EP4615854A1 - Artificial amino acid containing lipo-oligomers for ribonucleoprotein delivery - Google Patents

Artificial amino acid containing lipo-oligomers for ribonucleoprotein delivery

Info

Publication number
EP4615854A1
EP4615854A1 EP23802183.6A EP23802183A EP4615854A1 EP 4615854 A1 EP4615854 A1 EP 4615854A1 EP 23802183 A EP23802183 A EP 23802183A EP 4615854 A1 EP4615854 A1 EP 4615854A1
Authority
EP
European Patent Office
Prior art keywords
acid
sequence
lipo
oligomer
rnp
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
EP23802183.6A
Other languages
German (de)
French (fr)
Inventor
Ernst Wagner
Ulrich LÄCHELT
Yi Lin
Mina YAZDI
Anna-Lina LESSL
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ludwig Maximilians Universitaet Muenchen LMU
Original Assignee
Ludwig Maximilians Universitaet Muenchen LMU
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ludwig Maximilians Universitaet Muenchen LMU filed Critical Ludwig Maximilians Universitaet Muenchen LMU
Publication of EP4615854A1 publication Critical patent/EP4615854A1/en
Pending legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K7/00Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/02Linear peptides containing at least one abnormal peptide link
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/542Carboxylic acids, e.g. a fatty acid or an amino acid
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/543Lipids, e.g. triglycerides; Polyamines, e.g. spermine or spermidine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/69Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
    • A61K47/6921Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere
    • A61K47/6927Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores
    • A61K47/6929Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores the form being a nanoparticle, e.g. an immuno-nanoparticle
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07CACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C233/00Carboxylic acid amides
    • C07C233/01Carboxylic acid amides having carbon atoms of carboxamide groups bound to hydrogen atoms or to acyclic carbon atoms
    • C07C233/34Carboxylic acid amides having carbon atoms of carboxamide groups bound to hydrogen atoms or to acyclic carbon atoms having the nitrogen atom of at least one of the carboxamide groups bound to a carbon atom of a hydrocarbon radical substituted by amino groups
    • C07C233/35Carboxylic acid amides having carbon atoms of carboxamide groups bound to hydrogen atoms or to acyclic carbon atoms having the nitrogen atom of at least one of the carboxamide groups bound to a carbon atom of a hydrocarbon radical substituted by amino groups with the substituted hydrocarbon radical bound to the nitrogen atom of the carboxamide group by an acyclic carbon atom
    • C07C233/36Carboxylic acid amides having carbon atoms of carboxamide groups bound to hydrogen atoms or to acyclic carbon atoms having the nitrogen atom of at least one of the carboxamide groups bound to a carbon atom of a hydrocarbon radical substituted by amino groups with the substituted hydrocarbon radical bound to the nitrogen atom of the carboxamide group by an acyclic carbon atom having the carbon atom of the carboxamide group bound to a hydrogen atom or to a carbon atom of an acyclic saturated carbon skeleton
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07CACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C233/00Carboxylic acid amides
    • C07C233/01Carboxylic acid amides having carbon atoms of carboxamide groups bound to hydrogen atoms or to acyclic carbon atoms
    • C07C233/34Carboxylic acid amides having carbon atoms of carboxamide groups bound to hydrogen atoms or to acyclic carbon atoms having the nitrogen atom of at least one of the carboxamide groups bound to a carbon atom of a hydrocarbon radical substituted by amino groups
    • C07C233/35Carboxylic acid amides having carbon atoms of carboxamide groups bound to hydrogen atoms or to acyclic carbon atoms having the nitrogen atom of at least one of the carboxamide groups bound to a carbon atom of a hydrocarbon radical substituted by amino groups with the substituted hydrocarbon radical bound to the nitrogen atom of the carboxamide group by an acyclic carbon atom
    • C07C233/37Carboxylic acid amides having carbon atoms of carboxamide groups bound to hydrogen atoms or to acyclic carbon atoms having the nitrogen atom of at least one of the carboxamide groups bound to a carbon atom of a hydrocarbon radical substituted by amino groups with the substituted hydrocarbon radical bound to the nitrogen atom of the carboxamide group by an acyclic carbon atom having the carbon atom of the carboxamide group bound to an acyclic carbon atom of a saturated carbon skeleton containing rings
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07CACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C233/00Carboxylic acid amides
    • C07C233/57Carboxylic acid amides having carbon atoms of carboxamide groups bound to carbon atoms of rings other than six-membered aromatic rings
    • C07C233/62Carboxylic acid amides having carbon atoms of carboxamide groups bound to carbon atoms of rings other than six-membered aromatic rings having the nitrogen atom of at least one of the carboxamide groups bound to a carbon atom of a hydrocarbon radical substituted by amino groups
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07CACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C233/00Carboxylic acid amides
    • C07C233/64Carboxylic acid amides having carbon atoms of carboxamide groups bound to carbon atoms of six-membered aromatic rings
    • C07C233/77Carboxylic acid amides having carbon atoms of carboxamide groups bound to carbon atoms of six-membered aromatic rings having the nitrogen atom of at least one of the carboxamide groups bound to a carbon atom of a hydrocarbon radical substituted by amino groups
    • C07C233/78Carboxylic acid amides having carbon atoms of carboxamide groups bound to carbon atoms of six-membered aromatic rings having the nitrogen atom of at least one of the carboxamide groups bound to a carbon atom of a hydrocarbon radical substituted by amino groups with the substituted hydrocarbon radical bound to the nitrogen atom of the carboxamide group by an acyclic carbon atom
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07CACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C235/00Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by oxygen atoms
    • C07C235/02Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by oxygen atoms having carbon atoms of carboxamide groups bound to acyclic carbon atoms and singly-bound oxygen atoms bound to the same carbon skeleton
    • C07C235/04Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by oxygen atoms having carbon atoms of carboxamide groups bound to acyclic carbon atoms and singly-bound oxygen atoms bound to the same carbon skeleton the carbon skeleton being acyclic and saturated
    • C07C235/10Carboxylic acid amides, the carbon skeleton of the acid part being further substituted by oxygen atoms having carbon atoms of carboxamide groups bound to acyclic carbon atoms and singly-bound oxygen atoms bound to the same carbon skeleton the carbon skeleton being acyclic and saturated having the nitrogen atom of at least one of the carboxamide groups bound to an acyclic carbon atom of a hydrocarbon radical substituted by nitrogen atoms not being part of nitro or nitroso groups
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K17/00Carrier-bound or immobilised peptides; Preparation thereof
    • C07K17/02Peptides being immobilised on, or in, an organic carrier
    • C07K17/04Peptides being immobilised on, or in, an organic carrier entrapped within the carrier, e.g. gel, hollow fibre
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K19/00Hybrid peptides, i.e. peptides covalently bound to nucleic acids, or non-covalently bound protein-protein complexes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111General methods applicable to biologically active non-coding nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/88Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation using microencapsulation, e.g. using amphiphile liposome vesicle
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90Stable introduction of foreign DNA into chromosome
    • C12N15/902Stable introduction of foreign DNA into chromosome using homologous recombination
    • C12N15/907Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22Ribonucleases [RNase]; Deoxyribonucleases [DNase]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B82NANOTECHNOLOGY
    • B82YSPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
    • B82Y5/00Nanobiotechnology or nanomedicine, e.g. protein engineering or drug delivery
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07CACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C2601/00Systems containing only non-condensed rings
    • C07C2601/12Systems containing only non-condensed rings with a six-membered ring
    • C07C2601/14The ring being saturated
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/20Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/323Chemical structure of the sugar modified ring structure
    • C12N2310/3233Morpholino-type ring
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/351Conjugate
    • C12N2310/3513Protein; Peptide
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/351Conjugate
    • C12N2310/3515Lipophilic moiety, e.g. cholesterol
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • C12N2320/32Special delivery means, e.g. tissue-specific
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • C12N2320/33Alteration of splicing

