EP4605437A1 - Multabodykonstrukte, zusammensetzungen und verfahren zum targeting von sarbecoviren - Google Patents

Multabodykonstrukte, zusammensetzungen und verfahren zum targeting von sarbecoviren

Info

Publication number
EP4605437A1
EP4605437A1 EP23878454.0A EP23878454A EP4605437A1 EP 4605437 A1 EP4605437 A1 EP 4605437A1 EP 23878454 A EP23878454 A EP 23878454A EP 4605437 A1 EP4605437 A1 EP 4605437A1
Authority
EP
European Patent Office
Prior art keywords
cdr
seq
sarbecovirus
self
cov
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
EP23878454.0A
Other languages
English (en)
French (fr)
Inventor
Jean-Philippe Julien
Arif JETHA
Krithika MUTHURAMAN
David D. Ho
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Hospital for Sick Children HSC
Columbia University in the City of New York
Original Assignee
Hospital for Sick Children HSC
Columbia University in the City of New York
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Hospital for Sick Children HSC, Columbia University in the City of New York filed Critical Hospital for Sick Children HSC
Publication of EP4605437A1 publication Critical patent/EP4605437A1/de
Pending legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/69Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
    • A61K47/6921Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere
    • A61K47/6927Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores
    • A61K47/6929Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores the form being a nanoparticle, e.g. an immuno-nanoparticle
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/14Antivirals for RNA viruses
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/08Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from viruses
    • C07K16/10RNA viruses
    • C07K16/102Coronaviridae (F)
    • C07K16/104Severe acute respiratory syndrome coronavirus 2 [SARS‐CoV‐2]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62DNA sequences coding for fusion proteins
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/30Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/31Immunoglobulins specific features characterized by aspects of specificity or valency multispecific
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/55Fab or Fab'
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/76Antagonist effect on antigen, e.g. neutralization or inhibition of binding
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/90Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/92Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/30Non-immunoglobulin-derived peptide or protein having an immunoglobulin constant or Fc region, or a fragment thereof, attached thereto
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011Details
    • C12N2770/20011Coronaviridae
    • C12N2770/20022New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011Details
    • C12N2770/20011Coronaviridae
    • C12N2770/20023Virus like particles [VLP]

