Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
  • C12N15/86—Viral vectors
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
  • C12N15/111—General methods applicable to biologically active non-coding nucleic acids
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2310/00—Structure or type of the nucleic acid
  • C12N2310/10—Type of nucleic acid
  • C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
  • C12N2310/141—MicroRNAs, miRNAs
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2310/00—Structure or type of the nucleic acid
  • C12N2310/50—Physical structure
  • C12N2310/51—Physical structure in polymeric form, e.g. multimers, concatemers
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2330/00—Production
  • C12N2330/50—Biochemical production, i.e. in a transformed host cell
  • C12N2330/51—Specially adapted vectors
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
  • C12N2770/00011—Details
  • C12N2770/36011—Togaviridae
  • C12N2770/36111—Alphavirus, e.g. Sindbis virus, VEE, EEE, WEE, Semliki
  • C12N2770/36141—Use of virus, viral particle or viral elements as a vector
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2800/00—Nucleic acids vectors
  • C12N2800/40—Systems of functionally co-operating vectors

Definitions

• RNA molecules comprising two RNA molecules, wherein the first RNA molecule comprises an open reading frame encoding a functional RNA-dependent RNA polymerase (replicase) and wherein the second RNA molecule is a replicable RNA molecule comprising at least one non-coding RNA sequence which is capable of being excised from the second replicable RNA molecule when present in a cell and is capable of regulating gene expression in a cell, and which replicable RNA molecule can be replicated in trans by the replicase encoded by the first RNA molecule.
• the second RNA molecule further comprises at least one open reading frame (ORF) encoding a protein of interest, as described herein.
• