EP4619757A1

EP4619757A1 - Methods and composition relating to particle capture

Info

Publication number: EP4619757A1
Application number: EP23892523.4A
Authority: EP
Inventors: M. Selim ÜNLÜ; Elisa CHIODI; Marcella Chiari; Dario Brambilla
Original assignee: Consiglio Nazionale delle Richerche CNR; Boston University
Current assignee: Consiglio Nazionale delle Richerche CNR; Boston University
Priority date: 2022-11-16
Filing date: 2023-11-16
Publication date: 2025-09-24
Also published as: WO2024107916A1

Abstract

The technology described herein is directed to compositions and methods for isolating and analyzing biological nanoparticles, e.g., extracellular vesicles.

Description

Attorney Docket No: 701586-192090WOPT METHODS AND COMPOSITION RELATING TO PARTICLE CAPTURE CROSS-REFERENCE TO RELATED APPLICATIONS [0001] This application claims benefit under 35 U.S.C. § 119(e) of U.S. Provisional Application No.63/383,930 filed November 16, 2022, the contents of which are incorporated herein by reference in their entirety. TECHNICAL FIELD [0002] The technology described herein relates to methods of capturing and analyzing biological particles, e.g., extracellular vesicles. BACKGROUND [0003] The ability to isolate and examine biological particles such as extracellular vesicles and viruses is of significant academic and therapeutic interest. However, such biological particles exist as only a small fraction of very complex substances such as blood. This provides significant hurdles in selectively isolating the particles, without destroying or disrupting the particles, and providing analysis of the isolated particles in a rapid manner. Existing technologies have not succeeded in overcoming these hurdles. SUMMARY [0004] The technology described herein is directed to capture reagents that permit flexible, rapid, reversible, and non-damaging capture and analysis of biological particles. In particular, the capture reagents use a first binding element to bind to the desired type of biological particle, a second binding element to perform a first reversible isolation process, and a third binding element to perform a second isolation process that can simultaneously arrange the biological particles for analysis. [0005] In one aspect of any of the embodiments, described herein is a capture reagent comprising: a first binding element that binds specifically to a target biomolecule; a second binding element that reversibly binds to a target and which can be competed off of the target; and a third binding element comprising an oligonucleotide sequence. [0006] In one aspect of any of the embodiments, described herein is a kit comprising a capture reagent, the capture reagent comprising: a first binding element that binds specifically to a target biomolecule; a second binding element that reversibly binds to a target and which can be competed off of the target; and a third binding element comprising an oligonucleotide sequence. In one aspect of any of the embodiments, described herein is a kit comprising a plurality of capture reagents, each capture reagent comprising: a first binding element that binds specifically to a target biomolecule; a second binding element that reversibly binds to a target and which can be competed off of the target; and a third binding element comprising an oligonucleotide sequence. [0007] In some embodiments of any of the aspects, each unique first binding element binds specifically to a unique target biomolecule. In some embodiments of any of the aspects, each unique 1 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT first binding element binds specifically to a unique epitope. In some embodiments of any of the aspects, each capture reagent of the plurality of capture reagents comprises a unique third binding element. [0008] In one aspect of any of the embodiments, described herein is a kit comprising at least one capture reagent as described herein, or a plurality of capture reagents as described herein, the kit further comprising: a) a first support comprising the target of the second binding element; and b) at least one of: i) the first support further comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence of the third binding element; and ii) a second support comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence of the third binding element. [0009] In one aspect of any of the embodiments, described herein is a kit comprising at least one capture reagent as described herein, or a plurality of capture reagents as described herein, the kit further comprising: a) a first support comprising the target of the second binding element; and b) a second support comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence of the third binding element. [0010] In some embodiments of any of the aspects, the first support is a magnetic particle. In some embodiments of any of the aspects, the support comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence comprises silicon, silicon oxide, gold, glass, and/or plastic. In some embodiments of any of the aspects, the support comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence comprises silicon and/or silicon oxide. In some embodiments of any of the aspects, the support comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence comprises silicon oxide coated silicon. [0011] In some embodiments of any of the aspects, the support comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence is a Single-Particle Interferometric Reflectance Imaging Sensor (SP-IRIS) substrate. In some embodiments of any of the aspects, the support comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence comprises gold. In some embodiments of any of the aspects, the support comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence comprises a Surface Plasmon Resonance (SPR) or interferometic technique substrate, e.g., interferometric detection technique substrate. 2 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT [0012] In some embodiments of any of the aspects, the support comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence of the third binding element is a Single-Particle Interferometric Reflectance Imaging Sensor (SP-IRIS) substrate. In some embodiments of any of the aspects, the support comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence of the third binding element comprises gold. In some embodiments of any of the aspects, the support comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence of the third binding element comprises a Surface Plasmon Resonance (SPR) or interferometic technique substrate, e.g., interferometric detection technique substrate. [0013] In some embodiments of any of the aspects, the first binding element comprises an antibody, antibody reagent, a nanobody, a polypeptide, an aptamer, or a DNA-binding protein. In some embodiments of any of the aspects, the target biomolecule is a nanovescicle surface protein. In some embodiments of any of the aspects, the target biomolecule is a tetraspannin; TSGS01; ALIX; or EPS15. In some embodiments of any of the aspects, the second binding element comprises an aptamer that binds streptavidin. In some embodiments of any of the aspects, the second binding element comprises an aptamer that binds streptavidin with a lower affinity than biotin. In some embodiments of any of the aspects, the second binding element comprises an aptamer comprising the sequence of any of Table 3. In some embodiments of any of the aspects, the second binding element comprises an oligonucleotide. In some embodiments of any of the aspects, the second binding element comprises an oligonucleotide that binds streptavidin. In some embodiments of any of the aspects, the second binding element comprises an oligonucleotide that binds streptavidin with a lower affinity than biotin. In some embodiments of any of the aspects, the second binding element binds streptavidin. In some embodiments of any of the aspects, the second binding element binds streptavidin with a lower affinity than biotin. In some embodiments of any of the aspects, the second binding element comprises an oligonucleotide that binds streptavidin. In some embodiments of any of the aspects, the second binding element comprises desthiobiotin. In some embodiments of any of the aspects, the second binding element is desthiobiotin. [0014] In some embodiments of any of the aspects, the third binding element comprises an oligonucleotide sequence of at least 10 bp in length. [0015] In one aspect of any of the embodiments, described herein is a method comprising: a) contacting a sample comprising one or more biological nanoparticles with at least one capture reagent of any of the preceding claims, thereby forming capture reagent- biological nanoparticle complexes; b) contacting the capture reagent-biological nanoparticle complexes with a first support comprising the target of the second binding element, thereby binding the capture reagent-biological nanoparticle complexes to the first support; 3 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT c) contacting the first support and the capture reagent-biological nanoparticle complexes bound to the first support with a competing reagent that binds the target of the second binding element with greater affinity than the second binding element binds the target, thereby releasing the capture reagent-biological nanoparticles complexes from the first support; and d) contacting the released capture reagent-biological nanoparticles complexes with: the first support, the first support further comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence of the third binding element, thereby binding the capture reagent- biological nanoparticle complexes to the first support; or a further support comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence of the third binding element, thereby binding the capture reagent-biological nanoparticle complexes to the second support. [0016] In one aspect of any of the embodiments, described herein is a method comprising: a) contacting at least one capture reagent of any of the preceding claims with a first support comprising the target of the second binding element, thereby binding the capture reagent to the first support; b) contacting a sample comprising one or more biological nanoparticles with the capture reagent bound to the first support, thereby forming capture reagent-biological nanoparticle complexes bound to the first support; c) contacting the first support and the capture reagent-biological nanoparticle complexes bound to the first support with a competing reagent that binds the target of the second binding element with greater affinity than the second binding element binds the target, thereby releasing the capture reagent-biological nanoparticles complexes from the first support; and d) contacting the released capture reagent-biological nanoparticles complexes with: the first support, the first support further comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence of the third binding element, thereby binding the capture reagent- biological nanoparticle complexes to the first support; or a further support comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence of the third binding element, thereby binding the capture reagent-biological nanoparticle complexes to the second support. 4 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT [0017] In some embodiments of any of the aspects, the method further comprises detecting the capture reagent-biological nanoparticle complexes bound in step d). In some embodiments of any of the aspects, the detecting comprises Single-Particle Interferometric Reflectance Imaging Sensor (SP- IRIS). [0018] In some embodiments of any of the aspects, the biological nanoparticle is at least 10x greater in size volumetrically than the capture reagent. In some embodiments of any of the aspects, the biological nanoparticle is at least 100x greater in size volumetrically than the capture reagent. [0019] In some embodiments of any of the aspects, the capture reagent is provided in a stoichiometric excess compared to the biological nanoparticle. In some embodiments of any of the aspects, the method does not comprise washing unbound capture reagents from the support or supports. [0020] In some embodiments of any of the aspects, the biological nanoparticle is an extracellular vesicle (EV), virus, viral vector, a microbe, a bacterium, or a spore. In some embodiments of any of the aspects, the biological nanoparticle is intact before step a and after step d. In some embodiments of any of the aspects, a lipid bilayer or envelope of the biological nanoparticle is intact before step a and after step d. In some embodiments of any of the aspects, the biological nanoparticle is not contacted with a detergent. BRIEF DESCRIPTION OF THE DRAWINGS [0021] Fig.1 depicts a schematic of an embodiment of the capture reagents and a method of using them. [0022] Fig.2 depicts a graph of aptamer-mediated immobilization and biotin-mediated release. [0023] Fig.3 depicts a graph of recapture on a DNA microarray [0024] Figs.4A-4B depict graphs of analysis of captured extracellular vesicles by NTA (Fig.4A) and the ExoViewer™ R100 (Fig.4B). [0025] Figs.5A-5D depict graphs of analysis of extracellular vesicles captured with anti-CD9 (Figs.5A-5B), rabbit IgG-Tag2 (Fig.5C), or “naked” beads (Fig.5D). [0026] Fig.6 depicts a transmission electron microscopy image of captured extracellular vesicles. [0027] Figs.7A-7C depict schematics of exemplary capture reagents and methods. [0028] Figs.8A-8C depict schematics of exemplary capture reagents and methods. [0029] Fig.9 depicts a schematic of the capture and release steps. 5 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT DETAILED DESCRIPTION [0030] Embodiments of the technology described herein relate to capture reagents that permit the rapid and non-damaging capture of biological particles, e.g., biological nanoparticles. The instant capture reagents provide advantaes over prior art techniques in that: 1) the capture reagents provide mild release of captured biological particles that does not negatively impact particle integrity or immunoreactivity, 2) the capture reagnets are highly flexible and readily adapted to different target molecules or multiplexed isolation, 3) the capture reagnets provide a capture-release-recapture ability that permits integrated in-line isolation and analysis/detection, and 4) the capture reagents do not require specialized buffers or temperatures. Additionally, the instant capture reagents provide higher capture efficiency than prior art techniques. [0031] In one aspect of any of the embodiments, described herein is a capture reagent comprising: a first binding element that binds specifically to a target biomolecule; a second binding element that reversibly binds to a target and which can be competed off of the target; and a third binding element comprising an oligonucleotide sequence. In one aspect of any of the embodiments, described herein is a capture reagent comprising, in linear sequence: a first binding element that binds specifically to a target biomolecule; a second binding element that reversibly binds to a target and which can be competed off of the target; and a third binding element comprising an oligonucleotide sequence. [0032] As used herein, the term “binding element” refers to a portion of a capture element that binds specifically to a cognate target molecule. A binding elemens can be can a peptide, a peptidomimetic, an amino acid, an amino acid analog, a polynucleotide, a polynucleotide analog, an aptamer, a nucleotide, a nucleotide analog, or an organic or inorganic compound. The first, second, and third binding elements referred to herein are distinguishable, e.g., non-identical with respect to each other. That is, a capture reagent as described herein comprises at least three different or distinguishable binding elements. [0033] In some embodiments of any of the aspects, the first, second, and third binding elements are not naturally found in the same molecule. In some embodiments of any of the aspects, a capture reagnet described herein is not a naturally occurring molecule. In some embodiments of any of the aspects, a capture reagent described herein is an engineered molecule. In some embodiments of any of the aspects, the binding elements of a capture reagent described herein are not naturally found in the same molecule. 6 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT [0034] In some embodiments of any of the aspects, the first binding element comprises a polypeptide and the second and third binding elements each comprise oligonucleotides. In some embodiments of any of the aspects, the first binding element consists of a polypeptide and the second and third binding elements each consist of oligonucleotides. [0035] As used herein, “target” refers to a binding partner. The target can be a biomolecule or a non-biological molecule. The “target” of the second binding element is distinguishable and different from the “target biomolecule” that is bound by the first binding element. [0036] In some embodiments of any of the aspects, the first binding element comprises an antibody, antibody reagent, a nanobody, a polypeptide, an aptamer, or a DNA-binding protein. Antibodies, antibody reagents, nanobodies, polypeptides, aptamers, and DNA-binding proteins specific for a selected target biomolecule are readily available in the art. For example, antibodies for a selected target biomolecule can be identified by one of skill in the art using The Antibody Registry (available on the world wide web at antibodyregistry.org); Antibodypedia (available on the world wide web at antibodypedia.com); the Validated Antibody Database (available on the world wide web at labome.com/index.html); or ABCD (available on the world wide web at web.expasy.org/abcd/); or commercial sources such as AbCam, Sigma, ThermoFisher, and BioLegend. Similar databases exist for aptamters, such as Apta-Index (available on the world wide web at aptagen.com/aptamer-index) and the Raptamer Library (available on the world wide web at raptamer.com). One of skill in the art can readily select a first binding element depending on the target biomolecule to be bound. [0037] In some embodiments of any of the aspects, the target biomolecule is a biomolecule found on a biological nanoparticle. As used herein, “biological nanoparticle” refers to particles that are on the order of about 10^-9 or one to several billionths of a meter and are of biological origin. Non-limiting examples of biological nanoparticles include an extracellular vesicle (EV), exosome, virus, viral vector, a microbe, a bacterium, or a spore. [0038] In some embodiments of any of the aspects, the target biomolecule is a biomolecule found on the surface of a biological nanoparticle, e.g., on an extracellular vesicle (EV), virus, viral vector, a microbe, a bacterium, or a spore. In some embodiments of any of the aspects, the target biomolecule is a nanovescicle surface protein. Such proteins and biomolecules are known in the art and readily selected by one of skill in the art depending on the biological nanoparticle that is to be bound. For example, further discussion of extracellular vesicle surface proteins can be found in the art at Ekstrom et al. BMC Cancer 202222:50 and Wu et la. Nature Communications 201910:3854; which are incorporated by reference herein in their entireties. As a further example, viral and viral vector surface biomolecules include capsid proteins and viral envelope proteins and glycoproteins. Further discussion of viral surface proteins can be found in the art at, e.g., Narkhede et al. Viruses 202113:1320; which is incorporated by reference herein in its entirety. 7 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT [0039] Non-limiting exemplary target biomolecules include tetraspanins (e.g., CD63, CD81, CD9), TSG101, ALIX/PDCD6IP, and EPS15. The sequences of the foregoing biomolecules are known in the art, e.g, and are available in the NCBI database for a number of species. For example, the human sequences are available under the following NCBI entires in Table 1. [0040] Table 1 Target Biomolecule NCBI Gene ID T i available in the art, e.g., as follows in Table 2. [0042] Table 2 Target Biomolecule Exemplary Antibodies (Name (Cat No; Vendor)) CD63 EPR5702 (Ab134045; Abcam) 8 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT JJ0900 (MA5-32463; Invitrogen) PDCD6IP/ALIX EPR23653-32 (ab275377; Abcam) EPR15314-33 (ab186728; Abcam) antibody reagent comprising the 6 CDRs of one of the antibodies of Table 2. [0044] In some embodiments of any of the aspects, the biological nanoparticle is at least 10x greater in size volumetrically than the capture reagent. In some embodiments of any of the aspects, the biological nanoparticle is at least 20x greater in size volumetrically than the capture reagent. In some embodiments of any of the aspects, the biological nanoparticle is at least 50x greater in size volumetrically than the capture reagent. In some embodiments of any of the aspects, the biological nanoparticle is at least 100x greater in size volumetrically than the capture reagent. [0045] In some embodiments of any of the aspects, a method described herein comprises providing the capture reagent in a stoichiometric excess compared to the biological nanoparticle. In some embodiments of any of the aspects, a method described herein comprises contacting the the biological nanoparticle with a stoichiometric excess of capture reagent. In some embodiments of any of the aspects, a method described herein comprises providing the capture reagent in at least a 10-fold stoichiometric excess compared to the biological nanoparticle. In some embodiments of any of the aspects, a method described herein comprises contacting the the biological nanoparticle with at least a 10-fold stoichiometric excess of capture reagent. In some embodiments of any of the aspects, a method described herein comprises providing the capture reagent in at least a 100-fold stoichiometric excess compared to the biological nanoparticle. In some embodiments of any of the aspects, a method described herein comprises contacting the the biological nanoparticle with at least a 100-fold stoichiometric excess of capture reagent. [0046] In some embodiments of any of the aspects, the second binding element comprises an aptamer. In some embodiments of any of the aspects, the target of the second binding element is avidin or streptavidin. In some embodiments of any of the aspects, the second binding element comprises an aptamer that binds streptavidin (or avidin). In some embodiments of any of the aspects, the second binding element comprises an aptamer that binds streptavidin (or aviding) with a lower affinity than biotin binds streptavidin (or avidin). 