodiments 64-80 or 86, wherein N1 is an adenine nucleobase and N2 is a terminal group.
Embodiment 90. The oligomeric compound of any of embodiments 64-80 or 86, wherein N1 is an adenine nucleobase and N2is absent.
Embodiment 91. The oligomeric compound of any of embodiments 64-80, wherein N1 is a modified adenine and N2is a cytosine nucleobase. a modified cytosine, an abasic sugar moiety, a terminal group, or is absent.
Embodiment 92. The oligomeric compound of any of embodiments 64-80 or 91 , wherein N1 is a modified adenine and N2is a modified cytosine.
Embodiment 93. The oligomeric compound of any of embodiments 64-80 or 91, wherein N1 is a modified adenine and N2 is 5-methylcytosine.
Embodiment 94. The oligomeric compound of any of embodiments 64-80 or 91, wherein N1 is a modified adenine and N2 is an abasic sugar moiety.
Embodiment 95. The oligomeric compound of any of embodiments 64-80 or 91, wherein N1 is a modified adenine and N2 is a terminal group.
Embodiment 96. The oligomeric compound of any of embodiments 64-80 or 91, wherein N1 is a modified adenine and N2 is absent.
Embodiment 97. The oligomeric compound of any of embodiments 64-80 or 91, wherein N1 is a hypoxanthine and N2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent.
Embodiment 98. The oligomeric compound of any of embodiments 64-80 or 97, wherein N1 is a hypoxanthine and N2 is a modified cytosine.
Embodiment 99. The oligomeric compound of any of embodiments 64-80 or 97, wherein N1 is a hypoxanthine and N2 is 5-methylcytosine.
Embodiment 100. The oligomeric compound of any of embodiments 64-80 or 97, wherein N1 is a hypoxanthine and N2 is an abasic sugar moiety.
Embodiment 101. The oligomeric compound of any of embodiments 64-80 or 97, wherein N1 is a hypoxanthine and N2 is a terminal group.
Embodiment 102. The oligomeric compound of any of embodiments 64-80 or 97, wherein N1 is a hypoxanthine and N2 is absent.
Embodiment 103. The oligomeric compound of any of embodiments 64-80, wherein N1 is an abasic sugar moiety and N2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety , a terminal group, or is absent.
Embodiment 104. The oligomeric compound of any of embodiments 64-80, wherein N1 is a terminal group and N2 is a cy tosine nucleobase, a modified cy tosine, an abasic sugar moiety, a terminal group, or is absent.
Embodiment 105. The oligomeric compound of any of embodiments 64-80, wherein N1 is absent and N2is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent.
Embodiment 106. The oligomeric compound of any of embodiments 64-80, wherein N1 is absent and N2is absent.
Embodiment 107. The oligomeric compound of any of embodiments 64-74 or 81-85, wherein N1 is an adenine nucleobase and N3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent.
Embodiment 108. The oligomeric compound of any of embodiments 64-74, 81-85, or 107. wherein N1 is an adenine nucleobase and N3 is a thymine nucleobase.
Embodiment 109. The oligomeric compound of any of embodiments 64-74, 81-85, or 107. wherein N1 is an adenine nucleobase and N3is a modified thymine.
Embodiment 110. The oligomeric compound of any of embodiments 64-74, 81-85, or 107. wherein N1 is an adenine nucleobase and N3 is an abasic sugar moiety.
Embodiment 111. The oligomeric compound of any of embodiments 64-74. 81 -85, or 107. wherein N1 is an adenine nucleobase and N3 is a terminal group.
Embodiment 112. The oligomeric compound of any of embodiments 64-74. 81-85, or 107. wherein N1 is an adenine nucleobase and N3 is absent.
Embodiment 113. The oligomeric compound of any of embodiments 64-74 or 81-85, wherein N1 is a modified adenine and N3 is a thymine nucleobase. a modified thymine, an abasic sugar moiety, a terminal group, or is absent.
Embodiment 114. The oligomeric compound of any of embodiments 64-74, 81-85, or 113, wherein N1 is a modified adenine and N3 is an unmodified thymine.
Embodiment 115. The oligomeric compound of any of embodiments 64-74, 81-85, or 113, wherein N1 is a modified adenine and N3 is an abasic sugar moiety.
Embodiment 116. The oligomeric compound of any of embodiments 64-74, 81-85, or 113, wherein N1 is a modified adenine and N3 is a terminal group.
Embodiment 117. The oligomeric compound of any of embodiments 64-74, 81-85, or 113, wherein N1 is a modified adenine and N3 is absent.
Embodiment 118. The oligomeric compound of any of embodiments 64-74 or 81-85, wherein N1 is a hypoxanthine and N3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent.
Embodiment 119. The oligomeric compound of any of embodiments 64-74, 81-85, or 118, wherein N1 is a hypoxanthine and N3 is an unmodified thymine.
Embodiment 120. The oligomeric compound of any of embodiments 64-74, 81-85, or 118, wherein N1 is a hypoxanthine and N3 is an abasic sugar moiety.
Embodiment 121. The oligomeric compound of any of embodiments 64-74, 81-85, or 118, wherein N1 is a hypoxanthine and N3 is a terminal group.
Embodiment 122. The oligomeric compound of any of embodiments 64-74, 81-85, or 118, wherein N1 is a hypoxanthine and N3 is absent.
Embodiment 123. The oligomeric compound of any of embodiments 64-74 or 81-85, wherein N1 is an abasic sugar nioiely and N3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety’, a terminal group, or is absent.
Embodiment 124. The oligomeric compound of any of embodiments 64-74 or 81-85, wherein N1 is a terminal group and N3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent.
Embodiment 125. The oligomeric compound of any of embodiments 64-74 or 81-85, wherein N1 is absent and N3 is a thymine nucleobase. a modified thymine, an abasic sugar moiety, a terminal group, or is absent.
Embodiment 126. The oligomeric compound of any of embodiments 64-74 or 81-85, wherein N1 is absent and N3 is absent.
Embodiment 127. The oligomeric compound of any of embodiments 64-126, wherein the conjugate group comprises a conjugate moiety’ and a conjugate linker.
Embodiment 128. The oligomeric compound of embodiment 127, wherein the conjugate linker is a phosphodiester linker.
Embodiment 129. The oligomeric compound of embodiment 127, wherein the conjugate linker consists of a single bond.
Embodiment 130. The oligomeric compound of any of embodiments 127-129, wherein the conjugate linker is cleavable.
Embodiment 131. The oligomeric compound of any of embodiments 127. 128, or 130. wherein the conjugate linker comprises 1-3 linker-nucleosides, wherein at least one linker nucleoside is linked to the conjugate moiety, to the oligomeric compound, or to another linker-nucleoside by a phosphodiester bond.
Embodiment 132. The oligomeric compound of any of embodiments 64-131. wherein the conjugate group is attached to the oligomeric compound at the 5 ’-end of the oligomeric compound.
Embodiment 133. The oligomeric compound of any of embodiments 64-131. wherein the conjugate group is attached to the oligomeric compound at the 3 ’-end of the oligomeric compound.
Embodiment 134. The oligomeric compound of any of embodiments 64-133. wherein the oligomeric compound is a pharmaceutically acceptable salt.
Embodiment 135. The oligomeric compound of embodiment 133. wherein the pharmaceutically acceptable salt comprises one or more cations selected from sodium, potassium, calcium, and magnesium.
Embodiment 136. An oligomeric duplex, comprising a first oligomeric compound and a second oligomeric compound comprising a second modified oligonucleotide, wherein the first oligomeric compound is an oligomeric compound of any of embodiments 1-135.
Embodiment 137. The oligomeric duplex of embodiment 136, wherein the second modified oligonucleotide consists of 12 to 50 linked nucleosides, and wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to an equal length portion of Hie first modified oligonucleotide.
Embodiment 138. The oligomeric duplex of embodiment 136 or embodiment 137, wherein the modified oligonucleotide of tire first oligomeric compound comprises a 5 ‘-stabilized phosphate group.
Embodiment 139. The oligomeric duplex of embodiment 138, wherein the stabilized phosphate group comprises a cyclopropyl phosphonate or a vinyl phosphorate.
Embodiment 140. The oligomeric duplex of any of embodiments 136-139, wherein at least one nucleoside of the second modified oligonucleotide comprises a modified sugar moiety’.
Embodiment 141. The oligomeric duplex of embodiment 140. wherein the modified sugar moiety' of the second modified oligonucleotide comprises a bicyclic sugar moiety.
Embodiment 142. The oligomeric duplex of embodiment 141. wherein the bicyclic sugar moiety’ of the second modified oligonucleotide comprises a 2 ‘-4’ bridge selected from -O-CH2-; and -O-CH(CH3)-.
Embodiment 143. The oligomeric duplex of embodiment 140. wherein the modified sugar moiety of the second modified oligonucleotide comprises a non-bicyclic modified sugar moiety.
Embodiment 144. The oligomeric duplex of embodiment 143. wherein the non-bicyclic modified sugar moiety of the second modified oligonucleotide is a 2’-MOE sugar moiety, a 2’-F modified sugar moiety, or 2’-OMe modified sugar moiety.
Embodiment 145. The oligomeric duplex of any of embodiments 136-144, wherein at least one intemucleoside linkage of the second modified oligonucleotide is a modified intemucleoside linkage.
Embodiment 146. The oligomeric duplex of embodiment 145. wherein at least one modified intemucleoside linkage of the second modified oligonucleotide is a phosphorothioate intemucleoside linkage.
Embodiment 147. The oligomeric duplex of any of embodiments 136-146, wherein at least one intemucleoside linkage of the second modified oligonucleotide is a phosphodiester intemucleoside linkage.
Embodiment 148. The oligomeric duplex of any of embodiments 145-147, wherein at least one intemucleoside linkage of the second modified oligonucleotide is a mesyl phosphoramidate intemucleoside linkage.
Embodiment 149. The oligomeric duplex of any of embodiments 136-148, wherein each intemucleoside linkage of tire second modified oligonucleotide is independently selected from a phosphodiester intemucleoside linkage, a phosphorothioate intemucleoside linkage, or a mesyl phosphoramidate intemucleoside linkage.
Embodiment 150. The oligomeric duplex of any of embodiments 136-149. wherein the second modified oligonucleotide comprises at least one modified nucleobase.
Embodiment 151. The oligomeric duplex of embodiment 150, wherein the at least one modified nucleobase of the second modified oligonucleotide is 5-methylcytosine.
Embodiment 152. The oligomeric duplex of any of embodiments 136-151, wherein the second modified oligonucleotide comprises a conjugate group.
Embodiment 153. The oligomeric duplex of embodiment 152, wherein the conjugate group comprises a conjugate moiety and a conjugate linker.
Embodiment 154. The oligomeric duplex of embodiment 153, wherein the conjugate linker consists of a single bond.
Embodiment 155. The oligomeric duplex of embodiment 153 or embodiment 154, wherein the conjugate linker is cleavable.
Embodiment 156. The oligomeric duplex of embodiment 153 or embodiment 155, wherein the conjugate linker comprises 1-3 linker-nucleosides, wherein at least one linker nucleoside is linked to the conjugate moiety, to the modified oligonucleotide, or to another linker-nucleoside by a phosphodiester bond.
Embodiment 157. The oligomeric duplex of any of embodiments 153-156, wherein the conjugate linker is a phosphodiester linker.
Embodiment 158. The oligomeric duplex of any of embodiments 152-157, wherein the conjugate group is attached to the 5 ’-end of the second modified oligonucleotide.
Embodiment 159. The oligomeric duplex of any of embodiments 152-157, wherein the conjugate group is attached to the 3 ’-end of the second modified oligonucleotide.
Embodiment 160. The oligomeric duplex of any of embodiments 152-157, wherein the conjugate group is attached via the 2’ position of a ribosyl sugar moiety at an internal position of the second modified oligonucleotide.
Embodiment 161. The oligomeric duplex of any of embodiments 152-160, wherein the conjugate group comprises a C22 alkyl, C20 alkyl, C16 alkyl. CIO alkyl. C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl. C13 alkyl. C12 alkyl. Cl 1 alkyl, C9 alkyl, C8 alkyl. C7 alkyl, C6 alkyl. C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl. CIO alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C17 alkenyl, C15 alkenyl, C14 alkenyl. C13 alkenyl. C12 alkenyl. Cl 1 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.
Embodiment 162. The oligomeric duplex of any of embodiments 152-161, wherein the conjugate group comprises a cell-targeting moiety.
Embodiment 163. The oligomeric duplex of any of embodiments 136-162, wherein the second modified oligonucleotide comprises a terminal group.
Embodiment 164. The oligomeric duplex of embodiment 163. wherein the terminal group is an abasic sugar moiety. Embodiment 165. An antisense agent comprising or consisting of an antisense compound, wherein the antisense compound is the oligomeric compound of any of embodiments 1-135.
Embodiment 166. An antisense agent, wherein the antisense agent is the oligomeric duplex of any of embodiments 136-164.
Embodiment 167. The antisense agent of embodiment 165 or embodiment 166. wherein the antisense agent is: i) an RNase H agent capable of reducing the amount of SNCA nucleic acid through the activation of
RNase H; or ii) an RN Ai agent capable of reducing the amount of SNCA nucleic acid through the activation of
RISC/Ago2.
Embodiment 168. The antisense agent of any of embodiments 165-167, wherein the antisense agent comprises a conjugate group, and wherein the conjugate group comprises a cell-targeting moiety.
Embodiment 169. A modified oligonucleotide according to the following chemical structure:
(SEQ ID NO: 3335). or a pharmaceutically acceptable salt thereof.
Embodiment 170. A modified oligonucleotide according to the following chemical structure:
(SEQ ID NO: 3336), or a pharmaceutically acceptable salt thereof.
T1
Embodiment 172. A modified oligonucleotide according to the following chemical structure:
(SEQ ID NO: 3338). or a pharmaceutically acceptable salt thereof.
Embodiment 173. The modified oligonucleotide of any of embodiments 169-172, which is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium.
Embodiment 177. A modified oligonucleotide according to the following chemical structure:
(SEQ ID NO: 3338).
Embodiment 178. A population of oligomeric compounds of any of embodiments 1-135 or a population of modified oligonucleotides of any of embodiments 169-177. wherein the population is chirally enriched for modified oligonucleotides comprising at least one particular phosphorothioate intemucleoside linkage having a particular stereochemical configuration.
Embodiment 179. The population of embodiment 178, wherein the population is chirally enriched for modified oligonucleotides comprising at least one particular phosphorothioate intemucleoside linkage having tire (S'p) configuration.
Embodiment 180. The population of embodiment 178, wherein the population is chirally enriched for modified oligonucleotides comprising at least one particular phosphorothioate intemucleoside linkage having tire (Ap) configuration.
Embodiment 181. The population of embodiment 178, wherein the population is chirally enriched for modified oligonucleotides having a particular, independently selected stereochemical configuration at each phosphorothioate intemucleoside linkage.
Embodiment 182. The population of embodiment 178, wherein the population is chirally enriched for modified oligonucleotides having the (.S'p) configuration at each phosphorothioate intemucleoside linkage or for modified oligonucleotides having the (7?p) configuration at each phosphorothioate intemucleoside linkage.
Embodiment 183. The population of embodiment 178, wherein the population is chirally enriched for modified oligonucleotides having the (Rp) configuration at one particular phosphorothioate intemucleoside linkage and the (.S'p) configuration at each of the remaining phosphorothioate intemucleoside linkages.
Embodiment 184. The population of embodiment 178, wherein the population is chirally enriched for modified oligonucleotides having at least 3 contiguous phosphorothioate intemucleoside linkages in the .S'p, S'p. and 7?p configurations, in the 5’ to 3’ direction.
Embodiment 185. A population of oligomeric compounds of any of embodiments 1-135, modified oligonucleotides of any of embodiments 169-177, oligomeric duplexes of any of embodiments 136-164, or antisense agents of any of embodiments 165-168, wherein all of the phosphorothioate intemucleoside linkages of the modified oligonucleotide are stereorandom.
Embodiment 186. A population of oligomeric compounds of any of embodiments 1-135, modified oligonucleotides of any of embodiments 169-177, oligomeric duplexes of any of embodiments 136-164, or antisense agents of any of embodiments 165-168, wherein all of the mesyl phosphoramidate intemucleoside linkages of the modified oligonucleotide are stereorandom.
Embodiment 187. A pharmaceutical composition comprising an oligomeric compound of any of embodiments 1-135, a modified oligonucleotide of any of embodiments 169-177, an oligomeric duplex of any of embodiments 136- 164, an antisense agent of any of embodiments 165-168, or a population of any of embodiments 178-186, and a pharmaceutically acceptable diluent.
Embodiment 188. The pharmaceutical composition of embodiment 187, wherein the pharmaceutically acceptable diluent is artificial cerebral spinal fluid (aCSF) or phosphate-buffered saline (PBS).
Embodiment 189. The pharmaceutical composition of embodiment 188, wherein the pharmaceutical composition consists essentially of the oligomeric compound of any of embodiments 1-135, the modified oligonucleotide of any of embodiments 169-177, the oligomeric duplex of any of embodiments 136-164, the antisense agent of any of embodiments 165-168, or the population of any of embodiments 178-186, and aCSF.
Embodiment 190. The pharmaceutical composition of embodiment 188, wherein the pharmaceutical composition consists essentially of the oligomeric compound of any of embodiments 1-135, the modified oligonucleotide of any of embodiments 169-177, the oligomeric duplex of any of embodiments 136-164, the antisense agent of any of embodiments 165-168, or the population of any of embodiments 178-186, and PBS.
Embodiment 191. A method comprising administering to a subject an oligomeric compound of any of embodiments 1-135, a modified oligonucleotide of any of embodiments 169-177, an oligomeric duplex of any of embodiments 136-164, an antisense agent of any of embodiments 165-168, a population of any of embodiments 178- 186, or a pharmaceutical composition of any of embodiments 187-190.
Embodiment 192. The method of embodiment 191. wherein the subject lias or is at risk of developing a synucleinopathy.
Embodiment 193. The method of embodiment 191. wherein the subject lias or is at risk of developing Parkinson’s disease.
Embodiment 194. The method of embodiment 191. wherein the subject has or is at risk of developing multiple system atrophy (MSA).
Embodiment 195. The method of embodiment 191. wherein the subject has or is at risk of developing dementia with Lewy bodies (DLB). diffuse Lewy body disease. Parkinson’s disease dementia (PDD), pure autonomic failure, neuronopathic Gaucher's disease, or Alzheimer’s disease.
Embodiment 196. A method of treating a synucleinopathy comprising administering to a subject having or at risk of developing a synucleinopathy a therapeutically effective amount of an oligomeric compound of any of embodiments 1-135. a modified oligonucleotide of any of embodiments 169-177. an oligomeric duplex of any of embodiments 136-164, an antisense agent of any of embodiments 165-168. a population of any of embodiments 178- 186, or a pharmaceutical composition of any of embodiments 187-190.
Embodiment 197. The method of embodiment 196, wherein tire synucleinopathy is Parkinson’s disease, dementia with Lewy bodies (DLB). diffuse Lewy body disease, Parkinson’s disease dementia (PDD). pure autonomic failure, multiple system atrophy (MSA), neuronopathic Gaucher's disease, or Alzheimer’s disease.
Embodiment 198. The method of embodiment 196, wherein tire synucleinopathy is Parkinson’s disease.
Embodiment 199. The method of embodiment 196, wherein tire synucleinopathy is multiple system atrophy (MSA).
Embodiment 200. The method of any of embodiments 196-199, wherein at least one symptom or hallmark of synucleinopathy is ameliorated.
Embodiment 201. The method of embodiment 200, wherein the symptom or hallmark is motor dysfunction, aggregation of alplia-synuclein. neurodegeneration, cognitive decline, dementia, sleep disorders, hyposmia, autonomic failure, ataxia, hallucination, or seizures.
Embodiment 202. The method of any of embodiments 196-201, wherein administering tire oligomeric compound of any of embodiments 1-135, the modified oligonucleotide of any of embodiments 169-177, the oligomeric duplex of any of embodiments 136-164, tire antisense agent of any of embodiments 165-168, the population of any of embodiments 178-186, or the pharmaceutical composition of any of embodiments 187-190 reduces or delays the onset or progression of motor dysfunction, aggregation of alp ha-sy nuclein, neurodegeneration, cognitive decline, dementia, sleep disorders, hyposmia, autonomic failure, ataxia, hallucination, or seizures.
Embodiment 203. The method of any of embodiments 191-202, wherein the oligomeric compound of any of embodiments 1-135, tire modified oligonucleotide of any of embodiments 169-177, the oligomeric duplex of any of embodiments 136-164, the antisense agent of any of embodiments 165-168, the population of any of embodiments 178- 186, or the pharmaceutical composition of any of embodiments 187-190 is administered to the central nervous system or systemically.
Embodiment 204. The method of any of embodiments 191-203, wherein the oligomeric compound of any of embodiments 1-135, the modified oligonucleotide of any of embodiments 169-177, the oligomeric duplex of any of embodiments 136-164, the antisense agent of any of embodiments 165-168, the population of any of embodiments 178- 186, or the pharmaceutical composition of any of embodiments 187-190 is administered intrathecally.
Embodiment 205. The method of any of embodiments 191-204, wherein the subject is a human.
Embodiment 206. A method of reducing expression of SNCA in a cell comprising contacting the cell with oligomeric compound of any of embodiments 1-135, a modified oligonucleotide of any of embodiments 169-177, an
oligomeric duplex of any of embodiments 136-164. an antisense agent of any of embodiments 165-168, a population of any of embodiments 178-186. or a pharmaceutical composition of any of embodiments 187-190.
Embodiment 207. The method of embodiment 206. wherein the cell is a brain cell.
Embodiment 208. The method of embodiment 206 or embodiment 207. wherein the cell is a neuron or an oligodendrocyte.
Embodiment 209. The method of any of embodiments 206-208, wherein the cell is a human cell.
Embodiment 210. Use of oligomeric compound of any of embodiments 1-135, a modified oligonucleotide of any of embodiments 169-177, an oligomeric duplex of any of embodiments 136-164, an antisense agent of any of embodiments 165-168, a population of any of embodiments 178-186, or a pharmaceutical composition of any of embodiments 187-190 for treating a synucleinopathy.
Embodiment 211. Use of oligomeric compound of any of embodiments 1-135, a modified oligonucleotide of any of embodiments 169-177, an oligomeric duplex of any of embodiments 136-164, an antisense agent of any of embodiments 165-168, a population of any of embodiments 178-186, or a pharmaceutical composition of any of embodiments 187-190 for the manufacture of a medicament for treating a synucleinopathy.
Embodiment 212. The use of embodiment 210 or embodiment 211, wherein the synucleinopathy is Parkinson’s disease, dementia with Lewy bodies (DLB), diffuse Lewy body disease, Parkinson’s disease dementia (PDD), pure autonomic failure, multiple system atrophy (MSA), neuronopathic Gaucher's disease, or Alzheimer’s disease.
Embodiment 213. The use of embodiment 210 or embodiment 211, wherein the synucleinopathy is Parkinson’s disease.
Embodiment 214. The use of embodiment 210 or embodiment 211, wherein the synucleinopathy is multiple system atrophy (MSA).
I. Certain Oligonucleotides
In certain embodiments, provided herein are oligomeric compounds comprising oligonucleotides, w hich consist of linked nucleosides. Oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or may be modified oligonucleotides. Modified oligonucleotides comprise at least one modification relative to unmodified RNA or DNA. That is, modified oligonucleotides comprise at least one modified nucleoside (comprising a modified sugar moiety and/or a modified nuclcobasc) and/or at least one modified intcmuclcosidc linkage. Certain modified nucleosides and modified intemucleoside linkages suitable for use in modified oligonucleotides are described below.
A. Certain Modified Nucleosides
Modified nucleosides comprise a modified sugar moiety or a modified nucleobase or both a modified sugar moiety7 and a modified nucleobase. In certain embodiments, modified nucleosides comprising the following modified sugar moieties and/or the following modified nucleobases may be incorporated into oligonucleotides.
1. Certain Sugar Moieties
In certain embodiments, modified sugar moieties are non-bicyclic modified sugar moieties. In certain embodiments, modified sugar moieties are bicyclic or tricyclic sugar moieties. In certain embodiments, modified sugar moieties are sugar surrogates. Such sugar surrogates may comprise one or more substitutions corresponding to those of other types of modified sugar moieties.
In certain embodiments, modified sugar moieties are non-bicyclic modified furanosyl sugar moieties comprising one or more acyclic substituent, including, but not limited to, substituents at the 2’, 3’, 4’, and/or 5’ positions. Tn certain embodiments, the furanosyl sugar moiety is a ribosyl sugar moiety. In certain embodiments, one or more acyclic substituent of non-bicyclic modified sugar moieties is branched.
In certain embodiments, non-bicyclic modifed sugar moieties comprise a substituent group at the 2 ’-position. Examples of substituent groups suitable for the 2’-position of modified sugar moieties include but are not limited to: -F. -OCH3 (“OMe” or “O-methyl”), and -OCH2CH2OCH3 (“MOE”). In certain embodiments. 2 ’-substituent groups are selected from among: halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3. O-Ci-Cio alkoxy. O-Ci-Cio substituted alkoxy. O-Ci-Cio alkyl, O-Ci-Cio substituted alkyl. S-alkyl. N(Rm)-alkyl. O-alkenyl, S-alkenyl, N(Rm)-alkenyl, O- alkynyl, S-alkynyl, N(Rm)-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl. O-alkaiyl. O-aralkyl. O(CH2)2SCH3. O(CH2)2ON(Rm)(Rn) or OCH2C(=O)-N(Rm)(Rn). where each Rm and Rn is, independently. H, an amino protecting group, or substituted or unsubstituted Ci-Cio alkyl, -O(CH2)2ON(CH3)2 (“DMAOE”), or 2’-O(CH2)2O(CH2)2N(CH3)2 (“DMAEOE”). And the 2’-substituent groups described in Cook et al.. U.S. 6,531,584; Cook et al.. U.S. 5,859,221; and Cook et al.. U.S. 6,005,087
Synthetic methods for some of these 2 ’-substituent groups can be found in ,e.g., Cook et al., U.S. 6,531,584; and Cook et al., U.S. 5,859,221. Certain embodiments of these 2’-substituent groups can be further substituted with one or more substituent groups independently selected from among: hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl and alkynyl.
In certain embodiments, a 2 ‘-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2 ‘-substituent group selected from: F, NH2, N3, OCF3> OCH3, O(CH2)3NH2, CH2CH=CH2, OCH2CH=CH2, OCH2CH2OCH3, O(CH2)2SCH3. O(CH2)2ON(Rm)(Rn), O(CH2)2O(CH2)2N(CH3)2, and N-substituted acetamide (OCH2C(=O)-N(Rm)(Rn)), where each Rm and Rn is, independently, H, an amino protecting group, or substituted or unsubstituted Ci-Cio alkyl.
In certain embodiments, a 2 ’-substituted sugar moiety of a modified nucleoside comprises 2 ‘-substituent group selected from: F, OCF3, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, O(CH2)2ON(CH3)2 (“DMAOE”), O(CH2)2O(CH2)2N(CH3)2 (“DMAEOE”), and OCH2C(=O)-N(H)CH3 (“NMA”).
In certain embodiments, a 2 ’-substituted non-bicyclic modified nucleoside comprises a sugar moiety comprising a non-bridging 2 ‘-substituent group selected from: F, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, and OCH2C(=O)-N(H)CH3 (“NMA”).
In certain embodiments, a 2 ’-substituted sugar moiety of a modified nucleoside comprises 2 ‘-substituent group selected from: F, OCH3, and OCH2CH2OCH3.
In certain embodiments, modified furanosyl sugar moieties and nucleosides incorporating such modified furanosyl sugar moieties are further defined by isomeric configuration. For example, a 2’-deoxyfuranosyl sugar moiety may be in seven isomeric configurations other than the naturally occurring 0-D-deoxyribosyl configuration. Such modified sugar moieties are described in, e.g., W02020/072991. A 2’-modified sugar moiety has an additional stereocenter at the 2’-position relative to a 2’-deoxyfuranosyl sugar moiety; therefore, such sugar moieties have a total of sixteen possible isomeric configurations. Modified furanosyl sugar moieties described herein are in the P-D-ribosyl isomeric configuration unless otherwise specified.
In certain embodiments, non-bicyclic modified sugar moieties are stereoisomers of DNA, such as 2’-0-D- deoxyxylosyl sugar moiety:
In certain embodiments, a non-bicyclic modified nucleoside comprises a 2’-a-L-deoxyribosyl sugar moiety:
In certain embodiments, non-bicyclic modified sugar moieties comprise a substituent group at the 4 ’-position. Examples of substituent groups suitable for the 4’-position of modified sugar moieties include, but are not limited to. alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al.. WO 2015/106128.
In certain embodiments, non-bicyclic modified sugar moieties comprise a substituent group at the 3 ’-position. Examples of substituent groups suitable for the 3 ’-position of modified sugar moieties include, but are not limited to. alkoxy (e.g., methoxy), alkyl (e.g., methyl, ethyl).
In certain embodiments, non-bicyclic modified sugar moieties comprise a substituent group at the 5 ’-position. Examples of substituent groups suitable for the 5’-position of modified sugar moieties include, but are not limited to. vinyl, alkoxy (e.g., methoxy), and alkyl (e g., methyl (R or S'), ethyl).
In certain embodiments, non-bicyclic modified sugar moieties comprise more than one non-bridging sugar substituent, for example, 2’-F-5’-methyl sugar moieties, such as described in Migawa et al., US2010/0190837, or alternative 2’- and 5’-modified sugar moieties as described inRajeev et al., US2013/0203836.
In naturally occurring nucleic acids, sugars are linked to one another 3’ to 5’. In certain embodiments, oligonucleotides include one or more nucleoside or sugar moiety linked at an alternative position, for example at the 2‘ position or inverted 5’ to 3’. For example, where the linkage is at the 2’ position, the 2 ’-substituent groups may instead be at the 3 ’-position.
Certain modified sugar moieties comprise a substituent that bridges two atoms of the furanosyl ring to form a second ring, resulting in a bicyclic sugar moiety. In certain embodiments, the bicyclic sugar moiety comprises a bridge between the 4’ and the 2’ furanose ring atoms. Examples of such 4’ to 2’ bridging sugar substituents include, but arc not limited to: 4’-CH2-2’, 4’-(CH2)2-2’, 4‘-(CH2)3-2’, 4’-CH2-O-2’ (“LNA”), 4’-CH2-S-2’, 4’-(CH2)2-O-2’ (“ENA”), 4’- CH(CH3)-O-2’ (referred to as “constrained ethyl” or “cEt” when in the S configuration), 4’-CH2-O-CH2-2’, 4’-CH2- N(R)-2’, 4’-CH(CH2OCH3)-O-2’ (“constrained MOE” or“cMOE”) and analogs thereof, 4’-C(CH3)(CH3)-O-2’ and analogs thereof, 4’-CH2-N(OCH3)-2’ and analogs thereof , 4’-CH2-O-N(CH3)-2’ , 4’-CH2-C(H)(CH3)-2’, 4’-CH2- C(=CH2)-2’ and analogs thereof ), 4’-C(RaRb)-N(R)-O-2’. 4’-C(RaRb)-O-N(R)-2’, 4’-CH2-O-N(R)-2’. and 4’-CH2-N(R)- 0-2’, wherein each R, Ra, and Rbis, independently, H, a protecting group, or C1-C12 alkyl. Representative U.S. patents
that teach the preparation of such bicyclic sugar moieties include, but are not limited to: Imanishi et al., U.S. 7.427.672; Swayze et al., U.S. 7.741.457, and Swayze et al., U.S. 8,022,193; Seth et al., U.S. 8,278,283; Prakash et al., U.S. 8,278,425; Seth et al., U.S. 8,278,426).
In certain embodiments, such 4’ to 2’ bridges independently comprise from 1 to 4 linked groups independently selected from: -[C(Ra)(Rb)]n-, -[C(Ra)(Rb)]n-O-. -C(Ra)=C(Rb)-, -C(Ra)=N-, -C(=NRa)-. -C(=O)-, -C(=S)-, -O-, -Si(Ra)2-. -S(=O)x-, and -N(Ra)-; wherein: x is 0, 1, or 2; n is 1, 2, 3. or 4; each Ra and Rb is. independently. H, a protecting group, hydroxyl. C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl. substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJi, NJ1J2, SJi, N3, COOJi. acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-Ji), or sulfoxyl (S(=O)-Ji); and each Ji and J2 is, independently, H, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl. substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, acyl (C(=O)- H). substituted acyl, a heterocycle radical, a substituted heterocycle radical, C1-C12 aminoalkyl, substituted C1-C12 aminoalkyl, or a protecting group.
Additional bicyclic sugar moieties are known in the art, see, for example: Wan. et al., J. Medicinal Chemistry, 2016, 59, 9645-9667; Wengel et al.. U.S. 8,080,644; Ramasamy et al., U.S. 6,525,191; Seth et al., U.S. 7,547,684; and Seth et al., U.S. 7,666,854.
In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration. For example, an LNA nucleoside (described herein) may be in the a-L configuration or in the p-D configuration.
LNA (p-D-configuration) a-L-LNA (a-Z-configuration) bridge = 4'-CH2-O-2' bridge = 4'-CH2-O-2' a-L-methyleneoxy (4’-CH2-O-2’) or a-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). The addition of locked nucleic acids to siRNAs has been shown to increase siRNA stability' in serum, and to reduce off-target effects (Ehnen. J. et al., (2005) Nucleic Acids Research 33(1)439-447; Mook, OR. et al., (2007) Mol. Cane. Ther. 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193). Herein, general descriptions of bicyclic nucleosides include both isomeric configurations. When the positions of specific bicyclic nucleosides (e g., LNA or cEt) are identified in exemplified embodiments herein, they are in the p-D configuration, unless otherwise specified.
In certain embodiments, modified sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5 ’-substituted and 4’-2‘ bridged sugars).
