EP4651908A1 - Nucleic acid constructs and uses thereof - Google Patents

Nucleic acid constructs and uses thereof

Info

Publication number
EP4651908A1
EP4651908A1 EP24808441.0A EP24808441A EP4651908A1 EP 4651908 A1 EP4651908 A1 EP 4651908A1 EP 24808441 A EP24808441 A EP 24808441A EP 4651908 A1 EP4651908 A1 EP 4651908A1
Authority
EP
European Patent Office
Prior art keywords
vector
cell
seq
human
cells
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
EP24808441.0A
Other languages
German (de)
French (fr)
Inventor
Haoquan Wu
Ying DANG
Lingling SU
Qing Ye
Jianjun TAO
Xiaodong Hu
Chao Jiang
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Kanglin Biotech Hangzhou Co Ltd
Original Assignee
Kanglin Biotech Hangzhou Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US18/383,596 external-priority patent/US20240167058A1/en
Application filed by Kanglin Biotech Hangzhou Co Ltd filed Critical Kanglin Biotech Hangzhou Co Ltd
Publication of EP4651908A1 publication Critical patent/EP4651908A1/en
Pending legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A61K48/0058Nucleic acids adapted for tissue specific expression, e.g. having tissue specific promoters as part of a contruct
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/795Porphyrin- or corrin-ring-containing peptides
    • C07K14/805Haemoglobins; Myoglobins
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86Viral vectors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A61K48/0066Manipulation of the nucleic acid to modify its expression pattern, e.g. enhance its duration of expression, achieved by the presence of particular introns in the delivered nucleic acid
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00Reverse transcribing RNA viruses
    • C12N2740/00011Details
    • C12N2740/10011Retroviridae
    • C12N2740/16011Human Immunodeficiency Virus, HIV
    • C12N2740/16041Use of virus, viral particle or viral elements as a vector
    • C12N2740/16043Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/42Vector systems having a special element relevant for transcription being an intron or intervening sequence for splicing and/or stability of RNA
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/48Vector systems having a special element relevant for transcription regulating transport or export of RNA, e.g. RRE, PRE, WPRE, CTE

Definitions

  • the present disclosure relates to the field of medical technology, in particular to gene therapy and nucleic acid constructs.
  • Inherited anemias such as thalassemia and sickle cell anemia are rare inherited blood diseases, most commonly in patients of Mediterranean, Middle Eastern, Indian and South Asian descent.
  • Thalassemia is typically derived from the imbalance between the single chains of globin hemoglobin tetramer.
  • the imbalance of red blood cell (RBC) a-globin and p-globin often produces various clinical symptoms, for example, 1) lack of sufficient red blood cells and hemoglobin, resulting in inadequacy of oxygen delivered to the whole body; 2) an increase in the hemolysis rate of red blood cells, leading to an increase in the mortality rate of chronic vascular system damage; and 3) spleen and liver damages caused by extreme load of ferine.
  • Allogeneic hematopoietic stem cell transplantation e.g., allogeneic bone marrow transplantation, peripheral blood hematopoietic stem cell transplantation, or cord blood transplantation
  • Allogeneic hematopoietic stem cell transplantation could be a potential cure for thalassemia.
  • the lack of transplant donors and the risk associated with transplantation limit the widespread use of allogeneic hematopoietic cell transplantation in patients with thalassemia.
  • the disclosure provides a vector comprising: a) a left (5') retroviral LTR; b) human p-globin gene; c) human p-globin gene upstream locus control region (LCR); d) a cis-acting posttranscriptional regulatory element; e) a right (3') retroviral LTR; and f) a SV40 polyadenylation signal and/or SV40 origin.
  • the sequence of the human p-globin gene comprises human p-globin gene exon 1, intron 1, exon 2, intron 2, and exon 3.
  • the sequence of the human p-globin gene is according to Ensembl Database Gene: HBB (ENSG00000244734) Transcript: HBB-201 (ENST00000335295.4).
  • the human p-globin gene comprises a human P-globin promoter.
  • human p-globin promoter is about 250 to about 275 bp (e.g., 268 bp) upstream of exon 1 of the human p-globin promoter.
  • the human P-globin gene comprises a human p-globin 3 ’-enhancer.
  • the human p-globin 3 ’-enhancer is about 850 bp to about 900 bp (e.g., 878 bp) downstream of exon 3 of the human p- globin gene.
  • the human p-globin gene comprises one or more (e.g., 2 or 3) wild-type exons.
  • the human p-globin gene comprises one or more (e.g., 2 or 3) codon-optimized exons.
  • the human p-globin gene comprises one or more wildtype introns.
  • the human p-globin gene comprises a wild-type intron 2.
  • the human p-globin gene comprises one or more truncated introns. In certain embodiments, the human p-globin gene comprises a tmncated intron 2. In some embodiments, the human p-globin gene comprises a wild-type exon 2. In some embodiments, the human p-globin gene comprises an exon 2 that encodes a threonine to glutamine mutation at codon 87 (T87Q). In some embodiments, the human p-globin gene comprises the nucleotide sequence of SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, or a nucleotide sequence having at least 85%, 90%, 95%, 98%, or 99% sequence identity thereto, or any combination thereof.
  • the upstream locus control region comprises one or more (e.g., 2 or 3) truncated DNase I hypersensitive sites, HS2, HS3 and HS4 of the LCR.
  • the posttranscriptional regulatory element is a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE).
  • WPRE woodchuck hepatitis virus post-transcriptional regulatory element
  • the SV40 poly adenylation signal and/or SV40 origin is located 3’ of the right (3’) retroviral LTR.
  • the WPRE is wildtype WPRE or a mutated WPRE, e.g., a mutated WPRE described herein.
  • the wildtype WPRE comprises the nucleotide sequence of SEQ ID NO: 32, or a nucleotide sequence having at least 85%, 90%, 95%, 98%, or 99% sequence identity thereto.
  • the mutated WPRE comprises the nucleotide sequence of SEQ ID NO: 33, or a nucleotide sequence having at least 85%, 90%, 95%, 98%, or 99% sequence identity thereto.
  • the vector is a lentivirus vector.
  • the left (5') retroviral LTR is a lentiviral LTR.
  • the right (3') LTR is a lentivirus LTR.
  • the left (5') and right (3’) retroviral LTRs are lentivirus LTRs.
  • the promoter of the left (5') retroviral LTR is replaced with a heterologous promoter.
  • the right (3') LTR is a self-inactivating (SIN) LTR.
  • the vector further comprises one or more (e.g., 2 or 3) of a Psi packaging sequence ('P+), a central polypurine tract/DNA flap (cPPT/FLAP), or a retroviral export element-rev response element (RRE).
  • 'P+ Psi packaging sequence
  • cPPT/FLAP central polypurine tract/DNA flap
  • RRE retroviral export element-rev response element
  • the vector comprises the nucleotide sequence of SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, and SEQ ID NO: 20, or a nucleotide sequence having at least 85%, 90%, 95%, 98%, or 99% sequence identity thereto.
  • the disclosure features a composition
  • a composition comprising a vector described herein and a pharmaceutically acceptable carrier.
  • the disclosure provides a cell comprising a vector described herein.
  • the cell is a human cell. In some embodiments, the cell is selected from the group consisting of an embryonic stem cell, an adult stem cell, an adult progenitor cell, and a differentiated adult cell. In some embodiments, the cell is a hematopoietic stem cell or a hematopoietic progenitor cell. In some embodiments, the cell is a hematopoietic stem cell or a hematopoietic progenitor cell. In certain embodiments, the source of the stem or progenitor cell is bone marrow, cord blood, placental blood, or peripheral blood. In some embodiments, the cell is transduced with the vector.
  • the disclosure provides a composition comprising a cell described herein and a pharmaceutically acceptable carrier.
  • the disclosure provides a method of treating p-thalassemia, comprising administering to a subject in need thereof an effective amount of a cell described herein, or a cell transduced with a vector described herein, thereby treating p-thalassemia.
  • the method further comprises obtaining a cell from the subject. In some embodiments, the method further comprises transducing the cell with the vector. In some embodiments, the cell is a hematopoietic stem cell or a hematopoietic progenitor cell.
  • the method further comprises administering to the subject an effective amount of busulfan and cyclophosphamide prior to administering the cell transduced with the vector to the subject.
  • busulfan is administered at a dose of 2 to 5 mg/kg/day, e.g., 2.4 to 4.8 mg/kg/day, intravenously.
  • busulfan is administered once every 6 hours.
  • cyclophosphamide is administered at a dose of 30-80 mg/kg/day, e.g., 45-65 mg/kg/day, intravenously.
  • cyclophosphamide is administered 18 to 30 hours, e.g., 24 hours, after busulfan is administered.
  • busulfan is administered for 2-4 days and cyclophosphamide is administered for 1-5 days.
  • the administration of the cell transduced the vector is initiated 24-72 hours after the administration of cyclophoshamide is completed.
  • the disclosure provides a method of pretreating a subject, comprising administering to the subject an effective amount of busulfan and cyclophosphamide prior to administering to the subject a therapy for p-thalassemia.
  • the therapy for p- thalassemia comprises a cell transduced with a vector comprising a human p-globin gene, e.g., a cell described herein, or a cell transduced with a vector described herein, to the subject.
  • busulfan is administered at a dose of 2 to 5 mg/kg/day, e.g., 2.4 to 4.8 mg/kg/day, intravenously. In some embodiments, busulfan is administered once every 6 hours.
  • cyclophosphamide is administered at a dose of 30-80 mg/kg/day, e.g., 45-65 mg/kg/day, intravenously. In some embodiments, cyclophosphamide is administered 18 to 30 hours, e.g., 24 hours, after busulfan is administered. In some embodiments, busulfan is administered for 2-4 days and cyclophosphamide is administered for 1-5 days. In some embodiments, the administration of the cell transduced the vector is initiated 24-72 hours after the administration of cyclophshamide is completed. In some embodiments, the subject is pretreated in accordance with a method described in Examples 9-12.
  • the disclosure provides a formulation comprising the vector described herein, a buffer, a stabilizer, and sodium chloride.
  • the vector is present at a concentration of IxlO 8 TU/mL to IxlO 10 TU/mL. In some embodiments, the vector is present at a concentration of 5xl0 8 TU/mL to 5xl0 9 TU/mL. In some embodiments, the vector is present at a concentration of 5xl0 8 TU/mL to IxlO 9 TU/mL, e.g., 6xl0 8 TU/mL or 6.2* 10 8 TU/mL. In some embodiments, the vector is present at a concentration of IxlO 9 TU/mL to 5xl0 9 TU/mL. In some embodiments, the vector is present at a concentration of 2* 10 9 TU/mL to 3*10 9 TU/mL, e.g., 2.5*10 9 TU/mL or 2.8xl0 9 TU/mL.
  • the buffer is phosphate buffer, sodium citrate, or PIPES. In some embodiments, the buffer is present at a concentration of 10 mM to 50 mM, e.g., 10 mM to 30 mM, 20 mM to 40 mM, 30 mM to 50 mM, or 10 mM to 40 mM. In some embodiments, the buffer is present at a concentration of 10 mM, 20 mM, or 40 mM.
  • the stabilizer comprises a sugar or a polyhydric alcohol, e.g., sucrose, trehalose, sorbitol, inositol, glucose, or dextran.
  • the stabilizer is present at a concentration of 1% to 5%, e.g., 1% to 3%, 2% to 3%, or 1% to 2.5%. In some embodiments, the stabilizer is present at a concentration of 1%, 2%, or 2.5%.
  • sodium chloride is present at a concentration of 50 mM to 200 mM, e.g., 50 mM to 70 mM, 70 mM to 90 mM, 80 mM to 100 mM, 100 mM to 120 mM, 140 mM to 160 mM, lOOmM to 150mM, or 50 mM to 150 mM.
  • sodium chloride is present at a concentration of 50 mM, 60 mM, 75 mM, 80 mM, 90 mM, 110 mM, 140 mM, or 150 mM.
  • the formulation comprises a vector described herein, sodium citrate, sucrose, and sodium chloride.
  • the vector is present at a concentration of 5xl0 8 TU/mL to 5xl0 9 TU/mL
  • sodium citrate is present at a concentration of 20 mM to 40 mM
  • sucrose is present at a concentration of 1% to 2%
  • sodium chloride is present at a concentration of 100 mM to 150 mM.
  • the formulation is any of the formulations described in Examples 13-
  • FIG. 1 depicts the schematic design of exemplary viral vector constmcts.
  • FIG. 2 depicts a diagram of an exemplary lentiviral vector packaging backbone plasmid without insertion of gene of interest.
  • FIG. 3 depicts viral vector packaging efficiency for exemplary viral vector constructs shown in FIG. 1.
  • FIG. 4 depicts the schematic design of additional exemplary viral vector constructs.
  • FIG. 5 is a graph depicting VCN values in PBMCs of recipient mice in the mock (without transduction), LV-TH04 (transduction), and positive (wild-type C57BL/6 cells) groups. Blood samples were collected 4, 6 and 8 weeks after bone marrow transplantation of the recipient mice.
  • FIG. 6 is a graph depicting the chimeric rate (%) of PBMCs of recipient mice in the mock (without transduction), LV-TH04 (transduction), and positive (wild-type C57BL/6 cells) groups. Blood samples were collected 4, 6 and 8 weeks after bone marrow transplantation of the recipient mice.
  • FIG. 7 is a series of graphs depicting the hemoglobin content (HGB (g/L); top left graph), percentage of reticulocytes (RET%; top right graph), hematocrit levels (HCT(%); bottom left graph), and average red blood cell volume (MCV(fL); bottom right graph) of recipient mice in the mock (without transduction), LV-TH04 (transduction), and positive (wild-type C57BL/6 cells) groups. Blood samples were collected 4, 6 and 8 weeks after bone marrow transplantation of the recipient animals.
  • FIG. 8 is a series of chromatograms from HPLC assays using supernatants collected from cells transduced LV-TH04 (top chromatogram) or cells without LV-TH04 (bottom chromatogram). The P- globin and a-globin peaks are indicated.
  • FIG. 9 is a graph depicting the absolute neutrophil count (10 9 /L) after infusion of LV-TH04- transduced hematopoietic stem cells.
  • Subjects PJYU and ZRHA were treated with myeloablative conditioning based on BU/CY; subject FAZH was treated with myeloablative conditioning based on BU.
  • FIG. 10 is a graph depicting platelet count (10 9 /L) after infusion of LV-TH04-transduced hematopoietic stem cells.
  • Subjects PJYU and ZRHA were treated with myeloablative conditioning based on BU/CY; subject FAZH was treated with myeloablative conditioning based on BU.
  • FIG. 11 is a graph depicting the loss (%) of lentiviral particles in the formulations described in Table 15 after being placed at room temperature for 1 day, placed at 4 °C for 3 days, or placed under conditions of freeze-thaw for 3 times.
  • FIG. 12 is a graph depicting the lentiviral titers (TU/mL) of the formulations described in Table 16 after being placed under conditions of freeze-thaw for 3 times, or placed under conditions of freezethaw for 9 times.
  • FIG. 13 is a graph depicting the lentiviral titers (TU/mL) of the formulations described in Table 17 after being placed under conditions of freeze-thaw for 3 times.
  • FIG. 14 is a graph depicting the loss (%) of lentiviral particles in the formulations described in Table 18 after being placed at room temperature for 1 day, placed at 4°C for 3 days, or placed under conditions of freeze-thaw for 3 times.
  • FIG. 15 is a graph depicting the lentiviral titers (TU/mL) of a formulation comprising sodium citrate (20mM), sodium chloride (1 lOrnM), and sucrose (1%), or PBS under control conditions, or after being placed at 4°C for 1 day, placed at 4°C for 3 days, or placed at room temperature for 1 day.
  • Lentiviral vectors have the characteristic of host genome integration and therefor are widely considered desirable gene deliver vectors for various genetic diseases, such as hereditary anemia, caused by the loss expression of a single gene.
  • Autologous hematopoietic stem cell therapy can be a promising curative therapy for severe hereditary anemia.
  • a functional gene encoding a human p-globin peptide chain is introduced into a patient’s hematopoietic stem cells ex vivo by lentiviral vector transduction and the transduced cells are infused back to the patient.
  • the methods described herein may achieve complete cure of thalassemia by a onetime treatment.
  • the human p-globin gene comprise a promoter region, 3 exons and 2 introns, a downstream enhancer region, and an endogenous upstream gene expression control region sequence DNase I hypersensitive sites (HSs).
  • HSs DNase I hypersensitive sites
  • the total length of the gene exceeds 60,000 base pairs (bp), which is difficult to be included in any kind of gene therapy vector. For decades, scientists have worked to develop a relatively small p-globin gene expression framework so that it can be used in gene therapy.
  • the term “about” or “approximately” when referring to a measurable value such as an amount, a temporal duration, and the like, are meant to encompass variations of ⁇ 20% or in some instances ⁇ 10%, or in some instances ⁇ 5%, or in some instances ⁇ 1%, or in some instances ⁇ 0.1% from the specified value, as such variations are appropriate in the context of the disclosure.
  • allogeneic refers to a cell of the same species that differs genetically to the cell in comparison.
  • the term “associated with” or “linked,” when used with respect to two or more moieties, means that the moieties are associated or connected, e.g., physically or chemically, with one another, either directly or via one or more additional moieties that serves as a linking agent, to form a structure that is sufficiently stable so that the moieties remain physically associated under the conditions in which the structure is used, e.g., physiological conditions.
  • the two or more moieties are covalently or non-covalently attached, coupled, linked, or tethered.
  • an association is through direct covalent chemical bonding.
  • the association is through ionic or hydrogen bonding or a hybridization based connectivity sufficiently stable such that the associated or linked entities remain physically associated.
  • autologous refers to a cell from the same subject.
  • carrier includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like.
  • the term “complementary” when used to describe a first nucleotide sequence in relation to a second nucleotide sequence refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize and form base pairs, e.g., a duplex, with an oligonucleotide or polynucleotide comprising the second nucleotide sequence.
  • base pairs are formed by hydrogen bonds between nucleotide units in antiparallel polynucleotide strands.
  • complementary polynucleotide or oligonucleotide strands can form base pairs in the Watson-Crick manner or in any other manner that allows for the formation of duplexes.
  • complementary as used herein can encompass fully complementary, partially complementary, or substantially complementary. “Fully complementary” refers to the situation in which each nucleotide unit of one polynucleotide or oligonucleotide strand can base-pair with a nucleotide unit of a second polynucleotide or oligonucleotide strand.
  • “Substantially complementary” refers to the situation in which two polynucleotides or oligonucleotide strands can be fully complementary or they may form one or more, but generally not more than 1, 2, 3, 4, or 5 mismatched or non-complimentary base pairs upon hybridization for a duplex, while still retaining the ability to hybridize under the conditions most relevant to their ultimate application.
  • control element refers to an element used for expression of a gene or gene product.
  • exemplary “control elements,” “regulatory control elements,” or “regulatory sequences” include, but are not limited to, promoter regions, polyadenylation signals, transcription termination sequences, upstream regulatory domains, origins of replication, internal ribosome entry sites (“IRES”), enhancers, and the like, which provide for the replication, transcription and translation of a coding sequence in a recipient cell.
  • IRS internal ribosome entry sites
  • the term “effective amount” refers to an amount of a compound, formulation, material, or composition, to achieve a particular biological result.
  • the effective amount is a therapeutically effective amount.
  • the effective amount of an agent is that amount sufficient to effect a beneficial or desired result, for example, a clinical result.
  • an effective amount of an agent is, for example, an amount sufficient to achieve treatment of the disorder, as compared to the response obtained without administration of the agent.
  • enhancer refers to a segment of DNA which contains a sequence capable of providing enhanced transcription and in some instances can function independent of their orientation relative to another control sequence.
  • An enhancer can function cooperatively or additively with promoters and/or other enhancer elements.
  • RNA export element refers to a cis-acting post-transcriptional regulatory element that regulates the transport of an RNA transcript from the nucleus to the cytoplasm of a cell.
  • RNA export elements include, but are not limited to, the human immunodeficiency virus (HIV) rev response element (RRE) and the hepatitis B virus post-transcriptional regulatory element (HPRE).
  • HAV human immunodeficiency virus
  • RRE human immunodeficiency virus
  • HPRE hepatitis B virus post-transcriptional regulatory element
  • the RNA export element is located within the 3' UTR of a gene and is inserted as one or multiple copies.
  • expression refers to transcription and/or translation of a particular nucleotide sequence.
  • Expression can generally include one or more of the following: (1) production of an RNA template from a DNA sequence (e.g., by transcription); (2) processing of an RNA transcript (e.g., by splicing, editing, 5’ cap formation, and/or 3’ end processing); (3) translation of an RNA into a polypeptide or protein; and (4) post-translational modification of a polypeptide or protein.
  • expression control sequence refers to a polynucleotide sequence that comprises one or more promoters, enhancers, or other transcriptional control elements or combinations thereof that are capable of directing, increasing, regulating, or controlling the transcription or expression of an operatively linked polynucleotide.
  • FLAP element refers to a nucleic acid whose sequence includes the central polypurine tract and the central termination sequence (cPPT and CTS) of a retrovirus (e.g., HIV-1 or HIV-2).
  • a retrovirus e.g., HIV-1 or HIV-2
  • CTS central termination at the central termination sequence
  • the central DNA flap may act as a cis-active determinant of retroviral genome nuclear import and/or may increase the titer of the virus.
  • a retroviral or lentiviral vector backbone described herein comprises one or more FLAP elements upstream or downstream of the heterologous genes of interest in the vector.
  • a transfer plasmid can include a FLAP element.
  • a viral vector described herein comprises a FLAP element isolated from HIV-1.
  • HSC hematopoietic stem cell
  • myeloid e.g., monocytes and macrophages, neutrophils, basophils, eosinophils, erythrocytes, megakaryocytes/platelets, dendritic cells
  • lymphoid lineages e.g., T-cells, B-cells, NK-cells
  • the term “host cell” refers to a cell transfected, infected, or transduced in vivo, ex vivo, or in vitro with a vector or a polynucleotide.
  • Host cells may include packaging cells, producer cells, and cells infected with viral vectors.
  • target cell is used interchangeably with host cell and refers to transfected, infected, or transduced cells of a desired cell type.
  • the term “identity” refers to the subunit sequence identity between two polymeric molecules, e.g., between two nucleic acid molecules (e.g. two DNA molecules and/or two RNA molecules) and/or between two polypeptide molecules. When a subunit position in both of the two molecules is occupied by the same monomeric subunit, they are considered identical at that position.
  • the percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which can to be introduced for optimal alignment of the two sequences.
  • calculation of the percent identity of two sequences can be performed by aligning the two sequences for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second sequences for optimal alignment and non-identical sequences can be disregarded for comparison purposes).
  • the length of a sequence aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, or 100% of the length of the reference sequence.
  • isolated means a material (e.g., a polynucleotide, a polypeptide, a cell) that is substantially or essentially free from components that normally accompany it in its native state.
  • an “isolated polynucleotide,” as used herein, refers to a polynucleotide that has been purified from the sequences that flank it in a naturally -occurring state, e.g., a DNA fragment that has been removed from the sequences that are normally adjacent to the fragment.
  • lentiviral vector refers to a viral vector containing a structural or functional element, or a portion thereof, that is primarily derived from a lentivims.
  • lentivims refers to a genus of retroviruses.
  • exemplary lentiviruses include, but are not limited to, HIV (human immunodeficiency vims, e.g., HIV type 1 and HIV type 2), bovine immune deficiency vims (BIV), caprine arthritis-encephalitis vims (CAEV), equine infectious anemia vims (EIAV), feline immunodeficiency vims (FIV), simian immunodeficiency vims (SIV), and visna-maedi vims (VMV) vims.
  • HIV human immunodeficiency vims
  • BIV bovine immune deficiency vims
  • CAEV caprine arthritis-encephalitis vims
  • EIAV equine infectious anemia vims
  • FIV feline immunodeficiency vims
  • SIV simian immunodeficiency vims
  • VMV visna-mae
  • LTR long terminal repeat
  • the LTR contains a number of regulatory signals, for example, transcriptional control elements, polyadenylation signals and sequences needed for replication and integration of the viral genome.
  • the LTR typically includes U3, R and U5 regions and appears at both the 5' and 3' ends of the viral genome.
  • the U3 region contains the enhancer and promoter elements.
  • the U5 region is the sequence between the primer binding site and the R region and contains the polyadenylation sequence.
  • the R (repeat) region is flanked by the U3 and U5 regions. Adjacent to the 5' LTR are sequences necessary for reverse transcription of the genome (the tRNA primer binding site) and for efficient packaging of viral RNA into particles (the Psi site).
  • nucleic acid cassette refers to a sequence within the vector which can express an RNA, and subsequently a polypeptide.
  • the nucleic acid cassette may contains a gene-of-interest and/or one or more expression control sequences.
  • Vectors may comprise one, two, three, four, five or more nucleic acid cassettes.
  • the nucleic acid cassette can be positionally and sequentially oriented within the vector such that the nucleic acid in the cassette can be transcribed into RNA, and when necessary, translated into a protein or a polypeptide, undergo appropriate post- translational modifications required for activity in the transformed cell, and be translocated to the appropriate compartment for biological activity by targeting to appropriate intracellular compartments or secretion into extracellular compartments.
  • the nucleic acid cassette has its 5’ and 3 ’ ends adapted for ready insertion into a vector, e.g., it has restriction endonuclease sites at each end.
  • the nucleic acid cassette contains a polynucleotide sequence that can be used to treat or prevent a disorder. The cassette can typically be removed and inserted into a plasmid or viral vector as a single unit.
  • operably linked refers to a functional connection between two or more molecules, constructs, transcripts, entities, moieties or the like.
  • “operably linked” refers to functional linkage between a regulatory sequence and a heterologous nucleic acid sequence resulting in expression of the latter.
  • a first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence.
  • a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence.
  • Operably linked DNA sequences can be contiguous with each other and, e.g., where necessary to join two protein coding regions, are in the same reading frame.
  • the term “of’ means either one, both, or any combination of the alternatives, and is used interchangeably with the term “and/or”, unless context clearly indicates otherwise.
  • packaging cell line refers to a cell line that does not contain a packaging signal, but does stably or transiently express viral structural proteins and replication enzymes (e.g., gag, pol, and env) which are necessary for the correct packaging of viral particles.
  • viral structural proteins and replication enzymes e.g., gag, pol, and env
  • the term “packaging signal” or “packaging sequence” refers to a sequence located within a retroviral genome that is required for insertion of the viral RNA into the viral capsid or particle.
  • Several retroviral vectors use the minimal packaging signal (also referred to as the psi
  • the terms “packaging sequence,” “packaging signal,” “psi” and the symbol “T” are used interchangeably to describe the non-coding sequence required for encapsidation of retroviral RNA strands during viral particle formation.
  • pharmaceutically acceptable refers to molecular entities and compositions that do not produce an allergic or similar untoward reaction when administered to a human.
  • pharmaceutically acceptable carrier includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible, including pharmaceutically acceptable cell culture media.
  • the term “prevent” or “prevention” means that a subject (e.g., a human) is less likely to have the disorder, e.g., a myeloma, if the subject receives the antibody molecule.
  • promoter refers to a recognition site of a polynucleotide (DNA or RNA) to which an RNA polymerase binds.
  • promoter/enhancer refers to a segment of DNA which contains a sequence capable of providing both promoter and enhancer functions.
  • prophylactically effective amount refers to an amount effective to achieve the desired prophylactic effect or result.
  • retroviral vector refers to a viral vector containing a structural or functional element, or a portion thereof, that is primarily derived from a retrovirus.
  • R region refers to a region within an LTR beginning at the start of the capping group (i.e., the start of transcription) and ending immediately prior to the start of the poly A tract.
  • the R region is also defined as being flanked by the U3 and U5 regions. Without wishing to be bound by theory, it is believed that in some embodiments, the R region plays a role during reverse transcription in permitting the transfer of nascent DNA from one end of the genome to the other.
  • retrovirus refers to an RNA vims that reverse transcribes its genomic RNA into DNA and subsequently integrates the DNA into a host genome.
  • retroviruses include, but are not limited to, lentiviruses, oncoretroviruses, and spumaviruses.
  • Exemplary oncoretroviruses include, but are not limited to, feline leukemia virus (FLV), Friend murine leukemia virus, gibbon ape leukemia virus (GaLV), Harvey murine sarcoma virus (HaMuS V), Moloney murine leukemia virus (M-MuLV), Moloney murine sarcoma virus (MoMS V), murine mammary tumor virus (MuMTV), murine stem cell virus (MSCV), and Rous sarcoma virus (RSV).
  • the retrovirus is a lentivirus.
  • thalassemia refers to a hereditary disorder characterized by defective production of hemoglobin.
  • the term “thalassemia” encompasses hereditary anemias that occur due to mutations affecting the synthesis of hemoglobin.
  • the term includes any symptomatic anemia resulting from thalassemic conditions such as severe or p-thalassemia, thalassemia major, thalassemia intermedia, a-thalassemias such as hemoglobin H disease.
  • thalassemias include a-thalassemia and p-thalassemia.
  • a-thalassemia is caused by deletion of a gene or genes from the globin chain
  • p-thalassemia is caused by a mutation in the p-globin chain, and can occur in a major or minor form.
  • P-thalassemia children typically are normal at birth, but develop anemia during the first year of life.
  • the mild form of p-thalassemia produces small red blood cells.
  • terapéuticaally effective amount refers to an amount effective to achieve the desired therapeutic effect or result.
  • the term “self-inactivating vector” or “SIN vector” refers to a replicationdefective vector (e.g., a retroviral or lentiviral vector) in which the right 3 ’ LTR enhancer-promoter region, known as the U3 region, has been modified (e.g., by deletion or substitution) to prevent viral transcription beyond the first round of viral replication.
  • the right 3’ LTR U3 region is used as a template for the left 5’ LTR U3 region during viral replication and, thus, the viral transcript cannot be made without a functional U3 enhancerpromoter.
  • the 3’ LTR is modified such that the U5 region is replaced, for example, with a poly(A) sequence.
  • stem cell refers to a cell which is an undifferentiated cell capable of (1) long term self -renewal, or the ability to generate at least one identical copy of the original cell, (2) differentiation at the single cell level into multiple, and in some instance only one, specialized cell type and (3) of in vivo functional regeneration of tissues.
  • the term “subject” is intended to include human and non-human animals.
  • the subject is a human subject, e.g., a human patient having a disorder described herein, or at risk of having a disorder described herein.
  • non-human animals includes mammals and non-mammals, such as non-human primates.
  • the vectors, cells, and compositions described herein are suitable for treating human patients a disorder described herein.
  • Patients having a disorder described herein include, e.g., those who have developed a disorder described herein but are (at least temporarily) asymptomatic, patients who have exhibited a symptom of a disorder described herein, and patients having a disorder related to or associated with a disorder described herein.
  • trans-activation response refers to a genetic element located in the R region of retroviral or lentiviral LTRs. Without wishing to be bound by theory, it is believed that in some embodiments, this element interacts with the retroviral or lentiviral transactivator (tat) genetic element to enhance viral replication. In some embodiments, this element is not required wherein the U3 region of the 5 ’ LTR is replaced by a heterologous promoter.
  • a viral vector described herein comprises a TAR element.
  • the term “treat” or “treatment” means that a subject (e.g., a human) who has a disorder and/or experiences a symptom of a disorder will, in some embodiments, suffer less a severe symptom and/or recover faster when a therapy is administered than if the therapy were never administered.
  • Treatment can, partially or completely, alleviate, ameliorate, relieve, inhibit, or reduce the severity of, and/or reduce incidence, and optionally, delay onset of, one or more manifestations of the effects or symptoms, features, and/or causes of a disorder.
  • treatment is of a subject who does not exhibit certain signs of a disorder, and/or of a subject who exhibits only early signs of a disorder.
  • treatment is of a subject who exhibits one or more established signs of a disorder.
  • treatment is of a subject diagnosed as suffering from a disorder.
  • the term “variant” refers to a polypeptide that is distinguished from a reference polypeptide by the addition, deletion, truncations, and/or substitution of at least one amino acid residue, and that retain a biological activity.
  • a polypeptide variant is distinguished from a reference polypeptide by one or more substitutions, which may be conservative or non-conservative, as known in the art.
  • vector refers to a nucleic acid molecule that is used as a vehicle to transfer another nucleic acid molecule into a host cell.
  • the transferred nucleic acid molecule is inserted to the vector nucleic acid molecule.
  • a vector may include a sequence that directs autonomous replication in a cell, or may include a sequence sufficient to allow integration into the host cell genome.
  • Exemplary vectors include, but are not limited to, viral vectors, plasmids (e.g., DNA plasmids orRNA plasmids), transposons, cosmids, and bacterial artificial chromosomes.
  • Exemplary viral vectors include, but are not limited to, retroviral vectors (e.g., replication defective retroviral vectors) and lentiviral vectors.
  • viral vector refers to a nucleic acid molecule (e.g., a plasmid) that includes one or more virus-derived nucleic acid elements that facilitate transfer of a nucleic acid molecule into a cell, integration of a nucleic acid molecule into the genome of cell, or delivery of a nucleic acid molecule to a viral particle.
  • a nucleic acid molecule e.g., a plasmid
  • virus-derived nucleic acid elements that facilitate transfer of a nucleic acid molecule into a cell, integration of a nucleic acid molecule into the genome of cell, or delivery of a nucleic acid molecule to a viral particle.
  • the disclosure provides a nucleic acid construct or vector (e.g., a viral vector) comprising a human p-globin gene or a functional fragment thereof.
  • a nucleic acid construct or vector e.g., a viral vector
  • the sequence of the human p-globin gene comprises human p-globin gene exon 1, intron 1, exon 2, intron 2, and exon 3.
  • the sequence of the human p-globin gene is according to Ensemble Database Gene: HBB (ENSG00000244734) Transcript: HBB-201 (ENST00000335295.4).
  • nucleic acid construct or vector comprises a regulatory control element. In some embodiments, nucleic acid construct or vector comprises an expression control sequence. In some embodiments, the nucleic acid construct or vector comprises a promoter or a promoter/enhancer.
  • the human p-globin gene comprises a human p-globin promoter. In some embodiment, the human p-globin gene does not comprise a human p-globin promoter. In some embodiments, human p-globin promoter is about 250 to about 275 bp (e.g., 268 bp) upstream of exon 1 of the human p-globin promoter. In some embodiments, the human p-globin gene comprises a human p-globin 3 ’-enhancer. In certain embodiments, the human p-globin 3 ’-enhancer is about 850 bp to about 900 bp (e.g., 878 bp) downstream of exon 3 of the human p-globin gene.
  • the human p-globin gene comprises one or more (e.g., 2 or 3) wild-type exons. In some embodiments, the human p-globin gene comprises one or more (e.g., 2 or 3) codon-optimized exons. In some embodiments, the human p-globin gene comprises one or more wild-type introns. In certain embodiments, the human p-globin gene comprises a wild-type intron 2. In some embodiments, the human p-globin gene comprises one or more truncated introns. In certain embodiments, the human p- globin gene comprises a truncated intron 2. In some embodiments, the human p-globin gene comprises a wild-type exon 2.
  • the human p-globin gene comprises an exon 2 that encodes a threonine to glutamine mutation at codon 87 (T87Q).
  • the human P-globin gene comprises the nucleotide sequence of SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, or a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity thereto, or any combination thereof.
  • the nucleic acid construct or vector comprises a nucleotide sequence that is complementary to the nucleotide sequence of SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, or a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity thereto, or any combination thereof.
  • the human p-globin gene encodes a human p-globin variant.
  • the variant may include an amino acid sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the wild-type human p-globin amino acid sequence.
  • the nucleic acid constmct or vector comprises a retroviral (e.g., lentiviral) LTR.
  • the nucleic acid construct or vector comprises a left (5') retroviral LTR and a right (3') retroviral LTR.
  • the right (3') LTR is a selfinactivating (SIN) LTR.
  • the retroviral LTR is unmodified, e.g., a wild-type retroviral LTR.
  • the retroviral LTR is modified, e.g., comprising one or more subtitutions, insertions, and/or deleteions.
  • the left (5’) retroviral LTR is replaced with a heterologous promoter, e.g., cytomegalovirus (CMV) promoter, a Rous Sarcoma Virus (RSV) promoter, a thymidine kinase promoter, or an Simian Virus 40 (SV40) promoter.
  • CMV cytomegalovirus
  • RSV Rous Sarcoma Virus
  • SV40 Simian Virus 40
  • the right (3’) retroviral LTR is absent.
  • the retroviral LTR is a lentiviral LTR.
  • the nucleic acid constmct or vector comprises a human p-globin gene upstream locus control region (LCR).
  • the upstream locus control region (LCR) comprises one or more (e.g., 2 or 3) tmncated DNase I hypersensitive sites, HS2, HS3 and HS4 of the LCR.
  • the nucleic acid construct or vector comprises a cis-acting posttranscriptional regulatory element.
  • the posttranscriptional regulatory element is a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE).
  • the nucleic acid constmct or vector comprises a polyadenylation signal and/or origin.
  • the polyadenylation signal is an SV40 polyadenylation signal.
  • the origina is an S V40 origin. The polyadenylation signal and/or origin can be located 3’ of the right (3’) retroviral LTR.
  • the nucleic acid construct or vector comprises one or more (e.g., two, three, four, or all) of a) a left (5') retroviral LTR; b) human p-globin gene; c) human p-globin gene upstream locus control region (LCR); d) a cis-acting posttranscriptional regulatory element; e) a right (3 ') retroviral LTR; and f) a S V40 polyadenylation signal and/or SV40 origin.
  • the nucleic acid constmct or vector comprises a nucleic acid cassette comprising one or more (e.g., two, three, four, or all) of a) a left (5') retroviral LTR; b) human p- globin gene; c) human p-globin gene upstream locus control region (LCR); d) a cis-acting posttranscriptional regulatory element; e) a right (3') retroviral LTR; and f) a SV40 polyadenylation signal and/or SV40 origin.
  • a nucleic acid cassette comprising one or more (e.g., two, three, four, or all) of a) a left (5') retroviral LTR; b) human p- globin gene; c) human p-globin gene upstream locus control region (LCR); d) a cis-acting posttranscriptional regulatory element; e) a right (3') retroviral LTR;
  • the nucleic acid construct or vector further comprises one or more (e.g., 2 or 3) of a Psi packaging sequence ('P+), a central polypurine tract/DNA flap (cPPT/FLAP), or a retroviral export element-rev response element (RRE).
  • 'P+ Psi packaging sequence
  • cPPT/FLAP central polypurine tract/DNA flap
  • RRE retroviral export element-rev response element
  • the nucleic acid construct or vector comprises the nucleotide sequence SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO : 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, or a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity thereto.
  • the nucleic acid construct or vector comprises a nucleotide sequence that is complementary to the nucleotide sequence SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO : 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, or a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity thereto.
  • the nucleic acid construcxt or vector further comprises a truncated erythroid cell expression control sequence.
  • the lentiviral nucleic acid construct or vector is an HIV nucleic acid construct or vector.
  • the lentiviral nucleic acid construct or vector may be derived from human immunodeficiency- 1 (HIV-1), human immunodeficiency -2 (HIV-2), simian immunodeficiency virus (SIV), feline immunodeficiency virus (FIV), bovine immunodeficiency virus (BIV), Jembrana Disease Virus (JDV), equine infectious anemia virus (EIAV), caprine arthritis encephalitis virus (CAEV), and the like.
  • compositions comprising a nucleic acid construct or vector described herein or a cell described herein, and a pharmaceutically acceptable carrier.
  • the pharmaceutically acceptable carrier is suitable for parenteral administration, e.g., intravascular (intravenous or intraarterial), intraperitoneal, or intramuscular administration.
  • exemplary pharmaceutically acceptable carriers include sterile aqueous solutions or dispersions and sterile powders for the preparation of sterile injectable solutions or dispersion.
  • the use of such media and agents for pharmaceutically active substances is well known in the art.
  • the compositions of the disclosure can comprise, for example, one or more polypeptides, polynucleotides, vectors comprising same, or transduced cells, formulated in pharmaceutically - acceptable or physiologically -acceptable solutions for administration to a cell or an animal, either alone, or in combination with one or more other therapeutic agents or modalities.
  • the compositions of the disclosure may also be administered in combination with other agents, including, but not limited to, cytokines, growth factors, hormones, small molecules, or other pharmaceutically -active agents.
  • compositions of the disclosure formulation of pharmaceutically - acceptable excipients and carrier solutions is well-known to those of skill in the art, as is the development of suitable dosing and treatment regimens for using the particular compositions described herein in a variety of treatment regimens, including, but not limited to, parenteral, intravenous, and intramuscular administration and formulation.
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and/or vegetable oils.
  • polyol e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like
  • suitable mixtures thereof e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like
  • vegetable oils e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like
  • Proper fluidity may be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
  • the prevention of the action of microorganisms can be facilitated by various antibacterial and antifungal agents.
  • aqueous solutions For parenteral administration in an aqueous solution, for example, the solution should be suitably buffered if necessary and the liquid diluent first rendered isotonic with sufficient saline or glucose.
  • aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous, and intraperitoneal administration. Some variation in dosage will necessarily occur depending on the condition of the subject being treated. The person responsible for administration will, in any event, determine the appropriate dose for the individual subject.
  • Sterile injectable solutions can be prepared by incorporating the active compounds in the required amount in the appropriate solvent with the various other ingredients enumerated above, as required, followed by filtered sterilization.
  • dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above.
  • the preferred methods of preparation are vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
  • compositions disclosed herein may be formulated in a neutral or salt form.
  • Pharmaceutically -acceptable salts include the acid addition salts (formed with the free amino groups of the protein) and which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, mandelic, and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, histidine, procaine and the like.
  • solutions Upon formulation, solutions will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective.
  • the formulations are easily administered in a variety of dosage forms such as injectable solutions, drug-release capsules, and the like.
  • compositions or formulations described herein can comprises a cell contacted with a combination of any number of polypeptides, polynucleotides, and small molecules, as described herein.
  • compositions that comprise a therapeutically - effective amount of one or more polynucleotides or polypeptides, as described herein, formulated together with one or more pharmaceutically acceptable carriers (additives) and/or diluents (e.g., pharmaceutically acceptable cell culture medium).
  • the disclosure provides formulations or compositions suitable for the delivery of viral vector systems (e.g., viral-mediated transduction), including, but not limited to, retroviral (e.g., lentiviral) vectors.
  • viral vector systems e.g., viral-mediated transduction
  • retroviral vectors e.g., lentiviral
  • Exemplary formulations for ex vivo delivery include, but are not limited to, the use of various transfection agents known in the art, such as calcium phosphate, electroporation, heat shock, and various liposome formulations (e.g., lipid-mediated transfection).
  • various transfection agents known in the art, such as calcium phosphate, electroporation, heat shock, and various liposome formulations (e.g., lipid-mediated transfection).
  • nucleic acid constructs, vectors, compositions, and cells described herein can be used in methods of treating or preventing thalassemia, e.g., p-thalassemia.
  • the vector is administered by direct injection to a cell, tissue, or organ of a subject in need of gene therapy, e.g., in vivo.
  • the cell is transduced in vitro or ex vivo with a nucleic acid construct or vector described herein, and optionally expanded ex vivo.
  • the transduced cell is then administered to a subject in need of gene therapy.
  • Cells suitable for transduction or administration in the methods described herein include, but are not limited to, stem cells, progenitor cells, and differentiated cells.
  • the transduced cell is a hematopoietic stem cell.
  • the transduced cells are hematopoietic stem and/or progenitor cells, e.g., isolated from bone marrow, umbilical cord blood, or peripheral circulation.
  • the transduced cells are hematopoietic stem cells, e.g., isolated from bone marrow, umbilical cord blood, or peripheral circulation.
  • Hemapoietic stem or pluripotent cells may be identified according to certain phenotypic or genotypic markers, which are known in the art.
  • the disclosure provides a method of treating a disorder.
  • the method comprises administering to a subject (e.g., a human subject) in need thereof an effective amount of a nucleic acid construct or vector described herein, or a cell (e.g., a hematopoietic stem or progenitor cell) transduced with a nucleic acid construct or vector described herein, thereby treating the disorder.
  • the effective amount is a therapeutically effective amount.
  • the effective amount is a prophylactically effective amount.
  • the disorder is a disorder is associated with a defective p-globin gene.
  • the disorder is thalassemia (e.g., p-thalassemia).
  • the method further comprises obtaining a cell (e.g., a hematopoietic stem or pluripotent cell) from the subject.
  • the method further comprises transducing a cell (e.g., a hematopoietic stem or pluripotent cell) from the subject with a nucleic acid construct or vector described herein.
  • the method further further comprises isolating the transduced cell.
  • the method further comprises administering to the subject a second therapeutic agent or modality.
  • the disclosure provides a method of providing a transduced cell.
  • the method comprises administering to a subject (e.g., a human subject) in need thereof a cell (e.g., a hematopoietic stem or progenitor cell) transduced with a nucleic acid constmct or vector described herein.
  • a subject e.g., a human subject
  • a cell e.g., a hematopoietic stem or progenitor cell
  • the disclosure provides a method of treating a hemoglobinopathy.
  • the method comprises administering to a subject (e.g., a human subject) in need thereof a nucleic acid construct or vector described herein, or a cell (e.g., a hematopoietic stem or progenitor cell) transduced with a vector described herein.
  • a subject e.g., a human subject
  • a cell e.g., a hematopoietic stem or progenitor cell
  • the disclosure provides a method of selectively expanding the number erythroid cells.
  • the method comprises administering to a subject (e.g., a human subject) in need thereof a nucleic acid construct or vector described herein, or a cell (e.g., a hematopoietic stem or progenitor cell) transduced with a nucleic construct or vector described herein.
  • a subject e.g., a human subject
  • a cell e.g., a hematopoietic stem or progenitor cell
  • the disclosure provides a method of increasing the proportion of red blood cells or erythrocytes compared to white blood cells or leukocytes in a subject.
  • the method comprises administering a nucleic acid construct or vector described herein, or a cell (e.g., a hematopoietic stem or progenitor cell) transduced with a nucleic acid construct or vector described herein.
  • the transduced cell is administered to the subject intravenously.
  • the transduced cells are administered to the subject at a dose of about IxlO 5 to about IxlO 8 cells, e.g., about IxlO 6 to about IxlO 7 cells, about IxlO 6 to about IxlO 8 cells, about IxlO 7 to about IxlO 8 cells, about IxlO 5 to about IxlO 7 cells, or about IxlO 5 to about IxlO 6 cells.
  • the transduced cells are administered as a single dose. Enumerated Emobidments
  • a vector comprising: a) a left (5') retroviral LTR; b) a human p-globin gene; c) a human p-globin gene upstream locus control region (LCR); d) a cis-acting posttranscriptional regulatory element; e) a right (3') retroviral LTR; and f) a cis-acting element SV40 polyadenylation signal and/or SV40 origin.
  • LCR human p-globin gene upstream locus control region
  • upstream locus control region comprises truncated DNase I hypersensitive sites, HS2, HS3 and HS4.
  • the vector of embodiment 12, wherein the wildtype WPRE comprises the nucleotide sequence of SEQ ID NO: 32, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, or 99% identity thereto.
  • mutated WPRE comprises the nucleotide sequence of SEQ ID NO: 33, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, or 99% identity thereto.
  • the human p-globin gene comprises one, two, or all of the nucleotide sequences of SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, or 99% identical thereto.
  • the vector of any of embodiments 1-16 which is a lentivirus vector.
  • composition comprising the vector of any of embodiments 1-22 and a pharmaceutically acceptable carrier.
  • composition comprising a cell transduced with the vector of any of embodiments 1-22 and a pharmaceutically acceptable carrier.
  • a method of treating p-thalassemia comprising administering to a subject in need thereof an effective amount of a cell transduced with the vector of any of embodiments 1-22, thereby treating p- thalassemia.
  • a formulation comprising the vector of any of embodiments 1-22, a buffer, a stabilizer, and sodium chloride.
  • the stabilizer comprises a sugar or a polyhydric alcohol, e.g., sucrose, trehalose, sorbitol, inositol, glucose, or dextran.
  • a sugar or a polyhydric alcohol e.g., sucrose, trehalose, sorbitol, inositol, glucose, or dextran.
  • FIG. 1 three vectors, P002, P005, and P006, were designed with woodchuck hepatitis virus post-transcriptional regulatory element (WPRE), SV40 virus polyadenylation signal (SV40 pA signal), and/or SV40 virus replication origin (SV40 ori) incorporated.
  • WPRE woodchuck hepatitis virus post-transcriptional regulatory element
  • SV40 pA signal SV40 virus polyadenylation signal
  • SV40 ori SV40 virus replication origin
  • the gene expression frames designed in Example 1 were cloned into a lentiviral vector backbone, which was from the third generation lentiviral vector backbone made in-house by Kanglin Biotech (Hangzhou) Co., Ltd., pKL-Kan (SEQ ID NO: 1) (FIG. 2).
  • the P-globin gene expression frame P001 (SEQ ID NO: 2) designed in Example 1 was synthesized by Nanjing Genscript Biotechnology Co., Ltd. and cloned in between the multi-cloning sites Xhol/Kpnl of the lentiviral vector backbone pKL-Kan by the homologous recombination method well-known to the field.
  • the sequence of the resultant construct was confirmed by sequencing and named as pKL-Kan-TH-POOl (SEQ ID NO: 3).
  • the P-globin gene expression frame P002 (SEQ ID NO: 4) with an incorporated WPRE was synthesized by Nanjing Genscript Biotechnology Co., Ltd. and cloned in between LCR and 3' LTR of the lentiviral vector pKL-Kan-TH-POOl by the homologous recombination method.
  • the sequence of the resultant construct was confirmed by sequencing and named as pKL-Kan-TH-P002 (SEQ ID NO: 5).
  • the P-globin gene expression frame P005 (SEQ ID NO: 6) with an incorporated SV40 pA signal plus SV40 ori was synthesized by Nanjing Genscript Biotechnology Co., Ltd. and cloned in between 3' LTR and kan ori of the lentiviral vector pKL-Kan-TH-POOl by the homologous recombination method.
  • the sequence of the resultant construct was confirmed by sequencing and named as pKL-Kan-TH-P005 (SEQ ID NO: 7).
  • the WPRE fragment was amplified by PCR and using pKL-Kan-TH-P002 as a template and cloned in between LCR and S V40 pA signal of the lentiviral vector pKL-Kan-TH-P005 by the homologous recombination method.
  • the sequence of the resultant construct was confirmed by sequencing and named as pKL-Kan-TH-P006 (SEQ ID NO: 8).
  • Example 3 Packaging of lentiviruses containing human P-globin gene
  • the lentiviral vectors of P-globin gene (pKL-Kan-TH-POOl, pKL-Kan-TH-P002, pKL-Kan-TH-P005, or pKL-Kan-TH-P006) constructed in Example 2, envelope plasmid (pKL-Kan-Vsvg; SEQ ID NO: 9), and packaging plasmids (pKL-Kan- Rev (SEQ ID NO: 10) and pKL-Kan-GagPol (SEQ ID NO: 11) were used to co-transfect 293T cells (purchased from ATCC; stock number: CRL-3216) on a 10-cm 2 cell culture dish, by PEI (a cationic polymer)-mediated transient transfection of eukaryotic cells according to manufacturer's instructions.
  • PEI-Max transfection reagent was from Polysciences (Catalog Number: 24765-1).
  • lentiviruses (supernatant of the transfected cells) were harvested, and aliquots were stored at -80°C. Variable volumes of lentivirus was inoculated into human CD4+ T cell line-MT4 cell line (purchased from Shanghai Suoer Biotechnology Co., Ltd.) pre-plated in 96- well cell culture plates.
  • Culture supernatant from the cells transfected with a lentiviral vector containing an EGFP reporter gene (lentivirus packaged with pCCL-sin-EFlcx-WPRE-EGFP using the above-described method) was used as positive control, and initial transfection titers of lentivirus in the harvested supernatant were calculated by quantitative PCR (qPCR) and flow cytometry data based on GFP signal using the well-known method in the field.
  • qPCR quantitative PCR
  • flow cytometry data based on GFP signal using the well-known method in the field.
  • LV probe 5’ -CCTCCAGGTCTGAAGATCAGCGGCCGC-3 ’ (SEQ ID NO: 28) HK Forward primer: 5’-GCTGTCATCTCTTGTGGGCTGT -3’ (SEQ ID NO: 29) HK probe: 5’-CCTGTCATGCCCACACAAATCTCTCC -3’ (SEQ ID NO: 30) HK Reverse primer: 5’-ACTCATGGGAGCTGCTGGTTC -3’ (SEQ ID NO: 31)
  • the LV probe carries 6-FAM fluorescent dye at the 5'-end and TAMRA fluorescent dye at the 3'-end.
  • the HK probe carries CY5 fluorescent dye at the 5'-end and BHQ2 fluorescent dye at the 3'- end.
  • the qPCR program 94°C 5 min; 95°C 10 sec, 60°C 30 sec, 40 cycles.
  • the initial transfection titers of the lentiviruses in the harvested supernatants of the four different P-globin gene lentiviral vectors (pKL-Kan-TH-POOl, pKL-Kan-TH-P002, pKL-Kan-TH- P005, pKL-Kan-TH-P006) are shown in FIG. 3.
  • the data show that the cis-acting WPRE and the sequence of SV40 pA signal combined with SV40 ori all significantly increased the initial transfection titers of the lentiviruses in the harvested supernatants, and these two enhancements can be additive.
  • the P-globin gene lentiviral vectors (pKL-Kan-TH-P005, pKL-Kan-TH-P006) were used to transfect 293T cells cultured on 2 of the 15-cm 2 cell culture dishes using the same protocol as in Example 3, to package lentiviruses. 48 hours after transfection, lentiviruses (supernatant of the transfected cells) were harvested and centrifuged in a table-top bucket centrifuge for 5 min at 4000 rpm and room temperature to remove cell debris, followed by centrifuging at 10000 g, 4°C for 4 hours.
  • RPMI complete culture medium was added to the virus pellet to resuspend the virus particles using a micro sample injector.
  • the virus resuspension was aliquoted and stored at -80°C for future use.
  • Variable volumes of lentivirus resuspension were inoculated into MT4 cell line, and transfection titers of the lentivirus resuspension were calculated by qPCR and flow cytometry data based on GFP signal following the protocol described in Example 3.
  • K562 cells are of the erythroleukemia type, derived from a patient of chronic granulocytic leukemia (acute phase), which can produce a small amount of hemoglobin during the fetal development and bear some potential to differentiate into erythrocytes.
  • K562 cells were purchased from ATCC (stock number CCL-243). Based on the above calculated transfection titers of the lentiviruses containing P-globin gene of the resuspension, the lentiviruses were inoculated into K562 cells pre-plated in 96-well plates at various multiplicity of infection (MOI). Some cells were harvested at day 5, 10, and 13 after transfection and used for the following experiments.
  • MOI multiplicity of infection
  • K562 cells transduced by lentivirus were harvested and washed with PBS. Then the cells were collected after centrifuged at 4200 rpm for 5 min and resuspended in 50 uL QuickExtractTM DNA Extraction Solution (purchased from Lucigen; Catalog Number QE09050). The resuspended cells were lysed in a PCR machine running at the following conditions (Table 1) and total DNAs were isolated.
  • the transduced K562 cells were fixed in 4% paraformaldehyde in PBS and permeabilized with 0.1% Triton-XlOO in PBS, and stained with FITC-labeled mouse anti-human [1- globin mAb. Flow cytometry based on FITC signal was used to determine the percentage of K562 cells expressing human P-globin protein as well as the relative signal intensity of the expressed human (3-globin protein.
  • this invention also optimized the expression frame of P-globin gene, including intron sequences and coding sequences.
  • FIG. 4 Based on P006, we designed 6 other vectors (FIG. 4), comprising of, wild-type human P- globin gene sequence (P009), codon-optimized exons with T87Q mutation using method 3 (P011), codon-optimized exons with T87Q mutation using method 4 (P012), coding sequence optimized human P-globin gene with full-length intron 2 and T87Q mutation using method 4 (P015), coding sequence optimized human P-globin gene with full-length intron 2 but no T87Q mutation using method 2 (P019), or coding sequence optimized human P-globin gene with full-length intron 2 and T87Q mutation using method 4 but with WPRE removed (P021).
  • P009 wild-type human P- globin gene sequence
  • P011 codon-optimized exons with T87Q mutation using method 3
  • P012 codon-optimized exons with T87Q mutation using method 4
  • P015 coding sequence optimized human P-glob
  • the wild-type human P-globin gene sequence (SEQ ID NO: 12) was amplified by the well- known PCR method in the field, using genomic DNAs isolated from 293T cells, which was derived from human (purchased from ATCC; stock number CRL-3216), as template.
  • the amplified PCR fragment was cloned in between cPPT/CTS and LCR of pKL-Kan-TH-P006 by the homologous recombination method well-known to the field.
  • the sequence of the resultant vector was confirmed by sequencing and named as pKL-Kan-TH-P009 (SEQ ID NO: 13).
  • the sequence of the full-length intron 2 of human P-globin gene was amplified by PCR using the plasmid DNA of pKL-Kan-TH-P009 as a template and cloned in between exon 2 and exon 3 of pKL-Kan-TH-P012 by homologous recombination.
  • the sequence of the resultant vector was confirmed by sequencing and named as pKL-Kan-TH-POl 5 (SEQ ID NO: 18).
  • the T87Q mutation of pKL-Kan-TH-P015 was changed back to T87 by a site-directed mutagenesis kit (purchased from Vazyme Biotech Co., Ltd.; catalog number C214) and confirmed by sequencing.
  • the new vector was named as pKL-Kan-TH-P019 (SEQ ID NO: 19).
  • pKL-Kan-TH-P015 plasmid DNA As a template, two fragments not including the WPRE sequence were amplified and recombined by homologous recombination. The sequence of the resultant new vector was confirmed by sequencing and named as pKL-Kan-TH-P021 (SEQ ID NO: 20).
  • lentiviruses were packaged in 293T cells for the lentiviral vectors pKL-Kan-TH-P006, pKL-Kan-TH-POl 1, and pKL-Kan-TH-P012 constructed in Example 6, and the lentivirus resuspension was aliquoted and stored at -80°C for future use.
  • the expression of P-globin gene mediated by lentivirus was tested in cultured cells. Based on the calculated transfection titers of the lentiviruses containing P-globin gene of the resuspension, the lentiviruses were inoculated into K562 cells pre-plated in 96-well plates at the multiplicity of infection (MOI) shown in Table 4. Some cells were harvested at day 5, 10, and 15 after transduction and used for the following experiments.
  • MOI multiplicity of infection
  • K562 cells transduced by lentiviruses were harvested and lysed, and total DNAs were isolated.
  • the vector copy number (VCN) of the lentivirus of the transduced K562 cells were calculated by qPCR and flow cytometry data based on GFP signal (Table 4).
  • K562 cells transduced by lentiviruses were harvested.
  • Flow cytometry based on PE signal was used to determine the percentage of K562 cells expressing human P-globin protein as well as the relative signal intensity of the expressed human P-globin protein.
  • lentiviruses were packaged in 293T cells for the lentiviral vectors pKL-Kan-TH-P006, pKL-Kan-TH-P009, pKL-Kan-TH-P012, pKL-Kan-TH-P015, and pKL-Kan-TH-P019 constructed in Example 6, and the lentivirus resuspension was aliquoted and stored at -80°C for future use.
  • the expression of P-globin gene mediated by lentivirus was then tested in cultured cells. Based on the calculated transfection titers of the lentiviruses containing P-globin gene of the resuspension, the lentiviruses were inoculated into K562 cells pre-plated in 96-well plates at the multiplicity of infection (MOI) shown in Table 6. Some cells were harvested at day 5 and day 10 after transduction and used for the following experiments.
  • MOI multiplicity of infection
  • K562 cells transfected by lentiviruses were harvested and lysed, and total DNAs were isolated.
  • the vector copy number (VCN) of the lentivims of the transfected K562 cells were calculated by qPCR and flow cytometry data based on GFP signal (Table 6).
  • K562 cells transfected by lentiviruses were harvested.
  • Flow cytometry based on PE signal was used to determine the percentage of K562 cells expressing human P-globin protein as well as the relative signal intensity of the expressed human P-globin protein.
  • WPRE Woodchuck hepatitis virus Post-transcriptional Regulatory Element
  • SEQ ID NO: 33 a mutated WPRE
  • WPRE Woodchuck hepatitis virus Post-transcriptional Regulatory Element
  • the WPRE when placed in the 3' UTR of the gene of interest, can enhance the expression of the transgene in the early stages of RNA transcription by increasing mRNA levels in the nucleus and cytoplasm. When placed in the upstream of 3' LTR, transcription termination is improved, and therefore, transcript read-through can be significantly reduced.
  • the WPRE sequence was mutated at 6 bases (mut6), including 5 bases in the predicted WHX promoter region and 1 base of the starting codon, so that WHX could not initiate expression of the WPRE sequence, thereby enhancing safety.
  • the mutated version of WPRE was named mWPRE (SEQ ID NO:33), and P0012, after modification, was named TH04.
  • the mWPRE gene was synthesized and inserted between Mini and Kpnl of POO 12 by restriction enzyme cleavage and ligation. The new construct was confirmed by sequencing and named TH04.
  • This Example describes evaluation of the efficacy of the TH04 vector in a mouse model of thalassemia.
  • the thalassemia model Hbbth-4/Hbb+ mice (purchased from Southern Model Organisms) were used to test efficacy of the TH04 vector.
  • the mice were 11 weeks old, with females as donors and males as recipients.
  • the bone marrow hematopoietic stem/progenitor cells were collected and purified from donor mice, transduced with TH04 lentivirus ex vivo, and infused into the recipient mice via the tail vein injection.
  • the therapeutic effect of TH04 lentivirus was assessed by determining the vector copy number, chimeric rate, and changes in thalassaemia-related blood indicators.
  • mice Three groups were tested: the treatment group, the negative control group, and the positive control group.
  • the negative control group G 1
  • purified bone marrow stem cells from female Hbbth4 mice without LV-TH04 transduction were transplanted into male Hbbth4 mice.
  • the treatment group G2
  • purified bone marrow stem cells from female Hbbth4 mice after LV-TH04 transduction were transplanted into male Hbbth4 mice.
  • G3 purified bone marrow stem cells from female C57BL/6 mice were transplanted into male Hbbth4 mice. Table 8 includes details of the experimental groups.
  • Isolation of mouse bone marrow stem cells After euthanizing the donor animals with carbon dioxide, the femur, tibia, and iliac were quickly separated in a biosafety cabinet and immediately transferred to a sterile Petri dish containing DPBS to prevent the bones from drying out. Bone marrows were rinsed with 5 mL DPBS (2% fetal bovine serum)/mouse into a new 50-mL tube with a 70 gm cell strainer, and bone marrow cells suspensions were centrifuged at 500xg for 5 min at room temperature.
  • DPBS 2% fetal bovine serum
  • mice bone marrow stem cells were purified with Lineage Cell Depletion Kit and c-Kit positive sorting kit from MACS according to manufacturer's instructions.
  • the transduced cells for the treatment group, as well as the cells of the negative control group and the positive control group, were continued to be cultured in a 5% CO2 cell culture incubator for two days.
  • Irradiation of recipient animals irradiation and cell transfusion On the day when culturing of bone marrow cells was finished, recipient animals were subjected to myeloablative conditioning with X-ray irradiation (4.5Gy), twice, 3 h apart. The cultured and collected cell suspensions were infused individually by tail vein injection to groups of animals within two hours after the myeloablative conditioning was completed, and the cells were infused at 1E+06 cells/ animal.
  • VCN and chimeric rate in PBMCs of mice 100 pL of whole blood samples were collected by retro-orbital bleeding at 4, 6 and 8 weeks after bone marrow transplantation of recipient animals, and about 5E+05 PBMCs were isolated after density gradient centrifugation and used for chimeric rate and VCN analysis.
  • the PBMC genomic DNAs were extracted by magnetic bead genome extraction kit, and the concentration of each extracted template DNA was determined by microspectrophotometer.
  • the genomic DNA samples were uniformly diluted with ultrapure water to about 50 ng/pL. Determination of chimeric rate and VCN was accomplished with real-time PCR.
  • VCN Mouse MKL3 gene was used as the reference gene, and LTR as the gene detection primer probe for integration of lentiviral vectors into cells.
  • the sequences for primers and probes are shown in Table 9, the reaction system is shown in Table 10, and the reaction procedure is shown in Table 11.
  • VCN determination results of the VCN determination are shown in FIG. 5.
  • the VCN determination in PBMC showed that the VCN of PBMC in the LV-TH04 transduction group was between 1 ⁇ 4, which was as expected.
  • chimeric rate The sample preparation and method of chimeric rate determination were the same as those of VCN determination, except that the LTR primers and probe were replaced with those for the SRY gene, which is a gene unique to the mouse Y chromosome.
  • SRY gene which is a gene unique to the mouse Y chromosome.
  • the SRY sequences are shown in Table 12.
  • the reaction system is the same as Table 10, except that the LTR primers and probe were replaced with those for SRY.
  • the reaction procedure is the same as Table 11.
  • results of the chimeric rate analyses are shown in FIG. 6.
  • the chimeric rate assay of PBMCs showed that the implantations of bone marrow stem cells in the three groups were consistent, indicating that LV-TH04 transduction did not affect the implantation of stem cells.
  • Routine blood tests Whole blood samples of 50 pL were collected by retro-orbital bleeding from recipient animals for complete blood count (CBC) at 4, 6, and 8 weeks after bone marrow transplantation. The results of main indicators related to thalassaemia are shown in FIG. 7. After transduction and infusion, the LV-TH04 transduction group had significantly improved the hemoglobin content, hematocrit, and average red blood cell volume compared with the Mock group, while the levels of reticulocytes was significantly decreased in the TH04 transduction group compared with the Mock group (FIG. 7). The levels of hemoglobin content, reticulocytes, hematocrit, and average red blood cell volume were similar between the LV-TH04 transduction group and the positive control group (FIG. 7). These data demonstrates the high therapeutic efficacy of TH04 in animal models of the thalassaemia, with curative effects achieved.
  • CBC complete blood count
  • Example 11 Clinical data 1 - Expression assay in red blood cells directionally differentiated from CD34+ stem cells isolated from thalassemia major patients after ex vivo transduction with LV-TH04
  • This Example describes the effects of TH04 on red blood cells directionally differentiated from CD34+ stem cells isolated from thalassemia major patients.
  • HPLC assay conditions include: column C4 4.6*250nm: UV 220nm detection; Sample loading, 20uL. Table 13. HPLC assay conditions
  • Example 12 Clinical data 2 - Myeloablative conditioning protocols generally shortened neutrophil engraftment time and platelet recovery time
  • This Example describes the effects of different myeloablative condition protocols on neutrophil engraftment time and platelet recovery time in patients infused with lentivirally transduced hematopoietic stem cells.
  • myeloablative conditioning based on BU/CY:
  • Busulfan was intravenously administered for 2 hours and every 6 hours at a dosage of 2.4-4.8 mg/kg/day. Cyclophosphamide was administered 24 hours after busulfan administration. The dosage of cyclophosphamide was 45 to 65 mg/kg/day intravenously. The duration of administration of busulfan was 2 to 4 days, and the duration of administration of cyclophosphamide was 1 to 5 days. Infusion of the composition began 24-72 hours after cyclophosphamide administration.
  • Myeloablative conditioning based on BU Myeloablative conditioning based on BU:
  • Busulfan was intravenously infused for 2 hours and every 6 hours at a dosage of 3.2 mg/kg/day. The duration of administration of busulfan was 4 days. Reinfusion of the composition began 72 hours after busulfan administration.
  • Platelet levels in PJYU and ZRHA showed a continuous upward trend from days 17 and 11, respectively, and recovered to normal levels (>100* 10 9 /L) on days 48 and 29, respectively.
  • Platelet levels in FAZH fluctuated between 20-40* I () 9 /L for up to 28 days, and only began to rise on day 43 and recovered to normal levels for the first time by day 56 (FIG. 10).
  • Example 13 Determination of stabilizers for pharmaceutical compositions comprising lentiviral vectors
  • This Example describes screening and evaluation of stabilizers for pharmaceutical compositions comprising, e.g., lentiviral vectors for thalassemia gene therapy.
  • the addition of sugars or polyhydric alcohols to the formulation inhibited the inactivation of lentiviral particles caused by microtherm and repeated freeze-thaw processes.
  • the formulation with sucrose exhibited the best performance, demonstrating significant protection compared with the formulation without sugars or poly hydric alcohols.
  • the combination of sodium citrate and sucrose in the formulation resulted in good bioactivity of lentiviral particles after repeated freeze-thaw, regardless of the ratio of sodium citrate and sucrose.
  • formulations comprising varying ratios of sodium citrate and sucrose, under isotonic conditions, effectively inhibited loss of the titers and bioactivity of the lentiviral vector particles.
  • Example 14 Determination of buffers for pharmaceutical compositions comprising lentiviral vectors
  • This Example describes screening and evaluation of buffers for pharmaceutical compositions comprising, e.g., lentiviral vectors for thalassemia gene therapy.
  • Initial screening of buffers was performed by dispersing purified lentiviral vectors for thalassemia gene therapy into the systems shown in Table 18 to form a formulation. Each formulation was tested as follows:
  • Table 18 Components of formulations tested during initial screening of buffers.
  • the sodium citrate buffer exhibited a better effect on stabilizing the biological activity of lentiviral particles when compared with other buffers. No obvious inactivation of viral particles was observed when using the sodium citrate buffer, indicating that viral particles are more stable in formulations with this buffer than in traditional formulations.
  • the formulations tested e.g., comprising the stabilizers and/or buffers described in Examples 13 and 14, provide a number of benefits, including good freeze-thaw stability and storage stability for lentiviral particles.
  • the formulations can effectively prevent loss of the biological activity of viral particles caused by repeated freeze-thaw and storage at low temperature, and the viral particles still exhibit good bioactivity after repeated freeze-thaw and long-term storage.
  • the formulations tested can disperse more active lentiviral particles in solution, with no obvious precipitation and turbidity observed even with 2-3 * 10 9 TU/mL viral particles.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Biophysics (AREA)
  • Epidemiology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Zoology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Virology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