9 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT [0047] In some embodiments of any of the aspects, the target of the second binding element is biotin. In some embodiments of any of the aspects, the second binding element comprises an aptamer that binds biotin. In some embodiments of any of the aspects, the second binding element comprises an aptamer that binds biotin with a lower affinity than biotin binds streptavidin. [0048] Aptamers that bind streptavidin are known in the art. For example, Rugirok et al. ChemBioChem 201213:826-836 describe more than 2 dozen aptamers that bind streptavidin and provide their KDs. In some embodiments of any of the aspects, the second binding element comprises an aptamer comprising, consisting of, or consisting essentially of a sequence with at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or greater sequence identity to the sequence of SEQ ID NO:1. In some embodiments of any of the aspects, the second binding element comprises an aptamer comprising, consisting of, or consisting essentially of the sequence of SEQ ID NO:1. In some embodiments of any of the aspects, the second binding element comprises an aptamer comprising, consisting of, or consisting essentially of a sequence with at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or greater sequence identity to the sequence of one of SEQ ID NOs:1-6. In some embodiments of any of the aspects, the second binding element comprises an aptamer comprising, consisting of, or consisting essentially of the sequence of one of SEQ ID NOs:1- 6. The foregoing references are incorporated by reference herein in their entireties. [0049] In some embodiments of any of the aspects, the target of the second binding element is a His-tag, e.g., a 6x His-tag. In some embodiments of any of the aspects, the second binding element comprises an aptamer that binds a His-tag, e.g., a 6x His-tag. Aptamers that bind His tags are known in the art. For example, Kokpinar et al. Biotechnology and Bioengineering 2011108(10):2371-9 describe more aptamers that bind His tags. In some embodiments of any of the aspects, the second binding element comprises an aptamer comprising, consisting of, or consisting essentially of a sequence with at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or greater sequence identity to the sequence of one of SEQ ID NOs: 7-8. In some embodiments of any of the aspects, the second binding element comprises an aptamer comprising, consisting of, or consisting essentially of the sequence of one of SEQ ID NOs:7-8. The foregoing references are incorporated by reference herein in their entireties. [0050] In some embodiments of any of the aspects, the target of the second binding element is a Staphylococcal Protein A. In some embodiments of any of the aspects, the second binding element comprises an aptamer that binds a Staphylococcal Protein A. Aptamers that bind Staphylococcal Protein A are known in the art. For example, Baumstummler et al. Letters in Applied Microbiology 201459:422-431 describe more aptamers that bind Staphylococcal Protein A. In some embodiments of any of the aspects, the second binding element comprises an aptamer comprising, consisting of, or consisting essentially of a sequence with at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or greater sequence identity to the sequence of one of SEQ ID NOs: 9-10. In some embodiments 10 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT of any of the aspects, the second binding element comprises an aptamer comprising, consisting of, or consisting essentially of the sequence of one of SEQ ID NOs: 9-10. The foregoing references are incorporated by reference herein in their entireties. [0051] Table 3 Aptamer Sequence SEQ ID NO [ ] ternat ve y, n some em o ments o any o t e aspects, t e secon n ng e ement comprises a synthetic analogues of biotin and the target comprises streptavidin (or avidin). Such synthetic analogues are known in the art, e.g., desthiobiotin. In some embodiments of any of the aspects, the synthetic analogue of biotin binds to streptavidin (or avidin) with a lower affinity than biotin binds to streptavidin (or avidin). [0053] Alternatively, in some embodiments of any of the aspects, the second binding element comprises a biotin molecule and a cleavable linker. A cleavable linker is a linker that can be cleaved to release the two parts the linker is holding together. A cleavable linker can be susceptible to cleavage agents, such as, but not limited to, enzymes, pH, redox potential or the presence of degradative molecules. Examples of such agents include but are not limited to: redox agents which are selected for particular substrates or which have no substrate specificity, including, e.g., oxidative or reductive enzymes or reductive agents such as mercaptans, present in cells, that can degrade a redox cleavable linking group by reduction; esterases; amidases; endosomes or agents that can create an acidic environment, e.g., those that result in a pH of five or lower; enzymes that can hydrolyze or degrade an acid cleavable linking group by acting as a general acid, peptidases (which can be substrate specific) and proteases, and phosphatases. Such cleavable linkers are known in the art and include, by way of non- 11 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT limiting example an ester, a thioester, a hydrazine, a disulfide, or a protease linker. In some embodiments, the cleavable linker is bromomaleimide-based linker. In such embodiments, the competing reagent is not needed, and instead, the method comprises contacting with a reagent that cleaves the cleavable linker. [0054] As described herein, the second binding element binds reversibly to its target and can be competed off that target. Also described herein is a competing reagent that binds the target of the second binding element with greater affinity than the second binding element binds the target. Such sets of elements (second binding element, target, and competing reagents) are known in the art for a variety of targets. As but one example, the aptamers of Table 3 have varying affinities for biotin (e.g., as laid out in Rugirok et al. ChemBioChem 201213:826-836) and a pair of aptamers of Table 3 can be a second binding element and a competing reagent when the target is biotin. Alternatively, when the target is streptavidin, the second binding element can be an aptamer (e.g., of Table 3) and the competing reagent can be biotin. Alternatively, when the target is biotin, the competing reagent can be streptavidin or avidin. Accordingly, as used herein “competing reagent” refers to a reagent (e.g, a polypeptide, peptide, antibody, antibody reagent, oligonucleotide, etc) that binds the target of the second binding element with a greater affinity than the second binding element. [0055] In some embodiments of any of the aspects, the third binding element comprises an oligonucleotide sequence of at least 10 bp in length. In some embodiments of any of the aspects, the third binding element comprises an oligonucleotide sequence of at least 15 bp in length. In some embodiments of any of the aspects, the third binding element comprises an oligonucleotide sequence of at least 18 bp in length. In some embodiments of any of the aspects, the third binding element comprises an oligonucleotide sequence of 10-50 bp in length. In some embodiments of any of the aspects, the third binding element comprises an oligonucleotide sequence of at 15-30 bp in length. [0056] In some embodiments of any of the aspects, the third binding element comprises an oligonucleotide sequence having a Tm of 40 C or higher. In some embodiments of any of the aspects, the third binding element comprises an oligonucleotide sequence having a Tm of 45 C or higher. In some embodiments of any of the aspects, the third binding element comprises an oligonucleotide sequence having a Tm of 47 C or higher. In some embodiments of any of the aspects, the third binding element comprises an oligonucleotide sequence having a Tm of 48 C or higher. In some embodiments of any of the aspects, the third binding element comprises an oligonucleotide sequence having a Tm of from 40 C to 65 C. In some embodiments of any of the aspects, the third binding element comprises an oligonucleotide sequence having a Tm of from 45 C to 60 C. In some embodiments of any of the aspects, the third binding element comprises an oligonucleotide sequence having a Tm of from 48 C to 55 C. [0057] For embodiments, e.g., kits or methods, utilizing multiple unique third binding elements, e.g., as barcode elements, the third binding elements can be selected from the sequences of the 12 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT GeneFlex™ Tag Array collection (Affymetrix, Santa Clara, CA). This array provides sequence information for 2000 oligonucleotides with minimal tendency for cross-hybridization. Similar collections of barcode nucleotides with minimal cross-hybridization are known in the art, and such sequences can be utilized by one of skill in the art as third binding elements in embodiments of the instant technology. [0058] In use, the kit, device or method described herein comprises a support comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence of the third binding element. As used herein, “complementary” when used in the context of a third binding element and an oligonucleotide refers to a level of complementarity between the third binding element and the oligonucleotide such that there exists an annealing temperature at which the third binding element will anneal to the oligonucleotide and will not anneal to non-target sequences present in a kit, device, or support. [0059] In some embodiments of any of the aspects, the first binding element and second binding element are contiguous. In some embodiments of any of the aspects, the first binding element and third binding element are contiguous. In some embodiments of any of the aspects, the second binding element and third binding element are contiguous. In some embodiments of any of the aspects, the first binding element and second binding element are contiguous, and the second binding element and third binding element are contiguous. [0060] In some embodiments of any of the aspects, the first binding element and second binding element are separated by a linker domain. In some embodiments of any of the aspects, the first binding element and third binding element are separated by a linker domain. In some embodiments of any of the aspects, the second binding element and third binding element are separated by a linker domain. In some embodiments of any of the aspects, the first binding element and second binding element are separated by a linker domain, and the second binding element and third binding element are separated by a linker domain. [0061] In some embodiments of any of the aspects, the first binding element and second binding element are separated by a linker domain, and the second binding element and third binding element are continguous. [0062] In some embodiments of any of the aspects, any two domains or portions as described herein in a polypeptide can be joined into a single polypeptide by positioning a peptide linker, e.g., a flexible linker between them. As used herein “linker” refers to an oligonucleotide or polypeptide region from about 2 to 100 nucleotides or amino acids in length, which links together any of the binding elements of the capture reagents as described herein. In some embodiment, linkers can include or be composed of flexible residues such as glycine and serine so that the adjacent protein domains are free to move relative to one another. Longer linkers may be used when it is desirable to ensure that two adjacent domains do not sterically interfere with one another. Linkers may be 13 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT cleavable or non-cleavable. In some embodiments, the linker is an oligonucleotide linker. In some embodiments, the linker is an oligonucleotide linker comprising 2-20 nucleotides. In some embodiments, the linker is an oligonucleotide linker comprising 2-20 adenosines. [0063] In some embodiments of any of the aspects, the first binding element is a polypeptide molecule and the second binding element and third binding elements are an oligonucleotide, and the capture reagent is a polypeptide-nucleotide conjugate. The term “conjugation,” refers to two or more molecular structures that are linked by a direct or indirect covalent or non-covalent bond. Non- covalent interactions include, but are not limited to, electrostatic interactions, hydrogen bonding interactions, van der Waals interactions, dipole-dipole interactions, π-π stacking, magnetic interactions, and metal coordination. In some embodiments of any of the aspects, the conjugation is via covalent bonds. [0064] Various methods of making such conjugates are well known in the art and include, e.g., via disulfides, hyrazones, thioethers, lysine-based conjugation, cysteine-based conjugation, DBCO- azide click chemistry, and the like. Further discussion of conjugation can be found, e.g., at Dugal- Tessier et al. J Clin Med 202110:838; which is incorporated by reference herein in its entirety. Numerous commercial sources offer conjugation services suitable for providing capture reagents according to the methods and compositions described herein, e.g. AbCam; Cambridge UK or NJ Bio; Princeton NJ. [0065] Methods of making polypeptides and antibody reagents are well known in the art, and numerous commercial sources offer pre-made polypeptides/antibody reagents or production services suitable for providing elements according to the methods and compositions described herein, e.g. the antibody sources described elsewhere herein. Methods of making oligonucleotides are well known in the art, and numerous commercial sources offer oligonucleotide synthesis services suitable for providing elements according to the methods and compositions described herein, e.g. INVITROGEN™ Custom DNA Oligos; Life Technologies; Grand Island, NY or custom DNA Oligos from IDT; Coralville, IA). [0066] In one aspect of any of the embodiments, described herein is a kit comprising a capture reagent, the capture reagent comprising: a first binding element that binds specifically to a target biomolecule; a second binding element that reversibly binds to a target and which can be competed off of the target; and a third binding element comprising an oligonucleotide sequence. [0067] In one aspect of any of the embodiments, described herein is a kit comprising a plurality of capture reagents, each capture reagent comprising: a first binding element that binds specifically to a target biomolecule; 14 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT a second binding element that reversibly binds to a target and which can be competed off of the target; and a third binding element comprising an oligonucleotide sequence. In embodiments comprising a plurality of capture reagents, each of the plurality of capture reagents can comprise a unique first binding element. In some embodiments of any of the aspects, each unique first binding element binds specifically to a unique target biomolecule. In some embodiments of any of the aspects, each unique first binding element binds specifically to a unique epitope of a target biomolecule (e.g., unique epitopes on a single biomolecule or unique epitopes on different biomolecules). In embodiments comprising a plurality of capture reagents, each of the plurality of capture reagents can comprise a unique third binding element. In embodiments comprising a plurality of capture reagents, each of the plurality of capture reagents can comprise identical second binding elements. [0068] The capture reagents described herein can be utilized to capture particles or molecules, e.g., a biological nanoparticle in conjuction with one or more supports that collectively comprise the target of the second binding element and the at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence of the third binding element. Accordingly, in one of the aspects of any of the embodiments, described herein is a kit comprising at least one capture reagent or plurality of capture reagents described herein and further comprising: a first support comprising the target of the second binding element; and at least one of: i) the first support further comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence of the third binding element; and ii) a second support comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence of the third binding element. In some embodiments of any of the aspects, the target of the second binding element and the at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence of the third binding element are found on different supports in the kit. In some embodiments of any of the aspects, the target of the second binding element and the at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence of the third binding element are found on the same support in the kit. In some embodiments of any of the aspects, the target of the second binding element and the at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence of the third binding element are found on different regions, spots, zones, areas, or ends of the same support in the kit. [0069] In some embodiments, the support can comprise a particle (including, but not limited to an agarose or latex bead or particle or a magnetic particle), a bead, a nanoparticle, a polymer, a 15 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT substrate, a slide, a coverslip, a plate, a dish, a well, a membrane, and/or a grating. The support can include many different materials including, but not limited to, polymers, plastics, resins, polysaccharides, silicon or silica based materials, carbon, metals, inorganic glasses, and membranes. [0070] In some embodiments of any of the aspects, the first support is a particle. In some embodiments of any of the aspects, the first support is a nanoparticle. In some embodiments of any of the aspects, the first support is a bead. [0071] In some embodiments of any of the aspects, the first support is a magnetic particle. In some embodiments of any of the aspects, the first support is a magnetic nanoparticle. In some embodiments of any of the aspects, the first support is a nanoparticle. In some embodiments of any of the aspects, the first support is a magnetic bead. [0072] In some embodiments of any of the aspects, one of the supports or both of the supports are provided on a surface of a substrate or a device. As used herein, a “substrate” refers to a structure, that provides a surface suitable for adherence of capture reagents bound to biological particles. The substrate can comprise patterns, grooves, channels, and/or supports. [0073] In some embodiments of any of the aspects, the substate, device, or support comprising comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence of the third binding element is a detection device or detection device substrate. As used herein, a “detection device” refers to a device or machine that can perceive a signal. The signal can be generated by a material being analyzed, or produced by the detection device. Detection devices include but are not limited to spectroscopic, interferometic, photochemical, biochemical, immunochemical, electromagnetic, radiochemical, or chemical detection devices are and well known in the art. [0074] Materials for detection device substrates are known in the art and will vary depending on the signal to be be detected and the individual detection device to be used. In some embodiments of any of the aspects, the detection device substrate and/or the support comprising the at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence of the third binding element comprises silicon, silicon oxide, gold, glass, and/or plastic. [0075] In some embodiments of any of the aspects, the detection device substrate and/or the support comprising the at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence of the third binding element comprises silicon and/or silicon oxide, e.g., when the detection device is a Single-Particle Interferometric Reflectance Imaging Sensor (SP-IRIS) device. In some embodiments of any of the aspects, the detection device substrate and/or the support comprising the at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence of the third binding element is a Single-Particle Interferometric Reflectance Imaging Sensor (SP-IRIS) substrate. SP-IRIS is known in the art and further details can be found, e.g., in Acvi et al. Sensors (Basel) 201515:17649-65; which is incorporated by reference herein in its entirety. 