Definitions

  • the invention relates to nanoparticles for Cas protein/gRNA ribonucleoprotein (RNP) complex, siRNA or PMO delivery comprising one or more Cas protein/gRNA RNP complex(es), siRNA(s) or PMO(s) as cargo; and a carrier comprising a sequence-defined T-shape lipo-oligomer comprising a tyrosine tripeptide and either a single artificial amino acid or two hydrophobic artificial amino acids at either side of a central lysine branching point and a hydrophobic tail comprising two fatty acids, wherein the artificial amino acid is an oligo(alkylamino) acid.
  • RNP Cas protein/gRNA ribonucleoprotein
  • siRNA or PMO delivery comprising one or more Cas protein/gRNA RNP complex(es), siRNA(s) or PMO(s) as cargo
  • a carrier comprising a sequence-defined T-shape lipo-oligomer comprising a tyrosine tri
  • the invention further relates to therapeutic and non-therapeutic uses thereof and to an in vitro method for transfecting mammalian cells.
  • BACKGROUND [2] Biopharmaceuticals, such as therapeutic proteins and therapeutic nucleic acids have become increasingly important.
  • CRISPR Clustered Regularly Interspaced Short Palindromic Repeat
  • DSB double-strand breaks
  • the CRISPR/Cas system has been used for biomedical applications such as transcriptional control, epigenetic modifications, genome-wide screening and chromosomal imaging, and treatment of genetic disorders.
  • Engineered CRISPR systems contain at least two components, a guide RNA (gRNA) and a CRISPR-associated endonuclease (Cas protein).
  • gRNA guide RNA
  • Cas protein CRISPR-associated endonuclease
  • the target sequence of the programmable endonuclease Cas is controlled by a guide RNA (a combination of crRNA and tracrRNA) or a single guide RNA (sgRNA).
  • RNPs pre-assembled ribonucleoproteins
  • gRNA guide RNA
  • the direct delivery of the Cas protein complexed with gRNA or sgRNA has several advantages over the 118371P1272PC delivery of the corresponding nucleic acid precursors, as the ribonucleoprotein (RNP) complex is immediately functional without the requirement of transcription and translation. Furthermore, there is no risk of spontaneous genome integration, and timely degradation reduces potential off-target effects.
  • RNP ribonucleoprotein
  • direct delivery of the Cas/gRNA complex remains to be a challenge as it requires suitable carrier systems, due to poor membrane permeability.
  • nucleic acids and proteins are susceptible to enzymatic degradation and incorporation into a carrier system potentially increases their stability in vivo.
  • Different non-viral delivery technologies have evolved for the direct delivery of the RNP complexes (Wan, T et al., Material solutions for delivery of CRISPR/Cas-based genome editing tools: Current status and future outlook, Materials Today, 2019, 26: 40-66), including cell-penetrating peptides, DNA nanoclews, gold nanoparticles, polymeric systems, black phosphorus nanosheets, hydrogels, or lipid nanoparticles. Nonetheless, the need for better carriers for stable RNP packaging, high cellular uptake, efficient endosomal escape, and nuclear entry while preserving biological activity remains.
  • Sequence-defined cationic oligomers containing artificial amino acids provide delivery systems with high chemical precision and flexibility. Artificial amino acids, such as oligo(ethylamino) acids containing the PEI-like aminoethylene motif, are assembled together with natural amino acids on solid- phase to sequence-defined oligomers.
  • Sequence-defined oligomers, such as oligo(ethylamino) amides, based on artificial oligoamino acids and solid-phase synthesis have recently been developed as a platform for the delivery of nucleic acids (Schaffert, D. et al., Solid-phase synthesis of sequence-defined T-, i-, and U-shape polymers for pDNA and siRNA Delivery, Angew.
  • sequence-defined oligomers may further contain a lipid portion (lipo-oligomer).
  • lipo-oligomer a convenient and frequently used mechanism is based on the ionic interaction between the negatively charged nucleic acid and polycations.
  • the nucleic acid condensation by positively charged polymers is an entropy driven process and produces nanosized complexes, also referred to as polyplexes.
  • Stable packaging predominantly depends on the size and charge density of the cationic polymer.
  • the nucleic acid complexation by cationic polymers produces particles with positive surface potential, which can induce internalization by electrostatic interaction with the negatively charged cell membrane. This may be further improved by attachment of targeting ligands.
  • PEI polyethylenimine
  • ribonucleoprotein (RNP) complexes comprising a guide RNA (gRNA) or single guide RNA (sgRNA) bound by a positively charged Cas protein are not comparable to RNA (such as siRNA), plasmid DNA (pDNA) or artificial antisense oligonucleotides (such as phosphorodiamidate morpholino oligomers (PMOs)) as cargos.
  • gRNA guide RNA
  • sgRNA single guide RNA
  • Cas ribonucleoprotein
  • gRNA guide RNA
  • sgRNA single guide RNA
  • PMOs phosphorodiamidate morpholino oligomers
  • lipo-oligomers comprising oligo(alkylamino) acids were generated as a delivery platform for co-delivery of the Cas9 protein and sgRNA, disclosing a T-shape lipid-oligomer comprising a headgroup with two succinyl-tetraethylenepentamines (Stp) on either side of the central lysine and a tail comprising hydroxysteric acid (Kuhn, J. et al., Delivery of Cas9/sgRNA Ribonucleoprotein Complexes via Hydroxystearyl Oligoamino Amides, Bioconjugate Chemistry, 2020, 31, 729-742).
  • the artificial amino acid Stp complexes the negatively charged RNP complex and facilitates its cellular delivery.
  • the two fatty acids are saturated or unsaturated C12 to C22 fatty acids, preferably the two fatty acids are selected from the group consisting of oleic acid (OleA), linoleic acid 118371P1272PC (LinA), linolenic acid (LenA) or hydroxy steric acid (OHSteA), preferably OleA, LinA or OHSteA, more preferably LinA or OHSteA.
  • OleA OleA
  • LinA or OHSteA more preferably LinA or OHSteA.
  • the T-shape lipo-oligomer comprises in certain embodiments the sequence of formula I: Cn-Y3-Hn(outer)-X 1 -Hn(inner)-Kc[Kf[FA]
  • the sequence-defined T-shape lipo-oligomer may further comprise a terminal functional group at the N-terminus or the C-terminus of the T-shape lipo-oligomer, wherein the function group is (i) an azido group, or (ii) a thiol group, provided that the sequence of formula I does not comprise a cysteine; More specifically, the sequence-defined T-shape lipo-oligomer may further comprises a terminal azido group and a targeting ligand is coupled to the azido group, preferably wherein the targeting ligand is coupled to the azido group via click chemistry, more preferably click chemistry with a dibenzocylcooctyne-coupled targeting ligand.
  • the RNP complex in certain embodiments comprises Cas protein/gRNA at a ratio of about 1:1 to about 1:2 and/or wherein the Cas protein/gRNA RNP complex and the sequence-defined T-shape lipo-oligomer are mixed at a lipo-oligomer nitrogen (N) to gRNA phosphate (P) ratio (N/P ratio) of about 1:12 to 1:30, preferably about 1:20 to 1:30, more preferably of about 1:22 to 1:26.
  • the Cas protein may be (a) a Cas9, a Cas12, a Cas13 protein or an engineered variant thereof and/or (b) a base editor or a prime editor.
  • the one or more Cas protein/gRNA RNP complex(es) may be Cas9/gRNA RNP complex(es).
  • the nanoparticle may further comprises two or more Cas protein/gRNA RNP 118371P1272PC complexes as cargo, wherein the two or more Cas protein/gRNA RNP complexes comprise two or more different gRNAs targeting the same or different genes, preferably different genes.
  • the nanoparticle comprises one or more Cas protein/gRNA RNP complexes and a donor DNA.
  • the invention relates to a nanoparticle for siRNA or phosphorodiamidate morpholino oligomers (PMO) (cargo) delivery comprising one or more siRNA(s) or PMO(s) as cargo; and a carrier comprising a sequence-defined T-shape lipo-oligomer comprising an artificial amino acid, wherein the artificial amino acid is an oligo(alkylamino) acid, and wherein the T-shape lipo-oligomer comprises the sequence of formula I: Cn-Y3-Hn(outer)-X 1 -Hn(inner)-Kc[Kf[FA]2]-Hn(inner)-X 1 -Hn(outer)-Y3-Cn; Formula I (SEQ ID NO: 1) wherein Kc is a central lysine; Kf is a further lysine linked to the ⁇ -amino group of Kc; FA is a fatty acid covalently linked to the ⁇ - and
  • PMO phospho
  • the invention relates to the nanoparticle of the invention for use in therapy.
  • the invention relates to the nanoparticle of the invention for use in treating cancer, a genetic disease, an infectious disease a cardiovascular disease, a metabolic disease, a neurodegenerative or neuromuscular disease, a hematological disease, a hereditary eye disease or an autoimmune disease or an autoimmune disease.
  • the invention relates to an in vitro method for transfecting mammalian cells with one or more Cas protein/gRNA complex(es) comprising contacting a mammalian cell in vitro with the nanoparticle according to the invention.
  • the invention relates to a use of the sequence-defined T-shape lipo- oligomer for cellular delivery of a Cas protein/gRNA ribonucleoprotein (RNP) complex into a target cell, wherein the sequence defined T-shape lipo-oligomer is as defined for the nanoparticles according to the invention.
  • RNP Cas protein/gRNA ribonucleoprotein
  • an artificial amino acid in a sequence-defined T- shape lipo-oligomer for cellular delivery of a Cas protein/gRNA ribonucleoprotein (RNP) complex into a target cell, wherein the artificial amino acid is an oligo(alkylamino) acid selected from the group consisting of Gtp, Gtt, Htp, Ptp, IDAtp, TFE-IDAtp, GEIPA, Ntp, and chGtp.
  • RNP Cas protein/gRNA ribonucleoprotein
  • the oligo(alkylamino) acid is selected from the group consisting of Gtp, Gtt, Htp, TFE-IDAtp, GEIPA, and chGtp, preferably Htp, TFE-IDAtp, and chGtp.
  • the target cell is preferably a mammalian cell, such as a cell line, e.g., CHO cell or a HEK 293 cell or a primary cell in cell culture (in vitro).
  • an artificial amino acid is provided, wherein the artificial amino acid is an oligo(alkylamino) acid selected from the group consisting of the following formulas: , , in its protected and unprotected form.
  • FIG. 1 Schematic illustration of oligomers with optimized sequences comprising (A) one (1 Stp Series; from top to bottom SEQ ID NOs: 103, 102, 101, 100) or (B) two consecutive artificial amino acids (2 Stp Series, from top to bottom SEQ ID NOs: 107, 106, 105, 104) showing the lead compound succinyl-tetraethylenepentamine (Stp) on either side of the central lysine K as a representative artificial amino acid; (C) chemical structure of sequence defined T-shape lipo-oligomers showing Stp as one representative artificial amino acid.
  • FIG. 118371P1272PC [25] Figure 2. eGFP knockout experiments illustrating the effect of sequence optimization on Stp- based oligomers.
  • A The percentage of GFP knockout in HeLa eGFP/tub cells was determined using a FACS analysis after treatment with Cas9 RNP nanoparticles at 75 nM RNP dose for 48 h. Shown is the eGFP knockout efficiency (%) and cell viability using the abbreviations of Table 1.
  • FIG. 10 [33] Figure 10.
  • A Gating strategy to differentiate non-edited (eGFP positive), NHEJ (eGFP negative), and HDR (BFP positive) cell populations.
  • B Evaluation of editing percentage of non- homologous end joining (NHEJ) and homology-directed repair (HDR) by quantification of GFP knockout (NHEJ) and GFP-to-BFP conversion (HDR) in HeLa-GFPd2 cells treated with TFE-IDAtp1- Lin1 (ID oligomer #1740) Cas9 RNP/ssDNA nanoparticles at various concentrations and ratios of RNP/ssDNA of 1/1 (top) and 1/8 (bottom).
  • Figure 11 Evaluation of non-homologous end joining (NHEJ) efficiency, homology-directed repair (HDR) efficiency, total editing efficiency and non-edited cell percentage in a side-by-side comparison of selected 1445-based structures, 1396-based structures and 1392-based structures comprising the artificial amino acids as indicated.
  • NHEJ non-homologous end joining
  • HDR homology-directed repair
  • Results are shown as (A) heat map of NHEJ efficiency in HeLa GFPd2 cells 48 h after treatment with different Cas9 RNP/ssDNA nanoparticle (fixed at 1/4) formulations at varied RNP concentrations; (B) heat map of HDR efficiency in HeLa GFPd2 cells 48 h after treatment with different Cas9 RNP/ssDNA (fixed at 1/4) nanoparticle formulations at varied RNP concentrations; (C) heat map of total editing efficiency in HeLa GFPd2 cells 48 h after treatment with different Cas9 RNP/ssDNA nanoparticle (fixed at 1/4) formulations at varied RNP concentrations; (D) heat map of non-edited cell percentages in HeLa GFPd2 cells 48 h after treatment with different Cas9 RNP/ssDNA (fixed at 1/4) nanoparticle formulations at varied RNP concentrations.
  • FIG. 12 Structure-activity relationship of PMO(Ex23)-LP 1:3 formulations.
  • A Schematic illustrations of lipo-oligomers (LP) architectures classified according to the ionizable backbone into “Stp” (#1391-#1393), “H-Stp-H” (#1395-#1397) and “Stp-Stp” (#1195).
  • the table summarizes individual fatty acids contained.
  • K lysin
  • Y tyrosine
  • Stp succinyl tetraethylene pentamine
  • FA fatty acid.
  • D) Dose titration of PMO(Ex23)-1195 and -1395 formulations (2.4 nM to 312.5 nM PMO) with exposure of HeLa mCherry- DMDEx23 cells for 24 h. Percentage of mCherry expressing cells was determined 24h after treatment. Data are presented as mean ⁇ SD (n 3).
  • Figure 13 Comparison of various artificial amino acids in 1392-based and 1396-based structures for PMO delivery.
  • Figure 14 Gene silencing activity of siRNA polyplexes in KB/eGFPLuc cells.
  • SiRNA polyplexes were formulated with different carriers with Stp2-HC (N/P 12), Stp1-H (N/P 24), and Stp1-HC carriers (N/P 24) in HBG (25 ⁇ g siRNA/mL), and tested at doses of 250, 125 and 63 ng siRNA per well.
  • siRNAs eGFP-targeted siRNA (siGFP) and control siRNA (siCtrl) were used.
  • Figure 15 Gel electrophoresis of siRNA polyplexes in comparison to free siRNA.
  • siCtrl polyplexes were formed with different carriers at indicated N/P ratios in HBG (25 ⁇ g siRNA/mL), and their stability was evaluated by standard agarose (2.5%, TBE buffer) gel shift assay.
  • DETAILED DESCRIPTION [39] The term “comprises” or “comprising” means “including, but not limited to”. The term is intended to be open-ended, to specify the presence of any stated features, elements, integers, steps or components, but not to preclude the presence or addition of one or more other features, elements, integers, steps, components or groups thereof.
  • protein is used interchangeably with “amino acid sequence” or “polypeptide” and refers to polymers of amino acids of any length. These terms also include proteins that are post- translationally modified through reactions that include, but are not limited to, glycosylation, acetylation, phosphorylation, glycation or protein processing. Modifications and changes, for example fusions to other proteins, amino acid sequence substitutions, deletions or insertions, can be made in the structure of a polypeptide while the molecule maintains its biological functional activity. For example, certain amino acid sequence substitutions can be made in a polypeptide or its underlying nucleic acid coding sequence and a protein can be obtained with the same properties.
  • sequence-defined (T-shape) lipo-oligomers comprising at least two artificial amino acids as used in the nanoparticle according to the invention are distinct from a polypeptide or protein.
  • a “peptide bond” as used herein is an amide type of covalent chemical bond linking two amino acids via the carboxylic group of one amino acid with the amino group of the other amino acid.
  • the peptide bond refers to the bond between two ⁇ -functional groups of two amino acids between C-1 of one amino acid (carboxylate) and N of C-2 of the other amino acid ( ⁇ -amino group), which may also be referred to as ⁇ -peptide bond in contrast to an amide bond with the ⁇ -amino group of lysine (side chain amino group).
  • nucleic acid sequence is used interchangeably with “polynucleotide” and refers to DNA or RNA of any length.
  • polynucleotide refers to DNA or RNA of any length.
  • pDNA as used herein means plasmid DNA.
  • eukaryotic cell refers to cells that have a nucleus within a nuclear envelop and include animal cells, human cells, plant cells and yeast cells.
  • a “eukaryotic cell” particularly encompasses mammalian cell, such as human or rodent cells, including without being limited thereto Chinese hamster ovary (CHO) cells, Neuro-2a cells, BHK cells, HEK293 cells, HeLa cells, HepG2 cells or derivatives thereof as well as primary cells, particularly human primary cells.
  • Mammalian cells as used herein refer to all cells of mammalian origin, such as human or rodent cells.
  • sequence-defined refers to a sequential assembly of the compounds, particularly using a solid-phase supported synthesis, such as common Fmoc solid-phase synthesis (SPS). In the present context this involves the use of artificial amino acids with appropriate protecting groups, such as compatible with Fmoc SPS together with Fmoc ⁇ -amino acids.
  • guide RNA abbreviated to gRNA as used herein refers to an RNA that is partially complementary to a target DNA locus and guides the Cas protein endonuclease to this site.
  • the gRNA may be a CRISPR RNA (crRNA), a crRNA that pairs with trans-activating crRNAs (tracrRNA), an artificial single-guide RNA, an artificial prime editing guide RNA (pegRNA) or other RNA molecules which form a complex with a Cas protein and guide it to the target DNA sequence.
  • single- guide RNA abbreviated to sgRNA as used herein refers to an artificial RNA consisting of tracr RNA, crRNA and an artificial RNA linker.
  • modified/improved sgRNAs such as tru-gRNA, using a spacer sequence with ⁇ 20 nucleotides complementary to the protospacer target, and hp- sgRNA, comprising an extension on the 5’end of the spacer.
  • modified/improved means compared to the canonical guide RNA.
  • Many Cas12 nucleases are guided by a single crRNA.
  • the term “artificial” in the context of an RNA means an engineered non-naturally occurring RNA.
  • a guide RNA may also be chemically modified to increase stability, reduce TLR activation and increase specificity.
  • the CRISPR/Cas system composed of the gRNA and a Cas protein as a targeted nuclease can identify a targeting sequence next to a protospacer adjacent motif (PAM) through guidance by a gRNA which is specific for the targeting sequence and then cleave the DNA (or RNA in specific cases) at specific sites.
  • the gRNA therefore confers sequence specificity to the RNP complex and several gRNA (with different target specificity) can be used with the CRISPR/Cas system.
  • the gRNA is a sgRNA.
  • the terms “Cas” and “Cas protein” are used interchangeably herein and refers to a CRISPR- associated endonuclease.
  • Suitable Cas proteins include, without being limited thereto, type II Cas proteins, e.g., Cas9 (such as SpCas9, SaCas9, CjCas9, StCas9 or NmeCas9); type V Cas proteins, e.g., Cas12a (formerly Cpf1), Cas12f (formerly Cas14), Cas12b (formerly c2c1), Cas12i, Cas12e 118371P1272PC (formerly CasX) or Cas12g; and type VI Cas proteins, e.g., Cas13a, all of which include engineered variants thereof (engineered Cas variants).
  • Cas9 such as SpCas9, SaCas9, CjCas9, StCas9 or NmeCas9
  • type V Cas proteins e.g., Cas12a (formerly Cpf1), Cas12f (formerly Cas14), Cas12b (formerly c2c1)
  • Engineered Cas variants include, without being limited thereto, variants with altered PAM compatibilities, such as less restrictive or different PAM compatibility of Cas9 or Cas12 variants (e.g., Anzalone et al., Nature Biotechnology, 38, 2020: pages 824-844, supplementary Table 1); variants with higher DNA specificity, such as variants with reduced off-target Cas nuclease activity (e.g., eSpCas(1.1), SpCas9-HF1, HypaCas9, evoCas9, Sniper-Cas9, HiFiCas9, enAsCas12a-HF1); base editors (e.g., as listed in Anzalone et al., Nature Biotechnology, 38, 2020: pages 824-844, supplementary Tables 2 and 3); CRISPR-associated transposases and engineered Cas-domain-fused transposase and recombinase systems; and prime editors
  • a Cas nickase e.g., nickase Cas9n and Cas9D10A
  • nickase Cas9n and Cas9D10A comprising an inactivating mutation in one or more of the nuclease domains (cleaving only one of the DNA strands) and a nuclease-deficient dCas mutant with only sgRNA binding ability, optionally further fused to another enzyme, expanded the conventional editing applications.
  • Cas protein ortholog refers to one of two or more homologous Cas proteins derived from different species, for example Cas9 orthologs include, without being limited thereto, Cas9 protein derived from a different bacterial species, such as SpCas9 derived from Streptococcus pyogenes, SaCas9 derived from Staphylococcus aureus, CjCas9 derived from Campylobacter jejuni, StCas9 derived from Streptococcus thermophilus, and NmeCas9 from Neisseria meningitidis. Cas orthologs typically differ in the recognized PAM sequences and size. The most often used Cas9 protein is SpCas9.
  • the term “engineered” in the context of a protein, particularly a Cas protein means an artificial, non-naturally protein, particularly Cas protein, such as a protein with a deleted domain and/or a fusion protein and/or a mutated protein, wherein the mutation may for example result in a different specificity, e.g., a different PAM specificity, or an inactivated or enhanced enzyme activity of the protein or of one or more of the distinct nuclease domain(s) (e.g., RuvC and/or HNH of Cas9).
  • a different specificity e.g., a different PAM specificity
  • an inactivated or enhanced enzyme activity of the protein or of one or more of the distinct nuclease domain(s) e.g., RuvC and/or HNH of Cas9
  • Cas9 protein refers to Cas9 nucleases that are guided by guide RNAs to generate predominantly blunt-end DSBs using two distinct nucleases (RuvC and HNH), as well as engineered variants thereof, e.g., Cas9 nickase comprising an inactivated HNH and/or RuvC nuclease domain and the nuclease-deficient dCas9.
  • RuvC and HNH two distinct nucleases
  • Cas9 nickase comprising an inactivated HNH and/or RuvC nuclease domain and the nuclease-deficient dCas9.
  • a double-strand break at the target site in the cellular genome is introduced.
  • Strand breaks can be repaired by non-homologous end joining (NHEJ), which can introduce insertions or deletions (indels) or in the presence of a donor DNA by homology-directed repair (HDR).
  • the donor DNA may be double-stranded DNA (dsDNA) or single-stranded DNA (ssDNA), such as single stranded oligonucleotide donors (ssODNs). It can be delivered as plasmid, linear double-stranded DNA or single stranded DNA. Also, the donor DNA may be co-delivered together with the RNP complex or may be delivered separately by non-viral or viral delivery.
  • the donor DNA may be delivered using a separate nanoparticle, wherein the carrier may be the same, i.e., the sequence-defined T-shape lipo-oligomer according to the invention or the carrier may be different.
  • exemplary viral-delivery methods include, e.g., adeno-associated virus (AAV), lentivirus or adenovirus, preferably AAV. 118371P1272PC [52]
  • AAV adeno-associated virus
  • lentivirus or adenovirus preferably AAV. 118371P1272PC
  • the term “indel” or “indels” as used herein refers to a variety of insertions and deletions, typically introduced by error-prone non-homologous end joining processes during the cellular repair of double- stranded DNA breaks (DSBs). Indel products that result from DSB cannot be controlled, but are not random.
  • chimeric single-guide RNA abbreviated to cgRNA as used herein refers to a modified sgRNA which carries a first sequence to generate double-stranded breaks and a second sequence for homology-directed repair.
  • base editor introduces targeted point mutations without the requirement of DSBs or donor DNA template. Typically, a base editor containing a catalytically impaired CRISPR-Cas nuclease (that cannot make DSBs), such as Cas9 nickases or dCas9, fused to a DNA deaminase enzyme.
  • CBEs cytosine base editors
  • ABEs adenine base editors
  • the base editor may optionally further be fused to proteins that modify the DNA repair machinery, (e.g., uracil glycosylase inhibitor domain (UGI) for CBEs or N- methylpurine DNA glycosylase for ABEs.
  • UMI uracil glycosylase inhibitor domain
  • ABEmax use a Cas nickase.
  • the person skilled in the art understands that the Cas nickase nicks the non-deaminated DNA strand.
  • a base editor may comprise a dCas mutant.
  • the term “prime editor” as used herein refers to a a combination of a Cas9 nickase domain (inactivated HNH nuclease) and an engineered reverse transcriptase domain, which may be fused or untethered.
  • Prime editors can introduce all possible types of point mutations, including all base pair conversions, small insertions and small deletions in a precise and targeted manner with favorable editing to indel ratios.
  • the prime editor is targeted to the editing site by an engineered prime editing guide RNA (pegRNA), which specifies the target site in its spacer sequence and the desired edit in an extension that is typically at the 3’end of the pegRNA.
  • pegRNA prime editing guide RNA
  • the Cas9 RuvC nuclease domain nicks the PAM-containing DNA strand and uses the newly liberated 3’ end at the target DNA site to prime reverse transcription using the extension of the pegRNA.
  • Successful priming requires that the extension in the pegRNA contain a primer binding sequence (PBS) that hybridizes with the 3’end of the nicked target DNA strand to form a primer-template complex.
  • PBS primer binding sequence
  • the reverse transcriptase domain then copies the template from the pegRNA extension into the genomic DNA directly adding the edited sequence to the target locus.
  • the edited 3’flap replaces the redundant 5’flap, presumably by cellular DNA repair processes.
  • the non-edited complementary strand is replaced by DNA repair using the edited strand as a template.
  • Prime editors without being limited thereto are PE1 (fusion of Cas9 nickase to wild-type Moloney murine leukemia virus (M-MLV) reverse transcriptase (RT), PE2 (fusion of Cas9 nickase to engineered pentamutant M-MLV RT with increased editing efficiency), PE3 (PE2 and pegRNA and additional sgRNA), PE3b (PE3 using a nicking sgRNA 118371P1272PC that targets only the edited sequence), PE4 (PE2 in combination with DNA mismatch repair inhibiting protein MLH1dn), PE5 (PE3 in combination with MLH1dn) and PEmax (optimization of PE2) or split Prime editors, such as Split-PE (Cas9 nickase and reverse transcriptase are expressed separately and combined at the mRNA or protein level).
  • M-MLV Moloney murine leukemia virus
  • RT fusion of Cas9 nickase to engineered pentamutant M-ML
  • Prime editors are known in the art, such as derivable from Anzalone et al., (Nature Biotechnology, 38, 2020: pages 824-844), Chen et al., (Cell, 184(22), 2021: pages 5635-5652.e29), Liu, B. et al., (Nat Biotechnol 40, 2022: 1388–1393) and Grünewald, J. et al., (Nat Biotechnol (2022); doi: 10.1038/s41587-022-01473-1).
  • click chemistry refers to a class of highly specific, in many cases biorthogonal, covalent conjugation reactions, that are modular, efficient, relatively insensitive to solvent parameters, water and oxygen.
  • Typical click reactions without being limited thereto are copper-catalyzed azide-alkylene cycloaddition (CuAAC) (copper-catalyzed reaction of an azide with an alkyne), copper-free azide-alkyne cycloaddition, such as strain-promoted azide-alkyne cycloaddition (SPAAC), Diels-Alder or inverse electron Diels-Alder reaction, thiol-ene or thiol-yne reaction, and alkene-tetrazole photoclick reaction.
  • CuAAC copper-catalyzed azide-alkylene cycloaddition
  • SPAAC strain-promoted azide-alkyne cycloaddition
  • targeting ligand refers to a ligand that binds to a receptor resulting in receptor-mediated endocytosis. Coupling a targeting ligand to the nanoparticles of the invention, or more specifically to the carrier comprised in the nanoparticle of the invention, allows targeted delivery and hence receptor or even cell specific delivery.
  • the nanoparticle can be converted to a receptor-targeted nanoparticle, e.g, via copper-free click chemistry for reacting azido functional groups with dibenzocyclooctyne (DBCO)-containing targeting ligands or thiol chemistry including thiol-maleimide addition for coupling targeting ligands such as folic acid (FolA)-PEG for folate receptor ⁇ (FR ⁇ )-specific delivery.
  • DBCO dibenzocyclooctyne
  • thiol chemistry including thiol-maleimide addition for coupling targeting ligands such as folic acid (FolA)-PEG for folate receptor ⁇ (FR ⁇ )-specific delivery.
  • carrier as used herein relates to a non-viral carrier for the delivery of nucleic acid and/or protein.
  • the carrier is a sequence-defined artificial polymer, more specifically a sequence-defined T-shape lipo-oligomer, that forms complexes, i.e., nanoparticles, with its cargo such as the Cas protein/gRNA ribonucleoprotein (RNP) complex.
  • RNP Cas protein/gRNA ribonucleoprotein
  • nanoparticle as used herein relates to the complex of the carrier (e.g., the sequence-defined T- shape lipo-oligomer) formed with its cargo (e.g. Cas protein/gRNA RNP complex) and can be as small as 6 nm up to several hundreds of nanometers, depending on the sequence-defined oligomer and/or the cargo.
  • Such nanoparticles are also sometimes referred to as polyplexes.
  • sequence-defined artificial polymers can be generated to meet the requirements for specific delivery.
  • These sequence-defined artificial polymers may be formed by peptide-like artificial macromolecular structures comprising an artificial amino acid and one or more lipids or fatty acids (lipo-oligomer).
  • the sequence-defined artificial polymers such as sequence-defined T-shape lipo- oligomers, may also be referred to as “carrier” herein.
  • the sequence-defined artificial polymer is a sequence-defined T-shape lipo-oligomer, wherein the peptide- like artificial macromolecule structure (oligomer) comprising an artificial amino acid forms a headgroup and two fatty acids covalently linked to a lysine form the hydrophobic tail.
  • the invention relates to a nanoparticle for Cas protein/gRNA ribonucleoprotein (RNP) complex (cargo) delivery comprising one or more Cas protein/gRNA RNP complex(es) as cargo; and a carrier comprising a sequence-defined T-shape lipo-oligomer comprising (a) a headgroup comprising an oligomer comprising i. a central lysine (Kc), and ii.
  • RNP Cas protein/gRNA ribonucleoprotein
  • carrier comprising a sequence-defined T-shape lipo-oligomer comprising (a) a headgroup comprising an oligomer comprising i. a central lysine (Kc), and ii.
  • FA two fatty acids
  • the invention relates to a sequence-defined T-shape lipo-oligomer comprising the sequence of formula I: Cn-Y3-Hn(outer)-X 1 -Hn(inner)-Kc[Kf[FA]2]-Hn(inner)-X 1 -Hn(outer)-Y3-Cn; 118371P1272PC Formula I, as disclosed and specified herein, or the sequence of formula III: Cn-Y3-Hn(outer)-[X 2 -Hn(inner)]2-Kc[Kf[FA]2]-[Hn(inner)-X 2 ]2-Hn(outer)-Y3-Cn; Formula III, as disclosed and specified herein.
  • sequence-defined T-shape lipo-oligomer is used as carrier for Cas protein/gRNA ribonucleoprotein (RNP) complex delivery as in the nanoparticles comprising one more Cas protein/gRNA RNP complex(es) as cargo according to the invention.
  • sequence-defined T-shape lipo-oligomer may also be used as carrier for delivery of nucleic acids, such as siRNA or phosphorodiamidate morpholino oligomers (PMO).
  • PMO phosphorodiamidate morpholino oligomers
  • the sequence-defined T-shape lipo-oligomer as carrier may form nanoparticles with the nucleic acid, such as siRNA or PMO, for delivery.
  • sequence-defined T-shape lipo-oligomer as carrier may be covalently linked to the PMO, preferably to the 5’- or 3’-end of the PMO.
  • sequence-defined T-shape lipo- oligomer as carrier covalently linked to the PMO comprises the sequence of formula I and/or the artificial amino acid is selected from Stp, chGtp, dGtp or TFEIDAtp.
  • the fatty acid is preferably OleA or LinA.
  • the sequence-defined T-shape lipo-oligomer of formula I or III of the nanoparticle according to the invention is T-shaped with an oligomer comprising the artificial amino acid as the horizontal bar (headgroup) and two fatty acids forming the vertical (hydrophobic) tail.
  • the sequence-defined T-shape lipo-oligomer comprises a central lysine (Kc) as branching point, with a further lysine linked to the ⁇ - amino group of Kc, which provides a further branching point to the covalently linked fatty acids ([FA]2).
  • the sequence-defined T-shape lipo-oligomer is preferably essentially symmetrical, more preferably it is symmetrical in sequence.
  • Kc central lysine
  • the sequence-defined T-shape lipo-oligomer of formula I or III of the nanoparticle according to the invention may further comprise a glycine between Kc and Kf.
  • a glycine between Kc and Kf.
  • Such an additional glycine is functionally inert. It therefore serves as a short spacer and has been added into some lipo-oligomers in the past to simplify synthesis.
  • Formula I comprises (a) a central lysine; (b) two tyrosine tripeptides (YYY or Y3), one tyrosine tripeptide at either side of the central lysine (Kc) and at the same distance to the central lysine; (c) two oligo(alkylamino) acids (X 1 ), one X 1 at either side of the central lysine (Kc) and at the same distance to the central lysine, wherein the oligo(alkylamino) acid has the formula IIa as disclosed herein; (d) a 118371P1272PC further lysine (Kf) linked to the ⁇ -amino group of the central lysine (Kc); and (e) two fatty acids (FA) covalently linked to the ⁇ - and ⁇ -amino group of a further lysine (Kf).
  • the central lysine (Kc) serves as a branching point between the headgroup and the hydrophobic tail and the further lysine (Kf) serves as a branching point for the covalent linkage of the two fatty acids (FA).
  • the sequence-defined T- shape lipo-oligomers contain a single artificial amino acid at either side of the central lysine, wherein the artificial amino acid is an oligo(alkylamino) acid. Due to the symmetry of the T-shape lipo-oligomer the artificial amino acid on opposite side of Kc is the same.
  • the tyrosine tripeptides at either side of the central lysine represent a hydrophobic motif.
  • the T-shape lipo-oligomer comprises the sequence of Y3-X 1 -Kc[Kf[FA]2]-X 1 -Y3 (SEQ ID NO: 10).
  • n(inner) and/or n(outer) are 0, n(inner) and/or n(outer) are 1, n(inner) and/or n(outer) are 2, n(inner) is 0 and n(outer) is 1, n(inner) is 1 and n(outer) is 0, n(inner) and n(outer) are 0, n(inner) and n(outer) are 1, or n(inner) and n(outer) are 2; preferably n(inner) and n(outer) are 0, n(inner) and n(outer) are 1, or n(inner) and n(outer) are 2; more preferably
  • the T-shape lipo-oligomer comprises a sequence selected from the group consisting of: Y3-Hn(outer)-X 1 -Hn(inner)-Kc[Kf[FA]2]-Hn(inner)-X 1 -Hn(outer)-Y3 (SEQ ID NO: 4), Y3-H-H-X 1 -H-H-Kc[Kf[FA]2]-H-H-X 1 -H-H-Y3 (SEQ ID NO: 6), Y3-H-X 1 -H-Kc[Kf[FA]2]-H-X 1 -H-Y3 (SEQ ID NO: 8), and Y3-X 1 -Kc[Kf[FA]2]-X 1 -Y3 (SEQ ID NO: 10).
  • sequence-defined T-shape lipo-oligomer comprises a sequence selected from the group consisting of: C-Y3-Hn(outer)-X 1 -Hn(inner)-Kc[Kf[FA]2]-Hn(inner)-X 1 -Hn(outer)-Y3-C (SEQ ID NO: 3), Y3-Hn(outer)-X 1 -Hn(inner)-Kc[Kf[FA]2]-Hn(inner)-X 1 -Hn(outer)-Y3 (SEQ ID NO: 4), C-Y3-H-H-X 1 -H-H-Kc[Kf[FA]2]-H-H-X 1 -H-H-Y3-C (SEQ ID NO: 5), 118371P1272PC Y3-H-H-X 1 -H-H-Kc[Kf[FA]2]-H-H-X 1 -H-H-Y3-C (
  • the functional group is, e.g., for coupling a targeting ligand.
  • the functional group may further be used for coupling cargo, such as PMOs.
  • the functional group (azido group or thiol group) may be N-terminally or C-terminally, preferably the functional group is N-terminally.
  • the sequence-defined T-shape lipo-oligomer comprising the sequence of formula I may comprise a terminal azido group, such as an azido-hexanoic acid or an azido-lysine, preferably an azido-lysine.
  • the azido group may be N-terminally or C-terminally, preferably the azido group is N-terminally. Although a single terminal azido group is sufficient, theoretically the sequence-defined T-shape lipo-oligomer may also comprise an azido group at the N- terminal and/or the C-terminal.
  • the azido-lysine (K(N3)) comprising sequence- defined T-shape lipo-oligomer comprises a sequence selected from the group consisting of: K(N3)-C-Y3-Hn(outer)-X 1 -Hn(inner)-Kc[Kf[FA]2]-Hn(inner)-X 1 -Hn(outer)-Y3-C (SEQ ID NO: 11), K(N3)-Y3-Hn(outer)-X 1 -Hn(inner)-Kc[Kf[FA]2]-Hn(inner)-X 1 -Hn(outer)-Y3 (SEQ ID NO: 12), K(N3)-C-Y3-H-H-X 1 -H-H-Kc[Kf[FA]2]-H-H-X 1 -H-H-Y3-C (SEQ ID NO: 13), K(N3)-Y3-H-H-X 1 -H-H-Y
  • the sequence-defined T- shape lipo-oligomer comprises a single terminal thiol group.
  • This single terminal thiol group may be 118371P1272PC N-terminally or C-terminally, preferably the thiol group is N-terminally.
  • the thiol group is a cysteine and the sequence-defined T-shape lipo-oligomer comprises a single cysteine at the N- terminus or the C-terminus.
  • the cysteine is used for coupling a targeting ligand only a single terminal cysteine should be present.
  • the single cysteine comprising sequence- defined T-shape lipo-oligomer comprises a sequence selected from the group consisting of: C-Y3-Hn(outer)-X 1 -Hn(inner)-Kc[Kf[FA]2]-Hn(inner)-X 1 -Hn(outer)-Y3 (SEQ ID NO: 27), Y3-Hn(outer)-X 1 -Hn(inner)-Kc[Kf[FA]2]-Hn(inner)-X 1 -Hn(outer)-Y3-C (SEQ ID NO: 28), C-Y3-H-H-X 1 -H-H-Kc[Kf[FA]2]-H-H-X 1 -H-H-Y3 (SEQ ID NO: 29), Y3-H-H-X 1 -H-H-Kc[Kf[FA]2]-H-H-X 1 -H-H-Y3-C
  • Formula III comprises (a) a central lysine; (b) two tyrosine tripeptides (YYY or Y3), one tyrosine tripeptide at either side of the central lysine (Kc) and at the same distance to the central lysine; (c) two oligo(alkylamino) acids (X 2 ) at either side of the central lysine (Kc) and at the same distance to the central lysine, wherein the oligo(alkylamino) acid has the formula IIa as disclosed herein for formula III; (d) a further lysine (Kf) linked to the ⁇ -amino group of the central lysine (Kc); and (e) two fatty acids (FA) covalently linked to the ⁇ - and ⁇ -amino group of a further lysine (Kf).
  • the central lysine (Kc) serves as a branching point between the headgroup and the hydrophobic tail and the further lysine (Kf) serves as a branching point for the covalent linkage of the two fatty acids (FA).
  • the two artificial amino acids (X 2 ) on the same side of Kc may be the same or different, preferably the two artificial amino acids (X 2 ) on the same side of Kc are the same. Due to the symmetry of the T-shape lipo-oligomer the artificial amino acids on opposite side of Kc are the same.
  • the tyrosine tripeptides at either side of the central lysine represent a hydrophobic motif.
  • the more hydrophobic artificial amino acids used in formula III may allow for decreasing size of the sequence-defined T shape lipo-oligomer, without losing stability.
  • the T-shape lipo-oligomer comprises the sequence of Y3-X 2 2-Kc[Kf[FA]2]-X 2 2-Y3 (SEQ ID NO: 40).
  • histidines or other imidazole derivatives with a pKa of around 6 have been incorporated into oligomers as they increase their endosomal buffer capacity, which may result in improved endosomal escape and delivery.
  • n(inner) and/or n(outer) are 0, n(inner) and/or n(outer) are 1, n(inner) is 0 and n(outer) is 1, n(inner) is 1 and n(outer) is 0, n(inner) and n(outer) are 0, n(inner) and n(outer) are 1; preferably n(inner) and n(outer) are 0 or n(inner) and n(outer) are 1; more preferably n(inner) and n(outer) are 0.
  • the T-shape lipo-oligomer comprises a sequence selected from the group consisting of: Y3-Hn(outer)-[X 2 -Hn(inner)]2-Kc[Kf[FA]2]-[Hn(inner)-X 2 ]2-Hn(outer)-Y3 (SEQ ID NO: 36), Y3-H-X 2 -H-X 2 -H-Kc[Kf[FA]2]-H-X 2 -H-X 2 -H-Y3 (SEQ ID NO: 38), and Y3-X 2 2-Kc[Kf[FA]2]-X 2 2-Y3 (SEQ ID NO: 40).
  • cysteine is either present at the N-terminal and the C-terminal end or is absent from both ends.
  • Cysteine may help to stabilize the nanoparticle by formation of disulfide bonds. Particularly for less stable sequence- defined oligomers cysteines may be important. As demonstrated in the examples, the presence of cysteine is not required in small hydrophobically stabilized sequence-defined T-shape lipo-oligomers and may further not be necessary when using more hydrophobic artificial amino acids.
  • sequence-defined T-shape lipo-oligomer comprises a sequence of formula III selected from the group consisting of: C-Y3-Hn(outer)-[X 2 -Hn(inner)]2-Kc[Kf[FA]2]-[Hn(inner)-X 2 ]2-Hn(outer)-Y3-C (SEQ ID NO: 35), Y3-Hn(outer)-[X 2 -Hn(inner)]2-Kc[Kf[FA]2]-[Hn(inner)-X 2 ]2-Hn(outer)-Y3 (SEQ ID NO: 36), C-Y3-H-X 2 -H-X 2 -H-Kc[Kf[FA]2]-H-X 2 -H-X 2 -H-Y3-C (SEQ ID NO: 37); Y3-H-X 2 -H-X 2 -H-Kc[Kf[FA]2]-H-X
  • the functional group is, e.g., for coupling a targeting ligand.
  • the functional group may further be used for coupling cargo, such as PMOs.
  • the functional group (azido group or thiol group) may be N-terminally or C-terminally, 118371P1272PC preferably the functional group is N-terminally.
  • the sequence-defined T-shape lipo-oligomer comprising the sequence of formula III may comprise a terminal azido group, such as an azido- hexanoic acid or an azido-lysine, preferably an azido-lysine.
  • the azido group may be N-terminally or C-terminally, preferably the azido group is N-terminally.
  • sequence-defined T-shape lipo-oligomer may also comprise an azido group at the N-terminal and/or the C-terminal.
  • the azido-lysine (K(N3)) comprising sequence-defined T-shape lipo-oligomer comprises a sequence of formula III selected from the group consisting of: K(N3)-C-Y3-Hn(outer)-[X 2 -Hn(inner)]2-Kc[Kf[FA]2]-[Hn(inner)-X 2 ]2-Hn(outer)-Y3-C (SEQ ID NO: 41), K(N3)-Y3-Hn(outer)-[X 2 -Hn(inner)]2-Kc[Kf[FA]2]-[Hn(inner)-X 2 ]2-Hn(outer)-Y3 (SEQ ID NO: 42), K(N3)-C-Y3-H-
  • the sequence-defined T-shape lipo-oligomer comprises a single terminal thiol group.
  • This single terminal thiol group may be N-terminally or C-terminally, preferably the thiol group is N-terminally.
  • the thiol group is a cysteine and the sequence-defined T-shape lipo-oligomer comprises a single cysteine at the N- terminus or the C-terminus.
  • the single cysteine comprising sequence- defined T-shape lipo-oligomer comprises a sequence selected from the group consisting of: C-Y3-Hn(outer)-[X 2 -Hn(inner)]2-Kc[Kf[FA]2]-[Hn(inner)-X 2 ]2-Hn(outer)-Y3 (SEQ ID NO: 53), Y3-Hn(outer)-[X 2 -Hn(inner)]2-Kc[Kf[FA]2]-[Hn(inner)-X 2 ]2-Hn(outer)-Y3-C (SEQ ID NO: 54), C-Y3-H-X 2 -H-X 2 -H-Kc[Kf[FA]2]-H-X 2 -H-X 2 -H-Y3 (SEQ ID NO: 55);
  • a terminal azido group or a single terminal thiol group allows coupling of, e.g., a targeting ligand using click chemistry or using thiol conjugation, respectively.
  • the functional group may further be used for coupling cargo, such as PMOs.
  • the sequence-defined T-shape lipo- oligomer comprises a sequence of formula I further comprising a terminal azido group, such as a 118371P1272PC terminal azido-lysine or azido-hexanoic acid and a targeting ligand is coupled to the azido-lysine or azido-hexanoic acid.
  • the terminal azido group is a terminal azido-lysine.
  • the targeting ligand is coupled to the azido-group via click chemistry, more preferably click chemistry with a dibenzocylooctyne-coupled targeting ligand.
  • Click chemistry is a general term for highly specific, in many cases biorthogonal, covalent conjugation reactions, that are modular, efficient and relatively insensitive to solvent parameters, water and oxygen.
  • Various click chemistry reactions are known in the art and the person skilled in the art would know how to select a specific click chemistry reaction for a certain conjugation and particular for a certain protein or oligomer, such as the sequence-defined T-shape lipo-oligomer.
  • Typical click reactions are copper-catalyzed azide-alkylene cycloaddition (CuAAC) (copper-catalyzed reaction of an azide with an alkyne), copper- free azide-alkyne cycloaddition, such as strain-promoted azide-alkyne cycloaddition (SPAAC), Diels- Alder or inverse electron Diels-Alder reaction, and alkene-tetrazole photoclick reaction.
  • CuAAC copper-catalyzed azide-alkylene cycloaddition
  • SPAAC strain-promoted azide-alkyne cycloaddition
  • Diels- Alder or inverse electron Diels-Alder reaction Diels- Alder or inverse electron Diels-Alder reaction
  • alkene-tetrazole photoclick reaction e-tetrazole photoclick reaction.
  • a single terminal cysteine may be used for coupling via dis
  • the targeting ligand may be a ligand that binds to a receptor resulting in receptor-mediated endocytosis (also referred to as receptor-mediated internalization). This may be a natural ligand or an artificial ligand, such as an antibody, a fusion protein or a small molecule binding to a receptor and mediating uptake. Coupling a targeting ligand to the carrier of the nanoparticles of the invention allows targeted delivery and hence receptor or even cell specific delivery.
  • the nanoparticle can be converted to a receptor-targeted nanoparticle, e.g, via copper-free click chemistry with dibenzocyclooctyne (DBCO)- containing targeting ligands, such as folic acid (FolA)-PEG as targeting ligand for folate receptor ⁇ (FR ⁇ )-specific delivery.
  • DBCO dibenzocyclooctyne
  • targeting ligands such as folic acid (FolA)-PEG as targeting ligand for folate receptor ⁇ (FR ⁇ )-specific delivery.
  • DBCO dibenzocyclooctyne
  • a single terminal thiol group in combination with thiol chemistry may be used for coupling targeting ligands, such as folic acid (FolA)-PEG as targeting ligand for folate receptor ⁇ (FR ⁇ )-specific delivery.
  • targeting ligands such as B6, cRGD, folic acid, methotrexate (MTX), c-Met-binding peptide (cMBP2), transferrin (Tf), AP-1, EGF, EGF receptor- binding peptide (GE11) and IL-6 receptor binding I6P7 peptide may be used.
  • Other suitable receptors for receptor-mediated internalization and specific delivery may, e.g., be tumor antigens and the like.
  • the two fatty acids in the sequence-defined T-shape lipo-oligomer ([FA]2 in formula I) may be the same or different, preferably the two fatty acids are the same fatty acid.
  • the two fatty acids are saturated or unsaturated C12 to C22 fatty acids, preferably the two fatty acids are linear (non-branched) saturated or unsaturated C12 or C22 fatty acids, more preferably unsaturated C14 to C20 fatty acids or saturated C12 to C18 fatty acids, more preferably unsaturated C16 to C20 fatty acids or saturated C12 to C14 fatty acids, more preferably unsaturated C18 fatty acids.
  • the two fatty acids are selected from the group consisting of oleic acid (OleA), linoleic acid (LinA), linolenic acid (LenA) or hydroxy steric acid (OHSteA), preferably OleA, LinA or OHSteA, more preferably LinA or OHSteA
  • the sequence defined T-shape lipo-oligomer comprises a 118371P1272PC terminal functional group selected from an azido group and a thiol group (single thiol group).
  • the artificial amino acid of the sequence-defined T-shape lipo-oligomer [79]
  • the sequence defined T-shape lipo-oligomer of formula I of the nanoparticle according to the invention comprises two artificial amino acids as building-block, wherein the artificial amino acid is an oligo(alkylamino) acid (X 1 ), one oligo(alkylamino) acid (X 1 ) at either side of the central lysine (Kc) and at the same distance to the central lysine.
  • X 1 in formula I represents a single artificial amino acid that is an oligo(alkylamino) acid in contrast to X 2 (e.g., in sequence 1445) or [X 2 -Hn(inner)]2 and [Hn(inner)- X 2 ]2 as in the T-shape lipo-oligomer of formula III.
  • X 2 2 represents two consecutive artificial amino acids (X 2 2, e.g., in sequence #1445) at either side of the central lysine, wherein the artificial amino acid is an oligo(alkylamino) acid.
  • [X 2 -Hn(inner)]2 and [Hn(inner)-X 2 ]2 represents two artificial amino acids separated by a histidine (H) and followed or preceded, respectively, at either side of the central lysine.
  • the two artificial amino acids (X 2 ) on the same side of Kc may be the same or different, preferably the two artificial amino acids (X 2 ) on the same side of Kc are the same. Due to the symmetry of the T-shape lipo-oligomer the artificial amino acids on opposite side of Kc are the same.
  • the oligo(alkylamino) acid is linked via its C-terminal carboxylic group and its N-terminal primary amino group.
  • the oligo(alkylamino) acid (of formula I or III) is selected from the group consisting of the following formulas: H(HN-(CH2)2)3-NH-CO-R, H(HN-(CH2)2)4-NH-CO-R, H(HN-(CH2)3)3-NH-CO-R, H(HN-(CH2)3)4-NH-CO-R, H(HN-(CH2)2-NH-(CH2)3-NH-(CH2)2-NH-CO-R, H(HN-(CH2)2-NH-(CH2)3-NH-(CH2)2-NH-(CH2)3NH-CO-R, H(HN-(CH2)3-NH-(CH2)2-NH-(CH2)3-NH-CO-R, and H(HN-(CH2)3-NH-(CH2)2-NH-(CH2)3-NH-(CH2)2NH-CO-R, wherein R is as defined for formula IIa of formula I or III.
  • the oligo(alkylamino) acid comprises a cyclohexyl group, for example R is -CH2-CH(c-hexyl)-CH2-CO2H;
  • oligo(alkylamino) acids of formula IIa for the nanoparticle according to the invention comprising the T- shape lipo-oligomers comprising the sequence of formula I are, without being limited thereto, succinyl- tetraethylenepentamine (Stp), cyclohexanedicarboxyl-tetraethylenepentamine (Htp), phthalyl- tetraethylenepentamine (Ptp), naphthalenedicarboxyl-tetraethylenepentamine (Ntp), glutaryl- tetraethylenepentamine (Gtp), 1,1-cyclohexanediacetyl-tetraethylenepentamine (chGtp), iminodiacetyl-tetraethylenepentamine (IDAtp), trifluoroe
  • the oligo(alkylamino) acid is selected from the group consisting of Stp, Htp, Gtp, chGtp, TFE-IDAtp, Gtt and GEIPA, more preferably Htp, Gtp, chGtp and TFE-IDAtp.
  • the oligo(alkylamino) acid comprises a cyclohexyl group, for example R is of formula IIa for the nanoparticle according to the invention comprising formula III are, without being limited thereto, chGtp, Htp, TFE-IDAtp, Gtt or GEIPA.
  • the oligo(alkylamino) acid is TFE- IDAtp or Gtt.
  • RNA tends to require stabilization, which may be achieved with the overall longer sequences and long fatty acids of the T-shape lipo-oligomers (head group), while DNA packaging generally is less problematic and rather cargo release inside cells can be critical, which may be achieved with shorter fatty acids and overall shorter sequences of the T-shape lipo-oligomers (headgroup).
  • head group the overall longer sequences and long fatty acids of the T-shape lipo-oligomers
  • DNA packaging generally is less problematic and rather cargo release inside cells can be critical, which may be achieved with shorter fatty acids and overall shorter sequences of the T-shape lipo-oligomers (headgroup).
  • the right balance of stabilization and destabilization needs to be identified for each cargo.
  • this is not trivial or predictable and sequence-defined lipo-oligomers need to be empirically tested for each cargo, and other aspects further play a role.
  • Critical bottle-necks within the 118371P1272PC delivery pathway of the CRISPR/Cas system are the
  • the T-shape lipo-oligomers of the nanoparticles according to the invention are particularly hydrophobic and it has been shown that more hydrophobic lipo-oligomers are advantageous for Cas protein/gRNA RNP complex delivery. It has been surprising that the short lipo-oligomers (comprising only one artificial amino acid on each site of the branching point, i.e., the central lysine) are sufficient to stabilize RNPs. Without being bound by theory, this may be due to the overall high hydrophobicity, stabilizing the nanoparticles formed with the RNP complexes.
  • the nanoparticle according to the invention in certain embodiments comprises one or more Cas protein/gRNA RNP complexes as cargo. Without being limited thereto, suitable Cas protein/gRNA ratios are about 1:1 to about 1:2.
  • the Cas protein/gRNA RNP complex and the sequence- defined T-shape lipo-oligomer are preferably mixed at a lipo-oligomer nitrogen (N) to nucleic acid phosphate (P) (gRNA or gRNA and donor DNA) ratio (N/P ratio) of about 1:12 to 1:30, preferably of about 1:12 to 1:26.
  • N lipo-oligomer nitrogen
  • P nucleic acid phosphate
  • N/P ratio nucleic acid phosphate
  • the nanoparticle may further comprise a donor DNA for HDR.
  • the donor DNA may be provided as plasmid DNA, as linear double-stranded DNA or as single-stranded DNA.
  • the guide RNA is complementary to a target DNA locus and guides the Cas protein endonuclease to this site.
  • the gRNA may be a CRISPR RNA (crRNA), a crRNA that pairs with trans- activating crRNAs (tracrRNA), an artificial single-guide RNA (sgRNA), an artificial prime editing guide RNA (pegRNA), a chimeric single-guide RNA (cgRNA) or other RNA molecules which form a complex with a Cas protein and guide it to the target DNA sequence.
  • the guide RNA is a single- guide RNA (sgRNA), an artificial RNA consisting of tracr RNA, crRNA and an artificial RNA linker.
  • the single-guide RNA may also be a modified and/or improved sgRNAs, such as tru-gRNA (using a spacer sequence with ⁇ 20 nucleotides complementary to the protospacer target) and hp-sgRNA (comprising an extension on the 5’end of the spacer).
  • tru-gRNA using a spacer sequence with ⁇ 20 nucleotides complementary to the protospacer target
  • hp-sgRNA comprising an extension on the 5’end of the spacer.
  • the person skilled in the art would know (see, e.g., Anzalone et al., Nature Biotechnology, 2020, 38: 824-844) that the type of guide RNA may depend on the intended use and on the Cas protein used.
  • the Cas protein may be any CRISPR-associated endonuclease, preferably class 2 (types II, V and VI) proteins, which have single-subunit effectors.
  • Suitable Cas proteins include, without being limited thereto, type II Cas proteins, e.g., Cas9 (such as SpCas9, SaCas9, CjCas9, StCas9 or NmeCas9); type V Cas proteins, e.g., Cas12, including without being limited thereto Cas12a, Cas12f, 118371P1272PC Cas12b, Cas12i, Cas12e and Cas12g; and type VI Cas proteins, e.g., Cas13, including without being limited thereto Cas13a, Cas13b, Cas13c and Cas13d, including engineered variants thereof (engineered Cas variants).
  • Cas9 such as SpCas9, SaCas9, CjCas9, StCas9 or NmeCas9
  • type V Cas proteins e.g., Cas12, including without being limited thereto Cas12a, Cas12f, 118371P
  • the Cas protein is selected from the group consisting of Cas9 protein, Cas 12 protein, Cas 13 protein, and engineered variants thereof, preferably the Cas protein is a Cas9 protein, a Cas 12 protein or an engineered variant thereof, more preferably the Cas protein is a Cas9 protein or an engineered variant thereof, such as a base editor or a prime editor.
  • Engineered Cas variants include, without being limited thereto, mutant and/or fusion proteins, such as variants with altered PAM compatibilities, such as less restrictive or different PAM compatibility of Cas9 or Cas12 variants; variants with higher DNA specificity, such as variants with reduced off-target Cas nuclease activity (e.g., eSpCas(1.1), SpCas9-HF1, HypaCas9, evoCas9, Sniper-Cas9, HiFiCas9, enAsCas12a-HF1); engineered Cas-domain-fused transposase and recombinase systems; base editors and prime editors.
  • mutant and/or fusion proteins such as variants with altered PAM compatibilities, such as less restrictive or different PAM compatibility of Cas9 or Cas12 variants
  • variants with higher DNA specificity such as variants with reduced off-target Cas nuclease activity (e.g., e
  • Cas nickase e.g., nickase Cas9n
  • Cas proteins may be derived from different species, such as Streptococcus pyogenes, Staphylococcus aureus, Campylobacter jejuni, Streptococcus thermophilus or Neisseria meningitidis.
