EP4594501A2 - Sirna compositions and methods targeting microtubule associated protein tau nucleic acids - Google Patents

Sirna compositions and methods targeting microtubule associated protein tau nucleic acids

Info

Publication number
EP4594501A2
EP4594501A2 EP23873952.8A EP23873952A EP4594501A2 EP 4594501 A2 EP4594501 A2 EP 4594501A2 EP 23873952 A EP23873952 A EP 23873952A EP 4594501 A2 EP4594501 A2 EP 4594501A2
Authority
EP
European Patent Office
Prior art keywords
formula
seq
ribonucleoside
internucleoside linkage
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
EP23873952.8A
Other languages
German (de)
English (en)
French (fr)
Inventor
Corrie Gallant-Behm
Matthew Hassler
Daniel Curtis
Bruno Miguel DA CRUZ GODINHO
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Atalanta Therapeutics Inc
Original Assignee
Atalanta Therapeutics Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Atalanta Therapeutics Inc filed Critical Atalanta Therapeutics Inc
Publication of EP4594501A2 publication Critical patent/EP4594501A2/en
Pending legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/713Double-stranded nucleic acids or oligonucleotides
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/28Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3212'-O-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3222'-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/343Spatial arrangement of the modifications having patterns, e.g. ==--==--==--
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/352Nature of the modification linked to the nucleic acid via a carbon atom
    • C12N2310/3521Methyl
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/353Nature of the modification linked to the nucleic acid via an atom other than carbon
    • C12N2310/3533Halogen
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/10Applications; Uses in screening processes
    • C12N2320/11Applications; Uses in screening processes for the determination of target sites, i.e. of active nucleic acids