16 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT [0076] In some embodiments of any of the aspects, the detection device substrate and/or the support comprising the at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence of the third binding element comprises gold, e.g., when the detection device is a Surface Plasmon Resonance (SPR) or interferometic technique device. In some embodiments of any of the aspects, the detection device substrate and/or the support comprising the at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence of the third binding element is Surface Plasmon Resonance (SPR) or interferometic technique substrate. [0077] In some embodiments of any of the aspects, the target of the second binding element and the at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence of the third binding element are found on different supports on a single substrate or device. In some embodiments of any of the aspects, the target of the second binding element and the at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence of the third binding element are found on different supports in a single substrate or device. For example, the target of the second binding element can be provided on magnetic particles in a kit or imaging device, and the at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence of the third binding element can be provided on a detection device substrate. [0078] In one aspect of any of the embodiments, described herein is a method comprising: a) contacting a sample comprising one or more biological nanoparticles with at least one capture reagent as described herein, thereby forming capture reagent-biological nanoparticle complexes; b) contacting the capture reagent-biological nanoparticle complexes with a first support comprising the target of the second binding element, thereby binding the capture reagent-biological nanoparticle complexes to the first support; c) contacting the first support and the capture reagent-biological nanoparticle complexes bound to the first support with a competing reagent that binds the target of the second binding element with greater affinity than the second binding element binds the target, thereby releasing the capture reagent-biological nanoparticles complexes from the first support; and d) contacting the released capture reagent-biological nanoparticles complexes with: the first support, the first support further comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence of the third binding element, thereby binding the capture reagent- biological nanoparticle complexes to the first support; or a further support comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence of the third binding element, 17 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT thereby binding the capture reagent-biological nanoparticle complexes to the second support. In one aspect of any of the embodiments, described herein is a method comprising: a) contacting at least one capture reagent as described herein with a first support comprising the target of the second binding element, thereby binding the capture reagent to the first support; b) contacting a sample comprising one or more biological nanoparticles with the capture reagent bound to the first support, thereby forming capture reagent-biological nanoparticle complexes bound to the first support; c) contacting the first support and the capture reagent-biological nanoparticle complexes bound to the first support with a competing reagent that binds the target of the second binding element with greater affinity than the second binding element binds the target, thereby releasing the capture reagent-biological nanoparticles complexes from the first support; and d) contacting the released capture reagent-biological nanoparticles complexes with: the first support, the first support further comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence of the third binding element, thereby binding the capture reagent- biological nanoparticle complexes to the first support; or a further support comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence of the third binding element, thereby binding the capture reagent-biological nanoparticle complexes to the second support. In some embodiments of any of the aspects, the method further comprises detecting the capture reagent-biological nanoparticle complexes bound in step d). The detecting can comprise detecting a signal as described elsewhere herein with a detection device as described elsewhere herein. In some embodiments of any of the aspects, the detecting comprises the use of a Single-Particle Interferometric Reflectance Imaging Sensor (SP-IRIS). [0079] In some embodiments of any of the aspects, the method does not comprise washing unbound capture reagents from the support or supports. In some embodiments of any of the aspects, the method does comprise washing unbound capture reagents and/or unbound capture reagent- biological nanoparticle complexes from the support or supports. [0080] In some embodiments of any of the aspects, the method does not comprise contacting the capture reagent with DNase. In some embodiments of any of the aspects, the method does not comprise contacting capture reagent-biological nanoparticle complexes bound to the first support with DNase. In some embodiments of any of the aspects, the method does not comprise contacting the 18 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT capture reagent with glycine. In some embodiments of any of the aspects, the method does not comprise contacting capture reagent-biological nanoparticle complexes bound to the first support with glycine. In some embodiments of any of the aspects, the method does not comprise contacting the capture reagent with a detergent. In some embodiments of any of the aspects, the method does not comprise contacting capture reagent-biological nanoparticle complexes bound to the first support with a detergent. In some embodiments of any of the aspects, the method does not comprise contacting the capture reagent-biological nanoparticle with a buffer or solution with a pH lower than 5.0. In some embodiments of any of the aspects, the method does not comprise contacting the capture reagent- biological nanoparticle with a buffer or solution with a pH lower than 4.0. In some embodiments of any of the aspects, the method does not comprise contacting capture reagent-biological nanoparticle complexes bound to the first support with a buffer or solution with a pH of 3.0 or lower. A non- limiting example of such a buffer is is 0.1 M glycine•HCl, pH 2.5-3.0. This buffer effectively dissociates most protein-protein and antibody-antigen binding interactions without permanently affecting protein structure. [0081] In some embodiments of any of the aspects, the method is performed at a temperature of 35 C or less. In some embodiments of any of the aspects, the method is performed at a temperature of 30 C or less. [0082] In some embodiments of any of the aspects, the biological nanoparticle is intact before step a. In some embodiments of any of the aspects, the biological nanoparticle is intact after step d. In some embodiments of any of the aspects, the biological nanoparticle is intact before step a and after step d. In some embodiments of any of the aspects, a lipid bilayer or envelope of the biological nanoparticle is intact before step a. In some embodiments of any of the aspects, a lipid bilayer or envelope of the biological nanoparticle is intact after step d. In some embodiments of any of the aspects, a lipid bilayer or envelope of the biological nanoparticle is intact before step a and after step d. [0083] In some embodiments of any of the aspects, the method further comprises a step e) of scanning/assaying/measuring one or more more aspect or property of the capture reagent-biological nanoparticle complexes bound to the second support. Such aspects and properties include but are not limited to quantification of biological nanoparticles, detecting (quantitatively or qualitatively) the protein composition of the biological nanoparticles, detecting (quantitatively or qualitatively) the topology of the biological nanoparticles, assaying one or more functions of the biological nanoparticles. Such assays and methods are known in the art and further description can be found, e.g., in Thery et al. Journal of Extracellular Vesicles 2018:1535750; which is incorporated by reference herein in its entirety. [0084] In one respect, the present invention relates to the herein described compositions, methods, and respective component(s) thereof, as essential to the technology, yet open to the inclusion 19 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT of unspecified elements, essential or not ("comprising). In some embodiments of any of the aspects, other elements to be included in the description of the composition, method or respective component thereof are limited to those that do not materially affect the basic and novel characteristic(s) of the technology (e.g., the composition, method, or respective component thereof “consists essentially of” the elements described herein). This applies equally to steps within a described method as well as compositions and components therein. In other embodiments of any of the aspects, the compositions, methods, and respective components thereof, described herein are intended to be exclusive of any element not deemed an essential element to the component, composition or method (e.g., the composition, method, or respective component thereof “consists of” the elements described herein). This applies equally to steps within a described method as well as compositions and components therein. [0085] For convenience, the meaning of some terms and phrases used in the specification, examples, and appended claims, are provided below. Unless stated otherwise, or implicit from context, the following terms and phrases include the meanings provided below. The definitions are provided to aid in describing particular embodiments, and are not intended to limit the claimed invention, because the scope of the invention is limited only by the claims. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. If there is an apparent discrepancy between the usage of a term in the art and its definition provided herein, the definition provided within the specification shall prevail. [0086] For convenience, certain terms employed herein, in the specification, examples and appended claims are collected here. [0087] In some embodiments, the biological nanoparticle is in a sample, or obtained from a sample. The term “sample” or “test sample” as used herein denotes a sample taken or isolated from a biological organism, e.g., a blood or plasma sample from a subject. In some embodiments of any of the aspects, the present invention encompasses several examples of a biological sample. In some embodiments of any of the aspects, the biological sample is cells, or tissue, or peripheral blood, or bodily fluid. Exemplary biological samples include, but are not limited to, a biopsy, a tumor sample, biofluid sample; blood; serum; plasma; urine; sperm; mucus; tissue biopsy; organ biopsy; synovial fluid; bile fluid; cerebrospinal fluid; mucosal secretion; effusion; sweat; saliva; and/or tissue sample etc. The term also includes a mixture of the above-mentioned samples. The term “test sample” also includes untreated or pretreated (or pre-processed) biological samples. In some embodiments of any of the aspects, a test sample can comprise cells from a subject. In some embodiments of any of the aspects, the test sample can be a blood sample. In some embodiments of any of the aspects, the test sample can be a plasma sample. In some embodiments of any of the aspects, the test sample can be a serum sample. 20 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT [0088] The test sample can be obtained by removing a sample from a subject, but can also be accomplished by using a previously isolated sample (e.g. isolated at a prior timepoint and isolated by the same or another person). [0089] In some embodiments of any of the aspects, the test sample can be an untreated test sample. As used herein, the phrase “untreated test sample” refers to a test sample that has not had any prior sample pre-treatment except for dilution and/or suspension in a solution. Exemplary methods for treating a test sample include, but are not limited to, centrifugation, filtration, sonication, homogenization, heating, freezing and thawing, and combinations thereof. In some embodiments of any of the aspects, the test sample can be a frozen test sample, e.g., a frozen tissue. The frozen sample can be thawed before employing methods, assays and systems described herein. After thawing, a frozen sample can be centrifuged before being subjected to methods, assays and systems described herein. In some embodiments of any of the aspects, the test sample is a clarified test sample, for example, by centrifugation and collection of a supernatant comprising the clarified test sample. In some embodiments of any of the aspects, a test sample can be a pre-processed test sample, for example, supernatant or filtrate resulting from a treatment selected from the group consisting of centrifugation, filtration, thawing, purification, and any combinations thereof. In some embodiments of any of the aspects, the test sample can be treated with a chemical and/or biological reagent. Chemical and/or biological reagents can be employed to protect and/or maintain the stability of the sample, including biomolecules (e.g., nucleic acid and protein) therein, during processing. One exemplary reagent is a protease inhibitor, which is generally used to protect or maintain the stability of protein during processing. The skilled artisan is well aware of methods and processes appropriate for pre-processing of biological samples required for capture of a biological nanoparticle as described herein. [0090] In some embodiments of any of the aspects, the methods, assays, and systems described herein can further comprise a step of obtaining or having obtained a test sample from a subject. In some embodiments of any of the aspects, the subject can be a human subject. [0091] The terms “decrease”, “reduced”, “reduction”, or “inhibit” are all used herein to mean a decrease by a statistically significant amount. In some embodiments, “reduce,” “reduction" or “decrease" or “inhibit” typically means a decrease by at least 10% as compared to a reference level (e.g. the absence of a given treatment or agent) and can include, for example, a decrease by at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99% , or more. As used herein, “reduction” or “inhibition” does not encompass a complete inhibition or reduction as compared to a reference level. “Complete inhibition” is a 100% inhibition as compared to a reference level. 21 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT [0092] The terms “increased”, “increase”, “enhance”, or “activate” are all used herein to mean an increase by a statically significant amount. In some embodiments, the terms “increased”, “increase”, “enhance”, or “activate” can mean an increase of at least 10% as compared to a reference level, for example an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a 100% increase or any increase between 10-100% as compared to a reference level, or at least about a 2-fold, or at least about a 3-fold, or at least about a 4-fold, or at least about a 5-fold or at least about a 10-fold increase, or any increase between 2-fold and 10-fold or greater as compared to a reference level. [0093] As used herein, a "subject" means a human or animal. Usually, the animal is a vertebrate such as a primate, rodent, domestic animal or game animal. Primates include chimpanzees, cynomologus monkeys, spider monkeys, and macaques, e.g., Rhesus. Rodents include mice, rats, woodchucks, ferrets, rabbits and hamsters. Domestic and game animals include cows, horses, pigs, deer, bison, buffalo, feline species, e.g., domestic cat, canine species, e.g., dog, fox, wolf, avian species, e.g., chicken, emu, ostrich, and fish, e.g., trout, catfish and salmon. In some embodiments, the subject is a mammal, e.g., a primate, e.g., a human. The terms, “individual,” “patient” and “subject” are used interchangeably herein. [0094] Preferably, the subject is a mammal. The mammal can be a human, non-human primate, mouse, rat, dog, cat, horse, or cow, but is not limited to these examples. A subject can be male or female. [0095] As used herein, the terms “protein" and “polypeptide" are used interchangeably herein to designate a series of amino acid residues, connected to each other by peptide bonds between the alpha-amino and carboxy groups of adjacent residues. The terms "protein", and "polypeptide" refer to a polymer of amino acids, including modified amino acids (e.g., phosphorylated, glycated, glycosylated, etc.) and amino acid analogs, regardless of its size or function. "Protein" and “polypeptide” are often used in reference to relatively large polypeptides, whereas the term "peptide" is often used in reference to small polypeptides, but usage of these terms in the art overlaps. The terms "protein" and "polypeptide" are used interchangeably herein when referring to a gene product and fragments thereof. Thus, exemplary polypeptides or proteins include gene products, naturally occurring proteins, homologs, orthologs, paralogs, fragments and other equivalents, variants, fragments, and analogs of the foregoing. The terms also refer to fragments or variants of the polypeptide that maintain at least 50% of the activity or effect, e.g. binding activity of the full length polypeptide. Conservative substitution variants that maintain the activity of wildtype will include a conservative substitution as defined herein. The identification of amino acids most likely to be tolerant of conservative substitution while maintaining at least 50% of the activity of the wildtype is guided by, for example, sequence alignment with homologs or paralogs from other species. Amino 22 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT acids that are identical between homologs are less likely to tolerate change, while those showing conservative differences are obviously much more likely to tolerate conservative change in the context of an artificial variant. Similarly, positions with non-conservative differences are less likely to be critical to function and more likely to tolerate conservative substitution in an artificial variant. [0096] In some embodiments, a polypeptide can be a variant of a sequence described herein. In some embodiments, the variant is a conservative substitution variant. Variants can be obtained by mutations of native nucleotide sequences, for example. A “variant,” as referred to herein, is a polypeptide substantially homologous to a native or reference polypeptide, but which has an amino acid sequence different from that of the native or reference polypeptide because of one or a plurality of deletions, insertions or substitutions. Polypeptide-encoding DNA sequences encompass sequences that comprise one or more additions, deletions, or substitutions of nucleotides when compared to a native or reference DNA sequence, but that encode a variant protein or fragment thereof that retains the relevant biological activity relative to the reference protein, e.g., can bind a target biomolecule at least 50% as well as wildtype. As to amino acid sequences, one of skill will recognize that individual substitutions, deletions or additions to a nucleic acid, peptide, polypeptide, or protein sequence which alters a single amino acid or a small percentage, (i.e.5% or fewer, e.g.4% or fewer, or 3% or fewer, or 1% or fewer) of amino acids in the encoded sequence is a “conservatively modified variant” where the alteration results in the substitution of an amino acid with a chemically similar amino acid. It is contemplated that some changes can potentially improve the relevant activity, such that a variant, whether conservative or not, has more than 100% of the activity of the wildtype, e.g.110%, 125%, 150%, 175%, 200%, 500%, 1000% or more. [0097] One method of identifying amino acid residues which can be substituted is to align, for example, human polypeptide to a homolog from one or more non-human species. Alignment can provide guidance regarding not only residues likely to be necessary for function but also, conversely, those residues likely to tolerate change. Where, for example, an alignment shows two identical or similar amino acids at corresponding positions, it is more likely that that site is important functionally. Where, conversely, alignment shows residues in corresponding positions to differ significantly in size, charge, hydrophobicity, etc., it is more likely that that site can tolerate variation in a functional polypeptide. The variant amino acid or DNA sequence can be at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more, identical to a native or reference sequence. The degree of homology (percent identity) between a native and a mutant sequence can be determined, for example, by comparing the two sequences using freely available computer programs commonly employed for this purpose on the world wide web. The variant amino acid or DNA sequence can be at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more, similar to the sequence from which it is derived (referred to herein as an “original” sequence). The degree of similarity (percent similarity) between an original 23 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT and a mutant sequence can be determined, for example, by using a similarity matrix. Similarity matrices are well known in the art and a number of tools for comparing two sequences using similarity matrices are freely available online, e.g. BLASTp or BLASTn (available on the world wide web at blast.ncbi.nlm.nih.gov), with default parameters set. [0098] In the various embodiments described herein, it is further contemplated that variants (naturally occurring or otherwise), alleles, homologs, conservatively modified variants, and/or conservative substitution variants of any of the particular polypeptides described are encompassed. As to amino acid sequences, one of skill will recognize that individual substitutions, deletions or additions to a nucleic acid, peptide, polypeptide, or protein sequence which alters a single amino acid or a small percentage of amino acids in the encoded sequence is a “conservatively modified variant" where the alteration results in the substitution of an amino acid with a chemically similar amino acid and retains the desired activity of the polypeptide. Such conservatively modified variants are in addition to and do not exclude polymorphic variants, interspecies homologs, and alleles consistent with the disclosure. [0099] A given amino acid can be replaced by a residue having similar physiochemical characteristics, e.g., substituting one aliphatic residue for another (such as Ile, Val, Leu, or Ala for one another), or substitution of one polar residue for another (such as between Lys and Arg; Glu and Asp; or Gln and Asn). Other such conservative substitutions, e.g., substitutions of entire regions having similar hydrophobicity characteristics, are well known. Polypeptides comprising conservative amino acid substitutions can be tested in any one of the assays described herein to confirm that a desired activity, e.g. binding affinity and specificity of a native or reference polypeptide is retained. [00100] A given amino acid can be replaced by a residue having similar physiochemical characteristics, e.g., substituting one aliphatic residue for another (such as Ile, Val, Leu, or Ala for one another), or substitution of one polar residue for another (such as between Lys and Arg; Glu and Asp; or Gln and Asn). Other such conservative substitutions, e.g., substitutions of entire regions having similar hydrophobicity characteristics, are well known. Polypeptides comprising conservative amino acid substitutions can be tested in any one of the assays described herein to confirm that a desired activity of a native or reference polypeptide is retained. Conservative substitution tables providing functionally similar amino acids are well known in the art. Such conservatively modified variants are in addition to and do not exclude polymorphic variants, interspecies homologs, and alleles consistent with the disclosure. [00101] Amino acids can be grouped according to similarities in the properties of their side chains (in A. L. Lehninger, in Biochemistry, second ed., pp.73-75, Worth Publishers, New York (1975)): (1) non-polar: Ala (A), Val (V), Leu (L), Ile (I), Pro (P), Phe (F), Trp (W), Met (M); (2) uncharged polar: Gly (G), Ser (S), Thr (T), Cys (C), Tyr (Y), Asn (N), Gln (Q); (3) acidic: Asp (D), Glu (E); (4) basic: Lys (K), Arg (R), His (H). Alternatively, naturally occurring residues can be divided into groups 24 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT based on common side-chain properties: (1) hydrophobic: Norleucine, Met, Ala, Val, Leu, Ile; (2) neutral hydrophilic: Cys, Ser, Thr, Asn, Gln; (3) acidic: Asp, Glu; (4) basic: His, Lys, Arg; (5) residues that influence chain orientation: Gly, Pro; (6) aromatic: Trp, Tyr, Phe. Non-conservative substitutions will entail exchanging a member of one of these classes for another class. Particular conservative substitutions include, for example; Ala into Gly or into Ser; Arg into Lys; Asn into Gln or into His; Asp into Glu; Cys into Ser; Gln into Asn; Glu into Asp; Gly into Ala or into Pro; His into Asn or into Gln; Ile into Leu or into Val; Leu into Ile or into Val; Lys into Arg, into Gln or into Glu; Met into Leu, into Tyr or into Ile; Phe into Met, into Leu or into Tyr; Ser into Thr; Thr into Ser; Trp into Tyr; Tyr into Trp; and/or Phe into Val, into Ile or into Leu. Typically conservative substitutions for one another also include: 1) Alanine (A), Glycine (G); 2) Aspartic acid (D), Glutamic acid (E); 3) Asparagine (N), Glutamine (Q); 4) Arginine (R), Lysine (K); 5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V); 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W); 7) Serine (S), Threonine (T); and 8) Cysteine (C), Methionine (M) (see, e.g., Creighton, Proteins (1984)). [00102] In some embodiments, the polypeptide described herein can be a variant of a sequence described herein. In some embodiments, the variant is a conservatively modified variant. Conservative substitution variants can be obtained by mutations of native nucleotide sequences, for example. A “variant," as referred to herein, is a polypeptide substantially homologous to a native or reference polypeptide, but which has an amino acid sequence different from that of the native or reference polypeptide because of one or a plurality of deletions, insertions or substitutions. Variant polypeptide- encoding DNA sequences encompass sequences that comprise one or more additions, deletions, or substitutions of nucleotides when compared to a native or reference DNA sequence, but that encode a variant protein or fragment thereof that retains activity. A wide variety of PCR-based site-specific mutagenesis approaches are known in the art and can be applied by the ordinarily skilled artisan. [00103] In some embodiments, a polypeptide can comprise one or more amino acid substitutions or modifications. In some embodiments, the substitutions and/or modifications can prevent or reduce proteolytic degradation and/or prolong half-life of the polypeptide in a subject. In some embodiments, a polypeptide can be modified by conjugating or fusing it to other polypeptide or polypeptide domains such as, by way of non-limiting example, transferrin (WO06096515A2), albumin (Yeh et al., 1992), growth hormone (US2003104578AA); cellulose (Levy and Shoseyov, 2002); and/or Fc fragments (Ashkenazi and Chamow, 1997). The references in the foregoing paragraph are incorporated by reference herein in their entireties. [00104] In some embodiments, a polypeptide as described herein can comprise at least one peptide bond replacement. A polypeptide as described herein can comprise one type of peptide bond replacement or multiple types of peptide bond replacements, e.g.2 types, 3 types, 4 types, 5 types, or more types of peptide bond replacements. Non-limiting examples of peptide bond replacements include urea, thiourea, carbamate, sulfonyl urea, trifluoroethylamine, ortho-(aminoalkyl)-phenylacetic 25 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT acid, para-(aminoalkyl)-phenylacetic acid, meta-(aminoalkyl)-phenylacetic acid, thioamide, tetrazole, boronic ester, olefinic group, and derivatives thereof. [00105] In some embodiments, a polypeptide, as described herein can comprise naturally occurring amino acids commonly found in polypeptides and/or proteins produced by living organisms, e.g. Ala (A), Val (V), Leu (L), Ile (I), Pro (P), Phe (F), Trp (W), Met (M), Gly (G), Ser (S), Thr (T), Cys (C), Tyr (Y), Asn (N), Gln (Q), Asp (D), Glu (E), Lys (K), Arg (R), and His (H). In some embodiments, a polypeptide as described herein can comprise alternative amino acids. Non- limiting examples of alternative amino acids include, D-amino acids; beta-amino acids; homocysteine, phosphoserine, phosphothreonine, phosphotyrosine, hydroxyproline, gamma-carboxyglutamate; hippuric acid, octahydroindole-2-carboxylic acid, statine, 1,2,3,4,-tetrahydroisoquinoline-3-carboxylic acid, penicillamine (3-mercapto-D-valine), ornithine, citruline, alpha-methyl-alanine, para- benzoylphenylalanine, para-amino phenylalanine, p-fluorophenylalanine, phenylglycine, propargylglycine, sarcosine, and tert-butylglycine), diaminobutyric acid, 7-hydroxy- tetrahydroisoquinoline carboxylic acid, naphthylalanine, biphenylalanine, cyclohexylalanine, amino- isobutyric acid, norvaline, norleucine, tert-leucine, tetrahydroisoquinoline carboxylic acid, pipecolic acid, phenylglycine, homophenylalanine, cyclohexylglycine, dehydroleucine, 2,2-diethylglycine, 1- amino-l-cyclopentanecarboxylic acid, 1-amino-l-cyclohexanecarboxylic acid, amino-benzoic acid, amino-naphthoic acid, gamma-aminobutyric acid, difluorophenylalanine, nipecotic acid, alpha-amino butyric acid, thienyl-alanine, t-butylglycine, trifluorovaline; hexafluoroleucine; fluorinated analogs; azide-modified amino acids; alkyne-modified amino acids; cyano-modified amino acids; and derivatives thereof. [00106] In some embodiments, a polypeptide, can be modified, e.g. by addition of a moiety to one or more of the amino acids that together comprise the peptide. In some embodiments, a polypeptide as described herein can comprise one or more moiety molecules, e.g.1 or more moiety molecules per polypeptide, 2 or more moiety molecules per polypeptide, 5 or more moiety molecules per polypeptide, 10 or more moiety molecules per polypeptide or more moiety molecules per polypeptide. In some embodiments, a polypeptide as described herein can comprise one more types of modifications and/or moieties, e.g.1 type of modification, 2 types of modifications, 3 types of modifications or more types of modifications. Non-limiting examples of modifications and/or moieties include PEGylation; glycosylation; HESylation; ELPylation; lipidation; acetylation; amidation; end-capping modifications; cyano groups; phosphorylation; albumin, and cyclization. In some embodiments, an end-capping modification can comprise acetylation at the N-terminus, N- terminal acylation, and N-terminal formylation. In some embodiments, an end-capping modification can comprise amidation at the C-terminus, introduction of C-terminal alcohol, aldehyde, ester, and thioester moieties. The half-life of a polypeptide can be increased by the addition of moieties, e.g. PEG, albumin, or other fusion partners (e.g. Fc fragment of an immunoglobin). 26 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT [00107] Any cysteine residue not involved in maintaining the proper conformation of the polypeptide also can be substituted, generally with serine, to improve the oxidative stability of the molecule and prevent aberrant crosslinking. Conversely, cysteine bond(s) can be added to the polypeptide to improve its stability or facilitate oligomerization. [00108] Alterations of the native amino acid sequence can be accomplished by any of a number of techniques known to one of skill in the art. Mutations can be introduced, for example, at particular loci by synthesizing oligonucleotides containing a mutant sequence, flanked by restriction sites enabling ligation to fragments of the native sequence. Following ligation, the resulting reconstructed sequence encodes an analog having the desired amino acid insertion, substitution, or deletion. Alternatively, oligonucleotide-directed site-specific mutagenesis procedures can be employed to provide an altered nucleotide sequence having particular codons altered according to the substitution, deletion, or insertion required. Techniques for making such alterations are very well established. Alterations of the original amino acid sequence can be accomplished by any of a number of techniques known to one of skill in the art. Mutations can be introduced, for example, at particular loci by synthesizing oligonucleotides containing a mutant sequence, flanked by restriction sites permitting ligation to fragments of the native sequence. Following ligation, the resulting reconstructed sequence encodes an analog having the desired amino acid insertion, substitution, or deletion. Alternatively, oligonucleotide-directed site-specific mutagenesis procedures can be employed to provide an altered nucleotide sequence having particular codons altered according to the substitution, deletion, or insertion required. Techniques for making such alterations include those disclosed by Khudyakov et al. “Artificial DNA: Methods and Applications” CRC Press, 2002; Braman “In Vitro Mutagenesis Protocols” Springer, 2004; and Rapley “The Nucleic Acid Protocols Handbook” Springer 2000; which are herein incorporated by reference in their entireties. In some embodiments, a polypeptide as described herein can be chemically synthesized and mutations can be incorporated as part of the chemical synthesis process. [00109] As used herein, the term “antibody” refers to immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, i.e., molecules that contain an antigen binding site that immunospecifically binds an antigen. The term also refers to antibodies comprised of two immunoglobulin heavy chains and two immunoglobulin light chains as well as a variety of forms including full length antibodies and antigen-binding portions thereof; including, for example, an immunoglobulin molecule, a monoclonal antibody, a chimeric antibody, a CDR-grafted antibody, a humanized antibody, a Fab, a Fab’, a F(ab’)2, a Fv, a disulfide linked Fv, a scFv, a single domain antibody (dAb), a diabody, a multispecific antibody, a dual specific antibody, an anti-idiotypic antibody, a bispecific antibody, a functionally active epitope-binding portion thereof, and/or bifunctional hybrid antibodies. 27 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT [00110] Each heavy chain is composed of a variable region of said heavy chain (abbreviated here as HCVR or VH) and a constant region of said heavy chain. The heavy chain constant region consists of three domains CH1, CH2 and CH3. Each light chain is composed of a variable region of said light chain (abbreviated here as LCVR or VL) and a constant region of said light chain. The light chain constant region consists of a CL domain. The VH and VL regions may be further divided into hypervariable regions referred to as complementarity-determining regions (CDRs) and interspersed with conserved regions referred to as framework regions (FR). Each VH and VL region thus consists of three CDRs and four FRs which are arranged from the N terminus to the C terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. This structure is well known to those skilled in the art. [00111] As used herein, the term “CDR” refers to the complementarity determining regions within antibody variable sequences. The exact boundaries of these CDRs have been defined differently according to different systems. CDRs may be defined according to the Kabat system (see Kabat, E. A.et al., 1991, “Sequences of Proteins of Immunological Interest”, 5th edit., NIH Publication no.91- 3242, U.S. Department of Health and Human Services). Other systems may be used to define CDRs, which as the system devised by Chothia et al (see Chothia, C. & Lesk, A. M., 1987, “Canonical structures for the hypervariable regions of immunoglobulins”, J. Mol. Biol., 196, 901-917) and the IMGT system (see Lefranc, M. P., 1997, “Unique database numbering system for immunogenetic analysis”, Immunol. Today, 18, 50). An antibody typically contains 3 heavy chain CDRs and 3 light chain CDRs. The term CDR or CDRs is used here to indicate one or several of these regions. A person skilled in the art is able to readily compare the different systems of nomenclature and determine whether a particular sequence may be defined as a CDR. The methods and compositions used herein may utilize CDRs defined according to any of these systems. The CDRs disclosed herein were identified via the Kabat system. [00112] The term “antigen-binding portion” of an antibody refers to one or more portions of an antibody as described herein, said one or more portions still having the binding affinities as defined above herein. Portions of a complete antibody have been shown to be able to carry out the antigen- binding function of an antibody. In accordance with the term “antigen-binding portion” of an antibody, examples of binding portions include (i) an Fab portion, i.e., a monovalent portion composed of the VL, VH, CL and CH1 domains; (ii) an F(ab’)2 portion, i.e., a bivalent portion comprising two Fab portions linked to one another in the hinge region via a disulfide bridge; (iii) an Fd portion composed of the VH and CH1 domains; (iv) an Fv portion composed of the FL and VH domains of a single arm of an antibody; and (v) a dAb portion consisting of a VH domain or of VH, CH1, CH2, DH3, or VH, CH2, CH3 (dAbs, or single domain antibodies, comprising only VL domains have also been shown to specifically bind to target eptiopes). 28 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT [00113] Although the two domains of the Fv portion, namely VL and VH, are encoded by separate genes, they may further be linked to one another using a synthetic linker, and recombinant methods, making it possible to prepare them as a single protein chain in which the VL and VH regions combine in order to form monovalent molecules (known as single chain Fv (ScFv)). [00114] The term “antigen-binding portion” of an antibody is also intended to comprise such single chain antibodies. Other forms of single chain antibodies such as “diabodies” can also be included. Diabodies are bivalent, bispecific antibodies in which VH and VL domains are expressed on a single polypeptide chain, but using a linker which is too short for the two domains being able to combine on the same chain, thereby forcing said domains to pair with complementary domains of a different chain and to form two antigen-binding sites. An immunoglobulin constant domain refers to a heavy or light chain constant domain. Human IgG heavy chain and light chain constant domain amino acid sequences are known in the art. [00115] As used herein, the term “antibody reagent” refers to a polypeptide that includes at least one immunoglobulin variable domain or immunoglobulin variable domain sequence and which specifically binds a given antigen. An antibody reagent can comprise an antibody or a polypeptide comprising an antigen-binding domain of an antibody. In some embodiments, an antibody reagent can comprise a monoclonal antibody or a polypeptide comprising an antigen-binding domain of a monoclonal antibody. For example, an antibody can include a heavy (H) chain variable region (abbreviated herein as VH), and a light (L) chain variable region (abbreviated herein as VL). In another example, an antibody includes two heavy (H) chain variable regions and two light (L) chain variable regions. The term “antibody reagent” encompasses antigen-binding fragments of antibodies (e.g., single chain antibodies, Fab and sFab fragments, F(ab’)2, Fd fragments, Fv fragments, scFv, and domain antibodies (dAb) fragments as well as complete antibodies. [00116] An antibody can have the structural features of IgA, IgG, IgE, IgD, IgM (as well as subtypes and combinations thereof). Antibodies can be from any source, including mouse, rabbit, pig, rat, and primate (human and non-human primate) and primatized antibodies. Antibodies also include midibodies, humanized antibodies, chimeric antibodies, and the like. [00117] Furthermore, an antibody, antigen-binding portion thereof, as described herein may be part of a larger immunoadhesion molecule formed by covalent or noncovalent association of said antibody or antibody portion with one or more further proteins or peptides. Relevant to such immunoadhesion molecules are the use of the streptavidin core region in order to prepare a tetrameric scFv molecule and the use of a cystein residue, a marker peptide and a C-terminal polyhistidinyl, (‘hexahistidinyl tag’) in order to produce bivalent and biotinylated scFv molecules. [00118] In some embodiments, the antibody or antigen-binding portion thereof is a fully human antibody. In some embodiments, the antibody, antigen-binding portion thereof, is a humanized antibody or antibody reagent. In some embodiments, the antibody, antigen-binding portion thereof, is 29 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT a fully humanized antibody or antibody reagent. In some embodiments, the antibody or antigen- binding portion thereof, is a chimeric antibody or antibody reagent. In some embodiments, the antibody, antigen-binding portion thereof, is a recombinant polypeptide. [00119] The term “human antibody” refers to antibodies whose variable and constant regions correspond to or are derived from immunoglobulin sequences of the human germ line, as described, for example, by Kabat et al. (see Kabat, et al. (1991) Sequences of Proteins of Immunological Interest, Fifth Edition, U.S. Department of Health and Human Services, NIH Publication No.91- 3242). However, the human antibodies can contain amino acid residues not encoded by human germ line immunoglobulin sequences (for example mutations which have been introduced by random or site-specific mutagenesis in vitro or by somatic mutation in vivo), for example in the CDRs, and in particular in CDR3. Recombinant human antibodies as described herein have variable regions and may also contain constant regions derived from immunoglobulin sequences of the human germ line (see Kabat, E. A., et al. (1991) Sequences of Proteins of Immunological Interest, Fifth Edition, U.S. Department of Health and Human Services, NIH Publication No.91-3242). [00120] According to particular embodiments, however, such recombinant human antibodies are subjected to in-vitro mutagenesis (or to a somatic in-vivo mutagenesis, if an animal is used which is transgenic due to human Ig sequences) so that the amino acid sequences of the VH and VL regions of the recombinant antibodies are sequences which although related to or derived from VH and VL sequences of the human germ line, do not naturally exist in vivo within the human antibody germ line repertoire. According to particular embodiments, recombinant antibodies of this kind are the result of selective mutagenesis or back mutation or of both. Preferably, mutagenesis leads to an affinity to the target which is greater, and/or an affinity to non-target structures which is smaller than that of the parent antibody. [00121] Generating a humanized antibody from the sequences and information provided herein can be practiced by those of ordinary skill in the art without undue experimentation. In one approach, there are four general steps employed to humanize a monoclonal antibody, see, e.g., U.S. Pat. No. 5,585,089; No.6,835,823; No.6,824,989. These are: (1) determining the nucleotide and predicted amino acid sequence of the starting antibody light and heavy variable domains; (2) designing the humanized antibody, i.e., deciding which antibody framework region to use during the humanizing process; (3) the actual humanizing methodologies/techniques; and (4) the transfection and expression of the humanized antibody. [00122] Usually the CDR regions in humanized antibodies and human antibody variants are substantially identical, and more usually, identical to the corresponding CDR regions in the mouse or human antibody from which they were derived. In some embodiments, it is possible to make one or more conservative amino acid substitutions of CDR residues without appreciably affecting the 30 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT binding affinity of the resulting humanized immunoglobulin or human antibody variant. In some embodiments, substitutions of CDR regions can enhance binding affinity. [00123] The term “chimeric antibody” refers to antibodies which contain sequences for the variable region of the heavy and light chains from one species and constant region sequences from another species, such as antibodies having murine heavy and light chain variable regions linked to human constant regions. Humanized antibodies have variable region framework residues substantially from a human antibody (termed an acceptor antibody) and complementarity determining regions substantially from a non-human antibody. [00124] The constant region(s), if present, are also substantially or entirely from a human immunoglobulin. The human variable domains are usually chosen from human antibodies whose framework sequences exhibit a high degree of sequence identity with the (murine) variable region domains from which the CDRs were derived. The heavy and light chain variable region framework residues can be substantially similar to a region of the same or different human antibody sequences. The