  • Cas9 orthologs include, without being limited thereto, Streptococcus pyogenes Cas9 (SpCas9), Staphylococcus aureus Cas9 (SaCas9), Campylobacter jejuni Cas9 (CjCas9), Streptococcus thermophilus Cas9 (StCas9), and Neisseria meningitidis Cas9 (NmeCas9) from.
  • Cas orthologs may differ in the recognized PAM sequences and in size. The most often used Cas9 protein is SpCas9.
  • the Cas protein is a Cas9, a Cas12, a Cas13 protein or an engineered variant thereof (also referred to as derivative thereof).
  • the Cas protein is a base editor or a prime editor, preferably a Cas9 base editor or a Cas9 prime editor.
  • the Cas protein forms the Cas protein/gRNA complex, thus in certain embodiments the one or more Cas protein/gRNA RNP complex(es) is/are Cas9/gRNA RNP complex(es), preferably Cas9/sgRNA RNP complex(es), optionally further comprising a donor DNA. This includes Cas9 nucleases as well as fusion proteins thereof, such as base editors and prime editors.
  • the nanoparticle according to the invention comprises one or more Cas protein/gRNA RNP complex(es) and hence may contain more than one Cas protein/gRNA RNP complexes.
  • the nanoparticle comprises two or more Cas protein/gRNA RNP complexes as cargo, preferably wherein the two or more Cas protein/gRNA RNP complexes comprise two or more different gRNAs targeting the same or different genes, preferably different genes.
  • the two or more gRNAs are two or more different sgRNAs targeting the same or different genes, preferably different genes.
  • the two or more Cas protein/gRNA RNP complexes only differ in the gRNA (or sgRNA), while the Cas protein is the same.
  • the nanoparticle comprising one or more Cas protein/gRNA RNP complex(es) as cargo may further comprise a donor DNA for HDR.
  • the nanoparticle comprises one or more Cas protein/gRNA RNP complexes and a donor DNA.
  • the donor DNA may be co-delivered with the one or more Cas protein/gRNA RNP complex(es), it may also be delivered separately by non-viral or viral delivery, e.g., an adeno- associated viral vector, a lentiviral vector or an adenoviral vector.
  • T-shape lipo-oligomers having the formula C-Y3-Gtt2-K(K-(OHSteA)2)-Gtt2-Y3-C or Y3-X 1 -K(K-(LinA)2)-X 1 -Y3 (particularly Y3- TFEIDAtp-K(K-(LinA)2)-TFEIDAtp-Y3) were found to be particularly efficient in inducing homology directed repair (HDR).
  • HDR homology directed repair
  • sequence-defined T-shape lipo-oligomer as described herein may be used as carrier for nucleic acid delivery, such as siRNA or phosphorodiamidate morpholino oligomers (PMO) delivery.
  • the sequence-defined T-shape lipo-oligomer as carrier may form nanoparticles with the nucleic acid, such as siRNA or PMO, for delivery. Because PMOs are not charged, the sequence-defined T-shape lipo-oligomer as carrier are preferably covalently linked to the PMO, preferably to the 5’- or 3’-end of the PMO.
  • the sequence-defined T-shape lipo- oligomer as carrier covalently linked to the PMO comprises the sequence of formula I and/or the artificial amino acid is selected from Stp, chGtp, dGtp or TFEIDAtp.
  • the fatty acid is preferably OleA or LinA.
  • the invention relates to a nanoparticle for siRNA or phosphorodiamidate morpholino oligomers (PMO) (cargo) delivery comprising one or more siRNA(s) or PMO(s) as cargo; and a carrier comprising a sequence-defined T-shape lipo-oligomer comprising 118371P1272PC (c) a headgroup comprising an oligomer comprising i. a central lysine (Kc), and ii.
  • PMO phosphorodiamidate morpholino oligomers
  • FA two fatty acids
  • the two fatty acids are saturated or unsaturated C12 to C22 fatty acids, preferably the two fatty acids are selected from the group consisting of oleic acid (OleA), linoleic acid (LinA), linolenic acid (LenA) or hydroxy steric acid (OHSteA), preferably OleA, LinA, LenA or OHSteA, more preferably OleA, LinA, or OHSteA, or even more preferably LinA or OHSteA.
  • the sequence-defined T-shape lipo-oligomer as carrier forms nanoparticles with the negatively charged siRNA for delivery.
  • the nanoparticle is for siRNA (cargo) delivery comprising one or more siRNA(s) as cargo; and a carrier comprising a sequence-defined T- shape lipo-oligomer comprising an artificial amino acid according to the invention and as specified herein.
  • the siRNA and the sequence-defined T-shape lipo-oligomer are preferably mixed at a lipo-oligomer nitrogen (N) to nucleic acid phosphate (P) (siRNA) ratio (N/P ratio) of about 1:12 to 1:30, preferably of about 1:12 to 1:26.
  • N/P ratio lipo-oligomer nitrogen
  • P nucleic acid phosphate
  • the person skilled in the art would know that only the protonatable nitrogens are considered for determining the N/P ratio.
  • siRNA refers to short single or double stranded ribonucleic acid molecules of typically 20-25 base pairs in length that bind to complementary single stranded ribonucleic acid molecules, such as messenger RNA (mRNA) and suppress their function, also referred to as RNA interference (RNAi).
  • mRNA messenger RNA
  • RNAi RNA interference
  • RNA 118371P1272PC molecules operating within the RNAi pathway is microRNA (miRNA), which further has a similar length compared to siRNA.
  • miRNA microRNA
  • Cysteine may help to stabilize the nanoparticle by formation of disulfide bonds, which is beneficial for siRNA delivery as demonstrated in the examples. Stability may be further improved using artificial amino acids as described herein that are more hydrophobic than Stp.
  • the carrier comprising a sequence- defined T-shape lipo-oligomer comprising the sequence of formula I or III, preferably of formula I, further comprises histidine and n(inner) and n(outer) are 1.
  • the sequence-defined T-shape lipo-oligomer comprises a sequence of formula I selected from the group consisting of SEQ ID NOs: 7, 8, 9 and 10, preferably SEQ ID NO: 7.
  • sequence-defined T-shape lipo-oligomer comprising the sequence of formula I or formula III as disclosed herein, preferably formula I, may further comprise a terminal functional group at the N- terminus or the C-terminus of the sequence-defined T-shape lipo-oligomer, wherein the functional group is an azido group, such as an azido-hexanoic acid or an azido-lysine.
  • the functional group is, e.g., for coupling a targeting ligand.
  • the functional group (azido group) may be N-terminally or C- terminally, preferably the functional group is N-terminally.
  • sequence-defined T-shape lipo- oligomer comprising the sequence of formula I or III may comprise a terminal azido group, such as an azido-hexanoic acid or an azido-lysine, preferably an azido-lysine.
  • the azido group may be N- terminally or C-terminally, preferably the azido group is N-terminally.
  • a single terminal azido group is sufficient, theoretically the sequence-defined T-shape lipo-oligomer may also comprise an azido group at the N-terminal and/or the C-terminal.
  • the azido-lysine (K(N3)) comprising sequence-defined T-shape lipo-oligomer comprises a sequence of formula I or III selected from the group consisting of SEQ ID NOs: 11-26 and 41-52, preferably 15, 17, 23 and 25, even more preferably 15.
  • PMOs are uncharged and it was therefore believed that they may not require carriers for cell entry. However, suitable carriers also improve PMO delivery.
  • PMOs are preferably covalently linked to the carrier, i.e., the sequence-defined T-shape lipo-oligomer.
  • sequence-defined T-shape lipo-oligomer as carrier is covalently linked to the PMO, preferably to the 5’- or 3’-end of the PMO.
  • the sequence-defined T-shape lipo- 118371P1272PC oligomer as carrier covalently linked to the PMO comprises the sequence of formula I or formula III, preferably the sequence of formula I.
  • the artificial amino acid is selected from Stp, Gtp, chGtp, dGtp, IDAtp or TFEIDAtp, more preferably Stp, chGtp, dGtp or TFEIDAtp.
  • PMO phosphorodiamidate morpholino oligomer
  • ASO antisense oligonucleotide
  • the PMO and the sequence-defined T-shape lipo-oligomer are preferably conjugated at a molar ratio of PMO to sequence-defined T-shape lipo-oligomer (LP) of 1:3.
  • the resulting solution comprises PMO-LP conjugates and free LPs at a ratio 1:2, which forms the nanoparticles.
  • the nanoparticles comprise PMO-sequence-defined T- shape lipo-oligomer conjugates (PMO-LP) and un-conjugated sequence-defined T-shape lipo- oligomer (LP), preferably at a ratio 1:2.
  • the invention also relates to a conjugate comprising a phosphorodiamidate morpholino oligomer (PMO) covalently linked to a carrier comprising a sequence- defined T-shape lipo-oligomer, comprising an artificial amino acid, wherein the artificial amino acid is an oligo(alkylamino) acid, and wherein the T-shape lipo-oligomer comprises the sequence of formula I: Cn-Y3-Hn(outer)-X 1 -Hn(inner)-Kc[Kf[FA] Formula wherein Kc is a central lysine; Kf is a further lysine linked to the ⁇ -amino group of Kc; FA is a fatty acid covalently linked to the ⁇ - and ⁇ -amino group of Kf; C is
  • the two fatty acids are saturated or unsaturated C12 to C22 fatty acids, preferably the two fatty acids are selected from the group consisting of oleic acid (OleA), linoleic acid 118371P1272PC (LinA), linolenic acid (LenA) or hydroxy steric acid (OHSteA), preferably OleA, LinA or OHSteA, more preferably LinA or OHSteA.
  • OleA OleA
  • LinA or OHSteA more preferably LinA or OHSteA.
  • the embodiments as specified for the nanoparticle of the invention for Cas protein/gRNA ribonucleoprotein (RNP) complex delivery, particularly the embodiments further specifying the sequence-defined T-shape lipo-oligomer as carrier and the artificial amino acid similarly apply to the conjugate comprising a phosphorodiamidate morpholino oligomer (PMO) covalently linked to a carrier comprising a sequence-defined T-shape lipo-oligomer.
  • PMO phosphorodiamidate morpholino oligomer
  • the invention relates to a nanoparticle for PMO delivery comprising the conjugate comprising a phosphorodiamidate morpholino oligomer (PMO) covalently linked to a carrier comprising a sequence-defined T-shape lipo-oligomer according to the invention.
  • the nanoparticle may further comprise the carrier comprising the sequence-defined T-shape lipo-oligomer not covalently linked to the PMO (free sequence-defined T-shape lipo-oligomer).
  • the free sequence-defined T-shape lipo-oligomer and the covalently linked sequence-defined T-shape lipo- oligomer are the same, wherein the free sequence-defined T-shape lipo-oligomer may be additionally coupled to a targeting ligand.
  • sequence-defined T-shape lipo-oligomer comprises a sequence of formula I selected from the group consisting of SEQ ID NOs: 7, 8, 9 and 10, preferably SEQ ID NO: 8.
  • the sequence-defined T-shape lipo-oligomer comprising the sequence of formula I or formula III as disclosed herein, preferably formula I may further comprise a terminal functional group at the N- terminus or the C-terminus of the sequence-defined T-shape lipo-oligomer, wherein the functional group is (i) an azido group, such as an azido-hexanoic acid or an azido-lysine, or (ii) a thiol group provided that the sequence of formula I or III does not comprise a cysteine.
  • the functional group is an azido group.
  • the functional group is used for coupling the PMO as cargo.
  • the functional group (azido group or thiol group) may be N-terminally or C-terminally, preferably the functional group is N-terminally.
  • the sequence-defined T-shape lipo-oligomer comprising the sequence of formula I or III may comprise a terminal azido group, such as an azido-hexanoic acid or an azido- lysine, preferably an azido-lysine.
  • the azido group may be N-terminally or C-terminally, preferably the 118371P1272PC azido group is N-terminally.
  • sequence-defined T-shape lipo-oligomer may also comprise an azido group at the N-terminal and/or the C-terminal.
  • the azido-lysine (K(N3)) comprising sequence-defined T-shape lipo-oligomer comprises a sequence of formula I or III selected from the group consisting of SEQ ID NOs: 11-26 and 41-52, preferably SEQ ID NOs: 15, 16, 17, 18, 23, 24, 25 and 26, more preferably SEQ ID NO: 16.
  • the functional group may further be used for coupling a targeting ligand. Since not all LPs are covalently linked to the PMO, others may be conjugated with the targeting ligand.
  • a terminal azido group or a single terminal thiol group allows coupling of the PMO (and optionally the targeting ligand) using click chemistry or using thiol conjugation, respectively.
  • the PMO as cargo is coupled to the azido-group via click chemistry, more preferably click chemistry with a dibenzocylooctyne-coupled PMO.
  • Click chemistry is a general term for highly specific, in many cases biorthogonal, covalent conjugation reactions, that are modular, efficient and relatively insensitive to solvent parameters, water and oxygen.
  • Typical click reactions are copper-catalyzed azide-alkylene cycloaddition (CuAAC) (copper-catalyzed reaction of an azide with an alkyne), copper- free azide-alkyne cycloaddition, such as strain-promoted azide-alkyne cycloaddition (SPAAC), Diels- Alder or inverse electron Diels-Alder reaction, and alkene-tetrazole photoclick reaction.
  • CuAAC copper-catalyzed azide-alkylene cycloaddition
  • SPAAC strain-promoted azide-alkyne cycloaddition
  • Diels- Alder or inverse electron Diels-Alder reaction inverse electron Diels-Alder reaction
  • alkene-tetrazole photoclick reaction are examples of Cas proteins.
  • Cas9 or Cas12 introduces double-strand breaks (DSB) at targeted DNA loci (Cas9 blunt end, Cas12 staggered ends). Since this system is modular it can be readily engineered. One of two cellular mechanisms then repairs the cut DNA by non-homologous end-joining (NHEJ), which introduces insertions or deletions (indels) or by homology- directed repair (HDR), which uses a donor DNA as template to introduce specific modifications near the target site. Thus, for some applications delivery of just the DNA nuclease is sufficient.
  • NHEJ non-homologous end-joining
  • indels insertions or deletions
  • HDR homology- directed repair
  • the Cas protein/gRNA RNP complex can be used to knockout alleles that underlie autosomal dominant genetic disorders, such as Huntington’s disease and amyotrophic lateral sclerosis or for exon skipping or removal of a cryptic splice site, such as for Duchenne’s muscular dystrophy and Leber’s congenital amaurosis type 10, respectively.
  • base editors may be used to edit point-mutations in disease-causing alleles and the more recently developed prime editors may be used to correct not only point mutations, but also small indels without the induction of a double-stranded break.
  • the nanoparticle of the invention is used in therapy. Since the Cas proteins are so versatile a large variety of diseases can be treated, including, without being limited thereto, a disease selected from the group consisting of cancer, a genetic disease, an infectious disease, a cardiovascular disease, a metabolic disease, a neurodegenerative or neuromuscular disease, a 118371P1272PC hematological disease, a hereditary eye disease and an autoimmune disease.
  • a disease selected from the group consisting of cancer, a genetic disease, an infectious disease, a cardiovascular disease, a metabolic disease, a neurodegenerative or neuromuscular disease, a 118371P1272PC hematological disease, a hereditary eye disease and an autoimmune disease.
  • siRNA and PMOs are versatile and can be used in treating a large variety of diseases, including, without being limited thereto, a disease selected from the group consisting of cancer, a genetic disease, an infectious disease, a cardiovascular disease, a metabolic disease, a neurodegenerative or neuromuscular disease, a hematological disease, a hereditary eye disease and an autoimmune disease.
  • a disease selected from the group consisting of cancer, a genetic disease, an infectious disease, a cardiovascular disease, a metabolic disease, a neurodegenerative or neuromuscular disease, a hematological disease, a hereditary eye disease and an autoimmune disease.
  • the nanoparticle according to the invention may be used in vivo or ex vivo for Cas protein/gRNA RNP, siRNA or PMO delivery.
  • the nanoparticle for use in therapy is delivered to a cell of the subject to be treated in vivo or ex vivo.
  • nanoparticle delivery to cells of the subject to be treated is followed by adoptive cell transfer of said cells to said subject.
  • Cas protein/gRNA RNP delivery mediating homology directed repair nanoparticles comprising the T-shape lipo-oligomers having the formula C-Y3-Gtt2-K(K-(OHSteA)2)-Gtt2-Y3-C or Y3-X 1 -K(K-(LinA)2)-X 1 -Y3 (particularly Y3-TFEIDAtp-K(K-(LinA)2)-TFEIDAtp-Y3) may be particularly suitable.
  • In vivo delivery involves local administration or systemic administration and may require the coupling of a targeting ligand.
  • targeted delivery may be achieved for cell types such as macrophages, with a high degree of phagocytosis and endocytosis.
  • the nanoparticle may therefore be administered by any route, including, without being limited thereto intravenous administration, subcutaneous administration, intradermal administration, intramuscular administration oral administration, intranasal administration, vaginal administration, intravitreal administration, or intrathecal administration.
  • Delivery may also be ex vivo to a cell of the subject to be treated followed by adoptive cell transfer. Prior to adoptive cell transfer the cell may be screened for successful genome editing mediated by the Cas protein/gRNA RNP. Alternatively, prior to adoptive cell transfer the cell may be screened for successful gene silencing by siRNA or successful gene modulation by PMOs.
  • the invention relates to a pharmaceutical composition comprising a nanoparticle and at least one pharmaceutically acceptable excipient.
  • the pharmaceutical composition comprising the nanoparticle according to the invention may be cryo-conserved, lyophilized or in an isotonic solution (i.e., in a physiological buffer).
  • the nanoparticle according to the invention may further be used for in vitro Cas protein/gRNA RNP delivery, siRNA delivery or PMO delivery, i.e., for non- therapeutic purposes.
  • the invention relates to an in vitro method for transfecting mammalian cells with one or more Cas protein/gRNA complex (or one or more siRNA(s) or PMO(s)) comprising 118371P1272PC contacting a mammalian cell in vitro with the nanoparticle according to the invention or the conjugate according to the invention.
  • Any mammalian cell may be suitable in the context of the present invention including cell lines and primary cells, suspension and adherent cells or even organoids.
  • the mammalian cells may be human or rodent cells, including, without being limited thereto CHO cells BHK cells, HEK293 cells, HeLa cells, HepG2 cells and derivatives thereof.
  • CHO cells include, e.g., glutathione deficient CHO cells such as CHO-K1 cells and the like.
  • derivatives of HEK 293 cells include, e.g., HEK293T, HEK293E, HEK293F, HEK293SF cells and the like.
  • the invention relates to a use of the sequence-defined T-shape lipo- oligomer (or a method comprising said use) for cellular delivery of a Cas protein/gRNA ribonucleoprotein (RNP) complex, an siRNA or a PMO, preferably a Cas protein/gRNA ribonucleoprotein (RNP) complex, into a target cell, wherein the sequence defined T-shape lipo- oligomer comprising the sequence of formula I: Cn-Y3-Hn(outer)-X 1 -Hn(inner)- Formula as disclosed and specified herein, or of formula III: Cn-Y3-Hn(outer)-[X 2 -Hn(inner)]2-Kc[Kf[FA]2]-[Hn(inner)-X 2 ]2-Hn(outer)-Y3-Cn; Formula III (SEQ ID NO: 2); as disclosed and specified herein.
  • RNP Cas protein/gRNA ribon
  • nanoparticle of the invention similarly apply to this aspect.
  • T-shape lipo- oligomers having the formula C-Y3-Gtt2-K(K-(OHSteA)2)-Gtt2-Y3-C or Y3-X 1 -K(K-(LinA)2)-X 1 -Y3 (particularly Y3-TFEIDAtp-K(K-(LinA)2)-TFEIDAtp-Y3) may be particularly suitable.
  • the invention relates to a use of an artificial amino acid in a sequence- defined T-shape lipo-oligomer (or a method comprising said used) for cellular delivery of a Cas protein/gRNA ribonucleoprotein (RNP) complex, an siRNA or a PMO, preferably a Cas protein/gRNA ribonucleoprotein (RNP) complex into a target cell, wherein the artificial amino acid is an oligo(alkylamino) acid selected from the group consisting of Gtp, Gtt, Htp, Ptp, IDAtp, TFE-IDAtp, GEIPA, Ntp, and chGtp.
  • RNP Cas protein/gRNA ribonucleoprotein
  • siRNA or a PMO preferably a Cas protein/gRNA ribonucleoprotein (RNP) complex into a target cell
  • the artificial amino acid is an oligo(alkylamino) acid selected from the group consisting of Gtp
  • the T-shape lipo-oligomer comprises the sequence of formula I: Cn-Y3-Hn(outer)-X 1 -Hn(inner)-Kc[Kf[FA]2]-Hn(inner)-X 1 -Hn(outer)-Y3-Cn (Formula I; SEQ ID NO: 1), as disclosed and specified herein.
  • the oligo(alkylamino) acid is selected from the group consisting of Gtp, Gtt, Htp, TFE-IDAtp, GEIPA, and chGtp, more preferably Htp, TFE-IDAtp, and chGtp.
  • the T-shape lipo-oligomer comprises the sequence of formula III: Cn-Y3-Hn(outer)-[X 2 -Hn(inner)]2-Kc[Kf[FA]2]-[Hn(inner)-X 2 ]2-Hn(outer)-Y3-Cn (Formula III; SEQ ID NO: 2), as disclosed and specified herein.
  • the oligo(alkylamino) acid artificial amino acid
  • the oligo(alkylamino) acid is selected from the group consisting of chGtp, Htp, TFE-IDAtp, Gtt or GEIPA.
  • the oligo(alkylamino) acid is TFE-IDAtp or Gtt.
  • the uses of the invention are in vitro uses, i.e., for non-therapeutic purpose.
  • the target cell is a mammalian cell, preferably as specified herein above.
  • the invention relates to an artificial amino acid, wherein the artificial amino acid is an oligo(alkylamino) acid selected from the group consisting of the following formulas: , , in its protected and unprotected form. 118371P1272PC
  • the use of the artificial amino acid according to the invention is for cellular delivery of a Cas protein/gRNA ribonucleoprotein (RNP) complex into a target cell, as specified herein above.
  • RNP Cas protein/gRNA ribonucleoprotein
  • oligo(alkylamino) acids are typically synthesized as protected building blocks prior to generating the sequence-defined lipo-oligomers, including the sequence-defined T-shape lipo- oligomers according to the invention.
  • suitable protecting groups such as fluorenylmethoxycarbonyl (Fmoc) and tert-butyloxycarbonyl (Boc).
  • Suitable amine protecting groups include without being limited thereto fluorenylmethoxycarbonyl (Fmoc), tert-butyloxycarbonyl (Boc), allyloxycarbonyl (Alloc), 1- methylethoxycarbonyl (Adpoc), 2,7-di-tert-butyl[9-(10,10-dioxo-10,10,10,10- tetrahydrothioxanthyl)] (Tmoc), benzyloxycarbonyl (Cbz, Z), 2-chlorobenzyloxycarbonyl (2-Cl-Z), benzyl (Bn), triphenylmethyl (Trityl), 4-Methyltrityl (Mtt), 1-(4,4-dimethyl-2,6-dioxocyclohex-1-ylidene)ethyl (Dde), 1-(4,4-dimethyl- 2,6-dioxocyclohe
  • Preferred protecting groups are Fmoc at a terminal primary amine and Boc at internal secondary amines.
  • the oligo(alkylamino) acids in their protected form may be Fmoc-GEIPA(Boc2)-OH, Fmoc-dGtp(Boc3)-OH, Fmoc-Ntp(Boc3)-OH, Fmoc-Htp(Boc3)-OH and Fmoc-chGtp(Boc3)-OH: .
  • Boc-IDA anhydride N-(tert-Butoxycarbonyl)iminodiacetic acid anhydride
  • the cyclic anhydride of Boc-IDA was prepared by using dicyclohexylcarbodiimide (DCC) as dehydrating agent.10.0 g of Boc-IDA (43 mmol) were put into a 500 mL round-bottom flask and 250 mL DCM were added.8.9 g of DCC (43 mmol, 1 eq) were dissolved in 50 mL DCM and added into the round-bottom flask. The heterogeneous mixture was stirred at RT overnight.
  • DCC dicyclohexylcarbodiimide
  • TFE-IDA N-(Trifluoroethyl)iminodiacetic acid
  • TFE-IDA anhydride N-(Trifluoroethyl)iminodiacetic acid anhydride
  • the mixture was concentrated to approx. 80 mL under reduced pressure and the insoluble dicyclohexyl urea was removed by filtration.
  • the DCM was removed in the rotary evaporator and at high vacuum to yield 4.3 g TFE-IDA anhydride (21.8 mmol, 94 %) as a solid.
  • the two primary amines were asymmetrically substituted by reaction with a cyclic anhydride (succinic anhydride for Fmoc-Stp(Boc3)-OH; glutaric anhydride for Fmoc-Gtp(Boc3)- OH and Fmoc-Gtt(Boc2)-OH; phthalic anhydride for Fmoc-Ptp(Boc3)-OH; 3-oxaspiro[5,5]undecan-2,4- dion for Fmoc-chGtp(Boc3)-OH; 1,2-cyclohexanedicarboxylic anhydride for Fmoc-Htp(Boc3)-OH; 2,3- napthalic anhydride for Fmoc-Ntp(Boc3)-OH; diglycolic anhydride for Fmoc-dGtp(Boc3)-OH) and N- (fluorenyl-9-me
  • oligomers were synthesized manually on 2-chlorotrityl chloride resin using standard Fmoc-based solid-phase peptide synthesis conditions.
  • Fmoc- ⁇ -amino acids Fmoc-Stp(Boc3)-OH, Fmoc-Boc-IDAtp(Boc3)-OH, Fmoc-dGtp(Boc3)- OH, Fmoc-Gtp(Boc3)-OH, Fmoc-TFE-IDAtp(Boc3)-OH, Fmoc-Gtt(Boc2)-OH, or Fmoc-GEIPA(Boc2)- OH
  • the coupling step was performed using 4 eq Fmoc-amino acid, 4 eq HOBt, 4 eq PyBOP, and 8 eq DIPEA in DCM/DMF (1/1, 5 mL g ⁇ 1 resin) for 75 min.
  • the coupling step was performed using 4 eq Fmoc-amino acid, 4 eq HOBt, 4 eq PyBOP, and 8 eq DIPEA in DCM/DMF (1/1, 5 mL g ⁇ 1 resin) containing 1 % Triton X-100 overnight.
  • the coupling step was performed using 4 eq Fmoc- amino acid, 4 eq Oxyma, and 4 eq DIC in NMP (5 mL g ⁇ 1 resin) overnight.
  • Fmoc deprotection step was performed by 3 times incubation with 20 % piperidine in DMF (5 mL g ⁇ 1 resin) for 15 min. The resin was washed 3 times with DMF and 3 times with DCM after each coupling and deprotection step.
  • the resin was washed 5 times with DMF, 5 times with 10 % DIPEA in DMF, and 3 times with DCM (5 mL g ⁇ 1 resin each). Afterwards, Fmoc-Lys(Fmoc)-OH was introduced followed by the coupling of different fatty acids. The resin was washed 3 times with DMF and DCM and dried in vacuo. The oligomers were cleaved off the resin by incubation with pre-cooled cleavage cocktail TFA/EDT/H2O/TIS (94/2.5/2.5/1, 10 mL g ⁇ 1 resin) for 30 min.
  • TFA/EDT/H2O/TIS 94/2.5/2.5/1, 10 mL g ⁇ 1 resin
  • ESI-MS Electrospray ionization mass spectroscopy
  • ESI mass spectra of artificial building blocks were recorded with a Thermo Scientific LTQ FT Ultra fourier transform ion cyclotron and an IonMax source in chloroform or methanol.
  • DLS Dynamic light scattering
  • zeta potential analysis The hydrodynamic particle size and zeta potential of nanoparticles were measured in folded capillary cells (DTS 1070) using a Zetasizer Nano ZS (Malvern Instruments, UK).
  • a VWR Hitachi Chromaster HPLC system equipped with a 5160 pump module, a 118371P1272PC 5260 auto sampler, a 5310 column oven, and a 5430 diode array detector, a YMC C18 column (HS- 302, HS12S05-1546WT, 5 ⁇ m, 4.6 x 150 mm, 12 nm, YMC Europe GmbH, Dinslaken, Germany) and a water/acetonitrile gradient (95:5 - 0:100) containing 0.1 % TFA were used. The extinction at 280 nm was monitored and the peak areas (A) of the oligoamino amides were determined.
  • LogD7.4 was calculated as log(Aoctanol / Awater). All experiments were performed in triplicates. EC50-logD7.4 correlation was analyzed with a second order polynomial equation by GraphPad prism 5.
  • sgRNA sequences [144] Chemically modified sgRNAs with the following sequences were obtained from Integrated DNA Technologies IDT (Leuven, Belgium).
  • sgGFP2 was used together with the ssDNA template in homology-directed repair (HDR) mediated eGFP to BFP conversion experiments; ‘m’ indicates 2'-O-methylated nucleosides; ‘*’ indicates phosphorothioate linkages and ‘r’ indicates ribonucleotides.
  • HDR homology-directed repair
  • Cas9 protein and sgRNA were mixed at 1:1 molar ratio and incubated at RT for 15 min to form the Cas9/sgRNA ribonucleoprotein (RNP) complexes.
  • Cas9 RNP was added into the lipo-oligomer solution in HBG buffer (20 mM HEPES, 5% glucose, pH 7.4) at an N/P (nitrogen to phosphate of sgRNA) ratio of 24. The solution was mixed thoroughly by pipetting up and down and incubated at RT for another 15 min to generate the final Cas9 RNP nanocarriers.
  • Cas9 RNP was mixed with ssDNA HDR template at 1:1 molar ratio and then added into the lipopeptide solution in HBG buffer (pH 7.4) at an N/P (nitrogen to phosphate of sgRNA plus ssDNA) ratio of 12. The solution was mixed and incubated for 40 min to generate the Cas9 RNP/ssDNA nanocarriers. Characterization of Cas9 RNP nanocarriers [146] The hydrodynamic size, PDI and zeta potential of Cas9 RNP nanocarriers were measured by DLS using a Zetasizer Nano ZS (Malvern Instruments, UK).
  • Cas9 RNP nanocarriers were prepared as described above. The hydrodynamic size of Cas9 RNP nanocarriers containing 1.25 ⁇ g Cas9 protein and 0.25 ⁇ g sgRNA (Cas9/sgRNA, 1:1 molar ratio) in 100 ⁇ L HBG was measured. Afterwards, 700 ⁇ L HEPES buffer (20 mM, pH 7.4) were added to each sample and the solution was mixed for the zeta potential measurement.
  • Cas9 RNP nanocarriers were prepared at an RNP concentration of 375 nM (6.25 ⁇ g Cas9 protein and 1.25 ⁇ g sgRNA) and then diluted with 118371P1272PC HBG buffer to a series of RNP concentrations (75, 50, 25, 10, 5, 2.5, 1, 0.5, and 0.1 nM). The size and zeta potential of diluted samples were measured as described above.
  • Ribogreen assay [147] sgRNA amount in naked Cas9/sgRNA ribonucleoproteins (Cas9 RNPs) or Cas9 RNP nanoparticles were determined using a Quant-iTTM RiboGreen® RNA assay kit (Invitrogen, CA, USA).50 ⁇ L of naked Cas9 RNPs or Cas9 RNP nanoparticles containing 250 ng Cas9 protein and 50 ng sgRNA were mixed with 50 ⁇ L of TE buffer and were added to the 96-well plate. The plate was incubated for 10 min. Afterwards, 100 ⁇ L of Ribogreen solution (diluted 1:100 in TE buffer) was added to each well. The plate was incubated for another 5 min.
  • Heparin competition assay was performed to evaluate the nanocarrier stability against anionic stress.50 ⁇ L TE buffer containing different amounts of Heparin were added to the 96-well plate.50 ⁇ L of Cas9 RNP nanocarriers containing 250 ng Cas9 protein and 50 ng sgRNA were prepared and added to each well. The final amounts of Heparin were 0, 0.25, 0.5, 1, 2.5, 5 IU per ⁇ g of sgRNA. The plate was incubated at 37 °C for 30 min.
  • HeLa GFPd2 cell line [150] HeLa cells were transfected using a Super piggyBac Transposase expression vector (SBI, CA, USA) and a PB-CAG-GFPd2 plasmid (Rui et al., ACS Appl Mater Interfaces, 11(11), 2019, 10472- 10480).
  • PB-CAG-GFPd2 was a gift from Jordan Green (Addgene plasmid # 115665; http://n2t.net/addgene:115665; RRID:Addgene_115665).
  • the cells were incubated and passaged twice a week for 3 weeks, allowing the GFP fluorescence from transient transfections to 118371P1272PC fade. Subsequently, GFP-positive cells were sorted and collected by fluorescence-assisted cell sorting (FACS). The colonies from single GFP-positive cells were generated using limited dilution method. A stably GFP-expressing cell population was selected from the regrown colonies by flow cytometry.
  • HeLa eGFP/tub cell line [151] For the generation of stably expressing HeLa eGFP/tub cells, the plasmid vector pEGFP- Tubulin (Clontech Laboratories) was linearized by restriction digestion and transfected into the cells.
  • the vector contains a neomycin resistance cassette, which enables selection of stably transfected cells by cultivation with G418. Single colonies from the surviving cell populations were generated using limited dilution method. Cell populations generated from the regrown clones were analyzed by flow cytometry and a monoclonal cell lines with stable eGFP expression was selected.
  • Cell culture [152] HeLa WT, HeLa eGFP/tub, and HeLa GFPd2 (destabilized eGFP) cells were grown in DMEM medium supplemented with 10 % FBS, 100 U/mL penicillin, and 100 ⁇ g/mL streptomycin.
  • the cells were cultured in ventilated flasks in the cell incubator at 37 °C and 5 % CO2 in a humidified atmosphere. The cells were passaged at a confluency of approximately 80 %.
  • Flow cytometry [153] Cells were harvested and resuspended in 600 ⁇ L of FACS buffer (PBS buffer containing 10 % FBS). The samples were analyzed by flow cytometry on a CytoFLEX S flow cytometer (Beckman Coulter, CA, USA). For eGFP knockout and cellular uptake experiments, 0.6 ⁇ L of 1 ⁇ g/ ⁇ L DAPI was added to each sample for differentiating live and dead cells before the measurement.
  • the DAPI signal and BFP fluorescence were detected with 405 nm excitation and 450 nm emission.
  • the eGFP and ATTO488 fluorescence was assayed with 488 nm excitation and 530 nm emission.
  • the ATTO647N fluorescence was assayed with 640 nm excitation and 670 nm emission.
  • Ten thousand of isolated live cells were counted and evaluated. The data were analyzed using FlowJo 7.6.5 by FlowJo, LLC (Becton, Dickinson and Company, USA).
  • Cellular uptake of Cas9 RNP nanocarriers [154] Cellular uptake of Cas9 RNP nanocarriers was evaluated by flow cytometry and confocal laser scanning microscopy (CLSM).
  • HeLa WT cells were seeded into 24- well plates at a density of 25000 cells/well one day prior to the treatments. On the next day, the medium was replaced with 400 ⁇ L of fresh medium.
  • Cas9 RNP nanocarriers were prepared as described above using 20 % of ATTO647N-labeled Cas9 and 20 % of ATTO488-labeled sgRNA. 100 ⁇ L of RNP nanocarriers were added to each well resulting in a final concentration of 75 nM Cas9 RNP followed by incubation of the cells for 4 h.
  • the medium was replaced with 500 ⁇ L of serum-free medium containing different endocytosis inhibitors (15.4 mM sodium azide, 10 ⁇ M chlorpromazine, 450 mM sucrose, 54 ⁇ M nystatin, or 1 mM amiloride).
  • the cells were incubated at 37 °C for 2 h.
  • the medium was replaced with 400 ⁇ L of fresh medium.100 ⁇ L of dye- labeled RNP nanocarriers were added to each well resulting in a final concentration of 75 nM Cas9 RNP followed by incubation of the cells for 4 h.
  • the cells were placed on ice for 2 h prior to the treatment of 75 nM Cas9 RNP in ice-cold medium. Afterwards, the medium was removed and 500 ⁇ L PBS containing 2000 IU heparin was added followed by incubation of the cells on ice for 30 min. The cells were then collected and prepared for flow cytometry analysis on a CytoFLEX S flow cytometer (Beckman Coulter, CA, USA). All experiments were performed in triplicate. Description eGFP knockout experiment [156] One day prior to eGFP knockout experiment, HeLa eGFP/tub cells were seeded into 96-well plates at a density of 5000 cells/well.
  • Cas9 protein was mixed with sgGFP1 at a molar ratio of 1:1 and the RNP complexes were incubated for 15 min at room temperature.
  • Cas9 RNP nanoparticles were prepared by mixing pre-assembled Cas9 RNP complexes with oligomers at N/P ratio of 24 at RNP dose of 500 nM and then diluted to a series of concentrations (375, 250, 125, 50, 25, 12.5, 5, 2.5, and 0.5 nM) with HBG buffer.
  • the N/P ratio defines the lipo-oligomer nitrogen (N) to sgRNA phosphate (P) ratio.
  • the RNP nanoparticles were incubated for 15 min at room temperature.20 ⁇ L of RNP nanoparticles with different concentrations was added to each well resulting in final concentrations of 100, 75, 50, 25, 10, 5, 2.5, 1, 0.5, and 0.1 nM RNP complexes. The cells were incubated for 48 h. Afterwards, the cells were trypsinized and transferred to the 24-well plates. After another 3 days incubation, the cells were harvested and resuspended in 600 ⁇ L of FACS buffer. The samples were analyzed by flow cytometry on a CytoFLEX S flow cytometer (Beckman Coulter, CA, USA). Before the measurement, 1 ng/ ⁇ L DAPI was added to differentiate between live and dead cells.
  • the DAPI signal was detected with 405 nm excitation and 450 nm emission.
  • Ten thousand of isolated live cells were counted and evaluated. The data were analyzed using FlowJo 7.6.5 by FlowJo, LLC (Becton, Dickinson and Company, USA). All experiments were performed in triplicate.
  • Description homology-directed repair (HDR) experiment [157] A single base substitution (196 T>C) in the chromophore of wild-type (wt) green fluorescent protein (GFP) shifts its fluorescent absorption and emission towards the blue spectrum, creating the blue fluorescent protein (BFP).
  • Cas9 RNP/ssDNA nanoparticles were prepared by mixing Cas9 RNP/ssDNA complexes with lipo-oligomers at N/P ratio of 12 at RNP dose of 500 nM and then diluted to a series of concentrations (375, 250, 125, 50, 25, 12.5, 5, 2.5, and 0.5 nM) with HBG buffer (20 mM HEPES, 5% glucose, pH 7.4). The RNP/ssDNA nanoparticles were incubated for 45 min at room temperature. 20 ⁇ L of RNP/ssDNA nanoparticles with different concentrations was added to each well resulting in final concentrations of 100, 75, 50, 25, 10, 5, 2.5, 1, 0.5, and 0.1 nM RNP complexes.
  • the cells were incubated for 48 h. Afterwards, the cells were trypsinized and transferred to the 24-well plates. After another 3 days incubation, the cells were harvested and resuspended in 600 ⁇ L of FACS buffer. The samples were analyzed by flow cytometry on a CytoFLEX S flow cytometer (Beckman Coulter, CA, USA). The BFP fluorescence was detected with 405 nm excitation and 450 nm emission. The GFP fluorescence was assayed with 488 nm excitation and 530 nm emission. Ten thousand of cells were counted and evaluated. The data were analyzed using FlowJo 7.6.5 by FlowJo, LLC (Becton, Dickinson and Company, USA).
  • MTT Cell viability assay
  • the relative cell viability (%) was calculated relative to control wells treated with HBG buffer as ([A] test/[A] control) ⁇ 100 %. All experiments were performed in triplicate.
  • Statistical analysis [160] Half maximal effective concentration (EC50) values were calculated by GraphPad prism 5. EC50-logD7.4 correlation was analyzed with a second order polynomial equation by GraphPad prism 5. All other data were analyzed with GraphPad prism 5 and presented as arithmetic mean ⁇ standard deviation (SD) of at least triplicates. The statistical significance of the experiments was estimated using the two-tailed student’s t-test, *** p ⁇ 0.001, ** p ⁇ 0.01, * p ⁇ 0.05.
  • Example 1 Oligomers with optimized sequences [161] Sequence-defined oligomers with different sequences based on ⁇ -amino acids and the artificial amino acid succinyl-tetraethylenepentamine and fatty acids were generated to identify optimized sequence-defined T-shape lipo-oligomers for Cas protein/gRNA RNP complex delivery, such as oligomer IDs #1208 to 1591 as shown in Table 1, including the already known structure 1445 (Stp2- C-OHSteA) as described in Kuhn et al., (Kuhn, J.
  • the artificial amino acid serves as an ionizable unit to complex negatively charged cargo, such as Cas9 RNP, and facilitate cellular delivery
  • a negatively charged cargo such as Cas9 RNP
  • D. Schaffert et al. Organic Letters 2011, 13, 1586-1589
  • D. Schaffert et al. Angewandte Chemie International Edition 2011, 50, 8986-8989
  • Krha ⁇ Leva ⁇ i ⁇ et al. Journal of Controlled Release 2021, 339, 27-40
  • T. Benli- Hoppe et al. Macromolecular Rapid Communications 2021, n/a, 2100602
  • J. Luo et al. Advanced Functional Materials 2019, 29, 1900697
  • the hydrophobic tyrosine (Y) tripeptide motif enhances nanoparticle stability via hydrophobic interactions and improves transfection efficiency (C. Troiber et al., Biomaterials 2013, 34, 1624-1633; S. Berger et al., Biomacromolecules 2021, 22, 1282-1296).
  • the lead structure Stp2-C-OHSteA oligomer ID #1445
  • has been varied systematically to elucidate structure-activity relationships and evolve the next generation of RNP carriers. Variations of the structural parameters of 1) presence of cysteine (C), 2) presence of histidine (H), 3) number of Stp units, and 4) type of fatty acid were introduced into the peptide sequence ( Figure 1).
  • All tested compounds comprised an N-terminal azido-lysine which can be used for coupling of a targeting ligand, but has no function with regard to the cargo delivery and/or nanoparticle stability.
  • the Cas9 RNP nanoparticles were prepared by straightforward complexation of the lipopeptides with Cas9 RNP at an N/P ratio of 24.
  • the hydrodynamic size, polydispersity index (PDI), and zeta potential of each nanoparticle were then determined by dynamic light scattering (DLS, Table 2).
  • Most lipopeptides generated RNP nanoparticles with a size between 150 – 250 nm and PDI of 0.15 – 0.40, except Stp2 and Stp2-H structures, which led to larger complexes (250 – 500 nm).
  • nanoparticles exhibited a positive surface charge with a zeta potential between 10 – 19 mV Table 2.
  • ID number, sequence, MALDI-MS of all lipopeptides and hydrodynamic size, PDI, zeta potential of Cas9 RNP nanoparticles formed with the lipopeptides were prepared at a N/P ratio of 24 and an RNP concentration of 75 nM.
  • the hydrodynamic size (z-average, nm), PDI and zeta potential of the nanoparticles were measured by DLS using a Zetasizer Nano ZS (Malvern Instruments, UK)).
  • Example 2 Oligomers with optimized artificial amino acid building blocks [165] Due to the generally more hydrophobic nature of the identified outperformers with lower content of ionizable artificial amino acid than the initial Stp2-C-OHSteA (#1445), it was hypothesized that the hydrophobicity of the lipo-oligomers may be an important parameter to achieve efficient Cas9 RNP delivery. Consequently, the potency could be improved even further by fine tuning the hydrophobic properties of the artificial amino acid units.
  • LogD7.4 of each lipopeptide was determined by quantifying the compound concentration in octanol and water phases by reversed-phase HPLC after mixing and phase separation (H. J. Kim et 118371P1272PC al., ACS Central Science 2019, 5, 1866-1875; A. Andrés et al., European Journal of Pharmaceutical Sciences 2015, 76, 181-191; C. Giaginis and A. Tsantili ⁇ Kakoulidou, Journal of Liquid Chromatography & Related Technologies 2007, 31, 79-96).
  • the determined logD7.4 values indicated the following order of artificial amino acids with increasing hydrophobicity: IDAtp ⁇ dGtp ⁇ Stp ⁇ Gtp ⁇ TFE-IDAtp ⁇ Htp ⁇ chGtp ⁇ Gtt ⁇ GEIPA ⁇ Ptp ⁇ Ntp.
  • TFE-IDAtp1-LinA achieved up to 99 % eGFP knockout at RNP concentrations down to 5 nM, ⁇ 88 % knockout at 1 nM, and still enabled ⁇ 61 % eGFP disruption at 0.5 nM.
  • Cell viability studies revealed that Htp and chGtp containing structures were toxic at high RNP concentrations (25 – 100 nM) while all other artificial amino acids- containing lipopeptides were well-tolerated in the investigated concentration range (data not shown).
  • the logD7.4 was plotted versus eGFP knockout EC50 values for each lipopeptide series ( Figure 8).
  • FIG. 9A the integrity of the nanoparticles upon dilution was investigated.
  • the nanoparticles were prepared at a high RNP concentration of 375 nM and then sequentially diluted to concentrations ranging from 0.1 nM to 75 nM.
  • the size of IDAtp2-C-OHSteA (#1736) and Stp2-C- OHSteA (#1445), the two most hydrophilic X2-C-OHSteA structures (1445-based structure) immediately increased upon dilution and was not detectable at a RNP concentration of 1 nM or lower. In contrast, the more hydrophobic analogs exhibited improved dilution stability.
  • the stability of the nanoparticles against excessive amounts of ions was investigated by the detection of RNA release with the intercalating dye Ribogreen ( Figure 9B and 9C).
  • the peptide architecture played an additional fundamental role in the endosomal escape 118371P1272PC process, since the X1-LinA sequences (1392-based structures) showed much better endosomal escape efficiency than the X2-C-OHSteA lipo-oligomer (1445-based structure).
  • hydrophobic lipopeptides form Cas9 RNP nanoparticles, which 1) are more resistant towards dilution- mediated dissociation and remain intact at low concentrations; 2) are more resistant towards ionic stress and avoid premature cargo release; 3) mediate more efficient cellular internalization that is driven by both clathrin-mediated endocytosis and macropinocytosis; and 4) possess a higher endosomal escape capacity.
  • optimal logD7.4 ranges and a requirement of finding the right balance have been observed can be explained, since too stable nanoparticles may result in insufficient cargo release in the right place at the right time.
  • Example 3 [173] Having demonstrated that hydrophobically balanced lipopeptides are potent nanoparticles for delivering Cas9 RNP to mediate gene knockouts via non-homologous end joining (NHEJ), we sought to extend the scope of application: the top 5 lipopeptides of each series were selected for the co- delivery of Cas9 RNP and a ssDNA template to mediate gene knockins via homology directed repair (HDR).
  • HDR homology directed repair
  • HeLa GFPd2 destabilized eGFP (HeLa GFPd2) (Rui et al., ACS Appl Mater Interfaces, 11(11), 2019, 10472-10480) was used in this study.
  • the plasmid PB-CAG-GFPd2 which was used for the generation of HeLa GFPd2 was a gift from Jordan Green (Addgene plasmid # 115665; http://n2t.net/addgene:115665; RRID:Addgene_115665).
  • the 66th amino acid in the eGFP sequence, tyrosine (code: TAC) can be replaced by histidine (code: CAT) via HDR-mediated DNA repair, which results in the conversion of eGFP into BFP (L. Farbiak et al., Advanced Materials 2021, 33, 2006619; R. Xie et al., Advanced Materials 2022, 34, 2110618; J.
  • the nanoparticles for HDR were prepared by complexing TFE-IDAtp1-LinA (#1740) with different RNP/ssDNA ratios ranging from 1/0.5 to 1/20 at a N/P ratio of 12 (representative ratios of RNP/ssDNA 1/1 and 1/8 are shown in Figure 10B).
  • HeLa GFPd2 cells were treated with the Cas9 RNP/ssDNA nanoparticles for 48 h followed by cell population analysis via flow cytometry.
  • the fluorinated lipopeptide TFE-IDAtp1-LinA (#1739) was found to be a particularly potent nanocarrier which can achieve 88 % NHEJ gene knockout and 23 % HDR knockin at just 1 nM RNP concentration.
  • the identified relationships between logD7.4 values, carrier characteristics and impact on cellular delivery are suggested to serve as a guide for the future design of Cas9 RNP nanocarriers.
  • the new artificial amino acids and lipopeptide architectures provide a versatile platform for the creation of highly potent and tunable cellular delivery agents.
  • Example 4 [176] The present sequence-defined T-shape oligomers were also tested for delivery of other cargo, such as PMO. [177] In an initial experiment sequence-defined T-shape oligomers comprising the sequence of formula I (#1392(Stp), #1639(Gtp), #1641(Htp), #1643(Ntp), #1644(Gtt), #1645(GEIPA), #1737(chGtp), #1738(dGtp), #1739(TFEIDAtp), #1740(IDAtp)) and with histidine (#1395(Stp), #1396(Stp), #1647(Gtp), #1649(Htp), #1651(Ntp), #1652(Gtt), #1653(GEIPA), #1741(chGtp), #1742(dGtp), #1743(TFEIDAtp), #1744(IDAtp)) were tested for PMO delivery by covalently binding the P
  • the reporter cell line enables determination of PMO- mediated modification of mRNA splicing via the induction of mCherry expression.
  • These oligomers comprising the sequence of formula I were more effective compared to oligomer #1195 (according to 118371P1272PC formula III; Y3-Stp2-K(G-K(LenA)2-Stp2-Y3; SEQ ID NO: 62 comprising an N-terminal azido-lysine and a glycine between Kc and Kf) by several orders of magnitude when tested at a range from 2.4 nM to 625 nM of PMO (data not shown).
  • PMO-1395 resulted in 100% mCherry positive cells at 625 nM while PMO-1195 only showed ⁇ 10% positive cells at the same concentration. A similar result was achieved with 9.8 nM PMO-1395.
  • the oligomers comprising Stp, chGtp, dGtp or TFEIDAtp as artificial amino acid showed best results out of the tested compounds, particularly TFEIDAtp.
  • Oligomers comprising OleA (#1395) were as effective as the same construct comprising LinA (#1396).
  • PMO-lipo-oligomer formation [179] PMO functionalization with DBCO-NHS ester and purification was performed as described in Kuhn et al., (Adv. Funct. Mater. 2019, 29, 1906432).
  • a dilution of PMO-DBCO with the concentration of 100 ⁇ M in water and a dilution of the lipo-oligomer with the concentration of 300 ⁇ M in water were prepared. Equal volumes of the two solutions were combined and incubated overnight at room temperature (RT) while shaking at 300 rpm.
  • the resulting PMO-LP conjugate solution has a concentration of 50 ⁇ M PMO.
  • the formulation solution was freeze-dried and reconstituted with the required volume of HBG (20 mM HEPES, 5% glucose, pH 7.4) to obtain the desired concentration.
  • Splice-switching activity of PMO-LP formulations in HeLa mCherry DMDEx23 reporter cells [180] The splice-switching activity of PMO-LP formulations was investigated in HeLa mCherry- DMDEx23 reporter cells which express mCherry upon specific oligonucleotide mediated splicing- modulation.
  • HeLa mCherry-DMDEx23 cells were seeded into 96-well plates (Corning® Costar, Sigma-Aldrich, Kunststoff, Germany) at a density of 5 ⁇ 10 3 cells/well. Prior to cell treatments, the medium in each well was replaced by 90 ⁇ L medium and 10 ⁇ L PMO-LP conjugate formulations was added resulting in the desired PMO concentrations. The cells were incubated at 37 °C and 5% CO2 in a humidified atmosphere.24 h after transfection, the medium was removed and the cells were washed with 100 ⁇ L PBS.
  • the cells were trypsinized and resuspended in 100 ⁇ L FACS buffer, consisting of 10% FBS in PBS substituted with DAPI (1 ng/ ⁇ L) to differentiate between live and dead cells. All samples were analyzed by flow cytometry using a CytoFLEX S flow cytometer (Beckman Coulter, Carlsbad, USA). The fluorescence of the cells was determined by measuring excitation of DAPI at 405 nm and detection of emission at 450 nm, excitation of mCherry at 561 nm and detection of emission at 610 nm. Only isolated and viable cells were evaluated.
  • Flow cytometry data was analyzed using FlowJo X 10.0.7r2 flow cytometric analysis software by FlowJo, LLC (Ashland, USA). All experiments were performed in triplicates.
  • 118371P1272PC Cell metabolic activity assay [181] Cell viability was determined via investigation of cell metabolic activity with MTT assay.
  • HeLa mCherry-DMDEx23 were seeded in 96-well plates at a density of 5 ⁇ 10 3 cells/well.24 h after seeding, the medium was replaced by 90 ⁇ L of fresh medium.10 ⁇ L PMO- LP formulation were added to each well resulting in the desired PMO concentrations.
  • MTT 3-(4,5-dimethylthiazol-2-yl)- 2,5-diphenyltetrazolium bromide
  • the best performing PMO formulations were based on LP #1392, #1395, #1396. Especially the oligomers #1395 and #1396 turned out to be very potent and resulted in >45 % mCherry positive cells even after exposure of only 5 minutes to the moderate PMO dose of 312.5 nM (data not shown). Transmission electron microscopy (TEM) confirmed self-association of PMO(Ex23)-13951:3 formulations into nanoparticles, similar to oligomer #1195 (data not shown). The increased splice switching activity correlated with higher PMO internalization mediated by the #1395 oligomers compared to #1195 oligomers.
  • TEM Transmission electron microscopy
  • Figure 13B shows that ( Figure 13A) for 1396- based structures TFE-IDAtp showed superior activity and dGtp about comparable activity and chGtp and IDAtp slightly lower activity compared to Stp.
  • Example 6 siRNA Polyplex Formation [185] siRNA and lipo-oligomer at an indicated N/P ratio (nitrogen/phosphate) were separately diluted in equal volume of HBG (20 mM of HEPES, 5% (w/v) glucose, pH 7.4). Only protonatable nitrogens were considered for N/P ratio calculation. The siRNA and lipo-oligomer solutions were mixed by rapid pipetting and incubated for 45 min at room temperature (RT). The final concentration of siRNA in the polyplex solution was 25 ⁇ g/mL.
  • siRNA duplexes were obtained from Axolabs GmbH (Kulmbach, Germany): eGFP-targeting siRNA (siGFP) (sense strand: 5’-AuAucAuGGccGAcAAGcAdTsdT-3’, SEQ ID NO: 144; antisense strand: 5’-UGCUUGUCGGCcAUGAuAUdTsdT-3’, SEQ ID NO: 145) for silencing of eGFPLuc; control siRNA (siCtrl) (sense strand: 5’-AuGuAuuGGccuGuAuuAGdTsdT-3’, SEQ ID NO: 146; antisense strand: 5’-CuAAuAcAGGCcAAuAcAUdTsdT-3’, SEQ ID NO: 147); small letters indicate 2′methoxy modifications; “s” indicates phosphorothioate linkages, “dT” refers to deoxythymidine.
  • Particle Size and Zeta Potential Measurement for siRNA Polyplexes [187] Particle size and zeta potential were measured in a folded capillary cell (DTS1070) with dynamic and electrophoretic laser-light scattering (DLS, ELS) using a Zetasizer Nano ZS (Malvern Instruments, Malvern, Worcestershire, U.K.). siRNA polyplexes were prepared in a total volume of 80 ⁇ L HBG with siRNA concentration of 25 ⁇ g/mL. Size and polydispersity index (PDI) were measured after an equilibration time of 30 sec at 25°C with refractive index of 1.330 and viscosity of 0.8872 mPa*s. Samples were measured three times with six sub runs per measurement.
  • PDI polydispersity index
  • each sample was diluted with HEPES to final volume of 800 ⁇ L. All the setting parameters were the same as for size measurement, except an equilibration time of 60 sec. Samples were measured three times with 15 sub runs, and the zeta potential was calculated by the Smuchowski equation.
  • a 2.5% agarose gel was prepared with TBE buffer (trizma base 10.8 g, boric acid 5.5 g, disodium EDTA 0.75 g, and 1 L of water).20 ⁇ L of siRNA polyplexes in HBG at concentration of 25 ⁇ g/mL was mixed with loading buffer (6 mL of glycerol, 1.2 mL of 0.5 M EDTA, 2.8 mL of H2O, 0.02 g of bromophenol blue) at ratio of 5:1 (V/V) followed by placing in the gel pockets. The gel electrophoresis was run at 100 V for 40 min in TBE buffer.
  • the adherent human cervix carcinoma cell line KB/eGFPLuc (stably expressing the enhanced green fluorescent protein/luciferase (eGFPLuc) fusion gene) [Dohmen et al. ACS Nano 2012] was cultured in Dulbecco’s modified Eagles’s medium (DMEM)-low glucose (1 g/L glucose) supplemented with 10% (v/v) fetal bovine serum (FBS), stable glutamine (4 mM), penicillin (100 U/mL), and streptomycin (100 ⁇ g/mL).
  • DMEM Dulbecco’s modified Eagles’s medium
  • FBS fetal bovine serum
  • stable glutamine 4 mM
  • penicillin 100 U/mL
  • streptomycin 100 ⁇ g/mL
  • the cells were kept at 37°C and 5 % CO2 in an incubator with a relative humidity of 95% Gene Silencing Mediated by GFP-siRNA
  • the KB/eGFPLuc cells were seeded in 96-well-plate (5 ⁇ 10 3 cells/well) 24 h prior to the experiment.
  • the culture medium was replaced with 80 ⁇ L of fresh supplemented medium followed by siRNA polyplex transfection.
  • the polyplexes were prepared at indicated N/P ratio with control siRNA (siCtrl) or GFP-siRNA (siGFP for targeting GFPLuc protein) at concentration of 25 ⁇ g/mL in HBG.
  • siRNA polyplex solution The volumes of 10, 5, and 2.5 ⁇ L of siRNA polyplex solution were added to the corresponding wells in triplicate as well as HBG to reach a final volume of 100 ⁇ L per well.
  • HBG buffer was used as negative control. After 48 h, the medium was removed and cells were treated with 100 ⁇ L of cell culture 0.5x lysis buffer (Promega, Mannheim, Germany) followed by 45 min incubation at RT.
  • Luciferase activity was measured in the 35 ⁇ L cell lysate by a Centro LB 960 plate reader luminometer (Berthold Technologies, Bad Wildbad, Germany) using LAR buffer (20 mM glycylglycine; 1 mM MgCl2; 0.1 mM EDTA (ethylenediaminetetraacetic acid); 3.3 mM DTT (dithiothreitol); 0.55 mM ATP (adenosine 5′- triphosphate); 0.27 mM coenzyme A, pH 8-8.5) supplemented with 5% (v/v) of a mixture of 10 mM luciferin and 29 mM glycylglycine.
  • LAR buffer (20 mM glycylglycine; 1 mM MgCl2; 0.1 mM EDTA (ethylenediaminetetraacetic acid); 3.3 mM DTT (dithiothreitol);
  • the tested structures and the respective particle sizes and zeta potential are listed in Table 3 below: 118371P1272PC
  • Table 3 Particle size and zeta potential of siRNA polyplexes [192] As may be taken from Figure 14, particularly at low siRNA concentrations the more hydrophobic structures are more active in gene silencing, the terminal cysteine seems favorable. No gross change was observed with the use of the different fatty acids. In siRNA gel shift assays, all lipopeptides bound siRNA efficiently at the used N/P ratios ( Figure 15).

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • Biophysics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Microbiology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Epidemiology (AREA)
  • Immunology (AREA)
  • Cell Biology (AREA)
  • Nanotechnology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Mycology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicinal Preparation (AREA)

Abstract

The invention relates to nanoparticles for Cas protein/gRNA ribonucleoprotein (RNP) complex, siRNA or PMO delivery comprising one or more Cas protein/gRNA RNP complex(es), siRNA(s) or PMO(s) as cargo; and a carrier comprising a sequence-defined T-shape lipo-oligomer comprising a tyrosine tripeptide and either a single artificial amino acid or two hydrophobic artificial amino acids at either side of a central lysine branching point and a hydrophobic tail comprising two fatty acids, wherein the artificial amino acid is an oligo(alkylamino) acid. The invention further relates to therapeutic and non-therapeutic uses thereof and to an in vitro method for transfecting mammalian cells.

Description

118371P1272PC Novel artificial amino acid containing lipo-oligomers for ribonucleoprotein and oligonucleotide delivery FIELD OF THE INVENTION [1] The invention relates to nanoparticles for Cas protein/gRNA ribonucleoprotein (RNP) complex, siRNA or PMO delivery comprising one or more Cas protein/gRNA RNP complex(es), siRNA(s) or PMO(s) as cargo; and a carrier comprising a sequence-defined T-shape lipo-oligomer comprising a tyrosine tripeptide and either a single artificial amino acid or two hydrophobic artificial amino acids at either side of a central lysine branching point and a hydrophobic tail comprising two fatty acids, wherein the artificial amino acid is an oligo(alkylamino) acid. The invention further relates to therapeutic and non-therapeutic uses thereof and to an in vitro method for transfecting mammalian cells. BACKGROUND [2] Biopharmaceuticals, such as therapeutic proteins and therapeutic nucleic acids have become increasingly important. Also, the Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) system, an adaptable DNA cleavage system found in bacteria, has evolved as a groundbreaking genetic engineering tool. It allows genome editing in both single cells and whole organisms with high precision by introducing double-strand breaks (DSB) at targeted genomic loci and offers immense therapeutic opportunities. It has been utilized as an efficient RNA-guided genome-editing tool in numerous species, including human cells, and has become the most popular genome engineering approach. The CRISPR/Cas system has been used for biomedical applications such as transcriptional control, epigenetic modifications, genome-wide screening and chromosomal imaging, and treatment of genetic disorders. Engineered CRISPR systems contain at least two components, a guide RNA (gRNA) and a CRISPR-associated endonuclease (Cas protein). [3] The target sequence of the programmable endonuclease Cas is controlled by a guide RNA (a combination of crRNA and tracrRNA) or a single guide RNA (sgRNA). Endogenous cellular mechanisms are exploited for repair of double strand breaks, non-homologous end joining (NHEJ) results in mutations and gene knockout, while homology directed repair (HDR) can result in precise gene editing and DNA sequence knock-in when using donor-DNA (template). [4] For efficient genome editing, a successful intracellular delivery of the CRISPR/Cas9 components is essential and represents one of the major challenges for CRISPR/Cas-based genome editing. So far, the most common strategy is based on the delivery of the CRISPR/Cas encoding DNA sequences, such as plasmid DNA encoding the Cas protein and a guide RNA or single guide RNA or in vitro transcribed RNA molecules. [5] However, delivery of pre-assembled ribonucleoproteins (RNPs) comprising the Cas protein and the guide RNA (gRNA) is generally considered as the most straightforward and efficient strategy. The direct delivery of the Cas protein complexed with gRNA or sgRNA has several advantages over the 118371P1272PC delivery of the corresponding nucleic acid precursors, as the ribonucleoprotein (RNP) complex is immediately functional without the requirement of transcription and translation. Furthermore, there is no risk of spontaneous genome integration, and timely degradation reduces potential off-target effects. [6] Yet, direct delivery of the Cas/gRNA complex remains to be a challenge as it requires suitable carrier systems, due to poor membrane permeability. Also, nucleic acids and proteins are susceptible to enzymatic degradation and incorporation into a carrier system potentially increases their stability in vivo. Different non-viral delivery technologies have evolved for the direct delivery of the RNP complexes (Wan, T et al., Material solutions for delivery of CRISPR/Cas-based genome editing tools: Current status and future outlook, Materials Today, 2019, 26: 40-66), including cell-penetrating peptides, DNA nanoclews, gold nanoparticles, polymeric systems, black phosphorus nanosheets, hydrogels, or lipid nanoparticles. Nonetheless, the need for better carriers for stable RNP packaging, high cellular uptake, efficient endosomal escape, and nuclear entry while preserving biological activity remains. [7] Sequence-defined cationic oligomers containing artificial amino acids provide delivery systems with high chemical precision and flexibility. Artificial amino acids, such as oligo(ethylamino) acids containing the PEI-like aminoethylene motif, are assembled together with natural amino acids on solid- phase to sequence-defined oligomers. [8] Sequence-defined oligomers, such as oligo(ethylamino) amides, based on artificial oligoamino acids and solid-phase synthesis have recently been developed as a platform for the delivery of nucleic acids (Schaffert, D. et al., Solid-phase synthesis of sequence-defined T-, i-, and U-shape polymers for pDNA and siRNA Delivery, Angew. Chem., Int. Ed.2011, 50(38), 8986-8989), proteins (Zhang, P. et al., Enhanced Intracellular Protein Transduction by Sequence Defined Tetra-Oleoyl Oligoaminoamides Targeted for Cancer Therapy, Adv. Funct. Mater., 2015, 25, 6627−6636), and drugs (Truebenbach, I. et al., Combination Chemotherapy of L1210 Tumors in Mice with Pretubulysin and Methotrexate Lipo-Oligomer Nanoparticles, Mol. Pharmaceutics, 2019, 16, 2405−2417). They combine the advantages of aminoethylene-based polymers with the chemical precision of peptides and enable cargo-specific optimization. These sequence-defined oligomers may further contain a lipid portion (lipo-oligomer). [9] Particularly for nucleic acids, a convenient and frequently used mechanism is based on the ionic interaction between the negatively charged nucleic acid and polycations. The nucleic acid condensation by positively charged polymers is an entropy driven process and produces nanosized complexes, also referred to as polyplexes. Stable packaging predominantly depends on the size and charge density of the cationic polymer. The nucleic acid complexation by cationic polymers produces particles with positive surface potential, which can induce internalization by electrostatic interaction with the negatively charged cell membrane. This may be further improved by attachment of targeting ligands. Following uptake, the entrapped polyplexes have to be released from the vesicles for nuclear delivery. Endosomal escape seems to be enhanced by specific protonation of ionizable groups in the endosomal pH range, which is, e.g., an intrinsic property of polyethylenimine (PEI). The proposed mechanism relies on the presence of basic groups, which are unprotonated at physiological pH, but 118371P1272PC can get protonated in the mildly acidic endosomal environment. The aminoethylene motifs contained in PEI or structurally related reagents provide a favorable combination of positive charge at neutral pH for electrostatic binding of nucleic acids as well as additional protonation capacity at endosomal pH. [10] Sequence-defined oligomers with a favorable stability, biocompatibility, and toxicity profile have been generated previously (Schaffert, D. et al., Angew. Chem., Int. Ed. 2011, 50(38), 8986-8989; Schaffert, D. et al, Org. Lett., 2011, 13, 1586-9). WO 2011/154331 describes various oligo(alkylamino) acids for siRNA delivery in vivo. However, the drug substance affects the suitability of the oligo(alkylamino) acids as well as the sequence and shape of the oligomer or lipo-oligomer. For instance, ribonucleoprotein (RNP) complexes comprising a guide RNA (gRNA) or single guide RNA (sgRNA) bound by a positively charged Cas protein are not comparable to RNA (such as siRNA), plasmid DNA (pDNA) or artificial antisense oligonucleotides (such as phosphorodiamidate morpholino oligomers (PMOs)) as cargos. Further, lipo-oligomers comprising oligo(alkylamino) acids were generated as a delivery platform for co-delivery of the Cas9 protein and sgRNA, disclosing a T-shape lipid-oligomer comprising a headgroup with two succinyl-tetraethylenepentamines (Stp) on either side of the central lysine and a tail comprising hydroxysteric acid (Kuhn, J. et al., Delivery of Cas9/sgRNA Ribonucleoprotein Complexes via Hydroxystearyl Oligoamino Amides, Bioconjugate Chemistry, 2020, 31, 729-742). The artificial amino acid Stp complexes the negatively charged RNP complex and facilitates its cellular delivery. [11] However, there is the need for further improved cargo-specific optimized lipo-oligomers for delivery of Cas9/sgRNA complexes, as well as for delivery of siRNA and PMOs. SUMMARY OF THE INVENTION [12] In the present invention it was found that more hydrophobic lipo-oligomers are advantageous for Cas protein/gRNA RNP complexes, which also turned out to be advantageous for siRNA and PMO delivery. More specifically, the present invention relates to a nanoparticle for Cas protein/gRNA ribonucleoprotein (RNP) complex (cargo) delivery comprising one or more Cas protein/gRNA RNP complex(es) as cargo; and a carrier comprising a sequence-defined T-shape lipo-oligomer, comprising an artificial amino acid, wherein the artificial amino acid is an oligo(alkylamino) acid, and wherein the T-shape lipo-oligomer comprises the sequence of formula I: Cn-Y3-Hn(outer)-X1-Hn(inner)-Kc[Kf[FA] Formula wherein Kc is a central lysine; Kf is a further lysine linked to the ε-amino group of Kc; FA is a fatty acid covalently linked to the ε- and α-amino group of Kf; C is cysteine and n = 0 or 1, preferably n = 0 Y3 is a tyrosine tripeptide; H is histidine and n(outer) and n(inner) are independently selected from 0, 1 or 2; and X1 is an oligo(alkylamino) acid of formula IIa: 118371P1272PC H(HN-(CH2)n)m-NH-CO-R Formula IIa wherein n = 2 or 3, alternating 2 and 3 or alternating 3 and 2; and m = 3 or 4; and wherein R is -(CH2)y-CO2H, wherein y = 2, 3 or 4; -CH2-CH(c-hexyl)-CH2-CO2H; or -CH2-NRa-CH2-CO2H, wherein Ra = H, CH2-CF3, or wherein the T-shape lipo-oligomer comprises the sequence of formula III: Cn-Y3-Hn(outer)-[X2-Hn(inner)]2-Kc[Kf[FA]2]-[Hn(inner)-X2]2-Hn(outer)-Y3-Cn; Formula III wherein Kc is a central lysine; Kf is a further lysine linked to the ε-amino group of Kc; FA is a fatty acid covalently linked to the ε- and α-amino group of Kf; C is cysteine and n = 0 or 1, preferably n = 1 Y3 is a tyrosine tripeptide; H is histidine and n(outer) and n(inner) are independently selected from 0 or 1; and X2 is an oligo(alkylamino) acid of formula IIa: H(HN-(CH2)n)m-NH-CO-R Formula IIa wherein n = 2 or 3, alternating 2 and 3 or alternating 3 and 2; and m = 3 or 4; wherein R is -(CH2)y-CO2H, wherein y = 3 or 4; -CH2-CH(c-hexyl)-CH2-CO2H; or -CH2-NRa-CH2-CO2H, wherein Ra = CH2-CF3. [13] In certain embodiments, the two fatty acids are saturated or unsaturated C12 to C22 fatty acids, preferably the two fatty acids are selected from the group consisting of oleic acid (OleA), linoleic acid 118371P1272PC (LinA), linolenic acid (LenA) or hydroxy steric acid (OHSteA), preferably OleA, LinA or OHSteA, more preferably LinA or OHSteA. The oligo(alkylamino) acid is in certain embodiments a tetraethylenepentamine or a triethylenetetramine of formula IIb: H(HN-(CH2)2)m = 3 or 4-NH-CO-R (Formula IIb); preferably a tetraethylenepentamine. The T-shape lipo-oligomer comprises in certain embodiments the sequence of formula I: Cn-Y3-Hn(outer)-X1-Hn(inner)-Kc[Kf[FA] Formula (a) wherein C is cysteine and n = 0 or 1, preferably n = 0 Y3 is a tyrosine tripeptide; H is histidine and n(outer) and n(inner) are 1; or (b) wherein C is cysteine and n = 0 Y3 is a tyrosine tripeptide; H is histidine and n(outer) and n(inner) are 0; or the sequence of formula III: Cn-Y3-Hn(outer)-[X2-Hn(inner)]2-Kc[Kf[FA]2]-[Hn(inner)-X2]2-Hn(outer)-Y3-Cn; Formula III (c) wherein C is cysteine and n = 1 Y3 is a tyrosine tripeptide; H is histidine and n(outer) and n(inner) are 1; or (d) wherein C is cysteine and n = 1 Y3 is a tyrosine tripeptide; H is histidine and n(outer) and n(inner) are 0. [14] The sequence-defined T-shape lipo-oligomer may further comprise a terminal functional group at the N-terminus or the C-terminus of the T-shape lipo-oligomer, wherein the function group is (i) an azido group, or (ii) a thiol group, provided that the sequence of formula I does not comprise a cysteine; More specifically, the sequence-defined T-shape lipo-oligomer may further comprises a terminal azido group and a targeting ligand is coupled to the azido group, preferably wherein the targeting ligand is coupled to the azido group via click chemistry, more preferably click chemistry with a dibenzocylcooctyne-coupled targeting ligand. [15] The RNP complex in certain embodiments comprises Cas protein/gRNA at a ratio of about 1:1 to about 1:2 and/or wherein the Cas protein/gRNA RNP complex and the sequence-defined T-shape lipo-oligomer are mixed at a lipo-oligomer nitrogen (N) to gRNA phosphate (P) ratio (N/P ratio) of about 1:12 to 1:30, preferably about 1:20 to 1:30, more preferably of about 1:22 to 1:26. The Cas protein may be (a) a Cas9, a Cas12, a Cas13 protein or an engineered variant thereof and/or (b) a base editor or a prime editor. Moreover, the one or more Cas protein/gRNA RNP complex(es) may be Cas9/gRNA RNP complex(es). The nanoparticle may further comprises two or more Cas protein/gRNA RNP 118371P1272PC complexes as cargo, wherein the two or more Cas protein/gRNA RNP complexes comprise two or more different gRNAs targeting the same or different genes, preferably different genes. In certain embodiments, the nanoparticle comprises one or more Cas protein/gRNA RNP complexes and a donor DNA. [16] In another aspect the invention relates to a nanoparticle for siRNA or phosphorodiamidate morpholino oligomers (PMO) (cargo) delivery comprising one or more siRNA(s) or PMO(s) as cargo; and a carrier comprising a sequence-defined T-shape lipo-oligomer comprising an artificial amino acid, wherein the artificial amino acid is an oligo(alkylamino) acid, and wherein the T-shape lipo-oligomer comprises the sequence of formula I: Cn-Y3-Hn(outer)-X1-Hn(inner)-Kc[Kf[FA]2]-Hn(inner)-X1-Hn(outer)-Y3-Cn; Formula I (SEQ ID NO: 1) wherein Kc is a central lysine; Kf is a further lysine linked to the ε-amino group of Kc; FA is a fatty acid covalently linked to the ε- and α-amino group of Kf; C is cysteine and n = 0 or 1, preferably n = 0 Y3 is a tyrosine tripeptide; H is histidine and n(outer) and n(inner) are independently selected from 0, 1 or 2; and X1 is an oligo(alkylamino) acid of formula IIa: H(HN-(CH2)n)m-NH-CO-R Formula IIa wherein n = 2 or 3, alternating 2 and 3 or alternating 3 and 2; and m = 3 or 4; wherein R is more preferably -CH2-CH(c-hexyl)-CH2-CO2H; or -CH2-NRa-CH2-CO2H, wherein Ra = H, CH2-CF3, wherein the two fatty acids are saturated or unsaturated C12 to C22 fatty acids, preferably the two fatty acids are selected from the group consisting of oleic acid (OleA), linoleic acid (LinA), linolenic acid (LenA) or hydroxy steric acid (OHSteA), preferably OleA, LinA or OHSteA, more preferably LinA or OHSteA. [17] In yet another aspect the invention also relates to a conjugate comprising a phosphorodiamidate morpholino oligomer (PMO) covalently linked to a carrier comprising a sequence-defined T-shape lipo- 118371P1272PC oligomer, comprising an artificial amino acid, wherein the artificial amino acid is an oligo(alkylamino) acid, and wherein the T-shape lipo-oligomer comprises the sequence of formula I: Cn-Y3-Hn(outer)-X1-Hn(inner)-Kc[Kf[FA] Formula wherein Kc is a central lysine; Kf is a further lysine linked to the ε-amino group of Kc; FA is a fatty acid covalently linked to the ε- and α-amino group of Kf; C is cysteine and n = 0 or 1, preferably n = 0 Y3 is a tyrosine tripeptide; H is histidine and n(outer) and n(inner) are independently selected from 0, 1 or 2; and X1 is an oligo(alkylamino) acid of formula IIa: H(HN-(CH2)n)m-NH-CO-R Formula Iia wherein n = 2 or 3, alternating 2 and 3 or alternating 3 and 2; and m = 3 or 4; and wherein R is -(CH2)y-CO2H, wherein y = 2, 3 or 4; , more preferably ; -CH2-CH(c-hexyl)-CH2-CO2H; or -CH2-NRa-CH2-CO2H, wherein Ra = H, CH2-CF3, and wherein the two fatty acids are saturated or unsaturated C12 to C22 fatty acids, preferably the two fatty acids are selected from the group consisting of oleic acid (OleA), linoleic acid (LinA), linolenic acid (LenA) or hydroxy steric acid (OHSteA), preferably OleA, LinA or OHSteA, more preferably LinA or OHSteA. [18] In a further aspect, the invention relates to the nanoparticle of the invention for use in therapy. [19] In yet another aspect, the invention relates to the nanoparticle of the invention for use in treating cancer, a genetic disease, an infectious disease a cardiovascular disease, a metabolic disease, a neurodegenerative or neuromuscular disease, a hematological disease, a hereditary eye disease or an autoimmune disease or an autoimmune disease. [20] In yet another aspect, the invention relates to an in vitro method for transfecting mammalian cells with one or more Cas protein/gRNA complex(es) comprising contacting a mammalian cell in vitro with the nanoparticle according to the invention. 118371P1272PC [21] In yet another aspect, the invention relates to a use of the sequence-defined T-shape lipo- oligomer for cellular delivery of a Cas protein/gRNA ribonucleoprotein (RNP) complex into a target cell, wherein the sequence defined T-shape lipo-oligomer is as defined for the nanoparticles according to the invention. [22] In yet another aspect, provided is the use of an artificial amino acid in a sequence-defined T- shape lipo-oligomer for cellular delivery of a Cas protein/gRNA ribonucleoprotein (RNP) complex into a target cell, wherein the artificial amino acid is an oligo(alkylamino) acid selected from the group consisting of Gtp, Gtt, Htp, Ptp, IDAtp, TFE-IDAtp, GEIPA, Ntp, and chGtp. Preferably, the oligo(alkylamino) acid is selected from the group consisting of Gtp, Gtt, Htp, TFE-IDAtp, GEIPA, and chGtp, preferably Htp, TFE-IDAtp, and chGtp. The target cell is preferably a mammalian cell, such as a cell line, e.g., CHO cell or a HEK 293 cell or a primary cell in cell culture (in vitro). [23] In yet another aspect, an artificial amino acid is provided, wherein the artificial amino acid is an oligo(alkylamino) acid selected from the group consisting of the following formulas: , , in its protected and unprotected form. The use is for (in vitro) cellular delivery of a Cas protein/gRNA ribonucleoprotein (RNP) complex into a target cell. DESCRIPTION OF THE FIGURES [24] Figure 1. Schematic illustration of oligomers with optimized sequences comprising (A) one (1 Stp Series; from top to bottom SEQ ID NOs: 103, 102, 101, 100) or (B) two consecutive artificial amino acids (2 Stp Series, from top to bottom SEQ ID NOs: 107, 106, 105, 104) showing the lead compound succinyl-tetraethylenepentamine (Stp) on either side of the central lysine K as a representative artificial amino acid; (C) chemical structure of sequence defined T-shape lipo-oligomers showing Stp as one representative artificial amino acid. 118371P1272PC [25] Figure 2. eGFP knockout experiments illustrating the effect of sequence optimization on Stp- based oligomers. (A) The percentage of GFP knockout in HeLa eGFP/tub cells was determined using a FACS analysis after treatment with Cas9 RNP nanoparticles at 75 nM RNP dose for 48 h. Shown is the eGFP knockout efficiency (%) and cell viability using the abbreviations of Table 1. (B) The percentage of GFP knockout in HeLa eGFP/tub cells was determined using a FACS analysis after 48 h treatment with Cas9 RNP nanoparticles at a series of RNP concentrations at concentrations ranging from 0.1 to 100 nM using the sequence-based oligomers as indicated by oligomer ID. Shown is the eGFP knockout efficiency (%) versus the ribonucleoprotein (RNP) concentration (nM). Data are presented as mean ± SD (n=3). [26] Figure 3. Schematic illustration of sequence-defined lipo-oligomers based on α-amino acids cysteine (C), tyrosine (Y), lysine (K), histidine (H) and the artificial oligoamino acid succinyl tetraethylenepentamine (Stp). [27] Figure 4. Chemical formulas of artificial amino acid building blocks as Stp analogs in their unprotected (A) and their protected forms (B). [28] Figure 5. eGFP knockout-experiments illustrating the effect of optimized artificial amino acid building blocks on lipo-oligomers with 1445-based structure. The percentage of GFP knockout in HeLa eGFP/tub cells was determined using a FACS analysis after 48 h treatment with Cas 9 RNP nanoparticles at a series of RNP concentrations ranging from 0.1 nM to 100 nM. Shown is the eGFP knockout efficiency (%) versus the ribonucleoprotein (RNP) concentration (nM). [29] Figure 6. eGFP knockout-experiments illustrating the effect of optimized artificial amino acid building blocks on oligomers with 1392-based structure. The percentage of GFP knockout in HeLa eGFP/tub cells was determined using a FACS analysis after 48 h treatment with Cas 9 RNP nanoparticles at a series of RNP concentrations ranging from 0.1 nM to 100 nM. Shown is the eGFP knockout efficiency (%) versus the ribonucleoprotein (RNP) concentration (nM). [30] Figure 7. eGFP knockout-experiments illustrating the effect of optimized artificial amino acid building blocks on oligomers with 1396-based structure. The percentage of GFP knockout in HeLa eGFP/tub cells was determined using a FACS analysis after 48 h treatment with Cas 9 RNP nanoparticles at a series of RNP concentrations ranging from 0.1 nM to 100 nM. Shown is the eGFP knockout efficiency (%) versus the ribonucleoprotein (RNP) concentration (nM). [31] Figure 8: Plot of eGFP knockout EC50 values versus oligomer logD7.4 values of (A) 1445- based structures (B) 1396-based structures and (C) 1392-based structures with varied artificial amino acid building blocks. [32] Figure 9: Evaluation of nanoparticle size, nanoparticle stability and cellular uptake in a side-by- side comparison of selected 1445-based structures, 1396-based structures and 1392-based structures. Shown is (A) Effect of dilution on the nanoparticle size determined by DLS; value = 0 indicates “not detectable”; (B) nanoparticle stability against different concentrations of NaCl (0, 0.05, 0.15, 0.25, 0.5, and 5 M); Ribogreen was used for the detection of free RNA (C) nanoparticle stability against different concentrations of heparin (0, 0.25, 0.5, 1, 2.5, and 5 IU / μg sgRNA); Ribogreen was used for the detection of free RNA; and (D) Cellular uptake of Cas9 RNP (75 nM) containing 20 % 118371P1272PC ATTO647N-Cas9 and 20 % ATTO488-sgRNA into HeLa cells determined by flow cytometry after 4 h incubation. [33] Figure 10. (A) Gating strategy to differentiate non-edited (eGFP positive), NHEJ (eGFP negative), and HDR (BFP positive) cell populations. (B) Evaluation of editing percentage of non- homologous end joining (NHEJ) and homology-directed repair (HDR) by quantification of GFP knockout (NHEJ) and GFP-to-BFP conversion (HDR) in HeLa-GFPd2 cells treated with TFE-IDAtp1- Lin1 (ID oligomer #1740) Cas9 RNP/ssDNA nanoparticles at various concentrations and ratios of RNP/ssDNA of 1/1 (top) and 1/8 (bottom). [34] Figure 11: Evaluation of non-homologous end joining (NHEJ) efficiency, homology-directed repair (HDR) efficiency, total editing efficiency and non-edited cell percentage in a side-by-side comparison of selected 1445-based structures, 1396-based structures and 1392-based structures comprising the artificial amino acids as indicated. Results are shown as (A) heat map of NHEJ efficiency in HeLa GFPd2 cells 48 h after treatment with different Cas9 RNP/ssDNA nanoparticle (fixed at 1/4) formulations at varied RNP concentrations; (B) heat map of HDR efficiency in HeLa GFPd2 cells 48 h after treatment with different Cas9 RNP/ssDNA (fixed at 1/4) nanoparticle formulations at varied RNP concentrations; (C) heat map of total editing efficiency in HeLa GFPd2 cells 48 h after treatment with different Cas9 RNP/ssDNA nanoparticle (fixed at 1/4) formulations at varied RNP concentrations; (D) heat map of non-edited cell percentages in HeLa GFPd2 cells 48 h after treatment with different Cas9 RNP/ssDNA (fixed at 1/4) nanoparticle formulations at varied RNP concentrations. [35] Figure 12: Structure-activity relationship of PMO(Ex23)-LP 1:3 formulations. (A) Schematic illustrations of lipo-oligomers (LP) architectures classified according to the ionizable backbone into “Stp” (#1391-#1393), “H-Stp-H” (#1395-#1397) and “Stp-Stp” (#1195). The table summarizes individual fatty acids contained. K: lysin, Y: tyrosine, Stp: succinyl tetraethylene pentamine, FA: fatty acid. (B) Splice switching activity in HeLa mCherry-DMDEx23 cells after 24 h treatment with PMO(Ex23)-LP 1:3 formulations (0.078 to 5 µM PMO). (C) Metabolic activity of HeLa mCherry- DMDEx23 cells after 24 h treatment with PMO(Ex23)-LP 1:3 formulations. (D) Dose titration of PMO(Ex23)-1195 and -1395 formulations (2.4 nM to 312.5 nM PMO) with exposure of HeLa mCherry- DMDEx23 cells for 24 h. Percentage of mCherry expressing cells was determined 24h after treatment. Data are presented as mean ± SD (n=3). [36] Figure 13: Comparison of various artificial amino acids in 1392-based and 1396-based structures for PMO delivery. (A) Splice-switching activity in HeLa mCherry-DMDEx23 cells after 24 h treatment with PMO(Ex23)-LP 1:3 formulations using 1392-based oligomers. Data are presented as mean ± SD (n = 3). (B) Splice-switching activity in HeLa mCherry-DMDEx23 cells after 24 h treatment with PMO(Ex23)-LP 1:3 formulations using 1396-based oligomers. Data are presented as mean ± SD (n = 3). [37] Figure 14: Gene silencing activity of siRNA polyplexes in KB/eGFPLuc cells. SiRNA polyplexes were formulated with different carriers with Stp2-HC (N/P 12), Stp1-H (N/P 24), and Stp1-HC carriers (N/P 24) in HBG (25 µg siRNA/mL), and tested at doses of 250, 125 and 63 ng siRNA per well. As siRNAs, eGFP-targeted siRNA (siGFP) and control siRNA (siCtrl) were used. Luciferase expression 118371P1272PC was measured 48 h after transfection without change of the medium. RLU was presented as percentage of the luciferase gene expression of the HBG buffer-treated cells (n=3, mean ± SD). [38] Figure 15: Gel electrophoresis of siRNA polyplexes in comparison to free siRNA. siCtrl polyplexes were formed with different carriers at indicated N/P ratios in HBG (25 µg siRNA/mL), and their stability was evaluated by standard agarose (2.5%, TBE buffer) gel shift assay. DETAILED DESCRIPTION [39] The term “comprises” or “comprising” means “including, but not limited to”. The term is intended to be open-ended, to specify the presence of any stated features, elements, integers, steps or components, but not to preclude the presence or addition of one or more other features, elements, integers, steps, components or groups thereof. The term “comprising” thus includes the more restrictive terms “consisting of” and “essentially consisting of”. With regard to sequences the terms “having an amino acid sequence of” and “comprising an amino acid of” are used interchangeably and include the embodiment “consisting of the amino acid sequence of”. Similarly, the term “encoding” or “encodes” is intended to be open-ended and allows the presence or addition or one or more other features, elements or components. Furthermore, singular and plural forms are not used in a limiting way. As used herein, the singular forms “a”, “an” and “the” designate both the singular and the plural, unless expressly stated to designate the singular only. [40] The term “protein” is used interchangeably with “amino acid sequence” or “polypeptide” and refers to polymers of amino acids of any length. These terms also include proteins that are post- translationally modified through reactions that include, but are not limited to, glycosylation, acetylation, phosphorylation, glycation or protein processing. Modifications and changes, for example fusions to other proteins, amino acid sequence substitutions, deletions or insertions, can be made in the structure of a polypeptide while the molecule maintains its biological functional activity. For example, certain amino acid sequence substitutions can be made in a polypeptide or its underlying nucleic acid coding sequence and a protein can be obtained with the same properties. The sequence-defined (T-shape) lipo-oligomers comprising at least two artificial amino acids as used in the nanoparticle according to the invention are distinct from a polypeptide or protein. [41] A “peptide bond” as used herein is an amide type of covalent chemical bond linking two amino acids via the carboxylic group of one amino acid with the amino group of the other amino acid. Typically, the peptide bond refers to the bond between two α-functional groups of two amino acids between C-1 of one amino acid (carboxylate) and N of C-2 of the other amino acid (α-amino group), which may also be referred to as α-peptide bond in contrast to an amide bond with the ε-amino group of lysine (side chain amino group). For the artificial amino acids described herein the peptide bond is analogously formed e.g., between a C-terminal carboxylic group of one artificial amino acid X and the N-terminal primary amino group of the adjacent amino acid (natural or artificial). [42] The term “nucleic acid sequence” is used interchangeably with “polynucleotide” and refers to DNA or RNA of any length. In the context of a non-viral expression vector, particularly a plasmid and/or 118371P1272PC integration into the host cell’s genome the person skilled in the art would understand that it refers to a DNA sequence or molecule. The term “pDNA” as used herein means plasmid DNA. [43] The term “eukaryotic cell” as used herein refers to cells that have a nucleus within a nuclear envelop and include animal cells, human cells, plant cells and yeast cells. In the present invention a “eukaryotic cell” particularly encompasses mammalian cell, such as human or rodent cells, including without being limited thereto Chinese hamster ovary (CHO) cells, Neuro-2a cells, BHK cells, HEK293 cells, HeLa cells, HepG2 cells or derivatives thereof as well as primary cells, particularly human primary cells. Mammalian cells as used herein refer to all cells of mammalian origin, such as human or rodent cells. [44] The term “about” as used herein refers to a variation of 10 % of the value specified, for example, about 50 % carries a variation from 45 to 55 %. [45] The term “sequence-defined” as used herein refers to a sequential assembly of the compounds, particularly using a solid-phase supported synthesis, such as common Fmoc solid-phase synthesis (SPS). In the present context this involves the use of artificial amino acids with appropriate protecting groups, such as compatible with Fmoc SPS together with Fmoc α-amino acids. [46] The term “guide RNA” abbreviated to gRNA as used herein refers to an RNA that is partially complementary to a target DNA locus and guides the Cas protein endonuclease to this site. The gRNA may be a CRISPR RNA (crRNA), a crRNA that pairs with trans-activating crRNAs (tracrRNA), an artificial single-guide RNA, an artificial prime editing guide RNA (pegRNA) or other RNA molecules which form a complex with a Cas protein and guide it to the target DNA sequence. The term “single- guide RNA” abbreviated to sgRNA as used herein refers to an artificial RNA consisting of tracr RNA, crRNA and an artificial RNA linker. It also includes modified/improved sgRNAs, such as tru-gRNA, using a spacer sequence with <20 nucleotides complementary to the protospacer target, and hp- sgRNA, comprising an extension on the 5’end of the spacer. Wherein modified/improved means compared to the canonical guide RNA. Many Cas12 nucleases are guided by a single crRNA. The term “artificial” in the context of an RNA means an engineered non-naturally occurring RNA. A guide RNA may also be chemically modified to increase stability, reduce TLR activation and increase specificity. [47] The binding of the gRNA to the Cas protein results in the formation of a ribonucleoprotein (RNP) complex. The CRISPR/Cas system composed of the gRNA and a Cas protein as a targeted nuclease can identify a targeting sequence next to a protospacer adjacent motif (PAM) through guidance by a gRNA which is specific for the targeting sequence and then cleave the DNA (or RNA in specific cases) at specific sites. The gRNA therefore confers sequence specificity to the RNP complex and several gRNA (with different target specificity) can be used with the CRISPR/Cas system. In a preferred embodiment the gRNA is a sgRNA. [48] The terms “Cas” and “Cas protein” are used interchangeably herein and refers to a CRISPR- associated endonuclease. Suitable Cas proteins include, without being limited thereto, type II Cas proteins, e.g., Cas9 (such as SpCas9, SaCas9, CjCas9, StCas9 or NmeCas9); type V Cas proteins, e.g., Cas12a (formerly Cpf1), Cas12f (formerly Cas14), Cas12b (formerly c2c1), Cas12i, Cas12e 118371P1272PC (formerly CasX) or Cas12g; and type VI Cas proteins, e.g., Cas13a, all of which include engineered variants thereof (engineered Cas variants). Engineered Cas variants include, without being limited thereto, variants with altered PAM compatibilities, such as less restrictive or different PAM compatibility of Cas9 or Cas12 variants (e.g., Anzalone et al., Nature Biotechnology, 38, 2020: pages 824-844, supplementary Table 1); variants with higher DNA specificity, such as variants with reduced off-target Cas nuclease activity (e.g., eSpCas(1.1), SpCas9-HF1, HypaCas9, evoCas9, Sniper-Cas9, HiFiCas9, enAsCas12a-HF1); base editors (e.g., as listed in Anzalone et al., Nature Biotechnology, 38, 2020: pages 824-844, supplementary Tables 2 and 3); CRISPR-associated transposases and engineered Cas-domain-fused transposase and recombinase systems; and prime editors, as well as mutated or truncated variants, such as Cas nickase and dCas. For example, a Cas nickase (e.g., nickase Cas9n and Cas9D10A) comprising an inactivating mutation in one or more of the nuclease domains (cleaving only one of the DNA strands) and a nuclease-deficient dCas mutant with only sgRNA binding ability, optionally further fused to another enzyme, expanded the conventional editing applications. A Cas protein ortholog refers to one of two or more homologous Cas proteins derived from different species, for example Cas9 orthologs include, without being limited thereto, Cas9 protein derived from a different bacterial species, such as SpCas9 derived from Streptococcus pyogenes, SaCas9 derived from Staphylococcus aureus, CjCas9 derived from Campylobacter jejuni, StCas9 derived from Streptococcus thermophilus, and NmeCas9 from Neisseria meningitidis. Cas orthologs typically differ in the recognized PAM sequences and size. The most often used Cas9 protein is SpCas9. [49] The term “engineered” in the context of a protein, particularly a Cas protein, means an artificial, non-naturally protein, particularly Cas protein, such as a protein with a deleted domain and/or a fusion protein and/or a mutated protein, wherein the mutation may for example result in a different specificity, e.g., a different PAM specificity, or an inactivated or enhanced enzyme activity of the protein or of one or more of the distinct nuclease domain(s) (e.g., RuvC and/or HNH of Cas9). [50] The term “Cas9 protein” as used herein refers to Cas9 nucleases that are guided by guide RNAs to generate predominantly blunt-end DSBs using two distinct nucleases (RuvC and HNH), as well as engineered variants thereof, e.g., Cas9 nickase comprising an inactivated HNH and/or RuvC nuclease domain and the nuclease-deficient dCas9. [51] Typically, a double-strand break at the target site in the cellular genome is introduced. Strand breaks can be repaired by non-homologous end joining (NHEJ), which can introduce insertions or deletions (indels) or in the presence of a donor DNA by homology-directed repair (HDR). The donor DNA may be double-stranded DNA (dsDNA) or single-stranded DNA (ssDNA), such as single stranded oligonucleotide donors (ssODNs). It can be delivered as plasmid, linear double-stranded DNA or single stranded DNA. Also, the donor DNA may be co-delivered together with the RNP complex or may be delivered separately by non-viral or viral delivery. For example, the donor DNA may be delivered using a separate nanoparticle, wherein the carrier may be the same, i.e., the sequence-defined T-shape lipo-oligomer according to the invention or the carrier may be different. Exemplary viral-delivery methods include, e.g., adeno-associated virus (AAV), lentivirus or adenovirus, preferably AAV. 118371P1272PC [52] The term “indel” or “indels” as used herein refers to a variety of insertions and deletions, typically introduced by error-prone non-homologous end joining processes during the cellular repair of double- stranded DNA breaks (DSBs). Indel products that result from DSB cannot be controlled, but are not random. In open reading frames they usually generate frameshift mutations in coding sequences that abrogate protein function. [53] The term “chimeric single-guide RNA” abbreviated to cgRNA as used herein refers to a modified sgRNA which carries a first sequence to generate double-stranded breaks and a second sequence for homology-directed repair. [54] The term “base editor” as used herein introduces targeted point mutations without the requirement of DSBs or donor DNA template. Typically, a base editor containing a catalytically impaired CRISPR-Cas nuclease (that cannot make DSBs), such as Cas9 nickases or dCas9, fused to a DNA deaminase enzyme. Two main classes of base editors have been developed, cytosine base editors (CBEs), which catalyze the conversion from C/G base pairs to T/A base pairs (cytidine deaminase); and adenine base editors (ABEs), which catalyze conversion from A/T base pairs to G/C base pairs (adenosine deaminase). The base editor may optionally further be fused to proteins that modify the DNA repair machinery, (e.g., uracil glycosylase inhibitor domain (UGI) for CBEs or N- methylpurine DNA glycosylase for ABEs. Most base editors, such as CBEs BE3, BE4, BE4max and ABEs ABE7.10, ABEmax use a Cas nickase. The person skilled in the art understands that the Cas nickase nicks the non-deaminated DNA strand. Alternatively, a base editor may comprise a dCas mutant. [55] The term “prime editor” as used herein refers to a a combination of a Cas9 nickase domain (inactivated HNH nuclease) and an engineered reverse transcriptase domain, which may be fused or untethered. Prime editors can introduce all possible types of point mutations, including all base pair conversions, small insertions and small deletions in a precise and targeted manner with favorable editing to indel ratios. The prime editor is targeted to the editing site by an engineered prime editing guide RNA (pegRNA), which specifies the target site in its spacer sequence and the desired edit in an extension that is typically at the 3’end of the pegRNA. Upon targeted binding, the Cas9 RuvC nuclease domain nicks the PAM-containing DNA strand and uses the newly liberated 3’ end at the target DNA site to prime reverse transcription using the extension of the pegRNA. Successful priming requires that the extension in the pegRNA contain a primer binding sequence (PBS) that hybridizes with the 3’end of the nicked target DNA strand to form a primer-template complex. The reverse transcriptase domain then copies the template from the pegRNA extension into the genomic DNA directly adding the edited sequence to the target locus. The edited 3’flap replaces the redundant 5’flap, presumably by cellular DNA repair processes. Finally, the non-edited complementary strand is replaced by DNA repair using the edited strand as a template. This is facilitated by the addition of a sgRNA to nick the non-edited strand, which stimulates resynthesis of the non-edited strand using the edited strand as a template, resulting in a double-stranded edited DNA. Known prime editors, without being limited thereto are PE1 (fusion of Cas9 nickase to wild-type Moloney murine leukemia virus (M-MLV) reverse transcriptase (RT), PE2 (fusion of Cas9 nickase to engineered pentamutant M-MLV RT with increased editing efficiency), PE3 (PE2 and pegRNA and additional sgRNA), PE3b (PE3 using a nicking sgRNA 118371P1272PC that targets only the edited sequence), PE4 (PE2 in combination with DNA mismatch repair inhibiting protein MLH1dn), PE5 (PE3 in combination with MLH1dn) and PEmax (optimization of PE2) or split Prime editors, such as Split-PE (Cas9 nickase and reverse transcriptase are expressed separately and combined at the mRNA or protein level). The use of prime editors is known in the art, such as derivable from Anzalone et al., (Nature Biotechnology, 38, 2020: pages 824-844), Chen et al., (Cell, 184(22), 2021: pages 5635-5652.e29), Liu, B. et al., (Nat Biotechnol 40, 2022: 1388–1393) and Grünewald, J. et al., (Nat Biotechnol (2022); doi: 10.1038/s41587-022-01473-1). [56] The term “click chemistry” as used herein refers to a class of highly specific, in many cases biorthogonal, covalent conjugation reactions, that are modular, efficient, relatively insensitive to solvent parameters, water and oxygen. Typical click reactions, without being limited thereto are copper-catalyzed azide-alkylene cycloaddition (CuAAC) (copper-catalyzed reaction of an azide with an alkyne), copper-free azide-alkyne cycloaddition, such as strain-promoted azide-alkyne cycloaddition (SPAAC), Diels-Alder or inverse electron Diels-Alder reaction, thiol-ene or thiol-yne reaction, and alkene-tetrazole photoclick reaction. [57] The term “targeting ligand” as used herein refers to a ligand that binds to a receptor resulting in receptor-mediated endocytosis. Coupling a targeting ligand to the nanoparticles of the invention, or more specifically to the carrier comprised in the nanoparticle of the invention, allows targeted delivery and hence receptor or even cell specific delivery. For example, by incorporating an azido functional group or a thiol group into the sequence-defined T-shape lipo-oligomer (carrier) the nanoparticle can be converted to a receptor-targeted nanoparticle, e.g, via copper-free click chemistry for reacting azido functional groups with dibenzocyclooctyne (DBCO)-containing targeting ligands or thiol chemistry including thiol-maleimide addition for coupling targeting ligands such as folic acid (FolA)-PEG for folate receptor α (FRα)-specific delivery. [58] The term “carrier” as used herein relates to a non-viral carrier for the delivery of nucleic acid and/or protein. In the context of the present invention the carrier is a sequence-defined artificial polymer, more specifically a sequence-defined T-shape lipo-oligomer, that forms complexes, i.e., nanoparticles, with its cargo such as the Cas protein/gRNA ribonucleoprotein (RNP) complex. The term “nanoparticle” as used herein relates to the complex of the carrier (e.g., the sequence-defined T- shape lipo-oligomer) formed with its cargo (e.g. Cas protein/gRNA RNP complex) and can be as small as 6 nm up to several hundreds of nanometers, depending on the sequence-defined oligomer and/or the cargo. Such nanoparticles are also sometimes referred to as polyplexes. [59] Precise sequence-defined artificial polymers can be generated to meet the requirements for specific delivery. These sequence-defined artificial polymers may be formed by peptide-like artificial macromolecular structures comprising an artificial amino acid and one or more lipids or fatty acids (lipo-oligomer). The sequence-defined artificial polymers, such as sequence-defined T-shape lipo- oligomers, may also be referred to as “carrier” herein. According to the present invention the sequence-defined artificial polymer is a sequence-defined T-shape lipo-oligomer, wherein the peptide- like artificial macromolecule structure (oligomer) comprising an artificial amino acid forms a headgroup and two fatty acids covalently linked to a lysine form the hydrophobic tail. 118371P1272PC [60] In one aspect the invention relates to a nanoparticle for Cas protein/gRNA ribonucleoprotein (RNP) complex (cargo) delivery comprising one or more Cas protein/gRNA RNP complex(es) as cargo; and a carrier comprising a sequence-defined T-shape lipo-oligomer comprising an artificial amino acid, wherein the artificial amino acid is an oligo(alkylamino) acid, and wherein the T-shape lipo-oligomer comprises the sequence of formula I: Cn-Y3-Hn(outer)-X1-Hn(inner)- Formula wherein Kc is a central lysine; Kf is a further lysine linked to the ε-amino group of Kc; FA is a fatty acid covalently linked to the ε- and α-amino group of Kf; C is cysteine and n = 0 or 1, preferably n = 0 Y3 is a tyrosine tripeptide; H is histidine and n(outer) and n(inner) are independently selected from 0, 1 or 2; and X1 is an oligo(alkylamino) acid of formula IIa: H(HN-(CH2)n)m-NH-CO-R Formula IIa wherein n = 2 or 3, alternating 2 and 3 or alternating 3 and 2; and m = 3 or 4; wherein R is -(CH2)y-CO2H, wherein y = 2, 3 or 4; -CH2-CH(c-hexyl)-CH2-CO2H; or -CH2-NRa-CH2-CO2H, wherein Ra = H, CH2-CF3; or wherein the T-shape lipo-oligomer comprises the sequence of formula III: Cn-Y3-Hn(outer)-[X2-Hn(inner)]2-Kc[Kf[FA]2]-[Hn(inner)-X2]2-Hn(outer)-Y3-Cn; Formula III (SEQ ID NO: 2) wherein Kc is a central lysine; Kf is a further lysine linked to the ε-amino group of Kc; FA is a fatty acid covalently linked to the ε- and α-amino group of Kf; 118371P1272PC C is cysteine and n = 0 or 1, preferably n = 1 Y3 is a tyrosine tripeptide; H is histidine and n(outer) and n(inner) are independently selected from 0 or, 1; and X2 is an oligo(alkylamino) acid of formula IIa: H(HN-(CH2)n)m-NH-CO-R Formula IIa wherein n = 2 or 3, alternating 2 and 3 or alternating 3 and 2; and m = 3 or 4; wherein R is -(CH2)y-CO2H, wherein y = 3 or 4; , wherein z = 0 or 1, preferably , more preferably -CH2-CH(c-hexyl)-CH2-CO2H; or -CH2-NRa-CH2-CO2H, wherein Ra = CH2-CF3. [61] In an alternative aspect the invention relates to a nanoparticle for Cas protein/gRNA ribonucleoprotein (RNP) complex (cargo) delivery comprising one or more Cas protein/gRNA RNP complex(es) as cargo; and a carrier comprising a sequence-defined T-shape lipo-oligomer comprising (a) a headgroup comprising an oligomer comprising i. a central lysine (Kc), and ii. an N-terminal peptide chain and a symmetrical C-terminal peptide chain referred to the central lysine, each comprising an artificial amino acid, wherein the artificial amino acid is an oligo(alkylamino) acid; and (b) a hydrophobic tail comprising i. two fatty acids (FA) covalently linked to the ε- and α-amino group of a further lysine (Kf) ii. wherein Kf is linked to the ε-amino group of the central lysine (Kc); wherein the T-shape lipo-oligomer comprises the sequence of formula I: Cn-Y3-Hn(outer)-X1-Hn(inner)-Kc[Kf[FA]2]-Hn(inner)-X1-Hn(outer)-Y3-Cn; Formula I wherein C is cysteine and n = 0 or 1, preferably n = 0 Y3 is a tyrosine tripeptide; H is histidine and n(outer) and n(inner) are independently selected from 0, 1 or 2; and X1 is an oligo(alkylamino) acid of formula IIa: H(HN-(CH2)n)m-NH-CO-R Formula IIa 118371P1272PC wherein n = 2 or 3, alternating 2 and 3 or alternating 3 and 2; and m = 3 or 4; wherein R is -(CH2)y-CO2H, wherein y = 2, 3 or 4; -CH2-CH(c-hexyl)-CH2-CO2H; or -CH2-NR-CH2-CO2H, wherein R = H, CH2-CF3; or wherein the T-shape lipo-oligomer comprises the sequence of formula III: Cn-Y3-Hn(outer)-[X2-Hn(inner)]2-Kc[Kf[FA]2]-[Hn(inner)-X2]2-Hn(outer)-Y3-Cn; Formula III wherein C is cysteine and n = 0 or 1, preferably n = 1 Y3 is a tyrosine tripeptide; H is histidine and n(outer) and n(inner) are independently selected from 0 or 1; and X2 is an oligo(alkylamino) acid of formula IIa: H(HN-(CH2)n)m-NH-CO-R Formula IIa wherein n = 2 or 3, alternating 2 and 3 or alternating 3 and 2; and m = 3 or 4; wherein R is -(CH2)y-CO2H, wherein y = 3 or 4; -CH2-CH(c-hexyl)-CH2-CO2H; or -CH2-NRa-CH2-CO2H, wherein Ra = CH2-CF3. [62] In yet another related aspect, the invention relates to a sequence-defined T-shape lipo-oligomer comprising the sequence of formula I: Cn-Y3-Hn(outer)-X1-Hn(inner)-Kc[Kf[FA]2]-Hn(inner)-X1-Hn(outer)-Y3-Cn; 118371P1272PC Formula I, as disclosed and specified herein, or the sequence of formula III: Cn-Y3-Hn(outer)-[X2-Hn(inner)]2-Kc[Kf[FA]2]-[Hn(inner)-X2]2-Hn(outer)-Y3-Cn; Formula III, as disclosed and specified herein. The embodiments as specified for the nanoparticle of the invention similarly apply to this aspect. Preferably the sequence-defined T-shape lipo-oligomer is used as carrier for Cas protein/gRNA ribonucleoprotein (RNP) complex delivery as in the nanoparticles comprising one more Cas protein/gRNA RNP complex(es) as cargo according to the invention. However, the sequence-defined T-shape lipo-oligomer may also be used as carrier for delivery of nucleic acids, such as siRNA or phosphorodiamidate morpholino oligomers (PMO). The sequence-defined T-shape lipo-oligomer as carrier may form nanoparticles with the nucleic acid, such as siRNA or PMO, for delivery. Alternatively, the sequence-defined T-shape lipo-oligomer as carrier may be covalently linked to the PMO, preferably to the 5’- or 3’-end of the PMO. Preferably the sequence-defined T-shape lipo- oligomer as carrier covalently linked to the PMO comprises the sequence of formula I and/or the artificial amino acid is selected from Stp, chGtp, dGtp or TFEIDAtp. The fatty acid is preferably OleA or LinA. The sequence-defined T-shape lipo-oligomer [63] The sequence-defined T-shape lipo-oligomer of formula I or III of the nanoparticle according to the invention is T-shaped with an oligomer comprising the artificial amino acid as the horizontal bar (headgroup) and two fatty acids forming the vertical (hydrophobic) tail. The sequence-defined T-shape lipo-oligomer comprises a central lysine (Kc) as branching point, with a further lysine linked to the ε- amino group of Kc, which provides a further branching point to the covalently linked fatty acids ([FA]2). The sequence-defined T-shape lipo-oligomer is preferably essentially symmetrical, more preferably it is symmetrical in sequence. This means the N-terminal and the C-terminal sequence of the headgroup is symmetrical referred to the central lysine (Kc), e.g., Y3-X1-Kc[Kf[FA]2]-X1-Y3 (SEQ ID NO: 10) or Y3- H-X1-H-Kc[Kf[FA]2]-H-X1-H-Y3 (SEQ ID NO: 8). The sequence-defined T-shape lipo-oligomer of formula I or III of the nanoparticle according to the invention may further comprise a glycine between Kc and Kf. Such an additional glycine is functionally inert. It therefore serves as a short spacer and has been added into some lipo-oligomers in the past to simplify synthesis. [64] In certain embodiments the T-shape lipo-oligomer comprises the sequence of formula I wherein C is cysteine and n = 0 or 1, preferably n = 0; Y3 is a tyrosine tripeptide; and H is histidine and n(outer) and n(inner) are 1. In certain other embodiments the T-shape lipo-oligomer comprises the sequence of formula I wherein C is cysteine and n = 0; Y3 is a tyrosine tripeptide; and H is histidine and n(outer) and n(inner) are 0. [65] Formula I comprises (a) a central lysine; (b) two tyrosine tripeptides (YYY or Y3), one tyrosine tripeptide at either side of the central lysine (Kc) and at the same distance to the central lysine; (c) two oligo(alkylamino) acids (X1), one X1 at either side of the central lysine (Kc) and at the same distance to the central lysine, wherein the oligo(alkylamino) acid has the formula IIa as disclosed herein; (d) a 118371P1272PC further lysine (Kf) linked to the ε-amino group of the central lysine (Kc); and (e) two fatty acids (FA) covalently linked to the ε- and α-amino group of a further lysine (Kf). Thus, the central lysine (Kc) serves as a branching point between the headgroup and the hydrophobic tail and the further lysine (Kf) serves as a branching point for the covalent linkage of the two fatty acids (FA). The sequence-defined T- shape lipo-oligomers contain a single artificial amino acid at either side of the central lysine, wherein the artificial amino acid is an oligo(alkylamino) acid. Due to the symmetry of the T-shape lipo-oligomer the artificial amino acid on opposite side of Kc is the same. The tyrosine tripeptides at either side of the central lysine represent a hydrophobic motif. This sequence provides a more hydrophobic lipo- oligomer and may allow for decreasing size of the sequence-defined T shape lipo-oligomer, without losing stability. Thus, in certain embodiments the T-shape lipo-oligomer comprises the sequence of Y3-X1-Kc[Kf[FA]2]-X1-Y3 (SEQ ID NO: 10). [66] The T-shape lipo-oligomer comprising the sequence of formula I according to the invention may further comprise no, one or two histidine(s) (n = 0, 1 or 2) (a) between the central lysine (Kc) and the oligo(alkylamino) acid (X1) on either side of the central lysine (n(inner) = 0, 1, 2); and/or (b) between the oligo(alkylamino) acid (X1) and the tyrosine tripeptide (Y3) on either side of the central lysine (Kc) (n(outer) = 0, 1 or 2), wherein n(inner) and n(outer) may be independently 0, 1 or 2, preferably 0 or 1. Without being bound by theory, histidines or other imidazole derivatives with a pKa of around 6 have been incorporated into oligomers as they increase their endosomal buffer capacity, which may result in improved endosomal escape and delivery. [67] In certain embodiments, n(inner) and/or n(outer) are 0, n(inner) and/or n(outer) are 1, n(inner) and/or n(outer) are 2, n(inner) is 0 and n(outer) is 1, n(inner) is 1 and n(outer) is 0, n(inner) and n(outer) are 0, n(inner) and n(outer) are 1, or n(inner) and n(outer) are 2; preferably n(inner) and n(outer) are 0, n(inner) and n(outer) are 1, or n(inner) and n(outer) are 2; more preferably n(inner) and n(outer) are 0, or n(inner) and n(outer) are 1. In certain embodiments the T-shape lipo-oligomer comprises a sequence selected from the group consisting of: Y3-Hn(outer)-X1-Hn(inner)-Kc[Kf[FA]2]-Hn(inner)-X1-Hn(outer)-Y3 (SEQ ID NO: 4), Y3-H-H-X1-H-H-Kc[Kf[FA]2]-H-H-X1-H-H-Y3 (SEQ ID NO: 6), Y3-H-X1-H-Kc[Kf[FA]2]-H-X1-H-Y3 (SEQ ID NO: 8), and Y3-X1-Kc[Kf[FA]2]-X1-Y3 (SEQ ID NO: 10). [68] Further, cysteine (C) in formula I may be present (n = 1) or absent (n = 0). According to formula I cysteine is either present at the N-terminal and the C-terminal end or is absent from both ends. In a preferred embodiment cysteine is not present (n = 0). Cysteine may help to stabilize the nanoparticle by formation of disulfide bonds. Particularly for less stable sequence-defined oligomers cysteines may be important. As demonstrated in the examples, the presence of cysteine is not required in small hydrophobically stabilized sequence-defined T-shape lipo-oligomers. In certain embodiments the sequence-defined T-shape lipo-oligomer comprises a sequence selected from the group consisting of: C-Y3-Hn(outer)-X1-Hn(inner)-Kc[Kf[FA]2]-Hn(inner)-X1-Hn(outer)-Y3-C (SEQ ID NO: 3), Y3-Hn(outer)-X1-Hn(inner)-Kc[Kf[FA]2]-Hn(inner)-X1-Hn(outer)-Y3 (SEQ ID NO: 4), C-Y3-H-H-X1-H-H-Kc[Kf[FA]2]-H-H-X1-H-H-Y3-C (SEQ ID NO: 5), 118371P1272PC Y3-H-H-X1-H-H-Kc[Kf[FA]2]-H-H-X1-H-H-Y3 (SEQ ID NO: 6), C-Y3-H-X1-H-Kc[Kf[FA]2]-H-X1-H-Y3-C (SEQ ID NO: 7); Y3-H-X1-H-Kc[Kf[FA]2]-H-X1-H-Y3 (SEQ ID NO: 8); C-Y3-X1-Kc[Kf[FA]2]-X1-Y3-C (SEQ ID NO: 9); and Y3-X1-Kc[Kf[FA]2]-X1-Y3 (SEQ ID NO: 10). [69] The sequence-defined T-shape lipo-oligomer comprising the sequence of formula I as disclosed herein may further comprise a terminal functional group at the N-terminus or the C-terminus of the sequence-defined T-shape lipo-oligomer, wherein the functional group is (i) an azido group, such as an azido-hexanoic acid or an azido-lysine, or (ii) a thiol group provided that the sequence of formula I does not comprise a cysteine (i.e., in formula I, n = 0 for Cn). The functional group is, e.g., for coupling a targeting ligand. The functional group may further be used for coupling cargo, such as PMOs. The functional group (azido group or thiol group) may be N-terminally or C-terminally, preferably the functional group is N-terminally. Thus, the sequence-defined T-shape lipo-oligomer comprising the sequence of formula I may comprise a terminal azido group, such as an azido-hexanoic acid or an azido-lysine, preferably an azido-lysine. The azido group may be N-terminally or C-terminally, preferably the azido group is N-terminally. Although a single terminal azido group is sufficient, theoretically the sequence-defined T-shape lipo-oligomer may also comprise an azido group at the N- terminal and/or the C-terminal. In certain embodiments the azido-lysine (K(N3)) comprising sequence- defined T-shape lipo-oligomer comprises a sequence selected from the group consisting of: K(N3)-C-Y3-Hn(outer)-X1-Hn(inner)-Kc[Kf[FA]2]-Hn(inner)-X1-Hn(outer)-Y3-C (SEQ ID NO: 11), K(N3)-Y3-Hn(outer)-X1-Hn(inner)-Kc[Kf[FA]2]-Hn(inner)-X1-Hn(outer)-Y3 (SEQ ID NO: 12), K(N3)-C-Y3-H-H-X1-H-H-Kc[Kf[FA]2]-H-H-X1-H-H-Y3-C (SEQ ID NO: 13), K(N3)-Y3-H-H-X1-H-H-Kc[Kf[FA]2]-H-H-X1-H-H-Y3 (SEQ ID NO: 14), K(N3)-C-Y3-H-X1-H-Kc[Kf[FA]2]-H-X1-H-Y3-C (SEQ ID NO: 15); K(N3)-Y3-H-X1-H-Kc[Kf[FA]2]-H-X1-H-Y3 (SEQ ID NO: 16); K(N3)-C-Y3-X1-Kc[Kf[FA]2]-X1-Y3-C (SEQ ID NO: 17); K(N3)-Y3-X1-Kc[Kf[FA]2]-X1-Y3 (SEQ ID NO: 18); C-Y3-Hn(outer)-X1-Hn(inner)-Kc[Kf[FA]2]-Hn(inner)-X1-Hn(outer)-Y3-C-K(N3) (SEQ ID NO: 19), Y3-Hn(outer)-X1-Hn(inner)-Kc[Kf[FA]2]-Hn(inner)-X1-Hn(outer)-Y3-K(N3) (SEQ ID NO: 20), C-Y3-H-H-X1-H-H-Kc[Kf[FA]2]-H-H-X1-H-H-Y3-C-K(N3) (SEQ ID NO: 21), Y3-H-H-X1-H-H-Kc[Kf[FA]2]-H-H-X1-H-H-Y3-K(N3) (SEQ ID NO: 22), C-Y3-H-X1-H-Kc[Kf[FA]2]-H-X1-H-Y3-C-K(N3) (SEQ ID NO: 23); Y3-H-X1-H-Kc[Kf[FA]2]-H-X1-H-Y3-K(N3) (SEQ ID NO: 24); C-Y3-X1-Kc[Kf[FA]2]-X1-Y3-C-K(N3) (SEQ ID NO: 25); and Y3-X1-Kc[Kf[FA]2]-X1-Y3-K(N3) (SEQ ID NO: 26). Alternatively, the sequence-defined T-shape lipo-oligomer comprising the sequence of formula I may comprise a terminal thiol group (a single terminal thiol group), provided that that the sequence of formula I does not comprise a cysteine (i.e., in formula I n = 0 for Cn). Thus, the sequence-defined T- shape lipo-oligomer comprises a single terminal thiol group. This single terminal thiol group may be 118371P1272PC N-terminally or C-terminally, preferably the thiol group is N-terminally. Preferably the thiol group is a cysteine and the sequence-defined T-shape lipo-oligomer comprises a single cysteine at the N- terminus or the C-terminus. Thus, if the cysteine is used for coupling a targeting ligand only a single terminal cysteine should be present. In certain embodiments the single cysteine comprising sequence- defined T-shape lipo-oligomer comprises a sequence selected from the group consisting of: C-Y3-Hn(outer)-X1-Hn(inner)-Kc[Kf[FA]2]-Hn(inner)-X1-Hn(outer)-Y3 (SEQ ID NO: 27), Y3-Hn(outer)-X1-Hn(inner)-Kc[Kf[FA]2]-Hn(inner)-X1-Hn(outer)-Y3-C (SEQ ID NO: 28), C-Y3-H-H-X1-H-H-Kc[Kf[FA]2]-H-H-X1-H-H-Y3 (SEQ ID NO: 29), Y3-H-H-X1-H-H-Kc[Kf[FA]2]-H-H-X1-H-H-Y3-C (SEQ ID NO: 30), C-Y3-H-X1-H-Kc[Kf[FA]2]-H-X1-H-Y3 (SEQ ID NO: 31); Y3-H-X1-H-Kc[Kf[FA]2]-H-X1-H-Y3-C (SEQ ID NO: 32); C-Y3-X1-Kc[Kf[FA]2]-X1-Y3 (SEQ ID NO: 33); and Y3-X1-Kc[Kf[FA]2]-X1-Y3-C (SEQ ID NO: 34). [70] In certain embodiments the T-shape lipo-oligomer comprises the sequence of formula III wherein C is cysteine and n = 0 or 1, preferably n = 1; Y3 is a tyrosine tripeptide; and H is histidine and n(outer) and n(inner) are 1. In certain other embodiments the T-shape lipo-oligomer comprises the sequence of formula III wherein C is cysteine and n = 1; Y3 is a tyrosine tripeptide; and H is histidine and n(outer) and n(inner) are 0. [71] Formula III comprises (a) a central lysine; (b) two tyrosine tripeptides (YYY or Y3), one tyrosine tripeptide at either side of the central lysine (Kc) and at the same distance to the central lysine; (c) two oligo(alkylamino) acids (X2) at either side of the central lysine (Kc) and at the same distance to the central lysine, wherein the oligo(alkylamino) acid has the formula IIa as disclosed herein for formula III; (d) a further lysine (Kf) linked to the ε-amino group of the central lysine (Kc); and (e) two fatty acids (FA) covalently linked to the ε- and α-amino group of a further lysine (Kf). Thus, the central lysine (Kc) serves as a branching point between the headgroup and the hydrophobic tail and the further lysine (Kf) serves as a branching point for the covalent linkage of the two fatty acids (FA). The sequence- defined T-shape lipo-oligomers contain either (a) two consecutive artificial amino acid at either side of the central lysine, wherein the artificial amino acid is an oligo(alkylamino) acid in the absence of Hn(inner) (H is histidine and n(inner) or n(outer) and n(inner) are absent (n=0)), or (b) two artificial amino acids separated by a histidine (H) at either side of the central lysine in the presence of Hn(inner) (H is histidine and n(inner) or n(outer) and n(inner) are present (n=1)). The two artificial amino acids (X2) on the same side of Kc may be the same or different, preferably the two artificial amino acids (X2) on the same side of Kc are the same. Due to the symmetry of the T-shape lipo-oligomer the artificial amino acids on opposite side of Kc are the same. The tyrosine tripeptides at either side of the central lysine represent a hydrophobic motif. The more hydrophobic artificial amino acids used in formula III may allow for decreasing size of the sequence-defined T shape lipo-oligomer, without losing stability. Thus, in certain embodiments the T-shape lipo-oligomer comprises the sequence of Y3-X22-Kc[Kf[FA]2]-X22-Y3 (SEQ ID NO: 40). 118371P1272PC [72] The T-shape lipo-oligomer comprising the sequence of formula III according to the invention may further comprise no or one histidine (n = 0 or 1) (a) between the central lysine (Kc) and each of the two oligo(alkylamino) acids (X2) on either side of the central lysine (n(inner) = 0 or 1); and/or (b) between the outer oligo(alkylamino) acid (X2) and the tyrosine tripeptide (Y3) on either side of the central lysine (Kc) (n(outer) = 0 or 1), wherein n(inner) and n(outer) may be independently 0 or 1. Preferably n(inner) and n(outer) are the same, both either absent or present (n(inner) and n(outer) = 0 or 1), more preferably n(inner) and n(outer) are both absent (n(inner) and n(outer) = 0). Without being bound by theory, histidines or other imidazole derivatives with a pKa of around 6 have been incorporated into oligomers as they increase their endosomal buffer capacity, which may result in improved endosomal escape and delivery. [73] In certain embodiments, n(inner) and/or n(outer) are 0, n(inner) and/or n(outer) are 1, n(inner) is 0 and n(outer) is 1, n(inner) is 1 and n(outer) is 0, n(inner) and n(outer) are 0, n(inner) and n(outer) are 1; preferably n(inner) and n(outer) are 0 or n(inner) and n(outer) are 1; more preferably n(inner) and n(outer) are 0. In certain embodiments the T-shape lipo-oligomer comprises a sequence selected from the group consisting of: Y3-Hn(outer)-[X2-Hn(inner)]2-Kc[Kf[FA]2]-[Hn(inner)-X2]2-Hn(outer)-Y3 (SEQ ID NO: 36), Y3-H-X2-H-X2-H-Kc[Kf[FA]2]-H-X2-H-X2-H-Y3 (SEQ ID NO: 38), and Y3-X22-Kc[Kf[FA]2]-X22-Y3 (SEQ ID NO: 40). [74] Further, cysteine (C) in formula III may be present (n = 1) or absent (n = 0), preferably cysteine is present. According to formula I cysteine is either present at the N-terminal and the C-terminal end or is absent from both ends. In a preferred embodiment cysteine is not present (n = 0). Cysteine may help to stabilize the nanoparticle by formation of disulfide bonds. Particularly for less stable sequence- defined oligomers cysteines may be important. As demonstrated in the examples, the presence of cysteine is not required in small hydrophobically stabilized sequence-defined T-shape lipo-oligomers and may further not be necessary when using more hydrophobic artificial amino acids. In certain embodiments the sequence-defined T-shape lipo-oligomer comprises a sequence of formula III selected from the group consisting of: C-Y3-Hn(outer)-[X2-Hn(inner)]2-Kc[Kf[FA]2]-[Hn(inner)-X2]2-Hn(outer)-Y3-C (SEQ ID NO: 35), Y3-Hn(outer)-[X2-Hn(inner)]2-Kc[Kf[FA]2]-[Hn(inner)-X2]2-Hn(outer)-Y3 (SEQ ID NO: 36), C-Y3-H-X2-H-X2-H-Kc[Kf[FA]2]-H-X2-H-X2-H-Y3-C (SEQ ID NO: 37); Y3-H-X2-H-X2-H-Kc[Kf[FA]2]-H-X2-H-X2-H-Y3 (SEQ ID NO: 38); C-Y3-X22-Kc[Kf[FA]2]-X22-Y3-C (SEQ ID NO: 39); and Y3-X22-Kc[Kf[FA]2]-X22-Y3 (SEQ ID NO: 40). [75] The sequence-defined T-shape lipo-oligomer comprising the sequence of formula III as disclosed herein may further comprise a terminal functional group at the N-terminus or the C-terminus of the sequence-defined T-shape lipo-oligomer, wherein the functional group is (i) an azido group, such as an azido-hexanoic acid or an azido-lysine, or (ii) a thiol group provided that the sequence of formula III does not comprise a cysteine (i.e., in formula III, n = 0 for Cn). The functional group is, e.g., for coupling a targeting ligand. The functional group may further be used for coupling cargo, such as PMOs. The functional group (azido group or thiol group) may be N-terminally or C-terminally, 118371P1272PC preferably the functional group is N-terminally. Thus, the sequence-defined T-shape lipo-oligomer comprising the sequence of formula III may comprise a terminal azido group, such as an azido- hexanoic acid or an azido-lysine, preferably an azido-lysine. The azido group may be N-terminally or C-terminally, preferably the azido group is N-terminally. Although a single terminal azido group is sufficient, theoretically the sequence-defined T-shape lipo-oligomer may also comprise an azido group at the N-terminal and/or the C-terminal. In certain embodiments the azido-lysine (K(N3)) comprising sequence-defined T-shape lipo-oligomer comprises a sequence of formula III selected from the group consisting of: K(N3)-C-Y3-Hn(outer)-[X2-Hn(inner)]2-Kc[Kf[FA]2]-[Hn(inner)-X2]2-Hn(outer)-Y3-C (SEQ ID NO: 41), K(N3)-Y3-Hn(outer)-[X2-Hn(inner)]2-Kc[Kf[FA]2]-[Hn(inner)-X2]2-Hn(outer)-Y3 (SEQ ID NO: 42), K(N3)-C-Y3-H-X2-H-X2-H-Kc[Kf[FA]2]-H-X2-H-X2-H-Y3-C (SEQ ID NO: 43); K(N3)-Y3-H-X2-H-X2-H-Kc[Kf[FA]2]-H-X2-H-X2-H-Y3 (SEQ ID NO: 44); K(N3)-C-Y3-X22-Kc[Kf[FA]2]-X22-Y3-C (SEQ ID NO: 45); K(N3)-Y3-X22-Kc[Kf[FA]2]-X22-Y3 (SEQ ID NO: 46); C-Y3-Hn(outer)-[X2-Hn(inner)]2-Kc[Kf[FA]2]-[Hn(inner)-X2]2-Hn(outer)-Y3-C-K(N3) (SEQ ID NO: 47), Y3-Hn(outer)-[X2-Hn(inner)]2-Kc[Kf[FA]2]-[Hn(inner)-X2]2-Hn(outer)-Y3-K(N3) (SEQ ID NO: 48), C-Y3-H-X2-H-X2-H-Kc[Kf[FA]2]-H-X2-H-X2-H-Y3-C-K(N3) (SEQ ID NO: 49); Y3-H-X2-H-X2-H-Kc[Kf[FA]2]-H-X2-H-X2-H-Y3-K(N3) (SEQ ID NO: 50); C-Y3-X22-Kc[Kf[FA]2]-X22-Y3-C-K(N3) (SEQ ID NO: 51); and Y3-X22-Kc[Kf[FA]2]-X22-Y3-K(N3) (SEQ ID NO: 52). Alternatively, the sequence-defined T-shape lipo-oligomer comprising the sequence of formula III may comprise a terminal thiol group (a single terminal thiol group), provided that that the sequence of formula III does not comprise a cysteine (i.e., in formula I n = 0 for Cn). Thus, the sequence-defined T-shape lipo-oligomer comprises a single terminal thiol group. This single terminal thiol group may be N-terminally or C-terminally, preferably the thiol group is N-terminally. Preferably the thiol group is a cysteine and the sequence-defined T-shape lipo-oligomer comprises a single cysteine at the N- terminus or the C-terminus. Thus, if the cysteine is used for coupling a targeting ligand only a single terminal cysteine should be present. In certain embodiments the single cysteine comprising sequence- defined T-shape lipo-oligomer comprises a sequence selected from the group consisting of: C-Y3-Hn(outer)-[X2-Hn(inner)]2-Kc[Kf[FA]2]-[Hn(inner)-X2]2-Hn(outer)-Y3 (SEQ ID NO: 53), Y3-Hn(outer)-[X2-Hn(inner)]2-Kc[Kf[FA]2]-[Hn(inner)-X2]2-Hn(outer)-Y3-C (SEQ ID NO: 54), C-Y3-H-X2-H-X2-H-Kc[Kf[FA]2]-H-X2-H-X2-H-Y3 (SEQ ID NO: 55); Y3-H-X2-H-X2-H-Kc[Kf[FA]2]-H-X2-H-X2-H-Y3-C (SEQ ID NO: 56); C-Y3-X22-Kc[Kf[FA]2]-X22-Y3 (SEQ ID NO: 57); and Y3-X22-Kc[Kf[FA]2]-X22-Y3-C (SEQ ID NO: 58). [76] A terminal azido group or a single terminal thiol group allows coupling of, e.g., a targeting ligand using click chemistry or using thiol conjugation, respectively. The functional group may further be used for coupling cargo, such as PMOs. Thus, in certain embodiments the sequence-defined T-shape lipo- oligomer comprises a sequence of formula I further comprising a terminal azido group, such as a 118371P1272PC terminal azido-lysine or azido-hexanoic acid and a targeting ligand is coupled to the azido-lysine or azido-hexanoic acid. Preferably the terminal azido group is a terminal azido-lysine. More preferably the targeting ligand is coupled to the azido-group via click chemistry, more preferably click chemistry with a dibenzocylooctyne-coupled targeting ligand. Click chemistry is a general term for highly specific, in many cases biorthogonal, covalent conjugation reactions, that are modular, efficient and relatively insensitive to solvent parameters, water and oxygen. Various click chemistry reactions are known in the art and the person skilled in the art would know how to select a specific click chemistry reaction for a certain conjugation and particular for a certain protein or oligomer, such as the sequence-defined T-shape lipo-oligomer. Typical click reactions, without being limited thereto, are copper-catalyzed azide-alkylene cycloaddition (CuAAC) (copper-catalyzed reaction of an azide with an alkyne), copper- free azide-alkyne cycloaddition, such as strain-promoted azide-alkyne cycloaddition (SPAAC), Diels- Alder or inverse electron Diels-Alder reaction, and alkene-tetrazole photoclick reaction. Alternatively, a single terminal cysteine may be used for coupling via disulfide bond formation, thiol-maleimide or other thiol click reaction, and preferably a targeting ligand is coupled to the cysteine. [77] The targeting ligand may be a ligand that binds to a receptor resulting in receptor-mediated endocytosis (also referred to as receptor-mediated internalization). This may be a natural ligand or an artificial ligand, such as an antibody, a fusion protein or a small molecule binding to a receptor and mediating uptake. Coupling a targeting ligand to the carrier of the nanoparticles of the invention allows targeted delivery and hence receptor or even cell specific delivery. For example, by incorporating an azido functional group into the sequence-defined oligomer the nanoparticle can be converted to a receptor-targeted nanoparticle, e.g, via copper-free click chemistry with dibenzocyclooctyne (DBCO)- containing targeting ligands, such as folic acid (FolA)-PEG as targeting ligand for folate receptor α (FRα)-specific delivery. Alternatively, a single terminal thiol group in combination with thiol chemistry may be used for coupling targeting ligands, such as folic acid (FolA)-PEG as targeting ligand for folate receptor α (FRα)-specific delivery. For example, targeting ligands such as B6, cRGD, folic acid, methotrexate (MTX), c-Met-binding peptide (cMBP2), transferrin (Tf), AP-1, EGF, EGF receptor- binding peptide (GE11) and IL-6 receptor binding I6P7 peptide may be used. Other suitable receptors for receptor-mediated internalization and specific delivery may, e.g., be tumor antigens and the like. [78] The two fatty acids in the sequence-defined T-shape lipo-oligomer ([FA]2 in formula I) may be the same or different, preferably the two fatty acids are the same fatty acid. In certain embodiments, the two fatty acids are saturated or unsaturated C12 to C22 fatty acids, preferably the two fatty acids are linear (non-branched) saturated or unsaturated C12 or C22 fatty acids, more preferably unsaturated C14 to C20 fatty acids or saturated C12 to C18 fatty acids, more preferably unsaturated C16 to C20 fatty acids or saturated C12 to C14 fatty acids, more preferably unsaturated C18 fatty acids. In certain embodiments, the two fatty acids are selected from the group consisting of oleic acid (OleA), linoleic acid (LinA), linolenic acid (LenA) or hydroxy steric acid (OHSteA), preferably OleA, LinA or OHSteA, more preferably LinA or OHSteA In certain specific embodiments the sequence defined T-shape lipo-oligomer comprises the sequence of formula I, wherein FA is LinA, more specifically wherein (i) H is histidine and n(outer) and n(inner) are both 1 or 0; and (ii) C is cysteine and n = 0; and (iii) FA is LinA, optionally the sequence defined T-shape lipo-oligomer comprises a 118371P1272PC terminal functional group selected from an azido group and a thiol group (single thiol group). In certain other specific embodiments, the sequence defined T-shape lipo-oligomer comprises the sequence of formula III, wherein FA is OHSteA, more specifically wherein (i) H is histidine and n(outer) and n(inner) are both 1 or 0; and (ii) C is cysteine and n = 1; and (iii) FA is OHSteA, optionally the sequence defined T-shape lipo-oligomer comprises a terminal azido group. The artificial amino acid of the sequence-defined T-shape lipo-oligomer [79] The sequence defined T-shape lipo-oligomer of formula I of the nanoparticle according to the invention comprises two artificial amino acids as building-block, wherein the artificial amino acid is an oligo(alkylamino) acid (X1), one oligo(alkylamino) acid (X1) at either side of the central lysine (Kc) and at the same distance to the central lysine. Thus, X1 in formula I represents a single artificial amino acid that is an oligo(alkylamino) acid in contrast to X2 (e.g., in sequence 1445) or [X2-Hn(inner)]2 and [Hn(inner)- X2]2 as in the T-shape lipo-oligomer of formula III. X22 represents two consecutive artificial amino acids (X22, e.g., in sequence #1445) at either side of the central lysine, wherein the artificial amino acid is an oligo(alkylamino) acid. In these cases Hn(inner) of formula III is absent (H is histidine and n(inner) or n(outer) and n(inner) are absent (n=0)). [X2-Hn(inner)]2 and [Hn(inner)-X2]2 represents two artificial amino acids separated by a histidine (H) and followed or preceded, respectively, at either side of the central lysine. In these cases Hn(inner) is present (H is histidine and n(inner) or n(outer) and n(inner) are present (n=1)). The two artificial amino acids (X2) on the same side of Kc may be the same or different, preferably the two artificial amino acids (X2) on the same side of Kc are the same. Due to the symmetry of the T-shape lipo-oligomer the artificial amino acids on opposite side of Kc are the same. The oligo(alkylamino) acid is linked via its C-terminal carboxylic group and its N-terminal primary amino group. The artificial amino acid of the sequence-defined T-shape lipo-oligomer of formula I according to the present invention is an oligo(alkylamino) acid (X1) of formula IIa: H(HN-(CH2)n)m-NH-CO-R (Formula IIa) wherein n = 2 or 3, alternating 2 and 3 or alternating 3 and 2; and m = 3 or 4; and wherein R is -(CH2)y-CO2H, wherein y = 2, 3 or 4; , wherein z = 0 or 1, preferably , more preferably -CH2-CH(c-hexyl)-CH2-CO2H; or -CH2-NR-CH2-CO2H, wherein R = H, CH2-CF3. The artificial amino acids in the sequence-defined T-shape lipo-oligomer of formula III according to the present invention are two oligo(alkylamino) acids (X2) of formula IIa: H(HN-(CH2)n)m-NH-CO-R (Formula Iia) 118371P1272PC wherein n = 2 or 3, alternating 2 and 3 or alternating 3 and 2; and m = 3 or 4; wherein R is -(CH2)y-CO2H, wherein y = 3 or 4; , wherein z = 0 or 1, preferably , more preferably ; -CH2-CH(c-hexyl)-CH2-CO2H; or -CH2-NR-CH2-CO2H, wherein R = CH2-CF3. [80] The oligo(alkylamino) acid (X1 and X2) of formula IIa contains 3 or 4 (m = 3 or 4) protonatable alkylamino repeats, particularly 3 or 4 repeats of protonatable amino ethylene (HN-(CH2)2; i.e., n = 2) or amino propylene motifs (HN-(CH2)3; i.e., n = 3) or alternating amino ethylene and amino propylene motifs (n = 2 and 3, preferably alternating) or vice versa. In certain embodiments n is 2, 2, 2 (for m = 3) or 2, 2, 2, 2 (for m = 4), or n is 3, 3, 3 (for m = 3) or 3, 3, 3, 3 (for m = 4), or n is 2, 3, 2 (for m = 3) or 2, 3, 2, 3 (for m = 4), or n is 3, 2, 3 (for m = 3) or 3, 2, 3, 2 (for m = 4). [81] According to the invention, the oligo(alkylamino) acid (of formula I and III) may be a tetraethylenepentamine or a triethylenetetramine of formula IIb: H(HN-(CH2)2)m=3 or 4-NH-CO-R Formula Iib; preferably a tetraethylenepentamine of formula IIc: H(HN-(CH2)2)4-NH-CO-R Formula Iic. In certain embodiments, the oligo(alkylamino) acid (of formula I or III) is selected from the group consisting of the following formulas: H(HN-(CH2)2)3-NH-CO-R, H(HN-(CH2)2)4-NH-CO-R, H(HN-(CH2)3)3-NH-CO-R, H(HN-(CH2)3)4-NH-CO-R, H(HN-(CH2)2-NH-(CH2)3-NH-(CH2)2-NH-CO-R, H(HN-(CH2)2-NH-(CH2)3-NH-(CH2)2-NH-(CH2)3NH-CO-R, H(HN-(CH2)3-NH-(CH2)2-NH-(CH2)3-NH-CO-R, and H(HN-(CH2)3-NH-(CH2)2-NH-(CH2)3-NH-(CH2)2NH-CO-R, wherein R is as defined for formula IIa of formula I or III. [82] In the context of formula I (comprising X1), residue R according to formula II may be -(CH2)y-CO2H, wherein y = 2, 3 or 4; preferably 3 or 4 118371P1272PC , wherein z = 0 or 1, preferably , more preferably ; -CH2-CH(c-hexyl)-CH2-CO2H; or -CH2-NRa-CH2-CO2H, wherein Ra = H or CH2-CF3. In a preferred embodiment the oligo(alkylamino) acid comprises a cyclohexyl group, for example R is -CH2-CH(c-hexyl)-CH2-CO2H; oligo(alkylamino) acids of formula IIa for the nanoparticle according to the invention comprising the T- shape lipo-oligomers comprising the sequence of formula I are, without being limited thereto, succinyl- tetraethylenepentamine (Stp), cyclohexanedicarboxyl-tetraethylenepentamine (Htp), phthalyl- tetraethylenepentamine (Ptp), naphthalenedicarboxyl-tetraethylenepentamine (Ntp), glutaryl- tetraethylenepentamine (Gtp), 1,1-cyclohexanediacetyl-tetraethylenepentamine (chGtp), iminodiacetyl-tetraethylenepentamine (IDAtp), trifluoroethyl-iminodiacetyl-tetraethylenepentamine (TFE-IDAtp), glutaryl-triethylenetetramine (Gtt), or glutaryl-N,N′-bis-(3-aminopropyl)-ethylenediamine (GEIPA) having the formula as shown below: 118371P1272PC . Preferably the oligo(alkylamino) acid is selected from the group consisting of Stp, Htp, Gtp, chGtp, TFE-IDAtp, Gtt and GEIPA, more preferably Htp, Gtp, chGtp and TFE-IDAtp. [83] In the context of formula III (comprising X22 or [X2-Hn(inner)]2 and [Hn(inner)-X2]2), the residue R according to formula IIa may be -(CH2)y-CO2H, wherein y = 3 or 4; preferably 3 or 4 , wherein z = 0 or 1, preferably , more preferably ; -CH2-CH(c-hexyl)-CH2-CO2H; or -CH2-NRa-CH2-CO2H, wherein Ra = CH2-CF3. In a preferred embodiment the oligo(alkylamino) acid comprises a cyclohexyl group, for example R is of formula IIa for the nanoparticle according to the invention comprising formula III are, without being limited thereto, chGtp, Htp, TFE-IDAtp, Gtt or GEIPA. Preferably the oligo(alkylamino) acid is TFE- IDAtp or Gtt. [84] An optimal sequence-defined lipo-oligomer for nanoparticle packaging and delivery depends on the cargo. For example, RNA tends to require stabilization, which may be achieved with the overall longer sequences and long fatty acids of the T-shape lipo-oligomers (head group), while DNA packaging generally is less problematic and rather cargo release inside cells can be critical, which may be achieved with shorter fatty acids and overall shorter sequences of the T-shape lipo-oligomers (headgroup). Overall, the right balance of stabilization and destabilization needs to be identified for each cargo. However, this is not trivial or predictable and sequence-defined lipo-oligomers need to be empirically tested for each cargo, and other aspects further play a role. Critical bottle-necks within the 118371P1272PC delivery pathway of the CRISPR/Cas system are the cellular uptake, endosomal release and nuclear entry. The T-shape lipo-oligomers of the nanoparticles according to the invention are particularly hydrophobic and it has been shown that more hydrophobic lipo-oligomers are advantageous for Cas protein/gRNA RNP complex delivery. It has been surprising that the short lipo-oligomers (comprising only one artificial amino acid on each site of the branching point, i.e., the central lysine) are sufficient to stabilize RNPs. Without being bound by theory, this may be due to the overall high hydrophobicity, stabilizing the nanoparticles formed with the RNP complexes. While some of the artificial amino acids used in the nanoparticles according to the invention have been used previously, they have been generated to provide basic properties, while a tuned or increased hydrophobicity of artificial amino acids has not been recognized as being an important parameter in this context. Ribonucleoproteins as cargo [85] The nanoparticle according to the invention in certain embodiments comprises one or more Cas protein/gRNA RNP complexes as cargo. Without being limited thereto, suitable Cas protein/gRNA ratios are about 1:1 to about 1:2. Moreover, the Cas protein/gRNA RNP complex and the sequence- defined T-shape lipo-oligomer are preferably mixed at a lipo-oligomer nitrogen (N) to nucleic acid phosphate (P) (gRNA or gRNA and donor DNA) ratio (N/P ratio) of about 1:12 to 1:30, preferably of about 1:12 to 1:26. The person skilled in the art would know that only the protonatable nitrogens are considered for determining the N/P ratio. In an oligo(alkylamino) acid with five nitrogens, three are protonatable and with 4 nitrogens, two are protonatable. The nanoparticle may further comprise a donor DNA for HDR. The donor DNA may be provided as plasmid DNA, as linear double-stranded DNA or as single-stranded DNA. [86] The guide RNA (gRNA) is complementary to a target DNA locus and guides the Cas protein endonuclease to this site. The gRNA may be a CRISPR RNA (crRNA), a crRNA that pairs with trans- activating crRNAs (tracrRNA), an artificial single-guide RNA (sgRNA), an artificial prime editing guide RNA (pegRNA), a chimeric single-guide RNA (cgRNA) or other RNA molecules which form a complex with a Cas protein and guide it to the target DNA sequence. Preferably, the guide RNA is a single- guide RNA (sgRNA), an artificial RNA consisting of tracr RNA, crRNA and an artificial RNA linker. The single-guide RNA may also be a modified and/or improved sgRNAs, such as tru-gRNA (using a spacer sequence with <20 nucleotides complementary to the protospacer target) and hp-sgRNA (comprising an extension on the 5’end of the spacer). However, the person skilled in the art would know (see, e.g., Anzalone et al., Nature Biotechnology, 2020, 38: 824-844) that the type of guide RNA may depend on the intended use and on the Cas protein used. While Cas9 proteins typically used in complex with an sgRNA, many Cas12 nucleases are guided by a single crRNA. Cas12 nucleases possess just a single RuvC-like nuclease domain that mediates targeted DNA cleavage of both strands, typically staggered cuts within the region of the protospacer. [87] The Cas protein may be any CRISPR-associated endonuclease, preferably class 2 (types II, V and VI) proteins, which have single-subunit effectors. Suitable Cas proteins include, without being limited thereto, type II Cas proteins, e.g., Cas9 (such as SpCas9, SaCas9, CjCas9, StCas9 or NmeCas9); type V Cas proteins, e.g., Cas12, including without being limited thereto Cas12a, Cas12f, 118371P1272PC Cas12b, Cas12i, Cas12e and Cas12g; and type VI Cas proteins, e.g., Cas13, including without being limited thereto Cas13a, Cas13b, Cas13c and Cas13d, including engineered variants thereof (engineered Cas variants). In certain embodiments the Cas protein is selected from the group consisting of Cas9 protein, Cas 12 protein, Cas 13 protein, and engineered variants thereof, preferably the Cas protein is a Cas9 protein, a Cas 12 protein or an engineered variant thereof, more preferably the Cas protein is a Cas9 protein or an engineered variant thereof, such as a base editor or a prime editor. [88] Engineered Cas variants include, without being limited thereto, mutant and/or fusion proteins, such as variants with altered PAM compatibilities, such as less restrictive or different PAM compatibility of Cas9 or Cas12 variants; variants with higher DNA specificity, such as variants with reduced off-target Cas nuclease activity (e.g., eSpCas(1.1), SpCas9-HF1, HypaCas9, evoCas9, Sniper-Cas9, HiFiCas9, enAsCas12a-HF1); engineered Cas-domain-fused transposase and recombinase systems; base editors and prime editors. [89] Commonly used exemplary engineered variants are, for example, Cas nickase (e.g., nickase Cas9n) comprising an inactivated nuclease (e.g., HNH) and a nuclease-deficient dCas (e.g., dCas9), with impaired or no nuclease activity. [90] Cas proteins may be derived from different species, such as Streptococcus pyogenes, Staphylococcus aureus, Campylobacter jejuni, Streptococcus thermophilus or Neisseria meningitidis. For example, Cas9 orthologs include, without being limited thereto, Streptococcus pyogenes Cas9 (SpCas9), Staphylococcus aureus Cas9 (SaCas9), Campylobacter jejuni Cas9 (CjCas9), Streptococcus thermophilus Cas9 (StCas9), and Neisseria meningitidis Cas9 (NmeCas9) from. Cas orthologs may differ in the recognized PAM sequences and in size. The most often used Cas9 protein is SpCas9. [91] In certain embodiments the Cas protein is a Cas9, a Cas12, a Cas13 protein or an engineered variant thereof (also referred to as derivative thereof). In some embodiments the Cas protein is a base editor or a prime editor, preferably a Cas9 base editor or a Cas9 prime editor. [92] The Cas protein forms the Cas protein/gRNA complex, thus in certain embodiments the one or more Cas protein/gRNA RNP complex(es) is/are Cas9/gRNA RNP complex(es), preferably Cas9/sgRNA RNP complex(es), optionally further comprising a donor DNA. This includes Cas9 nucleases as well as fusion proteins thereof, such as base editors and prime editors. [93] The nanoparticle according to the invention comprises one or more Cas protein/gRNA RNP complex(es) and hence may contain more than one Cas protein/gRNA RNP complexes. In certain embodiments, the nanoparticle comprises two or more Cas protein/gRNA RNP complexes as cargo, preferably wherein the two or more Cas protein/gRNA RNP complexes comprise two or more different gRNAs targeting the same or different genes, preferably different genes. In a preferred embodiment the two or more gRNAs are two or more different sgRNAs targeting the same or different genes, preferably different genes. Typically, the two or more Cas protein/gRNA RNP complexes only differ in the gRNA (or sgRNA), while the Cas protein is the same. The nanoparticle comprising one or more Cas protein/gRNA RNP complex(es) as cargo may further comprise a donor DNA for HDR. Thus, in 118371P1272PC certain embodiments, the nanoparticle comprises one or more Cas protein/gRNA RNP complexes and a donor DNA. While the donor DNA may be co-delivered with the one or more Cas protein/gRNA RNP complex(es), it may also be delivered separately by non-viral or viral delivery, e.g., an adeno- associated viral vector, a lentiviral vector or an adenoviral vector. The T-shape lipo-oligomers having the formula C-Y3-Gtt2-K(K-(OHSteA)2)-Gtt2-Y3-C or Y3-X1-K(K-(LinA)2)-X1-Y3 (particularly Y3- TFEIDAtp-K(K-(LinA)2)-TFEIDAtp-Y3) were found to be particularly efficient in inducing homology directed repair (HDR). Oligonucleotides as cargo [94] It was surprisingly further found that the sequence-defined T-shape lipo-oligomer as described herein may be used as carrier for nucleic acid delivery, such as siRNA or phosphorodiamidate morpholino oligomers (PMO) delivery. The sequence-defined T-shape lipo-oligomer as carrier may form nanoparticles with the nucleic acid, such as siRNA or PMO, for delivery. Because PMOs are not charged, the sequence-defined T-shape lipo-oligomer as carrier are preferably covalently linked to the PMO, preferably to the 5’- or 3’-end of the PMO. Preferably, the sequence-defined T-shape lipo- oligomer as carrier covalently linked to the PMO comprises the sequence of formula I and/or the artificial amino acid is selected from Stp, chGtp, dGtp or TFEIDAtp. The fatty acid is preferably OleA or LinA. [95] Thus, in another aspect the invention relates to a nanoparticle for siRNA or phosphorodiamidate morpholino oligomers (PMO) (cargo) delivery comprising one or more siRNA(s) or PMO(s) as cargo; and a carrier comprising a sequence-defined T-shape lipo-oligomer comprising an artificial amino acid, wherein the artificial amino acid is an oligo(alkylamino) acid, and wherein the T-shape lipo-oligomer comprises the sequence of formula I: Cn-Y3-Hn(outer)-X1-Hn(inner)- Formula wherein Kc is a central lysine; Kf is a further lysine linked to the ε-amino group of Kc; FA is a fatty acid covalently linked to the ε- and α-amino group of Kf; C is cysteine and n = 0 or 1, preferably n = 0 Y3 is a tyrosine tripeptide; H is histidine and n(outer) and n(inner) are independently selected from 0, 1 or 2; and X1 is an oligo(alkylamino) acid of formula IIa: H(HN-(CH2)n)m-NH-CO-R Formula IIa wherein n = 2 or 3, alternating 2 and 3 or alternating 3 and 2; and m = 3 or 4; wherein R is 118371P1272PC -(CH2)y-CO2H, wherein y = 2, 3 or 4; -CH2-CH(c-hexyl)-CH2-CO2H; or -CH2-NRa-CH2-CO2H, wherein Ra = H, CH2-CF3; or wherein the T-shape lipo-oligomer comprises the sequence of formula III: Cn-Y3-Hn(outer)-[X2-Hn(inner)]2-Kc[Kf[FA]2]-[Hn(inner)-X2]2-Hn(outer)-Y3-Cn; Formula III (SEQ ID NO: 2) wherein Kc is a central lysine; Kf is a further lysine linked to the ε-amino group of Kc; FA is a fatty acid covalently linked to the ε- and α-amino group of Kf; C is cysteine and n = 0 or 1, preferably n = 1 Y3 is a tyrosine tripeptide; H is histidine and n(outer) and n(inner) are independently selected from 0 or, 1; and X2 is an oligo(alkylamino) acid of formula IIa: H(HN-(CH2)n)m-NH-CO-R Formula IIa wherein n = 2 or 3, alternating 2 and 3 or alternating 3 and 2; and m = 3 or 4; wherein R is -(CH2)y-CO2H, wherein y = 3 or 4; , wherein z = 0 or 1, preferably , more preferably -CH2-CH(c-hexyl)-CH2-CO2H; or -CH2-NRa-CH2-CO2H, wherein Ra = CH2-CF3. [96] In a related aspect the invention relates to a nanoparticle for siRNA or phosphorodiamidate morpholino oligomers (PMO) (cargo) delivery comprising one or more siRNA(s) or PMO(s) as cargo; and a carrier comprising a sequence-defined T-shape lipo-oligomer comprising 118371P1272PC (c) a headgroup comprising an oligomer comprising i. a central lysine (Kc), and ii. an N-terminal peptide chain and a symmetrical C-terminal peptide chain referred to the central lysine, each comprising an artificial amino acid, wherein the artificial amino acid is an oligo(alkylamino) acid; and (d) a hydrophobic tail comprising i. two fatty acids (FA) covalently linked to the ε- and α-amino group of a further lysine (Kf) ii. wherein Kf is linked to the ε-amino group of the central lysine (Kc); wherein the T-shape lipo-oligomer comprises the sequence of formula I: Cn-Y3-Hn(outer)-X1-Hn(inner)-Kc[Kf[FA]2]-Hn(inner)-X1-Hn(outer)-Y3-Cn; Formula I wherein C is cysteine and n = 0 or 1, preferably n = 0 Y3 is a tyrosine tripeptide; H is histidine and n(outer) and n(inner) are independently selected from 0, 1 or 2; and X1 is an oligo(alkylamino) acid of formula IIa: H(HN-(CH2)n)m-NH-CO-R Formula IIa wherein n = 2 or 3, alternating 2 and 3 or alternating 3 and 2; and m = 3 or 4; wherein R is -(CH2)y-CO2H, wherein y = 2, 3 or 4; -CH2-CH(c-hexyl)-CH2-CO2H; or -CH2-NR-CH2-CO2H, wherein R = H, CH2-CF3; or wherein the T-shape lipo-oligomer comprises the sequence of formula III: Cn-Y3-Hn(outer)-[X2-Hn(inner)]2-Kc[Kf[FA]2]-[Hn(inner)-X2]2-Hn(outer)-Y3-Cn; Formula III wherein C is cysteine and n = 0 or 1, preferably n = 1 Y3 is a tyrosine tripeptide; H is histidine and n(outer) and n(inner) are independently selected from 0 or 1; and X2 is an oligo(alkylamino) acid of formula IIa: 118371P1272PC H(HN-(CH2)n)m-NH-CO-R Formula IIa wherein n = 2 or 3, alternating 2 and 3 or alternating 3 and 2; and m = 3 or 4; wherein R is -(CH2)y-CO2H, wherein y = 3 or 4; -CH2-CH(c-hexyl)-CH2-CO2H; or -CH2-NRa-CH2-CO2H, wherein Ra = CH2-CF3. [97] The embodiments as specified for the nanoparticle of the invention for Cas protein/gRNA ribonucleoprotein (RNP) complex delivery, particularly the embodiments further specifying the sequence-defined T-shape lipo-oligomer as carrier and the artificial amino acid similarly apply to nanoparticles for siRNA or PMO delivery. [98] For example, the two fatty acids are saturated or unsaturated C12 to C22 fatty acids, preferably the two fatty acids are selected from the group consisting of oleic acid (OleA), linoleic acid (LinA), linolenic acid (LenA) or hydroxy steric acid (OHSteA), preferably OleA, LinA, LenA or OHSteA, more preferably OleA, LinA, or OHSteA, or even more preferably LinA or OHSteA. [99] The sequence-defined T-shape lipo-oligomer as carrier forms nanoparticles with the negatively charged siRNA for delivery. Thus, in certain embodiments, the nanoparticle is for siRNA (cargo) delivery comprising one or more siRNA(s) as cargo; and a carrier comprising a sequence-defined T- shape lipo-oligomer comprising an artificial amino acid according to the invention and as specified herein. [100] Without being limited thereto, the siRNA and the sequence-defined T-shape lipo-oligomer are preferably mixed at a lipo-oligomer nitrogen (N) to nucleic acid phosphate (P) (siRNA) ratio (N/P ratio) of about 1:12 to 1:30, preferably of about 1:12 to 1:26. The person skilled in the art would know that only the protonatable nitrogens are considered for determining the N/P ratio. In an oligo(alkylamino) acid with five nitrogens, three are protonatable and with 4 nitrogens, two are protonatable. [101] The term “small interfering RNA” or “siRNA” refers to short single or double stranded ribonucleic acid molecules of typically 20-25 base pairs in length that bind to complementary single stranded ribonucleic acid molecules, such as messenger RNA (mRNA) and suppress their function, also referred to as RNA interference (RNAi). Thus, siRNA interferes with the expression of specific genes by degrading mRNA after transcription and preventing translation. Small interfering RNA (also referred to as short interfering RNA) are non-coding RNAs, i.e., not coding for a protein. Another RNA 118371P1272PC molecules operating within the RNAi pathway is microRNA (miRNA), which further has a similar length compared to siRNA. [102] In certain embodiments, the oligo(alkylamino) acid is a tetraethylenepentamine or a triethylenetetramine of formula IIb: H(HN-(CH2)2)m = 3 or 4-NH-CO-R (Formula IIb); preferably a tetraethylenepentamine. Preferably, the T-shape lipo-oligomer comprises the sequence of formula I: Cn-Y3-Hn(outer)-X1-Hn(inner)-Kc[Kf[FA]2]-Hn(inner)-X1-Hn(outer)-Y3-Cn (Formula I); wherein C is cysteine and n = 1; Y3 is a tyrosine tripeptide; and H is histidine and n(outer) and n(inner) are 1. [103] According to formula I or III, cysteine (C) may be present (n = 1) or absent (n = 0) and is either present at the N-terminal and the C-terminal end or is absent from both ends. In a preferred embodiment the nanoparticles for siRNA delivery comprise one or more siRNA(s) as cargo and a carrier comprising a sequence-defined T-shape lipo-oligomer comprising the sequence of formula I or III, preferably of formula I, and the cysteine is present (n = 1). This is in contrast to nanoparticles for Cas protein/gRNA ribonucleoprotein (RNP) delivery, where cysteine is not required. Cysteine may help to stabilize the nanoparticle by formation of disulfide bonds, which is beneficial for siRNA delivery as demonstrated in the examples. Stability may be further improved using artificial amino acids as described herein that are more hydrophobic than Stp. Preferably, the carrier comprising a sequence- defined T-shape lipo-oligomer comprising the sequence of formula I or III, preferably of formula I, further comprises histidine and n(inner) and n(outer) are 1. In certain embodiments the sequence-defined T-shape lipo-oligomer comprises a sequence of formula I selected from the group consisting of SEQ ID NOs: 7, 8, 9 and 10, preferably SEQ ID NO: 7. [104] The sequence-defined T-shape lipo-oligomer comprising the sequence of formula I or formula III as disclosed herein, preferably formula I, may further comprise a terminal functional group at the N- terminus or the C-terminus of the sequence-defined T-shape lipo-oligomer, wherein the functional group is an azido group, such as an azido-hexanoic acid or an azido-lysine. The functional group is, e.g., for coupling a targeting ligand. The functional group (azido group) may be N-terminally or C- terminally, preferably the functional group is N-terminally. Thus, the sequence-defined T-shape lipo- oligomer comprising the sequence of formula I or III may comprise a terminal azido group, such as an azido-hexanoic acid or an azido-lysine, preferably an azido-lysine. The azido group may be N- terminally or C-terminally, preferably the azido group is N-terminally. Although a single terminal azido group is sufficient, theoretically the sequence-defined T-shape lipo-oligomer may also comprise an azido group at the N-terminal and/or the C-terminal. In certain embodiments the azido-lysine (K(N3)) comprising sequence-defined T-shape lipo-oligomer comprises a sequence of formula I or III selected from the group consisting of SEQ ID NOs: 11-26 and 41-52, preferably 15, 17, 23 and 25, even more preferably 15. [105] PMOs are uncharged and it was therefore believed that they may not require carriers for cell entry. However, suitable carriers also improve PMO delivery. For efficient nanoparticle formation PMOs are preferably covalently linked to the carrier, i.e., the sequence-defined T-shape lipo-oligomer. Thus, in certain embodiments the sequence-defined T-shape lipo-oligomer as carrier is covalently linked to the PMO, preferably to the 5’- or 3’-end of the PMO. The sequence-defined T-shape lipo- 118371P1272PC oligomer as carrier covalently linked to the PMO comprises the sequence of formula I or formula III, preferably the sequence of formula I. In a preferred embodiment the artificial amino acid is selected from Stp, Gtp, chGtp, dGtp, IDAtp or TFEIDAtp, more preferably Stp, chGtp, dGtp or TFEIDAtp. Histidine containing sequence-defined T-shape lipo-oligomers as carrier generally mediated higher transfection efficiencies even at lower concentrations. The fatty acid is preferably OleA, LenA or LinA, more preferably OleA or LinA. [106] The term “phosphorodiamidate morpholino oligomer” as used herein is abbreviated as PMO and refers to antisense oligonucleotide (ASO) analogs that are artificial, uncharged antisense oligonucleotides with favorable stability, nuclease-resistance, low immunogenicity and toxicity. PMOs may be used to modulate gene expression by interfering with pre-mRNA splicing and are therefore a promising therapeutic molecule. [107] Without being limited thereto, the PMO and the sequence-defined T-shape lipo-oligomer are preferably conjugated at a molar ratio of PMO to sequence-defined T-shape lipo-oligomer (LP) of 1:3. The resulting solution comprises PMO-LP conjugates and free LPs at a ratio 1:2, which forms the nanoparticles. Thus, in certain embodiments the nanoparticles comprise PMO-sequence-defined T- shape lipo-oligomer conjugates (PMO-LP) and un-conjugated sequence-defined T-shape lipo- oligomer (LP), preferably at a ratio 1:2. The terms “conjugated” and “coupled” are used synonymously herein mean covalently linked and hence also “conjugates” are covalently linked. [108] Thus, in another aspect the invention also relates to a conjugate comprising a phosphorodiamidate morpholino oligomer (PMO) covalently linked to a carrier comprising a sequence- defined T-shape lipo-oligomer, comprising an artificial amino acid, wherein the artificial amino acid is an oligo(alkylamino) acid, and wherein the T-shape lipo-oligomer comprises the sequence of formula I: Cn-Y3-Hn(outer)-X1-Hn(inner)-Kc[Kf[FA] Formula wherein Kc is a central lysine; Kf is a further lysine linked to the ε-amino group of Kc; FA is a fatty acid covalently linked to the ε- and α-amino group of Kf; C is cysteine and n = 0 or 1, preferably n = 0 Y3 is a tyrosine tripeptide; H is histidine and n(outer) and n(inner) are independently selected from 0, 1 or 2; and X1 is an oligo(alkylamino) acid of formula IIa: H(HN-(CH2)n)m-NH-CO-R Formula IIa wherein n = 2 or 3, alternating 2 and 3 or alternating 3 and 2; and m = 3 or 4; and wherein R is 118371P1272PC -(CH2)y-CO2H, wherein y = 2, 3 or 4; -CH2-CH(c-hexyl)-CH2-CO2H; or -CH2-NRa-CH2-CO2H, wherein Ra = H, CH2-CF3, or wherein the T-shape lipo-oligomer comprises the sequence of formula III: Cn-Y3-Hn(outer)-[X2-Hn(inner)]2-Kc[Kf[FA]2]-[Hn(inner)-X2]2-Hn(outer)-Y3-Cn; Formula III (SEQ ID NO: 2) wherein Kc is a central lysine; Kf is a further lysine linked to the ε-amino group of Kc; FA is a fatty acid covalently linked to the ε- and α-amino group of Kf; C is cysteine and n = 0 or 1, preferably n = 1 Y3 is a tyrosine tripeptide; H is histidine and n(outer) and n(inner) are independently selected from 0 or, 1; and X2 is an oligo(alkylamino) acid of formula IIa: H(HN-(CH2)n)m-NH-CO-R Formula IIa wherein n = 2 or 3, alternating 2 and 3 or alternating 3 and 2; and m = 3 or 4; wherein R is -(CH2)y-CO2H, wherein y = 3 or 4; -CH2-CH(c-hexyl)-CH2-CO2H; or -CH2-NRa-CH2-CO2H, wherein Ra = CH2-CF3. and wherein the two fatty acids are saturated or unsaturated C12 to C22 fatty acids, preferably the two fatty acids are selected from the group consisting of oleic acid (OleA), linoleic acid 118371P1272PC (LinA), linolenic acid (LenA) or hydroxy steric acid (OHSteA), preferably OleA, LinA or OHSteA, more preferably LinA or OHSteA. [109] The embodiments as specified for the nanoparticle of the invention for Cas protein/gRNA ribonucleoprotein (RNP) complex delivery, particularly the embodiments further specifying the sequence-defined T-shape lipo-oligomer as carrier and the artificial amino acid similarly apply to the conjugate comprising a phosphorodiamidate morpholino oligomer (PMO) covalently linked to a carrier comprising a sequence-defined T-shape lipo-oligomer. [110] In yet another aspect, the invention relates to a nanoparticle for PMO delivery comprising the conjugate comprising a phosphorodiamidate morpholino oligomer (PMO) covalently linked to a carrier comprising a sequence-defined T-shape lipo-oligomer according to the invention. The nanoparticle may further comprise the carrier comprising the sequence-defined T-shape lipo-oligomer not covalently linked to the PMO (free sequence-defined T-shape lipo-oligomer). Typically, the free sequence-defined T-shape lipo-oligomer and the covalently linked sequence-defined T-shape lipo- oligomer are the same, wherein the free sequence-defined T-shape lipo-oligomer may be additionally coupled to a targeting ligand. [111] In certain embodiments of the conjugate or the nanoparticle for PMO delivery, the oligo(alkylamino) acid is a tetraethylenepentamine or a triethylenetetramine of formula IIb: H(HN- (CH2)2)m = 3 or 4-NH-CO-R (Formula IIb); preferably a tetraethylenepentamine. Preferably, the T-shape lipo-oligomer comprises the sequence of formula I: Cn-Y3-Hn(outer)-X1-Hn(inner)-Kc[Kf[FA]2]-Hn(inner)-X1- Hn(outer)-Y3-Cn (Formula I); wherein C is cysteine and n = 0 or 1, preferably 0; Y3 is a tyrosine tripeptide; and H is histidine and n(outer) and n(inner) are 0 or 1, preferably 1. [112] According to formula I or III cysteine (C) may be present (n = 1) or absent (n = 0) and is either present at the N-terminal and the C-terminal end or is absent from both ends. In a preferred embodiment the nanoparticles for PMO delivery comprising one or more PMO as cargo and a carrier comprising a sequence-defined T-shape lipo-oligomer comprising the sequence of formula I or III, preferably of formula I, the cysteine is absent (n = 0) and/or histidine is present, and n(inner) and n(outer) are 1. In certain embodiments the sequence-defined T-shape lipo-oligomer comprises a sequence of formula I selected from the group consisting of SEQ ID NOs: 7, 8, 9 and 10, preferably SEQ ID NO: 8. [113] The sequence-defined T-shape lipo-oligomer comprising the sequence of formula I or formula III as disclosed herein, preferably formula I, may further comprise a terminal functional group at the N- terminus or the C-terminus of the sequence-defined T-shape lipo-oligomer, wherein the functional group is (i) an azido group, such as an azido-hexanoic acid or an azido-lysine, or (ii) a thiol group provided that the sequence of formula I or III does not comprise a cysteine. Preferably, the functional group is an azido group. The functional group is used for coupling the PMO as cargo. The functional group (azido group or thiol group) may be N-terminally or C-terminally, preferably the functional group is N-terminally. Thus, the sequence-defined T-shape lipo-oligomer comprising the sequence of formula I or III may comprise a terminal azido group, such as an azido-hexanoic acid or an azido- lysine, preferably an azido-lysine. The azido group may be N-terminally or C-terminally, preferably the 118371P1272PC azido group is N-terminally. Although a single terminal azido group is sufficient, theoretically the sequence-defined T-shape lipo-oligomer may also comprise an azido group at the N-terminal and/or the C-terminal. In certain embodiments the azido-lysine (K(N3)) comprising sequence-defined T-shape lipo-oligomer comprises a sequence of formula I or III selected from the group consisting of SEQ ID NOs: 11-26 and 41-52, preferably SEQ ID NOs: 15, 16, 17, 18, 23, 24, 25 and 26, more preferably SEQ ID NO: 16. The functional group may further be used for coupling a targeting ligand. Since not all LPs are covalently linked to the PMO, others may be conjugated with the targeting ligand. [114] A terminal azido group or a single terminal thiol group allows coupling of the PMO (and optionally the targeting ligand) using click chemistry or using thiol conjugation, respectively. Preferably, the PMO as cargo is coupled to the azido-group via click chemistry, more preferably click chemistry with a dibenzocylooctyne-coupled PMO. Click chemistry is a general term for highly specific, in many cases biorthogonal, covalent conjugation reactions, that are modular, efficient and relatively insensitive to solvent parameters, water and oxygen. Various click chemistry reactions are known in the art and the person skilled in the art would know how to select a specific click chemistry reaction for a certain conjugation and particular for a certain protein or oligomer, such as the sequence-defined T-shape lipo-oligomer. Typical click reactions, without being limited thereto, are copper-catalyzed azide-alkylene cycloaddition (CuAAC) (copper-catalyzed reaction of an azide with an alkyne), copper- free azide-alkyne cycloaddition, such as strain-promoted azide-alkyne cycloaddition (SPAAC), Diels- Alder or inverse electron Diels-Alder reaction, and alkene-tetrazole photoclick reaction. Therapeutic and non-therapeutic uses [115] Cas proteins are RNA-directed nucleases, wherein a small guide RNA (gRNA) complementary to a target site guides the nuclease to this site. For example, Cas9 or Cas12 introduces double-strand breaks (DSB) at targeted DNA loci (Cas9 blunt end, Cas12 staggered ends). Since this system is modular it can be readily engineered. One of two cellular mechanisms then repairs the cut DNA by non-homologous end-joining (NHEJ), which introduces insertions or deletions (indels) or by homology- directed repair (HDR), which uses a donor DNA as template to introduce specific modifications near the target site. Thus, for some applications delivery of just the DNA nuclease is sufficient. For example, the Cas protein/gRNA RNP complex can be used to knockout alleles that underlie autosomal dominant genetic disorders, such as Huntington’s disease and amyotrophic lateral sclerosis or for exon skipping or removal of a cryptic splice site, such as for Duchenne’s muscular dystrophy and Leber’s congenital amaurosis type 10, respectively. Moreover, base editors may be used to edit point-mutations in disease-causing alleles and the more recently developed prime editors may be used to correct not only point mutations, but also small indels without the induction of a double-stranded break. In addition to base editors and prime editors genome editing may be effected using nuclease-mediated, double- stranded break to trigger HDR via the co-delivery of a donor DNA. [116] In one aspect, the nanoparticle of the invention is used in therapy. Since the Cas proteins are so versatile a large variety of diseases can be treated, including, without being limited thereto, a disease selected from the group consisting of cancer, a genetic disease, an infectious disease, a cardiovascular disease, a metabolic disease, a neurodegenerative or neuromuscular disease, a 118371P1272PC hematological disease, a hereditary eye disease and an autoimmune disease. Similarly, siRNA and PMOs are versatile and can be used in treating a large variety of diseases, including, without being limited thereto, a disease selected from the group consisting of cancer, a genetic disease, an infectious disease, a cardiovascular disease, a metabolic disease, a neurodegenerative or neuromuscular disease, a hematological disease, a hereditary eye disease and an autoimmune disease. [117] In another aspect, the nanoparticle of the invention is used in treating cancer, a genetic disease, an infectious disease, a cardiovascular disease, a metabolic disease, a neurodegenerative or neuromuscular disease, a hematological disease, a hereditary eye disease or an autoimmune disease. [118] The nanoparticle according to the invention may be used in vivo or ex vivo for Cas protein/gRNA RNP, siRNA or PMO delivery. Thus, the nanoparticle for use in therapy is delivered to a cell of the subject to be treated in vivo or ex vivo. For therapeutic uses ex vivo, nanoparticle delivery to cells of the subject to be treated is followed by adoptive cell transfer of said cells to said subject. For Cas protein/gRNA RNP delivery mediating homology directed repair nanoparticles comprising the T-shape lipo-oligomers having the formula C-Y3-Gtt2-K(K-(OHSteA)2)-Gtt2-Y3-C or Y3-X1-K(K-(LinA)2)-X1-Y3 (particularly Y3-TFEIDAtp-K(K-(LinA)2)-TFEIDAtp-Y3) may be particularly suitable. [119] In vivo delivery involves local administration or systemic administration and may require the coupling of a targeting ligand. Alternatively, targeted delivery may be achieved for cell types such as macrophages, with a high degree of phagocytosis and endocytosis. The nanoparticle may therefore be administered by any route, including, without being limited thereto intravenous administration, subcutaneous administration, intradermal administration, intramuscular administration oral administration, intranasal administration, vaginal administration, intravitreal administration, or intrathecal administration. [120] Delivery may also be ex vivo to a cell of the subject to be treated followed by adoptive cell transfer. Prior to adoptive cell transfer the cell may be screened for successful genome editing mediated by the Cas protein/gRNA RNP. Alternatively, prior to adoptive cell transfer the cell may be screened for successful gene silencing by siRNA or successful gene modulation by PMOs. Routes for adoptive transfer of the genome edited (or siRNA or PMO modified) cells to the subject are known in the art and include, without being limited thereto, intravenous administration, subcutaneous administration and intramuscular administration, particularly intravenous administration. [121] In yet another aspect the invention relates to a pharmaceutical composition comprising a nanoparticle and at least one pharmaceutically acceptable excipient. The pharmaceutical composition comprising the nanoparticle according to the invention may be cryo-conserved, lyophilized or in an isotonic solution (i.e., in a physiological buffer). [122] In addition to in vivo or ex vivo delivery, the nanoparticle according to the invention may further be used for in vitro Cas protein/gRNA RNP delivery, siRNA delivery or PMO delivery, i.e., for non- therapeutic purposes. [123] Thus, in another aspect the invention relates to an in vitro method for transfecting mammalian cells with one or more Cas protein/gRNA complex (or one or more siRNA(s) or PMO(s)) comprising 118371P1272PC contacting a mammalian cell in vitro with the nanoparticle according to the invention or the conjugate according to the invention. Any mammalian cell may be suitable in the context of the present invention including cell lines and primary cells, suspension and adherent cells or even organoids. For example, the mammalian cells may be human or rodent cells, including, without being limited thereto CHO cells BHK cells, HEK293 cells, HeLa cells, HepG2 cells and derivatives thereof. The person skilled in the art will understand that derivatives of CHO cells include, e.g., glutathione deficient CHO cells such as CHO-K1 cells and the like. Moreover, derivatives of HEK 293 cells include, e.g., HEK293T, HEK293E, HEK293F, HEK293SF cells and the like. [124] In yet another aspect, the invention relates to a use of the sequence-defined T-shape lipo- oligomer (or a method comprising said use) for cellular delivery of a Cas protein/gRNA ribonucleoprotein (RNP) complex, an siRNA or a PMO, preferably a Cas protein/gRNA ribonucleoprotein (RNP) complex, into a target cell, wherein the sequence defined T-shape lipo- oligomer comprising the sequence of formula I: Cn-Y3-Hn(outer)-X1-Hn(inner)- Formula as disclosed and specified herein, or of formula III: Cn-Y3-Hn(outer)-[X2-Hn(inner)]2-Kc[Kf[FA]2]-[Hn(inner)-X2]2-Hn(outer)-Y3-Cn; Formula III (SEQ ID NO: 2); as disclosed and specified herein. [125] Particularly, wherein the T-shape lipo-oligomer comprises the sequence of formula I: Cn-Y3-Hn(outer)-X1-Hn(inner)-Kc[Kf[FA] Formula wherein Kc is a central lysine; Kf is a further lysine linked to the ε-amino group of Kc; FA is a fatty acid covalently linked to the ε- and α-amino group of Kf; C is cysteine and n = 0 or 1, preferably n = 0 Y3 is a tyrosine tripeptide; H is histidine and n(outer) and n(inner) are independently selected from 0, 1 or 2; and X1 is an oligo(alkylamino) acid of formula IIa: H(HN-(CH2)n)m-NH-CO-R Formula IIa wherein n = 2 or 3, alternating 2 and 3 or alternating 3 and 2; and m = 3 or 4; and wherein R is -(CH2)y-CO2H, wherein y = 2, 3 or 4; 118371P1272PC -CH2-CH(c-hexyl)-CH2-CO2H; or -CH2-NRa-CH2-CO2H, wherein Ra = H, CH2-CF3; or wherein the T-shape lipo-oligomer comprises the sequence of formula III: Cn-Y3-Hn(outer)-[X2-Hn(inner)]2-Kc[Kf[FA]2]-[Hn(inner)-X2]2-Hn(outer)-Y3-Cn; Formula III wherein Kc is a central lysine; Kf is a further lysine linked to the ε-amino group of Kc; FA is a fatty acid covalently linked to the ε- and α-amino group of Kf; C is cysteine and n = 0 or 1, preferably n = 1 Y3 is a tyrosine tripeptide; H is histidine and n(outer) and n(inner) are independently selected from 0 or 1; and X2 is an oligo(alkylamino) acid of formula IIa: H(HN-(CH2)n)m-NH-CO-R Formula IIa wherein n = 2 or 3, alternating 2 and 3 or alternating 3 and 2; and m = 3 or 4; and wherein R is -(CH2)y-CO2H, wherein y = 3 or 4; -CH2-CH(c-hexyl)-CH2-CO2H; or -CH2-NRa-CH2-CO2H, wherein Ra = CH2-CF3. The embodiments and disclosures as specified for the nanoparticle of the invention similarly apply to this aspect. For mediating homology directed repair nanoparticles comprising the T-shape lipo- oligomers having the formula C-Y3-Gtt2-K(K-(OHSteA)2)-Gtt2-Y3-C or Y3-X1-K(K-(LinA)2)-X1-Y3 (particularly Y3-TFEIDAtp-K(K-(LinA)2)-TFEIDAtp-Y3) may be particularly suitable. 118371P1272PC [126] In yet another aspect, the invention relates to a use of an artificial amino acid in a sequence- defined T-shape lipo-oligomer (or a method comprising said used) for cellular delivery of a Cas protein/gRNA ribonucleoprotein (RNP) complex, an siRNA or a PMO, preferably a Cas protein/gRNA ribonucleoprotein (RNP) complex into a target cell, wherein the artificial amino acid is an oligo(alkylamino) acid selected from the group consisting of Gtp, Gtt, Htp, Ptp, IDAtp, TFE-IDAtp, GEIPA, Ntp, and chGtp. In certain embodiments, the T-shape lipo-oligomer comprises the sequence of formula I: Cn-Y3-Hn(outer)-X1-Hn(inner)-Kc[Kf[FA]2]-Hn(inner)-X1-Hn(outer)-Y3-Cn (Formula I; SEQ ID NO: 1), as disclosed and specified herein. In a preferred embodiment the oligo(alkylamino) acid (artificial amino acid) is selected from the group consisting of Gtp, Gtt, Htp, TFE-IDAtp, GEIPA, and chGtp, more preferably Htp, TFE-IDAtp, and chGtp. In certain other embodiments, the T-shape lipo-oligomer comprises the sequence of formula III: Cn-Y3-Hn(outer)-[X2-Hn(inner)]2-Kc[Kf[FA]2]-[Hn(inner)-X2]2-Hn(outer)-Y3-Cn (Formula III; SEQ ID NO: 2), as disclosed and specified herein. In a preferred embodiment the oligo(alkylamino) acid (artificial amino acid) is selected from the group consisting of chGtp, Htp, TFE-IDAtp, Gtt or GEIPA. Preferably the oligo(alkylamino) acid is TFE-IDAtp or Gtt. [127] Preferably the uses of the invention are in vitro uses, i.e., for non-therapeutic purpose. In certain embodiments the target cell is a mammalian cell, preferably as specified herein above. [128] In yet another aspect, the invention relates to an artificial amino acid, wherein the artificial amino acid is an oligo(alkylamino) acid selected from the group consisting of the following formulas: , , in its protected and unprotected form. 118371P1272PC In certain embodiments the use of the artificial amino acid according to the invention is for cellular delivery of a Cas protein/gRNA ribonucleoprotein (RNP) complex into a target cell, as specified herein above. [129] The oligo(alkylamino) acids are typically synthesized as protected building blocks prior to generating the sequence-defined lipo-oligomers, including the sequence-defined T-shape lipo- oligomers according to the invention. The person skilled in the art would know suitable protecting groups, such as fluorenylmethoxycarbonyl (Fmoc) and tert-butyloxycarbonyl (Boc). Building blocks with suitable amine protecting groups are known in the art and include without being limited thereto fluorenylmethoxycarbonyl (Fmoc), tert-butyloxycarbonyl (Boc), allyloxycarbonyl (Alloc), 1- methylethoxycarbonyl (Adpoc), 2,7-di-tert-butyl[9-(10,10-dioxo-10,10,10,10- tetrahydrothioxanthyl)] (Tmoc), benzyloxycarbonyl (Cbz, Z), 2-chlorobenzyloxycarbonyl (2-Cl-Z), benzyl (Bn), triphenylmethyl (Trityl), 4-Methyltrityl (Mtt), 1-(4,4-dimethyl-2,6-dioxocyclohex-1-ylidene)ethyl (Dde), 1-(4,4-dimethyl- 2,6-dioxocyclohex-1-ylidene)isovaleryl (ivDde), 2,7-disulfo-9-fluorenylmethoxycarbonyl (Smoc), trifluoroacetamide (TFA), tolylsuflonyl (Tos), 2-nitrobenzenesulfonyl (Ns). Preferred protecting groups are Fmoc at a terminal primary amine and Boc at internal secondary amines. Thus, the oligo(alkylamino) acids in their protected form may be Fmoc-GEIPA(Boc2)-OH, Fmoc-dGtp(Boc3)-OH, Fmoc-Ntp(Boc3)-OH, Fmoc-Htp(Boc3)-OH and Fmoc-chGtp(Boc3)-OH: . 118371P1272PC EXAMPLES Synthesis of N-(tert-Butoxycarbonyl)iminodiacetic acid (Boc-IDA) [130] N-tert-Butoxycarbonyl protected iminodiacetic acid (Boc-IDA) was synthesized using the procedure reported by Cookson et al. (Cookson, J., Amide functionalised dithiocarbamate ruthenium(II) bis-bipyridyl receptors: A new class of redox-responsive anion sensor, Inorganica Chimica Acta, 2008, 361, 1689-1698) with slight modification. Briefly 13.3 g iminodiacetic acid (0.1 mol) and 200 mL 1,4-dioxane were put into a 1 L round-bottom flask.200 mL of 1 M sodium hydroxide solution were added and the mixture was stirred until a clear solution formed.24.0 g of di-tert-butyl dicarbonate (0.11 mol, 1.1 eq) were dissolved in 50 mL 1,4-dioxane and added to the reaction mixture, which was stirred at RT for 72 h. The mixture was concentrated to approx.200 mL under reduced pressure, washed twice with 150 mL diethyl ether. After acidification with 100 mL 10 % HCl, the reaction product was extracted with EtOAc (3 x 150 mL). The organic phases were combined and dried over anhydrous sodium sulfate. The EtOAc was evaporated after filtration, yielding 22.3 g of Boc-IDA (0.096 mol, 96 %) as white crystals. Synthesis of N-(tert-Butoxycarbonyl)iminodiacetic acid anhydride (Boc-IDA anhydride) [131] The cyclic anhydride of Boc-IDA was prepared by using dicyclohexylcarbodiimide (DCC) as dehydrating agent.10.0 g of Boc-IDA (43 mmol) were put into a 500 mL round-bottom flask and 250 mL DCM were added.8.9 g of DCC (43 mmol, 1 eq) were dissolved in 50 mL DCM and added into the round-bottom flask. The heterogeneous mixture was stirred at RT overnight. The next day the mixture was concentrated to a volume of approx.100 mL under reduced pressure and the insoluble dicyclohexyl urea was removed by filtration. The DCM was removed in the rotary evaporator and at high vacuum to yield 8.4 g of Boc-IDA anhydride (39 mmol, 91 %) as a solid. 118371P1272PC Synthesis of N-(Trifluoroethyl)iminodiacetic acid (TFE-IDA) [132] TFE-IDA was prepared by modification of the protocol for the synthesis of methyliminodiacetic acid published by Berchet (Berchet, G. J., METHYLIMINODIACETIC ACID, Organic Syntheses, 18 (1938) 56).27.9 g chloroacetic acid (295.2 mmol, 2 eq) were placed in a 500 mL round-bottom flask. 22 mL H2O were added and the flask was cooled in an ice bath. A cold solution of 29.5 g NaOH (738 mmol, 5 eq) in 93 mL H2O was added slowly under stirring. After the complete addition, the cooling bath was removed and a solution of 20.0 g trifluoroethylamine hydrochloride (147.6 mmol, 1 eq) in 65 mL H2O was added dropwise. After complete addition, the solution was stirred overnight.60 g BaCl2 dihydrate in approx.140 mL boiling H2O were added and the mixture was heated for 1.5 hours. The solid was filtered off and dried in the drying cabinet over 2 days yielding 27.6 g of TFE-IDA barium salt (78.8 mmol). The dry TFE-IDA barium salt was placed in a 500 mL round-bottom flask.65 mL H2O were added and heated to boiling. 31.5 mL of a 2.5 M H2SO4 solution (78.8 mmol) were added gradually over 1 hour under continuous heating to boiling. After cooling to RT, the mixture was centrifuged to remove the solid BaSO4. The clear supernatant was freeze-dried yielding 16.1 g of TFE- IDA (74.8 mmol, 51 %) as colorless crystals. Synthesis of N-(Trifluoroethyl)iminodiacetic acid anhydride (TFE-IDA anhydride) [133] The cyclic anhydride of TFE-IDA was prepared analogously to the anhydride of Boc-IDA by using DCC.5.0 g TFE-IDA (23.2 mmol) were placed in a 250 mL round-bottom flask.140 mL DCM were added.4.8 g DCC (23.2 mmol, 1 eq) were dissolved in 30 mL DCM and added into the flask. The mixture was stirred at RT overnight. The mixture was concentrated to approx. 80 mL under reduced pressure and the insoluble dicyclohexyl urea was removed by filtration. The DCM was removed in the rotary evaporator and at high vacuum to yield 4.3 g TFE-IDA anhydride (21.8 mmol, 94 %) as a solid. Synthesis of protected artificial amino acid building blocks (depicted in Scheme 1) [134] The synthesis of protected building blocks Fmoc-Gtt(Boc2)-OH, Fmoc-Stp(Boc3)-OH, Fmoc- Gtp(Boc3)-OH, Fmoc-Ptp(Boc3)-OH, Fmoc-Htp(Boc3)-OH, Fmoc-chGtp(Boc3)-OH, Fmoc-Ntp(Boc3)- OH, Fmoc-Boc-IDAtp(Boc3)-OH, Fmoc-TFE-IDAtp(Boc3)-OH and Fmoc-dGtp(Boc3)-OH was carried out with cyclic dicarboxylic acid anhydrides analog to the description published by Schaffert et al. (Schaffert, D. et al., Novel Fmoc-polyamino acids for solid-phase synthesis of defined 118371P1272PC polyamidoamines, Organic letters, 2011, 13.7: 1586-1589). Briefly, the two primary amines of the polyamines 1 (TETA, TEPA) were selectively protected with ethyl trifluoroacetate (EtOTFA). Subsequently the remaining secondary amines were Boc-protected by reaction with di-tert-butyl dicarbonate (Boc2O) in a one-pot reaction. Work-up and recrystallization gave the compounds 2, bis- tfa-Tt(Boc2) or bis-tfa-Tp(Boc3), respectively. The primary amines were deprotected by alkaline hydrolysis with aqueous NaOH containing 45 % EtOH to obtain the compounds 3, Tt(Boc2) or Tp(Boc3). [135] In the final step, the two primary amines were asymmetrically substituted by reaction with a cyclic anhydride (succinic anhydride for Fmoc-Stp(Boc3)-OH; glutaric anhydride for Fmoc-Gtp(Boc3)- OH and Fmoc-Gtt(Boc2)-OH; phthalic anhydride for Fmoc-Ptp(Boc3)-OH; 3-oxaspiro[5,5]undecan-2,4- dion for Fmoc-chGtp(Boc3)-OH; 1,2-cyclohexanedicarboxylic anhydride for Fmoc-Htp(Boc3)-OH; 2,3- napthalic anhydride for Fmoc-Ntp(Boc3)-OH; diglycolic anhydride for Fmoc-dGtp(Boc3)-OH) and N- (fluorenyl-9-methoxycarbonyloxy)-succinimid (Fmoc-OSu). Purification of the products 4a was carried out by dry column vacuum chromatography (DCVC) (D.S. Pedersen, C. Rosenbohm, Dry Column Vacuum Chromatography Synthesis, (2001) 2431-2434). [136] In case of the IDA derived building blocks for the production of Fmoc-Boc-IDAtp(Boc3)-OH and Fmoc-TFE-IDAtp(Boc3)-OH, TEPA (n=3) was used as the polyamine element. The first steps to obtain Tp(Boc3) were carried out in the same manner as described above for the other building blocks. In the last step, the custom-synthesized IDA derived anhydrides (Boc-IDA and TFE-IDA anhydride, respectively) were used and the synthesis protocol described above was adapted without additional modification. Scheme 1: Synthesis of Fmoc oligoamine building blocks: 118371P1272PC Synthesis of protected artificial amino acid building block Fmoc-GEIPA(Boc2)-OH (depicted in Scheme 2) The protected building block Fmoc-GEIPA(Boc2)-OH was synthesized by exact adaption of the synthesis protocol described above and using the oligoamine 3,3′-ethylenediiminodipropylamine instead of TETA or TEPA. Analytical results: Fmoc-Stp(Boc3)-OH. Yield: 77 %.1H NMR (400 MHz, CDCl3) δ (ppm) = 7.78 (d, 2H, ArH-Fmoc), 7.61 (d, 2H, ArH-Fmoc), 7.41 (t, 2H, ArH-Fmoc), 7.31 (t, 2H, ArH-Fmoc), 4.40 (m, 2H, CH2-Fmoc), 4.21 (m, 1H, CH-Fmoc), 3.47 – 3.20 (m, 16H, CH2-Tepa), 2.67 (t, 2H, CH2CONH-Suc), 2.48 (m, 2H, CH2COOH- Suc), 1.46 (s, 27H, CH3-tert-but). ESI-MS: calculated 811.4; found 810.4 [M-H]-. Fmoc-Boc-IDAtp(Boc3)-OH. Yield: 29 %. 1H NMR (400 MHz, CDCl3) δ (ppm) = 7.77 (d, 2H, ArH- Fmoc), 7.59 (d, 2H, ArH-Fmoc), 7.40 (t, 2H, ArH-Fmoc), 7.31 (t, 2H, ArH-Fmoc), 4.40 (m, 2H, CH2- Fmoc), 4.20 (m, 1H, CH-Fmoc), 3.91 (s, 4H, CH2-IDA) 3.48 – 3.19 (m, 16H, CH2-Tepa), 1.43 (s, 36H, CH3-tert-but). ESI-MS: calculated 926.5; found 925.5 [M-H]-. Fmoc-dGtp(Boc3)-OH. Yield: 73 %.1H NMR (400 MHz, CDCl3) δ (ppm) = 7.77 (d, 2H, ArH-Fmoc), 7.60 (d, 2H, ArH-Fmoc), 7.42 (t, 2H, ArH-Fmoc), 7.32 (t, 2H, ArH-Fmoc), 4.41 (m, 2H, CH2-Fmoc), 4.23 (m, 1H, CH-Fmoc), 4.17 (d, 2H, CH2CONH-diglycolic acid), 4.10 (d, 2H, CH2COOH- diglycolic acid), 1.45 (s, 27H, CH3-tert-but). ESI-MS: calculated 827.4; found 826.4 [M-H]-. 118371P1272PC Fmoc-Gtp(Boc3)-OH. Yield: 68 %. 1H NMR (400 MHz, CDCl3) δ (ppm) = 7.79 (d, 2H, ArH-Fmoc), 7.60 (d, 2H, ArH-Fmoc), 7.41 (t, 2H, ArH-Fmoc), 7.32 (t, 2H, ArH-Fmoc), 4.41 (m, 2H, CH2-Fmoc), 4.22 (m, 1H, CH-Fmoc), 3.48 – 3.24 (m, 16H, CH2-Tepa), 2.42 (t, 2H, CH2CONH-Glu), 2.29 (t, 2H, CH2COOH-Glu), 1.97 (m, 2H, CH2CH2CH2COOH-Glu), 1.47 (s, 27H, CH3-tert-but). ESI-MS: calculated 825.4; found 824.4 [M-H]-. Fmoc-Htp(Boc3)-OH. Yield: 55 %.1H NMR (400 MHz, CDCl3) δ (ppm) = 7.69 (d, 2H, ArH-Fmoc), 7.51 (d, 2H, ArH-Fmoc), 7.32 (t, 2H, ArH-Fmoc), 7.23 (t, 2H, ArH-Fmoc), 4.30 (m, 2H, CH2-Fmoc), 4.12 (m, 1H, CH-Fmoc), 3.48 – 3.08 (m, 16H, CH2-Tepa), 2.50 (d, 1H, CHCONH-Hexahydrophthalic acid), 2.16 (s, 1H, CHCOOH-Hexahydrophthalic acid), 1.89 – 1.24 (m, 35H, CH2-Hexahydrophthalic acid, CH3- tert-but). ESI-MS: calculated 865.5; found 864.5 [M-H]-. Fmoc-chGtp(Boc3)-OH. Yield: 63 %.1H NMR (400 MHz, CDCl3) δ (ppm) = 7.69 (d, 2H, ArH-Fmoc), 7.51 (d, 2H, ArH-Fmoc), 7.32 (t, 2H, ArH-Fmoc), 7.23 (t, 2H, ArH-Fmoc), 4.30 (m, 2H, CH2-Fmoc), 4.12 (m, 1H, CH-Fmoc), 3.48 – 3.08 (m, 16H, CH2-Tepa), 2.50 (d, 1H, CHCONH-Hexahydrophthalic acid), 2.16 (s, 1H, CHCOOH-Hexahydrophthalic acid), 1.89 – 1.24 (m, 35H, CH2-Hexahydrophthalic acid, CH3-tert-but). ESI-MS: calculated 893.5; found 892.5 [M-H]-. Fmoc-TFE-IDAtp(Boc3)-OH. Yield: 28 %. 1H NMR (400 MHz, CDCl3) δ (ppm) = 7.69 (d, 2H, ArH- Fmoc), 7.51 (d, 2H, ArH-Fmoc), 7.32 (t, 2H, ArH-Fmoc), 7.23 (t, 2H, ArH-Fmoc), 4.30 (m, 2H, CH2- Fmoc), 4.12 (m, 1H, CH-Fmoc), 3.48 – 3.08 (m, 16H, CH2-Tepa), 2.50 (d, 1H, CHCONH- Hexahydrophthalic acid), 2.16 (s, 1H, CHCOOH-Hexahydrophthalic acid), 1.89 – 1.24 (m, 35H, CH2- Hexahydrophthalic acid, CH3-tert-but). ESI-MS: calculated 908.4; found 907.4 [M-H]-. Fmoc-Gtt(Boc2)-OH. Yield: 66 %.1H NMR (400 MHz, CDCl3) δ (ppm) = 7.79 (d, 2H, ArH-Fmoc), 7.61 (d, 2H, ArH-Fmoc), 7.42 (t, 2H, ArH-Fmoc), 7.32 (t, 2H, ArH-Fmoc), 4.42 (m, 2H, CH2-Fmoc), 4.22 (m, 1H, CH-Fmoc), 3.52 – 3.21 (m, 12H, CH2-Teta), 2.41 (t, 2H, CH2CONH-Glu), 2.28 (t, 2H, CH2COOH- Glu), 1.98 (m, 2H, CH2CH2CH2COOH-Glu), 1.45 (s, 18H, CH3-tert-but). ESI-MS: calculated 682.4; found 681.4 [M-H]-. Fmoc-GEIPA(Boc2)-OH. Yield: 72 %.1H NMR (400 MHz, CDCl3) δ (ppm) = 7.78 (d, 2H, ArH-Fmoc), 7.62 (d, 2H, ArH-Fmoc), 7.41 (t, 2H, ArH-Fmoc), 7.32 (t, 2H, ArH-Fmoc), 4.42 (m, 2H, CH2-Fmoc), 4.23 (m, 1H, CH-Fmoc), 3.43 – 3.03 (m, 12H, CH2CH2CH2-GEIPA, CH2CH2-GEIPA), 2.44 (t, 2H, CH2CONH-Glu), 2.30 (t, 2H, CH2COOH-Glu), 1.99 (m, 2H, CH2CH2CH2COOH-Glu), 1.71 (m, 4H, CH2CH2CH2-GEIPA), 1.47 (s, 18H, CH3-tert-but). ESI-MS: calculated 710.4; found 709.4 [M-H]-. Fmoc-Ptp(Boc3)-OH. Yield: 45 %.1H NMR (400 MHz, CDCl3) δ (ppm) = 7.81 – 7.25 (m, 12H, ArH- Fmoc, ArH-Phthalic acid), 4.41 (m, 2H, CH2-Fmoc), 4.22 (m, 1H, CH-Fmoc), 3.69 – 3.17 (m, 16H, CH2-Tepa), 1.44 (s, 27H, CH3-tert-but). ESI-MS: calculated 859.4; found 858.4 [M-H]-. Fmoc-Ntp(Boc3)-OH. Yield: 52 %.1H NMR (400 MHz, CDCl3) δ (ppm) = 7.98 – 7.17 (m, 14H, ArH- Fmoc, ArH-Naphthalenedicarboxylic acid), 4.29 (m, 2H, CH2-Fmoc), 4.12 (m, 1H, CH-Fmoc), 3.62 – 3.12 (m, 16H, CH2-Tepa), 1.34 (s, 27H, CH3-tert-but). ESI-MS: calculated 909.4; found 908.4 [M-H]-. Hydroxystearic acid (OHSteA). Yield: 84 %.1H NMR (400 MHz, CDCl3) δ (ppm) = 3.57 - 3.48 (q, 1H, CH-OH), 2.35 - 2.21 (t, 2H, CH2COOH), 1.63 - 1.49 (q, 2H, CH2CH2COOH), 1.44 - 1.11 (m, 26H, -CH2-), 0.87 - 0.72 (t, 3H, CH3). ESI-MS: calculated 300.3; found 299.3 [M-H]-. Sequence-defined oligomers comprising artificial amino acids synthesized by solid phase synthesis [137] Sequence defined oligomers comprising oligoamino amides were synthesized by solid-phase synthesis (Schaffert, D. et al., Angewandte Chemie International Edition, 2011, 50, 8986-8989) as described previously (Reinhard, S., Optimized Solid-Phase-Assisted Synthesis of Oleic Acid Containing siRNA Nanocarriers, ChemMedChem, 2017, 12, 1464-1470; Kuhn, J. et al., Delivery of Cas9/sgRNA Ribonucleoprotein Complexes via Hydroxystearyl Oligoamino Amides, Bioconjugate Chemistry, 2020, 31, 729-742) with slight modification. The sequence defined oligomers generated 118371P1272PC and tested for Cas9 RNP delivery are shown in Table 1. All oligomers were synthesized manually on 2-chlorotrityl chloride resin using standard Fmoc-based solid-phase peptide synthesis conditions. For standard Fmoc-α-amino acids, Fmoc-Stp(Boc3)-OH, Fmoc-Boc-IDAtp(Boc3)-OH, Fmoc-dGtp(Boc3)- OH, Fmoc-Gtp(Boc3)-OH, Fmoc-TFE-IDAtp(Boc3)-OH, Fmoc-Gtt(Boc2)-OH, or Fmoc-GEIPA(Boc2)- OH, the coupling step was performed using 4 eq Fmoc-amino acid, 4 eq HOBt, 4 eq PyBOP, and 8 eq DIPEA in DCM/DMF (1/1, 5 mL g−1 resin) for 75 min. For Fmoc-Htp(Boc3)-OH or Fmoc- chGtp(Boc3)-OH, the coupling step was performed using 4 eq Fmoc-amino acid, 4 eq HOBt, 4 eq PyBOP, and 8 eq DIPEA in DCM/DMF (1/1, 5 mL g−1 resin) containing 1 % Triton X-100 overnight. For Fmoc-Ptp(Boc3)-OH or Fmoc-Ntp(Boc3)-OH, the coupling step was performed using 4 eq Fmoc- amino acid, 4 eq Oxyma, and 4 eq DIC in NMP (5 mL g−1 resin) overnight. Fmoc deprotection step was performed by 3 times incubation with 20 % piperidine in DMF (5 mL g−1 resin) for 15 min. The resin was washed 3 times with DMF and 3 times with DCM after each coupling and deprotection step. A Kaiser test (Kaiser et al., Analytical Biochemistry, 34, 1970, 595-598.) was carried out after each coupling and deprotection step. In case of unexpected results (positive after coupling, negative after deprotection), the last coupling or deprotection step, respectively, was repeated. After the last deprotection of Fmoc-Lys(N3)-OH, the N-terminal amino group was protected with 10 eq Boc2O and 10 eq DIPEA in DCM/DMF (1/1, 5 mL g−1 resin). Dde deprotection of the central Fmoc-Lys(Dde)-OH was accomplished by 15 times incubation with 2 % hydrazine in DMF for 2 min. Subsequently, the resin was washed 5 times with DMF, 5 times with 10 % DIPEA in DMF, and 3 times with DCM (5 mL g−1 resin each). Afterwards, Fmoc-Lys(Fmoc)-OH was introduced followed by the coupling of different fatty acids. The resin was washed 3 times with DMF and DCM and dried in vacuo. The oligomers were cleaved off the resin by incubation with pre-cooled cleavage cocktail TFA/EDT/H2O/TIS (94/2.5/2.5/1, 10 mL g−1 resin) for 30 min. The cleavage solution was then immediately precipitated in pre-cooled MTBE/n-hexane (1/1, 40 mL). Afterwards, the oligomers were purified by size exclusion chromatography. The fractions were combined and snap frozen and lyophilized to obtain the final products. Table 1. The sequence-defined T-shape lipo-oligomers synthesized and tested for Cas9 RNP delivery 118371P1272PC 118371P1272PC (a) α-amino acids are indicated using the one-letter code. Stp, succinyl-tetraethylenepentamine; Gtp, glutaryl- tetraethylenepentamine; Htp, cyclohexanedicarboxyl-tetraethylenepentamine; Ptp, phthalyl- tetraethylenepentamine; Ntp, naphthalenedicarboxyl-tetraethylenepentamine; chGtp, 1,1-cyclohexanediacetyl- tetraethylenepentamine; dGtp, diglycolyl-tetraethylenepentamine; Htp, 1,2-cyclohexanedicarboxyl- tetraethylenepentamine; IDAtp, iminodiacetyl-tetraethylenepentamine; TFE-IDAtp, trifluoroethyl-iminodiacetyl- tetraethylenepentamine; Gtt, glutaryl-triethylenetetramine; GEIPA, glutaryl-N,N′-bis-(3-aminopropyl)- ethylenediamine; OleA, oleic acid; OHSteA, mono-hydroxylated stearic acid; LinA, linoleic acid; LenA, linolenic acid; SteA, stearic acid; CholA, cholanic acid. (b)All sequences were synthesized and analyzed with an N-terminal azido lysine (K(N3)). 118371P1272PC Analytical data [138] The various sequence defined oligomers (see Table 1) were analyzed using MALDI-TOF mass spectrometry. In brief, matrix solution containing 10 mg/mL Super-DHB (90/10 m/m mixture of 2,5- dihydroxybenzoic acid and 2-hydroxy-5-methoxybenzoic acid) in 69.93/30/0.07 (v/v/v) H2O/acetonitrile/trifluoroacetic acid was spotted on an MTP Anchor Chip (Bruker Daltonics, Germany). After crystallization of 1 μL matrix solution, 1 μL of sample solution (10 mg/mL in water) was added to the matrix spot. Samples were analyzed using an Autoflex II mass spectrometer (Bruker Daltonics, Germany). All spectra were recorded in positive ion mode. 1H Nuclear magnetic resonance (1H NMR) spectroscopy [139] 1H NMR spectra were recorded on an Advance III HD Bruker BioSpin (400 MHz) in chloroform- d (CDCl3), deuterium oxide (D2O) or methanol-d4 (CD3OD) without TMS. Chemical shifts were calibrated to the residual solvent signal and were reported in parts per million (ppm). The spectra were processed in MestReNova software (MestReLab Research, SL). Integration was performed manually. Electrospray ionization mass spectroscopy (ESI-MS) [140] ESI mass spectra of artificial building blocks were recorded with a Thermo Scientific LTQ FT Ultra fourier transform ion cyclotron and an IonMax source in chloroform or methanol. Dynamic light scattering (DLS) and zeta potential analysis [141] The hydrodynamic particle size and zeta potential of nanoparticles were measured in folded capillary cells (DTS 1070) using a Zetasizer Nano ZS (Malvern Instruments, UK). The scattering angle of 173° was fixed, the refractive index (RI) of the solvent was 1.330, the viscosity was 0.8872 mPa·s, and the temperature was set to 25 °C. All samples were measured 3 times with 12-15 sub-runs. Determination of half maximal effective concentration (EC50) [142] The eGFP knockout studies were carried out with a series of concentrations of RNP (100, 75, 50, 25, 10, 5, 2.5, 1, 0.5, and 0.1 nM). Each concentration was used in triplicates. Based on the obtained dose-response correlation, half maximal effective concentration (EC50) values were calculated by GraphPad prism 5. LogD7.4 determination of artificial amino acids [143] Octanol–water partition coefficient D at pH 7.4 (logD7.4) was determined as previously reported (H. J. Kim, S. Ogura, T. Otabe, R. Kamegawa, M. Sato, K. Kataoka, K. Miyata, ACS Cent. Sci.2019, 5, 1866-1875 and J. Yum, B. S. Kim, S. Ogura, R. Kamegawa, M. Naito, Y. Yamasaki, H. J. Kim, K. Miyata, J. Controlled Release 2022, 342, 148-156) with slight modification. 10 μL of a solution containing 10 mg/mL lipo-oligomer in water was diluted with 90 μL HEPES buffer (20 mM, pH 7.4) in 1.5 mL reaction tubes.100 μL n-octanol were then added. The tubes were shaken at 1400 rpm for 24 h. Afterwards, the tubes were centrifuged followed by storage at 4 °C for 1 h to separate n-octanol and water phases. The concentration of lipo-oligomer in each phase was determined by RP-HPLC analysis. For this, a VWR Hitachi Chromaster HPLC system equipped with a 5160 pump module, a 118371P1272PC 5260 auto sampler, a 5310 column oven, and a 5430 diode array detector, a YMC C18 column (HS- 302, HS12S05-1546WT, 5 µm, 4.6 x 150 mm, 12 nm, YMC Europe GmbH, Dinslaken, Germany) and a water/acetonitrile gradient (95:5 - 0:100) containing 0.1 % TFA were used. The extinction at 280 nm was monitored and the peak areas (A) of the oligoamino amides were determined. LogD7.4 was calculated as log(Aoctanol / Awater). All experiments were performed in triplicates. EC50-logD7.4 correlation was analyzed with a second order polynomial equation by GraphPad prism 5. sgRNA sequences [144] Chemically modified sgRNAs with the following sequences were obtained from Integrated DNA Technologies IDT (Leuven, Belgium). sgRNA/ssD Sequences NA sgGFP1[a] mG*mA*mC*rCrArGrGrArUrGrGrGrCrArCrCrArCrCrCrGrUrUrUrUrArGrArGrCrUrArGrArArAr UrArGrCrArArGrUrUrArArArArUrArArGrGrCrUrArGrUrCrCrGrUrUrArUrCrArArCrUrUrGrArArA rArArGrUrGrGrCrArCrCrGrArGrUrCrGrGrUrGrCmU*mU*mU*rU (SEQ ID NO: 108) sgGFP2[b] mG*mC*mU*rGrArArGrCrArCrUrGrCrArCrGrCrCrGrUrGrUrUrUrUrArGrArGrCrUrArGrArArAr UrArGrCrArArGrUrUrArArArArUrArArGrGrCrUrArGrUrCrCrGrUrUrArUrCrArArCrUrUrGrArArA rArArGrUrGrGrCrArCrCrGrArGrUrCrGrGrUrGrCmU*mU*mU*rU (SEQ ID NO: 109) ssDNA G*C*CACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTG CCCTGGCCCACCCTCGTGACCACCCTGAGCCACGGCGTGCAGTGCTTCAGCCGCTACC CCGACCACAT*G*A (SEQ ID NO: 110) [a] sgGFP1 was used in eGFP knockout experiments. [b] sgGFP2 was used together with the ssDNA template in homology-directed repair (HDR) mediated eGFP to BFP conversion experiments; ‘m’ indicates 2'-O-methylated nucleosides; ‘*’ indicates phosphorothioate linkages and ‘r’ indicates ribonucleotides. Preparation of Cas9 RNP and Cas9 RNP/ssDNA nanocarriers [145] Cas9 protein expression and purification was performed as described in Kuhn et al., (Bioconjugate Chemistry, 2020, 31.3: 729-742). Cas9 protein and sgRNA were mixed at 1:1 molar ratio and incubated at RT for 15 min to form the Cas9/sgRNA ribonucleoprotein (RNP) complexes. Afterwards, Cas9 RNP was added into the lipo-oligomer solution in HBG buffer (20 mM HEPES, 5% glucose, pH 7.4) at an N/P (nitrogen to phosphate of sgRNA) ratio of 24. The solution was mixed thoroughly by pipetting up and down and incubated at RT for another 15 min to generate the final Cas9 RNP nanocarriers. In case of preparing Cas9 RNP/ssDNA nanocarriers for HDR experiments, Cas9 RNP was mixed with ssDNA HDR template at 1:1 molar ratio and then added into the lipopeptide solution in HBG buffer (pH 7.4) at an N/P (nitrogen to phosphate of sgRNA plus ssDNA) ratio of 12. The solution was mixed and incubated for 40 min to generate the Cas9 RNP/ssDNA nanocarriers. Characterization of Cas9 RNP nanocarriers [146] The hydrodynamic size, PDI and zeta potential of Cas9 RNP nanocarriers were measured by DLS using a Zetasizer Nano ZS (Malvern Instruments, UK). Cas9 RNP nanocarriers were prepared as described above. The hydrodynamic size of Cas9 RNP nanocarriers containing 1.25 μg Cas9 protein and 0.25 μg sgRNA (Cas9/sgRNA, 1:1 molar ratio) in 100 μL HBG was measured. Afterwards, 700 μL HEPES buffer (20 mM, pH 7.4) were added to each sample and the solution was mixed for the zeta potential measurement. For the dilution stability study, Cas9 RNP nanocarriers were prepared at an RNP concentration of 375 nM (6.25 μg Cas9 protein and 1.25 μg sgRNA) and then diluted with 118371P1272PC HBG buffer to a series of RNP concentrations (75, 50, 25, 10, 5, 2.5, 1, 0.5, and 0.1 nM). The size and zeta potential of diluted samples were measured as described above. Ribogreen assay [147] sgRNA amount in naked Cas9/sgRNA ribonucleoproteins (Cas9 RNPs) or Cas9 RNP nanoparticles were determined using a Quant-iTTM RiboGreen® RNA assay kit (Invitrogen, CA, USA).50 μL of naked Cas9 RNPs or Cas9 RNP nanoparticles containing 250 ng Cas9 protein and 50 ng sgRNA were mixed with 50 μL of TE buffer and were added to the 96-well plate. The plate was incubated for 10 min. Afterwards, 100 μL of Ribogreen solution (diluted 1:100 in TE buffer) was added to each well. The plate was incubated for another 5 min. Ribogreen fluorescence intensity was detected using a microplate reader (Spectrafluor Plus, Tecan, Männedorf, Switzerland) with excitation and emission wavelength of 485 and 528 nm, respectively. Heparin competition assay [148] Heparin competition assay was performed to evaluate the nanocarrier stability against anionic stress.50 μL TE buffer containing different amounts of Heparin were added to the 96-well plate.50 μL of Cas9 RNP nanocarriers containing 250 ng Cas9 protein and 50 ng sgRNA were prepared and added to each well. The final amounts of Heparin were 0, 0.25, 0.5, 1, 2.5, 5 IU per μg of sgRNA. The plate was incubated at 37 °C for 30 min. Afterwards, 100 μL Ribogreen solution was added and a Ribogreen assay was performed. HBG buffer and naked Cas9 RNP at the same conditions were prepared as the controls. After subtraction of the blank wells (HBG buffer), the fraction of dye exclusion was calculated as [1 − fraction of Ribogreen intercalation (normalized to Ribogreen intercalation of naked Cas9/sgRNA RNP)]. All experiments were performed in triplicate. Nanocarrier stability in salt conditions [149] Nanocarrier stability against salt was studied using NaCl solutions.50 μL TE buffer containing different concentrations of NaCl were added to the 96-well plate. 