Disclosed herein are gene therapy vectors used for efficiently transducing cells to express a human β-globin gene. Specifically disclosed is an expression vector which comprises: an expression cassette for a β-globin gene, which comprises exons and introns of human β-globin gene, as well as cis-acting elements including one or more of WPRE, SV40 polyadenylation signal and/or SV40 ori. The disclosed expression vectors have significantly enhanced viral vector packaging efficiency in viral vector packaging cell lines, which leads to effective integration of lentiviral vectors and high expression level of β-globin gene in target cells. Also disclosed are pharmaceutical compositions and therapeutic methods utilizing such expression vectors.

Description

NUCLEIC ACID CONSTRUCTS AND USES THEREOF
CROSS REFERENCE TO RELATED APPLICATIONS
This application claims to the benefit of U.S. Application No.: 18/383,596, filed October 25, 2023. The contents of the aforesaid application are hereby incorporated by reference in their entirety.
SEQUENCE LISTING
The instant application contains a Sequence Listing which has been submitted electronically in XML file format and is hereby incorporated by reference in its entirety. Said XML copy, created on October 22, 2024, is named K2046-7006WO_SL.xml and is 177,688 bytes in size.
FIELD OF DISCLOSURE
The present disclosure relates to the field of medical technology, in particular to gene therapy and nucleic acid constructs.
BACKGROUND
Inherited anemias such as thalassemia and sickle cell anemia are rare inherited blood diseases, most commonly in patients of Mediterranean, Middle Eastern, Indian and South Asian descent. Thalassemia is typically derived from the imbalance between the single chains of globin hemoglobin tetramer. The imbalance of red blood cell (RBC) a-globin and p-globin often produces various clinical symptoms, for example, 1) lack of sufficient red blood cells and hemoglobin, resulting in inadequacy of oxygen delivered to the whole body; 2) an increase in the hemolysis rate of red blood cells, leading to an increase in the mortality rate of chronic vascular system damage; and 3) spleen and liver damages caused by extreme load of ferine.
Current treatment methods for inherited anemias include, for example, blood transfusion therapy, iron chelation therapy, and splenectomy or splenic artery embolization. Allogeneic hematopoietic stem cell transplantation (e.g., allogeneic bone marrow transplantation, peripheral blood hematopoietic stem cell transplantation, or cord blood transplantation) could be a potential cure for thalassemia. However, the lack of transplant donors and the risk associated with transplantation limit the widespread use of allogeneic hematopoietic cell transplantation in patients with thalassemia.
Thus, there still exists a need for developing new therapies for thalassemia.
SUMMARY
In one aspect, the disclosure provides a vector comprising: a) a left (5') retroviral LTR; b) human p-globin gene; c) human p-globin gene upstream locus control region (LCR); d) a cis-acting posttranscriptional regulatory element; e) a right (3') retroviral LTR; and f) a SV40 polyadenylation signal and/or SV40 origin. In some embodiments, the sequence of the human p-globin gene comprises human p-globin gene exon 1, intron 1, exon 2, intron 2, and exon 3. In certain embodiments, the sequence of the human p-globin gene is according to Ensembl Database Gene: HBB (ENSG00000244734) Transcript: HBB-201 (ENST00000335295.4). In some embodiment, the human p-globin gene comprises a human P-globin promoter. In some embodiments, human p-globin promoter is about 250 to about 275 bp (e.g., 268 bp) upstream of exon 1 of the human p-globin promoter. In some embodiments, the human P-globin gene comprises a human p-globin 3 ’-enhancer. In certain embodiments, the human p-globin 3 ’-enhancer is about 850 bp to about 900 bp (e.g., 878 bp) downstream of exon 3 of the human p- globin gene. In some embodiments, the human p-globin gene comprises one or more (e.g., 2 or 3) wild-type exons. In some embodiments, the human p-globin gene comprises one or more (e.g., 2 or 3) codon-optimized exons. In some embodiments, the human p-globin gene comprises one or more wildtype introns. In certain embodiments, the human p-globin gene comprises a wild-type intron 2. In some embodiments, the human p-globin gene comprises one or more truncated introns. In certain embodiments, the human p-globin gene comprises a tmncated intron 2. In some embodiments, the human p-globin gene comprises a wild-type exon 2. In some embodiments, the human p-globin gene comprises an exon 2 that encodes a threonine to glutamine mutation at codon 87 (T87Q). In some embodiments, the human p-globin gene comprises the nucleotide sequence of SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, or a nucleotide sequence having at least 85%, 90%, 95%, 98%, or 99% sequence identity thereto, or any combination thereof.
In some embodiments, the upstream locus control region (LCR) comprises one or more (e.g., 2 or 3) truncated DNase I hypersensitive sites, HS2, HS3 and HS4 of the LCR. In some embodiments, the posttranscriptional regulatory element is a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE). In some embodiments, the SV40 poly adenylation signal and/or SV40 origin is located 3’ of the right (3’) retroviral LTR.
In some embodiments, the WPRE is wildtype WPRE or a mutated WPRE, e.g., a mutated WPRE described herein. In some embodiments, the wildtype WPRE comprises the nucleotide sequence of SEQ ID NO: 32, or a nucleotide sequence having at least 85%, 90%, 95%, 98%, or 99% sequence identity thereto. In some embodiments, the mutated WPRE comprises the nucleotide sequence of SEQ ID NO: 33, or a nucleotide sequence having at least 85%, 90%, 95%, 98%, or 99% sequence identity thereto.
In some embodiments, the vector is a lentivirus vector. In some embodiments, the left (5') retroviral LTR is a lentiviral LTR. In some embodiments, the right (3') LTR is a lentivirus LTR. In some embodiments, the left (5') and right (3’) retroviral LTRs are lentivirus LTRs. In some embodiments, the promoter of the left (5') retroviral LTR is replaced with a heterologous promoter. In some embodiments, the right (3') LTR is a self-inactivating (SIN) LTR. In some embodiments, the vector further comprises one or more (e.g., 2 or 3) of a Psi packaging sequence ('P+), a central polypurine tract/DNA flap (cPPT/FLAP), or a retroviral export element-rev response element (RRE).
In some embodiments, the vector comprises the nucleotide sequence of SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, and SEQ ID NO: 20, or a nucleotide sequence having at least 85%, 90%, 95%, 98%, or 99% sequence identity thereto.
In another aspect, the disclosure features a composition comprising a vector described herein and a pharmaceutically acceptable carrier.
In yet another aspect, the disclosure provides a cell comprising a vector described herein.
In some embodiments, the cell is a human cell. In some embodiments, the cell is selected from the group consisting of an embryonic stem cell, an adult stem cell, an adult progenitor cell, and a differentiated adult cell. In some embodiments, the cell is a hematopoietic stem cell or a hematopoietic progenitor cell. In some embodiments, the cell is a hematopoietic stem cell or a hematopoietic progenitor cell. In certain embodiments, the source of the stem or progenitor cell is bone marrow, cord blood, placental blood, or peripheral blood. In some embodiments, the cell is transduced with the vector.
In still another aspect, the disclosure provides a composition comprising a cell described herein and a pharmaceutically acceptable carrier.
In another aspect, the disclosure provides a method of treating p-thalassemia, comprising administering to a subject in need thereof an effective amount of a cell described herein, or a cell transduced with a vector described herein, thereby treating p-thalassemia.
In some embodiments, the method further comprises obtaining a cell from the subject. In some embodiments, the method further comprises transducing the cell with the vector. In some embodiments, the cell is a hematopoietic stem cell or a hematopoietic progenitor cell.
In some embodiments, the method further comprises administering to the subject an effective amount of busulfan and cyclophosphamide prior to administering the cell transduced with the vector to the subject. In some embodiments, busulfan is administered at a dose of 2 to 5 mg/kg/day, e.g., 2.4 to 4.8 mg/kg/day, intravenously. In some embodiments, busulfan is administered once every 6 hours. In some embodiments, cyclophosphamide is administered at a dose of 30-80 mg/kg/day, e.g., 45-65 mg/kg/day, intravenously. In some embodiments, cyclophosphamide is administered 18 to 30 hours, e.g., 24 hours, after busulfan is administered. In some embodiments, busulfan is administered for 2-4 days and cyclophosphamide is administered for 1-5 days. In some embodiments, the administration of the cell transduced the vector is initiated 24-72 hours after the administration of cyclophoshamide is completed.
In yet another aspect, the disclosure provides a method of pretreating a subject, comprising administering to the subject an effective amount of busulfan and cyclophosphamide prior to administering to the subject a therapy for p-thalassemia. In some embodiments, the therapy for p- thalassemia comprises a cell transduced with a vector comprising a human p-globin gene, e.g., a cell described herein, or a cell transduced with a vector described herein, to the subject. In some embodiments, busulfan is administered at a dose of 2 to 5 mg/kg/day, e.g., 2.4 to 4.8 mg/kg/day, intravenously. In some embodiments, busulfan is administered once every 6 hours. In some embodiments, cyclophosphamide is administered at a dose of 30-80 mg/kg/day, e.g., 45-65 mg/kg/day, intravenously. In some embodiments, cyclophosphamide is administered 18 to 30 hours, e.g., 24 hours, after busulfan is administered. In some embodiments, busulfan is administered for 2-4 days and cyclophosphamide is administered for 1-5 days. In some embodiments, the administration of the cell transduced the vector is initiated 24-72 hours after the administration of cyclophshamide is completed. In some embodiments, the subject is pretreated in accordance with a method described in Examples 9-12.
In still another aspect, the disclosure provides a formulation comprising the vector described herein, a buffer, a stabilizer, and sodium chloride.
In some embodiments, the vector is present at a concentration of IxlO8 TU/mL to IxlO10 TU/mL. In some embodiments, the vector is present at a concentration of 5xl08 TU/mL to 5xl09 TU/mL. In some embodiments, the vector is present at a concentration of 5xl08 TU/mL to IxlO9 TU/mL, e.g., 6xl08 TU/mL or 6.2* 108 TU/mL. In some embodiments, the vector is present at a concentration of IxlO9 TU/mL to 5xl09 TU/mL. In some embodiments, the vector is present at a concentration of 2* 109 TU/mL to 3*109 TU/mL, e.g., 2.5*109 TU/mL or 2.8xl09 TU/mL.
In some embodiments, the buffer is phosphate buffer, sodium citrate, or PIPES. In some embodiments, the buffer is present at a concentration of 10 mM to 50 mM, e.g., 10 mM to 30 mM, 20 mM to 40 mM, 30 mM to 50 mM, or 10 mM to 40 mM. In some embodiments, the buffer is present at a concentration of 10 mM, 20 mM, or 40 mM.
In some embodiments, the stabilizer comprises a sugar or a polyhydric alcohol, e.g., sucrose, trehalose, sorbitol, inositol, glucose, or dextran. In some embodiments, the stabilizer is present at a concentration of 1% to 5%, e.g., 1% to 3%, 2% to 3%, or 1% to 2.5%. In some embodiments, the stabilizer is present at a concentration of 1%, 2%, or 2.5%.
In some embodiments, sodium chloride is present at a concentration of 50 mM to 200 mM, e.g., 50 mM to 70 mM, 70 mM to 90 mM, 80 mM to 100 mM, 100 mM to 120 mM, 140 mM to 160 mM, lOOmM to 150mM, or 50 mM to 150 mM. In some embodiments, sodium chloride is present at a concentration of 50 mM, 60 mM, 75 mM, 80 mM, 90 mM, 110 mM, 140 mM, or 150 mM.
In some embodiments, the formulation comprises a vector described herein, sodium citrate, sucrose, and sodium chloride. In some embodiments, the vector is present at a concentration of 5xl08 TU/mL to 5xl09 TU/mL, sodium citrate is present at a concentration of 20 mM to 40 mM, sucrose is present at a concentration of 1% to 2%, and sodium chloride is present at a concentration of 100 mM to 150 mM. In some embodiments, the formulation is any of the formulations described in Examples 13-
14.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 depicts the schematic design of exemplary viral vector constmcts.
FIG. 2 depicts a diagram of an exemplary lentiviral vector packaging backbone plasmid without insertion of gene of interest.
FIG. 3 depicts viral vector packaging efficiency for exemplary viral vector constructs shown in FIG. 1.
FIG. 4 depicts the schematic design of additional exemplary viral vector constructs.
FIG. 5 is a graph depicting VCN values in PBMCs of recipient mice in the mock (without transduction), LV-TH04 (transduction), and positive (wild-type C57BL/6 cells) groups. Blood samples were collected 4, 6 and 8 weeks after bone marrow transplantation of the recipient mice.
FIG. 6 is a graph depicting the chimeric rate (%) of PBMCs of recipient mice in the mock (without transduction), LV-TH04 (transduction), and positive (wild-type C57BL/6 cells) groups. Blood samples were collected 4, 6 and 8 weeks after bone marrow transplantation of the recipient mice.
FIG. 7 is a series of graphs depicting the hemoglobin content (HGB (g/L); top left graph), percentage of reticulocytes (RET%; top right graph), hematocrit levels (HCT(%); bottom left graph), and average red blood cell volume (MCV(fL); bottom right graph) of recipient mice in the mock (without transduction), LV-TH04 (transduction), and positive (wild-type C57BL/6 cells) groups. Blood samples were collected 4, 6 and 8 weeks after bone marrow transplantation of the recipient animals. FIG. 8 is a series of chromatograms from HPLC assays using supernatants collected from cells transduced LV-TH04 (top chromatogram) or cells without LV-TH04 (bottom chromatogram). The P- globin and a-globin peaks are indicated.
FIG. 9 is a graph depicting the absolute neutrophil count (109/L) after infusion of LV-TH04- transduced hematopoietic stem cells. Subjects PJYU and ZRHA were treated with myeloablative conditioning based on BU/CY; subject FAZH was treated with myeloablative conditioning based on BU.
FIG. 10 is a graph depicting platelet count (109/L) after infusion of LV-TH04-transduced hematopoietic stem cells. Subjects PJYU and ZRHA were treated with myeloablative conditioning based on BU/CY; subject FAZH was treated with myeloablative conditioning based on BU.
FIG. 11 is a graph depicting the loss (%) of lentiviral particles in the formulations described in Table 15 after being placed at room temperature for 1 day, placed at 4 °C for 3 days, or placed under conditions of freeze-thaw for 3 times.
FIG. 12 is a graph depicting the lentiviral titers (TU/mL) of the formulations described in Table 16 after being placed under conditions of freeze-thaw for 3 times, or placed under conditions of freezethaw for 9 times. FIG. 13 is a graph depicting the lentiviral titers (TU/mL) of the formulations described in Table 17 after being placed under conditions of freeze-thaw for 3 times.
FIG. 14 is a graph depicting the loss (%) of lentiviral particles in the formulations described in Table 18 after being placed at room temperature for 1 day, placed at 4°C for 3 days, or placed under conditions of freeze-thaw for 3 times.
FIG. 15 is a graph depicting the lentiviral titers (TU/mL) of a formulation comprising sodium citrate (20mM), sodium chloride (1 lOrnM), and sucrose (1%), or PBS under control conditions, or after being placed at 4°C for 1 day, placed at 4°C for 3 days, or placed at room temperature for 1 day.
DETAILED DESCRIPTION
Lentiviral vectors have the characteristic of host genome integration and therefor are widely considered desirable gene deliver vectors for various genetic diseases, such as hereditary anemia, caused by the loss expression of a single gene. Autologous hematopoietic stem cell therapy can be a promising curative therapy for severe hereditary anemia. Basically, a functional gene encoding a human p-globin peptide chain is introduced into a patient’s hematopoietic stem cells ex vivo by lentiviral vector transduction and the transduced cells are infused back to the patient. Without being limited by the availability of donors and associated risk of rejection of transplanted cells and/or graft- versus-host disease, the methods described herein may achieve complete cure of thalassemia by a onetime treatment.
The human p-globin gene comprise a promoter region, 3 exons and 2 introns, a downstream enhancer region, and an endogenous upstream gene expression control region sequence DNase I hypersensitive sites (HSs). The total length of the gene exceeds 60,000 base pairs (bp), which is difficult to be included in any kind of gene therapy vector. For decades, scientists have worked to develop a relatively small p-globin gene expression framework so that it can be used in gene therapy.
However, the commercial production of exisiting vectors for treating disorders associated with a defective human p-globin gene face a number of difficulties. For example, the vector production rate tends to be low, which greatly increases the production cost and eventually the drug cost. In addition, the gene expression efficiency is oftentimes not optimized, and the viral copy number (VCN) in hematopietic stem cells, one of the most critical quality attributes, still needs to be significantly improved.
The nucleic acid constructs, vectors, compositions, cells, and methods described herein can have various beneficial effects, for example, 1) significantly enhanced virus packaging efficiency; 2) stronger and more efficient vector integration into target cell genome; 3) better clinical efficacy with a lower dose, reducing immunogenicity; 4) higher vector production efficiency and lower production cost; and 5) a wide range of applications, including generation of various forms of vectors for the gene therapy of hereditary anemia. Definitions
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the disclosure pertains.
As used herein, the term “a” and “an” refers to one or to more than one (i.e. , to at least one) of the grammatical object of the article.
As used herein, the term “about” or “approximately” when referring to a measurable value such as an amount, a temporal duration, and the like, are meant to encompass variations of ±20% or in some instances ±10%, or in some instances ±5%, or in some instances ±1%, or in some instances ±0.1% from the specified value, as such variations are appropriate in the context of the disclosure.
As used herein, the term “allogeneic” refers to a cell of the same species that differs genetically to the cell in comparison.
As used herein, the term “associated with” or “linked,” when used with respect to two or more moieties, means that the moieties are associated or connected, e.g., physically or chemically, with one another, either directly or via one or more additional moieties that serves as a linking agent, to form a structure that is sufficiently stable so that the moieties remain physically associated under the conditions in which the structure is used, e.g., physiological conditions. In some embodiments, the two or more moieties are covalently or non-covalently attached, coupled, linked, or tethered. In some embodiments, an association is through direct covalent chemical bonding. In other embodiments, the association is through ionic or hydrogen bonding or a hybridization based connectivity sufficiently stable such that the associated or linked entities remain physically associated.
As used herein the term “autologous” refers to a cell from the same subject.
As used herein, the term “carrier” includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like.
As used herein, the term “complementary” when used to describe a first nucleotide sequence in relation to a second nucleotide sequence, refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize and form base pairs, e.g., a duplex, with an oligonucleotide or polynucleotide comprising the second nucleotide sequence. In some embodiments, base pairs are formed by hydrogen bonds between nucleotide units in antiparallel polynucleotide strands. In some embodiments, complementary polynucleotide or oligonucleotide strands can form base pairs in the Watson-Crick manner or in any other manner that allows for the formation of duplexes. The term “complementary” as used herein can encompass fully complementary, partially complementary, or substantially complementary. “Fully complementary” refers to the situation in which each nucleotide unit of one polynucleotide or oligonucleotide strand can base-pair with a nucleotide unit of a second polynucleotide or oligonucleotide strand. “Substantially complementary” refers to the situation in which two polynucleotides or oligonucleotide strands can be fully complementary or they may form one or more, but generally not more than 1, 2, 3, 4, or 5 mismatched or non-complimentary base pairs upon hybridization for a duplex, while still retaining the ability to hybridize under the conditions most relevant to their ultimate application.
As used herein, the term “control element,” “regulatory control element,” or “regulatory sequence” refers to an element used for expression of a gene or gene product. Exemplary “control elements,” “regulatory control elements,” or “regulatory sequences” include, but are not limited to, promoter regions, polyadenylation signals, transcription termination sequences, upstream regulatory domains, origins of replication, internal ribosome entry sites (“IRES”), enhancers, and the like, which provide for the replication, transcription and translation of a coding sequence in a recipient cell.
As used herein, the term “effective amount” refers to an amount of a compound, formulation, material, or composition, to achieve a particular biological result. In some embodiments, the effective amount is a therapeutically effective amount. In some embodiments, the effective amount of an agent is that amount sufficient to effect a beneficial or desired result, for example, a clinical result. For example, in the context of administering an agent that treats a disorder, an effective amount of an agent is, for example, an amount sufficient to achieve treatment of the disorder, as compared to the response obtained without administration of the agent.
As used herein, the term “enhancer” refers to a segment of DNA which contains a sequence capable of providing enhanced transcription and in some instances can function independent of their orientation relative to another control sequence. An enhancer can function cooperatively or additively with promoters and/or other enhancer elements.
As used herein, the term “export element” refers to a cis-acting post-transcriptional regulatory element that regulates the transport of an RNA transcript from the nucleus to the cytoplasm of a cell. Examples of RNA export elements include, but are not limited to, the human immunodeficiency virus (HIV) rev response element (RRE) and the hepatitis B virus post-transcriptional regulatory element (HPRE). In some embodiments, the RNA export element is located within the 3' UTR of a gene and is inserted as one or multiple copies.
As used herein, the term “expression” refers to transcription and/or translation of a particular nucleotide sequence. Expression can generally include one or more of the following: (1) production of an RNA template from a DNA sequence (e.g., by transcription); (2) processing of an RNA transcript (e.g., by splicing, editing, 5’ cap formation, and/or 3’ end processing); (3) translation of an RNA into a polypeptide or protein; and (4) post-translational modification of a polypeptide or protein.
As used herein, the term “expression control sequence” refers to a polynucleotide sequence that comprises one or more promoters, enhancers, or other transcriptional control elements or combinations thereof that are capable of directing, increasing, regulating, or controlling the transcription or expression of an operatively linked polynucleotide.
As used herein, the term “FLAP element” refers to a nucleic acid whose sequence includes the central polypurine tract and the central termination sequence (cPPT and CTS) of a retrovirus (e.g., HIV-1 or HIV-2). Without wishing to be bound by theory, it is believed that during retrovirus reverse transcription, central initiation of the plus-strand DNA at the central polypurine tract (cPPT) and central termination at the central termination sequence (CTS) lead to the formation of a three-stranded DNA structure: the central DNA flap. The central DNA flap may act as a cis-active determinant of retroviral genome nuclear import and/or may increase the titer of the virus. Exemplary FLAP elements are described, e.g., in Zennou, et al., 2000, Cell, 101: 173 and U.S. Patent No. 6,682,907, the contents of which are incorporated by reference in their entirety. In an embodiment, a retroviral or lentiviral vector backbone described herein comprises one or more FLAP elements upstream or downstream of the heterologous genes of interest in the vector. For example, a transfer plasmid can include a FLAP element. In an embodiment, a viral vector described herein comprises a FLAP element isolated from HIV-1.
As used herein, the term “hematopoietic stem cell” or “HSC” refers to multipotent stem cells that give rise to the all the blood cell types of an organism, including myeloid (e.g., monocytes and macrophages, neutrophils, basophils, eosinophils, erythrocytes, megakaryocytes/platelets, dendritic cells), and lymphoid lineages (e.g., T-cells, B-cells, NK-cells), and others known in the art.
As used herein, the term “host cell” refers to a cell transfected, infected, or transduced in vivo, ex vivo, or in vitro with a vector or a polynucleotide. Host cells may include packaging cells, producer cells, and cells infected with viral vectors. In certain embodiments, the term "target cell" is used interchangeably with host cell and refers to transfected, infected, or transduced cells of a desired cell type.
As used herein, the term “identity” refers to the subunit sequence identity between two polymeric molecules, e.g., between two nucleic acid molecules (e.g. two DNA molecules and/or two RNA molecules) and/or between two polypeptide molecules. When a subunit position in both of the two molecules is occupied by the same monomeric subunit, they are considered identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which can to be introduced for optimal alignment of the two sequences. For example, calculation of the percent identity of two sequences can be performed by aligning the two sequences for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second sequences for optimal alignment and non-identical sequences can be disregarded for comparison purposes). In certain embodiments, the length of a sequence aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, or 100% of the length of the reference sequence. When a position in the first sequence is occupied by the same nucleotide or amino acid as the corresponding position in the second sequence, then the sequences are identical at that position. The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm known in the art. As used herein, the term “isolated” means a material (e.g., a polynucleotide, a polypeptide, a cell) that is substantially or essentially free from components that normally accompany it in its native state. In some embodiments, the term “obtained” or “derived” is used interchangeably with the term “isolated.” For example, an “isolated polynucleotide,” as used herein, refers to a polynucleotide that has been purified from the sequences that flank it in a naturally -occurring state, e.g., a DNA fragment that has been removed from the sequences that are normally adjacent to the fragment.
As used herein, the term “lentiviral vector” refers to a viral vector containing a structural or functional element, or a portion thereof, that is primarily derived from a lentivims.
As used herein, the term “lentivims” refers to a genus of retroviruses. Exemplary lentiviruses include, but are not limited to, HIV (human immunodeficiency vims, e.g., HIV type 1 and HIV type 2), bovine immune deficiency vims (BIV), caprine arthritis-encephalitis vims (CAEV), equine infectious anemia vims (EIAV), feline immunodeficiency vims (FIV), simian immunodeficiency vims (SIV), and visna-maedi vims (VMV) vims. In an embodiment, the lentivims is an HIV.
As used herein, the term “long terminal repeat” or “LTR” refers to domains of base pairs located at the ends of retroviral DNAs that, in their natural sequence context, are direct repeats and contain U3, R and U5 regions. Without wishing to be bound by theory, it is believed that in some embodiments, LTRs provide functions fundamental to the expression of retroviral genes (e.g., promotion, initiation and polyadenylation of gene transcripts) and to viral replication. The LTR contains a number of regulatory signals, for example, transcriptional control elements, polyadenylation signals and sequences needed for replication and integration of the viral genome. The LTR typically includes U3, R and U5 regions and appears at both the 5' and 3' ends of the viral genome. The U3 region contains the enhancer and promoter elements. The U5 region is the sequence between the primer binding site and the R region and contains the polyadenylation sequence. The R (repeat) region is flanked by the U3 and U5 regions. Adjacent to the 5' LTR are sequences necessary for reverse transcription of the genome (the tRNA primer binding site) and for efficient packaging of viral RNA into particles (the Psi site).
As used herein, the term “nucleic acid cassette” refers to a sequence within the vector which can express an RNA, and subsequently a polypeptide. Foe example, the nucleic acid cassette may contains a gene-of-interest and/or one or more expression control sequences. Vectors may comprise one, two, three, four, five or more nucleic acid cassettes. The nucleic acid cassette can be positionally and sequentially oriented within the vector such that the nucleic acid in the cassette can be transcribed into RNA, and when necessary, translated into a protein or a polypeptide, undergo appropriate post- translational modifications required for activity in the transformed cell, and be translocated to the appropriate compartment for biological activity by targeting to appropriate intracellular compartments or secretion into extracellular compartments. In some embodiments, the nucleic acid cassette has its 5’ and 3 ’ ends adapted for ready insertion into a vector, e.g., it has restriction endonuclease sites at each end. In some embodiments, the nucleic acid cassette contains a polynucleotide sequence that can be used to treat or prevent a disorder. The cassette can typically be removed and inserted into a plasmid or viral vector as a single unit.
As used herein, the term “operably linked” refers to a functional connection between two or more molecules, constructs, transcripts, entities, moieties or the like. In some embodiments, “operably linked” refers to functional linkage between a regulatory sequence and a heterologous nucleic acid sequence resulting in expression of the latter. For example, a first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence. For instance, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence. Operably linked DNA sequences can be contiguous with each other and, e.g., where necessary to join two protein coding regions, are in the same reading frame.
As used herein, the term “of’ means either one, both, or any combination of the alternatives, and is used interchangeably with the term “and/or”, unless context clearly indicates otherwise.
As used herein, the term “packaging cell line” refers to a cell line that does not contain a packaging signal, but does stably or transiently express viral structural proteins and replication enzymes (e.g., gag, pol, and env) which are necessary for the correct packaging of viral particles.
As used herein, the term “packaging signal” or “packaging sequence” refers to a sequence located within a retroviral genome that is required for insertion of the viral RNA into the viral capsid or particle. Several retroviral vectors use the minimal packaging signal (also referred to as the psi |T| sequence) needed for encapsidation of the viral genome. Thus, in some embodiments, the terms “packaging sequence,” “packaging signal,” “psi” and the symbol “T” are used interchangeably to describe the non-coding sequence required for encapsidation of retroviral RNA strands during viral particle formation.
As used herein, the term “pharmaceutically acceptable” refers to molecular entities and compositions that do not produce an allergic or similar untoward reaction when administered to a human.
As used herein, the term “pharmaceutically acceptable carrier” includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible, including pharmaceutically acceptable cell culture media.
As used herein, the term “prevent” or “prevention” means that a subject (e.g., a human) is less likely to have the disorder, e.g., a myeloma, if the subject receives the antibody molecule.
As used herein, the term “promoter” refers to a recognition site of a polynucleotide (DNA or RNA) to which an RNA polymerase binds.
As used herein, the term "promoter/enhancer" refers to a segment of DNA which contains a sequence capable of providing both promoter and enhancer functions. As used herein, the term “prophylactically effective amount” refers to an amount effective to achieve the desired prophylactic effect or result.
As used herein the term “retroviral vector” refers to a viral vector containing a structural or functional element, or a portion thereof, that is primarily derived from a retrovirus.
As used herein, the term “R region” refers to a region within an LTR beginning at the start of the capping group (i.e., the start of transcription) and ending immediately prior to the start of the poly A tract. The R region is also defined as being flanked by the U3 and U5 regions. Without wishing to be bound by theory, it is believed that in some embodiments, the R region plays a role during reverse transcription in permitting the transfer of nascent DNA from one end of the genome to the other.
As used herein, the term “retrovirus” refers to an RNA vims that reverse transcribes its genomic RNA into DNA and subsequently integrates the DNA into a host genome. Exemplary retroviruses include, but are not limited to, lentiviruses, oncoretroviruses, and spumaviruses. Exemplary oncoretroviruses include, but are not limited to, feline leukemia virus (FLV), Friend murine leukemia virus, gibbon ape leukemia virus (GaLV), Harvey murine sarcoma virus (HaMuS V), Moloney murine leukemia virus (M-MuLV), Moloney murine sarcoma virus (MoMS V), murine mammary tumor virus (MuMTV), murine stem cell virus (MSCV), and Rous sarcoma virus (RSV). In an embodiment, the retrovirus is a lentivirus.
As used herein, the term “thalassemia” refers to a hereditary disorder characterized by defective production of hemoglobin. The term “thalassemia” encompasses hereditary anemias that occur due to mutations affecting the synthesis of hemoglobin. Thus, the term includes any symptomatic anemia resulting from thalassemic conditions such as severe or p-thalassemia, thalassemia major, thalassemia intermedia, a-thalassemias such as hemoglobin H disease. Examples of thalassemias include a-thalassemia and p-thalassemia. a-thalassemia is caused by deletion of a gene or genes from the globin chain, p-thalassemia is caused by a mutation in the p-globin chain, and can occur in a major or minor form. In the major form of P-thalassemia, children typically are normal at birth, but develop anemia during the first year of life. The mild form of p-thalassemia produces small red blood cells.
As used herein, the term “therapeutically effective amount” refers to an amount effective to achieve the desired therapeutic effect or result.
As used herein, the term “self-inactivating vector” or “SIN vector” refers to a replicationdefective vector (e.g., a retroviral or lentiviral vector) in which the right 3 ’ LTR enhancer-promoter region, known as the U3 region, has been modified (e.g., by deletion or substitution) to prevent viral transcription beyond the first round of viral replication. Without wishing to be bound by theory, it is believed that the right 3’ LTR U3 region is used as a template for the left 5’ LTR U3 region during viral replication and, thus, the viral transcript cannot be made without a functional U3 enhancerpromoter. In some embodiments, the 3’ LTR is modified such that the U5 region is replaced, for example, with a poly(A) sequence. As used herein, the term “stem cell” refers to a cell which is an undifferentiated cell capable of (1) long term self -renewal, or the ability to generate at least one identical copy of the original cell, (2) differentiation at the single cell level into multiple, and in some instance only one, specialized cell type and (3) of in vivo functional regeneration of tissues.
As used herein, the term “subject” is intended to include human and non-human animals. In some embodiments, the subject is a human subject, e.g., a human patient having a disorder described herein, or at risk of having a disorder described herein. The term “non-human animals” includes mammals and non-mammals, such as non-human primates. The vectors, cells, and compositions described herein are suitable for treating human patients a disorder described herein. Patients having a disorder described herein include, e.g., those who have developed a disorder described herein but are (at least temporarily) asymptomatic, patients who have exhibited a symptom of a disorder described herein, and patients having a disorder related to or associated with a disorder described herein.
As used herein, the term “trans-activation response” or “TAR” refers to a genetic element located in the R region of retroviral or lentiviral LTRs. Without wishing to be bound by theory, it is believed that in some embodiments, this element interacts with the retroviral or lentiviral transactivator (tat) genetic element to enhance viral replication. In some embodiments, this element is not required wherein the U3 region of the 5 ’ LTR is replaced by a heterologous promoter. In an embodiment, a viral vector described herein comprises a TAR element.
As used herein, the term “treat” or “treatment” means that a subject (e.g., a human) who has a disorder and/or experiences a symptom of a disorder will, in some embodiments, suffer less a severe symptom and/or recover faster when a therapy is administered than if the therapy were never administered. Treatment can, partially or completely, alleviate, ameliorate, relieve, inhibit, or reduce the severity of, and/or reduce incidence, and optionally, delay onset of, one or more manifestations of the effects or symptoms, features, and/or causes of a disorder. In some embodiments, treatment is of a subject who does not exhibit certain signs of a disorder, and/or of a subject who exhibits only early signs of a disorder. In some embodiments, treatment is of a subject who exhibits one or more established signs of a disorder. In some embodiments, treatment is of a subject diagnosed as suffering from a disorder.
As used herein, the term “variant” refers to a polypeptide that is distinguished from a reference polypeptide by the addition, deletion, truncations, and/or substitution of at least one amino acid residue, and that retain a biological activity. In certain embodiments, a polypeptide variant is distinguished from a reference polypeptide by one or more substitutions, which may be conservative or non-conservative, as known in the art.
As used herein, the term “vector” refers to a nucleic acid molecule that is used as a vehicle to transfer another nucleic acid molecule into a host cell. In an embodiment, the transferred nucleic acid molecule is inserted to the vector nucleic acid molecule. A vector may include a sequence that directs autonomous replication in a cell, or may include a sequence sufficient to allow integration into the host cell genome. Exemplary vectors include, but are not limited to, viral vectors, plasmids (e.g., DNA plasmids orRNA plasmids), transposons, cosmids, and bacterial artificial chromosomes. Exemplary viral vectors include, but are not limited to, retroviral vectors (e.g., replication defective retroviral vectors) and lentiviral vectors.
As used herein, the term “viral vector” refers to a nucleic acid molecule (e.g., a plasmid) that includes one or more virus-derived nucleic acid elements that facilitate transfer of a nucleic acid molecule into a cell, integration of a nucleic acid molecule into the genome of cell, or delivery of a nucleic acid molecule to a viral particle.
Nucleic Acid Constructs and Vectors
The disclosure provides a nucleic acid construct or vector (e.g., a viral vector) comprising a human p-globin gene or a functional fragment thereof.
In some embodiments, the sequence of the human p-globin gene comprises human p-globin gene exon 1, intron 1, exon 2, intron 2, and exon 3. In certain embodiments, the sequence of the human p-globin gene is according to Ensemble Database Gene: HBB (ENSG00000244734) Transcript: HBB-201 (ENST00000335295.4).
In some embodiments, nucleic acid construct or vector comprises a regulatory control element. In some embodiments, nucleic acid construct or vector comprises an expression control sequence. In some embodiments, the nucleic acid construct or vector comprises a promoter or a promoter/enhancer.
In some embodiment, the human p-globin gene comprises a human p-globin promoter. In some embodiment, the human p-globin gene does not comprise a human p-globin promoter. In some embodiments, human p-globin promoter is about 250 to about 275 bp (e.g., 268 bp) upstream of exon 1 of the human p-globin promoter. In some embodiments, the human p-globin gene comprises a human p-globin 3 ’-enhancer. In certain embodiments, the human p-globin 3 ’-enhancer is about 850 bp to about 900 bp (e.g., 878 bp) downstream of exon 3 of the human p-globin gene. In some embodiments, the human p-globin gene comprises one or more (e.g., 2 or 3) wild-type exons. In some embodiments, the human p-globin gene comprises one or more (e.g., 2 or 3) codon-optimized exons. In some embodiments, the human p-globin gene comprises one or more wild-type introns. In certain embodiments, the human p-globin gene comprises a wild-type intron 2. In some embodiments, the human p-globin gene comprises one or more truncated introns. In certain embodiments, the human p- globin gene comprises a truncated intron 2. In some embodiments, the human p-globin gene comprises a wild-type exon 2. In some embodiments, the human p-globin gene comprises an exon 2 that encodes a threonine to glutamine mutation at codon 87 (T87Q). In some embodiments, the human P-globin gene comprises the nucleotide sequence of SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, or a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity thereto, or any combination thereof. In some embodiments, the nucleic acid construct or vector comprises a nucleotide sequence that is complementary to the nucleotide sequence of SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, or a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity thereto, or any combination thereof.
In some embodiments, the human p-globin gene encodes a human p-globin variant. For example, the variant may include an amino acid sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the wild-type human p-globin amino acid sequence.
In some embodiments, the nucleic acid constmct or vector comprises a retroviral (e.g., lentiviral) LTR. In some embodiments, the nucleic acid construct or vector comprises a left (5') retroviral LTR and a right (3') retroviral LTR. In some embodiments, the right (3') LTR is a selfinactivating (SIN) LTR. In some embodiments, the retroviral LTR is unmodified, e.g., a wild-type retroviral LTR. In some embodiments, the retroviral LTR is modified, e.g., comprising one or more subtitutions, insertions, and/or deleteions. In some embodiments, the left (5’) retroviral LTR is replaced with a heterologous promoter, e.g., cytomegalovirus (CMV) promoter, a Rous Sarcoma Virus (RSV) promoter, a thymidine kinase promoter, or an Simian Virus 40 (SV40) promoter. In some embodiments, the right (3’) retroviral LTR is absent. In some embodiments, the retroviral LTR is a lentiviral LTR.
In some embodiments, the nucleic acid constmct or vector comprises a human p-globin gene upstream locus control region (LCR). In some embodiments, the upstream locus control region (LCR) comprises one or more (e.g., 2 or 3) tmncated DNase I hypersensitive sites, HS2, HS3 and HS4 of the LCR.
In some embodiments, the nucleic acid construct or vector comprises a cis-acting posttranscriptional regulatory element. In some embodiments, the posttranscriptional regulatory element is a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE).
In some embodiments, the nucleic acid constmct or vector comprises a polyadenylation signal and/or origin. In some embodiments, the polyadenylation signal is an SV40 polyadenylation signal. In some embodiments, the origina is an S V40 origin. The polyadenylation signal and/or origin can be located 3’ of the right (3’) retroviral LTR.