human antibody sequences can be the sequences of naturally occurring human antibodies or can be consensus sequences of several human antibodies. [00125] In addition, techniques developed for the production of “chimeric antibodies” by splicing genes from a mouse, or other species, antibody molecule of appropriate antigen specificity together with genes from a human antibody molecule of appropriate biological activity can be used. The variable segments of chimeric antibodies are typically linked to at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin. Human constant region DNA sequences can be isolated in accordance with well-known procedures from a variety of human cells, such as immortalized B-cells. The antibody can contain both light chain and heavy chain constant regions. The heavy chain constant region can include CH1, hinge, CH2, CH3, and, sometimes, CH4 regions. In some embodiments, the CH2 domain can be deleted or omitted. [00126] Additionally, and as described herein, a recombinant humanized antibody can be further optimized to decrease potential immunogenicity, while maintaining functional activity. In this regard, functional activity means a polypeptide capable of displaying one or more known functional activities associated with a recombinant antibody, antigen-binding portion thereof, as described herein. Such functional activities include binding to a target biomolecule. [00127] Additionally, a polypeptide having functional activity means the polypeptide exhibits activity similar, but not necessarily identical to, an activity of a reference antibody, antigen-binding portion thereof, as described herein, including mature forms, as measured in a particular assay, such as, for example, a biological assay, with or without dose dependency. In the case where dose dependency does exist, it need not be identical to that of the reference antibody, antigen-binding portion thereof, , but rather substantially similar to the dose-dependence in a given activity as compared to the reference antibody, antigen-binding portion thereof, as described herein (i.e., the 31 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT candidate polypeptide will exhibit greater activity, or not more than about 25-fold less, about 10-fold less, or about 3-fold less activity relative to the antibodies, and/or antigen-binding portions, described herein). [00128] In some embodiments, the antibody reagents (e.g., antibodies) described herein are not naturally-occurring biomolecules. For example, a murine antibody raised against an antigen of human origin would not occur in nature absent human intervention and manipulation, e.g., manufacturing steps carried out by a human. Chimeric antibodies are also not naturally-occurring biomolecules, e.g., in that they comprise sequences obtained from multiple species and assembled into a recombinant molecule. In certain particular embodiments, the human antibody reagents described herein are not naturally-occurring biomolecules, e.g., fully human antibodies directed against a human antigen would be subject to negative selection in nature and are not naturally found in the human body. [00129] In some embodiments, the antibody, antibody reagent, and/or antigen-binding portion thereof, is an isolated polypeptide. In some embodiments, the antibody, antibody reagent, and/or antigen-binding portion thereof, is a purified polypeptide. In some embodiments, the antibody, antibody reagent, and/or antigen-binding portion thereof, is an engineered polypeptide. [00130] In some embodiments of any of the aspects, the antibody reagent or antigen-binding fragment thereof is fully human or fully humanized. In some embodiments of any of the aspects, the antibody reagent or antigen-binding fragment thereof is fully humanized except for the CDR sequences. In some embodiments of any of the aspects, the antibody reagent or antigen-binding fragment is selected from the group consisting of: an immunoglobulin molecule, a monoclonal antibody, a chimeric antibody, a CDR-grafted antibody, a humanized antibody, a Fab, a Fab’, a F(ab’)2, a Fv, a disulfide linked Fv, a scFv, a single domain antibody, a diabody, a multispecific antibody, a dual specific antibody, an anti-idiotypic antibody, and a bispecific antibody. [00131] As used herein, an “epitope” can be formed on a polypeptide both from contiguous amino acids, or noncontiguous amino acids juxtaposed by tertiary folding of a protein. Epitopes formed from contiguous amino acids are typically retained on exposure to denaturing solvents, whereas epitopes formed by tertiary folding are typically lost on treatment with denaturing solvents. An epitope typically includes at least 3, and more usually, at least 5, about 9, or about 8-10 amino acids in a unique spatial conformation. An “epitope” includes the unit of structure conventionally bound by an immunoglobulin VH/VL pair. Epitopes define the minimum binding site for an antibody, and thus represent the target of specificity of an antibody. In the case of a single domain antibody, an epitope represents the unit of structure bound by a variable domain in isolation. The terms “antigenic determinant” and “epitope” can also be used interchangeably herein. In certain embodiments, epitope determinants include chemically active surface groupings of molecules such as amino acids, sugar side chains, phosphoryl, or sulfonyl, and, in certain embodiments, may have specific three dimensional structural characteristics, and/or specific charge characteristics. 32 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT [00132] “Avidity” is the measure of the strength of binding between an antigen-binding molecule (such as an antibody or antigen-binding portion thereof described herein) and the pertinent antigen. Avidity is related to both the affinity between an antigenic determinant and its antigen binding site on the antigen-binding molecule, and the number of pertinent binding sites present on the antigen- binding molecule. Typically, antigen-binding proteins (such as an antibody or portion of an antibody as described herein) will bind to their cognate or specific antigen with a dissociation constant (KD of 10⁻⁵ to 10⁻¹² moles/liter or less, such as 10⁻⁷ to 10⁻¹² moles/liter or less, or 10⁻⁸ to 10⁻¹² moles/liter (i.e., with an association constant (KA) of 10⁵ to 10¹² liter/moles or more, such as 10⁷ to 10¹² liter/moles or 10⁸ to 10¹² liter/moles). Any KD value greater than 10⁻⁴ mol/liter (or any KA value lower than 10⁴ M⁻¹) is generally considered to indicate non-specific binding. The KD for biological interactions which are considered meaningful (e.g., specific) are typically in the range of 10⁻¹⁰ M (0.1 nM) to 10⁻⁵ M (10000 nM). The stronger an interaction, the lower is its KD. For example, a binding site on an antibody or portion thereof described herein will bind to the desired antigen with an affinity less than 500 nM, such as less than 200 nM, or less than 10 nM, such as less than 500 pM. Specific binding of an antigen-binding protein to an antigen or antigenic determinant can be determined in any suitable manner known per se, including, for example, Scatchard analysis and/or competitive binding assays, such as radioimmunoassays (RIA), enzyme immunoassays (EIA) and sandwich competition assays, and the different variants thereof known per se in the art; as well as other techniques as mentioned herein. [00133] Accordingly, as used herein, “selectively binds” or “specifically binds” refers to the ability of a peptide (e.g., an antibody or portion thereof) described herein to bind to a target, such as an antigen present on the cell-surface, with a KD 10⁻⁵ M (10000 nM) or less, e.g., 10⁻⁶ M, 10⁻⁷ M, 10⁻⁸ M, 10⁻⁹ M, 10⁻¹⁰ M, 10⁻¹¹ M, 10⁻¹² M, or less. Specific binding can be influenced by, for example, the affinity and avidity of the polypeptide agent and the concentration of polypeptide agent. The person of ordinary skill in the art can determine appropriate conditions under which the polypeptide agents described herein selectively bind the targets using any suitable methods, such as titration of a polypeptide agent in a suitable cell binding assay. A polypeptide specifically bound to a target is not displaced by a non-similar competitor. In certain embodiments, an antibody, or antigen-binding portion thereof, is said to specifically bind an antigen when it preferentially recognizes its target antigen in a complex mixture of proteins and/or macromolecules. [00134] As used herein, the term “nucleic acid” or “nucleic acid sequence” refers to any molecule, preferably a polymeric molecule, incorporating units of ribonucleic acid, deoxyribonucleic acid or an analog thereof. The nucleic acid can be either single-stranded or double-stranded. A single-stranded nucleic acid can be one nucleic acid strand of a denatured double- stranded DNA. Alternatively, it can be a single-stranded nucleic acid not derived from any double-stranded DNA. In one aspect, the 33 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT nucleic acid can be DNA. In another aspect, the nucleic acid can be RNA. Suitable DNA can include, e.g., genomic DNA or cDNA. Suitable RNA can include, e.g., mRNA. [00135] In some embodiments of any of the aspects, an oligonucleotide is chemically modified to enhance stability or other beneficial characteristics. The nucleic acids described herein may be synthesized and/or modified by methods well established in the art, such as those described in “Current protocols in nucleic acid chemistry,” Beaucage, S.L. et al. (Edrs.), John Wiley & Sons, Inc., New York, NY, USA, which is hereby incorporated herein by reference. Modifications include, for example, (a) end modifications, e.g., 5’ end modifications (phosphorylation, conjugation, inverted linkages, etc.) 3’ end modifications (conjugation, DNA nucleotides, inverted linkages, etc.), (b) base modifications, e.g., replacement with stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners, removal of bases (abasic nucleotides), or conjugated bases, (c) sugar modifications (e.g., at the 2’ position or 4’ position) or replacement of the sugar, as well as (d) backbone modifications, including modification or replacement of the phosphodiester linkages. The preparation of the modified nucleic acids, backbones, and nucleobases described above are well known in the art. [00136] The term “aptamer” refers to a nucleic acid molecule that is capable of binding to a target molecule, such as a polypeptide. For example, an aptamer of the invention can specifically bind to a target molecule, or to a molecule in a signaling pathway that modulates the expression and/or activity of a target molecule. The generation and therapeutic use of aptamers are well established in the art. See, e.g., U.S. Pat. No.5,475,096. [00137] In some embodiments, the methods described herein relate to measuring, detecting, or determining the level or a property of at least one entity. As used herein, the term "detecting" or “measuring” refers to observing a signal from, e.g. a probe, label, or target molecule to indicate the presence, quantity, location, or distribution of an analyte in a sample. Any method known in the art for detecting a particular label moiety can be used for detection. Exemplary detection methods include, but are not limited to, spectroscopic, fluorescent, photochemical, biochemical, immunochemical, electrical, optical or chemical methods. In some embodiments of any of the aspects, measuring can be a quantitative observation. [00138] In some embodiments of any of the aspects, a capture reagent as described herein can be engineered. As used herein, “engineered" refers to the aspect of having been manipulated by the hand of man. For example, a polypeptide is considered to be “engineered" when at least one aspect of the polypeptide, e.g., its sequence, has been manipulated by the hand of man to differ from the aspect as it exists in nature. [00139] As used herein, “contacting" refers to any suitable means for delivering, or exposing, an molecule or entity with another molecule or entity. Exemplary delivery methods include, but are not limited to, mixing, fludic delivery, direct delivery to cell culture medium, perfusion, injection, or 34 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT other delivery method well known to one skilled in the art. In some embodiments, contacting comprises physical human activity, e.g., an injection; an act of dispensing, mixing, and/or decanting; and/or manipulation of a delivery device or machine. [00140] The term “statistically significant" or “significantly" refers to statistical significance and generally means a two standard deviation (2SD) or greater difference. [00141] Other than in the operating examples, or where otherwise indicated, all numbers expressing quantities of ingredients or reaction conditions used herein should be understood as modified in all instances by the term “about.” The term “about” when used in connection with percentages can mean ±1%. [00142] As used herein, the term “comprising” means that other elements can also be present in addition to the defined elements presented. The use of “comprising” indicates inclusion rather than limitation. [00143] The term "consisting of" refers to compositions, methods, and respective components thereof as described herein, which are exclusive of any element not recited in that description of the embodiment. [00144] As used herein the term "consisting essentially of" refers to those elements required for a given embodiment. The term permits the presence of additional elements that do not materially affect the basic and novel or functional characteristic(s) of that embodiment of the invention. [00145] As used herein, the term “specific binding” refers to a chemical interaction between two molecules, compounds, cells and/or particles wherein the first entity binds to the second, target entity with greater specificity and affinity than it binds to a third entity which is a non-target. In some embodiments, specific binding can refer to an affinity of the first entity for the second target entity which is at least 10 times, at least 50 times, at least 100 times, at least 500 times, at least 1000 times or greater than the affinity for the third nontarget entity. A reagent specific for a given target is one that exhibits specific binding for that target under the conditions of the assay being utilized. [00146] The singular terms "a," "an," and "the" include plural referents unless context clearly indicates otherwise. Similarly, the word "or" is intended to include "and" unless the context clearly indicates otherwise. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of this disclosure, suitable methods and materials are described below. The abbreviation, "e.g." is derived from the Latin exempli gratia, and is used herein to indicate a non-limiting example. Thus, the abbreviation "e.g." is synonymous with the term "for example." [00147] Groupings of alternative elements or embodiments of the invention disclosed herein are not to be construed as limitations. Each group member can be referred to and claimed individually or in any combination with other members of the group or other elements found herein. One or more members of a group can be included in, or deleted from, a group for reasons of convenience and/or patentability. When any such inclusion or deletion occurs, the specification is herein deemed to 35 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT contain the group as modified thus fulfilling the written description of all Markush groups used in the appended claims. [00148] Unless otherwise defined herein, scientific and technical terms used in connection with the present application shall have the meanings that are commonly understood by those of ordinary skill in the art to which this disclosure belongs. It should be understood that this invention is not limited to the particular methodology, protocols, and reagents, etc., described herein and as such can vary. The terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention, which is defined solely by the claims. Definitions of common terms in immunology and molecular biology can be found in The Merck Manual of Diagnosis and Therapy, 20th Edition, published by Merck Sharp & Dohme Corp., 2018 (ISBN 0911910190, 978-0911910421); Robert S. Porter et al. (eds.), The Encyclopedia of Molecular Cell Biology and Molecular Medicine, published by Blackwell Science Ltd., 1999-2012 (ISBN 9783527600908); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8); Immunology by Werner Luttmann, published by Elsevier, 2006; Janeway's Immunobiology, Kenneth Murphy, Allan Mowat, Casey Weaver (eds.), W. W. Norton & Company, 2016 (ISBN 0815345054, 978-0815345053); Lewin's Genes XI, published by Jones & Bartlett Publishers, 2014 (ISBN- 1449659055); Michael Richard Green and Joseph Sambrook, Molecular Cloning: A Laboratory Manual, 4th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., USA (2012) (ISBN 1936113414); Davis et al., Basic Methods in Molecular Biology, Elsevier Science Publishing, Inc., New York, USA (2012) (ISBN 044460149X); Laboratory Methods in Enzymology: DNA, Jon Lorsch (ed.) Elsevier, 2013 (ISBN 0124199542); Current Protocols in Molecular Biology (CPMB), Frederick M. Ausubel (ed.), John Wiley and Sons, 2014 (ISBN 047150338X, 9780471503385), Current Protocols in Protein Science (CPPS), John E. Coligan (ed.), John Wiley and Sons, Inc., 2005; and Current Protocols in Immunology (CPI) (John E. Coligan, ADA M Kruisbeek, David H Margulies, Ethan M Shevach, Warren Strobe, (eds.) John Wiley and Sons, Inc., 2003 (ISBN 0471142735, 9780471142737), the contents of which are all incorporated by reference herein in their entireties. [00149] In all embodiments where a sample is obtained or has been obtained or provided, the sample can be sample taken, obtained, or provided via minimally invasive methods and/or involves only a minor intervention. In some embodiments of any of the aspects, a sample is taken, obtained, or provided by one or more of a blood draw or prick, an epidermal or mucus membrane swab, buccal sampling, saliva sample, a epidermal skin sampling technique, and/or collection of a secreted or expelled bodily fluid (e.g., mucus, urine, sweat, etc), fecal sampling, semen/seminal fluid sampling, or clippings (e.g., of hair or nails). In some emodiments of any of the aspects, the sample comprises, consists of, or consists essentially of blood (or any fraction or component thereof), serum, urine, 36 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT mucus, epithelial cells, saliva, buccal cells, a secreted or expelled bodily fluid, and/or hair or nail clippings. [00150] Other terms are defined herein within the description of the various aspects of the invention. [00151] All patents and other publications; including literature references, issued patents, published patent applications, and co-pending patent applications; cited throughout this application are expressly incorporated herein by reference for the purpose of describing and disclosing, for example, the methodologies described in such publications that might be used in connection with the technology described herein. These publications are provided solely for their disclosure prior to the filing date of the present application. Nothing in this regard should be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention or for any other reason. All statements as to the date or representation as to the contents of these documents is based on the information available to the applicants and does not constitute any admission as to the correctness of the dates or contents of these documents. [00152] The description of embodiments of the disclosure is not intended to be exhaustive or to limit the disclosure to the precise form disclosed. While specific embodiments of, and examples for, the disclosure are described herein for illustrative purposes, various equivalent modifications are possible within the scope of the disclosure, as those skilled in the relevant art will recognize. For example, while method steps or functions are presented in a given order, alternative embodiments may perform functions in a different order, or functions may be performed substantially concurrently. The teachings of the disclosure provided herein can be applied to other procedures or methods as appropriate. The various embodiments described herein can be combined to provide further embodiments. Aspects of the disclosure can be modified, if necessary, to employ the compositions, functions and concepts of the above references and application to provide yet further embodiments of the disclosure. Moreover, due to biological functional equivalency considerations, some changes can be made in protein structure without affecting the biological or chemical action in kind or amount. These and other changes can be made to the disclosure in light of the detailed description. All such modifications are intended to be included within the scope of the appended claims. [00153] Specific elements of any of the foregoing embodiments can be combined or substituted for elements in other embodiments. Furthermore, while advantages associated with certain embodiments of the disclosure have been described in the context of these embodiments, other embodiments may also exhibit such advantages, and not all embodiments need necessarily exhibit such advantages to fall within the scope of the disclosure. [00154] In some embodiments, the present technology may be defined in any of the following numbered paragraphs: 1. A capture reagent comprising: 37 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT a first binding element that binds specifically to a target biomolecule; a second binding element that reversibly binds to a target and which can be competed off of the target; and a third binding element comprising an oligonucleotide sequence. 2. A kit comprising a capture reagent of paragraph 1. 3. A kit comprising a plurality of capture reagents of paragraph 1, the capture reagents each comprising a unique first binding element. 4. The kit of paragraph 3, wherein each unique first binding element binds specifically to a unique target biomolecule. 5. The kit of paragraph 3, wherein each unique first binding element binds specifically to a unique epitope. 6. The kit of any of the preceding paragraphs, wherein each capture reagent of the plurality of capture reagents comprises a unique third binding element. 7. A kit comprising at least one capture reagent of paragraph 1, or a plurality of capture reagents of any of paragraphs 3-6, the kit further comprising: a) a first support comprising the target of the second binding element; and b) at least one of: i) the first support further comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence of the third binding element; and ii) a second support comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence of the third binding element. 8. The kit of any of the preceding paragraphs, wherein the first support is a magnetic particle. 9. The kit of any of the preceding paragraphs, wherein the support comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence comprises silicon, silicon oxide, gold, glass, and/or plastic. 10. The kit of any of the preceding paragraphs, wherein the support comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence comprises silicon and/or silicon oxide. 11. The kit of any of the preceding paragraphs, wherein the support comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence is a Single-Particle Interferometric Reflectance Imaging Sensor (SP-IRIS) substrate. 12. The kit of any of the preceding paragraphs, wherein the support comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence comprises gold. 38 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT 13. The kit of any of the preceding paragraphs, wherein the support comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence comprises a Surface Plasmon Resonance (SPR) or interferometic technique substrate. 14. The capture reagent or kit of any of the preceding paragraphs, wherein the first binding element comprises an antibody, antibody reagent, a nanobody, a polypeptide, an aptamer, or a DNA-binding protein. 15. The capture reagent or kit of any of the preceding paragraphs, wherein the target biomolecule is a nanovescicle surface protein. 16. The capture reagent or kit of any of the preceding paragraphs, wherein the target biomolecule is a tetraspannin; TSGS01; ALIX; or EPS15. 17. The capture reagent or kit of any of the preceding paragraphs, wherein the second binding element comprises an aptamer that binds streptavidin. 18. The capture reagent or kit of any of the preceding paragraphs, wherein the second binding element comprises an aptamer that binds streptavidin with a lower affinity than biotin. 19. The capture reagent or kit of any of the preceding paragraphs, wherein the second binding element comprises an aptamer comprising the sequence of any of Table 3. 20. The capture reagent or kit of any of the preceding paragraphs, wherein the third binding element comprises an oligonucleotide sequence of at least 10 bp in length. 21. A method comprising: a) contacting a sample comprising one or more biological nanoparticles with at least one capture reagent of any of the preceding paragraphs, thereby forming capture reagent- biological nanoparticle complexes; b) contacting the capture reagent-biological nanoparticle complexes with a first support comprising the target of the second binding element, thereby binding the capture reagent-biological nanoparticle complexes to the first support; c) contacting the first support and the capture reagent-biological nanoparticle complexes bound to the first support with a competing reagent that binds the target of the second binding element with greater affinity than the second binding element binds the target, thereby releasing the capture reagent-biological nanoparticles complexes from the first support; and d) contacting the released capture reagent-biological nanoparticles complexes with: the first support, the first support further comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence of the third binding element, thereby binding the capture reagent- biological nanoparticle complexes to the first support; or 39 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT a further support comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence of the third binding element, thereby binding the capture reagent-biological nanoparticle complexes to the second support. 22. A method comprising: a) contacting at least one capture reagent of any of the preceding paragraphs with a first support comprising the target of the second binding element, thereby binding the capture reagent to the first support; b) contacting a sample comprising one or more biological nanoparticles with the capture reagent bound to the first support, thereby forming capture reagent-biological nanoparticle complexes bound to the first support; c) contacting the first support and the capture reagent-biological nanoparticle complexes bound to the first support with a competing reagent that binds the target of the second binding element with greater affinity than the second binding element binds the target, thereby releasing the capture reagent-biological nanoparticles complexes from the first support; and d) contacting the released capture reagent-biological nanoparticles complexes with: the first support, the first support further comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence of the third binding element, thereby binding the capture reagent- biological nanoparticle complexes to the first support; or a further support comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence of the third binding element, thereby binding the capture reagent-biological nanoparticle complexes to the second support. 23. The method of any one of the preceding paragraphs, further comprising detecting the capture reagent-biological nanoparticle complexes bound in step d). 24. The method of any one of the preceding paragraphs, wherein the detecting comprises Single- Particle Interferometric Reflectance Imaging Sensor (SP-IRIS). 25. The method of any one of the preceding paragraphs, wherein the biological nanoparticle is at least 10x greater in size volumetrically than the capture reagent. 26. The method of any one of the preceding paragraphs, wherein the biological nanoparticle is at least 100x greater in size volumetrically than the capture reagent. 27. The method of any one of the preceding paragraphs, wherein the capture reagent is provided in a stoichiometric excess compared to the biological nanoparticle. 40 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT 28. The method of any one of the preceding paragraphs, wherein the method does not comprise washing unbound capture reagents from the support or supports. 29. The method of any one of the preceding paragraphs, wherein the biological nanoparticle is an extracellular vesicle (EV), virus, viral vector, a microbe, a bacterium, or a spore. 30. The method of any one of the preceding paragraphs, wherein the biological nanoparticle is intact before step a and after step d. 31. The method of any one of the preceding paragraphs, wherein a lipid bilayer or envelope of the biological nanoparticle is intact before step a and after step d. 32. The method of any one of the preceding paragraphs, wherein the biological nanoparticle is not contacted with a detergent. [00155] In some embodiments, the present technology may be defined in any of the following numbered paragraphs: 1. A capture reagent comprising: a first binding element that binds specifically to a target biomolecule; a second binding element that reversibly binds to a target and which can be competed off of the target; and a third binding element comprising an oligonucleotide sequence. 2. A kit comprising a capture reagent of paragraph 1. 3. A kit comprising a plurality of capture reagents of paragraph 1, the capture reagents each comprising a unique first binding element. 4. The kit of paragraph 3, wherein each unique first binding element binds specifically to a unique target biomolecule. 5. The kit of paragraph 3, wherein each unique first binding element binds specifically to a unique epitope. 6. The kit of any of the preceding paragraphs, wherein each capture reagent of the plurality of capture reagents comprises a unique third binding element. 7. A kit comprising at least one capture reagent of paragraph 1, or a plurality of capture reagents of any of paragraphs 3-6, the kit further comprising: a) a first support comprising the target of the second binding element; and b) a second support comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence of the third binding element. 8. A kit comprising at least one capture reagent of paragraph 1, or a plurality of capture reagents of any of paragraphs 3-6, the kit further comprising: a) a first support comprising the target of the second binding element; and b) at least one of: 41 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT i) the first support further comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence of the third binding element; and ii) a second support comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence of the third binding element. 9. The kit of any of the preceding paragraphs, wherein the first support is a magnetic particle. 10. The kit of any of the preceding paragraphs, wherein the support comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence comprises silicon, silicon oxide, gold, glass, and/or plastic. 11. The kit of any of the preceding paragraphs, wherein the support comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence comprises silicon and/or silicon oxide. 12. The kit of any of the preceding paragraphs, wherein the support comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence comprises silicon oxide coated silicon. 13. The kit of any of the preceding paragraphs, wherein the second support comprising at least one oligonucleotide having a sequence complementary to the third binding element is a Single-Particle Interferometric Reflectance Imaging Sensor (SP-IRIS) substrate. 14. The kit of any of the preceding paragraphs, wherein the support comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence is a Single-Particle Interferometric Reflectance Imaging Sensor (SP-IRIS) substrate. 15. The kit of any of the preceding paragraphs, wherein the support comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence comprises gold. 16. The kit of any of the preceding paragraphs, wherein the support comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence comprises a Surface Plasmon Resonance (SPR) or interferometic detection technique substrate. 17. The capture reagent or kit of any of the preceding paragraphs, wherein the first binding element comprises an antibody, antibody reagent, a nanobody, a polypeptide, an aptamer, or a DNA-binding protein. 18. The capture reagent or kit of any of the preceding paragraphs, wherein the target biomolecule is a nanovesicle surface protein. 19. The capture reagent or kit of any of the preceding paragraphs, wherein the target biomolecule is a tetraspannin; TSGS01; ALIX; or EPS15. 20. The capture reagent or kit of any of the preceding paragraphs, wherein the second binding element binds streptavidin. 42 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT 21. The capture reagent or kit of any of the preceding paragraphs, wherein the second binding element binds streptavidin with a lower affinity than biotin. 22. The capture reagent or kit of any of the preceding paragraphs, wherein the second binding element comprises an aptamer that binds streptavidin. 23. The capture reagent or kit of any of the preceding paragraphs, wherein the second binding element comprises an aptamer that binds streptavidin with a lower affinity than biotin. 24. The capture reagent or kit of any of the preceding paragraphs, wherein the second binding element comprises an aptamer comprising the sequence of any of Table 3. 25. The capture reagent or kit of any of the preceding paragraphs, wherein the second binding element comprises desthiobiotin. 26. The capture reagent or kit of any of the preceding paragraphs, wherein the second binding element comprises an oligonucleotide. 27. The capture reagent or kit of any of the preceding paragraphs, wherein the third binding element comprises an oligonucleotide sequence of at least 10 bp in length. 28. A method comprising: a) contacting a sample comprising one or more biological nanoparticles with at least one capture reagent of any of the preceding paragraphs, thereby forming capture reagent- biological nanoparticle complexes; b) contacting the capture reagent-biological nanoparticle complexes with a first support comprising the target of the second binding element, thereby binding the capture reagent-biological nanoparticle complexes to the first support; c) contacting the first support and the capture reagent-biological nanoparticle complexes bound to the first support with a competing reagent that binds the target of the second binding element with greater affinity than the second binding element binds the target, thereby releasing the capture reagent-biological nanoparticles complexes from the first support; and d) contacting the released capture reagent-biological nanoparticles complexes with: the first support, the first support further comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence of the third binding element, thereby binding the capture reagent- biological nanoparticle complexes to the first support; or a further support comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence of the third binding element, thereby binding the capture reagent-biological nanoparticle complexes to the second support. 29. A method comprising: 43 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT a) contacting at least one capture reagent of any of the preceding paragraphs with a first support comprising the target of the second binding element, thereby binding the capture reagent to the first support; b) contacting a sample comprising one or more biological nanoparticles with the capture reagent bound to the first support, thereby forming capture reagent-biological nanoparticle complexes bound to the first support; c) contacting the first support and the capture reagent-biological nanoparticle complexes bound to the first support with a competing reagent that binds the target of the second binding element with greater affinity than the second binding element binds the target, thereby releasing the capture reagent-biological nanoparticles complexes from the first support; and d) contacting the released capture reagent-biological nanoparticles complexes with: the first support, the first support further comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence of the third binding element, thereby binding the capture reagent- biological nanoparticle complexes to the first support; or a further support comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence of the third binding element, thereby binding the capture reagent-biological nanoparticle complexes to the second support. 30. The method of any one of the preceding paragraphs, further comprising detecting the capture reagent-biological nanoparticle complexes bound in step d). 31. The method of any one of the preceding paragraphs, wherein the detecting comprises Single- Particle Interferometric Reflectance Imaging Sensor (SP-IRIS). 32. The method of any one of the preceding paragraphs, wherein the biological nanoparticle is at least 10x greater in size volumetrically than the capture reagent. 33. The method of any one of the preceding paragraphs, wherein the biological nanoparticle is at least 100x greater in size volumetrically than the capture reagent. 34. The method of any one of the preceding paragraphs, wherein the capture reagent is provided in a stoichiometric excess compared to the biological nanoparticle. 35. The method of any one of the preceding paragraphs, wherein the method does not comprise washing unbound capture reagents from the support or supports. 36. The method of any one of the preceding paragraphs, wherein the biological nanoparticle is an extracellular vesicle (EV), virus, viral vector, a microbe, a bacterium, or a spore. 37. The method of any one of the preceding paragraphs, wherein the biological nanoparticle is intact before step a and after step d. 44 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT 38. The method of any one of the preceding paragraphs, wherein a lipid bilayer or envelope of the biological nanoparticle is intact before step a and after step d. 39. The method of any one of the preceding paragraphs, wherein the biological nanoparticle is not contacted with a detergent. [00156] The technology described herein is further illustrated by the following examples which in no way should be construed as being further limiting. EXAMPLES Example 1 [00157] Described herein are reagents and assays that permit sequential isolation, purification and detection of biological particles such as bacteria, viruses, and extra cellular vesicles. The technology described herein utilized capture probes (such as antibodies) conjugated with specific and generic domains of secondary recognition molecules such as oligo sequences and aptamers. Generic component of conjugated entity (for example an oligo sequence, reversible small molecule such as desthio-biotin, or aptamer) is used during the isolation purification steps in a mixture of multiple target particles. [00158] Generic biomolecule binders can be used to capture target particles on beads or other high-surface area constructs to improve capture efficiency. After release of the isolated biological particles, the specific recognition element (for example a specific oligo sequence) permits detection on a multiplexed sensor where specificity of the recognition element permits spatial separation of target particles from the mixed solution. [00159] This concept has been applied to extracellular vesicle assays with preliminary experimental demonstrations. Extracellular vesicles (EVs) is a collective term for a heterogeneous group of cellreleased membranous vesicles, that vary in size and subcellular origin, and display different repertory of surface presented and luminal molecules and functional features, all reminiscent of parental cell type and condition. These vesicles are abundantly present in circulation and can be secured from blood, as well as from other body fluids in a noninvasive manner. [00160] Described herein methods and reagents for affinity isolation and in situ enrichment of target (cancer) sEVs from plasma in a way to obtain pure, integral, and concentrated vesicles and ultiparameter analysis giving the simultaneous information on vesicle size, number and phenotype. With this technology, EV isolation, purification and detection are streamlined using a single reagent with multiple 45 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT functions for each step. This technology directly applies to virus assays as well as bacteria detection. [00161] Problems in EV isolation and detection and Technical Advantages in EV detection [00162] Capturing EVs by direct interaction with high-affinity antibodies during isolation and purification steps is not be the best approach when targeting surface antigens and using subsequent imaging based detection techniques for the analysis. Since the detachment of EVs from antibodies requires harsh conditions (low pH or high ionic strength buffers, high temperatures) that cause damage or breaking of EVs, the release of antibodies from a solid surface after binding of EVs has to be preferred to enable analysis by imaging techniques (e.g. nanoparticle tracking analysis, electron microscopy and flow cytometry). [00163] The technology described herein permits separating extracellular vesicles (EV) from complex biological fluids while maintaining their structure. Capture occurs using antibodies that recognize antigens on the surface of the Evs functionalized by oligonucleotide linkers having two domains, one consisting of an aptamer and the other of a DNA sequence encoding the specific antibody used. In one embodiment, the steps of the process are: the capture of the antibody on magnetic beads through the aptamer, the incubation with the biological fluid and the consequent capture of the EVs of interest, the release of the EVs promoted by the incubation with molecules that compete with the aptamer, the recapture on any surface of the antibody/vesicle complexes using the coding oligonucleotide sequence. This process separates and enriches a particular EV population before its analysis using the same reagents for the capture and the analysis. [00164] In the patent US20210102191A1, Method for the Isolation of Extracellular Vesicles the separation of Evs the disclosed methods require the use of DNase. However, the use of an enzyme such as DNAse to catalyze the cleavage of a DNA linker presents some disadvantages the most critical one being the degradation of DNA on the surface of EVs that prevents genomic analysis. The present technology introduces new capture reagents designed for sequential isolation, purification and detection of biological nano-particles. In this invention, (Figure 9), antibodies that target a specific EV subpopulation are conjugated to a ssDNA oligonucleotide composed of two domains: a “barcode” sequence (e.g., in Figs.7A-7C) and a reversible binding domain (for example a streptavidin aptamer region, Figure 9). [00165] The reversible generic region can be small molecule (Eg Desthio-biotin), an oligo sequence, or an aptamer. In experimental demonstrations a streptavidin binding aptamer has been utilized. This aptamer region is designed to specifically recognize and bind to avidin/streptavidin attached onto the surface of magnetic beads, thus allowing the reversible immobilization of the antibody-DNA conjugates. The beads, upon extensive washing, are incubated with biotin, which competes for streptavidin with the aptamer sequence. This incubation allows releasing the DNA- modified antibodies from the surface. The antibodies, that upon incubation with biological fluids, 46 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT have bound specific EVs, are re-captured on a microarray chip functionalized with oligonucleotides complementary to the “barcode” sequences for subsequent detection and phenotyping. [00166] Preliminary results demonstrate that the approach described herein is extremely efficient allowing for successful purification of intact exosomes down to tens of nanometer in diameter, and with increased yield as illustrated by the TEM picture in Fig.6 as compared to the prior art results. One embodiment of the proposed method/assay is described in Figs.7A-7C, another in Figs.8A-8C. Advangtages of the technology described herein include: 1. The biotin-mediated release works at room temperature, while DNase I requires a temperature of 37°C. This represents an advantage both from a chemical (EVs are less stressed and more likely to remain intact) and technological side (there is no need to introduce a temperature control unit in the separation module). 