In certain embodiments, modified sugar moieties are sugar surrogates. In certain such embodiments, the oxygen atom of the sugar moiety is replaced, e.g., with a sulfur, carbon or nitrogen atom. In certain such embodiments, such modified sugar moieties also comprise bridging and/or non-bridging substituents as described herein. For example, certain sugar surrogates comprise a 4’-sulfur atom and a substitution at the 2'-position and/or the 5’ position.
In certain embodiments, sugar surrogates comprise rings having other than 5 atoms. For example, in certain embodiments, a sugar surrogate comprises a six-membered tetrahydropyran (“THP”). Such tetrahydropyrans may be farther modified or substituted. Nucleosides comprising such modified tetrahydropyrans include, but are not limited to, hexitol nucleic acid (“HNA”), anitol nucleic acid (“ANA”), manitol nucleic acid (“MNA”), fluoro HNA:
F-HNA
(“F-HNA”, see e.g., Egli, et. al, J Am Chem (2011) 133(41):16642-16649, Swayze et al, U.S. 8,088,904; and Swayze et al, U.S. 8,440,803) F-HNA can also be referred to as a F-THP or 3'-fluoro tetrahydropyran, and nucleosides comprising additional modified THP compounds having the formula:
wherein, independently, for each of said modified THP nucleoside:
Bx is a nucleobase moiety:
T3 and T4 are each, independently, an intemucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide or one of T3 and T4 is an intemucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide and the other of T3 and T4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5' or 3'-terminal group; qi, q3, q3, q4, q3, qeand q? are each, independently, H, Ci-Ce alkyl, substituted Ci-Ce alkyl, CT-C’e alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, or substituted C2-C6 alkynyl; and each of Ri and R2 is independently selected from among: hydrogen, halogen, substituted or unsubstituted alkoxy, NJi J2, SJi, N3, OC(=X)JI, OC(=X)NJIJ2, NJ3C(=X)NJI J2, and CN, wherein X is O, S or NJi, and each Ji, J2, and J3 is, independently, H or Ci-Ce alkyl.
In certain embodiments, modified THP nucleosides are provided wherein qi, q2, q3, q4, q3, qe and q? are each H. In certain embodiments, at least one of qi, q3, q3, q4, qs, qe and q? is other than H. In certain embodiments, at least one of qi, q2, q3, q4, qe, qeand q- is methyl. In certain embodiments, modified THP nucleosides are provided wherein one of Ri and R2 is F. In certain embodiments, Ri is F and R2 is H, in certain embodiments, Ri is methoxy' and R2 is H. and in certain embodiments, Ri is methoxy ethoxy and R2 is H.
In certain embodiments, sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom. For example, nucleosides comprising morpholino sugar moieties and their use in oligonucleotides have been reported. As used here, the term “morpholino” means a sugar surrogate having the following structure:
In certain embodiments, morpholinos may be modified, for example, by adding or altering various substituent groups from the above morpholino structure. Such sugar surrogates are referred to herein as “modified morpholinos.”
In certain embodiments, sugar surrogates comprise acyclic moieties. Examples of nucleosides and oligonucleotides comprising such acy clic sugar surrogates include, but are not limited to: peptide nucleic acid (“PNA”), acyclic butyl nucleic acid ), and nucleosides and oligonucleotides described in Manoharan et al., U.S. 10,913,767. Representative U.S. patents that teach tire preparation of PNA compounds include, but are not limited to, U.S. Patent Nos. 5,539,082; 5,714,331; and 5.719.262.
In certain embodiments, sugar surrogates are the “unlocked” sugar structure of UNA (unlocked nucleic acid) nucleosides. UNA is a nucleoside wherein any of the bonds of tire sugar moiety has been removed, forming an unlocked sugar surrogate. A representative U.S. publication that teaches the preparation of UNA includes, but is not limited to. US Patent Publication No 2011/0313020.
In certain embodiments, sugar surrogates are the glycerol as found in GNA (glycol nucleic acid) nucleosides as depicted below: 6S)-GNA
where Bx represents any nucleobase.
Many other bicyclic and tricyclic sugar and sugar surrogates are known in the art that can be used in modified nucleosides.
2. Certain Modified Nucleobases
In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising an unmodified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside that does not comprise a nucleobase, referred to as an abasic nucleoside. In certain embodiments, modified oligonucleotides comprise one or more inosine nucleosides (i.e., nucleosides comprising a hypoxanthine nucleobase). An “unmodified nucleobase” is
adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). A modified nucleobase is a group of atoms other than unmodified A, T, C, U, or G capable of pairing with at least one other nucleobase. A 5-methylcytosine is an example of a modified nucleobase. A universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases.
In certain embodiments, modified adenine has structure (I):
wherein: R2A is H. Ci-Ce alkyl, substituted Ci-Ce alky l, Ci-Ce thioalkyl, or substituted Ci-Ce thioalkyl, Ci-Ce alkyloxy, or substituted Ci -Cs alkyloxy; R6A is H, N(Ra)(Rb), acetyl, formyl, or O-phenyl; Y7A is N and R7A is absent or is Ci -Ce alkyl; or Y7A is C and R7A is selected from H, Ci -Ce alkyl, or CN(Ra)(Rb); Y8A is N and R8A is absent, or Y8A is C and R8A is selected from H, a halogen, OH, Ci-Ce alkyl, or substituted Ci-Ce alkyl; Ra and Rb are independently selected from H, Ci-Ce alkyl, substituted Ci-C6 alkyl, Ci-C6 alkenyl, substituted Ci-C6 alkenyl, acetyl, formyl, or together form a 5-7 -membered heterocycle; excluding where Y7A is N; Y8A is C, R8A is H. R2A is H, and R6A is NH2 (unmodified adenine).
In certain embodiments, modified guanine has structure (II):
II wherein: R2G is N(Ra)(Rb); R6G is oxo and R1G is H, or R6G is selected from O-Ci-C,, alky l or S-Ci-Ce alkyl and R1G is absent; Y7G is N and R7A is absent or is Cj-C6 alkyd; or Y7G is C and R7G is selected from H, Ci-C6 alky l, or CN(Ra)(Rb); Y8G is N and R8Gis absent, or Y8G is C and R8G is selected from H, a halogen, OH, Ci-C6 alky l, or substituted Ci-Cg alky 1; Ra and Rb are independently selected from H, Ci-Ce alky 1, substituted Ci-Ce alky 1, Ci-Cg alkenyl, substituted Ci-Cg alkenyl, acetyl, formyl, or together form a 5-7 -membered heterocycle; excluding where Y7G is N; Y8G is C, R8G is H, R2G is NH2, and R6G is =O (unmodified guanosine).
In certain embodiments, modified thymine or modified uracil has structure (III):
wherein: X is selected from O or S and R" is selected from H. OH. halogen. O-Ci -Ci 2 alkyl, O-Ci -Ci 2 substituted alkyl, C1-C12 alkyl , substituted C1-C12 alkyl. C1-C12 alkenyl, substituted C1-C12 alkenyl; wherein if each X is O, R5U is not H or CH3 (unmodified uracil and unmodified thymine, respectively).
In certain embodiments, modified cytosine has structure (IV):
IV wherein: X is selected from O or S, R4Cis N(Ra)(Rb); R5C is selected from H, OH. halogen, O-C1-C12 alkyl, O- C1-C12 substituted alky l, C1-C12 alkyl . substituted C1-C12 alkyd, C1-C12 alkeny l, substituted C1-C12 alkenyl; Ra and Rb are independently selected from H, Ci-Cg alky l, substituted Ci-Ce alky l, Ci-Ce alkeny l, substituted Ci-Ce alkeny l, acetyl, formyl, or together form a 5-7 -membered heterocycle; excluding where X is O, R4C is NH2 and RbC is H (unmodified cytosine).
In certain embodiments, modified nucleobases are selected from: 5-substituted pyrimidines, 6-azapyrimidines. alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and 0-6 substituted purines. In certain embodiments, modified nucleobases are selected from: 5-methylcytosine, 2-aminopropyladenine, 5-hydroxymethyl cytosine, xanthine, hypoxanthine. 2-aminoadenine. 6-N-methylguanine, 6-N-methyladenine. 2-propyladenine. 2- thiouracil. 2-thiothymine and 2-thiocytosine, 5-propynyl (-C=C-CH ,) uracil. 5-propynylcytosine, 6-azouraciL 6- azocytosine. 6-azothymine, 5-ribosyluracil (pseudouracil). 4-thiouracil. 8-halo, 8-amino, 8-thiol, 8-thioalkyl. 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo (particularly 5-bromo), 5 -trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine. 2-F-adenine. 2-aminoadenine. 7-deazaguanine. 7 -deazaadenine, 3 -deazaguanine. 3- deazaadenine. 6-N-benzoyladenine. 2-N-isobutyrylguanine. 4-N-benzoylcytosine. 4-N-benzoyluracil. 5-methyl 4-N- benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines, such as 1.3-diazaphenoxazine- 2-one, l,3-diazaphenothiazine-2-one and 9-(2-aminoethoxy)-l,3-diazaphenoxazine-2-one (G-clamp). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include those disclosed in Englisch et al., Angewandte Chemie, International Edition, 1991, 30. 613; Sanghvi, Y.S., Chapter 15,
Antisense Research and Applications, Crooke, S.T. and Lebien, B.. Eds., CRC Press, 1993. 273-288; and those disclosed in Chapters 6 and 15. Antisense Drug Technology, Crooke S T., Ed., CRC Press, 2008, 163-166 and 442-443.
Publications that teach the preparation of certain of the above noted modified nucleobases. as well as other modified nucleobases include without limitation, Rogers et al.. U.S. 5,134,066 ; Benner et al., U.S. 5,432,272; Matteucci et al., U.S. 5,502,177 ; Froehler et al., U.S. 5.594.121 ; and Cook et al., U.S. 5,681,941.
In certain embodiments, each nucleobase of a modified oligonucleotide of the invention is selected from A, G. C, T, U. and mC.
In certain embodiments, each nucleobase of a modified oligonucleotide of the invention is selected from A. G, T, and mC (i.e., unmodified purines and 5-methyl pyrimidines).
3. Certain Modified Internucleoside Linkages
The naturally occurring intemucleoside linkage of RNA and DNA is a 3' to 5' phosphodiester linkage. In certain embodiments, nucleosides of modified oligonucleotides may be linked together using one or more modified intemucleoside linkages. The two main classes of intemucleoside linking groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing intemucleoside linkages include, but are not limited to. phosphodiesters, which contain a phosphodiester bond (“P=O”) (also referred to as unmodified or naturally occurring linkages), phosphotriesters, methylphosphonates, phosphoramidates. phosphorothioates (“P=S”), and phosphorodithioates ("HS-P=S"). Representative non-phosphorus containing intemucleoside linking groups include, but are not limited to, methylenemethylimino (-CH2-N(CH3)-O-CH2-), thiodiester, thionocaibamate (-O-C(=O)(NH)-S-); siloxane (-O-SiEL-O-); and N,N'-dimethylhydrazine (-CH2-N(CH3)-N(CH3)-). Modified intemucleoside linkages, compared to naturally occurring phosphodiester intemucleoside linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide. In certain embodiments, intemucleoside linkages having a chiral atom can be prepared as a racemic mi xture, or as separate enantiomers. Methods of preparation of phosphorous-containing and non- phosphorous-containing intemucleoside linkages are well known to those skilled in the art.
In certain embodiments, a modified intemucleoside linkage is any of those described in WO2021/030778, incorporated by reference herein. In certain embodiments, a modified intemucleoside linkage comprises the formula: o
X=P I-N-T
6 Ri wherein independently for each such intemucleoside linking group of a modified oligonucleotide:
X is selected from O or S;
Ri is selected from H, Ci-Cg alkyl, and substituted Ci-Cg alkyl; and
T is selected from SO2R2, C(=O)R3, and P(=O)R4R5, wherein:
R2 is selected from an aryl, a substituted aryl, a heterocycle, a substituted heterocycle, an aromatic heterocycle, a substituted aromatic heterocycle, a diazolc, a substituted diazolc, a Ci-Cg alkoxy, Ci-Cg alkyl, Ci-C6 alkenyl. Ci-C6 alkynyl, substituted Ci-Cg alkyl, substituted Ci-Cg alkeny l substituted Ci-Cg alkynyl, and a conjugate group;
R3 is selected from an aryl, a substituted ary l, CH3, N(CH3)2, OCH3 and a conjugate group;
R4 is selected from OCH3, OH, Ci-Cg alkyl, substituted Ci-Cg alkyd and a conjugate group; and
R5 is selected from OCH3, OH, Ci-C6 alky l, and substituted Ci-C6 alky l.
In certain embodiments, a modified intemucleoside linkage comprises a mesyl phosphoramidate linking group which has the formula:
The mesyl phosphoramidate intemucleoside linkage comprises a chiral center. In certain embodiments, modified oligonucleotides comprise (Rp) and/or O'p) mesyl phosphoramidates. which are shown in the following formulas, respectively , wherein “B” indicates a nucleobase:
In certain embodiments, a phosphorothioate intemucleoside linkage may comprise a chiral center. In certain embodiments, modified oligonucleotides comprising (Rp) and/or (Sp) phosphorothioates comprise one or more of the following formulas, respectively, wherein “B” indicates a nucleobase:
Representative intemucleoside linkages having a chiral center include but are not limited to alkylphosphonates and phosphorothioates. Modified oligonucleotides comprising intemucleoside linkages having a chiral center can be prepared as populations of modified oligonucleotides comprising stereorandom intemucleoside linkages, or as populations of modified oligonucleotides comprising such intemucleoside linkages in particular stereochemical configurations. In certain embodiments, populations of modified oligonucleotides comprise phosphorothioate intemucleoside linkages wherein all of tire phosphorothioate intemucleoside linkages are stereorandom. In certain
embodiments, populations of modified oligonucleotides comprise mesyl phosphoramidate intemucleoside linkages wherein all of the mesyl phosphoramidate intemucleoside linkages are stereorandom. Such modified oligonucleotides can be generated using synthetic methods that result in random selection of the stereochemical configuration of each intemucleoside linkage having a chiral center. Nonetheless, each individual intemucleoside linkage having a chiral center of each individual oligonucleotide molecule has a defined stereoconfiguration. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising one or more particular phosphorothioate and/or mesyl phosphoramidate intemucleoside linkages, each independently in a particular, independently selected stereochemical configuration. In certain embodiments, the particular configuration of the particular phosphorothioate and/or mesyl phosphoramidate linkage is present in at least 65% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate and/or mesyl phosphoramidate linkage is present in at least 70% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate and/or mesyl phosphoramidate linkage is present in at least 80% of the molecules in the population. In certain embodiments, tire particular configuration of the particular phosphorothioate and/or mesyl phosphoramidate linkage is present in at least 90% of the molecules in the population. In certain embodiments, the particular configuration of the particular phosphorothioate and/or mesyl phosphoramidate linkage is present in at least 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be generated using synthetic methods known in the art, e.g., methods described in Oka et al., JACS 125, 8307 (2003), Wan et al. Nucleic Acids Res. 42, 13456 (2014). and WO 2017/015555. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one indicated phosphorothioate and/or mesyl phosphoramidate in the (Sp) configuration. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate and/or mesyl phosphoramidate in the (Rp) configuration. Unless otherwise indicated, intemucleoside linkages having chiral centers of modified oligonucleotides described herein can be stereorandom or in a particular stereochemical configuration.
Neutral intemucleoside linkages include, without limitation, phosphotriesters, methylphosphonates, MMI (3'- CH2-N(CH3)-O-5'), amide-3 (3'-CH2-C(=O)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), formacetal (3'-O-CH2-O-5'), methoxypropyl (MOP), and thiofonnacetal (3'-S-CH2-O-5'). Further neutral intemucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxanc). carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (Sec for example: Carbohydrate Modifications in Antisense Research; Y.S. Sanghvi and P.D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral intemucleoside linkages include nonionic linkages comprising mixed N, O, S and CH2 component parts.
In certain embodiments, modified oligonucleotides comprise one or more inverted nucleoside, as shown below:
wherein each Bx independently represents any nucleobase. In certain embodiments, an inverted nucleoside is terminal (i.e., the last nucleoside on one end of an oligonucleotide) and so only one intemucleoside linkage depicted above will be present. In certain such embodiments, additional features (such as a conjugate group) may be attached to the inverted nucleoside. Such terminal inverted nucleosides can be attached to either or both ends of an oligonucleotide.
In certain embodiments, nucleic acids can be linked 2’ to 5’ rather than tire standard 3’ to 5’ linkage. Such a linkage is illustrated below.
wherein each Bx represents any nucleobase. B. Certain Motifs
In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more modified
intemucleoside linkage. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and/or intemucleoside linkages of a modified oligonucleotide define a pattern or motif. In certain embodiments, the patterns of sugar moieties, nucleobases. and intemucleoside linkages are each independent of one another. Thus, a modified oligonucleotide may be described by its sugar motif, nucleobase motif and/or intemucleoside linkage motif (as used herein, nucleobase motif describes the modifications to the nucleobases independent of the sequence of nucleobases).
1. Certain Sugar Motifs
In certain embodiments, oligonucleotides comprise one or more type of modified sugar and/or unmodified sugar moiety arranged along the oligonucleotide or region thereof in a defined pattern or sugar motif. In certain instances, such sugar motifs include but are not limited to any of the sugar modifications discussed herein.
In certain embodiments, modified oligonucleotides comprise a deoxy region. In certain embodiments, each nucleoside of the deoxy region is a 2’-p-D-deoxynucleoside. In certain embodiments, the deoxy region consists of 5-12 linked nucleosides. In certain embodiments, the deoxy region consists of 6. 7, 8, 9, 10, or 6-10 linked nucleosides. In certain embodiments, at least one nucleoside within tire deoxy region comprises a modified sugar moiety. In certain embodiments, exactly one nucleoside within the deoxy region comprises a modified sugar moiety'. In certain embodiments, two or three nucleosides within the deoxy region comprise a modified sugar moiety.
In certain embodiments, the deoxy region is flanked on the 5 ’-side by a 5 ’-region consisting of linked 5 ’-region nucleosides and on the 3 ’-side by a 3 ‘-region consisting of linked 3‘-region nucleosides; wherein the 3 ‘-most nucleoside of the 5’-region is a modified nucleoside and the 5‘-most nucleoside of the 3‘-region is a modified nucleoside. At least one nucleoside of the 5 ’-region comprises a modified sugar moiety'; and at least one nucleoside of the 3 ’-region comprises a modified sugar moiety. The three regions (the 5 ’-region, the deoxy region, and Hie 3 ’-region) form a contiguous sequence of nucleosides. In certain embodiments, the sugar moiety of tire 3 ’ -most nucleoside of the 5 ’ -region and the sugar moiety of the 5 ’-most nucleoside of the 3 ’-region each differ from the sugar moiety of the respective adjacent nucleoside of the deoxy region, thus defining the boundary between the 5 ’-region, the deoxy region, and the 3’- region. In certain embodiments, each nucleoside of the 5 ’-region and each nucleoside of tire 3 ’-region comprises a modified sugar moiety . In certain embodiments, the nucleosides within tire 5 ‘-region comprise tire same sugar modification. In certain embodiments, the nucleosides within the 5 ’-region comprise two or more different sugar modifications. In certain embodiments, the nucleosides within tire 3 ’-region comprise the same sugar modification. In certain embodiments, the nucleosides w ithin the 3’-region comprise two or more different sugar modifications.
In certain embodiments, the 5 ’-region and the 3 ’-region of a modified oligonucleotide each comprises 1-8 nucleosides. In certain embodiments, the 5 ’-region comprises 1-7 nucleosides. In certain embodiments, the 5 ’-region comprises 1-6 nucleosides. In certain embodiments, the 5’-region comprises 1, 2, 3, 4, 5. 6, 7, or 8 nucleosides. In certain embodiments, the 3 ’-region comprises 1-7 nucleosides. In certain embodiments, the 3 ’-region comprises 1-6 nucleosides. In certain embodiments, the 3 ’-region comprises 1, 2, 3. 4, 5, 6, 7, or 8 nucleosides.
In certain embodiments, modified oligonucleotides comprise or consist of a region having a gapmer motif, which is defined by two external regions or ‘"wings” and a central or internal region or “gap.” The three regions of a gapmer motif (the 5 ’-wing, the gap, and the 3 ’-wing) form a contiguous sequence of nucleosides wherein at least some of the sugar moieties of the nucleosides of each of the wings differ from at least some of the sugar moieties of the
nucleosides of the gap. Specifically, at least the sugar moieties of the nucleosides of each wing that are closest to the gap (the 3 ’-most nucleoside of the 5 ’-wing and the 5 ’-most nucleoside of the 3 ’-wing) differ from the sugar moiety of the neighboring gap nucleosides, thus defining the boundary between the wings and the gap (i.e.. the wing/gap junction). Tn certain embodiments, the sugar moieties within the gap are the same as one another. In certain embodiments, the gap includes one or more nucleoside having a sugar moiety that differs from the sugar moiety of one or more other nucleosides of the gap. In certain embodiments, the sugar motifs of the two wings are the same as one another (symmetric gapmer). In certain embodiments, the sugar motif of the 5'-wing differs from the sugar motif of the 3'-wing (asymmetric gapmer).
In certain embodiments, the wings of a gapmer comprise 1-6 nucleosides. In certain embodiments, each nucleoside of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least one nucleoside of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least two nucleosides of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least three nucleosides of each wing of a gapmer comprises a modified sugar moiety'. In certain embodiments, at least four nucleosides of each wing of a gapmer comprises a modified sugar moiety'. In certain embodiments, at least five nucleosides of each wing of a gapmer comprises a modified sugar moiety'.
In certain embodiments, the gap of a gapmer comprises 7-12 nucleosides. In certain embodiments, each nucleoside of the gap of a gapmer comprises a 2’-p-D-deoxyribosyl sugar moiety. In certain embodiments, at least one nucleoside of the gap of a gapmer comprises a modified sugar moiety.
In certain embodiments, the gapmer is a deoxy gapmer. In certain embodiments, tire nucleosides on the gap side of each wing/gap junction comprise 2’-p-D-deoxyribosyl sugar moieties and the nucleosides on the wing sides of each wing/gap j miction comprise modified sugar moieties. In certain embodiments, each nucleoside of the gap comprises a 2’-p-D-deoxyribosyl sugar moiety. In certain embodiments, each nucleoside of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least one nucleoside of the gap of a gapmer comprises a modified sugar moiety. In certain embodiments, at least one nucleoside of the gap of a gapmer comprises a 2’-0Me sugar moiety'.
In certain embodiments, modified oligonucleotides comprise or consist of a portion having a fully modified sugar motif. In such embodiments, each nucleoside of the fully modified portion of the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, each nucleoside of the entire modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise or consist of a portion having a fully modified sugar motif, w herein each nucleoside within the fully modified portion comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif. In certain embodiments, a fully modified oligonucleotide is a uniformly modified oligonucleotide. In certain embodiments, each nucleoside of a uniformly modified oligonucleotide comprises tire same 2 ’-modification.
Herein, the lengths (number of nucleosides) of the three regions of a gapmer may be provided using the notation [# of nucleosides in the 5 ’ -w ing] - [# of nucleosides in the gap] - [# of nucleosides in the 3 ’ -w ing] . Thus, a 3 - 10-3 gapmer consists of 3 linked nucleosides in each w ing and 10 linked nucleosides in the gap. Where such nomenclature is follow ed by a specific modification, that modification is the modification in each sugar moiety of each wing and the gap nucleosides comprise 2 ’-P-D-deoxy ribosyl sugar moieties. Thus, a 5-10-5 MOE gapmer consists of 5 linked 2’-MOE nucleosides in the 5’-wing. 10 linked 2’- P-D-deoxynucleosides in the gap. and 5 linked 2’-MOE nucleosides in the 3’-wing. A 3-10-3 cEt gapmer consists of 3 linked cEt nucleosides in the 5’-wing, 10 linked 2’- P-D-
deoxynucleosides in the gap, and 3 linked cEt nucleosides in the 3’-wing. A 5-8-5 gapmer consists of 5 linked nucleosides comprising a modified sugar moiety in the 5’-wing, 8 linked 2’-P-D-deoxynucleosides in the gap, and 5 linked nucleosides comprising a modified sugar moiety in the 3 ’-wing. A 5-8-5 mixed gapmer has at least two different modified sugar moieties in the 5 ’ - and/or the 3 ’ -wing, two different modified sugar moieties in the gap region, or a combination thereof.
In certain embodiments, modified oligonucleotides disclosed herein are modified by a specific sugar modification. In certain embodiments, modified oligonucleotides are 5-10-5 MOE gapmers. In certain embodiments, modified oligonucleotides are 3-10-3 BNA gapmers. In certain embodiments, modified oligonucleotides are 3-10-3 cEt gapmers. In certain embodiments, modified oligonucleotides are 3-10-3 LNA gapmers. In certain embodiments, modified oligonucleotides are 3-10-4 cEt gapmers. In certain embodiments, modified oligonucleotides are 4-10-3 cEt gapmers. In certain embodiments, modified oligonucleotides are 4-10-4 cEt gapmers. In certain embodiments. 5-10-5 cEt gapmers. In certain embodiments, modified oligonucleotides are 6-10-4 MOE gapmers.
In certain embodiments, modified oligonucleotides disclosed herein are modified by two or more sugar modifications. In certain embodiments, modified oligonucleotides are 3-10-3 mixed gapmers, wherein each nucleoside within the 5’ and the 3’ wings comprises a modified sugar moiety selected from a 2’-MOE sugar moiety and a 2’-cEt sugar moiety, and the gap nucleosides comprise 2’-p-D-deoxyribosyl sugar moieties. In certain embodiments, modified oligonucleotides are 3-10-4 mixed gapmers, wherein each nucleoside within the 5’ and the 3’ wings comprises a modified sugar moiety selected from a 2’-MOE sugar moiety and a 2’-cEt sugar moiety, and the gap nucleosides comprise 2‘-p-D-deoxyribosyl sugar moieties. In certain embodiments, modified oligonucleotides are 3-10-5 mixed gapmers, wherein each nucleoside within tire 5’ and the 3’ wings comprises a modified sugar moiety selected from a 2’- MOE sugar moiety and a 2’-cEt sugar moiety, and the gap nucleosides comprise 2’-p-D-deoxyribosyl sugar moieties. In certain embodiments, modified oligonucleotides are 4-9-4 mixed gapmers, wherein each nucleoside within tire 5’ and the 3 ’ wings comprises a modified sugar moiety selected from a 2'-MOE sugar moiety and a 2’-cEt sugar moiety, and the gap nucleosides comprise 2’-p-D-deoxyribosyl sugar moieties. In certain embodiments, modified oligonucleotides are 5-10-5 mixed gapmers, wherein each nucleoside within the 5’ and the 3’ wings comprises a modified sugar moiety selected from a 2’-MOE sugar moiety and a 2‘-cEt sugar moiety, and the gap nucleosides comprise 2’-p-D-deoxyribosyl sugar moieties. In certain embodiments, modified oligonucleotides arc 6-10-4 mixed gapmers, wherein each nucleoside within the 5’ and the 3’ wings comprises a modified sugar moiety selected from a 2’-MOE sugar moiety and a 2’-cEt sugar moiety, and the gap nucleosides comprise 2 ’-p-D-deoxy ribosyl sugar moieties.
In certain embodiments, modified oligonucleotides disclosed herein are modified by two or more sugar modifications within the gap region. In certain embodiments, modified oligonucleotides are 3-10-3 mixed gapmers, wherein each nucleoside within tire 5’ and the 3’ wings comprises a 2’-cEt sugar moiety, and each nucleoside within the gap comprises a sugar moiety selected from a 2’-OMe sugar moiety or a 2’-P-D-deoxyribosyl sugar moiety. In certain embodiments, modified oligonucleotides are 5-10-5 mixed gapmers, wherein each nucleoside within the 5’ and the 3’ wings comprises a 2 ’-MOE sugar moiety, and each nucleoside within the gap comprises a sugar moiety selected from a 2’-p-D-deoxyxylosyl sugar moiety, a 2’-a-L-deoxyribosyl sugar moiety, and 2’-P-D-deoxyribosyl sugar moiety.
In certain embodiments, modified oligonucleotides have a sugar motif selected from 5’ - kkkddddddddddkkk - 3’, 5’- kkkddddddddddkkkk -3’. 5’ - kkkkddddddddddkkk -3’, 5’- kkkkddddddddddkkkk -3’, 5’- kkkkkddddddddddkkkkk -3’, 5’ - kkkdyddddddddkkk -3’, 5’ - kkkddddddddddkeee -3’. 5’ - kkkddddddddddkkee -3’, 5’-
kkkddddddddddkeeee -3’, 5’- ekkddddddddddkeeee -3’. 5’ - kkkddddddddddkkeee -3’. 5’ - eeeeeddddddddddeeeee -3’, 5’ - eeeeeeddddddddddeeee -3’, 5’- eeeeeeddddddddddkkee -3’, 5’ - eeeeed[bDdx]ddddddddeeeee -3’, 5’- eeeeedd[bDdx]dddddddeeeee -3’, 5’- eeeeed[aLdr]ddddddddeeeee -3’, 5’- eeeeedd[aLdr]dddddddeeeee -3’, and 5’- eekkdddddddddkkee -3’, wherein each “d” represents a 2’-P-D-deoxyribosyl sugar moiety, each “e” represents a 2’- MOE sugar moiety, each “k” represents a cEt sugar moiety, each “y” represents a 2’-O-methyl sugar moiety, each “[bDdx]” represents a 2'-P-D-deoxyxylosyl sugar moiety, and each “[aLdr]” represents a 2’-a-L-deoxyribosyl sugar moiety. In certain embodiments, modified oligonucleotides have a sugar motif of 5’- eeeeeddddddddddeeeee -3’, wherein each "e” represents a 2’-M0E sugar moiety, and each “d” represents a 2’-P-D-deoxyribosyl sugar moiety. In certain embodiments, modified oligonucleotides have a sugar motif of 5’- eeeeeeddddddddddeeee -3’, wherein each "e” represents a 2’-M0E sugar moiety, and each “d” represents a 2’-p-D-deoxyribosyl sugar moiety.
2. Certain Nucleobase Motifs
In certain embodiments, oligonucleotides comprise modified and/or unmodified nucleobases arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases are modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in a modified oligonucleotide are 5-methylcytosines. In certain embodiments, all of the cytosine nucleobases are 5-methylcytosines and all of the other nucleobases of tire modified oligonucleotide are unmodified nucleobases.
In certain embodiments, modified oligonucleotides comprise a block of modified nucleobases. In certain such embodiments, the block is at the 3 ’-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 3 ’-end of the oligonucleotide. In certain embodiments, the block is at tire 5 ‘-end of the oligonucleotide. In certain embodiments tire block is within 3 nucleosides of the 5 ’-end of the oligonucleotide.
In certain embodiments, oligonucleotides having a gapmer motif comprise a nucleoside comprising a modified nucleobase. In certain such embodiments, one nucleoside comprising a modified nucleobase is in tire central gap of an oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of said nucleoside is a 2’- p-D- dcoxynbosyl sugar moiety. In certain embodiments, the modified nucleobase is selected from a 2-thiopyrimidinc and a 5 -propynepyrimidine .
3. Certain Internucleoside Linkage Motifs
In certain embodiments, oligonucleotides comprise modified and/or unmodified intemucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, each intemucleoside linking group is a phosphodiester intemucleoside linkage (P=O). In certain embodiments, each intemucleoside linking group of a modified oligonucleotide is a phosphorothioate intemucleoside linkage (P=S). In certain embodiments, each intemucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate intemucleoside linkage and phosphodiester intemucleoside linkage. In certain embodiments, each phosphorothioate intemucleoside linkage is independently selected from a stereorandom phosphorothioate a (.S'p) phosphorothioate, and a (7?p) phosphorothioate.
In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer and the intemucleoside linkages within the gap are all modified. In certain embodiments, some or all of the intemucleoside linkages in the wings are unmodified phosphodiester intemucleoside linkages. In certain embodiments, the terminal intemucleoside linkages are modified. In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer, and the intemucleoside linkage motif comprises at least one phosphodiester intemucleoside linkage in at least one wing, wherein the at least one phosphodiester linkage is not a terminal intemucleoside linkage, and the remaining intemucleoside linkages are phosphorothioate intemucleoside linkages. In certain such embodiments, all of the phosphorothioate linkages are stereorandom. In certain embodiments, all of the phosphorothioate linkages in the wings are (Sp) phosphorothioates. and the gap comprises at least one Sp. Sp. or Rp motif. In certain embodiments, populations of modified oligonucleotides are enriched for modified oligonucleotides comprising such intemucleoside linkage motifs.
In certain embodiments, modified oligonucleotides have an intemucleoside linkage motif comprising one or more mesyl phosphoramidate linking groups. In certain embodiments, one or more phosphorothioate intemucleoside linkages or one or more phosphodiester intemucleoside linkages of tire intemucleoside linkage motifs herein is substituted with a mesyl phosphoramidate linking group.
In certain embodiments, modified oligonucleotides have an intemucleoside linkage motif of 5’- soossssssssssos -3’, 5’- soossssssssssoos -3’, 5’- sooossssssssssos -3’. 5’- sooossssssssssoos -3’. 5’- soooossssssssssooos -3’, 5’- soossssssssssooos -3’, 5’- soossssssssssssss -3’, 5’- sssssssssssssssssss -3’, 5’- sooooossssssssssoss -3’, 5’- ssssszzzzssssssssss -3’, 5’- soooszzzzssssssooss -3’, 5’- sooosssssssssssooss -3’, 5’- sosssssssssssssooss -3’, 5’- sooosszzsssssoss -3‘, 5’- sossssssssssssssoss -3’, 5‘- soosszzzzssssssooss -3’, 5‘- sossszzzzssssssooss -3’, 5‘- sossszzzzsssssssoss -3’, 5’- sssssszsszzszssssss -3’, 5’- ssssssssszzsssssoss -3’, 5’- ssooszsssssszsssoss -3‘, 5’- ssosszsssssszzssoss -3', 5’- sssoszzzsssssssssss -3’, 5’- ssoosszzsssssssosss -3’, 5‘- ssssszzsssszzssssss -3‘, 5’- sssssszssssszsssoss -3‘, 5’- soossssssssssssooss -3’, 5’- sossszzsssszzssosss -3’, 5‘- sossszzsssszzsssoss -3’, 5’- sossszzsssszzssssss -3‘, 5’- ssssszzsssszzssooss -3’. 5’- ssssszssssszzssssss -3’, 5’- sssssszsssszzssssss -3’, 5’- ssssszzssssszssssss -3’, 5’- ssssszzsssszsssssss -3’, 5’- sossszssssszzssosss -3‘, 5’- sosssszsssszzssosss -3’, 5’- sossszzssssszssosss -3‘, 5’- sossszzsssszsssosss -3’. 5’- sossszssssszzsssoss -3’, 5‘- sosssszsssszzsssoss -3’, 5’- sossszzssssszsssoss -3‘, 5’- sossszzsssszssssoss -3’, 5’- szssszzsssszzsszzss -3’, 5‘- zzssszzsssszzsssszz -3’, 5’- zsssszzsssszzsssssz -3‘, 5’- ssooszsssssszzssoss -3’, 5’- sssoszsssssszzssoss -3’, 5‘- ssooszsssssszzsssss -3’, 5’- ssssszsssssszzssoss -3‘, 5’- sssszzsssssszzsssss -3’, 5‘- soooszzssssszssooss -3’, 5‘- soooszzssssszzsooss -3’, 5’- ssooszzssssszssooss -3’, 5’- ssooszzssssszzsooss -3’, 5’- sssoszzssssszssooss -3’, 5’- sssoszzssssszzsooss -3‘, 5’- sssoszzssssszssosss -3‘, or 5’- sssoszzssssszzsosss -3‘, wherein each“s” represents a phosphorothioate intemucleoside linkage, each “o” represents a phosphodiester intemucleoside linkage, and each “z” represents a mesyl phosphoramidate intemucleoside linkage. In certain embodiments, modified oligonucleotides have an intemucleoside linkage motif of 5'- ssssszzsssszzssssss -3’. wherein each “s’’ represents a phosphorothioate intemucleoside linkage and each "z " represents a mesyl phosphoramidate intemucleoside linkage. In certain embodiments, modified oligonucleotides have an intemucleoside linkage motif of 5’- ssooszsssssszsssoss -3’, wherein each “s” represents a phosphorothioate intemucleoside linkage, each “o” represents a phosphodiester intemucleoside linkage, and each “z” represents a mesyl phosphoramidate intemucleoside linkage. In certain embodiments, modified oligonucleotides have an intemucleoside linkage motif of 5’- ssssszzzzssssssssss -3’, wherein each “s” represents a phosphorothioate intemucleoside linkage and each “z” represents a mesyl phosphoramidate intemucleoside linkage. In certain embodiments, modified
oligonucleotides have an intemucleoside linkage motif of 5’- sooooossssssssssoss -3’, wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage.
C. Certain Lengths
It is possible to increase or decrease the length of an oligonucleotide without eliminating activity. For example, in Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309. 1992), a series of oligonucleotides 13-25 nucleobases in length were tested for their ability to induce cleavage of a target RNA in an oocyte injection model. Oligonucleotides 25 nucleobases in length with 8 or 11 mismatch bases near the ends of the oligonucleotides were able to direct specific cleavage of the target RNA, albeit to a lesser extent than the oligonucleotides that contained no mismatches. Similarly, target specific cleavage was achieved using 13 nucleobase oligonucleotides, including those with 1 or 3 mismatches.
In certain embodiments, oligonucleotides (including modified oligonucleotides) can have any of a variety of ranges of lengths. In certain embodiments, oligonucleotides consist of X to Y linked nucleosides, where X represents tire fewest number of nucleosides in the range and Y represents the largest number nucleosides in the range. In certain such embodiments. X and Y are each independently selected from 8, 9, 10, 11, 12. 13, 14, 15. 16, 17, 18, 19. 20, 21, 22. 23, 24. 25, 26, 27, 28. 29, 30, 31. 32, 33, 34, 35. 36, 37, 38. 39, 40, 41, 42. 43, 44, 45. 46, 47, 48, 49. and 50; provided that X<Y. For example, in certain embodiments, oligonucleotides consist of 12 to 13, 12 to 14. 12 to 15, 12 to 16, 12 to 17, 12 to 18, 12 to 19, 12 to 20, 12 to 21, 12 to 22, 12 to 23, 12 to 24, 12 to 25, 12 to 26, 12 to 27, 12 to 28, 12 to 29, 12 to 30. 13 to 14, 13 to 15, 13 to 16. 13 to 17, 13 to 18, 13 to 19, 13 to 20, 13 to 21, 13 to 22, 13 to 23, 13 to 24, 13 to 25, 13 to 26, 13 to 27, 13 to 28, 13 to 29, 13 to 30, 14 to 15, 14 to 16, 14 to 17, 14 to 18, 14 to 19. 14 to 20, 14 to 21, 14 to 22. 14 to 23, 14 to 24, 14 to 25, 14 to 26, 14 to 27, 14 to 28, 14 to 29, 14 to 30, 15 to 16, 15 to 17, 15 to 18, 15 to 19, 15 to 20, 15 to 21, 15 to 22, 15 to 23, 15 to 24, 15 to 25, 15 to 26, 15 to 27, 15 to 28, 15 to 29, 15 to 30, 16 to 17, 16 to 18, 16 to 19, 16 to 20, 16 to 21, 16 to 22, 16 to 23, 16 to 24, 16 to 25, 16 to 26, 16 to 27, 16 to 28, 16 to 29, 16 to 30, 17 to 18. 17 to 19, 17 to 20, 17 to 21, 17 to 22, 17 to 23, 17 to 24, 17 to 25, 17 to 26, 17 to 27, 17 to 28, 17 to 29, 17 to 30, 18 to 19, 18 to 20, 18 to 21, 18 to 22, 18 to 23, 18 to 24, 18 to 25, 18 to 26, 18 to 27, 18 to 28, 18 to 29, 18 to 30, 19 to 20, 19 to 21, 19 to 22, 19 to 23, 19 to 24, 19 to 25, 19 to 26, 19 to 27, 19 to 28, 19 to 29, 19 to 30. 20 to 21, 20 to 22, 20 to 23, 20 to 24, 20 to 25, 20 to 26, 20 to 27, 20 to 28, 20 to 29, 20 to 30, 21 to 22, 21 to 23, 21 to 24, 21 to 25, 21 to 26, 21 to 27, 21 to 28, 21 to 29, 21 to 30, 22 to 23, 22 to 24, 22 to 25, 22 to 26, 22 to 27, 22 to 28, 22 to 29, 22 to 30, 23 to 24, 23 to 25, 23 to 26, 23 to 27, 23 to 28, 23 to 29, 23 to 30, 24 to 25, 24 to 26, 24 to 27, 24 to 28, 24 to 29, 24 to 30, 25 to 26, 25 to 27, 25 to 28, 25 to 29, 25 to 30, 26 to 27, 26 to 28, 26 to 29, 26 to 30, 27 to 28, 27 to 29, 27 to 30, 28 to 29, 28 to 30, or 29 to 30 linked nucleosides.
In certain embodiments, oligonucleotides (including modified oligonucleotides) consist of 16 linked nucleosides. In certain embodiments, oligonucleotides (including modified oligonucleotides) consist of 17 linked nucleosides. In certain embodiments, oligonucleotides (including modified oligonucleotides) consist of 18 linked nucleosides. In certain embodiments, oligonucleotides (including modified oligonucleotides) consist of 19 linked nucleosides. In certain embodiments, oligonucleotides (including modified oligonucleotides) consist of 20 linked nucleosides.
D. Certain Modified Oligonucleotides
In certain embodiments, the above modifications (sugar, nucleobase. intemucleoside linkage) are incorporated into a modified oligonucleotide. In certain embodiments, modified oligonucleotides are characterized by their
modification motifs and overall lengths. In certain embodiments, such parameters are each independent of one another. Thus, unless otherwise indicated, each intemucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified and may or may not follow the gapmer modification pattern of the sugar modifications. For example, the intemucleoside linkages within the wing regions of a sugar gapmer may be the same or different from one another and may be the same or different from the intemucleoside linkages of the gap region of the sugar motif. Likewise, such sugar gapmer oligonucleotides may comprise one or more modified nucleobase independent of the gapmer pattern of the sugar modifications. Unless otherwise indicated, all modifications are independent of nucleobase sequence.
E. Certain Populations of Modified Oligonucleotides
Populations of modified oligonucleotides in which all of the modified oligonucleotides of the population have the same molecular formula can be stereorandom populations or chirally enriched populations. All of the chiral centers of all of the modified oligonucleotides are stereorandom in a stereorandom population. In a chirally enriched population, at least one particular chiral center is not stereorandom in the modified oligonucleotides of the population. In certain embodiments, the modified oligonucleotides of a chirally enriched population are enriched for 0-D ribosyl sugar moieties, and all of the phosphorothioate intemucleoside linkages are stereorandom. In certain embodiments, the modified oligonucleotides of a chirally enriched population are enriched for both p-D ribosyl sugar moieties and at least one, particular phosphorothioate intemucleoside linkage in a particular stereochemical configuration.
F. Nucleobase Sequence
In certain embodiments, oligonucleotides (or portions thereof) have a nucleobase sequence that is complementary to a second oligonucleotide or an identified reference nucleic acid (or portion thereof), such as a target nucleic acid. In certain embodiments, tire nucleobase sequence of a region or entire length of an oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the second oligonucleotide or identified reference nucleic acid (or portion thereof), such as a target nucleic acid.
II. Certain Oligomeric Compounds
In certain embodiments, provided herein arc oligomeric compounds, which comprises an oligonucleotide and optionally one or more conjugate groups and/or terminal groups. A conjugate group consists of a conjugate moiety and a conjugate linker which links the conjugate moiety to the oligonucleotide. Conjugate groups may be attached to either or both ends of an oligonucleotide and/or at any internal position. In certain embodiments, conjugate groups are attached to the 2'-position of a nucleoside of a modified oligonucleotide. In certain embodiments, conjugate groups are attached to either or both ends of an oligonucleotide (such conjugate groups are also terminal groups). In certain such embodiments, conjugate groups or terminal groups are attached at the 3 ’ and/or 5 ’-end of oligonucleotides.
A. Certain Conjugate Groups
In certain embodiments, oligonucleotides are covalently attached to one or more conjugate groups. In certain embodiments, conjugate groups modify one or more properties of the attached oligonucleotide, including but not limited
to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge and clearance.
In certain embodiments, conjugation of one or more carbohydrate moieties to a modified oligonucleotide can alter one or more properties of the modified oligonucleotide. In certain embodiments, the carbohydrate moiety is attached to a modified subunit of the modified oligonucleotide. For example, the ribose sugar of one or more ribonucleotide subunits of a modified oligonucleotide can be replaced with another moiety, e.g. a non-carbohydrate (preferably cyclic) carrier to which is attached a carbohydrate ligand. A ribonucleotide subunit in which the ribose sugar of the subunit has been so replaced is referred to herein as a ribose replacement modification subunit (RRMS), which is a modified sugar moiety. A cyclic carrier may be a carbocyclic ring system, i.e., one or more ring atoms may be a heteroatom, e.g., nitrogen, oxygen, sulphur. The cyclic carrier may be a monocyclic ring system, or may contain two or more rings, e.g. fused rings. The cyclic carrier may be a fully saturated ring system, or it may contain one or more double bonds. In certain embodiments, the modified oligonucleotide is a gapmer.
In certain embodiments, conjugate groups impart a new property on the attached oligonucleotide, e.g. , Ihiorophores or reporter groups that enable detection of the oligonucleotide. Certain conjugate groups and conjugate moieties have been described previously, for example: cholesterol moiety (Letsinger et al.. Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett.. 1994, 4. 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N. Y. Acad. Set., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 5, 2765-2770), a thiocholesterol (Oberhauser et al., Nucleic Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., do-decan-diol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991. 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259. 327-330; Svinarchuk et al., Biochimie, 1993 , 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac- glycerol or triethyl-ammonium l,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucleic Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), an octadecylamine or hcxylamino-carbonyl-oxycholcstcrol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937), a tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, c22O; and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or a GalNAc cluster (e.g., WO2014/179620).
In certain embodiments, a conjugate group consists of a lipid and a conjugate linker. In certain embodiments, a conjugate group is a phosphate linked lipid having the following structure:
1. Conjugate Moieties
Conjugate moieties include, without limitation, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates (e.g., GalNAc), antibodies, vitamin moieties. polyethylene glycols, thioethers, poly ethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.
In certain embodiments, a conjugate moiety comprises an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen. (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5- triiodobenzoic acid, fingolimod. flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indo-methicin. a barbiturate, a cephalosporin, a sulfa dmg. an antidiabetic, an antibacterial or an antibiotic.
In certain embodiments, conjugate moieties are selected from any of C22 alkyl, C20 alkyl, C16 alkyl. CIO alkyl. C21 alkyl. C19 alkyl. C18 alkyl. C17 alkyl. C15 alkyl. C14 alkyl. C13 alkyl. C12 alkyl, Cll alkyl, C9 alkyl, C8 alkyl. C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, CIO alkenyl, C21 alkenyl, C19 alkenyl. C18 alkenyl, C17 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl. C12 alkenyl. Cll alkenyl. C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.
In certain embodiments, conjugate moieties are selected from any of C22 alkyl. C20 alkyl, C16 alkyl, CIO alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, Cll alkyl, C9 alkyl. C8 alkyl, C7 alkyl, C6 alkyl, or C5 alkyl, where the alkyl chain has one or more unsaturated bonds.
2. Conjugate Linkers
Conjugate moieties are attached to oligonucleotides through conjugate linkers. In certain oligomeric compounds, tire conjugate linker is a single chemical bond (i.e. , the conjugate moiety is attached directly to an oligonucleotide through a single bond). In certain embodiments, the conjugate linker comprises a drain structure, such as a hydrocarbyl drain, or an oligomer of repeating units such as ethylene glycol, nucleosides, or amino acid units.
In certain embodiments, a conjugate linker comprises pyrrolidine.
In certain embodiments, a conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises groups selected from alkyl, amino, oxo, amide and ether groups. In certain embodiments, Hie conjugate linker comprises groups selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises groups selected from alkyd and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety . In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, tire conjugate linker includes at least one neutral linking group.
In certain embodiments, conjugate linkers, including the conjugate linkers described above, arc bifunctional linking moieties, e.g., those known in the art to be useful for attaching conjugate groups to compounds, such as the oligonucleotides provided herein. In general, a bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to bind to a particular site on a compound and the other is selected to bind to a conjugate group. Examples of functional groups used in a bifunctional linking moiety’ include but are not limited to electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups. In certain embodiments, bifunctional linking moieties comprise one or more groups selected from amino, hydroxyl, carboxy lic acid, thiol, alkyl, alkenyl, and alkynyl.
Examples of conjugate linkers include but are not limited to pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane- 1 -carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include but are not limited to substituted or unsubstituted Ci-Cio alkyl, substituted or unsubstituted C2-C10 alkenyl or substituted or unsubstituted C2-C10 alkynyl, wherein a nonlimiting list of preferred
substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzy l, phenyl, nitro, thiol, thioalkoxy7, halogen, alkyl, ary l, alkenyl and alkynyl.
In certain embodiments, conjugate linkers comprise 1-10 linker-nucleosides. In certain embodiments, conjugate linkers comprise 2-5 linker-nucleosides. In certain embodiments, conjugate linkers comprise exactly 3 linker- nucleosides. In certain embodiments, conjugate linkers comprise the TCA motif. In certain embodiments, such linker- nucleosides are modified nucleosides. In certain embodiments such linker-nucleosides comprise a modified sugar moiety. In certain embodiments, linker-nucleosides are unmodified. In certain embodiments, linker-nucleosides comprise an optionally protected heterocyclic base selected from a purine, substituted purine, pyrimidine or substituted pyrimidine. In certain embodiments, a cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N- benzoylcytosine, 5-methylcytosine. 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine and 2-N- isobutyrylguanine. It is typically desirable for linker-nucleosides to be cleaved from the oligomeric compound after it reaches a target tissue. Accordingly, linker-nucleosides are typically linked to one another and to the remainder of the oligomeric compound through cleavable bonds. In certain embodiments, such cleavable bonds are phosphodiester bonds.
Herein, linker-nucleosides are not considered to be part of the oligonucleotide. Accordingly, in embodiments in which an oligomeric compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and/or a specified percent complementarity to a reference nucleic acid and tire oligomeric compound also comprises a conjugate group comprising a conjugate linker comprising linker-nucleosides. those linker-nucleosides are not counted toward tire length of the oligonucleotide and are not used in determining the percent complementarity of the oligonucleotide for tire reference nucleic acid. For example, an oligomeric compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides and (2) a conjugate group comprising 1-10 linker-nucleosides that are contiguous with the nucleosides of the modified oligonucleotide. The total number of contiguous linked nucleosides in such an oligomeric compound is more than 30. Alternatively, an oligomeric compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides and no conjugate group. The total number of contiguous linked nucleosides in such an oligomeric compound is no more than 30. Unless otherwise indicated conjugate linkers comprise no more than 10 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 5 linker- nucleosides. In certain embodiments, conjugate linkers comprise no more than 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 2 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 1 linkcr-nuclcosidc.
In certain embodiments, it is desirable for a conjugate group to be cleaved from tire oligonucleotide. For example, in certain circumstances oligomeric compounds comprising a particular conjugate moiety are better taken up by a particular cell type, but once the oligomeric compound has been taken up, it is desirable that tire conjugate group be cleaved to release the unconjugated or parent oligonucleotide. Thus, certain conjugate linkers may comprise one or more cleavable moieties. In certain embodiments, a cleavable moiety is a cleavable bond. In certain embodiments, a cleavable moiety is a group of atoms comprising at least one cleavable bond. In certain embodiments, a cleavable moiety comprises a group of atoms having one, two. three, four, or more than four cleavable bonds. In certain embodiments, a cleavable moiety is selectively cleaved inside a cell or subcellular compartment, such as a lysosome. In certain embodiments, a cleavable moiety is selectively cleaved by endogenous enzymes, such as nucleases.
In certain embodiments, a cleavable bond is selected from among: an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, a cleavable bond is
one or both of the esters of a phosphodiester. In certain embodiments, a cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a phosphate linkage between an oligonucleotide and a conjugate moiety or conjugate group.
In certain embodiments, a cleavable moiety comprises or consists of one or more linker-nucleosides. In certain such embodiments, the one or more linker-nucleosides are linked to one another and/or to the remainder of the oligomeric compound through cleavable bonds. In certain embodiments, such cleavable bonds are unmodified phosphodiester bonds. In certain embodiments, a cleavable moiety is 2'-deoxynucleoside that is attached to either the 3' or 5'-terminal nucleoside of an oligonucleotide by a phosphate intemucleoside linkage and covalently attached to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate linkage. In certain such embodiments, the cleavable moiety is 2'-deoxyadenosine.
3. Cell-Targeting Moieties
In certain embodiments, a conjugate group comprises a cell-targeting moiety. In certain embodiments, the celltargeting moiety targets neurons. In certain embodiments, the cell-targeting moiety targets a neurotransmitter receptor. In certain embodiments, the cell targeting moiety targets a neurotransmitter transporter. In certain embodiments, the cell targeting moiety targets a GABA transporter. See e.g., WO 2011/131693, WO 2014/064257.
In certain embodiments, conjugate groups comprise cell-targeting moieties that have affinities for transferrin receptor (TfR) (also referred to herein as TfR 1 and CD71). In certain embodiments, a conjugate group described herein comprises an anti-TfRl antibody or fragment thereof. In certain embodiments, the conjugate group comprises a protein or peptide capable of binding TfRl. In certain embodiments, the conjugate group comprises an aptamer capable of binding TfRl . In certain embodiments, the anti-TfRl antibody or fragment thereof can be any known in the art including but not limited to those described in WO1991/004753; W02013/103800; WO2014/144060; WO2016/081643; WO2016/179257; WO2016/207240; WO2017/221883; WO2018/129384; WO2018/124121; WO2019/151539; WO2020/132584; W02020/028864; US 7,208,174; US 9,034,329; and US 10,550,188. In certain embodiments, a fragment of an anti-TfRl antibody is F(ab')2, Fab, Fab', Fv, or scFv.
In certain embodiments, tire conjugate group comprises a protein or peptide capable of binding TfRl. In certain embodiments, tire protein or peptide capable of binding TfRl can be any known in the art including but not limited to those described in W02019/140050; W02020/037150; W02020/124032; and US 10,138,483.
In certain embodiments, the conjugate group comprises an aptamer capable of binding TfRl. In certain embodiments, tire aptamer capable of binding TfRl can be any known in tire art including but not limited to those described in WO2013/163303; WO2019/033051; and WO2020/245198.
B. Certain Terminal Groups
In certain embodiments, oligomeric compounds comprise one or more terminal groups. In certain such embodiments, oligomeric compounds comprise a stabilized 5’-phosphate. Stabilized 5’-phosphates include, but are not limited to 5’-phosphonates, including, but not limited to 5’-vinylphosphonates. In certain embodiments, terminal groups comprise one or more abasic sugar moieties and/or inverted nucleosides. In certain embodiments, a terminal group comprises an inverted abasic sugar moiety’. In certain embodiments, the inverted abasic sugar moiety may be further attached to a conjugate group. In certain embodiments, terminal groups comprise one or more 2’-linked nucleosides or
sugar moieties. In certain such embodiments, the 2’-linked group is an abasic sugar moiety. Such terminal abasic sugar moieties can be attached to either or both ends of an oligonucleotide.
III. Antisense Activity
In certain embodiments, oligomeric compounds are capable of hybridizing to a target nucleic acid, resulting in at least one antisense activity. In certain embodiments, an oligomeric compound forms an oligomeric duplex with a second oligomeric compound comprising a complementary nucleobase sequence. Such oligomeric compounds and oligomeric duplexes are antisense compounds. In certain embodiments, antisense compounds are deemed to have antisense activity when they reduce or inhibit the amount or activity of a target nucleic acid by 50% or more in the standard in vitro assay. In certain embodiments, antisense compounds selectively affect one or more target nucleic acid. Such antisense compounds comprise a nucleobase sequence that hybridizes to one or more target nucleic acid, resulting in one or more desired antisense activity and does not hybridize to one or more non-target nucleic acid or does not hybridize to one or more non-target nucleic acid in such a way that results in significant undesired antisense activity.
In certain antisense activities, hybridization of an antisense compound to a target nucleic acid results in recruitment of a protein that cleaves the target nucleic acid. For example, certain antisense compounds result in RNase H mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in such an RNA:DNA duplex need not be unmodified DNA. In certain embodiments, described herein are antisense compounds that are sufficiently “DNA-like” to elicit RNase H activity. In certain embodiments, one or more non-DNA-like nucleoside in tire gap of a gapmer is tolerated.
In certain antisense activities, an antisense compound or a portion of an antisense compound is loaded into an RNA-induced silencing complex (RISC), ultimately resulting in cleavage of tire target nucleic acid. For example, certain antisense compounds result in cleavage of the target nucleic acid by Argonaute. Antisense compounds that are loaded into RISC are RNAi agents. RNAi agents may be double-stranded (siRNA or dsRNAi) or single-stranded (ssRNAi).
In certain embodiments, hybridization of an antisense compound to a target nucleic acid does not result in recruitment of a protein that cleaves that target nucleic acid. In certain embodiments, hybridization of the antisense compound to the target nucleic acid results in alteration of splicing of the target nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in inhibition of a binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in alteration of translation of the target nucleic acid.
Antisense activities may be observed directly or indirectly. In certain embodiments, observ ation or detection of an antisense activity involves observ ation or detection of a change in an amount of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein and/or a phenotypic change in a cell or subject.
TV. Certain Target Nucleic Acids
In certain embodiments, oligomeric compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from: a mature mRNA and a pre-mRNA. including intronic, exonic and untranslated regions. Tn
certain embodiments, the target RNA is a mature mRNA. In certain embodiments, the target nucleic acid is a pre- mRNA. Tn certain embodiments, the target region is entirely within an intron. Tn certain embodiments, the target region spans an intron/exon junction. In certain embodiments, the target region is at least 50% within an intron. In certain embodiments, the target nucleic acid is the RNA transcriptional product of a retrogene. In certain embodiments, the target nucleic acid is a non-coding RNA. In certain embodiments, the target non-coding RNA is selected from: a long non-coding RNA, a short non-coding RNA, an intronic RNA molecule.
A. Complementaritv/Mismatches to the Target Nucleic Acid and Duplex Complementarity
In certain embodiments, oligonucleotides are complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, oligonucleotides are 99%, 95%. 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, oligonucleotides are at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide and comprise a region that is 100% or hilly complementary to a target nucleic acid. In certain embodiments, the region of full complementarity is from 6 to 20. 10 to 18, or 18 to 20 nucleobases in length.
It is possible to introduce mismatch bases without eliminating activity. For example, Gautschi et al (J. Natl. Cancer Inst. 93:463-471. March 2001) demonstrated the ability of an oligonucleotide having 100% complementarity to the bcl-2 mRNA and having 3 mismatches to the bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide demonstrated potent anti-tumor activity in vivo. Maher and Dolnick {Nucleic Acids Res. 16:3341-3358, 1988) tested a series of tandem 14 nucleobase oligonucleotides, and 28 and 42 nucleobase oligonucleotides comprised of the sequence of two or three of the tandem oligonucleotides, respectively, for their ability to arrest translation of human DHFR in a rabbit reticulocyte assay. Each of tire three 14 nucleobase oligonucleotides alone was able to inhibit translation, albeit at a more modest level than the 28 or 42 nucleobase oligonucleotides.
In certain embodiments, oligonucleotides comprise one or more mismatched nucleobases relative to the target nucleic acid. In certain embodiments, antisense activity against the target is reduced by such mismatch, but activity' against a non-target is reduced by a greater amount. Thus, in certain embodiments selectivity of the oligonucleotide is improved.
In certain embodiments, a mismatch is specifically positioned within an oligonucleotide having a gapmer motif. In certain embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, or 8 from the 5’-end of tire gap region. In certain embodiments, tire mismatch is at position 9, 8, 7, 6. 5, 4, 3, 2, 1 from tire 3 ‘-end of the gap region. In certain embodiments, tire mismatch is at position 1, 2, 3, or 4 from the 5 ’-end of the wing region. In certain embodiments, the mismatch is at position 4, 3, 2, or 1 from the 3 -end of the wing region.
B. SNCA
In certain embodiments, oligomeric compounds described herein comprise or consist of an oligonucleotide comprising a region that is complementary' to a target nucleic acid, wherein tire target nucleic acid is SNCA. In each of the embodiments described above, the oligomeric compounds may target the SNCA nucleic acid. In certain embodiments, tire SNCA nucleic acid has the sequence set forth in SEQ ID NO: 1 (Ensembl Accession ENSG00000145335.17, Ensembl release 106 - Apr 2022), SEQ ID NO: 2 (the complement of GENBANK Accession No: NT 016354.20 truncated from nucleoside 30800000 to nucleoside 30919000), SEQ ID NO: 3 (GENBANK
Accession No: NM 001146055.1), SEQ ID NO: 4 (Ensembl ID ENST00000618500.4, Ensembl release 106-Apr 2022), SEQ ID NO: 5 (GENBANK Accession No: NM 000345.3). SEQ ID NO: 6 (GENBANK Accession No: JN709863.1), SEQ ID NO: 7 (GENBANK Accession No: BC013293.2). SEQ ID NO: 8 (GENBANK Accession No:
NM 001146054.2), or SEQ ID NO: 9 (GENBANK Accession No: HQ830269.1). In certain embodiments, contacting a cell with an oligomeric compound described herein that is complementary to any of SEQ ID NOs: 1-9 reduces the amount of SNCA RNA, and in certain embodiments reduces the amount of alpha-synuclein protein. In certain embodiments, contacting a cell with an oligomeric compound described herein that is complcmcntan to any of SEQ ID NOs: 1-9 results in reduced aggregation of alpha-sy nuclein protein. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide and a conjugate group.
In certain embodiments, contacting a cell with an oligomeric compound described herein that is complementary to any of SEQ ID NOs: 1-9 reduces the amount of SNCA RNA in a cell. In certain embodiments, contacting a cell with an oligomeric compound described herein that is complementary to any of SEQ ID NOs: 1-9 reduces the amount of alpha-synuclein protein in the cell. In certain embodiments, the cell is in vitro. In certain embodiments, the cell is in a subject. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide. In certain embodiments, contacting a cell in a subject with an oligomeric compound described herein that is complementary to any of SEQ ID NOs: 1-9 ameliorates one or more symptoms or hallmarks of a synucleinopathy. In certain embodiments, the synucleinopathy is Parkinson’s disease, dementia with Lewy bodies (DLB), diffuse Lewy body disease. Parkinson’s disease dementia (PDD), pure autonomic failure, multiple system atrophy (MSA), neuronopathic Gaucher's disease, or Alzheimer’s disease. In certain embodiments, the one or more symptoms or hallmarks include Parkinson’s disease, dementia with Lewy bodies (DLB), diffuse Lewy body disease, Parkinson’s disease dementia (PDD). pure autonomic failure, multiple system atrophy (MSA), neuronopathic Gaucher's disease, and Alzheimer’s disease.
In certain embodiments, an oligomeric compound described herein that is complementary to any of SEQ ID NOs: 1-9 is capable of reducing the amount of SNCA RNA in vitro by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% when administered according to the standard in vitro assay. In certain embodiments, an oligomeric compound described herein that is complementary' to any of SEQ ID NOs: 1-9 is capable of reducing the amount of SNCA RNA in vivo by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% when administered according to tire standard in vivo assay. In certain embodiments, an oligomeric compound described herein that is complementary' to any of SEQ ID NOs: 1-9 is capable of reducing the amount of alpha-synuclein protein in vitro by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% when administered according to the standard in vitro assay. In certain embodiments, an oligomeric compound described herein that is complementary to any of SEQ ID NOs: 1-9 is capable of reducing the amount of alpha-synuclein protein in vivo by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%. at least 70%, at least 80%, or at least 90% yvhen administered according to the standard in vivo assay. In certain embodiments, an oligomeric compound described herein that is complementary' to any of SEQ ID NOs: 1-9 is capable of reducing the amount of SNCA RNA in the cell of a subject by at least 10%. at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%. at least 80%, or at least 90%. In certain embodiments, an oligomeric compound described herein that is complementary to any of SEQ ID NOs: 1 -9 is capable of reducing the amount of alpha-synuclein protein or the amount of alpha-synuclein protein
aggregation in the cell of a subject by at least 10%, at least 20%, at least 30%. at least 40%, at least 50%, at least 60%, at least 70%. at least 80%, or at least 90%.
C. Certain Target Nucleic Acids in Certain Tissues
In certain embodiments, oligomeric compounds comprise or consist of an oligonucleotide comprising a region that is complementary to a target nucleic acid, wherein the target nucleic acid is expressed in a pharmacologically relevant tissue. In certain embodiments, the pharmacologically relevant tissue are the cells and tissues that comprise the central nervous system (CNS). Such tissues include the brain and the spinal cord. In certain embodiments, the pharmacologically relevant tissues include the motor cortex, frontal cortex, caudate, putamen, amygdala, pons, substantia nigra, putamen, cerebellar peduncle, corpus collosum, deep cerebellar nuclei (DCN), entorhinal cortex (Ent Cortex), hippocampus, insular cortex, medulla oblongata, central gray matter, pulvinar, occipital cortex, cerebral cortex, temporal cortex, globus pallidus, superior colliculi, and basal forebrain nuclei. In certain embodiments, the cells are brain cells. In certain embodiments, the cells include neurons and oligodendrocytes.
V. Certain Methods and Uses
Certain embodiments provided herein relate to methods of reducing or inhibiting SNCA expression or activity, which can be useful for treating, preventing, or ameliorating a synucleinopathy in a subject. In certain embodiments, the synucleinopathy is Parkinson’s disease, dementia with Lewy bodies (DLB), diffuse Lewy body disease. Parkinson’s disease dementia (PDD), pure autonomic failure, multiple system atrophy (MSA), neuronopathic Gaucher's disease, or Alzheimer’s disease.
In certain embodiments, a method comprises administering to a subject an oligomeric compound, a modified oligonucleotide, an oligomeric duplex, or an antisense agent, any of which having a nucleobase sequence complementary to a SNCA nucleic acid. In certain embodiments, the subject has or is at risk for developing a synucleinopathy. In certain embodiments, tire subject has or is at risk for developing Parkinson’s disease, dementia with Lewy bodies (DLB), diffuse Lewy body disease, Parkinson’s disease dementia (PDD), pure autonomic failure, multiple system atrophy (MSA), neuronopathic Gaucher's disease, or Alzheimer’s disease. In certain embodiments, the subject lias Parkinson’s disease. In certain embodiments, the subject lias dementia with Levy bodies (DLB). In certain embodiments, the subject lias diffuse Lewy body disease. In certain embodiments, the subject lias Parkinson’s disease dementia (PDD). In certain embodiments, the subject has pure autonomic failure. In certain embodiments, the subject lias multiple system atrophy (MSA). In certain embodiments, the subject has neuronopathic Gaucher’s disease. In certain embodiments, the subject lias Alzheimer’s disease.