In some embodiments, the nucleic acid construct or vector comprises one or more (e.g., two, three, four, or all) of a) a left (5') retroviral LTR; b) human p-globin gene; c) human p-globin gene upstream locus control region (LCR); d) a cis-acting posttranscriptional regulatory element; e) a right (3 ') retroviral LTR; and f) a S V40 polyadenylation signal and/or SV40 origin.
In some embodiments, the nucleic acid constmct or vector comprises a nucleic acid cassette comprising one or more (e.g., two, three, four, or all) of a) a left (5') retroviral LTR; b) human p- globin gene; c) human p-globin gene upstream locus control region (LCR); d) a cis-acting posttranscriptional regulatory element; e) a right (3') retroviral LTR; and f) a SV40 polyadenylation signal and/or SV40 origin.
In some embodiments, the nucleic acid construct or vector further comprises one or more (e.g., 2 or 3) of a Psi packaging sequence ('P+), a central polypurine tract/DNA flap (cPPT/FLAP), or a retroviral export element-rev response element (RRE).
In some embodiments, the nucleic acid construct or vector comprises the nucleotide sequence SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO : 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, or a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity thereto. In some embodiments, the nucleic acid construct or vector comprises a nucleotide sequence that is complementary to the nucleotide sequence SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO : 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, or a nucleotide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity thereto.
In some embodiments, the nucleic acid construcxt or vector further comprises a truncated erythroid cell expression control sequence.
In some embodiments, the lentiviral nucleic acid construct or vector is an HIV nucleic acid construct or vector. For example, the lentiviral nucleic acid construct or vector may be derived from human immunodeficiency- 1 (HIV-1), human immunodeficiency -2 (HIV-2), simian immunodeficiency virus (SIV), feline immunodeficiency virus (FIV), bovine immunodeficiency virus (BIV), Jembrana Disease Virus (JDV), equine infectious anemia virus (EIAV), caprine arthritis encephalitis virus (CAEV), and the like.
The nucleic acid construct or vector components described herein can be operably linked to allow for exrepssion of human p-globin. The vectors described herein can be self-inactivating vector.
Large scale viral particle production is typically necessary to achieve a reasonable viral titer. Viral particles can be produced by transfecting a transfer nucleic acid construct or vector into a packaging cell line that comprises viral structural and/or accessory genes, e.g., gag, pol, env, tat, rev, vif, vpr, vpu, vpx, or nef genes or other retroviral genes.
Pharmaceutical Compositions and Formulations
The disclosure provides pharmaceutical compositions comprising a nucleic acid construct or vector described herein or a cell described herein, and a pharmaceutically acceptable carrier.
In some embodiments, the pharmaceutically acceptable carrier is suitable for parenteral administration, e.g., intravascular (intravenous or intraarterial), intraperitoneal, or intramuscular administration. Exemplary pharmaceutically acceptable carriers include sterile aqueous solutions or dispersions and sterile powders for the preparation of sterile injectable solutions or dispersion. The use of such media and agents for pharmaceutically active substances is well known in the art. The compositions of the disclosure can comprise, for example, one or more polypeptides, polynucleotides, vectors comprising same, or transduced cells, formulated in pharmaceutically - acceptable or physiologically -acceptable solutions for administration to a cell or an animal, either alone, or in combination with one or more other therapeutic agents or modalities. The compositions of the disclosure may also be administered in combination with other agents, including, but not limited to, cytokines, growth factors, hormones, small molecules, or other pharmaceutically -active agents.
In the pharmaceutical compositions of the disclosure, formulation of pharmaceutically - acceptable excipients and carrier solutions is well-known to those of skill in the art, as is the development of suitable dosing and treatment regimens for using the particular compositions described herein in a variety of treatment regimens, including, but not limited to, parenteral, intravenous, and intramuscular administration and formulation.
In all cases the form should be sterile and should be fluid to the extent that easy syringeability exists. It should be stable under the conditions of manufacture and storage and should be preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and/or vegetable oils. Proper fluidity may be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be facilitated by various antibacterial and antifungal agents.
For parenteral administration in an aqueous solution, for example, the solution should be suitably buffered if necessary and the liquid diluent first rendered isotonic with sufficient saline or glucose. These particular aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous, and intraperitoneal administration. Some variation in dosage will necessarily occur depending on the condition of the subject being treated. The person responsible for administration will, in any event, determine the appropriate dose for the individual subject.
Sterile injectable solutions can be prepared by incorporating the active compounds in the required amount in the appropriate solvent with the various other ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
The compositions disclosed herein may be formulated in a neutral or salt form. Pharmaceutically -acceptable salts, include the acid addition salts (formed with the free amino groups of the protein) and which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, mandelic, and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, histidine, procaine and the like. Upon formulation, solutions will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective. The formulations are easily administered in a variety of dosage forms such as injectable solutions, drug-release capsules, and the like.
The compositions or formulations described herein can comprises a cell contacted with a combination of any number of polypeptides, polynucleotides, and small molecules, as described herein.
In another aspect, the disclosure provides compositions that comprise a therapeutically - effective amount of one or more polynucleotides or polypeptides, as described herein, formulated together with one or more pharmaceutically acceptable carriers (additives) and/or diluents (e.g., pharmaceutically acceptable cell culture medium).
In yet another aspect, the disclosure provides formulations or compositions suitable for the delivery of viral vector systems (e.g., viral-mediated transduction), including, but not limited to, retroviral (e.g., lentiviral) vectors.
Exemplary formulations for ex vivo delivery include, but are not limited to, the use of various transfection agents known in the art, such as calcium phosphate, electroporation, heat shock, and various liposome formulations (e.g., lipid-mediated transfection).
Therapeutic Use
The nucleic acid constructs, vectors, compositions, and cells described herein can be used in methods of treating or preventing thalassemia, e.g., p-thalassemia.
In some embodiments, the vector is administered by direct injection to a cell, tissue, or organ of a subject in need of gene therapy, e.g., in vivo. In some embodiments, the cell is transduced in vitro or ex vivo with a nucleic acid construct or vector described herein, and optionally expanded ex vivo. The transduced cell is then administered to a subject in need of gene therapy. Cells suitable for transduction or administration in the methods described herein include, but are not limited to, stem cells, progenitor cells, and differentiated cells. In some embodiments, the transduced cell is a hematopoietic stem cell.
In some embodiments, the transduced cells are hematopoietic stem and/or progenitor cells, e.g., isolated from bone marrow, umbilical cord blood, or peripheral circulation. In certain embodiments, the transduced cells are hematopoietic stem cells, e.g., isolated from bone marrow, umbilical cord blood, or peripheral circulation.
Hemapoietic stem or pluripotent cells may be identified according to certain phenotypic or genotypic markers, which are known in the art. In another aspect, the disclosure provides a method of treating a disorder. The method comprises administering to a subject (e.g., a human subject) in need thereof an effective amount of a nucleic acid construct or vector described herein, or a cell (e.g., a hematopoietic stem or progenitor cell) transduced with a nucleic acid construct or vector described herein, thereby treating the disorder. In some embodiments, the effective amount is a therapeutically effective amount. In some embodiments, the effective amount is a prophylactically effective amount.
In some embodiments, the disorder is a disorder is associated with a defective p-globin gene. In some embodiments, the disorder is thalassemia (e.g., p-thalassemia). In some embodiments, the method further comprises obtaining a cell (e.g., a hematopoietic stem or pluripotent cell) from the subject. In some embodiments, the method further comprises transducing a cell (e.g., a hematopoietic stem or pluripotent cell) from the subject with a nucleic acid construct or vector described herein. In some embodiments, the method further further comprises isolating the transduced cell. In some embodiments, the method further comprises administering to the subject a second therapeutic agent or modality.
In another aspect, the disclosure provides a method of providing a transduced cell. The method comprises administering to a subject (e.g., a human subject) in need thereof a cell (e.g., a hematopoietic stem or progenitor cell) transduced with a nucleic acid constmct or vector described herein.
In another aspect, the disclosure provides a method of treating a hemoglobinopathy. The method comprises administering to a subject (e.g., a human subject) in need thereof a nucleic acid construct or vector described herein, or a cell (e.g., a hematopoietic stem or progenitor cell) transduced with a vector described herein.
In another aspect, the disclosure provides a method of selectively expanding the number erythroid cells. The method comprises administering to a subject (e.g., a human subject) in need thereof a nucleic acid construct or vector described herein, or a cell (e.g., a hematopoietic stem or progenitor cell) transduced with a nucleic construct or vector described herein.
In another aspect, the disclosure provides a method of increasing the proportion of red blood cells or erythrocytes compared to white blood cells or leukocytes in a subject. The method comprises administering a nucleic acid construct or vector described herein, or a cell (e.g., a hematopoietic stem or progenitor cell) transduced with a nucleic acid construct or vector described herein.
In some embodiments, the transduced cell is administered to the subject intravenously. In some embodiments, the transduced cells are administered to the subject at a dose of about IxlO5 to about IxlO8 cells, e.g., about IxlO6 to about IxlO7 cells, about IxlO6 to about IxlO8 cells, about IxlO7 to about IxlO8 cells, about IxlO5 to about IxlO7 cells, or about IxlO5 to about IxlO6 cells. In some embodiments, the transduced cells are administered as a single dose. Enumerated Emobidments
1. A vector comprising: a) a left (5') retroviral LTR; b) a human p-globin gene; c) a human p-globin gene upstream locus control region (LCR); d) a cis-acting posttranscriptional regulatory element; e) a right (3') retroviral LTR; and f) a cis-acting element SV40 polyadenylation signal and/or SV40 origin.
2. The vector of embodiment 1, wherein the human p-globin gene comprises exon 1, intron 1, exon 2, intron 2, and exon 3.
3. The vector of embodiment 1 or 2, wherein the human p-globin gene comprises a human p-globin promoter.
4. The vector of embodiment 3, wherein the human p-globin gene comprises exon 1 and the human p- globin promoter is located 268 bp upstream of exon 1.
5. The vector of any of embodiments 1-3, wherein the P-globin gene comprises a human p-globin 3’- enhancer.
6. The vector of embodiment 5, wherein the human p-globin gene comprises exon 3 and the human p- globin 3 ’-enhancer is located 878 bp downstream of exon 3.
7. The vector of any of embodiments 1-6, wherein the human p-globin gene comprises wild-type exons or codon-optimized exons.
8. The vector of any of embodiments 1-7, wherein the human p-globin gene comprises a wild-type intron 2 or a truncated intron 2.
9. The vector of any of embodiments 1-8, wherein the human p-globin gene comprises a wild-type exon 2 or an exon 2 encoding a threonine to glutamine mutation at codon 87 (T87Q).
10. The vector of any of embodiments 1-9, wherein the upstream locus control region (LCR) comprises truncated DNase I hypersensitive sites, HS2, HS3 and HS4.
11. The vector of any of embodiments 1-10, wherein the posttranscriptional regulatory element is a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE).
12. The vector of embodiment 11, wherein the WPRE is wildtype WPRE or a mutated WPRE, e.g., a mutated WPRE comprising one or more, or all, of the mutations described herein.
13. The vector of embodiment 12, wherein the wildtype WPRE comprises the nucleotide sequence of SEQ ID NO: 32, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, or 99% identity thereto.
14. The vector of embodiment 12, wherein the mutated WPRE comprises the nucleotide sequence of SEQ ID NO: 33, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, or 99% identity thereto. 15. The vector of any of embodiments 1-14, wherein the SV40 polyadenylation signal and/or SV40 origin is located 3’ downstream of the right (3') retroviral LTR.
16. The vector of any of embodiments 1-15, wherein the human p-globin gene comprises one, two, or all of the nucleotide sequences of SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, or 99% identical thereto.
17. The vector of any of embodiments 1-16, which is a lentivirus vector.
18. The vector of any of embodiments 1-17, wherein the left (5') retroviral LTR, the right (3’) retroviral LTR, or both, is a lentiviral LTR.
19. The vector of any of embodiments 1-18, wherein the right (5') LTR comprises a promoter that is replaced with a heterologous promoter.
20. The vector of any of embodiments 1-19, wherein the right (3 ’) LTR is a self-inactivating (SIN) LTR.
21. The vector of any of embodiments 1-20, further comprising one or more of a Psi packaging sequence (¥+), a central polypurine tract/DNA flap (cPPT/FLAP), or a retroviral export element-rev response element (RRE).
22. The vector of any of embodiments 1-21, which comprises the nucleotide sequence of SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, or SEQ ID NO: 20, or a nucleotide sequence having at least 80%, 85%, 90%, 95%, or 99% identity thereto.
23. A composition comprising the vector of any of embodiments 1-22 and a pharmaceutically acceptable carrier.
24. A human cell transduced with the vector of any of embodiments 1-22.
25. The cell of embodiment 24, which is an embryonic stem cell, an adult stem cell, an adult progenitor cell, or a differentiated adult cell.
26. The cell of embodiment 24, which is a hematopoietic stem cell or a hematopoietic progenitor cell.
27. The cell of embodiment 26, wherein the hematopoietic stem cell or hematopoietic progenitor cell is obtained from bone marrow, cord blood, placental blood, or peripheral blood.
28. A composition comprising a cell transduced with the vector of any of embodiments 1-22 and a pharmaceutically acceptable carrier.
29. A method of treating p-thalassemia, comprising administering to a subject in need thereof an effective amount of a cell transduced with the vector of any of embodiments 1-22, thereby treating p- thalassemia.
30. The method of embodiment 29, further comprising obtaining a cell from the subject.
31. The method of embodiment 29 or 30, further comprising transducing the cell with the vector.
32. The method of any of embodiments 29-31, wherein the cell is a hematopoietic stem cell or a hematopoietic progenitor cell. 33. The method of any of embodiments 29-32, further comprising administering to the subject an effective amount of busulfan and cyclophosphamide prior to administering the cell transduced with the vector to the subject.
34. The method of embodiment 33, wherein busulfan is administered at a dose of 2 to 5 mg/kg/day, e.g., 2.4 to 4.8 mg/kg/day, intravenously.
35. The method of embodiment 33 or 34, wherein cyclophosphamide is administered at a dose of 30- 80 mg/kg/day, e.g., 45-65 mg/kg/day, intravenously.
36. The method of any of embodiments 33-35, wherein cyclophosphamide is administered 18 to 30 hours, e.g., 24 hours, after busulfan is administered.
37. The method of any of embodiments 33-36, wherein busulfan is administered for 2-4 days and cyclophosphamide is administered for 1-5 days.
38. The method of any of embodiments 33-37, wherein the administration of the cell transduced the vector is initiated 24-72 hours after the administration of cyclophshamide is completed.
39. A formulation comprising the vector of any of embodiments 1-22, a buffer, a stabilizer, and sodium chloride.
40. The formulation of embodiment 39, wherein the vector is present at a concentration of IxlO8 TU/mL to IxlO10 TU/mL.
41. The formulation of embodiment 40, wherein the vector is present at a concentration of 5xl08 TU/mL to 5xl09 TU/mL.
42. The formulation of any of embodiments 39-41, wherein the vector is present at a concentration of 5xl08 TU/mL to IxlO9 TU/mL, e.g., 6xl08 TU/mL.
43. The formulation of any of embodiments 39-42, wherein the buffer is phosphate buffer, sodium citrate, or PIPES.
44. The formulation of any of embodiments 39-43, wherein the buffer is present at a concentration of 10 mM to 50 mM, e.g., 10 mM to 30 mM, 20 mM to 40 mM, 30 mM to 50 mM, or 10 mM to 40 mM.
45. The formulation of any of embodiments 39-44, wherein the buffer is present at a concentration of 10 mM, 20 mM, or 40 mM.
46. The formulation of any of embodiments 39-45 wherein the stabilizer comprises a sugar or a polyhydric alcohol, e.g., sucrose, trehalose, sorbitol, inositol, glucose, or dextran.
47. The formulation of any of embodiments 39-46, wherein the stabilizer is present at a concentration of 1% to 5%, e.g., 1% to 3%, 2% to 3%, or 1% to 2.5%.
48. The formulation of any of embodiments 39-47, wherein the stabilizer is present at a concentration of 1%, 2%, or 2.5%.
49. The formulation of any of embodiments 39-48, wherein sodium chloride is present at a concentration of 50 mM to 200 mM, e.g., 50 mM to 70 mM, 70 mM to 90 mM, 80 mM to 100 mM, 100 mM to 120 mM, 140 mM to 160 mM, or 50 mM to 150 mM. 50. The formulation of any of embodiments 39-49, wherein sodium chloride is present at a concentration of 50 mM, 60 mM, 80 mM, 90 mM, 110 mM, or 150 mM.
51. The formulation of any of embodiments 39-50, comprising the vector of embodiment 1, sodium citrate, sucrose, and sodium chloride.
52. The formulation of embodiment 51, wherein the vector is present at a concentration of 5xl08 TU/mL to 5xl09 TU/mL, sodium citrate is present at a concentration of 20 mM to 40 mM, sucrose is present at a concentration of 1% to 2%, and sodium chloride is present at a concentration of 100 mM to 150 mM.
EXAMPLES
Example 1. Design of lentiviral vectors of human P-globin gene
As shown in FIG. 1, three vectors, P002, P005, and P006, were designed with woodchuck hepatitis virus post-transcriptional regulatory element (WPRE), SV40 virus polyadenylation signal (SV40 pA signal), and/or SV40 virus replication origin (SV40 ori) incorporated. In FIG. 1 and FIG. 4, the upstream artificial gene expression control regions represent the truncated locus control regions. A human p-globin gene expression frame that is similar to the gene therapy dmg, betibeglogene autotemcel, was designed and used as a control, named as P001 (May C. et al. Nature. 2000;
406(6791):82-6).
Example 2. Construction of lentiviral vectors of human P-globin gene
The gene expression frames designed in Example 1 were cloned into a lentiviral vector backbone, which was from the third generation lentiviral vector backbone made in-house by Kanglin Biotech (Hangzhou) Co., Ltd., pKL-Kan (SEQ ID NO: 1) (FIG. 2).
The P-globin gene expression frame P001 (SEQ ID NO: 2) designed in Example 1 was synthesized by Nanjing Genscript Biotechnology Co., Ltd. and cloned in between the multi-cloning sites Xhol/Kpnl of the lentiviral vector backbone pKL-Kan by the homologous recombination method well-known to the field. The sequence of the resultant construct was confirmed by sequencing and named as pKL-Kan-TH-POOl (SEQ ID NO: 3).
The P-globin gene expression frame P002 (SEQ ID NO: 4) with an incorporated WPRE was synthesized by Nanjing Genscript Biotechnology Co., Ltd. and cloned in between LCR and 3' LTR of the lentiviral vector pKL-Kan-TH-POOl by the homologous recombination method. The sequence of the resultant construct was confirmed by sequencing and named as pKL-Kan-TH-P002 (SEQ ID NO: 5).
The P-globin gene expression frame P005 (SEQ ID NO: 6) with an incorporated SV40 pA signal plus SV40 ori was synthesized by Nanjing Genscript Biotechnology Co., Ltd. and cloned in between 3' LTR and kan ori of the lentiviral vector pKL-Kan-TH-POOl by the homologous recombination method. The sequence of the resultant construct was confirmed by sequencing and named as pKL-Kan-TH-P005 (SEQ ID NO: 7).
The WPRE fragment was amplified by PCR and using pKL-Kan-TH-P002 as a template and cloned in between LCR and S V40 pA signal of the lentiviral vector pKL-Kan-TH-P005 by the homologous recombination method. The sequence of the resultant construct was confirmed by sequencing and named as pKL-Kan-TH-P006 (SEQ ID NO: 8).
Example 3. Packaging of lentiviruses containing human P-globin gene
For packaging of P-globin gene therapy lentiviruses, the lentiviral vectors of P-globin gene (pKL-Kan-TH-POOl, pKL-Kan-TH-P002, pKL-Kan-TH-P005, or pKL-Kan-TH-P006) constructed in Example 2, envelope plasmid (pKL-Kan-Vsvg; SEQ ID NO: 9), and packaging plasmids (pKL-Kan- Rev (SEQ ID NO: 10) and pKL-Kan-GagPol (SEQ ID NO: 11) were used to co-transfect 293T cells (purchased from ATCC; stock number: CRL-3216) on a 10-cm2 cell culture dish, by PEI (a cationic polymer)-mediated transient transfection of eukaryotic cells according to manufacturer's instructions. PEI-Max transfection reagent was from Polysciences (Catalog Number: 24765-1).
48 hours after transfection, lentiviruses (supernatant of the transfected cells) were harvested, and aliquots were stored at -80°C. Variable volumes of lentivirus was inoculated into human CD4+ T cell line-MT4 cell line (purchased from Shanghai Suoer Biotechnology Co., Ltd.) pre-plated in 96- well cell culture plates. Culture supernatant from the cells transfected with a lentiviral vector containing an EGFP reporter gene (lentivirus packaged with pCCL-sin-EFlcx-WPRE-EGFP using the above-described method) was used as positive control, and initial transfection titers of lentivirus in the harvested supernatant were calculated by quantitative PCR (qPCR) and flow cytometry data based on GFP signal using the well-known method in the field. The sequences of primers and probe used in qPCR were as follows.
LVForward primer: 5’-AGTAAGACCACCGCACAGCA-3’ (SEQ ID NO: 26)
LV Reverse primer: 5’-CCTTGGTGGGTGCTACTCCT-3’ (SEQ ID NO: 27)
LV probe: 5’ -CCTCCAGGTCTGAAGATCAGCGGCCGC-3 ’ (SEQ ID NO: 28) HK Forward primer: 5’-GCTGTCATCTCTTGTGGGCTGT -3’ (SEQ ID NO: 29) HK probe: 5’-CCTGTCATGCCCACACAAATCTCTCC -3’ (SEQ ID NO: 30) HK Reverse primer: 5’-ACTCATGGGAGCTGCTGGTTC -3’ (SEQ ID NO: 31) The LV probe carries 6-FAM fluorescent dye at the 5'-end and TAMRA fluorescent dye at the 3'-end. The HK probe carries CY5 fluorescent dye at the 5'-end and BHQ2 fluorescent dye at the 3'- end.
The qPCR program: 94°C 5 min; 95°C 10 sec, 60°C 30 sec, 40 cycles.
The initial transfection titers of the lentiviruses in the harvested supernatants of the four different P-globin gene lentiviral vectors (pKL-Kan-TH-POOl, pKL-Kan-TH-P002, pKL-Kan-TH- P005, pKL-Kan-TH-P006) are shown in FIG. 3. The data show that the cis-acting WPRE and the sequence of SV40 pA signal combined with SV40 ori all significantly increased the initial transfection titers of the lentiviruses in the harvested supernatants, and these two enhancements can be additive.
Example 4. Evaluation of expression efficiency of human p-globin gene in lentivirus
The P-globin gene lentiviral vectors (pKL-Kan-TH-P005, pKL-Kan-TH-P006) were used to transfect 293T cells cultured on 2 of the 15-cm2 cell culture dishes using the same protocol as in Example 3, to package lentiviruses. 48 hours after transfection, lentiviruses (supernatant of the transfected cells) were harvested and centrifuged in a table-top bucket centrifuge for 5 min at 4000 rpm and room temperature to remove cell debris, followed by centrifuging at 10000 g, 4°C for 4 hours. After removing the clear supernatant, 1 mL of RPMI complete culture medium was added to the virus pellet to resuspend the virus particles using a micro sample injector. The virus resuspension was aliquoted and stored at -80°C for future use.
Variable volumes of lentivirus resuspension were inoculated into MT4 cell line, and transfection titers of the lentivirus resuspension were calculated by qPCR and flow cytometry data based on GFP signal following the protocol described in Example 3.
The expression of P-globin gene mediated by lentivirus was tested in cultured cells. K562 cells are of the erythroleukemia type, derived from a patient of chronic granulocytic leukemia (acute phase), which can produce a small amount of hemoglobin during the fetal development and bear some potential to differentiate into erythrocytes. K562 cells were purchased from ATCC (stock number CCL-243). Based on the above calculated transfection titers of the lentiviruses containing P-globin gene of the resuspension, the lentiviruses were inoculated into K562 cells pre-plated in 96-well plates at various multiplicity of infection (MOI). Some cells were harvested at day 5, 10, and 13 after transfection and used for the following experiments.
1. K562 cells transduced by lentivirus were harvested and washed with PBS. Then the cells were collected after centrifuged at 4200 rpm for 5 min and resuspended in 50 uL QuickExtract™ DNA Extraction Solution (purchased from Lucigen; Catalog Number QE09050). The resuspended cells were lysed in a PCR machine running at the following conditions (Table 1) and total DNAs were isolated.
Table 1. PCR conditions The vector copy number (VCN) of the lentivirus of the transduced K562 cells were calculated by qPCR and flow cytometry data based on GFP signal using the well-known method in the field. Data show that the two lentiviral vectors P005 and P006 resulted in very similar VCNs in K562 cells when transduced at the same MOI (Table 2).
Table 2. VCN in transduced K562 cells
2. The transduced K562 cells were fixed in 4% paraformaldehyde in PBS and permeabilized with 0.1% Triton-XlOO in PBS, and stained with FITC-labeled mouse anti-human [1- globin mAb. Flow cytometry based on FITC signal was used to determine the percentage of K562 cells expressing human P-globin protein as well as the relative signal intensity of the expressed human (3-globin protein.
Data in Table 3 showed that when K562 cells were transduced at the same MOI and very similar VCNs were obtained, the lentiviral vector P005resulted in significantly higher expression of (3-globin than the lentiviral vector P006.
Table 3. Expression levels of 0-globin in transduced K562 cells
Example 5. Additional design of lentiviral vectors of human P-globin gene
Besides the optimization of the cis-acting elements in the lentiviral vectors of P-globin gene, this invention also optimized the expression frame of P-globin gene, including intron sequences and coding sequences.
Based on P006, we designed 6 other vectors (FIG. 4), comprising of, wild-type human P- globin gene sequence (P009), codon-optimized exons with T87Q mutation using method 3 (P011), codon-optimized exons with T87Q mutation using method 4 (P012), coding sequence optimized human P-globin gene with full-length intron 2 and T87Q mutation using method 4 (P015), coding sequence optimized human P-globin gene with full-length intron 2 but no T87Q mutation using method 2 (P019), or coding sequence optimized human P-globin gene with full-length intron 2 and T87Q mutation using method 4 but with WPRE removed (P021).
Example 6. Construction of lentiviral vectors of human P-globin gene
The wild-type human P-globin gene sequence (SEQ ID NO: 12) was amplified by the well- known PCR method in the field, using genomic DNAs isolated from 293T cells, which was derived from human (purchased from ATCC; stock number CRL-3216), as template. The amplified PCR fragment was cloned in between cPPT/CTS and LCR of pKL-Kan-TH-P006 by the homologous recombination method well-known to the field. The sequence of the resultant vector was confirmed by sequencing and named as pKL-Kan-TH-P009 (SEQ ID NO: 13).
The sequence of human P-globin gene with the codon-optimized exons and T87Q mutation using method 3, as designed in Example 5 (SEQ ID NO: 14), was synthesized by Nanjing Genscript Biotechnology Co., Ltd. and cloned in between P-globin-enhancer and P-globin-promoter of pKL- Kan-TH-P006 by homologous recombination. The sequence of the resultant vector was confirmed by sequencing and named as pKL-Kan-TH-POl 1 (SEQ ID NO: 15).
The sequence of human P-globin gene with the codon-optimized exons with T87Q mutation using method 4, as designed in Example 5 (SEQ ID NO: 16), was synthesized by Nanjing Genscript Biotechnology Co., Ltd. and cloned in between P-globin-enhancer and P-globin-promoter of pKL- Kan-TH-P006 by homologous recombination. The sequence of the resultant vector was confirmed by sequencing and named as pKL-Kan-TH-P012 (SEQ ID NO: 17).
The sequence of the full-length intron 2 of human P-globin gene was amplified by PCR using the plasmid DNA of pKL-Kan-TH-P009 as a template and cloned in between exon 2 and exon 3 of pKL-Kan-TH-P012 by homologous recombination. The sequence of the resultant vector was confirmed by sequencing and named as pKL-Kan-TH-POl 5 (SEQ ID NO: 18). The T87Q mutation of pKL-Kan-TH-P015 was changed back to T87 by a site-directed mutagenesis kit (purchased from Vazyme Biotech Co., Ltd.; catalog number C214) and confirmed by sequencing. The new vector was named as pKL-Kan-TH-P019 (SEQ ID NO: 19).
Using pKL-Kan-TH-P015 plasmid DNA as a template, two fragments not including the WPRE sequence were amplified and recombined by homologous recombination. The sequence of the resultant new vector was confirmed by sequencing and named as pKL-Kan-TH-P021 (SEQ ID NO: 20).
Example 7. Evaluation of expression efficiency of P-globin gene in lentivirus
The expression efficiency of human P-globin gene using the lentiviral vectors constructed in Example 6 was evaluated using the method described in Example 4.
First, lentiviruses were packaged in 293T cells for the lentiviral vectors pKL-Kan-TH-P006, pKL-Kan-TH-POl 1, and pKL-Kan-TH-P012 constructed in Example 6, and the lentivirus resuspension was aliquoted and stored at -80°C for future use.
The expression of P-globin gene mediated by lentivirus was tested in cultured cells. Based on the calculated transfection titers of the lentiviruses containing P-globin gene of the resuspension, the lentiviruses were inoculated into K562 cells pre-plated in 96-well plates at the multiplicity of infection (MOI) shown in Table 4. Some cells were harvested at day 5, 10, and 15 after transduction and used for the following experiments.
1. K562 cells transduced by lentiviruses were harvested and lysed, and total DNAs were isolated. The vector copy number (VCN) of the lentivirus of the transduced K562 cells were calculated by qPCR and flow cytometry data based on GFP signal (Table 4).
Table 4. VCN in transduced K562 cells
2. K562 cells transduced by lentiviruses were harvested. Flow cytometry based on PE signal was used to determine the percentage of K562 cells expressing human P-globin protein as well as the relative signal intensity of the expressed human P-globin protein.
Table 5. Expression levels of |3-globin in transduced K562 cells Data showed that when K562 cells were transduced at the same MOI and very similar VCNs were obtained, the lentiviral vectors P011 and P012 resulted in significantly higher expression of (J- globin than the lentiviral vector P006 (Table 5). Among them, P012 is more advantageous.
Example 8. Evaluation of expression efficiency of P-globin gene in lentivirus
The expression efficiency of human P-globin gene using the lentiviral vectors constructed in Example 6 was evaluated using the method described in Example 4.
First, lentiviruses were packaged in 293T cells for the lentiviral vectors pKL-Kan-TH-P006, pKL-Kan-TH-P009, pKL-Kan-TH-P012, pKL-Kan-TH-P015, and pKL-Kan-TH-P019 constructed in Example 6, and the lentivirus resuspension was aliquoted and stored at -80°C for future use.
The expression of P-globin gene mediated by lentivirus was then tested in cultured cells. Based on the calculated transfection titers of the lentiviruses containing P-globin gene of the resuspension, the lentiviruses were inoculated into K562 cells pre-plated in 96-well plates at the multiplicity of infection (MOI) shown in Table 6. Some cells were harvested at day 5 and day 10 after transduction and used for the following experiments.
1. K562 cells transfected by lentiviruses were harvested and lysed, and total DNAs were isolated. The vector copy number (VCN) of the lentivims of the transfected K562 cells were calculated by qPCR and flow cytometry data based on GFP signal (Table 6).
Table 6. VCN in transduced K562 cells
2. K562 cells transfected by lentiviruses were harvested. Flow cytometry based on PE signal was used to determine the percentage of K562 cells expressing human P-globin protein as well as the relative signal intensity of the expressed human P-globin protein.
Data in Table 7 showed that when K562 cells were transfected at the same MOI and very similar VCNs were obtained, the lentiviral vectors P012 and P015 resulted in significantly higher expression of P-globin than the other lentiviral vectors. Table 7. Expression levels of 0-globin in transduced K562 cells
Example 9. Construction of TH04 Vector
Considering the safety for clinical trials, the wild-type WPRE (SEQ ID NO: 32) in the lentiviral vector POO 12 for beta-thalassemia gene therapy, was replaced with a mutated WPRE (SEQ ID NO: 33). WPRE (Woodchuck hepatitis virus Post-transcriptional Regulatory Element) is a commonly used regulatory element in lentiviral vectors. The WPRE, when placed in the 3' UTR of the gene of interest, can enhance the expression of the transgene in the early stages of RNA transcription by increasing mRNA levels in the nucleus and cytoplasm. When placed in the upstream of 3' LTR, transcription termination is improved, and therefore, transcript read-through can be significantly reduced. In the P0012 plasmid, in order to prevent the intron in the P-globin gene from being sliced out before reverse transcription of the lentiviral genome, its reverse complementary sequence was cloned into the lentiviral vector (according to the transcription direction of the lentivims). The WPRE, just as an element placed in tire 3‘ LTR, theoretically cannot increase the expression efficiency of p- globin gene. In the POO 12 plasmid, the inclusion of WPRE surprisingly significantly increased lentiviral packaging yield by at least about 50%. However, it was discovered that the use of WPRE has risks because of its sequence overlap with the woodchuck hepatitis vims protein X (WHX). Thus, the WPRE sequence was mutated at 6 bases (mut6), including 5 bases in the predicted WHX promoter region and 1 base of the starting codon, so that WHX could not initiate expression of the WPRE sequence, thereby enhancing safety. The mutated version of WPRE was named mWPRE (SEQ ID NO:33), and P0012, after modification, was named TH04.
The mWPRE gene was synthesized and inserted between Mini and Kpnl of POO 12 by restriction enzyme cleavage and ligation. The new construct was confirmed by sequencing and named TH04.
SEQ ID NO: 32
AATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTAC GCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTTCT CCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCAGGCAACGTGGC GTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTCAGCTCCT TTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCT GCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAGCTGACGTCCTTT CCATGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGACGTCCTTCTGCTACGTCCCTTCGGC CCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGCC TTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGC
SEQ ID NO: 33
AATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTAC GCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTTCT CCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCAGGCAACGTGGC GTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTCAGCTCCT TTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCT GCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAATCATCGTCCTTT CCTTGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGACGTCCTTCTGCTACGTCCCTTCGGC CCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGCC TTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGC
Example 10. Efficacy test in mouse model of thalassemia
This Example describes evaluation of the efficacy of the TH04 vector in a mouse model of thalassemia.
The thalassemia model Hbbth-4/Hbb+ mice (purchased from Southern Model Organisms) were used to test efficacy of the TH04 vector. The mice were 11 weeks old, with females as donors and males as recipients. The bone marrow hematopoietic stem/progenitor cells were collected and purified from donor mice, transduced with TH04 lentivirus ex vivo, and infused into the recipient mice via the tail vein injection. The therapeutic effect of TH04 lentivirus was assessed by determining the vector copy number, chimeric rate, and changes in thalassaemia-related blood indicators.
Experimental protocol: Three groups were tested: the treatment group, the negative control group, and the positive control group. For the negative control group (G 1), purified bone marrow stem cells from female Hbbth4 mice without LV-TH04 transduction were transplanted into male Hbbth4 mice. For the treatment group (G2), purified bone marrow stem cells from female Hbbth4 mice after LV-TH04 transduction were transplanted into male Hbbth4 mice. For the positive control group (G3), purified bone marrow stem cells from female C57BL/6 mice were transplanted into male Hbbth4 mice. Table 8 includes details of the experimental groups.
Table 8. Overview of experimental groups
Isolation of mouse bone marrow stem cells : After euthanizing the donor animals with carbon dioxide, the femur, tibia, and iliac were quickly separated in a biosafety cabinet and immediately transferred to a sterile Petri dish containing DPBS to prevent the bones from drying out. Bone marrows were rinsed with 5 mL DPBS (2% fetal bovine serum)/mouse into a new 50-mL tube with a 70 gm cell strainer, and bone marrow cells suspensions were centrifuged at 500xg for 5 min at room temperature. Bone marrow cells were resuspended with 5 mL of DPBS and slowly added to 4 mL of Ficoll-Paque (p=1.084 g/mL) pre-warmed at room temperature. Mature red blood cells were removed after centrifugation for 15 minutes at room temperature with ramp down to 0/0. After density gradient centrifugation, the liquid except the bottom red blood cell layer was slowly aspirated, the samples were centrifuged at 500xg for 5 min at 4 °C, and the pellets were resuspended with 5 mL of DPBS after centrifugation.
Purification of mouse bone marrow stem cells : Stem cells were purified with Lineage Cell Depletion Kit and c-Kit positive sorting kit from MACS according to manufacturer's instructions.
Transduction of bone marrow stem cells and culture: Cells sorted by Lineage Cell
Depletion Kit and c-Kit-positive sorting kit were cultured overnight in a 37°C, 5% CO2 cell culture incubator, and then transduced with LV-TH04 lentivirus with a MOI=200 for the treatment group. The transduced cells for the treatment group, as well as the cells of the negative control group and the positive control group, were continued to be cultured in a 5% CO2 cell culture incubator for two days.
Irradiation of recipient animals irradiation and cell transfusion : On the day when culturing of bone marrow cells was finished, recipient animals were subjected to myeloablative conditioning with X-ray irradiation (4.5Gy), twice, 3 h apart. The cultured and collected cell suspensions were infused individually by tail vein injection to groups of animals within two hours after the myeloablative conditioning was completed, and the cells were infused at 1E+06 cells/ animal.
Determination of VCN and chimeric rate in PBMCs of mice: 100 pL of whole blood samples were collected by retro-orbital bleeding at 4, 6 and 8 weeks after bone marrow transplantation of recipient animals, and about 5E+05 PBMCs were isolated after density gradient centrifugation and used for chimeric rate and VCN analysis.
The PBMC genomic DNAs were extracted by magnetic bead genome extraction kit, and the concentration of each extracted template DNA was determined by microspectrophotometer. The genomic DNA samples were uniformly diluted with ultrapure water to about 50 ng/pL. Determination of chimeric rate and VCN was accomplished with real-time PCR.
Determination of VCN : Mouse MKL3 gene was used as the reference gene, and LTR as the gene detection primer probe for integration of lentiviral vectors into cells. The sequences for primers and probes are shown in Table 9, the reaction system is shown in Table 10, and the reaction procedure is shown in Table 11.
Table 9. Primer and probe sequences used for VCN qPCR
Table 10. Preparation of qPCR reaction system for VCN determination (20 pL)
Table 11. Program of the qPCR
The VCN values in the samples were calculated as follows: 2AMKL3/2ALTR = relative VCN Relative VCN/single-copy relative VCN average = absolute VCN Each assay included RAW264.7 cell DNA template containing a single-copy vector per genome (with the integration of only one lentiviral vector).
Results of the VCN determination are shown in FIG. 5. The VCN determination in PBMC showed that the VCN of PBMC in the LV-TH04 transduction group was between 1~4, which was as expected.
Determination of chimeric rate : The sample preparation and method of chimeric rate determination were the same as those of VCN determination, except that the LTR primers and probe were replaced with those for the SRY gene, which is a gene unique to the mouse Y chromosome. The SRY sequences are shown in Table 12. The reaction system is the same as Table 10, except that the LTR primers and probe were replaced with those for SRY. The reaction procedure is the same as Table 11.
Table 12. Sequences of primers and probe used in qPCR for chimeric rate determination
Chimeric rate was analyzed as follows:
(1) Calculation of the VCN value in the samples: 2AMKL3/2ASRY=relative VCN
(2) Relative VCN of the samples/mean relative VCN of male mouse bone marrow cells of the thalassemia model = absolute VCN
(3) Calculation of chimeric rate after female mouse cells reinfused to male mice: 1-VCN then converted to percentage
Results of the chimeric rate analyses are shown in FIG. 6. The chimeric rate assay of PBMCs showed that the implantations of bone marrow stem cells in the three groups were consistent, indicating that LV-TH04 transduction did not affect the implantation of stem cells.
Routine blood tests : Whole blood samples of 50 pL were collected by retro-orbital bleeding from recipient animals for complete blood count (CBC) at 4, 6, and 8 weeks after bone marrow transplantation. The results of main indicators related to thalassaemia are shown in FIG. 7. After transduction and infusion, the LV-TH04 transduction group had significantly improved the hemoglobin content, hematocrit, and average red blood cell volume compared with the Mock group, while the levels of reticulocytes was significantly decreased in the TH04 transduction group compared with the Mock group (FIG. 7). The levels of hemoglobin content, reticulocytes, hematocrit, and average red blood cell volume were similar between the LV-TH04 transduction group and the positive control group (FIG. 7). These data demonstrates the high therapeutic efficacy of TH04 in animal models of the thalassaemia, with curative effects achieved.
Example 11. Clinical data 1 - Expression assay in red blood cells directionally differentiated from CD34+ stem cells isolated from thalassemia major patients after ex vivo transduction with LV-TH04
This Example describes the effects of TH04 on red blood cells directionally differentiated from CD34+ stem cells isolated from thalassemia major patients.
CD34+ stem cells were isolated from thalassemia major patients by apheresis and transduced with TH04 at MOI=100. After transduction, medium containing erythropoietin was used to promote the directional differentiation of stem cells to red blood cells. The cells were collected after 15 days of culture. 200 uL of ultrapure water was added to and fully mixed with 1E7 cells to lyse the cells, and the supernatants were collected after centrifuging at 12000rpm for 5min and used for HPLC assays.
The conditions for the HPLC assays are shown in Table 13. HPLC assay conditions include: column C4 4.6*250nm: UV 220nm detection; Sample loading, 20uL. Table 13. HPLC assay conditions
