EP4658808A2 - Test zur vorhersage der aggressivität von cercospora beticola in beta-vulgaris-varianten - Google Patents
Test zur vorhersage der aggressivität von cercospora beticola in beta-vulgaris-variantenInfo
- Publication number
- EP4658808A2 EP4658808A2 EP24711621.3A EP24711621A EP4658808A2 EP 4658808 A2 EP4658808 A2 EP 4658808A2 EP 24711621 A EP24711621 A EP 24711621A EP 4658808 A2 EP4658808 A2 EP 4658808A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- beticola
- seq
- sample
- sequence
- strain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Definitions
- TECHNICAL FIELD The present invention relates to the field of determining whether at least one virulent Cercospora beticola strain is present in a sample of plant material, wherein a C. beticola strain is considered to be virulent if it is able to overcome the resistance conferred to a plant of the genus Beta by the resistance gene BvCR4.
- BACKGROUND Cercospora leaf spot disease is one of the most important, globally prevalent leaf diseases of different plants including the species Beta vulgaris and Spinacia oleracea. It is caused by the fungus Cercospora beticola. Plants infested by this disease typically form small, relatively round leaf spots (2–3 mm) that are light gray in the middle and are surrounded by a red-brown border.
- Indirect control of Cercospora beticola is done via the selection of beet cultivars with healthy leaves and cultivation of the beets with at least a 3-year crop rotation. Markedly better control of the infestation may be achieved with a combination of resistant cultivars. Less susceptible Cercospora-resistant beet cultivars have been offered on the market since 2000 (Steinschreiben, 1997). These cultivars are furnished with a quantitative resistance to Cercospora beticola. The resistance of these cultivars is based upon several genes and is quantitatively passed down, wherein the exact number of the genes that are responsible for the resistance is not known; see Weiland and Koch, 2004.
- the aim of the present invention therefore consists in the provision of means to determine whether a virulent C.
- beticola strain is present in a sample, e.g. a plant sample from a given field.
- One or more marker sequences can be such means and can be used to detect a virulent C. beticola strain in a sample which is able to overcome the resistance conferred by the sugar beet resistance gene BvCR4.
- Such one or more marker sequences can also be used to determine whether C. beticola is the disease-causing microorganism in a sample, e.g. plant sample from a given field.
- the present invention further aims at providing an assay method which allows to detect differences in the genomes of the C. beticola strains present in the sample which in turn can be used to detect and predict the ability of local Cercospora populations to be virulent towards BvCR4.
- the aim is also to provide oligonucleotide sequences which can be used as primers in these methods.
- a further aim of the invention is to provide methods to deal with the presence of such virulent C. beticola strains, which for example include (further) application of fungicides on top of the growing crops, the inclusion of further phytosanitary steps in preparation of the coming cropping season, the application of alternative cropping schemes or the switch to a different cultivar, the use of further fungicide applications as preparation for the next sowing. SOLUTION TO THE PROBLEM
- the marker is detecting a) one or more highly diagnostic SNP alleles on chromosome 1 of C. beticola which is tightly linked to virulence of at least one C. beticola strain, or b) one or more deletion of genomic sequence on chromosome 1 of C. beticola in the genome of at least one virulent fungal C. beticola strain which is tightly linked to virulence of C. beticola, and thereby allows to identify a virulent C. beticola strain.
- the marker is also used to determine whether at least one C.
- the one or more highly diagnostic SNP allele and/or the one or more deletion is located on chromosome 1 of C. beticola within a mappable region of an interval which corresponds to regions on chromosome 1 of the reference genome of C. beticola strain CB_CbHevensen-1_hq-v2 which is spanning the sequence between positions 4,058,174 bp and 4,113,144 bp, preferably the sequence between positions 4,085,502 bp and 4,109,180 bp.
- the one or more highly diagnostic SNP allele and/or the one or more deletion which is detected by the marker is located on chromosome 1 of C. beticola within a mappable region of an interval which corresponds to regions in the reference genome of C. beticola strain CB_CbHevensen-1_hq-v2 which is spanning the sequence between positions 4,087,634 bp and 4,094,364 bp.
- the one or more highly diagnostic SNP allele and/or the one or more deletion is located on chromosome 1 of C. beticola within the genomic sequence of the AvrCR4 gene of C.
- one or more highly diagnostic SNP allele and/or the one or more deletion is located on chromosome 1 of C. beticola within the genomic sequence of the AvrCR4 gene of C.
- the method also comprises the determination by marker whether at least one C. beticola strain is present in the sample.
- the sample is selected from the group comprising one or more soil sample, one or more sample of plant material taken from one or more plants growing in a field, or one or more DNA sample extracted from one or more soil sample or from one or more sample of plant material taken from one or more plants growing in a field.
- the one or more soil sample is taken from one or more fields where plants of the genus Beta are grown, or wherein the one or more sample of plant material is taken from one more or more plant of the genus Beta growing in one or more fields. 245761.000234
- the method further comprises the step of extracting DNA, preferably genomic DNA, from the C. beticola strains present in the one or more samples.
- beticola strain is able to overcome the resistance conferred to plants of the genus Beta by the resistance gene BvCR4, said method comprising the steps of (a) planting C. beticola-resistant plants of the genus Beta carrying the resistance gene BvCR4 in a field, (b) prior to or after the planting of step (a) analyze one or more samples from that field for the presence of one or more virulent strains of C.
- the at least one marker of the present invention is used for the identification of one or more virulent C. beticola strains in a sample, wherein the one or more C.
- beticola strain is able to overcome the resistance conferred to plants of the genus Beta by the resistance gene BvCR4 on the basis of differences in the genomic DNA on chromosome 1 of C. beticola, preferably on the basis of one or more highly diagnostic SNP allele and/or one or more deletion, wherein the one or more highly diagnostic SNP allele and/or the one or more deletion is located on chromosome 1 of C. beticola within a mappable region of an interval which corresponds to regions on chromosome 1 of the reference genome of C.
- beticola strain CB_CbHevensen-1_hq-v2 which is spanning the sequence between positions 4,058,174 bp and 4,113,144 bp, preferably the sequence between positions 4,085,502 bp and 4,109,180 bp, preferably located on chromosome 1 of C. beticola within a mappable region of an interval which corresponds to regions in the reference genome of C. beticola strain CB_CbHevensen-1_hq-v2 which is spanning the sequence between positions 4,087,634 bp and 4,094,364 bp, more preferably located on chromosome 1 of C. beticola within the genomic sequence of the AvrCR4 gene of C.
- avirulent haplotype of the gene AvrCR4 which is known to be necessary for full functionality of the C. beticola resistance mediated by BvCR4 is provided as SEQ ID NO: 12.
- a set of at least two, preferable three, oligonucleotides suitable for use as primers in a PCR which are able to hybridize to the genomic sequence of chromosome 1 of C. beticola and which are able to identify the haplotype of at least one C.
- beticola in a sample which is characterized by (a) one or more highly diagnostic SNP alleles which is tightly linked to virulence of at least one C. beticola strain, or (b) one or more deletion of genomic sequence in the genome of at least one virulent fungal C. beticola strain which is tightly linked to virulence of C. beticola, and thereby allow to identify in a sample at least one virulent C. beticola strain which is able to overcome the resistance conferred to plants of the genus Beta by the resistance gene BvCR4.
- the set of oligonucleotides is a set of two oligonucleotides suitable for use as primer in a PCR which are able to identify the haplotype of at least one C. beticola in a sample which is characterized by (a) one or more highly diagnostic SNP alleles which are tightly linked to virulence of at least one C. beticola strain, or (b) one or more deletion of genomic sequence in the genome of at least one virulent fungal C. beticola strain which is tightly linked to virulence of C. beticola, and thereby allow to identify in a sample at least one virulent C.
- the set of oligonucleotides is a set of three oligonucleotides suitable for use as primer in a PCR involving two forward primers and a reverse primer wherein each primer has a different nucleotide sequence and wherein the reverse primer and only one of the two forward primers are able to identify the haplotype of at least one C. beticola in a sample which is characterized by (a) one or more highly diagnostic SNP alleles which are tightly linked to virulence of at least one C.
- Figure 1 (Fig. 1): Histogram of the count of the rating of the severity of Cercospora leaf spot disease on one of the sugar beet varieties carrying BvCR4 after inoculation with 56 Cercospora isolates collected from infection hot spots of two naturally infested test locations in Switzerland.
- allele refers to a nucleic acid sequence variant at a specific location, such as an allele of a single nucleotide polymorphism. Generally, an allele can be understood as any one of two or more genes and/or loci that may occur alternatively at a given site on a chromosome. Alleles may occur in pairs, or there may be multiple alleles affecting the expression (phenotype) of a particular trait.
- “Capable of being detected” refers to the ability of a particular DNA molecule, segment or sequence to be detected in a sample, such as by amplification and determining its presence, size or sequence such as by DNA sequence analysis, and/or binding of a probe to the target DNA molecule, segment or sequence.
- the genus Cercospora encompasses various species, e.g., the species Cercospora arachidicola, Cercospora ariminiensis, Cercospora asparagi, Cercospora bertoreae, Cercospora beticola, Cercospora bizzozeriana, Cercospora canescens, Cercospora carotae, Cercospora chenopodii, Cercospora cistinearum, Cercospora cladosporioides, Cercospora diazu, Cercospora dulcamarae, Cercospora erysimi, Cercospora hayii, Cercospora kikuchii, Cercospora malvacearum, Cercospora malvicola, Cercospora medicaginis, Cercospora oryzaem, Cercospora per sonata, Cercospora plantaginis, Cercospora ricinella, Cercospora setariae, Cercospora unam
- a “virulent Cercospora beticola strain” is able to overcome the major resistance gene BvCR4 that confers to a plant of the genus Beta, preferably to sugar beet plants, a high level of resistance to Cercospora leaf spot disease caused by the pathogen C. beticola. Such virulent Cercospora beticola strains cannot be controlled by this resistance gene alone.
- co-dominant marker refers to a marker for which both alleles are expressed when co-occurring in an individual. Therefore, with co-dominant markers, heterozygotes can be distinguished from homozygotes, allowing the determination of genotypes and allele frequencies at loci. With co-dominant markers each allele of a marker can be clearly discriminated from the other resulting in a clear separation between homozygous and heterozygous individuals.
- SNP markers described below are co-dominant markers where both alleles if present are detected as different florescence signals in a KASP assay.
- deletion refers to the physical position in a DNA sequence or a genomic sequence where a deletion (also called deletion mutation) removes one or more nucleotide base pair resulting in a shortening of the affected (mutated) sequence compared to the wildtype sequence.
- insertion refers to the physical position in a DNA sequence or a genomic sequence where an insertion (also called insertion mutation) adds one or more nucleotide base pairs resulting in an extension (lengthening) of the affected (mutated) sequence compared to the wildtype sequence.
- DNA and insertions can however be used as molecular markers in case they represent a length polymorphism or as presence/absence polymorphism.
- DNA and “DNA molecule” refer to a deoxyribonucleic acid (DNA) molecule.
- a DNA molecule may be of genomic or synthetic origin and is by convention from the 5' (upstream) end to the 3' (downstream) end.
- DNA sequence refers to the nucleotide sequence of a DNA molecule, i.e. the sequence of consecutive nucleotides in the DNA molecule.
- nucleotides of a polynucleotide or DNA sequence or molecule are interchangeable and synonymous and refer to the 5' to 3' order of nucleotides in a polynucleotide or DNA sequence, strand or molecule without any gap or interruption between them.
- the nomenclature used is that required by Title 37 of the United States Code of Federal Regulations ⁇ 1.822 and set forth in the tables in WIPO Standard ST.25 (1998), Appendix 2, Tables 1 and 3.
- DNA sequences and fragments thereof are disclosed with reference to only one strand of the two complementary DNA sequence strands.
- references to SEQ ID NOs: 1 - 123 and fragments thereof include and refer to the sequence of the complementary strand and fragments thereof.
- fungicide and “fungicidal agrochemical” are used interchangeably herein. Both terms refer to agrochemicals used to kill parasitic fungi or their spores in agriculture.
- isolated refers to separating a molecule from other molecules that are normally associated with it in its native or natural state.
- isolated thus may refer to one or more DNA molecules that has been separated from other DNA molecule(s) that it is associated with in its native or natural state.
- a DNA molecule removed from its natural state and fused to another DNA molecule with which it is not normally associated would be an isolated DNA molecule.
- Such an isolated DNA molecule could result from the use of biotechnology techniques, such as making recombinant DNA or integrating a foreign DNA molecule into the chromosome of a cell, plant, or seed.
- the term “mappable region” as used herein refers to a region of a DNA sequence or a genomic sequence which shows an average mappability value (computed with GenMap, Pockrandt et. al, 2020) larger than 0.5, indicating that this region does not belong to a highly repetitive region but instead likely represents a unique region.
- a “molecular marker” or “marker” is a nucleic acid that is polymorphic in a defined population and is used as a reference or orientation point.
- the term “marker” may be related to a specific genomic position which is detectable by a corresponding “molecular marker” wherein the “molecular marker” in most cases is sequentially compatible to the genomic position.
- a marker for the detection of a virulent C. beticola strain which is able to overcome the resistance conferred to a plant of the genus Beta by the Cercospora resistance gene BvCR4 should be suitable for monitoring differences or polymorphisms within a population of C. beticola strains. Such a marker is thus able to detect and differentiate between various allelic states (alleles).
- the markers may be derived from genomic or expressed nucleic acids, e.g., spliced RNA, cDNA, or EST's, and may also relate to nucleic acids that are used as probes or primer pairs and as such are suitable for amplifying a sequence fragment using PCR-based methods. Markers that describe genetic polymorphisms (between parts of a population) may be detected using well-established methods from the prior art (Griffiths et al., 2000).
- DNA sequencing for example, among these are DNA sequencing, PCR-based, sequence- specific amplification, verification of RFLP's, verification of polynucleotide polymorphisms by means of allele-specific hybridization (ASH), detection of amplified variable sequences of the plant genome, detection of a 3 SR (self-sustained sequence replication), detection of SSR's, SNP's, RFLP's, or AFLP's (amplified fragment length polymorphisms).
- EST's expressed sequence tags
- SSR markers derived from EST sequences and RAPD randomly amplified polymorphic DNA
- the 245761.000234 term, “marker,” in the description may also mean a specific chromosome position in the genome of a species where a specific marker (SNP, for example) may be found.
- Markers also include synthetic oligonucleotides that may be connected with one or more detection molecules, wherein the detection molecules may be used for a detection reaction or the generation of a signal within the scope of a verification method.
- Synthetic oligonucleotides also include labeled primers. Synthetic oligonucleotides and labeled primers are artificial compounds, do not occur in nature, and cannot be isolated from nature. The production of such compounds is explained further below.
- oligonucleotides as used herein relates to oligonucleotide sequences, in particular to primer oligonucleotides. These comprise a nucleic acid molecule of at least 15 nucleotides in length that specifically hybridizes with a nucleotide sequence defined herein. The term also refers to pairs or triplets of oligonucleotides or a kit containing these oligonucleotides which are suitable for hybridization as forward and reverse primers and for amplifying an amplicon in a polymerase chain reaction (PCR).
- PCR polymerase chain reaction
- the oligonucleotides may be connected with one or more detection molecules, wherein the detection molecules may be used for a detection reaction or the generation of a signal within the scope of a verification method.
- Synthetic oligonucleotides also include labeled primers. Synthetic oligonucleotides and labeled primers are artificial compounds, do not occur in nature, and cannot be isolated from nature. The production of such compounds is known to the person of skill in the art. “Plant material” or “plant parts” means, for example, complete plants, leaves, shoot, stem, roots, hypocotyl, vegetative buds, meristems, embryos, anthers, ovula, seeds, or fruits.
- this plant material(s) or plant part(s) is/are taken from one or more of the plants of the genus Beta growing in the field from which a sample is taken for analysis according to the invention.
- a “primer” is a DNA molecule that is designed for use in annealing or hybridization methods that involve an amplification reaction.
- An amplification reaction is an in vitro reaction that amplifies template DNA to produce an amplicon.
- an “amplification product” or “amplified DNA” or “amplicon” is a DNA molecule that has been synthesized using amplification techniques as further described herein, which is directed to a target nucleic acid or DNA molecule that is part of a template nucleic acid molecule.
- Amplification or amplifying refers to making multiple copies of a target DNA molecule or segment from a template DNA.
- the amplicon may range in length depending on the length of the intervening polynucleotide or DNA sequence between the two primer target sequences in the template DNA molecule.
- the use of the term “amplicon” specifically excludes primer dimers that may be formed in a DNA amplification reaction. Amplification and detection of such an amplicon is indictive or diagnostic for the presence of a virulent C. beticola strain which is able to overcome the resistance conferred to plants of the genus Beta by the resistance gene BvCR4.
- a primer is typically designed to hybridize to a complementary target DNA strand to form a hybrid between the primer and the target DNA strand.
- primer pairs refer to use of two primers binding opposite strands of a double stranded nucleotide segment for the purpose of amplifying the polynucleotide segment between the positions targeted for binding by the individual members of the primer pair, typically in a thermal amplification reaction or other conventional nucleic-acid amplification methods.
- a primer may further comprise an oligo tail sequence such as those used in the Kompetitive Allele-Specific PCR (KASPTM) method.
- the KASP assay is a particularly useful assay method for genotyping of single nucleotide polymorphism markers and is described, e.g., by He et al., 2014.
- the allele-specific primers each harbor a unique tail sequence that corresponds with a universal FRET (fluorescence resonant energy transfer) cassette; one labelled with FAMTM dye and the other with HEXTM dye.
- FRET fluorescence resonant energy transfer
- primers comprising an oligo tail sequence are the primers of the present invention whose names end with “_A” (SEQ ID NOs: 40 to 62 and SEQ ID NO: 121) or “_B” (SEQ ID NOs: 63 to 85 and SEQ ID NO: 122), respectively.
- primers which do not contain an oligo tail sequence are the primers of the present invention whose names end with “_G” (SEQ ID NOs: 86 to 108 and SEQ ID NO: 123).
- oligo tail sequence of the primers of the present invention whose names end with “_A” is found at the 5’ end and reads “GAAGGTGACCAAGTTCATGCT”, whereas the oligo tail sequence of the primers of the present invention whose names end with “_B” is found at the 5’ end and reads “GAAGGTCGGAGTCAACGGATT”.
- Primers may have complete sequence identity with the target sequence, although primers differing from the target sequence that retain the ability to hybridize preferentially to target sequences may be designed by conventional methods. In order for a nucleic acid molecule to serve as a primer it needs only be sufficiently complementary in sequence and/or of sufficient length to be able to form a stable double-stranded structure under the particular hybridization conditions or reaction conditions.
- polynucleotide segment of sufficient length or “sufficient length of contiguous nucleotides” therefore are capable of specifically hybridizing to a target DNA sequence under certain hybridization conditions or reaction conditions.
- the term “of sufficient length” refers to any length that is sufficient to be useful in a detection method of choice.
- Primers are generally at least about 8 nucleotides, at least about 10 nucleotides, at least about 12 nucleotides, at least about 14 nucleotides, at least about 16 nucleotides, at least about 18 nucleotides, at least about 20 nucleotides, at least about 22 nucleotides, at least about 24 nucleotides, at least about 26 nucleotides, at least about 28 nucleotides, or at least about 30 nucleotides or more in length.