Definitions

  • BACKGROUND [0002] Expression of the microtubule associated protein tau (MAPT) gene produces the protein tau. Mutations in the MAPT gene have been linked to a number of disorders referred to as tauopathies.
  • the instant application is directed to single- or double-stranded interfering RNA molecules (e.g., siRNA) that target a MAPT gene.
  • the interfering RNA molecules may contain specific patterns of nucleoside modifications and internucleoside linkage modifications.
  • the disclosure also features pharmaceutical compositions including the same.
  • the siRNA molecules may be branched siRNA molecules, such as di-branched, tri-branched, or tetra- branched siRNA molecules.
  • the disclosed siRNA molecules may further feature a 5’ phosphorus stabilizing moiety and/or a hydrophobic moiety.
  • the disclosure provides methods for delivering the siRNA molecule of the disclosure to the central nervous system of a subject, such as a subject identified as having a tauopathy.
  • an interfering RNA molecule of the present disclosure is a di-branched siRNA molecule.
  • the di-branched siRNA molecules of the present disclosure comprise: a) a sense strand comprising the sequence (mG)#(mA)#(mA)(fU)(mG)(fA)(mG)(fA) (mG)(fA)(mG)(mU)(mG)(fU)#(mG)#(mA)-DIO (SEQ ID NO: 847) and an antisense strand comprising the sequence V(mU)#(fC)#(mA)(fC)(fA)(fC)(mU)(fC)(mU)(fC)(mU)(fC)(mA)(fU)(mU) (fC)(mA)(fU)(mU) (fC)#(mU)#(mC)#(mC) (SEQ ID NO: 832); b) a sense strand comprising the sequence (mU)#(mC)#(mU)(fG)
  • the disclosure features a small interfering RNA (siRNA) molecule comprising an antisense strand and sense strand having complementarity to the antisense strand.
  • the antisense strand may be, e.g., from 10 to 30 nucleotides in length and may have complementarity sufficient to hybridize to a region within a microtubule-associated protein tau (MAPT) mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 409- 816.
  • MTT microtubule-associated protein tau
  • the antisense strand has at least 70% complementarity to a region of 21 contiguous nucleobases within the MAPT mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 409-816. In some embodiments, the antisense strand has at least 75% complementarity to a region of 21 contiguous nucleobases within the MAPT mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 409-816.
  • the antisense strand has at least 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementarity to the region within the MAPT mRNA transcript having the nucleic acid sequence of any one of SEQ ID Nos: 409-816.
  • the antisense strand comprises at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the MAPT mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 409-816.
  • the antisense strand comprises from 10 to 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the MAPT mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 409-816. [0008] In some embodiments, the antisense strand comprises from 12 to 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the MAPT mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 409-816.
  • the antisense strand comprises from 15 to 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the MAPT mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 409-816. [0010] In some embodiments, the antisense strand comprises from 18 to 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the MAPT mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 409-816.
  • the antisense strand comprises from 21 to 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the MAPT mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 409-816. [0012] In some embodiments, the antisense strand comprises from 24 to 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the MAPT mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 409-816.
  • the antisense strand comprises 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the MAPT mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 409-816. [0014] In some embodiments, the antisense strand comprises 9 or fewer nucleotide mismatches relative to a region of 21 contiguous nucleobases of the MAPT mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 409-816.
  • the antisense strand comprises 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer, or only 1 mismatch relative to the region of the MAPT mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 409-816.
  • the region of the MAPT mRNA transcript has the nucleic acid sequence of any one of SEQ ID NOs: 817-831.
  • the region of the MAPT mRNA transcript has the nucleic acid sequence of any one of SEQ ID NOs: 817-821, 823-825, and 827-830.
  • the antisense strand has a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of any one of SEQ ID NOs: 1-408. [0018] In some embodiments, the antisense strand has a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of any one of SEQ ID NOs: 1-408. [0019] In some embodiments, the antisense strand has a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NOs: 1-408.
  • the antisense strand has a nucleic acid sequence that is at least 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 1-408. [0020] In some embodiments, the antisense strand has the nucleic acid sequence of any one of SEQ ID NOs: 1-408. [0021] In some embodiments, the nucleic acid sequence is any one of SEQ ID NOs: 834-846. [0022] In some embodiments, the nucleic acid sequence is any one of SEQ ID NOs: 834-836, 838-840, and 842-845.
  • the sense strand has a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of any one of SEQ ID NOs: 409-816. [0024] In some embodiments, the sense strand has a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of any one of SEQ ID NOs: 409-816. [0025] In some embodiments, the sense strand has a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NOs: 409-816.
  • the sense strand has a nucleic acid sequence that is at least 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 409-816. [0026] In some embodiments, the sense strand has the nucleic acid sequence of any one of SEQ ID NOs: 409-816. [0027] In some embodiments, the nucleic acid sequence is any one of SEQ ID NOs: 817-831. [0028] In some embodiments, the nucleic acid sequence is any one of SEQ ID NOs: 817-821, 823-825, and 827-830.
  • the antisense strand comprises a structure represented by Formula I, wherein Formula I is, in the 5’-to-3’ direction: A-B-(A’) j -C-P 2 -D-P 1 -(C’-P 1 ) k -C’ Formula I; wherein A is represented by the formula C-P 1 -D-P 1 ; each A’ is represented by the formula C-P 2 -D-P 2 ; B is represented by the formula C-P 2 -D-P 2 -D-P 2 -D-P 2 ; each C is a 2’-O-methyl (2’-O-Me) ribonucleoside; each C’, independently, is a 2’-O-Me ribonucleoside or a 2’-fluoro (2’-F) ribonucleoside; each D is a 2’-F ribonucleoside; each P 1 is a phosphorothioate internu
  • the antisense strand comprises a structure represented by Formula A1, wherein Formula A1 is, in the 5’-to-3’ direction: A-S-B-S-A-O-B-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-S-A-S-A-S- A-S-B-S-A Formula A1; wherein A represents a 2’-O-Me ribonucleoside, B represents a 2’-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.
  • A represents a 2’-O-Me ribonucleoside
  • B represents a 2’-F ribonucleoside
  • O represents a phosphodiester internucleoside linkage
  • S represents a phosphorothioate intern
  • the antisense strand comprises a structure represented by Formula II, wherein Formula II is, in the 5’-to-3’ direction: A-B-(A’) j -C-P 2 -D-P 1 -(C-P 1 ) k -C’ Formula II; wherein A is represented by the formula C-P 1 -D-P 1 ; each A’ is represented by the formula C-P 2 -D-P 2 ; B is represented by the formula C-P 2 -D-P 2 -D-P 2 -D-P 2 ; each C is a 2’-O-methyl (2’-O-Me) ribonucleoside; each C’, independently, is a 2’-O-Me ribonucleoside or a 2’-fluoro (2’-F) ribonucleoside; each D is a 2’-F ribonucleoside; each P 1 is a phosphorothioate internucle
  • the antisense strand comprises a structure represented by Formula A2, wherein Formula A2 is, in the 5’-to-3’ direction: A-S-B-S-A-O-B-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-S-A-S- A-S-A-S-A Formula A2; wherein A represents a 2’-O-Me ribonucleoside, B represents a 2’-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.
  • A represents a 2’-O-Me ribonucleoside
  • B represents a 2’-F ribonucleoside
  • O represents a phosphodiester internucleoside linkage
  • S represents a phosphorothioate intern
  • the sense strand comprises a structure represented by Formula III, wherein Formula III is, in the 5’-to-3’ direction: E-(A’) m -F Formula III; wherein E is represented by the formula (C-P 1 ) 2 ; F is represented by the formula (C-P 2 ) 3 -D-P 1 -C-P 1 -C, (C-P 2 ) 3 -D-P 2 -C-P 2 -C, (C-P 2 ) 3 -D-P 1 -C- P 1 -D, or (C-P 2 ) 3 -D-P 2 -C-P 2 -D; A’, C, D, P 1 , and P 2 are as defined in Formula II; and m is an integer from 1 to 7.
  • the sense strand comprises a structure represented by Formula S1, wherein Formula S1 is, in the 5’-to-3’ direction: A-S-A-S-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-A-O-B-S-A-S-A Formula S1; wherein A represents a 2’-O-Me ribonucleoside, B represents a 2’-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.
  • A represents a 2’-O-Me ribonucleoside
  • B represents a 2’-F ribonucleoside
  • O represents a phosphodiester internucleoside linkage
  • S represents a phosphorothioate internucleoside linkage.
  • the sense strand comprises a structure represented by Formula S2, wherein Formula S2 is, in the 5’-to-3’ direction: A-S-A-S-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-A-O-B-O-A-O-A-O-B-O-A-O-A-O-A Formula S2; wherein A represents a 2’-O-Me ribonucleoside, B represents a 2’-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.
  • A represents a 2’-O-Me ribonucleoside
  • B represents a 2’-F ribonucleoside
  • O represents a phosphodiester internucleoside linkage
  • S represents a phosphorothioate internucleoside linkage
  • the sense strand comprises a structure represented by Formula S3, wherein Formula S3 is, in the 5’-to-3’ direction: A-S-A-S-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-A-O-B-S-A-S-B Formula S3; wherein A represents a 2’-O-Me ribonucleoside, B represents a 2’-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.
  • A represents a 2’-O-Me ribonucleoside
  • B represents a 2’-F ribonucleoside
  • O represents a phosphodiester internucleoside linkage
  • S represents a phosphorothioate internucleoside linkage.
  • the sense strand comprises a structure represented by Formula S4, wherein Formula S4 is, in the 5’-to-3’ direction: A-S-A-S-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B Formula S4; wherein A represents a 2’-O-Me ribonucleoside, B represents a 2’-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.
  • A represents a 2’-O-Me ribonucleoside
  • B represents a 2’-F ribonucleoside
  • O represents a phosphodiester internucleoside linkage
  • S represents a phosphorothioate internucleoside linkage
  • the antisense strand comprises a structure represented by Formula IV, wherein Formula IV is, in the 5’-to-3’ direction: A-(A’) j -C-P 2 -B-(C-P 1 ) k -C’ Formula IV; wherein A is represented by the formula C-P 1 -D-P 1 ; each A’ is represented by the formula C-P 2 -D-P 2 ; B is represented by the formula D-P 1 -C-P 1 -D-P 1 ; each C is a 2’-O-Me ribonucleoside; each C’, independently, is a 2’-O-Me ribonucleoside or a 2’-F ribonucleoside; each D is a 2’-F ribonucleoside; each P 1 is a phosphorothioate internucleoside linkage; each P 2 is a phosphodiester internucleoside linkage; j is
  • the antisense strand comprises a structure represented by Formula A3, wherein Formula A3 is, in the 5’-to-3’ direction: A-S-B-S-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-S-A-S-B-S- A-S-A-S-A Formula A3; wherein A represents a 2’-O-Me ribonucleoside, B represents a 2’-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.
  • A represents a 2’-O-Me ribonucleoside
  • B represents a 2’-F ribonucleoside
  • O represents a phosphodiester internucleoside linkage
  • S represents a phosphoroth
  • the sense strand comprises a structure represented by Formula V, wherein Formula V is, in the 5’-to-3’ direction: E-(A’) m -C-P 2 -F Formula V; wherein E is represented by the formula (C-P 1 ) 2 ; F is represented by the formula D-P 1 -C-P 1 -C, D-P 2 -C-P 2 -C, D-P 1 -C-P 1 -D, or D-P 2 -C-P 2 -D; A’, C, D, P 1 and P 2 are as defined in Formula IV; and m is an integer from 1 to 7.
  • the sense strand comprises a structure represented by Formula S5, wherein Formula S5 is, in the 5’-to-3’ direction: A-S-A-S-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-S-A-S-A Formula S5; wherein A represents a 2’-O-Me ribonucleoside, B represents a 2’-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.
  • A represents a 2’-O-Me ribonucleoside
  • B represents a 2’-F ribonucleoside
  • O represents a phosphodiester internucleoside linkage
  • S represents a phosphorothioate internucleoside linkage.
  • the sense strand comprises a structure represented by Formula S6, wherein Formula S6 is, in the 5’-to-3’ direction: A-S-A-S-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-A-O-A Formula S6; wherein A represents a 2’-O-Me ribonucleoside, B represents a 2’-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.
  • A represents a 2’-O-Me ribonucleoside
  • B represents a 2’-F ribonucleoside
  • O represents a phosphodiester internucleoside linkage
  • S represents a phosphorothioate internucleoside linkage
  • the sense strand comprises a structure represented by Formula S7, wherein Formula S7 is, in the 5’-to-3’ direction: A-S-A-S-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-S-A-S-B Formula S7; wherein A represents a 2’-O-Me ribonucleoside, B represents a 2’-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.
  • A represents a 2’-O-Me ribonucleoside
  • B represents a 2’-F ribonucleoside
  • O represents a phosphodiester internucleoside linkage
  • S represents a phosphorothioate internucleoside linkage.
  • the sense strand comprises a structure represented by Formula S8, wherein Formula S8 is, in the 5’-to-3’ direction: A-S-A-S-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B Formula S8; wherein A represents a 2’-O-Me ribonucleoside, B represents a 2’-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.
  • A represents a 2’-O-Me ribonucleoside
  • B represents a 2’-F ribonucleoside
  • O represents a phosphodiester internucleoside linkage
  • S represents a phosphorothioate internucleoside linkage.
  • the antisense strand comprises a structure represented by Formula VI, wherein Formula VI is, in the 5’-to-3’ direction: A-B j -E-B k -E-F-G l -D-P 1 -C’ Formula VI; wherein A is represented by the formula C-P 1 -D-P 1 ; each B is represented by the formula C-P 2 ; each C is a 2’-O-Me ribonucleoside; each C’, independently, is a 2’-O-Me ribonucleoside or a 2’-F ribonucleoside; each D is a 2’-F ribonucleoside; each E is represented by the formula D-P 2 -C-P 2 ; F is represented by the formula D-P 1 -C-P 1 ; each G is represented by the formula C-P 1 ; each P 1 is a phosphorothioate internucleoside linkage; each P
  • the antisense strand comprises a structure represented by Formula A4, wherein Formula A4 is, in the 5’-to-3’ direction: A-S-B-S-A-O-A-O-A-O-B-O-A-O-A-O-A-O-A-O-A-O-B-O-A-S-A-S- A-S-B-S-A Formula A4; wherein A represents a 2’-O-Me ribonucleoside, B represents a 2’-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.
  • A represents a 2’-O-Me ribonucleoside
  • B represents a 2’-F ribonucleoside
  • O represents a phosphodiester internucleoside linkage
  • S represents a phosphorothioate internucleoside linkage.
  • the sense strand comprises a structure represented by Formula VII, wherein Formula VII is, in the 5’-to-3’ direction: H-B m -I n -A’-B o -H-C Formula VII; wherein A’ is represented by the formula C-P 2 -D-P 2 ; each H is represented by the formula (C-P 1 ) 2 ; each I is represented by the formula (D-P 2 ); B, C, D, P 1 and P 2 are as defined in Formula VI; m is an integer from 1 to 7; n is an integer from 1 to 7; and o is an integer from 1 to 7.
  • the sense strand comprises a structure represented by Formula S9, wherein Formula S9 is, in the 5’-to-3’ direction: A-S-A-S-A-O-A-O-A-O-B-O-B-O-B-O-A-O-B-O-A-O-A-O-A-S-A-S-A Formula S9; wherein A represents a 2’-O-Me ribonucleoside, B represents a 2’-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.
  • A represents a 2’-O-Me ribonucleoside
  • B represents a 2’-F ribonucleoside
  • O represents a phosphodiester internucleoside linkage
  • S represents a phosphorothioate internucleoside linkage.
  • the antisense strand further comprises a 5’ phosphorus stabilizing moiety at the 5’ end of the antisense strand.
  • the sense strand further comprises a 5’ phosphorus stabilizing moiety at the 5’ end of the sense strand.
  • each 5’ phosphorus stabilizing moiety is, independently, represented by any one of Formulas IX-XVI: wherein Nuc represents a nucleobase selected from the group consisting of adenine, uracil, guanine, thymine, and cytosine, and R represents an optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, phenyl, benzyl, hydroxy, or hydrogen. [0052] In some embodiments, the nucleobase is an adenine, uracil, guanine, thymine, or cytosine.
  • the 5’ phosphorus stabilizing moiety is (E)-vinylphosphonate represented by Formula XI.
  • the siRNA molecule further comprises a hydrophobic moiety at the 5’ or the 3’ end of the siRNA molecule.
  • the hydrophobic moiety is selected from a group consisting of cholesterol, vitamin D, or tocopherol.
  • the length of the sense strand is between 12 and 30 nucleotides.
  • the siRNA molecule is a branched siRNA molecule.
  • the branched siRNA molecule is di-branched, tri-branched, or tetra-branched.
  • the siRNA molecule is a di-branched siRNA molecule.
  • the di-branched siRNA molecule is represented by any one of Formulas XVII- XIX: wherein each RNA is, independently, an siRNA molecule, L is a linker, and each X, independently, represents a branch point moiety.