2. Avoiding the use of DNase I potentially simplifies the downstream analysis of EV-related nucleic acids, increasing the diagnostic potential of the new platform. 3. The same antibodies (a single antibody or a cocktail of different antibodies) are used for both separation and detection/phenotyping, thus allowing the simultaneous separation and characterization of multiple EV subpopulations in a single experiment. 4. The recapture step is performed on DNA microarrays instead of antibody microarrays as in the prior art. Utilizing DNA microarrays for antibody-based diagnostics is an alternative approach to antibody microarrays and offers advantages such as configurable sensor surface, long-term storage ability, and decreased antibody use. There is a chemical advantage since the affinity between complementary strands of DNA is generally higher than antibody-target complex, thus capture efficiency is higher as demonstrated in virus detection. There is also a technological improvement since DNA microarrays are easier to fabricate and have very long shelf lives. Furthermore, a DNA microarray chips also offer the advantage of being configurable, allowing the use of the same multiplexed DNA chips to create the desired exosome detection panel. DNAchips can be manufactured in large quantities, and the same multiplexed chips can be used in combination with different sets of antibody−DNA(barcode) conjugates. 5. DNA conjugated reagents further advantages to enhance the detection process by adding mass-labels to exosomes prior to detection and phenotyping. TEM demonstrates that the highly efficient capture and release yields intact exosomes with diameters as small as ~20nm. Example 2 [00167] Introduction 47 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT [00168] Extracellular vesicles, (EVs), are nano-sized vesicles containing nucleic acid and protein cargo released from many cell types. Natural multiplex biomarkers, EVs enclose different molecular species, such as proteins, nucleic acids, glycans, and lipids. Human serum is a rich source of readily accessible EVs that can be simultaneously investigated to provide real-time information on all tissue homeostasis alterations. Unfortunately, the serum is a challenging matrix due to its viscosity, abundance of serum proteins, such as albumin and globulins, and non-EV lipid particles such as chylomicrons and lipoprotein particles. Therefore, separating EVs from serum proteins and non-EV lipid particles represents a considerable challenge. Despite their apparent abundance, the heterogeneity and complexity of EVs and the biofluids that contain them remain a huge challenge that is poorly addressed by state-of-art technologies for EV purification and characterization, which are still at research grade and don’t have clinical and commercial maturity. The availability of techniques enabling the separation of serum EVs from soluble proteins and non-EV lipid particles is critically important for developing strategies for biomarker discovery and validation. [00169] A variety of methods have been used to isolate EVs, each with its advantages and disadvantages. They include ultracentrifugation, polymer-based precipitation, size exclusion chromatography (SEC), density gradient centrifugation, and immunoaffinity capturing. [00170] Immunocapturing is the only approach that allows discriminating EVs from other bio- nano particles in bodily fluids. For instance, EVs in human blood are outnumbered mainly by other contaminating particles such as lipoproteins, with the EV-associated proteins likely to account for less than 0.01% of plasma proteome. Although it is not possible to directly measure the number of tumor- derived vesicles in patients’ blood, it has been calculated that their dilution among all resident blood vesicles is likely less than 0,00001% (10⁴ per ml), while they are 10⁷ times diluted in lipoproteins. Cancer-associated proteins are much less abundant in blood than in original tissues, having pico- or even femtomolar concentrations. Such extreme rarity and the high background pose a severe analytical challenge to EV profiling based on vesicle counting or bulk molecular assays making it difficult to reach the throughput and sensitivity necessary to detect rare EV subsets and shuttled proteins. [00171] While most separation methods allow collecting/concentrating all EVs regardless of their origin, immunocapture-based technologies allow selecting only the population of vesicles characterized by the presence on their surface of proteins defining both the cellular source and the disease state. If the subpopulation is a minority component, its separation from the other vesicles facilitates an enrichment that enables downstream analysis. [00172] Thanks to the wide range of antigens on the EVs surface, the immunocapture-based technologies may well be implemented by using the broad panel of antibodies available to date. Immunocapture, using tetraspanins CD63, CD9 and CD81 or other molecules generally found in EVs, such as TSG101, Alix, etc15, can provide a tool to selectively enrich EVs from a complex 48 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT preparation. At the same time, the use of antibodies directed toward specific biomarkers allows for the detection of EVs that would go undetected in the absence of an enrichment step. [00173] Once separated from the biological matrix in which they are embedded, EVs are characterized by several techniques including electron microscopy, atomic force microscopy (AFM), dynamic light scattering (DLS), nanoparticle tracking analysis (NTA), tunable resistive pulse sensing (TRPS), flow cytometry, enzyme linked immune-sorbent assays (ELISA), and western blotting (WB). [00174] Instruments and technologies with a “sample in – result out” design for real-time in-liquid measurements of scalable sample volumes equipped with an automated software-controlled flow would significantly accelerate the adoption of EV-based biomarkers in diagnostics. In fact, despite significant research and money have been invested over the last few years in the development of systems for EV purification and analysis, no platform is consistently able to meet the requirements of the diagnostic market. [00175] In view of the integration of separation and detection into a single analytical platform, a possible approach is the use of microfluidic technology to immunocapture exosomes from a small volume of biological fluids, combined with a novel interferometry-based bio-nano-particle (BNP) sensor platform that allows digital detection and classification of individual exosomes. In this context, one of the sensor requirements is that the EVs are released intact from the separation module since the detection module involves their capture on an array of antibodies where the nanovesicles are individually detected using a Single Interferometric Imaging Sensor (SP-IRIS). [00176] The effective purification of intact EVs from biological fluids was described in the US20210102191A1 publication: Method for the isolation of intact extracellular vesicles. The method applies an immunoaffinity capture approach to collect exosomes on the surface of a substrate combined with an enzymatic approach for their release. The method proposed is enabled by the strategy used to immobilize antibodies directed against surface antigens or affinity ligands that is based on the so-called DNA-directed immobilization (DDI) strategy (Niemeyer CM, Boldt L, et al. (1999). The EVs are released from the surface by the enzymatic cleavage of the DNA linker. [00177] Described herein is a new approach for the simultaneous separation and characterization of multiple EV subpopulations in a single experiment through chemically modified antibodies (a single Ab or a cocktail of different Abs). This invention provides a method for separating EVs from non-EV protein and lipoprotein starting from small amounts of human serum or other bodily fluids. One embodiment of the invention describes antibodies, targeting specific EV subpopulations, conjugated to an ssDNA oligonucleotide composed of two domains: a “the barcode” sequence (green line in Figure 2) and a streptavidin aptamer region (purple line in Figure 1). This aptamer region is designed to specifically recognize and bind to avidin/streptavidin attached to a surface, thus allowing the reversible immobilization of the antibody-DNA conjugates. In fact, upon incubation with biotin, which competes for streptavidin with the aptamer sequence, the DNA-modified antibodies are 49 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT released from the surface. The components and the essential elements of the assay are depicted in Figure 2. Biotin released antibodies, bound specific EVs, are re-captured on a microarray chip functionalized with oligonucleotides complementary to the “barcode” sequences for subsequent detection and phenotyping. Preliminary results demonstrate that the DDI-Ab approach is highly efficient, allowing for successful purification of intact exosomes down to tens of nanometer in diameter and with increased yield. [00178] The proposed barcoding strategy represents a significant advantage over a few commercial or reported solutions for reversible EV capturing: a. Mild and efficient EV release, without use of harsh treatments (such as low pH or glycine) that may interfere with EVs integrity and immunoreactivity (example Dynabeads Thermo Fisher, Pearce, Sytiva) b. Flexibility and customized capture of a large number of EV targets: unlike current solutions offering reversible capture of one or two EV markers (Ca-sensitive, a-Timp Ab, Wako and Nanoview respectively). c. Unique Capture-Release-Re-capture features for integrated in-line EV isolation and detection. [00179] The Biotin mediated release strategy represents a significant improvement over the approach described in US20210102191A1 from both chemical and technological points of view since it does not require particular buffer compositions (it is compatible with the use of PBS), while an optimized buffer is needed for DNase I-mediated digestion of DNA linker. This means that it works at room temperature, while DNase I requires 37°C. This represents an advantage both from a chemical (EVs are less stressed and more likely to remain intact) and technological side (there is no need to introduce a temperature control unit in the separation module). By avoiding the use of DNAse I it enables the downstream analysis of also EV-related nucleic acids, increasing the diagnostic potential of the new platform. [00180] An additional advantage it that it exploits for the capturing the affinity between complementary strands of DNA that is generally higher than that of antibody-target complex, granting higher capture efficiency as demonstrated in preliminary experiments with viruses and EVs. [00181] Materials and Methods [00182] Materials. Ammonium sulfate ((NH₄)₂SO₄), phosphate buffer saline tablets (PBS), Trizma base, 37% chloric acid (HCl), sodium phosphate (Na3PO4), sucrose monolaurate, sodium chloride (NaCl), ethanolamine, trehalose dehydrate, magnesium chloride (MgCl2), sodium azide (NaN3), streptavidin, Dibenzocyclooctyne-N-hydroxysuccinimyde ester (DBCO-NHS ester), Amicon Ultra 100MWCO centrifugal filters and polyclonal rabbit IgG were purchased from Sigma Aldrich (St. Louis, MO, USA). Mouse anti-human CD9 IgG (clone MEM-61) and biotinylated mouse anti- human CD9 IgG (clone MEM-61) were obtained from Hansa BioMed Life Sciences Ltd (Tallinn, 50 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT Estonia). Cy3-labeled goat antirabbit IgG was purchased from Jackson ImmunoResearch (Baltimore, PA, USA). Oligonucleotides were synthesized by MWG-Biotech AG (Ebevsberg, Germany): see below for oligonucleotide sequences. Oligonucleotides were modified in 5’ position with either a C6 amino-linker and a C3 azido-linker. Oligonucleotides were freeze-dried and resuspended in de- ionized water (DI water) at a final concentration of 100 µM before use. Streptavidin coated magnetic beads were purchased from Thermofisher (Waltham, MA, USA). Untreated silicon chips with 100 nm thermal grown oxide (14 x 14 mm) were supplied by SVM, Silicon Valley Microelectronics Inc. (Santa Clara, CA, USA). NV10B silicon chips were supplied by NanoView Biosciences (Boston, MA, USA). Both chips were pretreated using a HARRICK Plasma Cleaner, PDC-002 (Ithaca, NY, USA), connected to an oxygen line. MCP-2 copolymer was purchased from Lucidant Polymers Inc. (Sunnyvale, CA, USA). Spotting is performed using SciFLEXARRAYER™ S12 (Scienion, Berlin, Germany). Fluorescence images were obtained using the ScanArray Lite confocal laser scanner and analyzed using ScanArray Express software (Perkin Elmer, MA, USA). Interferometric and fluorescence analyses of EVs were performed exploiting SP-IRIS technique using ExoView™ R100 for image acquisition and nanoViewer™ 2.6.0 software for analysis (NanoView Biosciences Inc., MA, USA). This instrument measures the number of single particles (ranging from 50 to 200 nm in diameter) captured on the chip surface as well as their size distribution. Nanoparticle Tracking Analysis was performed with NanoSight™ NS300 using 3.2 Dev Build 3.2.16 software (Malvern Instruments Ltd, Malvern, United Kingdom). [00183] Synthesis of AACs: Antibody Aptamer Conjugates (general procedure). To a sodium azide free antibody solution (100 μL, 1 mg/mL) 2.46 μL of DBCO-NHS ester 4 mM (15 equivalents) were added and the mixture was allowed to react 30 min at room temperature. The reaction was quenched by adding 10 μL of 1 M Tris/HCl pH 8.0. The mixture was stirred for 5 minutes at room temperature. Unreacted DBCO-NHS ester was removed through centrifugation on Amicon Ultra 100 MWCO filters (3 × 5 min at 12.000×g). After centrifugation, the volume was adjusted to 100 μL with PBS-M (PBS containing 2 mM MgCl2). DNA-antibody conjugation was performed by adding 13.4 μL (2 equivalents) of azido modified DNA from a 100 μM stock solution to 100 μL of DBCO- modified antibody. The reaction mixture was incubated overnight at 37 °C. Unreacted DNA-tags were removed through centrifugation on Amicon Ultra 100 MWCO filters (3 × 5 min at 12.000×g). After centrifugation, the volume was adjusted to 99 μL with PBS-M. Finally, 1 μL of 2% w/v sodium azide solution was added as preservative (up to a final azide concentration 0.02%). [00184] Oligonucleotide sequences Different ssDNA sequences were attached to mammalian IgGs using the protocol described above: Tag1:5’-Azide- AAAAAGGGAACGCACCGATCGCAGGTTTCCCATCGTACTTGGCACTGGAGT-3’ 51 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT Tag2:5’-Azide- AAAAAGGGAACGCACCGATCGCAGGTTTCCCCCGCGACCAGAATTAGATTA-3’ Tag3:5’-Azide- AAAAAGGGAACGCACCGATCGCAGGTTTCCCGCCCAAATAAGACGTGAGCC-3’ [00185] StrepApt5 is the simple sequence of streptavidin binding aptamer, while StrepApt5-5A includes an additional 5-adenine spacer at the 5’ end to space the antibody from the aptamer sequence. Tag1-3 include 3 regions: the 5-adenine spacer, the aptamer and a barcode sequence that allows to recapture the DNA conjugate antibody on a DNA microarray. [00186] Different sequences were used for the functionalization of microarray chips. Probe1: 5’-Amino-AAAAAAAAAAAAAAAAAAAAACTCCAGTGCCAAGTACGAT-3’ Probe2: 5’-Amino-AAAAAAAAAAAAAAAAAAAATAATCTAATTCTGGTCGCGG-3’ Probe3: 5’-Amino-AAAAAAAAAAAAAAAAAAAAGGCTCACGTCTTATTTGGGC-3’ Stabilizer: 5’-TTTTTTTTTTTTTTTTTTTT-3’ [00187] Functionalization of microarray chips (general procedure). Silicon supports were pretreated with oxygen plasma to clean and activate the surface. The oxygen pressure was set to 1.2 bar with a power of 29.6 W for 10 min. Then, the chips were dipped into a 1% w/v solution of MCP-2 (Lucidant Polymers Inc., Sunnyvale CA, USA) in 0.9 M aqueous ammonium sulfate. The supports were immersed into the coating solution for 30 min at room temperature, rinsed with bi-distilled water, dried under nitrogen stream and then cured at 80 °C for 15 min. [00188] The supports were spotted using a noncontact microarray spotter (sciFLEXARRAYER™ S12, Scienion, Berlin) equipped with an 80 µm nozzle. 400 pL of solution were spotted at room temperature and 65% humidity. [00189] To prepare the spotting solutions, proteins were dissolved in PBS or PBS containing 50 mM trehalose, while oligonucleotides were dissolved in a solution of 150 mM sodium phosphate buffer containing 0.01% sucrose monolaurate at pH 8.5. After spotting, chips were stored overnight in a sealed chamber filled at the bottom with sodium chloride saturated water (40 g/100 mL H₂O, 65% humidity). Finally, chips were treated with a blocking solution of ethanolamine (50 mM in 0.1M Tris/HCl buffer pH 9 and 2 mM MgCl₂) at room temperature for 1 h, rinsed with bi-distilled water and dried. [00190] Functionalization of magnetic beads coated with streptavidin (general procedure). 0.4 mg of streptavidin coated magnetic beads were washed twice with 500 µL of bidistilled water, and once with 500 µL of PBS-M. Beads were then incubated with 100 µL of AAC diluted 1:10 in PBS-M for 1 h at 25°C under stirring. Beads were washed twice with 100 µL of PBS-M and used for following experiments. [00191] Capture and release of AACs on microarray chips. Six silicon chips were coated using MCP-2 and spotted with different concentrations of streptavidin in PBS (namely 0.2, 0.5, 1 and 52 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT 2 mg/mL) as described above. Chips were incubated with the Rabbit IgG-Tag2 conjugate diluted 1:10 with PBS-M for 1 h at RT. Chips were washed 10 min with PBS-M, rinsed with 2 mM MgCl2 and dried under nitrogen stream. Then, half of the chips were incubated using 4 mM biotin in PBS for 1 h at RT and 80 rpm, washed 10 min with PBS-M, rinsed with 2 mM MgCl₂ and dried under a nitrogen stream. All chips were then incubated with 10 µg/mL Cy3-labeled goat antirabbit IgG in PBS-M for 45 min at RT, washed 10 min in PBS-M, rinsed with 2 mM MgCl2 and dried under a nitrogen stream. Finally, chips were scanned using 65% laser power and 65% PMT. [00192] The same experimental protocol was repeated on 18 silicon chips and used to test the capture and release efficiency for AACs obtained by the conjugation of Rabbit IgG with Tag1, Tag2 and Tag3. [00193] Recapture of AACs on DNA microarray chips. Two aliquots of 0.4 mg of magnetic beads, functionalized using either Rabbit IgG-Tag1 or Rabbit IgG-Tag2 as described in Section 2.5, were incubated with 4 mM biotin in PBS for 1 h at 25°C under stirring. After incubation, supernatant was recollected and used to incubate six silicon chips (three chips for each AAC) coated with MCP-2 and spotted with RADI-Probe1, RADI-Probe2, and RADI-Probe3 (both ssDNA molecules were spotted at 25 µM and were mixed with the Stabilizer at 25 µM concentration) for 1 h at RT. Chips were then washed 10 min with PBS, rinsed with 2 mM MgCl₂ and dried under a nitrogen stream. Chips were then incubated with 10 µg/mL Cy3-labeled goat antirabbit IgG in PBS for 45 min at RT, washed 10 min in PBS, rinsed with 2 mM MgCl2 and dried under nitrogen stream. Chips were scanned using 75% laser power and 75% PMT. [00194] Reversible immuno-capturing of EVs and recapture on DNA microarray. Two aliquots of 0.4 mg of streptavidin coated magnetic beads were functionalized with antiCD9-Tag2 a described in Section 2.5. One aliquot was then incubated with 200 µL of EVs (1*10¹⁰ particles/mL in PBS-M, purified via ultracentrifugation) for 2.5 h at 25°C under stirring. Beads were then washed twice with 100 µL of PBS-M and incubated with 100 µL of 4 mM biotin in PBS for 1 h at 25°C under stirring. After incubation, the supernatant was recollected and analyzed by NTA (after 1:100 dilution with PBS). As a negative control, the second aliquot of beads was incubated with PBS-M instead of EVs following the same experimental protocol. [00195] Six silicon chips were coated with MCP-4 and functionalized with RADI-Probe2, RADI- Probe3 and Rabbit IgG as described is Section 2.4. Supernatants recollected from beads were used to incubate silicon chips (3 chips for each supernatant) for 1 h at RT. Chips were then washed 10 min in PBS rinsed with 2 mM MgCl2 and dried. Chips were then scanned using ExoView™ R100. [00196] Separation of EVs from human blood plasma using reversible aptamer-directed immobilization (RADI). 0.5 mg of streptavidin coated magnetic beads were functionalized with AntiCD9-Tag2 as described in Section 2.5. Beads were washed twice with 100 µL of PBS-M and then incubated with 200 µL of human blood plasma added with 2 mM MgCl₂ (plasma have been 53 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT previously centrifuged for 30 min at 12.000 x g to remove cell debris) for 2.5 h at 25°C under stirring. Beads were washed twice with 100 µL of PBS-M and then incubated with 100 µL of 4 mM biotin in PBS for 1 h at 25°C under stirring. After incubation the supernatant was recovered and analyzed by Nanoparticle Tracking Analysis and SP-IRIS. As negative controls, the same procedure has been followed on naked streptavidin magnetic beads and on beads functionalized using rabbit IgG-Tag2. [00197] For the SP-IRIS experiment, 9 silicon chips were coated with MCP-2 and functionalized with Probe2 (25 µM + Stabilizer 25 µM), Probe3 (25 µM + Stabilizer 25 µM) and Rabbit IgG as above. Chips were incubated in triplicates with supernatants recovered from beads for 1 h at room temperature, washed 10 min with PBS, rinsed with 2 mM MgCl2 and dried. Chips were then incubated with a mix of Cy5-labelled AntiCD63 and Cy3-labelled AntiCD81 (1 µg/mL each) in PBS for 1 h at room temperature, washed 10 min with PBS, rinsed with 2 mM MgCl₂ and dried. Finally, silicon chips were scanned using ExoView™ R100. [00198] Comparison of recapture of EVs (purified from plasma using RADI) on DNA vs antibody microarray. 