In certain embodiments, a method for treating a synucleinopathy comprises administering to a subject an oligomeric compound, a modified oligonucleotide, an oligomeric duplex, or an antisense agent, any of which having a nucleobase sequence complementary to a SNCA nucleic acid. In certain embodiments, the subject has or is at risk for developing a synucleinopathy. In certain embodiments, the subject has or is at risk for developing Parkinson’s disease, dementia with Lewy7 bodies (DLB), diffuse Lewy body disease, Parkinson’s disease dementia (PDD), pure autonomic failure, multiple system atrophy (MSA), neuronopathic Gaucher's disease, or Alzheimer’s disease. In certain embodiments, the subject has Parkinson’s disease. In certain embodiments, the subject has multiple system atrophy (MSA). Tn certain embodiments, the subject has Alzheimer’s disease. In certain embodiments, at least one symptom or
hallmark of the synucleinopathy is ameliorated. In certain embodiments, the at least one symptom or hallmark is motor dysfunction, aggregation of alpha-synuclein, neurodegeneration, cognitive decline, dementia, sleep disorders, hyposmia, autonomic failure, ataxia, hallucination, or seizures.
In certain embodiments, a method of reducing expression of SNCA, for example RNA, or reducing tire expression of alpha-synuclein protein in a cell comprises contacting the cell with an oligomeric compound, a modified oligonucleotide, an oligomeric duplex, or an antisense agent, any of which having a nucleobase sequence complementary to a SNCA nucleic acid. In certain embodiments, the subject has or is at risk for developing a synucleinopathy. In certain embodiments, the subject has or is at risk for developing Parkinson’s disease, dementia with Lew bodies (DLB). diffuse Lewy body disease. Parkinson’s disease dementia (PDD), pure autonomic failure, multiple system atrophy (MSA), neuronopathic Gaucher's disease, or Alzheimer’s disease. In certain embodiments, the subject has Parkinson’s disease. In certain embodiments, the subject has multiple system atrophy (MSA). In certain embodiments, the subject has Alzheimer’s disease. In certain embodiments, tire cell is a brain cell. In certain embodiments, the cell is a neuron. In certain embodiments, the cell is an oligodendrocyte. In certain embodiments, the cell is a human cell.
Certain embodiments are drawn to an oligomeric compound, a modified oligonucleotide, an oligomeric duplex, or an antisense agent, any of which having a nucleobase sequence complementary to a SNCA nucleic acid, for use in treating a synucleinopathy or for use in the manufacturing of a medicament for treating a synucleinopathy . In certain embodiments, the synucleinopathy is Parkinson’s disease, dementia with Lewy bodies (DLB), diffuse Lewy body disease, Parkinson’s disease dementia (PDD), pure autonomic failure, multiple system atrophy (MSA), neuronopathic Gaucher's disease, or Alzheimer’s disease.
In any of the methods or uses described herein, the oligomeric compound, the modified oligonucleotide, the oligomeric duplex, or tire antisense agent can be any described herein.
VI. Certain Pharmaceutical Compositions
In certain embodiments, described herein are pharmaceutical compositions comprising one or more oligomeric compounds. In certain embodiments, the one or more oligomeric compounds each consists of a modified oligonucleotide. In certain embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier. In certain embodiments, a pharmaceutical composition comprises or consists of a sterile saline solution and one or more oligomeric compound. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric compound and sterile w ater. In certain embodiments, the sterile w ater is pharmaceutical grade w ater. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric compound and phosphate- buffered saline (PBS). In certain embodiments, the sterile PBS is pharmaceutical grade PBS. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric compound and artificial cerebrospinal fluid ('‘artificial CSF” or “aCSF”). In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.
In certain embodiments, a pharmaceutical composition comprises a modified oligonucleotide and artificial cerebrospinal fluid (aCSF). In certain embodiments, a pharmaceutical composition consists of a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, a pharmaceutical composition consists
essentially of a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.
In certain embodiments, aCSF comprises sodium chloride, potassium chloride, sodium dihydrogen phosphate dihydrate, sodium phosphate dibasic anhydrous, calcium chloride dihydrate, and magnesium chloride hexahydrate. In certain embodiments, the pH of an aCSF solution is modulated with a suitable pH-adjusting agent, for example, with acids such as hydrochloric acid and alkalis such as sodium hydroxide, to a range of from about 7.1-7.3, or to about 7.2.
In certain embodiments, pharmaceutical compositions comprise one or more oligomeric compound and one or more excipients. In certain embodiments, excipients are selected from water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose and polyvinylpyrrolidone .
In certain embodiments, oligomeric compounds may be admixed with pharmaceutically acceptable active and/or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions depend on a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.
In certain embodiments, pharmaceutical compositions comprising an oligomeric compound encompass any pharmaceutically acceptable salts of the oligomeric compound, esters of the oligomeric compound, or salts of such esters. In certain embodiments, pharmaceutical compositions comprising oligomeric compounds comprising one or more oligonucleotide, upon administration to a subject, including a human, are capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of oligomeric compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. In certain embodiments, pharmaceutically acceptable salts comprise inorganic salts, such as monovalent or divalent inorganic salts. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium, potassium, calcium, and magnesium salts. In certain embodiments, prodrugs comprise one or more conjugate group attached to an oligonucleotide, wherein the conjugate group is cleaved by endogenous nucleases within tire body.
In certain embodiments, oligomeric compounds are lyophilized and isolated as sodium salts. In certain embodiments, tire sodium salt of an oligomeric compound is mixed with a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent comprises sterile saline, sterile water, PBS, or aCSF. In certain embodiments, the sodium salt of an oligomeric compound is mixed with PBS. In certain embodiments, the sodium salt of an oligomeric compound is mixed with aCSF.
Lipid moieties have been used in nucleic acid therapies in a variety of methods. In certain such methods, the nucleic acid, such as an oligomeric compound, is introduced into preformed liposomes or lipoplexes made of mixtures of cationic lipids and neutral lipids. In certain methods, DNA complexes with mono- or poly -cationic lipids are formed without the presence of a neutral lipid. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to a particular cell or tissue. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to fat tissue. In certain embodiments, a lipid moiety is selected to increase distribution of a pharmaceutical agent to muscle tissue.
In certain embodiments, pharmaceutical compositions comprise a delivery system. Examples of delivery systems include, but are not limited to. liposomes and emulsions. Certain delivery systems are useful for preparing
certain pharmaceutical compositions including those comprising hydrophobic compounds. In certain embodiments, certain organic solvents such as dimethylsulfoxide are used.
In certain embodiments, pharmaceutical compositions comprise one or more tissue-specific delivery molecules designed to deliver the one or more pharmaceutical agents of the present invention to specific tissues or cell types. For example, in certain embodiments, pharmaceutical compositions include liposomes coated with a tissue-specific antibody.
In certain embodiments, pharmaceutical compositions comprise a co-solvent system. Certain of such co-solvent systems comprise, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such co-solvent systems are used for hydrophobic compounds. A non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of absolute ethanol comprising 3% w/v benzyl alcohol, 8% w/v of the nonpolar surfactant Polysorbate 80™ and 65% w/v polyethylene glycol 300. The proportions of such co-solvent systems may be varied considerably without significantly altering their solubility and toxicity characteristics. Furthermore, the identity of co-solvent components may be varied: for example, other surfactants may be used instead of Polysorbate 80™; the fraction size of polyethylene glycol may be varied; other biocompatible polymers may replace polyethylene glycol, e.g., polyvinyl pyrrolidone; and other sugars or polysaccharides may substitute for dextrose.
In certain embodiments, pharmaceutical compositions are prepared for oral administration. In certain embodiments, pharmaceutical compositions are prepared for buccal administration. In certain embodiments, a pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), etc.). In certain of such embodiments, a pharmaceutical composition comprises a carrier and is formulated in aqueous solution, such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other ingredients are included (e.g., ingredients that aid in solubility or serve as preservatives). In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents and tire like. Certain pharmaceutical compositions for injection are presented in unit dosage form, e.g., in ampoules or in multi-dose containers. Certain pharmaceutical compositions for injection are suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Certain solvents suitable for use in pharmaceutical compositions for injection include, but arc not limited to, lipophilic solvents and fatty oils, such as sesame oil, sy nthetic fatty acid esters, such as ethyl oleate or trigly cerides, and liposomes.
Under certain conditions, certain compounds disclosed herein act as acids. Although such compounds may be drawn or described in protonated (free acid) form, or ionized and in association with a cation (salt) form, aqueous solutions of such compounds exist in equilibrium among such forms. For example, a phosphodiester linkage of an oligonucleotide in aqueous solution exists in equilibrium among free acid, anion and salt forms. Unless otherwise indicated, compounds described herein are intended to include all such forms. Moreover, certain oligonucleotides have several such linkages, each of which is in equilibrium. Thus, oligonucleotides in solution exist in an ensemble of forms at multiple positions all at equilibrium. The term “oligonucleotide” is intended to include all such forms. Drawn structures necessarily depict a single form. Nevertheless, unless otherwise indicated, such drawings are likewise intended to include corresponding forms. Herein, a structure depicting the free acid of a compound followed by the term “or a pharmaceutically acceptable salt thereof’ expressly includes all such forms that may be fully or partially
protonated/de-protonated/in association with a cation or a combination of cations. In certain embodiments, one or more specific cation is identified. The cations include, but are not limited to, sodium, potassium, calcium, and magnesium. Tn certain embodiments, a structure depicting the free acid of a compound followed by the term “or a pharmaceutically acceptable salt thereof’ expressly includes all such forms that may be fully or partially protonated/de-protonated/in association with one or more cations selected from sodium, potassium, calcium, and magnesium.
In certain embodiments, modified oligonucleotides or oligomeric compounds are in aqueous solution with sodium. In certain embodiments, modified oligonucleotides or oligomeric compounds are in aqueous solution with potassium. In certain embodiments, modified oligonucleotides or oligomeric compounds are in PBS. In certain embodiments, modified oligonucleotides or oligomeric compounds are in water. In certain such embodiments, the pH of the solution is adjusted with NaOH and/or HC1 to achieve a desired pH.
Herein, certain specific doses are described. A dose may be in the form of a dosage unit. For clarity, a dose (or dosage unit) of a modified oligonucleotide or an oligomeric compound in milligrams indicates the mass of the free acid form of the modified oligonucleotide or oligomeric compound. As described above, in aqueous solution, the free acid is in equilibrium with anionic and salt forms. However, for the purpose of calculating dose, it is assumed that the modified oligonucleotide or oligomeric compound exists as a solvent-free, sodium-acetate free, anhydrous, free acid.
In certain embodiments, where a modified oligonucleotide or an oligomeric compound is in solution comprising sodium (e.g.. saline), the modified oligonucleotide or oligomeric compound may be partially or fully deprotonated and in association with sodium ions. However, tire mass of the protons is nevertheless counted toward tire weight of the dose, and tire mass of the sodium ions is not counted toward tire weight of the dose. Thus, for example, a dose, or dosage unit, of 10 mg of Compound No. 1482139 equals the number of fully protonated molecules that weighs 10 mg. This would be equivalent to 10.61 mg of solvent-free, sodium acetate-free, anhydrous sodiated Compound No. 1482139.
In certain embodiments, where a modified oligonucleotide or oligomeric compound is in a solution, such as aCSF, comprising sodimn, potassium, calcium, and magnesium, tire modified oligonucleotide or oligomeric compound may be partially or fully de-protonated and in association with sodium, potassium, calcium, and/or magnesium. However, the mass of the protons is nevertheless counted toward the weight of the dose, and tire mass of the sodium, potassium, calcium, and magnesium ions is not counted toward the weight of tire dose.
In certain embodiments, when an oligomeric compound comprises a conjugate group, tire mass of the conjugate group may be included in calculating the dose of such oligomeric compound. If tire conjugate group also has an acid, tire conjugate group is likewise assumed to be fully protonated for the purpose of calculating dose.
VII. Certain Oligomeric Compounds
In certain embodiments, an oligomeric compound disclosed herein comprises a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16. at least 17, at least 18, at least 19, or 20 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 13-3334. In certain such embodiments, the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified intemucleoside linkage. In certain embodiments, the oligomeric compound comprises a conjugate group. In certain embodiments, the oligomeric
compound does not comprise a conjugate group. In certain embodiments, the oligomeric compound comprises a terminal group. In certain embodiments, the oligomeric compound does not comprise a terminal group.
In certain embodiments, an oligomeric compound disclosed herein comprises a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 12. at least 13, at least 14, at least 15, at least 16. at least 17. at least 18, at least 19, or 20 contiguous nucleobases of 5’- ACAGATATTTTTGTTCTGCC -3 ’ (SEQ ID NO: 3318). In certain embodiments, the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified intemucleoside linkage. In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety selected from a 2 ’-MOE sugar moiety, a 2’-OMe sugar moiety, a 2’-(3-D-deoxyxylosyl sugar moiety, and a 2’-a-L-deoxyribosyl sugar moiety'. In certain embodiments, the modified intemucleoside linkage is selected from a phosphorothioate intemucleoside linkage and a mesyl phosphoramidate intemucleoside linkage. In certain embodiments, each nucleobase of the modified oligonucleotide is an unmodified nucleobase. In certain embodiments, at least one nucleobase of the modified oligonucleotide is a modified nucleobase. In certain embodiments, the oligomeric compound comprises a conjugate group. In certain embodiments, the oligomeric compound does not comprise a conjugate group. In certain embodiments, the oligomeric compound comprises a terminal group. In certain embodiments, the oligomeric compound does not comprise a terminal group.
In certain embodiments, the modified oligonucleotide has a nucleobase sequence of SEQ ID NO: 3318. In certain embodiments, tire modified oligonucleotide has a modified sugar motif of (from 5’ to 3’) eeeeeddddddddddeeeee, wherein each “e" is a 2‘-MOE sugar moiety and each “d” is a 2’-p-D-deoxyribosyl sugar moiety. In certain embodiments, the modified oligonucleotide comprises a modified intemucleoside linkage selected from a phosphorothioate intemucleoside linkage and a mesyl phosphoramidate intemucleoside linkage. In certain embodiments, each nucleobase of the modified oligonucleotide is an unmodified nucleobase. In certain embodiments, at least one nucleobase of the modified oligonucleotide is a modified nucleobase. In certain embodiments, at least one cytosine of the modified oligonucleotide is a modified cytosine. In certain embodiments, each cytosine of the modified oligonucleotide is a 5 -methylcytosine.
In certain embodiments, the modified oligonucleotide lias a nucleobase sequence of SEQ ID NO: 3318. In certain embodiments, the modified oligonucleotide has a modified sugar motif of (from 5’ to 3’) eeeeeddddddddddeeeee, wherein each “c” is a 2 ’-MOE sugar moiety and each “d” is a 2’-p-D-dcoxyribosyl sugar moiety. In certain embodiments, the modified oligonucleotide has a modified intemucleoside linkage motif of (from 5’ to 3’) ssssszzzzssssssssss, wherein each “s” is a phosphorothioate intemucleoside linkage and each “z” is a mesyl phosphoramidate intemucleoside linkage. In certain embodiments, each nucleobase of the modified oligonucleotide is an unmodified nucleobase. In certain embodiments, at least one nucleobase of the modified oligonucleotide is a modified nucleobase. In certain embodiments, at least one cytosine of the modified oligonucleotide is a modified cytosine. In certain embodiments, each cytosine of the modified oligonucleotide is a 5-methylcytosine.
In certain embodiments, the modified oligonucleotide has a nucleobase sequence of SEQ ID NO: 3318. In certain embodiments, the modified oligonucleotide has a modified sugar motif of (from 5’ to 3’) eeeeeddddddddddeeeee, wherein each “e” is a 2 ’-MOE sugar moiety and each “d” is a 2’-P-D-deoxyribosyl sugar moiety. In certain embodiments, the modified oligonucleotide has a modified intemucleoside linkage motif of (from 5’ to 3’) ssssszzsssszzssssss. wherein each “s” is a phosphorothioate intemucleoside linkage and each “z” is a mesyl
phosphoramidate intemucleoside linkage. In certain embodiments, each nucleobase of the modified oligonucleotide is an unmodified nucleobase. In certain embodiments, at least one nucleobase of the modified oligonucleotide is a modified nucleobase. In certain embodiments, at least one cytosine of the modified oligonucleotide is a modified cytosine. In certain embodiments, each cytosine of the modified oligonucleotide is a 5-methylcytosine.
In certain embodiments, an oligomeric compound disclosed herein comprises a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 12. at least 13, at least 14, at least 15, at least 16, at least 17. at least 18, at least 19, or 20 contiguous nucleobases of 5’- ACGACATTTTCTTGCCTCTT -3 ’ (SEQ ID NO: 3319). In certain embodiments, the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified intemucleoside linkage. In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety selected from a 2 ’-MOE sugar moiety, a 2’-OMe sugar moiety, a 2’-|3-D-deoxyxylosyl sugar moiety, and a 2’-a-L-deoxyribosyl sugar moiety. In certain embodiments, the modified intemucleoside linkage is selected from a phosphorothioate intemucleoside linkage and a mesyl phosphoramidate intemucleoside linkage. In certain embodiments, each nucleobase of the modified oligonucleotide is an unmodified nucleobase. In certain embodiments, at least one nucleobase of the modified oligonucleotide is a modified nucleobase. In certain embodiments, the oligomeric compound comprises a conjugate group. In certain embodiments, the oligomeric compound does not comprise a conjugate group. In certain embodiments, tire oligomeric compound comprises a terminal group. In certain embodiments, the oligomeric compound does not comprise a terminal group.
In certain embodiments, the modified oligonucleotide has a nucleobase sequence of SEQ ID NO: 3319. In certain embodiments, the modified oligonucleotide has a modified sugar motif of (from 5‘ to 3’) eeeeeddddddddddeeeee, wherein each “e” is a 2‘-MOE sugar moiety and each “d” is a 2’-p-D-deoxyribosyl sugar moiety. In certain embodiments, the modified oligonucleotide comprises a modified intemucleoside linkage selected from a phosphorothioate intemucleoside linkage and a mesyl phosphoramidate intemucleoside linkage. In certain embodiments, each nucleobase of the modified oligonucleotide is an unmodified nucleobase. In certain embodiments, at least one nucleobase of the modified oligonucleotide is a modified nucleobase. In certain embodiments, at least one cytosine of the modified oligonucleotide is a modified cytosine. In certain embodiments, each cy tosine of the modified oligonucleotide is a 5-mcthylcytosinc.
In certain embodiments, the modified oligonucleotide lias a nucleobase sequence of SEQ ID NO: 3319. In certain embodiments, the modified oligonucleotide has a modified sugar motif of (from 5’ to 3’) eeeeeddddddddddeeeee, wherein each “e” is a 2 ’-MOE sugar moiety and each “d” is a 2’-p-D-deoxyribosyl sugar moiety. In certain embodiments, the modified oligonucleotide has a modified intemucleoside linkage motif of (from 5’ to 3’) ssooszsssssszsssoss, wherein each “s” is a phosphorothioate intemucleoside linkage, each “o” is a phosphodiester intemucleoside linkage, and each “z” is a mesyl phosphoramidate intemucleoside linkage. In certain embodiments, each nucleobase of the modified oligonucleotide is an unmodified nucleobase. In certain embodiments, at least one nucleobase of the modified oligonucleotide is a modified nucleobase. In certain embodiments, at least one cytosine of the modified oligonucleotide is a modified cytosine. In certain embodiments, each cytosine of the modified oligonucleotide is a 5-methylcytosine.
In certain embodiments, an oligomeric compound disclosed herein comprises a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises at
least 12, at least 13, at least 14, at least 15, at least 16. at least 17, at least 18, at least 19, or 20 contiguous nucleobases of 5’- ATCACGACATTTTCTTGCCT -3’ (SEQ ID NO: 3328). In certain embodiments, the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified intemucleoside linkage. Tn certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety selected from a 2 ’-MOE sugar moiety, a 2’-OMe sugar moiety, a 2’-(3-D-deoxyxylosyl sugar moiety, and a 2’-a-L-deoxyribosyl sugar moiety. In certain embodiments, the modified intemucleoside linkage is selected from a phosphorothioate intemucleoside linkage and a mesyl phosphoramidate intemucleoside linkage. In certain embodiments, each nucleobase of the modified oligonucleotide is an unmodified nucleobase. In certain embodiments, at least one nucleobase of the modified oligonucleotide is a modified nucleobase. In certain embodiments, the oligomeric compound comprises a conjugate group. In certain embodiments, the oligomeric compound does not comprise a conjugate group. In certain embodiments, the oligomeric compound comprises a terminal group. In certain embodiments, the oligomeric compound does not comprise a terminal group.
In certain embodiments, the modified oligonucleotide has a nucleobase sequence of SEQ ID NO: 3328. In certain embodiments, the modified oligonucleotide has a modified sugar motif of (from 5’ to 3’) eeeeeeddddddddddeeee, wherein each “e” is a 2’-MOE sugar moiety and each “d” is a 2’-p-D-deoxyribosyl sugar moiety. In certain embodiments, the modified oligonucleotide comprises a modified intemucleoside linkage selected from a phosphorothioate intemucleoside linkage and a mesyl phosphoramidate intemucleoside linkage. In certain embodiments, each nucleobase of the modified oligonucleotide is an unmodified nucleobase. In certain embodiments, at least one nucleobase of tire modified oligonucleotide is a modified nucleobase. In certain embodiments, at least one cytosine of the modified oligonucleotide is a modified cytosine. In certain embodiments, each cytosine of the modified oligonucleotide is a 5-methylcytosine.
In certain embodiments, the modified oligonucleotide has a nucleobase sequence of SEQ ID NO: 3328. In certain embodiments, the modified oligonucleotide has a modified sugar motif of (from 5’ to 3’) eeeeeeddddddddddeeee, wherein each “e” is a 2‘-MOE sugar moiety and each “d” is a 2 ’-p-D-deoxy ribosyl sugar moiety. In certain embodiments, the modified oligonucleotide has a modified intemucleoside linkage motif of (from 5‘ to 3’) sooooossssssssssoss, wherein each “s’’ is a phosphorothioate intemucleoside linkage and each “o” is a phosphodicstcr intemucleoside linkage. In certain embodiments, each nucleobase of tire modified oligonucleotide is an unmodified nucleobase. In certain embodiments, at least one nucleobase of tire modified oligonucleotide is a modified nucleobase. In certain embodiments, at least one cytosine of tire modified oligonucleotide is a modified cytosine. In certain embodiments, each cytosine of the modified oligonucleotide is a 5-methylcytosine.
In certain embodiments, disclosed herein is an oligomeric compound according to the following chemical notation: N1eS lnCeSAesGeSAesTdzAdzTdzTdzT*TdsTdsGdsTdsTds mCeSTesGeS lnCeSN2 e (SEQ ID NO: 3346), wherein:
A = an adenine nucleobase, mC = a 5-methylcytosine nucleobase. G = a guanine nucleobase, T = a thymine nucleobase,
N1 = an adenine nucleobase. a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent, wherein when N1 is absent its sugar and intemucleoside linkage are also absent,
N2 = a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent, wherein
when N2 is absent its sugar is also absent, e = a 2’-MOE sugar moiety, d = a 2’-P-D-deoxyribosyl sugar moiety, s = a phosphorothioate intemucleoside linkage, and z = a mesyl phosphoramidate intemucleoside linkage; and wherein the oligomeric compound optionally comprises a conjugate group. In certain embodiments. N1 is an adenine nucleobase. In certain embodiments. N1 is an unmodified adenine. In certain embodiments. N1 is a modified adenine. In certain embodiments, N1 is a hypoxanthine. In certain embodiments. N1 is an abasic sugar moiety. In certain embodiments. N1 is a terminal group. In certain embodiments. N1 is absent. In certain embodiments, N2 is a modified cytosine. In certain embodiments. N2is 5-methylcytosine. In certain embodiments, N2is an unmodified cytosine. In certain embodiments, N2is an abasic sugar moiety. In certain embodiments, N2is a terminal group. In certain embodiments. N2 is absent. In certain embodiments, N3 is a modified thymine. In certain embodiments, N3 is an unmodified thymine. In certain embodiments, N3 is an abasic sugar moiety. In certain embodiments, N3 is a terminal group. In certain embodiments. N3 is absent. In certain embodiments, N1 is an adenine nucleobase and N2 is a cytosine nucleobase. a modified cytosine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments, N1 is an adenine nucleobase and N2 is a modified cytosine. In certain embodiments, N1 is an adenine nucleobase and N2 is an abasic sugar moiety. In certain embodiments, N1 is an adenine nucleobase and N2 is a tenninal group. In certain embodiments. N1 is an adenine nucleobase and N2 is absent. In certain embodiments, N1 is a modified adenine and N2 is a cytosine nucleobase. a modified cytosine, an abasic sugar moiety, a tenninal group, or is absent. In certain embodiments, N1 is a modified adenine and N2 is a modified cytosine. In certain embodiments, N1 is a modified adenine and N2 is 5- methylcytosine. In certain embodiments, N1 is a modified adenine and N2 is an abasic sugar moiety. In certain embodiments, N1 is a modified adenine and N2 is a tenninal group. In certain embodiments, N1 is a modified adenine and N2 is absent. In certain embodiments, N1 is a hypoxanthine and N2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments, N1 is a hypoxanthine and N2 is a modified cytosine. In certain embodiments, N1 is a hypoxanthine and N2is 5-methylcytosine. In certain embodiments, N1 is a hypoxanthine and N2 is an abasic sugar moiety . In certain embodiments, N1 is a hypoxanthine and N2 is a tenninal group. In certain embodiments, N1 is a hypoxanthine and N2 is absent. In certain embodiments, N1 is an abasic sugar moiety and N2 is a cytosine nucleobase, a modified cy tosine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments, N1 is a terminal group and N2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments, N1 is absent and N2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety', a tenninal group, or is absent. In certain embodiments, N1 is absent and N2 is absent. In certain embodiments, N1 is an adenine nucleobase and N3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety', a terminal group, or is absent. In certain embodiments, N1 is an adenine nucleobase and N3 is a thymine nucleobase. In certain embodiments, N1 is an adenine nucleobase and N3 is a modified thymine. In certain embodiments, N1 is an adenine nucleobase and N3 is an abasic sugar moiety. In certain embodiments, N1 is an adenine nucleobase and N3 is a terminal group. In certain embodiments, N1 is an adenine nucleobase and N3 is absent. In certain embodiments. N1 is a modified adenine and N3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments. N1 is a modified adenine and N3 is an unmodified thymine. In certain embodiments, N1 is a modified adenine and N3 is an abasic sugar moiety. In certain embodiments. N1 is a modified adenine and N3 is a
terminal group. In certain embodiments, N1 is a modified adenine and N3 is absent. In certain embodiments, N1 is a hypoxanthine and N3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments. N1 is a hypoxanthine and N3 is an unmodified thymine. In certain embodiments, N1 is a hypoxanthine and N3 is an abasic sugar moiety. In certain embodiments, N1 is a hypoxanthine and N3 is a terminal group. In certain embodiments, N1 is a hypoxanthine and N3 is absent. In certain embodiments, N1 is an abasic sugar moiety and N3 is a thymine nucleobase. a modified thymine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments, N1 is a terminal group and N3 is a thymine nucleobase. a modified thymine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments. N1 is absent and N3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments, N1 is absent and N3 is absent.
In certain embodiments, disclosed herein is an oligomeric compound according to the following chemical notation: N1eS mCeSGeoAeomCeSAdzTdsTdsT*Tds mCdsTdsTdzGds mCds mCeSTeo mCeSTeSN3e (SEQ ID NO: 3347). wherein: A = an adenine nucleobase. mC = a 5-methylcytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, N1 = an adenine nucleobase, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent, wherein when N1 is absent its sugar and intemucleoside linkage are also absent,
N3 = a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent, wherein when N3 is absent its sugar is also absent, e = a 2 ’-MOE sugar moiety. d = a 2’-p-D-deoxyribosyl sugar moiety, s = a phosphorothioate intemucleoside linkage, z = a mesyl phosphoramidate intemucleoside linkage, and o = a phosphodiester intemucleoside linkage; and wherein the oligomeric compound optionally comprises a conjugate group. In certain embodiments, N1 is an adenine nucleobase. In certain embodiments, N1 is an unmodified adenine. In certain embodiments, N1 is a modified adenine. In certain embodiments, N1 is a hypoxanthine. In certain embodiments, N1 is an abasic sugar moiety . In certain embodiments, N1 is a terminal group. In certain embodiments, N1 is absent. In certain embodiments, N2 is a modified cytosine. In certain embodiments, N2 is 5-methylcytosine. In certain embodiments, N2 is an unmodified cytosine. In certain embodiments, N2 is an abasic sugar moiety. In certain embodiments, N2 is a terminal group. In certain embodiments, N2 is absent. In certain embodiments, N3 is a modified thymine. In certain embodiments, N3 is an unmodified thymine. In certain embodiments, N3 is an abasic sugar moiety. In certain embodiments, N3 is a terminal group. In certain embodiments, N3 is absent. In certain embodiments. N1 is an adenine nucleobase and N2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments, N1 is an adenine nucleobase and N2 is a modified cytosine. In certain embodiments, N1 is an adenine nucleobase and N2 is an abasic sugar moiety. In certain embodiments, N1 is an adenine nucleobase and N2 is a terminal group. In certain embodiments, N1 is an adenine nucleobase and N2 is absent. In certain embodiments. N1 is a modified adenine and N2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments, N1 is a modified adenine and N2is a modified cytosine. In certain embodiments, N1 is a modified adenine and N2is 5-
methylcytosine. In certain embodiments. N1 is a modified adenine and N2 is an abasic sugar moiety. In certain embodiments, N1 is a modified adenine and N2is a terminal group. Tn certain embodiments. N1 is a modified adenine and N2is absent. In certain embodiments, N1 is a hypoxanthine and N2 is a cytosine nucleobase. a modified cytosine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments. N1 is a hypoxanthine and N2 is a modified cytosine. In certain embodiments, N1 is a hypoxanthine and N2is 5-methylcytosine. In certain embodiments, N1 is a hypoxanthine and N2 is an abasic sugar moiety. In certain embodiments, N1 is a hypoxanthine and N2 is a terminal group. In certain embodiments, N1 is a hypoxanthine and N2 is absent. In certain embodiments, N1 is an abasic sugar moiety and N2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments. N1 is a terminal group and N2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments. N1 is absent and N2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments, N1 is absent and N2 is absent. In certain embodiments. N1 is an adenine nucleobase and N3 is a thymine nucleobase. a modified thymine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments, N1 is an adenine nucleobase and N3 is a thymine nucleobase. In certain embodiments, N1 is an adenine nucleobase and N3 is a modified thymine. In certain embodiments, N1 is an adenine nucleobase and N3 is an abasic sugar moiety. In certain embodiments, N1 is an adenine nucleobase and N3 is a terminal group. In certain embodiments. N1 is an adenine nucleobase and N3 is absent. In certain embodiments, N1 is a modified adenine and N3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments, N1 is a modified adenine and N3 is an unmodified thymine. In certain embodiments, N1 is a modified adenine and N3 is an abasic sugar moiety. In certain embodiments, N1 is a modified adenine and N3 is a terminal group. In certain embodiments, N1 is a modified adenine and N3 is absent. In certain embodiments, N1 is a hypoxanthine and N3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments, N1 is a hypoxanthine and N3 is an umnodified thymine. In certain embodiments, N1 is a hypoxanthine and N3 is an abasic sugar moiety. In certain embodiments, N1 is a hypoxanthine and N3 is a terminal group. In certain embodiments, N1 is a hypoxanthine and N3 is absent. In certain embodiments, N1 is an abasic sugar moiety and N3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments, N1 is a terminal group and N3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments, N1 is absent and N3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments, N1 is absent and N3 is absent.
In certain embodiments, disclosed herein is an oligomeric compound according to the following chemical notation: N1eS mCeSAeSGeSAeSTdZAdzTdSTdSTdSTdSTdzGdZTdSTdS mCeSTesGeS mCeSN2 e (SEQ ID NO: 3348), wherein: A = an adenine nucleobase, mC = a 5-methylcytosine nucleobase.
G = a guanine nucleobase, T = a thymine nucleobase, N1 = an adenine nucleobase. a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent, wherein when N1 is absent its sugar and intemucleoside linkage are also absent,
N2 = a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent, wherein when N2 is absent its sugar is also absent, e = a 2’-MOE sugar moiety,
d = a 2 ’-P-D-deoxj ribosyl sugar moiety, s = a phosphorothioate intemucleoside linkage, and
7. = a mesyl phosphoramidate intemucleoside linkage; and wherein the oligomeric compound optionally comprises a conjugate group. In certain embodiments. N1 is an adenine nucleobase. In certain embodiments. N1 is an unmodified adenine. In certain embodiments. N1 is a modified adenine. In certain embodiments. N1 is a hypoxanthine. In certain embodiments, N1 is an abasic sugar moiety. In certain embodiments, N1 is a terminal group. In certain embodiments, N1 is absent. In certain embodiments. N2 is a modified cytosine. In certain embodiments. N2is 5-methylcytosine. In certain embodiments, N2is an unmodified cytosine. In certain embodiments, N2is an abasic sugar moiety. In certain embodiments, N2is a terminal group. In certain embodiments. N2 is absent. In certain embodiments, N3 is a modified thymine. In certain embodiments, N3 is an unmodified thymine. In certain embodiments, N3 is an abasic sugar moiety. In certain embodiments, N3 is a terminal group. In certain embodiments. N3 is absent. In certain embodiments, N1 is an adenine nucleobase and N2 is a cytosine nucleobase. a modified cytosine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments. N1 is an adenine nucleobase and N2 is a modified cytosine. In certain embodiments, N1 is an adenine nucleobase and N2 is an abasic sugar moiety. In certain embodiments, N1 is an adenine nucleobase and N2 is a terminal group. In certain embodiments. N1 is an adenine nucleobase and N2 is absent. In certain embodiments, N1 is a modified adenine and N2 is a cytosine nucleobase. a modified cytosine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments, N1 is a modified adenine and N2 is a modified cytosine. In certain embodiments, N1 is a modified adenine and N2 is 5- methylcytosine. In certain embodiments, N1 is a modified adenine and N2 is an abasic sugar moiety. In certain embodiments. N1 is a modified adenine and N2 is a terminal group. In certain embodiments, N1 is a modified adenine and N2 is absent. In certain embodiments, N1 is a hypoxanthine and N2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments, N1 is a hypoxanthine and N2 is a modified cytosine. In certain embodiments, N1 is a hypoxanthine and N2 is 5-methylcytosine. In certain embodiments, N1 is a hypoxanthine and N2 is an abasic sugar moiety. In certain embodiments, N1 is a hypoxanthine and N2 is a terminal group. In certain embodiments, N1 is a hypoxanthine and N2 is absent. In certain embodiments, N1 is an abasic sugar moiety and N2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments, N1 is a terminal group and N2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety’, a terminal group, or is absent. In certain embodiments, N1 is absent and N2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety , a terminal group, or is absent. In certain embodiments, N1 is absent and N2 is absent. In certain embodiments, N1 is an adenine nucleobase and N3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments, N1 is an adenine nucleobase and N3 is a thymine nucleobase. In certain embodiments, N1 is an adenine nucleobase and N3 is a modified thymine. In certain embodiments, N1 is an adenine nucleobase and N3 is an abasic sugar moiety. In certain embodiments, N1 is an adenine nucleobase and N3 is a terminal group. In certain embodiments, N1 is an adenine nucleobase and N3 is absent. In certain embodiments. N1 is a modified adenine and N3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments. N1 is a modified adenine and N3 is an unmodified thymine. In certain embodiments, N1 is a modified adenine and N3 is an abasic sugar moiety. In certain embodiments. N1 is a modified adenine and N3 is a terminal group. In certain embodiments, N1 is a modified adenine and N3 is absent. In certain embodiments, N1 is a hypoxanthine and N3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is
absent. In certain embodiments. N1 is a hypoxanthine and N3 is an unmodified thymine. In certain embodiments, N1 is a hypoxanthine and N3 is an abasic sugar moiety. In certain embodiments, N1 is a hypoxanthine and N3 is a terminal group. In certain embodiments, N1 is a hypoxanthine and N3 is absent. In certain embodiments, N1 is an abasic sugar moiety and N3 is a thymine nucleobase. a modified thymine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments, N1 is a terminal group and N3 is a thymine nucleobase. a modified thymine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments, N1 is absent and N3 is a thymine nucleobase. a modified thymine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments, N1 is absent and N3 is absent.
In certain embodiments, disclosed herein is an oligomeric compound according to the following chemical notation: N1 esTeomCeoAeomCeoGeOAds mCdsAdsTdsTdsTdsTds mCdsTdsTdsGeomCes mCeSN3 e (SEQ ID NO: 3349), wherein: A = an adenine nucleobase. mC = a 5-methylcytosine nucleobase, G = a guanine nucleobase, T = a thymine nucleobase, N1 = an adenine nucleobase, a modified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent, wherein when N1 is absent its sugar and intemucleoside linkage are also absent,
N3 = a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent, wherein when N3 is absent its sugar is also absent, e = a 2 ’-MOE sugar moiety. d = a 2‘-p-D-deoxyribosyl sugar moiety, s = a phosphorothioate intemucleoside linkage, and o = a phosphodiester intemucleoside linkage; and wherein the oligomeric compound optionally comprises a conjugate group. In certain embodiments, N1 is an adenine nucleobase. In certain embodiments, N1 is an unmodified adenine. In certain embodiments, N1 is a modified adenine. In certain embodiments, N1 is a hypoxanthine. In certain embodiments, N1 is an abasic sugar moiety. In certain embodiments, N1 is a terminal group. In certain embodiments, N1 is absent. In certain embodiments, N2 is a modified cytosine. In certain embodiments, N2is 5-methylcytosine. In certain embodiments, N2is an unmodified cytosine. In certain embodiments, N2 is an abasic sugar moiety. In certain embodiments, N2 is a terminal group. In certain embodiments, N2 is absent. In certain embodiments, N3 is a modified thymine. In certain embodiments, N3 is an unmodified thymine. In certain embodiments, N3 is an abasic sugar moiety. In certain embodiments, N3 is a terminal group. In certain embodiments, N3 is absent. In certain embodiments, N1 is an adenine nucleobase and N2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments, N1 is an adenine nucleobase and N2 is a modified cytosine. In certain embodiments, N1 is an adenine nucleobase and N2 is an abasic sugar moiety. In certain embodiments, N1 is an adenine nucleobase and N2 is a terminal group. In certain embodiments, N1 is an adenine nucleobase and N2 is absent. In certain embodiments, N1 is a modified adenine and N2 is a cytosine nucleobase, a modified cytosine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments, N1 is a modified adenine and N2is a modified cytosine. In certain embodiments, N1 is a modified adenine and N2is 5- methylcytosine. In certain embodiments. N1 is a modified adenine and N2 is an abasic sugar moiety. In certain embodiments, N1 is a modified adenine and N2is a terminal group. In certain embodiments, N1 is a modified adenine and N2is absent. In certain embodiments, N1 is a hypoxanthine and N2 is a cytosine nucleobase. a modified cytosine, an
abasic sugar moiety, a terminal group, or is absent. In certain embodiments. N1 is a hypoxanthine and N2 is a modified cytosine. In certain embodiments, N1 is a hypoxanthine and N2is 5-methylcytosine. In certain embodiments, N1 is a hypoxanthine and N2 is an abasic sugar moiety. In certain embodiments, N1 is a hypoxanthine and N2 is a terminal group. In certain embodiments, N1 is a hypoxanthine and N2 is absent. In certain embodiments, N1 is an abasic sugar moiety and N2is a cytosine nucleobase. a modified cytosine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments, N1 is a terminal group and N2 is a cytosine nucleobase. a modified cytosine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments, N1 is absent and N2is a cytosine nucleobase. a modified cytosine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments, N1 is absent and N2 is absent. In certain embodiments. N1 is an adenine nucleobase and N3 is a thymine nucleobase. a modified thymine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments, N1 is an adenine nucleobase and N3 is a thymine nucleobase. In certain embodiments, N1 is an adenine nucleobase and N3 is a modified thymine. In certain embodiments, N1 is an adenine nucleobase and N3 is an abasic sugar moiety. In certain embodiments, N1 is an adenine nucleobase and N3 is a tenninal group. In certain embodiments. N1 is an adenine nucleobase and N3 is absent. In certain embodiments, N1 is a modified adenine and N3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments, N1 is a modified adenine and N3 is an unmodified thymine. In certain embodiments, N1 is a modified adenine and N3 is an abasic sugar moiety. In certain embodiments, N1 is a modified adenine and N3 is a tenninal group. In certain embodiments. N1 is a modified adenine and N3 is absent. In certain embodiments, N1 is a hypoxanthine and N3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments, N1 is a hypoxanthine and N3 is an umnodified thymine. In certain embodiments, N1 is a hypoxanthine and N3 is an abasic sugar moiety. In certain embodiments, N1 is a hypoxanthine and N3 is a tenninal group, hr certain embodiments, N1 is a hypoxanthine and N3 is absent. In certain embodiments, N1 is an abasic sugar moiety and N3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a tenninal group, or is absent. In certain embodiments, N1 is a terminal group and N3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a terminal group, or is absent. In certain embodiments, N1 is absent and N3 is a thymine nucleobase, a modified thymine, an abasic sugar moiety, a tenninal group, or is absent. In certain embodiments, N1 is absent and N3 is absent.
VIII. Certain Compositions
1. Compound No, 1601260
Compound No. 1601260 is characterized as a 5-10-5 MOE gapmer of linked nucleosides having a nucleobase sequence (from 5’ to 3’) of ACAGATATTTTTGTTCTGCC (SEQ ID NO: 3318). wherein each of nucleosides 1-5 and 16-20 (from 5’ to 3’) are 2‘-MOE nucleosides and each of nucleosides 6-15 are 2‘-p-D-deoxynucleosides, wherein tire intemucleoside linkages between nucleosides 1 to 2, 2 to 3, 3 to 4, 4 to 5, 5 to 6, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15. 15 to 16, 16 to 17, 17 to 18. 18 to 19, and 19 to 20 are phosphorothioate intemucleoside linkages, wherein the intemucleoside linkages between nucleosides 6 to 7, 7 to 8, 8 to 9, and 9 to 10 are mesyl phosphoramidate intemucleoside linkages, and wherein each cytosine is a 5-methylcytosine.
Compound No. 1601260 is represented by the following chemical notation:
Acs mCcsAcsGcsAcsTdzAdzTdzTdzTdsTdsTd.,GdsTdsTds mCcSTcsGcs mCcs mCe (SEQ ID NO: 3335), wherein:
A = an adenine nucleobase, mC = a 5-methylcytosine nucleobase.
G = a guanine nucleobase.
T = a thymine nucleobase. e = a 2’-MOE sugar moiety, d = a 2’-P-D-deoxyribosyl sugar moiety, s = a phosphorothioate intemucleoside linkage, and z = a mesyl phosphoramidate intemucleoside linkage; and the compound does not include a conjugate group or a terminal group.
Compound No. 1601260 is represented by the following chemical structure:
(SEQ ID NO: 3335) (Structure 1), or a pharmaceutically acceptable salt thereof. The pharmaceutically acceptable salt of
Compound No. 1601260 comprises one or more cations selected from sodium, potassium, calcium, and magnesium.
The sodium salt of Compound No. 1601260 is represented by the following chemical structure:
(SEQ ID NO: 3335) (Structure 2). 2. Compound No, 1616039
Compound No. 1616039 is characterized as a 5-10-5 MOE gapmer of linked nucleosides having a nucleobase sequence (from 5’ to 3’) of ACGACATTTTCTTGCCTCTT (SEQ ID NO: 3319), wherein each of nucleosides 1-5 and 16-20 (from 5’ to 3’) are 2’-MOE nucleosides and each of nucleosides 6-15 are 2'-f>-D-deoxynucleosides. wherein the intemucleoside linkages between nucleosides 1 to 2, 2 to 3, 5 to 6, 7 to 8, 8 to 9. 9 to 10, 10 to 11, 11 to 12, 12 to 13, 14 to 15. 15 to 16, 16 to 17, 18 to 19. and 19 to 20 are phosphorothioate intemucleoside linkages, wherein the intemucleoside linkages between nucleosides 3 to 4, 4 to 5, and 17 to 18 are phosphodiester intemucleoside linkages, wherein the intemucleoside linkages between nucleosides 6 to 7 and 13 to 14 are mesyl phosphoramidate intemucleoside linkages, and wherein each cytosine is a 5-methylcytosine.
Compound No. 1616039 is represented by the follow ing chemical notation: Aes mCesGeoAeomCesAdzTdsTdsTdsTds mCdsTdsTdzGds mCds mCesTeomCesTesTe (SEQ ID NO: 3336), wherein:
A = an adenine nucleobase, mC = a 5-methylcytosine nucleobase.
G = a guanine nucleobase.
T = a thymine nucleobase. e = a 2’-M0E sugar moiety, d = a 2’-P-D-deoxyribosyl sugar moiety, s = a phosphorothioate intemucleoside linkage, z = a mesyl phosphoramidate intemucleoside linkage, and o = a phosphodiester intemucleoside linkage; and the compound does not include a conjugate group or a terminal group.
Compound No. 1616039 is represented by the following chemical structure:
(SEQ ID NO: 3336) (Structure 3), or a pharmaceutically acceptable salt. The pharmaceutically acceptable salt of Compound No. 1616039 comprises one or more cations selected from sodium, potassium, calcium, and magnesium.
The sodium salt of Compound No. 1616039 is represented by the following chemical structure:
(SEQ ID NO: 3336) (Structure 4). 3. Compound No, 1616357
Compound No. 1616357 is characterized as a 5-10-5 MOE gapmer of linked nucleosides having a nucleobase sequence (from 5’ to 3’) of ACAGATATTTTTGTTCTGCC (SEQ ID NO: 3318). wherein each of nucleosides 1-5 and 16-20 (from 5’ to 3’) are 2‘-MOE nucleosides and each of nucleosides 6-15 are 2'-[l-D-deo.\ynucleosides. wherein tire intemucleoside linkages between nucleosides 1 to 2, 2 to 3, 3 to 4, 4 to 5. 5 to 6, 8 to 9, 9 to 10. 10 to 11, 11 to 12, 14 to 15, 15 to 16, 16 to 17, 17 to 18, 18 to 19, and 19 to 20 are phosphorothioate intemucleoside linkages, wherein the intemucleoside linkages between nucleosides 6 to 7, 7 to 8, 12 to 13, and 13 to 14 are mesyl phosphoramidate intemucleoside linkages, and wherein each cytosine is a 5-methylcytosine.
Compound No. 1616357 is represented by the following chemical notation:
Aes mCesAesGesAesTdzAdzTdsT<isTdsTdsTdzGdzTdsTds mCeSTesGeS mCeS mCe (SEQ ID NO: 3337), wherein: A = an adenine nucleobase, mC = a 5-methylcytosine nucleobase.
G = a guanine nucleobase.
T = a thymine nucleobase. e = a 2’-MOE sugar moiety, d = a 2’-P-D-deoxyribosyl sugar moiety, s = a phosphorothioate intemucleoside linkage, and z = a mesyl phosphoramidate intemucleoside linkage; and the compound does not include a conjugate group or a terminal group.
(SEQ ID NO: 3337) (Structure 5), or a pharmaceutically acceptable salt thereof. The pharmaceutically acceptable salt of
Compound No. 1616357 comprises one or more cations selected from sodium, potassium, calcium, and magnesium.
The sodium salt of Compound No. 1616357 is represented by the following chemical structure:
(SEQ ID NO: 3337) (Structure 6). 4. Compound No, 1620605
Compound No. 1620605 is characterized as a 6-10-4 MOE gapmer of linked nucleosides having a nuclcobasc sequence (from 5’ to 3’) of ATCACGACATTTTCTTGCCT (SEQ ID NO: 3328), wherein each of nucleosides 1-6 and 17-20 (from 5’ to 3’) are 2‘-MOE nucleosides and each of nucleosides 7-16 are 2'-[l-D-deo.\ynucleosides. wherein tire intemucleoside linkages between nucleosides 1 to 2, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 17, 18 to 19, and 19 to 20 are phosphorothioate intemucleoside linkages, wherein the intemucleoside linkages between nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, and 17 to 18 are phosphodiester intemucleoside linkages, and wherein each cytosine is a 5-methylcytosine.
Compound No. 1620605 is represented by the following chemical notation:
AesTeO mCeoAeo mCeoGeoAd.s mCdsAdsTclsTdsTclsT*mCdsTdsTdsGeomCeS mCeSTe (SEQ ID NO: 3338), wherein: A = an adenine nucleobase,
mC = a 5-methylcytosine nucleobase.
G = a guanine nucleobase.
T = a thymine nucleobase. e = a 2’-MOE sugar moiety, d = a 2’-P-D-deoxyribosyl sugar moiety, s = a phosphorothioate intemucleoside linkage, and o = a phosphodiester intemucleoside linkage; and the compound does not include a conjugate group or a terminal group.
(SEQ ID NO: 3338) (Structure 7), or a pharmaceutically acceptable salt thereof. The pharmaceutically acceptable salt of Compound No. 1620605 comprises one or more cations selected from sodium, potassium, calcium, and magnesium.
The sodium salt of Compound No. 1620605 is represented by the following chemical structure:
(SEQ ID NO: 3338) (Structure 8). IX. Certain Comparator Compositions
In certain embodiments, compound 827599 is a comparator compound and is previously described in WO 2019/164562. Compound 827599 consists of the nucleobase sequence (from 5’ to 3’): ACAGATATTTTTGTTCTGCC, designated herein as SEQ ID NO: 3318. The sugar motif for Compound No. 827599 is (from 5’ to 3 ’): cccccddddddddddccccc; wherein each “d’‘ represents a 2'-[TD-dcoxyribosyl sugar moiety’, and each “c’‘ represents a 2‘- MOE sugar moiety’. The intemucleoside linkage motif for Compound No. 827599 is (from 5’ to 3’): sosssssssssssssooss; wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage. Each cytosine nucleobase in Compound No. 827599 is a 5-methylcytosine.
In certain embodiments, compound 763364 is a comparator compound and is previously described in WO 2019/164562. Compound 763364 consists of the nucleobase sequence (from 5’ to 3’): ACGACATTTTCTTGCCTCTT, designated herein as SEQ ID NO: 3319. The sugar motif for Compound No. 763364 is (from 5’ to 3 ’): eeeeeddddddddddeeeee; wherein each “d” represents a 2’-P-D-deoxyribosyl sugar moiety, and each “e” represents a 2’- MOE sugar moiety. The intemucleoside linkage motif for Compormd No. 763364 is (from 5’ to 3’):
sooosssssssssssooss; wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage. Each cytosine nucleobase in Compound No. 763364 is a 5-methylcytosine.
In certain embodiments, compounds described herein are superior relative to compounds described in WO2019/164562, because they demonstrate one or more improved properties, such as duration of action and potency.
For example, Compound No. 1601260, Compound No. 1616357, and Compound No. 1616039 each demonstrated a longer duration of action in vivo as compared to Compound No. 827599 in the assay shown in Example 13. In particular. Compound No. 1601260, Compound No. 1616357, and Compound No. 1616039 achieved a 48%, 58%. and 60% reduction of human SNCA RNA. respectively, at day 224 post-dose. In comparison, Compound No. 827599 achieved a 0% reduction of human SNCA RNA at day 224 post-dose. Therefore, each of Compound No. 1601260. Compound No. 1616357. and Compound No. 1616039 exhibited a longer duration of action compared to Compound No. 827599 in this assay.
For example, Compound No. 1601260, Compound No. 1616357, and Compound No. 1616039 each demonstrated improved potency in vivo compared to Compound No. 827599 (see Example 14) and to Compound No. 763364 (see Example 22). In particular, Compound No. 1601260, Compound No. 1616357, and Compound No. 1616039 achieved an ED5o in the cortical brain tissue of 46 pg. 29pg. and 23 pg. respectively. In comparison, Compound No. 827599 achieved an ED50 in the cortical brain tissue of 122pg and Compound No. 763374 achieved an ED50 in the cortical brain tissue of 63pg. As such, each of Compound No. 1601260, Compound No. 1616357, and Compound No. 1616039 was more potent than Compound No. 827599 and Compound No. 763364 in these assays.
X. Certain Hotspot Regions
1. Nucleobases 16,692-16,716 of SEO ID NO: 1 or nucleobases 18,758-18,782 of SEO ID NO: 2
In certain embodiments, nucleobases 16,692-16,716 of SEQ ID NO: 1 or nucleobases 18,758-18,782 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to an equal length portion within nucleobases 16,692-16,716 of SEQ ID NO: 1 or within nucleobases 18,758-18,782 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 16 nucleobases in length. In certain embodiments, modified oligonucleotides are 17 nucleobases in length. In certain embodiments, modified oligonucleotides are 18 nucleobases in length. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides arc gapmers. In certain embodiments, modified oligonucleotides arc cEt gapmers. In certain embodiments, modified oligonucleotides arc MOE gapmers. In certain embodiments, modified oligonucleotides arc mixed cEt/MOE gapmers.
In certain embodiments, the gapmers are 3-10-3 cEt gapmers. In certain embodiments, the gapmers are 3-10-4 cEt gapmers. In certain embodiments, the gapmers are 4-10-3 cEt gapmers. In certain embodiments, the gapmers are 4- 10-4 cEt gapmers. In certain embodiments, the gapmers are 5-10-5 cEt gapmers. In certain embodiments, the gapmers are 3-10-4 or 3-10-5 mixed cEt/MOE gapmers. In certain embodiments, the sugar motif for the mixed cEt/MOE gapmers is (from 5’ to 3’): kkkddddddddddkkee, kkkddddddddddkeee, ekkddddddddddkeeee, kkkdddddddddkkeee, or kkkdddddddddkeeee; wherein “k” represents a cEt sugar moiety, “e” represents a 2 ’-MOE sugar moiety, and ‘ d” represents a 2’-P-D-deoxyribosyl sugar moiety'.
In certain embodiments, the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages. In certain embodiments, the intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3’): soossssssssssos. soossssssssssoos. soossssssssssooos.
sooossssssssssos, sooossssssssssoos. soossssssssssssss, or soooossssssssssooos; wherein each “s” represents a phosphorothioate intemucleoside linkage, and each “o” represents a phosphodiester intemucleoside linkage.
The nucleobase sequences of SEQ ID NOs: 78. 2564. 2697, 2747, 2789, 2936, 3063, 3081. 3142. 3189, and 3271 are complementary to an equal length portion within nucleobases 16,692-16.716 of SEQ ID NO: 1 or within nucleobases 18,758-18.782 of SEQ ID NO: 2.
The nucleobase sequences of Compound Nos: 1483635. 1484499, 1485433. 1486327, 1486437, 1486657. 1535220, 1535277, 1535335, 1535391, 1535466. 1535496, 1535524. 1535578, and 1535629 are complementary to an equal length portion within nucleobases 16,692-16,716 of SEQ ID NO: 1 or within nucleobases 18.758-18,782 of SEQ ID NO: 2.
In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 16.692-16,716 of SEQ ID NO: 1 or within nucleobases 18,758-18.782 of SEQ ID NO: 2 achieve at least 72% reduction of SNCA mRNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 16,692-16.716 of SEQ ID NO: 1 or within nucleobases 18.758-18,782 of SEQ ID NO: 2 achieve an average of 88.9% reduction of SNCA mRNA in the standard in vitro assay.
2. Nucleobases 18,568-18,593 of SEQ ID NO: 1 or nucleobases 20,634-20,659 of SEQ ID NO: 2
In certain embodiments, nucleobases 18,568-18,593 of SEQ ID NO: 1 or nucleobases 20,634-20,659 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to an equal length portion within nucleobases 18,568-18,593 of SEQ ID NO: 1 or within nucleobases 20,634-20,659 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 16 nucleobases in length. In certain embodiments, modified oligonucleotides are 17 nucleobases in length. In certain embodiments, modified oligonucleotides are 18 nucleobases in length. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, modified oligonucleotides are cEt gapmers. In certain embodiments, modified oligonucleotides are MOE gapmers. In certain embodiments, modified oligonucleotides are mixed cEt/MOE gapmers.
In certain embodiments, the gapmers are 3-10-3 cEt gapmers. In certain embodiments, the gapmers are 3-10-4 cEt gapmers. In certain embodiments, tire gapmers arc 4-10-3 cEt gapmers. In certain embodiments, the gapmers arc 4- 10-4 cEt gapmers. In certain embodiments, the gapmers arc 5-10-5 cEt gapmers. In certain embodiments, the gapmers are 3-10-4 or 3-10-5 mixed cEt/MOE gapmers. In certain embodiments, the sugar motif for the mixed cEt/MOE gapmers is (from 5’ to 3‘): kkkddddddddddkkee, kkkddddddddddkeee, kkkdddddddddkkeee, or kkkdddddddddkeeee; wherein “k” represents a cEt sugar moiety7, “e” represents a 2’-M0E sugar moiety, and “d” represents a 2 -p-D- deoxyribosyl sugar moiety7.
In certain embodiments, the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages. In certain embodiments, the intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3’): soossssssssssos. soossssssssssoos, soossssssssssooos. sooossssssssssos, sooossssssssssoos. or soooossssssssssooos; wherein each “s” represents a phosphorothioate intemucleoside linkage, and each “o” represents a phosphodiester intemucleoside linkage.
The nucleobase sequences of SEQ ID NOs: 206, 231. 270, 316, 2486, 2558, 3041. 3076. 3137, 3184, and 3266 are complementary to an equal length portion within nucleobases 18.568-18,593 of SEQ ID NO: 1 or within nucleobases
20.634-20,659 of SEQ ID NO: 2.
The nucleobase sequences of Compound Nos: 1482920. 1484352, 1534261, 1534329, 1534428, 1534460. 1535214, 1535272. 1535330, 1535386, 1535439. 1535460, 1535518. and 1535573 are complementaiy to an equal length portion within nucleobases 18,568-18.593 of SEQ ID NO: 1 or within nucleobases 20.634-20,659 of SEQ ID NO:
2.
In certain embodiments, modified oligonucleotides complementaiy to an equal length portion within nucleobases 18.568-18,593 of SEQ ID NO: 1 or within nucleobases 20,634-20.659 of SEQ ID NO: 2 achieve at least 73% reduction of SNCA mRNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 18,568-18.593 of SEQ ID NO: 1 or within nucleobases
20.634-20,659 of SEQ ID NO: 2 achieve an average of 88.1% reduction of SN CA mRNA in the standard in vitro assay.
3. Nucleobases 18,621-18,649 of SEQ ID NO: 1 or nucleobases 20,687-20,715 of SEQ ID NO: 2
In certain embodiments, nucleobases 18,621-18,649 of SEQ ID NO: 1 or nucleobases 20,687-20,715 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to an equal length portion within nucleobases 18,621-18,649 of SEQ ID NO: 1 or within nucleobases 20,687-20,715 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 16 nucleobases in length. In certain embodiments, modified oligonucleotides are 17 nucleobases in length. In certain embodiments, modified oligonucleotides are 18 nucleobases in length. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, modified oligonucleotides are cEt gapmers. In certain embodiments, modified oligonucleotides are MOE gapmers. In certain embodiments, modified oligonucleotides are mixed cEt/MOE gapmers.
In certain embodiments, the gapmers are 3-10-3 cEt gapmers. In certain embodiments, the gapmers are 3-10-4 cEt gapmers. In certain embodiments, tire gapmers are 4-10-3 cEt gapmers. In certain embodiments, the gapmers are 4- 10-4 cEt gapmers. In certain embodiments, the gapmers are 5-10-5 cEt gapmers. In certain embodiments, the gapmers arc 3-10-4 or 3-10-5 mixed cEt/MOE gapmers. In certain embodiments, the sugar motif for the mixed cEt/MOE gapmers is (from 5’ to 3‘): kkkddddddddddkkcc, kkkddddddddddkccc, ckkddddddddddkcccc, kkkdddddddddkkccc, or kkkdddddddddkeeee; wherein “k" represents a cEt sugar moiety , “e’’ represents a 2’-MOE sugar moiety, and “d" represents a 2'-[i-D-deoxy ribosyl sugar moiety.
In certain embodiments, the intemucleoside linkages of tire modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages. In certain embodiments, the intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3’): soossssssssssos. soossssssssssoos, soossssssssssooos. sooossssssssssos, sooossssssssssoos, soossssssssssssss, or soooossssssssssooos; wherein each “s” represents a phosphorothioate intemucleoside linkage, and each “o” represents a phosphodiester intemucleoside linkage.
The nucleobase sequences of SEQ ID NOs: 64, 128, 289, 921. 2744, 2853, 2922, 3031, 3057, 3099, 3123. 3132. 3160, 3207, 3231, 3289, and 3313 are complementary to an equal length portion within nucleobases 18,621- 18,649 of SEQ ID NO: 1 or within nucleobases 20,687-20,715 of SEQ ID NO: 2.
The nucleobase sequences of Compound Nos: 1485236, 1485314, 1485897, 1486071, 1486591, 1533975. 1534327, 1535209, 1535240, 1535266, 1535297. 1535315, 1535324. 1535355, 1535381, 1535411 , 1535437, 1535455. 1535487, 1535513, 1535543, 1535568, 1535598. and 1535628 are complementary to an equal length portion within nucleobases 18,621-18.649 of SEQ ID NO: 1 or within nucleobases 20.687-20,715 of SEQ ID NO: 2.
In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 18,621-18.649 of SEQ ID NO: 1 or within nucleobases 20.687-20,715 of SEQ ID NO: 2 achieve at least 61% reduction of SNCA mRNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 18,621-18.649 of SEQ ID NO: 1 or within nucleobases 20.687-20,715 of SEQ ID NO: 2 achieve an average of 85.7% reduction of SNCA mRNA in the standard in vitro assay.
4. Nucleobases 18,721-18,752 of SEQ ID NO: 1 or nucleobases 20,787-20,818 of SEQ ID NO: 2
In certain embodiments, nucleobases 18,721-18.752 of SEQ ID NO: 1 or nucleobases 20,787-20,818 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to an equal length portion within nucleobases 18,721-18,752 of SEQ ID NO: 1 or within nucleobases 20,787-20,818 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 16 nucleobases in length. In certain embodiments, modified oligonucleotides are 17 nucleobases in length. In certain embodiments, modified oligonucleotides are 18 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, modified oligonucleotides are cEt gapmers. In certain embodiments, modified oligonucleotides are MOE gapmers. In certain embodiments, modified oligonucleotides are mixed cEt/MOE gapmers.
In certain embodiments, the gapmers are 3-10-3 cEt gapmers. In certain embodiments, the gapmers are 3-10-4 cEt gapmers. In certain embodiments, the gapmers are 4-10-3 cEt gapmers. In certain embodiments, the gapmers are 4- 10-4 cEt gapmers. In certain embodiments, lire gapmers are 3-10-4 or 3-10-5 mixed cEt/MOE gapmers. In certain embodiments, the sugar motif for the mixed cEt/MOE gapmers is (from 5’ to 3‘): kkkddddddddddkkee, kkkddddddddddkeee, ekkddddddddddkeeee, kkkdddddddddkkeee, or kkkdddddddddkeeee; wherein “k" represents a cEt sugar moiety, “e” represents a 2’-MOE sugar moiety, and “d” represents a 2'-[5-D-dcoxyribosyl sugar moiety.
In certain embodiments, the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intcmuclcosidc linkages and phosphodicstcr intemucleoside linkages. In certain embodiments, the intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3’): soossssssssssos, soossssssssssoos, soossssssssssooos. sooossssssssssos, sooossssssssssoos, or soossssssssssssss; wherein each “s’- represents a phosphorothioate intemucleoside linkage, and each “o” represents a phosphodiester intemucleoside linkage.
The nucleobase sequences of SEQ ID NOs: 227, 427. 545, 1214, 1279, 1385, 1401, 1476, 1616, 3048, 3115, 3176. and 3305 are complementary to an equal length portion within nucleobases 18,721-18,752 of SEQ ID NO: 1 or within nucleobases 20,787-20,818 of SEQ ID NO: 2.
The nucleobase sequences of Compound Nos: 1482396, 1483241, 1485037, 1485579, 1486302, 1486305. 1533429, 1534037, 1534406, 1535257, 1535316. 1535372, 1535428, 1535446, 1535504, 1535615, and 1535621 are complementary to an equal length portion within nucleobases 18,721-18,752 of SEQ ID NO: 1 or within nucleobases 20,787-20,818 of SEQ ID NO: 2.
In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 18,721-18.752 of SEQ ID NO: 1 or within nucleobases 20.787-20,818 of SEQ ID NO: 2 achieve at least
66% reduction of SNCA mRNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 18,721-18,752 of SEQ ID NO: 1 or within nucleobases 20,787-20,818 of SEQ ID NO: 2 achieve an average of 85.6% reduction of SNCA mRNA in the standard in vitro assay.
5. Nucleobases 19.423-19.443 of SEO ID NO: 1 or nucleobases 21.489-21,509 of SEO ID NO: 2
In certain embodiments, nucleobases 19.423-19,443 of SEQ ID NO: 1 or nucleobases 21,489-21,509 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to an equal length portion within nucleobases 19.423-19,443 of SEQ ID NO: 1 or within nucleobases 21,489-21.509 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 16 nucleobases in length. In certain embodiments, modified oligonucleotides are 17 nucleobases in length. In certain embodiments, modified oligonucleotides are 18 nucleobases in length. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, modified oligonucleotides are cEt gapmers. In certain embodiments, modified oligonucleotides are MOE gapmers. In certain embodiments, modified oligonucleotides are mixed cEt/MOE gapmers.
In certain embodiments, the gapmers are 3-10-3 cEt gapmers. In certain embodiments, tire gapmers are 3-10-4 cEt gapmers. In certain embodiments, the gapmers are 4-10-3 cEt gapmers. In certain embodiments, the gapmers are 4- 10-4 cEt gapmers. In certain embodiments, tire gapmers are 5-10-5 cEt gapmers. In certain embodiments, the gapmers are 3-10-4 or 3-10-5 mixed cEt/MOE gapmers. In certain embodiments, the sugar motif for tire mixed cEt/MOE gapmers is (from 5’ to 3‘): kkkddddddddddkkee, kkkddddddddddkeee. kkkdddddddddkkeee, or kkkdddddddddkeeee; wherein ‘ k” represents a cEt sugar moiety, “e‘‘ represents a 2‘-MOE sugar moiety, and “d” represents a 2’-p-D- deoxyribosyl sugar moiety.
In certain embodiments, the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages. In certain embodiments, the intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3 ’): soossssssssssos, soossssssssssoos, soossssssssssooos, sooossssssssssos, sooossssssssssoos, or soooossssssssssooos; wherein each “s” represents a phosphorothioate intemucleoside linkage, and each “o” represents a phosphodiester intemucleoside linkage.
The nuclcobasc sequences of SEQ ID NOs: 203, 285, 1974, 2044, 2949, 3021, 3090, 3151, 3198, and 3280 arc complementary to an equal length portion within nucleobases 19,423-19,443 of SEQ ID NO: 1 or within nucleobases 21,489-21,509 of SEQ ID NO: 2.
The nucleobase sequences of Compound Nos: 1484583, 1485328, 1485484, 1534314, 1534320, 1535215, 1535230, 1535287, 1535345, 1535401, 1535477. 1535533, and 1535588 are complementary to an equal length portion within nucleobases 19,423-19,443 of SEQ ID NO: 1 or within nucleobases 21,489-21,509 of SEQ ID NO: 2.
In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 19,423-19,443 of SEQ ID NO: 1 or within nucleobases 21,489-21,509 of SEQ ID NO: 2 achieve at least 79% reduction of SNCA mRNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 19,423-19,443 of SEQ ID NO: 1 or within nucleobases 21,489-21,509 of SEQ ID NO: 2 achieve an average of 88.6% reduction of SNCA mRNA in the standard in vitro assay.
6. Nucleobases 19,555-19,575 of SEO ID NO: 1 or nucleobases 21,621-21,641 of SEO ID NO: 2
In certain embodiments, nucleobases 19.555-19,575 of SEQ ID NO: 1 or nucleobases 21,621-21 ,641 of SEQ
ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to an equal length portion within nucleobases 19,555-19.575 of SEQ ID NO: 1 or within nucleobases 21.621-21,641 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 16 nucleobases in length. In certain embodiments, modified oligonucleotides are 17 nucleobases in length. In certain embodiments, modified oligonucleotides are 18 nucleobases in length. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, modified oligonucleotides are cEt gapmers. In certain embodiments, modified oligonucleotides are MOE gapmers. In certain embodiments, modified oligonucleotides are mixed cEt/MOE gapmers.
In certain embodiments, the gapmers are 3-10-3 cEt gapmers. In certain embodiments, the gapmers are 3-10-4 cEt gapmers. In certain embodiments, the gapmers are 4-10-3 cEt gapmers. In certain embodiments, the gapmers are 4- 10-4 cEt gapmers. In certain embodiments, the gapmers are 5-10-5 cEt gapmers. In certain embodiments, the gapmers are 3-10-4 or 3-10-5 mixed cEt/MOE gapmers. In certain embodiments, the sugar motif for the mixed cEt/MOE gapmers is (from 5’ to 3’): kkkddddddddddkkee. kkkddddddddddkeee. kkkdddddddddkkeee, or kkkdddddddddkeeee; wherein “k” represents a cEt sugar moiety, “e” represents a 2’-MOE sugar moiety, and “d” represents a 2'-|l-D- deoxyribosyl sugar moiety.
In certain embodiments, the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages. In certain embodiments, the intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3 '): soossssssssssos, soossssssssssoos, soossssssssssooos, sooossssssssssos, sooossssssssssoos, or soooossssssssssooos; wherein each “s” represents a phosphorothioate intemucleoside linkage, and each “o” represents a phosphodiester intemucleoside linkage.
The nucleobase sequences of SEQ ID NOs: 205, 2594, 2686, 3028, 3097, 3158, 3205, and 3287 are complementary to an equal length portion within nucleobases 19,555-19,575 of SEQ ID NO: 1 or within nucleobases 21,621-21,641 of SEQ ID NO: 2.
The nucleobase sequences of Compound Nos: 1485166, 1486157, 1534324, 1535238, 1535292, 1535295, 1535352, 1535409, 1535484, 1535540, and 1535596 arc complementary to an equal length portion within nucleobases 19,555-19,575 of SEQ ID NO: 1 or within nucleobases 21,621-21,641 of SEQ ID NO: 2.
In certain embodiments, modified oligonucleotides complementary’ to an equal length portion within nucleobases 19,555-19,575 of SEQ ID NO: 1 or within nucleobases 21,621-21,641 of SEQ ID NO: 2 achieve at least 77% reduction of SNCA mRNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 19,555-19,575 of SEQ ID NO: 1 or within nucleobases 21,621-21,641 of SEQ ID NO: 2 achieve an average of 89.5% reduction of SNCA mRNA in the standard in vitro assay.
7. Nucleobases 21,457-21,501 of SEQ ID NO: 1 or nucleobases 23,523-23,567 of SEQ ID NO: 2
In certain embodiments, nucleobases 21.457-21,501 of SEQ ID NO: 1 or nucleobases 23,523-23,567 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to an equal length portion within nucleobases 21,457-21.501 of SEQ ID NO: 1 or within nucleobases 23.523-23,567 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 16 nucleobases in length. In certain embodiments, modified
oligonucleotides are 17 nucleobases in length. In certain embodiments, modified oligonucleotides are 18 nucleobases in length. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments. modified oligonucleotides are gapmers. In certain embodiments, modified oligonucleotides are cEt gapmers. In certain embodiments, modified oligonucleotides are MOE gapmers. In certain embodiments, modified oligonucleotides are mixed cEt/MOE gapmers.
In certain embodiments, the gapmers are 3-10-3 cEt gapmers. In certain embodiments, the gapmers are 3-10-4 cEt gapmers. In certain embodiments, the gapmers are 4-10-3 cEt gapmers. In certain embodiments, the gapmers are 4- 10-4 cEt gapmers. In certain embodiments, the gapmers are 5-10-5 cEt gapmers. In certain embodiments, the gapmers are 3-10-4 or 3-10-5 mixed cEt/MOE gapmers. In certain embodiments, the sugar motif for the mixed cEt/MOE gapmers is (from 5’ to 3’): kkkddddddddddkkee. kkkddddddddddkeee. ekkddddddddddkeeee, kkkdddddddddkkeee, or kkkdddddddddkeeee; wherein “k” represents a cEt sugar moiety, “e” represents a 2’-MOE sugar moiety, and ‘ d” represents a 2’-p-D-deoxyribosyl sugar moiety.
In certain embodiments, the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages. In certain embodiments, the intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3’): soossssssssssos, soossssssssssoos, soossssssssssooos, sooossssssssssos, sooossssssssssoos, soossssssssssssss, or soooossssssssssooos; wherein each “s” represents a phosphorothioate intemucleoside linkage, and each “o” represents a phosphodiester intemucleoside linkage.
The nucleobase sequences of SEQ ID NOs: 214, 247, 865, 1887, 1948, 3067. 3085, 3146, 3193, and 3275 are complementary to an equal length portion within nucleobases 21,457-21.501 of SEQ ID NO: 1 or within nucleobases
23.523-23,567 of SEQ ID NO: 2.
The nucleobase sequences of Compound Nos: 1483319, 1483650, 1483923, 1485260, 1534362, 1535224, 1535282, 1535339, 1535396, 1535470, 1535528, 1535563, 1535583, and 1535631 are complementary to an equal length portion within nucleobases 21,457-21,501 of SEQ ID NO: 1 or within nucleobases 23,523-23,567 of SEQ ID NO: 2.
In certain embodiments, modified oligonucleotides complementary' to an equal length portion within nucleobases 21,457-21,501 of SEQ ID NO: 1 or within nucleobases 23,523-23,567 of SEQ ID NO: 2 achieve at least 73% reduction of SNCA mRNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 21,457-21,501 of SEQ ID NO: 1 or within nucleobases
23.523-23,567 of SEQ ID NO: 2 achieve an average of 86.6% reduction of SNCA mRNA in the standard in vitro assay.
8. Nucleobases 22,008-22,030 of SEQ ID NO: 1 or nucleobases 24,074-24,096 of SEQ ID NO: 2
In certain embodiments, nucleobases 22,008-22,030 of SEQ ID NO: 1 or nucleobases 24,074-24,096 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to an equal length portion within nucleobases 22,008-22,030 of SEQ ID NO: 1 or within nucleobases 24.074-24,096 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 16 nucleobases in length. In certain embodiments, modified oligonucleotides are 17 nucleobases in length. In certain embodiments, modified oligonucleotides are 18 nucleobases in length. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, modified oligonucleotides are cEt gapmers. In certain
embodiments, modified oligonucleotides are MOE gapmers. In certain embodiments, modified oligonucleotides are mixed cEt/MOE gapmers.
In certain embodiments, the gapmers are 3-10-3 cEt gapmers. Tn certain embodiments, the gapmers are 3-10-4 cEt gapmers. In certain embodiments, the gapmers are 4-10-3 cEt gapmers. In certain embodiments, the gapmers are 4- 10-4 cEt gapmers. In certain embodiments, the gapmers are 5-10-5 cEt gapmers. In certain embodiments, the gapmers are 3-10-4 or 3-10-5 mixed cEt/MOE gapmers. In certain embodiments, the sugar motif for the mixed cEt/MOE gapmers is (from 5’ to 3’): kkkddddddddddkkee, kkkddddddddddkeee, ekkddddddddddkeeee. kkkdddddddddkkeee, or kkkdddddddddkeeee; wherein “k” represents a cEt sugar moiety, “e” represents a 2’-MOE sugar moiety, and ‘ d” represents a 2’-P-D-deoxyribosyl sugar moiety.
In certain embodiments, the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages. In certain embodiments, the intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3’): soossssssssssos, soossssssssssoos, soossssssssssooos, sooossssssssssos, sooossssssssssoos, soossssssssssssss, or soooossssssssssooos; wherein each "s” represents a phosphorothioate intemucleoside linkage, and each “o” represents a phosphodiester intemucleoside linkage.
The nucleobase sequences of SEQ ID NOs: 167. 208, 248, 304, 1930, 3054, 3120, 3129, 3228. and 3310 are complementary to an equal length portion within nucleobases 22,008-22.030 of SEQ ID NO: 1 or within nucleobases 24.074-24,096 of SEQ ID NO: 2.
The nucleobase sequences of Compound Nos: 1483819, 1484024. 1486466, 1534334, 1534403, 1535206, 1535263, 1535321, 1535377. 1535434, 1535452, 1535510, 1535565, and 1535625 are complementary to an equal length portion within nucleobases 22,008-22,030 of SEQ ID NO: 1 or within nucleobases 24,074-24,096 of SEQ ID NO: 2.
In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 22,008-22,030 of SEQ ID NO: 1 or within nucleobases 24,074-24,096 of SEQ ID NO: 2 achieve at least 75% reduction of SNCA mRNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 22,008-22,030 of SEQ ID NO: 1 or within nucleobases 24,074-24,096 of SEQ ID NO: 2 achieve an average of 89% reduction of SNCA mRNA in the standard in vitro assay.
9. Nucleobases 22,507-22,529 of SEQ ID NO: 1 or nucleobases 24,573-24,595 of SEQ ID NO: 2
In certain embodiments, nucleobases 22,507-22,529 of SEQ ID NO: 1 or nucleobases 24,573-24,595 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to an equal length portion within nucleobases 22,507-22,529 of SEQ ID NO: 1 or within nucleobases 24,573-24,595 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 16 nucleobases in length. In certain embodiments, modified oligonucleotides are 17 nucleobases in length. In certain embodiments, modified oligonucleotides are 18 nucleobases in length. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, modified oligonucleotides are cEt gapmers. In certain embodiments, modified oligonucleotides are MOE gapmers. In certain embodiments, modified oligonucleotides are mixed cEt/MOE gapmers.
In certain embodiments, the gapmers are 3-10-3 cEt gapmers. In certain embodiments, the gapmers are 3-10-4 cEt gapmers. In certain embodiments, the gapmers are 4-10-3 cEt gapmers. Tn certain embodiments, the gapmers are 4-
10-4 cEt gapmers. In certain embodiments, the gapmers are 5-10-5 cEt gapmers. In certain embodiments, the gapmers are 3-10-4 or 3-10-5 mixed cEt/MOE gapmers. In certain embodiments, the sugar motif for the mixed cEt/MOE gapmers is (from 5’ to 3’): kkkddddddddddkkee, kkkddddddddddkeee, kkkdddddddddkkeee, or kkkdddddddddkeeee; wherein “k” represents a cEt sugar moiety, “e” represents a 2’-MOE sugar moiety, and “d” represents a 2’-P-D- deoxyribosyl sugar moiety.
In certain embodiments, the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages. In certain embodiments, the intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3’): soossssssssssos, soossssssssssoos, soossssssssssooos, sooossssssssssos, sooossssssssssoos, or soooossssssssssooos; wherein each “s” represents a phosphorothioate intemucleoside linkage, and each “o” represents a phosphodiester intemucleoside linkage.
The nucleobase sequences of SEQ ID NOs: 196. 1814. 1909, 3042, 3109, 3170, 3217. and 3299 are complementary to an equal length portion within nucleobases 22,507-22.529 of SEQ ID NO: 1 or within nucleobases
24.573-24,595 of SEQ ID NO: 2.
The nucleobase sequences of Compound Nos: 1484851, 1485878. 1534284, 1535251, 1535308, 1535365, 1535422. 1535440, 1535498. 1535553, and 1535609 are complementary to an equal length portion within nucleobases 22.507-22,529 of SEQ ID NO: 1 or within nucleobases 24,573-24.595 of SEQ ID NO: 2.
In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 22,507-22,529 of SEQ ID NO: 1 or within nucleobases 24,573-24,595 of SEQ ID NO: 2 achieve at least 78% reduction of SNCA mRNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 22,507-22.529 of SEQ ID NO: 1 or within nucleobases
24.573-24,595 of SEQ ID NO: 2 achieve an average of 89.4% reduction of SNCA mRNA in the standard in vitro assay.
10. Nucleobases 22,614-22,637 of SEQ ID NO: 1 or nucleobases 24,680-24,703 of SEQ ID NO: 2
In certain embodiments, nucleobases 22,614-22,637 of SEQ ID NO: 1 or nucleobases 24,680-24,703 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to an equal length portion within nucleobases 22,614-22,637 of SEQ ID NO: 1 or within nucleobases 24,680-24,703 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides arc 16 nucleobases in length. In certain embodiments, modified oligonucleotides arc 17 nucleobases in length. In certain embodiments, modified oligonucleotides arc 18 nucleobases in length. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, modified oligonucleotides are cEt gapmers. In certain embodiments, modified oligonucleotides are MOE gapmers. In certain embodiments, modified oligonucleotides are mixed cEt/MOE gapmers.
In certain embodiments, the gapmers are 3-10-3 cEt gapmers. In certain embodiments, the gapmers are 3-10-4 cEt gapmers. In certain embodiments, the gapmers are 4-10-3 cEt gapmers. In certain embodiments, the gapmers are 4- 10-4 cEt gapmers. In certain embodiments, the gapmers are 5-10-5 cEt gapmers. In certain embodiments, the gapmers are 3-10-4 or 3-10-5 mixed cEt/MOE gapmers. In certain embodiments, the sugar motif for the mixed cEt/MOE gapmers is (from 5’ to 3’): kkkddddddddddkkee, kkkddddddddddkeee, kkkdddddddddkkeee, or kkkdddddddddkeeee; wherein “k” represents a cEt sugar moiety, “e” represents a 2’-M0E sugar moiety, and “d” represents a 2'-[i-D- deoxyribosyl sugar moiety.
In certain embodiments, the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages. In certain embodiments, the intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3’): soossssssssssos. soossssssssssoos. soossssssssssooos. sooossssssssssos, sooossssssssssoos. or soooossssssssssooos; wherein each “s” represents a phosphorothioate intemucleoside linkage, and each “o” represents a phosphodiester intemucleoside linkage.
The nucleobase sequences of SEQ ID NOs: 171, 207. 245. 489, 2390, 3053. 3119. 3128. 3227, and 3309 are complementary to an equal length portion within nucleobases 22.614-22,637 of SEQ ID NO: 1 or within nucleobases 24.680-24,703 of SEQ ID NO: 2.
The nucleobase sequences of Compound Nos: 1482571, 1486455. 1533179, 1534179, 1534332. 1535205, 1535262. 1535320, 1535376. 1535433, 1535451, 1535509. and 1535564 are complementary to an equal length portion within nucleobases 22.614-22,637 of SEQ ID NO: 1 or within nucleobases 24,680-24.703 of SEQ ID NO: 2.
In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 22.614-22,637 of SEQ ID NO: 1 or within nucleobases 24,680-24.703 of SEQ ID NO: 2 achieve at least 57% reduction of SNCA mRNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 22,614-22.637 of SEQ ID NO: 1 or within nucleobases 24.680-24,703 of SEQ ID NO: 2 achieve an average of 87.2% reduction of SNCA mRNA in the standard in vitro assay.
11. Nucleobases 25,049-25,090 of SEQ ID NO: 1 or nucleobases 27,115-27,156 of SEQ ID NO: 2
In certain embodiments, nucleobases 25,049-25,090 of SEQ ID NO: 1 or nucleobases 27,115-27,156 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to an equal length portion within nucleobases 25,049-25,090 of SEQ ID NO: 1 or within nucleobases 27,115-27,156 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 16 nucleobases in length. In certain embodiments, modified oligonucleotides are 17 nucleobases in length. In certain embodiments, modified oligonucleotides are 18 nucleobases in length. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, modified oligonucleotides are cEt gapmers. In certain embodiments, modified oligonucleotides are MOE gapmers. In certain embodiments, modified oligonucleotides are mixed cEt/MOE gapmers.
In certain embodiments, the gapmers arc 3-10-3 cEt gapmers. In certain embodiments, the gapmers arc 3-10-4 cEt gapmers. In certain embodiments, tire gapmers are 4-10-3 cEt gapmers. In certain embodiments, the gapmers are 4- 10-4 cEt gapmers. In certain embodiments, the gapmers are 5-10-5 cEt gapmers. In certain embodiments, the gapmers are 3-10-4 or 3-10-5 mixed cEt/MOE gapmers. In certain embodiments, the sugar motif for the mixed cEt/MOE gapmers is (from 5’ to 3’): kkkddddddddddkkee, kkkddddddddddkeee, ekkddddddddddkeeee, kkkdddddddddkkeee, or kkkdddddddddkeeee; wherein “k” represents a cEt sugar moiety, “e’’ represents a 2’-M0E sugar moiety', and “d” represents a 2’-P-D-deoxyribosyl sugar moiety.
In certain embodiments, the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages. In certain embodiments, the intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3’): soossssssssssos. soossssssssssoos, soossssssssssooos. sooossssssssssos, sooossssssssssoos. soossssssssssssss, or soooossssssssssooos; wherein each “s” represents a phosphorothioate intemucleoside linkage, and each “o” represents a phosphodiester intemucleoside linkage.
The nucleobase sequences of SEQ ID NOs: 24. 133, 199, 228. 230, 276, 314, 946. 2759. 2818, 2873, 3069, 3087. 3148, 3195, and 3277 are complementary to an equal length portion within nucleobases 25.049-25,090 of SEQ ID NO: 1 or within nucleobases 27.115-27, 156 of SEQ ID NO: 2.
The nucleobase sequences of Compound Nos: 1484502. 1484512, 1484515, 1485351, 1485506, 1485716. 1534281, 1534299. 1534409, 1534422, 1534454. 1535227, 1535284. 1535342, 1535398. 1535472, 1535530, 1535585. 1535592, and 1535633 are complementary to an equal length portion within nucleobases 25,049-25.090 of SEQ ID NO: 1 or within nucleobases 27,115-27,156 of SEQ ID NO: 2.
In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 25.049-25,090 of SEQ ID NO: 1 or within nucleobases 27,115-27.156 of SEQ ID NO: 2 achieve at least 71% reduction of SNCA mRNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 25,049-25.090 of SEQ ID NO: 1 or within nucleobases 27.115-27,156 of SEQ ID NO: 2 achieve an average of 85.5% reduction of SNCA mRNA in the standard in vitro assay.
12. Nucleobases 26,367-26,388 of SEQ ID NO: 1 or nucleobases 28,433-28,454 of SEQ ID NO: 2
In certain embodiments, nucleobases 26,367-26,388 of SEQ ID NO: 1 or nucleobases 28,433-28,454 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to an equal length portion within nucleobases 26,367-26,388 of SEQ ID NO: 1 or within nucleobases 28,433-28,454 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 16 nucleobases in length. In certain embodiments, modified oligonucleotides are 17 nucleobases in length. In certain embodiments, modified oligonucleotides are 18 nucleobases in length. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, modified oligonucleotides are cEt gapmers. In certain embodiments, modified oligonucleotides are MOE gapmers. In certain embodiments, modified oligonucleotides are mixed cEt/MOE gapmers.
In certain embodiments, the gapmers are 3-10-3 cEt gapmers. In certain embodiments, the gapmers are 3-10-4 cEt gapmers. In certain embodiments, tire gapmers are 4-10-3 cEt gapmers. In certain embodiments, the gapmers are 4- 10-4 cEt gapmers. In certain embodiments, the gapmers are 5-10-5 cEt gapmers. In certain embodiments, the gapmers arc 3-10-4 or 3-10-5 mixed cEt/MOE gapmers. In certain embodiments, the sugar motif for the mixed cEt/MOE gapmers is (from 5’ to 3‘): kkkddddddddddkkcc, kkkddddddddddkccc, ckkddddddddddkcccc, kkkdddddddddkkccc, or kkkdddddddddkeeee; wherein “k" represents a cEt sugar moiety , “e’’ represents a 2’-MOE sugar moiety, and “d" represents a 2'-[i-D-deoxy ribosyl sugar moiety.
In certain embodiments, the intemucleoside linkages of tire modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages. In certain embodiments, the intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3’): soossssssssssos. soossssssssssoos, soossssssssssooos. sooossssssssssos, sooossssssssssoos, soossssssssssssss, or soooossssssssssooos; wherein each “s” represents a phosphorothioate intemucleoside linkage, and each “o” represents a phosphodiester intemucleoside linkage.
The nucleobase sequences of SEQ ID NOs: 168, 193. 236, 313, 2446, 3049, 3116, 3177. 3224, and 3306 are complementary to an equal length portion within nucleobases 26,367-26,388 of SEQ ID NO: 1 or within nucleobases 28,433-28,454 of SEQ ID NO: 2.
The nucleobase sequences of Compound Nos: 1485739, 1486339, 1534264, 1534442, 1534444, 1535258. 1535317, 1535373, 1535429, 1535447, 1535505. 1535560, 1535616. and 1535622 are complementary to an equal length portion within nucleobases 26,367-26.388 of SEQ ID NO: 1 or within nucleobases 28.433-28,454 of SEQ ID NO: 2.
In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 26,367-26.388 of SEQ ID NO: 1 or within nucleobases 28.433-28,454 of SEQ ID NO: 2 achieve at least 76% reduction of SNCA mRNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 26,367-26.388 of SEQ ID NO: 1 or within nucleobases 28.433-28,454 of SEQ ID NO: 2 achieve an average of 90.5% reduction of SNCA mRNA in the standard in vitro assay.
13. Nucleobases 26,508-26,531 of SEQ ID NO: 1 or nucleobases 28,574-28,597 of SEQ ID NO: 2
In certain embodiments, nucleobases 26,508-26.531 of SEQ ID NO: 1 or nucleobases 28,574-28,597 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to an equal length portion within nucleobases 26,508-26,531 of SEQ ID NO: 1 or within nucleobases 28,574-28,597 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 16 nucleobases in length. In certain embodiments, modified oligonucleotides are 17 nucleobases in length. In certain embodiments, modified oligonucleotides are 18 nucleobases in length. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, modified oligonucleotides are cEt gapmers. In certain embodiments, modified oligonucleotides are MOE gapmers. In certain embodiments, modified oligonucleotides are mixed cEt/MOE gapmers.
In certain embodiments, the gapmers are 3-10-3 cEt gapmers. In certain embodiments, the gapmers are 3-10-4 cEt gapmers. In certain embodiments, the gapmers are 4-10-3 cEt gapmers. In certain embodiments, the gapmers are 4- 10-4 cEt gapmers. In certain embodiments, the gapmers are 5-10-5 cEt gapmers. In certain embodiments, the gapmers are 3-10-4 or 3-10-5 mixed cEt/MOE gapmers. In certain embodiments, the sugar motif for the mixed cEt/MOE gapmers is (from 5’ to 3‘): kkkddddddddddkkee, kkkddddddddddkeee, ekkddddddddddkeeee, kkkdddddddddkkeee, or kkkdddddddddkeeee; wherein “k" represents a cEt sugar moiety , “e’’ represents a 2‘-MOE sugar moiety, and “d" represents a 2’-p-D-dcoxyribosyl sugar moiety.
In certain embodiments, the intcmuclcosidc linkages of tire modified oligonucleotides arc phosphorothioatc intemucleoside linkages and phosphodiester intemucleoside linkages. In certain embodiments, the intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3’): soossssssssssos, soossssssssssoos, soossssssssssooos. sooossssssssssos, sooossssssssssoos, soossssssssssssss, or soooossssssssssooos; wherein each “s” represents a phosphorothioate intemucleoside linkage, and each “o” represents a phosphodiester intemucleoside linkage.
The nucleobase sequences of SEQ ID NOs: 210, 223. 272, 273, 274, 1026, 1143, 3020, 3089, 3150, 3197. and 3279 are complementary to an equal length portion within nucleobases 26,508-26.531 of SEQ ID NO: 1 or within nucleobases 28,574-28,597 of SEQ ID NO: 2.
The nucleobase sequences of Compound Nos: 1484579, 1485953, 1534266, 1534267, 1534268, 1534341. 1534391, 1535203, 1535229, 1535286, 1535344. 1535400, 1535476. 1535532, 1535587, and 1535636 are complementary to an equal length portion within nucleobases 26,508-26,531 of SEQ ID NO: 1 or within nucleobases 28,574-28,597 of SEQ ID NO: 2.
In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 26,508-26.531 of SEQ ID NO: 1 or within nucleobases 28.574-28,597 of SEQ ID NO: 2 achieve at least 78% reduction of SNCA mRNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 26,508-26,531 of SEQ ID NO: 1 or within nucleobases 28,574-28,597 of SEQ ID NO: 2 achieve an average of 89.3% reduction of SNCA mRNA in the standard in vitro assay.
14. Nucleobases 30.207-30.226 of SEO ID NO: 1 or nucleobases 32.273-32.292 of SEO ID NO: 2
In certain embodiments, nucleobases 30,207-30.226 of SEQ ID NO: 1 or nucleobases 32,273-32,292 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to an equal length portion within nucleobases 30.207-30,226 of SEQ ID NO: 1 or within nucleobases 32,273-32.292 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 16 nucleobases in length. In certain embodiments, modified oligonucleotides are 17 nucleobases in length. In certain embodiments, modified oligonucleotides are 18 nucleobases in length. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, modified oligonucleotides are cEt gapmers. In certain embodiments, modified oligonucleotides are MOE gapmers. In certain embodiments, modified oligonucleotides are mixed cEt/MOE gapmers.
In certain embodiments, the gapmers are 3-10-3 cEt gapmers. In certain embodiments, tire gapmers are 3-10-4 cEt gapmers. In certain embodiments, the gapmers are 4-10-3 cEt gapmers. In certain embodiments, the gapmers are 4- 10-4 cEt gapmers. In certain embodiments, the gapmers are 5-10-5 cEt gapmers. In certain embodiments, the gapmers are 3-10-4 or 3-10-5 mixed cEt/MOE gapmers. In certain embodiments, the sugar motif for the mixed cEt/MOE gapmers is (from 5’ to 3‘): kkkddddddddddkkee, kkkddddddddddkeee, ekkddddddddddkeeee, kkkdddddddddkkeee, or kkkdddddddddkeeee; wherein “k” represents a cEt sugar moiety, “e" represents a 2‘-MOE sugar moiety, and “d" represents a 2’-p-D-deoxyribosyl sugar moiety.
In certain embodiments, the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages. In certain embodiments, the intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3 ’): soossssssssssos, soossssssssssoos, soossssssssssooos, sooossssssssssos, sooossssssssssoos, soossssssssssssss, or soooossssssssssooos; wherein each “s’- represents a phosphorothioate intemucleoside linkage, and each “o’‘ represents a phosphodicstcr intemucleoside linkage.
The nucleobase sequences of SEQ ID NOs: 287, 964, 1040, 1154, 3050, 3117, 3178, 3225, and 3307 are complementary’ to an equal length portion within nucleobases 30,207-30,226 of SEQ ID NO: 1 or within nucleobases 32,273-32,292 of SEQ ID NO: 2.
The nucleobase sequences of Compound Nos: 1485060, 1485105, 1486348, 1534322, 1535260, 1535318, 1535374, 1535430, 1535448, 1535506, 1535561. 1535617, and 1535623 are complementary to an equal length portion within nucleobases 30,207-30,226 of SEQ ID NO: 1 or within nucleobases 32,273-32,292 of SEQ ID NO: 2.
In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 30,207-30,226 of SEQ ID NO: 1 or within nucleobases 32,273-32,292 of SEQ ID NO: 2 achieve at least 81% reduction of SNCA mRNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 30,207-30,226 of SEQ ID NO: 1 or within nucleobases 32,273-32,292 of SEQ ID NO: 2 achieve an average of 92.9% reduction of SNCA mRNA in the standard in vitro assay.
15. Nucleobases 31,412-31,438 of SEO ID NO: 1 of nucleobases 33,478-33,504 of SEQ TD NO: 2
In certain embodiments, nucleobases 31.412-31,438 of SEQ ID NO: 1 or nucleobases 33,478-33,504 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complemenlan to an equal length portion within nucleobases 31,412-31.438 of SEQ ID NO: 1 or within nucleobases 33.478-33,504 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 16 nucleobases in length. In certain embodiments, modified oligonucleotides are 17 nucleobases in length. In certain embodiments, modified oligonucleotides are 18 nucleobases in length. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, modified oligonucleotides are cEt gapmers. In certain embodiments, modified oligonucleotides are MOE gapmers. In certain embodiments, modified oligonucleotides are mixed cEt/MOE gapmers.
In certain embodiments, the gapmers are 3-10-3 cEt gapmers. In certain embodiments, tire gapmers are 3-10-4 cEt gapmers. In certain embodiments, the gapmers are 4-10-3 cEt gapmers. In certain embodiments, the gapmers are 4- 10-4 cEt gapmers. In certain embodiments, the gapmers are 5-10-5 cEt gapmers. In certain embodiments, the gapmers are 3-10-4 or 3-10-5 mixed cEt/MOE gapmers. In certain embodiments, the sugar motif for the mixed cEt/MOE gapmers is (from 5’ to 3’): kkkddddddddddkkee. kkkddddddddddkeee. ekkddddddddddkeeee, kkkdddddddddkkeee, or kkkdddddddddkeeee; wherein “k” represents a cEt sugar moiety, "c" represents a 2’-MOE sugar moiety, and “d” represents a 2’-p-D-deoxyribosyl sugar moiety.
In certain embodiments, the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages. In certain embodiments, the intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3‘): soossssssssssos, soossssssssssoos, soossssssssssooos, sooossssssssssos, sooossssssssssoos, soossssssssssssss, or soooossssssssssooos; wherein each “s’- represents a phosphorothioate intemucleoside linkage, and each “o’- represents a phosphodiester intemucleoside linkage.
The nucleobase sequences of SEQ ID NOs: 119, 980, 1085, 1166, 3051, 3118, 3127, 3226, and 3308 are complementary to an equal length portion within nucleobases 31,412-31,438 of SEQ ID NO: 1 or within nucleobases 33,478-33,504 of SEQ ID NO: 2.
The nucleobase sequences of Compound Nos: 1484891, 1485806, 1486424, 1486626, 1535204, 1535261, 1535319, 1535375, 1535432, 1535449, 1535508, 1535562, and 1535624 arc complementary to an equal length portion within nucleobases 31,412-31,438 of SEQ ID NO: 1 or within nucleobases 33,478-33,504 of SEQ ID NO: 2.
In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 31,412-31,438 of SEQ ID NO: 1 or within nucleobases 33,478-33,504 of SEQ ID NO: 2 achieve at least 79% reduction of SNCA mRNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 31,412-31,438 of SEQ ID NO: 1 or within nucleobases 33,478-33,504 of SEQ ID NO: 2 achieve an average of 86.8% reduction of SNCA mRNA in the standard in vitro assay.
16. Nucleobases 33,027-33,057 of SEQ ID NO: 1 or nucleobases 35,093-35,123 of SEQ ID NO: 2
In certain embodiments, nucleobases 33.027-33,057 of SEQ ID NO: 1 or nucleobases 35,093-35,123 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to an equal length portion within nucleobases 33,027-33.057 of SEQ ID NO: 1 or within nucleobases 35.093-35,123 of SEQ ID NO:
2. In certain embodiments, modified oligonucleotides are 16 nucleobases in length. In certain embodiments, modified oligonucleotides are 17 nucleobases in length. In certain embodiments, modified oligonucleotides are 18 nucleobases in length. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, modified oligonucleotides are cEt gapmers. In certain embodiments, modified oligonucleotides are MOE gapmers. In certain embodiments, modified oligonucleotides are mixed cEt/MOE gapmers.
In certain embodiments, the gapmers are 3-10-3 cEt gapmers. In certain embodiments, the gapmers are 3-10-4 cEt gapmers. In certain embodiments, the gapmers are 4-10-3 cEt gapmers. In certain embodiments, the gapmers are 4- 10-4 cEt gapmers. In certain embodiments, the gapmers are 5-10-5 cEt gapmers. In certain embodiments, the gapmers are 3-10-4 or 3-10-5 mixed cEt/MOE gapmers. In certain embodiments, the sugar motif for the mixed cEt/MOE gapmers is (from 5’ to 3’): kkkddddddddddkkee. kkkddddddddddkeee. ekkddddddddddkeeee, kkkdddddddddkkeee, or kkkdddddddddkeeee; wherein “k” represents a cEt sugar moiety, “e” represents a 2’-MOE sugar moiety, and “d” represents a 2’-p-D-deoxyribosyl sugar moiety.
In certain embodiments, the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages. In certain embodiments, the intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3 ’): soossssssssssos, soossssssssssoos, soossssssssssooos, sooossssssssssos, sooossssssssssoos, soossssssssssssss, or soooossssssssssooos; wherein each “s” represents a phosphorothioate intemucleoside linkage, and each “o” represents a phosphodiester intemucleoside linkage.
The nucleobase sequences of SEQ ID NOs: 194, 277, 1113. 1185, 1309, 3024, 3093, 3154, 3201, and 3283 are complementary to an equal length portion within nucleobases 33,027-33.057 of SEQ ID NO: 1 or within nucleobases 35,093-35,123 of SEQ ID NO: 2.
The nucleobase sequences of Compound Nos: 1484757, 1485131, 1486277, 1534265, 1534282, 1535233, 1535248, 1535290, 1535348, 1535404, 1535480, 1535536, 1535591, and 1535637 are complementary to an equal length portion within nucleobases 33,027-33,057 of SEQ ID NO: 1 or within nucleobases 35,093-35,123 of SEQ ID NO: 2.
In certain embodiments, modified oligonucleotides complementary' to an equal length portion within nucleobases 33,027-33,057 of SEQ ID NO: 1 or within nucleobases 35,093-35,123 of SEQ ID NO: 2 achieve at least 66% reduction of SNCA mRNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 33,027-33,057 of SEQ ID NO: 1 or within nucleobases 35,093-35,123 of SEQ ID NO: 2 achieve an average of 86.9% reduction of SNCA mRNA in tire standard in vitro assay.
17. Nucleobases 48,460-48,489 of SEQ ID NO: 1 or nucleobases 50,526-50,555 of SEQ ID NO: 2
In certain embodiments, nucleobases 48,460-48,489 of SEQ ID NO: 1 or nucleobases 50,526-50,555 of SEQ ID NO: 2 comprise a hotspot region. In certain embodiments, modified oligonucleotides are complementary to an equal length portion within nucleobases 48,460-48.489 of SEQ ID NO: 1 or within nucleobases 50.526-50,555 of SEQ ID NO: 2. In certain embodiments, modified oligonucleotides are 16 nucleobases in length. In certain embodiments, modified oligonucleotides are 17 nucleobases in length. In certain embodiments, modified oligonucleotides are 18 nucleobases in length. In certain embodiments, modified oligonucleotides are 20 nucleobases in length. In certain embodiments, modified oligonucleotides are gapmers. In certain embodiments, modified oligonucleotides are cEt gapmers. In certain
embodiments, modified oligonucleotides are MOE gapmers. In certain embodiments, modified oligonucleotides are mixed cEt/MOE gapmers.
In certain embodiments, the gapmers are 3-10-3 cEt gapmers. Tn certain embodiments, the gapmers are 3-10-4 cEt gapmers. In certain embodiments, the gapmers are 4-10-3 cEt gapmers. In certain embodiments, the gapmers are 4- 10-4 cEt gapmers. In certain embodiments, the gapmers are 5-10-5 cEt gapmers. In certain embodiments, the gapmers are 3-10-4 or 3-10-5 mixed cEt/MOE gapmers. In certain embodiments, the sugar motif for the mixed cEt/MOE gapmers is (from 5’ to 3’): kkkddddddddddkkee, kkkddddddddddkeee, kkkdddddddddkkeee, or kkkdddddddddkeeee; wherein “k” represents a cEt sugar moiety, “e” represents a 2’-MOE sugar moiety, and “d” represents a 2'-(j-D- deoxyribosyl sugar moiety.
In certain embodiments, the intemucleoside linkages of the modified oligonucleotides are phosphorothioate intemucleoside linkages and phosphodiester intemucleoside linkages. In certain embodiments, the intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3’): soossssssssssos, soossssssssssoos, soossssssssssooos, sooossssssssssos, sooossssssssssoos, or soooossssssssssooos; wherein each “s” represents a phosphorothioate intemucleoside linkage, and each “o” represents a phosphodiester intemucleoside linkage.
The nucleobase sequences of SEQ ID NOs: 310. 803, 919, 1582, 1674, 3032. 3032. 3032, 3100, 3161, 3208, 3290, and 3290 are complementary to an equal length portion within nucleobases 48,460-48.489 of SEQ ID NO: 1 or within nucleobases 50.526-50,555 of SEQ ID NO: 2.
The nucleobase sequences of Compound Nos: 1485242, 1485665. 1533161, 1533933, 1534424, 1535241, 1535298, 1535327, 1535356. 1535412, 1535488, 1535544, and 1535599 are complementary to an equal length portion within nucleobases 48.460-48,489 of SEQ ID NO: 1 or within nucleobases 50,526-50.555 of SEQ ID NO: 2.
In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 48,460-48,489 of SEQ ID NO: 1 or within nucleobases 50,526-50,555 of SEQ ID NO: 2 achieve at least 70% reduction of SNCA mRNA in the standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to an equal length portion within nucleobases 48,460-48,489 of SEQ ID NO: 1 or within nucleobases 50,526-50,555 of SEQ ID NO: 2 achieve an average of 89.2% reduction of SNCA mRNA in the standard in vitro assay.
Nonlimiting disclosure and incorporation by reference
Each of the literature and patent publications listed herein is incorporated by reference in its entirety.
While certain compounds, compositions and methods described herein have been described with specificity7 in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the references, GenBank accession numbers, ENSEMBL identifiers, and the like recited in the present application is incorporated herein by reference in its entirety.
The sequence listing accompanying this filing identifies each nucleic acid sequence as either “RNA” or “DNA” as required; however, one of skill in the art will readily7 appreciate that designation of “RNA” or “DNA” to describe modified oligonucleotides is, in certain instances, arbitrary. For example, an oligonucleotide comprising a nucleoside comprising a 2’-OH sugar moiety7 and a thymine base could be described as a DNA having a modified sugar (2’-OH in place of one 2’-H of DNA) or as an RNA having a modified base (thymine (5 -methyl uracil)) in place of an uracil of RNA); and certain nucleic acid compounds described herein comprise one or more nucleosides comprising modified
sugar moieties having 2’-substituent(s) that are neither OH nor H. One of skill in the art will readily appreciate that labeling such nucleic acid compounds “RNA” or “DNA” does not alter or limit the description of such nucleic acid compounds.
Herein, the description of compounds as having “the nucleobase sequence of’ a SEQ ID NO. describes only the nucleobase sequence. Accordingly, absent additional description, such description of compounds by reference to a nucleobase sequence of a SEQ ID NO. does not limit sugar or intemucleoside linkage modifications or presence or absence of additional substituents such as a conjugate group. Further, absent additional description, the nucleobases of a compound “having the nucleobase sequence of’ a SEQ ID NO. include such compounds having modified forms of the identified nucleobases as described herein.
Herein, the description of compounds by chemical notation (subscripts and/or superscripts to indicate chemical modifications) without reference to a specific Compound No. include only each noted modification, but may include additional substituents, such as a conjugate group, unless otherwise indicated. For example, the chemical notation of “AesTkoinCeZGdsCd” indicates a compound wherein the first nucleoside comprises a 2’-M0E sugar moiety (indicated by tire “e” subscript) and an unmodified adenine nucleobase linked to the second nucleoside via a phosphorothioate linkage (indicated by the "s” subscript); the second nucleoside comprises a cEt sugar moiety (indicated by the “k” subscript) and an unmodified thymine nucleobase linked to the third nucleoside via a phosphodiester linkage (indicated by the “o” subscript); the third nucleoside comprises a 2’-MOE sugar moiety and a 5-methyl modified cytosine nucleobase (indicated by the “m” superscript) linked to the fourth nucleoside via a mesyl phosphoramidate linkage (indicated by the “z” subscript); tire fourth nucleoside comprises a 2’-p-D-deoxyribosyl sugar moiety (indicated by tire “d” subscript) and an umnodified guanine nucleobase linked to the fifth nucleoside with a phosphorothioate linkage; and the fifth nucleoside comprises a 2’-p-D-deoxyribosyl sugar moiety and an umnodified cytosine nucleobase; and the compound may include additional substituents, such as a conjugate group.
Herein, where a specific compound (e.g., with reference to a Compound No.) is described (as in the examples) by chemical notation, each nucleobase, sugar, and intemucleoside linkage of such specific compound is modified only as indicated. Accordingly, in tire context of a description of a specific compound having a particular Compound No., “AesTkomCeZGdsCd” indicates a compound wherein the first nucleoside comprises a 2’-M0E sugar moiety (indicated by the “c” subscript) and an unmodified adenine nucleobase linked to the second nucleoside via a phosphorothioate linkage (indicated by the “s’’ subscript); tire second nucleoside comprises a cEt sugar moiety (indicated by the “k’‘ subscript) and an umnodified thy mine nucleobase linked to tire third nucleoside via a phosphodiester linkage (indicated by tire “o” subscript); the third nucleoside comprises a 2’-MOE sugar moiety' and a 5-methyl modified cytosine nucleobase (indicated by the “m” superscript) linked to the fourth nucleoside via a mesylphosphoramidate linkage (indicated by the “z” subscript); the fourth nucleoside comprises a 2’-P-D-deoxyribosyl sugar moiety (indicated by the “d” subscript) and an unmodified guanine nucleobase linked to the fifth nucleoside with a phosphorothioate linkage; and the fifth nucleoside comprises a 2'-(>-D-deo.xyribosyl sugar moiety and an unmodified cytosine nucleobase; and the compound does not include additional substituents.
Herein, sugar, intemucleoside linkage, and nucleobase modifications may be indicated within a nucleotide or nucleobase sequence (e.g., by superscript or subscript, as shown above) or may be indicated in text accompanying a sequence (e.g., in separate text that appears within or above or below a table of compounds).
Where a specific compound is described herein by way of a drawn chemical structure, each nucleobase. sugar, and intemucleoside linkage of such a specific compound includes only the modifications indicated in the drawn chemical structure. One of skill will appreciate, however, that drawn compounds may exist in equilibrium between tautomeric forms and/or as salts in equilibrium with protonated or ionic forms. Drawn structures are intended to capture all such forms of such compounds.
While effort has been made to accurately describe compounds in the accompanying sequence listing, should there be any discrepancies betw een a description in this specification and in the accompanying sequence listing, the description in the specification and not in the sequence listing is the accurate description.
The compounds described herein include variations in which one or more atoms are replaced with a nonradioactive isotope or radioactive isotope of the indicated element. For example, compounds herein that comprise hydrogen atoms encompass all possible deuterium substitutions for each of the 'H hydrogen atoms. Isotopic substitutions encompassed by the compounds herein include but are not limited to: 2H or 3H in place of *H, 13C or 14C in place of 12C, 15N in place of 14N, 17O or 1SO in place of 16O, and 33S, 34S, 35S, or 36S in place of 32S. In certain embodiments, non-radioactive isotopic substitutions may impart new' properties on the oligomeric compound that are beneficial for use as a therapeutic or research tool. In certain embodiments, radioactive isotopic substitutions may make tire compound suitable for research or diagnostic purposes such as imaging.
EXAMPLES
The following examples illustrate certain embodiments of the present disclosure and are not limiting. Moreover, where specific embodiments are provided, the inventors have contemplated generic application of those specific embodiments. For example, disclosure of an oligonucleotide having a particular motif provides reasonable support for additional oligonucleotides having the same or similar motif. And, for example, where a particular high-affinity modification appears at a particular position, other high-affinitv modifications at the same position are considered suitable, unless otherwise indicated.
Example 1: Design and Effect of 3-10-3 cEt gapmers complementary to human SNCA RNA
Modified oligonucleotides complementary to a human SNCA RNA were designed and tested for their single dose effects on SNCA RNA in vitro. The modified oligonucleotides were tested in a series of experiments that had the same culture conditions.
The modified oligonucleotides in the table below are modified oligonucleotides with mixed PS/PO intemucleoside linkages. The modified oligonucleotides in tire table below are 16 nucleosides in length, wherein the sugar motif for the modified oligonucleotides is (from 5’ to 3’): kkkddddddddddkkk; wherein "k” represents a cEt sugar moiety, and “d” represents a 2’-p-D-deoxyribosyl sugar moiety. The intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3’): soossssssssssos; wherein each “s” represents a phosphorothioate intemucleoside linkage, and each “o” represents a phosphodiester intemucleoside linkage. Each cytosine residue is a 5-methylcytosine.
“Start site” indicates the 5 ‘-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. “Stop site” indicates the 3 ’-most nucleoside to which Hie modified oligonucleotide is complementary in the target nucleic acid sequence. Each modified oligonucleotide listed in the tables below is 100% complementary to SEQ ID NO: 1 (Ensembl Accession ENSG00000145335.17, Ensembl release 106 - Apr 2022) or to
SEQ ID NO: 2 (the complement of GENBANK Accession No: NT 016354.20 truncated from nucleoside 30800000 to nucleoside 30919000), or to both. ‘N/A’ indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.
Cultured differentiated SH-SY 5Y cells were treated with modified oligonucleotide at a concentration of 2.000 nM by electroporation at a density of 20,000 cells per well. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and SNCA RNA levels were measured by quantitative real-time RT-PCR. SNCA RNA levels were measured by human primer-probe set RTS2621 (forward sequence ACGAACCTGAAGCCTAAGAAATATCT, designated herein as SEQ ID NO: 10; reverse sequence GAGCACTTGTACAGGATGGAACAT, designated herein as SEQ ID NO: 11 ; probe sequence TGCTCCCAGTTTCTTGAGATCTGCTGACA, designated herein as SEQ ID NO: 12). SNCA RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of SNCA RNA is presented in the table below as percent SNCA RNA relative to the amount of SNCA RNA in untreated control cells (% UTC). Each separate experiment described in this example is identified by an Assay Identification letter in the table column labeled “AID”.
Table 1 3-10-3 cEt gapmers with mixed PS/PO linkages complementary to human SNCA
The modified oligonucleotide listed in the tables below is 100% complementary to SEQ ID NO: 3 (GENBANK Accession No: NM 001146055.1). as indicated. ‘N/A’ indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.
Table 2
3-10-3 cEt gapmers with mixed PS/PO linkages complementary to human SNCA
Cultured differentiated SH-SY5Y cells were treated with modified oligonucleotide at a concentration of 1.000 nM by electroporation at a density of 20,000 cells per well. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and SNCA RNA levels were measured by quantitative real-time RT-PCR. SNCA RNA levels were measured by human primer-probe set RTS2621 (described herein above). SNCA RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of SNCA RNA is presented in the table below as percent SNCA RNA relative to tire amount of SNCA RNA in untreated control cells (% UTC).
“Start site” indicates the 5 ’-most nucleoside to which the modified oligonucleotide is complcmcntan in the target nucleic acid sequence. “Stop site” indicates the 3 ’-most nucleoside to which tire modified oligonucleotide is complementary in the target nucleic acid sequence. Each modified oligonucleotide listed in the tables below is 100%
complementary to SEQ ID NO: 1 (Ensembl Accession ENSG00000145335.17, Ensembl release 106 - Apr 2022) or to SEQ ID NO: 2 (the complement of GENBANK Accession No: NT 016354.20 truncated from nucleoside 30800000 to nucleoside 30919000), or to both. ‘N/A’ indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence. Table 3
3-10-3 cEt gapmers with mixed PS/PO linkages complementary to human SNCA
Table 4
3-10-3 cEt gapmers with mixed PS/PO linkages complementary to human SNCA
Each modified oligonucleotide listed in the tables below is 100% complementary to SEQ ID NO: 3 (GENBANK Accession No: NM 001146055.1), as indicated. ‘N/A’ indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence. Table 5
3-10-3 cEt gapmers with mixed PS/PO linkages complementary to human SNCA
Example 2: Design and Effect of 3-10-4 cEt gapmers complementary to human SNCA RNA
Modified oligonucleotides complementary to a human SNCA RNA were designed and tested for their single dose effects on SNCA RNA in vitro. The modified oligonucleotides were tested in a series of experiments that had the same culture conditions.
The modified oligonucleotides in the table below are modified oligonucleotides with mixed PS/PO intemucleoside linkages. The modified oligonucleotides in tire table below are 17 nucleosides in length. wherein the sugar motif for the modified oligonucleotides is (from 5’ to 3 ’): kkkddddddddddkkkk; wherein “k” represents a cEt sugar moiety. and “d” represents a 2’-p-D-deoxyribosyl sugar moiety. The intemucleoside linkage motif for the modified
oligonucleotides is (from 5’ to 3’): soossssssssssoos; wherein each “s” represents a phosphorothioate intemucleoside linkage, and each “o” represents a phosphodiester intemucleoside linkage. Each cytosine residue is a 5-methylcytosine.
“Start site” indicates the 5 ’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. “Stop site” indicates the 3 ’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. Each modified oligonucleotide listed in the tables below is 100% complementary to SEQ ID NO: 1 (Ensembl Accession ENSG00000145335.17. Ensembl release 106 - Apr 2022) or to SEQ ID NO: 2 (the complement of GENBANK Accession No: NT 016354.20 truncated from nucleoside 30800000 to nucleoside 30919000). or to both. ‘N/A’ indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence. Cultured differentiated SH-SY 5Y cells were treated with modified oligonucleotide at a concentration of 2,000 nM by electroporation at a density of 20.000 cells per well. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and SNCA RNA levels were measured by quantitative real-time RT-PCR. SNCA RNA levels were measured by human primer-probe set RTS2621 (described herein above). SNCA RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of SNCA RNA is presented in the table below as percent SNCA RNA relative to the amount of SNCA RNA in untreated control cells (% UTC). Each separate experiment described in this example is identified by an Assay Identification letter in the table column labeled “AID”.
Table 6
3-10-4 cEt gapmers with mixed PS/PO linkages complementary to human SNCA
Example 3: Design and Effect of 4-10-3 cEt gapmers complementary to human SNCA RNA
Modified oligonucleotides complementary to a human SNCA RNA were designed and tested for their single dose effects on SNCA RNA in vitro. The modified oligonucleotides were tested in a series of experiments that had the same culture conditions.
The modified oligonucleotides in the table below are modified oligonucleotides with mixed PS/PO intemucleoside linkages. The modified oligonucleotides in the table below are 17 nucleosides in length, wherein the sugar motif for the modified oligonucleotides is (from 5’ to 3 ’): kkkkddddddddddkkk; wherein ‘ k” represents a cEt sugar moiety, and “d” represents a 2’-P-D-deoxyribosyl sugar moiety. The intemucleoside linkage motif for the modified
oligonucleotides is (from 5’ to 3’): sooossssssssssos; wherein each “s” represents a phosphorothioate intemucleoside linkage, and each “o” represents a phosphodiester intemucleoside linkage. Each cytosine residue is a 5-methylcytosine.
Cultured differentiated SH-SY 5Y cells were treated with modified oligonucleotide at a concentration of 2.000 nM by electroporation at a density of 20,000 cells per well. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and SNCA RNA levels were measured by quantitative real-time RT-PCR. SNCA RNA levels were measured by human primer-probe set RTS2621 (described herein above). SNCA RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of SNCA RNA is presented in the table below as percent SNCA RNA relative to the amount of SNCA RNA in untreated control cells (% UTC). Each separate experiment described in this example is identified by an Assay Identification letter in the table column labeled “AID”. “Start site” indicates the 5 ’-most nucleoside to which the modified oligonucleotide is complcmcnlan in the target nucleic acid sequence. “Stop site” indicates the 3 ’-most nucleoside to which tire modified oligonucleotide is complementary in the target nucleic acid sequence. Each modified oligonucleotide listed in the tables below is 100% complementary to SEQ ID NO: 1 (Ensembl Accession ENSG00000145335.17, Ensembl release 106 - Apr 2022) or to SEQ ID NO: 2 (the complement of GENBANK Accession No: NT 016354.20 truncated from nucleoside 30800000 to nucleoside 30919000). or to both. ‘N/A’ indicates that the modified oligonucleotide is not 100% complementaiy to that particular target nucleic acid sequence.
Table 7
4-10-3 cEt gapmers with mixed PS/PO linkages complementary to human SNCA
Example 4: Design and Effect of 4-10-4 cEt gapmers complementary to human SNCA RNA
Modified oligonucleotides complementary to a human SNCA RNA were designed and tested for their single dose effects on SNCA RNA in vitro. The modified oligonucleotides were tested in a series of experiments that had the same culture conditions.
The modified oligonucleotides in the table below are modified oligonucleotides with mixed PS/PO intemucleoside linkages. The modified oligonucleotides in the table below are 18 nucleosides in length, wherein the sugar motif for the modified oligonucleotides is (from 5’ to 3’): kkkkddddddddddkkkk: wherein “k” represents a cEt sugar moiety, and “d” represents a 2 ’-p-D-deoxy ribosyl sugar moiety. The intemucleoside linkage motif for the modified
oligonucleotides is (from 5’ to 3’): sooossssssssssoos; wherein each “s” represents a phosphorothioate intemucleoside linkage, and each “o” represents a phosphodiester intemucleoside linkage. Each cytosine residue is a 5-methylcytosine.
“Start site” indicates the 5 ’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. “Stop site” indicates the 3 ’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. Each modified oligonucleotide listed in the tables below is 100% complementary to SEQ ID NO: 1 (Ensembl Accession ENSG00000145335.17. Ensembl release 106 - Apr 2022) or to SEQ ID NO: 2 (the complement of GENBANK Accession No: NT 016354.20 truncated from nucleoside 30800000 to nucleoside 30919000). or to both. ‘N/A’ indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence. Cultured differentiated SH-SY 5Y cells were treated with modified oligonucleotide at a concentration of 2,000 nM by electroporation at a density of 20.000 cells per well. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and SNCA RNA levels were measured by quantitative real-time RT-PCR. SNCA RNA levels were measured by human primer-probe set RTS2621 (described herein above). SNCA RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of SNCA RNA is presented in the table below as percent SNCA RNA relative to the amount of SNCA RNA in untreated control cells (% UTC). Each separate experiment described in this example is identified by an Assay Identification letter in the table column labeled “AID”.
Table 8
4-10-4 cEt gapmers with mixed PS/PO linkages complementary to human SNCA
Example 5: Design and Effect of 5-10-5 cEt gapmers complementary to human SNCA RNA
Modified oligonucleotides complementary to a human SNCA RNA were designed and tested for their single dose effects on SNCA RNA in vitro. The modified oligonucleotides were tested in a series of experiments that had the same culture conditions.
The modified oligonucleotides in the table below are modified oligonucleotides with mixed PS/PO intemucleoside linkages. The modified oligonucleotides in the table below are 20 nucleosides in length, wherein the sugar motif for the modified oligonucleotides is (from 5’ to 3’): kkkkkddddddddddkkkkk; wherein “k” represents a cEt sugar moiety, and “d” represents a 2 ’-p-D-deoxy ribosyl sugar moiety. The intemucleoside linkage motif for the modified
oligonucleotides is (from 5’ to 3’): soooossssssssssooos; wherein each “s” represents a phosphorothioate intemucleoside linkage, and each “o” represents a phosphodiester intemucleoside linkage. Each cytosine residue is a 5-methylcytosine.
“Start site” indicates the 5 ’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. “Stop site” indicates the 3 ’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. Each modified oligonucleotide listed in the tables below is 100% complementary to SEQ ID NO: 1 (Ensembl Accession ENSG00000145335.17. Ensembl release 106 - Apr 2022) or to SEQ ID NO: 2 (the complement of GENBANK Accession No: NT 016354.20 truncated from nucleoside 30800000 to nucleoside 30919000). or to both. ‘N/A’ indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence. Cultured differentiated SH-SY 5Y cells were treated with modified oligonucleotide at a concentration of 2,000 nM by electroporation at a density of 20.000 cells per well. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and SNCA RNA levels were measured by quantitative real-time RT-PCR. SNCA RNA levels were measured by human primer-probe set RTS2621 (described herein above). SNCA RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of SNCA RNA is presented in the table below as percent SNCA RNA relative to the amount of SNCA RNA in untreated control cells (% UTC). Each separate experiment described in this example is identified by an Assay Identification letter in the table column labeled “AID”.
Table 9
5-10-5 cEt gapmers with mixed PS/PO linkages complementary to human SNCA
Example 6: Design and effect of modified oligonucleotides complementary to human SNCA RNA
Modified oligonucleotides complementary to a human SNCA RNA were designed and tested for their single dose effects on SNCA RNA in vitro. The modified oligonucleotides were tested in a series of experiments that had the same culture conditions.
The modified oligonucleotides in the table below are modified oligonucleotides with mixed PS/PO intemucleoside linkages. The modified oligonucleotides in the table below are 16 nucleosides in length, wherein the sugar motif for the modified oligonucleotides is (from 5 ’ to 3 ’ ) : kkkdyddddddddkkk; wherein “k” represents a cEt sugar moiety, “y” represents a 2’-O-methyl sugar moiety and ‘ d” represents a 2’-|3-D-deoxyribosyl sugar moiety. The intemucleoside
linkage motif for the modified oligonucleotides is (from 5’ to 3’): soossssssssssos; wherein each “s” represents a phosphorothioate intemucleoside linkage, and each “o” represents a phosphodiester intemucleoside linkage. Each cytosine residue is a 5-methylcytosine. unless otherwise specified. Non-methylated cytosines are bolded and underlined.
“Start site” indicates the 5 ’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. “Stop site” indicates the 3 ’-most nucleoside to which tire modified oligonucleotide is complementary in the target nucleic acid sequence. Each modified oligonucleotide listed in the tables below is 100% complementary to SEQ ID NO: 1 (Ensembl Accession ENSG00000145335.17, Ensembl release 106 - Apr 2022) or to SEQ ID NO: 2 (the complement of GENBANK Accession No: NT 016354.20 truncated from nucleoside 30800000 to nucleoside 30919000). or to both. ‘N/A’ indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.
Cultured differentiated SH-SY5Y cells were treated with modified oligonucleotide at a concentration of 1,000 nM by electroporation at a density of 20.000 cells per well. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and SNCA RNA levels were measured by quantitative real-time RT-PCR. SNCA RNA levels were measured by human primer-probe set RTS2621 (forward sequence ACGAACCTGAAGCCTAAGAAATATCT. designated herein as SEQ ID NO: 10; reverse sequence GAGCACTTGTACAGGATGGAACAT, designated herein as SEQ ID NO: 11; probe sequence TGCTCCCAGTTTCTTGAGATCTGCTGACA, designated herein as SEQ ID NO: 12). SNCA RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of SNCA RNA is presented in the table below as percent SNCA RNA relative to the amount of SNCA RNA in untreated control cells (% UTC). Each separate experiment described in tins example is identified by an Assay Identification letter in the table column labeled “AID”.
Table 10
3-10-3 gapmers with mixed PS/PO linkages complementary to human SNCA
Each modified oligonucleotide listed in the tables below is 100% complementary to SEQ ID NO: 3 (GENBANK Accession No: NM 001146055.1). as indicated. ‘N/A’ indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.
Table 11
3-10-3 gapmers with mixed PS/PO linkages complementary to human SNCA
Example 7: Design and Effect of cEt gapmers containing 2’-MOE modifications complementary to human SNCA RNA
Modified oligonucleotides complementary’ to a human SNCA RNA were designed and tested for their single dose effects on SNCA RNA in vitro. The modified oligonucleotides were tested in a series of experiments that had the same culture conditions.
“Start site” indicates the 5 ’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. “Stop site” indicates the 3 ’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. Each modified oligonucleotide listed in the tables below is 100% complementary to SEQ ID NO: 1 (Ensembl Accession ENSG00000145335.17, Ensembl release 106 - Apr 2022) or to SEQ ID NO: 2 (the complement of GENBANK Accession No: NT 016354.20 truncated from nucleoside 30800000 to nucleoside 30919000), or to both. ‘N/A’ indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.
Cultured differentiated SH-SY 5Y cells were treated with modified oligonucleotide at a concentration of 2,000 nM by electroporation at a density of 20.000 cells per well. After a treatment period of approximately 24 hours, total RNA
was isolated from the cells and SNCA RNA levels were measured by quantitative real-time RT-PCR. SNCA RNA levels were measured by human primer-probe set RTS2621 (described herein above). SNCA RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of SNCA RNA is presented in the table below as percent SNCA RNA relative to the amount of SNCA RNA in untreated control cells (% UTC). Each separate experiment described in this example is identified by an Assay Identification letter in the table column labeled “AID”.
The modified oligonucleotides in the table below are modified oligonucleotides with mixed PS/PO intemucleoside linkages. The modified oligonucleotides in the table below are 17 nucleosides in length, wherein the sugar motif for the modified oligonucleotides is (from 5’ to 3 ’): kkkddddddddddkeee; wherein “k” represents a cEt sugar moiety, “e” represents a 2’-M0E sugar moiety, and “d” represents a 2’-P-D-deoxyribosyl sugar moiety. The intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3’): soossssssssssoos; wherein each “s” represents a phosphorotliioate intemucleoside linkage, and each "o” represents a phosphodiester intemucleoside linkage. Each cytosine residue is a 5-methylcytosine.
Table 12 cEt gapmers containing 2’-M0E modifications with mixed PS/PO linkages complementary to human SNCA
The modified oligonucleotides in the table below are modified oligonucleotides with mixed PS/PO intemucleoside linkages. The modified oligonucleotides in the table below are 17 nucleosides in length, wherein the sugar motif for the modified oligonucleotides is (from 5’ to 3 ’): kkkddddddddddkkee; wherein “k" represents a cEt sugar moiety, “c” represents a 2’-MOE sugar moiety, and “d” represents a 2'-[TD-dcoxyribosyl sugar moiety. The intemucleoside linkage motif for tire modified oligonucleotides is (from 5" to 3‘): soossssssssssoos; wherein each “s” represents a phosphorothioate intemucleoside linkage, and each “o” represents a phosphodiester intemucleoside linkage. Each cytosine residue is a 5-methylcytosine.
Table 13 cEt gapmers containing 2 ’-MOE modifications with mixed PS/PO linkages complementary to human SNCA
The modified oligonucleotides in the table below are modified oligonucleotides with mixed PS/PO intemucleoside linkages. The modified oligonucleotides in the table below are 18 nucleosides in length, wherein the sugar motif for the modified oligonucleotides is (from 5’ to 3’): kkkddddddddddkeeee; wherein “k” represents a cEt sugar moiety, “e” represents a 2’-M0E sugar moiety, and “d” represents a 2 ’-P-D-deoxy ribosyl sugar moiety. The intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3’): soossssssssssooos; wherein each “s” represents a phosphorothioate intemucleoside linkage, and each "o” represents a phosphodiester intemucleoside linkage. Each cytosine residue is a 5-methylcytosine.
Table 14 cEt gapmers containing 2’-MOE modifications with mixed PS/PO linkages complementary to human SNCA
The modified oligonucleotides in the table below are modified oligonucleotides with mixed PS/PO intemucleoside linkages. The modified oligonucleotides in the table below are 18 nucleosides in length, wherein the sugar motif for the modified oligonucleotides is (from 5’ to 3’): ekkddddddddddkeeee; wherein “k” represents a cEt sugar
moiety, “e” represents a 2’-M0E sugar moiety, and “d” represents a 2'-|W-deoxyribosyl sugar moiety. The intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3’): soossssssssssssss; wherein each “s” represents a phosphorothioate intemucleoside linkage, and each “o” represents a phosphodiester intemucleoside linkage. Each cytosine residue is a 5-methylcytosine.
Table 15 cEt gapmers containing 2’-M0E modifications with mixed PS/PO linkages complementary to human SNCA
The modified oligonucleotides in the table below are modified oligonucleotides with mixed PS/PO intemucleoside linkages. The modified oligonucleotides in the table below are 18 nucleosides in length, wherein the sugar motif for the modified oligonucleotides is (from 5’ to 3’): kkkddddddddddkkeee; wherein “k” represents a cEt sugar moiety, “e” represents a 2’-MOE sugar moiety, and “d” represents a 2’-P-D-deoxyribosyl sugar moiety . The intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3’): soossssssssssooos; wherein each “s” represents a phosphorothioate intemucleoside linkage, and each “o” represents a phosphodiester intemucleoside linkage. Each cytosine residue is a 5-methylcytosine.
Table 16 cEt gapmers containing 2’-MOE modifications with mixed PS/PO linkages complementary to human SNCA
Example 8: Dose-dependent inhibition of human SNCA in SH-SY5Y cells by modified oligonucleotides, in vitro
Modified oligonucleotides selected from the example above were tested at various doses in SH-SY5Y cells. SH- SY5Y cells plated at a density of 20,000 cells per well were treated using electroporation with various concentrations of modified oligonucleotide as specified in the tables below. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and SNCA RNA levels were measured by quantitative real-time RT-PCR. Human primerprobe set hSNCA LTS00672 MGB (forward sequence TGGCAGAAGCAGCAGGAAA, designated herein as SEQ ID NO: 3339; reverse sequence TCCTTGGTTTTGGAGCCTACA. designated herein as SEQ ID NO: 3340; probe sequence CAAAAGAGGGTGTTCTC, designated herein as SEQ ID NO: 3341) was used to measure RNA levels as described above. SNCA RNA levels were nonnalized to total RNA content, as measured by RIBOGREEN®.
Reduction of SNCA RNA is presented in the tables below as percent SNCA RNA, relative to tire amount of SNCA RNA in untreated control cells (% UTC). The half maximal inhibitory concentration (IC50) of each modified oligonucleotide was calculated using a linear regression on a log/linear plot of the data in Excel and is also presented in the table below. Each table represents a separate experiment. Compound No. 1483842 was included in the following experiments as a benchmark.
Table 17
Dose-dependent reduction of human SNCA RNA in SH-SY5Y cells by modified oligonucleotides
Table 18 Dose-dependent reduction of human SNCA RNA in SH-SY5Y cells by modified oligonucleotides
Table 19
Dose-dependent reduction of human SNCA RNA in SH-SY5Y cells by modified oligonucleotides
Table 20
Dose-dependent reduction of human SNCA RNA in SH-SY5Y cells by modified oligonucleotides
Table 21
Dose-dependent reduction of human SNCA RNA in SH-SY5Y cells by modified oligonucleotides
Table 22
Dose-dependent reduction of human SNCA RNA in SH-SY5Y cells by modified oligonucleotides
Table 23
Dose-dependent reduction of human SNCA RNA in SH-SY5Y cells by modified oligonucleotides
Table 24
Dose-dependent reduction of human SNCA RNA in SH-SY5Y cells by modified oligonucleotides
Table 25 Dose-dependent reduction of human SNCA RNA in SH-SY5Y cells by modified oligonucleotides
Tabic 26
Dose-dependent reduction of human SNCA RNA in SH-SY5Y cells by modified oligonucleotides
Table 27
Dose-dependent reduction of human SNCA RNA in SH-SY5Y cells by modified oligonucleotides
Table 28
Dose-dependent reduction of human SNCA RNA in SH-SY5Y cells by modified oligonucleotides
Tabic 29
Dose-dependent reduction of human SNCA RNA in SH-SY5Y cells by modified oligonucleotides
Modified oligonucleotides selected from the example above were tested at various doses in SH-SY5Y cells. SH- SY5Y cells plated at a density of 20,000 cells per well were treated using electroporation with various concentrations of modified oligonucleotide as specified in the tables below. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and SNCA RNA levels were measured by quantitative real-time RT-PCR. Human SNCA primer-probe set RTS2621 (described herein above) was used to measure RNA levels as described above. SNCA RNA levels were normalized to total RNA content, as measured by RIBOGREEN®.