50 μL of Cas9 RNP nanocarriers containing 250 ng Cas9 protein and 50 ng sgRNA were prepared and added to each well. The final concentrations of NaCl were 0, 0.05, 0.15, 0.25, 0.5, 5 M. The plate was incubated at 37 °C for 30 min. Afterwards, 100 μL Ribogreen solution was added and a Ribogreen assay was performed. HBG buffer and naked Cas9 RNP at the same conditions were prepared as the controls. After subtraction of the blank wells (HBG buffer), the fraction of dye exclusion was calculated as [1 − fraction of Ribogreen intercalation (normalized to Ribogreen intercalation of naked Cas9/sgRNA RNP)]. All experiments were performed in triplicate. Establishment of HeLa GFPd2 cell line [150] HeLa cells were transfected using a Super piggyBac Transposase expression vector (SBI, CA, USA) and a PB-CAG-GFPd2 plasmid (Rui et al., ACS Appl Mater Interfaces, 11(11), 2019, 10472- 10480). PB-CAG-GFPd2 was a gift from Jordan Green (Addgene plasmid # 115665; http://n2t.net/addgene:115665; RRID:Addgene_115665). Afterwards, the cells were incubated and passaged twice a week for 3 weeks, allowing the GFP fluorescence from transient transfections to 118371P1272PC fade. Subsequently, GFP-positive cells were sorted and collected by fluorescence-assisted cell sorting (FACS). The colonies from single GFP-positive cells were generated using limited dilution method. A stably GFP-expressing cell population was selected from the regrown colonies by flow cytometry. Establishment of HeLa eGFP/tub cell line [151] For the generation of stably expressing HeLa eGFP/tub cells, the plasmid vector pEGFP- Tubulin (Clontech Laboratories) was linearized by restriction digestion and transfected into the cells. The vector contains a neomycin resistance cassette, which enables selection of stably transfected cells by cultivation with G418. Single colonies from the surviving cell populations were generated using limited dilution method. Cell populations generated from the regrown clones were analyzed by flow cytometry and a monoclonal cell lines with stable eGFP expression was selected. Cell culture [152] HeLa WT, HeLa eGFP/tub, and HeLa GFPd2 (destabilized eGFP) cells were grown in DMEM medium supplemented with 10 % FBS, 100 U/mL penicillin, and 100 μg/mL streptomycin. The cells were cultured in ventilated flasks in the cell incubator at 37 °C and 5 % CO2 in a humidified atmosphere. The cells were passaged at a confluency of approximately 80 %. Flow cytometry [153] Cells were harvested and resuspended in 600 μL of FACS buffer (PBS buffer containing 10 % FBS). The samples were analyzed by flow cytometry on a CytoFLEX S flow cytometer (Beckman Coulter, CA, USA). For eGFP knockout and cellular uptake experiments, 0.6 μL of 1 μg/μL DAPI was added to each sample for differentiating live and dead cells before the measurement. The DAPI signal and BFP fluorescence were detected with 405 nm excitation and 450 nm emission. The eGFP and ATTO488 fluorescence was assayed with 488 nm excitation and 530 nm emission. The ATTO647N fluorescence was assayed with 640 nm excitation and 670 nm emission. Ten thousand of isolated live cells were counted and evaluated. The data were analyzed using FlowJo 7.6.5 by FlowJo, LLC (Becton, Dickinson and Company, USA). Cellular uptake of Cas9 RNP nanocarriers [154] Cellular uptake of Cas9 RNP nanocarriers was evaluated by flow cytometry and confocal laser scanning microscopy (CLSM). For flow cytometry experiments, HeLa WT cells were seeded into 24- well plates at a density of 25000 cells/well one day prior to the treatments. On the next day, the medium was replaced with 400 μL of fresh medium. Cas9 RNP nanocarriers were prepared as described above using 20 % of ATTO647N-labeled Cas9 and 20 % of ATTO488-labeled sgRNA. 100 μL of RNP nanocarriers were added to each well resulting in a final concentration of 75 nM Cas9 RNP followed by incubation of the cells for 4 h. Afterwards, the medium was removed and 500 μL PBS containing 2000 IU heparin was added to disassociate the nanocarriers attached to the cell membrane. The cells were incubated on ice for 30 min. Subsequently, the cells were collected and prepared for flow cytometry analysis on a CytoFLEX S flow cytometer (Beckman Coulter, CA, USA). All experiments were performed in triplicate. 118371P1272PC Endocytosis pathway study [155] Endocytosis pathway of Cas9 RNP nanocarriers with varied hydrophobicity was investigated by using different endocytosis inhibitors. One day prior to the treatments, HeLa WT cells were seeded into 24-well plates at a density of 25000 cells/well. On the next day, the medium was replaced with 500 μL of serum-free medium containing different endocytosis inhibitors (15.4 mM sodium azide, 10 μM chlorpromazine, 450 mM sucrose, 54 μM nystatin, or 1 mM amiloride). The cells were incubated at 37 °C for 2 h. Afterwards, the medium was replaced with 400 μL of fresh medium.100 μL of dye- labeled RNP nanocarriers were added to each well resulting in a final concentration of 75 nM Cas9 RNP followed by incubation of the cells for 4 h. For 4 °C group, the cells were placed on ice for 2 h prior to the treatment of 75 nM Cas9 RNP in ice-cold medium. Afterwards, the medium was removed and 500 μL PBS containing 2000 IU heparin was added followed by incubation of the cells on ice for 30 min. The cells were then collected and prepared for flow cytometry analysis on a CytoFLEX S flow cytometer (Beckman Coulter, CA, USA). All experiments were performed in triplicate. Description eGFP knockout experiment [156] One day prior to eGFP knockout experiment, HeLa eGFP/tub cells were seeded into 96-well plates at a density of 5000 cells/well. On the next day, the medium in each well was replaced with 80 μL of fresh medium. Cas9 protein was mixed with sgGFP1 at a molar ratio of 1:1 and the RNP complexes were incubated for 15 min at room temperature. Cas9 RNP nanoparticles were prepared by mixing pre-assembled Cas9 RNP complexes with oligomers at N/P ratio of 24 at RNP dose of 500 nM and then diluted to a series of concentrations (375, 250, 125, 50, 25, 12.5, 5, 2.5, and 0.5 nM) with HBG buffer. The N/P ratio defines the lipo-oligomer nitrogen (N) to sgRNA phosphate (P) ratio. The RNP nanoparticles were incubated for 15 min at room temperature.20 μL of RNP nanoparticles with different concentrations was added to each well resulting in final concentrations of 100, 75, 50, 25, 10, 5, 2.5, 1, 0.5, and 0.1 nM RNP complexes. The cells were incubated for 48 h. Afterwards, the cells were trypsinized and transferred to the 24-well plates. After another 3 days incubation, the cells were harvested and resuspended in 600 μL of FACS buffer. The samples were analyzed by flow cytometry on a CytoFLEX S flow cytometer (Beckman Coulter, CA, USA). Before the measurement, 1 ng/μL DAPI was added to differentiate between live and dead cells. The DAPI signal was detected with 405 nm excitation and 450 nm emission. The eGFP fluorescence was assayed with 488 nm excitation and 530 nm emission. Ten thousand of isolated live cells were counted and evaluated. The data were analyzed using FlowJo 7.6.5 by FlowJo, LLC (Becton, Dickinson and Company, USA). All experiments were performed in triplicate. Description homology-directed repair (HDR) experiment [157] A single base substitution (196 T>C) in the chromophore of wild-type (wt) green fluorescent protein (GFP) shifts its fluorescent absorption and emission towards the blue spectrum, creating the blue fluorescent protein (BFP). This can be exploited to detect CRISPR/Cas9 mediated HDR. [158] One day prior to GFP to BFP HDR experiment, HeLa GFPd2 cells were seeded into 96-well plates at a density of 5000 cells/well. On the next day, the medium in each well was replaced with 80 118371P1272PC μL of fresh medium. Pre-assembled Cas9/sgGFP RNP was mixed with single stranded DNA template (ssDNA) at various molar ratios (1:0.5, 1:1, 1:2, 1:3, 1:4, 1:5, 1:8, 1:10, 1:15, and 1:20). Cas9 RNP/ssDNA nanoparticles were prepared by mixing Cas9 RNP/ssDNA complexes with lipo-oligomers at N/P ratio of 12 at RNP dose of 500 nM and then diluted to a series of concentrations (375, 250, 125, 50, 25, 12.5, 5, 2.5, and 0.5 nM) with HBG buffer (20 mM HEPES, 5% glucose, pH 7.4). The RNP/ssDNA nanoparticles were incubated for 45 min at room temperature. 20 μL of RNP/ssDNA nanoparticles with different concentrations was added to each well resulting in final concentrations of 100, 75, 50, 25, 10, 5, 2.5, 1, 0.5, and 0.1 nM RNP complexes. The cells were incubated for 48 h. Afterwards, the cells were trypsinized and transferred to the 24-well plates. After another 3 days incubation, the cells were harvested and resuspended in 600 μL of FACS buffer. The samples were analyzed by flow cytometry on a CytoFLEX S flow cytometer (Beckman Coulter, CA, USA). The BFP fluorescence was detected with 405 nm excitation and 450 nm emission. The GFP fluorescence was assayed with 488 nm excitation and 530 nm emission. Ten thousand of cells were counted and evaluated. The data were analyzed using FlowJo 7.6.5 by FlowJo, LLC (Becton, Dickinson and Company, USA). All experiments were performed in triplicate. Cell viability assay (MTT) [159] Treatments were performed as described in eGFP knockout and HDR studies. The cells were incubated for 48 h and an MTT assay was then carried out.10 μL of MTT (5 mg/mL) was added to each well. Cells were incubated for 2 h. Afterwards, medium was removed and the plate was frozen at – 80 °C for 4 h.100 μL of DMSO was added to each well. The plate was incubated for another 30 min at 37 °C under constant shaking. The absorbance was measured at 590 nm with background correction at 630 nm using a fluorescence microplate reader (Tecan, Männedorf, Switzerland). The relative cell viability (%) was calculated relative to control wells treated with HBG buffer as ([A] test/[A] control) × 100 %. All experiments were performed in triplicate. Statistical analysis [160] Half maximal effective concentration (EC50) values were calculated by GraphPad prism 5. EC50-logD7.4 correlation was analyzed with a second order polynomial equation by GraphPad prism 5. All other data were analyzed with GraphPad prism 5 and presented as arithmetic mean ± standard deviation (SD) of at least triplicates. The statistical significance of the experiments was estimated using the two-tailed student’s t-test, *** p ≤ 0.001, ** p ≤ 0.01, * p ≤ 0.05. Example 1: Oligomers with optimized sequences [161] Sequence-defined oligomers with different sequences based on α-amino acids and the artificial amino acid succinyl-tetraethylenepentamine and fatty acids were generated to identify optimized sequence-defined T-shape lipo-oligomers for Cas protein/gRNA RNP complex delivery, such as oligomer IDs #1208 to 1591 as shown in Table 1, including the already known structure 1445 (Stp2- C-OHSteA) as described in Kuhn et al., (Kuhn, J. et al., Delivery of Cas9/sgRNA Ribonucleoprotein Complexes via Hydroxystearyl Oligoamino Amides, Bioconjugate Chemistry, 2020, 31, 729-742). These sequence-defined oligomers are summarized and illustrated as 1Stp series and 2Stp series in 118371P1272PC Figure 1 showing the lead compound Stp as representative artificial amino acid. The core structures of the 1Stp and 2Stp series differ in the presence of one or two Stp on either side of the central lysine (either chain (N-terminal and C-terminal) of the head group). [162] The artificial amino acid, succinyl-tetraethylenepentamine (Stp), serves as an ionizable unit to complex negatively charged cargo, such as Cas9 RNP, and facilitate cellular delivery (D. Schaffert et al., Organic Letters 2011, 13, 1586-1589; D. Schaffert et al., Angewandte Chemie International Edition 2011, 50, 8986-8989; Krhač Levačić et al., Journal of Controlled Release 2021, 339, 27-40; T. Benli- Hoppe et al., Macromolecular Rapid Communications 2021, n/a, 2100602; J. Luo et al., Advanced Functional Materials 2019, 29, 1900697). The hydrophobic tyrosine (Y) tripeptide motif enhances nanoparticle stability via hydrophobic interactions and improves transfection efficiency (C. Troiber et al., Biomaterials 2013, 34, 1624-1633; S. Berger et al., Biomacromolecules 2021, 22, 1282-1296). Here, the lead structure Stp2-C-OHSteA (oligomer ID #1445) has been varied systematically to elucidate structure-activity relationships and evolve the next generation of RNP carriers. Variations of the structural parameters of 1) presence of cysteine (C), 2) presence of histidine (H), 3) number of Stp units, and 4) type of fatty acid were introduced into the peptide sequence (Figure 1). All tested compounds comprised an N-terminal azido-lysine which can be used for coupling of a targeting ligand, but has no function with regard to the cargo delivery and/or nanoparticle stability. The Cas9 RNP nanoparticles were prepared by straightforward complexation of the lipopeptides with Cas9 RNP at an N/P ratio of 24. The hydrodynamic size, polydispersity index (PDI), and zeta potential of each nanoparticle were then determined by dynamic light scattering (DLS, Table 2). Most lipopeptides generated RNP nanoparticles with a size between 150 – 250 nm and PDI of 0.15 – 0.40, except Stp2 and Stp2-H structures, which led to larger complexes (250 – 500 nm). Besides, all nanoparticles exhibited a positive surface charge with a zeta potential between 10 – 19 mV Table 2. ID number, sequence, MALDI-MS of all lipopeptides and hydrodynamic size, PDI, zeta potential of Cas9 RNP nanoparticles formed with the lipopeptides (Cas9 RNP nanoparticles were prepared at a N/P ratio of 24 and an RNP concentration of 75 nM. The hydrodynamic size (z-average, nm), PDI and zeta potential of the nanoparticles were measured by DLS using a Zetasizer Nano ZS (Malvern Instruments, UK)). 118371P1272PC 1579 C-Y3-Stp-K(K(LenA)2)-Stp-Y3-C 151.5 ± 6.8 0.29 ± 0.03 11.5 ± 0.2 2675.51 2671.4 1580 C-Y3-Stp-K(K(CholA)2)-Stp-Y3-C 190.1 ± 6.0 0.19 ± 0.03 14.1 ± 0.8 2839.67 2833.69 1582 C-Y3-Stp-K(K(OHSteA)2)-Stp-Y3-C 180.2 ± 4.3 0.24 ± 0.02 12.2 ± 1.2 2719.60 2713.53 1587 C-Y3-H-Stp-H-K(K(SteA)2)-H-Stp-H-Y3-C 245.1 ± 10.3 0.27 ± 0.02 14.1 ± 0.1 3235.84 3230.05 1583 C-Y3-H-Stp-H-K(K(OleA)2)-H-Stp-H-Y3-C 195.3 ± 5.8 0.15 ± 0.01 12.3 ± 1.9 3231.81 3228.02 1584 C-Y3-H-Stp-H-K(K(LinA)2)-H-Stp-H-Y3-C 235.8 ± 9.5 0.23 ± 0.04 12.8 ± 1.7 3227.78 3223.99 1585 C-Y3-H-Stp-H-K(K(LenA)2)-H-Stp-H-Y3-C 202.4 ± 8.7 0.39 ± 0.04 13.4 ± 0.7 3223.75 3218.96 1586 C-Y3-H-Stp-H-K(K(CholA)2)-H-Stp-H-Y3-C 199.0 ± 8.6 0.36 ± 0.03 16.1 ± 0.6 3387.91 3383.24 1588 C-Y3-H-Stp-H-K(K(OHSteA)2)-H-Stp-H-Y3-C 190.1 ± 6.0 0.20 ± 0.03 12.9 ± 0.7 3267.83 3261.05 1361 Y3-Stp2-K(K(SteA)2)-Stp2-Y3 377.5 ± 56.6 0.37 ± 0.01 17.5 ± 1.4 3023.99 3017.93 1208 Y3-Stp2-K(K(OleA)2)-Stp2-Y3 379.2 ± 70.5 0.29 ± 0.03 14.1 ± 0.4 3019.96 3013.69 1399 Y3-Stp2-K(K(LinA)2)-Stp2-Y3 345.5 ± 33.8 0.29 ± 0.01 13.1 ± 0.9 3015.93 3011.87 1400 Y3-Stp2-K(K(LenA)2)-Stp2-Y3 385.0 ± 47.5 0.35 ± 0.03 14.3 ± 1.6 3011.90 3005.84 1364 Y3-Stp2-K(K(CholA)2)-Stp2-Y3 501.6 ± 52.6 0.41 ± 0.01 13.0 ± 1.9 3176.05 3170.12 1573 Y3-Stp2-K(K(OHSteA)2)-Stp2-Y3 440.3 ± 33.2 0.24 ± 0.01 14.3 ± 0.3 3055.98 3051.93 1321 Y3-(H-Stp)2-H-K(K(SteA)2)-H-(Stp-H)2-Y3 340.2 ± 31.2 0.16 ± 0.04 14.3 ± 1.5 3846.34 3840.77 1209 Y3-(H-Stp)2-H-K(K(OleA)2)-H-(Stp-H)2-Y3 338.3 ± 28.0 0.28 ± 0.05 14.9 ± 0.5 3842.31 3836.73 1401 Y3-(H-Stp)2-H-K(K(LinA)2)-H-(Stp-H)2-Y3 478.7 ± 8.1 0.16 ± 0.02 11.1 ± 1.5 3838.28 3832.71 1402 Y3-(H-Stp)2-H-K(K(LenA)2)-H-(Stp-H)2-Y3 288.5 ± 17.5 0.45 ± 0.04 11.9 ± 0.5 3834.25 3830.67 1403 Y3-(H-Stp)2-H-K(K(CholA)2)-H-(Stp-H)2-Y3 366.8 ± 37.7 0.40 ± 0.04 13.9 ± 1.0 3998.41 3995.96 1574 Y3-(H-Stp)2-H-K(K(OHSteA)2)-H-(Stp-H)2-Y3 256.4 ± 11.5 0.37 ± 0.03 12.4 ± 0.3 3878.33 3872.76 1337 C-Y3-Stp2-K(K(SteA)2)-Stp2-Y3-C 201.4 ± 10.6 0.29 ± 0.03 16.7 ± 1.9 3230.01 3226.22 1338 C-Y3-Stp2-K(K(OleA)2)-Stp2-Y3-C 166.6 ± 5.8 0.25 ± 0.03 16.6 ± 0.4 3225.98 3221.18 1199 C-Y3-Stp2-K(K(LinA)2)-Stp2-Y3-C 159.3 ± 5.9 0.23 ± 0.02 15.9 ± 1.3 3221.95 3217.15 1200 C-Y3-Stp2-K(K(LenA)2)-Stp2-Y3-C 160.6 ± 4.3 0.17 ± 0.03 16.8 ± 1.2 3217.92 3211.12 1340 C-Y3-Stp2-K(K(CholA)2)-Stp2-Y3-C 203.4 ± 6.9 0.28 ± 0.03 15.4 ± 0.8 3382.07 3376.41 1445 C-Y3-Stp2-K(K(OHSteA)2)-Stp2-Y3-C 177.7 ± 5.9 0.25 ± 0.04 16.5 ± 1.7 3262.00 3256.56 1278 C-Y3-(H-Stp)2-H-K(K(SteA)2)-H-(Stp-H)2-Y3-C 205.1 ± 12.9 0.20 ± 0.04 15.1 ± 1.1 4052.36 4048.05 1214 C-Y3-(H-Stp)2-H-K(K(OleA)2)-H-(Stp-H)2-Y3-C 185.5 ± 5.7 0.26 ± 0.05 18.5 ± 1.5 4048.33 4042.02 1389 C-Y3-(H-Stp)2-H-K(K(LinA)2)-H-(Stp-H)2-Y3-C 178.5 ± 10.2 0.30 ± 0.02 16.8 ± 1.2 4044.30 4038.99 1390 C-Y3-(H-Stp)2-H-K(K(LenA)2)-H-(Stp-H)2-Y3-C 188.8 ± 9.9 0.28 ± 0.02 15.8 ± 0.6 4042.96 4036.96 1575 C-Y3- 2-H-K -H- 2-Y3-C 200.7 ± 10.3 0.33 ± 0.03 14.7 ± 1.4 4204.43 4200.25 *All sequences were synthesized and analysed with an N-terminal azido lysine (K(N3)). [163] The gene knockout efficiency and cytotoxicity of the nanoparticles were investigated in HeLa eGFP/tub cells after treatment with 75 nM RNP for 48 h (Figure 2A). The systematic evaluation demonstrated the effect of each variation. Firstly, cysteine showed benefits in lipo-oligomers containing 2 Stp units at each side beyond the lysine (Stp2 structures), but rather decreased the 118371P1272PC transfection efficiency in Stp1-based sequences. Secondly, histidine which has been previously shown to facilitate endosomal escape of pDNA polyplexes did not induce significant improvement in case of RNP nanoparticles. Thirdly, Stp1 structures in general demonstrated a better knockout performance than Stp2 structures. Lastly, in all cases unsaturated (OleA, LinA, LenA) or hydroxyl-modified fatty acids (OHSteA) were essential to mediate significant gene editing; saturated stearic acid (SteA) as well as the steroid cholanic acid almost completely interrupted any knockout efficiency. Seven lipopeptides exhibited better or comparable knockout efficiency than the initial structure with the oligomer ID # 1445 (Stp2-C-OHSteA) and especially the Stp1 series outperformed the preceding lead structure. Over 90 % of eGFP knockout was achieved with these structures at the dose of 75 nM RNP. To differentiate the potency of the nanoparticles more in depth, a dose titration experiment was conducted in the concentration range of 1 nM – 100 nM RNP (Figure 2B). The lead structure Stp2-C- OHSteA (#1445, Figure 3 top) showed a clear dose-dependent activity and eGFP knockout levels dropped below 40% at concentrations of 10 nM RNP or lower. [164] The new lipopeptide analogs Stp1-LinA (#1392, Figure 3 middle), Stp1-LenA (#1393) and Stp1- H-LinA (#1396, Figure 3 bottom) turned out to be much more potent and induced ~80 % eGFP knockout even at the lowest RNP dose of 1 nM. Cell viability studies showed that all nanoparticles were generally well-tolerated except Stp1-C-OHSteA (data not shown). Example 2: Oligomers with optimized artificial amino acid building blocks [165] Due to the generally more hydrophobic nature of the identified outperformers with lower content of ionizable artificial amino acid than the initial Stp2-C-OHSteA (#1445), it was hypothesized that the hydrophobicity of the lipo-oligomers may be an important parameter to achieve efficient Cas9 RNP delivery. Consequently, the potency could be improved even further by fine tuning the hydrophobic properties of the artificial amino acid units. To validate this hypothesis, a series of artificial amino acid building blocks with varied hydrophilic or hydrophobic structural elements and suitable protective groups for SPPS was synthesized (Scheme 1 and 2 above, Figure 4B). [166] Eight more hydrophobic Stp analogs were obtained by replacing tetraethylenepentamine (tp) by oligoamines with lower number of ionizable nitrogens (triethylenetetramine, tt or 3,3’- ethylenediiminodipropylamine, EIPA), and by including more hydrophobic dicarboxylic acids instead of succinic acid. Two more hydrophilic analogs were generated by replacing succinic acid by more hydrophilic dicarboxylic acids containing an amine or ether group (IDAtp and dGtp). For a systematic evaluation of the new building blocks, the backbone sequences of the two best-performers Stp1-LinA (#1392) and Stp1-H-LinA (#1396), as well as the initial lead structure Stp2-C-OHSteA (#1445) were selected as lipo-oligomer architectures (Figure 3). The combination of 11 building blocks with 3 architectures resulted in a total of 33 lipopeptides which were synthesized by SPPS (#1445, #1392, #1396 and #1631 - #1744 of Table 1). [167] LogD7.4 of each lipopeptide was determined by quantifying the compound concentration in octanol and water phases by reversed-phase HPLC after mixing and phase separation (H. J. Kim et 118371P1272PC al., ACS Central Science 2019, 5, 1866-1875; A. Andrés et al., European Journal of Pharmaceutical Sciences 2015, 76, 181-191; C. Giaginis and A. Tsantili‐Kakoulidou, Journal of Liquid Chromatography & Related Technologies 2007, 31, 79-96). The determined logD7.4 values (data not shown) indicated the following order of artificial amino acids with increasing hydrophobicity: IDAtp < dGtp < Stp < Gtp < TFE-IDAtp < Htp < chGtp < Gtt < GEIPA < Ptp < Ntp. Cas9 RNP nanoparticles were then formulated with the lipopeptides (N/P = 24), and the size, PDI and zeta potential were determined by DLS. All lipopeptides formed homogeneous nanoparticles with Cas9 RNP with a size of 140 – 190 nm, PDI of 0.15 – 0.38, and zeta potential of 10.5 – 17.2 mV (Table 2). A dose titration study in the RNP concentration range between 0.1 nM – 100 nM was performed and the eGFP knockout EC50 of each lipopeptide was calculated (Figure 5-7). [168] In general, structures based on the X1-LinA architecture (1392-based structures) exhibited the best knockout efficiency, where 6 out of 11 lipo-oligomers achieved ~75 - 80 % eGFP knockout at 1 nM RNP dose and 3 out of 11 lipopeptides even induced over 50 % eGFP disruption at 0.5 nM. X1- H-LinA based structures (1396-based structures) also demonstrated very high potency, but slightly lower efficacy than X1-LinA derivatives (1392-based structures) at very low doses of RNP (0.5 nM). Notably, the performance of X2-C-OHSteA structures (1445-based structures) was significantly enhanced by introducing more hydrophobic artificial amino acids (Gtt, GEIPA, Htp, chGtp, TFE-IDAtp). The best performers of each lipopeptide series were identified as Gtt2-C-OHSteA (#1636), GEIPA1- H-LinA (#1653), and TFE-IDAtp1-LinA (#1739). Especially, TFE-IDAtp1-LinA (#1739) achieved up to 99 % eGFP knockout at RNP concentrations down to 5 nM, ~88 % knockout at 1 nM, and still enabled ~61 % eGFP disruption at 0.5 nM. Cell viability studies revealed that Htp and chGtp containing structures were toxic at high RNP concentrations (25 – 100 nM) while all other artificial amino acids- containing lipopeptides were well-tolerated in the investigated concentration range (data not shown). [169] To correlate the obtained structure-activity relationships with hydrophobic characteristics, the logD7.4 was plotted versus eGFP knockout EC50 values for each lipopeptide series (Figure 8). A clear correlation between the logD7.4 and EC50 was found, and optimal logD7.4 ranges were identified for each sequence-defined lipopeptide series. The efficacy of structures with logD7.4 values beyond the optimal range (too hydrophililc or too hydrophobic) dramatically dropped. [170] To explore the reason why hydrophobically balanced lipopeptides are more potent, especially at low RNP concentrations, a group of representatives covering the spectrum from most hydrophilic to most hydrophobic were selected for investigation of the impact on critical carrier characteristics. The set of lipo-oligomers consisted of IDAtp-, Stp-, TFE-IDAtp-, Gtt-, GEIPA-, and Ntp-based structures. Firstly, the integrity of the nanoparticles upon dilution was investigated (Figure 9A). The nanoparticles were prepared at a high RNP concentration of 375 nM and then sequentially diluted to concentrations ranging from 0.1 nM to 75 nM. The size of IDAtp2-C-OHSteA (#1736) and Stp2-C- OHSteA (#1445), the two most hydrophilic X2-C-OHSteA structures (1445-based structure), immediately increased upon dilution and was not detectable at a RNP concentration of 1 nM or lower. In contrast, the more hydrophobic analogs exhibited improved dilution stability. A similar tendency was observed with the more hydrophobic X1-H-LinA (1396-based structure) and X1-LinA (1392-based 118371P1272PC structure) architectures that were generally more resistant towards dilution. Nanoparticles generated with the most hydrophobic structure, Ntp1-LinA (#1343), retained a stable size between 180 – 220 nm at 2.5 – 375 nM of RNP and were still detectable at 0.1 nM. In addition, the stability of the nanoparticles against excessive amounts of ions was investigated by the detection of RNA release with the intercalating dye Ribogreen (Figure 9B and 9C). Sodium chloride (NaCl) and the polyanion, heparin, were selected as ionic stress factors in this study. At isotonic NaCl concentration (0.15 M), all the nanoparticles showed robust encapsulation of Cas9 RNP. With increasing NaCl concentrations, higher Ribogreen fluorescence was detected indicating lower dye exclusion and therefore release of Cas9 RNP from dissociated nanoparticles (Figure 9B). Notably, the more hydrophobic lipopeptides of each series exhibited better resistance against NaCl. Similar trends were found in the heparin competition assay, where hydrophobic artificial amino acids remarkably enhanced the nanoparticle stability against polyanionic stress (Figure 9C). [171] To examine the cellular uptake of hydrophobically balanced Cas9 RNP nanocarriers, flow cytometry experiments were performed with ATTO647N-labeled Cas9 and ATTO488-labeled sgRNA (Figure 9D). The results demonstrated a general correlation of higher cellular uptake with increasing hydrophobic properties. A representative example are the hydrophobic Ntp-based structures, where Ntp2-C-OHSteA (#1635) and Ntp1-LinA (#1643) achieved 4.4- and 7.3-foldenhanced sgRNA uptake compared to the Stp-based analogs. CLSM studies further confirmed the observation that Ntp2-C- OHSteA (#1635) and Ntp1-LinA (#1643) leads to higher Cas9 RNP uptake, indicated by the brighter intracellular fluorescence in HeLa cells (data not shown). Furthermore, the endocytosis pathways of Stp2-C-OHSteA (#1445), Ntp2-C-OHSteA (#1635), Stp1-LinA (#1392), and Ntp1-LinA (#1643) nanoparticles were probed by pretreating the cells with different inhibitors or incubation at 4 °C (data not shown). Low temperature and sodium azide inhibited the uptake of all 4 nanoparticles by 85-90 % and 65-77 % respectively, indicating an energy-dependent internalization mechanism. Chlorpromazine and sucrose were the only other inhibitors that significantly reduced the uptake of the more hydrophilic Stp2-C-OHSteA (#1445) nanoparticle, suggesting a dominant role of clathrin- mediated endocytosis. Interestingly, the Cas9 RNP uptake mediated by the more hydrophobic lipopeptides Ntp2-C-OHSteA (#1635), Stp1-LinA (#1392), and Ntp1-LinA (#1643) could also be blocked by pretreatment with amiloride, which indicates a contribution of macropinocytosis in addition to the clathrin-mediated pathway. Notably, macropinosomes are reported to be more leaky than other endosomes, which may be beneficial for the translocation of nanoparticles into the cytosol (J. S. Wadia et al., Nature Medicine 2004, 10, 310-315; Z. Zhang et al., Advanced Materials 2021, 33, 2102219; W. Zhang et al., Theranostics 2019, 9, 1580-1598). Following the intracellular delivery pathway stepwise, an endosomal escape reporter cell line HeLa mRuby3/gal8 (Y. Rui et al., Science Advances 2022, 8, eabk2855) was used to evaluate the endosomal escape capability of the selected nanoparticles (data not shown). In this model, the rupture of endosomal membranes results in recruitment of a mRuby3/galectin-8 (gal8) fusion protein which is visible by intracellular punctate red spots. After 4 h treatment, the Ntp-based structures were found to induce a higher number of endosomolytic events than their Stp counterparts, especially at a low RNP concentration (5 nM). Notably, the peptide architecture played an additional fundamental role in the endosomal escape 118371P1272PC process, since the X1-LinA sequences (1392-based structures) showed much better endosomal escape efficiency than the X2-C-OHSteA lipo-oligomer (1445-based structure). [172] Taken the above results together, the mechanistic effects can be explained as follows: hydrophobic lipopeptides form Cas9 RNP nanoparticles, which 1) are more resistant towards dilution- mediated dissociation and remain intact at low concentrations; 2) are more resistant towards ionic stress and avoid premature cargo release; 3) mediate more efficient cellular internalization that is driven by both clathrin-mediated endocytosis and macropinocytosis; and 4) possess a higher endosomal escape capacity. The fact, that optimal logD7.4 ranges and a requirement of finding the right balance have been observed can be explained, since too stable nanoparticles may result in insufficient cargo release in the right place at the right time. Example 3: [173] Having demonstrated that hydrophobically balanced lipopeptides are potent nanoparticles for delivering Cas9 RNP to mediate gene knockouts via non-homologous end joining (NHEJ), we sought to extend the scope of application: the top 5 lipopeptides of each series were selected for the co- delivery of Cas9 RNP and a ssDNA template to mediate gene knockins via homology directed repair (HDR). A HeLa cell line expressing destabilized eGFP (HeLa GFPd2) (Rui et al., ACS Appl Mater Interfaces, 11(11), 2019, 10472-10480) was used in this study. The plasmid PB-CAG-GFPd2, which was used for the generation of HeLa GFPd2 was a gift from Jordan Green (Addgene plasmid # 115665; http://n2t.net/addgene:115665; RRID:Addgene_115665). The 66th amino acid in the eGFP sequence, tyrosine (code: TAC), can be replaced by histidine (code: CAT) via HDR-mediated DNA repair, which results in the conversion of eGFP into BFP (L. Farbiak et al., Advanced Materials 2021, 33, 2006619; R. Xie et al., Advanced Materials 2022, 34, 2110618; J. Walther et al., Pharmaceutics 2022, 14). Three cell populations can be expected after such treatments: 1) eGFP positive cells, representing non-edited cells; 2) eGFP and BFP negative cells representing cells with NHEJ-mediated gene knockout; and 3) BFP positive and eGFP negative cells representing HDR-mediated gene corrected cells (Figure 10A). In the first step, TFE-IDAtp1-LinA (#1740), which performed best in gene knockout experiments, was used for finding the most suitable RNP/ssDNA ratios. The nanoparticles for HDR were prepared by complexing TFE-IDAtp1-LinA (#1740) with different RNP/ssDNA ratios ranging from 1/0.5 to 1/20 at a N/P ratio of 12 (representative ratios of RNP/ssDNA 1/1 and 1/8 are shown in Figure 10B). HeLa GFPd2 cells were treated with the Cas9 RNP/ssDNA nanoparticles for 48 h followed by cell population analysis via flow cytometry. As shown in Figure 10, the best knockout and total editing efficiencies were achieved at high RNP concentrations (10 – 100 nM) and high RNP/ssDNA ratios (1/0.5 – 1/3, shown in 1/1), while the highest HDR levels were induced at moderate to low RNP concentrations (10 – 1 nM) and moderate RNP/ssDNA ratios (1/3 – 1/8, shown is 1/8). At RNP/ssDNA ratios below 1/10, almost all editing events were blocked, presumably due to severe cytotoxicity (data not shown). The highest HDR efficiency of ~28 % was achieved at a dose of 10 nM RNP and 1/8 RNP/ssDNA ratio (Figure 10B, bottom). Notably, a general trend of increasing 118371P1272PC percentage of HDR events in relation to total editing was observed with decreasing RNP concentration, which is explainable by the competition between NHEJ and HDR repair pathways. [174] Next, the NHEJ efficiency (Figure 11A), HDR induction efficiency (Figure 11B) and total editing efficiency (Figure 11C) of the other selected lipopeptides was investigated at a RNP/ssDNA ratio of 1/4 to circumvent cytotoxicity. Surprisingly, the X2-C-OHSteA series (1445-based structures) that was the least efficient in gene knockout experiments, achieved the highest maximum HDR levels (Figure 11B). Especially the hydrophobically balanced Gtt2-C-OHSteA (#1636), enabled HDR induction up to 40 % at a 25 nM RNP dose. Nevertheless, X1-LinA lipo-oligomers (1392-bases structures) still showed the highest potency and best HDR efficiency at low concentrations (Figure 11B). For instance, TFE- IDAtp1-LinA nanoparticles (#1739) induced ~23 % and ~11 % HDR in HeLa GFPd2 cells treated with 1 nM or 0.5 nM RNP doses, respectively. Consistent with the studies in HeLa GFP/tub cells, lipo- oligomers with X1-LinA architecture (1392-based structures) achieved the highest and most potent GFP knockout via NHEJ in HeLa GFPd2 cells (Figure 11A). The total editing efficiency (Figure 11C), which refers to the union of NHEJ and HDR edits, confirms the advantage of the X1-LinA architecture (1392-based structures), which achieved high maximal editing levels and demonstrated the highest potency at low concentrations. [175] In summary, a series of artificial amino acids and derived lipo-oligomers for the intracellular delivery of Cas9 RNP were designed and synthesized. Systematic biological evaluation revealed that the hydrophobic characteristics play a decisive role for potent gene editing, especially at low concentrations. The fluorinated lipopeptide TFE-IDAtp1-LinA (#1739) was found to be a particularly potent nanocarrier which can achieve 88 % NHEJ gene knockout and 23 % HDR knockin at just 1 nM RNP concentration. The identified relationships between logD7.4 values, carrier characteristics and impact on cellular delivery are suggested to serve as a guide for the future design of Cas9 RNP nanocarriers. The new artificial amino acids and lipopeptide architectures provide a versatile platform for the creation of highly potent and tunable cellular delivery agents. Example 4: [176] The present sequence-defined T-shape oligomers were also tested for delivery of other cargo, such as PMO. [177] In an initial experiment sequence-defined T-shape oligomers comprising the sequence of formula I (#1392(Stp), #1639(Gtp), #1641(Htp), #1643(Ntp), #1644(Gtt), #1645(GEIPA), #1737(chGtp), #1738(dGtp), #1739(TFEIDAtp), #1740(IDAtp)) and with histidine (#1395(Stp), #1396(Stp), #1647(Gtp), #1649(Htp), #1651(Ntp), #1652(Gtt), #1653(GEIPA), #1741(chGtp), #1742(dGtp), #1743(TFEIDAtp), #1744(IDAtp)) were tested for PMO delivery by covalently binding the PMO to the oligomers at a ratio of 1:3 and determining the bioactivity in HeLa mCherry-DMDEx23 reporter cells as described in Example 5. The reporter cell line enables determination of PMO- mediated modification of mRNA splicing via the induction of mCherry expression. These oligomers comprising the sequence of formula I were more effective compared to oligomer #1195 (according to 118371P1272PC formula III; Y3-Stp2-K(G-K(LenA)2-Stp2-Y3; SEQ ID NO: 62 comprising an N-terminal azido-lysine and a glycine between Kc and Kf) by several orders of magnitude when tested at a range from 2.4 nM to 625 nM of PMO (data not shown). PMO-1395 resulted in 100% mCherry positive cells at 625 nM while PMO-1195 only showed <10% positive cells at the same concentration. A similar result was achieved with 9.8 nM PMO-1395. At PMO concentrations of 6.25 nM, 312.5 nM and 625 nM, the oligomers comprising Stp, chGtp, dGtp or TFEIDAtp as artificial amino acid showed best results out of the tested compounds, particularly TFEIDAtp. Oligomers comprising OleA (#1395) were as effective as the same construct comprising LinA (#1396). Example 5: [178] In another experiment further sequence-defined T-shape oligomers were tested for PMO delivery. Preparation of PMO-lipo-oligomer formation [179] PMO functionalization with DBCO-NHS ester and purification was performed as described in Kuhn et al., (Adv. Funct. Mater. 2019, 29, 1906432). For the conjugation of PMO-DBCO and lipo- oligomer at a molar ratio of 1:3 – PMO to lipo-oligomer (LP), a dilution of PMO-DBCO with the concentration of 100 µM in water and a dilution of the lipo-oligomer with the concentration of 300 µM in water were prepared. Equal volumes of the two solutions were combined and incubated overnight at room temperature (RT) while shaking at 300 rpm. The resulting PMO-LP conjugate solution has a concentration of 50 µM PMO. The formulation solution was freeze-dried and reconstituted with the required volume of HBG (20 mM HEPES, 5% glucose, pH 7.4) to obtain the desired concentration. Splice-switching activity of PMO-LP formulations in HeLa mCherry DMDEx23 reporter cells [180] The splice-switching activity of PMO-LP formulations was investigated in HeLa mCherry- DMDEx23 reporter cells which express mCherry upon specific oligonucleotide mediated splicing- modulation. The day before cell treatments, HeLa mCherry-DMDEx23 cells were seeded into 96-well plates (Corning® Costar, Sigma-Aldrich, Munich, Germany) at a density of 5 × 103 cells/well. Prior to cell treatments, the medium in each well was replaced by 90 µL medium and 10 µL PMO-LP conjugate formulations was added resulting in the desired PMO concentrations. The cells were incubated at 37 °C and 5% CO2 in a humidified atmosphere.24 h after transfection, the medium was removed and the cells were washed with 100 µL PBS. The cells were trypsinized and resuspended in 100 µL FACS buffer, consisting of 10% FBS in PBS substituted with DAPI (1 ng/µL) to differentiate between live and dead cells. All samples were analyzed by flow cytometry using a CytoFLEX S flow cytometer (Beckman Coulter, Carlsbad, USA). The fluorescence of the cells was determined by measuring excitation of DAPI at 405 nm and detection of emission at 450 nm, excitation of mCherry at 561 nm and detection of emission at 610 nm. Only isolated and viable cells were evaluated. Flow cytometry data was analyzed using FlowJo X 10.0.7r2 flow cytometric analysis software by FlowJo, LLC (Ashland, USA). All experiments were performed in triplicates. 118371P1272PC Cell metabolic activity assay [181] Cell viability was determined via investigation of cell metabolic activity with MTT assay. One day prior to cell treatments, HeLa mCherry-DMDEx23 were seeded in 96-well plates at a density of 5 × 103 cells/well.24 h after seeding, the medium was replaced by 90 µL of fresh medium.10 µL PMO- LP formulation were added to each well resulting in the desired PMO concentrations. After incubation for 24 h at 37 °C and 5% CO2 in humidified atmosphere, 10 µL of MTT (3-(4,5-dimethylthiazol-2-yl)- 2,5-diphenyltetrazolium bromide) (5 mg/mL) was added to each well. After 2 h of incubation, medium containing unreacted dye was removed, and the 96-well plates were stored at -80 °C overnight.100 µL DMSO was added per well to dissolve the purple formazan product. The 96-well plates were incubated for 30 min at 37 °C while constantly shaking. The absorbance at λ = 590 nm of each well was measured with background correction at λ = 630 nm using a microplate reader (Tecan Spark 10M, Tecan, Nänikon, Switzerland). The relative cell viability (%) was calculated by normalizing the values to control wells treated with HBG. The following equation was used: 100 % A, difference of absorbance at λ = 590 nm and background correction at λ = 630 nm Means are reported +/- standard deviation. Results: [182] The novel sequence-defined T-shape oligomers #1391, #1392, #1393, #1395, #1396 and #1397, all comprising Stp, were tested in comparison to the more polar reference carrier #1195 (Figure 12A). In direct comparison five of the tested oligomers exhibited much higher potency (Figure 12B). Histidine containing oligomers generally mediated higher transfection efficiencies even at low concentrations. Oleic acid and linoleic acid (#1395 and #1396) were found to be favorable structural elements in the new LP architectures (Figure 12B). Over 90 % of cells were mCherry positive after treatment with the most potent oligomers #1395 and #1396 containing 156.25 nM PMO. In all cases, the ratio of mCherry expressing cells increased with increasing PMO concentration. At the same time a dose dependent cytotoxicity was observed (Figure 12C), which supports the requirement for potent oligomers, which achieve high activity at low concentrations. The best performing PMO formulations were based on LP #1392, #1395, #1396. Especially the oligomers #1395 and #1396 turned out to be very potent and resulted in >45 % mCherry positive cells even after exposure of only 5 minutes to the moderate PMO dose of 312.5 nM (data not shown). Transmission electron microscopy (TEM) confirmed self-association of PMO(Ex23)-13951:3 formulations into nanoparticles, similar to oligomer #1195 (data not shown). The increased splice switching activity correlated with higher PMO internalization mediated by the #1395 oligomers compared to #1195 oligomers. [183] To assess the favorable properties of #1395 oligomers in more detail, an additional comparison was carried out at low PMO concentrations between 2.4 nM and 312.5 nM and analysed following 24 118371P1272PC h treatment. The dose response curves (Figure 12D) clearly illustrate the much higher potency of #1395, which mediated splice-switching already at PMO concentrations ≤ 5 nM. [184] Further #1392 and #1396 analoga were tested. Of the 11 1392-based and 1396-based structures described in Example 2 using different, mainly more hydrophobic, artificial amino acids, 10 (all except 1392-Ptp and 1396-Ptp) were also tested for PMO delivery at three different concentrations (156.25 nM, 312.5 nM, 625 nM) as described above. As may be taken from Figure 13A 1392-dGtp and 1392-IDAtp showed about comparable or slightly lower activity and 1392-Gtp and 1392-TFE- IDAtp showed better activity compared to 1392-Stp. Figure 13B shows that (Figure 13A) for 1396- based structures TFE-IDAtp showed superior activity and dGtp about comparable activity and chGtp and IDAtp slightly lower activity compared to Stp. Example 6: siRNA Polyplex Formation [185] siRNA and lipo-oligomer at an indicated N/P ratio (nitrogen/phosphate) were separately diluted in equal volume of HBG (20 mM of HEPES, 5% (w/v) glucose, pH 7.4). Only protonatable nitrogens were considered for N/P ratio calculation. The siRNA and lipo-oligomer solutions were mixed by rapid pipetting and incubated for 45 min at room temperature (RT). The final concentration of siRNA in the polyplex solution was 25 µg/mL. [186] siRNA duplexes were obtained from Axolabs GmbH (Kulmbach, Germany): eGFP-targeting siRNA (siGFP) (sense strand: 5’-AuAucAuGGccGAcAAGcAdTsdT-3’, SEQ ID NO: 144; antisense strand: 5’-UGCUUGUCGGCcAUGAuAUdTsdT-3’, SEQ ID NO: 145) for silencing of eGFPLuc; control siRNA (siCtrl) (sense strand: 5’-AuGuAuuGGccuGuAuuAGdTsdT-3’, SEQ ID NO: 146; antisense strand: 5’-CuAAuAcAGGCcAAuAcAUdTsdT-3’, SEQ ID NO: 147); small letters indicate 2′methoxy modifications; “s” indicates phosphorothioate linkages, “dT” refers to deoxythymidine. Particle Size and Zeta Potential Measurement for siRNA Polyplexes [187] Particle size and zeta potential were measured in a folded capillary cell (DTS1070) with dynamic and electrophoretic laser-light scattering (DLS, ELS) using a Zetasizer Nano ZS (Malvern Instruments, Malvern, Worcestershire, U.K.). siRNA polyplexes were prepared in a total volume of 80 μL HBG with siRNA concentration of 25 µg/mL. Size and polydispersity index (PDI) were measured after an equilibration time of 30 sec at 25°C with refractive index of 1.330 and viscosity of 0.8872 mPa*s. Samples were measured three times with six sub runs per measurement. For zeta potential measurement, each sample was diluted with HEPES to final volume of 800 μL. All the setting parameters were the same as for size measurement, except an equilibration time of 60 sec. Samples were measured three times with 15 sub runs, and the zeta potential was calculated by the Smuchowski equation. 118371P1272PC siRNA Gel Shift Assay [188] A 2.5% agarose gel was prepared with TBE buffer (trizma base 10.8 g, boric acid 5.5 g, disodium EDTA 0.75 g, and 1 L of water).20 μL of siRNA polyplexes in HBG at concentration of 25 µg/mL was mixed with loading buffer (6 mL of glycerol, 1.2 mL of 0.5 M EDTA, 2.8 mL of H2O, 0.02 g of bromophenol blue) at ratio of 5:1 (V/V) followed by placing in the gel pockets. The gel electrophoresis was run at 100 V for 40 min in TBE buffer. Cell Culture [189] The adherent human cervix carcinoma cell line KB/eGFPLuc (stably expressing the enhanced green fluorescent protein/luciferase (eGFPLuc) fusion gene) [Dohmen et al. ACS Nano 2012] was cultured in Dulbecco’s modified Eagles’s medium (DMEM)-low glucose (1 g/L glucose) supplemented with 10% (v/v) fetal bovine serum (FBS), stable glutamine (4 mM), penicillin (100 U/mL), and streptomycin (100 µg/mL). The cells were kept at 37°C and 5 % CO2 in an incubator with a relative humidity of 95% Gene Silencing Mediated by GFP-siRNA [190] The KB/eGFPLuc cells were seeded in 96-well-plate (5 × 103 cells/well) 24 h prior to the experiment. The culture medium was replaced with 80 µL of fresh supplemented medium followed by siRNA polyplex transfection. The polyplexes were prepared at indicated N/P ratio with control siRNA (siCtrl) or GFP-siRNA (siGFP for targeting GFPLuc protein) at concentration of 25 µg/mL in HBG. The volumes of 10, 5, and 2.5 µL of siRNA polyplex solution were added to the corresponding wells in triplicate as well as HBG to reach a final volume of 100 µL per well. HBG buffer was used as negative control. After 48 h, the medium was removed and cells were treated with 100 µL of cell culture 0.5x lysis buffer (Promega, Mannheim, Germany) followed by 45 min incubation at RT. Luciferase activity was measured in the 35 µL cell lysate by a Centro LB 960 plate reader luminometer (Berthold Technologies, Bad Wildbad, Germany) using LAR buffer (20 mM glycylglycine; 1 mM MgCl2; 0.1 mM EDTA (ethylenediaminetetraacetic acid); 3.3 mM DTT (dithiothreitol); 0.55 mM ATP (adenosine 5′- triphosphate); 0.27 mM coenzyme A, pH 8-8.5) supplemented with 5% (v/v) of a mixture of 10 mM luciferin and 29 mM glycylglycine. The relative light units (RLUs) were presented as percentage of the luciferase gene expression of the HBG buffer-treated cells. Results [191] In a gene silencing assay using siRNA targeting GFP, the more polar structures #1214 (Stp2- HC) comprising OleA was compared to the respective non-polar structure #1395 and #1583, the same structure without the terminal cysteine (Figure 14, top), as well as the same structures comprising LinA (#1389, #1396, #1584; Figure 14, middle) and LenA (#1390, #1397, #1585; Figure 14, bottom). siRNA polyplexes were formed with carriers at indicated N/P ratios in HBG (25 µg siRNA/mL). The size, PDI, and zeta potential were measured via DLS and ELS (n=3, mean ± SD). The tested structures and the respective particle sizes and zeta potential are listed in Table 3 below: 118371P1272PC Table 3: Particle size and zeta potential of siRNA polyplexes [192] As may be taken from Figure 14, particularly at low siRNA concentrations the more hydrophobic structures are more active in gene silencing, the terminal cysteine seems favorable. No gross change was observed with the use of the different fatty acids. In siRNA gel shift assays, all lipopeptides bound siRNA efficiently at the used N/P ratios (Figure 15).