0.5 mg of streptavidin coated magnetic beads were functionalized with AntiCD9-Tag2 as described above. Beads were washed twice with 100 µL of PBS-M and then incubated with 200 µL of human blood plasma added with 2 mM MgCl2 (plasma have been previously centrifuged for 30 min at 12.000 x g to remove cell debris) for 2.5 h at 25°C under stirring. Beads were washed twice with 100 µL of PBS-M and then incubated with 100 µL of 4 mM biotin in PBS for 1 h at 25°C under stirring. After incubation the supernatant was recovered and used for the microarray experiment. Three silicon chips were coated using MCP-2 and functionalized with rabbit IgG, AntiCD9, Probe2 (25 µM + Stabilizer 25 µM) and Probe3 (25 µM + Stabilizer 25 µM) as described in Section 2.4. Chips were incubated with supernatant for 1 h at room temperature, washed 10 min with PBS, rinsed with 2 mM MgCl₂ and dried. Finally, silicon chips were scanned using ExoView™ R100. [00199] Analysis of EVs (purified from plasma using RADI) by Transmission Electron Microscopy. 1.5 mg of streptavidin coated magnetic beads were functionalized with AntiCD9-Tag2 as described above. Beads were washed twice with 300 µL of PBS-M and then incubated with 600 µL of human blood plasma added with 2 mM MgCl2 (plasma have been previously centrifuged for 30 min at 12.000 x g to remove cell debris) for 2.5 h at 25°C under stirring. Beads were washed twice with 300 µL of PBS-M and then incubated with 50 µL of 4 mM biotin in PBS for 1 h at 25°C under stirring. After incubation the supernatant was recovered, diluted 1:10 using PBS and analyzed. The TEM images were collected through ZEISS Libra™ 200 FE 200 kV equipped with Omega filter in column. The samples were prepared by dropping the EV suspension on a TEM grid covered with formvar/carbon film. After blotting with filter paper, the samples were negative stained using UranyLess™ (EMS-Electron Microscopy Science). 54 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT [00200] Analysis of EVs (purified from plasma using RADI) by Nanoparticle Tracking Analysis. EV-containing supernatants obtained with different separation approaches were analyzed using Nanosight™ NS300 (Malvern Panalytical, Malvern, UK). Videos were analyzed by the inbuilt NanoSight™ Software NTA 3.2 Dev Build 3.2.16. The camera type, camera level, and detection threshold were sCMOS, 14, and 4, respectively. The number of completed tracks in NTA measurements was 5 (a 60 s movie was registered for each measurement). Sample was diluted 1:100 in PBS to a final volume of 1 mL. The ideal concentration was assessed by pre-testing the optimal particle per frame value (20–100 particles per frame). [00201] Discussion & Results [00202] Described herein is a method to separate extracellular vesicles by immunoaffinity capture. The invention relies on the use of antibody-DNA conjugates where the antibody is a mammalian IgG that recognizes an antigen exposed on the surface of extracellular vesicles, while DNA is an oligonucleotide characterized by two distinct domains. [00203] The first domain is an aptamer that binds streptavidin [1], while the second is a region called “barcode” that allows the immobilization of the conjugate on the surface of microarray chips functionalized with the complementary sequence of DNA. This type of conjugate is called Antibody Aptamer Conjugate (AAC). [00204] The separation strategy is depicted in Figure 1. In the first step, the AAC is immobilized on the surface of streptavidin coated beads exploiting the aptamer sequence. Then, the antibody is used to capture EVs from complex fluids through a specific antigen recognition, allowing seprating EVs from contaminants. In the last separation step EVs, together with bound AACs are released from beads exploiting a biotin-containing buffer. In fact, the strong binding of biotin to streptavidin outcompetes the aptamer causing the release of AAC from the surface of beads. During the detection step, AACs with EVs bound to them are recaptured on the surface of DNA microarrays by a specific interaction between the “barcode” region of the AAC and its complementary sequence on the surface of the microarray chip. [00205] In order to enable the separation of EVs using this strategy, AACs were synthesized adapting a protocol previously described [2]. [00206] A proof-of-concept experiment was carried out in a microarray experiment. The aptamer portion of the AAC was bound to streptavidin and released upon incubation with biotin. Silicon chips were coated with MCP-2 copolymer and functionalized with different concentrations of streptavidin. Half of the chips incubated with rabbit IgG-Tag2 were treated with 4 mM biotin. All the chips were incubated with a Cy3-labelled secondary antibody to detect the presence of the AAC on the surface of microarray chips. [00207] The results, shown in Figure 2, show that a significant amount of AAC is immobilized through aptamer recognition of streptavidin. Additionally, incubation with biotin causes the release of 55 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT most AAC molecules from the surface, confirming the feasibility of this approach for the reversible immobilization of antibodies on solid surfaces. [00208] As a negative control, the same experimental procedure was followed by incubating chips with native rabbit IgG (without DNA modification) instead of rabbit IgG-Tag2. In this case, no fluorescence was detected in correspondence of streptavidin spots, confirming that the interaction between AACs and streptavidin is highly selective and depends on the presence of the aptamer sequence. [00209] The possibility of recapturing AACs on the surface of DNA microarrays was then evaluated by exploiting the “barcode” region. Two aliquots of streptavidin-coated magnetic beads were incubated with either rabbit IgG-Tag1 and rabbit IgG-Tag2. Beads were then incubated with 4 mM biotin. The supernatant was hybridized with and silicon microarray chips spotted with sequences complementary to Tag 1 (Probe 1) and Tag2 (Probe 2). In particular rabbit IgG-tag1 is expected to bind to Probe1 while rabbit IgG-Tag2 should bind to Probe2 spots. Probe3 is used as negative control. Finally, the chips were incubated with Cy3-labelled secondary antibody to detect the presence of the AAC on the surface of microarray chips, and the fluorescence was detected using a laser scanner. [00210] The results show (see Figure 3) that both AACs bind strongly and selectively only in correspondence of their specific probe, while no signal can be detected on the negative control DNA sequences. This experiment confirms that AACs can be effectively immobilized and released from magnetic beads coated with streptavidin, and that the “barcode” region of the AAC allows re- capturing of the conjugate on the surface of a DNA microarray chip. [00211] Finally the approach described above was evaluated for the separation of EVs from biological fluids. Two sets of magnetic beads were decorated using the antiCD9-Tag2 conjugate. Then, one aliquot was incubated with EVs separated from a cell culture supernatant via ultracentrifugation (1*10¹⁰ particles/mL in PBS-M), while the second one was incubated with only PBS-M as the negative control. After the capturing step, the beads were incubated with biotin, and the supernatant recovered, analyzed by NTA and used to incubate microarray chips functionalized with Probe2 (the sequence of DNA which complementary to the AAC coding reagion) and two negative controls: Probe3 and rabbit IgG. After washing, chips were scanned using ExoView R100. The results are shown in Figs.4A-4B. [00212] Analysis by NTA (Fig.4A) shows how a population of nanoparticles with a size distribution that can be associated with a population of EVs ranging from 100 to 500 nm can be detected only in the sample incubated with EVs, while in the negative control only a small number of particles, without a well-defined distribution is detectable. [00213] Similarly, an experiment using ExoViewer™ R100 (Fig.4B), an instrument based on SP- IRIS technique, shows that particles are captured and digitally counted only in the sample incubated 56 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT with EVs. Moreover, EVs are recaptured in a selective way only on spots with DNA complementary to AntiCD9-Tag2, producing almost a saturated signal. On the contrary, only a small number of vesicles is captured on both negative controls. [00214] This experiment demonstrates that 1) EVs can be separated and recaptured on DNA microarray exploiting the approach described in this invention and 2) when only AACs are released from beads (i.e. the negative control) no signal is registered using ExoViewer™, demonstrating that AAC itself does not interfere in the detection step. [00215] Finally, the separation of EVs from complex biological fluids, namely human blood plasma, was evaluated. Following the protocol described for the previous experiment, magnetic beads were functionalized using AntiCD9-Tag2 and incubated with human blood plasma (previously centrifuged 30 min at 10000 x g to remove cell debris) for 2.5 h at room temperature. After the incubation EVs were released from the surface of beads using biotin and the supernatant was recovered, and analyzed by SP-IRIS. As negative controls, an aliquot of beads was functionalized using rabbit IgG-Tag2, and streptavidin coated beads (called “naked beads”). [00216] Supernatants were analyzed by NTA and used to incubate microarray chips functionalized with Probe2, Probe3 and Rabbit IgG as described previously. After washing, the chips were further incubated with a mix of fluorescently labeled antibodies directed against CD63 and CD9 to perform colocalization experiments, and scanned by ExoView™ R100. [00217] NTA results (see Fig. 5A) show that using AntiCD9 to functionalize beads, a good number of nanoparticles compatible with an EV population is obtained. Using beads decorated with rabbit IgG a lower number of particles is obtained, confirming a selectivity given by the antibody, while the use of naked beads led to the separation of a higher number of vesicles, suggesting some non-specific adsorption of contaminants on streptavidin. [00218] The results obtained using SP-IRIS technique are instead quite different. In fact, when beads are functionalized using AntiCD9 (Fig.5B) a strong signal for the recapture of EVs is detected on Probe2 spots, while only negligible signals are measured on the negative controls (Probe3 and rabbit IgG). Remarkably, there is a strong correspondence between label free signals (gray bars) and fluorescent colocalization (green and red bars), confirming that particles recaptured using AntiCD9- Tag2 are actually EVs. [00219] Contrarily, when magnetic beads are decorated using rabbit IgG-Tag2 (see Fig.5C), there is no correspondence. In fact, a strong signal is detected on Probe2 for label free imaging, but very low signals are registered on the same spot. This result suggests that vesicular entities (probably lipoproteins or other protein aggregates) are non-specifically captured by rabbit IgG and subsequently brought on the surface of microarray chip. However, these vesicles are not recognized by anti- tetraspanin antibodies. Instead, when “naked beads” are used for the incubation, a high number of 57 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT particles were measured by NTA, but they are not recaptured on the microarray chip, confirming that the immobilization of particles on the surface is driven only by the AAC. [00220] Finally, EVs separated from human blood plasma using AntiCD9-Tag2 were analyzed by Transmission Electron Microscopy which revealed the presence in the supernatant of a large number of intact and round-shaped extracellular vesicles (see Figure 6). This result confirmed that separation of EVs exploiting reversible aptamer-directed immobilization of antibodies occurs in conditions that preserve the integrity of their structure, thus enabling the analysis of EVs by means of imaging techniques. [00221] Described herein is the use of DNA-antibody conjugates for the separation and subsequent detection of extracellular vesicles. In particular, antibodies are conjugated to ssDNA sequences composed by two domains: a streptavidin binding aptamer and a “barcode”. The aptamer enables both the immobilization of the conjugate on streptavidin coated beads and its competitive release upon incubation with biotin, while the “barcode” region is exploited to recapture the conjugate on the surface of a microarray chip which displays the complementary DNA sequence. [00222] The Antibody Aptamer Conjugates (AACs) can be exploited to separate EVs from complex biological fluids with high affinity and selectivity. Additionally, this separation strategy exploits only mild conditions that preserve the integrity of EVs as confirmed by TEM analysis. [00223] Separated vesicles can be recaptured on a DNA microarray to be analyzed by both label free interferometric imaging and fluorescence detection. However, this separation technique can be coupled to other analytical techniques which look at different parameters, for example the EVs’ cargo composition. 58 4893-6749-9660.1 701586-192090PL01

Claims

Attorney Docket No: 701586-192090WOPT What is claimed herein is: 1. A capture reagent comprising: a first binding element that binds specifically to a target biomolecule; a second binding element that reversibly binds to a target and which can be competed off of the target; and a third binding element comprising an oligonucleotide sequence. 2. A kit comprising a capture reagent of claim 1. 3. A kit comprising a plurality of capture reagents of claim 1, the capture reagents each comprising a unique first binding element. 4. The kit of claim 3, wherein each unique first binding element binds specifically to a unique target biomolecule. 5. The kit of claim 3, wherein each unique first binding element binds specifically to a unique epitope. 6. The kit of any of the preceding claims, wherein each capture reagent of the plurality of capture reagents comprises a unique third binding element. 7. A kit comprising at least one capture reagent of claim 1, or a plurality of capture reagents of any of claims 3-6, the kit further comprising: a) a first support comprising the target of the second binding element; and b) a second support comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence of the third binding element. 8. A kit comprising at least one capture reagent of claim 1, or a plurality of capture reagents of any of claims 3-6, the kit further comprising: a) a first support comprising the target of the second binding element; and b) at least one of: i) the first support further comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence of the third binding element; and ii) a second support comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence of the third binding element. 9. The kit of any of the preceding claims, wherein the first support is a magnetic particle. 10. The kit of any of the preceding claims, wherein the support comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence comprises silicon, silicon oxide, gold, glass, and/or plastic. 59 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT 11. The kit of any of the preceding claims, wherein the support comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence comprises silicon and/or silicon oxide. 12. The kit of any of the preceding claims, wherein the support comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence comprises silicon oxide coated silicon. 13. The kit of any of the preceding claims, wherein the second support comprising at least one oligonucleotide having a sequence complementary to the third binding element is a Single- Particle Interferometric Reflectance Imaging Sensor (SP-IRIS) substrate. 14. The kit of any of the preceding claims, wherein the support comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence is a Single-Particle Interferometric Reflectance Imaging Sensor (SP-IRIS) substrate. 15. The kit of any of the preceding claims, wherein the support comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence comprises gold. 16. The kit of any of the preceding claims, wherein the support comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence comprises a Surface Plasmon Resonance (SPR) or interferometic detection technique substrate. 17. The capture reagent or kit of any of the preceding claims, wherein the first binding element comprises an antibody, antibody reagent, a nanobody, a polypeptide, an aptamer, or a DNA- binding protein. 18. The capture reagent or kit of any of the preceding claims, wherein the target biomolecule is a nanovesicle surface protein. 19. The capture reagent or kit of any of the preceding claims, wherein the target biomolecule is a tetraspannin; TSGS01; ALIX; or EPS15. 20. The capture reagent or kit of any of the preceding claims, wherein the second binding element binds streptavidin. 21. The capture reagent or kit of any of the preceding claims, wherein the second binding element binds streptavidin with a lower affinity than biotin. 22. The capture reagent or kit of any of the preceding claims, wherein the second binding element comprises an aptamer that binds streptavidin. 23. The capture reagent or kit of any of the preceding claims, wherein the second binding element comprises an aptamer that binds streptavidin with a lower affinity than biotin. 24. The capture reagent or kit of any of the preceding claims, wherein the second binding element comprises an aptamer comprising the sequence of any of Table 3. 60 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT 25. The capture reagent or kit of any of the preceding claims, wherein the second binding element comprises desthiobiotin. 26. The capture reagent or kit of any of the preceding claims, wherein the second binding element comprises an oligonucleotide. 27. The capture reagent or kit of any of the preceding claims, wherein the third binding element comprises an oligonucleotide sequence of at least 10 bp in length. 28. A method comprising: a) contacting a sample comprising one or more biological nanoparticles with at least one capture reagent of any of the preceding claims, thereby forming capture reagent- biological nanoparticle complexes; b) contacting the capture reagent-biological nanoparticle complexes with a first support comprising the target of the second binding element, thereby binding the capture reagent-biological nanoparticle complexes to the first support; c) contacting the first support and the capture reagent-biological nanoparticle complexes bound to the first support with a competing reagent that binds the target of the second binding element with greater affinity than the second binding element binds the target, thereby releasing the capture reagent-biological nanoparticles complexes from the first support; and d) contacting the released capture reagent-biological nanoparticles complexes with: the first support, the first support further comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence of the third binding element, thereby binding the capture reagent- biological nanoparticle complexes to the first support; or a further support comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence of the third binding element, thereby binding the capture reagent-biological nanoparticle complexes to the second support. 29. A method comprising: a) contacting at least one capture reagent of any of the preceding claims with a first support comprising the target of the second binding element, thereby binding the capture reagent to the first support; b) contacting a sample comprising one or more biological nanoparticles with the capture reagent bound to the first support, thereby forming capture reagent-biological nanoparticle complexes bound to the first support; 61 4893-6749-9660.1 701586-192090PL01 Attorney Docket No: 701586-192090WOPT c) contacting the first support and the capture reagent-biological nanoparticle complexes bound to the first support with a competing reagent that binds the target of the second binding element with greater affinity than the second binding element binds the target, thereby releasing the capture reagent-biological nanoparticles complexes from the first support; and d) contacting the released capture reagent-biological nanoparticles complexes with: the first support, the first support further comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence of the third binding element, thereby binding the capture reagent- biological nanoparticle complexes to the first support; or a further support comprising at least one oligonucleotide having a sequence complementary to the oligonucleotide sequence of the third binding element, thereby binding the capture reagent-biological nanoparticle complexes to the second support. 30. The method of any one of the preceding claims, further comprising detecting the capture reagent-biological nanoparticle complexes bound in step d). 31. The method of any one of the preceding claims, wherein the detecting comprises Single- Particle Interferometric Reflectance Imaging Sensor (SP-IRIS). 32. The method of any one of the preceding claims, wherein the biological nanoparticle is at least 10x greater in size volumetrically than the capture reagent. 33. The method of any one of the preceding claims, wherein the biological nanoparticle is at least 100x greater in size volumetrically than the capture reagent. 34. The method of any one of the preceding claims, wherein the capture reagent is provided in a stoichiometric excess compared to the biological nanoparticle. 35. The method of any one of the preceding claims, wherein the method does not comprise washing unbound capture reagents from the support or supports. 36. The method of any one of the preceding claims, wherein the biological nanoparticle is an extracellular vesicle (EV), virus, viral vector, a microbe, a bacterium, or a spore. 37. The method of any one of the preceding claims, wherein the biological nanoparticle is intact before step a and after step d. 38. The method of any one of the preceding claims, wherein a lipid bilayer or envelope of the biological nanoparticle is intact before step a and after step d. 39. The method of any one of the preceding claims, wherein the biological nanoparticle is not contacted with a detergent. 62 4893-6749-9660.1 701586-192090PL01