- Such primers hybridize specifically 245761.000234 to a target DNA sequence under stringent hybridization conditions.
- nucleic acid molecules are capable of specifically hybridizing to one another if the two molecules are capable of forming an anti-parallel, double-stranded nucleic acid structure.
- a nucleic acid molecule is the “complement” of another nucleic acid molecule if they exhibit complete complementarity.
- two molecules exhibit “complete complementarity” if when aligned every nucleotide of the first molecule is complementary to every nucleotide of the second molecule.
- Two molecules are “minimally complementary” if they can hybridize to one another with sufficient stability to permit them to remain annealed to one another under at least conventional “low-stringency” conditions.
- the molecules are “complementary” if they can hybridize to one another with sufficient stability to permit them to remain annealed to one another under conventional “high-stringency” conditions. Departures from complete complementarity are therefore permissible, as long as such departures do not completely preclude the capacity of the molecules to form a double-stranded structure.
- Optimal alignment of sequences for aligning a comparison window are well known to those skilled in the art and may be conducted by tools such as the local homology algorithm of Smith and Waterman, the homology alignment algorithm of Needleman and Wunsch, the search for similarity method of Pearson and Lipman, and by computerized implementations of these algorithms such as GAP, BESTFTT, PASTA, and TFASTA available as part of the Sequence Analysis software package of the GCG® Wisconsin Package® (Accelrys Inc., San Diego, Calif.), MEGAlign (DNAStar Inc., 1228 S. Park St., Madison, Wis. 53715), and MUSCLE (version 3.6) (Edgar, 2004) for instance with default parameters.
- tools such as the local homology algorithm of Smith and Waterman, the homology alignment algorithm of Needleman and Wunsch, the search for similarity method of Pearson and Lipman, and by computerized implementations of these algorithms such as GAP, BESTFTT, PASTA, and TFASTA available as part of the Sequence Analysis software package of the
- identity fraction for aligned segments of a test sequence and a reference sequence is the number of identical components that are shared by the two aligned sequences divided by the total number of components in the portion of the reference sequence segment being aligned, that is, the entire reference sequence or a smaller defined part of the reference sequence. Percent sequence identity is represented as the identity fraction multiplied by 100. The comparison of one or more sequences may be to a full-length sequence or a portion thereof, or to a longer sequence.
- Primer sequences having a nucleotide sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% identical to the full length of SEQ ID NO: 1 to 123 are within the scope of the present disclosure.
- the term “resistance” is to be understood broadly and covers the range of the protection from a retardation up to a complete blocking of the development of the Cercospora leaf spot disease on plants of the genus Beta caused by the pathogen Cercospora beticola.
- a Cercospora resistant plant cell or resistant plant preferably shows resistance to the disease which this pathogen causes; for example, a resistance to Cercospora beticola is also a resistance to leaf spot disease.
- an increase in the resistance can be measured via a reduced fungal biomass on the host plant; for this, the fungal DNA may be determined with the aid of quantitative PCR in comparison to the plant DNA in the infested plant tissue.
- the Cercospora resistance gene BvCR4 is a major resistance gene which confers high resistance to plants of the genus Beta, preferably sugar beet plants.
- the gene and its identification is described in International patent applications WO2020/169178 and WO2022/037967, respectively, the disclosure of which is incorporated herein in this entirety, and by Chen et al., 2023).
- a “sample” is intended to refer to any sample taken from a given field where a crop is grown, has been grown or will be grown.
- this crop is a plant of the genus Beta.
- the sample can be a soil sample, or a sample of plant material or plant parts taken from the crop grown in a given field.
- the sample of plant material is a leave sample or a sample of any other part of the crop plant.
- the sample of plant material can be a sample from a single plant or a sample with pooled plants material taken from several plants. Further, “sample” is intended to refer to any composition comprising or derived from, either directly or indirectly, a biological sample, source, or material.
- the sample may generally comprise DNA of a plant and/or fungal (preferably of Cercospora beticola) DNA and/or substantially or completely pure, purified, or isolated plant and/or fungal DNA (preferably of Cercospora beticola).
- a “biological sample” contains biological materials, including but not limited to DNA obtained or derived from, either directly or indirectly, the genome of a cell(s), tissue(s), seed(s), plant(s), plant part(s) found in the sample, which is preferable from plants of the genus Beta grown in the field and the fungus material growing in or on the plants of the genus Beta.
- Directly refers to directly obtaining DNA by a skilled artisan from the plant material of the genus Beta and/or fungal (preferably Cercospora beticola) genome by fracturing cells from material from plants of the genus Beta 245761.000234 and/or the fungus (preferably Cercospora beticola) (or by obtaining samples of material of a plant of the genus Beta and/or the fungus (preferably Cercospora beticola) that contain fractured cells from material of a plant of the genus Beta and/or the fungus (preferably Cercospora beticola) and exposing or using the genomic DNA from cells from material of a plant of the genus Beta and/or the fungus (preferably Cercospora beticola) for the purposes of detection.
- a “single nucleotide polymorphism” or SNP is a genetic variation between two samples of DNA wherein at least one nucleotide between the two samples is different. In most cases the samples belong to the same species and the comparison or alignment of the two samples is performed on the basis of homologues genomic regions. SNPs may cause allelic variations but not all SNPs need to occur within a functional genomic element like a gene. SNPs can be used two differentiate between for example different genotypes / haplotypes or may be used to screen and select for the presence of absence of a functional genomic element like for example a specific gene or its allelic variant. Due to genetic linkage SNPs need not to be within the functional genomic element which is to be selected.
- SNPs in the sense of the invention are given in Table 1 below.
- the detection or identification of SNPs may occur by a PCR involving two different forward primers and one common reverse primer.
- the technical details for such a detection or identification may be derived from passages below.
- the term “tightly linked”, when used in the context of markers of the present invention e.g., in the context of the polymorphisms which are genetically linked to the virulence of a given C. beticola strain), means that the markers are located on the same chromosome next to AvrCR4 such that they tend to be co-inherited and not independently assorted during meiosis.
- LIST OF SEQUENCES 1 Exemplary sequences for marker development in core genomic regions.
- SEQ ID NO. 1 >seq85720 ..., conserved region of chromosome 1 of C. beticola for the confirmation of the detection of C. beticola.
- SEQ ID NO. 2 >seq87992 ..., conserved region of chromosome 1 of C. beticola for the confirmation of the detection of C. beticola.
- SEQ ID NO.3 >seq57120, conserved region of chromosome 1 of C. beticola for the confirmation of the detection of C. beticola.
- SEQ ID NO.4 >seq89668, conserved region of chromosome 1 of C. beticola for the confirmation of the detection of C. beticola.
- SEQ ID NO.5 >seq11413, conserved region of chromosome 1 of C.
- This region is detected via the marker assay sxcb010d01.
- This region is detected via the marker assay sxcb011d01. 2) Haplotype sequences of target gene used for assay development.
- SEQ ID NO. 12 Nucleotide sequence of avirulent haplotype of gene AvrCR4 known to be necessary for full functionality of BvCR4 mediated resistance.
- SEQ ID NO. 13 Nucleotide sequence of virulence allele of AvrCR4 which will overcome BvCR4 resistance having a point mutation at position 176 (G to A) compared to the avirulent haplotype of SEQ ID NO: 12.
- SEQ ID NO. 14 Nucleotide sequence of virulence allele of AvrCR4 which will overcome BvCR4 resistance having a point mutation at position 73 (G to A) compared to the avirulent haplotype of SEQ ID NO: 12. 245761.000234 SEQ ID NO.
- SEQ ID NO. 15 Nucleotide sequence of virulence allele of AvrCR4 which will overcome BvCR4 resistance having a point mutation at position 107 (C to T) compared to the avirulent haplotype of SEQ ID NO: 12.
- SEQ ID NO. 16 Nucleotide sequence of virulence allele of AvrCR4 which will overcome BvCR4 resistance having a point mutation at position 11 (C to T), at position 289 (G to A), and at position 291 (G to A) compared to the avirulent haplotype of SEQ ID NO.12.
- SEQ ID NO. 16 Nucleotide sequence of virulence allele of AvrCR4 which will overcome BvCR4 resistance having a point mutation at position 11 (C to T), at position 289 (G to A), and at position 291 (G to A) compared to the avirulent haplotype of SEQ ID NO.12.
- SEQ ID NO. 18 Nucleotide sequence of virulence allele of AvrCR4 which will overcome BvCR4 resistance having a point mutation at position 268 (C to T) compared to the avirulent haplotype of SEQ ID NO: 12.
- SEQ ID NO. 19 Nucleotide sequence of hypothetical virulence allele of AvrCR4 which will overcome BvCR4 resistance having a point mutation at position 56 (G to A) compared to the avirulent haplotype of SEQ ID NO: 12.
- SEQ ID NO. 19 Nucleotide sequence of hypothetical virulence allele of AvrCR4 which will overcome BvCR4 resistance having a point mutation at position 56 (G to A) compared to the avirulent haplotype of SEQ ID NO: 12.
- SEQ ID NO. 20 Nucleotide sequence of hypothetical virulence allele of AvrCR4 which will overcome BvCR4 resistance having a point mutation at position 100 (G to A), at position 228 (G to A), at position 237 (G to A), and at position 291 (G to A) compared to the avirulent haplotype of SEQ ID NO: 12.
- SEQ ID NO. 21 Nucleotide sequence of hypothetical virulence allele of AvrCR4 which will overcome BvCR4 resistance having a point mutation at position 116 (G to A) compared to the avirulent haplotype of SEQ ID NO: 12.
- SEQ ID NO. 23 Nucleotide sequence of hypothetical virulence allele of AvrCR4 which will overcome BvCR4 resistance having a point mutation at position 11 (C to T), at position 73 (G to 245761.000234 A), at position 206 (C to T), and at position 243 (C to T) compared to the avirulent haplotype of SEQ ID NO: 12.