As shown in the chromatograms of FIG. 8 and the peak area calculations in Table 14, the proportion of p/a increased from 0 to 43%. Clinical trial results indicate that patients who have this p/a ratio no longer need blood transfusions and achieve complete cure.
Table 14. Peak area of HPLC assays
Example 12. Clinical data 2 - Myeloablative conditioning protocols generally shortened neutrophil engraftment time and platelet recovery time
This Example describes the effects of different myeloablative condition protocols on neutrophil engraftment time and platelet recovery time in patients infused with lentivirally transduced hematopoietic stem cells.
In order to make LV-TH04-transduced CD34+ hematopoietic stem cells (compositions) implant better and faster after infusion into patients, it may be necessary to perform myeloablative conditioning on patients before the composition is reinfused into the patient. In previous clinical trials of gene therapy for thalassemia, including those that have used lentiviral vectors to transduce CD34+ hematopoietic stem cells or gene-editing technology to modify CD 34+ hematopoietic stem cells, myeloablative conditioning based on busulfan (BU) was performed. In this Example, myeloablative conditioning based on busulfan combined with cyclophosphamide (BU/CY) was performed, and the protocol was optimized for individual patients. As described below, the results of clinical trials showed that myeloablative conditioning based on BU/CY generally shortened neutrophil engraftment time and platelet recovery time compared with myeloablative conditioning based on BU alone.
The specific steps of myeloablative conditioning are as follows: Myeloablative conditioning based on BU/CY:
Busulfan was intravenously administered for 2 hours and every 6 hours at a dosage of 2.4-4.8 mg/kg/day. Cyclophosphamide was administered 24 hours after busulfan administration. The dosage of cyclophosphamide was 45 to 65 mg/kg/day intravenously. The duration of administration of busulfan was 2 to 4 days, and the duration of administration of cyclophosphamide was 1 to 5 days. Infusion of the composition began 24-72 hours after cyclophosphamide administration. Myeloablative conditioning based on BU:
Busulfan was intravenously infused for 2 hours and every 6 hours at a dosage of 3.2 mg/kg/day. The duration of administration of busulfan was 4 days. Reinfusion of the composition began 72 hours after busulfan administration.
The results of the clinical trial showed that neutrophils engrafted on the 10th day after the reinfusion (ANC>0.5* 109/L for 3 consecutive days) in subjects treated with myeloablative conditioning based on BU/CY (PJYU, ZRHA), while neutrophils engrafted on the 14th day after the reinfusion in subjects treated with myeloablative conditioning based on BU (FAZH) (FIG. 9). Similarly, subjects treated with myeloablative conditioning based on BU/CY (PJYU, ZRHA) had faster platelet recovery than subjects treated with myeloablative conditioning based on BU (FAZH) (FIG. 10). Platelet levels in PJYU and ZRHA showed a continuous upward trend from days 17 and 11, respectively, and recovered to normal levels (>100* 109/L) on days 48 and 29, respectively. Platelet levels in FAZH, on the other hand, fluctuated between 20-40* I ()9/L for up to 28 days, and only began to rise on day 43 and recovered to normal levels for the first time by day 56 (FIG. 10).
Example 13. Determination of stabilizers for pharmaceutical compositions comprising lentiviral vectors
This Example describes screening and evaluation of stabilizers for pharmaceutical compositions comprising, e.g., lentiviral vectors for thalassemia gene therapy. Initial screening of stabilizers:
Initial screening of stabilizers was performed by dispersing purified lentiviral vectors for thalassemia gene therapy into the systems shown in Table 15 to form a formulation. Each formulation was tested as follows:
Placing at room temperature for 1 day,
Placing at 4 °C for 3 days, or Placing under conditions of freeze-thaw for 3 times (freezing at -80°C, with the freezing duration not less than 6 hours, thawing at 23°C, with the thawing duration not less than 30 minutes).
Then, a certain amount of sample was analyzed for loss rate of the viral particles to characterize the stability of the formulations.
Table 15. Components of formulations tested during initial screening of stabilizers.
As shown in FIG. 11, the addition of sugars or polyhydric alcohols to the formulation inhibited the inactivation of lentiviral particles caused by microtherm and repeated freeze-thaw processes. In particular, the formulation with sucrose exhibited the best performance, demonstrating significant protection compared with the formulation without sugars or poly hydric alcohols.
Effect of stabilizers:
To evaluate the effect of stabilizers, purified lentiviral vectors for thalassemia gene therapy were dispersed into the systems shown in Table 16 to form a formulation. Each formulation was tested as follows:
Placing under conditions of freeze-thaw for 3 times (freezing at -80 °C, with the freezing duration not less than 6 hours, thawing at 23 °C, with the thawing duration not less than 30 minutes), or
Placing under conditions of freeze-thaw for 9 times (freezing at -80 °C, with the freezing duration not less than 6 hours, thawing at 23 °C, with the thawing duration not less than 30 minutes).
Then, a certain amount of sample was analyzed using biometric titer determination (PCR method).
Table 16. Components of formulations tested for comparing the effect of stabilizers.
As shown in FIG. 12, the combination of sodium citrate and sucrose in the formulation resulted in good bioactivity of lentiviral particles after repeated freeze-thaw, regardless of the ratio of sodium citrate and sucrose.
Concentrations of stabilizers:
To determine how the concentrations of stabilizers affect the stability of lentiviral particles, purified lentiviral vectors for thalassemia gene therapy were dispersed into the systems shown in Table 17 to form a formulation. Each formulation was tested as follows:
Placing under conditions of freeze-thaw for 3 times (freezing at -80 °C, with the freezing duration not less than 6 hours, melting at 23 °C, with the thawing duration not less than 30 minutes).
Then, a certain amount of sample was analyzed using biometric titer determination (PCR method).
Table 17. Components of formulations tested for comparing concentrations of stabilizers.
As shown in FIG. 13, formulations comprising varying ratios of sodium citrate and sucrose, under isotonic conditions, effectively inhibited loss of the titers and bioactivity of the lentiviral vector particles.
Example 14. Determination of buffers for pharmaceutical compositions comprising lentiviral vectors
This Example describes screening and evaluation of buffers for pharmaceutical compositions comprising, e.g., lentiviral vectors for thalassemia gene therapy.
Initial screening of buffers: Initial screening of buffers was performed by dispersing purified lentiviral vectors for thalassemia gene therapy into the systems shown in Table 18 to form a formulation. Each formulation was tested as follows:
Placing at room temperature for 1 day,
Placing at 4°C for 3 days, or
Placing under conditions of freeze-thaw for 3 times (freezing at -80°C, with the freezing duration not less than 6 hours, thawing at 23 °C, with the thawing duration not less than 30 minutes).
Then, a certain amount of sample was analyzed for loss rate of the viral particles to characterize the stability of the formulations.
Table 18. Components of formulations tested during initial screening of buffers.
As shown in FIG. 14, the sodium citrate buffer exhibited a better effect on stabilizing the biological activity of lentiviral particles when compared with other buffers. No obvious inactivation of viral particles was observed when using the sodium citrate buffer, indicating that viral particles are more stable in formulations with this buffer than in traditional formulations.
Effect of buffers:
To evaluate the effects of buffers, purified lentiviral vectors for thalassemia gene therapy were dispersed into the systems shown in Table 19 to form a formulation. Each group of formulation was tested as follows:
Placing at 4°C for 1 day,
Placing at room temperature for 1 day, or
Placing at 4°C for 3 days.
Then, a certain amount of sample was analyzed using biometric titer determination (PCR method).
Table 19. Components of formulations tested for comparing the effects of buffers.
As shown in FIG. 15, when compared with traditional PBS, the combination of sodium citrate and sucrose exhibited a better effect on stabilizing the lentiviral bioactivity under isotonic conditions, and there was no significant change in the biological titer of lentiviral particles under various test conditions.
Summary
The formulations tested, e.g., comprising the stabilizers and/or buffers described in Examples 13 and 14, provide a number of benefits, including good freeze-thaw stability and storage stability for lentiviral particles. The formulations can effectively prevent loss of the biological activity of viral particles caused by repeated freeze-thaw and storage at low temperature, and the viral particles still exhibit good bioactivity after repeated freeze-thaw and long-term storage. Moreover, the formulations tested can disperse more active lentiviral particles in solution, with no obvious precipitation and turbidity observed even with 2-3 * 109TU/mL viral particles.
The specific examples described above are to explain the implementation plan of this disclosure and should not be regarded as the limit of the scope of this disclosure. In addition, any modifications and/or variations described in this disclosure are obvious to those skilled in the art to which the present disclosure pertains, as long as they do not depart from the concepts of the present disclosure or go beyond the scope defined by the claims. Although various preferred examples were used to describe the details of the present disclosure, it should be noted that the present disclosure is not limited to these specific examples. In fact, any modifications to the described specific examples, which are obvious to those skilled in the art to which the present disclosure pertains, should all belong to the scope of the present patent protection.
INCORPORATION BY REFERENCE
All publications, patents, and Accession numbers mentioned herein are hereby incorporated by reference in their entirety as if each individual publication or patent was specifically and individually indicated to be incorporated by reference. EQUIVALENTS
While specific embodiments of the subject invention have been discussed, the above specification is illustrative and not restrictive. Many variations of the invention will become apparent to those skilled in the art upon review of this specification and the claims below. The full scope of the invention should be determined by reference to the claims, along with their full scope of equivalents, and the specification, along with such variations.
LISTING OF SEQUENCES
SEQ ID NO : 1 ggccgcgttg ctggcgtttt tccataggct ccgcccccct gacgagcatc acaaaaatcg 60 acgctcaagt cagaggtggc gaaacccgac aggactataa agataccagg cgtttccccc 120 tggaagctcc ctcgtgcgct ctcctgttcc gaccctgccg cttaccggat acctgtccgc 180 ctttctccct tcgggaagcg tggcgctttc tcatagctca cgctgtaggt atctcagttc 240 ggtgtaggtc gttcgctcca agctgggctg tgtgcacgaa ccccccgttc agcccgaccg 300 ctgcgcctta tccggtaact atcgtcttga gtccaacccg gtaagacacg acttatcgcc 360 actggcagca gccactggta acaggattag cagagcgagg tatgtaggcg gtgctacaga 420 gttcttgaag tggtggccta actacggcta cactagaaga acagtatttg gtatctgcgc 480 tctgctgaag ccagttacct tcggaaaaag agttggtagc tcttgatccg gcaaacaaac 540 caccgctggt agcggtggtt tttttgtttg caagcagcag attacgcgca gaaaaaaagg 600 atctcaagaa gatcctttga tcttttctac ggggtctgac gctcagtgga acgaaaactc 660 acgttaaggg attttggtca tgaagcgctt ttgaagctcg gatccgaaca aacgacccaa 720 cacccgtgcg ttttattctg tctttttatt gccgatcccc tcagaagaac tcgtcaagaa 780 ggcgatagaa ggcgatgcgc tgcgaatcgg gagcggcgat accgtaaagc acgaggaagc 840 ggtcagccca ttcgccgcca agctcttcag caatatcacg ggtagccaac gctatgtcct 900 gatagcggtc cgccacaccc agccggccac agtcgatgaa tccagaaaag cggccatttt 960 ccaccatgat attcggcaag caggcatcgc catgggtcac gacgagatcc tcgccgtcgg 1020 gcatgctcgc cttgagcctg gcgaacagtt cggctggcgc gagcccctga tgctcttcgt 1080 ccagatcatc ctgatcgaca agaccggctt ccatccgagt acgtgctcgc tcgatgcgat 1140 gtttcgcttg gtggtcgaat gggcaggtag ccggatcaag cgtatgcagc cgccgcattg 1200 catcagccat gatggatact ttctcggcag gagcaaggtg agatgacagg agatcctgcc 1260 ccggcacttc gcccaatagc agccagtccc ttcccgcttc agtgacaacg tcgagcacag 1320 ctgcgcaagg aacgcccgtc gtggccagcc acgatagccg cgctgcctcg tcttgcagtt 1380 cattcagggc accggacagg tcggtcttga caaaaagaac cgggcgcccc tgcgctgaca 1440 gccggaacac ggcggcatca gagcagccga ttgtctgttg tgcccagtca tagccgaata 1500 gcctctccac ccaagcggcc ggagaacctg cgtgcaatcc atcttgttca atcatgcgaa 1560 acgatcctca tcctgtctct tgatcagagc ttgatcccct gcgccatcag atccttggcg 1620 gcaagaaagc catccagttt actttgcagg gcttcccaac cttaccagag gcctgcgccg 1680 cggccagctg gctagcaatt cccgggttaa ctctagagac attgattatt gactagttat 1740 taatagtaat caattacggg gtcattagtt catagcccat atatggagtt ccgcgttaca 1800 taacttacgg taaatggccc gcctggctga ccgcccaacg acccccgccc attgacgtca 1860 ataatgacgt atgttcccat agtaacgcca atagggactt tccattgacg tcaatgggtg 1920 gagtatttac ggtaaactgc ccacttggca gtacatcaag tgtatcatat gccaagtacg 1980 ccccctattg acgtcaatga cggtaaatgg cccgcctggc attatgccca gtacatgacc 2040 ttatgggact ttcctacttg gcagtacatc tacgtattag tcatcgctat taccatggtg 2100 atgcggtttt ggcagtacat caatgggcgt ggatagcggt ttgactcacg gggatttcca 2160 agtctccacc ccattgacgt caatgggagt ttgttttggc accaaaatca acgggacttt 2220 ccaaaatgtc gtaacaactc cgccccattg acgcaaatgg gcggtaggcg tgtacggtgg 2280 gaggtctata taagcagagc tcgtttagtg aaccggggtc tctctggtta gaccagatct 2340 gagcctggga gctctctggc taactaggga acccactgct taagcctcaa taaagcttgc 2400 cttgagtgct tcaagtagtg tgtgcccgtc tgttgtgtga ctctggtaac tagagatccc 2460 tcagaccctt ttagtcagtg tggaaaatct ctagcagtgg cgcccgaaca gggacttgaa 2520 agcgaaaggg aaaccagagg agctctctcg acgcaggact cggcttgctg aagcgcgcac 2580 ggcaagaggc gaggggcggc gactggtgag tacgccaaaa attttgacta gcggaggcta 2640 gaaggagaga gatgggtgcg agagcgtcag tattaagcgg gggagaatta gatcgcgatg 2700 ggaaaaaatt cggttaaggc cagggggaaa gaaaaaatat aaattaaaac atatagtatg 2760 ggcaagcagg gagctagaac gattcgcagt taatcctggc ctgttagaaa catcagaagg 2820 ctgtagacaa atactgggac agctacaacc atcccttcag acaggatcag aagaacttag 2880 atcattatat aatacagtag caaccctcta ttgtgtgcat caaaggatag agataaaaga 2940 caccaaggaa gctttagaca agatagagga agagcaaaac aaaagtaaga ccaccgcaca 3000 gcaagcggcc gctgatcttc agacctggag gaggagatat gagggacaat tggagaagtg 3060 aattatataa atataaagta gtaaaaattg aaccattagg agtagcaccc accaaggcaa 3120 agagaagagt ggtgcagaga gaaaaaagag cagtgggaat aggagctttg ttccttgggt 3180 tcttgggagc agcaggaagc actatgggcg cagcgtcaat gacgctgacg gtacaggcca 3240 gacaattatt gtctggtata gtgcagcagc agaacaattt gctgagggct attgaggcgc 3300 aacagcatct gttgcaactc acagtctggg gcatcaagca gctccaggca agaatcctgg 3360 ctgtggaaag atacctaaag gatcaacagc tcctggggat ttggggttgc tctggaaaac 3420 tcatttgcac cactgctgtg ccttggaatg ctagttggag taataaatct ctggaacaga 3480 tttggaatca cacgacctgg atggagtggg acagagaaat taacaattac acaagcttaa 3540 tacactcctt aattgaagaa tcgcaaaacc agcaagaaaa gaatgaacaa gaattattgg 3600 aattagataa atgggcaagt ttgtggaatt ggtttaacat aacaaattgg ctgtggtata 3660 taaaattatt cataatgata gtaggaggct tggtaggttt aagaatagtt tttgctgtac 3720 tttctatagt gaatagagtt aggcagggat attcaccatt atcgtttcag acccacctcc 3780 caaccccgag gggacccgac aggcccgaag gaatagaaga agaaggtgga gagagagaca 3840 gagacagatc cattcgatta gtgaacggat ctcgacggta tcggttaact tttaaaagaa 3900 aaggggggat tggggggtac agtgcagggg aaagaatagt agacataata gcaacagaca 3960 tacaaactaa agaattacaa aaacaaatta caaaaattca aaattttatc gatcacgaga 4020 ctagcctcga ggcatgcctg caggaattcg agctcggtac ctttaagacc aatgacttac 4080 aaggcagctg tagatcttag ccacttttta aaagaaaagg ggggactgga agggctaatt 4140 cactcccaac gaagacaaga tctgcttttt gcttgtactg ggtctctctg gttagaccag 4200 atctgagcct gggagctctc tggctaacta gggaacccac tgcttaagcc tcaataaagc 4260 ttgccttgag tgcttcaagt agtgtgtgcc cgtctgttgt gtgactctgg taactagaga 4320 tccctcagac ccttttagtc agtgtggaaa atctctagca gtagtagttc atgtcatctt 4380 attattcagt atttataact tgcaaagaaa tgaatatcag agagtgagag ggtcgaccat 4440 tacttattgt tttagctgtc ctcatgaatg tcttttcact acccatttgc ttatcctgca 4500 tctctcagcc ttgactccac tcagttctct tgcttagaga taccaccttt cccctgaagt 4560 gttccttcca tgttttacgg cgagatggtt tctcctcgcc tggccactca gccttagttg 4620 tctctgttgt cttatagagg tctacttgaa gaaggaaaaa cagggggcat ggtttgactg 4680 tcctgtgagc ccttcttccc tgcctccccc actcacagtg acccggaatc cctcgacatg 4740 gcagtctagc actagtgcgg ccgcagatct gcttcctcgc tcactgactc gctgcgctcg 4800 gtcgttcggc tgcggcgagc ggtatcagct cactcaaagg cggtaatacg gttatccaca 4860 gaatcagggg ataacgcagg aaagaacatg tgagcaaaag gccagcaaaa ggccaggaac 4920 cgtaaaaa 4928
SEQ ID NO : 2 cctcaagatg ataactttta ttttctggac ttgtaatagc tttctcttgt attcaccatg 60 ttgtaacttt cttagagtag taacaatata aagttattgt gagtttttgc aaacacagca 120 aacacaacga cccatataga cattgatgtg aaattgtcta ttgtcaattt atgggaaaac 180 aagtatgtac tttttctact aagccattga aacaggaata acagaacaag attgaaagaa 240 tacattttcc gaaattactt gagtattata caaagacaag cacgtggacc tgggaggagg 300 gttattgtcc atgactggtg tgtggagaca aatgcaggtt tataatagat gggatggcat 360 ctagcgcaat gactttgcca tcacttttag agagctcttg gggaccccag tacacaagag 420 gggacgcagg gtatatgtag acatctcatt ctttttctta gtgtgagaat aagaatagcc 480 atgacctgag tttatagaca atgagccctt ttctctctcc cactcagcag ctatgagatg 540 gcttgccctg cctctctact aggctgactc actccaaggc ccagcaatgg gcagggctct 600 gtcagggctt tgatagcact atctgcagag ccagggccga gaaggggtgg actccagaga 660 ctctccctcc cattcccgag cagggtttgc ttatttatgc atttaaatga tatatttatt 720 ttaaaagaaa taacaggaga ctgcccagcc ctggctgtga catggaaact atgtagaata 780 ttttgggttc catttttttt tccttctttc agttagagga aaaggggctc actgcacata 840 cactagacag aaagtcagga gctttgaatc caagcctgat catttccatg tcatactgag 900 aaagtcccca cccttctctg agcctcagtt tctcttttta taagtaggag tctggagtaa 960 atgatttcca atggctctca tttcaataca aaatttccgt ttattaaatg catgagcttc 1020 tgttactcca agactgagaa ggaaattgaa cctgagactc attgactggc aagatgtccc 1080 cagaggctct cattcagcaa taaaattctc accttcaccc aggcccactg agtgtcagat 1140 ttgcatgcac tagagaagag tcaagcattt gcctaaggtc ggacatgtca gaggcagtgc 1200 cagacctatg tgagactctg cagctactgc tcatgggccc tgtgctgcac tgatgaggag 1260 gatcagatgg atggggcaat gaagcaaagg aatcattctg tggataaagg agacagccat 1320 gaagaagtct atgactgtaa atttgggagc aggagtctct aaggacttgg atttcaagga 1380 attttgactc agcaaacaca agaccctcac ggtgactttg cgagctggtg tgccagatgt 1440 gtctatcaga ggttccaggg agggtggggt ggggtcaggg ctggccacca gctatcaggg 1500 cccagatggg ttataggctg gcaggctcag ataggtggtt aggtcaggtt ggtggtgctg 1560 ggtggagtcc atgactccca ggagccagga gagatagacc atgagtagag ggcagacatg 1620 ggaaaggtgg gggaggcaca gcatagcagc atttttcatt ctactactac atgggactgc 1680 tcccctatac ccccagctag gggcaagtgc cttgactcct atgttttcag gatcatcatc 1740 tataaagtaa gagtaataat tgtgtctatc tcatagggtt attatgagga tcaaaggaga 1800 tgcacactct ctggaccagt ggcctaacag ttcaggacag agctatgggc ttcctatgta 1860 tgggtcagtg gtctcaatgt agcaggcaag ttccagaaga tagcatcaac cactgttaga 1920 gatatactgc cagtctcaga gcctgatgtt aatttagcaa tgggctggga ccctcctcca 1980 gtagaacctt ctaaccagcc cgggaggcgg aggttgcagt gagctgagat cgtgccactg 2040 cactccagcc tgggggacag agcacattat aattaactgt tattttttac ttggactctt 2100 gtggggaata agatacatgt tttattctta tttatgattc aagcactgaa aatagtgttt 2160 agcatccagc aggtgcttca aaaccatttg ctgaatgatt actatacttt ttacaagctc 2220 agctccctct atcccttcca gcatcctcat ctctgattaa ataagcttca gtttttcctt 2280 agttcctgtt acatttctgt gtgtctccat tagtgacctc ccatagtcca agcatgagca 2340 gttctggcca ggcccctgtc ggggtcagtg ccccaccccc gccttctggt tctgtgtaac 2400 cttctaagca aaccttctgg ctcaagcaca gcaatgctga gtcatgatga gtcatgctga 2460 ggcttagggt gtgtgcccag atgttctcag cctagagtga tgactcctat ctgggtcccc 2520 agcaggatgc ttacagggca gatggcaaaa aaaaggagaa gctgaccacc tgactaaaac 2580 tccacctcaa acggcatcat aaagaaaatg gatgcctgag acagaatgtg acatattcta 2640 gatacgtaaa tacacttgca aaggaggatg tttttagtag caatttgtac tgatggtatg 2700 gggccaagag atatatctta gagggagggc tgagggtttg aagtccaact cctaagccag 2760 tgccagaaga gccaaggaca ggtacggctg tcatcactta gacctcaccc tgtggagcca 2820 caccctaggg ttggccaatc tactcccagg agcagggagg gcaggagcca gggctgggca 2880 taaaagtcag ggcagagcca tctattgctt acatttgctt ctgacacaac tgtgttcact 2940 agcaacctca aacagacacc atggtgcatc tgactcctga ggagaagtct gccgttactg 3000 ccctgtgggg caaggtgaac gtggatgaag ttggtggtga ggccctgggc aggttggtat 3060 caaggttaca agacaggttt aaggagacca atagaaactg ggcatgtgga gacagagaag 3120 actcttgggt ttctgatagg cactgactct ctctgcctat tggtctattt tcccaccctt 3180 aggctgctgg tggtctaccc ttggacccag aggttctttg agtcctttgg ggatctgtcc 3240 actcctgatg ctgttatggg caaccctaag gtgaaggctc atggcaagaa agtgctcggt 3300 gcctttagtg atggcctggc tcacctggac aacctcaagg gcacctttgc ccagctgagt 3360 gagctgcact gtgacaagct gcacgtggat cctgagaact tcagggtgag tctatgggac 3420 gcttgatgtt ttctttcccc ttcttttcta tggttaagtt catgtcatag gaaggggata 3480 agtaacaggg tacacatatt gaccaaatca gggtaatttt gcatttgtaa ttttaaaaaa 3540 tgctttcttc ttttaatata cttttttgtt tatcttattt ctaatacttt ccctaatctc 3600 tttctttcag ggcaataatg atacaatgta tcatgcctct ttgcaccatt ctaaagaata 3660 acagtgataa tttctgggtt aaggcaatag caatatctct gcatataaat atttctgcat 3720 ataaattgta actgatgtaa gaggtttcat attgctaata gcagctacaa tccagctacc 3780 attctgcttt tattttatgg ttgggataag gctggattat tctgagtcca agctaggccc 3840 ttttgctaat catgttcata cctcttatct tcctcccaca gctcctgggc aacgtgctgg 3900 tctgtgtgct ggcccatcac tttggcaaag aattcacccc accagtgcag gctgcctatc 3960 agaaagtggt ggctggtgtg gctaatgccc tggcccacaa gtatcactaa gctcgctttc 4020 ttgctgtcca atttctatta aaggttcctt tgttccctaa gtccaactac taaactgggg 4080 gatattatga agggccttga gcatctggat tctgcctaat aaaaaacatt tattttcatt 4140 gcaatgatgt atttaaatta tttctgaata ttttactaaa aagggaatgt gggaggtcag 4200 tgcatttaaa acataaagaa atgaagagct agttcaaacc ttgggaaaat acactatatc 4260 ttaaactcca tgaaagaagg tgaggctgca aacagctaat gcacattggc aacagcccct 4320 gatgcatatg ccttattcat ccctcagaaa aggattcaag tagaggcttg atttggaggt 4380 taaagttttg ctatgctgta ttttacatta cttattgttt tagctgtcct catgaatgtc 4440 ttttcactac ccatttgctt atcctgcatc tctcagcctt gactccactc agttctcttg 4500 cttagagata ccacctttcc cctgaagtgt tccttccatg ttttacggcg agatggtttc 4560 tcctcgcctg gccactcagc cttagttgtc tctgttgtct tatagaggtc tacttgaaga 4620 aggaaaaaca ggggtcatgg tttgactgtc ctgtgagccc ttcttccctg cctcccccac 4680 tcacagtgac ccggaatctg cagtgctagt ctcccggaac tatcactctt tcacagtctg 4740 ctttggaagg actgggctta gtatgaaaag ttaggactga gaagaatttg aaaggcggct 4800 ttttgtagct tgatattcac tactgtctta ttaccctgtc ataggcccac cccaaatgga 4860 agtcccattc ttcctcagga tgtttaagat tagcattcag gaagagatca gaggtctgct 4920 ggctccctta tcatgtccct tatggtgctt ctggctctgc agttattagc atagtgttac 4980 catcaaccac cttaacttca tttttcttat tcaataccta gg 5022
SEQ ID NO : 3 ggccgcgttg ctggcgtttt tccataggct ccgcccccct gacgagcatc acaaaaatcg 60 acgctcaagt cagaggtggc gaaacccgac aggactataa agataccagg cgtttccccc 120 tggaagctcc ctcgtgcgct ctcctgttcc gaccctgccg cttaccggat acctgtccgc 180 ctttctccct tcgggaagcg tggcgctttc tcatagctca cgctgtaggt atctcagttc 240 ggtgtaggtc gttcgctcca agctgggctg tgtgcacgaa ccccccgttc agcccgaccg 300 ctgcgcctta tccggtaact atcgtcttga gtccaacccg gtaagacacg acttatcgcc 360 actggcagca gccactggta acaggattag cagagcgagg tatgtaggcg gtgctacaga 420 gttcttgaag tggtggccta actacggcta cactagaaga acagtatttg gtatctgcgc 480 tctgctgaag ccagttacct tcggaaaaag agttggtagc tcttgatccg gcaaacaaac 540 caccgctggt agcggtggtt tttttgtttg caagcagcag attacgcgca gaaaaaaagg 600 atctcaagaa gatcctttga tcttttctac ggggtctgac gctcagtgga acgaaaactc 660 acgttaaggg attttggtca tgaagcgctt ttgaagctcg gatccgaaca aacgacccaa 720 cacccgtgcg ttttattctg tctttttatt gccgatcccc tcagaagaac tcgtcaagaa 780 ggcgatagaa ggcgatgcgc tgcgaatcgg gagcggcgat accgtaaagc acgaggaagc 840 ggtcagccca ttcgccgcca agctcttcag caatatcacg ggtagccaac gctatgtcct 900 gatagcggtc cgccacaccc agccggccac agtcgatgaa tccagaaaag cggccatttt 960 ccaccatgat attcggcaag caggcatcgc catgggtcac gacgagatcc tcgccgtcgg 1020 gcatgctcgc cttgagcctg gcgaacagtt cggctggcgc gagcccctga tgctcttcgt 1080 ccagatcatc ctgatcgaca agaccggctt ccatccgagt acgtgctcgc tcgatgcgat 1140 gtttcgcttg gtggtcgaat gggcaggtag ccggatcaag cgtatgcagc cgccgcattg 1200 catcagccat gatggatact ttctcggcag gagcaaggtg agatgacagg agatcctgcc 1260 ccggcacttc gcccaatagc agccagtccc ttcccgcttc agtgacaacg tcgagcacag 1320 ctgcgcaagg aacgcccgtc gtggccagcc acgatagccg cgctgcctcg tcttgcagtt 1380 cattcagggc accggacagg tcggtcttga caaaaagaac cgggcgcccc tgcgctgaca 1440 gccggaacac ggcggcatca gagcagccga ttgtctgttg tgcccagtca tagccgaata 1500 gcctctccac ccaagcggcc ggagaacctg cgtgcaatcc atcttgttca atcatgcgaa 1560 acgatcctca tcctgtctct tgatcagagc ttgatcccct gcgccatcag atccttggcg 1620 gcaagaaagc catccagttt actttgcagg gcttcccaac cttaccagag gcctgcgccg 1680 cggccagctg gctagcaatt cccgggttaa ctctagagac attgattatt gactagttat 1740 taatagtaat caattacggg gtcattagtt catagcccat atatggagtt ccgcgttaca 1800 taacttacgg taaatggccc gcctggctga ccgcccaacg acccccgccc attgacgtca 1860 ataatgacgt atgttcccat agtaacgcca atagggactt tccattgacg tcaatgggtg 1920 gagtatttac ggtaaactgc ccacttggca gtacatcaag tgtatcatat gccaagtacg 1980 ccccctattg acgtcaatga cggtaaatgg cccgcctggc attatgccca gtacatgacc 2040 ttatgggact ttcctacttg gcagtacatc tacgtattag tcatcgctat taccatggtg 2100 atgcggtttt ggcagtacat caatgggcgt ggatagcggt ttgactcacg gggatttcca 2160 agtctccacc ccattgacgt caatgggagt ttgttttggc accaaaatca acgggacttt 2220 ccaaaatgtc gtaacaactc cgccccattg acgcaaatgg gcggtaggcg tgtacggtgg 2280 gaggtctata taagcagagc tcgtttagtg aaccggggtc tctctggtta gaccagatct 2340 gagcctggga gctctctggc taactaggga acccactgct taagcctcaa taaagcttgc 2400 cttgagtgct tcaagtagtg tgtgcccgtc tgttgtgtga ctctggtaac tagagatccc 2460 tcagaccctt ttagtcagtg tggaaaatct ctagcagtgg cgcccgaaca gggacttgaa 2520 agcgaaaggg aaaccagagg agctctctcg acgcaggact cggcttgctg aagcgcgcac 2580 ggcaagaggc gaggggcggc gactggtgag tacgccaaaa attttgacta gcggaggcta 2640 gaaggagaga gatgggtgcg agagcgtcag tattaagcgg gggagaatta gatcgcgatg 2700 ggaaaaaatt cggttaaggc cagggggaaa gaaaaaatat aaattaaaac atatagtatg 2760 ggcaagcagg gagctagaac gattcgcagt taatcctggc ctgttagaaa catcagaagg 2820 ctgtagacaa atactgggac agctacaacc atcccttcag acaggatcag aagaacttag 2880 atcattatat aatacagtag caaccctcta ttgtgtgcat caaaggatag agataaaaga 2940 caccaaggaa gctttagaca agatagagga agagcaaaac aaaagtaaga ccaccgcaca 3000 gcaagcggcc gctgatcttc agacctggag gaggagatat gagggacaat tggagaagtg 3060 aattatataa atataaagta gtaaaaattg aaccattagg agtagcaccc accaaggcaa 3120 agagaagagt ggtgcagaga gaaaaaagag cagtgggaat aggagctttg ttccttgggt 3180 tcttgggagc agcaggaagc actatgggcg cagcgtcaat gacgctgacg gtacaggcca 3240 gacaattatt gtctggtata gtgcagcagc agaacaattt gctgagggct attgaggcgc 3300 aacagcatct gttgcaactc acagtctggg gcatcaagca gctccaggca agaatcctgg 3360 ctgtggaaag atacctaaag gatcaacagc tcctggggat ttggggttgc tctggaaaac 3420 tcatttgcac cactgctgtg ccttggaatg ctagttggag taataaatct ctggaacaga 3480 tttggaatca cacgacctgg atggagtggg acagagaaat taacaattac acaagcttaa 3540 tacactcctt aattgaagaa tcgcaaaacc agcaagaaaa gaatgaacaa gaattattgg 3600 aattagataa atgggcaagt ttgtggaatt ggtttaacat aacaaattgg ctgtggtata 3660 taaaattatt cataatgata gtaggaggct tggtaggttt aagaatagtt tttgctgtac 3720 tttctatagt gaatagagtt aggcagggat attcaccatt atcgtttcag acccacctcc 3780 caaccccgag gggacccgac aggcccgaag gaatagaaga agaaggtgga gagagagaca 3840 gagacagatc cattcgatta gtgaacggat ctcgacggta tcggttaact tttaaaagaa 3900 aaggggggat tggggggtac agtgcagggg aaagaatagt agacataata gcaacagaca 3960 tacaaactaa agaattacaa aaacaaatta caaaaattca aaattttatc gatcacgaga 4020 ctagcctcga gaagcttgat atccctaggt attgaataag aaaaatgaag ttaaggtggt 4080 tgatggtaac actatgctaa taactgcaga gccagaagca ccataaggga catgataagg 4140 gagccagcag acctctgatc tcttcctgaa tgctaatctt aaacatcctg aggaagaatg 4200 ggacttccat ttggggtggg cctatgacag ggtaataaga cagtagtgaa tatcaagcta 4260 caaaaagccg cctttcaaat tcttctcagt cctaactttt catactaagc ccagtccttc 4320 caaagcagac tgtgaaagag tgatagttcc gggagactag cactgcagat tccgggtcac 4380 tgtgagtggg ggaggcaggg aagaagggct cacaggacag tcaaaccatg acccctgttt 4440 ttccttcttc aagtagacct ctataagaca acagagacaa ctaaggctga gtggccaggc 4500 gaggagaaac catctcgccg taaaacatgg aaggaacact tcaggggaaa ggtggtatct 4560 ctaagcaaga gaactgagtg gagtcaaggc tgagagatgc aggataagca aatgggtagt 4620 gaaaagacat tcatgaggac agctaaaaca ataagtaatg taaaatacag catagcaaaa 4680 ctttaacctc caaatcaagc ctctacttga atccttttct gagggatgaa taaggcatat 4740 gcatcagggg ctgttgccaa tgtgcattag ctgtttgcag cctcaccttc tttcatggag 4800 tttaagatat agtgtatttt cccaaggttt gaactagctc ttcatttctt tatgttttaa 4860 atgcactgac ctcccacatt ccctttttag taaaatattc agaaataatt taaatacatc 4920 attgcaatga aaataaatgt tttttattag gcagaatcca gatgctcaag gcccttcata 4980 atatccccca gtttagtagt tggacttagg gaacaaagga acctttaata gaaattggac 5040 agcaagaaag cgagcttagt gatacttgtg ggccagggca ttagccacac cagccaccac 5100 tttctgatag gcagcctgca ctggtggggt gaattctttg ccaaagtgat gggccagcac 5160 acagaccagc acgttgccca ggagctgtgg gaggaagata agaggtatga acatgattag 5220 caaaagggcc tagcttggac tcagaataat ccagccttat cccaaccata aaataaaagc 5280 agaatggtag ctggattgta gctgctatta gcaatatgaa acctcttaca tcagttacaa 5340 tttatatgca gaaatattta tatgcagaga tattgctatt gccttaaccc agaaattatc 5400 actgttattc tttagaatgg tgcaaagagg catgatacat tgtatcatta ttgccctgaa 5460 agaaagagat tagggaaagt attagaaata agataaacaa aaaagtatat taaaagaaga 5520 aagcattttt taaaattaca aatgcaaaat taccctgatt tggtcaatat gtgtaccctg 5580 ttacttatcc ccttcctatg acatgaactt aaccatagaa aagaagggga aagaaaacat 5640 caagcgtccc atagactcac cctgaagttc tcaggatcca cgtgcagctt gtcacagtgc 5700 agctcactca gctgggcaaa ggtgcccttg aggttgtcca ggtgagccag gccatcacta 5760 aaggcaccga gcactttctt gccatgagcc ttcaccttag ggttgcccat aacagcatca 5820 ggagtggaca gatccccaaa ggactcaaag aacctctggg tccaagggta gaccaccagc 5880 agcctaaggg tgggaaaata gaccaatagg cagagagagt cagtgcctat cagaaaccca 5940 agagtcttct ctgtctccac atgcccagtt tctattggtc tccttaaacc tgtcttgtaa 6000 ccttgatacc aacctgccca gggcctcacc accaacttca tccacgttca ccttgcccca 6060 cagggcagta acggcagact tctcctcagg agtcagatgc accatggtgt ctgtttgagg 6120 ttgctagtga acacagttgt gtcagaagca aatgtaagca atagatggct ctgccctgac 6180 ttttatgccc agccctggct cctgccctcc ctgctcctgg gagtagattg gccaacccta 6240 gggtgtggct ccacagggtg aggtctaagt gatgacagcc gtacctgtcc ttggctcttc 6300 tggcactggc ttaggagttg gacttcaaac cctcagccct ccctctaaga tatatctctt 6360 ggccccatac catcagtaca aattgctact aaaaacatcc tcctttgcaa gtgtatttac 6420 gtatctagaa tatgtcacat tctgtctcag gcatccattt tctttatgat gccgtttgag 6480 gtggagtttt agtcaggtgg tcagcttctc cttttttttg ccatctgccc tgtaagcatc 6540 ctgctgggga cccagatagg agtcatcact ctaggctgag aacatctggg cacacaccct 6600 aagcctcagc atgactcatc atgactcagc attgctgtgc ttgagccaga aggtttgctt 6660 agaaggttac acagaaccag aaggcggggg tggggcactg accccgacag gggcctggcc 6720 agaactgctc atgcttggac tatgggaggt cactaatgga gacacacaga aatgtaacag 6780 gaactaagga aaaactgaag cttatttaat cagagatgag gatgctggaa gggatagagg 6840 gagctgagct tgtaaaaagt atagtaatca ttcagcaaat ggttttgaag cacctgctgg 6900 atgctaaaca ctattttcag tgcttgaatc ataaataaga ataaaacatg tatcttattc 6960 cccacaagag tccaagtaaa aaataacagt taattataat gtgctctgtc ccccaggctg 7020 gagtgcagtg gcacgatctc agctcactgc aacctccgcc tcccgggctg gttagaaggt 7080 tctactggag gagggtccca gcccattgct aaattaacat caggctctga gactggcagt 7140 atatctctaa cagtggttga tgctatcttc tggaacttgc ctgctacatt gagaccactg 7200 acccatacat aggaagccca tagctctgtc ctgaactgtt aggccactgg tccagagagt 7260 gtgcatctcc tttgatcctc ataataaccc tatgagatag acacaattat tactcttact 7320 ttatagatga tgatcctgaa aacataggag tcaaggcact tgcccctagc tgggggtata 7380 ggggagcagt cccatgtagt agtagaatga aaaatgctgc tatgctgtgc ctcccccacc 7440 tttcccatgt ctgccctcta ctcatggtct atctctcctg gctcctggga gtcatggact 7500 ccacccagca ccaccaacct gacctaacca cctatctgag cctgccagcc tataacccat 7560 ctgggccctg atagctggtg gccagccctg accccacccc accctccctg gaacctctga 7620 tagacacatc tggcacacca gctcgcaaag tcaccgtgag ggtcttgtgt ttgctgagtc 7680 aaaattcctt gaaatccaag tccttagaga ctcctgctcc caaatttaca gtcatagact 7740 tcttcatggc tgtctccttt atccacagaa tgattccttt gcttcattgc cccatccatc 7800 tgatcctcct catcagtgca gcacagggcc catgagcagt agctgcagag tctcacatag 7860 gtctggcact gcctctgaca tgtccgacct taggcaaatg cttgactctt ctctagtgca 7920 tgcaaatctg acactcagtg ggcctgggtg aaggtgagaa ttttattgct gaatgagagc 7980 ctctggggac atcttgccag tcaatgagtc tcaggttcaa tttccttctc agtcttggag 8040 taacagaagc tcatgcattt aataaacgga aattttgtat tgaaatgaga gccattggaa 8100 atcatttact ccagactcct acttataaaa agagaaactg aggctcagag aagggtgggg 8160 actttctcag tatgacatgg aaatgatcag gcttggattc aaagctcctg actttctgtc 8220 tagtgtatgt gcagtgagcc ccttttcctc taactgaaag aaggaaaaaa aaatggaacc 8280 caaaatattc tacatagttt ccatgtcaca gccagggctg ggcagtctcc tgttatttct 8340 tttaaaataa atatatcatt taaatgcata aataagcaaa ccctgctcgg gaatgggagg 8400 gagagtctct ggagtccacc ccttctcggc cctggctctg cagatagtgc tatcaaagcc 8460 ctgacagagc cctgcccatt gctgggcctt ggagtgagtc agcctagtag agaggcaggg 8520 caagccatct catagctgct gagtgggaga gagaaaaggg ctcattgtct ataaactcag 8580 gtcatggcta ttcttattct cacactaaga aaaagaatga gatgtctaca tataccctgc 8640 gtcccctctt gtgtactggg gtccccaaga gctctctaaa agtgatggca aagtcattgc 8700 gctagatgcc atcccatcta ttataaacct gcatttgtct ccacacacca gtcatggaca 8760 ataaccctcc tcccaggtcc acgtgcttgt ctttgtataa tactcaagta atttcggaaa 8820 atgtattctt tcaatcttgt tctgttattc ctgtttcaat ggcttagtag aaaaagtaca 8880 tacttgtttt cccataaatt gacaatagac aatttcacat caatgtctat atgggtcgtt 8940 gtgtttgctg tgtttgcaaa aactcacaat aactttatat tgttactact ctaagaaagt 9000 tacaacatgg tgaatacaag agaaagctat tacaagtcca gaaaataaaa gttatcatct 9060 tgagggtcga cctggaattc gagctcggta cctttaagac caatgactta caaggcagct 9120 gtagatctta gccacttttt aaaagaaaag gggggactgg aagggctaat tcactcccaa 9180 cgaagacaag atctgctttt tgcttgtact gggtctctct ggttagacca gatctgagcc 9240 tgggagctct ctggctaact agggaaccca ctgcttaagc ctcaataaag cttgccttga 9300 gtgcttcaag tagtgtgtgc ccgtctgttg tgtgactctg gtaactagag atccctcaga 9360 cccttttagt cagtgtggaa aatctctagc agtagtagtt catgtcatct tattattcag 9420 tatttataac ttgcaaagaa atgaatatca gagagtgaga gggtcgacca ttacttattg 9480 ttttagctgt cctcatgaat gtcttttcac tacccatttg cttatcctgc atctctcagc 9540 cttgactcca ctcagttctc ttgcttagag ataccacctt tcccctgaag tgttccttcc 9600 atgttttacg gcgagatggt ttctcctcgc ctggccactc agccttagtt gtctctgttg 9660 tcttatagag gtctacttga agaaggaaaa acagggggca tggtttgact gtcctgtgag 9720 cccttcttcc ctgcctcccc cactcacagt gacccggaat ccctcgacat ggcagtctag 9780 cactagtgcg gccgcagatc tgcttcctcg ctcactgact cgctgcgctc ggtcgttcgg 9840 ctgcggcgag cggtatcagc tcactcaaag gcggtaatac ggttatccac agaatcaggg 9900 gataacgcag gaaagaacat gtgagcaaaa ggccagcaaa aggccaggaa ccgtaaaaa 9959
SEQ ID NO : 4 aatcaacctc tggattacaa aatttgtgaa agattgactg gtattcttaa ctatgttgct 60 ccttttacgc tatgtggata cgctgcttta atgcctttgt atcatgctat tgcttcccgt 120 atggctttca ttttctcctc cttgtataaa tcctggttgc tgtctcttta tgaggagttg 180 tggcccgttg tcaggcaacg tggcgtggtg tgcactgtgt ttgctgacgc aacccccact 240 ggttggggca ttgccaccac ctgtcagctc ctttccggga ctttcgcttt ccccctccct 300 attgccacgg cggaactcat cgccgcctgc cttgcccgct gctggacagg ggctcggctg 360 ttgggcactg acaattccgt ggtgttgtcg gggaagctga cgtcctttcc atggctgctc 420 gcctgtgttg ccacctggat tctgcgcggg acgtccttct gctacgtccc ttcggccctc 480 aatccagcgg accttccttc ccgcggcctg ctgccggctc tgcggcctct tccgcgtctt 540 cgccttcgcc ctcagacgag tcggatctcc ctttgggccg cctccccgc 589
SEQ ID NO : 5 ggccgcgttg ctggcgtttt tccataggct ccgcccccct gacgagcatc acaaaaatcg 60 acgctcaagt cagaggtggc gaaacccgac aggactataa agataccagg cgtttccccc 120 tggaagctcc ctcgtgcgct ctcctgttcc gaccctgccg cttaccggat acctgtccgc 180 ctttctccct tcgggaagcg tggcgctttc tcatagctca cgctgtaggt atctcagttc 240 ggtgtaggtc gttcgctcca agctgggctg tgtgcacgaa ccccccgttc agcccgaccg 300 ctgcgcctta tccggtaact atcgtcttga gtccaacccg gtaagacacg acttatcgcc 360 actggcagca gccactggta acaggattag cagagcgagg tatgtaggcg gtgctacaga 420 gttcttgaag tggtggccta actacggcta cactagaaga acagtatttg gtatctgcgc 480 tctgctgaag ccagttacct tcggaaaaag agttggtagc tcttgatccg gcaaacaaac 540 caccgctggt agcggtggtt tttttgtttg caagcagcag attacgcgca gaaaaaaagg 600 atctcaagaa gatcctttga tcttttctac ggggtctgac gctcagtgga acgaaaactc 660 acgttaaggg attttggtca tgaagcgctt ttgaagctcg gatccgaaca aacgacccaa 720 cacccgtgcg ttttattctg tctttttatt gccgatcccc tcagaagaac tcgtcaagaa 780 ggcgatagaa ggcgatgcgc tgcgaatcgg gagcggcgat accgtaaagc acgaggaagc 840 ggtcagccca ttcgccgcca agctcttcag caatatcacg ggtagccaac gctatgtcct 900 gatagcggtc cgccacaccc agccggccac agtcgatgaa tccagaaaag cggccatttt 960 ccaccatgat attcggcaag caggcatcgc catgggtcac gacgagatcc tcgccgtcgg 1020 gcatgctcgc cttgagcctg gcgaacagtt cggctggcgc gagcccctga tgctcttcgt 1080 ccagatcatc ctgatcgaca agaccggctt ccatccgagt acgtgctcgc tcgatgcgat 1140 gtttcgcttg gtggtcgaat gggcaggtag ccggatcaag cgtatgcagc cgccgcattg 1200 catcagccat gatggatact ttctcggcag gagcaaggtg agatgacagg agatcctgcc 1260 ccggcacttc gcccaatagc agccagtccc ttcccgcttc agtgacaacg tcgagcacag 1320 ctgcgcaagg aacgcccgtc gtggccagcc acgatagccg cgctgcctcg tcttgcagtt 1380 cattcagggc accggacagg tcggtcttga caaaaagaac cgggcgcccc tgcgctgaca 1440 gccggaacac ggcggcatca gagcagccga ttgtctgttg tgcccagtca tagccgaata 1500 gcctctccac ccaagcggcc ggagaacctg cgtgcaatcc atcttgttca atcatgcgaa 1560 acgatcctca tcctgtctct tgatcagagc ttgatcccct gcgccatcag atccttggcg 1620 gcaagaaagc catccagttt actttgcagg gcttcccaac cttaccagag gcctgcgccg 1680 cggccagctg gctagcaatt cccgggttaa ctctagagac attgattatt gactagttat 1740 taatagtaat caattacggg gtcattagtt catagcccat atatggagtt ccgcgttaca 1800 taacttacgg taaatggccc gcctggctga ccgcccaacg acccccgccc attgacgtca 1860 ataatgacgt atgttcccat agtaacgcca atagggactt tccattgacg tcaatgggtg 1920 gagtatttac ggtaaactgc ccacttggca gtacatcaag tgtatcatat gccaagtacg 1980 ccccctattg acgtcaatga cggtaaatgg cccgcctggc attatgccca gtacatgacc 2040 ttatgggact ttcctacttg gcagtacatc tacgtattag tcatcgctat taccatggtg 2100 atgcggtttt ggcagtacat caatgggcgt ggatagcggt ttgactcacg gggatttcca 2160 agtctccacc ccattgacgt caatgggagt ttgttttggc accaaaatca acgggacttt 2220 ccaaaatgtc gtaacaactc cgccccattg acgcaaatgg gcggtaggcg tgtacggtgg 2280 gaggtctata taagcagagc tcgtttagtg aaccggggtc tctctggtta gaccagatct 2340 gagcctggga gctctctggc taactaggga acccactgct taagcctcaa taaagcttgc 2400 cttgagtgct tcaagtagtg tgtgcccgtc tgttgtgtga ctctggtaac tagagatccc 2460 tcagaccctt ttagtcagtg tggaaaatct ctagcagtgg cgcccgaaca gggacttgaa 2520 agcgaaaggg aaaccagagg agctctctcg acgcaggact cggcttgctg aagcgcgcac 2580 ggcaagaggc gaggggcggc gactggtgag tacgccaaaa attttgacta gcggaggcta 2640 gaaggagaga gatgggtgcg agagcgtcag tattaagcgg gggagaatta gatcgcgatg 2700 ggaaaaaatt cggttaaggc cagggggaaa gaaaaaatat aaattaaaac atatagtatg 2760 ggcaagcagg gagctagaac gattcgcagt taatcctggc ctgttagaaa catcagaagg 2820 ctgtagacaa atactgggac agctacaacc atcccttcag acaggatcag aagaacttag 2880 atcattatat aatacagtag caaccctcta ttgtgtgcat caaaggatag agataaaaga 2940 caccaaggaa gctttagaca agatagagga agagcaaaac aaaagtaaga ccaccgcaca 3000 gcaagcggcc gctgatcttc agacctggag gaggagatat gagggacaat tggagaagtg 3060 aattatataa atataaagta gtaaaaattg aaccattagg agtagcaccc accaaggcaa 3120 agagaagagt ggtgcagaga gaaaaaagag cagtgggaat aggagctttg ttccttgggt 3180 tcttgggagc agcaggaagc actatgggcg cagcgtcaat gacgctgacg gtacaggcca 3240 gacaattatt gtctggtata gtgcagcagc agaacaattt gctgagggct attgaggcgc 3300 aacagcatct gttgcaactc acagtctggg gcatcaagca gctccaggca agaatcctgg 3360 ctgtggaaag atacctaaag gatcaacagc tcctggggat ttggggttgc tctggaaaac 3420 tcatttgcac cactgctgtg ccttggaatg ctagttggag taataaatct ctggaacaga 3480 tttggaatca cacgacctgg atggagtggg acagagaaat taacaattac acaagcttaa 3540 tacactcctt aattgaagaa tcgcaaaacc agcaagaaaa gaatgaacaa gaattattgg 3600 aattagataa atgggcaagt ttgtggaatt ggtttaacat aacaaattgg ctgtggtata 3660 taaaattatt cataatgata gtaggaggct tggtaggttt aagaatagtt tttgctgtac 3720 tttctatagt gaatagagtt aggcagggat attcaccatt atcgtttcag acccacctcc 3780 caaccccgag gggacccgac aggcccgaag gaatagaaga agaaggtgga gagagagaca 3840 gagacagatc cattcgatta gtgaacggat ctcgacggta tcggttaact tttaaaagaa 3900 aaggggggat tggggggtac agtgcagggg aaagaatagt agacataata gcaacagaca 3960 tacaaactaa agaattacaa aaacaaatta caaaaattca aaattttatc gatcacgaga 4020 ctagcctcga gaagcttgat atccctaggt attgaataag aaaaatgaag ttaaggtggt 4080 tgatggtaac actatgctaa taactgcaga gccagaagca ccataaggga catgataagg 4140 gagccagcag acctctgatc tcttcctgaa tgctaatctt aaacatcctg aggaagaatg 4200 ggacttccat ttggggtggg cctatgacag ggtaataaga cagtagtgaa tatcaagcta 4260 caaaaagccg cctttcaaat tcttctcagt cctaactttt catactaagc ccagtccttc 4320 caaagcagac tgtgaaagag tgatagttcc gggagactag cactgcagat tccgggtcac 4380 tgtgagtggg ggaggcaggg aagaagggct cacaggacag tcaaaccatg acccctgttt 4440 ttccttcttc aagtagacct ctataagaca acagagacaa ctaaggctga gtggccaggc 4500 gaggagaaac catctcgccg taaaacatgg aaggaacact tcaggggaaa ggtggtatct 4560 ctaagcaaga gaactgagtg gagtcaaggc tgagagatgc aggataagca aatgggtagt 4620 gaaaagacat tcatgaggac agctaaaaca ataagtaatg taaaatacag catagcaaaa 4680 ctttaacctc caaatcaagc ctctacttga atccttttct gagggatgaa taaggcatat 4740 gcatcagggg ctgttgccaa tgtgcattag ctgtttgcag cctcaccttc tttcatggag 4800 tttaagatat agtgtatttt cccaaggttt gaactagctc ttcatttctt tatgttttaa 4860 atgcactgac ctcccacatt ccctttttag taaaatattc agaaataatt taaatacatc 4920 attgcaatga aaataaatgt tttttattag gcagaatcca gatgctcaag gcccttcata 4980 atatccccca gtttagtagt tggacttagg gaacaaagga acctttaata gaaattggac 5040 agcaagaaag cgagcttagt gatacttgtg ggccagggca ttagccacac cagccaccac 5100 tttctgatag gcagcctgca ctggtggggt gaattctttg ccaaagtgat gggccagcac 5160 acagaccagc acgttgccca ggagctgtgg gaggaagata agaggtatga acatgattag 5220 caaaagggcc tagcttggac tcagaataat ccagccttat cccaaccata aaataaaagc 5280 agaatggtag ctggattgta gctgctatta gcaatatgaa acctcttaca tcagttacaa 5340 tttatatgca gaaatattta tatgcagaga tattgctatt gccttaaccc agaaattatc 5400 actgttattc tttagaatgg tgcaaagagg catgatacat tgtatcatta ttgccctgaa 5460 agaaagagat tagggaaagt attagaaata agataaacaa aaaagtatat taaaagaaga 5520 aagcattttt taaaattaca aatgcaaaat taccctgatt tggtcaatat gtgtaccctg 5580 ttacttatcc ccttcctatg acatgaactt aaccatagaa aagaagggga aagaaaacat 5640 caagcgtccc atagactcac cctgaagttc tcaggatcca cgtgcagctt gtcacagtgc 5700 agctcactca gctgggcaaa ggtgcccttg aggttgtcca ggtgagccag gccatcacta 5760 aaggcaccga gcactttctt gccatgagcc ttcaccttag ggttgcccat aacagcatca 5820 ggagtggaca gatccccaaa ggactcaaag aacctctggg tccaagggta gaccaccagc 5880 agcctaaggg tgggaaaata gaccaatagg cagagagagt cagtgcctat cagaaaccca 5940 agagtcttct ctgtctccac atgcccagtt tctattggtc tccttaaacc tgtcttgtaa 6000 ccttgatacc aacctgccca gggcctcacc accaacttca tccacgttca ccttgcccca 6060 cagggcagta acggcagact tctcctcagg agtcagatgc accatggtgt ctgtttgagg 6120 ttgctagtga acacagttgt gtcagaagca aatgtaagca atagatggct ctgccctgac 6180 ttttatgccc agccctggct cctgccctcc ctgctcctgg gagtagattg gccaacccta 6240 gggtgtggct ccacagggtg aggtctaagt gatgacagcc gtacctgtcc ttggctcttc 6300 tggcactggc ttaggagttg gacttcaaac cctcagccct ccctctaaga tatatctctt 6360 ggccccatac catcagtaca aattgctact aaaaacatcc tcctttgcaa gtgtatttac 6420 gtatctagaa tatgtcacat tctgtctcag gcatccattt tctttatgat gccgtttgag 6480 gtggagtttt agtcaggtgg tcagcttctc cttttttttg ccatctgccc tgtaagcatc 6540 ctgctgggga cccagatagg agtcatcact ctaggctgag aacatctggg cacacaccct 6600 aagcctcagc atgactcatc atgactcagc attgctgtgc ttgagccaga aggtttgctt 6660 agaaggttac acagaaccag aaggcggggg tggggcactg accccgacag gggcctggcc 6720 agaactgctc atgcttggac tatgggaggt cactaatgga gacacacaga aatgtaacag 6780 gaactaagga aaaactgaag cttatttaat cagagatgag gatgctggaa gggatagagg 6840 gagctgagct tgtaaaaagt atagtaatca ttcagcaaat ggttttgaag cacctgctgg 6900 atgctaaaca ctattttcag tgcttgaatc ataaataaga ataaaacatg tatcttattc 6960 cccacaagag tccaagtaaa aaataacagt taattataat gtgctctgtc ccccaggctg 7020 gagtgcagtg gcacgatctc agctcactgc aacctccgcc tcccgggctg gttagaaggt 7080 tctactggag gagggtccca gcccattgct aaattaacat caggctctga gactggcagt 7140 atatctctaa cagtggttga tgctatcttc tggaacttgc ctgctacatt gagaccactg 7200 acccatacat aggaagccca tagctctgtc ctgaactgtt aggccactgg tccagagagt 7260 gtgcatctcc tttgatcctc ataataaccc tatgagatag acacaattat tactcttact 7320 ttatagatga tgatcctgaa aacataggag tcaaggcact tgcccctagc tgggggtata 7380 ggggagcagt cccatgtagt agtagaatga aaaatgctgc tatgctgtgc ctcccccacc 7440 tttcccatgt ctgccctcta ctcatggtct atctctcctg gctcctggga gtcatggact 7500 ccacccagca ccaccaacct gacctaacca cctatctgag cctgccagcc tataacccat 7560 ctgggccctg atagctggtg gccagccctg accccacccc accctccctg gaacctctga 7620 tagacacatc tggcacacca gctcgcaaag tcaccgtgag ggtcttgtgt ttgctgagtc 7680 aaaattcctt gaaatccaag tccttagaga ctcctgctcc caaatttaca gtcatagact 7740 tcttcatggc tgtctccttt atccacagaa tgattccttt gcttcattgc cccatccatc 7800 tgatcctcct catcagtgca gcacagggcc catgagcagt agctgcagag tctcacatag 7860 gtctggcact gcctctgaca tgtccgacct taggcaaatg cttgactctt ctctagtgca 7920 tgcaaatctg acactcagtg ggcctgggtg aaggtgagaa ttttattgct gaatgagagc 7980 ctctggggac atcttgccag tcaatgagtc tcaggttcaa tttccttctc agtcttggag 8040 taacagaagc tcatgcattt aataaacgga aattttgtat tgaaatgaga gccattggaa 8100 atcatttact ccagactcct acttataaaa agagaaactg aggctcagag aagggtgggg 8160 actttctcag tatgacatgg aaatgatcag gcttggattc aaagctcctg actttctgtc 8220 tagtgtatgt gcagtgagcc ccttttcctc taactgaaag aaggaaaaaa aaatggaacc 8280 caaaatattc tacatagttt ccatgtcaca gccagggctg ggcagtctcc tgttatttct 8340 tttaaaataa atatatcatt taaatgcata aataagcaaa ccctgctcgg gaatgggagg 8400 gagagtctct ggagtccacc ccttctcggc cctggctctg cagatagtgc tatcaaagcc 8460 ctgacagagc cctgcccatt gctgggcctt ggagtgagtc agcctagtag agaggcaggg 8520 caagccatct catagctgct gagtgggaga gagaaaaggg ctcattgtct ataaactcag 8580 gtcatggcta ttcttattct cacactaaga aaaagaatga gatgtctaca tataccctgc 8640 gtcccctctt gtgtactggg gtccccaaga gctctctaaa agtgatggca aagtcattgc 8700 gctagatgcc atcccatcta ttataaacct gcatttgtct ccacacacca gtcatggaca 8760 ataaccctcc tcccaggtcc acgtgcttgt ctttgtataa tactcaagta atttcggaaa 8820 atgtattctt tcaatcttgt tctgttattc ctgtttcaat ggcttagtag aaaaagtaca 8880 tacttgtttt cccataaatt gacaatagac aatttcacat caatgtctat atgggtcgtt 8940 gtgtttgctg tgtttgcaaa aactcacaat aactttatat tgttactact ctaagaaagt 9000 tacaacatgg tgaatacaag agaaagctat tacaagtcca gaaaataaaa gttatcatct 9060 tgagggtcga caatcaacct ctggattaca aaatttgtga aagattgact ggtattctta 9120 actatgttgc tccttttacg ctatgtggat acgctgcttt aatgcctttg tatcatgcta 9180 ttgcttcccg tatggctttc attttctcct ccttgtataa atcctggttg ctgtctcttt 9240 atgaggagtt gtggcccgtt gtcaggcaac gtggcgtggt gtgcactgtg tttgctgacg 9300 caacccccac tggttggggc attgccacca cctgtcagct cctttccggg actttcgctt 9360 tccccctccc tattgccacg gcggaactca tcgccgcctg ccttgcccgc tgctggacag 9420 gggctcggct gttgggcact gacaattccg tggtgttgtc ggggaagctg acgtcctttc 9480 catggctgct cgcctgtgtt gccacctgga ttctgcgcgg gacgtccttc tgctacgtcc 9540 cttcggccct caatccagcg gaccttcctt cccgcggcct gctgccggct ctgcggcctc 9600 ttccgcgtct tcgccttcgc cctcagacga gtcggatctc cctttgggcc gcctccccgc 9660 ctggaattcg agctcggtac ctttaagacc aatgacttac aaggcagctg tagatcttag 9720 ccacttttta aaagaaaagg ggggactgga agggctaatt cactcccaac gaagacaaga 9780 tctgcttttt gcttgtactg ggtctctctg gttagaccag atctgagcct gggagctctc 9840 tggctaacta gggaacccac tgcttaagcc tcaataaagc ttgccttgag tgcttcaagt 9900 agtgtgtgcc cgtctgttgt gtgactctgg taactagaga tccctcagac ccttttagtc 9960 agtgtggaaa atctctagca gtagtagttc atgtcatctt attattcagt atttataact 10020 tgcaaagaaa tgaatatcag agagtgagag ggtcgaccat tacttattgt tttagctgtc 10080 ctcatgaatg tcttttcact acccatttgc ttatcctgca tctctcagcc ttgactccac 10140 tcagttctct tgcttagaga taccaccttt cccctgaagt gttccttcca tgttttacgg 10200 cgagatggtt tctcctcgcc tggccactca gccttagttg tctctgttgt cttatagagg 10260 tctacttgaa gaaggaaaaa cagggggcat ggtttgactg tcctgtgagc ccttcttccc 10320 tgcctccccc actcacagtg acccggaatc cctcgacatg gcagtctagc actagtgcgg 10380 ccgcagatct gcttcctcgc tcactgactc gctgcgctcg gtcgttcggc tgcggcgagc 10440 ggtatcagct cactcaaagg cggtaatacg gttatccaca gaatcagggg ataacgcagg 10500 aaagaacatg tgagcaaaag gccagcaaaa ggccaggaac cgtaaaaa 10548