  • the siRNA molecule is a tri-branched siRNA molecule, optionally wherein the tri-branched siRNA molecule is represented by any one of Formulas XX-XXIII: wherein each RNA is, independently, an siRNA molecule, L is a linker, and each X, independently, represents a branch point moiety.
  • the siRNA molecule is a tetra-branched siRNA molecule, optionally wherein the tetra-branched siRNA molecule is represented by any one of Formulas XXIV-XXVIII: wherein each RNA is, independently, an siRNA molecule, L is a linker, and each X, independently, represents a branch point moiety.
  • the linker is selected from a group consisting of one or more contiguous subunits of an ethylene glycol, alkyl, carbohydrate, block copolymer, peptide, RNA, and DNA.
  • the one or more contiguous subunits is 2 to 20 contiguous subunits.
  • the disclosure features a pharmaceutical composition comprising the siRNA molecule of any of the foregoing aspects or embodiments of the disclosure, in combination with a pharmaceutically acceptable excipient, carrier, or diluent.
  • the disclosure features a method of delivering an siRNA molecule to a subject diagnosed as having a tauopathy, the method comprising administering to the subject a therapeutically effective amount of the siRNA molecule of any of the foregoing aspects or embodiments of the disclosure, optionally in combination with a pharmaceutically acceptable excipient, carrier, or diluent.
  • the disclosure features a method of treating a tauopathy in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of the siRNA molecule of any of the foregoing aspects or embodiments of the disclosure, optionally in combination with a pharmaceutically acceptable excipient, carrier, or diluent.
  • the tauopathy is Alzheimer’s disease. In some embodiments, the tauopathy is frontotemporal dementia. In some embodiments, the tauopathy is progressive supranuclear palsy. In some embodiments, the tauopathy is corticobasal degeneration. [0068] In another aspect, the disclosure features a method of reducing MAPT expression in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of the siRNA molecule of any of the foregoing aspects or embodiments of the disclosure, optionally in combination with a pharmaceutically acceptable excipient, carrier, or diluent.
  • the siRNA molecule or the pharmaceutical composition is administered to the subject by way of intracerebroventricular, intrastriatal, intraparenchymal, or intrathecal injection. In some embodiments, the siRNA molecule or the pharmaceutical composition is administered to the subject by way of intravenous, intramuscular, or subcutaneous injection. [0070] In some embodiments, the subject is a human. [0071] In a further aspect, the disclosure features a kit comprising (a) the siRNA molecule of any of the foregoing aspects or embodiments of the disclosure, optionally in combination with a pharmaceutically acceptable excipient, carrier, or diluent, and (b) a package insert.
  • FIG.1A is a graph showing reduction in MAPT mRNA in hMAPT mice in frontal cortex (fCTx), striatum (Cpu), thalamus (Thal), temporal cortex (tCTx), and hippocampus (Hp) at 1, 2, 3, or 4 months after administration of a di-siRNA molecule of the disclosure.
  • FIG.1B is a graph showing reduction in MAPT mRNA in hMAPT mice in Midbrain (Mb), Pons, medulla (Med), and cerebellum (Cb) at 1, 2, 3, or 4 months after administration of a di-siRNA molecule of the disclosure.
  • FIG.1C is a graph showing reduction in MAPT mRNA in hMAPT mice in cervical spinal cord (SC-C), thoracic spinal cord (SC-T), and lumbar spinal cord (SC-L) at 1, 2, 3, or 4 months after administration of a di-siRNA molecule of the disclosure.
  • FIG.2A is a graph showing reduction in MAPT protein in hMAPT mice in fCTx, tCTx, Cpu, Hp, Thal, Cb, and Mb at 1, 2, 3, or 4 months after administration of a di-siRNA molecule of the disclosure.
  • FIG.2B is a graph showing reduction in MAPT protein in hMAPT mice in Med, Pons, SC-C, SC-T, and SC-L at 1, 2, 3, or 4 months after administration of a di-siRNA molecule of the disclosure. 5.
  • the instant application is directed to single- or double-stranded interfering RNA molecules (e.g., siRNA) that target a MAPT gene.
  • the interfering RNA molecules may contain specific patterns of nucleoside modifications and internucleoside linkage modifications, as pharmaceutical compositions including the same.
  • the siRNA molecules may be branched siRNA molecules, such as di-branched, tri-branched, or tetra-branched siRNA molecules.
  • the disclosed siRNA molecules may further feature a 5’ phosphorus stabilizing moiety and/or a hydrophobic moiety.
  • the disclosure provides methods for delivering the siRNA molecule of the disclosure to the central nervous system of a subject, such as a subject identified as having a tauopathy 5.1.
  • nucleic acids refers to RNA or DNA molecules consisting of a chain of ribonucleotides or deoxyribonucleotides, respectively.
  • the term “therapeutic nucleic acid” refers to a nucleic acid molecule (e.g., ribonucleic acid) that has partial or complete complementarity to, and interacts with, a disease-associated target mRNA and mediates silencing of expression of the mRNA.
  • the term “carrier nucleic acid” refers to a nucleic acid molecule (e.g., ribonucleic acid) that has sequence complementarity with, and hybridizes with, a therapeutic nucleic acid.
  • the term “3' end” refers to the end of the nucleic acid that contains an unmodified hydroxyl group at the 3' carbon of the ribose ring.
  • nucleoside refers to a molecule made up of a heterocyclic base and its sugar.
  • nucleotide refers to a nucleoside having a phosphate group on its 3' or 5' sugar hydroxyl group.
  • siRNA refers to small interfering RNA duplexes that induce the RNA interference (RNAi) pathway. siRNA molecules can vary in length (generally, between 18 and 30 base pairs) and contain varying degrees of complementarity to their target mRNA.
  • RNA includes duplexes of two separate strands, as well as single strands that optionally form hairpin structures including a duplex region.
  • antisense strand refers to the strand of the siRNA duplex that contains some degree of complementarity to the target gene.
  • sense strand refers to the strand of the siRNA duplex that contains complementarity to the antisense strand.
  • chemically modified nucleotide refers to a non-standard nucleotide, including non-naturally occurring ribonucleotides or deoxyribonucleotides.
  • Exemplary chemically modified nucleotides are modified at any position so as to alter certain chemical properties of the nucleotide yet retain the ability of the chemically modified nucleotide to perform its intended function.
  • the term "metabolically stabilized” refers to RNA molecules that contain ribonucleotides that have been chemically modified from 2'-hydroxyl groups to 2’-O- methyl groups , 2’ fluoro groups, or other modifications known in the art to stabilized RNA to enzymatic and/or non-enzymatic degradation.
  • phosphorothioate refers to a phosphate group of a nucleotide that is modified by substituting one or more of the oxygens of the phosphate group with sulfur.
  • ethylene glycol chain refers to a carbon chain with the formula ((CH 2 OH) 2 ).
  • alkyl refers to a saturated hydrocarbon group. Alkyl groups may be acyclic or cyclic and contain only C and H when unsubstituted.
  • alkyl residue having a specific number of carbons When an alkyl residue having a specific number of carbons is named, all geometric isomers having that number of carbons are intended to be encompassed and described; thus, for example, “butyl” is meant to include n-butyl, sec-butyl, and iso-butyl.
  • alkyl examples include ethyl, propyl, butyl, pentyl, hexyl, heptyl, octyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, and the like. In some embodiments, alkyl may be substituted.
  • alkenyl residue having a specific number of carbons When an alkenyl residue having a specific number of carbons is named, all geometric isomers having that number of carbons are intended to be encompassed and described; thus, for example, “butenyl” is meant to include n-butenyl, sec-butenyl, and iso-butenyl.
  • alkenyl may be substituted. Suitable substituents that may be introduced into an alkenyl group include, for example, hydroxy, alkoxy, amino, alkylamino, and halo, among others.
  • alkynyl refers to an acyclic or cyclic unsaturated hydrocarbon group having at least one site of acetylenic unsaturation (i.e., having at least one moiety of the formula C ⁇ C). Alkynyl groups contain only C and H when unsubstituted. When an alkynyl residue having a specific number of carbons is named, all geometric isomers having that number of carbons are intended to be encompassed and described; thus, for example, “pentynyl” is meant to include n-pentynyl, sec-pentynyl, iso-pentynyl, and tert-pentynyl.
  • alkynyl examples include –C ⁇ CH and –C ⁇ C-CH 3 .
  • alkynyl may be substituted.
  • Suitable substituents that may be introduced into an alkynyl group include, for example, hydroxy, alkoxy, amino, alkylamino, and halo, among others.
  • phenyl denotes a monocyclic arene in which one hydrogen atom from a carbon atom of the ring has been removed.
  • a phenyl group can be unsubstituted or substituted with one or more suitable substituents, wherein the substituent replaces an H of the phenyl group.
  • benzyl refers to monovalent radical obtained when a hydrogen atom attached to the methyl group of toluene is removed.
  • a benzyl generally has the formula of phenyl-CH 2 -.
  • a benzyl group can be unsubstituted or substituted with one or more suitable substituents.
  • the substituent may replace an H of the phenyl component and/or an H of the methylene (-CH 2 -) component.
  • amide refers to an alkyl, alkenyl, alkynyl, or aromatic group that is attached to an amino-carbonyl functional group.
  • nucleoside and nucleotide refer to the bonds between nucleosides and nucleotides, respectively.
  • triazol refers to heterocyclic compounds with the formula (C2H 3 N3), having a five-membered ring of two carbons and three nitrogens, the positions of which can change resulting in multiple isomers.
  • terminal group refers to the group at which a carbon chain or nucleic acid ends.
  • lipophilic amino acid refers to an amino acid including a hydrophobic moiety (e.g., an alkyl chain or an aromatic ring).
  • target of delivery refers to the organ or part of the body that is desired to deliver the branched oligonucleotide compositions to.
  • branched siRNA refers to a compound containing two or more double-stranded siRNA molecules covalently bound to one another.
  • Branched siRNA molecules may be “di-branched,” also referred to herein as “di-siRNA,” wherein the siRNA molecule includes 2 siRNA molecules covalently bound to one another, e.g., by way of a linker.
  • Branched siRNA molecules may be “tri-branched,” also referred to herein as “tri-siRNA,” wherein the siRNA molecule includes 3 siRNA molecules covalently bound to one another, e.g., by way of a linker.
  • Branched siRNA molecules may be “tetra-branched,” also referred to herein as “tetra-siRNA,” wherein the siRNA molecule includes 4 siRNA molecules covalently bound to one another, e.g., by way of a linker.
  • branch point moiety refers to a chemical moiety of a branched siRNA structure of the disclosure that may be covalently linked to a 5’ end or a 3’ end of an antisense strand or a sense strand of an siRNA molecule and which may support the attachment of additional single- or double-stranded siRNA molecules.
  • branch point moieties suitable for use in conjunction with the disclosed methods and compositions include, e.g., phosphoroamidite, tosylated solketal, 1,3-diaminopropanol, pentaerythritol, and any one of the branch point moieties described in US 10,478,503.
  • the term “5′ phosphorus stabilizing moiety” refers to a terminal phosphate group that includes phosphates as well as modified phosphates (e.g., phosphorothioates, phosphodiesters, phosphonates).
  • the phosphate moiety can be located at either terminus, e.g., at the 5′-terminal nucleoside.
  • the terminal phosphate is modified such that one or more of the O and OH groups are replaced with H, O, S, N(R’), or alkyl where R’ is H, an amino protecting group, or unsubstituted or substituted alkyl.
  • the 5′ and or 3′ terminal group can include from 1 to 3 phosphate moieties that are each, independently, unmodified (di- or tri-phosphates) or modified.
  • the term “between X and Y” is inclusive of the values of X and Y.
  • “between X and Y” refers to the range of values between the value of X and the value of Y, as well as the value of X and the value of Y.
  • amino acid refers to a molecule containing amine and carboxyl functional groups and a side chain specific to the amino acid.
  • amino acid is chosen from the group of proteinogenic amino acids.
  • the amino acid is an L-amino acid or a D-amino acid.
  • the amino acid is a synthetic amino acid (e.g., a beta-amino acid).
  • internucleoside linkages provided herein include a formal charge of -1 at physiological pH, and that said formal charge will be balanced by a cationic moiety, e.g., an alkali metal such as sodium or potassium, an alkali earth metal such as calcium or magnesium, or an ammonium or guanidinium ion.
  • a cationic moiety e.g., an alkali metal such as sodium or potassium, an alkali earth metal such as calcium or magnesium, or an ammonium or guanidinium ion.
  • the phosphate group of the nucleotide may also be modified, e.g., by substituting one or more of the oxygens of the phosphate group with sulfur (e.g., phosphorothioates), or by making other substitutions which allow the nucleotide to perform its intended function such as described in, for example, Eckstein, Antisense Nucleic Acid Drug Dev.
  • Watson-Crick base pairs in the context of the present disclosure include adenine-thymine, adenine-uracil, and cytosine-guanine base pairs.
  • a proper Watson-Crick base pair is referred to in this context as a “match,” while each unpaired nucleotide, and each incorrectly paired nucleotide, is referred to as a “mismatch.”
  • Alignment for purposes of determining percent nucleic acid sequence complementarity can be achieved in various ways that are within the capabilities of one of skill in the art, for example, using publicly available computer software such as BLAST, BLAST-2, or Megalign software.
  • Percent (%) sequence complementarity with respect to a reference polynucleotide sequence is defined as the percentage of nucleic acids in a candidate sequence that are complementary to the nucleic acids in the reference polynucleotide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence complementarity.
  • a given nucleotide is considered to be “complementary” to a reference nucleotide as described herein if the two nucleotides form canonical Watson-Crick base pairs.
  • Watson-Crick base pairs in the context of the present disclosure include adenine-thymine, adenine-uracil, and cytosine-guanine base pairs.
  • a proper Watson- Crick base pair is referred to in this context as a “match,” while each unpaired nucleotide, and each incorrectly paired nucleotide, is referred to as a “mismatch.”
  • Alignment for purposes of determining percent nucleic acid sequence complementarity can be achieved in various ways that are within the capabilities of one of skill in the art, for example, using publicly available computer software such as BLAST, BLAST-2, or Megalign software. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms needed to achieve maximal complementarity over the full length of the sequences being compared.
  • the percent sequence complementarity of a given nucleic acid sequence, A, to a given nucleic acid sequence, B, is calculated as follows: 100 multiplied by (the fraction X/Y) where X is the number of complementary base pairs in an alignment (e.g., as executed by computer software, such as BLAST) in that program’s alignment of A and B, and where Y is the total number of nucleic acids in B.
  • nucleic acid sequence A is not equal to the length of nucleic acid sequence B
  • percent sequence complementarity of A to B will not equal the percent sequence complementarity of B to A.
  • a query nucleic acid sequence is considered to be “completely complementary” to a reference nucleic acid sequence if the query nucleic acid sequence has 100% sequence complementarity to the reference nucleic acid sequence.
  • gene silencing refers to the suppression of gene expression, e.g., transgene, heterologous gene and/or endogenous gene expression, which may be mediated through processes that affect transcription and/or through processes that affect post-transcriptional mechanisms.
  • gene silencing occurs when an RNAi molecule initiates the inhibition or degradation of the mRNA transcribed from a gene of interest in a sequence- specific manner via RNA interference, thereby preventing translation of the gene's product.
  • RNAi RNAi molecule initiates the inhibition or degradation of the mRNA transcribed from a gene of interest in a sequence- specific manner via RNA interference, thereby preventing translation of the gene's product.
  • the term “negative regulator,” as used herein, refers to a gene that negatively regulates (e.g., reduces or inhibits) the expression and/or activity of another gene or set of genes.
  • the term “positive regulator,” as used herein, refers to a gene that positively regulates (e.g., increases or saturates) the expression and/or activity of another gene or set of genes.
  • the term “phosphate moiety” as used herein, refers to a terminal phosphate group that includes phosphates as well as modified phosphates. The phosphate moiety can be located at either terminus, e.g., at the 5′-terminal nucleoside.
  • the terminal phosphate is unmodified having the formula —O—P( ⁇ O)(OH)OH.
  • the terminal phosphate is modified such that one or more of the O and OH groups are replaced with H, O, S, N(R’) or alkyl where R’ is H, an amino protecting group or unsubstituted or substituted alkyl.
  • the 5′ and or 3′ terminal group can include from 1 to 3 phosphate moieties that are each, independently, unmodified (di or tri-phosphates) or modified.
  • oligonucleotide refers to an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or other nucleic acids.
  • RNA ribonucleic acid
  • DNA deoxyribonucleic acid
  • oligonucleotides composed of naturally-occurring nucleobases, sugars and covalent internucleoside (backbone) linkages as well as oligonucleotides having non-naturally- occurring (e.g., modified) portions that function similarly.
  • Such chemically modified oligonucleotides can exhibit desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target and increased stability in the presence of nucleases.
  • treatment refers to clinical intervention designed to alter the natural course of the patient or cell being treated during the course of clinical pathology. Desirable effects of treatment include decreasing the rate of disease progression, ameliorating or palliating the disease state, and remission or improved prognosis.
  • a patient is successfully “treated” if one or more symptoms associated with a synucleinopathy described herein are mitigated or eliminated, including, but are not limited to, decreasing symptoms resulting from the disease, increasing the quality of life of those suffering from the disease, decreasing the dose of other medications required to treat the disease, and/or prolonging survival of patients.
  • the term “delaying progression” of a disease refers to deferring, hindering, slowing, retarding, stabilizing, and/or postponing development of a cancer described herein. This delay can be of varying lengths of time, depending on the history of the synucleinopathy and/or patient being treated. As is evident to one skilled in the art, a sufficient or significant delay can, in effect, encompass prevention, in that the patient does not develop a synucleinopathy or relapse.
  • Anti-MAPT siRNAs [0120] The instant application is directed to single- or double-stranded interfering RNA molecules (e.g., siRNA) targeting an MAPT gene.
  • siRNA molecules targeting an MAPT gene can be designed to target an MAPT mRNA sequence.
  • the MAPT gene targeted by an siRNA of the instant disclosure expresses a mRNA comprising the sequence of NM_001123066.3 (Homo sapiens microtubule associated protein tau (MAPT), transcript variant 6, mRNA): GGACGGCCGAGCGGCAGGGCGCTCGCGCGCGCCCACTAGTGGCCGGAGGAGAA GGCTCCCGCGGAGGCCGCGCTGCCCGCCCCCCTGGGGAGGCTCGCGTTCCC GCTGCTCGCCTGCCGCCCGCCGGCCTCAGGAACGCGCCCTCTTCGCCGGCG CGCGCCCTCGCAGTCACCGCCACCCACCAGCTCCGGCACCAACAGCAGCGCCGC TGCCACCGCCCACCTTCTGCCGCCGCCACCACAGCCACCTTCTCCTCCTCCGCTGT CCTCTCCCGTCCTCCCGTCCTCGCCTCTGTCGACTATCAGGTGA
  • NM_001123066.3 Homo sapiens microtub
  • the antisense strand comprises at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the MAPT RNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 409-816.
  • the antisense strand comprises from 10 to 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the MAPT RNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 409-816. In certain embodiments, the antisense strand comprises from 12 to 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the MAPT RNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 409-816.
  • the antisense strand comprises from 15 to 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the MAPT RNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 409-816. In certain embodiments, the antisense strand comprises from 18 to 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the MAPT RNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 409-816.
  • the antisense strand comprises from 21 to 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the MAPT RNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 409-816. In certain embodiments, the antisense strand comprises from 24 to 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the MAPT RNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 409-816.
  • the antisense strand comprises 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the MAPT RNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 409- 816. [0123] In certain embodiments, the antisense strand comprises 9 or fewer nucleotide mismatches relative to a region of 21 contiguous nucleobases of the MAPT RNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 409-816.
  • the antisense strand can comprise 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer, or only 1 mismatch relative to the region of the MAPT RNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 409-816.
  • the siRNA molecule of the present disclosure targets a region of an MAPT RNA transcript that has the nucleic acid sequence of any one of SEQ ID NOs: 409-816.
  • the present disclosure is directed to an siRNA molecule comprising a sense strand comprising a modified sense strand of Table 1.
  • the present disclosure is directed to an siRNA molecule comprising an antisense strand comprising a modified antisense strand of Table 1.
  • the sense strand is SEQ ID NO. 847 and the antisense strand is SEQ ID NO 832.
  • the sense strand is SEQ ID NO. 848 and the antisense strand is SEQ ID NO.833.
  • the sense strand is SEQ ID NO. 849 and the antisense strand is SEQ ID NO. 834. In certain embodiments the sense strand is SEQ ID NO. 850 and the antisense strand is SEQ ID NO. 835. In certain embodiments the sense strand is SEQ ID NO.851 and the antisense strand is SEQ ID NO.836. In certain embodiments the sense strand is SEQ ID NO.852 and the antisense strand is SEQ ID NO. 837. In certain embodiments the sense strand is SEQ ID NO. 853 and the antisense strand is SEQ ID NO.838. In certain embodiments the sense strand is SEQ ID NO.854 and the antisense strand is SEQ ID NO.839.
  • the sense strand is SEQ ID NO.855 and the antisense strand is SEQ ID NO.840. In certain embodiments the sense strand is SEQ ID NO. 856 and the antisense strand is SEQ ID NO.841. In certain embodiments the sense strand is SEQ ID NO. 857 and the antisense strand is SEQ ID NO. 842. In certain embodiments the sense strand is SEQ ID NO.858 and the antisense strand is SEQ ID NO.843. In certain embodiments the sense strand is SEQ ID NO.859 and the antisense strand is SEQ ID NO. 844. In certain embodiments the sense strand is SEQ ID NO. 860 and the antisense strand is SEQ ID NO. 845. In certain embodiments the sense strand is SEQ ID NO.861 and the antisense strand is SEQ ID NO.846.
  • the siRNA molecules of the disclosure may be in the form of a single-stranded (ss) or double-stranded (ds) oligonucleotide structure.
  • the siRNA molecules may be di-branched, tri-branched, or tetra-branched molecules.
  • the siRNA molecules of the disclosure may contain one or more phosphodiester internucleoside linkages and/or an analog thereof, such as a phosphorothioate internucleoside linkage.
  • the siRNA molecules of the disclosure may further contain chemically modified nucleosides having 2’ sugar modifications.
  • siRNAs consist of a ribonucleic acid, including a ss- or ds- structure, formed by a first strand (i.e., antisense strand), and in the case of a ds-siRNA, a second strand (i.e., sense strand).
  • the first strand includes a stretch of contiguous nucleotides that is at least partially complementary to a target nucleic acid.
  • the second strand also includes a stretch of contiguous nucleotides where the second stretch is at least partially identical to a target nucleic acid.
  • the first strand and said second strand may be hybridized to each other to form a double- stranded structure.
  • the hybridization typically occurs by Watson Crick base pairing.
  • the hybridization or base pairing is not necessarily complete or perfect, which means that the first and second strand are not 100% base-paired due to mismatches.
  • One or more mismatches may also be present within the duplex without necessarily impacting the siRNA RNAi activity.
  • the first strand contains a stretch of contiguous nucleotides which is essentially complementary to a target nucleic acid.
  • the target nucleic acid sequence is, in accordance with the mode of action of interfering ribonucleic acids, a ss-RNA, e.g., an mRNA.
  • the extent to which the first strand has a complementary stretch of contiguous nucleotides to a target nucleic acid sequence may be between 80% and 100%, e.g., 80%, 85%, 90%, 95%, or 100% complementary.
  • the siRNA molecules described herein may employ modifications to the nucleobase, phosphate backbone, ribose core, 5′- and 3′-ends, and branching, wherein multiple strands of siRNA may be covalently linked.
  • the siRNA molecules described herein may contain one or more phosphodiester internucleoside linkages and/or an analog thereof, such as a phosphorothioate internucleoside linkage, in which oxyanion moieties are electrostatically neutralized by ionic bonding to a divalent metal cation, such as Ba 2+ , Be 2+ , Ca 2+ , Cu 2+ , Mg 2+ , Mn 2+ , Ni 2+ , or Zn 2+ .
  • a divalent metal cation such as Ba 2+ , Be 2+ , Ca 2+ , Cu 2+ , Mg 2+ , Mn 2+ , Ni 2+ , or Zn 2+ .
  • the one or more divalent cations includes Ca 2+ and Mg 2+ , optionally wherein the ratio of Ca 2+ to Mg 2+ is from 1:100 to 100:1 (e.g., 1:75, 1:50, 1:25, 1:10, 1:5, 1:1, 5:1, 10:1, 25:1. 50:1, 75:1, or 100:1). In certain embodiments, the Ca 2+ and Mg 2+ are present in a 1:1 ratio. In certain embodiments, the one or more divalent cations displace water from a cationic binding site of the siRNA molecule.
  • the degree of saturation of the cationic binding sites by the one or more divalent cations is from about 10% to about 100% (e.g., from about 20% to about 100%, from about 30% to about 100%, from about 40% to about 100%, from about 50% to about 100%, from about 60% to about 100%, from about 70% to about 100%, from about 80% to about 100%, or from about 90% to about 100%).
  • the cationic binding site is located within an internucleoside linkage, such as a phosphodiester linkage and/or a phosphorothioate linkage.
  • the cationic binding site may be an oxyanion moiety within a phosphodiester linage or phosphorothioate linkage.
  • the one or more divalent cations are characterized as having an ionic radius ranging from about 30 picometers to about 150 picometers (e.g., from about 30 picometers to about 140 picometers, from about 40 picometers to about 130 picometers, from about 50 picometers to about 120 picometers, from about 60 picometers to about 110 picometers, from about 60 picometers to about 100 picometers, or from about 60 picometers to about 90 picometers).
  • ionic radius ranging from about 30 picometers to about 150 picometers (e.g., from about 30 picometers to about 140 picometers, from about 40 picometers to about 130 picometers, from about 50 picometers to about 120 picometers, from about 60 picometers to about 110 picometers, from about 60 picometers to about 100 picometers, or from about 60 picometers to about 90 picometers).
  • potential lengths for an antisense strand of the siRNA molecules of the present disclosure is between 10 and 30 nucleotides (e.g., 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides, 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides, 25 nucleotides, 26 nucleotides, 27 nucleotides, 28 nucleotides, 29 nucleotides, or 30 nucleotides), 15 and 25 nucleotides (e.g., 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, 14
  • the antisense strand is 20 nucleotides. In some embodiments, the antisense strand is 21 nucleotides. In some embodiments, the antisense strand is 22 nucleotides. In some embodiments, the antisense strand is 23 nucleotides. In some embodiments, the antisense strand is 24 nucleotides. In some embodiments, the antisense strand is 25 nucleotides. In some embodiments, the antisense strand is 26 nucleotides. In some embodiments, the antisense strand is 27 nucleotides. In some embodiments, the antisense strand is 28 nucleotides. In some embodiments, the antisense strand is 29 nucleotides.
  • the antisense strand is 30 nucleotides.
  • the sense strand of the siRNA molecules of the present disclosure is between 12 and 30 nucleotides (e.g., 12 nucleotides, 13 nucleotides, 14 nucleotides, 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides, 21 nucleotides, 22 nucleotides, 23 nucleotides, 24 nucleotides, 25 nucleotides, 26 nucleotides, 27 nucleotides, 28 nucleotides, 29 nucleotides, or 30 nucleotides), or 14 and 23 nucleotides (e.g., 14 nucleotides, 15 nucleotides, 16 nucleotides, 17 nucleotides, 18 nucleotides, 19 nucleotides, 20 nucleotides,
  • the sense strand is 15 nucleotides. In some embodiments, the sense strand is 16 nucleotides. In some embodiments, the sense strand is 17 nucleotides. In some embodiments, the sense strand is 18 nucleotides. In some embodiments, the sense strand is 19 nucleotides. In some embodiments, the sense strand is 20 nucleotides. In some embodiments, the sense strand is 21 nucleotides. In some embodiments, the sense strand is 22 nucleotides. In some embodiments, the sense strand is 23 nucleotides. In some embodiments, the sense strand is 24 nucleotides. In some embodiments, the sense strand is 25 nucleotides.
  • the sense strand is 26 nucleotides. In some embodiments, the sense strand is 27 nucleotides. In some embodiments, the sense strand is 28 nucleotides. In some embodiments, the sense strand is 29 nucleotides. In some embodiments, the sense strand is 30 nucleotides. 5.3.2. 2’ Sugar Modifications [0134] The present disclosure may include ss- and ds- siRNA molecule compositions including at least one (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or more) nucleosides having 2’ sugar modifications.
  • Possible 2′-modifications include all possible orientations of OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted C1 to C10 alkyl or C2 to C10 alkenyl and alkynyl.
  • the modification includes a 2’-O-methyl (2’-O-Me) modification.
  • Other potential sugar substituent groups include: C1 to C10 lower alkyl, substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH 3 , OCN, Cl, Br, CN, CF 3 , OCF 3 , SOCH 3 , SO 2 CH 3 , ONO 2 , NO 2 , N 3 , NH 2 , heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties.
  • the modification includes 2′-methoxyethoxy (2′-O- CH 2 CH 2 OCH 3 , also known as 2′-O-(2-methoxyethyl) or 2′-MOE).
  • the modification includes 2′-dimethylaminooxyethoxy, i.e., a O(CH 2 ) 2 ON(CH 3 ) 2 group, also known as 2′-DMAOE, and 2′-dimethylaminoethoxyethoxy (also known in the art as 2′-O- dimethylamino-ethoxy-ethyl or 2′-DMAEOE), i.e., 2′-O-CH 2 OCH 2 N(CH 3 ) 2 .
  • 2′-sugar substituent groups may be in the arabino (up) position or ribo (down) position.
  • the 2′-arabino modification is 2′-F.
  • Similar modifications may also be made at other positions on the siRNA molecule, particularly the 3′ position of the sugar on the 3′ terminal nucleoside or in 2′-5′ linked oligonucleotides and the 5′ position of 5′ terminal nucleotide.
  • Oligonucleotides may also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. 5.3.3. Nucleobase Modifications [0135]
  • the siRNA molecules of the disclosure may also include nucleosides or other surrogate or mimetic monomeric subunits that include a nucleobase (often referred to in the art simply as "base” or "heterocyclic base moiety").
  • base or heterocyclic base moiety
  • the nucleobase is another moiety that has been extensively modified or substituted and such modified and or substituted nucleobases are amenable to the present disclosure.
  • unmodified or “natural” nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).
  • Nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone.
  • Further nucleobases include those disclosed in US 3,687,808, those disclosed in Kroschwitz, J.I., ed. The Concise Encyclopedia of Polymer Science and Engineering, New York, John Wiley & Sons, 1990, pp. 858-859; those disclosed by Englisch et al., Angewandte Chemie, International Edition 30:613, 1991; and those disclosed by Sanghvi, Y.S., Chapter 16, Antisense Research and Applications, CRC Press, Gait, M.J.
  • siRNA molecules of the present disclosure may also include polycyclic heterocyclic compounds in place of one or more heterocyclic base moieties.
  • a number of tricyclic heterocyclic compounds have been previously reported. These compounds are routinely used in antisense applications to increase the binding properties of the modified strand to a target strand.
  • Representative cytosine analogs that make three hydrogen bonds with a guanosine in a second strand include 1,3-diazaphenoxazine-2-one (Kurchavov et al., Nucleosides and Nucleotides, 16:1837-46, 1997), 1,3-diazaphenothiazine-2-one (Lin et al.
  • cytosine analog/substitute has an aminoethoxy moiety attached to the rigid 1,3- diazaphenoxazine-2-one scaffold (Lin et al., Am. Chem. Soc., 120:8531-2, 1998). 5.3.4. Internucleoside Linkage Modifications [0137] Another variable in the design of the present disclosure is the internucleoside linkage making up the phosphate backbone of the siRNA molecule. Although the natural RNA phosphate backbone may be employed here, derivatives thereof may be used which enhance desirable characteristics of the siRNA molecule. In certain embodiments, the siRNA molecule will be modified to exhibit reduced hydrolysis relative to the unmodified siRNA.
  • the internucleoside linkages may be between 0 and 100% phosphorothioate, e.g., between 0 and 100%, 10 and 100%, 20 and 100%, 30 and 100%, 40 and 100%, 50 and 100%, 60 and 100%, 70 and 100%, 80 and 100%, 90 and 100%, 0 and 90%, 0 and 80%, 0 and 70%, 0 and 60%, 0 and 50%, 0 and 40%, 0 and 30%, 0 and 20%, 0 and 10%, 10 and 90%, 20 and 80%, 30 and 70%, 40 and 60%, 10 and 40%, 20 and 50%, 30 and 60%, 40 and 70%, 50 and 80%, or 60 and 90% phosphorothioate linkages.
  • the internucleoside linkages may be between 0 and 100% phosphodiester linkages, e.g., between 0 and 100%, 10 and 100%, 20 and 100%, 30 and 100%, 40 and 100%, 50 and 100%, 60 and 100% 70 and 100%, 80 and 100%, 90 and 100%, 0 and 90%, 0 and 80%, 0 and 70%, 0 and 60%, 0 and 50%, 0 and 40%, 0 and 30%, 0 and 20%, 0 and 10%, 10 and 90%, 20 and 80%, 30 and 70%, 40 and 60%, 10 and 40%, 20 and 50%, 30 and 60%, 40 and 70%, 50 and 80%, or 60 and 90% phosphodiester linkages.
  • 0 and 100% phosphodiester linkages e.g., between 0 and 100%, 10 and 100%, 20 and 100%, 30 and 100%, 40 and 100%, 50 and 100%, 60 and 100% 70 and 100%, 80 and 100%, 90 and 100%, 0 and 90%, 0 and 80%, 0 and 70%, 0 and 60%, 0 and 50%, 0 and 40%,
  • oligonucleotides containing modified e.g., non-naturally occurring internucleoside linkages include internucleoside linkages that retain a phosphorus atom and internucleoside linkages that do not have a phosphorus atom.
  • modified oligonucleotides that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides.
  • an exemplary phosphorus containing modified internucleoside linkage is the phosphorothioate internucleoside linkage.
  • the modified oligonucleotide backbones containing a phosphorus atom therein include, for example, phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates, 5'-alkylene phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkyl-phosphonates, thionoalkylphosphotriesters, selenophosphates, and boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs of these, and those having inverted polarity wherein one or more internucleotide linkages is
  • Exemplary U.S. patents describing the preparation of phosphorus-containing linkages include but are not limited to, U.S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,195; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,316; 5,550,111; 5,563,253; 5,571,799; 5,587,361; 5,625,050; 6,028,188; 6,124,445; 6,160,109; 6,169,170; 6,172,209; 6,239,265; 6,277,603; 6,326,199; 6,346,614; 6,444,423; 6,531,590; 6,534,639; 6,
  • the modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages.
  • patents that teach the preparation of non-phosphorus backbones include, but are not limited to, U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,64,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and 5,677,439, the entire contents of each of which are hereby incorporated herein by reference.
  • the siRNA may contain an antisense strand including a region represented by Formula I, wherein Formula I is, in the 5’-to-3’ direction A-B-(A’) j -C-P 2 -D-P 1 -(C’-P 1 ) k -C’ Formula I; wherein A is represented by the formula C-P 1 -D-P 1 ; each A’ is represented by the formula C- P 2 -D-P 2 ; B is represented by the formula C-P 2 -D-P 2 -D-P 2 -D-P 2 ; each C is a 2’-O-methyl (2’- O-Me) ribonucleoside; each C’, independently, is a 2’-O-Me ribonucleoside
  • the antisense strand includes a structure represented by Formula A1, wherein Formula A1 is, in the 5’-to-3’ direction: A-S-B-S-A-O-B-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-S-A-S-A-S- A-S-B-S-A Formula A1; wherein A represents a 2’-O-Me ribonucleoside, B represents a 2’-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside
  • the siRNA may contain an antisense strand including a region represented by Formula II, wherein Formula II is, in the 5’-to-3’ direction: A-B-(A’) j -C-P 2 -D-P 1 -(C-P 1 ) k -C’ Formula II; wherein A is represented by the formula C-P 1 -D-P 1 ; each A’ is represented by the formula C- P 2 -D-P 2 ; B is represented by the formula C-P 2 -D-P 2 -D-P 2 -D-P 2 ; each C is a 2’-O-methyl (2’- O-Me) ribonucleoside; each C’, independently, is a 2’-O-Me ribonucleoside or a 2’-fluoro (2’- F) ribonucleoside; each D is a 2’-F ribonucleoside; each P 1 is a phosphorative, a phosphorative,
  • the antisense strand includes a structure represented by Formula A2, wherein Formula A2 is, in the 5’-to-3’ direction: A-S-B-S-A-O-B-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-S-A-S-A-S- A-S-A-S-A-S- A-S-A-S-A Formula A2; [0145] wherein A represents a 2’-O-Me ribonucleoside, B represents a 2’-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothi
  • the sense strand includes a structure represented by Formula III, wherein Formula III is, in the 5’-to-3’ direction: E-(A’) m -F Formula III; wherein E is represented by the formula (C-P 1 ) 2 ; F is represented by the formula (C-P 2 ) 3 -D-P 1 - C-P 1 -C, (C-P 2 ) 3 -D-P 2 -C-P 2 -C, (C-P 2 ) 3 -D-P 1 -C-P 1 -D, or (C-P 2 ) 3 -D-P 2 -C-P 2 -D; A’, C, D, P 1 , and P 2 are as defined in Formula I; and m is an integer from 1 to 7 (e.g., 1, 2, 3, 4, 5, 6, or 7).
  • the sense strand is complementary (e.g., fully or partially complementary) to the antisense strand.
  • the sense strand includes a structure represented by Formula S1, wherein Formula S1 is, in the 5’-to-3’ direction: A-S-A-S-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-A-O-B-S-A-S-A Formula S1; wherein A represents a 2’-O-Me ribonucleoside, B represents a 2’-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.
  • the sense strand includes a structure represented by Formula S2, wherein Formula S2 is, in the 5’-to-3’ direction: A-S-A-S-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-A-O-B-O-A-O-A-O-B-O-A-O-A-O-A Formula S2; wherein A represents a 2’-O-Me ribonucleoside, B represents a 2’-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.
  • A represents a 2’-O-Me ribonucleoside
  • B represents a 2’-F ribonucleoside
  • O represents a phosphodiester internucleoside linkage
  • S represents a phosphorothioate internucleoside linkage
  • the sense strand includes a structure represented by Formula S3, wherein Formula S3 is, in the 5’-to-3’ direction: A-S-A-S-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-A-O-B-S-A-S-B Formula S3; wherein A represents a 2’-O-Me ribonucleoside, B represents a 2’-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.
  • A represents a 2’-O-Me ribonucleoside
  • B represents a 2’-F ribonucleoside
  • O represents a phosphodiester internucleoside linkage
  • S represents a phosphorothioate internucleoside linkage.
  • the sense strand includes a structure represented by Formula S4, wherein Formula S4 is, in the 5’-to-3’ direction: A-S-A-S-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-A-O-B-O-A-O-B-O-A-O-B Formula S4; wherein A represents a 2’-O-Me ribonucleoside, B represents a 2’-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.
  • A represents a 2’-O-Me ribonucleoside
  • B represents a 2’-F ribonucleoside
  • O represents a phosphodiester internucleoside linkage
  • S represents a phosphorothioate internucleoside linkage.
  • the siRNA may contain an antisense strand including a region represented by Formula IV, wherein Formula IV is, in the 5’-to-3’ direction: A-(A’) j -C-P 2 -B-(C-P 1 ) k -C’ Formula IV; wherein A is represented by the formula C-P 1 -D-P 1 ; each A’ is represented by the formula C- P 2 -D-P 2 ; B is represented by the formula D-P 1 -C-P 1 -D-P 1 ; each C is a 2’-O-Me ribonucleoside; each C’, independently, is a 2’-O-Me ribonucleoside or a 2’-F ribonucleoside; each D is a 2’- F ribonucleoside; each P 1 is a phosphorothioate internucleoside linkage; each P 2 is a phosphodiester internucle
  • the antisense strand is complementary (e.g., fully or partially complementary) to a target nucleic acid.
  • the antisense strand includes a structure represented by Formula A3, wherein Formula A3 is, in the 5’-to-3’ direction: A-S-B-S-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-S-A-S-B-S- A-S-A-S-A Formula A3; wherein A represents a 2’-O-Me ribonucleoside, B represents a 2’-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate intern
  • the siRNA of the disclosure may have a sense strand represented by Formula V, wherein Formula V is, in the 5’-to-3’ direction: E-(A’) m -C-P 2 -F Formula V; [0154] wherein E is represented by the formula (C-P 1 ) 2 ; F is represented by the formula D-P 1 - C-P 1 -C, D-P 2 -C-P 2 -C, D-P 1 -C-P 1 -D, or D-P 2 -C-P 2 -D; A’, C, D, P 1 , and P 2 are as defined in Formula IV; and m is an integer from 1 to 7 (e.g., 1, 2, 3, 4, 5, 6, or 7).
  • E is represented by the formula (C-P 1 ) 2
  • F is represented by the formula D-P 1 - C-P 1 -C, D-P 2 -C-P 2 -C, D-P 1 -C-P 1 -D, or D-
  • the sense strand is complementary (e.g., fully or partially complementary) to the antisense strand.
  • the sense strand includes a structure represented by Formula S5, wherein Formula S5 is, in the 5’-to-3’ direction: A-S-A-S-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-S-A-S-A Formula S5; wherein A represents a 2’-O-Me ribonucleoside, B represents a 2’-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.
  • the sense strand includes a structure represented by Formula S6, wherein Formula S6 is, in the 5’-to-3’ direction: A-S-A-S-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-A-O-A Formula S6; wherein A represents a 2’-O-Me ribonucleoside, B represents a 2’-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.
  • A represents a 2’-O-Me ribonucleoside
  • B represents a 2’-F ribonucleoside
  • O represents a phosphodiester internucleoside linkage
  • S represents a phosphorothioate internucleoside linkage
  • the sense strand includes a structure represented by Formula S7, wherein Formula S7 is, in the 5’-to-3’ direction: A-S-A-S-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-S-A-S-B Formula S7; wherein A represents a 2’-O-Me ribonucleoside, B represents a 2’-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.
  • A represents a 2’-O-Me ribonucleoside
  • B represents a 2’-F ribonucleoside
  • O represents a phosphodiester internucleoside linkage
  • S represents a phosphorothioate internucleoside linkage.
  • the sense strand includes a structure represented by Formula S8, wherein Formula S8 is, in the 5’-to-3’ direction: A-S-A-S-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B Formula S8; wherein A represents a 2’-O-Me ribonucleoside, B represents a 2’-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.
  • A represents a 2’-O-Me ribonucleoside
  • B represents a 2’-F ribonucleoside
  • O represents a phosphodiester internucleoside linkage
  • S represents a phosphorothioate internucleoside linkage.
  • the siRNA may contain an antisense strand including a region represented by Formula VI, wherein Formula VI is, in the 5’-to-3’ direction: 2- B j -E-B k -E-F-G l -D-P 1 -C’ Formula VI; wherein A is represented by the formula C-P 1 -D-P 1 ; each B is represented by the formula C- P 2 ; each C is a 2’-O-Me ribonucleoside; each C’, independently, is a 2’-O-Me ribonucleoside or a 2’-F ribonucleoside; each D is a 2’-F ribonucleoside; each E is represented by the formula D-P 2 -C-P 2 ; F is represented by the formula D-P 1 -C-P 1 ; each G is represented by the formula C-P 1 ; each P 1 is a phosphorothioate internucle
  • j is 3. In some embodiments, k is 6. In some embodiments, l is 2. In some embodiments, j is 3, k is 6, and l is 2.
  • the antisense strand is complementary (e.g., fully or partially complementary) to a target nucleic acid.
  • the antisense strand includes a structure represented by Formula A4, wherein Formula A4 is, in the 5’-to-3’ direction: A-S-B-S-A-O-A-O-A-O-B-O-A-O-A-O-A-O-A-O-A-O-B-O-A-S-A-S- A-S-B-S-A Formula A4; wherein A represents a 2’-O-Me ribonucleoside, B represents a 2’-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.
  • A represents a 2’-O-Me ribonucleoside
  • B represents a 2’-F ribonucleoside
  • O represents a phosphodiester internucleoside linkage
  • S represents a phosphorothioate internucleoside linkage.
  • the siRNA may contain a sense strand including a region represented by Formula VII, wherein Formula VII is, in the 5’-to-3’ direction: H-B m -I n -A’-B o -H-C Formula VII; wherein A’ is represented by the formula C-P 2 -D-P 2 ; each H is represented by the formula (C- P 1 ) 2 ; each I is represented by the formula (D-P 2 ); B, C, D, P 1 , and P 2 are as defined in Formula VI; m is an integer from 1 to 7 (e.g., 1, 2, 3, 4, 5, 6, or 7); n is an integer from 1 to 7 (e.g., 1, 2, 3, 4, 5, 6, or 7); and o is an integer from 1 to 7 (e.g., 1, 2, 3, 4, 5, 6, or 7).
  • m is 3. In some embodiments, n is 3. In some embodiments, o is 3. In some embodiments, m is 3, n is 3, and o is 3.
  • the sense strand is complementary (e.g., fully or partially complementary) to the antisense strand.
  • the sense strand includes a structure represented by Formula S9, wherein Formula S9 is, in the 5’-to-3’ direction: A-S-A-S-A-O-A-O-A-O-B-O-B-O-B-O-A-O-B-O-A-O-A-O-A-S-A-S-A Formula S9; wherein A represents a 2’-O-Me ribonucleoside, B represents a 2’-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.
  • A represents a 2’-O-Me ribonucleoside
  • B represents a 2’-F ribonucleoside
  • O represents a phosphodiester internucleoside linkage
  • S represents a phosphorothioate internucleoside linkage.
  • the siRNA may contain an antisense strand including a region that is represented by Formula VIII: Z-((A-P-) n (B-P-) m ) q ; Formula VIII wherein Z is a 5’ phosphorus stabilizing moiety; each A is a 2’-O-methyl (2′-O-Me) ribonucleoside; each B is a 2′-fluoro-ribonucleoside; each P is, independently, an internucleoside linkage selected from a phosphodiester linkage and a phosphorothioate linkage; n is an integer from 1 to 5 (e.g., 1, 2, 3, 4, or 5); m is an integer from 1 to 5 (e.g., 1, 2, 3, 4, or 5); and q is an integer between 1 and 30 (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30).
  • siRNA molecules of the disclosure can be synthesized by standard methods known in the art as further discussed below, e.g., by use of an automated DNA synthesizer, such as are commercially available from, for example, Biosearch, Applied Biosystems, Inc.
  • the siRNA agent can be prepared using solution-phase or solid-phase organic synthesis or both.
  • Organic synthesis offers the advantage that the oligonucleotide including unnatural or modified nucleotides can be easily prepared.
  • siRNA molecules of the disclosure can be prepared using solution-phase or solid-phase organic synthesis or both.
  • siRNA agent for any siRNA agent disclosed herein, further optimization could be achieved by systematically either adding or removing linked nucleosides to generate longer or shorter sequences. Further still, such optimized sequences can be adjusted by, e.g., the introduction of modified nucleosides, and/or modified internucleoside linkages as described herein or as known in the art, including alternative nucleosides, alternative sugar moieties, and/or alternative internucleoside linkages as known in the art and/or discussed herein to further optimize the molecule (e.g., increasing serum stability or circulating half-life, increasing thermal stability, enhancing transmembrane delivery, and/or targeting to a particular location or cell type). 5.6.
  • 5′ Phosphorus Stabilizing Moieties may be employed.
  • a 5′-phosphorus stabilizing moiety replaces the 5′-phosphate to prevent hydrolysis of the phosphate. Hydrolysis of the 5′-phosphate prevents binding to RISC, a necessary step in gene silencing. Any replacement for phosphate that does not impede binding to RISC is contemplated in this disclosure. In some embodiments, the replacement for the 5′-phosphate is also stable to in vivo hydrolysis.
  • Each strand of a siRNA molecule may independently and optionally employ any suitable 5′-phosphorus stabilizing moiety.
  • Some embodiments employ hydroxy as in Formula IX, phosphate as in Formula X, vinylphosphonates as in Formula XI and XIV, 5’-methyl-substitued phosphates as in Formula XII, XIII, and XVI, methylenephosphonates as in Formula XV, or vinyl 5′-vinylphsophonate as a 5′-phosphorus stabilizing moiety as demonstrated in Formula XI.
  • the present disclosure further provides siRNA molecules having one or more hydrophobic moieties attached thereto. The hydrophobic moiety may be covalently attached to the 5’ end or the 3’ end of the siRNA molecules of the disclosure.
  • Non-limiting examples of hydrophobic moieties suitable for use with the siRNA molecules of the disclosure may include cholesterol, vitamin D, tocopherol, phosphatidylcholine (PC), docosahexaenoic acid, docosanoic acid, PC-docosanoic acid, eicosapentaenoic acid, lithocholic acid or any combination of the aforementioned hydrophobic moieties with PC.
  • siRNA Branching [0170]
  • the siRNA molecules of the disclosure may be branched.
  • the siRNA molecules of the disclosure may have one of several branching patterns, as described herein.
  • the siRNA molecules disclosed herein may be branched siRNA molecules.
  • the siRNA molecule may not be branched, or may be di- branched, tri-branched, or tetra-branched, connected through a linker. Each main branch may be further branched to allow for 2, 3, 4, 5, 6, 7, or 8 separate RNA single- or double-strands.
  • the branch points on the linker may stem from the same atom, or separate atoms along the linker.
  • the siRNA molecule is a branched siRNA molecule.
  • the branched siRNA molecule is di-branched, tri-branched, or tetra-branched.
  • the di-branched siRNA molecule is represented by any one of Formulas XVII-XIX, wherein each RNA, independently, is an siRNA molecule, L is a linker, and each X, independently, represents a branch point moiety (e.g., phosphoroamidite, tosylated solketal, 1,3-diaminopropanol, pentaerythritol, or any one of the branch point moieties described in US 10,478,503).
  • a branch point moiety e.g., phosphoroamidite, tosylated solketal, 1,3-diaminopropanol, pentaerythritol, or any one of the branch point moieties described in US 10,478,503.
  • Multiple strands of siRNA described herein may be covalently attached by way of a linker.
  • linking moiety may be employed which is not incompatible with the siRNAs of the present invention.
  • Linkers include ethylene glycol chains of 2 to 10 subunits (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10 subunits), alkyl chains, carbohydrate chains, block copolymers, peptides, RNA, DNA, and others.
  • any carbon or oxygen atom of the linker is optionally replaced with a nitrogen atom, bears a hydroxyl substituent, or bears an oxo substituent.
  • the linker is a poly-ethylene glycol (PEG) linker.
  • PEG linkers suitable for use with the disclosed compositions and methods include linear or non-linear PEG linkers. Examples of non-linear PEG linkers include branched PEGs, linear forked PEGs, or branched forked PEGs.
  • PEG linkers of various weights may be used with the disclosed compositions and methods.
  • the PEG linker may have a weight that is between 5 and 500 Daltons.
  • a PEG linker having a weight that is between 500 and 1,000 Dalton may be used.
  • a PEG linker having a weight that is between 1,000 and 10,000 Dalton may be used.
  • a PEG linker having a weight that is between 200 and 20,000 Dalton may be used.
  • the linker is covalently attached to a sense strand of the siRNA.
  • the linker is covalently attached to an antisense strand of the siRNA.
  • the PEG linker is a triethylene glycol (TrEG) linker.
  • the PEG linker is a tetraethylene glycol (TEG) linker.
  • the linker is an alkyl chain linker.
  • the linker is a peptide linker.
  • the linker is an RNA linker.
  • the linker is a DNA linker.
  • Linkers may covalently link 2, 3, 4, or 5 unique siRNA strands.
  • the linker may covalently bind to any part of the siRNA oligomer.
  • the linker attaches to the 3′ end of nucleosides of each siRNA strand.
  • the linker attaches to the 5′ end of nucleosides of each siRNA strand.
  • the linker attaches to a nucleoside of an siRNA strand (e.g., sense or antisense strand) by way of a covalent bond- forming moiety.
  • the covalent-bond-forming moiety is selected from the group consisting of an alkyl, ester, amide, carbonate, carbamate, triazole, urea, formacetal, phosphonate, phosphate, and phosphate derivative (e.g., phosphorothioate, phosphoramidate, etc.).
  • the linker is a divalent oligonucleotide (DIO) linker [0179]
  • the linker has a structure of Formula L1: (Formula L1) [0180]
  • the linker has a structure of Formula L2: .
  • the linker has a structure of Formula L3: (Formula L3) [0182] In some embodiments, the linker has a structure of Formula L4: . (Formula L4) [0183] In some embodiments, the linker has a structure of Formula L5: . (Formula L5) [0184] In some embodiments, the linker has a structure of Formula L6: . (Formula L6) [0185] In some embodiments, the linker has a structure of Formula L7, as is shown below: . (Formula L7) [0186] In some embodiments, the linker has a structure of Formula L8: .
  • the linker has a structure of Formula L9: .
  • the selection of a linker for use with one or more of the branched siRNA molecules disclosed herein may be based on the hydrophobicity of the linker, such that, e.g., desirable hydrophobicity is achieved for the one or more branched siRNA molecules of the disclosure.
  • a linker containing an alkyl chain may be used to increase the hydrophobicity of the branched siRNA molecule as compared to a branched siRNA molecule having a less hydrophobic linker or a hydrophilic linker.
  • siRNA agents disclosed herein may be synthesized and/or modified by methods well established in the art, such as those described in Beaucage, S. L. et al. (edrs.), Current Protocols in Nucleic Acid Chemistry, John Wiley & Sons, Inc., New York, N.Y., 2000, which is hereby incorporated herein by reference. 5.8. Methods of Treatment [0190]
  • the MAPT-targeting siRNA molecules of the disclosure may be delivered to a subject, thereby treating a tauopathy.
  • tauopathies include Alzheimer’s disease, frontotemporal dementia, progressive supranuclear palsy, corticobasal degeneration or any other medical risk(s) associated with the MAPT gene.
  • siRNA molecules of the disclosure may also be delivered to a subject having a variant of the MAPT gene for which siRNA-mediated gene silencing of the MAPT variant gene reduces the expression level of MAPT transcript, thereby treating a tauopathy, e.g., Alzheimer’s disease, frontotemporal dementia, progressive supranuclear palsy, corticobasal degeneration or any other medical risk(s) associated with the MAPT gene [0191]
  • a tauopathy e.g., Alzheimer’s disease, frontotemporal dementia, progressive supranuclear palsy, corticobasal degeneration or any other medical risk(s) associated with the MAPT gene
  • the gene silencing may be performed in a subject to silence wild type MAPT transcripts, mutant MAPT transcripts, splice isoforms of MAPT transcripts, and/or overexpressed MAPT transcripts thereof, relative to a healthy subject.
  • the method may include delivering to the CNS or affected tissues of the subject (e.g., a human) the siRNA molecules of the disclosure or a pharmaceutical composition containing the same by any appropriate route of administration (e.g., intracerebroventricular, intrathecal injection, intrastriatal injection, intra-cisterna magna injection by catheterization, intraparenchymal injection, intravenous injection, subcutaneous injection, or intramuscular injection).
  • the active compound can be administered in any suitable dose.
  • the actual dosage amount of a composition of the present disclosure administered to a patient can be determined by physical and physiological factors such as body weight, severity of condition, previous or concurrent therapeutic interventions, idiopathy of the patient and on the route of administration.
  • the number of administrations of an exemplary dosage and/or an effective amount may vary according to the response of the subject.
  • the practitioner responsible for administration will, in any event, determine the concentration of active ingredient(s) in a composition and appropriate dose(s) for the individual subject. Administration may occur any suitable number of times per day, and for as long as necessary.
  • Subjects may be adult or pediatric humans, with or without comorbid diseases. 5.8.1.
  • Subjects that may be treated with the siRNA molecules disclosed herein are subjects in need of treatment of, for example, a tauopathy, Alzheimer’s disease, frontotemporal dementia, progressive supranuclear palsy, corticobasal degeneration or any other medical risk(s) associated with the MAPT gene.
  • Subjects that may be treated with the siRNA molecules disclosed herein may include, for example, humans, monkeys, rats, mice, pigs, and other mammals containing at least one orthologous copy of the MAPT gene. Subjects may be adult or pediatric humans, with or without comorbid diseases. 5.8.2.
  • the siRNA molecules in the present disclosure may be formulated into a pharmaceutical composition for administration to a subject in a biologically compatible form suitable for administration in vivo. Accordingly, the present disclosure provides a pharmaceutical composition containing a siRNA molecule of the disclosure in admixture with a suitable diluent, carrier, or excipient.
  • the siRNA molecules may be administered, for example, directly into the CNS or affected tissues of the subject (e.g., by way of intracerebroventricular, intrastriatally, intrathecal injection, intra-cisterna magna injection by catheterization, intraparenchymal injection, intravenous injection, subcutaneous injection, or intramuscular injection).
  • a pharmaceutical composition may contain a preservative, e.g., to prevent the growth of microorganisms.
  • Pharmaceutical compositions may include sterile aqueous solutions, dispersions, or powders, e.g., for the extemporaneous preparation of sterile solutions or dispersions.
  • a pharmaceutical composition may be administered to a subject, e.g., a human subject, alone or in combination with pharmaceutically acceptable carriers, as noted herein, the proportion of which may be determined by the solubility and/or chemical nature of the compound, chosen route of administration, and standard pharmaceutical practice. 5.8.3. Dosing Regimens [0197] A physician having ordinary skill in the art can readily determine an effective amount of the siRNA molecule for administration to a mammalian subject (e.g., a human) in need thereof.
  • a physician could start prescribing doses of one the siRNA molecules of the disclosure at levels lower than that required to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved.
  • a physician may begin a treatment regimen by administering one of the siRNA molecules of the disclosure at a high dose and subsequently administer progressively lower doses until reaching a minimal dosage at which a therapeutic effect is achieved (e.g., a reduction in expression of a target gene sequence).
  • a suitable daily dose of one of the siRNA molecules of the disclosure will be an amount of the siRNA molecule which is the lowest dose effective to produce a therapeutic effect.
  • the ss- or ds-siRNA molecules of the disclosure may be administered by injection, e.g., intrathecally, intracerebroventricularly, by intra-cisterna magna injection by catheterization, intraparenchy-mally, intravenously, subcutaneously, or intramuscularly.
  • a daily dose of a therapeutic composition of the siRNA molecules of the disclosure may be administered as a single dose or as two, three, four, five, six or more doses administered separately at appropriate intervals throughout the day, week, month, or year, optionally, in unit dosage forms. While it is possible for the siRNA molecules of the disclosure to be administered alone, it may also be administered as a pharmaceutical formulation in combination with excipients, carriers, and optionally, additional therapeutic agents. 5.8.4.
  • the method of the disclosure contemplates any route of administration tolerated by the therapeutic composition. Some embodiments of the method include injection intrathecally, intracerebroventricularly, intrastriatally, intraparenchymally, or by intra-cisterna magna injection by catheterization.
  • Intrathecal injection is the direct injection into the spinal column or subarachnoid space. By injecting directly into the CSF of the spinal column the siRNA molecules of the disclosure have direct access to cells (e.g., neurons and glial cells) in the spinal column and a route to access the cells in the brain by bypassing the blood brain barrier.
  • Intracerebroventricular (ICV) injection is a method to directly inject into the CSF of the cerebral ventricles.
  • Intrastriatal injection is the direct injection into the striatum, or corpus striatum.
  • the striatum is an area in the subcortical basal ganglia in the brain. Injecting into the striatum bypasses the blood brain barrier and the pharmacokinetic challenges of injection into the blood stream and allows for direct access to the cells of the brain.
  • Intraparenchymal administration is the direct injection into the parenchyma (e.g., the brain parenchyma).
  • Intra-cisterna magna injection by catheterization is the direct injection into the cisterna magna.
  • the cisterna magna is the area of the brain located between the cerebellum and the dorsal surface of the medulla oblongata. Injecting into the cisterna magna results in more direct delivery to the cells of the cerebellum, brainstem, and spinal cord.
  • the therapeutic composition may be delivered to the subject by way of systemic administration, e.g., intravenously, intramuscularly, or subcutaneously.
  • Intravenous (IV) injection is a method to directly inject into the bloodstream of a subject.
  • the IV administration may be in the form of a bolus dose or by way of continuous infusion, or any other method tolerated by the therapeutic composition.
  • Intramuscular (IM) injection is injection into a muscle of a subject, such as the deltoid muscle or gluteal muscle. IM may allow for rapid absorption of the therapeutic composition.
  • Subcutaneous injection is injection into subcutaneous tissue. Absorption of compositions delivered subcutaneously may be slower than IV or IM injection, which may be beneficial for compositions requiring continuous absorption. 6.
  • Embodiment 1 A small interfering RNA (siRNA) molecule comprising an antisense strand and sense strand having complementarity to the antisense strand, wherein the antisense strand is from 10 to 30 nucleotides in length and has complementarity sufficient to hybridize to a region within a microtubule-associated protein tau (MAPT) mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 409-816.
  • siRNA small interfering RNA
  • siRNA molecule of embodiment 2 wherein the antisense strand has at least 75% complementarity to a region of 21 contiguous nucleobases within the MAPT mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 409-816, optionally wherein the antisense strand has at least 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementarity to the region within the MAPT mRNA transcript having the nucleic acid sequence of any one of SEQ ID Nos: 409-816.
  • Embodiment 4 The siRNA molecule of any one of embodiments 1-3, wherein the antisense strand comprises at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the MAPT mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 409-816.
  • Embodiment 5 Embodiment 5.
  • siRNA molecule of embodiment 4 wherein the antisense strand comprises from 10 to 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the MAPT mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 409-816.
  • Embodiment 6 The siRNA molecule of embodiment 5, wherein the antisense strand comprises from 12 to 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the MAPT mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 409-816.
  • siRNA molecule of embodiment 6, wherein the antisense strand comprises from 15 to 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the MAPT mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 409-816.
  • Embodiment 8 The siRNA molecule of embodiment 7, wherein the antisense strand comprises from 18 to 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the MAPT mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 409-816.
  • siRNA molecule of embodiment 8 wherein the antisense strand comprises from 21 to 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the MAPT mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 409-816.
  • Embodiment 10. The siRNA molecule of any one of embodiments 1-9, wherein the antisense strand comprises from 24 to 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the MAPT mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 409-816.
  • Embodiment 11
  • siRNA molecule of embodiment 10, wherein the antisense strand comprises 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the MAPT mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 409-816.
  • siRNA molecule of any one of embodiments 1-11 wherein the antisense strand comprises 9 or fewer nucleotide mismatches relative to a region of 21 contiguous nucleobases of the MAPT mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 409-816, optionally wherein the antisense strand comprises 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer, or only 1 mismatch relative to the region of the MAPT mRNA transcript having the nucleic acid sequence of any one of SEQ ID NOs: 409-816.
  • Embodiment 13 Embodiment 13.
  • Embodiment 14 The siRNA molecule of embodiment 13, wherein the region of the MAPT mRNA transcript has the nucleic acid sequence of any one of SEQ ID NOs: 817-821, 823- 825, and 827-830.
  • Embodiment 15 The siRNA molecule of any one of embodiments 1-14, wherein the antisense strand has a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of any one of SEQ ID NOs: 1-408.
  • Embodiment 17 The siRNA molecule of embodiment 16, wherein the antisense strand has a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NOs: 1-408, optionally wherein the antisense strand has a nucleic acid sequence that is at least 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 1-408.
  • the siRNA molecule of embodiment 17, wherein the antisense strand has the nucleic acid sequence of any one of SEQ ID NOs: 1-408.
  • Embodiment 19 The siRNA molecule of any one of embodiments 15-18, wherein the nucleic acid sequence is any one of SEQ ID NOs: 834-846.
  • Embodiment 20 The siRNA molecule of embodiment 19, wherein the nucleic acid sequence is any one of SEQ ID NOs: 834-836, 838-840, and 842-845.
  • Embodiment 21 The siRNA molecule of any one of embodiments 1-20, wherein the sense strand has a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of any one of SEQ ID NOs: 409-816.
  • Embodiment 22 The siRNA molecule of embodiment 21, wherein the sense strand has a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence of any one of SEQ ID NOs: 409-816.
  • Embodiment 23 The siRNA molecule of embodiment 22, wherein the sense strand has a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence of SEQ ID NOs: 409-816, optionally wherein the sense strand has a nucleic acid sequence that is at least 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of any one of SEQ ID NOs: 409-816.
  • Embodiment 24 Embodiment 24.
  • Embodiment 27 Embodiment 27.
  • Embodiment 28 The siRNA molecule of embodiment 27, wherein the antisense strand comprises a structure represented by Formula A1, wherein Formula A1 is, in the 5’-to-3’ direction: A-S-B-S-A-O-B-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-S-A-S-A-S- A-S-B-S-A Formula A1; wherein A represents a 2’-O-Me ribonucleoside, B represents a 2’-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.
  • A represents a 2’-O-Me ribonucleoside
  • B represents a 2’-F ribonucleoside
  • O represents a phosphodiester internucleoside link
  • Embodiment 29 The siRNA molecule of any one of embodiments 1-26, wherein the antisense strand comprises a structure represented by Formula II, wherein Formula II is, in the 5’-to-3’ direction: A-B-(A’) j -C-P 2 -D-P 1 -(C-P 1 ) k -C’ Formula II; wherein A is represented by the formula C-P 1 -D-P 1 ; each A’ is represented by the formula C-P 2 -D-P 2 ; B is represented by the formula C-P 2 -D-P 2 -D-P 2 -D-P 2 ; each C is a 2’-O-methyl (2’-O-Me) ribonucleoside; each C’, independently, is a 2’-O-Me ribonucleoside or a 2’-fluoro (2’-F) ribonucleoside; each D is a 2’-F ribonucleoside; each P 1
  • Embodiment 30 The siRNA molecule of embodiment 29, wherein the antisense strand comprises a structure represented by Formula A2, wherein Formula A2 is, in the 5’-to-3’ direction: A-S-B-S-A-O-B-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-S-A-S- A-S-A-S-A Formula A2; wherein A represents a 2’-O-Me ribonucleoside, B represents a 2’-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.
  • Formula A2 is, in the 5’-to-3’ direction: A-S-B-S-A-O-B-O-B-O-A-O-B-O-A-O-B-O-
  • Embodiment 31 The siRNA molecule of any one of embodiments 1-30, wherein the sense strand comprises a structure represented by Formula III, wherein Formula III is, in the 5’-to- 3’ direction: E-(A’) m -F Formula III; wherein E is represented by the formula (C-P 1 ) 2 ; F is represented by the formula (C-P 2 ) 3 -D-P 1 -C-P 1 -C, (C-P 2 ) 3 -D-P 2 -C-P 2 -C, (C-P 2 ) 3 -D-P 1 -C- P 1 -D, or (C-P 2 ) 3 -D-P 2 -C-P 2 -D; A’, C, D, P 1 , and P 2 are as defined in Formula II; and m is an integer from 1 to 7.
  • Embodiment 32 The siRNA molecule of embodiment 31, wherein the sense strand comprises a structure represented by Formula S1, wherein Formula S1 is, in the 5’-to-3’ direction: A-S-A-S-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-A-O-B-S-A-S-A Formula S1; wherein A represents a 2’-O-Me ribonucleoside, B represents a 2’-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.
  • Formula S1 is, in the 5’-to-3’ direction: A-S-A-S-A-O-B-O-A-O-B-O-A-O-B-O-A-O-A-O-B-S-A-S-A Formula S1; wherein A represents
  • siRNA molecule of embodiment 31, wherein the sense strand comprises a structure represented by Formula S2, wherein Formula S2 is, in the 5’-to-3’ direction: A-S-A-S-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-A-O-B-O-A-O-A-O-B-O-A-O-A-O-A Formula S2; wherein A represents a 2’-O-Me ribonucleoside, B represents a 2’-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.
  • Formula S2 is, in the 5’-to-3’ direction: A-S-A-S-A-O-B-O-A-O-B-O-A-O-B-O-A-O-A-A-O-A Formula S2; where
  • siRNA molecule of embodiment 31, wherein the sense strand comprises a structure represented by Formula S3, wherein Formula S3 is, in the 5’-to-3’ direction: A-S-A-S-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-A-O-B-S-A-S-B Formula S3; wherein A represents a 2’-O-Me ribonucleoside, B represents a 2’-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.
  • Formula S3 is, in the 5’-to-3’ direction: A-S-A-S-A-O-B-O-A-O-B-O-A-O-B-O-A-O-A-B-S-A-S-B Formula S3; wherein A represents a 2’-O-Me
  • siRNA molecule of embodiment 31, wherein the sense strand comprises a structure represented by Formula S4, wherein Formula S4 is, in the 5’-to-3’ direction: A-S-A-S-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-A-O-B-O-A-O-B-O-A-O-B Formula S4; wherein A represents a 2’-O-Me ribonucleoside, B represents a 2’-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.
  • Formula S4 is, in the 5’-to-3’ direction: A-S-A-S-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B Formula S4; wherein A represents a 2
  • siRNA molecule of any one of embodiments 1-26 and 31-35, wherein the antisense strand comprises a structure represented by Formula IV, wherein Formula IV is, in the 5’-to-3’ direction: A-(A’) j -C-P 2 -B-(C-P 1 ) k -C’ Formula IV; wherein A is represented by the formula C-P 1 -D-P 1 ; each A’ is represented by the formula C-P 2 -D-P 2 ; B is represented by the formula D-P 1 -C-P 1 -D-P 1 ; each C is a 2’-O-Me ribonucleoside; each C’, independently, is a 2’-O-Me ribonucleoside or a 2’-F ribonucleoside; each D is a 2’-F ribonucleoside; each P 1 is a phosphorothioate internucleoside linkage; each P 2 is a phosphodiester
  • Embodiment 37 The siRNA molecule of embodiment 36, wherein the antisense strand comprises a structure represented by Formula A3, wherein Formula A3 is, in the 5’-to-3’ direction: A-S-B-S-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-S-A-S-B-S- A-S-A-S-A Formula A3; wherein A represents a 2’-O-Me ribonucleoside, B represents a 2’-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.
  • A represents a 2’-O-Me ribonucleoside
  • B represents a 2’-F ribonucleoside
  • O represents a phosphodiester intern
  • Embodiment 38 The siRNA molecule of any one of embodiments 1-30, 36, and 37, wherein the sense strand comprises a structure represented by Formula V, wherein Formula V is, in the 5’-to-3’ direction: E-(A’) m -C-P 2 -F Formula V; wherein E is represented by the formula (C-P 1 ) 2 ; F is represented by the formula D-P 1 -C-P 1 -C, D-P 2 -C-P 2 -C, D-P 1 -C-P 1 -D, or D-P 2 -C-P 2 -D; A’, C, D, P 1 and P 2 are as defined in Formula IV; and m is an integer from 1 to 7.
  • Embodiment 39 Embodiment 39.
  • Formula S5 is, in the 5’-to-3’ direction: A-S-A-S-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-S-A-S-A Formula S5; wherein A represents a 2’-O-Me ribonucle
  • Formula S6 is, in the 5’-to-3’ direction: A-S-A-S-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-A Formula S
  • the siRNA molecule of embodiment 38, wherein the sense strand comprises a structure represented by Formula S7, wherein Formula S7 is, in the 5’-to-3’ direction: A-S-A-S-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-S-A-S-B Formula S7; wherein A represents a 2’-O-Me ribonucleoside, B represents a 2’-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.
  • Formula S7 is, in the 5’-to-3’ direction: A-S-A-S-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-S-A-S-B Formula S7; wherein A represents a 2’-O-Me ribon
  • siRNA molecule of embodiment 38 wherein the sense strand comprises a structure represented by Formula S8, wherein Formula S8 is, in the 5’-to-3’ direction: A-S-A-S-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B Formula S8; wherein A represents a 2’-O-Me ribonucleoside, B represents a 2’-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.
  • Formula S8 is, in the 5’-to-3’ direction: A-S-A-S-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B-O-A-O-B Formula S8; wherein A
  • siRNA molecule of any one of embodiments 1-26, 31-35 and 38-42, wherein the antisense strand comprises a structure represented by Formula VI, wherein Formula VI is, in the 5’-to-3’ direction: A-B j -E-B k -E-F-G l -D-P 1 -C’ Formula VI; wherein A is represented by the formula C-P 1 -D-P 1 ; each B is represented by the formula C-P 2 ; each C is a 2’-O-Me ribonucleoside; each C’, independently, is a 2’-O-Me ribonucleoside or a 2’-F ribonucleoside; each D is a 2’-F ribonucleoside; each E is represented by the formula D-P 2 -C-P 2 ; F is represented by the formula D-P 1 -C-P 1 ; each G is represented by the formula C-P 1 ; each P 1 is a phospho
  • Embodiment 44 The siRNA molecule of embodiment 43, wherein the antisense strand comprises a structure represented by Formula A4, wherein Formula A4 is, in the 5’-to-3’ direction: A-S-B-S-A-O-A-O-A-O-B-O-A-O-A-O-A-O-A-O-A-O-B-O-A-S-A-S- A-S-B-S-A Formula A4; wherein A represents a 2’-O-Me ribonucleoside, B represents a 2’-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.
  • Formula A4 is, in the 5’-to-3’ direction: A-S-B-S-A-O-A-O-A-O-A-O-A-O-A-O-A-O-B-O-A-S-A-S
  • Embodiment 45 The siRNA molecule of any one of embodiments 1-30, 36, 37, 43, and 44, wherein the sense strand comprises a structure represented by Formula VII, wherein Formula VII is, in the 5’-to-3’ direction: H-B m -I n -A’-B o -H-C Formula VII; wherein A’ is represented by the formula C-P 2 -D-P 2 ; each H is represented by the formula (C-P 1 ) 2 ; each I is represented by the formula (D-P 2 ); B, C, D, P 1 and P 2 are as defined in Formula VI; m is an integer from 1 to 7; n is an integer from 1 to 7; and o is an integer from 1 to 7.
  • Embodiment 46 Embodiment 46.
  • siRNA molecule of embodiment 45 wherein the sense strand comprises a structure represented by Formula S9, wherein Formula S9 is, in the 5’-to-3’ direction: A-S-A-S-A-O-A-O-A-O-B-O-B-O-B-O-A-O-B-O-A-O-A-O-A-S-A-S-A Formula S9; wherein A represents a 2’-O-Me ribonucleoside, B represents a 2’-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.
  • Formula S9 wherein A represents a 2’-O-Me ribonucleoside, B represents a 2’-F ribonucleoside, O represents a phosphodiester internucleoside linkage, and S represents a phosphorothioate internucleoside linkage.
  • Embodiment 50 The siRNA molecule of embodiment 49, wherein the nucleobase is an adenine, uracil, guanine, thymine, or cytosine.
  • Embodiment 51 Embodiment 51.
  • the siRNA molecule of any one of embodiments 47-50, wherein the 5’ phosphorus stabilizing moiety is (E)-vinylphosphonate represented by Formula XI.
  • Embodiment 52. The siRNA molecule of any one of embodiments 1-51, wherein the siRNA molecule further comprises a hydrophobic moiety at the 5’ or the 3’ end of the siRNA molecule.
  • Embodiment 53. The siRNA molecule of embodiment 52, wherein the hydrophobic moiety is selected from a group consisting of cholesterol, vitamin D, or tocopherol.
  • Embodiment 54 The siRNA molecule of any one of embodiments 1-53, wherein the length of the sense strand is between 12 and 30 nucleotides.
  • Embodiment 56. The siRNA molecule of embodiment 55, wherein the branched siRNA molecule is di-branched, tri-branched, or tetra-branched.
  • siRNA molecule of embodiment 56 wherein the siRNA molecule is a di-branched siRNA molecule, optionally wherein the di-branched siRNA molecule is represented by any one of Formulas XVII-XIX: Formula XVII; Formula XVIII; Formula XIX; wherein each RNA is, independently, an siRNA molecule, L is a linker, and each X, independently, represents a branch point moiety.
  • Formulas XVII-XIX Formula XVII
  • Formula XVIII Formula XIX
  • each RNA is, independently, an siRNA molecule
  • L is a linker
  • each X independently, represents a branch point moiety.
  • siRNA molecule of embodiment 56 wherein the siRNA molecule is a tri-branched siRNA molecule, optionally wherein the tri-branched siRNA molecule is represented by any one of Formulas XX-XXIII: Formula XX; Formula XXI; Formula XXII; Formula XXIII; wherein each RNA is, independently, an siRNA molecule, L is a linker, and each X, independently, represents a branch point moiety.
  • Formulas XX-XXIII Formula XX; Formula XI; Formula XXII; Formula XIII; wherein each RNA is, independently, an siRNA molecule, L is a linker, and each X, independently, represents a branch point moiety.
  • siRNA molecule of embodiment 56 wherein the siRNA molecule is a tetra-branched siRNA molecule, optionally wherein the tetra-branched siRNA molecule is represented by any one of Formulas XXIV-XXVIII: Formula XXIV; Formula XXV; Formula XXVI; Formula XXVII; Formula XXVIII; wherein each RNA is, independently, an siRNA molecule, L is a linker, and each X, independently, represents a branch point moiety.
  • Formulas XXIV-XXVIII Formula XXIV; Formula XXV; Formula XVI; Formula XVII; Formula XXVIII; wherein each RNA is, independently, an siRNA molecule, L is a linker, and each X, independently, represents a branch point moiety.
  • the linker is selected from a group consisting of one or more contiguous subunits of an ethylene glycol, alkyl, carbohydrate, block copolymer, peptide, RNA, and DNA.
  • Embodiment 61 The siRNA molecule of embodiment 60, wherein the one or more contiguous subunits is 2 to 20 contiguous subunits.
  • siRNA molecule comprising: a) a sense strand comprising the sequence (mG)#(mA)#(mA)(fU)(mG)(fA)(mG)(fA) (mG)(fA)(mG)(mU)(mG)(fU)#(mG)#(mA)-DIO (SEQ ID NO: 847) and an antisense strand comprising the sequence V(mU)#(fC)#(mA)(fC)(fA)(fC)(mU)(fC)(mU)(fC)(mU)(fC)(mA)(fU)(mU) (fC)(mA)(fU)(mU) (fC)#(mU)#(mC)#(mC)#(mC) (SEQ ID NO: 832); b) a sense strand comprising the sequence (mU)#(mC)#(mU)(fG)(m
  • Embodiment 63 A pharmaceutical composition comprising the siRNA molecule of any one of embodiments 1-62 and a pharmaceutically acceptable excipient, carrier, or diluent.
  • Embodiment 64 A method of delivering an siRNA molecule to a subject diagnosed as having an , the method comprising administering a therapeutically effective amount of the siRNA molecule of any one of embodiments 1-62 or the pharmaceutical composition of embodiment 63 to the subject.
  • Embodiment 65 A method of treating a tauopathy in a subject in need thereof, the method comprising administering a therapeutically effective amount of the siRNA molecule of any one of embodiments 1-62 or the pharmaceutical composition of embodiment 63 to the subject.
  • Embodiment 66 The method of embodiment 65, wherein the tauopathy is Alzheimer’s disease.
  • Embodiment 67 The method of embodiment 65, wherein the tauopathy is frontotemporal dementia.
  • Embodiment 68 The method of embodiment 65, wherein the tauopathy is progressive supranuclear palsy.
  • Embodiment 69 The method of embodiment 65, wherein the tauopathy is corticobasal degeneration.
  • Embodiment 70 A method of reducing MAPT expression in a subject in need thereof, the method comprising administering a therapeutically effective amount of the siRNA molecule of any one of embodiments 1-62 or the pharmaceutical composition of embodiment 63 to the subject.
  • Embodiment 71 Embodiment 71.
  • any one of embodiments 64-70 wherein the siRNA molecule or the pharmaceutical composition is administered to the subject by way of intracerebroventricular, intrastriatal, intraparenchymal, or intrathecal injection.
  • Embodiment 72 The method of any one of embodiments 64-71, wherein the siRNA molecule or the pharmaceutical composition is administered to the subject by way of intravenous, intramuscular, or subcutaneous injection.
  • Embodiment 73 The method of any one of embodiments 64-72, wherein the subject is a human.
  • Embodiment 74 The method of any one of embodiments 64-70, wherein the siRNA molecule or the pharmaceutical composition is administered to the subject by way of intracerebroventricular, intrastriatal, intraparenchymal, or intrathecal injection.
  • Embodiment 72 The method of any one of embodiments 64-71, wherein the siRNA molecule or the pharmaceutical composition is administered to the subject by way of intravenous, intramuscular, or subcutaneous injection.
  • Embodiment 73 The method of any one
  • a kit comprising the siRNA molecule of any one of embodiments 1-62, or the pharmaceutical composition of embodiment 63, and a package insert, wherein the package insert instructs a user of the kit to perform the method of any one of embodiments 64-73. 7.
  • Example 1. In Vitro Screening [0210] In vitro screening was performed using human SHSY-5Y cells in a 96-well format. In some embodiments, MeWo cells may be used.
  • QRT- PCR Quantitative reverse transcriptase polymerase change reaction
  • Tau protein knockdown (Table 3B) is quantified by fluorescent ELISA (abcam 229394). Biological samples are lysed using tissue lysis buffer (CST Cell Lysis Buffer #9803) and bead-beater homogenization on a Qiagen Tissuelyser II. The ELISA is performed using the tissue lysates in accordance to the manufacturer’s instructions. The ELISA utilizes an anti- tag coated immunoassay plate to bind to a conjugated capture antibody which in turn binds to the analyte. An HRP conjugated detection antibody is used in conjunction with a substrate to generate the fluorescent signal which is read on a fluorescent plate reader. In Tables 3A and 3B, below, 100% represents complete target knockdown and 0% represents no target knockdown.
  • Example 3 Durability of MAPT knockdown in vivo Objective [0213] This Example describes the results of a series of experiments undertaken to determine the durability of MAPT silencing with a di-branched siRNA molecule in vivo.
  • Materials and Methods In vivo administration of di-siRNA [0214] A siRNA molecule of the disclosure was synthesized as a di-branched siRNA molecule having the structure of Formula XVII.
  • the sense strand had the sequence of SEQ ID NO.409 and a pattern of chemical modifications defined by the broad structure of Formula III and the specific structure of Formula S1.
  • the antisense strand had the sequence of SEQ ID NO.1 and a pattern of chemical modifications defined by the broad structure of Formula II and the specific structure of Formula A2.
  • the antisense strand further included a 5’ vinyl phosphonate moiety of Formula XI.
  • In vivo durability was assessed in 12-week-old hMAPT transgenic mice using similar methods as described in Example 2. Briefly, PBS or the di-branched siRNA molecule described above was administered via bilateral stereotactic ICV injection at a dose of 30 nmol in a total volume of 10 ⁇ L.
  • PBS or the di-branched siRNA molecule described above was administered via bilateral stereotactic ICV injection at a dose of 30 nmol in a total volume of 10 ⁇ L.
  • One month, two months, three months, or four months after compound administration, animals were euthanized, perfused, and the brain was sliced into 1 mm thick cortical slices.
  • Results are shown in Figures 1A-C.
  • results in this example demonstrate that a siRNA molecule of the disclosure, with a sense strand having SEQ ID NO.409 and an antisense strand having SEQ ID NO.1 successfully reduced MAPT gene and protein expression in vivo for up to four months post- treatment.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Neurosurgery (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • Neurology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Psychiatry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Epidemiology (AREA)
  • Hospice & Palliative Care (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
EP23873952.8A 2022-09-29 2023-09-28 Sirna compositions and methods targeting microtubule associated protein tau nucleic acids Pending EP4594501A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202263377715P 2022-09-29 2022-09-29
PCT/US2023/075446 WO2024073618A2 (en) 2022-09-29 2023-09-28 Sirna compositions and methods targeting microtubule associated protein tau nucleic acids

Publications (1)

Publication Number Publication Date
EP4594501A2 true EP4594501A2 (en) 2025-08-06

Family

ID=90479287

Family Applications (1)

Application Number Title Priority Date Filing Date
EP23873952.8A Pending EP4594501A2 (en) 2022-09-29 2023-09-28 Sirna compositions and methods targeting microtubule associated protein tau nucleic acids

Country Status (12)

Country Link
EP (1) EP4594501A2 (he)
JP (1) JP2025531482A (he)
KR (1) KR20250078967A (he)
CN (1) CN120129749A (he)
AU (1) AU2023354157A1 (he)
CL (1) CL2025000925A1 (he)
CO (1) CO2025005052A2 (he)
IL (1) IL319732A (he)
MX (1) MX2025003674A (he)
PE (1) PE20251843A1 (he)
TW (1) TW202426643A (he)
WO (1) WO2024073618A2 (he)

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2025233849A2 (en) * 2024-05-07 2025-11-13 Janssen Pharmaceutica Nv MAPT siRNA AND USES THEREOF
WO2026017176A1 (zh) * 2024-07-19 2026-01-22 北京安龙生物医药有限公司 靶向微管相关蛋白Tau基因的寡核苷酸及其用途
CN121780524A (zh) * 2024-08-02 2026-04-03 北京尧景基因技术有限公司 抑制MAPT基因表达的siRNA及其缀合物和应用
WO2026067655A1 (zh) * 2024-09-26 2026-04-02 大睿生物医药科技(上海)有限公司 调控TAU表达的dsRNA分子

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2851388C (en) * 2011-10-10 2023-11-21 The Hospital For Sick Children Methods and compositions for screening and treating developmental disorders
AU2021238319A1 (en) * 2020-03-18 2022-10-06 University Of Massachusetts Oligonucleotides for MAPT modulation

Also Published As

Publication number Publication date
CL2025000925A1 (es) 2025-08-01
CN120129749A (zh) 2025-06-10
WO2024073618A2 (en) 2024-04-04
KR20250078967A (ko) 2025-06-04
IL319732A (he) 2025-05-01
AU2023354157A1 (en) 2025-04-10
WO2024073618A3 (en) 2024-07-18
JP2025531482A (ja) 2025-09-19
TW202426643A (zh) 2024-07-01
MX2025003674A (es) 2025-05-02
CO2025005052A2 (es) 2025-05-19
PE20251843A1 (es) 2025-07-17

Similar Documents

Publication Publication Date Title
EP4594501A2 (en) Sirna compositions and methods targeting microtubule associated protein tau nucleic acids
US20250109402A1 (en) Compositions and methods for treatment of pain
WO2024073609A2 (en) Sirna compositions and methods targeting alpha-synuclein nucleic acids
EP4594495A2 (en) Compositions and methods for treatment of neuroinflammatory diseases
AU2023354010A1 (en) Compositions and methods for treatment of neurodegenerative diseases
WO2024073592A2 (en) Compositions and methods for treatment of neurological disorders
EP4413136A1 (en) Compositions and methods for treatment of prion diseases
US20260098269A1 (en) Compositions and methods for treatment of neuroinflammatory diseases
WO2024073596A2 (en) Compositions and methods for treatment of spinocerebellar ataxias
AU2022402159A1 (en) Compositions and methods for treatment of epilepsies
JP2026509929A (ja) 改善された遺伝子サイレンシングのための組成物及び方法
EP4594497A2 (en) Compositions and methods for treatment of huntington's disease

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20250423

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR

RAV Requested validation state of the european patent: fee paid

Extension state: MA

Effective date: 20250423

REG Reference to a national code

Ref country code: HK

Ref legal event code: DE

Ref document number: 40130539

Country of ref document: HK