- SEQ ID NO. 23 Nucleotide sequence of hypothetical virulence allele of AvrCR4 which will overcome BvCR4 resistance having a point mutation at position 11 (C to T), at position 73 (G to 245761.000234 A), at position 206 (C to T), and at position 243 (C to T) compared to the avirulent haplotype of SEQ ID NO: 12.
- SEQ ID NO.27 >10037229@101
- the sequence is derived from the genome of C. beticola within the core area of the gene AvrCR4. It can be analyzed by the marker assay sxcb013s01.
- SEQ ID NO.28: >10037230@101 the sequence is derived from the genome of C. beticola within the core area of the gene AvrCR4. It can be analyzed by the marker assay sxcb014s014.
- SEQ ID NO.29: >10037231@101 the sequence is derived from the genome of C. beticola within the core area of the gene AvrCR4.
- the sequence can be analyzed by the marker assay sxcb015s01. SEQ ID NO.30: >10037232@101, the sequence is derived from the genome of C. beticola within the core area of the gene AvrCR4. It can be analyzed by the marker assay sxcb016s01. SEQ ID NO.31: >10037233@101, the sequence is derived from the genome of C. beticola within the core area of the gene AvrCR4. It can be analyzed by the marker assay, sxcb017s01. SEQ ID NO.32: >10037234@101, the sequence is derived from the genome of C. beticola within the core area of the gene AvrCR4.
- the sequence is derived from the genome of C. beticola within the core area of the gene AvrCR4. It can be analyzed by the marker assay sxcb019s01. SEQ ID NO.34: >10037236@101, the sequence is derived from the genome of C. beticola within the core area of the gene AvrCR4. It can be analyzed by the marker assay sxcb020s01. SEQ ID NO.35: >10037237@101, the sequence is derived from the genome of C. beticola within the core area of the gene AvrCR4.
- SEQ ID NO.36 >1_4089400-4089528, the sequence is derived from the genome of C. beticola within the core area of the gene AvrCR4. It can be analyzed by the marker assay sxcb022s01. SEQ ID NO. 37: 1_4089490-4089620, the sequence is derived from the genome of C. beticola within the core area of the gene AvrCR4. It can be analyzed by the marker assay sxcb023s01. SEQ ID NO.
- the sequence is derived from the genome of C. beticola within the core area of the gene AvrCR4. It can be analyzed by the marker assay sxcb024s01. SEQ ID NO.39: >1_4089640-4089761, the sequence is derived from the genome of C. beticola within the core area of the gene AvrCR4. It can be analyzed by the marker assay sxcb025s01.
- Primer sequences for assays SEQ ID NO: 40: Nucleotide sequence of primer sxcb012s01_A SEQ ID NO: 41: Nucleotide sequence of primer sxcb013s01_A SEQ ID NO: 42: Nucleotide sequence of primer sxcb014s01_A SEQ ID NO: 43: Nucleotide sequence of primer sxcb015s01_A SEQ ID NO: 44: Nucleotide sequence of primer sxcb016s01_A SEQ ID NO: 45: Nucleotide sequence of primer sxcb017s01_A SEQ ID NO: 46: Nucleotide sequence of primer sxcb018s01_A SEQ ID NO: 47: Nucleotide sequence of primer sxcb019s01_A SEQ ID NO: 48: Nucleotide sequence of primer sxcb021s01_A SEQ ID NO: 49: Nucleotide
- beticola strains by the present inventors are essential for the detection of virulent C. beticola strains present in the local fungal populations which are able to overcome BvCR4.
- BvCR4 provides a high resistance level to C. beticola but the virulent C. beticola strains now identified by the present inventors with the genomic characteristics described herein are lacking a feature or functionality which is detected by the resistance gene BvCR4 to function properly.
- the virulent C. beticola strains now identified are able to infect even Beta vulgaris plants carrying BvCR4. 245761.000234 Accordingly, the present invention relates to diagnostic markers which can be used for the detection of the presence of one or more virulent C.
- the present invention thus provides a marker for the identification of at least one virulent C. beticola strain in a sample, wherein the marker is detecting a) one or more highly diagnostic SNP alleles on chromosome 1 of C. beticola which is tightly linked to virulence of at least one C.
- the marker is also used to determine whether at least one C. beticola strain is present in the sample. This aspect is important if null alleles are detected by the diagnostic markers to ensure that the lack of a signal is not due to the absence of C. beticola in the sample.
- markers are preferably, for example, dominant markers able to detect presence or absence of non-polymorphic region(s) (referred to herein as “dominant species marker”) or “dominant AVR region / gene marker” which are tightly linked to virulence of C. beticola towards BvCR4) or co-dominant markers able to detect single nucleotide polymorphisms which are tightly linked to virulence of C.
- markers are KASP markers, markers for PCR assays (such as, ddPCR, RFLP marker, markers for chips or micro arrays, markers for TagMan or qPCR assays or the like.
- markers for PCR assays such as, ddPCR, RFLP marker, markers for chips or micro arrays, markers for TagMan or qPCR assays or the like.
- the person skilled in the art is aware of other types of markers which can be used to detect the genetic variation described herein.
- the one or more highly diagnostic SNP allele and/or the one or more deletion is located on chromosome 1 of C.
- the one or more highly diagnostic SNP allele and/or the one or more deletion which is detected by the marker is located on chromosome 1 of C. beticola within a mappable region of an interval which corresponds to regions in the reference genome of C.
- the one or more highly diagnostic SNP allele and/or the one or more deletion is located on chromosome 1 of C. beticola within the genomic sequence of the AvrCR4 gene of C. beticola and 1000 bp upstream or 1000 bp downstream of that genomic sequence of the AvrCR4 gene of C. beticola which is located on chromosome 1 of C. beticola at a position which corresponds to a region on chromosome 1 in the reference genome of C.
- the sequence of the avirulent haplotype of the gene AvrCR4 which is known to be necessary for full functionality of the C. beticola resistance medidated by BvCR4 is provided as SEQ ID NO: 12.
- the region on chromosome 1 in the reference genome of C. beticola strain CB_CbHevensen- 1_hq-v2 which is spanning the sequence between positions 4,058,174 bp and 4,113,144 bp is a region of about 54 kb which was found to be missing in a number of virulent C. beticola strains as result of recombination and thus rearrangement within the genome of chromosome 1 of C. beticola.
- beticola strain CB_CbHevensen- 1_hq-v2 which is spanning the sequence between positions 4,085,502 bp and 4,109,180 bp is a region of about 23.7 kb which was found to be missing in a number of virulent C. beticola strains as result of recombination and thus rearrangement within the genome of chromosome 1 of C. beticola.
- the region on chromosome 1 in the reference genome of C. beticola strain CB_CbHevensen- 1_hq-v2 which is spanning the sequence between positions 4,088,434 bp and 4,090,764bp is the region of the GWS peak as detailed in Example 3.
- the region on chromosome 1 in the reference genome of C. beticola strain CB_CbHevensen- 1_hq-v2 which is spanning the sequence between positions 4,088,434 bp and 4,090,764 bp is the genomic sequence of the AvrCR4 gene of C. beticola including 1000 bp upstream or 1000 bp downstream of that genomic sequence.
- the region on chromosome 1 in the reference genome of C. beticola strain CB_CbHevensen- 1_hq-v2 which is spanning the sequence between positions 4,089,424 bp and 4,089,764 bp is the genomic sequence of the AvrCR4 gene of C.
- the markers according to the invention preferably are markers derived from the sequences disclosed herein as SEQ ID NOs: 1 to 39 and as shown in Tables 1 and 3. 245761.000234
- the markers described herein can also be used for the unambiguous identification of C. beticola as disease causing microorganism as such. This is particularly useful as the early symptoms of C. beticola are very similar to infections with bacteria of the genus Pseudomonas or of Rhizoctonia infections. The clear and early clarification of C. beticola as the symptom-causing organism will allow an early chemical countermeasure by traditional application or by precision spraying as used currently for weed control.
- the present invention relates to diagnostic, marker-based methods which allow to screen biological samples for the presence of virulent C. beticola strains which are able to overcome the resistance conferred by BvCR4. Accordingly, a method of detecting the presence of one or more virulent C. beticola strains is provided, wherein said one or more virulent C. beticola strain is able to overcome the resistance conferred to plants of the genus Beta by the resistance gene BvCR4, and wherein said method is based on the detection of one or more of the markers of the present invention described above in a biological sample.
- this method also comprises the determination by marker whether at least one C. beticola strain is present in the biological sample.
- the biological sample which is analyzed in the methods of the present invention can be obtained from various sources.
- the sample is a soil sample, a sample of plant material taken from one or more plants growing in the field to be examined, or a DNA sample extracted from a soil sample or from a sample of plant material taken from one or more plants growing in a field.
- the single sample or the plurality of samples can be obtained from one location or can be obtained from several individual locations in the same field or in different fields (in case of soil samples).
- the single sample or the plurality of samples of plant material can further be obtained from one plant only (in case of several samples these samples are preferably taken from different parts of the plant) or from several individual plants.
- the several individual plants from which a plurality of samples is taken can grow in the same field or in different fields.
- the samples are taken when sufficient C. beticola has grown to allow detection of the fungus in the sample(s) and/or the distinction between avirulent and virulent C. beticola strains can be achieved.
- the best timing for taking soil samples or plant samples for the detection of C. beticola in the sample are known to the person of skill in the art.
- the ideal points of 245761.000234 time for taking the samples can also be determined empirically by taking samples at different times in the life cycle of the fungus and determining the points of time when sufficient fungal DNA is present in the sample(s).
- the sample is one or more soil sample obtained from one or more fields where plants of the genus Beta are grown.
- the one or more sample is preferably plant material obtained from one more or more plant of the genus Beta growing in one or more fields.