SEQ ID NO : 6 aacttgttta ttgcagctta taatggttac aaataaagca atagcatcac aaatttcaca 60 aataaagcat ttttttcact gcattctagt tgtggtttgt ccaaactcat caatgtatct 120 tatcatgtct ggctctagct atcccgcccc taactccgcc catcccgccc ctaactccgc 180 ccagttccgc ccattctccg ccccatggct gactaatttt ttttatttat gcagaggccg 240 aggccgcctc ggcctctgag ctattccaga agtagtgagg aggctttttt ggaggcc 297
SEQ ID NO : 7 ggccgcgttg ctggcgtttt tccataggct ccgcccccct gacgagcatc acaaaaatcg 60 acgctcaagt cagaggtggc gaaacccgac aggactataa agataccagg cgtttccccc 120 tggaagctcc ctcgtgcgct ctcctgttcc gaccctgccg cttaccggat acctgtccgc 180 ctttctccct tcgggaagcg tggcgctttc tcatagctca cgctgtaggt atctcagttc 240 ggtgtaggtc gttcgctcca agctgggctg tgtgcacgaa ccccccgttc agcccgaccg 300 ctgcgcctta tccggtaact atcgtcttga gtccaacccg gtaagacacg acttatcgcc 360 actggcagca gccactggta acaggattag cagagcgagg tatgtaggcg gtgctacaga 420 gttcttgaag tggtggccta actacggcta cactagaaga acagtatttg gtatctgcgc 480 tctgctgaag ccagttacct tcggaaaaag agttggtagc tcttgatccg gcaaacaaac 540 caccgctggt agcggtggtt tttttgtttg caagcagcag attacgcgca gaaaaaaagg 600 atctcaagaa gatcctttga tcttttctac ggggtctgac gctcagtgga acgaaaactc 660 acgttaaggg attttggtca tgaagcgctt ttgaagctcg gatccgaaca aacgacccaa 720 cacccgtgcg ttttattctg tctttttatt gccgatcccc tcagaagaac tcgtcaagaa 780 ggcgatagaa ggcgatgcgc tgcgaatcgg gagcggcgat accgtaaagc acgaggaagc 840 ggtcagccca ttcgccgcca agctcttcag caatatcacg ggtagccaac gctatgtcct 900 gatagcggtc cgccacaccc agccggccac agtcgatgaa tccagaaaag cggccatttt 960 ccaccatgat attcggcaag caggcatcgc catgggtcac gacgagatcc tcgccgtcgg 1020 gcatgctcgc cttgagcctg gcgaacagtt cggctggcgc gagcccctga tgctcttcgt 1080 ccagatcatc ctgatcgaca agaccggctt ccatccgagt acgtgctcgc tcgatgcgat 1140 gtttcgcttg gtggtcgaat gggcaggtag ccggatcaag cgtatgcagc cgccgcattg 1200 catcagccat gatggatact ttctcggcag gagcaaggtg agatgacagg agatcctgcc 1260 ccggcacttc gcccaatagc agccagtccc ttcccgcttc agtgacaacg tcgagcacag 1320 ctgcgcaagg aacgcccgtc gtggccagcc acgatagccg cgctgcctcg tcttgcagtt 1380 cattcagggc accggacagg tcggtcttga caaaaagaac cgggcgcccc tgcgctgaca 1440 gccggaacac ggcggcatca gagcagccga ttgtctgttg tgcccagtca tagccgaata 1500 gcctctccac ccaagcggcc ggagaacctg cgtgcaatcc atcttgttca atcatgcgaa 1560 acgatcctca tcctgtctct tgatcagagc ttgatcccct gcgccatcag atccttggcg 1620 gcaagaaagc catccagttt actttgcagg gcttcccaac cttaccagag gcctgcgccg 1680 cggccagctg gctagcaatt cccgggttaa ctctagagac attgattatt gactagttat 1740 taatagtaat caattacggg gtcattagtt catagcccat atatggagtt ccgcgttaca 1800 taacttacgg taaatggccc gcctggctga ccgcccaacg acccccgccc attgacgtca 1860 ataatgacgt atgttcccat agtaacgcca atagggactt tccattgacg tcaatgggtg 1920 gagtatttac ggtaaactgc ccacttggca gtacatcaag tgtatcatat gccaagtacg 1980 ccccctattg acgtcaatga cggtaaatgg cccgcctggc attatgccca gtacatgacc 2040 ttatgggact ttcctacttg gcagtacatc tacgtattag tcatcgctat taccatggtg 2100 atgcggtttt ggcagtacat caatgggcgt ggatagcggt ttgactcacg gggatttcca 2160 agtctccacc ccattgacgt caatgggagt ttgttttggc accaaaatca acgggacttt 2220 ccaaaatgtc gtaacaactc cgccccattg acgcaaatgg gcggtaggcg tgtacggtgg 2280 gaggtctata taagcagagc tcgtttagtg aaccggggtc tctctggtta gaccagatct 2340 gagcctggga gctctctggc taactaggga acccactgct taagcctcaa taaagcttgc 2400 cttgagtgct tcaagtagtg tgtgcccgtc tgttgtgtga ctctggtaac tagagatccc 2460 tcagaccctt ttagtcagtg tggaaaatct ctagcagtgg cgcccgaaca gggacttgaa 2520 agcgaaaggg aaaccagagg agctctctcg acgcaggact cggcttgctg aagcgcgcac 2580 ggcaagaggc gaggggcggc gactggtgag tacgccaaaa attttgacta gcggaggcta 2640 gaaggagaga gatgggtgcg agagcgtcag tattaagcgg gggagaatta gatcgcgatg 2700 ggaaaaaatt cggttaaggc cagggggaaa gaaaaaatat aaattaaaac atatagtatg 2760 ggcaagcagg gagctagaac gattcgcagt taatcctggc ctgttagaaa catcagaagg 2820 ctgtagacaa atactgggac agctacaacc atcccttcag acaggatcag aagaacttag 2880 atcattatat aatacagtag caaccctcta ttgtgtgcat caaaggatag agataaaaga 2940 caccaaggaa gctttagaca agatagagga agagcaaaac aaaagtaaga ccaccgcaca 3000 gcaagcggcc gctgatcttc agacctggag gaggagatat gagggacaat tggagaagtg 3060 aattatataa atataaagta gtaaaaattg aaccattagg agtagcaccc accaaggcaa 3120 agagaagagt ggtgcagaga gaaaaaagag cagtgggaat aggagctttg ttccttgggt 3180 tcttgggagc agcaggaagc actatgggcg cagcgtcaat gacgctgacg gtacaggcca 3240 gacaattatt gtctggtata gtgcagcagc agaacaattt gctgagggct attgaggcgc 3300 aacagcatct gttgcaactc acagtctggg gcatcaagca gctccaggca agaatcctgg 3360 ctgtggaaag atacctaaag gatcaacagc tcctggggat ttggggttgc tctggaaaac 3420 tcatttgcac cactgctgtg ccttggaatg ctagttggag taataaatct ctggaacaga 3480 tttggaatca cacgacctgg atggagtggg acagagaaat taacaattac acaagcttaa 3540 tacactcctt aattgaagaa tcgcaaaacc agcaagaaaa gaatgaacaa gaattattgg 3600 aattagataa atgggcaagt ttgtggaatt ggtttaacat aacaaattgg ctgtggtata 3660 taaaattatt cataatgata gtaggaggct tggtaggttt aagaatagtt tttgctgtac 3720 tttctatagt gaatagagtt aggcagggat attcaccatt atcgtttcag acccacctcc 3780 caaccccgag gggacccgac aggcccgaag gaatagaaga agaaggtgga gagagagaca 3840 gagacagatc cattcgatta gtgaacggat ctcgacggta tcggttaact tttaaaagaa 3900 aaggggggat tggggggtac agtgcagggg aaagaatagt agacataata gcaacagaca 3960 tacaaactaa agaattacaa aaacaaatta caaaaattca aaattttatc gatcacgaga 4020 ctagcctcga gaagcttgat atccctaggt attgaataag aaaaatgaag ttaaggtggt 4080 tgatggtaac actatgctaa taactgcaga gccagaagca ccataaggga catgataagg 4140 gagccagcag acctctgatc tcttcctgaa tgctaatctt aaacatcctg aggaagaatg 4200 ggacttccat ttggggtggg cctatgacag ggtaataaga cagtagtgaa tatcaagcta 4260 caaaaagccg cctttcaaat tcttctcagt cctaactttt catactaagc ccagtccttc 4320 caaagcagac tgtgaaagag tgatagttcc gggagactag cactgcagat tccgggtcac 4380 tgtgagtggg ggaggcaggg aagaagggct cacaggacag tcaaaccatg acccctgttt 4440 ttccttcttc aagtagacct ctataagaca acagagacaa ctaaggctga gtggccaggc 4500 gaggagaaac catctcgccg taaaacatgg aaggaacact tcaggggaaa ggtggtatct 4560 ctaagcaaga gaactgagtg gagtcaaggc tgagagatgc aggataagca aatgggtagt 4620 gaaaagacat tcatgaggac agctaaaaca ataagtaatg taaaatacag catagcaaaa 4680 ctttaacctc caaatcaagc ctctacttga atccttttct gagggatgaa taaggcatat 4740 gcatcagggg ctgttgccaa tgtgcattag ctgtttgcag cctcaccttc tttcatggag 4800 tttaagatat agtgtatttt cccaaggttt gaactagctc ttcatttctt tatgttttaa 4860 atgcactgac ctcccacatt ccctttttag taaaatattc agaaataatt taaatacatc 4920 attgcaatga aaataaatgt tttttattag gcagaatcca gatgctcaag gcccttcata 4980 atatccccca gtttagtagt tggacttagg gaacaaagga acctttaata gaaattggac 5040 agcaagaaag cgagcttagt gatacttgtg ggccagggca ttagccacac cagccaccac 5100 tttctgatag gcagcctgca ctggtggggt gaattctttg ccaaagtgat gggccagcac 5160 acagaccagc acgttgccca ggagctgtgg gaggaagata agaggtatga acatgattag 5220 caaaagggcc tagcttggac tcagaataat ccagccttat cccaaccata aaataaaagc 5280 agaatggtag ctggattgta gctgctatta gcaatatgaa acctcttaca tcagttacaa 5340 tttatatgca gaaatattta tatgcagaga tattgctatt gccttaaccc agaaattatc 5400 actgttattc tttagaatgg tgcaaagagg catgatacat tgtatcatta ttgccctgaa 5460 agaaagagat tagggaaagt attagaaata agataaacaa aaaagtatat taaaagaaga 5520 aagcattttt taaaattaca aatgcaaaat taccctgatt tggtcaatat gtgtaccctg 5580 ttacttatcc ccttcctatg acatgaactt aaccatagaa aagaagggga aagaaaacat 5640 caagcgtccc atagactcac cctgaagttc tcaggatcca cgtgcagctt gtcacagtgc 5700 agctcactca gctgggcaaa ggtgcccttg aggttgtcca ggtgagccag gccatcacta 5760 aaggcaccga gcactttctt gccatgagcc ttcaccttag ggttgcccat aacagcatca 5820 ggagtggaca gatccccaaa ggactcaaag aacctctggg tccaagggta gaccaccagc 5880 agcctaaggg tgggaaaata gaccaatagg cagagagagt cagtgcctat cagaaaccca 5940 agagtcttct ctgtctccac atgcccagtt tctattggtc tccttaaacc tgtcttgtaa 6000 ccttgatacc aacctgccca gggcctcacc accaacttca tccacgttca ccttgcccca 6060 cagggcagta acggcagact tctcctcagg agtcagatgc accatggtgt ctgtttgagg 6120 ttgctagtga acacagttgt gtcagaagca aatgtaagca atagatggct ctgccctgac 6180 ttttatgccc agccctggct cctgccctcc ctgctcctgg gagtagattg gccaacccta 6240 gggtgtggct ccacagggtg aggtctaagt gatgacagcc gtacctgtcc ttggctcttc 6300 tggcactggc ttaggagttg gacttcaaac cctcagccct ccctctaaga tatatctctt 6360 ggccccatac catcagtaca aattgctact aaaaacatcc tcctttgcaa gtgtatttac 6420 gtatctagaa tatgtcacat tctgtctcag gcatccattt tctttatgat gccgtttgag 6480 gtggagtttt agtcaggtgg tcagcttctc cttttttttg ccatctgccc tgtaagcatc 6540 ctgctgggga cccagatagg agtcatcact ctaggctgag aacatctggg cacacaccct 6600 aagcctcagc atgactcatc atgactcagc attgctgtgc ttgagccaga aggtttgctt 6660 agaaggttac acagaaccag aaggcggggg tggggcactg accccgacag gggcctggcc 6720 agaactgctc atgcttggac tatgggaggt cactaatgga gacacacaga aatgtaacag 6780 gaactaagga aaaactgaag cttatttaat cagagatgag gatgctggaa gggatagagg 6840 gagctgagct tgtaaaaagt atagtaatca ttcagcaaat ggttttgaag cacctgctgg 6900 atgctaaaca ctattttcag tgcttgaatc ataaataaga ataaaacatg tatcttattc 6960 cccacaagag tccaagtaaa aaataacagt taattataat gtgctctgtc ccccaggctg 7020 gagtgcagtg gcacgatctc agctcactgc aacctccgcc tcccgggctg gttagaaggt 7080 tctactggag gagggtccca gcccattgct aaattaacat caggctctga gactggcagt 7140 atatctctaa cagtggttga tgctatcttc tggaacttgc ctgctacatt gagaccactg 7200 acccatacat aggaagccca tagctctgtc ctgaactgtt aggccactgg tccagagagt 7260 gtgcatctcc tttgatcctc ataataaccc tatgagatag acacaattat tactcttact 7320 ttatagatga tgatcctgaa aacataggag tcaaggcact tgcccctagc tgggggtata 7380 ggggagcagt cccatgtagt agtagaatga aaaatgctgc tatgctgtgc ctcccccacc 7440 tttcccatgt ctgccctcta ctcatggtct atctctcctg gctcctggga gtcatggact 7500 ccacccagca ccaccaacct gacctaacca cctatctgag cctgccagcc tataacccat 7560 ctgggccctg atagctggtg gccagccctg accccacccc accctccctg gaacctctga 7620 tagacacatc tggcacacca gctcgcaaag tcaccgtgag ggtcttgtgt ttgctgagtc 7680 aaaattcctt gaaatccaag tccttagaga ctcctgctcc caaatttaca gtcatagact 7740 tcttcatggc tgtctccttt atccacagaa tgattccttt gcttcattgc cccatccatc 7800 tgatcctcct catcagtgca gcacagggcc catgagcagt agctgcagag tctcacatag 7860 gtctggcact gcctctgaca tgtccgacct taggcaaatg cttgactctt ctctagtgca 7920 tgcaaatctg acactcagtg ggcctgggtg aaggtgagaa ttttattgct gaatgagagc 7980 ctctggggac atcttgccag tcaatgagtc tcaggttcaa tttccttctc agtcttggag 8040 taacagaagc tcatgcattt aataaacgga aattttgtat tgaaatgaga gccattggaa 8100 atcatttact ccagactcct acttataaaa agagaaactg aggctcagag aagggtgggg 8160 actttctcag tatgacatgg aaatgatcag gcttggattc aaagctcctg actttctgtc 8220 tagtgtatgt gcagtgagcc ccttttcctc taactgaaag aaggaaaaaa aaatggaacc 8280 caaaatattc tacatagttt ccatgtcaca gccagggctg ggcagtctcc tgttatttct 8340 tttaaaataa atatatcatt taaatgcata aataagcaaa ccctgctcgg gaatgggagg 8400 gagagtctct ggagtccacc ccttctcggc cctggctctg cagatagtgc tatcaaagcc 8460 ctgacagagc cctgcccatt gctgggcctt ggagtgagtc agcctagtag agaggcaggg 8520 caagccatct catagctgct gagtgggaga gagaaaaggg ctcattgtct ataaactcag 8580 gtcatggcta ttcttattct cacactaaga aaaagaatga gatgtctaca tataccctgc 8640 gtcccctctt gtgtactggg gtccccaaga gctctctaaa agtgatggca aagtcattgc 8700 gctagatgcc atcccatcta ttataaacct gcatttgtct ccacacacca gtcatggaca 8760 ataaccctcc tcccaggtcc acgtgcttgt ctttgtataa tactcaagta atttcggaaa 8820 atgtattctt tcaatcttgt tctgttattc ctgtttcaat ggcttagtag aaaaagtaca 8880 tacttgtttt cccataaatt gacaatagac aatttcacat caatgtctat atgggtcgtt 8940 gtgtttgctg tgtttgcaaa aactcacaat aactttatat tgttactact ctaagaaagt 9000 tacaacatgg tgaatacaag agaaagctat tacaagtcca gaaaataaaa gttatcatct 9060 tgagggtcga cctggaattc gagctcggta cctttaagac caatgactta caaggcagct 9120 gtagatctta gccacttttt aaaagaaaag gggggactgg aagggctaat tcactcccaa 9180 cgaagacaag atctgctttt tgcttgtact gggtctctct ggttagacca gatctgagcc 9240 tgggagctct ctggctaact agggaaccca ctgcttaagc ctcaataaag cttgccttga 9300 gtgcttcaag tagtgtgtgc ccgtctgttg tgtgactctg gtaactagag atccctcaga 9360 cccttttagt cagtgtggaa aatctctagc agtagtagtt catgtcatct tattattcag 9420 tatttataac ttgcaaagaa atgaatatca gagagtgaga ggaacttgtt tattgcagct 9480 tataatggtt acaaataaag caatagcatc acaaatttca caaataaagc atttttttca 9540 ctgcattcta gttgtggttt gtccaaactc atcaatgtat cttatcatgt ctggctctag 9600 ctatcccgcc cctaactccg cccatcccgc ccctaactcc gcccagttcc gcccattctc 9660 cgccccatgg ctgactaatt ttttttattt atgcagaggc cgaggccgcc tcggcctctg 9720 agctattcca gaagtagtga ggaggctttt ttggaggccg ctagcgtcga ccattactta 9780 ttgttttagc tgtcctcatg aatgtctttt cactacccat ttgcttatcc tgcatctctc 9840 agccttgact ccactcagtt ctcttgctta gagataccac ctttcccctg aagtgttcct 9900 tccatgtttt acggcgagat ggtttctcct cgcctggcca ctcagcctta gttgtctctg 9960 ttgtcttata gaggtctact tgaagaagga aaaacagggg gcatggtttg actgtcctgt 10020 gagcccttct tccctgcctc ccccactcac agtgacccgg aatccctcga catggcagtc 10080 tagcactagt gcggccgcag atctgcttcc tcgctcactg actcgctgcg ctcggtcgtt 10140 cggctgcggc gagcggtatc agctcactca aaggcggtaa tacggttatc cacagaatca 10200 ggggataacg caggaaagaa catgtgagca aaaggccagc aaaaggccag gaaccgtaaa 10260 aa 10262
SEQ ID NO : 8 ggccgcgttg ctggcgtttt tccataggct ccgcccccct gacgagcatc acaaaaatcg 60 acgctcaagt cagaggtggc gaaacccgac aggactataa agataccagg cgtttccccc 120 tggaagctcc ctcgtgcgct ctcctgttcc gaccctgccg cttaccggat acctgtccgc 180 ctttctccct tcgggaagcg tggcgctttc tcatagctca cgctgtaggt atctcagttc 240 ggtgtaggtc gttcgctcca agctgggctg tgtgcacgaa ccccccgttc agcccgaccg 300 ctgcgcctta tccggtaact atcgtcttga gtccaacccg gtaagacacg acttatcgcc 360 actggcagca gccactggta acaggattag cagagcgagg tatgtaggcg gtgctacaga 420 gttcttgaag tggtggccta actacggcta cactagaaga acagtatttg gtatctgcgc 480 tctgctgaag ccagttacct tcggaaaaag agttggtagc tcttgatccg gcaaacaaac 540 caccgctggt agcggtggtt tttttgtttg caagcagcag attacgcgca gaaaaaaagg 600 atctcaagaa gatcctttga tcttttctac ggggtctgac gctcagtgga acgaaaactc 660 acgttaaggg attttggtca tgaagcgctt ttgaagctcg gatccgaaca aacgacccaa 720 cacccgtgcg ttttattctg tctttttatt gccgatcccc tcagaagaac tcgtcaagaa 780 ggcgatagaa ggcgatgcgc tgcgaatcgg gagcggcgat accgtaaagc acgaggaagc 840 ggtcagccca ttcgccgcca agctcttcag caatatcacg ggtagccaac gctatgtcct 900 gatagcggtc cgccacaccc agccggccac agtcgatgaa tccagaaaag cggccatttt 960 ccaccatgat attcggcaag caggcatcgc catgggtcac gacgagatcc tcgccgtcgg 1020 gcatgctcgc cttgagcctg gcgaacagtt cggctggcgc gagcccctga tgctcttcgt 1080 ccagatcatc ctgatcgaca agaccggctt ccatccgagt acgtgctcgc tcgatgcgat 1140 gtttcgcttg gtggtcgaat gggcaggtag ccggatcaag cgtatgcagc cgccgcattg 1200 catcagccat gatggatact ttctcggcag gagcaaggtg agatgacagg agatcctgcc 1260 ccggcacttc gcccaatagc agccagtccc ttcccgcttc agtgacaacg tcgagcacag 1320 ctgcgcaagg aacgcccgtc gtggccagcc acgatagccg cgctgcctcg tcttgcagtt 1380 cattcagggc accggacagg tcggtcttga caaaaagaac cgggcgcccc tgcgctgaca 1440 gccggaacac ggcggcatca gagcagccga ttgtctgttg tgcccagtca tagccgaata 1500 gcctctccac ccaagcggcc ggagaacctg cgtgcaatcc atcttgttca atcatgcgaa 1560 acgatcctca tcctgtctct tgatcagagc ttgatcccct gcgccatcag atccttggcg 1620 gcaagaaagc catccagttt actttgcagg gcttcccaac cttaccagag gcctgcgccg 1680 cggccagctg gctagcaatt cccgggttaa ctctagagac attgattatt gactagttat 1740 taatagtaat caattacggg gtcattagtt catagcccat atatggagtt ccgcgttaca 1800 taacttacgg taaatggccc gcctggctga ccgcccaacg acccccgccc attgacgtca 1860 ataatgacgt atgttcccat agtaacgcca atagggactt tccattgacg tcaatgggtg 1920 gagtatttac ggtaaactgc ccacttggca gtacatcaag tgtatcatat gccaagtacg 1980 ccccctattg acgtcaatga cggtaaatgg cccgcctggc attatgccca gtacatgacc 2040 ttatgggact ttcctacttg gcagtacatc tacgtattag tcatcgctat taccatggtg 2100 atgcggtttt ggcagtacat caatgggcgt ggatagcggt ttgactcacg gggatttcca 2160 agtctccacc ccattgacgt caatgggagt ttgttttggc accaaaatca acgggacttt 2220 ccaaaatgtc gtaacaactc cgccccattg acgcaaatgg gcggtaggcg tgtacggtgg 2280 gaggtctata taagcagagc tcgtttagtg aaccggggtc tctctggtta gaccagatct 2340 gagcctggga gctctctggc taactaggga acccactgct taagcctcaa taaagcttgc 2400 cttgagtgct tcaagtagtg tgtgcccgtc tgttgtgtga ctctggtaac tagagatccc 2460 tcagaccctt ttagtcagtg tggaaaatct ctagcagtgg cgcccgaaca gggacttgaa 2520 agcgaaaggg aaaccagagg agctctctcg acgcaggact cggcttgctg aagcgcgcac 2580 ggcaagaggc gaggggcggc gactggtgag tacgccaaaa attttgacta gcggaggcta 2640 gaaggagaga gatgggtgcg agagcgtcag tattaagcgg gggagaatta gatcgcgatg 2700 ggaaaaaatt cggttaaggc cagggggaaa gaaaaaatat aaattaaaac atatagtatg 2760 ggcaagcagg gagctagaac gattcgcagt taatcctggc ctgttagaaa catcagaagg 2820 ctgtagacaa atactgggac agctacaacc atcccttcag acaggatcag aagaacttag 2880 atcattatat aatacagtag caaccctcta ttgtgtgcat caaaggatag agataaaaga 2940 caccaaggaa gctttagaca agatagagga agagcaaaac aaaagtaaga ccaccgcaca 3000 gcaagcggcc gctgatcttc agacctggag gaggagatat gagggacaat tggagaagtg 3060 aattatataa atataaagta gtaaaaattg aaccattagg agtagcaccc accaaggcaa 3120 agagaagagt ggtgcagaga gaaaaaagag cagtgggaat aggagctttg ttccttgggt 3180 tcttgggagc agcaggaagc actatgggcg cagcgtcaat gacgctgacg gtacaggcca 3240 gacaattatt gtctggtata gtgcagcagc agaacaattt gctgagggct attgaggcgc 3300 aacagcatct gttgcaactc acagtctggg gcatcaagca gctccaggca agaatcctgg 3360 ctgtggaaag atacctaaag gatcaacagc tcctggggat ttggggttgc tctggaaaac 3420 tcatttgcac cactgctgtg ccttggaatg ctagttggag taataaatct ctggaacaga 3480 tttggaatca cacgacctgg atggagtggg acagagaaat taacaattac acaagcttaa 3540 tacactcctt aattgaagaa tcgcaaaacc agcaagaaaa gaatgaacaa gaattattgg 3600 aattagataa atgggcaagt ttgtggaatt ggtttaacat aacaaattgg ctgtggtata 3660 taaaattatt cataatgata gtaggaggct tggtaggttt aagaatagtt tttgctgtac 3720 tttctatagt gaatagagtt aggcagggat attcaccatt atcgtttcag acccacctcc 3780 caaccccgag gggacccgac aggcccgaag gaatagaaga agaaggtgga gagagagaca 3840 gagacagatc cattcgatta gtgaacggat ctcgacggta tcggttaact tttaaaagaa 3900 aaggggggat tggggggtac agtgcagggg aaagaatagt agacataata gcaacagaca 3960 tacaaactaa agaattacaa aaacaaatta caaaaattca aaattttatc gatcacgaga 4020 ctagcctcga gaagcttgat atccctaggt attgaataag aaaaatgaag ttaaggtggt 4080 tgatggtaac actatgctaa taactgcaga gccagaagca ccataaggga catgataagg 4140 gagccagcag acctctgatc tcttcctgaa tgctaatctt aaacatcctg aggaagaatg 4200 ggacttccat ttggggtggg cctatgacag ggtaataaga cagtagtgaa tatcaagcta 4260 caaaaagccg cctttcaaat tcttctcagt cctaactttt catactaagc ccagtccttc 4320 caaagcagac tgtgaaagag tgatagttcc gggagactag cactgcagat tccgggtcac 4380 tgtgagtggg ggaggcaggg aagaagggct cacaggacag tcaaaccatg acccctgttt 4440 ttccttcttc aagtagacct ctataagaca acagagacaa ctaaggctga gtggccaggc 4500 gaggagaaac catctcgccg taaaacatgg aaggaacact tcaggggaaa ggtggtatct 4560 ctaagcaaga gaactgagtg gagtcaaggc tgagagatgc aggataagca aatgggtagt 4620 gaaaagacat tcatgaggac agctaaaaca ataagtaatg taaaatacag catagcaaaa 4680 ctttaacctc caaatcaagc ctctacttga atccttttct gagggatgaa taaggcatat 4740 gcatcagggg ctgttgccaa tgtgcattag ctgtttgcag cctcaccttc tttcatggag 4800 tttaagatat agtgtatttt cccaaggttt gaactagctc ttcatttctt tatgttttaa 4860 atgcactgac ctcccacatt ccctttttag taaaatattc agaaataatt taaatacatc 4920 attgcaatga aaataaatgt tttttattag gcagaatcca gatgctcaag gcccttcata 4980 atatccccca gtttagtagt tggacttagg gaacaaagga acctttaata gaaattggac 5040 agcaagaaag cgagcttagt gatacttgtg ggccagggca ttagccacac cagccaccac 5100 tttctgatag gcagcctgca ctggtggggt gaattctttg ccaaagtgat gggccagcac 5160 acagaccagc acgttgccca ggagctgtgg gaggaagata agaggtatga acatgattag 5220 caaaagggcc tagcttggac tcagaataat ccagccttat cccaaccata aaataaaagc 5280 agaatggtag ctggattgta gctgctatta gcaatatgaa acctcttaca tcagttacaa 5340 tttatatgca gaaatattta tatgcagaga tattgctatt gccttaaccc agaaattatc 5400 actgttattc tttagaatgg tgcaaagagg catgatacat tgtatcatta ttgccctgaa 5460 agaaagagat tagggaaagt attagaaata agataaacaa aaaagtatat taaaagaaga 5520 aagcattttt taaaattaca aatgcaaaat taccctgatt tggtcaatat gtgtaccctg 5580 ttacttatcc ccttcctatg acatgaactt aaccatagaa aagaagggga aagaaaacat 5640 caagcgtccc atagactcac cctgaagttc tcaggatcca cgtgcagctt gtcacagtgc 5700 agctcactca gctgggcaaa ggtgcccttg aggttgtcca ggtgagccag gccatcacta 5760 aaggcaccga gcactttctt gccatgagcc ttcaccttag ggttgcccat aacagcatca 5820 ggagtggaca gatccccaaa ggactcaaag aacctctggg tccaagggta gaccaccagc 5880 agcctaaggg tgggaaaata gaccaatagg cagagagagt cagtgcctat cagaaaccca 5940 agagtcttct ctgtctccac atgcccagtt tctattggtc tccttaaacc tgtcttgtaa 6000 ccttgatacc aacctgccca gggcctcacc accaacttca tccacgttca ccttgcccca 6060 cagggcagta acggcagact tctcctcagg agtcagatgc accatggtgt ctgtttgagg 6120 ttgctagtga acacagttgt gtcagaagca aatgtaagca atagatggct ctgccctgac 6180 ttttatgccc agccctggct cctgccctcc ctgctcctgg gagtagattg gccaacccta 6240 gggtgtggct ccacagggtg aggtctaagt gatgacagcc gtacctgtcc ttggctcttc 6300 tggcactggc ttaggagttg gacttcaaac cctcagccct ccctctaaga tatatctctt 6360 ggccccatac catcagtaca aattgctact aaaaacatcc tcctttgcaa gtgtatttac 6420 gtatctagaa tatgtcacat tctgtctcag gcatccattt tctttatgat gccgtttgag 6480 gtggagtttt agtcaggtgg tcagcttctc cttttttttg ccatctgccc tgtaagcatc 6540 ctgctgggga cccagatagg agtcatcact ctaggctgag aacatctggg cacacaccct 6600 aagcctcagc atgactcatc atgactcagc attgctgtgc ttgagccaga aggtttgctt 6660 agaaggttac acagaaccag aaggcggggg tggggcactg accccgacag gggcctggcc 6720 agaactgctc atgcttggac tatgggaggt cactaatgga gacacacaga aatgtaacag 6780 gaactaagga aaaactgaag cttatttaat cagagatgag gatgctggaa gggatagagg 6840 gagctgagct tgtaaaaagt atagtaatca ttcagcaaat ggttttgaag cacctgctgg 6900 atgctaaaca ctattttcag tgcttgaatc ataaataaga ataaaacatg tatcttattc 6960 cccacaagag tccaagtaaa aaataacagt taattataat gtgctctgtc ccccaggctg 7020 gagtgcagtg gcacgatctc agctcactgc aacctccgcc tcccgggctg gttagaaggt 7080 tctactggag gagggtccca gcccattgct aaattaacat caggctctga gactggcagt 7140 atatctctaa cagtggttga tgctatcttc tggaacttgc ctgctacatt gagaccactg 7200 acccatacat aggaagccca tagctctgtc ctgaactgtt aggccactgg tccagagagt 7260 gtgcatctcc tttgatcctc ataataaccc tatgagatag acacaattat tactcttact 7320 ttatagatga tgatcctgaa aacataggag tcaaggcact tgcccctagc tgggggtata 7380 ggggagcagt cccatgtagt agtagaatga aaaatgctgc tatgctgtgc ctcccccacc 7440 tttcccatgt ctgccctcta ctcatggtct atctctcctg gctcctggga gtcatggact 7500 ccacccagca ccaccaacct gacctaacca cctatctgag cctgccagcc tataacccat 7560 ctgggccctg atagctggtg gccagccctg accccacccc accctccctg gaacctctga 7620 tagacacatc tggcacacca gctcgcaaag tcaccgtgag ggtcttgtgt ttgctgagtc 7680 aaaattcctt gaaatccaag tccttagaga ctcctgctcc caaatttaca gtcatagact 7740 tcttcatggc tgtctccttt atccacagaa tgattccttt gcttcattgc cccatccatc 7800 tgatcctcct catcagtgca gcacagggcc catgagcagt agctgcagag tctcacatag 7860 gtctggcact gcctctgaca tgtccgacct taggcaaatg cttgactctt ctctagtgca 7920 tgcaaatctg acactcagtg ggcctgggtg aaggtgagaa ttttattgct gaatgagagc 7980 ctctggggac atcttgccag tcaatgagtc tcaggttcaa tttccttctc agtcttggag 8040 taacagaagc tcatgcattt aataaacgga aattttgtat tgaaatgaga gccattggaa 8100 atcatttact ccagactcct acttataaaa agagaaactg aggctcagag aagggtgggg 8160 actttctcag tatgacatgg aaatgatcag gcttggattc aaagctcctg actttctgtc 8220 tagtgtatgt gcagtgagcc ccttttcctc taactgaaag aaggaaaaaa aaatggaacc 8280 caaaatattc tacatagttt ccatgtcaca gccagggctg ggcagtctcc tgttatttct 8340 tttaaaataa atatatcatt taaatgcata aataagcaaa ccctgctcgg gaatgggagg 8400 gagagtctct ggagtccacc ccttctcggc cctggctctg cagatagtgc tatcaaagcc 8460 ctgacagagc cctgcccatt gctgggcctt ggagtgagtc agcctagtag agaggcaggg 8520 caagccatct catagctgct gagtgggaga gagaaaaggg ctcattgtct ataaactcag 8580 gtcatggcta ttcttattct cacactaaga aaaagaatga gatgtctaca tataccctgc 8640 gtcccctctt gtgtactggg gtccccaaga gctctctaaa agtgatggca aagtcattgc 8700 gctagatgcc atcccatcta ttataaacct gcatttgtct ccacacacca gtcatggaca 8760 ataaccctcc tcccaggtcc acgtgcttgt ctttgtataa tactcaagta atttcggaaa 8820 atgtattctt tcaatcttgt tctgttattc ctgtttcaat ggcttagtag aaaaagtaca 8880 tacttgtttt cccataaatt gacaatagac aatttcacat caatgtctat atgggtcgtt 8940 gtgtttgctg tgtttgcaaa aactcacaat aactttatat tgttactact ctaagaaagt 9000 tacaacatgg tgaatacaag agaaagctat tacaagtcca gaaaataaaa gttatcatct 9060 tgagggtcga caatcaacct ctggattaca aaatttgtga aagattgact ggtattctta 9120 actatgttgc tccttttacg ctatgtggat acgctgcttt aatgcctttg tatcatgcta 9180 ttgcttcccg tatggctttc attttctcct ccttgtataa atcctggttg ctgtctcttt 9240 atgaggagtt gtggcccgtt gtcaggcaac gtggcgtggt gtgcactgtg tttgctgacg 9300 caacccccac tggttggggc attgccacca cctgtcagct cctttccggg actttcgctt 9360 tccccctccc tattgccacg gcggaactca tcgccgcctg ccttgcccgc tgctggacag 9420 gggctcggct gttgggcact gacaattccg tggtgttgtc ggggaagctg acgtcctttc 9480 catggctgct cgcctgtgtt gccacctgga ttctgcgcgg gacgtccttc tgctacgtcc 9540 cttcggccct caatccagcg gaccttcctt cccgcggcct gctgccggct ctgcggcctc 9600 ttccgcgtct tcgccttcgc cctcagacga gtcggatctc cctttgggcc gcctccccgc 9660 ctggaattcg agctcggtac ctttaagacc aatgacttac aaggcagctg tagatcttag 9720 ccacttttta aaagaaaagg ggggactgga agggctaatt cactcccaac gaagacaaga 9780 tctgcttttt gcttgtactg ggtctctctg gttagaccag atctgagcct gggagctctc 9840 tggctaacta gggaacccac tgcttaagcc tcaataaagc ttgccttgag tgcttcaagt 9900 agtgtgtgcc cgtctgttgt gtgactctgg taactagaga tccctcagac ccttttagtc 9960 agtgtggaaa atctctagca gtagtagttc atgtcatctt attattcagt atttataact 10020 tgcaaagaaa tgaatatcag agagtgagag gaacttgttt attgcagctt ataatggtta 10080 caaataaagc aatagcatca caaatttcac aaataaagca tttttttcac tgcattctag 10140 ttgtggtttg tccaaactca tcaatgtatc ttatcatgtc tggctctagc tatcccgccc 10200 ctaactccgc ccatcccgcc cctaactccg cccagttccg cccattctcc gccccatggc 10260 tgactaattt tttttattta tgcagaggcc gaggccgcct cggcctctga gctattccag 10320 aagtagtgag gaggcttttt tggaggccgc tagcgtcgac cattacttat tgttttagct 10380 gtcctcatga atgtcttttc actacccatt tgcttatcct gcatctctca gccttgactc 10440 cactcagttc tcttgcttag agataccacc tttcccctga agtgttcctt ccatgtttta 10500 cggcgagatg gtttctcctc gcctggccac tcagccttag ttgtctctgt tgtcttatag 10560 aggtctactt gaagaaggaa aaacaggggg catggtttga ctgtcctgtg agcccttctt 10620 ccctgcctcc cccactcaca gtgacccgga atccctcgac atggcagtct agcactagtg 10680 cggccgcaga tctgcttcct cgctcactga ctcgctgcgc tcggtcgttc ggctgcggcg 10740 agcggtatca gctcactcaa aggcggtaat acggttatcc acagaatcag gggataacgc 10800 aggaaagaac atgtgagcaa aaggccagca aaaggccagg aaccgtaaaa a 10851 SEQ ID NO : 9 ggccgcgttg ctggcgtttt tccataggct ccgcccccct gacgagcatc acaaaaatcg 60 acgctcaagt cagaggtggc gaaacccgac aggactataa agataccagg cgtttccccc 120 tggaagctcc ctcgtgcgct ctcctgttcc gaccctgccg cttaccggat acctgtccgc 180 ctttctccct tcgggaagcg tggcgctttc tcatagctca cgctgtaggt atctcagttc 240 ggtgtaggtc gttcgctcca agctgggctg tgtgcacgaa ccccccgttc agcccgaccg 300 ctgcgcctta tccggtaact atcgtcttga gtccaacccg gtaagacacg acttatcgcc 360 actggcagca gccactggta acaggattag cagagcgagg tatgtaggcg gtgctacaga 420 gttcttgaag tggtggccta actacggcta cactagaaga acagtatttg gtatctgcgc 480 tctgctgaag ccagttacct tcggaaaaag agttggtagc tcttgatccg gcaaacaaac 540 caccgctggt agcggtggtt tttttgtttg caagcagcag attacgcgca gaaaaaaagg 600 atctcaagaa gatcctttga tcttttctac ggggtctgac gctcagtgga acgaaaactc 660 acgttaaggg attttggtca tgaagcgctt ttgaagctcg gatccgaaca aacgacccaa 720 cacccgtgcg ttttattctg tctttttatt gccgatcccc tcagaagaac tcgtcaagaa 780 ggcgatagaa ggcgatgcgc tgcgaatcgg gagcggcgat accgtaaagc acgaggaagc 840 ggtcagccca ttcgccgcca agctcttcag caatatcacg ggtagccaac gctatgtcct 900 gatagcggtc cgccacaccc agccggccac agtcgatgaa tccagaaaag cggccatttt 960 ccaccatgat attcggcaag caggcatcgc catgggtcac gacgagatcc tcgccgtcgg 1020 gcatgctcgc cttgagcctg gcgaacagtt cggctggcgc gagcccctga tgctcttcgt 1080 ccagatcatc ctgatcgaca agaccggctt ccatccgagt acgtgctcgc tcgatgcgat 1140 gtttcgcttg gtggtcgaat gggcaggtag ccggatcaag cgtatgcagc cgccgcattg 1200 catcagccat gatggatact ttctcggcag gagcaaggtg agatgacagg agatcctgcc 1260 ccggcacttc gcccaatagc agccagtccc ttcccgcttc agtgacaacg tcgagcacag 1320 ctgcgcaagg aacgcccgtc gtggccagcc acgatagccg cgctgcctcg tcttgcagtt 1380 cattcagggc accggacagg tcggtcttga caaaaagaac cgggcgcccc tgcgctgaca 1440 gccggaacac ggcggcatca gagcagccga ttgtctgttg tgcccagtca tagccgaata 1500 gcctctccac ccaagcggcc ggagaacctg cgtgcaatcc atcttgttca atcatgcgaa 1560 acgatcctca tcctgtctct tgatcagagc ttgatcccct gcgccatcag atccttggcg 1620 gcaagaaagc catccagttt actttgcagg gcttcccaac cttaccagag gcctgcgccg 1680 cggccagctg gctagcaatt cccgggttaa ctctagagac attgattatt gactagttat 1740 taatagtaat caattacggg gtcattagtt catagcccat atatggagtt ccgcgttaca 1800 taacttacgg taaatggccc gcctggctga ccgcccaacg acccccgccc attgacgtca 1860 ataatgacgt atgttcccat agtaacgcca atagggactt tccattgacg tcaatgggtg 1920 gagtatttac ggtaaactgc ccacttggca gtacatcaag tgtatcatat gccaagtacg 1980 ccccctattg acgtcaatga cggtaaatgg cccgcctggc attatgccca gtacatgacc 2040 ttatgggact ttcctacttg gcagtacatc tacgtattag tcatcgctat taccatggtg 2100 atgcggtttt ggcagtacat caatgggcgt ggatagcggt ttgactcacg gggatttcca 2160 agtctccacc ccattgacgt caatgggagt ttgttttggc accaaaatca acgggacttt 2220 ccaaaatgtc gtaacaactc cgccccattg acgcaaatgg gcggtaggcg tgtacggtgg 2280 gaggtctata taagcagagc tcgtttagtg aaccgtcaga tcgcctggag acgccatcca 2340 cgctgttttg acctccatag aagacaccgg gaccgatcca gcctcccctc gaagcttaca 2400 tgtggtaccg agctcggatc ctgagaactt cagggtgagt ctatgggacc cttgatgttt 2460 tctttcccct tcttttctat ggttaagttc atgtcatagg aaggggagaa gtaacagggt 2520 acacatattg accaaatcag ggtaattttg catttgtaat tttaaaaaat gctttcttct 2580 tttaatatac ttttttgttt atcttatttc taatactttc cctaatctct ttctttcagg 2640 gcaataatga tacaatgtat catgcctctt tgcaccattc taaagaataa cagtgataat 2700 ttctgggtta aggcaatagc aatatttctg catataaata tttctgcata taaattgtaa 2760 ctgatgtaag aggtttcata ttgctaatag cagctacaat ccagctacca ttctgctttt 2820 attttatggt tgggataagg ctggattatt ctgagtccaa gctaggccct tttgctaatc 2880 atgttcatac ctcttatctt cctcccacag ctcctgggca acgtgctggt ctgtgtgctg 2940 gcccatcact ttggcaaagc acgtgagatc tgaattctga cactatgaag tgccttttgt 3000 acttagcctt tttattcatt ggggtgaatt gcaagttcac catagttttt ccacacaacc 3060 aaaaaggaaa ctggaaaaat gttccttcta attaccatta ttgcccgtca agctcagatt 3120 taaattggca taatgactta ataggcacag ccttacaagt caaaatgccc aagagtcaca 3180 aggctattca agcagacggt tggatgtgtc atgcttccaa atgggtcact acttgtgatt 3240 tccgctggta tggaccgaag tatataacac attccatccg atccttcact ccatctgtag 3300 aacaatgcaa ggaaagcatt gaacaaacga aacaaggaac ttggctgaat ccaggcttcc 3360 ctcctcaaag ttgtggatat gcaactgtga cggatgccga agcagtgatt gtccaggtga 3420 ctcctcacca tgtgctggtt gatgaataca caggagaatg ggttgattca cagttcatca 3480 acggaaaatg cagcaattac atatgcccca ctgtccataa ctctacaacc tggcattctg 3540 actataaggt caaagggcta tgtgattcta acctcatttc catggacatc accttcttct 3600 cagaggacgg agagctatca tccctgggaa aggagggcac agggttcaga agtaactact 3660 ttgcttatga aactggaggc aaggcctgca aaatgcaata ctgcaagcat tggggagtca 3720 gactcccatc aggtgtctgg ttcgagatgg ctgataagga tctctttgct gcagccagat 3780 tccctgaatg cccagaaggg tcaagtatct ctgctccatc tcagacctca gtggatgtaa 3840 gtctaattca ggacgttgag aggatcttgg attattccct ctgccaagaa acctggagca 3900 aaatcagagc gggtcttcca atctctccag tggatctcag ctatcttgct cctaaaaacc 3960 caggaaccgg tcctgctttc accataatca atggtaccct aaaatacttt gagaccagat 4020 acatcagagt cgatattgct gctccaatcc tctcaagaat ggtcggaatg atcagtggaa 4080 ctaccacaga aagggaactg tgggatgact gggcaccata tgaagacgtg gaaattggac 4140 ccaatggagt tctgaggacc agttcaggat ataagtttcc tttatacatg attggacatg 4200 gtatgttgga ctccgatctt catcttagct caaaggctca ggtgttcgaa catcctcaca 4260 ttcaagacgc tgcttcgcaa cttcctgatg atgagagttt attttttggt gatactgggc 4320 tatccaaaaa tccaatcgag cttgtagaag gttggttcag tagttggaaa agctctattg 4380 cctctttttt ctttatcata gggttaatca ttggactatt cttggttctc cgagttggta 4440 tccatctttg cattaaatta aagcacacca agaaaagaca gatttataca gacatagaga 4500 tgaaccgact tggaaagtaa ctcaaatcct gcacaacaga ttcttcatgt ttggaccaaa 4560 tcaacttgtg ataccatgct caaagaggcc tcaattatat ttgagttttt aatttttatg 4620 aaaaaaaaaa aaaaaaacgg aattcacccc accagtgcag gctgcctatc agaaagtggt 4680 ggctggtgtg gctaatgccc tggcccacaa gtatcactaa gctcgctttc ttgctgtcca 4740 atttctatta aaggttcctt tgttccctaa gtccaactac taaactgggg gatattatga 4800 agggccttga gcatctggat tctgcctaat aaaaaacatt tattttcatt gcaatgatgt 4860 atttaaatta tttctgaata ttttactaaa aagggaatgt gggaggtcag tgcatttaaa 4920 acataaagaa atgaagagct agttcaaacc ttgggaaaat acactatatc ttaaactcca 4980 tgaaagaagg tgaggctgca aacagctaat gcacattggc aacagcccct gatgcctatg 5040 ccttattcat ccctcagaaa aggattcaag tagaggcttg atttggaggt taaagttttg 5100 ctatgctgta ttttagtcga ccattactta ttgttttagc tgtcctcatg aatgtctttt 5160 cactacccat ttgcttatcc tgcatctctc agccttgact ccactcagtt ctcttgctta 5220 gagataccac ctttcccctg aagtgttcct tccatgtttt acggcgagat ggtttctcct 5280 cgcctggcca ctcagcctta gttgtctctg ttgtcttata gaggtctact tgaagaagga 5340 aaaacagggg gcatggtttg actgtcctgt gagcccttct tccctgcctc ccccactcac 5400 agtgacccgg aatccctcga catggcagtc tagcactagt gcggccgcag atctgcttcc 5460 tcgctcactg actcgctgcg ctcggtcgtt cggctgcggc gagcggtatc agctcactca 5520 aaggcggtaa tacggttatc cacagaatca ggggataacg caggaaagaa catgtgagca 5580 aaaggccagc aaaaggccag gaaccgtaaa aa 5612
SEQ ID NO : 10 ggccgcgttg ctggcgtttt tccataggct ccgcccccct gacgagcatc acaaaaatcg 60 acgctcaagt cagaggtggc gaaacccgac aggactataa agataccagg cgtttccccc 120 tggaagctcc ctcgtgcgct ctcctgttcc gaccctgccg cttaccggat acctgtccgc 180 ctttctccct tcgggaagcg tggcgctttc tcatagctca cgctgtaggt atctcagttc 240 ggtgtaggtc gttcgctcca agctgggctg tgtgcacgaa ccccccgttc agcccgaccg 300 ctgcgcctta tccggtaact atcgtcttga gtccaacccg gtaagacacg acttatcgcc 360 actggcagca gccactggta acaggattag cagagcgagg tatgtaggcg gtgctacaga 420 gttcttgaag tggtggccta actacggcta cactagaaga acagtatttg gtatctgcgc 480 tctgctgaag ccagttacct tcggaaaaag agttggtagc tcttgatccg gcaaacaaac 540 caccgctggt agcggtggtt tttttgtttg caagcagcag attacgcgca gaaaaaaagg 600 atctcaagaa gatcctttga tcttttctac ggggtctgac gctcagtgga acgaaaactc 660 acgttaaggg attttggtca tgaagcgctt ttgaagctcg gatccgaaca aacgacccaa 720 cacccgtgcg ttttattctg tctttttatt gccgatcccc tcagaagaac tcgtcaagaa 780 ggcgatagaa ggcgatgcgc tgcgaatcgg gagcggcgat accgtaaagc acgaggaagc 840 ggtcagccca ttcgccgcca agctcttcag caatatcacg ggtagccaac gctatgtcct 900 gatagcggtc cgccacaccc agccggccac agtcgatgaa tccagaaaag cggccatttt 960 ccaccatgat attcggcaag caggcatcgc catgggtcac gacgagatcc tcgccgtcgg 1020 gcatgctcgc cttgagcctg gcgaacagtt cggctggcgc gagcccctga tgctcttcgt 1080 ccagatcatc ctgatcgaca agaccggctt ccatccgagt acgtgctcgc tcgatgcgat 1140 gtttcgcttg gtggtcgaat gggcaggtag ccggatcaag cgtatgcagc cgccgcattg 1200 catcagccat gatggatact ttctcggcag gagcaaggtg agatgacagg agatcctgcc 1260 ccggcacttc gcccaatagc agccagtccc ttcccgcttc agtgacaacg tcgagcacag 1320 ctgcgcaagg aacgcccgtc gtggccagcc acgatagccg cgctgcctcg tcttgcagtt 1380 cattcagggc accggacagg tcggtcttga caaaaagaac cgggcgcccc tgcgctgaca 1440 gccggaacac ggcggcatca gagcagccga ttgtctgttg tgcccagtca tagccgaata 1500 gcctctccac ccaagcggcc ggagaacctg cgtgcaatcc atcttgttca atcatgcgaa 1560 acgatcctca tcctgtctct tgatcagagc ttgatcccct gcgccatcag atccttggcg 1620 gcaagaaagc catccagttt actttgcagg gcttcccaac cttaccagag gcctgcgccg 1680 cggccagctg gctagcaatt cccgggttaa ctctagagaa tgtagtctta tgcaatactc 1740 ttgtagtctt gcaacatggt aacgatgagt tagcaacatg ccttacaagg agagaaaaag 1800 caccgtgcat gccgattggt ggaagtaagg tggtacgatc gtgccttatt aggaaggcaa 1860 cagacgggtc tgacatggat tggacgaacc actgaattcc gcattgcaga gatattgtat 1920 ttaagtgcct agctcgatac aataaacgcc atttgaccat tcaccacatt ggtgtgcacc 1980 tccaagctcg agctcgttta gtgaaccgtc agatcgcctg gagacgccat ccacgctgtt 2040 ttgacctcca tagaagacac cgggaccgat ccagcctccc ctcgaagcta gtcgattagg 2100 catctcctat ggcaggaaga agcggagaca gcgacgaaga cctcctcaag gcagtcagac 2160 tcatcaagtt tctctatcaa agcaacccac ctcccaatcc cgaggggacc cgacaggccc 2220 gaaggaatag aagaagaagg tggagagaga gacagagaca gatccattcg attagtgaac 2280 ggatccttag cacttatctg ggacgatctg cggagcctgt gcctcttcag ctaccaccgc 2340 ttgagagact tactcttgat tgtaacgagg attgtggaac ttctgggacg cagggggtgg 2400 gaagccctca aatattggtg gaatctccta caatattgga gtcaggagct aaagaatagt 2460 gctgttagct tgctcaatgc cacagctata gcagtagctg aggggacaga tagggttata 2520 gaagtagtac aagaagcttg gcactggccg tcgttttaca acgtcgtgat ctgagcctgg 2580 gagatctctg gctaactagg gaacccactg cttaagcctc aataaagctt gccttgagtg 2640 cttcaagtag tgtgtgcccg tctgttgtgt gactctggta actagagatc aggaaaaccc 2700 tggcgttacc caacttaatc gccttgcagc acatccccct ttcgccagct ggcgtaatag 2760 cgaagaggcc cgcaccgatc gcccttccca acagttgcgc agcctgaatg gcgaatggcg 2820 cctgatgcgg tattttctcc ttacgcatct gtgcggtatt tcacaccgca tacgtcaaag 2880 caaccatagt gtcgaccatt acttattgtt ttagctgtcc tcatgaatgt cttttcacta 2940 cccatttgct tatcctgcat ctctcagcct tgactccact cagttctctt gcttagagat 3000 accacctttc ccctgaagtg ttccttccat gttttacggc gagatggttt ctcctcgcct 3060 ggccactcag ccttagttgt ctctgttgtc ttatagaggt ctacttgaag aaggaaaaac 3120 agggggcatg gtttgactgt cctgtgagcc cttcttccct gcctccccca ctcacagtga 3180 cccggaatcc ctcgacatgg cagtctagca ctagtgcggc cgcagatctg cttcctcgct 3240 cactgactcg ctgcgctcgg tcgttcggct gcggcgagcg gtatcagctc actcaaaggc 3300 ggtaatacgg ttatccacag aatcagggga taacgcagga aagaacatgt gagcaaaagg 3360
SEQ ID NO : 11 ggccgcgttg ctggcgtttt tccataggct ccgcccccct gacgagcatc acaaaaatcg 60 acgctcaagt cagaggtggc gaaacccgac aggactataa agataccagg cgtttccccc 120 tggaagctcc ctcgtgcgct ctcctgttcc gaccctgccg cttaccggat acctgtccgc 180 ctttctccct tcgggaagcg tggcgctttc tcatagctca cgctgtaggt atctcagttc 240 ggtgtaggtc gttcgctcca agctgggctg tgtgcacgaa ccccccgttc agcccgaccg 300 ctgcgcctta tccggtaact atcgtcttga gtccaacccg gtaagacacg acttatcgcc 360 actggcagca gccactggta acaggattag cagagcgagg tatgtaggcg gtgctacaga 420 gttcttgaag tggtggccta actacggcta cactagaaga acagtatttg gtatctgcgc 480 tctgctgaag ccagttacct tcggaaaaag agttggtagc tcttgatccg gcaaacaaac 540 caccgctggt agcggtggtt tttttgtttg caagcagcag attacgcgca gaaaaaaagg 600 atctcaagaa gatcctttga tcttttctac ggggtctgac gctcagtgga acgaaaactc 660 acgttaaggg attttggtca tgaagcgctt ttgaagctcg gatccgaaca aacgacccaa 720 cacccgtgcg ttttattctg tctttttatt gccgatcccc tcagaagaac tcgtcaagaa 780 ggcgatagaa ggcgatgcgc tgcgaatcgg gagcggcgat accgtaaagc acgaggaagc 840 ggtcagccca ttcgccgcca agctcttcag caatatcacg ggtagccaac gctatgtcct 900 gatagcggtc cgccacaccc agccggccac agtcgatgaa tccagaaaag cggccatttt 960 ccaccatgat attcggcaag caggcatcgc catgggtcac gacgagatcc tcgccgtcgg 1020 gcatgctcgc cttgagcctg gcgaacagtt cggctggcgc gagcccctga tgctcttcgt 1080 ccagatcatc ctgatcgaca agaccggctt ccatccgagt acgtgctcgc tcgatgcgat 1140 gtttcgcttg gtggtcgaat gggcaggtag ccggatcaag cgtatgcagc cgccgcattg 1200 catcagccat gatggatact ttctcggcag gagcaaggtg agatgacagg agatcctgcc 1260 ccggcacttc gcccaatagc agccagtccc ttcccgcttc agtgacaacg tcgagcacag 1320 ctgcgcaagg aacgcccgtc gtggccagcc acgatagccg cgctgcctcg tcttgcagtt 1380 cattcagggc accggacagg tcggtcttga caaaaagaac cgggcgcccc tgcgctgaca 1440 gccggaacac ggcggcatca gagcagccga ttgtctgttg tgcccagtca tagccgaata 1500 gcctctccac ccaagcggcc ggagaacctg cgtgcaatcc atcttgttca atcatgcgaa 1560 acgatcctca tcctgtctct tgatcagagc ttgatcccct gcgccatcag atccttggcg 1620 gcaagaaagc catccagttt actttgcagg gcttcccaac cttaccagag gcctgcgccg 1680 cggccagctg gctagcaatt cccgggttaa ctctagagac attgattatt gactagttat 1740 taatagtaat caattacggg gtcattagtt catagcccat atatggagtt ccgcgttaca 1800 taacttacgg taaatggccc gcctggctga ccgcccaacg acccccgccc attgacgtca 1860 ataatgacgt atgttcccat agtaacgcca atagggactt tccattgacg tcaatgggtg 1920 gagtatttac ggtaaactgc ccacttggca gtacatcaag tgtatcatat gccaagtacg 1980 ccccctattg acgtcaatga cggtaaatgg cccgcctggc attatgccca gtacatgacc 2040 ttatgggact ttcctacttg gcagtacatc tacgtattag tcatcgctat taccatggtg 2100 atgcggtttt ggcagtacat caatgggcgt ggatagcggt ttgactcacg gggatttcca 2160 agtctccacc ccattgacgt caatgggagt ttgttttggc accaaaatca acgggacttt 2220 ccaaaatgtc gtaacaactc cgccccattg acgcaaatgg gcggtaggcg tgtacggtgg 2280 gaggtctata taagcagagc tcgtttagtg aaccgtcaga tcgcctggag acgccatcca 2340 cgctgttttg acctccatag aagacaccgg gaccgatcca gcctcccctc gaagcttaca 2400 tgtggtaccg agctcggatc ctgagaactt cagggtgagt ctatgggacc cttgatgttt 2460 tctttcccct tcttttctat ggttaagttc atgtcatagg aaggggagaa gtaacagggt 2520 acacatattg accaaatcag ggtaattttg catttgtaat tttaaaaaat gctttcttct 2580 tttaatatac ttttttgttt atcttatttc taatactttc cctaatctct ttctttcagg 2640 gcaataatga tacaatgtat catgcctctt tgcaccattc taaagaataa cagtgataat 2700 ttctgggtta aggcaatagc aatatttctg catataaata tttctgcata taaattgtaa 2760 ctgatgtaag aggtttcata ttgctaatag cagctacaat ccagctacca ttctgctttt 2820 attttatggt tgggataagg ctggattatt ctgagtccaa gctaggccct tttgctaatc 2880 atgttcatac ctcttatctt cctcccacag ctcctgggca acgtgctggt ctgtgtgctg 2940 gcccatcact ttggcaaagc acgtgagatc tgaattcgag atctgccgcc gccatgggtg 3000 cgagagcgtc agtattaagc gggggagaat tagatcgatg ggaaaaaatt cggttaaggc 3060 cagggggaaa gaaaaaatat aaattaaaac atatagtatg ggcaagcagg gagctagaac 3120 gattcgcagt taatcctggc ctgttagaaa catcagaagg ctgtagacaa atactgggac 3180 agctacaacc atcccttcag acaggatcag aagaacttag atcattatat aatacagtag 3240 caaccctcta ttgtgtgcat caaaggatag agataaaaga caccaaggaa gctttagaca 3300 agatagagga agagcaaaac aaaagtaaga aaaaagcaca gcaagcagca gctgacacag 3360 gacacagcaa tcaggtcagc caaaattacc ctatagtgca gaacatccag gggcaaatgg 3420 tacatcaggc catatcacct agaactttaa atgcatgggt aaaagtagta gaagagaagg 3480 ctttcagccc agaagtgata cccatgtttt cagcattatc agaaggagcc accccacaag 3540 atttaaacac catgctaaac acagtggggg gacatcaagc agccatgcaa atgttaaaag 3600 agaccatcaa tgaggaagct gcagaatggg atagagtgca tccagtgcat gcagggccta 3660 ttgcaccagg ccagatgaga gaaccaaggg gatcagacat cgctggaact actagtaccc 3720 ttcaggaaca aataggatgg atgacacata atccacctat cccagtagga gaaatctata 3780 aaagatggat aatcctggga ttaaataaaa tagtaagaat gtatagccct accagcattc 3840 tggacataag acaaggacca aaggaaccct ttagagacta tgtagaccga ttctataaaa 3900 ctctaagagc cgagcaagct tcacaagagg taaaaaattg gatgacagaa accttgttgg 3960 tccaaaatgc gaacccagat tgtaagacta ttttaaaagc attgggacca ggagcgacac 4020 tagaagaaat gatgacagca tgtcagggag tggggggacc cggccataaa gcaagagttt 4080 tggctgaagc aatgagccaa gtaacaaatc cagctaccat aatgatacag aaaggcaatt 4140 ttaggaacca aagaaagact gttaagtgtt tcaattgtgg caaagaaggg cacatagcca 4200 aaaattgcag ggcccctagg aaaaagggct gttggaaatg tggaaaggaa ggacaccaaa 4260 tgaaagattg tactgagaga caggctaatt ttttagggaa gatctggcct tcccacaagg 4320 gaaggccagg gaattttctt cagagcagac cagagccaac agccccacca gaagagagct 4380 tcaggtttgg ggaagagaca acaactccct ctcagaagca ggagccgata gacaaggaac 4440 tgtatccttt agcttccctc agatcactct ttggcagcga cccctcgtca caataaagat 4500 aggggggcaa ttaaaggaag ctctattaga tactggtgct gacgacacag tattagaaga 4560 aatgaatttg ccaggaagat ggaaaccaaa aatgataggg ggaattggag gttttatcaa 4620 agtaagacag tatgatcaga tactcataga aatctgcgga cataaagcta taggtacagt 4680 attagtagga cctacacctg tcaacataat tggaagaaat ctgttgactc agattggctg 4740 cactttaaat tttcccatta gtcctattga gactgtacca gtaaaattaa agccaggaat 4800 ggatggccca aaagttaaac aatggccatt gacagaagaa aaaataaaag cattagtaga 4860 aatttgtaca gaaatggaaa aggaaggaaa aatttcaaaa attgggcctg aaaatccata 4920 caatactcca gtatttgcca taaagaaaaa agacagtact aaatggagaa aattagtaga 4980 tttcagagaa cttaataaga gaactcaaga tttctgggaa gttcaattag gaataccaca 5040 tcctgcaggg ttaaaacaga aaaaatcagt aacagtactg gatgtgggcg atgcatattt 5100 ttcagttccc ttagataaag acttcaggaa gtatactgca tttaccatac ctagtataaa 5160 caatgagaca ccagggatta gatatcagta caatgtgctt ccacagggat ggaaaggatc 5220 accagcaata ttccagtgta gcatgacaaa aatcttagag ccttttagaa aacaaaatcc 5280 agacatagtc atctatcaat acatggatga tttgtatgta ggatctgact tagaaatagg 5340 gcagcataga acaaaaatag aggaactgag acaacatctg ttgaggtggg gatttaccac 5400 accagacaaa aaacatcaga aagaacctcc attcctttgg atgggttatg aactccatcc 5460 tgataaatgg acagtacagc ctatagtgct gccagaaaag gacagctgga ctgtcaatga 5520 catacagaaa ttagtgggaa aattgaattg ggcaagtcag atttatgcag ggattaaagt 5580 aaggcaatta tgtaaacttc ttaggggaac caaagcacta acagaagtag taccactaac 5640 agaagaagca gagctagaac tggcagaaaa cagggagatt ctaaaagaac cggtacatgg 5700 agtgtattat gacccatcaa aagacttaat agcagaaata cagaagcagg ggcaaggcca 5760 atggacatat caaatttatc aagagccatt taaaaatctg aaaacaggaa agtatgcaag 5820 aatgaagggt gcccacacta atgatgtgaa acaattaaca gaggcagtac aaaaaatagc 5880 cacagaaagc atagtaatat ggggaaagac tcctaaattt aaattaccca tacaaaagga 5940 aacatgggaa gcatggtgga cagagtattg gcaagccacc tggattcctg agtgggagtt 6000 tgtcaatacc cctcccttag tgaagttatg gtaccagtta gagaaagaac ccataatagg 6060 agcagaaact ttctatgtag atggggcagc caatagggaa actaaattag gaaaagcagg 6120 atatgtaact gacagaggaa gacaaaaagt tgtcccccta acggacacaa caaatcagaa 6180 gactgagtta caagcaattc atctagcttt gcaggattcg ggattagaag taaacatagt 6240 gacagactca caatatgcat tgggaatcat tcaagcacaa ccagataaga gtgaatcaga 6300 gttagtcagt caaataatag agcagttaat aaaaaaggaa aaagtctacc tggcatgggt 6360 accagcacac aaaggaattg gaggaaatga acaagtagat aaattggtca gtgctggaat 6420 caggaaagta ctatttttag atggaataga taaggcccaa gaagaacatg agaaatatca 6480 cagtaattgg agagcaatgg ctagtgattt taacctacca cctgtagtag caaaagaaat 6540 agtagccagc tgtgataaat gtcagctaaa aggggaagcc atgcatggac aagtagactg 6600 tagcccagga atatggcagc tagattgtac acatttagaa ggaaaagtta tcttggtagc 6660 agttcatgta gccagtggat atatagaagc agaagtaatt ccagcagaga cagggcaaga 6720 aacagcatac ttcctcttaa aattagcagg aagatggcca gtaaaaacag tacatacaga 6780 caatggcagc aatttcacca gtactacagt taaggccgcc tgttggtggg cggggatcaa 6840 gcaggaattt ggcattccct acaatccgca gtcacaagga gtaatagaat ctatgaataa 6900 agaattaaag aaaattatag gacaggtaag agatcaggct gaacatctta aaacagcagt 6960 acaaatggca gtattcatcc acaattttaa aagaaaaggg gggattgggg ggtacagtgc 7020 aggggaaaga atagtagaca taatagcaac agacatacaa actaaagaat tacaaaaaca 7080 aattacaaaa attcaaaatt ttcgggttta ttacagggac agcagagatc cagtttggaa 7140 aggaccagca aagctcctct ggaaaggtga aggggcagta gtaatacaag ataatagtga 7200 cataaaagta gtgccaagaa gaaaagcaaa gatcatcagg gattatggaa aacagatggc 7260 aggtgatgat tgtgtggcaa gtagacagga tgaggattaa cacatggaat tccggagcgg 7320 ccgcaggagc tttgttcctt gggttcttgg gagcagcagg aagcactatg ggcgcagcgt 7380 caatgacgct gacggtacag gccagacaat tattgtctgg tatagtgcag cagcagaaca 7440 atttgctgag ggctattgag gcgcaacagc atctgttgca actcacagtc tggggcatca 7500 agcagctcca ggcaagaatc ctggctgtgg aaagatacct aaaggatcaa cagctcctgg 7560 ggatttgggg ttgctctgga aaactcattt gcaccactgc tgtgccttgg aatgctagtt 7620 ggagtaataa atctctggaa cagatttgga atcacacgac ctggatggag tgggacagag 7680 aaattaacaa ttacacaagc ttccgcggaa ttcaccccac cagtgcaggc tgcctatcag 7740 aaagtggtgg ctggtgtggc taatgccctg gcccacaagt atcactaagc tcgctttctt 7800 gctgtccaat ttctattaaa ggttcctttg ttccctaagt ccaactacta aactggggga 7860 tattatgaag ggccttgagc atctggattc tgcctaataa aaaacattta ttttcattgc 7920 aatgatgtat ttaaattatt tctgaatatt ttactaaaaa gggaatgtgg gaggtcagtg 7980 catttaaaac ataaagaaat gaagagctag ttcaaacctt gggaaaatac actatatctt 8040 aaactccatg aaagaaggtg aggctgcaaa cagctaatgc acattggcaa cagcccctga 8100 tgcctatgcc ttattcatcc ctcagaaaag gattcaagta gaggcttgat ttggaggtta 8160 aagttttgct atgctgtatt ttacattact tattgtttta gctgtcctca tgaatgtctt 8220 ttcactaccc atttgcttat cctgcatctc tcagccttga ctccactcag ttctcttgct 8280 tagagatacc acctttcccc tgaagtgttc cttccatgtt ttacggcgag atggtttctc 8340 ctcgcctggc cactcagcct tagttgtctc tgttgtctta tagaggtcta cttgaagaag 8400 gaaaaacagg gggcatggtt tgactgtcct gtgagccctt cttccctgcc tcccccactc 8460 acagtgaccc ggaatccctc gacatggcag tctagcacta gtgcggccgc agatctgctt 8520 cctcgctcac tgactcgctg cgctcggtcg ttcggctgcg gcgagcggta tcagctcact 8580 caaaggcggt aatacggtta tccacagaat caggggataa cgcaggaaag aacatgtgag 8640 caaaaggcca gcaaaaggcc aggaaccgta aaaagtcgac cattacttat tgttttagct 8700 gtcctcatga atgtcttttc actacccatt tgcttatcct gcatctctca gccttgactc 8760 cactcagttc tcttgcttag agataccacc tttcccctga agtgttcctt ccatgtttta 8820 cggcgagatg gtttctcctc gcctggccac tcagccttag ttgtctctgt tgtcttatag 8880 aggtctactt gaagaaggaa aaacaggggg catggtttga ctgtcctgtg agcccttctt 8940 ccctgcctcc cccactcaca gtgacccgga atccctcgac atggcagtct agcactagtg 9000 cggccgcaga tctgcttcct cgctcactga ctcgctgcgc tcggtcgttc ggctgcggcg 9060 agcggtatca gctcactcaa aggcggtaat acggttatcc acagaatcag gggataacgc 9120 aggaaagaac atgtgagcaa aaggccagca aaaggccagg aaccgtaaaa a 9171