Reduction of SNCA RNA is presented in the tables below as percent SNCA RNA, relative to tire amount of SNCA RNA in untreated control cells (% UTC). The half maximal inhibitory concentration (IC50) of each modified oligonucleotide was calculated using a linear regression on a log/linear plot of the data in Excel and is also presented in the table below. Each table represents a separate experiment. Compound No. 1486339 was included in the following experiments as a benchmark.
Table 30 Dose-dependent reduction of human SNCA RNA in SH-SY5Y cells by modified oligonucleotides
Table 31
Dose-dependent reduction of human SNCA RNA in SH-SY5Y cells by modified oligonucleotides
Table 32
Dose-dependent reduction of human SNCA RNA in SH-SY5Y cells by modified oligonucleotides
Table 33
Dose-dependent reduction of human SNCA RNA in SH-SY5Y cells by modified oligonucleotides
Table 34
Dose-dependent reduction of human SNCA RNA in SH-SY5Y cells by modified oligonucleotides
Table 35 Dose-dependent reduction of human SNCA RNA in SH-SY5Y cells by modified oligonucleotides
Table 36
Dose-dependent reduction of human SNCA RNA in SH-SY5Y cells by modified oligonucleotides
Example 9: Design of modified oligonucleotides complementary to human SNCA RNA
Modified oligonucleotides complementary to a human SNCA RNA were designed as described in tire tables below.
“Start site” indicates the 5 ‘-most nucleoside to which the modified oligonucleotide is complementary' in the target nucleic acid sequence. “Stop site” indicates the 3 ’-most nucleoside to which tire modified oligonucleotide is complementary in the target nucleic acid sequence. Each modified oligonucleotide listed in the tables below is 100% complementary to SEQ ID NO: 1 (described herein above), or to SEQ ID NO: 2 (described herein above), or to both. ‘N/A’ indicates that the modified oligonucleotide is not 100% complementary' to that particular target nucleic acid sequence.
The modified oligonucleotides in the table below arc 5-10-5 MOE gapmers with uniform phosphorothioatc intcmuclcosidc linkages. The modified oligonucleotides in the table below arc 20 nucleosides in length, wherein the sugar motif for the modified oligonucleotides is (from 5 ’ to 3 ‘): eeeeeddddddddddeeeee; wherein each “e” represents a 2‘-M0E
sugar moiety and each “d” represents a 2'-|W-deoxyribosyl sugar moiety. The intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3’): sssssssssssssssssss; wherein each “s” represents a phosphorothioate intemucleoside linkage. Each cytosine residue is a 5-methylcytosine.
Table 37 5-10-5 MOE gapmers with uniform phosphorothioate linkages complementary to human SNCA
The modified oligonucleotides in the table below are 6-10-4 MOE gapmers with mixed PS/PO intemucleoside linkages. The modified oligonucleotides in the table below are 20 nucleosides in length, wherein the sugar motif for the modified oligonucleotides is (from 5’ to 3’): eeeeeeddddddddddeeee; wherein each “e” represents a 2’-M0E sugar moiety and each “d” represents a 2’-P-D-deoxyribosyl sugar moiety. The intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3’): sooooossssssssssoss; wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage. Each cytosine residue is a 5-methylcytosine.
Table 38
6-10-4 MOE gapmers with mixed PS/PO linkages complementary to human SNCA
The modified oligonucleotides in the table below are MOE gapmers with cEt modifications with mixed PS/PO intemucleoside linkages. The modified oligonucleotides in the table below are 20 nucleosides in length, wherein the sugar motif for the modified oligonucleotides is (from 5’ to 3 ’): eeeeeeddddddddddkkee; wherein each “e” represents a 2’-MOE sugar moiety, each “k” represents a cEt sugar moiety, and each “d” represents a 2 ’-P-D-deoxj ribosyl sugar moiety. The intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3’): sooooossssssssssoss; wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage. Each cytosine residue is a 5-methylcytosine.
Table 39
MOE gapmers with cEt modifications with mixed PS/PO linkages complementary to human SNCA
The modified oligonucleotides in the table below are 5-10-5 MOE gapmers with mixed intemucleoside linkages. The modified oligonucleotides in the table below are 20 nucleosides in length, wherein the sugar motif for the modified oligonucleotides is (from 5’ to 3’): eeeeeddddddddddeeeee; wherein each “e” represents a 2’-MOE sugar moiety and each “d” represents a 2’-p-D-deoxyribosyl sugar moiety. The intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3’): ssssszzzzssssssssss; wherein each “s” represents a phosphorothioate intemucleoside linkage and each “z” represents a mesyl phosphoramidate intemucleoside linkage. Each cytosine residue is a 5-methylcytosine.
Table 40
5-10-5 MOE gapmers with mixed intemucleoside linkages complementary to human SNCA
The modified oligonucleotides in the table below are 5-10-5 MOE gapmers with mixed intemucleoside linkages. The modified oligonucleotides in the table below are 20 nucleosides in length, wherein the sugar motif for the modified oligonucleotides is (from 5’ to 3’): eeeeeddddddddddeeeee; wherein each “e” represents a 2’-MOE sugar moiety and each “d” represents a 2’-P-D-deoxyribosyl sugar moiety. The intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3’): soooszzzzssssssooss; wherein each “s” represents a phosphorothioate intemucleoside linkage, each “z” represents a mesyl phosphoramidate intemucleoside linkage, and each “o” represents a phosphodiester intemucleoside linkage. Each cytosine residue is a 5-methylcytosine.
Table 41
5-10-5 MOE gapmers with mixed intemucleoside linkages complementary to human SNCA
The modified oligonucleotides in the table below are 5-10-5 MOE gapmers with mixed intemucleoside linkages. The modified oligonucleotides in tire table below are 20 nucleosides in length, wherein the sugar motif for tire modified oligonucleotides is (from 5’ to 3’): eeeeeddddddddddeeeee; wherein each“e” represents a 2’-MOE sugar moiety and each “d" represents a 2'-(>-D-dcoxvribosvl sugar moiety. The intemucleoside linkage motifs for the modified oligonucleotides are presented in the column labeled “Intemucleoside Linkages (5’ to 3’)” in the table below, wherein each “s’’ represents a phosphorothioate intemucleoside linkage, each “z” represents a mesyl phosphoramidate intemucleoside linkage, and each “o” represents a phosphodiester intemucleoside linkage. Each cytosine residue is a 5-methylcytosine.
Table 42
5-10-5 MOE gapmers with mixed intemucleoside linkages complementary to human SNCA
The modified oligonucleotides in the table below are MOE gapmers containing a 2’-p-D-deoxyxylosyl modification with mixed intemucleoside linkages. The modified oligonucleotides in the table below are 20 nucleosides in length, wherein the sugar motif for the modified oligonucleotides is (from 5 ‘ to 3’): eeeeed[bDdx]ddddddddeeeee; wherein
each “e” represents a 2’-M0E sugar moiety, each “d” represents a 2’-P-D-deoxyribosyl sugar moiety and each “[bDdx]” represents a 2’-P-D-deoxyxylosyl sugar moiety. The intemucleoside linkage motifs for the modified oligonucleotides are presented in the column labeled “Intemucleoside Linkages (5’ to 3’)” in the table below, wherein each “s” represents a phosphorothioate intemucleoside linkage, and each “o” represents a phosphodiester intemucleoside linkage. Each cytosine residue is a 5-methylcytosine.
Table 43
MOE gapmers containing a 2’-P-D-deoxyxylosyl modification with mixed intemucleoside linkages complementary to human SNCA
The modified oligonucleotides in the table below are MOE gapmers containing a 2’-[3-D-deoxyxylosyl modification with mixed intemucleoside linkages. The modified oligonucleotides in the table below are 20 nucleosides in length, wherein the sugar motif for the modified oligonucleotides is (from 5’ to 3’): eeeeedd[bDdx]dddddddeeeee; wherein each “e” represents a 2’-MOE sugar moiety, each “d” represents a 2’-P-D-deoxyribosyl sugar moiety and each “[bDdx]” represents a 2’-P-D-deoxyxylosyl sugar moiety. The intemucleoside linkage motifs for the modified oligonucleotides are presented in the column labeled “Intemucleoside Linkages (5’ to 3’)” in the table below, wherein each “s” represents a phosphorothioate intemucleoside linkage, and each “o” represents a phosphodiester intemucleoside linkage. Each cytosine residue is a 5-methylcytosine.
Table 44
MOE gapmers containing a 2’-P-D-deoxyxylosyl modification with mixed intemucleoside linkages complementary to human SNCA
The modified oligonucleotides in the table below are MOE gapmers containing a 2’-a-L-deoxyribosyl modification with mixed intemucleoside linkages. The modified oligonucleotides in the table below are 20 nucleosides in length, wherein the sugar motif for the modified oligonucleotides is (from 5’ to 3 ’): eeeeed[aLdr]ddddddddeeeee; wherein each “e” represents a 2’-MOE sugar moiety, each “d” represents a 2’-P-D-deoxyribosyl sugar moiety, and each “[aLdr]” represents a 2’-a-L-deoxyribosyl sugar moiety'. The intemucleoside linkage motifs for the modified oligonucleotides are presented in the column labeled “Intemucleoside Linkages (5’ to 3’)” in the table below, wherein each “s” represents a
phosphorothioate intemucleoside linkage, and each “o” represents a phosphodiester intemucleoside linkage. Each cytosine residue is a 5-methylcytosine.
Table 45
MOE gapmers containing a 2’-a-L-deoxyribosyl modification with mixed intemucleoside linkages complementary to human SNCA
The modified oligonucleotides in the table below are MOE gapmers containing a 2’-a-L-deoxyribosyl modification with mixed intemucleoside linkages. The modified oligonucleotides in the table below are 20 nucleosides in length, wherein the sugar motif for the modified oligonucleotides is (from 5’ to 3 ’): eeeeedd[aLdr]dddddddeeeee; wherein each “e” represents a 2’-MOE sugar moiety, each “d-’ represents a 2’-P-D-deoxyribosyl sugar moiety, and each “[aLdr]” represents a 2’-a-L-deoxyribosyl sugar moiety. The intemucleoside linkage motifs for the modified oligonucleotides are presented in the column labeled “Intemucleoside Linkages (5’ to 3’)” in the table below, wherein each “s” represents a phosphorothioate intemucleoside linkage, and each “o” represents a phosphodiester intemucleoside linkage. Each cytosine residue is a 5-methylcytosine.
Table 46
MOE gapmers containing a 2’-a-L-deoxyribosyl modification with mixed intemucleoside linkages complementary to human SNCA
The modified oligonucleotide in the table below is a MOE gapmer containing cEt modifications with mixed intemucleoside linkages. The modified oligonucleotide in the table below are 17 nucleosides in length, wherein the sugar motif for tire modified oligonucleotide is (from 5‘ to 3’): cckkdddddddddkkcc; wherein each “c” represents a 2‘-MOE sugar moiety’, each “k” represents a cEt sugar moiety , and each “d” represents a 2 ’-p-D-deoxy ribosy 1 sugar moiety’. The intemucleoside linkage motif for the modified oligonucleotide is (from 5’ to 3’): sooosszzsssssoss; wherein each “s” represents a phosphorothioate intemucleoside linkage, each “o” represents a phosphodiester intemucleoside linkage, and each “z” represents a mesyl phosphoramidate intemucleoside linkage. Each cytosine residue is a 5-methylcytosine.
Table 47
MOE gapmer containing cEt modifications with mixed linkages complementary to human SNCA
“Start site” indicates the 5 ’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. “Stop site” indicates the 3 ’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. The modified oligonucleotides listed in the table below are complementary to SEQ ID NO: 3 (described herein above), or to SEQ ID NO: 4 (Ensembl ID ENST00000618500.4, Ensembl release 106 - Apr 2022). ‘N/A’ indicates that the modified oligonucleotide is not 100% complementaiy to that particular target nucleic acid sequence.
The modified oligonucleotides in the table below are 6-10-4 MOE gapmers with mixed PS/PO intemucleoside linkages. The modified oligonucleotides in the table below are 20 nucleosides in length, wherein the sugar motif for the modified oligonucleotides is (from 5’ to 3’): eeeeeeddddddddddeeee: wherein each “e” represents a 2’-M0E sugar moiety and each “d” represents a 2’-P-D-deoxyribosyl sugar moiety . The intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3’): sooooossssssssssoss; wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage. Each cytosine residue is a 5-methylcytosine.
Table 48
6-10-4 MOE gapmers with mixed PS/PO linkages complementary to human SNCA
Example 10: Activity of modified oligonucleotides complementary to human SNCA in transgenic mice, 2-weeks, single dose
Modified oligonucleotides described above were tested in the FVB/N-Tg(SNCA)Mjfa transgenic mouse model expressing wildtype full-length SNCA gene directed by the human SNCA promotor/enliancer regions on the B AC transgene (J AX strain 018442).
The SNCA transgenic mice were divided into groups of 4 mice each. Each mouse received a single ICV bolus of 300 pg of modified oligonucleotide. A group of 4 mice received a single ICV bolus with PBS as a negative control.
Two weeks post treatment, mice were sacrificed and RNA was extracted from cortical brain tissue and hippocampus for real-time PCR analysis of measurement of mRNA expression of SNCA using primer probe set hSNCA_LTS00672_MGB (forward sequence TGGCAGAAGCAGCAGGAAA, designated herein as SEQ ID NO: 3339; reverse sequence TCCTTGGTTTTGGAGCCTACA, designated herein as SEQ ID NO: 3340; probe sequence CAAAAGAGGGTGTTCTC, designated herein as SEQ ID NO: 3341). SNCA RNA levels were normalized to mouse
Ppia. Mouse Ppia was amplified using primer probe set m_cyclo24 (forward sequence TCGCCGCTTGCTGCA. designated herein as SEQ ID NO: 3342; reverse sequence ATCGGCCGTGATGTCGA, designated herein as SEQ ID NO: 3343; probe sequence CCATGGTCAACCCCACCGTGTTC, designated herein as SEQ ID NO: 3344). Results are presented as percent human SNCA RNA relative to the amount of human SNCA RNA in PBS treated animals. (% control).
Table 49
Reduction of human SNCA RNA in SNCA transgenic mice at a dose of 300pg
J indicates fewer than 4 samples available
Example 11: Activity of modified oligonucleotides complementary to human SNCA in transgenic mice, 8-weeks, single dose
Modified oligonucleotides described above were tested in the FVB/N-Tg(SNCA)Mjfa transgenic mouse model described herein above.
The SNCA transgenic mice were divided into groups of 4 mice each. Each mouse received a single ICV bolus of 3OOpg of modified oligonucleotide. A group of 4 mice received a single ICV bolus with PBS as a negative control.
Eight weeks post treatment, mice were sacrificed and RNA was extracted from cortical brain tissue and hippocampus for real-time PCR analysis of measurement of mRNA expression of SNCA using primer probe set hSNCA_LTS00672_MGB (described herein above). SNCA RNA levels were normalized to mouse Ppia. Mouse Ppia was amplified using primer probe set m_cyclo24 (described herein above). Results are presented as percent human SNCA RNA relative to tire amount of SNCA RNA in PBS treated animals, (% control).
Compound 827606 is previously described in WO 2019/164562. Compound 827606 consists of the sequence (from 5’ to 3 ’): ACAGATATTTTTGTTCTGCC, designated herein as SEQ ID NO: 3318. The sugar motif for Compound No. 827606 is (from 5’ to 3‘): eeeeeddddddddddeeeee; wherein each “d" represents a 2’-p-D-deoxyribosyl sugar moiety’, and each “e’‘ represents a 2’-MOE sugar moiety . The intemucleoside linkage motif for Compound No. 827606 is (from 5’ to 3’): sossssssssssssssoss; wherein each “s” represents a phosphorothioatc intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage. Each cytosine nucleobase in Compound No. 827606 is a 5-methylcytosine.
Compound 763391 is previously described in WO 2019/164562. Compound 763391 consists of the sequence (from 5’ to 3 ’): GTTTTCATCAATATCTGCAA, designated herein as SEQ ID NO: 3316. The sugar motif for Compound No. 763391 is (from 5’ to 3’): eeeeeddddddddddeeeee; wherein each “d" represents a 2’-p-D-deoxyribosyl sugar moiety, and each “e” represents a 2’-MOE sugar moiety. The intemucleoside linkage motif for Compound No.
763391 is (from 5’ to 3’): sooosssssssssssooss; wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage. Each cytosine nucleobase in Compound No. 763391 is a 5-methylcytosine.
Compound 827599 is described herein above.
Table 50
Reduction of human SNCA RNA in SNCA transgenic mice at a dose of 300pg
J indicates fewer than 4 samples available
Table 51
Reduction of human SNC A RNA in SNCA transgenic mice at a dose of 300pg
Table 55
Reduction of human SNCA RNA in SNCA transgenic mice at a dose of 300 pg
J indicates fewer than 4 samples available
Example 12: Activity of modified oligonucleotides complementary to human SNCA in transgenic mice, 16-weeks, single dose
Modified oligonucleotides described above were tested in the FVB/N-Tg(SNCA)Mjfa transgenic mouse model described herein above.
The SNCA transgenic mice were divided into groups of 4 mice each. Each mouse received a single ICV bolus of 300 pg of modified oligonucleotide. A group of 4 mice received a single ICV bolus with PBS as a negative control.
Sixteen weeks post treatment, mice were sacrificed, and RNA was extracted from cortical brain tissue for realtime PCR analysis of measurement of mRNA expression of SNCA using primer probe set hSNCA_LTS00672_MGB (described herein above). SNCA RNA levels were normalized to mouse Ppia. Mouse Ppia was amplified using primer probe set m_cyclo24 (described herein above). Results are presented as percent human SNCA RNA relative to tire amount of SNCA RNA in PBS treated animals, (% control). “N.C.” represents datapoints that were not calculated.
Compound 827714 is previously described in WO 2019/164562. Compound 827714 consists of tire sequence (from 5’ to 3 ’): GTTTTCATCAATATCTGCAA, designated herein as SEQ ID NO: 3316. The sugar motif for Compound No. 827714 is (from 5’ to 3‘): eeeeeddddddddddeeeee; wherein each “d" represents a 2’-p-D-deoxyribosyl sugar moiety, and each “e’‘ represents a 2’-M0E sugar moiety. The intemucleoside linkage motif for Compound No. 827714 is (from 5’ to 3’): soossssssssssssooss; wherein each “s’- represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage. Each cytosine nucleobase in Compound No. 827714 is a 5-mcthylcytosinc.
Compound 762838 is previously described in WO 2019/164562. Compound 762838 consists of the sequence (from 5’ to 3’): ATGAATTCCTTTACACCACA, designated herein as SEQ ID NO: 3315. The sugar motif for
Compound No. 762838 is (from 5’ to 3’): eeeeeddddddddddeeeee; wherein each ‘ d” represents a 2’-P-D-deoxyribosyl sugar moiety, and each “e” represents a 2’-M0E sugar moiety. The intemucleoside linkage motif for Compound No. 762838 is (from 5’ to 3’): sooosssssssssssooss; wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage. Each cytosine nucleobase in Compound No. 762838 is a 5-methylcytosine.
Compound 763033 is previously described in WO 2019/164562. Compound 763033 consists of the sequence (from 5’ to 3’): GCTCAGTATTCTTTGCATTA, designated herein as SEQ ID NO: 3320. The sugar motif for Compound No. 763033 is (from 5’ to 3’): eeeeeddddddddddeeeee; wherein each ‘ d” represents a 2’-P-D-deoxyribosyl sugar moiety, and each “e” represents a 2’-MOE sugar moiety. The intemucleoside linkage motif for Compound No. 763033 is (from 5’ to 3’): sooosssssssssssooss; wherein each “s” represents a phosphorothioate intemucleoside linkage and each "o” represents a phosphodiester intemucleoside linkage. Each cytosine nucleobase in Compound No. 763033 is a 5-methylcytosine.
Compound 763032 is previously described in WO 2019/164562. Compound 763032 consists of the sequence (from 5’ to 3 ’): CTCAGTATTCTTTGCATTAG, designated herein as SEQ ID NO: 3317. The sugar motif for Compound No. 763032 is (from 5’ to 3’): eeeeeddddddddddeeeee; wherein each “d” represents a 2’-p-D-deoxyribosyl sugar moiety, and each “e” represents a 2’-MOE sugar moiety. The intemucleoside linkage motif for Compound No. 763032 is (from 5’ to 3’): sooosssssssssssooss; wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage. Each cytosine nucleobase in Compound No. 763032 is a 5-methylcytosine.
Compound 763364, Compound 763391, Compound 827599, Compound 827606, and Compound 789291 are described herein above.
Table 56 Reduction of human SNCA RNA in SNCA transgenic mice at a dose of 300pg
Table 57
Reduction of human SNCA RNA in SNCA transgenic mice at a dose of 300pg
Table 58
Reduction of human SNCA RNA in SNCA transgenic mice at a dose of 300 pg
Table 59
Reduction of human SNCA RNA in SNCA transgenic mice at a dose of 300 pg
J indicates fewer than 4 samples available
Example 13: Duration of Action study of modified oligonucleotides complementary to human SNCA in transgenic mice, single dose
Modified oligonucleotides described above were tested in the FVB/N-Tg(SNCA)Mjfa transgenic mouse model described herein above.
The SNCA transgenic mice were divided into groups of 4 mice each. Each mouse received a single ICV bolus of 300 pg of modified oligonucleotide. A group of 4 mice received a single ICV bolus with PBS as a negative control.
Mice were sacrificed at various timepoints as indicated in the table below and RNA was extracted from cortical brain tissue for real-time PCR analysis of measurement of mRNA expression of SNCA using primer probe set hSNCA_LTS00672_MGB (described herein above). SNCA RNA levels were normalized to mouse Ppia. Mouse Ppia was amplified using primer probe set m_cyclo24 (described herein above). Results are presented as percent human SNCA RNA relative to the amount of SNCA RNA in PBS treated animals, (% control).
Compound 827599 is a comparator compound and is described herein above.
Table 60 Reduction of human SNCA RNA in SNCA transgenic mice at a dose of 300 pg
indicates fewer than 4 samples available
Table 61
Reduction of human SNCA RNA in SNCA transgenic mice at a dose of 300 pg
Example 14: Potency of modified oligonucleotides complementary to human SNCA in transgenic mice, 12-weeks, multiple dose
Modified oligonucleotides described above were tested in the FVB/N-Tg(SNCA)Mjfa transgenic mouse model described herein above.
Treatment The SNCA transgenic mice were divided into groups of 4 mice each. Each mouse received a single ICV bolus of modified oligonucleotide at doses indicated in the tables below. A group of 4 mice received a single ICV bolus with PBS as a negative control.
RNA analysis
12 weeks post treatment, mice were sacrificed, and RNA was extracted from cortical brain tissue for quantitative real-time RTPCR analysis of RNA expression of SNCA using human primer probe set hSNCA_LTS00672_MGB (described herein above). SNCA RNA levels were normalized to mouse Ppia. Mouse Ppia was amplified using primer probe set m_cyclo24 (described herein above). Results are presented as percent human SNCA RNA relative to the amount of SNCA RNA in PBS treated animals, (% control).
The half maximal effective dose (ED50) of each modified oligonucleotide was calculated using GraphPad Prism 7 software (GraphPad Software. San Diego, CA).
Compound 827599 is a comparator compound and is described herein above.
Table 62 Dose-dependent percent reduction of human SNCA mRNA in transgenic mice
J indicates fewer than 4 samples available
Table 63
Dose-dependent percent reduction of human SNCA mRNA in transgenic mice
J indicates fewer than 4 samples available
Example 15: Activity of modified oligonucleotides complementary to human SNCA in transgenic mice, 24-weeks, single dose
Modified oligonucleotides described above were tested in the FVB/N-Tg(SNCA)Mjfa transgenic mouse model described herein above.
The SNCA transgenic mice were divided into groups of 4 mice each. Each mouse received a single ICV bolus of 300 pg of modified oligonucleotide. A group of 4 mice received a single ICV bolus with PBS as a negative control.
Twenty -four weeks post treatment, mice were sacrificed, and RNA was extracted from cortical brain tissue for real-time PCR analysis of measurement of mRNA expression of SNCA using primer probe set hSNCA_LTS00672_MGB (described herein above). SNCA RNA levels were normalized to mouse Ppia. Mouse Ppia was amplified using primer probe set m_cyclo24 (described herein above). Results are presented as percent human SNCA RNA relative to tire amount of SNCA RNA in PBS treated animals, (% control).
Compound 763032 is previously described in WO 2019/164562. Compound 763032 consists of the sequence (from 5’ to 3 ’): CTCAGTATTCTTTGCATTAG, designated herein as SEQ ID NO: 3317. The sugar motif for Compound No. 763032 is (from 5’ to 3‘): eeeeeddddddddddeeeee: wherein each “d” represents a 2’-p-D-deoxyribosyl sugar moiety, and each “e‘‘ represents a 2‘-MOE sugar moiety. The intemucleoside linkage motif for Compound No. 763032 is (from 5’ to 3’): sooosssssssssssooss; wherein each “s" represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage. Each cytosine nucleobase in Compound No. 763032 is a 5-methylcytosine.
Compound 827599 and compound 763364 are described herein above.
Table 64
Reduction of human SNCA RNA in SNCA transgenic mice at a dose of 300 pg
Example 16: Design of modified oligonucleotides complementary to human SNCA RNA
Modified oligonucleotide complementary to a human SNCA RNA was designed as described in the table below. “Start site” indicates the 5 ’-most nucleoside to which the modified oligonucleotide is complementary' in the target nucleic acid sequence. “Stop site” indicates the 3 ’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. The modified oligonucleotide listed in the table below is 100% complementary to SEQ ID NO: 1 (described herein above), or to SEQ ID NO: 2 (described herein above), or to both.
The modified oligonucleotide in the table below is a 5-10-5 MOE gapmer with mixed PS/PO intcmuclcosidc linkages. The modified oligonucleotide is 20 nucleosides in length, wherein the sugar motif for the modified oligonucleotides is (from 5’ to 3’): eeeeeddddddddddeeeee; wherein each “e” represents a 2’-MOE sugar moiety’ and each
“d” represents a 2’-P-D-deoxyribosyl sugar moiety. The intemucleoside linkage motif for the modified oligonucleotide is presented in the column labeled “Intemucleoside Linkages (5’ to 3’)” in the table below, wherein each “s” represents a phosphorothioate intemucleoside linkage and each “o” represents a phosphodiester intemucleoside linkage. Each cytosine residue is a 5-methylcytosine.
Table 65
5-10-5 MOE gapmers with mixed PS/PO intemucleoside linkages complementary to human SNCA
Example 17: Activity of modified oligonucleotides complementary to human SNCA in transgenic mice, 2-weeks, single dose
Modified oligonucleotides described above were tested in the FVB/N-Tg(SNCA)Mjfa transgenic mouse model described herein above.
The SNCA transgenic mice were divided into groups of 4 mice each. Each mouse received a single ICV bolus of 300 pg of modified oligonucleotide. A group of 4 mice received a single ICV bolus with PBS as a negative control.
Two weeks post treatment, mice were sacrificed and RNA was extracted from cortical brain tissue and hippocampus for real-time PCR analysis of measurement of mRNA expression of SNCA using primer probe set hSNCA_LTS00672_MGB (described herein above). SNCA RNA levels were normalized to mouse Ppia. Mouse Ppia was amplified using primer probe set m_cyclo24 (described herein above). Results are presented as percent human SNCA RNA relative to the amount of human SNCA RNA in PBS treated animals, (% control).
Compound 827599 is described herein above.
Table 66
Reduction of human SNCA RNA in SNCA transgenic mice at a dose of 300pg
Example 18: Activity of modified oligonucleotides complementary to human SNCA in transgenic mice, 8-weeks, single dose
Modified oligonucleotides described above were tested in the FVB/N-Tg(SNCA)Mjfa transgenic mouse model described herein above.
The SNCA transgenic mice were divided into groups of 4 mice each. Each mouse received a single ICV bolus of 300pg of modified oligonucleotide. A group of 4 mice received a single ICV bolus with PBS as a negative control.
Eight weeks post treatment, mice were sacrificed and RNA was extracted from cortical brain tissue and hippocampus for real-time PCR analysis of measurement of mRNA expression of SNCA using primer probe set hSNCA_LTS00672_MGB (described herein above). SNCA RNA levels were normalized to mouse Ppia. Mouse Ppia was amplified using primer probe set m_cyclo24 (described herein above). Results are presented as percent human SNCA RNA relative to the amount of SNCA RNA in PBS treated animals, (% control).
Compound 827599 is described herein above.
Table 67
Reduction of human SNCA RNA in SNCA transgenic mice at a dose of 300pg
Example 19: Activity of modified oligonucleotides complementary to human SNCA in transgenic mice, 2-weeks, single dose
Modified oligonucleotides described above were tested in the FVB/N-Tg(SNCA)Mjfa transgenic mouse model described herein above.
The SNCA transgenic mice were divided into groups of 4 mice each. Each mouse received a single ICV bolus of 3OOpg of modified oligonucleotide. A group of 4 mice received a single ICV bolus with PBS as a negative control.
Two weeks post treatment, mice were sacrificed and RNA was extracted from cortical brain tissue and hippocampus for real-time PCR analysis of measurement of mRNA expression of SNCA using primer probe set hSNCA_LTS00672_MGB (described herein above). SNCA RNA levels were normalized to mouse Ppia. Mouse Ppia was amplified using primer probe set m_cyclo24 (described herein above). Results are presented as percent human SNCA RNA relative to the amount of human SNCA RNA in PBS treated animals, (% control).
Table 68
Reduction of human SNCA RNA in SNCA transgenic mice at a dose of 300pg
Example 20: Activity of modified oligonucleotides complementary to human SNCA in transgenic mice, 2-weeks, single dose
Modified oligonucleotides described above were tested in the FVB/N-Tg(SNCA)Mjfa transgenic mouse model described herein above.
The SNCA transgenic mice were divided into groups of 2-4 mice each. Each mouse received a single TCV bolus of 30()|ig of modified oligonucleotide. A group of 4 mice received a single ICV bolus with PBS as a negative control.
Two weeks post treatment, mice were sacrificed, and RNA was extracted from cortical brain tissue for quantitative real-time RT-PCR analysis of RNA expression of SNCA using human primer probe set hSNCA_LTS00672_MGB (described herein above). SNCA RNA levels were normalized to mouse Ppia. Mouse Ppia was amplified using primer probe set m_cyclo24 (described herein above). Results are presented as percent human SNCA RNA relative to the amount of SNCA RNA in PBS treated animals. (% control). Each experiment is identified in separate tables below.
Table 69
Reduction of human SNCA mRNA in transgenic mice
Table 70
Reduction of human SNCA mRNA in transgenic mice
Example 21: Duration of Action study of a modified oligonucleotide complementary to human SNCA in transgenic mice
FIG. 1 illustrates tire duration of action in the CNS of an exemplary modified oligonucleotide disclosed above comprising mesyl phosphoramidate intemucleoside linkage compared to a modified oligonucleotide without the mesyl phosphoramidate intemucleoside linkage modification. In particular. FIG. 1 illustrates the duration of action for Compound Nos. 1616357 (labeled as MsPA ASO) and 827599 (labeled as ASO). The duration of action study was carried out to 32 w eeks post injection. As show n by FIG. 1, Compound No. 1616357 maintained a higher percentage of SNCA mRNA inhibition (i.e., a lower percentage of SNCA mRNA) up to 32 weeks compared to Compound No. 827599. The column labeled “Table” in the table below indicates the source for each datapoint taken from the examples herein above. If multiple experiments were used, the average of the values is presented in the table below. MsPA ASO: antisense oligonucleotide (ASO) with mesyl phosphoramidate intemucleoside linkage (MsPA) modification.
Table 71
Reduction of human SNCA RNA in SNCA transgenic mice at a dose of 300 pg
FIG. 2 illustrates the concentration of Compound No. 1616357 (labeled as MsPA ASO) in the cortex compared to Compound No. 827599 (labeled as ASO). Compound concentration in tissue is expressed in pg/g. The specific compound concentrations are listed in Table 72.
Table 72
Concentration of modified oligonucleotide in Cortex in SNCA transgenic mice at a dose of 300 pg
FTG. 3 illustrates the concentration of an exemplary modified oligonucleotide disclosed above comprising mesyl phosphoramidate intemucleoside linkage (labeled as MsPA ASO) in the cortex compared to a modified oligonucleotide without the mesyl phosphoramidate intemucleoside linkage modification (labeled as ASO).
Example 22: Potency of modified oligonucleotides complementary to human SNCA RNA in human SNCA transgenic mice, 12-weeks
The modified oligonucleotides described above were tested in the FVB/N-Tg(SNCA)Mjfa transgenic mouse model described herein above.
The SNCA transgenic mice were divided into groups of 4 mice each. Each mouse received a single ICV bolus of modified oligonucleotide at various doses indicated in the table below. A group of 4 mice received a single ICV bolus of PBS as a negative control.
Twelve weeks post treatment, mice were sacrificed, and RNA was extracted from cortical brain tissue for RT- PCR analysis to measure amount of SNCA RNA using human primer probe set hSNCA_LTS00672_MGB (described herein above). SNCA RNA levels were normalized to mouse Ppia. Mouse Ppia was amplified using primer probe set m cyclo24 (described herein above). Results are presented as percent human SNCA RNA relative to the amount of SNCA RNA in PBS treated animals, (% control).
The half maximal effective dose (ED?o) of each modified oligonucleotide was calculated using GraphPad Prism 10 software (GraphPad Software. San Diego, CA).
Table 73
Dosc-dcpcndcnt reduction of human SNCA mRNA in human SNCA transgenic mice