- the soil of fields where the planting of plants of the genus Beta such as, for example, sugar beet is intended can also be sampled and tested in a method of the present invention.
- one or more samples are taken from one or more infected Beta vulgaris plants (in particular, sugar beet plants) plants (e.g., from individual infected plants, or from several or all plants from an infection hot spot in the field).
- the method of detecting the presence of one or more virulent C. beticola strains in a sample further comprises the step of extracting DNA, preferably genomic DNA, from the C. beticola strains present in the one or more sample.
- DNA extraction methods suitable for the extraction of DNA from the samples are known to the person skilled in the art.
- the assay methods of the present invention are based on the genomic differences amongst the isolates of the plant pathogen C. beticola which were identified by the present inventors. In particular, the assay methods of the present invention are addressing the one or more of the genomic variations in C. beticola which is or are causal for the virulence of certain C.
- beticola strains which are able to overcome the resistance conferred to plants of the genus Beta by the resistance gene BvCR4.
- the markers employed in these assays are preferably dominant markers able to detect presence or absence of non-polymorphic region(s) (referred to herein as “dominant species marker”) or “dominant AVR region / gene marker” which are tightly linked to virulence of C. beticola towards BvCR4) or co-dominant markers able to detect single nucleotide polymorphisms which are tightly linked to virulence of C.
- the markers employed in the assays of the present invention are SNP alleles provided in Tables 1 and 3 which can further be derived from SEQ ID NOs: 1 to 39.
- Table 1 Overview of the haplotype sequences of target gene AvrCR4 used for assay development and the SNP alleles located therein.
- the assay methods preferably are PCR methods comprises (i) extracting a DNA sample from at least one plant or soil sample; (ii) contacting the DNA sample with at least one primer pair that is capable of producing an amplicon from the genomic DNA of C.
- nucleotide sequence of the amplicon comprises a nucleotide sequence specific for one or more of the genomic variations in C. beticola which is or are causal for the virulence of certain C. beticola strains.
- Primer pairs that are capable of producing an amplicon from the genomic DNA of C. beticola present in the sample under conditions appropriate for DNA amplification may be readily designed by one of skill in the art to produce an amplicon diagnostic for one or more of the genomic variations in C.
- the assay methods of the present invention include KASP assays.
- the KASP assays are based on competitive allele-specific PCR and allows bi-allelic scoring of single-nucleotide polymorphisms (SNPs) and insertions and deletions (indels) at specific loci of the genome of C. beticola (Semagn et al., 2013).
- KASP assays There are different types of KASP assays which can be used according to the invention: a first set of assays which employ co-dominant markers encoding single nucleotide polymorphisms (like those in Table 1 and Table 3 below), a second set of assays which employ dominant markers able to detect presence or absence of non- polymorphic regions. The latter assay preferably employs markers developed for regions within the GWAS peak as well as for region that were detected as universally present in all sequenced C. beticola isolates. A third set of in silico KASP assays employs the read out of both co-dominant and dominant markers into a single presence/absence determination. KASP assays are generally known to the person skilled in the art.
- These assays are preferably the combination of two dominant KASP assays for use in the detection of virulent C. beticola strains in a sample, wherein these assays are based on species- specific sequences and sequences of the AvrCR4 gene (see Example 5) and use dominant species and dominant AvrCR4 gene markers.
- One assay is used first for the determination of the presence of at least one C. beticola strain in the sample. This assay detects the reference allele, and if positive returns a readout indicating the presence of C. beticola in the sample.
- the second assay is used for the determination of the presence of at least one avirulent C.
- beticola strain in the sample based on the detection of either a reference allele or the determination of virulence based on lack of amplification (deletion detection).
- the principle of the detection of virulent C. beticola strains in a sample with two dominant KASP assays (using dominant species and dominant AVR gene markers) is further explained in Table 4 in Example 5 below.
- these two assays are assay sxcb01d01 to confirm the presence at least one of C. beticola strain in the sample, and assay sxcb022d01 to determine the avirulence of the C. beticola strain(s) in the sample.
- these assays are preferably the combination of two KASP assays for detecting virulent Cercospora strains in a sample using dominant species and co-dominant SNP markers (see Example 6).
- One dominant KASP assay based on species-specific sequences is used first for the determination of the presence of at least one C. beticola strain in the sample.
- the assay detects the reference allele, and if positive returns a readout indicating the species presence.
- a co-dominant SNP assay is used for the determination of the presence of at least avirulent C.
- the two assays in this preferred embodiment are assay sxcb01d01 to confirm the presence at least one of C. beticola strain in the sample, and assay sxcb016s01 to determine the avirulence of the C. beticola strain(s) in the sample.
- these assays are preferably the combination of two KASP assays for detecting virulent Cercospora strains in a sample using dominant species and co- dominant sequence markers.
- one dominant KASP assay based on species- specific sequences whereas one co-dominant sequence assay covering both flanks of the insertion site of the AvrCR4 region / gene and an insertion sequence close to one border of the insertion can be used to detect the presence of at least one virulent C. beticola strain in the sample.
- the dominant species assay is first used for the determination of the presence of at least one C. beticola strain in the sample.
- the assay detects the reference allele, and if positive returns a readout indicating the species presence.
- the co-dominant sequence assay is used for the determination of avirulence based on the detection of the avirulent insertion allele or for the determination of virulence based detection of the virulent deletion allele.
- the dominant species assay determines the presence of at least one C. beticola strain in the sample, and the co-dominant sequence assay determines the avirulence of the C. beticola strain(s) in the sample, the readout of both assays is combined into an avirulent sample state (AVIR), which means that the sample does not contain a virulent C. beticola strain.
- the dominant species assay confirms the presence of at least one C. beticola strain in the sample, and the co-dominant sequence assay determines the virulence of at least one of the C.
- KASP methods comprise (i) extracting a DNA sample from at least one plant or soil sample; (ii) contacting the DNA sample with a set of three primers that is capable of producing signals (e.g.
- an amplicon or a signal which can be detected from the genomic DNA of C. beticola present in the sample under conditions appropriate for DNA amplification with KASP primers; (iii) performing DNA amplification reaction(s); and then (iv) detecting an amplicon or a fluorescence signal (or the lack thereof), wherein the detection of an amplicon or a fluorescence signal is indicative for the presence of avirulent C. beticola strains in the sample only.
- the allele-specific primers used in KASP assays each harbor a unique tail sequence that corresponds with a universal FRET (fluorescence resonant energy transfer) cassette; one labelled with FAMTM dye and the other with HEXTM dye.
- primers comprising an oligo tail sequence are the primers of the present invention whose names end with “_A” (SEQ ID NOs: 40 to 62 and SEQ ID NO: 121) or “_B” (SEQ ID NOs: 63 to 85 and SEQ ID NO: 122), respectively.
- primers which do not contain an oligo tail sequence are the primers of the present invention whose names end with “_G” (SEQ ID NOs: 86 to 108 and SEQ ID NO: 123).
- the KASP Master mix used in such preferred KASP method contain the universal FRET cassettes, ROX passive reference dye, Taq polymerase, free nucleotides and MgCh in an optimized buffer solution.
- KASP PCR during thermal cycling, the relevant allele-specific primer binds to the template and elongates, thus attaching the tail sequence to the newly synthesized strand.
- the complement of the allele-specific tail sequence is then generated during subsequent rounds of PCR, enabling the FRET cassette to bind to the DNA.
- the FRET cassette is then no longer quenched and emits fluorescence. When a virulent C. beticola strain is present in a sample, no fluorescent signal was produced. However, when an avirulent C.
- beticola strain is present in a sample (but no virulent C. beticola strain), a fluorescent signal was produced.
- the present invention is based on genomic variation in C. beticola strains which is causal for the fungal isolate’s virulence towards BvCR4.
- the identified variants can also be used in alternative assays other than the KASP systems described above.
- the full presence/absence variation can be used to establish ddPCR assays (to measure copy number variations (CNV) of non-polymorphic dominant marker within the presence/absence variation), RFLP marker assays (cut sites outside and inside the presence/absence variation), TagMan or qPCR assays using the variants within the presence/absence, High Resolution Melting Curves or PCR to measure the 245761.000234 deletion length, targeted or amplicon sequences as well as full genome sequencing.
- CNV copy number variations
- RFLP marker assays cut sites outside and inside the presence/absence variation
- TagMan or qPCR assays using the variants within the presence/absence
- High Resolution Melting Curves or PCR to measure the 245761.000234 deletion length, targeted or amplicon sequences as well as full genome sequencing.
- the genomic variation in C. beticola strains can also be detected by sandwich ELISA assays in a lateral flow assay.
- a further embodiment of the assay methods of the present invention is the sequencing
- the present invention also relates to methods for controlling virulent strains of C. beticola in fields in which plants of the genus Beta, preferably sugar beet plants, are grown, wherein these virulent C. beticola strains are able to overcome the resistance conferred by the gene BvCR4. In a preferred embodiment such a method of controlling virulent strains of C.
- beticola in fields in which plants of the genus Beta, preferably sugar beet plants, are grown comprises the steps of (1) planting Cercospora-resistant plants of the genus Beta (carrying BvCR4) in a field, (2) prior to or after the planting of step (1) analyzing soil or plant samples from that field for the presence of one or more virulent strains of C. beticola which is able to overcome the resistance conferred by the gene BvCR4 by employing the markers of the present invention or one of the assays of the present invention, and (3) applying fungicides for at least one time over the top of the plants of the genus Beta in the field after emergence if one or more virulent strains of C. beticola is identified in step (b) in the sample.
- Other preferred means of controlling the one or more virulent strains of C. beticola in the field(s) where plants of the genus Beta, preferably sugar beet plants, are grown and which can be employed as part of above method of controlling virulent strains of C. beticola are intercropping (preferably with catch crops) or an adapted crop rotation to decrease the C. beticola occulum in the field over time.