SEQ ID NO : 12 tacgtaaata cacttgcaaa ggaggatgtt tttagtagca atttgtactg atggtatggg 60 gccaagagat atatcttaga gggagggctg agggtttgaa gtccaactcc taagccagtg 120 ccagaagagc caaggacagg tacggctgtc atcacttaga cctcaccctg tggagccaca 180 ccctagggtt ggccaatcta ctcccaggag cagggagggc aggagccagg gctgggcata 240 aaagtcaggg cagagccatc tattgcttac atttgcttct gacacaactg tgttcactag 300 caacctcaaa cagacaccat ggtgcatctg actcctgagg agaagtctgc cgttactgcc 360 ctgtggggca aggtgaacgt ggatgaagtt ggtggtgagg ccctgggcag gttggtatca 420 aggttacaag acaggtttaa ggagaccaat agaaactggg catgtggaga cagagaagac 480 tcttgggttt ctgataggca ctgactctct ctgcctattg gtctattttc ccacccttag 540 gctgctggtg gtctaccctt ggacccagag gttctttgag tcctttgggg atctgtccac 600 tcctgatgct gttatgggca accctaaggt gaaggctcat ggcaagaaag tgctcggtgc 660 ctttagtgat ggcctggctc acctggacaa cctcaagggc acctttgcca cactgagtga 720 gctgcactgt gacaagctgc acgtggatcc tgagaacttc agggtgagtc tatgggacgc 780 ttgatgtttt ctttcccctt cttttctatg gttaagttca tgtcatagga aggggataag 840 taacagggta cagtttagaa tgggaaacag acgaatgatt gcatcagtgt ggaagtctca 900 ggatcgtttt agtttctttt atttgctgtt cataacaatt gttttctttt gtttaattct 960 tgctttcttt ttttttcttc tccgcaattt ttactattat acttaatgcc ttaacattgt 1020 gtataacaaa aggaaatatc tctgagatac attaagtaac ttaaaaaaaa actttacaca 1080 gtctgcctag tacattacta tttggaatat atgtgtgctt atttgcatat tcataatctc 1140 cctactttat tttcttttat ttttaattga tacataatca ttatacatat ttatgggtta 1200 aagtgtaatg ttttaatatg tgtacacata ttgaccaaat cagggtaatt ttgcatttgt 1260 aattttaaaa aatgctttct tcttttaata tacttttttg tttatcttat ttctaatact 1320 ttccctaatc tctttctttc agggcaataa tgatacaatg tatcatgcct ctttgcacca 1380 ttctaaagaa taacagtgat aatttctggg ttaaggcaat agcaatatct ctgcatataa 1440 atatttctgc atataaattg taactgatgt aagaggtttc atattgctaa tagcagctac 1500 aatccagcta ccattctgct tttattttat ggttgggata aggctggatt attctgagtc 1560 caagctaggc ccttttgcta atcatgttca tacctcttat cttcctccca cagctcctgg 1620 gcaacgtgct ggtctgtgtg ctggcccatc actttggcaa agaattcacc ccaccagtgc 1680 aggctgccta tcagaaagtg gtggctggtg tggctaatgc cctggcccac aagtatcact 1740 aagctcgctt tcttgctgtc caatttctat taaaggttcc tttgttccct aagtccaact 1800 actaaactgg gggatattat gaagggcctt gagcatctgg attctgccta ataaaaaaca 1860 tttattttca ttgcaatgat gtatttaaat tatttctgaa tattttacta aaaagggaat 1920 gtgggaggtc agtgcattta aaacataaag aaatgaagag ctagttcaaa ccttgggaaa 1980 atacactata tcttaaactc catgaaagaa ggtgaggctg caaacagcta atgcacattg 2040 gcaacagccc ctgatgcata tgccttattc atccctcaga aaaggattca agtagaggct 2100 tgatttggag gttaaagttt tgctatgctg tattttacat tacttattgt tttagctgtc 2160 ctcatgaatg tcttttcact acccatttgc ttatcctgca tctctcagcc ttgactccac 2220 tcagttctct tgcttagaga taccaccttt cccctgaagt gttccttcca tgttttacgg 2280 cgagatggtt tctcctcgcc tggccactca gccttagttg tctctgttgt cttatagagg 2340 tctacttgaa gaaggaaaaa caggggtcat ggtttgactg tcctgtgagc ccttcttccc 2400 tgcctccccc actcacagtg acccggaatc tgcagtgcta gtctcccgga actatcactc 2460 tttcacagtc tgctttggaa ggactgggct tagtatgaaa agttaggact gagaagaatt 2520 tgaaaggcgg ctttttgtag cttgatattc actactgtct tattaccctg tcataggccc 2580 accccaaatg gaagtcccat tcttcctcag gatgtttaag attagcattc aggaagagat 2640 cagaggtctg ctggctccct tatcatgtcc cttatggtgc ttctggctct gcagttatta 2700 gcatagtgtt accatcaacc accttaactt catttttctt attcaatacc tagg 2754
SEQ ID NO : 13 ggccgcgttg ctggcgtttt tccataggct ccgcccccct gacgagcatc acaaaaatcg 60 acgctcaagt cagaggtggc gaaacccgac aggactataa agataccagg cgtttccccc 120 tggaagctcc ctcgtgcgct ctcctgttcc gaccctgccg cttaccggat acctgtccgc 180 ctttctccct tcgggaagcg tggcgctttc tcatagctca cgctgtaggt atctcagttc 240 ggtgtaggtc gttcgctcca agctgggctg tgtgcacgaa ccccccgttc agcccgaccg 300 ctgcgcctta tccggtaact atcgtcttga gtccaacccg gtaagacacg acttatcgcc 360 actggcagca gccactggta acaggattag cagagcgagg tatgtaggcg gtgctacaga 420 gttcttgaag tggtggccta actacggcta cactagaaga acagtatttg gtatctgcgc 480 tctgctgaag ccagttacct tcggaaaaag agttggtagc tcttgatccg gcaaacaaac 540 caccgctggt agcggtggtt tttttgtttg caagcagcag attacgcgca gaaaaaaagg 600 atctcaagaa gatcctttga tcttttctac ggggtctgac gctcagtgga acgaaaactc 660 acgttaaggg attttggtca tgaagcgctt ttgaagctcg gatccgaaca aacgacccaa 720 cacccgtgcg ttttattctg tctttttatt gccgatcccc tcagaagaac tcgtcaagaa 780 ggcgatagaa ggcgatgcgc tgcgaatcgg gagcggcgat accgtaaagc acgaggaagc 840 ggtcagccca ttcgccgcca agctcttcag caatatcacg ggtagccaac gctatgtcct 900 gatagcggtc cgccacaccc agccggccac agtcgatgaa tccagaaaag cggccatttt 960 ccaccatgat attcggcaag caggcatcgc catgggtcac gacgagatcc tcgccgtcgg 1020 gcatgctcgc cttgagcctg gcgaacagtt cggctggcgc gagcccctga tgctcttcgt 1080 ccagatcatc ctgatcgaca agaccggctt ccatccgagt acgtgctcgc tcgatgcgat 1140 gtttcgcttg gtggtcgaat gggcaggtag ccggatcaag cgtatgcagc cgccgcattg 1200 catcagccat gatggatact ttctcggcag gagcaaggtg agatgacagg agatcctgcc 1260 ccggcacttc gcccaatagc agccagtccc ttcccgcttc agtgacaacg tcgagcacag 1320 ctgcgcaagg aacgcccgtc gtggccagcc acgatagccg cgctgcctcg tcttgcagtt 1380 cattcagggc accggacagg tcggtcttga caaaaagaac cgggcgcccc tgcgctgaca 1440 gccggaacac ggcggcatca gagcagccga ttgtctgttg tgcccagtca tagccgaata 1500 gcctctccac ccaagcggcc ggagaacctg cgtgcaatcc atcttgttca atcatgcgaa 1560 acgatcctca tcctgtctct tgatcagagc ttgatcccct gcgccatcag atccttggcg 1620 gcaagaaagc catccagttt actttgcagg gcttcccaac cttaccagag gcctgcgccg 1680 cggccagctg gctagcaatt cccgggttaa ctctagagac attgattatt gactagttat 1740 taatagtaat caattacggg gtcattagtt catagcccat atatggagtt ccgcgttaca 1800 taacttacgg taaatggccc gcctggctga ccgcccaacg acccccgccc attgacgtca 1860 ataatgacgt atgttcccat agtaacgcca atagggactt tccattgacg tcaatgggtg 1920 gagtatttac ggtaaactgc ccacttggca gtacatcaag tgtatcatat gccaagtacg 1980 ccccctattg acgtcaatga cggtaaatgg cccgcctggc attatgccca gtacatgacc 2040 ttatgggact ttcctacttg gcagtacatc tacgtattag tcatcgctat taccatggtg 2100 atgcggtttt ggcagtacat caatgggcgt ggatagcggt ttgactcacg gggatttcca 2160 agtctccacc ccattgacgt caatgggagt ttgttttggc accaaaatca acgggacttt 2220 ccaaaatgtc gtaacaactc cgccccattg acgcaaatgg gcggtaggcg tgtacggtgg 2280 gaggtctata taagcagagc tcgtttagtg aaccggggtc tctctggtta gaccagatct 2340 gagcctggga gctctctggc taactaggga acccactgct taagcctcaa taaagcttgc 2400 cttgagtgct tcaagtagtg tgtgcccgtc tgttgtgtga ctctggtaac tagagatccc 2460 tcagaccctt ttagtcagtg tggaaaatct ctagcagtgg cgcccgaaca gggacttgaa 2520 agcgaaaggg aaaccagagg agctctctcg acgcaggact cggcttgctg aagcgcgcac 2580 ggcaagaggc gaggggcggc gactggtgag tacgccaaaa attttgacta gcggaggcta 2640 gaaggagaga gatgggtgcg agagcgtcag tattaagcgg gggagaatta gatcgcgatg 2700 ggaaaaaatt cggttaaggc cagggggaaa gaaaaaatat aaattaaaac atatagtatg 2760 ggcaagcagg gagctagaac gattcgcagt taatcctggc ctgttagaaa catcagaagg 2820 ctgtagacaa atactgggac agctacaacc atcccttcag acaggatcag aagaacttag 2880 atcattatat aatacagtag caaccctcta ttgtgtgcat caaaggatag agataaaaga 2940 caccaaggaa gctttagaca agatagagga agagcaaaac aaaagtaaga ccaccgcaca 3000 gcaagcggcc gctgatcttc agacctggag gaggagatat gagggacaat tggagaagtg 3060 aattatataa atataaagta gtaaaaattg aaccattagg agtagcaccc accaaggcaa 3120 agagaagagt ggtgcagaga gaaaaaagag cagtgggaat aggagctttg ttccttgggt 3180 tcttgggagc agcaggaagc actatgggcg cagcgtcaat gacgctgacg gtacaggcca 3240 gacaattatt gtctggtata gtgcagcagc agaacaattt gctgagggct attgaggcgc 3300 aacagcatct gttgcaactc acagtctggg gcatcaagca gctccaggca agaatcctgg 3360 ctgtggaaag atacctaaag gatcaacagc tcctggggat ttggggttgc tctggaaaac 3420 tcatttgcac cactgctgtg ccttggaatg ctagttggag taataaatct ctggaacaga 3480 tttggaatca cacgacctgg atggagtggg acagagaaat taacaattac acaagcttaa 3540 tacactcctt aattgaagaa tcgcaaaacc agcaagaaaa gaatgaacaa gaattattgg 3600 aattagataa atgggcaagt ttgtggaatt ggtttaacat aacaaattgg ctgtggtata 3660 taaaattatt cataatgata gtaggaggct tggtaggttt aagaatagtt tttgctgtac 3720 tttctatagt gaatagagtt aggcagggat attcaccatt atcgtttcag acccacctcc 3780 caaccccgag gggacccgac aggcccgaag gaatagaaga agaaggtgga gagagagaca 3840 gagacagatc cattcgatta gtgaacggat ctcgacggta tcggttaact tttaaaagaa 3900 aaggggggat tggggggtac agtgcagggg aaagaatagt agacataata gcaacagaca 3960 tacaaactaa agaattacaa aaacaaatta caaaaattca aaattttatc gatcacgaga 4020 ctagcctcga gaagcttgat atccctaggt attgaataag aaaaatgaag ttaaggtggt 4080 tgatggtaac actatgctaa taactgcaga gccagaagca ccataaggga catgataagg 4140 gagccagcag acctctgatc tcttcctgaa tgctaatctt aaacatcctg aggaagaatg 4200 ggacttccat ttggggtggg cctatgacag ggtaataaga cagtagtgaa tatcaagcta 4260 caaaaagccg cctttcaaat tcttctcagt cctaactttt catactaagc ccagtccttc 4320 caaagcagac tgtgaaagag tgatagttcc gggagactag cactgcagat tccgggtcac 4380 tgtgagtggg ggaggcaggg aagaagggct cacaggacag tcaaaccatg acccctgttt 4440 ttccttcttc aagtagacct ctataagaca acagagacaa ctaaggctga gtggccaggc 4500 gaggagaaac catctcgccg taaaacatgg aaggaacact tcaggggaaa ggtggtatct 4560 ctaagcaaga gaactgagtg gagtcaaggc tgagagatgc aggataagca aatgggtagt 4620 gaaaagacat tcatgaggac agctaaaaca ataagtaatg taaaatacag catagcaaaa 4680 ctttaacctc caaatcaagc ctctacttga atccttttct gagggatgaa taaggcatat 4740 gcatcagggg ctgttgccaa tgtgcattag ctgtttgcag cctcaccttc tttcatggag 4800 tttaagatat agtgtatttt cccaaggttt gaactagctc ttcatttctt tatgttttaa 4860 atgcactgac ctcccacatt ccctttttag taaaatattc agaaataatt taaatacatc 4920 attgcaatga aaataaatgt tttttattag gcagaatcca gatgctcaag gcccttcata 4980 atatccccca gtttagtagt tggacttagg gaacaaagga acctttaata gaaattggac 5040 agcaagaaag cgagcttagt gatacttgtg ggccagggca ttagccacac cagccaccac 5100 tttctgatag gcagcctgca ctggtggggt gaattctttg ccaaagtgat gggccagcac 5160 acagaccagc acgttgccca ggagctgtgg gaggaagata agaggtatga acatgattag 5220 caaaagggcc tagcttggac tcagaataat ccagccttat cccaaccata aaataaaagc 5280 agaatggtag ctggattgta gctgctatta gcaatatgaa acctcttaca tcagttacaa 5340 tttatatgca gaaatattta tatgcagaga tattgctatt gccttaaccc agaaattatc 5400 actgttattc tttagaatgg tgcaaagagg catgatacat tgtatcatta ttgccctgaa 5460 agaaagagat tagggaaagt attagaaata agataaacaa aaaagtatat taaaagaaga 5520 aagcattttt taaaattaca aatgcaaaat taccctgatt tggteaatat gtgtacacat 5580 attaaaacat tacactttaa cccataaata tgtataatga ttatgtatca attaaaaata 5640 aaagaaaata aagtagggag attatgaata tgcaaataag cacacatata ttccaaatag 5700 taatgtacta ggcagactgt gtaaagtttt tttttaagtt acttaatgta tctcagagat 5760 atttcctttt gttatacaca atgttaaggc attaagtata atagtaaaaa ttgcggagaa 5820 gaaaaaaaaa gaaagcaaga attaaacaaa agaaaacaat tgttatgaac agcaaataaa 5880 agaaactaaa acgatcctga gacttccaca ctgatgcaat cattcgtctg tttcccattc 5940 taaactgtac cctgttactt atccccttcc tatgacatga acttaaccat agaaaagaag 6000 gggaaagaaa acatcaagcg tcccatagac tcaccctgaa gttctcagga tccacgtgca 6060 gcttgtcaca gtgcagctca ctcagtgtgg caaaggtgcc cttgaggttg tccaggtgag 6120 ccaggccatc actaaaggca ccgagcactt tcttgccatg agccttcacc ttagggttgc 6180 ccataacagc atcaggagtg gacagatccc caaaggactc aaagaacctc tgggtccaag 6240 ggtagaccac cagcagccta agggtgggaa aatagaccaa taggcagaga gagteagtge 6300 ctatcagaaa cccaagagtc ttctctgtct ccacatgccc agtttctatt ggtctcctta 6360 aacctgtctt gtaaccttga taccaacctg cccagggcct caccaccaac ttcatccacg 6420 ttcaccttgc cccacagggc agtaacggca gacttctcct caggagtcag atgcaccatg 6480 gtgtctgttt gaggttgcta gtgaacacag ttgtgtcaga agcaaatgta agcaatagat 6540 ggctctgccc tgacttttat gcccagccct ggctcctgcc ctccctgctc ctgggagtag 6600 attggccaac cctagggtgt ggctccacag ggtgaggtct aagtgatgac agccgtacct 6660 gtccttggct cttctggcac tggcttagga gttggacttc aaaccctcag ccctccctct 6720 aagatatatc tcttggcccc ataccatcag tacaaattgc tactaaaaac atcctccttt 6780 gcaagtgtat ttacgtatct agaatatgtc acattctgtc tcaggcatcc attttcttta 6840 tgatgccgtt tgaggtggag ttttagtcag gtggtcagct tctccttttt tttgccatct 6900 gccctgtaag catcctgctg gggacccaga taggagteat cactctaggc tgagaacatc 6960 tgggcacaca ccctaagcct cagcatgact catcatgact cagcattgct gtgettgage 7020 cagaaggttt gcttagaagg ttacacagaa ccagaaggcg ggggtggggc actgaccccg 7080 acaggggcct ggccagaact gctcatgctt ggactatggg aggtcactaa tggagacaca 7140 cagaaatgta acaggaacta aggaaaaact gaagettatt taatcagaga tgaggatget 7200 ggaagggata gagggagctg agcttgtaaa aagtatagta atcattcagc aaatggtttt 7260 gaagcacctg ctggatgcta aacactattt teagtgettg aatcataaat aagaataaaa 7320 catgtatctt attccccaca agagtccaag taaaaaataa cagttaatta taatgtgctc 7380 tgtcccccag gctggagtgc agtggcacga tctcagctca ctgcaacctc cgcctcccgg 7440 gctggttaga aggttctact ggaggagggt cccagcccat tgetaaatta acatcaggct 7500 ctgagactgg cagtatatct ctaacagtgg ttgatgetat cttctggaac ttgeetgeta 7560 cattgagacc actgacccat acataggaag cccatagctc tgtcctgaac tgttaggcca 7620 ctggtccaga gagtgtgcat ctcctttgat cctcataata accctatgag atagacacaa 7680 ttattactct tactttatag atgatgatcc tgaaaacata ggagteaagg cacttgcccc 7740 tagctggggg tataggggag cagtcccatg tagtagtaga atgaaaaatg etgetatget 7800 gtgcctcccc cacctttccc atgtctgccc tctactcatg gtetatetet cctggctcct 7860 gggagtcatg gactccaccc agcaccacca acctgaccta accacctatc tgagcctgcc 7920 agcctataac ccatctgggc cctgatagct ggtggccagc cctgacccca ccccaccctc 7980 cctggaacct ctgatagaca catctggcac accagctcgc aaagtcaccg tgagggtctt 8040 gtgtttgctg agtcaaaatt ccttgaaatc caagtcctta gagactcctg ctcccaaatt 8100 tacagtcata gacttcttca tggctgtctc ctttatccac agaatgattc ctttgcttca 8160 ttgccccatc catctgatcc tcctcatcag tgcagcacag ggcccatgag cagtagctgc 8220 agagtctcac ataggtctgg cactgcctct gacatgtccg accttaggca aatgcttgac 8280 tcttctctag tgcatgcaaa tctgacactc agtgggcctg ggtgaaggtg agaattttat 8340 tgctgaatga gagcctctgg ggacatcttg ccagtcaatg agtctcaggt tcaatttcct 8400 tctcagtctt ggagtaacag aagctcatgc atttaataaa cggaaatttt gtattgaaat 8460 gagagccatt ggaaatcatt tactccagac tcctacttat aaaaagagaa actgaggctc 8520 agagaagggt ggggactttc tcagtatgac atggaaatga tcaggcttgg attcaaagct 8580 cctgactttc tgtctagtgt atgtgcagtg agcccctttt cctctaactg aaagaaggaa 8640 aaaaaaatgg aacccaaaat attctacata gtttccatgt cacagccagg gctgggcagt 8700 ctcctgttat ttcttttaaa ataaatatat catttaaatg cataaataag caaaccctgc 8760 tcgggaatgg gagggagagt ctctggagtc caccccttct cggccctggc tctgcagata 8820 gtgctatcaa agccctgaca gagccctgcc cattgctggg ccttggagtg agtcagccta 8880 gtagagaggc agggcaagcc atctcatagc tgctgagtgg gagagagaaa agggctcatt 8940 gtctataaac tcaggtcatg gctattctta ttctcacact aagaaaaaga atgagatgtc 9000 tacatatacc ctgcgtcccc tcttgtgtac tggggtcccc aagagctctc taaaagtgat 9060 ggcaaagtca ttgcgctaga tgccatccca tctattataa acctgcattt gtctccacac 9120 accagtcatg gacaataacc ctcctcccag gtccacgtgc ttgtctttgt ataatactca 9180 agtaatttcg gaaaatgtat tctttcaatc ttgttctgtt attcctgttt caatggctta 9240 gtagaaaaag tacatacttg ttttcccata aattgacaat agacaatttc acatcaatgt 9300 ctatatgggt cgttgtgttt gctgtgtttg caaaaactca caataacttt atattgttac 9360 tactctaaga aagttacaac atggtgaata caagagaaag ctattacaag tccagaaaat 9420 aaaagttatc atcttgaggg tcgacaatca acctctggat tacaaaattt gtgaaagatt 9480 gactggtatt cttaactatg ttgctccttt tacgctatgt ggatacgctg ctttaatgcc 9540 tttgtatcat gctattgctt cccgtatggc tttcattttc tcctccttgt ataaatcctg 9600 gttgctgtct ctttatgagg agttgtggcc cgttgtcagg caacgtggcg tggtgtgcac 9660 tgtgtttgct gacgcaaccc ccactggttg gggcattgcc accacctgtc agctcctttc 9720 cgggactttc gctttccccc tccctattgc cacggcggaa ctcatcgccg cctgccttgc 9780 ccgctgctgg acaggggctc ggctgttggg cactgacaat tccgtggtgt tgtcggggaa 9840 gctgacgtcc tttccatggc tgctcgcctg tgttgccacc tggattctgc gcgggacgtc 9900 cttctgctac gtcccttcgg ccctcaatcc agcggacctt ccttcccgcg gcctgctgcc 9960 ggctctgcgg cctcttccgc gtcttcgcct tcgccctcag acgagtcgga tctccctttg 10020 ggccgcctcc ccgcctggaa ttcgagctcg gtacctttaa gaccaatgac ttacaaggca 10080 gctgtagatc ttagccactt tttaaaagaa aaggggggac tggaagggct aattcactcc 10140 caacgaagac aagatctgct ttttgcttgt actgggtctc tctggttaga ccagatctga 10200 gcctgggagc tctctggcta actagggaac ccactgctta agcctcaata aagcttgcct 10260 tgagtgcttc aagtagtgtg tgcccgtctg ttgtgtgact ctggtaacta gagatccctc 10320 agaccctttt agtcagtgtg gaaaatctct agcagtagta gttcatgtca tcttattatt 10380 cagtatttat aacttgcaaa gaaatgaata tcagagagtg agaggaactt gtttattgca 10440 gcttataatg gttacaaata aagcaatagc atcacaaatt tcacaaataa agcatttttt 10500 tcactgcatt ctagttgtgg tttgtccaaa ctcatcaatg tatcttatca tgtctggctc 10560 tagctatccc gcccctaact ccgcccatcc cgcccctaac tccgcccagt tccgcccatt 10620 ctccgcccca tggctgacta atttttttta tttatgcaga ggccgaggcc gcctcggcct 10680 ctgagctatt ccagaagtag tgaggaggct tttttggagg ccgctagcgt cgaccattac 10740 ttattgtttt agctgtcctc atgaatgtct tttcactacc catttgctta tcctgcatct 10800 ctcagccttg actccactca gttctcttgc ttagagatac cacctttccc ctgaagtgtt 10860 ccttccatgt tttacggcga gatggtttct cctcgcctgg ccactcagcc ttagttgtct 10920 ctgttgtctt atagaggtct acttgaagaa ggaaaaacag ggggcatggt ttgactgtcc 10980 tgtgagccct tcttccctgc ctcccccact cacagtgacc cggaatccct cgacatggca 11040 gtctagcact agtgcggccg cagatctgct tcctcgctca ctgactcgct gcgctcggtc 11100 gttcggctgc ggcgagcggt atcagctcac tcaaaggcgg taatacggtt atccacagaa 11160 tcaggggata acgcaggaaa gaacatgtga gcaaaaggcc agcaaaaggc caggaaccgt 11220 aaaaa 11225
SEQ ID NO : 14 acatttgctt ctgacacaac tgtgttcact agcaacctca aacagacacc atggtgcacc 60 tgacccctga ggagaagagc gccgtgacag ccctgtgggg caaggtgaac gtggacgaag 120 tgggaggaga ggccctgggc aggttggtat caaggttaca agacaggttt aaggagacca 180 atagaaactg ggcatgtgga gacagagaag actcttgggt ttctgatagg cactgactct 240 ctctgcctat tggtctattt tcccaccctt aggctgctgg tggtgtaccc atggacccag 300 agattctttg agagcttcgg cgacctgtcc acaccagatg ccgtgatggg caaccccaag 360 gtgaaggccc acggcaagaa ggtgctggga gccttctctg acggactggc ccacctggat 420 aatctgaagg gcacctttgc ccagctgagc gagctgcact gcgacaagct gcacgtggat 480 cccgagaact tcagggtgag tctatgggac gcttgatgtt ttctttcccc ttcttttcta 540 tggttaagtt catgtcatag gaaggggata agtaacaggg tacacatatt gaccaaatca 600 gggtaatttt gcatttgtaa ttttaaaaaa tgctttcttc ttttaatata cttttttgtt 660 tatcttattt ctaatacttt ccctaatctc tttctttcag ggcaataatg atacaatgta 720 tcatgcctct ttgcaccatt ctaaagaata acagtgataa tttctgggtt aaggcaatag 780 caatatctct gcatataaat atttctgcat ataaattgta actgatgtaa gaggtttcat 840 attgctaata gcagctacaa tccagctacc attctgcttt tattttatgg ttgggataag 900 gctggattat tctgagtcca agctaggccc ttttgctaat catgttcata cctcttatct 960 tcctcccaca gctcctgggc aacgtgctgg tgtgcgtgct ggcccaccac ttcggcaagg 1020 agtttacacc ccctgtgcag gcagcatacc agaaggtggt ggcaggagtg gcaaatgcac 1080 tggcccacaa gtatcactga gctcgctttc ttgctgtcca atttctatta aaggttcctt 1140 tgttccctaa gtccaactac taaactgggg gatattatga agggccttga gcatctggat 1200 tctgcctaat aaaaaacatt tattttcatt gcaa 1234
SEQ ID NO : 15 ggccgcgttg ctggcgtttt tccataggct ccgcccccct gacgagcatc acaaaaatcg 60 acgctcaagt cagaggtggc gaaacccgac aggactataa agataccagg cgtttccccc 120 tggaagctcc ctcgtgcgct ctcctgttcc gaccctgccg cttaccggat acctgtccgc 180 ctttctccct tcgggaagcg tggcgctttc tcatagctca cgctgtaggt atctcagttc 240 ggtgtaggtc gttcgctcca agctgggctg tgtgcacgaa ccccccgttc agcccgaccg 300 ctgcgcctta tccggtaact atcgtcttga gtccaacccg gtaagacacg acttatcgcc 360 actggcagca gccactggta acaggattag cagagcgagg tatgtaggcg gtgctacaga 420 gttcttgaag tggtggccta actacggcta cactagaaga acagtatttg gtatctgcgc 480 tctgctgaag ccagttacct tcggaaaaag agttggtagc tcttgatccg gcaaacaaac 540 caccgctggt agcggtggtt tttttgtttg caagcagcag attacgcgca gaaaaaaagg 600 atctcaagaa gatcctttga tcttttctac ggggtctgac gctcagtgga acgaaaactc 660 acgttaaggg attttggtca tgaagcgctt ttgaagctcg gatccgaaca aacgacccaa 720 cacccgtgcg ttttattctg tctttttatt gccgatcccc tcagaagaac tcgtcaagaa 780 ggcgatagaa ggcgatgcgc tgcgaatcgg gagcggcgat accgtaaagc acgaggaagc 840 ggtcagccca ttcgccgcca agctcttcag caatatcacg ggtagccaac gctatgtcct 900 gatagcggtc cgccacaccc agccggccac agtcgatgaa tccagaaaag cggccatttt 960 ccaccatgat attcggcaag caggcatcgc catgggtcac gacgagatcc tcgccgtcgg 1020 gcatgctcgc cttgagcctg gcgaacagtt cggctggcgc gagcccctga tgctcttcgt 1080 ccagatcatc ctgatcgaca agaccggctt ccatccgagt acgtgctcgc tcgatgcgat 1140 gtttcgcttg gtggtcgaat gggcaggtag ccggatcaag cgtatgcagc cgccgcattg 1200 catcagccat gatggatact ttctcggcag gagcaaggtg agatgacagg agatcctgcc 1260 ccggcacttc gcccaatagc agccagtccc ttcccgcttc agtgacaacg tcgagcacag 1320 ctgcgcaagg aacgcccgtc gtggccagcc acgatagccg cgctgcctcg tcttgcagtt 1380 cattcagggc accggacagg tcggtcttga caaaaagaac cgggcgcccc tgcgctgaca 1440 gccggaacac ggcggcatca gagcagccga ttgtctgttg tgcccagtca tagccgaata 1500 gcctctccac ccaagcggcc ggagaacctg cgtgcaatcc atcttgttca atcatgcgaa 1560 acgatcctca tcctgtctct tgatcagagc ttgatcccct gcgccatcag atccttggcg 1620 gcaagaaagc catccagttt actttgcagg gcttcccaac cttaccagag gcctgcgccg 1680 cggccagctg gctagcaatt cccgggttaa ctctagagac attgattatt gactagttat 1740 taatagtaat caattacggg gtcattagtt catagcccat atatggagtt ccgcgttaca 1800 taacttacgg taaatggccc gcctggctga ccgcccaacg acccccgccc attgacgtca 1860 ataatgacgt atgttcccat agtaacgcca atagggactt tccattgacg tcaatgggtg 1920 gagtatttac ggtaaactgc ccacttggca gtacatcaag tgtatcatat gccaagtacg 1980 ccccctattg acgtcaatga cggtaaatgg cccgcctggc attatgccca gtacatgacc 2040 ttatgggact ttcctacttg gcagtacatc tacgtattag tcatcgctat taccatggtg 2100 atgcggtttt ggcagtacat caatgggcgt ggatagcggt ttgactcacg gggatttcca 2160 agtctccacc ccattgacgt caatgggagt ttgttttggc accaaaatca acgggacttt 2220 ccaaaatgtc gtaacaactc cgccccattg acgcaaatgg gcggtaggcg tgtacggtgg 2280 gaggtctata taagcagagc tcgtttagtg aaccggggtc tctctggtta gaccagatct 2340 gagcctggga gctctctggc taactaggga acccactgct taagcctcaa taaagcttgc 2400 cttgagtgct tcaagtagtg tgtgcccgtc tgttgtgtga ctctggtaac tagagatccc 2460 tcagaccctt ttagtcagtg tggaaaatct ctagcagtgg cgcccgaaca gggacttgaa 2520 agcgaaaggg aaaccagagg agctctctcg acgcaggact cggcttgctg aagcgcgcac 2580 ggcaagaggc gaggggcggc gactggtgag tacgccaaaa attttgacta gcggaggcta 2640 gaaggagaga gatgggtgcg agagcgtcag tattaagcgg gggagaatta gatcgcgatg 2700 ggaaaaaatt cggttaaggc cagggggaaa gaaaaaatat aaattaaaac atatagtatg 2760 ggcaagcagg gagctagaac gattcgcagt taatcctggc ctgttagaaa catcagaagg 2820 ctgtagacaa atactgggac agctacaacc atcccttcag acaggatcag aagaacttag 2880 atcattatat aatacagtag caaccctcta ttgtgtgcat caaaggatag agataaaaga 2940 caccaaggaa gctttagaca agatagagga agagcaaaac aaaagtaaga ccaccgcaca 3000 gcaagcggcc gctgatcttc agacctggag gaggagatat gagggacaat tggagaagtg 3060 aattatataa atataaagta gtaaaaattg aaccattagg agtagcaccc accaaggcaa 3120 agagaagagt ggtgcagaga gaaaaaagag cagtgggaat aggagctttg ttccttgggt 3180 tcttgggagc agcaggaagc actatgggcg cagcgtcaat gacgctgacg gtacaggcca 3240 gacaattatt gtctggtata gtgcagcagc agaacaattt gctgagggct attgaggcgc 3300 aacagcatct gttgcaactc acagtctggg gcatcaagca gctccaggca agaatcctgg 3360 ctgtggaaag atacctaaag gatcaacagc tcctggggat ttggggttgc tctggaaaac 3420 tcatttgcac cactgctgtg ccttggaatg ctagttggag taataaatct ctggaacaga 3480 tttggaatca cacgacctgg atggagtggg acagagaaat taacaattac acaagcttaa 3540 tacactcctt aattgaagaa tcgcaaaacc agcaagaaaa gaatgaacaa gaattattgg 3600 aattagataa atgggcaagt ttgtggaatt ggtttaacat aacaaattgg ctgtggtata 3660 taaaattatt cataatgata gtaggaggct tggtaggttt aagaatagtt tttgctgtac 3720 tttctatagt gaatagagtt aggcagggat attcaccatt atcgtttcag acccacctcc 3780 caaccccgag gggacccgac aggcccgaag gaatagaaga agaaggtgga gagagagaca 3840 gagacagatc cattcgatta gtgaacggat ctcgacggta tcggttaact tttaaaagaa 3900 aaggggggat tggggggtac agtgcagggg aaagaatagt agacataata gcaacagaca 3960 tacaaactaa agaattacaa aaacaaatta caaaaattca aaattttatc gatcacgaga 4020 ctagcctcga gaagcttgat atccctaggt attgaataag aaaaatgaag ttaaggtggt 4080 tgatggtaac actatgctaa taactgcaga gccagaagca ccataaggga catgataagg 4140 gagccagcag acctctgatc tcttcctgaa tgctaatctt aaacatcctg aggaagaatg 4200 ggacttccat ttggggtggg cctatgacag ggtaataaga cagtagtgaa tatcaagcta 4260 caaaaagccg cctttcaaat tcttctcagt cctaactttt catactaagc ccagtccttc 4320 caaagcagac tgtgaaagag tgatagttcc gggagactag cactgcagat tccgggtcac 4380 tgtgagtggg ggaggcaggg aagaagggct cacaggacag tcaaaccatg acccctgttt 4440 ttccttcttc aagtagacct ctataagaca acagagacaa ctaaggctga gtggccaggc 4500 gaggagaaac catctcgccg taaaacatgg aaggaacact tcaggggaaa ggtggtatct 4560 ctaagcaaga gaactgagtg gagtcaaggc tgagagatgc aggataagca aatgggtagt 4620 gaaaagacat tcatgaggac agctaaaaca ataagtaatg taaaatacag catagcaaaa 4680 ctttaacctc caaatcaagc ctctacttga atccttttct gagggatgaa taaggcatat 4740 gcatcagggg ctgttgccaa tgtgcattag ctgtttgcag cctcaccttc tttcatggag 4800 tttaagatat agtgtatttt cccaaggttt gaactagctc ttcatttctt tatgttttaa 4860 atgcactgac ctcccacatt ccctttttag taaaatattc agaaataatt taaatacatc 4920 attgcaatga aaataaatgt tttttattag gcagaatcca gatgctcaag gcccttcata 4980 atatccccca gtttagtagt tggacttagg gaacaaagga acctttaata gaaattggac 5040 agcaagaaag cgagctcagt gatacttgtg ggccagtgca tttgccactc ctgccaccac 5100 cttctggtat gctgcctgca cagggggtgt aaactccttg ccgaagtggt gggccagcac 5160 gcacaccagc acgttgccca ggagctgtgg gaggaagata agaggtatga acatgattag 5220 caaaagggcc tagcttggac tcagaataat ccagccttat cccaaccata aaataaaagc 5280 agaatggtag ctggattgta gctgctatta gcaatatgaa acctcttaca tcagttacaa 5340 tttatatgca gaaatattta tatgcagaga tattgctatt gccttaaccc agaaattatc 5400 actgttattc tttagaatgg tgcaaagagg catgatacat tgtatcatta ttgccctgaa 5460 agaaagagat tagggaaagt attagaaata agataaacaa aaaagtatat taaaagaaga 5520 aagcattttt taaaattaca aatgcaaaat taccctgatt tggtcaatat gtgtaccctg 5580 ttacttatcc ccttcctatg acatgaactt aaccatagaa aagaagggga aagaaaacat 5640 caagcgtccc atagactcac cctgaagttc tcgggatcca cgtgcagctt gtcgcagtgc 5700 agctcgctca gctgggcaaa ggtgcccttc agattatcca ggtgggccag tccgtcagag 5760 aaggctccca gcaccttctt gccgtgggcc ttcaccttgg ggttgcccat cacggcatct 5820 ggtgtggaca ggtcgccgaa gctctcaaag aatctctggg tccatgggta caccaccagc 5880 agcctaaggg tgggaaaata gaccaatagg cagagagagt cagtgcctat cagaaaccca 5940 agagtcttct ctgtctccac atgcccagtt tctattggtc tccttaaacc tgtcttgtaa 6000 ccttgatacc aacctgccca gggcctctcc tcccacttcg tccacgttca ccttgcccca 6060 cagggctgtc acggcgctct tctcctcagg ggtcaggtgc accatggtgt ctgtttgagg 6120 ttgctagtga acacagttgt gtcagaagca aatgtaagca atagatggct ctgccctgac 6180 ttttatgccc agccctggct cctgccctcc ctgctcctgg gagtagattg gccaacccta 6240 gggtgtggct ccacagggtg aggtctaagt gatgacagcc gtacctgtcc ttggctcttc 6300 tggcactggc ttaggagttg gacttcaaac cctcagccct ccctctaaga tatatctctt 6360 ggccccatac catcagtaca aattgctact aaaaacatcc tcctttgcaa gtgtatttac 6420 gtatctagaa tatgtcacat tctgtctcag gcatccattt tctttatgat gccgtttgag 6480 gtggagtttt agtcaggtgg tcagcttctc cttttttttg ccatctgccc tgtaagcatc 6540 ctgctgggga cccagatagg agtcatcact ctaggctgag aacatctggg cacacaccct 6600 aagcctcagc atgactcatc atgactcagc attgctgtgc ttgagccaga aggtttgctt 6660 agaaggttac acagaaccag aaggcggggg tggggcactg accccgacag gggcctggcc 6720 agaactgctc atgcttggac tatgggaggt cactaatgga gacacacaga aatgtaacag 6780 gaactaagga aaaactgaag cttatttaat cagagatgag gatgctggaa gggatagagg 6840 gagctgagct tgtaaaaagt atagtaatca ttcagcaaat ggttttgaag cacctgctgg 6900 atgctaaaca ctattttcag tgcttgaatc ataaataaga ataaaacatg tatcttattc 6960 cccacaagag tccaagtaaa aaataacagt taattataat gtgctctgtc ccccaggctg 7020 gagtgcagtg gcacgatctc agctcactgc aacctccgcc tcccgggctg gttagaaggt 7080 tctactggag gagggtccca gcccattgct aaattaacat caggctctga gactggcagt 7140 atatctctaa cagtggttga tgctatcttc tggaacttgc ctgctacatt gagaccactg 7200 acccatacat aggaagccca tagctctgtc ctgaactgtt aggccactgg tccagagagt 7260 gtgcatctcc tttgatcctc ataataaccc tatgagatag acacaattat tactcttact 7320 ttatagatga tgatcctgaa aacataggag tcaaggcact tgcccctagc tgggggtata 7380 ggggagcagt cccatgtagt agtagaatga aaaatgctgc tatgctgtgc ctcccccacc 7440 tttcccatgt ctgccctcta ctcatggtct atctctcctg gctcctggga gtcatggact 7500 ccacccagca ccaccaacct gacctaacca cctatctgag cctgccagcc tataacccat 7560 ctgggccctg atagctggtg gccagccctg accccacccc accctccctg gaacctctga 7620 tagacacatc tggcacacca gctcgcaaag tcaccgtgag ggtcttgtgt ttgctgagtc 7680 aaaattcctt gaaatccaag tccttagaga ctcctgctcc caaatttaca gtcatagact 7740 tcttcatggc tgtctccttt atccacagaa tgattccttt gcttcattgc cccatccatc 7800 tgatcctcct catcagtgca gcacagggcc catgagcagt agctgcagag tctcacatag 7860 gtctggcact gcctctgaca tgtccgacct taggcaaatg cttgactctt ctctagtgca 7920 tgcaaatctg acactcagtg ggcctgggtg aaggtgagaa ttttattgct gaatgagagc 7980 ctctggggac atcttgccag tcaatgagtc tcaggttcaa tttccttctc agtcttggag 8040 taacagaagc tcatgcattt aataaacgga aattttgtat tgaaatgaga gccattggaa 8100 atcatttact ccagactcct acttataaaa agagaaactg aggctcagag aagggtgggg 8160 actttctcag tatgacatgg aaatgatcag gcttggattc aaagctcctg actttctgtc 8220 tagtgtatgt gcagtgagcc ccttttcctc taactgaaag aaggaaaaaa aaatggaacc 8280 caaaatattc tacatagttt ccatgtcaca gccagggctg ggcagtctcc tgttatttct 8340 tttaaaataa atatatcatt taaatgcata aataagcaaa ccctgctcgg gaatgggagg 8400 gagagtctct ggagtccacc ccttctcggc cctggctctg cagatagtgc tatcaaagcc 8460 ctgacagagc cctgcccatt gctgggcctt ggagtgagtc agcctagtag agaggcaggg 8520 caagccatct catagctgct gagtgggaga gagaaaaggg ctcattgtct ataaactcag 8580 gtcatggcta ttcttattct cacactaaga aaaagaatga gatgtctaca tataccctgc 8640 gtcccctctt gtgtactggg gtccccaaga gctctctaaa agtgatggca aagtcattgc 8700 gctagatgcc atcccatcta ttataaacct gcatttgtct ccacacacca gtcatggaca 8760 ataaccctcc tcccaggtcc acgtgcttgt ctttgtataa tactcaagta atttcggaaa 8820 atgtattctt tcaatcttgt tctgttattc ctgtttcaat ggcttagtag aaaaagtaca 8880 tacttgtttt cccataaatt gacaatagac aatttcacat caatgtctat atgggtcgtt 8940 gtgtttgctg tgtttgcaaa aactcacaat aactttatat tgttactact ctaagaaagt 9000 tacaacatgg tgaatacaag agaaagctat tacaagtcca gaaaataaaa gttatcatct 9060 tgagggtcga caatcaacct ctggattaca aaatttgtga aagattgact ggtattctta 9120 actatgttgc tccttttacg ctatgtggat acgctgcttt aatgcctttg tatcatgcta 9180 ttgcttcccg tatggctttc attttctcct ccttgtataa atcctggttg ctgtctcttt 9240 atgaggagtt gtggcccgtt gtcaggcaac gtggcgtggt gtgcactgtg tttgctgacg 9300 caacccccac tggttggggc attgccacca cctgtcagct cctttccggg actttcgctt 9360 tccccctccc tattgccacg gcggaactca tcgccgcctg ccttgcccgc tgctggacag 9420 gggctcggct gttgggcact gacaattccg tggtgttgtc ggggaagctg acgtcctttc 9480 catggctgct cgcctgtgtt gccacctgga ttctgcgcgg gacgtccttc tgctacgtcc 9540 cttcggccct caatccagcg gaccttcctt cccgcggcct gctgccggct ctgcggcctc 9600 ttccgcgtct tcgccttcgc cctcagacga gtcggatctc cctttgggcc gcctccccgc 9660 ctggaattcg agctcggtac ctttaagacc aatgacttac aaggcagctg tagatcttag 9720 ccacttttta aaagaaaagg ggggactgga agggctaatt cactcccaac gaagacaaga 9780 tctgcttttt gcttgtactg ggtctctctg gttagaccag atctgagcct gggagctctc 9840 tggctaacta gggaacccac tgcttaagcc tcaataaagc ttgccttgag tgcttcaagt 9900 agtgtgtgcc cgtctgttgt gtgactctgg taactagaga tccctcagac ccttttagtc 9960 agtgtggaaa atctctagca gtagtagttc atgtcatctt attattcagt atttataact 10020 tgcaaagaaa tgaatatcag agagtgagag gaacttgttt attgcagctt ataatggtta 10080 caaataaagc aatagcatca caaatttcac aaataaagca tttttttcac tgcattctag 10140 ttgtggtttg tccaaactca tcaatgtatc ttatcatgtc tggctctagc tatcccgccc 10200 ctaactccgc ccatcccgcc cctaactccg cccagttccg cccattctcc gccccatggc 10260 tgactaattt tttttattta tgcagaggcc gaggccgcct cggcctctga gctattccag 10320 aagtagtgag gaggcttttt tggaggccgc tagcgtcgac cattacttat tgttttagct 10380 gtcctcatga atgtcttttc actacccatt tgcttatcct gcatctctca gccttgactc 10440 cactcagttc tcttgcttag agataccacc tttcccctga agtgttcctt ccatgtttta 10500 cggcgagatg gtttctcctc gcctggccac tcagccttag ttgtctctgt tgtcttatag 10560 aggtctactt gaagaaggaa aaacaggggg catggtttga ctgtcctgtg agcccttctt 10620 ccctgcctcc cccactcaca gtgacccgga atccctcgac atggcagtct agcactagtg 10680 cggccgcaga tctgcttcct cgctcactga ctcgctgcgc tcggtcgttc ggctgcggcg 10740 agcggtatca gctcactcaa aggcggtaat acggttatcc acagaatcag gggataacgc 10800 aggaaagaac atgtgagcaa aaggccagca aaaggccagg aaccgtaaaa a 10851
SEQ ID NO : 16 acatttgctt ctgacacaac tgtgttcact agcaacctca aacagacacc atggtgcacc 60 taaccccgga ggagaaaagc gccgtgacgg ccctctgggg caaggtgaac gtcgacgagg 120 tcggcgggga ggccctgggc aggttggtat caaggttaca agacaggttt aaggagacca 180 atagaaactg ggcatgtgga gacagagaag actcttgggt ttctgatagg cactgactct 240 ctctgcctat tggtctattt tcccaccctt aggctgctgg tggtctaccc ctggacgcag 300 cgcttttttg agagcttcgg ggatctgtcc acccccgacg cggtgatggg caaccctaag 360 gtcaaggccc acggcaagaa ggtgctcggc gccttctccg acggcctggc tcacctggac 420 aacctcaagg gcaccttcgc ccagctgtcg gagctgcact gcgacaagct gcacgtcgac 480 cccgagaact tcagggtgag tctatgggac gcttgatgtt ttctttcccc ttcttttcta 540 tggttaagtt catgtcatag gaaggggata agtaacaggg tacacatatt gaccaaatca 600 gggtaatttt gcatttgtaa ttttaaaaaa tgctttcttc ttttaatata cttttttgtt 660 tatcttattt ctaatacttt ccctaatctc tttctttcag ggcaataatg atacaatgta 720 tcatgcctct ttgcaccatt ctaaagaata acagtgataa tttctgggtt aaggcaatag 780 caatatctct gcatataaat atttctgcat ataaattgta actgatgtaa gaggtttcat 840 attgctaata gcagctacaa tccagctacc attctgcttt tattttatgg ttgggataag 900 gctggattat tctgagtcca agctaggccc ttttgctaat catgttcata cctcttatct 960 tcctcccaca gctcctgggc aacgtgctgg tgtgcgtgct ggcccaccac ttcgggaagg 1020 aattcacgcc cccagtgcag gccgcgtacc agaaggtggt ggccggggtg gccaacgccc 1080 tggcccacaa gtaccactga gctcgctttc ttgctgtcca atttctatta aaggttcctt 1140 tgttccctaa gtccaactac taaactgggg gatattatga agggccttga gcatctggat 1200 tctgcctaat aaaaaacatt tattttcatt gcaa 1234
SEQ ID NO : 17 ggccgcgttg ctggcgtttt tccataggct ccgcccccct gacgagcatc acaaaaatcg 60 acgctcaagt cagaggtggc gaaacccgac aggactataa agataccagg cgtttccccc 120 tggaagctcc ctcgtgcgct ctcctgttcc gaccctgccg cttaccggat acctgtccgc 180 ctttctccct tcgggaagcg tggcgctttc tcatagctca cgctgtaggt atctcagttc 240 ggtgtaggtc gttcgctcca agctgggctg tgtgcacgaa ccccccgttc agcccgaccg 300 ctgcgcctta tccggtaact atcgtcttga gtccaacccg gtaagacacg acttatcgcc 360 actggcagca gccactggta acaggattag cagagcgagg tatgtaggcg gtgctacaga 420 gttcttgaag tggtggccta actacggcta cactagaaga acagtatttg gtatctgcgc 480 tctgctgaag ccagttacct tcggaaaaag agttggtagc tcttgatccg gcaaacaaac 540 caccgctggt agcggtggtt tttttgtttg caagcagcag attacgcgca gaaaaaaagg 600 atctcaagaa gatcctttga tcttttctac ggggtctgac gctcagtgga acgaaaactc 660 acgttaaggg attttggtca tgaagcgctt ttgaagctcg gatccgaaca aacgacccaa 720 cacccgtgcg ttttattctg tctttttatt gccgatcccc tcagaagaac tcgtcaagaa 780 ggcgatagaa ggcgatgcgc tgcgaatcgg gagcggcgat accgtaaagc acgaggaagc 840 ggtcagccca ttcgccgcca agctcttcag caatatcacg ggtagccaac gctatgtcct 900 gatagcggtc cgccacaccc agccggccac agtcgatgaa tccagaaaag cggccatttt 960 ccaccatgat attcggcaag caggcatcgc catgggtcac gacgagatcc tcgccgtcgg 1020 gcatgctcgc cttgagcctg gcgaacagtt cggctggcgc gagcccctga tgctcttcgt 1080 ccagatcatc ctgatcgaca agaccggctt ccatccgagt acgtgctcgc tcgatgcgat 1140 gtttcgcttg gtggtcgaat gggcaggtag ccggatcaag cgtatgcagc cgccgcattg 1200 catcagccat gatggatact ttctcggcag gagcaaggtg agatgacagg agatcctgcc 1260 ccggcacttc gcccaatagc agccagtccc ttcccgcttc agtgacaacg tcgagcacag 1320 ctgcgcaagg aacgcccgtc gtggccagcc acgatagccg cgctgcctcg tcttgcagtt 1380 cattcagggc accggacagg tcggtcttga caaaaagaac cgggcgcccc tgcgctgaca 1440 gccggaacac ggcggcatca gagcagccga ttgtctgttg tgcccagtca tagccgaata 1500 gcctctccac ccaagcggcc ggagaacctg cgtgcaatcc atcttgttca atcatgcgaa 1560 acgatcctca tcctgtctct tgatcagagc ttgatcccct gcgccatcag atccttggcg 1620 gcaagaaagc catccagttt actttgcagg gcttcccaac cttaccagag gcctgcgccg 1680 cggccagctg gctagcaatt cccgggttaa ctctagagac attgattatt gactagttat 1740 taatagtaat caattacggg gtcattagtt catagcccat atatggagtt ccgcgttaca 1800 taacttacgg taaatggccc gcctggctga ccgcccaacg acccccgccc attgacgtca 1860 ataatgacgt atgttcccat agtaacgcca atagggactt tccattgacg tcaatgggtg 1920 gagtatttac ggtaaactgc ccacttggca gtacatcaag tgtatcatat gccaagtacg 1980 ccccctattg acgtcaatga cggtaaatgg cccgcctggc attatgccca gtacatgacc 2040 ttatgggact ttcctacttg gcagtacatc tacgtattag tcatcgctat taccatggtg 2100 atgcggtttt ggcagtacat caatgggcgt ggatagcggt ttgactcacg gggatttcca 2160 agtctccacc ccattgacgt caatgggagt ttgttttggc accaaaatca acgggacttt 2220 ccaaaatgtc gtaacaactc cgccccattg acgcaaatgg gcggtaggcg tgtacggtgg 2280 gaggtctata taagcagagc tcgtttagtg aaccggggtc tctctggtta gaccagatct 2340 gagcctggga gctctctggc taactaggga acccactgct taagcctcaa taaagcttgc 2400 cttgagtgct tcaagtagtg tgtgcccgtc tgttgtgtga ctctggtaac tagagatccc 2460 tcagaccctt ttagtcagtg tggaaaatct ctagcagtgg cgcccgaaca gggacttgaa 2520 agcgaaaggg aaaccagagg agctctctcg acgcaggact cggcttgctg aagcgcgcac 2580 ggcaagaggc gaggggcggc gactggtgag tacgccaaaa attttgacta gcggaggcta 2640 gaaggagaga gatgggtgcg agagcgtcag tattaagcgg gggagaatta gatcgcgatg 2700 ggaaaaaatt cggttaaggc cagggggaaa gaaaaaatat aaattaaaac atatagtatg 2760 ggcaagcagg gagctagaac gattcgcagt taatcctggc ctgttagaaa catcagaagg 2820 ctgtagacaa atactgggac agctacaacc atcccttcag acaggatcag aagaacttag 2880 atcattatat aatacagtag caaccctcta ttgtgtgcat caaaggatag agataaaaga 2940 caccaaggaa gctttagaca agatagagga agagcaaaac aaaagtaaga ccaccgcaca 3000 gcaagcggcc gctgatcttc agacctggag gaggagatat gagggacaat tggagaagtg 3060 aattatataa atataaagta gtaaaaattg aaccattagg agtagcaccc accaaggcaa 3120 agagaagagt ggtgcagaga gaaaaaagag cagtgggaat aggagctttg ttccttgggt 3180 tcttgggagc agcaggaagc actatgggcg cagcgtcaat gacgctgacg gtacaggcca 3240 gacaattatt gtctggtata gtgcagcagc agaacaattt gctgagggct attgaggcgc 3300 aacagcatct gttgcaactc acagtctggg gcatcaagca gctccaggca agaatcctgg 3360 ctgtggaaag atacctaaag gatcaacagc tcctggggat ttggggttgc tctggaaaac 3420 tcatttgcac cactgctgtg ccttggaatg ctagttggag taataaatct ctggaacaga 3480 tttggaatca cacgacctgg atggagtggg acagagaaat taacaattac acaagcttaa 3540 tacactcctt aattgaagaa tcgcaaaacc agcaagaaaa gaatgaacaa gaattattgg 3600 aattagataa atgggcaagt ttgtggaatt ggtttaacat aacaaattgg ctgtggtata 3660 taaaattatt cataatgata gtaggaggct tggtaggttt aagaatagtt tttgctgtac 3720 tttctatagt gaatagagtt aggcagggat attcaccatt atcgtttcag acccacctcc 3780 caaccccgag gggacccgac aggcccgaag gaatagaaga agaaggtgga gagagagaca 3840 gagacagatc cattcgatta gtgaacggat ctcgacggta tcggttaact tttaaaagaa 3900 aaggggggat tggggggtac agtgcagggg aaagaatagt agacataata gcaacagaca 3960 tacaaactaa agaattacaa aaacaaatta caaaaattca aaattttatc gatcacgaga 4020 ctagcctcga gaagcttgat atccctaggt attgaataag aaaaatgaag ttaaggtggt 4080 tgatggtaac actatgctaa taactgcaga gccagaagca ccataaggga catgataagg 4140 gagccagcag acctctgatc tcttcctgaa tgctaatctt aaacatcctg aggaagaatg 4200 ggacttccat ttggggtggg cctatgacag ggtaataaga cagtagtgaa tatcaagcta 4260 caaaaagccg cctttcaaat tcttctcagt cctaactttt catactaagc ccagtccttc 4320 caaagcagac tgtgaaagag tgatagttcc gggagactag cactgcagat tccgggtcac 4380 tgtgagtggg ggaggcaggg aagaagggct cacaggacag tcaaaccatg acccctgttt 4440 ttccttcttc aagtagacct ctataagaca acagagacaa ctaaggctga gtggccaggc 4500 gaggagaaac catctcgccg taaaacatgg aaggaacact tcaggggaaa ggtggtatct 4560 ctaagcaaga gaactgagtg gagtcaaggc tgagagatgc aggataagca aatgggtagt 4620 gaaaagacat tcatgaggac agctaaaaca ataagtaatg taaaatacag catagcaaaa 4680 ctttaacctc caaatcaagc ctctacttga atccttttct gagggatgaa taaggcatat 4740 gcatcagggg ctgttgccaa tgtgcattag ctgtttgcag cctcaccttc tttcatggag 4800 tttaagatat agtgtatttt cccaaggttt gaactagctc ttcatttctt tatgttttaa 4860 atgcactgac ctcccacatt ccctttttag taaaatattc agaaataatt taaatacatc 4920 attgcaatga aaataaatgt tttttattag gcagaatcca gatgctcaag gcccttcata 4980 atatccccca gtttagtagt tggacttagg gaacaaagga acctttaata gaaattggac 5040 agcaagaaag cgagctcagt ggtacttgtg ggccagggcg ttggccaccc cggccaccac 5100 cttctggtac gcggcctgca ctgggggcgt gaattccttc ccgaagtggt gggccagcac 5160 gcacaccagc acgttgccca ggagctgtgg gaggaagata agaggtatga acatgattag 5220 caaaagggcc tagcttggac tcagaataat ccagccttat cccaaccata aaataaaagc 5280 agaatggtag ctggattgta gctgctatta gcaatatgaa acctcttaca tcagttacaa 5340 tttatatgca gaaatattta tatgcagaga tattgctatt gccttaaccc agaaattatc 5400 actgttattc tttagaatgg tgcaaagagg catgatacat tgtatcatta ttgccctgaa 5460 agaaagagat tagggaaagt attagaaata agataaacaa aaaagtatat taaaagaaga 5520 aagcattttt taaaattaca aatgcaaaat taccctgatt tggtcaatat gtgtaccctg 5580 ttacttatcc ccttcctatg acatgaactt aaccatagaa aagaagggga aagaaaacat 5640 caagcgtccc atagactcac cctgaagttc tcggggtcga cgtgcagctt gtcgcagtgc 5700 agctccgaca gctgggcgaa ggtgcccttg aggttgtcca ggtgagccag gccgtcggag 5760 aaggcgccga gcaccttctt gccgtgggcc ttgaccttag ggttgcccat caccgcgtcg 5820 ggggtggaca gatccccgaa gctctcaaaa aagcgctgcg tccaggggta gaccaccagc 5880 agcctaaggg tgggaaaata gaccaatagg cagagagagt cagtgcctat cagaaaccca 5940 agagtcttct ctgtctccac atgcccagtt tctattggtc tccttaaacc tgtcttgtaa 6000 ccttgatacc aacctgccca gggcctcccc gccgacctcg tcgacgttca ccttgcccca 6060 gagggccgtc acggcgcttt tctcctccgg ggttaggtgc accatggtgt ctgtttgagg 6120 ttgctagtga acacagttgt gtcagaagca aatgtaagca atagatggct ctgccctgac 6180 ttttatgccc agccctggct cctgccctcc ctgctcctgg gagtagattg gccaacccta 6240 gggtgtggct ccacagggtg aggtctaagt gatgacagcc gtacctgtcc ttggctcttc 6300 tggcactggc ttaggagttg gacttcaaac cctcagccct ccctctaaga tatatctctt 6360 ggccccatac catcagtaca aattgctact aaaaacatcc tcctttgcaa gtgtatttac 6420 gtatctagaa tatgtcacat tctgtctcag gcatccattt tctttatgat gccgtttgag 6480 gtggagtttt agtcaggtgg tcagcttctc cttttttttg ccatctgccc tgtaagcatc 6540 ctgctgggga cccagatagg agtcatcact ctaggctgag aacatctggg cacacaccct 6600 aagcctcagc atgactcatc atgactcagc attgctgtgc ttgagccaga aggtttgctt 6660 agaaggttac acagaaccag aaggcggggg tggggcactg accccgacag gggcctggcc 6720 agaactgctc atgcttggac tatgggaggt cactaatgga gacacacaga aatgtaacag 6780 gaactaagga aaaactgaag cttatttaat cagagatgag gatgctggaa gggatagagg 6840 gagctgagct tgtaaaaagt atagtaatca ttcagcaaat ggttttgaag cacctgctgg 6900 atgctaaaca ctattttcag tgcttgaatc ataaataaga ataaaacatg tatcttattc 6960 cccacaagag tccaagtaaa aaataacagt taattataat gtgctctgtc ccccaggctg 7020 gagtgcagtg gcacgatctc agctcactgc aacctccgcc tcccgggctg gttagaaggt 7080 tctactggag gagggtccca gcccattgct aaattaacat caggctctga gactggcagt 7140 atatctctaa cagtggttga tgctatcttc tggaacttgc ctgctacatt gagaccactg 7200 acccatacat aggaagccca tagctctgtc ctgaactgtt aggccactgg tccagagagt 7260 gtgcatctcc tttgatcctc ataataaccc tatgagatag acacaattat tactcttact 7320 ttatagatga tgatcctgaa aacataggag tcaaggcact tgcccctagc tgggggtata 7380 ggggagcagt cccatgtagt agtagaatga aaaatgctgc tatgctgtgc ctcccccacc 7440 tttcccatgt ctgccctcta ctcatggtct atctctcctg gctcctggga gtcatggact 7500 ccacccagca ccaccaacct gacctaacca cctatctgag cctgccagcc tataacccat 7560 ctgggccctg atagctggtg gccagccctg accccacccc accctccctg gaacctctga 7620 tagacacatc tggcacacca gctcgcaaag tcaccgtgag ggtcttgtgt ttgctgagtc 7680 aaaattcctt gaaatccaag tccttagaga ctcctgctcc caaatttaca gtcatagact 7740 tcttcatggc tgtctccttt atccacagaa tgattccttt gcttcattgc cccatccatc 7800 tgatcctcct catcagtgca gcacagggcc catgagcagt agctgcagag tctcacatag 7860 gtctggcact gcctctgaca tgtccgacct taggcaaatg cttgactctt ctctagtgca 7920 tgcaaatctg acactcagtg ggcctgggtg aaggtgagaa ttttattgct gaatgagagc 7980 ctctggggac atcttgccag tcaatgagtc tcaggttcaa tttccttctc agtcttggag 8040 taacagaagc tcatgcattt aataaacgga aattttgtat tgaaatgaga gccattggaa 8100 atcatttact ccagactcct acttataaaa agagaaactg aggctcagag aagggtgggg 8160 actttctcag tatgacatgg aaatgatcag gcttggattc aaagctcctg actttctgtc 8220 tagtgtatgt gcagtgagcc ccttttcctc taactgaaag aaggaaaaaa aaatggaacc 8280 caaaatattc tacatagttt ccatgtcaca gccagggctg ggcagtctcc tgttatttct 8340 tttaaaataa atatatcatt taaatgcata aataagcaaa ccctgctcgg gaatgggagg 8400 gagagtctct ggagtccacc ccttctcggc cctggctctg cagatagtgc tatcaaagcc 8460 ctgacagagc cctgcccatt gctgggcctt ggagtgagtc agcctagtag agaggcaggg 8520 caagccatct catagctgct gagtgggaga gagaaaaggg ctcattgtct ataaactcag 8580 gtcatggcta ttcttattct cacactaaga aaaagaatga gatgtctaca tataccctgc 8640 gtcccctctt gtgtactggg gtccccaaga gctctctaaa agtgatggca aagtcattgc 8700 gctagatgcc atcccatcta ttataaacct gcatttgtct ccacacacca gtcatggaca 8760 ataaccctcc tcccaggtcc acgtgcttgt ctttgtataa tactcaagta atttcggaaa 8820 atgtattctt tcaatcttgt tctgttattc ctgtttcaat ggcttagtag aaaaagtaca 8880 tacttgtttt cccataaatt gacaatagac aatttcacat caatgtctat atgggtcgtt 8940 gtgtttgctg tgtttgcaaa aactcacaat aactttatat tgttactact ctaagaaagt 9000 tacaacatgg tgaatacaag agaaagctat tacaagtcca gaaaataaaa gttatcatct 9060 tgagggtcga caatcaacct ctggattaca aaatttgtga aagattgact ggtattctta 9120 actatgttgc tccttttacg ctatgtggat acgctgcttt aatgcctttg tatcatgcta 9180 ttgcttcccg tatggctttc attttctcct ccttgtataa atcctggttg ctgtctcttt 9240 atgaggagtt gtggcccgtt gtcaggcaac gtggcgtggt gtgcactgtg tttgctgacg 9300 caacccccac tggttggggc attgccacca cctgtcagct cctttccggg actttcgctt 9360 tccccctccc tattgccacg gcggaactca tcgccgcctg ccttgcccgc tgctggacag 9420 gggctcggct gttgggcact gacaattccg tggtgttgtc ggggaagctg acgtcctttc 9480 catggctgct cgcctgtgtt gccacctgga ttctgcgcgg gacgtccttc tgctacgtcc 9540 cttcggccct caatccagcg gaccttcctt cccgcggcct gctgccggct ctgcggcctc 9600 ttccgcgtct tcgccttcgc cctcagacga gtcggatctc cctttgggcc gcctccccgc 9660 ctggaattcg agctcggtac ctttaagacc aatgacttac aaggcagctg tagatcttag 9720 ccacttttta aaagaaaagg ggggactgga agggctaatt cactcccaac gaagacaaga 9780 tctgcttttt gcttgtactg ggtctctctg gttagaccag atctgagcct gggagctctc 9840 tggctaacta gggaacccac tgcttaagcc tcaataaagc ttgccttgag tgcttcaagt 9900 agtgtgtgcc cgtctgttgt gtgactctgg taactagaga tccctcagac ccttttagtc 9960 agtgtggaaa atctctagca gtagtagttc atgtcatctt attattcagt atttataact 10020 tgcaaagaaa tgaatatcag agagtgagag gaacttgttt attgcagctt ataatggtta 10080 caaataaagc aatagcatca caaatttcac aaataaagca tttttttcac tgcattctag 10140 ttgtggtttg tccaaactca tcaatgtatc ttatcatgtc tggctctagc tatcccgccc 10200 ctaactccgc ccatcccgcc cctaactccg cccagttccg cccattctcc gccccatggc 10260 tgactaattt tttttattta tgcagaggcc gaggccgcct cggcctctga gctattccag 10320 aagtagtgag gaggcttttt tggaggccgc tagcgtcgac cattacttat tgttttagct 10380 gtcctcatga atgtcttttc actacccatt tgcttatcct gcatctctca gccttgactc 10440 cactcagttc tcttgcttag agataccacc tttcccctga agtgttcctt ccatgtttta 10500 cggcgagatg gtttctcctc gcctggccac tcagccttag ttgtctctgt tgtcttatag 10560 aggtctactt gaagaaggaa aaacaggggg catggtttga ctgtcctgtg agcccttctt 10620 ccctgcctcc cccactcaca gtgacccgga atccctcgac atggcagtct agcactagtg 10680 cggccgcaga tctgcttcct cgctcactga ctcgctgcgc tcggtcgttc ggctgcggcg 10740 agcggtatca gctcactcaa aggcggtaat acggttatcc acagaatcag gggataacgc 10800 aggaaagaac atgtgagcaa aaggccagca aaaggccagg aaccgtaaaa a 10851