Claims

118371P1272PC CLAIMS 1. A nanoparticle for Cas protein/gRNA ribonucleoprotein (RNP) complex delivery comprising one or more Cas protein/gRNA RNP complex(es) as cargo; and a carrier comprising a sequence-defined T-shape lipo-oligomer, comprising an artificial amino acid, wherein the artificial amino acid is an oligo(alkylamino) acid, and wherein the T-shape lipo-oligomer comprises the sequence of formula I: Cn-Y3-Hn(outer)-X1-Hn(inner)-Kc[Kf[FA] Formula wherein Kc is a central lysine; Kf is a further lysine linked to the ε-amino group of Kc; FA is a fatty acid covalently linked to the ε- and α-amino group of Kf; C is cysteine and n = 0 or 1, preferably n = 0 Y3 is a tyrosine tripeptide; H is histidine and n(outer) and n(inner) are independently selected from 0, 1 or 2; and X1 is an oligo(alkylamino) acid of formula IIa: H(HN-(CH2)n)m-NH-CO-R Formula IIa wherein n = 2 or 3, alternating 2 and 3 or alternating 3 and 2; and m = 3 or 4; and wherein R is -(CH2)y-CO2H, wherein y = 2, 3 or 4; , wherein z = 0 or 1, preferably , more preferably -CH2-CH(c-hexyl)-CH2-CO2H; or -CH2-NRa-CH2-CO2H, wherein Ra = H, CH2-CF3, or wherein the T-shape lipo-oligomer comprises the sequence of formula III: Cn-Y3-Hn(outer)-[X2-Hn(inner)]2-Kc[Kf[FA]2]-[Hn(inner)-X2]2-Hn(outer)-Y3-Cn; Formula III wherein 118371P1272PC Kc is a central lysine; Kf is a further lysine linked to the ε-amino group of Kc; FA is a fatty acid covalently linked to the ε- and α-amino group of Kf; C is cysteine and n = 0 or 1, preferably n = 1 Y3 is a tyrosine tripeptide; H is histidine and n(outer) and n(inner) are independently selected from 0 or 1; and X2 is an oligo(alkylamino) acid of formula IIa: H(HN-(CH2)n)m-NH-CO-R Formula IIa wherein n = 2 or 3, alternating 2 and 3 or alternating 3 and 2; and m = 3 or 4; wherein R is -(CH2)y-CO2H, wherein y = 3 or 4; , more ; -CH2-CH(c-hexyl)-CH2-CO2H; or -CH2-NRa-CH2-CO2H, wherein Ra = CH2-CF3. 2. The nanoparticle of claim 1, wherein the two fatty acids are saturated or unsaturated C12 to C22 fatty acids, preferably the two fatty acids are selected from the group consisting of oleic acid (OleA), linoleic acid (LinA), linolenic acid (LenA) or hydroxy steric acid (OHSteA), preferably OleA, LinA or OHSteA, more preferably LinA or OHSteA. 3. The nanoparticle of claim 1 or 2, wherein the oligo(alkylamino) acid is a tetraethylenepentamine or a triethylenetetramine of formula IIb: H(HN-(CH2)2)m = 3 or 4-NH-CO-R Formula IIb; preferably a tetraethylenepentamine. 4. The nanoparticle of any one of the preceding claims, wherein the T-shape lipo-oligomer comprises the sequence of formula I: Cn-Y3-Hn(outer)-X1-Hn(inner)-Kc[Kf Cn; (a) wherein C is cysteine and n = 0 or 1, preferably n = 0 Y3 is a tyrosine tripeptide; 118371P1272PC H is histidine and n(outer) and n(inner) are 1; or (b) wherein C is cysteine and n = 0 Y3 is a tyrosine tripeptide; H is histidine and n(outer) and n(inner) are 0; or wherein the T-shape lipo-oligomer comprises the sequence of formula III: Cn-Y3-Hn(outer)-[X2-Hn(inner)]2-Kc[Kf[FA]2]-[Hn(inner)-X2]2-Hn(outer)-Y3-Cn; Formula III (a) wherein C is cysteine and n = 1 Y3 is a tyrosine tripeptide; H is histidine and n(outer) and n(inner) are 1; or (b) wherein C is cysteine and n = 1 Y3 is a tyrosine tripeptide; H is histidine and n(outer) and n(inner) are 0. 5. The nanoparticle of any one of the preceding claims, wherein the sequence-defined T-shape lipo-oligomer (a) further comprises a terminal functional group at the N-terminus or the C-terminus of the T- shape lipo-oligomer, wherein the function group is (i) an azido group, or (ii) a thiol group, provided that the sequence of formula I does not comprise a cysteine; and/or (b) further comprises a terminal azido group and a targeting ligand is coupled to the azido group, preferably wherein the targeting ligand is coupled to the azido group via click chemistry, more preferably click chemistry with a dibenzocylcooctyne-coupled targeting ligand. 6. The nanoparticle of any one of the preceding claims, wherein the RNP complex comprises Cas protein/gRNA at a ratio of about 1:1 to about 1:2 and/or wherein the Cas protein/gRNA RNP complex and the sequence-defined T-shape lipo-oligomer are mixed at a lipo-oligomer nitrogen (N) to gRNA phosphate (P) ratio (N/P ratio) of about 1:12 to 1:30, preferably about 1:20 to 1:30, more preferably of about 1:22 to 1:26. 7. The nanoparticle of any one of the preceding claims, wherein (a) the Cas protein is a Cas9, a Cas12, a Cas13 protein or an engineered variant thereof; (b) the Cas protein is a base editor or a prime editor; (c) the one or more Cas protein/gRNA RNP complex(es) is/are Cas9/gRNA RNP complex(es); and/or 118371P1272PC (d) wherein the nanoparticle comprises two or more Cas protein/gRNA RNP complexes as cargo and wherein the two or more Cas protein/gRNA RNP complexes comprise two or more different gRNAs targeting the same or different genes, preferably different genes; and/or (e) wherein the nanoparticle comprises one or more Cas protein/gRNA RNP complexes and a donor DNA. 8. A nanoparticle for siRNA or phosphorodiamidate morpholino oligomers (PMO) delivery comprising one or more siRNA(s) or PMO(s) as cargo; and a carrier comprising a sequence- defined T-shape lipo-oligomer, comprising an artificial amino acid, wherein the artificial amino acid is an oligo(alkylamino) acid, and wherein the T-shape lipo-oligomer comprises the sequence of formula I: Cn-Y3-Hn(outer)-X1-Hn(inner)-Kc[Kf[FA] Formula wherein Kc is a central lysine; Kf is a further lysine linked to the ε-amino group of Kc; FA is a fatty acid covalently linked to the ε- and α-amino group of Kf; C is cysteine and n = 0 or 1, preferably n = 0 Y3 is a tyrosine tripeptide; H is histidine and n(outer) and n(inner) are independently selected from 0, 1 or 2; and X1 is an oligo(alkylamino) acid of formula IIa: H(HN-(CH2)n)m-NH-CO-R Formula IIa wherein n = 2 or 3, alternating 2 and 3 or alternating 3 and 2; and m = 3 or 4; and wherein R is -(CH2)y-CO2H, wherein y = 2, 3 or 4; -CH2-CH(c-hexyl)-CH2-CO2H; or -CH2-NRa-CH2-CO2H, wherein Ra = H, CH2-CF3, and 118371P1272PC wherein the two fatty acids are saturated or unsaturated C12 to C22 fatty acids, preferably the two fatty acids are selected from the group consisting of oleic acid (OleA), linoleic acid (LinA), linolenic acid (LenA) or hydroxy steric acid (OHSteA), preferably OleA, LinA or OHSteA, more preferably LinA or OHSteA. 9. A conjugate comprising a phosphorodiamidate morpholino oligomer (PMO) covalently linked to a carrier comprising a sequence-defined T-shape lipo-oligomer, comprising an artificial amino acid, wherein the artificial amino acid is an oligo(alkylamino) acid, and wherein the T-shape lipo-oligomer comprises the sequence of formula I: Cn-Y3-Hn(outer)-X1-Hn(inner)-Kc[Kf[FA] Formula wherein Kc is a central lysine; Kf is a further lysine linked to the ε-amino group of Kc; FA is a fatty acid covalently linked to the ε- and α-amino group of Kf; C is cysteine and n = 0 or 1, preferably n = 0 Y3 is a tyrosine tripeptide; H is histidine and n(outer) and n(inner) are independently selected from 0, 1 or 2; and X1 is an oligo(alkylamino) acid of formula IIa: H(HN-(CH2)n)m-NH-CO-R Formula Iia wherein n = 2 or 3, alternating 2 and 3 or alternating 3 and 2; and m = 3 or 4; and wherein R is -(CH2)y-CO2H, wherein y = 2, 3 or 4; -CH2-CH(c-hexyl)-CH2-CO2H; or -CH2-NRa-CH2-CO2H, wherein Ra = H, CH2-CF3, and wherein the two fatty acids are saturated or unsaturated C12 to C22 fatty acids, preferably the two fatty acids are selected from the group consisting of oleic acid (OleA), linoleic acid 118371P1272PC (LinA), linolenic acid (LenA) or hydroxy steric acid (OHSteA), preferably OleA, LinA or OHSteA, more preferably LinA or OHSteA. 10. The nanoparticle of any one of claims 1 to 8 for use in therapy. 11. The nanoparticle of any one of claims 1 to 8 for use in treating cancer, a genetic disease, an infectious disease a cardiovascular disease, a metabolic disease, a neurodegenerative or neuromuscular disease, a hematological disease, a hereditary eye disease or an autoimmune disease or an autoimmune disease. 12. An in vitro method for transfecting mammalian cells with one or more Cas protein/gRNA complex, siRNA or PMO comprising contacting a mammalian cell in vitro with the nanoparticle according to any one of claims 1 to 8 or the conjugate according to claim 9. 13. Use of the sequence-defined T-shape lipo-oligomer for cellular delivery of a Cas protein/gRNA ribonucleoprotein (RNP) complex, siRNA or PMO into a target cell, wherein the sequence defined T-shape lipo-oligomer is as in any one of claims 1-8 or the conjugate according to claim 9. 14. Use of an artificial amino acid in a sequence-defined T-shape lipo-oligomer for cellular delivery of a Cas protein/gRNA ribonucleoprotein (RNP) complex into a target cell, wherein the artificial amino acid is an oligo(alkylamino) acid selected from the group consisting of 118371P1272PC , preferably, wherein the oligo(alkylamino) acid is selected from the group consisting of Gtp, Gtt, Htp, TFE-IDAtp, GEIPA, and chGtp, more preferably Htp, TFE-IDAtp and chGtp. 15. An artificial amino acid, wherein the artificial amino acid is an oligo(alkylamino) acid selected from the group consisting of the following formulas: , in its protected and unprotected form. 16. Use of the artificial amino acid of claim 15 for cellular delivery of a Cas protein/gRNA ribonucleoprotein (RNP) complex into a target cell.
EP23802183.6A 2022-11-07 2023-11-06 Artificial amino acid containing lipo-oligomers for ribonucleoprotein delivery Pending EP4615854A1 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
EP22205883 2022-11-07
EP22208928 2022-11-22
PCT/EP2023/080853 WO2024099975A1 (en) 2022-11-07 2023-11-06 Artificial amino acid containing lipo-oligomers for ribonucleoprotein delivery

Publications (1)

Publication Number Publication Date
EP4615854A1 true EP4615854A1 (en) 2025-09-17

Family

ID=88745659

Family Applications (1)

Application Number Title Priority Date Filing Date
EP23802183.6A Pending EP4615854A1 (en) 2022-11-07 2023-11-06 Artificial amino acid containing lipo-oligomers for ribonucleoprotein delivery

Country Status (2)

Country Link
EP (1) EP4615854A1 (en)
WO (1) WO2024099975A1 (en)

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011154331A1 (en) 2010-06-10 2011-12-15 F. Hoffmann-La Roche Ag Polymers for delivery of nucleic acids

Also Published As

Publication number Publication date
WO2024099975A9 (en) 2025-01-30
WO2024099975A1 (en) 2024-05-16

Similar Documents

Publication Publication Date Title
US20200095605A1 (en) Compositions and methods for nucleic acid and/or protein payload delivery
US6572881B1 (en) Lipid-conjugated polyamide compounds and related compositions and methods thereof
CN109475646A (en) Lipid Nanoparticle Formulations for CRISPR/CAS Components
AU2017388753A1 (en) Synthetic guide molecules, compositions and methods relating thereto
CN101060849A (en) Highly branched HK peptides as effective carriers of siRNA
CA3221154A1 (en) Genome editing compositions and methods for treatment of wilson&#39;s disease
CA3125009A1 (en) A non-toxic cas9 enzyme and application thereof
WO2011154331A1 (en) Polymers for delivery of nucleic acids
WO2001004135A2 (en) Crosslinked dna condensate compositions and gene delivery methods
US20200208177A1 (en) Methods and compositions for genome editing
JP2024508832A (en) Strategies for developing genome-editing globular nucleic acids (SNAs)
JP7582956B2 (en) Cell-Membrane-Permeable Conjugates for Gene Editing
US11834517B2 (en) Branched peptides for enzymatic assembly and mitochondria drug delivery
WO2024238828A2 (en) Gene editing systems and compositions for treatment of hemoglobinopathies and methods of using the same
JP2002533088A (en) Nonpathogenic transfection vector
EP4097237A1 (en) Nuclease-scaffold composition delivery platform
JP2002526456A (en) Cationic compounds and their use as macromolecular carriers
EP4037716A1 (en) Tumor-targeting polypeptide nanoparticle delivery system for nucleic acid therapeutics
WO2024099975A1 (en) Artificial amino acid containing lipo-oligomers for ribonucleoprotein delivery
WO2025059599A1 (en) Lipid nanoparticles for delivery of therapeutic payloads to cells
Sun et al. New amphiphilic N-phosphoryl oligopeptides designed for gene delivery
US11179471B2 (en) Peptide for cytosolic delivery
WO2024110492A9 (en) Novel carriers for nucleic acid and/or protein delivery
US20240158441A1 (en) Branched peptides for enzymatic assembly and mitochondria drug delivery
Uddin et al. Impact of acetylation, succinylation, and pH on PEI-based polyplex structure and function

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: UNKNOWN

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20250528

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR

GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: GRANT OF PATENT IS INTENDED

DAV Request for validation of the european patent (deleted)
DAX Request for extension of the european patent (deleted)
RIC1 Information provided on ipc code assigned before grant

Ipc: C07K 7/02 20060101AFI20260123BHEP

Ipc: C07K 17/04 20060101ALI20260123BHEP

Ipc: C07K 19/00 20060101ALI20260123BHEP

Ipc: C12N 15/11 20060101ALI20260123BHEP

Ipc: A61K 48/00 20060101ALI20260123BHEP

Ipc: B82Y 5/00 20110101ALI20260123BHEP

Ipc: A61P 35/00 20060101ALI20260123BHEP

Ipc: A61K 47/54 20170101ALI20260123BHEP

Ipc: A61K 47/64 20170101ALI20260123BHEP

Ipc: A61K 47/69 20170101ALI20260123BHEP

Ipc: C07C 233/36 20060101ALI20260123BHEP

Ipc: C07C 233/37 20060101ALI20260123BHEP

Ipc: C07C 233/62 20060101ALI20260123BHEP

Ipc: C07C 233/78 20060101ALI20260123BHEP

Ipc: C07C 235/10 20060101ALI20260123BHEP

Ipc: C12N 9/22 20060101ALI20260123BHEP

Ipc: C12N 15/88 20060101ALI20260123BHEP

Ipc: C12N 15/90 20060101ALI20260123BHEP

Ipc: C12N 15/113 20100101ALI20260123BHEP

Ipc: A61K 38/00 20060101ALN20260123BHEP

INTG Intention to grant announced

Effective date: 20260205