- Further means of controlling fungal infection in a field where crops are grown include treatments with fungicidal agrochemicals or fungicides and are known the person of skill in the art.
- Such fungicidal agrochemical is an agrochemical which is effective against Cercospora wherein these agrochemicals may include, but are not limited to, those which contain one or more of the 245761.000234 following fungicides: epoxiconazole, kresoxim-methyl, thiophanate methyl, mancozeb, thiram, hymexazol and/or and other fungicides effective against C. beticola.
- the fungicide(s) used in the methods described herein can be applied alone or in combination with one or more fungicide(s) during the growing season.
- the fungicide(s) used in the methods described herein can be applied in combination with one or more fungicide(s) temporally (for example, as a tank mixture or in sequential applications), spatially (for example, at different times during the growing season after planting of Beta vulgaris seeds), or both.
- the method for controlling virulent strains of C. beticola in the field where Beta vulgaris plants are growing may comprise applying a fungicidally effective amount post-emergence (any time after Beta vulgaris plants emerge).
- Multiple applications of one or more fungicides, or a combination of fungicides together or individually, may be used over a growing season, for example, two applications (such as at different times during the growing season of the Beta vulgaris plants) or three or more applications.
- Beta vulgaris preferably sugar beet
- varieties that combine the resistance gene BvCR4 and a high level of quantitative background resistance are a further means to strengthen and control the overall CR resistance and thus virulent strains of C. beticola in the context of the above method of controlling virulent strains of C. beticola in fields in which plants of the genus Beta, preferably sugar beet plants, are grown.
- a further aspect of the present invention relates to methods for characterizing and diagnosing infestations of fields with one or more virulent, strains of C.
- Another aspect of the present invention relates to methods which allow a farmer to save fungicides by the use of the Cercospora-resistant Beta vulgaris, preferably sugar beet, varieties that carry the resistance gene BvCR4, wherein the assay method of the present invention allows to determine and thus ensure that the Cercospora resistance present in the varieties is able to control all C. beticola strains present in the field. This is the case if no or only little infection with virulent C.
- the present invention also allows a farmer to monitor precisely if one or more of the virulent strains of C. beticola are present in a field at the end of the growing season. This allows the farmer to take further phytosanitary steps for the coming cropping season. These additional measures can consist of an alternative cropping scheme, of further fungicide applications as preparation for the next sowing and or for a switch to different cultivar. Furthermore, the present invention allows to precisely determine the frequency of virulent C. beticola strains which are able to overcome the resistance conferred by the gene BvCR4 within the whole population of C. beticola strains present in the field and further to predict the vitality 245761.000234 of those virulent C.
- Another aspect of the present invention is the unambiguous identification of C. beticola as disease causing microorganism per se in infected plants of the genus Beta such as, for example, sugar beet plants.
- This is in particular useful as the early symptoms of infection with C. beticola are very similar to the symptoms of infections with bacteria of the genus Pseudomonas or of the genus Rhizoctonia.
- the clear and early identification of the symptom-causing organism or pest will allow an early chemical countermeasure by traditional application or by precision spraying as used currently for weed control.
- the use of at least one marker preferably at least two, at least three, at least four, or at least five, or more marker of the present invention is provided for the identification of one or more virulent C. beticola strains in a sample.
- at least one marker of the present invention is used for the identification of one or more virulent C. beticola strains in a sample, wherein the one or more C. beticola strain is able to overcome the resistance conferred to plants of the genus Beta by the resistance gene BvCR4 on the basis of differences in the genomic DNA on chromosome 1 of C.
- beticola preferably on the basis of one or more highly diagnostic SNP allele and/or one or more deletion, wherein the one or more highly diagnostic SNP allele and/or the one or more deletion is located on chromosome 1 of C. beticola within a mappable region of an interval which corresponds to regions on chromosome 1 of the reference genome of C. beticola strain CB_CbHevensen-1_hq-v2 which is spanning the sequence between positions 4,058,174 bp and 4,113,144 bp, preferably the sequence between positions 4,085,502 bp and 4,109,180 bp, more preferably being located on chromosome 1 of C.
- beticola strain CB_CbHevensen-1_hq-v2 which is spanning the sequence between positions 4,088,424 bp and 4,090,764bp, and even more preferably located on chromosome 1 of C. beticola within the genomic sequence of the AvrCR4 gene of C. beticola at a position which corresponds to a region on chromosome 1 in the reference genome of C. beticola strain CB_CbHevensen-1_hq-v2 which is spanning the sequence between positions 4,089,424 bp and 4,089,764bp.
- the sequence of the avirulent haplotype of the gene AvrCR4 which is known to be necessary for full functionality of the C.
- beticola resistance medidated by BvCR4 is provided as SEQ ID NO: 12.
- markers in detection assays is described above and is also generally known to the person of skill in the art.
- 245761.000234 in a fifth aspect, there is provided a set of at least two, preferable three, oligonucleotides suitable for use as primers in a PCR which are able to hybridize to the genomic sequence of chromosome 1 of C. beticola and which are able to identify the haplotype of at least one C. beticola in a sample which is characterized by (a) one or more highly diagnostic SNP alleles which are tightly linked to virulence of at least one C.
- the set of oligonucleotides is a set of two oligonucleotides suitable for use as primer in a PCR which are able to identify the haplotype of at least one C.
- beticola in a sample which is characterized by (a) one or more highly diagnostic SNP alleles which are tightly linked to virulence of at least one C. beticola strain, or (b) one or more deletion of genomic sequence in the genome of at least one virulent fungal C. beticola strain which is tightly linked to virulence of C. beticola, and thereby allow to identify in a sample at least one virulent C. beticola strain which is able to overcome the resistance conferred to plants of the genus Beta by the resistance gene BvCR4.
- the set of oligonucleotides is a set of three oligonucleotides suitable for use as primer in a PCR involving two forward primers and a reverse primer wherein each primer has a different nucleotide sequence and wherein the reverse primer and only one of the two forward primers are able to identify the haplotype of at least one C. beticola in a sample which is characterized by (a) one or more highly diagnostic SNP alleles which are tightly linked to virulence of at least one C. beticola strain, or (b) one or more deletion of genomic sequence in the genome of at least one virulent fungal C. beticola strain which is tightly linked to virulence of C.
- the oligonucleotides of the present invention are oligonucleotides which allow the identify the dominant markers which are able to detect presence or absence of non- polymorphic region(s) (referred to herein as “dominant species marker”) which are tightly linked to virulence of C. beticola towards BvCR4.
- the oligonucleotides of the present invention are oligonucleotides which allow to identify the co-dominant markers able to detect single nucleotide polymorphisms which are tightly linked to virulence of C. beticola towards BvCR4 (see for example in Tables 1and 3 below) (referred to herein as (co-dominant SNP marker” or “c-dominant sequence marker”).
- the oligonucleotides for the identification of dominant markers and co-dominant markers can also be used together if assays of the present invention are combined.
- beticola strain is present in a sample which is able to 245761.000234 overcome the resistance conferred to plants of the genus Beta by the resistance gene BvCR4.
- primers are specific for a target nucleic acid sequence and as such are useful for the identification of virulent C. beticola strains by the methods described herein.
- a primer can hybridize to a target polynucleotide sequence to allow for specific detection or amplification of a polynucleotide molecule that comprises, or is covalently linked and associated with, the target polynucleotide sequence.
- the target nucleotide sequence targeted by the oligonucleotides of the present invention may comprise all or part of the genomic DNA on chromosome 1 of C.
- beticola preferably on chromosome 1 of C. beticola within a mappable region of an interval which corresponds to regions on chromosome 1 of the reference genome of C. beticola strain CB_CbHevensen-1_hq- v2 which is spanning the sequence between positions 4,058,174 bp and 4,113,144 bp, preferably the sequence between positions 4,085,502 bp and 4,109,180 bp, more preferably within an interval which on chromosome 1 of C. beticola within a mappable region of an interval which corresponds to a region on chromosome 1 of the reference genome of C.
- beticola strain CB_CbHevensen-1_hq-v2 which is spanning the sequence between positions 4,087,634 bp and 4,094,364 bp, even more preferably within an interval located on chromosome 1 of C. beticola within the genomic sequence of the AvrCR4 gene of C. beticola and 1000 bp upstream or 1000 bp downstream of that genomic sequence of the AvrCR4 gene of C. beticola which is located on chromosome 1 of C. beticola at a position which corresponds to a region on chromosome 1 of the reference genome of C.
- beticola strain CB_CbHevensen-1_hq-v2 which is spanning the sequence between positions 4,088,424 bp and 4,090,764 bp, and most preferably within an interval which corresponds to the genomic sequence of the AvrCR4 gene of C. beticola at a position which corresponds to a region on chromosome 1 in the reference genome of C. beticola strain CB_CbHevensen-1_hq-v2 which is spanning the sequence between positions 4,089,424 bp and 4,089,764bp.
- the sequence of the avirulent haplotype of the gene AvrCR4 is provided as SEQ ID NO: 12 herein.
- the oligonucleotides (primers) may have (i) complete or 100% sequence complementarity (i.e., 100% complementary) to a target polynucleotide sequence or (ii) incomplete sequence complementarity to a target polynucleotide, such as at least 60% complementary, at least 65% complementary, at least 70% complementary, at least 75% complementary, at least 80% complementary, at least 85% complementary, at least 90% complementary, at least 95% complementary, or at least 99% complementary to the target polynucleotide sequence as long as the oligonucleotide (primer) has sufficient complementarity to the target polynucleotide sequence to hybridize to the target polynucleotide sequence under stringent hybridization conditions that are suitable and necessary for use of the primer in the relevant amplification or detection assay, reaction or method.
- the percentage complementarity of a primer may be lower if the length of the primer is longer and depends on the stringency and use.