SEQ ID NO : 18 ggccgcgttg ctggcgtttt tccataggct ccgcccccct gacgagcatc acaaaaatcg 60 acgctcaagt cagaggtggc gaaacccgac aggactataa agataccagg cgtttccccc 120 tggaagctcc ctcgtgcgct ctcctgttcc gaccctgccg cttaccggat acctgtccgc 180 ctttctccct tcgggaagcg tggcgctttc tcatagctca cgctgtaggt atctcagttc 240 ggtgtaggtc gttcgctcca agctgggctg tgtgcacgaa ccccccgttc agcccgaccg 300 ctgcgcctta tccggtaact atcgtcttga gtccaacccg gtaagacacg acttatcgcc 360 actggcagca gccactggta acaggattag cagagcgagg tatgtaggcg gtgctacaga 420 gttcttgaag tggtggccta actacggcta cactagaaga acagtatttg gtatctgcgc 480 tctgctgaag ccagttacct tcggaaaaag agttggtagc tcttgatccg gcaaacaaac 540 caccgctggt agcggtggtt tttttgtttg caagcagcag attacgcgca gaaaaaaagg 600 atctcaagaa gatcctttga tcttttctac ggggtctgac gctcagtgga acgaaaactc 660 acgttaaggg attttggtca tgaagcgctt ttgaagctcg gatccgaaca aacgacccaa 720 cacccgtgcg ttttattctg tctttttatt gccgatcccc tcagaagaac tcgtcaagaa 780 ggcgatagaa ggcgatgcgc tgcgaatcgg gagcggcgat accgtaaagc acgaggaagc 840 ggtcagccca ttcgccgcca agctcttcag caatatcacg ggtagccaac gctatgtcct 900 gatagcggtc cgccacaccc agccggccac agtcgatgaa tccagaaaag cggccatttt 960 ccaccatgat attcggcaag caggcatcgc catgggtcac gacgagatcc tcgccgtcgg 1020 gcatgctcgc cttgagcctg gcgaacagtt cggctggcgc gagcccctga tgctcttcgt 1080 ccagatcatc ctgatcgaca agaccggctt ccatccgagt acgtgctcgc tcgatgcgat 1140 gtttcgcttg gtggtcgaat gggcaggtag ccggatcaag cgtatgcagc cgccgcattg 1200 catcagccat gatggatact ttctcggcag gagcaaggtg agatgacagg agatcctgcc 1260 ccggcacttc gcccaatagc agccagtccc ttcccgcttc agtgacaacg tcgagcacag 1320 ctgcgcaagg aacgcccgtc gtggccagcc acgatagccg cgctgcctcg tcttgcagtt 1380 cattcagggc accggacagg tcggtcttga caaaaagaac cgggcgcccc tgcgctgaca 1440 gccggaacac ggcggcatca gagcagccga ttgtctgttg tgcccagtca tagccgaata 1500 gcctctccac ccaagcggcc ggagaacctg cgtgcaatcc atcttgttca atcatgcgaa 1560 acgatcctca tcctgtctct tgatcagagc ttgatcccct gcgccatcag atccttggcg 1620 gcaagaaagc catccagttt actttgcagg gcttcccaac cttaccagag gcctgcgccg 1680 cggccagctg gctagcaatt cccgggttaa ctctagagac attgattatt gactagttat 1740 taatagtaat caattacggg gtcattagtt catagcccat atatggagtt ccgcgttaca 1800 taacttacgg taaatggccc gcctggctga ccgcccaacg acccccgccc attgacgtca 1860 ataatgacgt atgttcccat agtaacgcca atagggactt tccattgacg tcaatgggtg 1920 gagtatttac ggtaaactgc ccacttggca gtacatcaag tgtatcatat gccaagtacg 1980 ccccctattg acgtcaatga cggtaaatgg cccgcctggc attatgccca gtacatgacc 2040 ttatgggact ttcctacttg gcagtacatc tacgtattag tcatcgctat taccatggtg 2100 atgcggtttt ggcagtacat caatgggcgt ggatagcggt ttgactcacg gggatttcca 2160 agtctccacc ccattgacgt caatgggagt ttgttttggc accaaaatca acgggacttt 2220 ccaaaatgtc gtaacaactc cgccccattg acgcaaatgg gcggtaggcg tgtacggtgg 2280 gaggtctata taagcagagc tcgtttagtg aaccggggtc tctctggtta gaccagatct 2340 gagcctggga gctctctggc taactaggga acccactgct taagcctcaa taaagcttgc 2400 cttgagtgct tcaagtagtg tgtgcccgtc tgttgtgtga ctctggtaac tagagatccc 2460 tcagaccctt ttagtcagtg tggaaaatct ctagcagtgg cgcccgaaca gggacttgaa 2520 agcgaaaggg aaaccagagg agctctctcg acgcaggact cggcttgctg aagcgcgcac 2580 ggcaagaggc gaggggcggc gactggtgag tacgccaaaa attttgacta gcggaggcta 2640 gaaggagaga gatgggtgcg agagcgtcag tattaagcgg gggagaatta gatcgcgatg 2700 ggaaaaaatt cggttaaggc cagggggaaa gaaaaaatat aaattaaaac atatagtatg 2760 ggcaagcagg gagctagaac gattcgcagt taatcctggc ctgttagaaa catcagaagg 2820 ctgtagacaa atactgggac agctacaacc atcccttcag acaggatcag aagaacttag 2880 atcattatat aatacagtag caaccctcta ttgtgtgcat caaaggatag agataaaaga 2940 caccaaggaa gctttagaca agatagagga agagcaaaac aaaagtaaga ccaccgcaca 3000 gcaagcggcc gctgatcttc agacctggag gaggagatat gagggacaat tggagaagtg 3060 aattatataa atataaagta gtaaaaattg aaccattagg agtagcaccc accaaggcaa 3120 agagaagagt ggtgcagaga gaaaaaagag cagtgggaat aggagctttg ttccttgggt 3180 tcttgggagc agcaggaagc actatgggcg cagcgtcaat gacgctgacg gtacaggcca 3240 gacaattatt gtctggtata gtgcagcagc agaacaattt gctgagggct attgaggcgc 3300 aacagcatct gttgcaactc acagtctggg gcatcaagca gctccaggca agaatcctgg 3360 ctgtggaaag atacctaaag gatcaacagc tcctggggat ttggggttgc tctggaaaac 3420 tcatttgcac cactgctgtg ccttggaatg ctagttggag taataaatct ctggaacaga 3480 tttggaatca cacgacctgg atggagtggg acagagaaat taacaattac acaagcttaa 3540 tacactcctt aattgaagaa tcgcaaaacc agcaagaaaa gaatgaacaa gaattattgg 3600 aattagataa atgggcaagt ttgtggaatt ggtttaacat aacaaattgg ctgtggtata 3660 taaaattatt cataatgata gtaggaggct tggtaggttt aagaatagtt tttgctgtac 3720 tttctatagt gaatagagtt aggcagggat attcaccatt atcgtttcag acccacctcc 3780 caaccccgag gggacccgac aggcccgaag gaatagaaga agaaggtgga gagagagaca 3840 gagacagatc cattcgatta gtgaacggat ctcgacggta tcggttaact tttaaaagaa 3900 aaggggggat tggggggtac agtgcagggg aaagaatagt agacataata gcaacagaca 3960 tacaaactaa agaattacaa aaacaaatta caaaaattca aaattttatc gatcacgaga 4020 ctagcctcga gaagcttgat atccctaggt attgaataag aaaaatgaag ttaaggtggt 4080 tgatggtaac actatgctaa taactgcaga gccagaagca ccataaggga catgataagg 4140 gagccagcag acctctgatc tcttcctgaa tgctaatctt aaacatcctg aggaagaatg 4200 ggacttccat ttggggtggg cctatgacag ggtaataaga cagtagtgaa tatcaagcta 4260 caaaaagccg cctttcaaat tcttctcagt cctaactttt catactaagc ccagtccttc 4320 caaagcagac tgtgaaagag tgatagttcc gggagactag cactgcagat tccgggtcac 4380 tgtgagtggg ggaggcaggg aagaagggct cacaggacag tcaaaccatg acccctgttt 4440 ttccttcttc aagtagacct ctataagaca acagagacaa ctaaggctga gtggccaggc 4500 gaggagaaac catctcgccg taaaacatgg aaggaacact tcaggggaaa ggtggtatct 4560 ctaagcaaga gaactgagtg gagtcaaggc tgagagatgc aggataagca aatgggtagt 4620 gaaaagacat tcatgaggac agctaaaaca ataagtaatg taaaatacag catagcaaaa 4680 ctttaacctc caaatcaagc ctctacttga atccttttct gagggatgaa taaggcatat 4740 gcatcagggg ctgttgccaa tgtgcattag ctgtttgcag cctcaccttc tttcatggag 4800 tttaagatat agtgtatttt cccaaggttt gaactagctc ttcatttctt tatgttttaa 4860 atgcactgac ctcccacatt ccctttttag taaaatattc agaaataatt taaatacatc 4920 attgcaatga aaataaatgt tttttattag gcagaatcca gatgctcaag gcccttcata 4980 atatccccca gtttagtagt tggacttagg gaacaaagga acctttaata gaaattggac 5040 agcaagaaag cgagctcagt ggtacttgtg ggccagggcg ttggccaccc cggccaccac 5100 cttctggtac gcggcctgca ctgggggcgt gaattccttc ccgaagtggt gggccagcac 5160 gcacaccagc acgttgccca ggagctgtgg gaggaagata agaggtatga acatgattag 5220 caaaagggcc tagcttggac tcagaataat ccagccttat cccaaccata aaataaaagc 5280 agaatggtag ctggattgta gctgctatta gcaatatgaa acctcttaca tcagttacaa 5340 tttatatgca gaaatattta tatgcagaga tattgctatt gccttaaccc agaaattatc 5400 actgttattc tttagaatgg tgcaaagagg catgatacat tgtatcatta ttgccctgaa 5460 agaaagagat tagggaaagt attagaaata agataaacaa aaaagtatat taaaagaaga 5520 aagcattttt taaaattaca aatgcaaaat taccctgatt tggtcaatat gtgtacacat 5580 attaaaacat tacactttaa cccataaata tgtataatga ttatgtatca attaaaaata 5640 aaagaaaata aagtagggag attatgaata tgcaaataag cacacatata ttccaaatag 5700 taatgtacta ggcagactgt gtaaagtttt tttttaagtt acttaatgta tctcagagat 5760 atttcctttt gttatacaca atgttaaggc attaagtata atagtaaaaa ttgcggagaa 5820 gaaaaaaaaa gaaagcaaga attaaacaaa agaaaacaat tgttatgaac agcaaataaa 5880 agaaactaaa acgatcctga gacttccaca ctgatgcaat cattcgtctg tttcccattc 5940 taaactgtac cctgttactt atccccttcc tatgacatga acttaaccat agaaaagaag 6000 gggaaagaaa acatcaagcg tcccatagac tcaccctgaa gttctcgggg tcgacgtgca 6060 gcttgtcgca gtgcagctcc gacagctggg cgaaggtgcc cttgaggttg tccaggtgag 6120 ccaggccgtc ggagaaggcg ccgagcacct tcttgccgtg ggccttgacc ttagggttgc 6180 ccatcaccgc gtcgggggtg gacagatccc cgaagctctc aaaaaagcgc tgcgtccagg 6240 ggtagaccac cagcagccta agggtgggaa aatagaccaa taggcagaga gagteagtge 6300 ctatcagaaa cccaagagtc ttctctgtct ccacatgccc agtttctatt ggtctcctta 6360 aacctgtctt gtaaccttga taccaacctg cccagggcct ccccgccgac ctcgtcgacg 6420 ttcaccttgc cccagagggc cgtcacggcg cttttctcct ccggggttag gtgcaccatg 6480 gtgtctgttt gaggttgcta gtgaacacag ttgtgtcaga agcaaatgta agcaatagat 6540 ggctctgccc tgacttttat gcccagccct ggctcctgcc ctccctgctc ctgggagtag 6600 attggccaac cctagggtgt ggctccacag ggtgaggtct aagtgatgac agccgtacct 6660 gtccttggct cttctggcac tggcttagga gttggacttc aaaccctcag ccctccctct 6720 aagatatatc tcttggcccc ataccatcag tacaaattgc tactaaaaac atcctccttt 6780 gcaagtgtat ttacgtatct agaatatgtc acattctgtc tcaggcatcc attttcttta 6840 tgatgccgtt tgaggtggag ttttagtcag gtggtcagct tctccttttt tttgccatct 6900 gccctgtaag catcctgctg gggacccaga taggagteat cactctaggc tgagaacatc 6960 tgggcacaca ccctaagcct cagcatgact catcatgact cagcattgct gtgettgage 7020 cagaaggttt gcttagaagg ttacacagaa ccagaaggcg ggggtggggc actgaccccg 7080 acaggggcct ggccagaact gctcatgctt ggactatggg aggtcactaa tggagacaca 7140 cagaaatgta acaggaacta aggaaaaact gaagettatt taatcagaga tgaggatget 7200 ggaagggata gagggagctg agcttgtaaa aagtatagta atcattcagc aaatggtttt 7260 gaagcacctg ctggatgcta aacactattt teagtgettg aatcataaat aagaataaaa 7320 catgtatctt attccccaca agagtccaag taaaaaataa cagttaatta taatgtgctc 7380 tgtcccccag gctggagtgc agtggcacga tctcagctca ctgcaacctc cgcctcccgg 7440 gctggttaga aggttctact ggaggagggt cccagcccat tgetaaatta acatcaggct 7500 ctgagactgg cagtatatct ctaacagtgg ttgatgetat cttctggaac ttgeetgeta 7560 cattgagacc actgacccat acataggaag cccatagctc tgtcctgaac tgttaggcca 7620 ctggtccaga gagtgtgcat ctcctttgat cctcataata accctatgag atagacacaa 7680 ttattactct tactttatag atgatgatcc tgaaaacata ggagteaagg cacttgcccc 7740 tagctggggg tataggggag cagtcccatg tagtagtaga atgaaaaatg etgetatget 7800 gtgcctcccc cacctttccc atgtctgccc tctactcatg gtetatetet cctggctcct 7860 gggagtcatg gactccaccc agcaccacca acctgaccta accacctatc tgagcctgcc 7920 agcctataac ccatctgggc cctgatagct ggtggccagc cctgacccca ccccaccctc 7980 cctggaacct ctgatagaca catctggcac accagctcgc aaagteaeeg tgagggtctt 8040 gtgtttgctg agtcaaaatt ccttgaaatc caagtcctta gagactcctg ctcccaaatt 8100 tacagtcata gacttcttca tggctgtctc ctttatccac agaatgattc etttgettea 8160 ttgccccatc catctgatcc tcctcatcag tgcagcacag ggcccatgag cagtagctgc 8220 agagtctcac ataggtctgg cactgcctct gacatgtccg accttaggca aatgcttgac 8280 tcttctctag tgcatgcaaa tctgacactc agtgggcctg ggtgaaggtg agaattttat 8340 tgctgaatga gagcctctgg ggacatcttg ccagtcaatg agtctcaggt tcaatttcct 8400 tctcagtctt ggagtaacag aagctcatgc atttaataaa cggaaatttt gtattgaaat 8460 gagagccatt ggaaatcatt tactccagac tcctacttat aaaaagagaa actgaggctc 8520 agagaagggt ggggactttc tcagtatgac atggaaatga teaggettgg attcaaagct 8580 cctgactttc tgtctagtgt atgtgcagtg agcccctttt cctctaactg aaagaaggaa 8640 aaaaaaatgg aacccaaaat attctacata gtttccatgt cacagccagg gctgggcagt 8700 ctcctgttat ttcttttaaa ataaatatat catttaaatg cataaataag caaaccctgc 8760 tcgggaatgg gagggagagt ctctggagtc caccccttct cggccctggc tctgcagata 8820 gtgctatcaa agccctgaca gagccctgcc cattgctggg ccttggagtg agtcagccta 8880 gtagagaggc agggcaagcc atctcatagc tgctgagtgg gagagagaaa agggctcatt 8940 gtctataaac tcaggtcatg gctattctta ttctcacact aagaaaaaga atgagatgtc 9000 tacatatacc ctgcgtcccc tcttgtgtac tggggtcccc aagagctctc taaaagtgat 9060 ggcaaagtca ttgcgctaga tgccatccca tctattataa acctgcattt gtctccacac 9120 accagtcatg gacaataacc ctcctcccag gtccacgtgc ttgtctttgt ataatactca 9180 agtaatttcg gaaaatgtat tctttcaatc ttgttctgtt attcctgttt caatggctta 9240 gtagaaaaag tacatacttg ttttcccata aattgacaat agacaatttc acatcaatgt 9300 ctatatgggt cgttgtgttt gctgtgtttg caaaaactca caataacttt atattgttac 9360 tactctaaga aagttacaac atggtgaata caagagaaag ctattacaag tccagaaaat 9420 aaaagttatc atcttgaggg tcgacaatca acctctggat tacaaaattt gtgaaagatt 9480 gactggtatt cttaactatg ttgctccttt tacgctatgt ggatacgctg ctttaatgcc 9540 tttgtatcat gctattgctt cccgtatggc tttcattttc tcctccttgt ataaatcctg 9600 gttgctgtct ctttatgagg agttgtggcc cgttgtcagg caacgtggcg tggtgtgcac 9660 tgtgtttgct gacgcaaccc ccactggttg gggcattgcc accacctgtc agctcctttc 9720 cgggactttc gctttccccc tccctattgc cacggcggaa ctcatcgccg cctgccttgc 9780 ccgctgctgg acaggggctc ggctgttggg cactgacaat tccgtggtgt tgtcggggaa 9840 gctgacgtcc tttccatggc tgctcgcctg tgttgccacc tggattctgc gcgggacgtc 9900 cttctgctac gtcccttcgg ccctcaatcc agcggacctt ccttcccgcg gcctgctgcc 9960 ggctctgcgg cctcttccgc gtcttcgcct tcgccctcag acgagtcgga tctccctttg 10020 ggccgcctcc ccgcctggaa ttcgagctcg gtacctttaa gaccaatgac ttacaaggca 10080 gctgtagatc ttagccactt tttaaaagaa aaggggggac tggaagggct aattcactcc 10140 caacgaagac aagatctgct ttttgcttgt actgggtctc tctggttaga ccagatctga 10200 gcctgggagc tctctggcta actagggaac ccactgctta agcctcaata aagcttgcct 10260 tgagtgcttc aagtagtgtg tgcccgtctg ttgtgtgact ctggtaacta gagatccctc 10320 agaccctttt agtcagtgtg gaaaatctct agcagtagta gttcatgtca tcttattatt 10380 cagtatttat aacttgcaaa gaaatgaata tcagagagtg agaggaactt gtttattgca 10440 gcttataatg gttacaaata aagcaatagc atcacaaatt tcacaaataa agcatttttt 10500 tcactgcatt ctagttgtgg tttgtccaaa ctcatcaatg tatcttatca tgtctggctc 10560 tagctatccc gcccctaact ccgcccatcc cgcccctaac tccgcccagt tccgcccatt 10620 ctccgcccca tggctgacta atttttttta tttatgcaga ggccgaggcc gcctcggcct 10680 ctgagctatt ccagaagtag tgaggaggct tttttggagg ccgctagcgt cgaccattac 10740 ttattgtttt agctgtcctc atgaatgtct tttcactacc catttgctta tcctgcatct 10800 ctcagccttg actccactca gttctcttgc ttagagatac cacctttccc ctgaagtgtt 10860 ccttccatgt tttacggcga gatggtttct cctcgcctgg ccactcagcc ttagttgtct 10920 ctgttgtctt atagaggtct acttgaagaa ggaaaaacag ggggcatggt ttgactgtcc 10980 tgtgagccct tcttccctgc ctcccccact cacagtgacc cggaatccct cgacatggca 11040 gtctagcact agtgcggccg cagatctgct tcctcgctca ctgactcgct gcgctcggtc 11100 gttcggctgc ggcgagcggt atcagctcac tcaaaggcgg taatacggtt atccacagaa 11160 tcaggggata acgcaggaaa gaacatgtga gcaaaaggcc agcaaaaggc caggaaccgt 11220 aaaaa 11225
SEQ ID NO : 19 ggccgcgttg ctggcgtttt tccataggct ccgcccccct gacgagcatc acaaaaatcg 60 acgctcaagt cagaggtggc gaaacccgac aggactataa agataccagg cgtttccccc 120 tggaagctcc ctcgtgcgct ctcctgttcc gaccctgccg cttaccggat acctgtccgc 180 ctttctccct tcgggaagcg tggcgctttc tcatagctca cgctgtaggt atctcagttc 240 ggtgtaggtc gttcgctcca agctgggctg tgtgcacgaa ccccccgttc agcccgaccg 300 ctgcgcctta tccggtaact atcgtcttga gtccaacccg gtaagacacg acttatcgcc 360 actggcagca gccactggta acaggattag cagagcgagg tatgtaggcg gtgctacaga 420 gttcttgaag tggtggccta actacggcta cactagaaga acagtatttg gtatctgcgc 480 tctgctgaag ccagttacct tcggaaaaag agttggtagc tcttgatccg gcaaacaaac 540 caccgctggt agcggtggtt tttttgtttg caagcagcag attacgcgca gaaaaaaagg 600 atctcaagaa gatcctttga tcttttctac ggggtctgac gctcagtgga acgaaaactc 660 acgttaaggg attttggtca tgaagcgctt ttgaagctcg gatccgaaca aacgacccaa 720 cacccgtgcg ttttattctg tctttttatt gccgatcccc tcagaagaac tcgtcaagaa 780 ggcgatagaa ggcgatgcgc tgcgaatcgg gagcggcgat accgtaaagc acgaggaagc 840 ggtcagccca ttcgccgcca agctcttcag caatatcacg ggtagccaac gctatgtcct 900 gatagcggtc cgccacaccc agccggccac agtcgatgaa tccagaaaag cggccatttt 960 ccaccatgat attcggcaag caggcatcgc catgggtcac gacgagatcc tcgccgtcgg 1020 gcatgctcgc cttgagcctg gcgaacagtt cggctggcgc gagcccctga tgctcttcgt 1080 ccagatcatc ctgatcgaca agaccggctt ccatccgagt acgtgctcgc tcgatgcgat 1140 gtttcgcttg gtggtcgaat gggcaggtag ccggatcaag cgtatgcagc cgccgcattg 1200 catcagccat gatggatact ttctcggcag gagcaaggtg agatgacagg agatcctgcc 1260 ccggcacttc gcccaatagc agccagtccc ttcccgcttc agtgacaacg tcgagcacag 1320 ctgcgcaagg aacgcccgtc gtggccagcc acgatagccg cgctgcctcg tcttgcagtt 1380 cattcagggc accggacagg tcggtcttga caaaaagaac cgggcgcccc tgcgctgaca 1440 gccggaacac ggcggcatca gagcagccga ttgtctgttg tgcccagtca tagccgaata 1500 gcctctccac ccaagcggcc ggagaacctg cgtgcaatcc atcttgttca atcatgcgaa 1560 acgatcctca tcctgtctct tgatcagagc ttgatcccct gcgccatcag atccttggcg 1620 gcaagaaagc catccagttt actttgcagg gcttcccaac cttaccagag gcctgcgccg 1680 cggccagctg gctagcaatt cccgggttaa ctctagagac attgattatt gactagttat 1740 taatagtaat caattacggg gtcattagtt catagcccat atatggagtt ccgcgttaca 1800 taacttacgg taaatggccc gcctggctga ccgcccaacg acccccgccc attgacgtca 1860 ataatgacgt atgttcccat agtaacgcca atagggactt tccattgacg tcaatgggtg 1920 gagtatttac ggtaaactgc ccacttggca gtacatcaag tgtatcatat gccaagtacg 1980 ccccctattg acgtcaatga cggtaaatgg cccgcctggc attatgccca gtacatgacc 2040 ttatgggact ttcctacttg gcagtacatc tacgtattag tcatcgctat taccatggtg 2100 atgcggtttt ggcagtacat caatgggcgt ggatagcggt ttgactcacg gggatttcca 2160 agtctccacc ccattgacgt caatgggagt ttgttttggc accaaaatca acgggacttt 2220 ccaaaatgtc gtaacaactc cgccccattg acgcaaatgg gcggtaggcg tgtacggtgg 2280 gaggtctata taagcagagc tcgtttagtg aaccggggtc tctctggtta gaccagatct 2340 gagcctggga gctctctggc taactaggga acccactgct taagcctcaa taaagcttgc 2400 cttgagtgct tcaagtagtg tgtgcccgtc tgttgtgtga ctctggtaac tagagatccc 2460 tcagaccctt ttagtcagtg tggaaaatct ctagcagtgg cgcccgaaca gggacttgaa 2520 agcgaaaggg aaaccagagg agctctctcg acgcaggact cggcttgctg aagcgcgcac 2580 ggcaagaggc gaggggcggc gactggtgag tacgccaaaa attttgacta gcggaggcta 2640 gaaggagaga gatgggtgcg agagcgtcag tattaagcgg gggagaatta gatcgcgatg 2700 ggaaaaaatt cggttaaggc cagggggaaa gaaaaaatat aaattaaaac atatagtatg 2760 ggcaagcagg gagctagaac gattcgcagt taatcctggc ctgttagaaa catcagaagg 2820 ctgtagacaa atactgggac agctacaacc atcccttcag acaggatcag aagaacttag 2880 atcattatat aatacagtag caaccctcta ttgtgtgcat caaaggatag agataaaaga 2940 caccaaggaa gctttagaca agatagagga agagcaaaac aaaagtaaga ccaccgcaca 3000 gcaagcggcc gctgatcttc agacctggag gaggagatat gagggacaat tggagaagtg 3060 aattatataa atataaagta gtaaaaattg aaccattagg agtagcaccc accaaggcaa 3120 agagaagagt ggtgcagaga gaaaaaagag cagtgggaat aggagctttg ttccttgggt 3180 tcttgggagc agcaggaagc actatgggcg cagcgtcaat gacgctgacg gtacaggcca 3240 gacaattatt gtctggtata gtgcagcagc agaacaattt gctgagggct attgaggcgc 3300 aacagcatct gttgcaactc acagtctggg gcatcaagca gctccaggca agaatcctgg 3360 ctgtggaaag atacctaaag gatcaacagc tcctggggat ttggggttgc tctggaaaac 3420 tcatttgcac cactgctgtg ccttggaatg ctagttggag taataaatct ctggaacaga 3480 tttggaatca cacgacctgg atggagtggg acagagaaat taacaattac acaagcttaa 3540 tacactcctt aattgaagaa tcgcaaaacc agcaagaaaa gaatgaacaa gaattattgg 3600 aattagataa atgggcaagt ttgtggaatt ggtttaacat aacaaattgg ctgtggtata 3660 taaaattatt cataatgata gtaggaggct tggtaggttt aagaatagtt tttgctgtac 3720 tttctatagt gaatagagtt aggcagggat attcaccatt atcgtttcag acccacctcc 3780 caaccccgag gggacccgac aggcccgaag gaatagaaga agaaggtgga gagagagaca 3840 gagacagatc cattcgatta gtgaacggat ctcgacggta tcggttaact tttaaaagaa 3900 aaggggggat tggggggtac agtgcagggg aaagaatagt agacataata gcaacagaca 3960 tacaaactaa agaattacaa aaacaaatta caaaaattca aaattttatc gatcacgaga 4020 ctagcctcga gaagcttgat atccctaggt attgaataag aaaaatgaag ttaaggtggt 4080 tgatggtaac actatgctaa taactgcaga gccagaagca ccataaggga catgataagg 4140 gagccagcag acctctgatc tcttcctgaa tgctaatctt aaacatcctg aggaagaatg 4200 ggacttccat ttggggtggg cctatgacag ggtaataaga cagtagtgaa tatcaagcta 4260 caaaaagccg cctttcaaat tcttctcagt cctaactttt catactaagc ccagtccttc 4320 caaagcagac tgtgaaagag tgatagttcc gggagactag cactgcagat tccgggtcac 4380 tgtgagtggg ggaggcaggg aagaagggct cacaggacag tcaaaccatg acccctgttt 4440 ttccttcttc aagtagacct ctataagaca acagagacaa ctaaggctga gtggccaggc 4500 gaggagaaac catctcgccg taaaacatgg aaggaacact tcaggggaaa ggtggtatct 4560 ctaagcaaga gaactgagtg gagtcaaggc tgagagatgc aggataagca aatgggtagt 4620 gaaaagacat tcatgaggac agctaaaaca ataagtaatg taaaatacag catagcaaaa 4680 ctttaacctc caaatcaagc ctctacttga atccttttct gagggatgaa taaggcatat 4740 gcatcagggg ctgttgccaa tgtgcattag ctgtttgcag cctcaccttc tttcatggag 4800 tttaagatat agtgtatttt cccaaggttt gaactagctc ttcatttctt tatgttttaa 4860 atgcactgac ctcccacatt ccctttttag taaaatattc agaaataatt taaatacatc 4920 attgcaatga aaataaatgt tttttattag gcagaatcca gatgctcaag gcccttcata 4980 atatccccca gtttagtagt tggacttagg gaacaaagga acctttaata gaaattggac 5040 agcaagaaag cgagctcagt ggtacttgtg ggccagggcg ttggccaccc cggccaccac 5100 cttctggtac gcggcctgca ctgggggcgt gaattccttc ccgaagtggt gggccagcac 5160 gcacaccagc acgttgccca ggagctgtgg gaggaagata agaggtatga acatgattag 5220 caaaagggcc tagcttggac tcagaataat ccagccttat cccaaccata aaataaaagc 5280 agaatggtag ctggattgta gctgctatta gcaatatgaa acctcttaca tcagttacaa 5340 tttatatgca gaaatattta tatgcagaga tattgctatt gccttaaccc agaaattatc 5400 actgttattc tttagaatgg tgcaaagagg catgatacat tgtatcatta ttgccctgaa 5460 agaaagagat tagggaaagt attagaaata agataaacaa aaaagtatat taaaagaaga 5520 aagcattttt taaaattaca aatgcaaaat taccctgatt tggteaatat gtgtacacat 5580 attaaaacat tacactttaa cccataaata tgtataatga ttatgtatca attaaaaata 5640 aaagaaaata aagtagggag attatgaata tgcaaataag cacacatata ttccaaatag 5700 taatgtacta ggcagactgt gtaaagtttt tttttaagtt acttaatgta tctcagagat 5760 atttcctttt gttatacaca atgttaaggc attaagtata atagtaaaaa ttgcggagaa 5820 gaaaaaaaaa gaaagcaaga attaaacaaa agaaaacaat tgttatgaac agcaaataaa 5880 agaaactaaa acgatcctga gacttccaca ctgatgcaat cattcgtctg tttcccattc 5940 taaactgtac cctgttactt atccccttcc tatgacatga acttaaccat agaaaagaag 6000 gggaaagaaa acatcaagcg tcccatagac tcaccctgaa gttctcgggg tegaegtgea 6060 gcttgtcgca gtgcagctcc gacagtgtgg cgaaggtgcc cttgaggttg tccaggtgag 6120 ccaggccgtc ggagaaggcg ccgagcacct tcttgccgtg ggccttgacc ttagggttgc 6180 ccatcaccgc gtcgggggtg gacagatccc cgaagctctc aaaaaagege tgcgtccagg 6240 ggtagaccac cagcagccta agggtgggaa aatagaccaa taggcagaga gagteagtge 6300 ctatcagaaa cccaagagtc ttctctgtct ccacatgccc agtttctatt ggtctcctta 6360 aacctgtctt gtaaccttga taccaacctg cccagggcct ccccgccgac ctcgtcgacg 6420 ttcaccttgc cccagagggc cgtcacggcg cttttctcct ccggggttag gtgcaccatg 6480 gtgtctgttt gaggttgcta gtgaacacag ttgtgtcaga agcaaatgta agcaatagat 6540 ggctctgccc tgacttttat gcccagccct ggctcctgcc ctccctgctc ctgggagtag 6600 attggccaac cctagggtgt ggctccacag ggtgaggtct aagtgatgac agccgtacct 6660 gtccttggct cttctggcac tggcttagga gttggacttc aaaccctcag ccctccctct 6720 aagatatatc tcttggcccc ataccatcag tacaaattgc tactaaaaac atcctccttt 6780 gcaagtgtat ttacgtatct agaatatgtc acattctgtc tcaggcatcc attttcttta 6840 tgatgccgtt tgaggtggag ttttagtcag gtggtcagct tctccttttt tttgccatct 6900 gccctgtaag catcctgctg gggacccaga taggagteat cactctaggc tgagaacatc 6960 tgggcacaca ccctaagcct cagcatgact catcatgact cagcattgct gtgettgage 7020 cagaaggttt gcttagaagg ttacacagaa ccagaaggcg ggggtggggc actgaccccg 7080 acaggggcct ggccagaact gctcatgctt ggactatggg aggtcactaa tggagacaca 7140 cagaaatgta acaggaacta aggaaaaact gaagcttatt taatcagaga tgaggatgct 7200 ggaagggata gagggagctg agcttgtaaa aagtatagta atcattcagc aaatggtttt 7260 gaagcacctg ctggatgcta aacactattt tcagtgcttg aatcataaat aagaataaaa 7320 catgtatctt attccccaca agagtccaag taaaaaataa cagttaatta taatgtgctc 7380 tgtcccccag gctggagtgc agtggcacga tctcagctca ctgcaacctc cgcctcccgg 7440 gctggttaga aggttctact ggaggagggt cccagcccat tgctaaatta acatcaggct 7500 ctgagactgg cagtatatct ctaacagtgg ttgatgctat cttctggaac ttgcctgcta 7560 cattgagacc actgacccat acataggaag cccatagctc tgtcctgaac tgttaggcca 7620 ctggtccaga gagtgtgcat ctcctttgat cctcataata accctatgag atagacacaa 7680 ttattactct tactttatag atgatgatcc tgaaaacata ggagtcaagg cacttgcccc 7740 tagctggggg tataggggag cagtcccatg tagtagtaga atgaaaaatg ctgctatgct 7800 gtgcctcccc cacctttccc atgtctgccc tctactcatg gtctatctct cctggctcct 7860 gggagtcatg gactccaccc agcaccacca acctgaccta accacctatc tgagcctgcc 7920 agcctataac ccatctgggc cctgatagct ggtggccagc cctgacccca ccccaccctc 7980 cctggaacct ctgatagaca catctggcac accagctcgc aaagtcaccg tgagggtctt 8040 gtgtttgctg agtcaaaatt ccttgaaatc caagtcctta gagactcctg ctcccaaatt 8100 tacagtcata gacttcttca tggctgtctc ctttatccac agaatgattc ctttgcttca 8160 ttgccccatc catctgatcc tcctcatcag tgcagcacag ggcccatgag cagtagctgc 8220 agagtctcac ataggtctgg cactgcctct gacatgtccg accttaggca aatgcttgac 8280 tcttctctag tgcatgcaaa tctgacactc agtgggcctg ggtgaaggtg agaattttat 8340 tgctgaatga gagcctctgg ggacatcttg ccagtcaatg agtctcaggt tcaatttcct 8400 tctcagtctt ggagtaacag aagctcatgc atttaataaa cggaaatttt gtattgaaat 8460 gagagccatt ggaaatcatt tactccagac tcctacttat aaaaagagaa actgaggctc 8520 agagaagggt ggggactttc tcagtatgac atggaaatga tcaggcttgg attcaaagct 8580 cctgactttc tgtctagtgt atgtgcagtg agcccctttt cctctaactg aaagaaggaa 8640 aaaaaaatgg aacccaaaat attctacata gtttccatgt cacagccagg gctgggcagt 8700 ctcctgttat ttcttttaaa ataaatatat catttaaatg cataaataag caaaccctgc 8760 tcgggaatgg gagggagagt ctctggagtc caccccttct cggccctggc tctgcagata 8820 gtgctatcaa agccctgaca gagccctgcc cattgctggg ccttggagtg agtcagccta 8880 gtagagaggc agggcaagcc atctcatagc tgctgagtgg gagagagaaa agggctcatt 8940 gtctataaac tcaggtcatg gctattctta ttctcacact aagaaaaaga atgagatgtc 9000 tacatatacc ctgcgtcccc tcttgtgtac tggggtcccc aagagctctc taaaagtgat 9060 ggcaaagtca ttgcgctaga tgccatccca tctattataa acctgcattt gtctccacac 9120 accagtcatg gacaataacc ctcctcccag gtccacgtgc ttgtctttgt ataatactca 9180 agtaatttcg gaaaatgtat tctttcaatc ttgttctgtt attcctgttt caatggctta 9240 gtagaaaaag tacatacttg ttttcccata aattgacaat agacaatttc acatcaatgt 9300 ctatatgggt cgttgtgttt gctgtgtttg caaaaactca caataacttt atattgttac 9360 tactctaaga aagttacaac atggtgaata caagagaaag ctattacaag tccagaaaat 9420 aaaagttatc atcttgaggg tcgacaatca acctctggat tacaaaattt gtgaaagatt 9480 gactggtatt cttaactatg ttgctccttt tacgctatgt ggatacgctg ctttaatgcc 9540 tttgtatcat gctattgctt cccgtatggc tttcattttc tcctccttgt ataaatcctg 9600 gttgctgtct ctttatgagg agttgtggcc cgttgtcagg caacgtggcg tggtgtgcac 9660 tgtgtttgct gacgcaaccc ccactggttg gggcattgcc accacctgtc agctcctttc 9720 cgggactttc gctttccccc tccctattgc cacggcggaa ctcatcgccg cctgccttgc 9780 ccgctgctgg acaggggctc ggctgttggg cactgacaat tccgtggtgt tgtcggggaa 9840 gctgacgtcc tttccatggc tgctcgcctg tgttgccacc tggattctgc gcgggacgtc 9900 cttctgctac gtcccttcgg ccctcaatcc agcggacctt ccttcccgcg gcctgctgcc 9960 ggctctgcgg cctcttccgc gtcttcgcct tcgccctcag acgagtcgga tctccctttg 10020 ggccgcctcc ccgcctggaa ttcgagctcg gtacctttaa gaccaatgac ttacaaggca 10080 gctgtagatc ttagccactt tttaaaagaa aaggggggac tggaagggct aattcactcc 10140 caacgaagac aagatctgct ttttgcttgt actgggtctc tctggttaga ccagatctga 10200 gcctgggagc tctctggcta actagggaac ccactgctta agcctcaata aagcttgcct 10260 tgagtgcttc aagtagtgtg tgcccgtctg ttgtgtgact ctggtaacta gagatccctc 10320 agaccctttt agtcagtgtg gaaaatctct agcagtagta gttcatgtca tcttattatt 10380 cagtatttat aacttgcaaa gaaatgaata tcagagagtg agaggaactt gtttattgca 10440 gcttataatg gttacaaata aagcaatagc atcacaaatt tcacaaataa agcatttttt 10500 tcactgcatt ctagttgtgg tttgtccaaa ctcatcaatg tatcttatca tgtctggctc 10560 tagctatccc gcccctaact ccgcccatcc cgcccctaac tccgcccagt tccgcccatt 10620 ctccgcccca tggctgacta atttttttta tttatgcaga ggccgaggcc gcctcggcct 10680 ctgagctatt ccagaagtag tgaggaggct tttttggagg ccgctagcgt cgaccattac 10740 ttattgtttt agctgtcctc atgaatgtct tttcactacc catttgctta tcctgcatct 10800 ctcagccttg actccactca gttctcttgc ttagagatac cacctttccc ctgaagtgtt 10860 ccttccatgt tttacggcga gatggtttct cctcgcctgg ccactcagcc ttagttgtct 10920 ctgttgtctt atagaggtct acttgaagaa ggaaaaacag ggggcatggt ttgactgtcc 10980 tgtgagccct tcttccctgc ctcccccact cacagtgacc cggaatccct cgacatggca 11040 gtctagcact agtgcggccg cagatctgct tcctcgctca ctgactcgct gcgctcggtc 11100 gttcggctgc ggcgagcggt atcagctcac tcaaaggcgg taatacggtt atccacagaa 11160 tcaggggata acgcaggaaa gaacatgtga gcaaaaggcc agcaaaaggc caggaaccgt 11220 aaaaa 11225
SEQ ID NO : 20 ggccgcgttg ctggcgtttt tccataggct ccgcccccct gacgagcatc acaaaaatcg 60 acgctcaagt cagaggtggc gaaacccgac aggactataa agataccagg cgtttccccc 120 tggaagctcc ctcgtgcgct ctcctgttcc gaccctgccg cttaccggat acctgtccgc 180 ctttctccct tcgggaagcg tggcgctttc tcatagctca cgctgtaggt atctcagttc 240 ggtgtaggtc gttcgctcca agctgggctg tgtgcacgaa ccccccgttc agcccgaccg 300 ctgcgcctta tccggtaact atcgtcttga gtccaacccg gtaagacacg acttatcgcc 360 actggcagca gccactggta acaggattag cagagcgagg tatgtaggcg gtgctacaga 420 gttcttgaag tggtggccta actacggcta cactagaaga acagtatttg gtatctgcgc 480 tctgctgaag ccagttacct tcggaaaaag agttggtagc tcttgatccg gcaaacaaac 540 caccgctggt agcggtggtt tttttgtttg caagcagcag attacgcgca gaaaaaaagg 600 atctcaagaa gatcctttga tcttttctac ggggtctgac gctcagtgga acgaaaactc 660 acgttaaggg attttggtca tgaagcgctt ttgaagctcg gatccgaaca aacgacccaa 720 cacccgtgcg ttttattctg tctttttatt gccgatcccc tcagaagaac tcgtcaagaa 780 ggcgatagaa ggcgatgcgc tgcgaatcgg gagcggcgat accgtaaagc acgaggaagc 840 ggtcagccca ttcgccgcca agctcttcag caatatcacg ggtagccaac gctatgtcct 900 gatagcggtc cgccacaccc agccggccac agtcgatgaa tccagaaaag cggccatttt 960 ccaccatgat attcggcaag caggcatcgc catgggtcac gacgagatcc tcgccgtcgg 1020 gcatgctcgc cttgagcctg gcgaacagtt cggctggcgc gagcccctga tgctcttcgt 1080 ccagatcatc ctgatcgaca agaccggctt ccatccgagt acgtgctcgc tcgatgcgat 1140 gtttcgcttg gtggtcgaat gggcaggtag ccggatcaag cgtatgcagc cgccgcattg 1200 catcagccat gatggatact ttctcggcag gagcaaggtg agatgacagg agatcctgcc 1260 ccggcacttc gcccaatagc agccagtccc ttcccgcttc agtgacaacg tcgagcacag 1320 ctgcgcaagg aacgcccgtc gtggccagcc acgatagccg cgctgcctcg tcttgcagtt 1380 cattcagggc accggacagg tcggtcttga caaaaagaac cgggcgcccc tgcgctgaca 1440 gccggaacac ggcggcatca gagcagccga ttgtctgttg tgcccagtca tagccgaata 1500 gcctctccac ccaagcggcc ggagaacctg cgtgcaatcc atcttgttca atcatgcgaa 1560 acgatcctca tcctgtctct tgatcagagc ttgatcccct gcgccatcag atccttggcg 1620 gcaagaaagc catccagttt actttgcagg gcttcccaac cttaccagag gcctgcgccg 1680 cggccagctg gctagcaatt cccgggttaa ctctagagac attgattatt gactagttat 1740 taatagtaat caattacggg gtcattagtt catagcccat atatggagtt ccgcgttaca 1800 taacttacgg taaatggccc gcctggctga ccgcccaacg acccccgccc attgacgtca 1860 ataatgacgt atgttcccat agtaacgcca atagggactt tccattgacg tcaatgggtg 1920 gagtatttac ggtaaactgc ccacttggca gtacatcaag tgtatcatat gccaagtacg 1980 ccccctattg acgtcaatga cggtaaatgg cccgcctggc attatgccca gtacatgacc 2040 ttatgggact ttcctacttg gcagtacatc tacgtattag tcatcgctat taccatggtg 2100 atgcggtttt ggcagtacat caatgggcgt ggatagcggt ttgactcacg gggatttcca 2160 agtctccacc ccattgacgt caatgggagt ttgttttggc accaaaatca acgggacttt 2220 ccaaaatgtc gtaacaactc cgccccattg acgcaaatgg gcggtaggcg tgtacggtgg 2280 gaggtctata taagcagagc tcgtttagtg aaccggggtc tctctggtta gaccagatct 2340 gagcctggga gctctctggc taactaggga acccactgct taagcctcaa taaagcttgc 2400 cttgagtgct tcaagtagtg tgtgcccgtc tgttgtgtga ctctggtaac tagagatccc 2460 tcagaccctt ttagtcagtg tggaaaatct ctagcagtgg cgcccgaaca gggacttgaa 2520 agcgaaaggg aaaccagagg agctctctcg acgcaggact cggcttgctg aagcgcgcac 2580 ggcaagaggc gaggggcggc gactggtgag tacgccaaaa attttgacta gcggaggcta 2640 gaaggagaga gatgggtgcg agagcgtcag tattaagcgg gggagaatta gatcgcgatg 2700 ggaaaaaatt cggttaaggc cagggggaaa gaaaaaatat aaattaaaac atatagtatg 2760 ggcaagcagg gagctagaac gattcgcagt taatcctggc ctgttagaaa catcagaagg 2820 ctgtagacaa atactgggac agctacaacc atcccttcag acaggatcag aagaacttag 2880 atcattatat aatacagtag caaccctcta ttgtgtgcat caaaggatag agataaaaga 2940 caccaaggaa gctttagaca agatagagga agagcaaaac aaaagtaaga ccaccgcaca 3000 gcaagcggcc gctgatcttc agacctggag gaggagatat gagggacaat tggagaagtg 3060 aattatataa atataaagta gtaaaaattg aaccattagg agtagcaccc accaaggcaa 3120 agagaagagt ggtgcagaga gaaaaaagag cagtgggaat aggagctttg ttccttgggt 3180 tcttgggagc agcaggaagc actatgggcg cagcgtcaat gacgctgacg gtacaggcca 3240 gacaattatt gtctggtata gtgcagcagc agaacaattt gctgagggct attgaggcgc 3300 aacagcatct gttgcaactc acagtctggg gcatcaagca gctccaggca agaatcctgg 3360 ctgtggaaag atacctaaag gatcaacagc tcctggggat ttggggttgc tctggaaaac 3420 tcatttgcac cactgctgtg ccttggaatg ctagttggag taataaatct ctggaacaga 3480 tttggaatca cacgacctgg atggagtggg acagagaaat taacaattac acaagcttaa 3540 tacactcctt aattgaagaa tcgcaaaacc agcaagaaaa gaatgaacaa gaattattgg 3600 aattagataa atgggcaagt ttgtggaatt ggtttaacat aacaaattgg ctgtggtata 3660 taaaattatt cataatgata gtaggaggct tggtaggttt aagaatagtt tttgctgtac 3720 tttctatagt gaatagagtt aggcagggat attcaccatt atcgtttcag acccacctcc 3780 caaccccgag gggacccgac aggcccgaag gaatagaaga agaaggtgga gagagagaca 3840 gagacagatc cattcgatta gtgaacggat ctcgacggta tcggttaact tttaaaagaa 3900 aaggggggat tggggggtac agtgcagggg aaagaatagt agacataata gcaacagaca 3960 tacaaactaa agaattacaa aaacaaatta caaaaattca aaattttatc gatcacgaga 4020 ctagcctcga gaagcttgat atccctaggt attgaataag aaaaatgaag ttaaggtggt 4080 tgatggtaac actatgctaa taactgcaga gccagaagca ccataaggga catgataagg 4140 gagccagcag acctctgatc tcttcctgaa tgctaatctt aaacatcctg aggaagaatg 4200 ggacttccat ttggggtggg cctatgacag ggtaataaga cagtagtgaa tatcaagcta 4260 caaaaagccg cctttcaaat tcttctcagt cctaactttt catactaagc ccagtccttc 4320 caaagcagac tgtgaaagag tgatagttcc gggagactag cactgcagat tccgggtcac 4380 tgtgagtggg ggaggcaggg aagaagggct cacaggacag tcaaaccatg acccctgttt 4440 ttccttcttc aagtagacct ctataagaca acagagacaa ctaaggctga gtggccaggc 4500 gaggagaaac catctcgccg taaaacatgg aaggaacact tcaggggaaa ggtggtatct 4560 ctaagcaaga gaactgagtg gagtcaaggc tgagagatgc aggataagca aatgggtagt 4620 gaaaagacat tcatgaggac agctaaaaca ataagtaatg taaaatacag catagcaaaa 4680 ctttaacctc caaatcaagc ctctacttga atccttttct gagggatgaa taaggcatat 4740 gcatcagggg ctgttgccaa tgtgcattag ctgtttgcag cctcaccttc tttcatggag 4800 tttaagatat agtgtatttt cccaaggttt gaactagctc ttcatttctt tatgttttaa 4860 atgcactgac ctcccacatt ccctttttag taaaatattc agaaataatt taaatacatc 4920 attgcaatga aaataaatgt tttttattag gcagaatcca gatgctcaag gcccttcata 4980 atatccccca gtttagtagt tggacttagg gaacaaagga acctttaata gaaattggac 5040 agcaagaaag cgagctcagt ggtacttgtg ggccagggcg ttggccaccc cggccaccac 5100 cttctggtac gcggcctgca ctgggggcgt gaattccttc ccgaagtggt gggccagcac 5160 gcacaccagc acgttgccca ggagctgtgg gaggaagata agaggtatga acatgattag 5220 caaaagggcc tagcttggac tcagaataat ccagccttat cccaaccata aaataaaagc 5280 agaatggtag ctggattgta gctgctatta gcaatatgaa acctcttaca tcagttacaa 5340 tttatatgca gaaatattta tatgcagaga tattgctatt gccttaaccc agaaattatc 5400 actgttattc tttagaatgg tgcaaagagg catgatacat tgtatcatta ttgccctgaa 5460 agaaagagat tagggaaagt attagaaata agataaacaa aaaagtatat taaaagaaga 5520 aagcattttt taaaattaca aatgcaaaat taccctgatt tggtcaatat gtgtacacat 5580 attaaaacat tacactttaa cccataaata tgtataatga ttatgtatca attaaaaata 5640 aaagaaaata aagtagggag attatgaata tgcaaataag cacacatata ttccaaatag 5700 taatgtacta ggcagactgt gtaaagtttt tttttaagtt acttaatgta tctcagagat 5760 atttcctttt gttatacaca atgttaaggc attaagtata atagtaaaaa ttgcggagaa 5820 gaaaaaaaaa gaaagcaaga attaaacaaa agaaaacaat tgttatgaac agcaaataaa 5880 agaaactaaa acgatcctga gacttccaca ctgatgcaat cattcgtctg tttcccattc 5940 taaactgtac cctgttactt atccccttcc tatgacatga acttaaccat agaaaagaag 6000 gggaaagaaa acatcaagcg tcccatagac tcaccctgaa gttctcgggg tegaegtgea 6060 gcttgtcgca gtgcagctcc gacagctggg cgaaggtgcc cttgaggttg tccaggtgag 6120 ccaggccgtc ggagaaggcg ccgagcacct tcttgccgtg ggccttgacc ttagggttgc 6180 ccatcaccgc gtcgggggtg gacagatccc cgaagctctc aaaaaagege tgcgtccagg 6240 ggtagaccac cagcagccta agggtgggaa aatagaccaa taggcagaga gagteagtge 6300 ctatcagaaa cccaagagtc ttctctgtct ccacatgccc agtttctatt ggtctcctta 6360 aacctgtctt gtaaccttga taccaacctg cccagggcct ccccgccgac ctcgtcgacg 6420 ttcaccttgc cccagagggc cgtcacggcg cttttctcct ccggggttag gtgcaccatg 6480 gtgtctgttt gaggttgcta gtgaacacag ttgtgtcaga agcaaatgta agcaatagat 6540 ggctctgccc tgacttttat gcccagccct ggctcctgcc ctccctgctc ctgggagtag 6600 attggccaac cctagggtgt ggctccacag ggtgaggtct aagtgatgac agccgtacct 6660 gtccttggct cttctggcac tggcttagga gttggacttc aaaccctcag ccctccctct 6720 aagatatatc tcttggcccc ataccatcag tacaaattgc tactaaaaac atcctccttt 6780 gcaagtgtat ttacgtatct agaatatgtc acattctgtc tcaggcatcc attttcttta 6840 tgatgccgtt tgaggtggag ttttagtcag gtggtcagct tctccttttt tttgccatct 6900 gccctgtaag catcctgctg gggacccaga taggagteat cactctaggc tgagaacatc 6960 tgggcacaca ccctaagcct cagcatgact catcatgact cagcattgct gtgettgage 7020 cagaaggttt gcttagaagg ttacacagaa ccagaaggcg ggggtggggc actgaccccg 7080 acaggggcct ggccagaact gctcatgctt ggactatggg aggtcactaa tggagacaca 7140 cagaaatgta acaggaacta aggaaaaact gaagettatt taatcagaga tgaggatget 7200 ggaagggata gagggagctg agcttgtaaa aagtatagta atcattcagc aaatggtttt 7260 gaagcacctg ctggatgcta aacactattt teagtgettg aatcataaat aagaataaaa 7320 catgtatctt attccccaca agagtccaag taaaaaataa cagttaatta taatgtgctc 7380 tgtcccccag gctggagtgc agtggcacga tctcagctca ctgcaacctc cgcctcccgg 7440 gctggttaga aggttctact ggaggagggt cccagcccat tgetaaatta acatcaggct 7500 ctgagactgg cagtatatct ctaacagtgg ttgatgetat cttctggaac ttgeetgeta 7560 cattgagacc actgacccat acataggaag cccatagctc tgtcctgaac tgttaggcca 7620 ctggtccaga gagtgtgcat ctcctttgat cctcataata accctatgag atagacacaa 7680 ttattactct tactttatag atgatgatcc tgaaaacata ggagteaagg cacttgcccc 7740 tagctggggg tataggggag cagtcccatg tagtagtaga atgaaaaatg etgetatget 7800 gtgcctcccc cacctttccc atgtctgccc tctactcatg gtetatetet cctggctcct 7860 gggagtcatg gactccaccc agcaccacca acctgaccta accacctatc tgagcctgcc 7920 agcctataac ccatctgggc cctgatagct ggtggccagc cctgacccca ccccaccctc 7980 cctggaacct ctgatagaca catctggcac accagctcgc aaagteaeeg tgagggtctt 8040 gtgtttgctg agtcaaaatt ccttgaaatc caagtcctta gagactcctg ctcccaaatt 8100 tacagtcata gacttcttca tggctgtctc ctttatccac agaatgattc ctttgcttca 8160 ttgccccatc catctgatcc tcctcatcag tgcagcacag ggcccatgag cagtagctgc 8220 agagtctcac ataggtctgg cactgcctct gacatgtccg accttaggca aatgcttgac 8280 tcttctctag tgcatgcaaa tctgacactc agtgggcctg ggtgaaggtg agaattttat 8340 tgctgaatga gagcctctgg ggacatcttg ccagtcaatg agtctcaggt tcaatttcct 8400 tctcagtctt ggagtaacag aagctcatgc atttaataaa cggaaatttt gtattgaaat 8460 gagagccatt ggaaatcatt tactccagac tcctacttat aaaaagagaa actgaggctc 8520 agagaagggt ggggactttc tcagtatgac atggaaatga tcaggcttgg attcaaagct 8580 cctgactttc tgtctagtgt atgtgcagtg agcccctttt cctctaactg aaagaaggaa 8640 aaaaaaatgg aacccaaaat attctacata gtttccatgt cacagccagg gctgggcagt 8700 ctcctgttat ttcttttaaa ataaatatat catttaaatg cataaataag caaaccctgc 8760 tcgggaatgg gagggagagt ctctggagtc caccccttct cggccctggc tctgcagata 8820 gtgctatcaa agccctgaca gagccctgcc cattgctggg ccttggagtg agtcagccta 8880 gtagagaggc agggcaagcc atctcatagc tgctgagtgg gagagagaaa agggctcatt 8940 gtctataaac tcaggtcatg gctattctta ttctcacact aagaaaaaga atgagatgtc 9000 tacatatacc ctgcgtcccc tcttgtgtac tggggtcccc aagagctctc taaaagtgat 9060 ggcaaagtca ttgcgctaga tgccatccca tctattataa acctgcattt gtctccacac 9120 accagtcatg gacaataacc ctcctcccag gtccacgtgc ttgtctttgt ataatactca 9180 agtaatttcg gaaaatgtat tctttcaatc ttgttctgtt attcctgttt caatggctta 9240 gtagaaaaag tacatacttg ttttcccata aattgacaat agacaatttc acatcaatgt 9300 ctatatgggt cgttgtgttt gctgtgtttg caaaaactca caataacttt atattgttac 9360 tactctaaga aagttacaac atggtgaata caagagaaag ctattacaag tccagaaaat 9420 aaaagttatc atcttgaggg tcgacctgga attcgagctc ggtaccttta agaccaatga 9480 cttacaaggc agctgtagat cttagccact ttttaaaaga aaagggggga ctggaagggc 9540 taattcactc ccaacgaaga caagatctgc tttttgcttg tactgggtct ctctggttag 9600 accagatctg agcctgggag ctctctggct aactagggaa cccactgctt aagcctcaat 9660 aaagcttgcc ttgagtgctt caagtagtgt gtgcccgtct gttgtgtgac tctggtaact 9720 agagatccct cagacccttt tagtcagtgt ggaaaatctc tagcagtagt agttcatgtc 9780 atcttattat tcagtattta taacttgcaa agaaatgaat atcagagagt gagaggaact 9840 tgtttattgc agcttataat ggttacaaat aaagcaatag catcacaaat ttcacaaata 9900 aagcattttt ttcactgcat tctagttgtg gtttgtccaa actcatcaat gtatcttatc 9960 atgtctggct ctagctatcc cgcccctaac tccgcccatc ccgcccctaa ctccgcccag 10020 ttccgcccat tctccgcccc atggctgact aatttttttt atttatgcag aggccgaggc 10080 cgcctcggcc tctgagctat tccagaagta gtgaggaggc ttttttggag gccgctagcg 10140 tcgaccatta cttattgttt tagctgtcct catgaatgtc ttttcactac ccatttgctt 10200 atcctgcatc tctcagcctt gactccactc agttctcttg cttagagata ccacctttcc 10260 cctgaagtgt tccttccatg ttttacggcg agatggtttc tcctcgcctg gccactcagc 10320 cttagttgtc tctgttgtct tatagaggtc tacttgaaga aggaaaaaca gggggcatgg 10380 tttgactgtc ctgtgagccc ttcttccctg cctcccccac tcacagtgac ccggaatccc 10440 tcgacatggc agtctagcac tagtgcggcc gcagatctgc ttcctcgctc actgactcgc 10500 tgcgctcggt cgttcggctg cggcgagcgg tatcagctca ctcaaaggcg gtaatacggt 10560 tatccacaga atcaggggat aacgcaggaa agaacatgtg agcaaaaggc cagcaaaagg 10620 ccaggaaccg taaaaa 10636
SEQ ID NO : 21 gtgagtctat gggacgcttg atgttttctt tccccttctt ttctatggtt aagttcatgt 60 cataggaagg ggataagtaa cagggtacac atattgacca aatcagggta attttgcatt 120 tgtaatttta aaaaatgctt tcttctttta atatactttt ttgtttatct tatttctaat 180 actttcccta atctctttct ttcagggcaa taatgataca atgtatcatg cctctttgca 240 ccattctaaa gaataacagt gataatttct gggttaaggc aatagcaata tctctgcata 300 taaatatttc tgcatataaa ttgtaactga tgtaagaggt ttcatattgc taatagcagc 360 tacaatccag ctaccattct gcttttattt tatggttggg ataaggctgg attattctga 420 gtccaagcta ggcccttttg ctaatcatgt tcatacctct tatcttcctc ccacag 476
SEQ ID NO : 22 cctcaagatg ataactttta ttttctggac ttgtaatagc tttctcttgt attcaccatg 60 ttgtaacttt cttagagtag taacaatata aagttattgt gagtttttgc aaacacagca 120 aacacaacga cccatataga cattgatgtg aaattgtcta ttgtcaattt atgggaaaac 180 aagtatgtac tttttctact aagccattga aacaggaata acagaacaag attgaaagaa 240 tacattttcc gaaattactt gagtattata caaagacaag cacgtggacc tgggaggagg 300 gttattgtcc atgactggtg tgtggagaca aatgcaggtt tataatagat gggatggcat 360 ctagcgcaat gactttgcca tcacttttag agagctcttg gggaccccag tacacaagag 420 gggacgcagg gtatatgtag acatctcatt ctttttctta gtgtgagaat aagaatagcc 480 atgacctgag tttatagaca atgagccctt ttctctctcc cactcagcag ctatgagatg 540 gcttgccctg cctctctact aggctgactc actccaaggc ccagcaatgg gcagggctct 600 gtcagggctt tgatagcact atctgcagag ccagggccga gaaggggtgg actccagaga 660 ctctccctcc cattcccgag cagggtttgc ttatttatgc atttaaatga tatatttatt 720 ttaaaagaaa taacaggaga ctgcccagcc ctggctgtga catggaaact atgtagaata 780 ttttgggttc catttttttt tccttctttc agttagagga aaaggggctc actgcacata 840 cactagacag aaagtcagga gctttgaatc caagcctgat catttccatg tcatactgag 900 aaagtcccca cccttctctg agcctcagtt tctcttttta taagtaggag tctggagtaa 960 atgatttcca atggctctca tttcaataca aaatttccgt ttattaaatg catgagcttc 1020 tgttactcca agactgagaa ggaaattgaa cctgagactc attgactggc aagatgtccc 1080 cagaggctct cattcagcaa taaaattctc accttcaccc aggcccactg agtgtcagat 1140 ttgcatgcac tagagaagag tcaagcattt gcctaaggtc ggacatgtca gaggcagtgc 1200 cagacctatg tgagactctg cagctactgc tcatgggccc tgtgctgcac tgatgaggag 1260 gatcagatgg atggggcaat gaagcaaagg aatcattctg tggataaagg agacagccat 1320 gaagaagtct atgactgtaa atttgggagc aggagtctct aaggacttgg atttcaagga 1380 attttgactc agcaaacaca agaccctcac ggtgactttg cgagctggtg tgccagatgt 1440 gtctatcaga ggttccaggg agggtggggt ggggtcaggg ctggccacca gctatcaggg 1500 cccagatggg ttataggctg gcaggctcag ataggtggtt aggtcaggtt ggtggtgctg 1560 ggtggagtcc atgactccca ggagccagga gagatagacc atgagtagag ggcagacatg 1620 ggaaaggtgg gggaggcaca gcatagcagc atttttcatt ctactactac atgggactgc 1680 tcccctatac ccccagctag gggcaagtgc cttgactcct atgttttcag gatcatcatc 1740 tataaagtaa gagtaataat tgtgtctatc tcatagggtt attatgagga tcaaaggaga 1800 tgcacactct ctggaccagt ggcctaacag ttcaggacag agctatgggc ttcctatgta 1860 tgggtcagtg gtctcaatgt agcaggcaag ttccagaaga tagcatcaac cactgttaga 1920 gatatactgc cagtctcaga gcctgatgtt aatttagcaa tgggctggga ccctcctcca 1980 gtagaacctt ctaaccagcc cgggaggcgg aggttgcagt gagctgagat cgtgccactg 2040 cactccagcc tgggggacag agcacattat aattaactgt tattttttac ttggactctt 2100 gtggggaata agatacatgt tttattctta tttatgattc aagcactgaa aatagtgttt 2160 agcatccagc aggtgcttca aaaccatttg ctgaatgatt actatacttt ttacaagctc 2220 agctccctct atcccttcca gcatcctcat ctctgattaa ataagcttca gtttttcctt 2280 agttcctgtt acatttctgt gtgtctccat tagtgacctc ccatagtcca agcatgagca 2340 gttctggcca ggcccctgtc ggggtcagtg ccccaccccc gccttctggt tctgtgtaac 2400 cttctaagca aaccttctgg ctcaagcaca gcaatgctga gtcatgatga gtcatgctga 2460 ggcttagggt gtgtgcccag atgttctcag cctagagtga tgactcctat ctgggtcccc 2520 agcaggatgc ttacagggca gatggcaaaa aaaaggagaa gctgaccacc tgactaaaac 2580 tccacctcaa acggcatcat aaagaaaatg gatgcctgag acagaatgtg acatattcta 2640 ga 2642
SEQ ID NO : 23 acatttgctt ctgacacaac tgtgttcact agcaacctca aacagacacc atggtgcacc 60 tgacccctga ggagaagagc gccgtgacag ccctgtgggg caaggtgaac gtggacgaag 120 tgggaggaga ggccctgggc aggctgctgg tggtgtaccc atggacccag agattctttg 180 agagcttcgg cgacctgtcc acaccagatg ccgtgatggg caaccccaag gtgaaggccc 240 acggcaagaa ggtgctggga gccttctctg acggactggc ccacctggat aatctgaagg 300 gcacctttgc ccagctgagc gagctgcact gcgacaagct gcacgtggat cccgagaact 360 tcaggctcct gggcaacgtg ctggtgtgcg tgctggccca ccacttcggc aaggagttta 420 caccccctgt gcaggcagca taccagaagg tggtggcagg agtggcaaat gcactggccc 480 acaagtatca ctgagctcgc tttcttgctg tccaatttct attaaaggtt cctttgttcc 540 ctaagtccaa ctactaaact gggggatatt atgaagggcc ttgagcatct ggattctgcc 600 taataaaaaa catttatttt cattgcaa 6: 8
SEQ ID NO : 24 acatttgctt ctgacacaac tgtgttcact agcaacctca aacagacacc atggtgcacc 60 taaccccgga ggagaaaagc gccgtgacgg ccctctgggg caaggtgaac gtcgacgagg 120 tcggcgggga ggccctgggc aggctgctgg tggtctaccc ctggacgcag cgcttttttg 180 agagcttcgg ggatctgtcc acccccgacg cggtgatggg caaccctaag gtcaaggccc 240 acggcaagaa ggtgctcggc gccttctccg acggcctggc tcacctggac aacctcaagg 300 gcaccttcgc ccagctgtcg gagctgcact gcgacaagct gcacgtcgac cccgagaact 360 tcaggctcct gggcaacgtg ctggtgtgcg tgctggccca ccacttcggg aaggaattca 420 cgcccccagt gcaggccgcg taccagaagg tggtggccgg ggtggccaac gccctggccc 480 acaagtacca ctgagctcgc tttcttgctg tccaatttct attaaaggtt cctttgttcc 540 ctaagtccaa ctactaaact gggggatatt atgaagggcc ttgagcatct ggattctgcc 600 taataaaaaa catttatttt cattgcaa 628
SEQ ID NO : 25 acatttgctt ctgacacaac tgtgttcact agcaacctca aacagacacc atggtgcacc 60 taaccccgga ggagaaaagc gccgtgacgg ccctctgggg caaggtgaac gtcgacgagg 120 tcggcgggga ggccctgggc aggctgctgg tggtctaccc ctggacgcag cgcttttttg 180 agagcttcgg ggatctgtcc acccccgacg cggtgatggg caaccctaag gtcaaggccc 240 acggcaagaa ggtgctcggc gccttctccg acggcctggc tcacctggac aacctcaagg 300 gcaccttcgc cacactgtcg gagctgcact gcgacaagct gcacgtcgac cccgagaact 360 tcaggctcct gggcaacgtg ctggtgtgcg tgctggccca ccacttcggg aaggaattca 420 cgcccccagt gcaggccgcg taccagaagg tggtggccgg ggtggccaac gccctggccc 480 acaagtacca ctgagctcgc tttcttgctg tccaatttct attaaaggtt cctttgttcc 540 ctaagtccaa ctactaaact gggggatatt atgaagggcc ttgagcatct ggattctgcc 600 taataaaaaa catttatttt cattgcaa 628

Claims

1. A vector comprising: a) a left (5') retroviral LTR; b) a human p-globin gene; c) a human p-globin gene upstream locus control region (LCR); d) a cis-acting posttranscriptional regulatory element; e) a right (3') retroviral LTR; and f) a cis-acting element SV40 polyadenylation signal and/or SV40 origin.
2. The vector of claim 1, wherein the human p-globin gene comprises a human p-globin promoter, exon 1, intron 1, exon 2, intron 2, exon 3, and a human p-globin 3 ’-enhancer.
3. The vector of claim 1 or 2, wherein the human p-globin gene comprises a wild-type exon 2 or an exon 2 encoding a threonine to glutamine mutation at codon 87 (T87Q).
4. The vector of any one of claims 1-3, wherein upstream locus control region (LCR) comprises truncated DNase I hypersensitive sites, HS2, HS3 and HS4.
5. The vector of any one of claims 1-4, wherein the posttranscriptional regulatory element is a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE).
6. The vector of claim 5, wherein the WPRE is a mutated WPRE comprising the nucleotide sequence of SEQ ID NO: 33.
7. The vector of any one of claims 1-6, wherein the SV40 polyadenylation signal and/or SV40 origin is located 3 ’ downstream of the right (3') retroviral LTR.
8. The vector of any one of claims 1-7, wherein the human p-globin gene comprises one, two, or all of the nucleotide sequences of SEQ ID NO: 23, SEQ ID NO: 24, or SEQ ID NO: 25, or a nucleotide sequence having at least 85%, 90%, 95%, or 99% identity thereto.
9. The vector of any one of claims 1-8, wherein the left (5') retroviral LTR, the right (3’) retroviral LTR, or both, is a lentiviral LTR, the left (5') LTR comprises a promoter that is replaced with a heterologous promoter, and the right (3’) LTR is a self-inactivating (SIN) LTR.
10. The vector of any one of claims 1-9, further comprising one or more of a Psi packaging sequence ('P+j, a central polypurine tract/DNA flap (cPPT/FLAP), or a retroviral export element-rev response element (RRE).
11. The vector of any one of claims 1-10, which comprises the nucleotide sequence of SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, or SEQ ID NO: 20, or a nucleotide sequence having at least 85%, 90%, 95%, or 99% identity thereto.
12. A composition comprising the vector of any one of claims 1-11 and a pharmaceutically acceptable carrier.
13. A human cell transduced with the vector of any one of claims 1-11.
14. The cell of claim 13, which is an embryonic stem cell, an adult stem cell, an adult progenitor cell, a differentiated adult cell, a hematopoietic stem cell, or a hematopoietic progenitor cell.
15. The cell of claim 14, wherein the hematopoietic stem cell or hematopoietic progenitor cell is obtained from bone marrow, cord blood, placental blood, or peripheral blood.
16. A composition comprising a cell transduced with a vector of any one of claims 1-11, and a pharmaceutically acceptable carrier.
17. A cell transduced with a vector of any one of claims 1-11 for use in a method of treating p- thalassemia in a subject.
18. The cell for use of claim 17, wherein the method further comprises obtaining a cell from the subject and transducing the cell with the vector.
19. The cell for use of claim 17 or 18, wherein the cell is a hematopoietic stem cell or a hematopoietic progenitor cell.
20. The cell for use of any one of claims 17-19, wherein the method further comprises administering to the subject an effective amount of busulfan and cyclophosphamide prior to administering the cell transduced with the vector to the subject.
21. The cell for use of claim 20, wherein: (a) busulfan is administered at a dose of 2.4 to 4.8 mg/kg/day intravenously;
(b) cyclophosphamide is administered at a dose of 45 to 65 mg/kg/day intravenously;
(c) cyclophosphamide is administered 24 hours after busulfan is administered;
(d) busulfan is administered for 2-4 days and cyclophosphamide is administered for 1-5 days; and
(e) the administration of the cell transduced the vector is initiated 24-72 hours after the administration of cyclophshamide is completed.
22. A formulation comprising the vector of any one of claims 1-11, a buffer, a stabilizer, and sodium chloride.
23. The formulation of claim 22, wherein the vector is present at a concentration of 5xl08 TU/mL to 5xl09 TU/mL.
24. The formulation of claim 22 or 23, wherein the buffer is phosphate buffer, sodium citrate, or PIPES.
25. The formulation of any one of claims 22-24, wherein the buffer is present at a concentration of 10 mM to 50 mM.
26. The formulation of any one of claims 22-25, wherein the stabilizer comprises sucrose, trehalose, sorbitol, inositol, or glucose.
27. The formulation of any one of claims 22-26, wherein the stabilizer is present at a concentration of l% to 5%.
28. The formulation of any one of claims 22-27, wherein sodium chloride is present at a concentration of 50 mM to 200 mM.
29. The formulation of any one of claims 22-28, wherein the buffer comprises sodium citrate and the stabilizer comprises sucrose.
30. The formulation of any one of claims 22-29, wherein the vector is present at a concentration of 5xl08 TU/mL to 5xl09 TU/mL, sodium citrate is present at a concentration of 20 mM to 40 mM, sucrose is present at a concentration of 1% to 2%, and sodium chloride is present at a concentration of 100 mM to 150 mM.
EP24808441.0A 2023-10-25 2024-10-25 Nucleic acid constructs and uses thereof Pending EP4651908A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US18/383,596 US20240167058A1 (en) 2022-10-25 2023-10-25 Nucleic acid constructs and uses thereof
PCT/IB2024/060500 WO2025088552A1 (en) 2023-10-25 2024-10-25 Nucleic acid constructs and uses thereof

Publications (1)

Publication Number Publication Date
EP4651908A1 true EP4651908A1 (en) 2025-11-26

Family

ID=93562834

Family Applications (1)

Application Number Title Priority Date Filing Date
EP24808441.0A Pending EP4651908A1 (en) 2023-10-25 2024-10-25 Nucleic acid constructs and uses thereof

Country Status (2)

Country Link
EP (1) EP4651908A1 (en)
WO (1) WO2025088552A1 (en)

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2777909B1 (en) 1998-04-24 2002-08-02 Pasteur Institut USE OF TRIPLEX-STRUCTURED DNA SEQUENCES FOR THE TRANSFER OF NUCLEOTID SEQUENCES IN CELLS, RECOMBINANT VECTORS CONTAINING THESE TRIPLEX SEQUENCES
WO2014026110A2 (en) * 2012-08-10 2014-02-13 Bluebird Bio, Inc. Compounds for improved viral transduction
EP3247409B1 (en) * 2015-01-21 2020-11-04 Cornell University Viral vectors for prophylaxis and therapy of hemoglobinopathies
EP3548617A4 (en) * 2016-12-05 2020-06-17 The Regents of The University of California LENTIVIRAL VECTOR OPTIMIZED FOR HEMOGLOBINOPATHY STEM CELL THERAPY
WO2020176712A1 (en) * 2019-02-28 2020-09-03 The Regents Of The University Of California Augmentations to lentiviral vectors (cclc-mgata/ank-core lcr-beta-as3-fb) to increase expression
CN117384967A (en) * 2020-04-24 2024-01-12 康霖生物科技(杭州)有限公司 Nucleic acid construct
US20240167058A1 (en) * 2022-10-25 2024-05-23 Kanglin Biotech (Hangzhou) Co., Ltd. Nucleic acid constructs and uses thereof

Also Published As

Publication number Publication date
WO2025088552A1 (en) 2025-05-01

Similar Documents

Publication Publication Date Title
KR101421312B1 (en) Delivery of targeted genes for dendritic cell vaccination
CN112512596B (en) Gene therapy vectors for treating Danon disease
CN111164211B (en) Compositions and methods for treating beta-hemoglobinopathies
US20240207318A1 (en) Chimeric costimulatory receptors, chemokine receptors, and the use of same in cellular immunotherapies
AU2018352855B2 (en) Adeno-associated virus compositions for restoring HBB gene function and methods of use thereof
CN113549654B (en) Nucleic acid construct
KR20210150486A (en) Gene therapy for lysosomal disorders
KR20230066360A (en) Gene Therapy for Neurodegenerative Disorders
KR20220078607A (en) Compositions and methods for TCR reprogramming using fusion proteins
US20240167058A1 (en) Nucleic acid constructs and uses thereof
US20220170045A1 (en) Augmentations to lentiviral vectors (cclc-mgata/ank-core lcr-beta-as3-fb) to increase expression
EP4651908A1 (en) Nucleic acid constructs and uses thereof
KR20200003160A (en) Improved Lentivirus for Transduction of Hematopoietic Stem Cells
US20260021181A1 (en) Chimeric costimulatory receptors, chemokine receptors, and the use of same in cellular immunotherapies
CN101516199A (en) Targeted gene delivery for dendritic cell vaccination
US20240082327A1 (en) Retroviral vectors
RU2808459C2 (en) Gene therapy vectors for treatment of danon's disease
JP2024509789A (en) retrovirus vector
JP2025533754A (en) Retroviral vector containing an RRE inserted within an intron

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: UNKNOWN

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20250820

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR