EP4605437A1 - Multabody constructs, compositions, and methods targeting sarbecoviruses - Google Patents

Multabody constructs, compositions, and methods targeting sarbecoviruses

Info

Publication number
EP4605437A1
EP4605437A1 EP23878454.0A EP23878454A EP4605437A1 EP 4605437 A1 EP4605437 A1 EP 4605437A1 EP 23878454 A EP23878454 A EP 23878454A EP 4605437 A1 EP4605437 A1 EP 4605437A1
Authority
EP
European Patent Office
Prior art keywords
cdr
seq
sarbecovirus
self
cov
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
EP23878454.0A
Other languages
German (de)
French (fr)
Inventor
Jean-Philippe Julien
Arif JETHA
Krithika MUTHURAMAN
David D. Ho
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Hospital for Sick Children HSC
Columbia University in the City of New York
Original Assignee
Hospital for Sick Children HSC
Columbia University in the City of New York
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Hospital for Sick Children HSC, Columbia University in the City of New York filed Critical Hospital for Sick Children HSC
Publication of EP4605437A1 publication Critical patent/EP4605437A1/en
Pending legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/69Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit
    • A61K47/6921Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere
    • A61K47/6927Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores
    • A61K47/6929Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the conjugate being characterised by physical or galenical forms, e.g. emulsion, particle, inclusion complex, stent or kit the form being a particulate, a powder, an adsorbate, a bead or a sphere the form being a solid microparticle having no hollow or gas-filled cores the form being a nanoparticle, e.g. an immuno-nanoparticle
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/14Antivirals for RNA viruses
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/08Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from viruses
    • C07K16/10RNA viruses
    • C07K16/102Coronaviridae (F)
    • C07K16/104Severe acute respiratory syndrome coronavirus 2 [SARS‐CoV‐2]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62DNA sequences coding for fusion proteins
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/30Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/31Immunoglobulins specific features characterized by aspects of specificity or valency multispecific
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/55Fab or Fab'
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/76Antagonist effect on antigen, e.g. neutralization or inhibition of binding
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/90Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/92Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/30Non-immunoglobulin-derived peptide or protein having an immunoglobulin constant or Fc region, or a fragment thereof, attached thereto
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011Details
    • C12N2770/20011Coronaviridae
    • C12N2770/20022New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011Details
    • C12N2770/20011Coronaviridae
    • C12N2770/20023Virus like particles [VLP]

Definitions

  • Omicron BA.l variant of concern which has 37 mutations within the spike domain and 15 mutations within the receptor binding domain (RBD), the target of most clinical antibodies against SARS- CoV-2.
  • Omicron BQ.1.1 and XBB.l subvariants even mAbs that were capable of neutralizing the original Omicron VOC, including Bebtelovimab, and a cocktail of Tixagevimab and Cilgavimab have had their authorization revoked due to viral escape.
  • the present invention addresses this need with the provision of self-assembled polypeptide complexes which exhibit broad neutralization against sarbecoviruses and which maintain potency. Also provided are related fusion polypeptides, compositions, and methods. [0007] In one aspect, provided are fusion polypeptides that can be used within selfassembled polypeptide complexes disclosed herein.
  • the first sarbecovirus binding moiety comprises a sarbecovirus antibody or sarbecovirus-binding fragment thereof, e.g, an Fab fragment of a sarbecovirus antibody.
  • the Fab fragment is a single chain Fab (scFab).
  • the sarbecovirus antibody is capable of neutralizing SARS- CoV-2 and at least one sarbecovirus other than SARS-CoV-2, for example, a sarbecovirus selected from the group consisting of SARS-CoV, GD-Pangolin, GX-Pangolin, RaTG13, WIV1, SHC014, Lyral l, Rs7327, Rs4231, Rs4084, and combinations thereof.
  • the at least one sarbecovirus other than SARS-CoV-2 comprises SARS-CoV.
  • fusion polypeptides comprising a sarbecovirus binding moiety linked to a nanocage monomer or subunit thereof, wherein the sarbecovirus binding moiety is a sarbecovirus antibody or a sarbecovirus binding fragment thereof, wherein the sarbecovirus antibody or sarbecovirus binding fragment thereof comprises a heavy chain complementarity determining region 3 (CDR-H3) having a sequence which comprises YYDRSGY (SEQ ID NO:70).
  • CDR-H3 heavy chain complementarity determining region 3
  • the sarbecovirus antibody or sarbecovirus binding fragment thereof comprises a CDR-H3 sequence and a CDR-L3 sequence of [0016] (a) SEQ ID NO:34 and SEQ ID NO:37, respectively,
  • the sarbecovirus antibody or sarbecovirus binding fragment thereof comprises a CDR-H3 sequence and a CDR-L3 sequence of [0063] (a) SEQ ID NO:34 and SEQ ID NO:37, respectively,
  • the Fc polypeptide comprises a single chain Fc (scFc) comprising two Fc chains, wherein the two Fc chains are linked via an amino acid linker, such as a linker comprising a (G n S) m linker, e.g., a (GGGGS) m linker.
  • the Fc polypeptide comprises an IgGl Fc chain or an IgG4 Fc chain.
  • the Fc polypeptide comprises an IgG4 Fc chain comprising a mutation or set of mutations selected from the group consisting of S228P, F234A, L235A, G237A, P238S, and combinations thereof.
  • each third fusion polypeptide comprising a third sarbecovirus antibody or sarbecovirus binding fragment thereof linked to a ferritin monomer or subunit thereof, and
  • each Fc-containing fusion polypeptide comprising an Fc polypeptide linked to a ferritin monomer or subunit thereof, [0244] wherein the first, second, and third sarbecovirus antibodies or sarbecovirus binding fragments thereof are distinct from each other, and wherein at least the first and second sarbecovirus antibodies are capable of neutralizing SARS-CoV, and SARS-CoV-2.
  • the self-assembled polypeptide complex is capable of neutralizing an Omicron variant, e.g., two or more Omicron variants, or three or more Omicron variants of SARS- CoV-2 virus.
  • Omicron variants are selected from the group consisting of BA.l, BA.2, BA.5, XBB.l, and BQ.1.1.
  • the self-assembled polypeptide complex is capable of neutralizing the BA.1 variant of SARS-CoV-2 virus, e.g., with an IC50 of 0.01 pg/mL or less.
  • the self-assembled polypeptide complex is capable of neutralizing the BA.2 variant of SARS-CoV-2 virus, e.g., with an IC50 of 0.02 pg/mL or less.
  • the self-assembled polypeptide complex is capable of neutralizing the BA.5 variant of SARS-CoV-2 virus, e.g., with an IC50 of less than 0.001 pg/mL.
  • the self-assembled polypeptide complex is capable of neutralizing the BQ.1.1 variant of SARS-CoV-2 virus, e.g., with an IC50 value of 0.5 pg/mL or less.
  • the self-assembled polypeptide complex is capable of neutralizing the XBB.1 variant of SARS-CoV-2 virus, e.g., with an IC50 value of 0.5 pg/mL or less or 0.1 pg/mL or less.
  • the self-assembled polypeptide complex is capable of neutralizing at least one or a combination of WT SARS-CoV-2, and the Alpha, Beta, Gamma, Delta, and an Omicron variant of SARS-CoV-2.
  • the self-assembled polypeptide complex is capable of neutralizing WT SARS-CoV-2 and the Alpha, Beta, Gamma, Delta, and an Omicron variant of SARS-CoV-2.
  • the self-assembled polypeptide complex is capable of neutralizing each of the WT SARS-CoV-2 and the Alpha, Beta, Gamma, Delta, and an Omicron variant of SARS-CoV-2 with IC50 values of 0.01 pg/mL or less.
  • the self-assembled polypeptide complex is capable of neutralizing at least one sarbecovirus other than SARS-CoV-2, for example, a sarbecovirus selected from the group consisting of SARS-CoV, GD-Pangolin, GX-Pangolin, RaTG13, WIV1, SHC014, Lyral l, Rs7327, Rs4231, Rs4084, and combinations thereof.
  • a sarbecovirus selected from the group consisting of SARS-CoV, GD-Pangolin, GX-Pangolin, RaTG13, WIV1, SHC014, Lyral l, Rs7327, Rs4231, Rs4084, and combinations thereof.
  • the at least one sarbecovirus other than SARS-CoV-2 comprises SARS-CoV.
  • compositions comprising the selfassembled polypeptide complex as disclosed herein and a pharmaceutically acceptable excipient.
  • kits for treating and/or preventing sarbecovirus infection and/or a sarbecovirus-associated condition comprising administering the self-assembled polypeptide complex as disclosed herein, or a pharmaceutical composition disclosed herein, to a subject in need thereof.
  • the subject is a mammal, e.g. a human.
  • the administering comprises systemic administration, for example, systemic administration by a route such as intranasal, intravascular, or intramuscular administration.
  • polypeptide complexes or pharmaceutical compositions as disclosed herein for use in treating and/or preventing sarbecovirus infection and/or a sarbecovirus-associated condition.
  • FIGS. 1A-1C show a series of plots demonstrating potency and breadth of anti- SARS-CoV-2 neutralizing Multabodies (MBs).
  • IgG neutralization potency left panel
  • breadth against a six PsV panel using a cut-off IC50 value of 5 pg/mL (light gray bars in right panel) or 0.01 pg/mL (dark gray bars in right panel)(FIG. 1A).
  • Heat map showing the neutralization potency of monospecific MBs displaying Fab specificities from (FIG. 1A) against each PsV variant in the panel FIG. IB). Individual IC50 values are displayed.
  • FIGS. 2A-2F 52 (FIGS. 2G-2L), 80 (FIGS. 2M-2R), 2-7 (FIGS. 2S-2X), 2-36 (FIGS. 2Y-2DD), 2-38 (FIGS. 2EE-2JJ), 10-40 (FIGS. 2KK-2PP), and 11-11 (FIGS. 2QQ-2VV), against SARS-CoV-2 WT (FIGS. 2A, 2G, 2M, 2S, 2Y, 2EE, 2 Ik Ik. 2QQ), Alpha (FIGS. 2B, 2H, 2N, 2T, 2Z, 2FF, 2LL, 2RR), Beta (FIGS. 2C, 21, 20, 2U, 2AA, 2GG, 2MM, 2SS), Gamma (FIGS.
  • FIG. 3C Phylogenetic tree with branch lengths representing divergence.
  • Heat map showing neutralization potency of 2-7-10-40-11-11 trispecific MB and its corresponding monospecific MBs against Omicron (BA.2) live virus and three SARS-CoV-1 related bat coronaviruses (LYRall, Rs4084, and Rs7327) PsVs.
  • FIGS. 4A-4E are a series of plots showing broad SARS-CoV-2 and sarbecovirus neutralization by a trispecific MB of the disclosure.
  • PsV neutralization of 2-7-10-40-11-11 trispecific MB against SARS-CoV-2 wildtype, Alpha, Beta, Gamma, Delta, Omicron BA.l and Omicron BA.5 (FIG. 4A).
  • the mean values ⁇ SEM for three biological replicates are shown in each neutralization plot.
  • Live virus neutralization of 2-7-10-40-11-11 trispecific MB and 2-7, 10-40, and 11-11 monospecific MBs against Omicron (BA.2) authentic virus FIG. 4B.
  • the mean values ⁇ SD for two technical replicates is shown in each neutralization plot.
  • FIG. 7B depicts binding (apparent KD) of cocktail IgGl, cocktail IgG4* and T10 MB* particles to human (FcyR I, Ila, lib and FcRn) and mouse (FcyR I, lib, IV and FcRn) receptors.
  • NB and LOD denote no-binding and limit-of-detection, respectively.
  • Mean values ⁇ SD for at least three independent experiments are shown.
  • FIGs. 7E-7H depict flow cytometry plots exemplifying gating strategy followed in an antibody-dependent cellular phagocytosis (ADCP) assay.
  • THP-1 cells were gated by size and live cells, and cells positive for internalization of SARS-CoV-2 Spike-coated fluorescent beads were quantified as a percentage of live THP-1 cells.
  • FIG. 71 depicts a bar graph showing % internalization (indicative of ADCP) determined as the percentage of THP-1 cells with internalized SARS-CoV-2 Spike-coated fluorescent microspheres. Mean values ⁇ SD for at least three independent experiments are shown. *** indicates significance compared to no antibody control (p ⁇ 0.001) by ANOVA.
  • FIGs. 8A-8G depict results from in vivo challenge experiments. (See Example 3.)
  • FIG. 8A depicts survival over a 12-day period following challenge. **** p ⁇ 0.0001, **p ⁇ 0.01, *p ⁇ 0.05 by Gehan Breslow Wilcoxon test.
  • FIG. % internalization indicative of ADCP
  • FIG. 8B depicts lung viral titers at the end of the experiment (open symbols) or at the time of death in the animals that succumbed (closed symbols) measured by viral outgrowth assay. TCID50 per gram of tissue is shown. ****p ⁇ 0.0001, **p ⁇ 0.01, Kruskall Wallis test.
  • FIG. 8E depicts SARS-CoV-2 genome copy number as quantified by qPCR from oropharyngeal swab samples collected at D-l (before challenge) and D2 following challenge by intranasal SARS-CoV-2 administration.
  • FIG. 8F Survival (FIG. 8F) and serum IgG or MB concentrations at day 2 (FIG. 8G) following administration of low dose tri-specific MB* (3 pg [1.4pmol]; 0.15 mg/kg) compared to high-dose (90 pg [600 pmol]; 4.5 mg/kg) cocktail IgG4*.
  • FIG 8G shows that
  • n 24 for T10 MB*
  • n 10 for cocktail IgG4* mix and control IgG, from 2-5 independent experiments.
  • FIGs. 9A-9B depict stereo-image of composite omit map electron density of 80 Fab- RBD interaction sites.
  • FIG. 9A depicts the map for heavy chain complementarity determining regions (HCDRs) 2 and 3 (light and dark green, respectively) and RBD (grey).
  • FIG. 9B depicts the map for Kappa light chain CDR (KCDR) 3 (orange) and RBD (grey).
  • FIG. 10A depicts the three-dimensional structure of the 80 Fab-RBD complex. The heavy and light chains of 80 Fab are colored in dark and light purple, respectively. RBD is shown as surface representation (grey) with the footprint of ACE2 depicted in salmon.
  • FIG. 10B depicts binding interactions within the 80 Fab-RBD complex. Binding to RBD (grey) involves interactions mediated by heavy chain complementarity determining regions (HCDRs) 2 and 3 (light and dark green, respectively) and kappa light chain CDRS (KCDRs) 2 and 3 (yellow and orange).
  • HCDRs heavy chain complementarity determining regions
  • KCDRs kappa light chain CDRS
  • FIG. 10C depicts a detailed view of the hydrogen bond network (dashed lines) formed between key residues at the binding interface of the 80-RBD complex.
  • FIG. 10D depicts a detailed view of interactions between RBD residues upon binding to antibody 80. Rearrangement of RBD aromatic residues (grey) upon 80 binding (green) to form a pi-stacking interaction network (shown in cyan dashed line). Left panel: unbound RBD and right panel: 80-RBD complex.
  • FIG 10E is a secondary structure cartoon representation of RBD, with residues mutated in the different variants of concern highlighted as red spheres. Inset: close-up view of the RBD area recognized by 80. Critical residues for binding are colored in pink according to their buried surface area (BSA). Mutated residues in the VOCs are indicated and shown in red in the BSA plot.
  • FIG. 10F Molecular modeling displays the possible conformation adopted by the side chains of the mutated residues T478K and S477N upon 80 binding. Hydrogen bonds are shown as dashed black lines.
  • FIG. 11B shows binding kinetic parameters (KD, k on , and k o ff) of 80 as Fab, IgG and MB for binding to WT and Omicron BA.1 RBD. Data shown is average from two independent experiments.
  • FIGs. 12A-12M relate to experiments analyzing tri-specific MB (298-52-80; “T10 MB”) by cryo-electron microscopy (cryoEM).
  • FIG. 12A depicts a processing workflow for cryoEM data.
  • FIG. 12B depicts a representative cryoEM micrograph of tri-specific MBs with white circles highlighting the whole particles and pink and green circles highlighting the scFab and scFc fragments, respectively.
  • FIG. 12C depicts representative 2D classes of scFab (top panels), tri-specific MB (middle panels), and Fc domains (bottom panels).
  • FIG. 12D depicts 3D reconstructions of components of a multabody of the present disclosure.
  • Images on the left are cryoEM maps of scFab at 6.7 A resolution (top), apoferritin nanocage scaffold at 2.4 A resolution (middle) and scFc at 7.1 A resolution (bottom).
  • Images on the right depict fitting of the human apoferritin light chain model (PDB ID:6WX6) into the 2.4 A map, focusing on features such as the N-terminus of the apoferritin scaffold that shows weak density beyond Ser5 due to the flexibility of the linker (top), the four-fold axis formed by four adjacent subunits (middle), and residues 87-109 of the human apoferritin light chain (bottom; the red arrow points to the split site between residues Trp93 and Gly94 in some subunits).
  • FIG. 12E depicts a representative cryoEM micrograph with Fab and Fc molecules highlighted with white circles. Scale bar is 50 nm.
  • FIG. 12F depicts representative 2D class averages of Fab.
  • FIG. 12G depicts an atomic model of Fab 298 (PDB ID: 7K9Z) fit into cryoEM map of Fab.
  • FIG. 12H depicts a gold standard Fourier shell correlation (GSFSC) curve of the final 3D non-uniform refinement of Fab in cryoSPARC v3.
  • FIG. 121 depicts the viewing direction distribution of the Fab data.
  • FIG. 12J depicts selected 2D class averages of Fc.
  • FIG. 12E depicts a representative cryoEM micrograph with Fab and Fc molecules highlighted with white circles. Scale bar is 50 nm.
  • FIG. 12F depicts representative 2D class averages of Fab.
  • FIG. 12G depicts an atomic model of Fab 298 (PDB ID: 7K9Z) fit
  • FIG. 12K depicts an atomic model of human IgGl Fc (PDB ID: 6CJX) fit into cryoEM map of Fc.
  • FIG. 12L depicts a GSFSC curve of the final 3D non-uniform refinement of Fc in cryoSPARC v3.
  • FIG. 12M depicts viewing direction distribution of the Fc data.
  • FIGs. 13A-13I relate to experiments analyzing tri-specific MB (298-52-80) by cryoEM.
  • FIG. 13A depicts a representative cryoEM micrograph of tri-specific MB particles (highlighted with white circles). Scale bar is 50 nm.
  • FIG. 13B depict selected 2D class averages of tri-specific MB particles.
  • FIG. 13C depicts a comparison of tri-specific MB (298-52-80) cryoEM reconstructions at two threshold levels (top - 0.7 and bottom - 2.0), which reveal weak and fragmented densities for antibody fragments fused to the apoferritin scaffold.
  • FIG. 13A depicts a representative cryoEM micrograph of tri-specific MB particles (highlighted with white circles). Scale bar is 50 nm.
  • FIG. 13B depict selected 2D class averages of tri-specific MB particles.
  • FIG. 13C depicts a comparison of tri-specific MB (298-52-80) cryoEM reconstructions at two threshold levels (top
  • 131 show details of atomic models of human apoferritin light chain (PDB ID: 6WX6) fit into the tri-specific MB (298-52-80) map refined with octahedral symmetry imposed.
  • CryoEM density of the tri-specific MB is shown as black mesh with the models of adjacent apoferritin protomers shown as white, grey or black sticks.
  • FIGs. 15A and 15B relate to experiments analyzing neutralization of SARS-CoV-2 subvariants XBB.l and BQ.1.1 by tri-specific MB (2-7-10-40-11-11).
  • FIG. 15A are plots showing PsV neutralization of 2-7-10-40-11-11 tri-specific MB and corresponding IgG cocktail represented in red and blue, respectively, against Omicron subvariants XBB.l and BQ.1.1. The mean values ⁇ SD for two technical replicates is shown in each neutralization plot.
  • FIG. 15B, left panel is a plot showing neutralization potency of 2-7-10-40-11-11 tri- specific MB (red bars) and corresponding IgG cocktail (blue bars) against Omicron subvariants XBB.1 and BQ.1.1.
  • FIG. 15B right panel, are molecular representations of percentage accessible surface area on the RBD (grey) covered by the tri-specific MB (green). Mutations found in SARS-CoV-2 VOCs (Alpha, Beta, Gamma, Delta, Omicron (BA.l, BA.2)) that are part of each antibody binding interface are shown in red. Additional mutations specific to XBB.l and BQ.1.1 Omicron subvariants are indicated in orange.
  • FIG. 16 is a bar graph depicting lack of binding of tri-specific MB 298-52-80 to self antigens in a polyreactivity assay. Shown are binding of tri-specific 298-52-80 MB and its corresponding subcomponent IgGs to cardiolipin (blue), insulin (green), dsDNA (red), and KLH (orange). The polyreactive HIV envelope directed IgG 4E10 was used as a positive control.
  • a maximal association binding response of less than 0.1 nm after 180 seconds to a biosensor loaded with 0.8 nm of target when the test article is present at a concentration of 20 nM is classified as “non-binding.”
  • the linker is an “amino acid linker,” that is, it comprises amino acid residues, e.g., an amino acid linker may comprise at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more amino acid residues.
  • a linker is characterized in that it tends not to adopt a rigid three-dimensional structure, but rather provides flexibility to the polypeptide.
  • nanocage monomer refers to a single chain of a polypeptide that is capable of self-assembling with other nanocage monomers to form a selfassembled polypeptide complex comprising a plurality of nanocage monomers.
  • the nanocage monomer is selected from monomers of ferritin, apoferritin, encapsulin, sulfur oxygenase reductase (SOR), lumazine synthase, pyruvate dehydrogenase, carboxysome, vault proteins, GroEL, heat shock protein, E2P coat protein, MS2 coat protein, fragments thereof, and variants thereof.
  • a subject to an organism, typically a mammal (e.g, a human).
  • a subject is suffering from or susceptible to a relevant disease, disorder or condition.
  • a subject displays one or more symptoms or characteristics of a disease, disorder or condition.
  • a subject is someone with one or more features characteristic of susceptibility to or risk of a disease, disorder, or condition.
  • a subject is a patient.
  • a subject is a subject to whom diagnosis and/or therapy is and/or has been administered.
  • treatment refers to any administration of a therapy that partially or completely alleviates, ameliorates, relieves, inhibits, delays onset of, reduces severity of, and/or reduces incidence of one or more symptoms, features, and/or causes of a particular disease, disorder, and/or condition.
  • such treatment may be of a subject who does not exhibit signs of the relevant disease, disorder and/or condition and/or of a subject who exhibits only early signs of the disease, disorder, and/or condition.
  • such treatment may be of a subject who exhibits one or more established signs of the relevant disease, disorder and/or condition.
  • treatment may be of a subject who has been diagnosed as suffering from the relevant disease, disorder, and/or condition. In some embodiments, treatment may be of a subject known to have one or more susceptibility factors that are statistically correlated with increased risk of development of the relevant disease, disorder, and/or condition.
  • fusion polypeptides compatible with compositions and methods disclosed herein generally comprise a nanocage monomer or subunit thereof linked to either (1) a sarbecovirus antibody or sarbeco virus -binding antibody fragment or (2) an Fc polypeptide.
  • the sarbecovirus antibody, sarbecovirus-binding antibody fragment, or Fc polypeptide may be linked to the nanocage monomer or subunit thereof at a particular terminus of the nanocage monomer or subunit thereof, e.g, the N- terminus or the C-terminus.
  • the sarbecovirus antibody, sarbecovirus- binding antibody fragment, or Fc polypeptide is linked to the nanocage monomer or subunit thereof via an amino acid linker, such as a linker described herein.
  • the ferritin monomer subunit comprises approximately half of a ferritin monomer.
  • the term “N-half ferritin” refers to approximately half of a ferritin chain, which half comprises the N-terminus of the ferritin chain.
  • the term “C-half ferritin” refers to approximately half a ferritin chain, which half comprises the C-terminus of the ferritin chain. The exact point at which a ferritin chain may be divided to form the N-half ferritin and the C-half ferritin may vary depending on the embodiment.
  • the halves may be divided at a point that corresponds to a position between about position 75 to about position 100 of SEQ ID NO: 1 (or a substantial portion thereof).
  • an N-half ferritin based on a human ferritin light chain has an amino acid sequence corresponding to residues 1-95 of SEQ ID NO: 1 (or a substantial portion thereof, e.g. , residues 2-95 of SEQ ID NO: 1)
  • a C-half ferritin based on a human ferritin light chain has an amino acid sequence corresponding to residues 96-175 of SEQ ID NO: 1 (or a substantial portion thereof).
  • Immunoglobulin molecules typically contain a fragment crystallizable (Fc) region composed of two chains which are each portions of an immunoglobulin heavy chain.
  • each chain hereinafter “Fc chain” includes a constant heavy 2 (CH2) region and a constant heavy 3 (CH3) region.
  • the Fc polypeptide comprises one or more human IgGl Fc chains; that is, except for any mutations noted herein, the Fc polypeptide comprises an Fc chain that is substantially similar to that of the Fc chains within a wild type human IgGl.
  • the Fc polypeptide comprises one or more human IgG4 Fc chains; that is, except for any mutations noted herein, the Fc polypeptide comprises an Fc chain that is substantially similar to that of the Fc chains within a wild type human IgG4.
  • the wild type IgGl Fc is a human IgGl Fc, in which each Fc chain has an amino acid sequence of SEQ ID NO:4.
  • the wild type IgG4 Fc is a human IgG4 Fc, in which each Fc chain has an amino acid sequence of SEQ ID NO:6.
  • an Fc polypeptide may comprise an Fc chain with an amino acid sequence that is at least 85%, at least 87.5%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:4 or SEQ ID NO:6.
  • an Fc polypeptide comprises an Fc chain that comprises the particular residue(s) at certain position(s) specifically described for that Fc chain, but has an amino acid sequence that is otherwise 100% identical to a corresponding Fc chain within a wild type Fc chain, e.g., a wild type IgGl Fc chain or wild type IgG4 Fc chain.
  • the Fc polypeptide comprises an Fc chain that has an amino acid sequence that differs by at least one, at least two, at least three, or at least four amino acid residues from the sequence of SEQ ID NO:4 or from the sequence of SEQ ID NO:6.
  • the Fc polypeptide is a single chain Fc (scFc), which comprises two Fc chains linked together by a covalent linker, e.g., via an amino acid linker.
  • scFc single chain Fc
  • a non-limiting example of an scFc using Fc chains from human IgGl and an amino acid linker is shown as SEQ ID NO:5.
  • the Fc chain comprises an alanine at position 234. In certain embodiments, the Fc chain comprises an alanine at position 235. In some embodiments, the Fc chain comprises an alanine at position 237. In some embodiments, the Fc chain comprises a serine at position 238.
  • the Fc chain is an IgG4 Fc chain and comprises a proline at position 228.
  • the Fc chain is an IgG4 Fc chain and comprises a mutation or set of mutations selected from the group consisting of S228P, F234A, L235A, G237A, P238S, and combinations thereof.
  • the Fc chain is an IgG4 Fc chain and comprises one of the following sets of mutations:
  • the Fc chain comprises a mutation or set of mutations (relative to a corresponding wild type Fc chain) associated with an altered characteristic as further described herein.
  • association with it is meant that the mutation or set of mutations has been previously characterized, in the context of antibodies such as IgG antibodies, as conferring the altered characteristic (e.g, altered binding to FcRn, altered effector function, etc.)
  • altered it is meant that the characteristic (e.g, binding to an Fc receptor (e.g, an Fey receptor or an FcRn)), is different than that observed without the mutation or set of mutations.
  • the sarbecovirus binding moiety is capable of binding at least one Omicron variant of SARS-CoV-2, e.g, BA.l, BA.2, BA.5, XBB.l or BQ.1.1.
  • the antibody fragment comprises a heavy chain variable region (e.g, a VH). In certain embodiments, the antibody fragment comprises a heavy chain variable domain (e.g, VH) and a light chain variable domain (e.g, a VL or VK). In certain embodiments, the antibody fragment comprises a Fab which comprises a heavy chain variable domain (e.g, VH) and a light chain variable domain (e.g, a VL or VK).
  • the antibody fragment does not comprise any domains from the Fc region, e.g, does not comprise any CH2 or CH3 domains.
  • the antibody fragment is an antibody fragment of, or derived from, any of a variety of sarbecovirus antibodies, including, e.g, fully human, humanized or chimeric sarbecovirus antibodies.
  • the sarbecovirus antibody from which the antibody fragment is obtained or derived can be of any of a variety of antibody classes, including, e.g., an IgGl antibody, an IgG2 antibody, an IgG4 antibody.
  • the sarbecovirus antibody or fragment is a neutralizing sarbecovirus antibody, e.g, a neutralizing humanized sarbecovirus antibody, or a fragment thereof.
  • the sarbecovirus antibody is capable of neutralizing SARS- CoV-2, e.g., with an IC50 below 10 pg/mL, below 2 pg/mL, or 1 pg/mL.
  • the sarbecovirus antibody is capable of neutralizing a sarbecovirus other than SARS-CoV-2 (e.g, SARS-Co-V), e.g, with an IC50 below 10 pg/mL, below 2 pg/mL, or 1 pg/mL.
  • the sarbecovirus binding moiety is capable of neutralizing both SARS-CoV-2 and another sarbecovirus (e.g, SARS-Co-V).
  • Antibody neutralizing ability may be determined, for example, using an in vitro assay such as one that employs a pseudovirus panel or an in vitro assay that employs live virus.
  • Non-limiting examples of sarbecovirus antibodies include, e.g., an antibody depicted in Table 1, shown below.
  • the sarbecovirus antibody or sarbecovirus binding fragment thereof comprises a heavy chain complementarity determining region 3 (CDR-H3) having a sequence which comprises YYDRSGY (SEQ ID NO: 70).
  • CDR-H3 heavy chain complementarity determining region 3
  • sarbecovirus antibody fragments comprises heavy chain and light chain CDRs having similar sequences (e.g, each CDR being identical, or having one or two amino acid substitutions) to that of the heavy and light chain CDRs of a sarbecovirus antibody (e.g, a sarbecovirus antibody mentioned in Table 1).
  • the sarbecovirus antibody fragment comprises heavy and light chain CDRs having sequences identical to those of the heavy and light chain CDRs of a sarbecovirus antibody (e.g, a sarbecovirus antibody mentioned in Table 1), except for one, two, or three amino acid substitutions total across all six CDRs.
  • a sarbecovirus antibody e.g, a sarbecovirus antibody mentioned in Table 1
  • the sarbecovirus antibody fragment comprises heavy chain and light chain complementarity-determining regions (CDRs) having the same sequences as the CDRs of a sarbecovirus antibody, e.g, a sarbecovirus antibody mentioned in Table 1.
  • CDRs heavy chain and light chain complementarity-determining regions
  • sarbecovirus antibody fragments comprises heavy chain and light chain variable regions having similar sequences (e.g, each VH and VL or VK being identical, or having at least 90%, at least 91%, at least 92%, at least 93%, at least 94% at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% amino acid sequence identity) to that of the heavy and light chain variable regions of a sarbecovirus antibody (e.g, a sarbecovirus antibody mentioned in Table 1).
  • a sarbecovirus antibody e.g, a sarbecovirus antibody mentioned in Table 1.
  • the antibody fragments in the various types of fusion polypeptides may be capable of binding to the same epitope on a sarbecovirus, capable of binding to epitopes that are distinct and nonoverlapping on a sarbecovirus (e.g, distinct epitopes on the same sarbecovirus and/or distinct epitopes on different sarbecoviruses or different variants of a sarbecovirus), or capable of binding to epitopes that are distinct but overlapping on a sarbecovirus.
  • linkers are used within fusion polypeptides and/or within single-chain molecules such as scFcs.
  • the linker is an amino acid linker.
  • a linker as employed herein may comprise from about 1 to about 100 amino acid residues, e.g, about 1 to about 70, about 2 to about 70, about 1 to about 30, or about 2 to about 30 amino acid residues.
  • the linker comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 amino acid residues.
  • the linker comprises a glycine-serine sequence, e.g, a (GnS)m sequence (e.g, GGS, GGGS (SEQ ID NO:55), or GGGGS (SEQ ID NO:54) sequence) that is present in at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, or at least 14 copies within the linker.
  • GnS glycine-serine sequence
  • provided are self-assembled polypeptide complexes comprising a plurality of fusion polypeptides as disclosed herein.
  • provided self-assembled polypeptide complexes comprise (a) a plurality of first fusion polypeptides, each first fusion polypeptide comprising (1) an Fc polypeptide linked to (2) a nanocage monomer or subunit thereof, wherein the Fc polypeptide comprises an Fc chain having one or more mutations relative to a reference Fc chain of the same Ig class, and (b) a plurality of second fusion polypeptides, each second fusion polypeptide comprising (1) an antigen-binding antibody fragment linked to (2) a nanocage monomer or subunit thereof.
  • the nanocage monomer is a ferritin monomer
  • each fusion polypeptide within the self-assembled polypeptide complex comprises a ferritin light chain or a subunit of a ferritin light chain.
  • the self-assembled polypeptide complex does not comprise any ferritin heavy chains, subunits of ferritin heavy chains, or other ferritin components capable of binding to iron or capable of ferroxidase activity.
  • the nanocage monomer or subunit thereof is a ferritin monomer subunit
  • each first fusion polypeptide comprises a ferritin monomer subunit which is C-half-ferritin and each second fusion polypeptide comprises a ferritin monomer subunit which is N-half-ferritin; or (b) each first fusion polypeptide comprises a ferritin monomer subunit which is N-half ferritin and each second fusion polypeptide comprises a ferritin monomer subunit which is C-half-ferritin.
  • the self-assembled polypeptide complex comprises between 24 and 48 fusion polypeptides in total. In some embodiments, the self-assembled polypeptide complex comprises 24 fusion polypeptides in total. In some embodiments, the self-assembled polypeptide complex comprises more than 24 fusion polypeptides, e.g., at least 26, at least 28, at least 30, at least 32 fusion polypeptides, at least 34 fusion polypeptides, at least 36 fusion polypeptides, at least 38 fusion polypeptides, at least 40 fusion polypeptides, at least 42 fusion polypeptides, at least 44 fusion polypeptides, at least 46 fusion polypeptides, or at least 48 fusion polypeptides in total.
  • 24 fusion polypeptides e.g., at least 26, at least 28, at least 30, at least 32 fusion polypeptides, at least 34 fusion polypeptides, at least 36 fusion polypeptides, at least 38 fusion polypeptides, at least 40 fusion polypeptides
  • the self-assembled polypeptide complex comprises about 32 fusion polypeptides. [0354] In some embodiments, the self-assembled polypeptide complex comprises at least 4, at least 5, least 6, at least 7, or at least 8 first fusion polypeptides.
  • the self-assembled polypeptide complex comprises at least 4, at least 5, least 6, at least 7, or at least 8 second fusion polypeptides.
  • the self-assembled polypeptide complex further comprises at least 4, at least 5, least 6, at least 7, at least 8, at least 9, at least 10, least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 third fusion polypeptides.
  • the self-assembled polypeptide complex comprises a ratio of approximately 1:1, 11:13, 3:5, 1:2, 7:17, 1:3, 2:7, 5:19, 1:4, 1:5, 1:6, 1:7, 1:8, 1:12, 1:24 of first fusion polypeptides to all other fusion polypeptides.
  • provided self-assembled polypeptide complexes are capable of neutralizing one or more sarbecoviruses, e.g., SARS-CoV-2.
  • provided self-assembled polypeptide complexes are capable of neutralizing one or more variants of SARS-CoV-2, e.g., an Omicron lineage variant, e.g, BA.l, BA.2, BA.5, XBB.l, and/or BQ.1.1.
  • an Omicron lineage variant e.g, BA.l, BA.2, BA.5, XBB.l, and/or BQ.1.1.
  • provided self-assembled polypeptide complexes are capable of neutralizing one or more sarbecoviruses other than SARS-CoV-2, such as a sarbeco virus selected from the group consisting of SARS-CoV, GD-Pangolin, GX-Pangolin, RaTG13, WIV1, SHC014, Lyral l, Rs7327, Rs4231, Rs4084, and combinations thereof.
  • a sarbeco virus selected from the group consisting of SARS-CoV, GD-Pangolin, GX-Pangolin, RaTG13, WIV1, SHC014, Lyral l, Rs7327, Rs4231, Rs4084, and combinations thereof.
  • provided self-assembled polypeptide complexes are capable of neutralizing such as SARS-CoV.
  • provided self-assembled polypeptide complexes are capable of neutralizing SARS-CoV-2 and one or more sarbecoviruses other than SARS-CoV-2, e.g, both SARS-CoV-2 and a sarbecovirus selected from the group consisting of SARS-CoV, GD-Pangolin, GX-Pangolin, RaTG13, WIV1, SHC014, Lyrall, Rs7327, Rs4231, Rs4084, and combinations thereof.
  • provided self-assembled polypeptide complexes are capable of neutralizing both SARS-CoV and SARS-CoV-2.
  • a self-assembled polypeptide complex is capable of neutralizing a sarbeco virus or variant of a sarbecovirus with an IC50 of less than 0.01 pg/mL, .005 pg/mL, 0.001 pg/mL, 0.0005 pg/mL, or 0.0002 pg/mL.
  • a self-assembled polypeptide complex is capable of neutralizing an Omicron variant of SARS-CoV-2 with an IC50 of less than 0.5 pg/mL, 0.1 pg/mL, 0.01 pg/mL, .005 pg/mL, 0.001 pg/mL, 0.0005 pg/mL, or 0.0002 pg/mL.
  • a selfassembled polypeptide complex is capable of neutralizing a BA.5 (Omicron) variant of SARS-CoV-2 with an IC50 of less than 0.01 pg/mL, .005 pg/mL, 0.001 pg/mL, 0.0005 pg/mL, or 0.0002 pg/mL.
  • a self-assembled polypeptide complex is capable of neutralizing a BQ.1.1 and/or XBB.1 (Omicron) variant of SARS-CoV-2 with an IC50 of less than 0.5 pg/mL.
  • a self-assembled polypeptide complex is capable of neutralizing a BQ.1.1 (Omicron) variant of SARS-CoV-2 with an IC50 of about 0.1 pg/mL. In some embodiments, a self-assembled polypeptide complex is capable of neutralizing an XBB.l (Omicron) variant of SARS-CoV-2 with an IC50 of less than 0.1 pg/mL.
  • methods that may be useful for treating, ameliorating, or preventing sarbecovirus infection or a sarbecovirus-associated condition, generally comprising a step of administering a composition comprising a self-assembled polypeptide complex of the present disclosure to a subject.
  • the subject is a mammal, e.g. , a human.
  • compositions for administration to subjects generally comprise a self-assembled polypeptide complex as disclosed herein.
  • such compositions further comprise a pharmaceutically acceptable excipient.
  • compositions may be formulated for administration for any of a variety of routes of administration, including systemic routes (e.g, oral, inhalation, intranasal, intravenous, intraperitoneal, subcutaneous, or intramuscular administration).
  • routes of administration including systemic routes (e.g, oral, inhalation, intranasal, intravenous, intraperitoneal, subcutaneous, or intramuscular administration).
  • the step of administering results in improvement in one or more clinical outcomes or metrics in the subject.
  • administration of a self-assembled polypeptide complex may, in some embodiments, result in reduction of viral load.
  • administration of self-assembled polypeptide complex described herein results in reduced chances of infection by a sarbecovirus and/or reduced forward transmission of the sarbecovirus.
  • administration may, in some embodiments, prevent, delay, reduce the severity of, relieve the symptoms of, and/or reduce incidence of one or more sarbecovirus-associated condition.
  • Sarbecovirus-associated conditions include, for example, respiratory distress, fever, ground-glass opacities in the lung, pneumonia, lymphocytopenia, cerebrovascular disorders, dysrhythmias, ischemic and non-ischemic heart disease, pericarditis, myocarditis, and heart failure, thromboembolic disease.
  • DMEM fetal bovine serum
  • FBS Hy clone, Logan, UT
  • penicillinstreptomycin Invitrogen, Thermo Fisher Scientific, Waltham, MA
  • HEK 293F and HEK 293 S cells were cultured in Freestyle 293 Expression Medium (Thermo Fisher Scientific, Waltham, MA) at 125 rpm oscillation, 37 °C, 8% CO 2 .
  • SARS-CoV-2/SB2-P4-PB Clone 1 (Banerjee et al. Emerg Infect Dis 26:2054-63, 2020) titers were determined by 50% tissue culture infectious dose (TCID50/mL) using cell supernatants using known methods. Protein expression and purification
  • Alpha, Beta, Gamma, Delta, and Omicron SARS-CoV-2 PsV variants were generated by substituting the WT Spike plasmid. PsV were harvested, filtered through 0.45 pm sterile filters, and concentrated using a 100 K Amicon filter (Merck Millipore Amicon - Ultra 2.0 Centrifugal Filter Units, Millipore Sigma, Burlington, MA).
  • Spike gene sarbecovirus S genes were codon-optimized for mammalian expression, synthesized by Twist Biosciences, and cloned into the same expression vectors as above by Gibson Assembly (New England Biolabs). Sarbecovirus sequences were retrieved from GenBank for Rs4084, Rs7327, and LYRal 1 as shown in Table 2.
  • HEK 293T cells ATCC
  • PKI poly(ethylenimine)
  • G*AG-luciferase Kerafast
  • MOI multiplicity of infection
  • Pseudoviruses were titrated to standardize the infectivity levels for target cells before setting up neutralization assays.
  • Neutralization assays were performed by incubating pseudoviruses with 5-fold serial dilutions of MB versus their corresponding IgGs in triplicate in a 96-well plate for 1 h at 37 °C. Briefly, 293T-hACE2 cells were seeded at a density of 1 xio 5 cells/well. Luciferase activity was measured using the Luciferase Assay System (Promega), according to the manufacturer’s instructions, 24 h after cells were added to the pseudovirus and serum. The neutralization curves and IC50 values were generated by fitting a nonlinear five-parameter dose-response curve in GraphPad Prism 9.3.
  • Viral RNA from swab samples were extracted using a QIAamp Viral RNA Mini Kit (Qiagen, Hilden, Germany). Primers targeting env (Forward Primer: ACAGGTACGTTAATAGTTAATAGCGT, Reverse Primer: ATATTGCAGCAGTACGCACACA) were used alongside the Luna Universal One-Step RT- qPCR kit (New England Biolabs, Ipswitch, MA) and CFX384 Touch Real-Time System (Bio-Rad) for RT-qPCR. Nuclease-free water was used as ano template control.
  • Example 2 Broad sarbecovirus neutralization achieved by trispecific Multabody [0394] Although monospecific MBs show potent neutralization and can rescue loss in potency compared to their mAb counterparts, monospecificity still carries the risk of viral escape, should sufficient mutations emerge to overcome the benefit conferred by binding avidity. Indeed, the 80 monospecific MB loses neutralization against Omicron BA.5 (FIG. 14A), underscoring the need for an improved approach to tackle evolving viral variants and achieveaji neutralization breadth that could potentially also extend to other sarbecoviruses beyond SARS-CoV-2. As such, a trispecific MB targeting three distinct epitopes while retaining avidity has the potential to provide vibrant resilience against evolving variants.
  • mAh specificities 2-7, 10-40, and 11-11 were selected to design a trispecific molecule to explore neutralization gains made by combining next-generation mAbs with different epitope specificities on the MB. Similar to mAh 80, structural data on mAh 2-7 revealed that RBD mutations found in VOCs form part of its binding interface (Cerutti et al.
  • Monospecific 2-7 MB did not show neutralization against the sarbecovirus panel, while 10- 40 and 11-11 MBs were not able to block infection of live Omicron BA.2 (FIG. 3C and FIGS. 4B-4E).
  • the trispecific MB of these specificities combined on a single molecule displayed both potent SARS-CoV-2 neutralization across the VOCs, including live Omicron BA.2, as well as pan-sarbecovirus neutralization of this panel (FIGS. 3B-3C and FIGS. 4A-4E).
  • the 2-7-10-40-11-11 tri-specific MB and the corresponding IgG cocktail was tested against the recent BQ.1.1 and XBB.1 Omicron subvariants to assess neutralization potency in pseudovirus assays.
  • the potency of the IgG cocktail falls below the IC50 range of clinically authorized antibodies (0.3 pg/mL for Sotrovimab and 0.01 pg/mL for REGEN-COV against WT SARS-CoV-2 PsV) and does not reach 100% neutralization even at 100 pg/mL (FIG. 15A and FIG. 15B).
  • the tri-specific Mb neutralized the BQ- 1.1 and XBB.l subvariants at a potency of 0.06 pg/mL and 0.18 pg/mL, respectively, corresponding to doses falling within the dosing range of FDA-authorized therapeutics (FIG.
  • the trispecific 2-7-10-40-11-11 MB contains 62 contact residues in the RBD compared to 23, 27, and 37 residues in the case of individual mAbs 2-7, 10-40, and 11- 11, respectively. Therefore, by targeting three partially overlapping functional epitopes on the RBD, and through the potency gain provided by avidity, the trispecific 2-7-10-40-11-11 MB provides proof-of-concept for potent, broad, and resilient neutralization across sarbecoviruses by a single MB molecule.
  • Example 3 Neutralization potency correlates with in vivo protection from SARS-CoV-2 [0398]
  • the inventors have previously reported the generation of tri-specific MB molecules targeting SARS-CoV-2 (“298-52-80 MB,” comprising Fab fragments from antibodies 298, 52, and 80, each targeting the RBD of SARS-CoV-2).
  • the 298-52-80 MB was constructed using an engineered apoferritin split design (FIG. 5A and FIG. 5B) (Rujas, E. et al. Multivalency transforms SARS-CoV-2 antibodies into ultrapotent neutralizers. Nat.
  • T10 MB* achieved an IC50 value of 0.0002 pg/mL, approximately 1000-fold more potent than its corresponding cocktail IgG (FIG. 6).
  • Binding kinetics studies revealed that both T10 MB* and the IgG4* antibody cocktail displayed pH-dependent binding to mouse and human FcRn (FIGS. 7A-7B), and no binding to human and mouse Fey receptors (FcyR). This was in contrast to the FcyR binding observed for the corresponding IgGl antibody cocktail control (FIG. 7B-7D).
  • the MB* and IgG4* antibody cocktail also displayed no binding to mouse and human FcRn at physiological pH and binding at acidic pH with no detectable off rate (FIG. 7C and FIG. 7D).
  • Antibody-dependent cell-mediated phagocytosis (ADCP) experiments using fluorescently labeled beads coated with SARS-CoV-2 Spike protein were performed using flow cytometry. Gating strategy was based on gating of THP-1 cells by size and live cells; cells positive for internalization of SARS-CoV-2 Spike-coated fluorescent beads were quantified as a percentage of live THP-1 cells (FIGs. 7E-7H). These experiments further confirmed the inability of T10 MB* and the IgG4* cocktail to engage Fc receptors, while the IgGl antibody cocktail showed substantial uptake of SARS-CoV-2 Spike-coated beads (FIG. 71).
  • FIG. 10A These data illustrate how mAh 80 inhibits SARS-CoV-2 infection through receptor blockade, preventing the interaction of ACE2 with the receptor binding motif (FIG. 10A).
  • the heavy chain of mAb 80 is primarily responsible for the interaction with RBD, contributing ten of the eleven hydrogen bonds found in the binding interface (FIG. 10B and FIG. 10C; Table 3). Additionally, interaction of F54 of the antibody heavy chain with Y489 from the RBD results in the formation of a new triple pi-stacking within the RBD structure, between residues Y473, F456 and Y421 (FIG. 10D).
  • Example 5 Cryo-electron microscopic characterization of trispecific MB, 298-52-80 Methods and Materials
  • the tri-specific MB (298-52-80) sample was concentrated to 2.0 mg/mL and 3.0 pl of the sample was deposited on homemade holey gold grids, which were glow-discharged in air for 15 s before use. Sample was blotted for 3.0 s, and subsequently plunge-frozen in liquid ethane using a Leica EM GP2 Automatic Plunge Freezer (maintained at 4 °C and 100% humidity). Data collection was performed on a Thermo Fisher Scientific Titan Krios G3 operated at 300 kV with a Falcon 4i camera automated with the EPU software.
  • a nominal magnification of 75,000' and defocus range between 0.5 and 2.0 pm were used for data collection. Exposures were collected for 8.3 s as movies of 30 frames with a camera exposure rate of ⁇ 6.3 e- per pixel per second, and total exposure of 49.6 electrons/ A2. A total of 4,385 raw movies were obtained. Image processing was carried out in cryoSPARC v374. Initial specimen movement correction, exposure weighting, and CTF parameters estimation were done using patch-based algorithms. Micrographs were sorted based on CTF fit resolution, and only micrographs with a fit better than 5.0 A were accepted for further processing. Manual picking was performed to create templates for template-based picking, which resulted in selection of 955,995 particle images.
  • Particle images were sorted via several rounds of 2D classification, which resulted in selection of 358,036 particle images.
  • a preliminary 3D model was obtained ab-initio with no symmetry applied.
  • 151,443 particle images with CTF fit resolution better than 3.0 A were reextracted from micrographs and subjected to non-uniform refinement75 with no symmetry applied, which resulted in a 2.4 A resolution map of the tri-specific MB.
  • 65,478 particle images with CTF fit better than 2.7 A were extracted from micrographs and subjected to non-uniform refinement with octahedral symmetry applied, which resulted in a 2.1 A resolution map.
  • Non-uniform refinements were performed with defocus refinement and optimization of per-group CTF parameters.
  • the pixel size was calibrated at 1.04 A per pixel by fitting a structure of human apoferritin light chain (PDB ID: 2FFX).
  • T10 MB a tri-specific MB incorporating antibody specificities 298, 52, and 80
  • FIG. 12A shows the processing workflow for cryoEM data.
  • 3D reconstructions of the apoferritin scaffold of the MB reached 2.4 A and 2.1 A resolution, respectively, when no symmetry (Cl; FIG. 12E, FIGS. 13A-13D) or octahedral symmetry (O; FIGS. 13A-13I) was applied.
  • the apoferritin scaffold in the tri-specific MB is virtually identical to that of the human apoferritin light chain (PDB ID: 6WX6) with measured cross-correlation (cc) coefficients between maps of 0.97 (Cl) and 0.92 (O).
  • the N and C termini of the core MB scaffold are similarly disposed in 3- and 4-fold symmetry axes as in the native human apoferritin light chain (FIG.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Virology (AREA)
  • Veterinary Medicine (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Immunology (AREA)
  • Epidemiology (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Communicable Diseases (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Nanotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

Described herein is a fusion polypeptide comprising a sarbecovirus binding moiety linked to a nanocage monomer or subunit thereof, wherein the sarbecovirus binding moiety is capable of binding to SARS-CoV-2 and at least one sarbecovirus other than SARS-CoV-2. Also described are methods for treating and/or preventing sarbecovirus infection and/or a sarbecovirus-associated condition.

Description

MULTABODY CONSTRUCTS, COMPOSITIONS, AND METHODS TARGETING SARBECOVIRUSES
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] The present application claims the benefit of and priority to U.S. Provisional Application No. 63/380,540 filed October 21, 2022 and U.S. Provisional Application No. 63/496,136 filed April 14, 2023, the entire content of which are hereby incorporated by reference in their entirety for all purposes.
SEQUENCE LISTING
[0002] The instant application contains a Sequence Listing which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. Said XML file, created on October 20, 2023, is named 3206-5126_.xml and is 288.8 kilobytes in size.
BACKGROUND
[0003] Emerging infectious agents, including viruses such as SARS-CoV-2 (a coronavirus of the subgenus sarbecovirus), present enormous challenges to global public health. Relatively short-lived vaccine-mediated protection, coupled with the emergence of new viral variants, further highlights the necessity for effective prophylactic and treatment options. While monoclonal antibodies (mAbs) present a promising option, mAb-based treatments have struggled to overcome viral diversity. Indeed, two mAh combinations that were previously approved by the US Food and Drug Administration (FDA) authorization to treat COVID-19 had their authorizations revoked after the emergence of the Omicron BA.l variant of concern (VOC), which has 37 mutations within the spike domain and 15 mutations within the receptor binding domain (RBD), the target of most clinical antibodies against SARS- CoV-2. Furthermore, with the rise of Omicron BQ.1.1 and XBB.l subvariants, even mAbs that were capable of neutralizing the original Omicron VOC, including Bebtelovimab, and a cocktail of Tixagevimab and Cilgavimab have had their authorization revoked due to viral escape.
[0004] Other therapeutics or potential therapeutics may exhibit increased breadth against subvariants and even other sarbecoviruses, but this increased breadth is often associated with reduced potency. [0005] A need exists for improved therapeutics that combine increased breadth without sacrificing potency.
SUMMARY
[0006] The present invention addresses this need with the provision of self-assembled polypeptide complexes which exhibit broad neutralization against sarbecoviruses and which maintain potency. Also provided are related fusion polypeptides, compositions, and methods. [0007] In one aspect, provided are fusion polypeptides that can be used within selfassembled polypeptide complexes disclosed herein.
[0008] In certain embodiments, provided are fusion polypeptides comprising a sarbecovirus binding moiety linked to a nanocage monomer or subunit thereof, wherein the sarbecovirus binding moiety is capable of binding to SARS-CoV-2 and at least one sarbecovirus other than SARS-CoV-2.
[0009] In some embodiments, the first sarbecovirus binding moiety comprises a sarbecovirus antibody or sarbecovirus-binding fragment thereof, e.g, an Fab fragment of a sarbecovirus antibody. In some embodiments, the Fab fragment is a single chain Fab (scFab). [0010] In some embodiments, the sarbecovirus antibody is capable of neutralizing SARS- CoV-2 and at least one sarbecovirus other than SARS-CoV-2, for example, a sarbecovirus selected from the group consisting of SARS-CoV, GD-Pangolin, GX-Pangolin, RaTG13, WIV1, SHC014, Lyral l, Rs7327, Rs4231, Rs4084, and combinations thereof. In some embodiments, the at least one sarbecovirus other than SARS-CoV-2 comprises SARS-CoV. In some embodiments, the at least one sarbecovirus other than SARS-CoV-2 comprises SARS-CoV, GD-Pangolin, GX-Pangolin, RaTG13, WIV1, SHC014, Lyrall, Rs7327, Rs4231, and Rs4084.
[0011] In certain embodiments, provided are fusion polypeptide comprising a sarbecovirus binding moiety linked to a nanocage monomer or subunit thereof, wherein the sarbecovirus binding moiety is a sarbecovirus antibody or a sarbecovirus binding fragment thereof, wherein the sarbecovirus antibody exhibits neutralizing activity against SARS-CoV with an IC50 below 1 pg/mL.
[0012] In certain embodiments, provided are fusion polypeptides comprising a sarbecovirus binding moiety linked to a nanocage monomer or subunit thereof, wherein the sarbecovirus binding moiety is a sarbecovirus antibody or a sarbecovirus binding fragment thereof, wherein the sarbecovirus antibody or sarbecovirus binding fragment thereof comprises a heavy chain complementarity determining region 3 (CDR-H3) having a sequence which comprises YYDRSGY (SEQ ID NO:70).
[0013] In some embodiments, the sarbecovirus antibody or sarbecovirus binding fragment thereof comprises a CDR-H3 sequence selected from the group consisting of SEQ ID NOs: 34, 40, 46, 75, 81, 87, 95, 101, 107, 115, 121, 127, 135, 141, 147, 155, 161, 167, 175, 181, 187, 195, 201, 207, 215, 221, 227, 235, 241, 247, 255, 261, 267, 275, 281, 287, 295, 301, 307, 315, 321, 327, 335, 341, or 347 or a variant of any of the foregoing sequences which comprises no more than three, no more than two, or no more than one amino acid substitution therefrom.
[0014] In some embodiments, the sarbecovirus antibody or sarbecovirus binding fragment thereof comprises a CDR-H3 sequence selected from the group consisting of SEQ ID NOs: 34, 40, 46, 75, 81, 87, 95, 101, 107, 115, 121, 127, 135, 141, 147, 155, 161, 167, 175, 181, 187, 195, 201, 207, 215, 221, 227, 235, 241, 247, 255, 261, 267, 275, 281, 287, 295, 301, 307, 315, 321, 327, 335, 341, or 347.
[0015] In some embodiments, the sarbecovirus antibody or sarbecovirus binding fragment thereof comprises a CDR-H3 sequence and a CDR-L3 sequence of [0016] (a) SEQ ID NO:34 and SEQ ID NO:37, respectively,
[0017] (b) SEQ ID NO:40 and SEQ ID NO:43, respectively,
[0018] (c) SEQ ID NO:46 and SEQ ID NO:49, respectively,
[0019] (d) SEQ ID NO:75 and SEQ ID NO:78, respectively,
[0020] (e) SEQ ID NO: 81 and SEQ ID NO: 84, respectively,
[0021] (f) SEQ ID NO:87 and SEQ ID NO:90, respectively,
[0022] (g) SEQ ID NO:95 and SEQ ID NO:98, respectively,
[0023] (h) SEQ ID NO: 101 and SEQ ID NO: 104, respectively,
[0024] (i) SEQ ID NO: 107 and SEQ ID NO: 110, respectively,
[0025] (j) SEQ ID NO: 115 and SEQ ID NO: 118, respectively,
[0026] (k) SEQ ID NO: 121 and SEQ ID NO: 124, respectively,
[0027] (1) SEQ ID NO: 127 and SEQ ID NO: 130, respectively,
[0028] (m) SEQ ID NO: 135 and SEQ ID NO: 138, respectively,
[0029] (n) SEQ ID NO: 141 and SEQ ID NO: 144, respectively,
[0030] (o) SEQ ID NO : 147 and SEQ ID NO : 150, respectively,
[0031] (p) SEQ ID NO: 155 and SEQ ID NO: 158, respectively,
[0032] (q) SEQ ID NO : 161 and SEQ ID NO : 164, respectively,
[0033] (r) SEQ ID NO: 167 and SEQ ID NO: 170, respectively, [0034] (s) SEQ ID NO: 175 and SEQ ID NO: 178, respectively,
[0035] (t) SEQ ID NO:181 and SEQ ID NO: 184, respectively,
[0036] (u) SEQ ID NO: 187 and SEQ ID NO: 190, respectively,
[0037] (v) SEQ ID NO: 195 and SEQ ID NO: 198, respectively,
[0038] (w) SEQ ID NO:201 and SEQ ID NO:204, respectively,
[0039] (y) SEQ ID NO : 207 and SEQ ID NO : 210, respectively,
[0040] (z) SEQ ID NO:215 and SEQ ID NO:218, respectively,
[0041] (aa) SEQ ID NO:221 and SEQ ID NO:224, respectively,
[0042] (bb) SEQ ID NO:227 and SEQ ID NO:230, respectively,
[0043] (cc) SEQ ID NO:235 and SEQ ID NO:238, respectively,
[0044] (dd) SEQ ID NO:241 and SEQ ID NO:244, respectively,
[0045] (ee) SEQ ID NO:247 and SEQ ID NO:250, respectively,
[0046] (ff) SEQ ID NO:255 and SEQ ID NO:258, respectively,
[0047] (gg) SEQ ID NO:261 and SEQ ID NO:264, respectively,
[0048] (hh) SEQ ID NO:267 and SEQ ID NO:270, respectively,
[0049] (ii) SEQ ID NO:275 and SEQ ID NO:278, respectively,
[0050] (jj) SEQ ID NO:281 and SEQ ID NO:284, respectively,
[0051] (kk) SEQ ID NO:287 and SEQ ID NO:290, respectively,
[0052] (11) SEQ ID NO:295 and SEQ ID NO:298, respectively,
[0053] (mm) SEQ ID NO: 301 and SEQ ID NO: 304, respectively,
[0054] (nn) SEQ ID NO:307 and SEQ ID NO:310, respectively,
[0055] (oo) SEQ ID NO:315 and SEQ ID NO:318, respectively,
[0056] (pp) SEQ ID NO:321 and SEQ ID NO:324, respectively,
[0057] (qq) SEQ ID NO:327 and SEQ ID NO:330, respectively,
[0058] (rr) SEQ ID NO:335 and SEQ ID NO:338, respectively,
[0059] (ss) SEQ ID NO:341 and SEQ ID NO:344, respectively,
[0060] (tt) SEQ ID NO:347 and SEQ ID NO:350, respectively, or
[0061] (uu) a CDR-H3 sequence and a CDR-L3 sequences which collectively differ by no more than three, no more than two, or one amino acid substitutions across both CDR- H3 and CDR-L3 sequences of any of the foregoing (a)-(tt).
[0062] In some embodiments, the sarbecovirus antibody or sarbecovirus binding fragment thereof comprises a CDR-H3 sequence and a CDR-L3 sequence of [0063] (a) SEQ ID NO:34 and SEQ ID NO:37, respectively,
[0064] (b) SEQ ID NO:40 and SEQ ID NO:43, respectively, [0065] (c) SEQ ID NO:46 and SEQ ID NO:49, respectively,
[0066] (d) SEQ ID NO:75 and SEQ ID NO:78, respectively,
[0067] (e) SEQ ID NO: 81 and SEQ ID NO: 84, respectively,
[0068] (f) SEQ ID NO:87 and SEQ ID NO:90, respectively,
[0069] (g) SEQ ID NO:95 and SEQ ID NO:98, respectively,
[0070] (h) SEQ ID NO: 101 and SEQ ID NO: 104, respectively,
[0071] (i) SEQ ID NO: 107 and SEQ ID NO: 110, respectively,
[0072] (j) SEQ ID NO: 115 and SEQ ID NO: 118, respectively,
[0073] (k) SEQ ID NO : 121 and SEQ ID NO : 124, respectively,
[0074] (1) SEQ ID NO: 127 and SEQ ID NO: 130, respectively,
[0075] (m) SEQ ID NO: 135 and SEQ ID NO: 138, respectively,
[0076] (n) SEQ ID NO: 141 and SEQ ID NO: 144, respectively,
[0077] (o) SEQ ID NO : 147 and SEQ ID NO : 150, respectively,
[0078] (p) SEQ ID NO: 155 and SEQ ID NO: 158, respectively,
[0079] (q) SEQ ID NO : 161 and SEQ ID NO : 164, respectively,
[0080] (r) SEQ ID NO: 167 and SEQ ID NO: 170, respectively,
[0081] (s) SEQ ID NO: 175 and SEQ ID NO: 178, respectively,
[0082] (t) SEQ ID NO:181 and SEQ ID NO:184, respectively,
[0083] (u) SEQ ID NO: 187 and SEQ ID NO: 190, respectively,
[0084] (v) SEQ ID NO: 195 and SEQ ID NO: 198, respectively,
[0085] (w) SEQ ID NO:201 and SEQ ID NO:204, respectively,
[0086] (y) SEQ ID NO : 207 and SEQ ID NO : 210, respectively,
[0087] (z) SEQ ID NO:215 and SEQ ID NO:218, respectively,
[0088] (aa) SEQ ID NO:221 and SEQ ID NO:224, respectively,
[0089] (bb) SEQ ID NO:227 and SEQ ID NO:230, respectively,
[0090] (cc) SEQ ID NO:235 and SEQ ID NO:238, respectively,
[0091] (dd) SEQ ID NO:241 and SEQ ID NO:244, respectively,
[0092] (ee) SEQ ID NO:247 and SEQ ID NO:250, respectively,
[0093] (ff) SEQ ID NO:255 and SEQ ID NO:258, respectively,
[0094] (gg) SEQ ID NO:261 and SEQ ID NO:264, respectively,
[0095] (hh) SEQ ID NO:267 and SEQ ID NO:270, respectively,
[0096] (ii) SEQ ID NO:275 and SEQ ID NO:278, respectively,
[0097] (jj) SEQ ID NO:281 and SEQ ID NO:284, respectively,
[0098] (kk) SEQ ID NO:287 and SEQ ID NO:290, respectively, [0099] (11) SEQ ID NO:295 and SEQ ID NO:298, respectively,
[0100] (mm) SEQ ID NO:301 and SEQ ID NO:304, respectively,
[0101] (nn) SEQ ID NO:307 and SEQ ID NO:310, respectively,
[0102] (oo) SEQ ID NO:315 and SEQ ID NO:318, respectively,
[0103] (pp) SEQ ID NO:321 and SEQ ID NO:324, respectively,
[0104] (qq) SEQ ID NO:327 and SEQ ID NO:330, respectively,
[0105] (rr) SEQ ID NO:335 and SEQ ID NO:338, respectively,
[0106] (ss) SEQ ID NO:341 and SEQ ID NO:344, respectively, or
[0107] (tt) SEQ ID NO:347 and SEQ ID NO:350, respectively.
[0108] In some embodiments, the sarbecovirus antibody or sarbecovirus binding fragment thereof comprises a CDR-H3 sequence and a CDR-L3 sequence of:
[0109] (a) SEQ ID NO:34 and SEQ ID NO:37, respectively,
[0110] (b) SEQ ID NO:40 and SEQ ID NO:43, respectively, or
[0111] (c) SEQ ID NO:46 and SEQ ID NO:49, respectively.
[0112] In some embodiments, the sarbecovirus antibody or sarbecovirus binding fragment thereof comprises a heavy chain variable region comprising complementarity determining regions CDR-H1, CDR-H2, and CDR-H3, and a light chain variable region comprising complementarity determining regions CDR-L1, CDR-L2, and CDR-L3, having amino acid sequences of
[0113] (a) SEQ ID NO:32, 33, and 34 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:35, 36, and 37 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0114] (b) SEQ ID NO:38, 39, and 40 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:41, 42, and 43 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0115] (c) SEQ ID NO:44, 45, and 46 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:47, 48, and 49 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0116] (d) SEQ ID NO:73, 74, and 75 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:76, 77, and 78 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0117] (e) SEQ ID NO:79, 80, and 81 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 82, 83, and 84 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0118] (f) SEQ ID NO:85, 86, and 87 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 88, 89, and 90 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0119] (g) SEQ ID NO:93, 94, and 95 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 96, 97, and 98 for CDR-L1, CDR-L2, and CDR-H3, respectively, [0120] (h) SEQ ID NO:99, 100, and 101 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 102, 103, and 104 for CDR-L1, CDR-L2, and CDR-H3, respectively, [0121] (i) SEQ ID NO: 105, 106, and 107 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 108, 109, and 110 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0122] (j) SEQ ID NO: 113, 114, and 115 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 116, 117, and 118 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0123] (k) SEQ ID NO: 119, 120, and 121 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 122, 123, and 124 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0124] (1) SEQ ID NO: 125, 126, and 127 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 128, 129, and 130 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0125] (m) SEQ ID NO: 133, 134, and 135 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 136, 137, and 138 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0126] (n) SEQ ID NO: 139, 140, and 141 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 142, 143, and 144 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0127] (o) SEQ ID NO: 145, 146, and 147 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 148, 149, and 150 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0128] (p) SEQ ID NO: 153, 154, and 155 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 156, 157, and 158 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0129] (q) SEQ ID NO: 159, 160, and 161 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 162, 163, and 164 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0130] (r) SEQ ID NO: 165, 166, and 167 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 168, 169, and 170 for CDR-L1, CDR-L2, and CDR-H3, respectively, [0131] (s) SEQ ID NO: 173, 174, and 175 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 176, 177, and 178 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0132] (t) SEQ ID NO: 179, 180, and 181 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 182, 183, and 184 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0133] (u) SEQ ID NO: 185, 186, and 187 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 188, 189, and 190 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0134] (v) SEQ ID NO: 193, 194, and 195 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 196, 197, and 198 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0135] (x) SEQ ID NO: 199, 200, and 201 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:202, 203, and 204 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0136] (y) SEQ ID NO:205, 206, and 207 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:208, 209, and 210 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0137] (z) SEQ ID NO:213, 214, and 215 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:216, 217, and 218 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0138] (aa) SEQ ID NO:219, 220, and 221 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:222, 223, and 224 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0139] (bb) SEQ ID NO:225, 226, and 227 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:228, 229, and 230 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0140] (cc) SEQ ID NO:233, 234 and 235 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:236, 237, and 238 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0141] (dd) SEQ ID NO:239, 240, and 241 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:242, 243, and 244 for CDR-L1, CDR-L2, and CDR-H3, respectively, [0142] (ee) SEQ ID NO:245, 246, and 247 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:248, 249, and 250 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0143] (ff) SEQ ID NO:253, 254, and 255 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:256, 257, and 258 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0144] (gg) SEQ ID NO:259, 260, and 261 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:262, 263, and 264 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0145] (hh) SEQ ID NO:265, 266, and 267 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:268, 269, and 270 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0146] (ii) SEQ ID NO:273, 274, and 275 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:276, 277, and 278 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0147] (jj) SEQ ID NO:279, 280, and 281 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:282, 283, and 284 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0148] (kk) SEQ ID NO:285, 286, and 287 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:288, 289, and 290 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0149] (11) SEQ ID NO:293, 294, and 295 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:296, 297, and 298 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0150] (mm) SEQ ID NO:299, 300, and 301 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:302, 303, and 304 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0151] (nn) SEQ ID NO:305, 306, and 307 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:308, 309, and 310 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0152] (oo) SEQ ID NO:313, 314, and 315 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:316, 317, and 318 for CDR-L1, CDR-L2, and CDR-H3, respectively, [0153] (pp) SEQ ID NO:319, 320, and 321 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:322, 323, and 324 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0154] (qq) SEQ ID NO: 325, 326, and 327 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:328, 329, and 330 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0155] (rr) SEQ ID NO:333, 334, and 335 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:336, 337, and 338 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0156] (ss) SEQ ID NO:339, 340, 341 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:342, 343, and 344 for CDR-L1, CDR-L2, and CDR-H3, respectively, [0157] (tt) SEQ ID NO:345, 346, and 347 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:348, 349, and 350 for CDR-L1, CDR-L2, and CDR-H3, respectively, or
[0158] (uu) CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2, and CDR-L3 sequences which collectively differ by no more than three, no more than two, or one amino acid substitutions across all six CDRs from any of the foregoing sequences in (a)-(tt).
[0159] In some embodiments, the sarbecovirus antibody or sarbecovirus binding fragment thereof comprises a heavy chain variable region comprising complementarity determining regions CDR-H1, CDR-H2, and CDR-H3, and a light chain variable region comprising complementarity determining regions CDR-L1, CDR-L2, and CDR-L3, having amino acid sequences of
[0160] (a) SEQ ID NO:32, 33, and 34 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:35, 36, and 37 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0161] (b) SEQ ID NO:38, 39, and 40 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:41, 42, and 43 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0162] (c) SEQ ID NO:44, 45, and 46 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:47, 48, and 49 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0163] (d) SEQ ID NO:73, 74, and 75 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:76, 77, and 78 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0164] (e) SEQ ID NO:79, 80, and 81 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 82, 83, and 84 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0165] (f) SEQ ID NO:85, 86, and 87 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 88, 89, and 90 for CDR-L1, CDR-L2, and CDR-H3, respectively, [0166] (g) SEQ ID NO:93, 94, and 95 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 96, 97, and 98 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0167] (h) SEQ ID NO:99, 100, and 101 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 102, 103, and 104 for CDR-L1, CDR-L2, and CDR-H3, respectively, [0168] (i) SEQ ID NO: 105, 106, and 107 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 108, 109, and 110 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0169] (j) SEQ ID NO: 113, 114, and 115 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 116, 117, and 118 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0170] (k) SEQ ID NO: 119, 120, and 121 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 122, 123, and 124 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0171] (1) SEQ ID NO: 125, 126, and 127 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 128, 129, and 130 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0172] (m) SEQ ID NO: 133, 134, and 135 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 136, 137, and 138 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0173] (n) SEQ ID NO: 139, 140, and 141 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 142, 143, and 144 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0174] (o) SEQ ID NO: 145, 146, and 147 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 148, 149, and 150 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0175] (p) SEQ ID NO: 153, 154, and 155 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 156, 157, and 158 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0176] (q) SEQ ID NO: 159, 160, and 161 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 162, 163, and 164 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0177] (r) SEQ ID NO: 165, 166, and 167 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 168, 169, and 170 for CDR-L1, CDR-L2, and CDR-H3, respectively, [0178] (s) SEQ ID NO: 173, 174, and 175 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 176, 177, and 178 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0179] (t) SEQ ID NO: 179, 180, and 181 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 182, 183, and 184 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0180] (u) SEQ ID NO: 185, 186, and 187 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 188, 189, and 190 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0181] (v) SEQ ID NO: 193, 194, and 195 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 196, 197, and 198 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0182] (x) SEQ ID NO: 199, 200, and 201 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:202, 203, and 204 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0183] (y) SEQ ID NO:205, 206, and 207 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:208, 209, and 210 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0184] (z) SEQ ID NO:213, 214, and 215 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:216, 217, and 218 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0185] (aa) SEQ ID NO:219, 220, and 221 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:222, 223, and 224 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0186] (bb) SEQ ID NO:225, 226, and 227 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:228, 229, and 230 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0187] (cc) SEQ ID NO:233, 234 and 235 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:236, 237, and 238 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0188] (dd) SEQ ID NO:239, 240, and 241 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:242, 243, and 244 for CDR-L1, CDR-L2, and CDR-H3, respectively, [0189] (ee) SEQ ID NO:245, 246, and 247 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:248, 249, and 250 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0190] (ff) SEQ ID NO:253, 254, and 255 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:256, 257, and 258 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0191] (gg) SEQ ID NO:259, 260, and 261 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:262, 263, and 264 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0192] (hh) SEQ ID NO:265, 266, and 267 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:268, 269, and 270 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0193] (ii) SEQ ID NO:273, 274, and 275 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:276, 277, and 278 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0194] (jj) SEQ ID NO:279, 280, and 281 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:282, 283, and 284 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0195] (kk) SEQ ID NO:285, 286, and 287 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:288, 289, and 290 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0196] (11) SEQ ID NO:293, 294, and 295 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:296, 297, and 298 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0197] (mm) SEQ ID NO:299, 300, and 301 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:302, 303, and 304 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0198] (nn) SEQ ID NO:305, 306, and 307 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:308, 309, and 310 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0199] (oo) SEQ ID NO:313, 314, and 315 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:316, 317, and 318 for CDR-L1, CDR-L2, and CDR-H3, respectively, [0200] (pp) SEQ ID NO:319, 320, and 321 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:322, 323, and 324 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0201] (qq) SEQ ID NO:325, 326, and 327 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:328, 329, and 330 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0202] (rr) SEQ ID NO:333, 334, and 335 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:336, 337, and 338 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0203] (ss) SEQ ID NO:339, 340, 341 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:342, 343, and 344 for CDR-L1, CDR-L2, and CDR-H3, respectively, or [0204] (tt) SEQ ID NO:345, 346, and 347 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:348, 349, and 350 for CDR-L1, CDR-L2, and CDR-H3, respectively.
[0205] In certain embodiments, provided are fusion polypeptides comprising a sarbecovirus binding moiety linked to a nanocage monomer or subunit thereof, wherein the sarbecovirus binding moiety is a sarbecovirus antibody or a sarbecovirus binding fragment thereof, wherein the sarbecovirus antibody or sarbecovirus binding fragment thereof comprises a heavy chain variable region comprising complementarity determining regions CDR-H1, CDR-H2, and CDR-H3, and a light chain variable region comprising complementarity determining regions CDR-L1, CDR-L2, and CDR-L3, having amino acid sequences of: [0206] (a) SEQ ID NO: 12, 13, and 14 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 15, 16, and 17 for CDR-L1, CDR-L2, and CDR-H3, respectively, [0207] (b) SEQ ID NO: 18, 19, and 20 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:21, 22, and 23 for CDR-L1, CDR-L2, and CDR-H3, respectively, [0208] (c) SEQ ID NO: 24, 25, and 26 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:27, 28, and 29 for CDR-L1, CDR-L2, and CDR-H3, respectively, [0209] (d) SEQ ID NO:52, 53, and 54 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:55, 56, and 57 for CDR-L1, CDR-L2, and CDR-H3, respectively, [0210] (e) SEQ ID NO:58, 59, and 60 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:61, 62, and 63 for CDR-L1, CDR-L2, and CDR-H3, respectively, [0211] (f) SEQ ID NO: 64, 65, and 66 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:67, 68, and 69 for CDR-L1, CDR-L2, and CDR-H3, respectively, [0212] or [0213] (g) CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2, and CDR-L3 sequences which collectively differ by no more than three, no more than two, or one amino acid substitutions across all six CDRs from any of the foregoing sequences in (a)-(f).
[0214] In some embodiments, the sarbecovirus antibody or sarbecovirus binding fragment thereof comprises a heavy chain variable region comprising complementarity determining regions CDR-H1, CDR-H2, and CDR-H3, and a light chain variable region comprising complementarity determining regions CDR-L1, CDR-L2, and CDR-L3, having amino acid sequences of:
[0215] (a) SEQ ID NO: 12, 13, and 14 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 15, 16, and 17 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0216] (b) SEQ ID NO: 18, 19, and 20 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:21, 22, and 23 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0217] (c) SEQ ID NO:24, 25, and 26 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:27, 28, and 29 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0218] (d) SEQ ID NO:52, 53, and 54 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:55, 56, and 57 for CDR-L1, CDR-L2, and CDR-H3, respectively,
[0219] (e) SEQ ID NO:58, 59, and 60 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:61, 62, and 63 for CDR-L1, CDR-L2, and CDR-H3, respectively, or
[0220] (f) SEQ ID NO: 64, 65, and 66 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:67, 68, and 69 for CDR-L1, CDR-L2, and CDR-H3, respectively.
[0221] In some embodiments, the sarbecovirus binding moiety is an Fab fragment of a sarbecovirus antibody. In some embodiments, the Fab fragment is a single chain Fab (scFab). [0222] In some embodiments, the sarbecovirus antibody is capable of binding the receptor binding domain (RBD) of SARS-CoV-2. In some embodiments, the sarbecovirus antibody is only capable of binding RBD in RBD’s up conformation.
[0223] In some embodiments, the sarbecovirus antibody is capable inhibiting binding to SARS-CoV-2 to ACE2.
[0224] In some embodiments, the nanocage monomer or subunit thereof is a ferritin monomer or subunit thereof, for example, a ferritin light chain or subunit thereof and/or a human ferritin or subunit thereof.
[0225] In some embodiments, the ferritin monomer or subunit thereof is a ferritin monomer subunit, such as a C-half ferritin. In some embodiments, the sarbecovirus binding moiety is fused to the N-terminus of the ferritin monomer or subunit thereof. In some such embodiments, the sarbecovirus binding moiety is linked to the ferritin monomer’s or ferritin monomer subunit’s N-terminus via an amino acid linker, such as an amino acid linker comprising a (GnS)m linker, e.g., a (GGGGS)m linker.
[0226] In one aspect, provided are self-assembled polypeptide complexes comprising: a plurality of first fusion polypeptides, each first fusion polypeptide comprising a first sarbecovirus binding moiety, and each first fusion polypeptide being a fusion polypeptide as disclosed herein.
[0227] In some embodiments, the self-assembled polypeptide complex, further comprises a plurality of second fusion polypeptides, each second fusion polypeptide comprising a second sarbecovirus binding moiety linked to a nanocage monomer or subunit thereof, wherein the second sarbecovirus binding moiety is distinct from the first sarbecovirus binding moiety. In some embodiments, each second fusion polypeptide is a fusion polypeptide as disclosed herein.
[0228] In some embodiments, the self-assembled polypeptide complex further comprises a plurality of third fusion polypeptides, each third fusion polypeptide comprising a third sarbecovirus binding moiety linked to a nanocage monomer or subunit thereof, wherein the third sarbecovirus binding moiety is distinct from the first and second sarbecovirus binding moieties. In some embodiments, each third fusion polypeptide is a fusion polypeptide as disclosed herein.
[0229] In some embodiments, the self-assembled polypeptide complex further comprises a plurality of Fc-containing fusion polypeptides, each Fc-containing fusion polypeptide comprising an Fc polypeptide linked to a nanocage monomer or subunit thereof. In some embodiments, the Fc-containing fusion polypeptide’s nanocage monomer or subunit thereof is a ferritin monomer or subunit thereof, for example, a ferritin light chain or subunit thereof and/or a human ferritin or subunit thereof.
[0230] In some embodiments, the ferritin monomer or subunit thereof is a ferritin monomer subunit, for example, an N-half ferritin.
[0231] In some embodiments, the Fc polypeptide is fused to the N-terminus of the ferritin monomer or subunit thereof.
[0232] In some embodiments, the Fc polypeptide is linked to the ferritin monomer’s or ferritin monomer subunit’s N-terminus via an amino acid linker, such as a linker comprising a (GnS)m linker such as a (GGGGS)m linker.
[0233] In some embodiments, the Fc polypeptide comprises a single chain Fc (scFc) comprising two Fc chains, wherein the two Fc chains are linked via an amino acid linker, such as a linker comprising a (GnS)m linker, e.g., a (GGGGS)m linker. [0234] In some embodiments, the Fc polypeptide comprises an IgGl Fc chain or an IgG4 Fc chain. In some embodiments, the Fc polypeptide comprises an IgG4 Fc chain comprising a mutation or set of mutations selected from the group consisting of S228P, F234A, L235A, G237A, P238S, and combinations thereof.
[0235] In some embodiments, the IgG4 Fc chain comprises a set of mutations selected from the group consisting of:
[0236] 1) S228P, F234A, and L235A
[0237] 2) S228P, F234A, L235A, G237A, and P238S, or
[0238] 3) F234A, L235A, G237A, and P238S.
[0239] In one aspect, provided are self-assembled polypeptide complexes comprising: [0240] (a) a plurality of first fusion polypeptides, each first fusion polypeptide comprising a first sarbecovirus antibody or sarbecovirus binding fragment thereof linked to a ferritin monomer or subunit thereof,
[0241] (b) a plurality of second fusion polypeptides, each second fusion polypeptide comprising a second sarbecovirus antibody or sarbecovirus binding fragment thereof linked to a ferritin monomer or subunit thereof,
[0242] (c) a plurality of third fusion polypeptides, each third fusion polypeptide comprising a third sarbecovirus antibody or sarbecovirus binding fragment thereof linked to a ferritin monomer or subunit thereof, and
[0243] (d) a plurality of Fc-containing fusion polypeptides, each Fc-containing fusion polypeptide comprising an Fc polypeptide linked to a ferritin monomer or subunit thereof, [0244] wherein the first, second, and third sarbecovirus antibodies or sarbecovirus binding fragments thereof are distinct from each other, and wherein at least the first and second sarbecovirus antibodies are capable of neutralizing SARS-CoV, and SARS-CoV-2.
[0245] In some embodiments, the self-assembled polypeptide complex is capable of neutralizing a SARS-CoV-2 virus.
[0246] In some embodiments, wherein the self-assembled polypeptide complex is capable of neutralizing an Omicron variant, e.g., two or more Omicron variants, or three or more Omicron variants of SARS- CoV-2 virus. In some embodiments, the Omicron variants are selected from the group consisting of BA.l, BA.2, BA.5, XBB.l, and BQ.1.1.
[0247] In some embodiments, the self-assembled polypeptide complex is capable of neutralizing the BA.1 variant of SARS-CoV-2 virus, e.g., with an IC50 of 0.01 pg/mL or less. [0248] In some embodiments, the self-assembled polypeptide complex is capable of neutralizing the BA.2 variant of SARS-CoV-2 virus, e.g., with an IC50 of 0.02 pg/mL or less. [0249] In some embodiments, the self-assembled polypeptide complex is capable of neutralizing the BA.5 variant of SARS-CoV-2 virus, e.g., with an IC50 of less than 0.001 pg/mL.
[0250] In some embodiments, the self-assembled polypeptide complex is capable of neutralizing the BQ.1.1 variant of SARS-CoV-2 virus, e.g., with an IC50 value of 0.5 pg/mL or less.
[0251] In some embodiments, the self-assembled polypeptide complex is capable of neutralizing the XBB.1 variant of SARS-CoV-2 virus, e.g., with an IC50 value of 0.5 pg/mL or less or 0.1 pg/mL or less.
[0252] In some embodiments, the self-assembled polypeptide complex is capable of neutralizing at least one or a combination of WT SARS-CoV-2, and the Alpha, Beta, Gamma, Delta, and an Omicron variant of SARS-CoV-2.
[0253] In some embodiments, the self-assembled polypeptide complex is capable of neutralizing WT SARS-CoV-2 and the Alpha, Beta, Gamma, Delta, and an Omicron variant of SARS-CoV-2.
[0254] In some embodiments, the self-assembled polypeptide complex is capable of neutralizing each of the WT SARS-CoV-2 and the Alpha, Beta, Gamma, Delta, and an Omicron variant of SARS-CoV-2 with IC50 values of 0.01 pg/mL or less.
[0255] In some embodiments, the self-assembled polypeptide complex is capable of neutralizing at least one sarbecovirus other than SARS-CoV-2, for example, a sarbecovirus selected from the group consisting of SARS-CoV, GD-Pangolin, GX-Pangolin, RaTG13, WIV1, SHC014, Lyral l, Rs7327, Rs4231, Rs4084, and combinations thereof.
[0256] In some embodiments, the at least one sarbecovirus other than SARS-CoV-2 comprises SARS-CoV.
[0257] In another aspect, provided are a pharmaceutical compositions comprising the selfassembled polypeptide complex as disclosed herein and a pharmaceutically acceptable excipient.
[0258] In yet another aspect, provided are methods for treating and/or preventing sarbecovirus infection and/or a sarbecovirus-associated condition, the method comprising administering the self-assembled polypeptide complex as disclosed herein, or a pharmaceutical composition disclosed herein, to a subject in need thereof.
[0259] In some embodiments, the subject is a mammal, e.g. a human. [0260] In some embodiments, the administering comprises systemic administration, for example, systemic administration by a route such as intranasal, intravascular, or intramuscular administration.
[0261] In one aspect, provided are uses of a self-assembled polypeptide complex as disclosed herein, or a pharmaceutical composition as disclosed herein, for treating and/or preventing sarbecovirus infection and/or a sarbecovirus-associated condition.
[0262] In one aspect, provided are self-assembled polypeptide complexes or pharmaceutical compositions as disclosed herein for use in treating and/or preventing sarbecovirus infection and/or a sarbecovirus-associated condition.
[0263] In some embodiments, the sarbecovirus infection is a SARS-CoV-2 infection or the sarbecovirus-associated condition is a SARS-CoV-2-associated condition.
BRIEF DESCRIPTION OF THE DRAWINGS
[0264] The patent or application fde contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
[0265] FIGS. 1A-1C show a series of plots demonstrating potency and breadth of anti- SARS-CoV-2 neutralizing Multabodies (MBs). IgG neutralization potency (left panel) and breadth against a six PsV panel using a cut-off IC50 value of 5 pg/mL (light gray bars in right panel) or 0.01 pg/mL (dark gray bars in right panel)(FIG. 1A). Heat map showing the neutralization potency of monospecific MBs displaying Fab specificities from (FIG. 1A) against each PsV variant in the panel (FIG. IB). Individual IC50 values are displayed.
Neutralization potency and breadth of monospecific MBs as in (A). PsV panel: WT, Alpha, Beta, Gamma, Delta, and Omicron BA.l (FIG. 1C). Data from three biological replicates are shown, bars indicate the mean.
[0266] FIGS. 2A-22VV show a series of neutralization curves of receptor binding domain (RBD)-directed IgGs, including mAbs and corresponding MBs, which include 298 (FIGS.
2A-2F), 52 (FIGS. 2G-2L), 80 (FIGS. 2M-2R), 2-7 (FIGS. 2S-2X), 2-36 (FIGS. 2Y-2DD), 2-38 (FIGS. 2EE-2JJ), 10-40 (FIGS. 2KK-2PP), and 11-11 (FIGS. 2QQ-2VV), against SARS-CoV-2 WT (FIGS. 2A, 2G, 2M, 2S, 2Y, 2EE, 2 Ik Ik. 2QQ), Alpha (FIGS. 2B, 2H, 2N, 2T, 2Z, 2FF, 2LL, 2RR), Beta (FIGS. 2C, 21, 20, 2U, 2AA, 2GG, 2MM, 2SS), Gamma (FIGS. 2D, 2J, 2P, 2V, 2BB, 2HH, 2NN, 2TT), Delta (FIGS. 2E, 2K, 2Q, 2W, 2CC, 2D, 200, 2UU), and Omicron (BA 1) (FIGS. 2F, 2L, 2R, 2X, 2DD, 2JJ, 2PP, 2VV) pseudoviruses (PsVs). The mean values ± SD for two technical replicates is shown in each plot. Mean IC50 values from three biological replicates are shown.
[0267] FIGS. 3A-3D show a series of plots demonstrating potent and broad sarbecovirus neutralization by a trispecific MB of the disclosure. PsV virus neutralization of 2-7 IgG (solid line) and MB (dashed lines) against WT (light gray) and Omicron (BA.l, dark gray)(FIG. 3A). The mean values ± SD for two technical replicates is shown in each neutralization plot. Neutralization potency (gray bars) and breadth of 2-7-10-40-11-11 trispecific MB against SARS-CoV-2 PsV and six VOCs (FIG. 3B). *Dashed line indicates IC50 of the REGN IgG mix against WT SARS-CoV-2 PsV. Phylogenetic tree with branch lengths representing divergence (FIG. 3C). Heat map showing neutralization potency of 2-7-10-40-11-11 trispecific MB and its corresponding monospecific MBs against Omicron (BA.2) live virus and three SARS-CoV-1 related bat coronaviruses (LYRall, Rs4084, and Rs7327) PsVs.
Individual IC50 values are shown. Bar graphs indicating percentage accessible surface area on the RBD (light gray) covered by the trispecific MB (2-7-10-40-11-11) and respective components, 2-7 (PDB ID: 7LSS), 10-40 (PDB ID: 7SD5), and 11-11 (EMD: 25167) (FIG. 3D). Mutations found in SARS-CoV-2 VOCs (Alpha, Beta, Gamma, Delta, Omicron (BA.l, BA.2)) that are part of each antibody binding interface are shown in dark gray.
[0268] FIGS. 4A-4E are a series of plots showing broad SARS-CoV-2 and sarbecovirus neutralization by a trispecific MB of the disclosure. PsV neutralization of 2-7-10-40-11-11 trispecific MB against SARS-CoV-2 wildtype, Alpha, Beta, Gamma, Delta, Omicron BA.l and Omicron BA.5 (FIG. 4A). The mean values ± SEM for three biological replicates are shown in each neutralization plot. Live virus neutralization of 2-7-10-40-11-11 trispecific MB and 2-7, 10-40, and 11-11 monospecific MBs against Omicron (BA.2) authentic virus (FIG. 4B). The mean values ± SD for two technical replicates is shown in each neutralization plot. PsV neutralization of 2-7-10-40-11-11 trispecific MB and 2-7, 10-40, and 11-11 monospecific MBs against Rs4084, Rs7327 and LYRall SARS-CoV-1 related bat coronaviruses (FIGS. 4C-4E, respectively).
[0269] FIGs. 5A and 5B show schematic representations of the elements that drive assembly of a tri-specific MB, such as 298-52-80 MB (“T10 MB”). FIG. 5A shows a 3D schematic of the MB quaternary structure. The red arrow indicates the split site between the first half (N- Ferr) and the second half (C-Ferr) of the human apoferritin light chain. FIG. 5B shows a simplified schematic of fusion proteins which self-assemble into a tri-specific MB of the disclosure. [0270] FIG. 6 shows a plot of neutralization potency of 289-52-80 MB* (“T10 MB*”) and the corresponding IgGl and IgG4 cocktails. * indicates the use of an IgG4* Fc bearing the specified mutations (S228P, F234A, L235A, G237A, P238S) to ablate Fey receptor binding. Mean values ± SD for at least three independent experiments are shown.
[0271] FIG. 7A depicts sensorgrams of samples of cocktail IgGl, cocktail IgG4*, or T10 M* binding to human and mouse FcRn (association at pH 5.6, dissociation at pH 7.4). Red lines represent raw data and black lines represent global fit. Representative data for at least three independent experiments are shown.
[0272] FIG. 7B depicts binding (apparent KD) of cocktail IgGl, cocktail IgG4* and T10 MB* particles to human (FcyR I, Ila, lib and FcRn) and mouse (FcyR I, lib, IV and FcRn) receptors. NB and LOD denote no-binding and limit-of-detection, respectively. Mean values ± SD for at least three independent experiments are shown.
[0273] FIGs. 7C and 7D depict sensorgrams of T10 MB* and cocktail IgGl and IgG4* binding to human (FIG. 7C) and mouse (FIG. 7D) Fc receptors. * indicates the use of an IgG4* Fc bearing the specified mutations (PAAAS; see Example 3) to ablate Fey receptor binding. Red lines represent raw data and black lines represent global fit. Representative data from 2-3 independent experiments is shown.
[0274] FIGs. 7E-7H depict flow cytometry plots exemplifying gating strategy followed in an antibody-dependent cellular phagocytosis (ADCP) assay. THP-1 cells were gated by size and live cells, and cells positive for internalization of SARS-CoV-2 Spike-coated fluorescent beads were quantified as a percentage of live THP-1 cells.
[0275] FIG. 71 depicts a bar graph showing % internalization (indicative of ADCP) determined as the percentage of THP-1 cells with internalized SARS-CoV-2 Spike-coated fluorescent microspheres. Mean values ± SD for at least three independent experiments are shown. *** indicates significance compared to no antibody control (p<0.001) by ANOVA. [0276] FIGs. 8A-8G depict results from in vivo challenge experiments. (See Example 3.) FIG. 8A depicts survival over a 12-day period following challenge. **** p<0.0001, **p<0.01, *p<0.05 by Gehan Breslow Wilcoxon test. FIG. 8B depicts lung viral titers at the end of the experiment (open symbols) or at the time of death in the animals that succumbed (closed symbols) measured by viral outgrowth assay. TCID50 per gram of tissue is shown. ****p<0.0001, **p<0.01, Kruskall Wallis test. FIGs. 8C and 8D depict disease scores and weight loss, respectively, over a!2-day period following challenge. For FIG. 8A-8D, n = 33 for T10 MB*, n = 30 for control IgG, n = 10 for cocktail IgG4*, from 2-6 independent experiments.
[0277] FIG. 8E depicts SARS-CoV-2 genome copy number as quantified by qPCR from oropharyngeal swab samples collected at D-l (before challenge) and D2 following challenge by intranasal SARS-CoV-2 administration.
[0278] Survival (FIG. 8F) and serum IgG or MB concentrations at day 2 (FIG. 8G) following administration of low dose tri-specific MB* (3 pg [1.4pmol]; 0.15 mg/kg) compared to high-dose (90 pg [600 pmol]; 4.5 mg/kg) cocktail IgG4*. In FIG 8G:
* * * *p<().001 compared to all other groups by ANOVA. For FIG. 8F and FIG. 8G, n = 24 for T10 MB*, n = 10 for cocktail IgG4* mix and control IgG, from 2-5 independent experiments.
[0279] FIGs. 9A-9B depict stereo-image of composite omit map electron density of 80 Fab- RBD interaction sites. FIG. 9A depicts the map for heavy chain complementarity determining regions (HCDRs) 2 and 3 (light and dark green, respectively) and RBD (grey). FIG. 9B depicts the map for Kappa light chain CDR (KCDR) 3 (orange) and RBD (grey). [0280] FIG. 10A depicts the three-dimensional structure of the 80 Fab-RBD complex. The heavy and light chains of 80 Fab are colored in dark and light purple, respectively. RBD is shown as surface representation (grey) with the footprint of ACE2 depicted in salmon.
[0281] FIG. 10B depicts binding interactions within the 80 Fab-RBD complex. Binding to RBD (grey) involves interactions mediated by heavy chain complementarity determining regions (HCDRs) 2 and 3 (light and dark green, respectively) and kappa light chain CDRS (KCDRs) 2 and 3 (yellow and orange).
[0282] FIG. 10C depicts a detailed view of the hydrogen bond network (dashed lines) formed between key residues at the binding interface of the 80-RBD complex.
[0283] FIG. 10D depicts a detailed view of interactions between RBD residues upon binding to antibody 80. Rearrangement of RBD aromatic residues (grey) upon 80 binding (green) to form a pi-stacking interaction network (shown in cyan dashed line). Left panel: unbound RBD and right panel: 80-RBD complex.
[0284] FIG 10E is a secondary structure cartoon representation of RBD, with residues mutated in the different variants of concern highlighted as red spheres. Inset: close-up view of the RBD area recognized by 80. Critical residues for binding are colored in pink according to their buried surface area (BSA). Mutated residues in the VOCs are indicated and shown in red in the BSA plot. [0285] FIG. 10F Molecular modeling displays the possible conformation adopted by the side chains of the mutated residues T478K and S477N upon 80 binding. Hydrogen bonds are shown as dashed black lines.
[0286] FIG. 11A depict sensorgrams of 80 Fab, IgG and MB binding to WT and Omicron BA.l RBD. Red lines represent raw data and black lines represent global fit.
[0287] FIG. 11B shows binding kinetic parameters (KD, kon, and koff) of 80 as Fab, IgG and MB for binding to WT and Omicron BA.1 RBD. Data shown is average from two independent experiments.
[0288] FIG. 11C is a plot of percentage of authentic virus neutralization against concentration for the 80 IgG and MB against wildtype and Omicron BA.2 indicated in grey and red, respectively. The mean values ± SD for two technical replicates is shown in each neutralization plot.
[0289] FIGs. 12A-12M relate to experiments analyzing tri-specific MB (298-52-80; “T10 MB”) by cryo-electron microscopy (cryoEM). FIG. 12A depicts a processing workflow for cryoEM data. FIG. 12B depicts a representative cryoEM micrograph of tri-specific MBs with white circles highlighting the whole particles and pink and green circles highlighting the scFab and scFc fragments, respectively. FIG. 12C depicts representative 2D classes of scFab (top panels), tri-specific MB (middle panels), and Fc domains (bottom panels). FIG. 12D depicts 3D reconstructions of components of a multabody of the present disclosure. Images on the left are cryoEM maps of scFab at 6.7 A resolution (top), apoferritin nanocage scaffold at 2.4 A resolution (middle) and scFc at 7.1 A resolution (bottom). Images on the right depict fitting of the human apoferritin light chain model (PDB ID:6WX6) into the 2.4 A map, focusing on features such as the N-terminus of the apoferritin scaffold that shows weak density beyond Ser5 due to the flexibility of the linker (top), the four-fold axis formed by four adjacent subunits (middle), and residues 87-109 of the human apoferritin light chain (bottom; the red arrow points to the split site between residues Trp93 and Gly94 in some subunits). All cryoEM maps were refined with no symmetry applied. Scale bars are 10 nm. FIG. 12E depicts a representative cryoEM micrograph with Fab and Fc molecules highlighted with white circles. Scale bar is 50 nm. FIG. 12F depicts representative 2D class averages of Fab. FIG. 12G depicts an atomic model of Fab 298 (PDB ID: 7K9Z) fit into cryoEM map of Fab. FIG. 12H depicts a gold standard Fourier shell correlation (GSFSC) curve of the final 3D non-uniform refinement of Fab in cryoSPARC v3. FIG. 121 depicts the viewing direction distribution of the Fab data. FIG. 12J depicts selected 2D class averages of Fc. FIG. 12K depicts an atomic model of human IgGl Fc (PDB ID: 6CJX) fit into cryoEM map of Fc. FIG. 12L depicts a GSFSC curve of the final 3D non-uniform refinement of Fc in cryoSPARC v3. FIG. 12M depicts viewing direction distribution of the Fc data.
[0290] FIGs. 13A-13I relate to experiments analyzing tri-specific MB (298-52-80) by cryoEM. FIG. 13A depicts a representative cryoEM micrograph of tri-specific MB particles (highlighted with white circles). Scale bar is 50 nm. FIG. 13B depict selected 2D class averages of tri-specific MB particles. FIG. 13C depicts a comparison of tri-specific MB (298-52-80) cryoEM reconstructions at two threshold levels (top - 0.7 and bottom - 2.0), which reveal weak and fragmented densities for antibody fragments fused to the apoferritin scaffold. FIG. 13D depicts gold standard Fourier shell correlation (GSFSC) curve of the final 3D non-uniform refinement of the tri-specific MB in cryoSPARC v3 without symmetry imposed. FIG. 13E depicts viewing direction distribution of tri-specific MB dataset refined without symmetry imposed. FIG. 13F depicts a GSFSC curve of the final 3D non-uniform refinement of the tri-specific MB in cryoSPARC v3 with octahedral symmetry imposed. FIG. 13G depicts a viewing direction distribution of the tri-specific MB dataset refined with octahedral symmetry imposed. FIG. 13H and FIG. 131 show details of atomic models of human apoferritin light chain (PDB ID: 6WX6) fit into the tri-specific MB (298-52-80) map refined with octahedral symmetry imposed. CryoEM density of the tri-specific MB is shown as black mesh with the models of adjacent apoferritin protomers shown as white, grey or black sticks.
[0291] FIGs. 14A-14F relate to experiments analyzing the molecular basis for 2-7 RBD recognition and MB resilience against mutations. FIG. 14A depicts a plot of neutralization potency of 2-7 and 80 monospecific MB (red bars) and corresponding IgG (blue bars) against Omicron BA.5. FIG. 14B and FIG. 14C are structural representations depicting residues commonly mutated in variants of concern (VOCs) (represented as red spheres on WT RBD (grey)). Inset image shows surface representation of the RBD with the footprint of 2-7 (PDB ID: 7LSS) colored according to its BSA. Mutated residues in VOC that fall in the antibody footprint are annotated. Right panel - graphical representation of the buried surface area (BSA) of residues involved in RBD binding. Residues colored in red are mutated in VOCs. FIG. 14D are schematic representations of molecular modeling of the N440K mutation in the RBD-2-7 complex, which shows sufficient space to accommodate the mutated side chain. Hydrogen bonds and Van der Waals interactions are shown in black and red dashed lines, respectively. FIG. 14E depicts sensorgrams of 2-7 IgG and MB binding to WT and Omicron BA.l RBD. Red lines represent raw data and black lines represent global fit. FIG. 14F shows a comparison of the binding kinetic parameters of 2-7 as IgG and MB for binding to WT and Omicron BA.1 RBD. Data shown are averages from two independent experiments.
[0292] FIGs. 15A and 15B relate to experiments analyzing neutralization of SARS-CoV-2 subvariants XBB.l and BQ.1.1 by tri-specific MB (2-7-10-40-11-11). FIG. 15A are plots showing PsV neutralization of 2-7-10-40-11-11 tri-specific MB and corresponding IgG cocktail represented in red and blue, respectively, against Omicron subvariants XBB.l and BQ.1.1. The mean values ± SD for two technical replicates is shown in each neutralization plot. FIG. 15B, left panel, is a plot showing neutralization potency of 2-7-10-40-11-11 tri- specific MB (red bars) and corresponding IgG cocktail (blue bars) against Omicron subvariants XBB.1 and BQ.1.1. Shaded grey indicates IC50 of Sotrovimab and the REGN IgG mix against WT SARS-CoV-2 PsV. FIG. 15B, right panel, are molecular representations of percentage accessible surface area on the RBD (grey) covered by the tri-specific MB (green). Mutations found in SARS-CoV-2 VOCs (Alpha, Beta, Gamma, Delta, Omicron (BA.l, BA.2)) that are part of each antibody binding interface are shown in red. Additional mutations specific to XBB.l and BQ.1.1 Omicron subvariants are indicated in orange.
[0293] FIG. 16 is a bar graph depicting lack of binding of tri-specific MB 298-52-80 to self antigens in a polyreactivity assay. Shown are binding of tri-specific 298-52-80 MB and its corresponding subcomponent IgGs to cardiolipin (blue), insulin (green), dsDNA (red), and KLH (orange). The polyreactive HIV envelope directed IgG 4E10 was used as a positive control.
DETAILED DESCRIPTION OF CERTAIN EMBODIMENTS OF THE INVENTION Definitions
[0294] The terms “about” and “approximately,” when used herein in reference to a value, are used interchangeably and refer to a value that is similar to the referenced value. In general, those skilled in the art, familiar with the context, will appreciate the relevant degree of variation encompassed by “about” or “approximately” in that context. For example, in some embodiments, the terms “about” and “approximately” may encompass a range of values that fall within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less of the referred value.
[0295] As used herein, the terms “alter,” “altered,” “decrease,” “decreased,” “increase,” “increased,” or “reduction,” “reduced,” (e.g, in reference to certain outcomes or effects) have meanings relative to a reference level. In some embodiments, in the context of discussing mutations in an Fc chain or Fc polypeptide, the reference level is a level known or as determined with an IgG that does not contain the referenced mutation(s) in the Fc region. [0296] As used herein, the term “binding,” unless otherwise specified, refers to a non- covalent association between or among two or more entities. "Direct" binding involves physical contact between entities or moieties; indirect binding involves physical interaction by way of physical contact with one or more intermediate entities. Binding between two or more entities can typically be assessed in any of a variety of contexts -including where interacting entities or moieties are studied in isolation or in the context of more complex systems (e.g, while covalently or otherwise associated with a carrier entity and/or in a biological system or cell). As used herein, the phrases “non-binding” or “no binding,” or similar phrases, between two entities refers to 1) a lack of detectable binding or 2) binding below a set threshold that corresponds to no binding in an appropriate assay, e.g, an in vitro binding assay such as biolayer interferometry. For example, in some embodiments, in an in vitro biolayer interferometry assay, a maximal association binding response of less than 0.1 nm after 180 seconds to a biosensor loaded with 0.8 nm of target when the test article is present at a concentration of 20 nM is classified as “non-binding.”
[0297] The terms “ferritin” and “apoferritin” are used interchangeably herein and generally refer to a polypeptide (e.g, a ferritin chain) that is capable of assembling into a ferritin complex which typically comprises 24 protein subunits. In some embodiments, the ferritin is a human ferritin, e.g. , a human ferritin light chain, e.g. , a human ferritin light chain having at least 85% sequence identity to SEQ ID NO:1 or UniProt P02792. In some embodiments, the ferritin is a wild-type ferritin. For example, the ferritin may be a wild-type human ferritin.
[0298] The term “ferritin monomer,” is used herein to refer to a single chain of a ferritin that, in the presence of other ferritin chains, is capable of self-assembling into a polypeptide complex comprising a plurality of ferritin chains, e.g., 24 or more ferritin chains.
[0299] As used herein, the term “linker” is used to refer to an entity that connects two or more elements to form a multi-element agent. For example, those of ordinary skill in the art appreciate that a polypeptide (e.g, fusion polypeptide) whose structure includes two or more functional or organizational domains often includes a stretch of amino acids between such domains that links them to one another. In some embodiments, a polypeptide comprising a linker element has an overall structure of the general form S1-L-S2, wherein SI and S2 may be the same or different and represent two domains associated with one another by the linker (L). In some embodiments, the linker is an “amino acid linker,” that is, it comprises amino acid residues, e.g., an amino acid linker may comprise at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more amino acid residues. In some embodiments, a linker is characterized in that it tends not to adopt a rigid three-dimensional structure, but rather provides flexibility to the polypeptide.
[0300] The term “multispecific,” as used herein, refers to the characteristic of having at least two binding sites at which at least two different binding partners, e.g., an antigen or receptor (e.g, Fc receptor), can bind. For example, a polypeptide complex that comprises at least two Fab fragments, wherein each of the two Fab fragments is capable of binding to a different antigen, is “multispecific.” As an additional example, a polypeptide complex that comprises an Fc fragment (which is capable of binding to an Fc receptor) and a Fab fragment (which is capable of binding to an antigen) is “multispecific.”
[0301] The term “multivalent,” as used herein, refers to the characteristic of having at least two binding sites at which a binding partner, e.g., an antigen or receptor (e.g, Fc receptor), can bind. The binding partners that can bind to at least two binding sites may be the same or different.
[0302] The term “nanocage monomer,” as used herein, refers to a single chain of a polypeptide that is capable of self-assembling with other nanocage monomers to form a selfassembled polypeptide complex comprising a plurality of nanocage monomers. In some embodiments, the nanocage monomer is selected from monomers of ferritin, apoferritin, encapsulin, sulfur oxygenase reductase (SOR), lumazine synthase, pyruvate dehydrogenase, carboxysome, vault proteins, GroEL, heat shock protein, E2P coat protein, MS2 coat protein, fragments thereof, and variants thereof.
[0303] The term “polypeptide,” as used herein, generally has its art-recognized meaning of a polymer of at least three amino acids, e.g, linked to each other by peptide bonds. Those of ordinary skill in the art will appreciate that the term “polypeptide” is intended to be sufficiently general as to encompass not only polypeptides having a complete sequence recited herein, but also to encompass polypeptides that represent functional fragments (i.e., fragments retaining at least one activity) of such complete polypeptides. Moreover, those of ordinary skill in the art understand that protein sequences generally tolerate some substitution without destroying activity. Thus, any polypeptide that retains activity and shares at least about 30-40% overall sequence identity, often greater than about 50%, 60%, 70%, or 80%, and further usually including at least one region of much higher identity, often greater than 90% or even 95%, 96%, 97%, 98%, or 99% in one or more highly conserved regions, usually encompassing at least 3-4 and often up to 20 or more amino acids, with another polypeptide of the same class, is encompassed within the relevant term “polypeptide” as used herein. Polypeptides may contain L-amino acids, D-amino acids, or both and may contain any of a variety of amino acid modifications or analogs known in the art. Useful modifications include, e.g, terminal acetylation, amidation, methylation, glycosylation etc. In some embodiments, proteins may comprise natural amino acids, non-natural amino acids, synthetic amino acids, and combinations thereof
[0304] The term “self-assembled,” when used in reference to a macromolecular complex (e.g., a polypeptide complex), refers to the spontaneous formation of that complex when sufficient constituents of the complex (e.g, fusion polypeptides) to be formed are present. In some embodiments, complexes self-assemble in physiological conditions, or in a buffer (e.g. , a solution) that corresponds to physiological conditions.
[0305] As used herein, the term “subject” to an organism, typically a mammal (e.g, a human). In some embodiments, a subject is suffering from or susceptible to a relevant disease, disorder or condition. In some embodiments, a subject displays one or more symptoms or characteristics of a disease, disorder or condition. In some embodiments, a subject is someone with one or more features characteristic of susceptibility to or risk of a disease, disorder, or condition. In some embodiments, a subject is a patient. In some embodiments, a subject is a subject to whom diagnosis and/or therapy is and/or has been administered.
[0306] As used herein, the term “treatment” (also “treat” or “treating”) refers to any administration of a therapy that partially or completely alleviates, ameliorates, relieves, inhibits, delays onset of, reduces severity of, and/or reduces incidence of one or more symptoms, features, and/or causes of a particular disease, disorder, and/or condition. In some embodiments, such treatment may be of a subject who does not exhibit signs of the relevant disease, disorder and/or condition and/or of a subject who exhibits only early signs of the disease, disorder, and/or condition. Alternatively, or additionally, such treatment may be of a subject who exhibits one or more established signs of the relevant disease, disorder and/or condition. In some embodiments, treatment may be of a subject who has been diagnosed as suffering from the relevant disease, disorder, and/or condition. In some embodiments, treatment may be of a subject known to have one or more susceptibility factors that are statistically correlated with increased risk of development of the relevant disease, disorder, and/or condition. A. Fusion polypeptides
[0307] In many embodiments, fusion polypeptides compatible with compositions and methods disclosed herein generally comprise a nanocage monomer or subunit thereof linked to either (1) a sarbecovirus antibody or sarbeco virus -binding antibody fragment or (2) an Fc polypeptide. Within the fusion polypeptide, the sarbecovirus antibody, sarbecovirus-binding antibody fragment, or Fc polypeptide may be linked to the nanocage monomer or subunit thereof at a particular terminus of the nanocage monomer or subunit thereof, e.g, the N- terminus or the C-terminus. In some embodiments, the sarbecovirus antibody, sarbecovirus- binding antibody fragment, or Fc polypeptide is linked to the nanocage monomer or subunit thereof via an amino acid linker, such as a linker described herein.
1. Nanocage monomers and subunits thereof
[0308] In some embodiments, the nanocage monomer is a ferritin monomer.
[0309] The term “ferritin monomer,” is used herein to refer to a single chain of a ferritin that, in the presence of other ferritin chains, is capable of self-assembling into a polypeptide complex comprising a plurality of ferritin chains, e.g., 24 or more ferritin chains. In some embodiments, the ferritin monomer is a ferritin light chain. In some embodiments, the ferritin monomer does not include a ferritin heavy chain or other ferritin components capable of binding to iron or capable of ferroxidase activity.
[0310] In some embodiments, each fusion polypeptide within the self-assembled polypeptide complex comprises a ferritin light chain or a subunit of a ferritin light chain. In these embodiments, the self-assembled polypeptide complex does not comprise any ferritin heavy chains or subunits of ferritin heavy chains.
[0311] In some embodiments, the ferritin monomer is a human ferritin chain, e.g., a human ferritin light chain, e.g., a human ferritin light chain having the sequence of at least residues 2-175 of SEQ ID NO:1.
[0312] A “subunit” of a ferritin monomer refers to a portion of a ferritin monomer that is capable of spontaneously associating with another, distinct subunit of a ferritin monomer, so that the subunits together form a ferritin monomer, which ferritin monomer, in turn, is capable of self-assembling with other ferritin monomers to form a polypeptide complex.
[0313] In some embodiments, the ferritin monomer subunit comprises approximately half of a ferritin monomer. As used herein, the term “N-half ferritin” refers to approximately half of a ferritin chain, which half comprises the N-terminus of the ferritin chain. As used herein, the term “C-half ferritin” refers to approximately half a ferritin chain, which half comprises the C-terminus of the ferritin chain. The exact point at which a ferritin chain may be divided to form the N-half ferritin and the C-half ferritin may vary depending on the embodiment. In the context of ferritin monomer subunits based on human ferritin light chain, for example, the halves may be divided at a point that corresponds to a position between about position 75 to about position 100 of SEQ ID NO: 1 (or a substantial portion thereof). For example, in some embodiments, an N-half ferritin based on a human ferritin light chain has an amino acid sequence corresponding to residues 1-95 of SEQ ID NO: 1 (or a substantial portion thereof, e.g. , residues 2-95 of SEQ ID NO: 1), and a C-half ferritin based on a human ferritin light chain has an amino acid sequence corresponding to residues 96-175 of SEQ ID NO: 1 (or a substantial portion thereof).
[0314] In some embodiments, the halves are divided at a point that corresponds to a position between about position 85 to about position 92 of SEQ ID NO: 1. For example, in some embodiments, an N-half ferritin based on a human ferritin light chain has an amino acid sequence corresponding to residues 1-90 of SEQ ID NO:1 (or a substantial portion thereof, e.g. , residues 2-90 of SEQ ID NO: 1), and a C-half ferritin based on a human ferritin light chain has an amino acid sequence corresponding to residues 91-175 of SEQ ID NO:1 (or a substantial portion thereof.
2, Fc polypeptides
[0315] Immunoglobulin molecules typically contain a fragment crystallizable (Fc) region composed of two chains which are each portions of an immunoglobulin heavy chain. In particular, each chain (hereinafter “Fc chain”) includes a constant heavy 2 (CH2) region and a constant heavy 3 (CH3) region.
[0316] Fc polypeptides suitable for use in the present invention generally comprise one or more Fc chains. In some embodiments, the Fc chain is a wild type Fc chain, e.g., having the same amino acid sequence as the Fc portion of a wild type immunoglobulin molecule (such as IgGl or IgG4). In some embodiments, the Fc chain has one or more mutations relative to a reference Fc chain of the same Ig class. As explained further herein below, the reference Fc chain may be of, e.g, the IgGl or IgG4 class.
[0317] Unless otherwise noted, numbering of residues within an antibody fragment, e.g, an Fc chain, throughout this disclosure is according to the EU numbering.
[0318] In some embodiments, the Fc polypeptide comprises one or more human IgGl Fc chains; that is, except for any mutations noted herein, the Fc polypeptide comprises an Fc chain that is substantially similar to that of the Fc chains within a wild type human IgGl. [0319] In some embodiments, the Fc polypeptide comprises one or more human IgG4 Fc chains; that is, except for any mutations noted herein, the Fc polypeptide comprises an Fc chain that is substantially similar to that of the Fc chains within a wild type human IgG4. [0320] In some embodiments, the wild type IgGl Fc is a human IgGl Fc, in which each Fc chain has an amino acid sequence of SEQ ID NO:4. In some embodiments, the wild type IgG4 Fc is a human IgG4 Fc, in which each Fc chain has an amino acid sequence of SEQ ID NO:6. For example, an Fc polypeptide may comprise an Fc chain with an amino acid sequence that is at least 85%, at least 87.5%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:4 or SEQ ID NO:6. In some embodiments, an Fc polypeptide comprises an Fc chain that comprises the particular residue(s) at certain position(s) specifically described for that Fc chain, but has an amino acid sequence that is otherwise 100% identical to a corresponding Fc chain within a wild type Fc chain, e.g., a wild type IgGl Fc chain or wild type IgG4 Fc chain. In some embodiments, the Fc polypeptide comprises an Fc chain that has an amino acid sequence that differs by at least one, at least two, at least three, or at least four amino acid residues from the sequence of SEQ ID NO:4 or from the sequence of SEQ ID NO:6. In some embodiments, the Fc polypeptide comprises an Fc chain that has an amino acid sequence that differs by no more than ten, no more than nine, no more than eight, no more than seven, no more than six, no more than five, or no more than four amino acid residues from the sequence of SEQ ID NO:4 or from the sequence of SEQ ID NO:6.
[0321] In some embodiments, the Fc polypeptide is a single chain Fc (scFc), which comprises two Fc chains linked together by a covalent linker, e.g., via an amino acid linker. A non-limiting example of an scFc using Fc chains from human IgGl and an amino acid linker is shown as SEQ ID NO:5.
[0322] In certain embodiments, the Fc chain comprises an alanine at position 234. In certain embodiments, the Fc chain comprises an alanine at position 235. In some embodiments, the Fc chain comprises an alanine at position 237. In some embodiments, the Fc chain comprises a serine at position 238.
[0323] In some embodiments, the Fc chain is an IgG4 Fc chain and comprises a proline at position 228.
[0324] In some embodiments, the Fc chain is an IgG4 Fc chain and comprises a mutation or set of mutations selected from the group consisting of S228P, F234A, L235A, G237A, P238S, and combinations thereof. [0325] For example, in some embodiments, the Fc chain is an IgG4 Fc chain and comprises one of the following sets of mutations:
1) S228P, F234A, and L235A
2) S228P, F234A, L235A, G237A, and P238S, or
3) F234A, L235A, G237A, and P238S.
[0326] In some embodiments, the Fc chain comprises a mutation or set of mutations (relative to a corresponding wild type Fc chain) associated with an altered characteristic as further described herein. By “associated with,” it is meant that the mutation or set of mutations has been previously characterized, in the context of antibodies such as IgG antibodies, as conferring the altered characteristic (e.g, altered binding to FcRn, altered effector function, etc.) By “altered” it is meant that the characteristic (e.g, binding to an Fc receptor (e.g, an Fey receptor or an FcRn)), is different than that observed without the mutation or set of mutations.
[0327] For example, in some embodiments, the altered characteristic comprises altered binding to an Fc receptor.
[0328] In some embodiments, the altered characteristic comprising altered binding to an Fey receptor, e.g, a human FcyR. In some embodiments, the FcyR is a human FcyR selected from the group consisting ofhFcyRI, hFcyRIIa, hFcyRIIb, hFcyRIIIa, hFcyRIIIb, and combinations thereof.
[0329] In some embodiments, the altered binding comprises no binding, or significantly reduced binding, relative to a corresponding control (e.g, binding levels typically observed under similar circumstances with a corresponding wild type chain), in an assay, e.g, an in vitro assay.
3, Sarbecovirus binding moieties
[0330] A “sarbecovirus binding moiety” as used herein is a moiety that is capable of binding to an epitope on at least one sarbecovirus, or, when more than one variant of a given sarbecovirus has been characterized, at least one variant of a sarbecovirus or at least the wild type version of the sarbecovirus.
[0331] Examples of sarbeco viruses characterized to date include viruses that are known to cause human disease, such as SARS-CoV and SARS-CoV-2, as well as isolates from animals such as bats and pangolins, such as GD-Pangolin, GX-Pangolin, RaTG13, WIV1, SHC014, Lyrall, Rs7327, Rs4231, Rs4084, and combinations thereof. [0332] SARS-CoV-2 variants include, for example, variants designated by public health organizations as variants of concern (VOC), variants of interest (VOI), and variants being monitored (VBM). Variant designations may change over time, and new variants my arise of time. Examples of SARS-CoV-2 variants characterized to date include variant of the Alpha lineages (e.g, B.1.1.7 and Q lineages), the Beta lineages (e.g, B.1.351 and descendent lineages), Gamma lineages (e.g, Pl and descendent lineages), Delta lineages (e.g, B.1.617.2 and AY lineages), Eta lineage (e.g, B.1.525 lineage), Iota lineage (e.g, B.1.526 lineage), Kappa lineage (e.g, B.1.617.1 lineage), 1.617.3 lineage, Mu lineages (e.g, B.1.621 and B.1.621.1 lineages), Omicron lineages (e.g, B.1.1.529, BA.l, BA1.1, BA.2, BA.2.75, BA.3, BA.4, BA.5, BQ.l, BQ.1.1, XBB lineages (e.g., XBB.l), and subvariants (including recombination variants) of any of the foregoing), and Zeta lineage (P.2 lineage). As used herein, the term “Omicron variant” refers to the original Omicron variant of SARS-CoV-2 or any descendent or subvariant (including recombination variant) thereof.
[0333] In some embodiments, the sarbecovirus binding moiety is capable of binding to SARS-CoV-2 and at least one sarbecovirus other than SARS-CoV-2, e.g, SARS-CoV.
[0334] In some embodiments, the sarbecovirus binding moiety is capable of binding at least one Omicron variant of SARS-CoV-2, e.g, BA.l, BA.2, BA.5, XBB.l or BQ.1.1.
[0335] In certain embodiments, the sarbecovirus binding moiety comprises a sarbecovirus antibody (an antibody capable of binding to an epitope on a sarbecovirus) or sarbecovirus- binding fragment thereof (a fragment capable of binding to an epitope on a sarbecovirus, interchangeably referred to as “sarbecovirus antibody fragment”).
[0336] In some embodiments, the sarbecovirus binding moiety is an antibody fragment, e.g, a Fab. In some embodiments, the antibody fragment is a single-chain Fab (scFab); for example, a fusion polypeptide comprising both the heavy and light chains of a Fab, optionally linked by a linker (e.g, amino acid linker as disclosed herein) is used.
[0337] In certain embodiments, the antibody fragment comprises a heavy chain variable region (e.g, a VH). In certain embodiments, the antibody fragment comprises a heavy chain variable domain (e.g, VH) and a light chain variable domain (e.g, a VL or VK). In certain embodiments, the antibody fragment comprises a Fab which comprises a heavy chain variable domain (e.g, VH) and a light chain variable domain (e.g, a VL or VK).
[0338] In certain embodiments, the antibody fragment does not comprise any domains from the Fc region, e.g, does not comprise any CH2 or CH3 domains. In certain embodiments, the antibody fragment is an antibody fragment of, or derived from, any of a variety of sarbecovirus antibodies, including, e.g, fully human, humanized or chimeric sarbecovirus antibodies. The sarbecovirus antibody from which the antibody fragment is obtained or derived can be of any of a variety of antibody classes, including, e.g., an IgGl antibody, an IgG2 antibody, an IgG4 antibody.
[0339] In some embodiments, the sarbecovirus antibody or fragment is a neutralizing sarbecovirus antibody, e.g, a neutralizing humanized sarbecovirus antibody, or a fragment thereof. In some embodiments, the sarbecovirus antibody is capable of neutralizing SARS- CoV-2, e.g., with an IC50 below 10 pg/mL, below 2 pg/mL, or 1 pg/mL. In some embodiments, the sarbecovirus antibody is capable of neutralizing a sarbecovirus other than SARS-CoV-2 (e.g, SARS-Co-V), e.g, with an IC50 below 10 pg/mL, below 2 pg/mL, or 1 pg/mL. In some embodiments, the sarbecovirus binding moiety is capable of neutralizing both SARS-CoV-2 and another sarbecovirus (e.g, SARS-Co-V). Antibody neutralizing ability may be determined, for example, using an in vitro assay such as one that employs a pseudovirus panel or an in vitro assay that employs live virus.
[0340] In some embodiments, the sarbecovirus antibody or fragment is capable of inhibiting binding of a sarbecovirus (e.g., SARS-CoV-2 and/or SARS-CoV) to ACE2. In some embodiments, “inhibiting” binding means reducing binding by, e.g., at least 2-fold, at least 5- fold, at least 10-fold, at least 20-fold, at least 30-fold, at least 40-fold, at least 50-fold, at least 60-fold, at least 70-fold, at least 80-fold, at least 90-fold, at least 100-fold, at least 150-fold, at least 200-fold, at least 250-fold, at least 300-fold, at least 350-fold, at least 400-fold, at least 450-fold, at least 500-fold, at least 550-fold, at least 600-fold, at least 650-fold, at least 700-fold, at least 550-fold, at least 600-fold, at least 650-fold, at least 700-fold, at least 750- fold, at least 800-fold, at least 850-fold, at least 900-fold, at least 950-fold, or at least 1,000- fold.
[0341] Non-limiting examples of sarbecovirus antibodies include, e.g., an antibody depicted in Table 1, shown below.
Table 1: Examples of sarbecovirus antibodies
[0342] In some embodiments, the sarbecovirus antibody or sarbecovirus binding fragment thereof comprises a heavy chain complementarity determining region 3 (CDR-H3) having a sequence which comprises YYDRSGY (SEQ ID NO: 70).
[0343] In some embodiments, sarbecovirus antibody fragments comprises heavy chain and light chain CDRs having similar sequences (e.g, each CDR being identical, or having one or two amino acid substitutions) to that of the heavy and light chain CDRs of a sarbecovirus antibody (e.g, a sarbecovirus antibody mentioned in Table 1).
[0344] In some embodiments, the sarbecovirus antibody fragment comprises heavy and light chain CDRs having sequences identical to those of the heavy and light chain CDRs of a sarbecovirus antibody (e.g, a sarbecovirus antibody mentioned in Table 1), except for one, two, or three amino acid substitutions total across all six CDRs.
[0345] In some embodiments, the sarbecovirus antibody fragment comprises heavy chain and light chain complementarity-determining regions (CDRs) having the same sequences as the CDRs of a sarbecovirus antibody, e.g, a sarbecovirus antibody mentioned in Table 1.
[0346] In some embodiments, sarbecovirus antibody fragments comprises heavy chain and light chain variable regions having similar sequences (e.g, each VH and VL or VK being identical, or having at least 90%, at least 91%, at least 92%, at least 93%, at least 94% at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% amino acid sequence identity) to that of the heavy and light chain variable regions of a sarbecovirus antibody (e.g, a sarbecovirus antibody mentioned in Table 1).
[0347] In embodiments where multiple types of fusion polypeptides having antibody fragments are used (e.g, within the same self-assembled polypeptide complex), the antibody fragments in the various types of fusion polypeptides may be capable of binding to the same epitope on a sarbecovirus, capable of binding to epitopes that are distinct and nonoverlapping on a sarbecovirus (e.g, distinct epitopes on the same sarbecovirus and/or distinct epitopes on different sarbecoviruses or different variants of a sarbecovirus), or capable of binding to epitopes that are distinct but overlapping on a sarbecovirus.
4, Linkers
[0348] In certain embodiments, linkers are used within fusion polypeptides and/or within single-chain molecules such as scFcs. In some embodiments, the linker is an amino acid linker. For example, a linker as employed herein may comprise from about 1 to about 100 amino acid residues, e.g, about 1 to about 70, about 2 to about 70, about 1 to about 30, or about 2 to about 30 amino acid residues. In some embodiments, the linker comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 amino acid residues.
[0349] In certain embodiments, the linker comprises a glycine-serine sequence, e.g, a (GnS)m sequence (e.g, GGS, GGGS (SEQ ID NO:55), or GGGGS (SEQ ID NO:54) sequence) that is present in at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, or at least 14 copies within the linker.
B. Self-assembled polypeptide complexes
[0350] In one aspect, provided are self-assembled polypeptide complexes comprising a plurality of fusion polypeptides as disclosed herein. Generally, provided self-assembled polypeptide complexes comprise (a) a plurality of first fusion polypeptides, each first fusion polypeptide comprising (1) an Fc polypeptide linked to (2) a nanocage monomer or subunit thereof, wherein the Fc polypeptide comprises an Fc chain having one or more mutations relative to a reference Fc chain of the same Ig class, and (b) a plurality of second fusion polypeptides, each second fusion polypeptide comprising (1) an antigen-binding antibody fragment linked to (2) a nanocage monomer or subunit thereof.
[0351] In some embodiments, the nanocage monomer is a ferritin monomer, and each fusion polypeptide within the self-assembled polypeptide complex comprises a ferritin light chain or a subunit of a ferritin light chain. In these embodiments, the self-assembled polypeptide complex does not comprise any ferritin heavy chains, subunits of ferritin heavy chains, or other ferritin components capable of binding to iron or capable of ferroxidase activity.
[0352] In some embodiments, the nanocage monomer or subunit thereof is a ferritin monomer subunit, and (a) each first fusion polypeptide comprises a ferritin monomer subunit which is C-half-ferritin and each second fusion polypeptide comprises a ferritin monomer subunit which is N-half-ferritin; or (b) each first fusion polypeptide comprises a ferritin monomer subunit which is N-half ferritin and each second fusion polypeptide comprises a ferritin monomer subunit which is C-half-ferritin.
[0353] In some embodiments, the self-assembled polypeptide complex comprises between 24 and 48 fusion polypeptides in total. In some embodiments, the self-assembled polypeptide complex comprises 24 fusion polypeptides in total. In some embodiments, the self-assembled polypeptide complex comprises more than 24 fusion polypeptides, e.g., at least 26, at least 28, at least 30, at least 32 fusion polypeptides, at least 34 fusion polypeptides, at least 36 fusion polypeptides, at least 38 fusion polypeptides, at least 40 fusion polypeptides, at least 42 fusion polypeptides, at least 44 fusion polypeptides, at least 46 fusion polypeptides, or at least 48 fusion polypeptides in total. In some embodiments, the self-assembled polypeptide complex comprises about 32 fusion polypeptides. [0354] In some embodiments, the self-assembled polypeptide complex comprises at least 4, at least 5, least 6, at least 7, or at least 8 first fusion polypeptides.
[0355] In some embodiments, the self-assembled polypeptide complex comprises at least 4, at least 5, least 6, at least 7, or at least 8 second fusion polypeptides.
[0356] In some embodiments, the self-assembled polypeptide complex further comprises at least 4, at least 5, least 6, at least 7, at least 8, at least 9, at least 10, least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 third fusion polypeptides.
[0357] In some embodiments, the self-assembled polypeptide complex comprises a ratio of approximately 1:1, 11:13, 3:5, 1:2, 7:17, 1:3, 2:7, 5:19, 1:4, 1:5, 1:6, 1:7, 1:8, 1:12, 1:24 of first fusion polypeptides to all other fusion polypeptides.
Potency and breadth
[0358] In certain embodiments, provided self-assembled polypeptide complexes are capable of neutralizing one or more sarbecoviruses, e.g., SARS-CoV-2.
[0359] In some embodiments, provided self-assembled polypeptide complexes are capable of neutralizing the WT SARS-CoV-2 or at least one variant of SARS-CoV-2 (e.g, Alpha, Beta, Gamma, Delta, and Omicron variants of SARS-CoV-2, or a combination thereof). In some embodiments, provided self-assembled polypeptide complexes are capable of neutralizing both WT SARS-CoV-2 and Alpha, Beta, Gamma, Delta, and Omicron variants of SARS-CoV-2.
[0360] In some embodiments, provided self-assembled polypeptide complexes are capable of neutralizing one or more variants of SARS-CoV-2, e.g., an Omicron lineage variant, e.g, BA.l, BA.2, BA.5, XBB.l, and/or BQ.1.1.
[0361] In some embodiments, provided self-assembled polypeptide complexes are capable of neutralizing one or more sarbecoviruses other than SARS-CoV-2, such as a sarbeco virus selected from the group consisting of SARS-CoV, GD-Pangolin, GX-Pangolin, RaTG13, WIV1, SHC014, Lyral l, Rs7327, Rs4231, Rs4084, and combinations thereof. In some embodiments, provided self-assembled polypeptide complexes are capable of neutralizing such as SARS-CoV.
[0362] In some embodiments, provided self-assembled polypeptide complexes are capable of neutralizing SARS-CoV-2 and one or more sarbecoviruses other than SARS-CoV-2, e.g, both SARS-CoV-2 and a sarbecovirus selected from the group consisting of SARS-CoV, GD-Pangolin, GX-Pangolin, RaTG13, WIV1, SHC014, Lyrall, Rs7327, Rs4231, Rs4084, and combinations thereof. In some embodiments, provided self-assembled polypeptide complexes are capable of neutralizing both SARS-CoV and SARS-CoV-2.
[0363] For example, in some embodiments, a self-assembled polypeptide complex is capable of neutralizing a sarbeco virus or variant of a sarbecovirus with an IC50 of less than 0.01 pg/mL, .005 pg/mL, 0.001 pg/mL, 0.0005 pg/mL, or 0.0002 pg/mL. In some embodiments, a self-assembled polypeptide complex is capable of neutralizing an Omicron variant of SARS-CoV-2 with an IC50 of less than 0.5 pg/mL, 0.1 pg/mL, 0.01 pg/mL, .005 pg/mL, 0.001 pg/mL, 0.0005 pg/mL, or 0.0002 pg/mL. In some embodiments, a selfassembled polypeptide complex is capable of neutralizing a BA.5 (Omicron) variant of SARS-CoV-2 with an IC50 of less than 0.01 pg/mL, .005 pg/mL, 0.001 pg/mL, 0.0005 pg/mL, or 0.0002 pg/mL. In some embodiments, a self-assembled polypeptide complex is capable of neutralizing a BQ.1.1 and/or XBB.1 (Omicron) variant of SARS-CoV-2 with an IC50 of less than 0.5 pg/mL. In some embodiments, a self-assembled polypeptide complex is capable of neutralizing a BQ.1.1 (Omicron) variant of SARS-CoV-2 with an IC50 of about 0.1 pg/mL. In some embodiments, a self-assembled polypeptide complex is capable of neutralizing an XBB.l (Omicron) variant of SARS-CoV-2 with an IC50 of less than 0.1 pg/mL.
C. Methods of treatment
[0364] In one aspect, provided are methods that may be useful for treating, ameliorating, or preventing sarbecovirus infection or a sarbecovirus-associated condition, generally comprising a step of administering a composition comprising a self-assembled polypeptide complex of the present disclosure to a subject.
[0365] In some embodiments, the subject is a mammal, e.g. , a human.
[0366] Compositions for administration to subjects generally comprise a self-assembled polypeptide complex as disclosed herein. In some embodiments, such compositions further comprise a pharmaceutically acceptable excipient.
[0367] Compositions may be formulated for administration for any of a variety of routes of administration, including systemic routes (e.g, oral, inhalation, intranasal, intravenous, intraperitoneal, subcutaneous, or intramuscular administration).
[0368] In some embodiments, the step of administering results in improvement in one or more clinical outcomes or metrics in the subject.
[0369] For example, in a subject who has been infected with a sarbecovirus, administration of a self-assembled polypeptide complex may, in some embodiments, result in reduction of viral load. In some embodiments, administration of self-assembled polypeptide complex described herein results in reduced chances of infection by a sarbecovirus and/or reduced forward transmission of the sarbecovirus.
[0370] Alternatively or additionally, administration may, in some embodiments, prevent, delay, reduce the severity of, relieve the symptoms of, and/or reduce incidence of one or more sarbecovirus-associated condition.
[0371] Sarbecovirus-associated conditions include, for example, respiratory distress, fever, ground-glass opacities in the lung, pneumonia, lymphocytopenia, cerebrovascular disorders, dysrhythmias, ischemic and non-ischemic heart disease, pericarditis, myocarditis, and heart failure, thromboembolic disease.
EXAMPLES
[0372] The following examples are put forth to provide those of ordinary skill in the art with a description of how the compositions and methods described herein may be used, made, and evaluated, and are intended to be purely exemplary of the disclosure and are not intended to limit the scope of what the inventors regard as their invention.
Methods and Materials
[0373] The following descriptions of Methods and Materials apply to Examples 1 through 5.
Cell lines and viruses
[0374] HEK 293T-ACE2 cells (BEI NR2511), HEK 293T (ATCC), and Vero E6 (Green Monkey Kidney cell line, ATCC) cells were grown in Dulbecco’s Modified Eagle Medium (DMEM; Thermo Fisher Scientific, Waltham, MA). For HEK 293T and 293T-ACE2 cells, DMEM was supplemented with 10% heat inactivated Fetal Bovine Serum (FBS), 5% 1 M HEPES and 1% gentamicin (Thermo Fisher Scientific, Waltham, MA). For Vero E6 cells, DMEM was supplemented with 10% FBS (Hy clone, Logan, UT) and 1% penicillinstreptomycin (Invitrogen, Thermo Fisher Scientific, Waltham, MA). HEK 293F and HEK 293 S cells (Thermo Fisher Scientific, Waltham, MA) were cultured in Freestyle 293 Expression Medium (Thermo Fisher Scientific, Waltham, MA) at 125 rpm oscillation, 37 °C, 8% CO2. SARS-CoV-2/SB2-P4-PB Clone 1 (Banerjee et al. Emerg Infect Dis 26:2054-63, 2020) titers were determined by 50% tissue culture infectious dose (TCID50/mL) using cell supernatants using known methods. Protein expression and purification
[0375] Genes encoding human apoferritin fusions, antigen-binding fragments (Fabs), fragment crystallizable regions (Fes), and IgGs were synthesized and cloned by GeneArt (Thermo Fisher Scientific, Waltham, MA) in the pcDNA3.4 expression vector and transiently expressed in HEK 293F cells. IgGl and IgG4* versions of Fc were used, where the asterisk indicates the inclusion of the following mutations in the IgG4 Fc to ablate Fey receptor binding: S228P, F234A, L235A, G237A, and P238S. Cells were cultured at a density of 0.8*106 cells/mL and transfected with 50 pg of DNA per 200 mL of cells using FectoPRO (Polyplus Transfections, Strasbourg, France) using known methods. Following 6-7 days of incubation with oscillation (Multitron Pro shaker, Infors HT, 125 rpm oscillation, 37 °C, 8% CO2, 70% humidity), cells were harvested by centrifugation at 5000 rpm for 20 min and supernatants were filtered through a 0.22 pm Steritop filter (EMD Millipore, Burlington, MA). Fabs and IgGs were expressed by transiently by co-transfecting 90 pg of heavy and light chain at a 2: 1 ratio, and purified using KappaSelect affinity and HiTrap Protein A HP columns, respectively (both GE Healthcare, Chicago, IL), eluted with 100 mM glycine (pH 2.2), and neutralized with 1 M Tris-HCl (pH 9.0). IgG fractions were further purified by size exclusion chromatography (SEC; Superdex 200 Increase, GE Healthcare, Chicago, IL), and Fab fractions were further purified by cation exchange chromatography (MonoS, GE Healthcare, Chicago, IL). His-tagged WT RBD (BEI NR52309), human (h) and murine (m) Fc receptors (hFcyRI, hFcyRIIa, hFcyRIIb, hFcRn, mFcyRI, mFcyRIIb, mFcyRIV, and mFcRn) were purified using a HisTrap Ni NTA column followed by SEC (Superdex 200 Increase column; both GE Healthcare, Chicago, IL) using 20 mM phosphate (pH 8.0) and 150 mM NaCl buffer.
Expression and purification ofMultabodies
[0376] Multabodies (MBs) were designed, expressed, and purified as follows. Briefly, genes encoding single chain (sc) Fab and scFc linked to human apoferritin light chain monomers were synthesized and cloned by Geneart (Thermo Fisher Scientific, Waltham, MA) into the pcDNA3.4 expression vector. MBs were expressed by transient transfection of 66 pg of plasmid (scFab-apoferritin: scFc-N-Ferr: scFab-C-Ferr at a 2:1:1 ratio for monospecific MBs; or a 4:2:l:l ratio of scFabl -apoferritin: scFc-N-Ferr: scFab2-C-Ferr: scFab3-C-Ferr for trispecific MBs) in to HEK 293F cells using FectoPRO (Polyplus Transfections, Strasbourg, France). MBs were purified by affinity chromatography using a HiTrap Protein A HP column (GE Healthcare, Chicago, IL) and eluted with 20 mM Tris (pH 8.0), 3 M MgCh, and 10% glycerol. Fractions were concentrated and further purified by gel filtration (Superose 6 10/300 GL column, GE Healthcare, Chicago, IL). For the trispecific MB (298-52-80), an IgGl or IgG4* scFc was used, where the asterisk indicates the use of an IgG4 with the Fey receptor binding mutations specified above. For in vivo studies, all IgGs and MBs were quality controlled to ensure endotoxin levels below 3.5 EU/mL at a 1 mg/mL concentration of protein.
Pseudovirus production
[0377] Pseudoviruses (PsV) were produced using a lentiviral vector backbone using known methods. Briefly, SARS-CoV-2 PsV were generated by transient co-transfection of 293T cells with a lentiviral backbone encoding luciferase reporter gene (BEI NR52516), plasmids encoding Gag-Pol (BEI NR52517), Tat (BEI NR52518), Rev (BEI NR52519) and a plasmid expressing SARS-CoV-2 Spike (BEI NR52310) with BioT transfection reagent (Bioland Scientific, Paramount, CA) according to the manufacturer’s directions. Cells were incubated at 37 °C for 24 h followed by addition of 5 mM of sodium butyrate. Cells were further incubated for an additional 24-30 h at 30 °C. Omicron (BA.l) variant PsV was generated using a Omicron (BA.l) Spike plasmid (D.R. Burton; The Scripps Research Institute). Genes encoding the Omicron (BA.5, BQ.1.1, and XBB.l) Spike was synthesized and cloned by GeneArt (Thermo Fisher Scientific, Waltham, MA) in the pcDNA3.4 expression vector. Alpha, Beta, Gamma, Delta, and Omicron SARS-CoV-2 PsV variants were generated by substituting the WT Spike plasmid. PsV were harvested, filtered through 0.45 pm sterile filters, and concentrated using a 100 K Amicon filter (Merck Millipore Amicon - Ultra 2.0 Centrifugal Filter Units, Millipore Sigma, Burlington, MA).
PsV neutralization assay
[0378] Single-cycle neutralization using 293T-ACE2 cells (BEI NR52511) was used to assess neutralization using known methods. Briefly, 96-well plates were coated with poly-L- Lysine (Sigma Aldrich, St. Louis, MO), and cells were seeded at a density of 10,000 cells/well in 100 pL. The following day, IgGs or MBs were serially diluted in duplicate and incubated with PsV for 1 h at 37 °C. Cell culture medium was then replaced with the PsV- IgG or PsV-MB mixture supplemented with 10 pg/mL polybrene (Sigma- Aldrich, St. Louis, MO). Cells were incubated for 48 h at 37 °C, before addition of 50 pL of Britelite plus reagent (PerkinElmer, Waltham, MA) for 2 min. Supernatants were transferred to 96-well white plates (Sigma Aldrich, St. Louis, MO) and luminescence in relative light units (RLUs) was measured using a Synergy Neo2 Multi Mode Assay Microplate Reader (Biotek Instruments, Winooski, VT). Three biological replicates were performed for each antibody or MB. IC50 values were calculated using nonlinear regression in GraphPad Prism 9.3.1.
Pseudovirus production of sarbecoviruses
[0379] Spike gene sarbecovirus S genes were codon-optimized for mammalian expression, synthesized by Twist Biosciences, and cloned into the same expression vectors as above by Gibson Assembly (New England Biolabs). Sarbecovirus sequences were retrieved from GenBank for Rs4084, Rs7327, and LYRal 1 as shown in Table 2.
Table 2, Accession ID numbers for sarbecovirus sequences
Recombinant VS V pseudoviruses in which the native glycoprotein was replaced with sarbecovirus S proteins were generated using known methods. Briefly, HEK 293T cells (ATCC), at a confluency of 80%, were transfected with a S protein-encoding expression vector using poly(ethylenimine)(PEI; 1 mg/mL) and cultured overnight at 37 °C under 5% CO2. Twenty -four hours later, cells were infected with VSV-G-pseudotyped AG-luciferase (G*AG-luciferase, Kerafast) at a multiplicity of infection (MOI) of 3 for 2 h. Following infection, cells were washed three times with lx PBS, changed to fresh medium, and cultured at 37 °C for another 24 h before supernatants were harvested and clarified by centrifugation at 300g for 10 min.
Sarbecovirus neutralization assay
[0380] Pseudoviruses were titrated to standardize the infectivity levels for target cells before setting up neutralization assays. Neutralization assays were performed by incubating pseudoviruses with 5-fold serial dilutions of MB versus their corresponding IgGs in triplicate in a 96-well plate for 1 h at 37 °C. Briefly, 293T-hACE2 cells were seeded at a density of 1 xio5 cells/well. Luciferase activity was measured using the Luciferase Assay System (Promega), according to the manufacturer’s instructions, 24 h after cells were added to the pseudovirus and serum. The neutralization curves and IC50 values were generated by fitting a nonlinear five-parameter dose-response curve in GraphPad Prism 9.3.
Virus propagation and titration
[0381] The SARS-CoV-2 Omicron isolate hCoV-19/USA/MD-HP24556/2022 (BA.2) was obtained from BEI Resources (NIAID, NIH). The virus was propagated using Vero E6 cells. Virus infectious titer was determined by an end-point dilution and cytopathic effect (CPE) assay on Vero E6 cells using known methods. An end-point-dilution microplate neutralization assay was performed to measure the neutralization activity of IgG and MBs. Triplicates of each dilution were incubated with SARS-CoV-2 at an MOI of 0.1 in DMEM with 7.5% inactivated fetal calf serum (FCS) for 1 h at 37 °C. Post-incubation, the virusantibody mixture was transferred onto a monolayer of Vero E6 cells grown overnight. The cells were incubated with the mixture for ~70 h. CPE was visually scored for each well in a blinded fashion by two independent observers. The results were then converted into percentage neutralization at a given sample dilution, and the averages ± SEM were plotted using a five-parameter dose-response curve to obtain the ID50 of each sample using GraphPad Prism v.9.3.
Biolayer interferometry
[0382] Binding kinetics were measured using an Octet RED96 Biolayer Interferometer (Sartorius ForteBio, Freemont, CA). His-tagged Omicron RBD (SinoBiological, China), WT RBD, human or mouse Fc gamma receptors (hFcyRI, hFcyRIIa, hFcyRIIb, mFcyRI, mFcyRIIb, mFcyRIV) were loaded on to Ni-NTA biosensors (Sartorius ForteBio, Freemont, CA) to reach a 0.8 nm signal response. Association rates were measured by transferring the loaded sensors to wells containing either Fab (titrated from 150 nM to 4.7 nM), IgG (titrated from 150 nM to 4.7 nM), or MB (titrated from 20 nM to 0.6 nM) for 180 s. Dissociation rates were measured by dipping the sensors into buffer-containing wells for 180 s. All steps were performed in buffer containing PBS (pH 7.4), 0.01% BSA and 0.0002% Tween-20 at 25 °C. To estimate the potential for endosomal recycling, binding of IgG or MB to mouse and human neonatal Fc receptor (FcRn) was assessed. IgGs and MBs were titrated at the concentrations listed above, e.g., using buffers containing PBS, pH 5.5, and 0.0002% Tween, and PBS, pH 7.4, and 0.0002% Tween-20. All binding and incubation steps except dissociation were performed in buffer containing PBS pH 5.6 and 0.0002% Tween. Dissociation step was measured using PBS pH 7.4 and 0.0002% Tween-20. Analysis was performed using the Octet software, with a 1 : 1 fit model.
Preparation of SARS-CoV-2 Spike microspheres
[0383] SARS-CoV-2 Spike protein (Sino Biological, Beijing, China) was biotinylated using the EZ-link Sulfo-NHS biotinylation kit (Thermo Scientific, 2143) according to the protocol provided. Red fluorescent Neutravidin microspheres (Invitrogen, F8775) were washed twice with PBS + 0.1% BSA before incubating 5 pL with 10 pg of biotinylated protein and bringing the total volume to 200 pL with PBS/0.1% BSA. Beads were incubated overnight at 4 °C and washed twice before use to remove unbound protein. Beads were resuspended in 200 pL per 5 pL bead volume.
Antibody-dependent cell-mediated phagocytosis assay
[0384] Immune complexes were formed by incubating SARS-CoV-2 Spike-coated fluorescent beads with diluted MB or IgG preparations for 2 h at 37 °C + 5% CO2 (10 pL beads and 10 pL of 1 mg/mL antibody sample). THP-1 cells (ATCC, TIB-202) were maintained at fewer than 5 x 105 cells/mL and 5 x 104 cells/well in 200 pL were added to the immune complexes for 1 h at 37 °C + 5% CO2. Cells were washed and stained with Live Dead Fixable Violet stain (Invitrogen, L34995) according to the provided protocol before being washed and fixed with 1% PFA for 20 min at room temperature. Fixed cells were washed with FACS buffer (PBS + 10% FBS, 0.5 mM EDTA) and collected on an LSRII Flow Cytometer (BD Biosciences). Data was analyzed in FlowJo (BD Biosciences, Ashland, OR), and phagocytosis was quantified as the percentage of live THP-1 cells that had phagocytosed red fluorescent SARS-CoV-2 Spike beads.
Mice and ethics statement
[0385] Age-matched female human ACE2-expressing and human FcRn-expressing mice (JAX strain #034902, B6.Cg-Tg(FCGRT)32Dcr Tg(K18-ACE2)2Prlmn FcgrttmlDc) were purchased from the Jackson Laboratory (JAX, Bar Harbor, ME) and housed in individually- ventilated caging under specific pathogen-free conditions . All procedures were approved by the Local Animal Care Committee at the University of Toronto, AUP#20012628. Studies with replication competent SARS-CoV-2 were performed according to the University of Toronto’s Containment Level 3 guidelines under Biosafety Permit EXT-J06-3. SARS-CoV-2 challenge
[0386] A pre-challenge oropharyngeal swab (Good Care nasopharyngeal swabs, Goodwood Medical Care, Dalian, China) sample was collected and female B6.Cg-Tg(FCGRT)32Dcr Tg(K18-ACE2)2Prlmn FcgrttmlDc mice were treated intraperitoneally (i.p.) with 3 pg (0.15 mg/kg), 30 pg (1.5 mg/kg) or 90 pg (4.5 mg/kg) of cocktail IgG4*; T10 MB* (298-52-80) or a negative control (PGDM1400 IgG) as specified before transfer to the Combined Containment Level 3 in vivo facility at the University of Toronto for SARS-CoV-2 challenge. Mice were anesthetized with inhaled isoflurane and inoculated intranasally with a lethal dose of 1 x io5 pfu/mouse of SARS-CoV-2 (SB2-P4-PB Clone 1). Mice received a second dose of T10 MB* or IgG4* cocktail one day following challenge; negative control recipient animals also received a second 30 pg dose of PGDM in dose investigation studies. Oropharyngeal swabs were collected two days post-challenge and subject to qPCR quantification to validate infection. Mice were weighed and monitored daily and scored according to weight loss and disease progression. Clinical disease was scored as follows: 0) no signs of disease; 1) 5 — 10% weight loss with no additional symptoms; 2) slightly reduced movement and 10 - 20% weight loss; 3) reduced movement or limited unprovoked movement with < 20% weight loss; 4) lack of provoked movement, rapid breathing, hunching and reduced grooming; or body weight loss of 20% or more; 5) Death. Mice were sacrificed at a score of 4 and given a score of 5 the following day.
Lung tissue viral outgrowth
[0387] At the time of sacrifice or 12 days following challenge for surviving animals, lung tissue was collected and snap frozen. Lung viral titer at the time of sacrifice was determined by homogenizing lung tissue in 0.5 mL of DMEM (Invitrogen, Carlsbad, CA) without additives, and calculating TCID50 on Vero E6 cells by performing ten-fold serial dilutions and monitoring cytopathic effect (CPE).
Enzyme-linked immunosorbent assay
[0388] PK assay: Serum collected at D2 following molecule administration was diluted 1:100 and evaluated for MB or antibody concentration by ELISA. Briefly, Nickel-coated 96- well plates (Pierce, Thermo Fisher Scientific, Waltham, MA) were coated overnight with 50 pL per well of His-tagged SARS-CoV-2 RBD protein or, for PGDM1400, BG505 D368R SOSIP.664 trimer3. Plates were blocked with TBS + 5% BSA for 1 h at room temperature and incubated with diluted serum or a standard curve of each of the administered molecules. MB and antibody were detected using an anti -human Fab secondary antibody (Abeam, 87422) and developed using BD TMB substrate reagent set (BD Biosciences, Franklin Lakes, NJ). Data was collected using a Synergy Neo2 Multi-Mode Assay Microplate Reader (Biotek Instruments, Winooski, VT).
[0389] Polyreactivity Assay: Microtiter plates (Costar) were coated with 10 pg/mL dsDNA, 10 pg/mL KLH, 10 pg/mL cardiolipin, and 5 pg/mL insulin. Microtiter plates were incubated at 37°C for 2 h and then at 4°C overnight. Insulin and KLH plates were washed with PBST and blocked with PBST for 1 h. dsDNA and cardiolipin plates were blocked with 1.5% BSA for 1 h. MB / IgG samples were diluted to 1 pg/mL with three 1:4 dilutions and added to antigen plates for 2 h. 50 pL of HRP-conjugated goat anti-human IgG antibody was added to antigen plates for 1 h. 100 pL of ABTS substrate was added, incubated for 15 min and absorbance was read at 405 nm using a Spectrostar nano plate reader (BMG Labtech). qPCR for oropharyngeal swab titers
[0390] Viral RNA from swab samples were extracted using a QIAamp Viral RNA Mini Kit (Qiagen, Hilden, Germany). Primers targeting env (Forward Primer: ACAGGTACGTTAATAGTTAATAGCGT, Reverse Primer: ATATTGCAGCAGTACGCACACA) were used alongside the Luna Universal One-Step RT- qPCR kit (New England Biolabs, Ipswitch, MA) and CFX384 Touch Real-Time System (Bio-Rad) for RT-qPCR. Nuclease-free water was used as ano template control. Reverse transcription was conducted by incubation for 10 min at 55 °C and PCR cycle conditions consisted of 1 min at 95 °C for initial denaturation, followed by 45 cycles of denaturation (95 °C for 10 s) and extension (58°C for 30 s). The melting curve was generated by running 5 s cycles between 65 °C to 95 °C at intervals of 0.5 °C. A reference copy number plasmid for c/iv-gene was used to generate a standard curve. Data was analyzed using CFX Maestro Software (Bio-Rad).
Crystallization and structure determination
[0391] A binary complex of purified 80 Fab-RBD was obtained by mixing Fab:RBD in a 2:1 molar ratio. After 30 min incubation at 4 °C, the complex was purified by size exclusion chromatography (Superdex 200 Increase size exclusion column, GE Healthcare, Chicago, IL) in 20 mM Tris pH 8.0, 150 mM NaCl buffer. The fractions of interest were then concentrated to 10 mg/mL and crystallization trials were set up using the sitting drop vapor diffusion method with JCSG Top 96 screen in a 1 : 1 protein: reservoir ratio. Crystals appeared on day 70 in a condition containing 0.2 M di-ammonium tartrate and 20% (w/v) PEG 3350. Crystals were cryoprotected in 10% (v/v) ethylene glycol and flash-frozen in liquid nitrogen. X-ray diffraction data was collected at the Argonne National Laboratory Advanced Photon Source on the 23-ID-D beamline. The data set was processed using XD and XPREP. Phases were determined using Phaser with the 80 Fab predicted by ABodyBuilder and the SARS-CoV-2 RBD (PDB ID: 7LM8) as search models. Iterative refinement was performed using Phenix Refine and manual building was done in Coot. All software were accessed through SBGrid. Modeling of 2-7 Fab binding to Omicron (BA.1, BA.2) was performed in Pymol using a published RBD structure (PDB ID: 7LSS). Footprint analysis was done using the 2-7 Spike complex (PDB ID: 7LSS), 10-40 RBD complex and 11-11 Spike complex structures (PDB ID:7SD5 and EMD-25167). Interface residues were identified with PISA (E, K. & K., H. Inference of macromolecular assemblies from crystalline state. J Mol Biol. (2007)) using default parameters and Pymol (Schrodinger. The PyMOL Molecular Graphics System. (2015)) was used to generate figures.
Statistical analysis
[0392] Statistical analyses were performed using Graphpad Prism version 9.3.1 software (Graphpad Software Inc., San Diego, CA). A P value of p < 0.05 was considered statistically significant, unless adjusted for multiple testing using the Bonferroni correction. Survival curves were compared using the Gehan-Breslow-Wilcoxon test; Data are shown as means ± SEM unless otherwise indicated.
Example 1: Multabodies display potent and broad responses against SARS-CoV-2 variants of concern
[0393] The rapid emergence of new SARS-CoV-2 variants of concern (VOCs) has stymied mAh therapeutics and driven antibody discovery efforts focused on expanding the breadth of viral sequences recognized by a single antibody. Increasing antibody valency is a potentially promising approach to enhance apparent binding affinity. The present inventors have found that Multabodies (MBs) of the disclosure offer multiple advantages as a next-generation multivalent biologic, including high stability, efficient assembly, ease of production and purification, and plug-and-play genetic fusion of antibodies of choice. Using this platform, enhanced affinity can be coupled with multi-specificity - the inclusion of several antibody fragments recognizing different epitopes - to result in antigen recognition that is more resistant to viral mutations. To assess whether the neutralization properties of previously characterized anti-SARS-COV-2 mAbs 2-7, 2-36, 2-38, 10-40, and 11-11 could be improved, monospecific MBs were expressed and evaluated for their neutralization potency and breadth compared to their corresponding mAbs against SARS-CoV-2 wildtype (WT) and five VOCs (Alpha, Beta, Gamma, Delta, and Omicron BA.1). Five of the eight mAbs (52, 80, 2-36, 11- 11 and 10-40) showed 100% breadth with an IC50 cut-off value of 5 pg/mL. However, when using an IC50 cut-off value of 0.01 pg/mL to resemble the potency of REGEN-COV (Weinreich et al. New Engl JMed 384:238-51, 2020), only two mAbs (11-11 and 10-40) showed neutralization against two of the five VOCs tested (FIG. 1A, FIGS. 2A-2VV). In contrast, when displayed as monospecific MBs, three specificities (2-7, 80 and 52) reached 100% neutralization breadth using an IC50 cut-off value of 0.01 pg/mL. The remaining MBs lose potency against Omicron BA.1, but, apart from 298 and 2-38 MBs, still neutralize with an IC50 below 0.3 pg/mL, which represents the pseudo virus (PsV) neutralization potency of Sotrovimab (VanBlargan et al. Nat Med 28:490-5, 2022) against WT SARS-CoV-2 (FIGS. 1B-1C, FIGS. 2A-2VV). The superior ability of these molecules to overcome viral sequence diversity is likely due to their enhanced potency against WT SARS-CoV-2, which ranges from 0.005 to 0.0002 pg/mL (FIG. IB). These increases in potency and breadth were not associated with increases in binding to antigens commonly used as measures of polyreactivity, namely, cardiolipin, insulin, dsDNA, and keyhole limpet antigen (KLH)(FIG.
16)
Example 2: Broad sarbecovirus neutralization achieved by trispecific Multabody [0394] Although monospecific MBs show potent neutralization and can rescue loss in potency compared to their mAb counterparts, monospecificity still carries the risk of viral escape, should sufficient mutations emerge to overcome the benefit conferred by binding avidity. Indeed, the 80 monospecific MB loses neutralization against Omicron BA.5 (FIG. 14A), underscoring the need for an improved approach to tackle evolving viral variants and achieve exquisite neutralization breadth that could potentially also extend to other sarbecoviruses beyond SARS-CoV-2. As such, a trispecific MB targeting three distinct epitopes while retaining avidity has the potential to provide exquisite resilience against evolving variants. mAbs 10-40 and 11-11 have are known to target conserved epitopes, and consequently confer broad neutralization that expand to other sarbecoviruses (Liu et al. Sci TranslMed 14:eabn6859, 2022). Based on this and the results from the monospecific MB screening (FIG. IB), mAh specificities 2-7, 10-40, and 11-11 were selected to design a trispecific molecule to explore neutralization gains made by combining next-generation mAbs with different epitope specificities on the MB. Similar to mAh 80, structural data on mAh 2-7 revealed that RBD mutations found in VOCs form part of its binding interface (Cerutti et al. Struct Land Engl 29:655-63, 2021) leading to the neutralization potency loss observed for this IgG against Omicron BA.l. However, 2-7 was rescued in neutralization potency in the MB format (FIG. 3A), similarly to what was observed for mAb 80, demonstrating the benefit of avidity to overcome viral escape.
[0395] The resulting trispecific (2-7-10-40-11-11) MB potently neutralized WT and all tested VOCs of SARS-CoV-2 in PsV neutralization assays with a mean IC50 of 0.002 pg/mL (FIG. 3B and FIG. 4A). These experiments were expanded in PsV neutralization assays using other viruses dependent on ACE2 as an entry receptor, including live Omicron BA.2 virus and a SARS-CoV-l-related bat sarbecovirus panel. To better assess the benefit of combining multispecificity, the monospecific MB components were also tested.
Monospecific 2-7 MB did not show neutralization against the sarbecovirus panel, while 10- 40 and 11-11 MBs were not able to block infection of live Omicron BA.2 (FIG. 3C and FIGS. 4B-4E). In contrast, the trispecific MB of these specificities combined on a single molecule displayed both potent SARS-CoV-2 neutralization across the VOCs, including live Omicron BA.2, as well as pan-sarbecovirus neutralization of this panel (FIGS. 3B-3C and FIGS. 4A-4E).
[0396] Furthermore, the 2-7-10-40-11-11 tri-specific MB and the corresponding IgG cocktail was tested against the recent BQ.1.1 and XBB.1 Omicron subvariants to assess neutralization potency in pseudovirus assays. The potency of the IgG cocktail falls below the IC50 range of clinically authorized antibodies (0.3 pg/mL for Sotrovimab and 0.01 pg/mL for REGEN-COV against WT SARS-CoV-2 PsV) and does not reach 100% neutralization even at 100 pg/mL (FIG. 15A and FIG. 15B). In contrast, the tri-specific Mb neutralized the BQ- 1.1 and XBB.l subvariants at a potency of 0.06 pg/mL and 0.18 pg/mL, respectively, corresponding to doses falling within the dosing range of FDA-authorized therapeutics (FIG.
15A and FIG. 15B)
[0397] To assess the molecular coverage of the trispecific 2-7-10-40-11-11 MB, the individual and combined receptor binding domain (RBD) buried surface area (BSA) of each antibody specificity was analyzed based on their previously published three-dimensional structures. Binding of mAbs 2-7, 10-40, and 11-11 to RBD covers approximately 8%, 9%, and 11% of the RBD-accessible BSA, respectively, whereas in the case of the 2-7-10-40-11- 11 trispecific MB, 23% of the RBD-accessible BSA is covered with a single molecule (FIG. 3D). Correspondingly, the trispecific 2-7-10-40-11-11 MB contains 62 contact residues in the RBD compared to 23, 27, and 37 residues in the case of individual mAbs 2-7, 10-40, and 11- 11, respectively. Therefore, by targeting three partially overlapping functional epitopes on the RBD, and through the potency gain provided by avidity, the trispecific 2-7-10-40-11-11 MB provides proof-of-concept for potent, broad, and resilient neutralization across sarbecoviruses by a single MB molecule.
Example 3: Neutralization potency correlates with in vivo protection from SARS-CoV-2 [0398] The inventors have previously reported the generation of tri-specific MB molecules targeting SARS-CoV-2 (“298-52-80 MB,” comprising Fab fragments from antibodies 298, 52, and 80, each targeting the RBD of SARS-CoV-2). The 298-52-80 MB was constructed using an engineered apoferritin split design (FIG. 5A and FIG. 5B) (Rujas, E. et al. Multivalency transforms SARS-CoV-2 antibodies into ultrapotent neutralizers. Nat.
Commun. 12, 3661 (2021) and Rujas, E. et al. Engineering pan-HIV-1 neutralization potency through multispecific antibody avidity. Proc National Acad Sci 119, e2112887119 (2022)). In this engineered apoferritin split design, the human apoferritin protomer was split into two halves based on its four-helical bundle fold: the two N-terminal a helices (N-Ferr) and the two C-terminal a helices (C-Ferr).
[0399] In this Example, the ability of the tri-specific 298-52-80 MB to confer in vivo protection against lethal SARS-CoV-2 challenge was assessed. For comparison, versions of the tri-specific 298-52-80 MB and the corresponding IgG cocktail with an IgG4 Fc, were generated, with both the MB and the IgG cocktail containing mutations to ablate binding to Fey receptors (S228P, F234A, L235A, G237A, P238S), hereinafter referred to as T10 MB* and IgG4*, respectively. As Replacement of the Fc subtype from IgGl to IgG4* did not affect the neutralization potency of the IgG or the MB. T10 MB* achieved an IC50 value of 0.0002 pg/mL, approximately 1000-fold more potent than its corresponding cocktail IgG (FIG. 6). Binding kinetics studies revealed that both T10 MB* and the IgG4* antibody cocktail displayed pH-dependent binding to mouse and human FcRn (FIGS. 7A-7B), and no binding to human and mouse Fey receptors (FcyR). This was in contrast to the FcyR binding observed for the corresponding IgGl antibody cocktail control (FIG. 7B-7D). The MB* and IgG4* antibody cocktail also displayed no binding to mouse and human FcRn at physiological pH and binding at acidic pH with no detectable off rate (FIG. 7C and FIG. 7D).
[0400] Antibody-dependent cell-mediated phagocytosis (ADCP) experiments using fluorescently labeled beads coated with SARS-CoV-2 Spike protein were performed using flow cytometry. Gating strategy was based on gating of THP-1 cells by size and live cells; cells positive for internalization of SARS-CoV-2 Spike-coated fluorescent beads were quantified as a percentage of live THP-1 cells (FIGs. 7E-7H). These experiments further confirmed the inability of T10 MB* and the IgG4* cocktail to engage Fc receptors, while the IgGl antibody cocktail showed substantial uptake of SARS-CoV-2 Spike-coated beads (FIG. 71).
[0401] To assess whether the increased neutralization potency achieved with the MB resulted in improved in vivo protection against SARS-CoV-2, hACE2, and hFcRn double transgenic mice were treated with 30 pg (1.5 mg/kg) of the FcyR-binding deficient IgG4* and T10 MB* molecules and challenged intranasally with a high dose (1 x 105 TCID50) of SARS-CoV-2. T10 MB* provided significantly better protection (60% survival) compared to the IgG4* cocktail, with all cocktail-recipient animals succumbing to the challenge at D6-7 (FIG. 8A). Improved protection was associated with fewer clinical signs of disease throughout the course of infection (FIG. 8C), reduced weight loss and weight rebound following challenge (FIG. 8D), and significantly lower lung viral titers, particularly in animals that survived the challenge (FIG. 8B). Infection was confirmed by qPCR using oropharyngeal swabs collected at D-l (before challenge) and D2 following challenge (FIG. 8E). In subsequent studies, we found that comparable in vivo protection was achieved when T10 MB* was delivered at 3 pg (1.4 pmol; 0.15 mg/kg) and the IgG4* cocktail at 90 pg (600 pmol; 4.5 mg/kg) (FIG. 8F). The difference in dose can be observed in circulating serum concentrations of administered molecule at D2 post challenge (FIG. 8G).
[0402] This data not only provides the first evidence of in vivo protection from lethal challenge mediated by the MB, but also illustrates that the increased neutralization potency conferred by a trispecific MB format provides enhanced protection in vivo against SARS- CoV-2 challenge compared to a corresponding IgG mixture. Indeed, comparable in vivo efficacy was obtained with an approximately 430/ lower molar amount of the MB compared to the IgG, corresponding to an approximately 540/ lower molar amount of Fab arms. Example 4: Molecular basis of Fabs 80 and 2-7 binding to SARS-CoV-2 RBD
[0403] To understand the molecular basis of binding of mAb 80 (the Fab to the receptor binding domain (RBD) of SARS-CoV-2, the crystal structure of 80 Fab in complex with RBD at 3.1 A resolution was solved (FIGS. 9A-9B). Epitope recognition is mediated by 20 residues that form the interface with the RBD, 14 of which are involved in ACE2 binding (Table 3)
[0404] Table 3, Fab 80-RBD contacting residues identified by PISA (Proteins. Interfaces. Structures and Assemblies) 1 BSA: Buried surface area; Total BSA (A2) 830; vDW: van der Waals interaction (4.0 A cutoff); HB: Hydrogen bond (3.7 A cut-off)
[0405] These data illustrate how mAh 80 inhibits SARS-CoV-2 infection through receptor blockade, preventing the interaction of ACE2 with the receptor binding motif (FIG. 10A). The heavy chain of mAb 80 is primarily responsible for the interaction with RBD, contributing ten of the eleven hydrogen bonds found in the binding interface (FIG. 10B and FIG. 10C; Table 3). Additionally, interaction of F54 of the antibody heavy chain with Y489 from the RBD results in the formation of a new triple pi-stacking within the RBD structure, between residues Y473, F456 and Y421 (FIG. 10D).
[0406] Detailed analysis of the RBD-80 Fab interface revealed that residues S477 and T478 of the RBD form hydrogen bonds with Y92 and D100D of the antibody, burying 124 A2 of its surface area and accounting for 15% of the total buried surface area (BSA) of the RBD (FIG. 10E and FIG. 10F, Table 3) These residues are mutated in several variants of concern (VOCs), including Omicron (BA.l, BA.2), which significantly reduces binding affinity of the antibody to the Omicron BA.l RBD (FIG. 11A and FIG. 11B); however, the increased avidity achieved with the MB format compensates for this weaker binding. Consequently, interaction of 80 MB with the mutated Omicron BA.1 RBD has high apparent binding affinity with no detectable off-rate (FIG. 11A and FIG. 11B), which likely contributes to resilient neutralization potency against Omicron BA.1 (FIG. IB). The potency of the 80 MB against Omicron BA.2 was additionally confirmed using replication-competent virus. Considerably reduced potency against Omicron BA.2 live virus was observed for the 80 mAb, but high neutralization potency is retained in the MB format (FIG. 11C).
[0407] Related analysis was performed for the 2-7 Fab to assess its binding to the RBD of SARS-CoV-2. Similar to Fab 80 (see Example 4), Fab 2-7 revealed that RBD mutations found in VOCs form part of its binding interface (FIGs. 14B-14D), leading to the neutralization potency loss observed for this IgG against Omicron BA.l. Neutralization potency was rescued in the MB format (FIG. 3A), including potent neutralization against Omicron BA.5 (FIG. 14A), underscoring the benefit of avidity to overcome viral escape. [0408] The present Example therefore provides structural insights relating to the binding of an antibody the receptor binding domain (RBD) of SARS-CoV-2 within an epitope that contains several residues that are mutated in variants of concern.
Example 5: Cryo-electron microscopic characterization of trispecific MB, 298-52-80 Methods and Materials [0409] The tri-specific MB (298-52-80) sample was concentrated to 2.0 mg/mL and 3.0 pl of the sample was deposited on homemade holey gold grids, which were glow-discharged in air for 15 s before use. Sample was blotted for 3.0 s, and subsequently plunge-frozen in liquid ethane using a Leica EM GP2 Automatic Plunge Freezer (maintained at 4 °C and 100% humidity). Data collection was performed on a Thermo Fisher Scientific Titan Krios G3 operated at 300 kV with a Falcon 4i camera automated with the EPU software. A nominal magnification of 75,000' and defocus range between 0.5 and 2.0 pm were used for data collection. Exposures were collected for 8.3 s as movies of 30 frames with a camera exposure rate of ~6.3 e- per pixel per second, and total exposure of 49.6 electrons/ A2. A total of 4,385 raw movies were obtained. Image processing was carried out in cryoSPARC v374. Initial specimen movement correction, exposure weighting, and CTF parameters estimation were done using patch-based algorithms. Micrographs were sorted based on CTF fit resolution, and only micrographs with a fit better than 5.0 A were accepted for further processing. Manual picking was performed to create templates for template-based picking, which resulted in selection of 955,995 particle images. Particle images were sorted via several rounds of 2D classification, which resulted in selection of 358,036 particle images. A preliminary 3D model was obtained ab-initio with no symmetry applied. To further select the highest-quality particle images, 151,443 particle images with CTF fit resolution better than 3.0 A were reextracted from micrographs and subjected to non-uniform refinement75 with no symmetry applied, which resulted in a 2.4 A resolution map of the tri-specific MB. 65,478 particle images with CTF fit better than 2.7 A, were extracted from micrographs and subjected to non-uniform refinement with octahedral symmetry applied, which resulted in a 2.1 A resolution map. Non-uniform refinements were performed with defocus refinement and optimization of per-group CTF parameters. The pixel size was calibrated at 1.04 A per pixel by fitting a structure of human apoferritin light chain (PDB ID: 2FFX).
[0410] To obtain 3D reconstructions of Fab and Fc molecules on the surface of the tri- specific MB, manual picking was performed, and templates were created for template-based picking, resulting in the selection of 6,692,141 particle images. Particle images were sorted via several rounds of 2D classification, which resulted in the selection of 668,214 particle images. Preliminary 3D maps were obtained ab-initio with no symmetry applied. Further cleaning of the dataset was performed via several rounds of heterogenous refinement and resulted in 73,163 Fab particle images and 13,328 Fc particle images. Final cryoEM maps at 6.7 A resolution for Fab and 7.1 A resolution for Fc were obtained using the local refinement job with a custom soft mask. To assess the quality of obtained maps, models of human apoferritin light chain (PDB ID: 6WX6), human IgGl Fc (PDB ID: 6CJX) and Fab 298 (PDB ID: 7K9Z) were manually docked in cryoEM maps using UCSF Chimera79. Figures were prepared with Pymol80, UCSF Chimera and UCSF ChimeraX.
Results
[0411] As discussed in Example 3, above, a tri-specific MB incorporating antibody specificities 298, 52, and 80 (“T10 MB”) increased neutralization potency by -1000-fold as compared to the corresponding IgG cocktail. To obtain molecular insights into the assembly of the MB design, T10MB was analyzed by cryo-electro microscopy (cryoEM). FIG. 12A shows the processing workflow for cryoEM data.
[0412] Analysis of cryoEM micrographs revealed the formation of highly decorated and homogeneous nanocage-like particles (FIG. 12B). Consistent with the presence of flexible (GGS)x linkers connecting the scFab and scFc components to the apoferritin scaffold, the density of these antibody fragments is poorly resolved in 2D classes (FIG. 12C) and 3D reconstruction of the tri-specific MB (FIG. 12D). However, manual picking of the scFab and scFc particles, followed by template-based particle picking, and subsequent refinement of these molecules confirmed the proper assembly of Fab and Fc components on the MB to -7 A resolution (FIGS. 12B-12M). 3D reconstructions of the apoferritin scaffold of the MB reached 2.4 A and 2.1 A resolution, respectively, when no symmetry (Cl; FIG. 12E, FIGS. 13A-13D) or octahedral symmetry (O; FIGS. 13A-13I) was applied. The apoferritin scaffold in the tri-specific MB is virtually identical to that of the human apoferritin light chain (PDB ID: 6WX6) with measured cross-correlation (cc) coefficients between maps of 0.97 (Cl) and 0.92 (O). The N and C termini of the core MB scaffold are similarly disposed in 3- and 4-fold symmetry axes as in the native human apoferritin light chain (FIG. 12E), indicating minimal impact for scFab and scFc genetic fusions. Data collection from a mixture of “split” and “non-split” apoferritin units within the MB results in the averaging of the split design site to closely resemble the “non-split” apoferritin monomer, and the cryoEM maps showed no evidence of deviation from the apoferritin fold for structural elements at the split design site (between residues Trp93 and Gly94; FIG. 12E, bottom right panel). In summary, our cryoEM analysis of the tri-specific 298-52-80 MB provided atomic-level details demonstrating that the MB, built on the apoferritin split design scaffold, adopted its intended structural disposition. SEQUENCE LISTING
Underlining within fusion sequences indicate linker sequences.
- Bolding within fusion sequences indicate ferritin or ferritin subunit sequences.
Within antibody variable region sequences, underlining and bolding together indicate complementary determining region sequences according to Kabat.
- Boxed and bolded residues indicate residues that are mutated relative to a reference molecule, e.g. relative to a wild type IgGl Fc or to a wild type IgG4 Fc.
EQUIVALENTS I OTHER EMBODIMENTS
[0413] While the invention has been described in connection with specific embodiments thereof, it will be understood that it is capable of further modifications and this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure that come within known or customary practice within the art to which the invention pertains and may be applied to the essential features herein before set forth.

Claims

1. A fusion polypeptide comprising a sarbecovirus binding moiety linked to a nanocage monomer or subunit thereof, wherein the sarbecovirus binding moiety is capable of binding to SARS-CoV-2 and at least one sarbecovirus other than SARS-CoV-2.
2. The fusion polypeptide of claim 1, wherein the first sarbecovirus binding moiety comprises a sarbecovirus antibody or sarbecovirus-binding fragment thereof.
3. The fusion polypeptide of claim 2, wherein the sarbecovirus binding moiety is an Fab fragment of a sarbecovirus antibody.
4. The fusion polypeptide of claim 3, wherein the Fab fragment is a single chain Fab (scFab).
5. The fusion polypeptide of any one of claims 2-4, wherein the sarbecovirus antibody is capable of neutralizing SARS-CoV-2 and at least one sarbecovirus other than SARS-CoV-2.
6. The fusion polypeptide of any one of claims 1-5, wherein the at least one sarbecovirus other than SARS-CoV-2 comprises a sarbecovirus selected from the group consisting of SARS-CoV, GD-Pangolin, GX-Pangolin, RaTG13, WIV1, SHC014, Lyrall, Rs7327, Rs4231, Rs4084, and combinations thereof.
7. The fusion polypeptide of claim 6, wherein the at least one sarbecovirus other than SARS-CoV-2 comprises SARS-CoV.
8. The fusion polypeptide of claim 7, wherein the at least one sarbecovirus other than SARS-CoV-2 comprises SARS-CoV, GD-Pangolin, GX-Pangolin, RaTG13, WIV1, SHC014, Lyral l, Rs7327, Rs4231, and Rs4084.
9. A fusion polypeptide comprising a sarbecovirus binding moiety linked to a nanocage monomer or subunit thereof, wherein the sarbecovirus binding moiety is a sarbecovirus antibody or a sarbecovirus binding fragment thereof, wherein the sarbecovirus antibody exhibits neutralizing activity against SARS-CoV with an IC50 below 1 pg/mL.
10. A fusion polypeptide comprising a sarbecovirus binding moiety linked to a nanocage monomer or subunit thereof, wherein the sarbecovirus binding moiety is a sarbecovirus antibody or a sarbecovirus binding fragment thereof, wherein the sarbecovirus antibody or sarbecovirus binding fragment thereof comprises a heavy chain complementarity determining region 3 (CDR-H3) having a sequence which comprises YYDRSGY (SEQ ID NO:70).
11. The fusion polypeptide of claim 10, wherein the sarbecovirus antibody or sarbecovirus binding fragment thereof comprises a CDR-H3 sequence selected from the group consisting of SEQ ID NOs: 34, 40, 46, 75, 81, 87, 95, 101, 107, 115, 121, 127, 135, 141, 147, 155, 161, 167, 175, 181, 187, 195, 201, 207, 215, 221, 227, 235, 241, 247, 255, 261, 267, 275, 281, 287, 295, 301, 307, 315, 321, 327, 335, 341, or 347 or a variant of any of the foregoing sequences which comprises no more than three, no more than two, or no more than one amino acid substitution therefrom.
12. The fusion polypeptide of claim 11, wherein the sarbecovirus antibody or sarbecovirus binding fragment thereof comprises a CDR-H3 sequence selected from the group consisting of SEQ ID NOs: 34, 40, 46, 75, 81, 87, 95, 101, 107, 115, 121, 127, 135, 141, 147, 155, 161, 167, 175, 181, 187, 195, 201, 207, 215, 221, 227, 235, 241, 247, 255, 261, 267, 275, 281, 287, 295, 301, 307, 315, 321, 327, 335, 341, or 347.
13. The fusion polypeptide of claim 11 or 12, wherein the sarbecovirus antibody or sarbecovirus binding fragment thereof comprises a CDR-H3 sequence and a CDR-L3 sequence of
(a) SEQ ID NO:34 and SEQ ID NO:37, respectively,
(b) SEQ ID NO:40 and SEQ ID NO:43, respectively,
(c) SEQ ID NO:46 and SEQ ID NO:49, respectively,
(d) SEQ ID NO:75 and SEQ ID NO:78, respectively,
(e) SEQ ID NO:81 and SEQ ID NO:84, respectively,
(f) SEQ ID NO:87 and SEQ ID NO:90, respectively,
(g) SEQ ID NO:95 and SEQ ID NO:98, respectively,
(h) SEQ ID NO: 101 and SEQ ID NO: 104, respectively,
(i) SEQ ID NO: 107 and SEQ ID NO: 110, respectively, (j) SEQ ID NO: 115 and SEQ ID NO: 118, respectively,
(k) SEQ ID NO: 121 and SEQ ID NO: 124, respectively,
(l) SEQ ID NO: 127 and SEQ ID NO: 130, respectively,
(m) SEQ ID NO: 135 and SEQ ID NO: 138, respectively,
(n) SEQ ID NO: 141 and SEQ ID NO: 144, respectively,
(o) SEQ ID NO: 147 and SEQ ID NO: 150, respectively,
(p) SEQ ID NO: 155 and SEQ ID NO: 158, respectively,
(q) SEQ ID NO: 161 and SEQ ID NO: 164, respectively,
(r) SEQ ID NO: 167 and SEQ ID NO: 170, respectively,
(s) SEQ ID NO: 175 and SEQ ID NO: 178, respectively,
(t) SEQ ID NO: 181 and SEQ ID NO: 184, respectively,
(u) SEQ ID NO: 187 and SEQ ID NO: 190, respectively,
(v) SEQ ID NO: 195 and SEQ ID NO: 198, respectively,
(w) SEQ ID NO:201 and SEQ ID NO:204, respectively,
(y) SEQ ID NO:207 and SEQ ID NO:210, respectively,
(z) SEQ ID NO:215 and SEQ ID NO:218, respectively, (aa) SEQ ID NO:221 and SEQ ID NO:224, respectively, (bb) SEQ ID NO:227 and SEQ ID NO:230, respectively,
(cc) SEQ ID NO:235 and SEQ ID NO:238, respectively, (dd) SEQ ID NO:241 and SEQ ID NO:244, respectively, (ee) SEQ ID NO:247 and SEQ ID NO:250, respectively, (ff) SEQ ID NO:255 and SEQ ID NO:258, respectively, (gg) SEQ ID NO:261 and SEQ ID NO:264, respectively, (hh) SEQ ID NO.267 and SEQ ID NO.270, respectively, (ii) SEQ ID NO:275 and SEQ ID NO:278, respectively, (jj) SEQ ID NO:281 and SEQ ID NO:284, respectively, (kk) SEQ ID NO:287 and SEQ ID NO:290, respectively,
(11) SEQ ID NO:295 and SEQ ID NO:298, respectively,
(mm) SEQ ID NO:301 and SEQ ID NO:304, respectively,
(nn) SEQ ID NO:307 and SEQ ID NO:310, respectively,
(oo) SEQ ID NO:315 and SEQ ID NO:318, respectively,
(pp) SEQ ID NO:321 and SEQ ID NO:324, respectively,
(qq) SEQ ID NO:327 and SEQ ID NO:330, respectively,
(rr) SEQ ID NO:335 and SEQ ID NO:338, respectively,
(ss) SEQ ID NO:341 and SEQ ID NO:344, respectively,
(tt) SEQ ID NO:347 and SEQ ID NO:350, respectively, or
(uu) a CDR-H3 sequence and a CDR-L3 sequences which collectively differ by no more than three, no more than two, or one amino acid substitutions across both CDR-H3 and CDR-L3 sequences of any of the foregoing (a)-(tt).
14. The fusion polypeptide of claim 13, wherein the sarbeco virus antibody or sarbecovirus binding fragment thereof comprises a CDR-H3 sequence and a CDR-L3 sequence of
(a) SEQ ID NO:34 and SEQ ID NO:37, respectively,
(b) SEQ ID NO:40 and SEQ ID NO:43, respectively,
(c) SEQ ID NO:46 and SEQ ID NO:49, respectively,
(d) SEQ ID NO:75 and SEQ ID NO:78, respectively,
(e) SEQ ID NO:81 and SEQ ID NO:84, respectively,
(f) SEQ ID NO:87 and SEQ ID NO:90, respectively,
(g) SEQ ID NO:95 and SEQ ID NO:98, respectively,
(h) SEQ ID NO: 101 and SEQ ID NO: 104, respectively,
(i) SEQ ID NO: 107 and SEQ ID NO: 110, respectively,
(j) SEQ ID NO: 115 and SEQ ID NO: 118, respectively,
(k) SEQ ID NO: 121 and SEQ ID NO: 124, respectively, (l) SEQ ID NO: 127 and SEQ ID NO: 130, respectively,
(m) SEQ ID NO: 135 and SEQ ID NO: 138, respectively,
(n) SEQ ID NO: 141 and SEQ ID NO: 144, respectively,
(o) SEQ ID NO: 147 and SEQ ID NO: 150, respectively,
(p) SEQ ID NO: 155 and SEQ ID NO: 158, respectively,
(q) SEQ ID NO: 161 and SEQ ID NO: 164, respectively,
(r) SEQ ID NO: 167 and SEQ ID NO: 170, respectively,
(s) SEQ ID NO: 175 and SEQ ID NO: 178, respectively,
(t) SEQ ID NO: 181 and SEQ ID NO: 184, respectively,
(u) SEQ ID NO: 187 and SEQ ID NO: 190, respectively,
(v) SEQ ID NO: 195 and SEQ ID NO: 198, respectively,
(w) SEQ ID NO:201 and SEQ ID NO:204, respectively,
(y) SEQ ID NO:207 and SEQ ID NO:210, respectively,
(z) SEQ ID NO:215 and SEQ ID NO:218, respectively,
(aa) SEQ ID NO:221 and SEQ ID NO:224, respectively, (bb) SEQ ID NO:227 and SEQ ID NO:230, respectively, (cc) SEQ ID NO:235 and SEQ ID NO:238, respectively, (dd) SEQ ID NO:241 and SEQ ID NO:244, respectively, (ee) SEQ ID NO:247 and SEQ ID NO:250, respectively, (ff) SEQ ID NO:255 and SEQ ID NO:258, respectively, (gg) SEQ ID NO:261 and SEQ ID NO:264, respectively, (hh) SEQ ID NO:267 and SEQ ID NO:270, respectively, (ii) SEQ ID NO:275 and SEQ ID NO:278, respectively, (jj) SEQ ID NO.281 and SEQ ID NO.284, respectively, (kk) SEQ ID NO:287 and SEQ ID NO:290, respectively,
(11) SEQ ID NO:295 and SEQ ID NO:298, respectively, (mm) SEQ ID NO:301 and SEQ ID NO:304, respectively,
(nn) SEQ ID NO:307 and SEQ ID NO:310, respectively,
(oo) SEQ ID NO:315 and SEQ ID NO:318, respectively,
(pp) SEQ ID NO:321 and SEQ ID NO:324, respectively,
(qq) SEQ ID NO:327 and SEQ ID NO:330, respectively,
(rr) SEQ ID NO:335 and SEQ ID NO:338, respectively,
(ss) SEQ ID NO:341 and SEQ ID NO:344, respectively, or
(tt) SEQ ID NO:347 and SEQ ID NO:350, respectively.
15. The fusion polypeptide of claim 14, wherein the sarbecovirus antibody or sarbecovirus binding fragment thereof comprises a CDR-H3 sequence and a CDR-L3 sequence of:
(a) SEQ ID NO:34 and SEQ ID NO:37, respectively,
(b) SEQ ID NO:40 and SEQ ID NO:43, respectively, or
(c) SEQ ID NO:46 and SEQ ID NO:49, respectively.
16. The fusion polypeptide of claim 11, wherein the sarbecovirus antibody or sarbecovirus binding fragment thereof comprises a heavy chain variable region comprising complementarity determining regions CDR-H1, CDR-H2, and CDR-H3, and a light chain variable region comprising complementarity determining regions CDR-L1, CDR-L2, and CDR-L3, having amino acid sequences of
(a) SEQ ID NO:32, 33, and 34 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:35, 36, and 37 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(b) SEQ ID NO:38, 39, and 40 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:41, 42, and 43 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(c) SEQ ID NO:44, 45, and 46 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:47, 48, and 49 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(d) SEQ ID NO:73, 74, and 75 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:76, 77, and 78 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(e) SEQ ID NO:79, 80, and 81 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 82, 83, and 84 for CDR-L1, CDR-L2, and CDR-H3, respectively, (f) SEQ ID NO:85, 86, and 87 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 88, 89, and 90 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(g) SEQ ID NO:93, 94, and 95 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 96, 97, and 98 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(h) SEQ ID NO:99, 100, and 101 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 102, 103, and 104 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(i) SEQ ID NO: 105, 106, and 107 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 108, 109, and 110 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(j) SEQ ID NO: 113, 114, and 115 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 116, 117, and 118 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(k) SEQ ID NO: 119, 120, and 121 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 122, 123, and 124 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(l) SEQ ID NO: 125, 126, and 127 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 128, 129, and 130 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(m) SEQ ID NO: 133, 134, and 135 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 136, 137, and 138 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(n) SEQ ID NO: 139, 140, and 141 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 142, 143, and 144 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(o) SEQ ID NO: 145, 146, and 147 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 148, 149, and 150 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(p) SEQ ID NO: 153, 154, and 155 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 156, 157, and 158 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(q) SEQ ID NO: 159, 160, and 161 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 162, 163, and 164 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(r) SEQ ID NO: 165, 166, and 167 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 168, 169, and 170 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(s) SEQ ID NO: 173, 174, and 175 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 176, 177, and 178 for CDR-L1, CDR-L2, and CDR-H3, respectively, (t) SEQ ID NO: 179, 180, and 181 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 182, 183, and 184 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(u) SEQ ID NO: 185, 186, and 187 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 188, 189, and 190 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(v) SEQ ID NO: 193, 194, and 195 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 196, 197, and 198 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(x) SEQ ID NO: 199, 200, and 201 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:202, 203, and 204 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(y) SEQ ID NO:205, 206, and 207 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:208, 209, and 210 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(z) SEQ ID NO:213, 214, and 215 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:216, 217, and 218 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(aa) SEQ ID NO:219, 220, and 221 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 222, 223, and 224 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(bb) SEQ ID NO:225, 226, and 227 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:228, 229, and 230 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(cc) SEQ ID NO:233, 234 and 235 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:236, 237, and 238 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(dd) SEQ ID NO:239, 240, and 241 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:242, 243, and 244 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(ee) SEQ ID NO:245, 246, and 247 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:248, 249, and 250 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(ff) SEQ ID NO:253, 254, and 255 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:256, 257, and 258 for CDR-L1, CDR-L2, and CDR-H3, respectively, (gg) SEQ ID NO:259, 260, and 261 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:262, 263, and 264 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(hh) SEQ ID NO:265, 266, and 267 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:268, 269, and 270 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(ii) SEQ ID NO: 273, 274, and 275 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:276, 277, and 278 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(jj) SEQ ID NO:279, 280, and 281 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:282, 283, and 284 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(kk) SEQ ID NO:285, 286, and 287 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:288, 289, and 290 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(11) SEQ ID NO: 293, 294, and 295 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 296, 297, and 298 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(mm) SEQ ID NO: 299, 300, and 301 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:302, 303, and 304 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(nn) SEQ ID NO:305, 306, and 307 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:308, 309, and 310 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(oo) SEQ ID NO:313, 314, and 315 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:316, 317, and 318 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(pp) SEQ ID NO:319, 320, and 321 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:322, 323, and 324 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(qq) SEQ ID NO:325, 326, and 327 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:328, 329, and 330 for CDR-L1, CDR-L2, and CDR-H3, respectively, (rr) SEQ ID NO:333, 334, and 335 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:336, 337, and 338 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(ss) SEQ ID NO:339, 340, 341 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:342, 343, and 344 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(tt) SEQ ID NO:345, 346, and 347 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:348, 349, and 350 for CDR-L1, CDR-L2, and CDR-H3, respectively, or
(uu) CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2, and CDR-L3 sequences which collectively differ by no more than three, no more than two, or one amino acid substitutions across all six CDRs from any of the foregoing sequences in (a)-(tt).
17. The fusion polypeptide of claim 16, wherein the sarbeco virus antibody or sarbecovirus binding fragment thereof comprises a heavy chain variable region comprising complementarity determining regions CDR-H1, CDR-H2, and CDR-H3, and a light chain variable region comprising complementarity determining regions CDR-L1, CDR-L2, and CDR-L3, having amino acid sequences of
(a) SEQ ID NO:32, 33, and 34 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:35, 36, and 37 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(b) SEQ ID NO:38, 39, and 40 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:41, 42, and 43 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(c) SEQ ID NO:44, 45, and 46 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:47, 48, and 49 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(d) SEQ ID NO:73, 74, and 75 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:76, 77, and 78 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(e) SEQ ID NO:79, 80, and 81 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 82, 83, and 84 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(f) SEQ ID NO:85, 86, and 87 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 88, 89, and 90 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(g) SEQ ID NO:93, 94, and 95 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 96, 97, and 98 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(h) SEQ ID NO:99, 100, and 101 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 102, 103, and 104 for CDR-L1, CDR-L2, and CDR-H3, respectively, (i) SEQ ID NO: 105, 106, and 107 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 108, 109, and 110 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(j) SEQ ID NO: 113, 114, and 115 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:116, 117, and 118 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(k) SEQ ID NO: 119, 120, and 121 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 122, 123, and 124 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(l) SEQ ID NO: 125, 126, and 127 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 128, 129, and 130 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(m) SEQ ID NO: 133, 134, and 135 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 136, 137, and 138 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(n) SEQ ID NO: 139, 140, and 141 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 142, 143, and 144 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(o) SEQ ID NO: 145, 146, and 147 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 148, 149, and 150 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(p) SEQ ID NO: 153, 154, and 155 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 156, 157, and 158 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(q) SEQ ID NO: 159, 160, and 161 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 162, 163, and 164 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(r) SEQ ID NO: 165, 166, and 167 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 168, 169, and 170 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(s) SEQ ID NO: 173, 174, and 175 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 176, 177, and 178 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(t) SEQ ID NO:179, 180, and 181 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 182, 183, and 184 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(u) SEQ ID NO:185, 186, and 187 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 188, 189, and 190 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(v) SEQ ID NO: 193, 194, and 195 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 196, 197, and 198 for CDR-L1, CDR-L2, and CDR-H3, respectively, (x) SEQ ID NO: 199, 200, and 201 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:202, 203, and 204 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(y) SEQ ID NO:205, 206, and 207 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:208, 209, and 210 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(z) SEQ ID NO:213, 214, and 215 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:216, 217, and 218 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(aa) SEQ ID NO:219, 220, and 221 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:222, 223, and 224 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(bb) SEQ ID NO:225, 226, and 227 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:228, 229, and 230 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(cc) SEQ ID NO:233, 234 and 235 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:236, 237, and 238 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(dd) SEQ ID NO:239, 240, and 241 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:242, 243, and 244 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(ee) SEQ ID NO:245, 246, and 247 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:248, 249, and 250 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(ff) SEQ ID NO:253, 254, and 255 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:256, 257, and 258 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(gg) SEQ ID NO:259, 260, and 261 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:262, 263, and 264 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(hh) SEQ ID NO:265, 266, and 267 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:268, 269, and 270 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(ii) SEQ ID NO: 273, 274, and 275 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:276, 277, and 278 for CDR-L1, CDR-L2, and CDR-H3, respectively, (jj) SEQ ID NO:279, 280, and 281 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:282, 283, and 284 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(kk) SEQ ID NO:285, 286, and 287 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:288, 289, and 290 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(11) SEQ ID NO: 293, 294, and 295 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:296, 297, and 298 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(mm) SEQ ID NO: 299, 300, and 301 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:302, 303, and 304 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(nn) SEQ ID NO:305, 306, and 307 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:308, 309, and 310 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(oo) SEQ ID NO:313, 314, and 315 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:316, 317, and 318 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(pp) SEQ ID NO:319, 320, and 321 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:322, 323, and 324 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(qq) SEQ ID NO:325, 326, and 327 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:328, 329, and 330 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(rr) SEQ ID NO:333, 334, and 335 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:336, 337, and 338 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(ss) SEQ ID NO:339, 340, 341 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:342, 343, and 344 for CDR-L1, CDR-L2, and CDR-H3, respectively, or
(tt) SEQ ID NO:345, 346, and 347 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:348, 349, and 350 for CDR-L1, CDR-L2, and CDR-H3, respectively.
18. A fusion polypeptide comprising a sarbecovirus binding moiety linked to a nanocage monomer or subunit thereof, wherein the sarbecovirus binding moiety is a sarbecovirus antibody or a sarbecovirus binding fragment thereof, wherein the sarbecovirus antibody or sarbecovirus binding fragment thereof comprises a heavy chain variable region comprising complementarity determining regions CDR-H1, CDR-H2, and CDR-H3, and a light chain variable region comprising complementarity determining regions CDR-L1, CDR-L2, and CDR-L3, having amino acid sequences of:
(a) SEQ ID NO: 12, 13, and 14 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 15, 16, and 17 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(b) SEQ ID NO: 18, 19, and 20 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:21, 22, and 23 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(c) SEQ ID NO:24, 25, and 26 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:27, 28, and 29 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(d) SEQ ID NO:52, 53, and 54 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:55, 56, and 57 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(e) SEQ ID NO:58, 59, and 60 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:61, 62, and 63 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(f) SEQ ID NO:64, 65, and 66 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:67, 68, and 69 for CDR-L1, CDR-L2, and CDR-H3, respectively, or
(g) CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2, and CDR-L3 sequences which collectively differ by no more than three, no more than two, or one amino acid substitutions across all six CDRs from any of the foregoing sequences in (a)-(f).
19. The fusion polypeptide of claim 18, wherein the sarbecovirus antibody or sarbecovirus binding fragment thereof comprises a heavy chain variable region comprising complementarity determining regions CDR-H1, CDR-H2, and CDR-H3, and a light chain variable region comprising complementarity determining regions CDR-L1, CDR-L2, and CDR-L3, having amino acid sequences of:
(a) SEQ ID NO: 12, 13, and 14 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO: 15, 16, and 17 for CDR-L1, CDR-L2, and CDR-H3, respectively, (b) SEQ ID NO: 18, 19, and 20 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:21, 22, and 23 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(c) SEQ ID NO:24, 25, and 26 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:27, 28, and 29 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(d) SEQ ID NO:52, 53, and 54 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:55, 56, and 57 for CDR-L1, CDR-L2, and CDR-H3, respectively,
(e) SEQ ID NO:58, 59, and 60 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:61, 62, and 63 for CDR-L1, CDR-L2, and CDR-H3, respectively, or
(f) SEQ ID NO:64, 65, and 66 for CDR-H1, CDR-H2, and CDR-H3, respectively and SEQ ID NO:67, 68, and 69 for CDR-L1, CDR-L2, and CDR-H3, respectively.
20. The fusion polypeptide of any one of claims 9-19, wherein the sarbecovirus binding moiety is an Fab fragment of a sarbecovirus antibody.
21. The fusion polypeptide of claim 20, wherein the Fab fragment is a single chain Fab (scFab).
22. The fusion polypeptide of any one of claims 2-21, wherein the sarbecovirus antibody is capable of binding the receptor binding domain (RBD) of SARS-CoV-2.
23. The fusion polypeptide of claim 22, wherein the sarbecovirus antibody is only capable of binding RBD in RBD’s up conformation.
24. The fusion polypeptide of any one of claims 2-23, wherein the sarbecovirus antibody is capable inhibiting binding to SARS-CoV-2 to ACE2.
25. The fusion polypeptide of any one of claims 1-24, wherein the nanocage monomer or subunit thereof is a ferritin monomer or subunit thereof.
26. The fusion polypeptide of claim 25, wherein the ferritin monomer or subunit thereof is a ferritin light chain or subunit thereof.
27. The fusion polypeptide of claim 25 or 26, wherein the ferritin monomer or subunit thereof is a human ferritin or subunit thereof.
28. The fusion polypeptide of any one of claims 25 to 27, wherein the ferritin monomer or subunit thereof is a ferritin monomer subunit.
29. The fusion polypeptide of claim 28, wherein the ferritin monomer subunit is a C-half ferritin.
30. The fusion polypeptide of any one of claims 25-29, wherein the sarbecovirus binding moiety is fused to the N-terminus of the ferritin monomer or subunit thereof.
31. The fusion polypeptide of claim 30, wherein the sarbecovirus binding moiety is linked to the ferritin monomer’s or ferritin monomer subunit’s N-terminus via an amino acid linker.
32. The fusion polypeptide of claim 31, wherein the amino acid linker comprises a (GnS)m linker.
33. The fusion polypeptide of claim 32, wherein the (GnS)m linker is a (GGGGS)m linker.
34. A self-assembled polypeptide complex comprising: a plurality of first fusion polypeptides, each first fusion polypeptide comprising a first sarbecovirus binding moiety, and each first fusion polypeptide being a fusion polypeptide of any one of claims 1-33.
35. The self-assembled polypeptide complex of claim 34, further comprising: a plurality of second fusion polypeptides, each second fusion polypeptide comprising a second sarbecovirus binding moiety linked to a nanocage monomer or subunit thereof, wherein the second sarbecovirus binding moiety is distinct from the first sarbecovirus binding moiety.
36. The self-assembled polypeptide complex of claim 35, wherein each second fusion polypeptide is a fusion polypeptide of any one of claims 1-33.
37. The self-assembled polypeptide complex of claim 34, 35, or 36, further comprising: a plurality of third fusion polypeptides, each third fusion polypeptide comprising a third sarbecovirus binding moiety linked to a nanocage monomer or subunit thereof, wherein the third sarbecovirus binding moiety is distinct from the first and second sarbecovirus binding moieties.
38. The self-assembled polypeptide complex of claim 37, wherein each third fusion polypeptide is a fusion polypeptide of any one of claims 1-33.
39. The self-assembled polypeptide complex of any one of claims 34-38, further comprising: a plurality of Fc-containing fusion polypeptides, each Fc-containing fusion polypeptide comprising an Fc polypeptide linked to a nanocage monomer or subunit thereof.
40. The self-assembled polypeptide complex of claim 39, wherein Fc-containing fusion polypeptide’s nanocage monomer or subunit thereof is a ferritin monomer or subunit thereof.
41. The self-assembled polypeptide complex of claim 40, wherein the ferritin monomer or subunit thereof is a ferritin light chain or subunit thereof.
42. The self-assembled polypeptide complex of claim 40 or 41, wherein the ferritin monomer or subunit thereof is a human ferritin or subunit thereof.
43. The self-assembled polypeptide complex of any one of claims 40-42, wherein the ferritin monomer or subunit thereof is a ferritin monomer subunit.
44. The self-assembled polypeptide complex of claim 43, wherein the ferritin monomer subunit is an N-half ferritin.
45. The self-assembled polypeptide complex of any one of claims 40-44, wherein the Fc polypeptide is fused to the N-terminus of the ferritin monomer or subunit thereof.
46. The self-assembled polypeptide complex of claim 45, wherein the Fc polypeptide is linked to the ferritin monomer’s or ferritin monomer subunit’s N-terminus via an amino acid linker.
47. The self-assembled polypeptide complex of claim 46, wherein the amino acid linker comprises a (GnS)m linker.
48. The self-assembled polypeptide complex of claim 47, wherein the (GnS)m linker is a (GGGGS)m linker.
49. The self-assembled polypeptide complex of any one of claims 39-48, wherein the Fc polypeptide comprises a single chain Fc (scFc) comprising two Fc chains, wherein the two Fc chains are linked via an amino acid linker.
50. The self-assembled polypeptide complex of claim 49, wherein the amino acid linker that links the two Fc chains comprises a (GnS)m linker.
51. The self-assembled polypeptide complex of claim 50, wherein the (GnS)m linker is a (GGGGS)m linker.
52. The self-assembled polypeptide complex of any one of claims 39-51, wherein the Fc polypeptide comprises an IgGl Fc chain.
53. The self-assembled polypeptide complex of any one of claims 39-51, wherein the Fc polypeptide comprises an IgG4 Fc chain.
54. The self-assembled polypeptide complex of claim 53, wherein the Fc polypeptide comprises an IgG4 Fc chain comprising a mutation or set of mutations selected from the group consisting of S228P, F234A, L235A, G237A, P238S, and combinations thereof.
55. The self-assembled polypeptide complex of claim 54, wherein the IgG4 Fc chain comprises a set of mutations selected from the group consisting of:
1) S228P, F234A, and L235A
2) S228P, F234A, L235A, G237A, and P238S, or
3) F234A, L235A, G237A, and P238S.
56. A self-assembled polypeptide complex comprising:
(a) a plurality of first fusion polypeptides, each first fusion polypeptide comprising a first sarbeco virus antibody or sarbecovirus binding fragment thereof linked to a ferritin monomer or subunit thereof,
(b) a plurality of second fusion polypeptides, each second fusion polypeptide comprising a second sarbecovirus antibody or sarbecovirus binding fragment thereof linked to a ferritin monomer or subunit thereof,
(c) a plurality of third fusion polypeptides, each third fusion polypeptide comprising a third sarbecovirus antibody or sarbecovirus binding fragment thereof linked to a ferritin monomer or subunit thereof, and
(d) a plurality of Fc-containing fusion polypeptides, each Fc-containing fusion polypeptide comprising an Fc polypeptide linked to a ferritin monomer or subunit thereof, wherein the first, second, and third sarbecovirus antibodies or sarbecovirus binding fragments thereof are distinct from each other, wherein at least the first and second sarbecovirus antibodies are capable of neutralizing SARS-CoV, and SARS-CoV-2.
57. The self-assembled polypeptide complex of claim 56, wherein the self-assembled polypeptide complex is capable of neutralizing a SARS-CoV-2 virus.
58. The self-assembled polypeptide complex of claim 57, wherein the self-assembled polypeptide complex is capable of neutralizing an Omicron variant of SARS-CoV-2 virus.
59. The self-assembled polypeptide complex of 58, wherein the self-assembled polypeptide complex is capable of neutralizing two or more Omicron variants of SARS- CoV-2 virus.
60. The self-assembled polypeptide complex of 59, wherein the self-assembled polypeptide complex is capable of neutralizing three or more Omicron variants of SARS- CoV-2 virus.
61. The self-assembled polyeptide complex of claim 66 or 67, wherein the Omicron variants are selected from the group consisting of BA.l, BA.2, BA.5, XBB.l, and BQ.1.1.
62. The self-assembled polypeptide complex of any one of claims 58-61, wherein the self-assembled polypeptide complex is capable of neutralizing the BA.l variant of SARS- CoV-2 virus.
63. The self-assembled polypeptide complex of claim 62, wherein the self-assembled polypeptide complex is capable of neutralizing the BA.l variant of SARS-CoV-2 virus with an IC50 of 0.01 pg/mL or less.
64. The self-assembled polypeptide complex of any one of claims 58-63, wherein the self-assembled polypeptide complex is capable of neutralizing the BA.2 variant of SARS- CoV-2 virus.
65. The self-assembled polypeptide complex of claim 64, wherein the self-assembled polypeptide complex is capable of neutralizing the BA.2 variant of SARS-CoV-2 virus with an IC50 of 0.02 pg/mL or less.
66. The self-assembled polypeptide complex of any one of claims 58-65, wherein the self-assembled polypeptide complex is capable of neutralizing the BA.5 variant of SARS- CoV-2 virus.
67. The self-assembled polypeptide complex of claim 66, wherein the self-assembled polypeptide complex is capable of neutralizing the BA.5 variant of SARS-CoV-2 virus with an IC50 of less than 0.001 pg/mL.
68. The self-assembled polypeptide complex of any one of claims 58-67, wherein the self-assembled polypeptide complex is capable of neutralizing the BQ.1.1 variant of SARS- CoV-2 virus.
69. The self-assembled polypeptide complex of claim 68, wherein the self-assembled polypeptide complex is capable of neutralizing the BQ.1.1 variant of SARS-CoV-2 virus with an IC50 value of 0.5 pg/mL or less.
70. The self-assembled polypeptide complex of any one of claims 56-69, wherein the self-assembled polypeptide complex is capable of neutralizing the XBB.l variant of SARS- CoV-2 virus.
71. The self-assembled polypeptide complex of claim 70, wherein the self-assembled polypeptide complex is capable of neutralizing the XBB.1 variant of SARS-CoV-2 virus with an IC50 value of 0.5 pg/mL or less.
72. The self-assembled polypeptide complex of claim 71, wherein the self-assembled polypeptide complex is capable of neutralizing the XBB.1 variant of SARS-CoV-2 virus with an IC50 value of 0.1 pg/mL or less.
73. The self-assembled polypeptide complex of any one of claims 56-72, wherein the self-assembled polypeptide complex is capable of neutralizing at least one or a combination of WT SARS-CoV-2, and the Alpha, Beta, Gamma, Delta, and an Omicron variant of SARS- CoV-2.
74. The self-assembled polypeptide complex of claim 73, wherein the self-assembled polypeptide complex is capable of neutralizing WT SARS-CoV-2 and the Alpha, Beta, Gamma, Delta, and an Omicron variant of SARS-CoV-2.
75. The self-assembled polypeptide complex of claim 74, wherein the self-assembled polypeptide complex is capable of neutralizing each of the WT SARS-CoV-2 and the Alpha, Beta, Gamma, Delta, and an Omicron variant of SARS-CoV-2 with IC50 values of 0.01 pg/mL or less.
76. The self-assembled polypeptide complex of any one of claims 56-75, wherein the self-assembled polypeptide complex is capable of neutralizing at least one sarbecovirus other than SARS-CoV-2.
77. The self-assembled polypeptide complex of claim 76, wherein the at least one sarbecovirus other than SARS-CoV-2 comprises a sarbecovirus selected from the group consisting of SARS-CoV, GD-Pangolin, GX-Pangolin, RaTG13, WIV1, SHC014, Lyrall, Rs7327, Rs4231, Rs4084, and combinations thereof.
78. The self-assembled polypeptide complex of claim 77, wherein the at least one sarbecovirus other than SARS-CoV-2 comprises SARS-CoV.
79. A pharmaceutical composition comprising the self-assembled polypeptide complex of any one of claims 34 to 78 and a pharmaceutically acceptable excipient.
80. A method for treating and/or preventing sarbecovirus infection and/or a sarbecovirus- associated condition, the method comprising administering the self-assembled polypeptide complex of any one of claims 34 to 78, or the pharmaceutical composition of claim 79, to a subject in need thereof.
81. The method of claim 80, wherein the subject is a mammal.
82. The method of claim 81, wherein the subject is a human.
83. The method of any one of claims 80-82, wherein the administering comprises systemic administration.
84. The method of claim 83, wherein the systemic administration comprises intranasal, intravascular, or intramuscular administration.
85. Use of the self-assembled polypeptide complex of any one of claims 34 to 78, or the pharmaceutical composition of claim 79, for treating and/or preventing sarbecovirus infection and/or a sarbeco virus-associated condition.
86. The self-assembled polypeptide complex of any one of claims 34 to 78, or the pharmaceutical composition of claim 79, for use in treating and/or preventing sarbecovirus infection and/or a sarbecovirus-associated condition.
87. The method of any one of claims 80-84, the use of claim 85, or the self-assembled polypeptide complex or pharmaceutical composition of claim 86, wherein the sarbecovirus infection is a SARS-CoV-2 infection or the sarbecovirus-associated condition is a SARS- CoV-2-associated condition.
EP23878454.0A 2022-10-21 2023-10-20 Multabody constructs, compositions, and methods targeting sarbecoviruses Pending EP4605437A1 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US202263380540P 2022-10-21 2022-10-21
US202363496136P 2023-04-14 2023-04-14
PCT/CA2023/051399 WO2024082067A1 (en) 2022-10-21 2023-10-20 Multabody constructs, compositions, and methods targeting sarbecoviruses

Publications (1)

Publication Number Publication Date
EP4605437A1 true EP4605437A1 (en) 2025-08-27

Family

ID=90736497

Family Applications (1)

Application Number Title Priority Date Filing Date
EP23878454.0A Pending EP4605437A1 (en) 2022-10-21 2023-10-20 Multabody constructs, compositions, and methods targeting sarbecoviruses

Country Status (3)

Country Link
EP (1) EP4605437A1 (en)
JP (1) JP2025536337A (en)
WO (1) WO2024082067A1 (en)

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP4225804A4 (en) * 2020-10-09 2025-07-02 Hospital For Sick Children Polypeptides for targeting SARS-CoV-2 and related compositions and methods

Also Published As

Publication number Publication date
JP2025536337A (en) 2025-11-05
WO2024082067A1 (en) 2024-04-25

Similar Documents

Publication Publication Date Title
US11479599B2 (en) Antibodies against SARS-CoV-2 and methods of using the same
CN113929771B (en) Polyoma virus neutralizing antibodies
US9493549B2 (en) Antibodies directed toward the HIV-1 GP120 CD4 binding site with increased potency and breadth
WO2021203053A1 (en) Immunotherapy targeting a conserved region in sars coronaviruses
US20250368722A1 (en) Multispecific antibodies targeting multiple epitopes on the hiv-1 envelope
WO2013016468A2 (en) Compositions and methods for improving potency and breadth or hiv antibodies
JP2024509054A (en) antibody
WO2013090644A2 (en) Anti-hiv antibodies having increased potency and breadth
WO2021247925A1 (en) Structure-guided immunotherapy against sars-cov-2
US20250263469A1 (en) Polypeptides targeting sars-cov-2 and related compositions and methods
EP4230650B1 (en) Antibodies capable of binding to the spike protein of coronavirus sars-cov-2
WO2017011414A1 (en) Bispecific molecules comprising an hiv-1 envelope targeting arm
US20240101645A1 (en) Monoclonal antibodies against coronaviruses and uses thereof
GB2614651A (en) Antibodies
Chen et al. Bifunctional fusion proteins of the human engineered antibody domain m36 with human soluble CD4 are potent inhibitors of diverse HIV-1 isolates
EP4605437A1 (en) Multabody constructs, compositions, and methods targeting sarbecoviruses
CN114751988B (en) Multispecific antibodies neutralizing coronavirus
US20250002564A1 (en) Modified multabody constructs, compositions, and methods
US20250011397A1 (en) Modified multabody constructs, compositions, and methods targeting sars-cov-2
WO2025252939A1 (en) Bk virus neutralizing antibodies
HK40059983A (en) Polyomavirus neutralizing antibodies
WO2023111796A1 (en) Pan-specific sars-cov-2 antibodies and uses thereof

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20250521

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR

DAV Request for validation of the european patent (deleted)
DAX Request for extension of the european patent (deleted)