- the oligonucleotides of the present invention can be used to detect the SNP alleles provided in Table 1 and Table 3.
- An oligonucleotide is typically designed to hybridize to a complementary target DNA strand to form a hybrid between the primer and the target DNA strand.
- the presence of a primer is a point of recognition by a polymerase to begin extension of the primer polymerization of additional nucleotides into a lengthening nucleotide molecule) using as a template the target DNA strand.
- Primer pairs refer to use of two primers binding opposite strands of a double stranded nucleotide segment for the purpose of amplifying the polynucleotide segment between the positions targeted for binding by the individual members of the primer pair, typically in a thermal amplification reaction or other conventional nucleic-acid amplification methods.
- DNA molecules comprising fragments of SEQ ID NOs: 40 to 108 and of SEQ ID Nos: 121 to 123 are useful as primers for detecting whether at least one virulent C. beticola strain is present in a sample which is able to overcome the resistance conferred to plants of the genus Beta by the resistance gene BvCR4 and can readily be designed by one of skill in the art using the sequences provided herein.
- DNA primers are generally ten (10) nucleotides or more in length, preferably at least 15, 16, 17, 18, 19, or 20, more preferably, at least 21, 22, 23, 24, or 25, particularly preferably, at least 30, 35, 40, 45, or 50, and, especially preferably, at least 100, 200, 300, 500 or 1,000 nucleotides in length.
- Such primers are selected to be of sufficient length to hybridize specifically to a target sequence under stringency hybridization conditions.
- the term “specific for” a target sequence indicates that primer hybridizes under stringent hybridization conditions only to the target sequence in a sample comprising the target sequence.
- Appropriate stringency conditions that promote DNA hybridization for example, 6.0x sodium chloride/sodium citrate (SSC) at about 45° C., followed by a wash of 2.0xSSC at 50°C, are known to those skilled in the art or can be found in Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6.
- the salt concentration in the wash step can be selected from a low stringency of about 2.0xSSC at 50°C to a high stringency of about 0.2xSSC at 50°C.
- the temperature in the wash step can be increased from low stringency conditions at room temperature, about 22°C, to high stringency conditions at about 65°C.
- the method for the production of oligonucleotides initially includes: the comparison of the nucleotide sequence of chromosome 1 of virulent C. beticola strains and avirulent C. beticola strains; the identification of the sequence differences between the two nucleotide sequences; and the generation of nucleic acid molecules - here, meaning oligonucleotides - that specifically allow to the detect a marker for the identification of at least one virulent C. beticola strain in a 245761.000234 sample which strain is able to overcome the resistance conferred to plants of the genus Beta by the resistance gene BvCR4.
- the oligonucleotide according to the invention may be connected to a fluorescent dye in order to generate a fluorescence signal, e.g., under excitation via light of the corresponding wavelength.
- the fluorescent dye may be fluorochrome.
- the oligonucleotides according to the invention may be coupled with other compounds that are suitable for generating a signal. Such oligonucleotides do not occur in nature and also cannot be isolated from nature. The following is executed to produce such marked oligonucleotides: DNA may be marked bio-orthogonally. For this, DNA may be marked in vivo or in vitro with nucleoside analogs, which, for example, may subsequently be coupled with a fluorophore per Staudinger reaction.
- DNA may also be chemically provided with fluorophores. Oligonucleotides may be marked via a phosphoramidite synthesis with fluorophores that, for example, are used in QPCR, DNA sequencing, and in situ hybridization. Furthermore, DNA may be generated enzymatically in the course of a polymerase chain reaction with fluorescent nucleotides or be marked with a ligase or a terminal deoxynucleotidyl transferase. DNA may also be detected indirectly via a biotinylation and fluorescent avidin. For couplings, fluorescein, fluorescent lanthanides, gold nanoparticles, carbon nanotubes, or quantum dots, among other things, are used as fluorophores.
- FAM fluorescein
- oligonucleotides and, in particular, primers that possess a FAM marking are encompassed by the invention.
- FAM is preferably present as 6-FAM, wherein - depending upon the desired wavelength of the emission and excitation - other FAM variants, e.g., 5-FAM, may, however, also be used.
- additional fluorescence markers are AlexaFluor, ATTO, Dabcyl, HEX, Rox, TET, Texas Red, and Yakima Yellow.
- the oligonucleotides may be furnished with modifications of the bases or of the sugar phosphate spine.
- the allele-specific primers used in KASP assays as described hereinabove each harbor a unique tail sequence that corresponds with a universal FRET (fluorescence resonant energy transfer) cassette; one labelled with FAMTM dye and the other with HEXTM dye. During thermal cycling, the relevant allele-specific primer binds to the template and elongates, thus attaching the tail sequence to the newly synthesized strand.
- FRET fluorescence resonant energy transfer
- primers comprising an oligo tail sequence are the primers of the present invention whose names end with “_A” (SEQ ID NOs: 40 to 62 and SEQ ID NO: 121) or “_B” (SEQ ID NOs: 63 to 85 and SEQ ID NO: 122), respectively.
- primers which do not contain an oligo tail sequence are the primers of the present invention whose names end with “_G” (SEQ ID NOs: 86 to 108 and SEQ ID Nos: 123).
- Preferred sets of three oligonucleotides suitable according to the present invention are the sets of three oligonucleotides selected from the following group comprising: - oligonucleotides sxcb012s01_A (SEQ ID NO: 40), sxcb012s01_B (SEQ ID NO: 63) and sxcb012s01_G (SEQ ID NO: 86) in assay sxcb012s01, - oligonucleotides sxcb013s01_A (SEQ ID NO: 41), sxcb013s01_B (SEQ ID NO: 64) and sxcb013s01_G (SEQ ID NO: 87) in assay sxcb013s01, - oligonucleotides sxcb014s01_A (SEQ ID NO: 42), sxcb014s01_B (SEQ ID NO: 65) and
- Particularly preferred sets of three oligonucleotides suitable according to the present invention are the sets of oligonucleotides sxcb018s01_A (SEQ ID NO: 46), sxcb018s01_B (SEQ ID NO: 69) and sxcb018s01_G (SEQ ID NO: 92) in assay sxcb018s01 and oligonucleotides sxcb024d01_A (SEQ ID NO: 61), sxcb024d01_B (SEQ ID NO: 84) and sxcb024d01_G (SEQ ID NO: 107) in assay sxcb024d01.
- kits for detecting the presence of DNA of one or more virulent C. beticola strains in a sample comprises all means needed to identify one or more of the markers of the present invention.
- Such means preferably are oligonucleotides and the sets of oligonucleotides of the present invention as described herein above.
- One example of such a kit is a kit comprising any of the oligonucleotides, preferably the sets of oligonucleotides described herein.
- the kits provided herein are useful for, among other things, identifying DNA of one or more C.
- kits can also be developed using the compositions and methods disclosed herein and the methods well known in the art of nucleic acid detection for the detection of DNA of one or more virulent C. beticola strains.
- kits contain oligonucleotides (e.g. primers) which are specific to genomic DNA of C. beticola.
- oligonucleotides may comprise one or more of SEQ ID NOs: 1 – 123, more preferred one or more of SEQ ID Nos: 40 to 108 and SEQ ID Nos: 121 to 123.
- kits can also contain instructions for using the oligonucleotides for identifying DNA of one or more C. beticola strains in a sample and/or for distinguishing between avirulent and virulent C. beticola strains in a sample.
- Kits may optionally also comprise reagents for performing the detection reactions described herein. 245761.000234
- the following examples explain the invention, but without limiting the subject matter of the invention.
- Example 1 Sampling Four sugarbeet cultivars with different levels of resistance were planted at two field sites in Switzerland (Rudolfingen, Hendschiken) which are 60km apart. The four cultivars varied in their resistance to Cercospora leaf spot disease (CLS), a disease caused by C. beticola; two cultivars represented highly resistant cultivars carrying the Cercospora resistance gene BvCR4 whereas the other two cultivars lacking BvCR4. In Hendschiken, 12 rows of each cultivar were planted, and in Rudolfingen, 18 rows of each cultivar were planted. Sugar beets were sown in March and harvested in early November. No fungicide was applied to either field site.
- CCS Cercospora leaf spot disease
- infection hot spots of the pathogen Cercospora beticola were identified in planted the sugar beet plants, labelled and the position recorded via GPS.
- An infection hot spot is defined as a group of at least 5 neighboring infected plants. From these hot spots Cercospora beticola was sampled, single-spore isolates were extracted and cultivated on petri dishes containing potato dextrose agar (PDA). In total 475 of such isolates were sampled. The genomes of these isolates were characterized for duplicates and genetic diversity groups determined using a set of 6 Single- Sequence-Repeat (SSR). Liquid cultures were made for all isolates by scraping mycelia from C.
- SSR Single- Sequence-Repeat
- the PCR amplifications were conducted with Qiagen Type-it kit (Qiagen) in a total volume of 11 ⁇ L.
- the reaction mixture contained 20 ng of template DNA, 0.4 ⁇ M of each forward and reverse primers, 4 ⁇ L Type-it mix (with buffer and MgCl2), 1 ⁇ L Q-solution (1 U Taq polymerase), 2ul deionized water.
- the initial denature was conducted at 95 °C for 5 mins, then followed by 30 cycles of denaturation at 95°C for 30 s, annealing at 58 °C or 56°C for 90 s, elongation at 72°C for 245761.000234 30 s and final extension at 60 °C for 30 min.
- the PCR amplicons were analysed on an ABI 3730xl. Based on the length polymorphism of the microsatellite alleles for the six SSR loci were scored and binned using R package Fragman (Covarrubias-Pazaran et al. 2016) and MsatAllele v 1.05 (Alberto 2009). The R package poppr v.2.9.3 (Kamvar et al.2014) was used to determine multi- locus genotypes (MLGs) for all isolates by combining the alleles of the six loci. Table 2: Description of simple sequence repeats (SSRs) used in Example 1 including flanking PCR primers.