Definitions

  • Omicron BA.l variant of concern which has 37 mutations within the spike domain and 15 mutations within the receptor binding domain (RBD), the target of most clinical antibodies against SARS- CoV-2.
  • Omicron BQ.1.1 and XBB.l subvariants even mAbs that were capable of neutralizing the original Omicron VOC, including Bebtelovimab, and a cocktail of Tixagevimab and Cilgavimab have had their authorization revoked due to viral escape.
  • the present invention addresses this need with the provision of self-assembled polypeptide complexes which exhibit broad neutralization against sarbecoviruses and which maintain potency. Also provided are related fusion polypeptides, compositions, and methods. [0007] In one aspect, provided are fusion polypeptides that can be used within selfassembled polypeptide complexes disclosed herein.
  • the first sarbecovirus binding moiety comprises a sarbecovirus antibody or sarbecovirus-binding fragment thereof, e.g, an Fab fragment of a sarbecovirus antibody.
  • the Fab fragment is a single chain Fab (scFab).
  • the sarbecovirus antibody is capable of neutralizing SARS- CoV-2 and at least one sarbecovirus other than SARS-CoV-2, for example, a sarbecovirus selected from the group consisting of SARS-CoV, GD-Pangolin, GX-Pangolin, RaTG13, WIV1, SHC014, Lyral l, Rs7327, Rs4231, Rs4084, and combinations thereof.
  • the at least one sarbecovirus other than SARS-CoV-2 comprises SARS-CoV.
  • fusion polypeptides comprising a sarbecovirus binding moiety linked to a nanocage monomer or subunit thereof, wherein the sarbecovirus binding moiety is a sarbecovirus antibody or a sarbecovirus binding fragment thereof, wherein the sarbecovirus antibody or sarbecovirus binding fragment thereof comprises a heavy chain complementarity determining region 3 (CDR-H3) having a sequence which comprises YYDRSGY (SEQ ID NO:70).
  • CDR-H3 heavy chain complementarity determining region 3
  • the sarbecovirus antibody or sarbecovirus binding fragment thereof comprises a CDR-H3 sequence and a CDR-L3 sequence of [0016] (a) SEQ ID NO:34 and SEQ ID NO:37, respectively,
  • the sarbecovirus antibody or sarbecovirus binding fragment thereof comprises a CDR-H3 sequence and a CDR-L3 sequence of [0063] (a) SEQ ID NO:34 and SEQ ID NO:37, respectively,
  • the Fc polypeptide comprises a single chain Fc (scFc) comprising two Fc chains, wherein the two Fc chains are linked via an amino acid linker, such as a linker comprising a (G n S) m linker, e.g., a (GGGGS) m linker.
  • the Fc polypeptide comprises an IgGl Fc chain or an IgG4 Fc chain.
  • the Fc polypeptide comprises an IgG4 Fc chain comprising a mutation or set of mutations selected from the group consisting of S228P, F234A, L235A, G237A, P238S, and combinations thereof.
  • each third fusion polypeptide comprising a third sarbecovirus antibody or sarbecovirus binding fragment thereof linked to a ferritin monomer or subunit thereof, and
  • each Fc-containing fusion polypeptide comprising an Fc polypeptide linked to a ferritin monomer or subunit thereof, [0244] wherein the first, second, and third sarbecovirus antibodies or sarbecovirus binding fragments thereof are distinct from each other, and wherein at least the first and second sarbecovirus antibodies are capable of neutralizing SARS-CoV, and SARS-CoV-2.
  • the self-assembled polypeptide complex is capable of neutralizing an Omicron variant, e.g., two or more Omicron variants, or three or more Omicron variants of SARS- CoV-2 virus.
  • Omicron variants are selected from the group consisting of BA.l, BA.2, BA.5, XBB.l, and BQ.1.1.
  • the self-assembled polypeptide complex is capable of neutralizing the BA.1 variant of SARS-CoV-2 virus, e.g., with an IC50 of 0.01 pg/mL or less.
  • the self-assembled polypeptide complex is capable of neutralizing the BA.2 variant of SARS-CoV-2 virus, e.g., with an IC50 of 0.02 pg/mL or less.
  • the self-assembled polypeptide complex is capable of neutralizing the BA.5 variant of SARS-CoV-2 virus, e.g., with an IC50 of less than 0.001 pg/mL.
  • the self-assembled polypeptide complex is capable of neutralizing the BQ.1.1 variant of SARS-CoV-2 virus, e.g., with an IC50 value of 0.5 pg/mL or less.
  • the self-assembled polypeptide complex is capable of neutralizing the XBB.1 variant of SARS-CoV-2 virus, e.g., with an IC50 value of 0.5 pg/mL or less or 0.1 pg/mL or less.
  • the self-assembled polypeptide complex is capable of neutralizing at least one or a combination of WT SARS-CoV-2, and the Alpha, Beta, Gamma, Delta, and an Omicron variant of SARS-CoV-2.
  • the self-assembled polypeptide complex is capable of neutralizing WT SARS-CoV-2 and the Alpha, Beta, Gamma, Delta, and an Omicron variant of SARS-CoV-2.
  • the self-assembled polypeptide complex is capable of neutralizing each of the WT SARS-CoV-2 and the Alpha, Beta, Gamma, Delta, and an Omicron variant of SARS-CoV-2 with IC50 values of 0.01 pg/mL or less.
  • the self-assembled polypeptide complex is capable of neutralizing at least one sarbecovirus other than SARS-CoV-2, for example, a sarbecovirus selected from the group consisting of SARS-CoV, GD-Pangolin, GX-Pangolin, RaTG13, WIV1, SHC014, Lyral l, Rs7327, Rs4231, Rs4084, and combinations thereof.
  • a sarbecovirus selected from the group consisting of SARS-CoV, GD-Pangolin, GX-Pangolin, RaTG13, WIV1, SHC014, Lyral l, Rs7327, Rs4231, Rs4084, and combinations thereof.
  • the at least one sarbecovirus other than SARS-CoV-2 comprises SARS-CoV.
  • compositions comprising the selfassembled polypeptide complex as disclosed herein and a pharmaceutically acceptable excipient.
  • kits for treating and/or preventing sarbecovirus infection and/or a sarbecovirus-associated condition comprising administering the self-assembled polypeptide complex as disclosed herein, or a pharmaceutical composition disclosed herein, to a subject in need thereof.
  • the subject is a mammal, e.g. a human.
  • the administering comprises systemic administration, for example, systemic administration by a route such as intranasal, intravascular, or intramuscular administration.
  • polypeptide complexes or pharmaceutical compositions as disclosed herein for use in treating and/or preventing sarbecovirus infection and/or a sarbecovirus-associated condition.
  • FIGS. 1A-1C show a series of plots demonstrating potency and breadth of anti- SARS-CoV-2 neutralizing Multabodies (MBs).
  • IgG neutralization potency left panel
  • breadth against a six PsV panel using a cut-off IC50 value of 5 pg/mL (light gray bars in right panel) or 0.01 pg/mL (dark gray bars in right panel)(FIG. 1A).
  • Heat map showing the neutralization potency of monospecific MBs displaying Fab specificities from (FIG. 1A) against each PsV variant in the panel FIG. IB). Individual IC50 values are displayed.
  • FIGS. 2A-2F 52 (FIGS. 2G-2L), 80 (FIGS. 2M-2R), 2-7 (FIGS. 2S-2X), 2-36 (FIGS. 2Y-2DD), 2-38 (FIGS. 2EE-2JJ), 10-40 (FIGS. 2KK-2PP), and 11-11 (FIGS. 2QQ-2VV), against SARS-CoV-2 WT (FIGS. 2A, 2G, 2M, 2S, 2Y, 2EE, 2 Ik Ik. 2QQ), Alpha (FIGS. 2B, 2H, 2N, 2T, 2Z, 2FF, 2LL, 2RR), Beta (FIGS. 2C, 21, 20, 2U, 2AA, 2GG, 2MM, 2SS), Gamma (FIGS.
  • FIG. 3C Phylogenetic tree with branch lengths representing divergence.
  • Heat map showing neutralization potency of 2-7-10-40-11-11 trispecific MB and its corresponding monospecific MBs against Omicron (BA.2) live virus and three SARS-CoV-1 related bat coronaviruses (LYRall, Rs4084, and Rs7327) PsVs.
  • FIGS. 4A-4E are a series of plots showing broad SARS-CoV-2 and sarbecovirus neutralization by a trispecific MB of the disclosure.
  • PsV neutralization of 2-7-10-40-11-11 trispecific MB against SARS-CoV-2 wildtype, Alpha, Beta, Gamma, Delta, Omicron BA.l and Omicron BA.5 (FIG. 4A).
  • the mean values ⁇ SEM for three biological replicates are shown in each neutralization plot.
  • Live virus neutralization of 2-7-10-40-11-11 trispecific MB and 2-7, 10-40, and 11-11 monospecific MBs against Omicron (BA.2) authentic virus FIG. 4B.
  • the mean values ⁇ SD for two technical replicates is shown in each neutralization plot.
  • FIG. 7B depicts binding (apparent KD) of cocktail IgGl, cocktail IgG4* and T10 MB* particles to human (FcyR I, Ila, lib and FcRn) and mouse (FcyR I, lib, IV and FcRn) receptors.
  • NB and LOD denote no-binding and limit-of-detection, respectively.
  • Mean values ⁇ SD for at least three independent experiments are shown.
  • FIGs. 7E-7H depict flow cytometry plots exemplifying gating strategy followed in an antibody-dependent cellular phagocytosis (ADCP) assay.
  • THP-1 cells were gated by size and live cells, and cells positive for internalization of SARS-CoV-2 Spike-coated fluorescent beads were quantified as a percentage of live THP-1 cells.
  • FIG. 71 depicts a bar graph showing % internalization (indicative of ADCP) determined as the percentage of THP-1 cells with internalized SARS-CoV-2 Spike-coated fluorescent microspheres. Mean values ⁇ SD for at least three independent experiments are shown. *** indicates significance compared to no antibody control (p ⁇ 0.001) by ANOVA.
  • FIGs. 8A-8G depict results from in vivo challenge experiments. (See Example 3.)
  • FIG. 8A depicts survival over a 12-day period following challenge. **** p ⁇ 0.0001, **p ⁇ 0.01, *p ⁇ 0.05 by Gehan Breslow Wilcoxon test.
  • FIG. % internalization indicative of ADCP
  • FIG. 8B depicts lung viral titers at the end of the experiment (open symbols) or at the time of death in the animals that succumbed (closed symbols) measured by viral outgrowth assay. TCID50 per gram of tissue is shown. ****p ⁇ 0.0001, **p ⁇ 0.01, Kruskall Wallis test.
  • FIG. 8E depicts SARS-CoV-2 genome copy number as quantified by qPCR from oropharyngeal swab samples collected at D-l (before challenge) and D2 following challenge by intranasal SARS-CoV-2 administration.
  • FIG. 8F Survival (FIG. 8F) and serum IgG or MB concentrations at day 2 (FIG. 8G) following administration of low dose tri-specific MB* (3 pg [1.4pmol]; 0.15 mg/kg) compared to high-dose (90 pg [600 pmol]; 4.5 mg/kg) cocktail IgG4*.
  • FIG 8G shows that
  • n 24 for T10 MB*
  • n 10 for cocktail IgG4* mix and control IgG, from 2-5 independent experiments.
  • FIGs. 9A-9B depict stereo-image of composite omit map electron density of 80 Fab- RBD interaction sites.
  • FIG. 9A depicts the map for heavy chain complementarity determining regions (HCDRs) 2 and 3 (light and dark green, respectively) and RBD (grey).
  • FIG. 9B depicts the map for Kappa light chain CDR (KCDR) 3 (orange) and RBD (grey).
  • FIG. 10A depicts the three-dimensional structure of the 80 Fab-RBD complex. The heavy and light chains of 80 Fab are colored in dark and light purple, respectively. RBD is shown as surface representation (grey) with the footprint of ACE2 depicted in salmon.
  • FIG. 10B depicts binding interactions within the 80 Fab-RBD complex. Binding to RBD (grey) involves interactions mediated by heavy chain complementarity determining regions (HCDRs) 2 and 3 (light and dark green, respectively) and kappa light chain CDRS (KCDRs) 2 and 3 (yellow and orange).
  • HCDRs heavy chain complementarity determining regions
  • KCDRs kappa light chain CDRS
  • FIG. 10C depicts a detailed view of the hydrogen bond network (dashed lines) formed between key residues at the binding interface of the 80-RBD complex.
  • FIG. 10D depicts a detailed view of interactions between RBD residues upon binding to antibody 80. Rearrangement of RBD aromatic residues (grey) upon 80 binding (green) to form a pi-stacking interaction network (shown in cyan dashed line). Left panel: unbound RBD and right panel: 80-RBD complex.
  • FIG 10E is a secondary structure cartoon representation of RBD, with residues mutated in the different variants of concern highlighted as red spheres. Inset: close-up view of the RBD area recognized by 80. Critical residues for binding are colored in pink according to their buried surface area (BSA). Mutated residues in the VOCs are indicated and shown in red in the BSA plot.
  • FIG. 10F Molecular modeling displays the possible conformation adopted by the side chains of the mutated residues T478K and S477N upon 80 binding. Hydrogen bonds are shown as dashed black lines.
  • FIG. 11B shows binding kinetic parameters (KD, k on , and k o ff) of 80 as Fab, IgG and MB for binding to WT and Omicron BA.1 RBD. Data shown is average from two independent experiments.
  • FIGs. 12A-12M relate to experiments analyzing tri-specific MB (298-52-80; “T10 MB”) by cryo-electron microscopy (cryoEM).
  • FIG. 12A depicts a processing workflow for cryoEM data.
  • FIG. 12B depicts a representative cryoEM micrograph of tri-specific MBs with white circles highlighting the whole particles and pink and green circles highlighting the scFab and scFc fragments, respectively.
  • FIG. 12C depicts representative 2D classes of scFab (top panels), tri-specific MB (middle panels), and Fc domains (bottom panels).
  • FIG. 12D depicts 3D reconstructions of components of a multabody of the present disclosure.
  • Images on the left are cryoEM maps of scFab at 6.7 A resolution (top), apoferritin nanocage scaffold at 2.4 A resolution (middle) and scFc at 7.1 A resolution (bottom).
  • Images on the right depict fitting of the human apoferritin light chain model (PDB ID:6WX6) into the 2.4 A map, focusing on features such as the N-terminus of the apoferritin scaffold that shows weak density beyond Ser5 due to the flexibility of the linker (top), the four-fold axis formed by four adjacent subunits (middle), and residues 87-109 of the human apoferritin light chain (bottom; the red arrow points to the split site between residues Trp93 and Gly94 in some subunits).
  • FIG. 12E depicts a representative cryoEM micrograph with Fab and Fc molecules highlighted with white circles. Scale bar is 50 nm.
  • FIG. 12F depicts representative 2D class averages of Fab.
  • FIG. 12G depicts an atomic model of Fab 298 (PDB ID: 7K9Z) fit into cryoEM map of Fab.
  • FIG. 12H depicts a gold standard Fourier shell correlation (GSFSC) curve of the final 3D non-uniform refinement of Fab in cryoSPARC v3.
  • FIG. 121 depicts the viewing direction distribution of the Fab data.
  • FIG. 12J depicts selected 2D class averages of Fc.
  • FIG. 12E depicts a representative cryoEM micrograph with Fab and Fc molecules highlighted with white circles. Scale bar is 50 nm.
  • FIG. 12F depicts representative 2D class averages of Fab.
  • FIG. 12G depicts an atomic model of Fab 298 (PDB ID: 7K9Z) fit
  • FIG. 12K depicts an atomic model of human IgGl Fc (PDB ID: 6CJX) fit into cryoEM map of Fc.
  • FIG. 12L depicts a GSFSC curve of the final 3D non-uniform refinement of Fc in cryoSPARC v3.
  • FIG. 12M depicts viewing direction distribution of the Fc data.
  • FIGs. 13A-13I relate to experiments analyzing tri-specific MB (298-52-80) by cryoEM.
  • FIG. 13A depicts a representative cryoEM micrograph of tri-specific MB particles (highlighted with white circles). Scale bar is 50 nm.
  • FIG. 13B depict selected 2D class averages of tri-specific MB particles.
  • FIG. 13C depicts a comparison of tri-specific MB (298-52-80) cryoEM reconstructions at two threshold levels (top - 0.7 and bottom - 2.0), which reveal weak and fragmented densities for antibody fragments fused to the apoferritin scaffold.
  • FIG. 13A depicts a representative cryoEM micrograph of tri-specific MB particles (highlighted with white circles). Scale bar is 50 nm.
  • FIG. 13B depict selected 2D class averages of tri-specific MB particles.
  • FIG. 13C depicts a comparison of tri-specific MB (298-52-80) cryoEM reconstructions at two threshold levels (top
  • 131 show details of atomic models of human apoferritin light chain (PDB ID: 6WX6) fit into the tri-specific MB (298-52-80) map refined with octahedral symmetry imposed.
  • CryoEM density of the tri-specific MB is shown as black mesh with the models of adjacent apoferritin protomers shown as white, grey or black sticks.
  • FIGs. 15A and 15B relate to experiments analyzing neutralization of SARS-CoV-2 subvariants XBB.l and BQ.1.1 by tri-specific MB (2-7-10-40-11-11).
  • FIG. 15A are plots showing PsV neutralization of 2-7-10-40-11-11 tri-specific MB and corresponding IgG cocktail represented in red and blue, respectively, against Omicron subvariants XBB.l and BQ.1.1. The mean values ⁇ SD for two technical replicates is shown in each neutralization plot.
  • FIG. 15B, left panel is a plot showing neutralization potency of 2-7-10-40-11-11 tri- specific MB (red bars) and corresponding IgG cocktail (blue bars) against Omicron subvariants XBB.1 and BQ.1.1.
  • FIG. 15B right panel, are molecular representations of percentage accessible surface area on the RBD (grey) covered by the tri-specific MB (green). Mutations found in SARS-CoV-2 VOCs (Alpha, Beta, Gamma, Delta, Omicron (BA.l, BA.2)) that are part of each antibody binding interface are shown in red. Additional mutations specific to XBB.l and BQ.1.1 Omicron subvariants are indicated in orange.
  • FIG. 16 is a bar graph depicting lack of binding of tri-specific MB 298-52-80 to self antigens in a polyreactivity assay. Shown are binding of tri-specific 298-52-80 MB and its corresponding subcomponent IgGs to cardiolipin (blue), insulin (green), dsDNA (red), and KLH (orange). The polyreactive HIV envelope directed IgG 4E10 was used as a positive control.
  • a maximal association binding response of less than 0.1 nm after 180 seconds to a biosensor loaded with 0.8 nm of target when the test article is present at a concentration of 20 nM is classified as “non-binding.”
  • the linker is an “amino acid linker,” that is, it comprises amino acid residues, e.g., an amino acid linker may comprise at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more amino acid residues.
  • a linker is characterized in that it tends not to adopt a rigid three-dimensional structure, but rather provides flexibility to the polypeptide.
  • nanocage monomer refers to a single chain of a polypeptide that is capable of self-assembling with other nanocage monomers to form a selfassembled polypeptide complex comprising a plurality of nanocage monomers.
  • the nanocage monomer is selected from monomers of ferritin, apoferritin, encapsulin, sulfur oxygenase reductase (SOR), lumazine synthase, pyruvate dehydrogenase, carboxysome, vault proteins, GroEL, heat shock protein, E2P coat protein, MS2 coat protein, fragments thereof, and variants thereof.
  • a subject to an organism, typically a mammal (e.g, a human).
  • a subject is suffering from or susceptible to a relevant disease, disorder or condition.
  • a subject displays one or more symptoms or characteristics of a disease, disorder or condition.
  • a subject is someone with one or more features characteristic of susceptibility to or risk of a disease, disorder, or condition.
  • a subject is a patient.
  • a subject is a subject to whom diagnosis and/or therapy is and/or has been administered.
  • treatment refers to any administration of a therapy that partially or completely alleviates, ameliorates, relieves, inhibits, delays onset of, reduces severity of, and/or reduces incidence of one or more symptoms, features, and/or causes of a particular disease, disorder, and/or condition.
  • such treatment may be of a subject who does not exhibit signs of the relevant disease, disorder and/or condition and/or of a subject who exhibits only early signs of the disease, disorder, and/or condition.
  • such treatment may be of a subject who exhibits one or more established signs of the relevant disease, disorder and/or condition.
  • treatment may be of a subject who has been diagnosed as suffering from the relevant disease, disorder, and/or condition. In some embodiments, treatment may be of a subject known to have one or more susceptibility factors that are statistically correlated with increased risk of development of the relevant disease, disorder, and/or condition.
  • fusion polypeptides compatible with compositions and methods disclosed herein generally comprise a nanocage monomer or subunit thereof linked to either (1) a sarbecovirus antibody or sarbeco virus -binding antibody fragment or (2) an Fc polypeptide.
  • the sarbecovirus antibody, sarbecovirus-binding antibody fragment, or Fc polypeptide may be linked to the nanocage monomer or subunit thereof at a particular terminus of the nanocage monomer or subunit thereof, e.g, the N- terminus or the C-terminus.
  • the sarbecovirus antibody, sarbecovirus- binding antibody fragment, or Fc polypeptide is linked to the nanocage monomer or subunit thereof via an amino acid linker, such as a linker described herein.
  • the ferritin monomer subunit comprises approximately half of a ferritin monomer.
  • the term “N-half ferritin” refers to approximately half of a ferritin chain, which half comprises the N-terminus of the ferritin chain.
  • the term “C-half ferritin” refers to approximately half a ferritin chain, which half comprises the C-terminus of the ferritin chain. The exact point at which a ferritin chain may be divided to form the N-half ferritin and the C-half ferritin may vary depending on the embodiment.
  • the halves may be divided at a point that corresponds to a position between about position 75 to about position 100 of SEQ ID NO: 1 (or a substantial portion thereof).
  • an N-half ferritin based on a human ferritin light chain has an amino acid sequence corresponding to residues 1-95 of SEQ ID NO: 1 (or a substantial portion thereof, e.g. , residues 2-95 of SEQ ID NO: 1)
  • a C-half ferritin based on a human ferritin light chain has an amino acid sequence corresponding to residues 96-175 of SEQ ID NO: 1 (or a substantial portion thereof).
  • Immunoglobulin molecules typically contain a fragment crystallizable (Fc) region composed of two chains which are each portions of an immunoglobulin heavy chain.
  • each chain hereinafter “Fc chain” includes a constant heavy 2 (CH2) region and a constant heavy 3 (CH3) region.
  • the Fc polypeptide comprises one or more human IgGl Fc chains; that is, except for any mutations noted herein, the Fc polypeptide comprises an Fc chain that is substantially similar to that of the Fc chains within a wild type human IgGl.
  • the Fc polypeptide comprises one or more human IgG4 Fc chains; that is, except for any mutations noted herein, the Fc polypeptide comprises an Fc chain that is substantially similar to that of the Fc chains within a wild type human IgG4.
  • the wild type IgGl Fc is a human IgGl Fc, in which each Fc chain has an amino acid sequence of SEQ ID NO:4.
  • the wild type IgG4 Fc is a human IgG4 Fc, in which each Fc chain has an amino acid sequence of SEQ ID NO:6.
  • an Fc polypeptide may comprise an Fc chain with an amino acid sequence that is at least 85%, at least 87.5%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:4 or SEQ ID NO:6.
  • an Fc polypeptide comprises an Fc chain that comprises the particular residue(s) at certain position(s) specifically described for that Fc chain, but has an amino acid sequence that is otherwise 100% identical to a corresponding Fc chain within a wild type Fc chain, e.g., a wild type IgGl Fc chain or wild type IgG4 Fc chain.
  • the Fc polypeptide comprises an Fc chain that has an amino acid sequence that differs by at least one, at least two, at least three, or at least four amino acid residues from the sequence of SEQ ID NO:4 or from the sequence of SEQ ID NO:6.
  • the Fc polypeptide is a single chain Fc (scFc), which comprises two Fc chains linked together by a covalent linker, e.g., via an amino acid linker.
  • scFc single chain Fc
  • a non-limiting example of an scFc using Fc chains from human IgGl and an amino acid linker is shown as SEQ ID NO:5.
  • the Fc chain comprises an alanine at position 234. In certain embodiments, the Fc chain comprises an alanine at position 235. In some embodiments, the Fc chain comprises an alanine at position 237. In some embodiments, the Fc chain comprises a serine at position 238.
  • the Fc chain is an IgG4 Fc chain and comprises a proline at position 228.
  • the Fc chain is an IgG4 Fc chain and comprises a mutation or set of mutations selected from the group consisting of S228P, F234A, L235A, G237A, P238S, and combinations thereof.
  • the Fc chain is an IgG4 Fc chain and comprises one of the following sets of mutations:
  • the Fc chain comprises a mutation or set of mutations (relative to a corresponding wild type Fc chain) associated with an altered characteristic as further described herein.
  • association with it is meant that the mutation or set of mutations has been previously characterized, in the context of antibodies such as IgG antibodies, as conferring the altered characteristic (e.g, altered binding to FcRn, altered effector function, etc.)
  • altered it is meant that the characteristic (e.g, binding to an Fc receptor (e.g, an Fey receptor or an FcRn)), is different than that observed without the mutation or set of mutations.
  • the sarbecovirus binding moiety is capable of binding at least one Omicron variant of SARS-CoV-2, e.g, BA.l, BA.2, BA.5, XBB.l or BQ.1.1.
  • the antibody fragment comprises a heavy chain variable region (e.g, a VH). In certain embodiments, the antibody fragment comprises a heavy chain variable domain (e.g, VH) and a light chain variable domain (e.g, a VL or VK). In certain embodiments, the antibody fragment comprises a Fab which comprises a heavy chain variable domain (e.g, VH) and a light chain variable domain (e.g, a VL or VK).
  • the antibody fragment does not comprise any domains from the Fc region, e.g, does not comprise any CH2 or CH3 domains.
  • the antibody fragment is an antibody fragment of, or derived from, any of a variety of sarbecovirus antibodies, including, e.g, fully human, humanized or chimeric sarbecovirus antibodies.
  • the sarbecovirus antibody from which the antibody fragment is obtained or derived can be of any of a variety of antibody classes, including, e.g., an IgGl antibody, an IgG2 antibody, an IgG4 antibody.
  • the sarbecovirus antibody or fragment is a neutralizing sarbecovirus antibody, e.g, a neutralizing humanized sarbecovirus antibody, or a fragment thereof.
  • the sarbecovirus antibody is capable of neutralizing SARS- CoV-2, e.g., with an IC50 below 10 pg/mL, below 2 pg/mL, or 1 pg/mL.
  • the sarbecovirus antibody is capable of neutralizing a sarbecovirus other than SARS-CoV-2 (e.g, SARS-Co-V), e.g, with an IC50 below 10 pg/mL, below 2 pg/mL, or 1 pg/mL.
  • the sarbecovirus binding moiety is capable of neutralizing both SARS-CoV-2 and another sarbecovirus (e.g, SARS-Co-V).
  • Antibody neutralizing ability may be determined, for example, using an in vitro assay such as one that employs a pseudovirus panel or an in vitro assay that employs live virus.
  • Non-limiting examples of sarbecovirus antibodies include, e.g., an antibody depicted in Table 1, shown below.
  • the sarbecovirus antibody or sarbecovirus binding fragment thereof comprises a heavy chain complementarity determining region 3 (CDR-H3) having a sequence which comprises YYDRSGY (SEQ ID NO: 70).
  • CDR-H3 heavy chain complementarity determining region 3
  • sarbecovirus antibody fragments comprises heavy chain and light chain CDRs having similar sequences (e.g, each CDR being identical, or having one or two amino acid substitutions) to that of the heavy and light chain CDRs of a sarbecovirus antibody (e.g, a sarbecovirus antibody mentioned in Table 1).
  • the sarbecovirus antibody fragment comprises heavy and light chain CDRs having sequences identical to those of the heavy and light chain CDRs of a sarbecovirus antibody (e.g, a sarbecovirus antibody mentioned in Table 1), except for one, two, or three amino acid substitutions total across all six CDRs.
  • a sarbecovirus antibody e.g, a sarbecovirus antibody mentioned in Table 1
  • the sarbecovirus antibody fragment comprises heavy chain and light chain complementarity-determining regions (CDRs) having the same sequences as the CDRs of a sarbecovirus antibody, e.g, a sarbecovirus antibody mentioned in Table 1.
  • CDRs heavy chain and light chain complementarity-determining regions
  • sarbecovirus antibody fragments comprises heavy chain and light chain variable regions having similar sequences (e.g, each VH and VL or VK being identical, or having at least 90%, at least 91%, at least 92%, at least 93%, at least 94% at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% amino acid sequence identity) to that of the heavy and light chain variable regions of a sarbecovirus antibody (e.g, a sarbecovirus antibody mentioned in Table 1).
  • a sarbecovirus antibody e.g, a sarbecovirus antibody mentioned in Table 1.
  • the antibody fragments in the various types of fusion polypeptides may be capable of binding to the same epitope on a sarbecovirus, capable of binding to epitopes that are distinct and nonoverlapping on a sarbecovirus (e.g, distinct epitopes on the same sarbecovirus and/or distinct epitopes on different sarbecoviruses or different variants of a sarbecovirus), or capable of binding to epitopes that are distinct but overlapping on a sarbecovirus.
  • linkers are used within fusion polypeptides and/or within single-chain molecules such as scFcs.
  • the linker is an amino acid linker.
  • a linker as employed herein may comprise from about 1 to about 100 amino acid residues, e.g, about 1 to about 70, about 2 to about 70, about 1 to about 30, or about 2 to about 30 amino acid residues.
  • the linker comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 amino acid residues.
  • the linker comprises a glycine-serine sequence, e.g, a (GnS)m sequence (e.g, GGS, GGGS (SEQ ID NO:55), or GGGGS (SEQ ID NO:54) sequence) that is present in at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, or at least 14 copies within the linker.
  • GnS glycine-serine sequence
  • provided are self-assembled polypeptide complexes comprising a plurality of fusion polypeptides as disclosed herein.
  • provided self-assembled polypeptide complexes comprise (a) a plurality of first fusion polypeptides, each first fusion polypeptide comprising (1) an Fc polypeptide linked to (2) a nanocage monomer or subunit thereof, wherein the Fc polypeptide comprises an Fc chain having one or more mutations relative to a reference Fc chain of the same Ig class, and (b) a plurality of second fusion polypeptides, each second fusion polypeptide comprising (1) an antigen-binding antibody fragment linked to (2) a nanocage monomer or subunit thereof.
  • the nanocage monomer is a ferritin monomer
  • each fusion polypeptide within the self-assembled polypeptide complex comprises a ferritin light chain or a subunit of a ferritin light chain.
  • the self-assembled polypeptide complex does not comprise any ferritin heavy chains, subunits of ferritin heavy chains, or other ferritin components capable of binding to iron or capable of ferroxidase activity.
  • the nanocage monomer or subunit thereof is a ferritin monomer subunit
  • each first fusion polypeptide comprises a ferritin monomer subunit which is C-half-ferritin and each second fusion polypeptide comprises a ferritin monomer subunit which is N-half-ferritin; or (b) each first fusion polypeptide comprises a ferritin monomer subunit which is N-half ferritin and each second fusion polypeptide comprises a ferritin monomer subunit which is C-half-ferritin.
  • the self-assembled polypeptide complex comprises between 24 and 48 fusion polypeptides in total. In some embodiments, the self-assembled polypeptide complex comprises 24 fusion polypeptides in total. In some embodiments, the self-assembled polypeptide complex comprises more than 24 fusion polypeptides, e.g., at least 26, at least 28, at least 30, at least 32 fusion polypeptides, at least 34 fusion polypeptides, at least 36 fusion polypeptides, at least 38 fusion polypeptides, at least 40 fusion polypeptides, at least 42 fusion polypeptides, at least 44 fusion polypeptides, at least 46 fusion polypeptides, or at least 48 fusion polypeptides in total.
  • 24 fusion polypeptides e.g., at least 26, at least 28, at least 30, at least 32 fusion polypeptides, at least 34 fusion polypeptides, at least 36 fusion polypeptides, at least 38 fusion polypeptides, at least 40 fusion polypeptides
  • the self-assembled polypeptide complex comprises about 32 fusion polypeptides. [0354] In some embodiments, the self-assembled polypeptide complex comprises at least 4, at least 5, least 6, at least 7, or at least 8 first fusion polypeptides.
  • the self-assembled polypeptide complex comprises at least 4, at least 5, least 6, at least 7, or at least 8 second fusion polypeptides.
  • the self-assembled polypeptide complex further comprises at least 4, at least 5, least 6, at least 7, at least 8, at least 9, at least 10, least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 third fusion polypeptides.
  • the self-assembled polypeptide complex comprises a ratio of approximately 1:1, 11:13, 3:5, 1:2, 7:17, 1:3, 2:7, 5:19, 1:4, 1:5, 1:6, 1:7, 1:8, 1:12, 1:24 of first fusion polypeptides to all other fusion polypeptides.
  • provided self-assembled polypeptide complexes are capable of neutralizing one or more sarbecoviruses, e.g., SARS-CoV-2.
  • provided self-assembled polypeptide complexes are capable of neutralizing one or more variants of SARS-CoV-2, e.g., an Omicron lineage variant, e.g, BA.l, BA.2, BA.5, XBB.l, and/or BQ.1.1.
  • an Omicron lineage variant e.g, BA.l, BA.2, BA.5, XBB.l, and/or BQ.1.1.
  • provided self-assembled polypeptide complexes are capable of neutralizing one or more sarbecoviruses other than SARS-CoV-2, such as a sarbeco virus selected from the group consisting of SARS-CoV, GD-Pangolin, GX-Pangolin, RaTG13, WIV1, SHC014, Lyral l, Rs7327, Rs4231, Rs4084, and combinations thereof.
  • a sarbeco virus selected from the group consisting of SARS-CoV, GD-Pangolin, GX-Pangolin, RaTG13, WIV1, SHC014, Lyral l, Rs7327, Rs4231, Rs4084, and combinations thereof.
  • provided self-assembled polypeptide complexes are capable of neutralizing such as SARS-CoV.
  • provided self-assembled polypeptide complexes are capable of neutralizing SARS-CoV-2 and one or more sarbecoviruses other than SARS-CoV-2, e.g, both SARS-CoV-2 and a sarbecovirus selected from the group consisting of SARS-CoV, GD-Pangolin, GX-Pangolin, RaTG13, WIV1, SHC014, Lyrall, Rs7327, Rs4231, Rs4084, and combinations thereof.
  • provided self-assembled polypeptide complexes are capable of neutralizing both SARS-CoV and SARS-CoV-2.
  • a self-assembled polypeptide complex is capable of neutralizing a sarbeco virus or variant of a sarbecovirus with an IC50 of less than 0.01 pg/mL, .005 pg/mL, 0.001 pg/mL, 0.0005 pg/mL, or 0.0002 pg/mL.
  • a self-assembled polypeptide complex is capable of neutralizing an Omicron variant of SARS-CoV-2 with an IC50 of less than 0.5 pg/mL, 0.1 pg/mL, 0.01 pg/mL, .005 pg/mL, 0.001 pg/mL, 0.0005 pg/mL, or 0.0002 pg/mL.
  • a selfassembled polypeptide complex is capable of neutralizing a BA.5 (Omicron) variant of SARS-CoV-2 with an IC50 of less than 0.01 pg/mL, .005 pg/mL, 0.001 pg/mL, 0.0005 pg/mL, or 0.0002 pg/mL.
  • a self-assembled polypeptide complex is capable of neutralizing a BQ.1.1 and/or XBB.1 (Omicron) variant of SARS-CoV-2 with an IC50 of less than 0.5 pg/mL.
  • a self-assembled polypeptide complex is capable of neutralizing a BQ.1.1 (Omicron) variant of SARS-CoV-2 with an IC50 of about 0.1 pg/mL. In some embodiments, a self-assembled polypeptide complex is capable of neutralizing an XBB.l (Omicron) variant of SARS-CoV-2 with an IC50 of less than 0.1 pg/mL.
  • methods that may be useful for treating, ameliorating, or preventing sarbecovirus infection or a sarbecovirus-associated condition, generally comprising a step of administering a composition comprising a self-assembled polypeptide complex of the present disclosure to a subject.
  • the subject is a mammal, e.g. , a human.
  • compositions for administration to subjects generally comprise a self-assembled polypeptide complex as disclosed herein.
  • such compositions further comprise a pharmaceutically acceptable excipient.
  • compositions may be formulated for administration for any of a variety of routes of administration, including systemic routes (e.g, oral, inhalation, intranasal, intravenous, intraperitoneal, subcutaneous, or intramuscular administration).
  • routes of administration including systemic routes (e.g, oral, inhalation, intranasal, intravenous, intraperitoneal, subcutaneous, or intramuscular administration).
  • the step of administering results in improvement in one or more clinical outcomes or metrics in the subject.
  • administration of a self-assembled polypeptide complex may, in some embodiments, result in reduction of viral load.
  • administration of self-assembled polypeptide complex described herein results in reduced chances of infection by a sarbecovirus and/or reduced forward transmission of the sarbecovirus.
  • administration may, in some embodiments, prevent, delay, reduce the severity of, relieve the symptoms of, and/or reduce incidence of one or more sarbecovirus-associated condition.
  • Sarbecovirus-associated conditions include, for example, respiratory distress, fever, ground-glass opacities in the lung, pneumonia, lymphocytopenia, cerebrovascular disorders, dysrhythmias, ischemic and non-ischemic heart disease, pericarditis, myocarditis, and heart failure, thromboembolic disease.
  • DMEM fetal bovine serum
  • FBS Hy clone, Logan, UT
  • penicillinstreptomycin Invitrogen, Thermo Fisher Scientific, Waltham, MA
  • HEK 293F and HEK 293 S cells were cultured in Freestyle 293 Expression Medium (Thermo Fisher Scientific, Waltham, MA) at 125 rpm oscillation, 37 °C, 8% CO 2 .
  • SARS-CoV-2/SB2-P4-PB Clone 1 (Banerjee et al. Emerg Infect Dis 26:2054-63, 2020) titers were determined by 50% tissue culture infectious dose (TCID50/mL) using cell supernatants using known methods. Protein expression and purification
  • Alpha, Beta, Gamma, Delta, and Omicron SARS-CoV-2 PsV variants were generated by substituting the WT Spike plasmid. PsV were harvested, filtered through 0.45 pm sterile filters, and concentrated using a 100 K Amicon filter (Merck Millipore Amicon - Ultra 2.0 Centrifugal Filter Units, Millipore Sigma, Burlington, MA).
  • Spike gene sarbecovirus S genes were codon-optimized for mammalian expression, synthesized by Twist Biosciences, and cloned into the same expression vectors as above by Gibson Assembly (New England Biolabs). Sarbecovirus sequences were retrieved from GenBank for Rs4084, Rs7327, and LYRal 1 as shown in Table 2.
  • HEK 293T cells ATCC
  • PKI poly(ethylenimine)
  • G*AG-luciferase Kerafast
  • MOI multiplicity of infection
  • Pseudoviruses were titrated to standardize the infectivity levels for target cells before setting up neutralization assays.
  • Neutralization assays were performed by incubating pseudoviruses with 5-fold serial dilutions of MB versus their corresponding IgGs in triplicate in a 96-well plate for 1 h at 37 °C. Briefly, 293T-hACE2 cells were seeded at a density of 1 xio 5 cells/well. Luciferase activity was measured using the Luciferase Assay System (Promega), according to the manufacturer’s instructions, 24 h after cells were added to the pseudovirus and serum. The neutralization curves and IC50 values were generated by fitting a nonlinear five-parameter dose-response curve in GraphPad Prism 9.3.
  • Viral RNA from swab samples were extracted using a QIAamp Viral RNA Mini Kit (Qiagen, Hilden, Germany). Primers targeting env (Forward Primer: ACAGGTACGTTAATAGTTAATAGCGT, Reverse Primer: ATATTGCAGCAGTACGCACACA) were used alongside the Luna Universal One-Step RT- qPCR kit (New England Biolabs, Ipswitch, MA) and CFX384 Touch Real-Time System (Bio-Rad) for RT-qPCR. Nuclease-free water was used as ano template control.
  • Example 2 Broad sarbecovirus neutralization achieved by trispecific Multabody [0394] Although monospecific MBs show potent neutralization and can rescue loss in potency compared to their mAb counterparts, monospecificity still carries the risk of viral escape, should sufficient mutations emerge to overcome the benefit conferred by binding avidity. Indeed, the 80 monospecific MB loses neutralization against Omicron BA.5 (FIG. 14A), underscoring the need for an improved approach to tackle evolving viral variants and achieveaji neutralization breadth that could potentially also extend to other sarbecoviruses beyond SARS-CoV-2. As such, a trispecific MB targeting three distinct epitopes while retaining avidity has the potential to provide vibrant resilience against evolving variants.
  • mAh specificities 2-7, 10-40, and 11-11 were selected to design a trispecific molecule to explore neutralization gains made by combining next-generation mAbs with different epitope specificities on the MB. Similar to mAh 80, structural data on mAh 2-7 revealed that RBD mutations found in VOCs form part of its binding interface (Cerutti et al.
  • Monospecific 2-7 MB did not show neutralization against the sarbecovirus panel, while 10- 40 and 11-11 MBs were not able to block infection of live Omicron BA.2 (FIG. 3C and FIGS. 4B-4E).
  • the trispecific MB of these specificities combined on a single molecule displayed both potent SARS-CoV-2 neutralization across the VOCs, including live Omicron BA.2, as well as pan-sarbecovirus neutralization of this panel (FIGS. 3B-3C and FIGS. 4A-4E).
  • the 2-7-10-40-11-11 tri-specific MB and the corresponding IgG cocktail was tested against the recent BQ.1.1 and XBB.1 Omicron subvariants to assess neutralization potency in pseudovirus assays.
  • the potency of the IgG cocktail falls below the IC50 range of clinically authorized antibodies (0.3 pg/mL for Sotrovimab and 0.01 pg/mL for REGEN-COV against WT SARS-CoV-2 PsV) and does not reach 100% neutralization even at 100 pg/mL (FIG. 15A and FIG. 15B).
  • the tri-specific Mb neutralized the BQ- 1.1 and XBB.l subvariants at a potency of 0.06 pg/mL and 0.18 pg/mL, respectively, corresponding to doses falling within the dosing range of FDA-authorized therapeutics (FIG.
  • the trispecific 2-7-10-40-11-11 MB contains 62 contact residues in the RBD compared to 23, 27, and 37 residues in the case of individual mAbs 2-7, 10-40, and 11- 11, respectively. Therefore, by targeting three partially overlapping functional epitopes on the RBD, and through the potency gain provided by avidity, the trispecific 2-7-10-40-11-11 MB provides proof-of-concept for potent, broad, and resilient neutralization across sarbecoviruses by a single MB molecule.
  • Example 3 Neutralization potency correlates with in vivo protection from SARS-CoV-2 [0398]
  • the inventors have previously reported the generation of tri-specific MB molecules targeting SARS-CoV-2 (“298-52-80 MB,” comprising Fab fragments from antibodies 298, 52, and 80, each targeting the RBD of SARS-CoV-2).
  • the 298-52-80 MB was constructed using an engineered apoferritin split design (FIG. 5A and FIG. 5B) (Rujas, E. et al. Multivalency transforms SARS-CoV-2 antibodies into ultrapotent neutralizers. Nat.
  • T10 MB* achieved an IC50 value of 0.0002 pg/mL, approximately 1000-fold more potent than its corresponding cocktail IgG (FIG. 6).
  • Binding kinetics studies revealed that both T10 MB* and the IgG4* antibody cocktail displayed pH-dependent binding to mouse and human FcRn (FIGS. 7A-7B), and no binding to human and mouse Fey receptors (FcyR). This was in contrast to the FcyR binding observed for the corresponding IgGl antibody cocktail control (FIG. 7B-7D).
  • the MB* and IgG4* antibody cocktail also displayed no binding to mouse and human FcRn at physiological pH and binding at acidic pH with no detectable off rate (FIG. 7C and FIG. 7D).
  • Antibody-dependent cell-mediated phagocytosis (ADCP) experiments using fluorescently labeled beads coated with SARS-CoV-2 Spike protein were performed using flow cytometry. Gating strategy was based on gating of THP-1 cells by size and live cells; cells positive for internalization of SARS-CoV-2 Spike-coated fluorescent beads were quantified as a percentage of live THP-1 cells (FIGs. 7E-7H). These experiments further confirmed the inability of T10 MB* and the IgG4* cocktail to engage Fc receptors, while the IgGl antibody cocktail showed substantial uptake of SARS-CoV-2 Spike-coated beads (FIG. 71).
  • FIG. 10A These data illustrate how mAh 80 inhibits SARS-CoV-2 infection through receptor blockade, preventing the interaction of ACE2 with the receptor binding motif (FIG. 10A).
  • the heavy chain of mAb 80 is primarily responsible for the interaction with RBD, contributing ten of the eleven hydrogen bonds found in the binding interface (FIG. 10B and FIG. 10C; Table 3). Additionally, interaction of F54 of the antibody heavy chain with Y489 from the RBD results in the formation of a new triple pi-stacking within the RBD structure, between residues Y473, F456 and Y421 (FIG. 10D).
  • Example 5 Cryo-electron microscopic characterization of trispecific MB, 298-52-80 Methods and Materials
  • the tri-specific MB (298-52-80) sample was concentrated to 2.0 mg/mL and 3.0 pl of the sample was deposited on homemade holey gold grids, which were glow-discharged in air for 15 s before use. Sample was blotted for 3.0 s, and subsequently plunge-frozen in liquid ethane using a Leica EM GP2 Automatic Plunge Freezer (maintained at 4 °C and 100% humidity). Data collection was performed on a Thermo Fisher Scientific Titan Krios G3 operated at 300 kV with a Falcon 4i camera automated with the EPU software.
  • a nominal magnification of 75,000' and defocus range between 0.5 and 2.0 pm were used for data collection. Exposures were collected for 8.3 s as movies of 30 frames with a camera exposure rate of ⁇ 6.3 e- per pixel per second, and total exposure of 49.6 electrons/ A2. A total of 4,385 raw movies were obtained. Image processing was carried out in cryoSPARC v374. Initial specimen movement correction, exposure weighting, and CTF parameters estimation were done using patch-based algorithms. Micrographs were sorted based on CTF fit resolution, and only micrographs with a fit better than 5.0 A were accepted for further processing. Manual picking was performed to create templates for template-based picking, which resulted in selection of 955,995 particle images.
  • Particle images were sorted via several rounds of 2D classification, which resulted in selection of 358,036 particle images.
  • a preliminary 3D model was obtained ab-initio with no symmetry applied.
  • 151,443 particle images with CTF fit resolution better than 3.0 A were reextracted from micrographs and subjected to non-uniform refinement75 with no symmetry applied, which resulted in a 2.4 A resolution map of the tri-specific MB.
  • 65,478 particle images with CTF fit better than 2.7 A were extracted from micrographs and subjected to non-uniform refinement with octahedral symmetry applied, which resulted in a 2.1 A resolution map.
  • Non-uniform refinements were performed with defocus refinement and optimization of per-group CTF parameters.
  • the pixel size was calibrated at 1.04 A per pixel by fitting a structure of human apoferritin light chain (PDB ID: 2FFX).
  • T10 MB a tri-specific MB incorporating antibody specificities 298, 52, and 80
  • FIG. 12A shows the processing workflow for cryoEM data.
  • 3D reconstructions of the apoferritin scaffold of the MB reached 2.4 A and 2.1 A resolution, respectively, when no symmetry (Cl; FIG. 12E, FIGS. 13A-13D) or octahedral symmetry (O; FIGS. 13A-13I) was applied.
  • the apoferritin scaffold in the tri-specific MB is virtually identical to that of the human apoferritin light chain (PDB ID: 6WX6) with measured cross-correlation (cc) coefficients between maps of 0.97 (Cl) and 0.92 (O).
  • the N and C termini of the core MB scaffold are similarly disposed in 3- and 4-fold symmetry axes as in the native human apoferritin light chain (FIG.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Virology (AREA)
  • Veterinary Medicine (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Immunology (AREA)
  • Epidemiology (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Communicable Diseases (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Nanotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
EP23878454.0A 2022-10-21 2023-10-20 Multabodykonstrukte, zusammensetzungen und verfahren zum targeting von sarbecoviren Pending EP4605437A1 (de)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US202263380540P 2022-10-21 2022-10-21
US202363496136P 2023-04-14 2023-04-14
PCT/CA2023/051399 WO2024082067A1 (en) 2022-10-21 2023-10-20 Multabody constructs, compositions, and methods targeting sarbecoviruses

Publications (1)

Publication Number Publication Date
EP4605437A1 true EP4605437A1 (de) 2025-08-27

Family

ID=90736497

Family Applications (1)

Application Number Title Priority Date Filing Date
EP23878454.0A Pending EP4605437A1 (de) 2022-10-21 2023-10-20 Multabodykonstrukte, zusammensetzungen und verfahren zum targeting von sarbecoviren

Country Status (3)

Country Link
EP (1) EP4605437A1 (de)
JP (1) JP2025536337A (de)
WO (1) WO2024082067A1 (de)

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP4225804A4 (de) * 2020-10-09 2025-07-02 Hospital For Sick Children Polypeptide zum targeting von sars-cov-2 und zugehörige zusammensetzungen und verfahren

Also Published As

Publication number Publication date
JP2025536337A (ja) 2025-11-05
WO2024082067A1 (en) 2024-04-25

Similar Documents

Publication Publication Date Title
US11479599B2 (en) Antibodies against SARS-CoV-2 and methods of using the same
CN113929771B (zh) 多瘤病毒中和抗体
US9493549B2 (en) Antibodies directed toward the HIV-1 GP120 CD4 binding site with increased potency and breadth
WO2021203053A1 (en) Immunotherapy targeting a conserved region in sars coronaviruses
US20250368722A1 (en) Multispecific antibodies targeting multiple epitopes on the hiv-1 envelope
WO2013016468A2 (en) Compositions and methods for improving potency and breadth or hiv antibodies
JP2024509054A (ja) 抗体
WO2013090644A2 (en) Anti-hiv antibodies having increased potency and breadth
WO2021247925A1 (en) Structure-guided immunotherapy against sars-cov-2
US20250263469A1 (en) Polypeptides targeting sars-cov-2 and related compositions and methods
EP4230650B1 (de) Antikörper, die an das spike-protein des coronavirus sars-cov-2 binden können
WO2017011414A1 (en) Bispecific molecules comprising an hiv-1 envelope targeting arm
US20240101645A1 (en) Monoclonal antibodies against coronaviruses and uses thereof
GB2614651A (en) Antibodies
Chen et al. Bifunctional fusion proteins of the human engineered antibody domain m36 with human soluble CD4 are potent inhibitors of diverse HIV-1 isolates
EP4605437A1 (de) Multabodykonstrukte, zusammensetzungen und verfahren zum targeting von sarbecoviren
CN114751988B (zh) 中和冠状病毒的多特异性抗体
US20250002564A1 (en) Modified multabody constructs, compositions, and methods
US20250011397A1 (en) Modified multabody constructs, compositions, and methods targeting sars-cov-2
WO2025252939A1 (en) Bk virus neutralizing antibodies
HK40059983A (en) Polyomavirus neutralizing antibodies
WO2023111796A1 (en) Pan-specific sars-cov-2 antibodies and uses thereof

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20250521

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR

DAV Request for validation of the european patent (deleted)
DAX Request for extension of the european patent (deleted)