- SSRs simple sequence repeats
- timepoint 4 approximately 4 weeks after inoculation was identified as the one with the best differentiation between the genotypes used in the experiments. Accordingly, mainly the data from this timepoint was used for the subsequent genome wide association analysis (GWAS) in Example 3.
- GWAS genome wide association analysis
- Example 3 Genome-wide Association Study All 56 isolates from Example 2 plus 66 isolates collected from susceptible sugar beet varieties where further used to extract DNA for whole genome short read sequencing on the Illumina NextSeq6000 platform. Additionally, a single Cercospora beticola isolate (CbHevensen-1) was used to extract high-molecular weight DNA and subsequent long read sequencing on the Oxford 245761.000234 Nanopore Promethion platform.
- Example 4 Marker Development The reference position 4087634–4094364 identified in Example 3 was analyzed for potential marker sequences linked to virulence of the C. beticola.
- the identified region contained a single gene later named AvrCR4 as it has many characteristics of an effector gene (Chen et al., 2023) that showed multiple variants as well as a complete absence in virulent strains. Accordingly, a set of highly diagnostic SNP alleles (see Table 3 below) was identified as well as a deletion of the parts or the whole coding sequence of the putative effector gene in the genome of some strains which turned out to be tightly linked to virulence towards BvCR4. Table 3: Examples of highly diagnostic SNP alleles which were identified in the reference position 4089434 to 4089744 (see Example 4 above). Due to their tight linkage to the virulence these SNPs are tightly diagnostic for the presence of one or more virulent C.
- Two dominant KASP assays based on species-specific sequences (assay sxcb01d01 with primer sxcb001d01_A (SEQ ID NO: 49), sxcb001d01_B (SEQ ID NO: 72) and sxcb001d01_G (SEQ ID NO: 95)) and sequences of the AvrCR4 gene (assay sxcb22s01 with primer sxcb022d01_A (SEQ ID NO: 121), sxcb022d01_B (SEQ ID NO: 122) and sxcb022d01_G (SEQ ID NO: 123)) were used to detect virulent C. beticola strains in a sample.
- KASP-reaction master mix was used according to the manufacturer’s instructions (LGC, Berlin (Germany)).
- the reaction consisted of 1,5 ⁇ l dried DNA ,1,5 ⁇ l reaction mixture, 20 nl Primer-mix (total volume 1,52 ⁇ l).
- the thermal cycling conditions were 1 minute 94°C, 10 cycles of 10 seconds 94 °C and 1 minute 61-55°C (with decrement of 0,6°C/cycle), followed by another 26 cycles of 10 seconds 94 °C and 1 minute 61-55°C.
- the final product was analyzed and scored following standard protocols by LGC (Teddington, UK; https://www.lgcgroup.com/).
- Assay sxcb01d01 was used first for the determination of the presence of at least one C.
- assay sxcb022s01 was used for the determination of the presence of at least one avirulent C. beticola strain in the sample based on the detection of either a reference allele or the determination of virulence based on lack of amplification (deletion detection).
- the principle of the detection of virulent C. beticola strains in a sample using dominant species and dominant AVR gene markers is explained and shown in Table 4 below.
- assay sxcb01d01 confirmed the presence at least one of C.
- DNA was extracted using the silica-membrane technology kit “NucleoSpin® 96 Plant II” from company Machery-Nagel (Düren, Germany), following the manufacturer instructions.
- One dominant KASP assay based on species-specific sequences (assay sxcb01d01 with primer sxcb001d01_A (SEQ ID NO: 49), sxcb001d01_B (SEQ ID NO: 72) and sxcb001d01_G (SEQ ID NO: 95)) and one co-dominant SNP assay (assay sxcb016s01 with primer sxcb016s01_A (SEQ ID NO: 44), sxcb016s01_B (SEQ ID NO: 67) and sxcb016s01_G (SEQ ID NO: 90)) was used to detect virulent C.
- KASP-reaction master mix was used according to the manufacturer’s instructions (LGC, Berlin (Germany)).
- the reaction consisted of 1,5 ⁇ l dried DNA ,1,5 ⁇ l reaction mixture, 20 nl Primer-mix (total volume 1,52 ⁇ l).
- the thermal cycling conditions were 1 minute 94°C, 10 cycles of 10 seconds 94 °C and 1 minute 61-55°C (with decrement of 0,6°C/cycle), followed by another 26 cycles of 10 seconds 94 °C and 1 minute 61-55°C.
- the final product was analyzed and scored following standard protocols by LGC (Teddington, UK; https://www.lgcgroup.com/).
- Assay sxcb01d01 was used first for the determination of the presence of at least one C. beticola strain in the sample. The assay detects the reference allele, and if positive returns a readout indicating the species presence. In a second step, assay sxcb016s01 was used for the determination of the presence of at least avirulent C. beticola strain in the sample based on the detection of either an avirulent allele or the determination of virulence based on the detection of a virulent allele. The principle of the detection of virulent C. beticola strains in a sample using dominant species and co-dominant SNP markers is explained and shown in Table 5 below.
- sxcb01d01 confirmed the presence of at least one C. beticola strain in the sample, and sxcb016s01 determined the avirulence of at least one of the C. beticola strain(s) in the sample, 245761.000234 the readout of both assays was combined into an avirulent sample state (AVIR) which meant that the sample does not contain a virulent C. beticola strain.
- sxcb01d01 confirmed the presence of at least one C. beticola strain in the sample, and sxcb016s01 determined the virulence of at least one of the C.
- MsatAllele_1.0 An R package to visualize the binning of microsatellite alleles, J. Hered., 100(3) doi: 10.1093/jhered/esn110. Epub 2009 Jan 6. Chen et al.
- GWAS reveals a rapidly evolving candidate avirulence effector in the Cercospora leaf spot pathogen, Mol Plant Pathol, 25: e13407 https://doi.org/10.1111/ mpp.13407 245761.000234 Covarrubias-Pazaran (2016), Genome-Assisted Prediction of Quantitative Traits Using the R Package sommer, PLoS One, 11(6) doi: 10.1371/journal.pone.0156744. eCollection 2016 Edgar (2004), MUSCLE: multiple sequence alignment with high accuracy and high throughput, Nucleic Acids Research 32(5):1792-1 Griffiths et al. (2000), An Introduction to Genetic Analysis, Biologia Plantarum 45, 50.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202363442799P | 2023-02-02 | 2023-02-02 | |
| PCT/IB2024/000054 WO2024161213A2 (en) | 2023-02-02 | 2024-02-02 | Assay for prediction of aggressiveness of cercospora beticola in beta vulgaris varieties |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP4658808A2 true EP4658808A2 (de) | 2025-12-10 |
Family
ID=90365056
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP24711621.3A Pending EP4658808A2 (de) | 2023-02-02 | 2024-02-02 | Test zur vorhersage der aggressivität von cercospora beticola in beta-vulgaris-varianten |
Country Status (3)
| Country | Link |
|---|---|
| EP (1) | EP4658808A2 (de) |
| CL (1) | CL2025002257A1 (de) |
| WO (1) | WO2024161213A2 (de) |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113646326A (zh) | 2019-02-18 | 2021-11-12 | 科沃施种子欧洲股份两合公司 | 用于抗植物病害的基因 |
| EP3957168A1 (de) | 2020-08-17 | 2022-02-23 | KWS SAAT SE & Co. KGaA | Pflanzenresistenzgen und mittel zu dessen identifizierung |
-
2024
- 2024-02-02 EP EP24711621.3A patent/EP4658808A2/de active Pending
- 2024-02-02 WO PCT/IB2024/000054 patent/WO2024161213A2/en not_active Ceased
-
2025
- 2025-07-30 CL CL2025002257A patent/CL2025002257A1/es unknown
Also Published As
| Publication number | Publication date |
|---|---|
| WO2024161213A2 (en) | 2024-08-08 |
| CL2025002257A1 (es) | 2025-10-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2020223625B2 (en) | Methods and compositions for peronospora resistance in spinach | |
| US11206776B2 (en) | Markers associated with soybean rust resistance and methods of use therefor | |
| Montanari et al. | A QTL detected in an interspecific pear population confers stable fire blight resistance across different environments and genetic backgrounds | |
| US10064351B2 (en) | F. oxysporum F.sp. melonis race 1,2-resistant melons | |
| US10337072B2 (en) | Copy number detection and methods | |
| US20240344079A1 (en) | Methods and compositions for peronospora resistance in spinach | |
| US9963750B2 (en) | High throughput method to genotype plants | |
| RU2717017C2 (ru) | Молекулярные маркеры гена rlm2 резистентности к черной ножке brassica napus и способы их применения | |
| EP3651568A1 (de) | Anthracnose-resistente alfalfa-pflanzen | |
| RU2718584C2 (ru) | Молекулярные маркеры гена rlm4 резистентности к черной ножке brassica napus и способы их применения | |
| US10883148B2 (en) | Molecular markers associated with Orobanche resistance in sunflower | |
| EP4193830A2 (de) | Salatpflanzen mit resistenz gegen falschen mehltau | |
| WO2024161213A2 (en) | Assay for prediction of aggressiveness of cercospora beticola in beta vulgaris varieties | |
| US20150167105A1 (en) | Genetic loci associated with gray leaf spot in maize | |
| WO2014169004A2 (en) | Methods for producing soybean plants with improved fungi resistance and compositions thereof | |
| US20250212743A1 (en) | Lettuce plants having resistance to downy mildew | |
| RU2776361C2 (ru) | Молекулярные маркеры, ассоциированные с устойчивостью подсолнечника к orobanche |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: UNKNOWN |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE |
|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE |
|
| 17P | Request for examination filed |
Effective date: 20250730 |
|
| AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR |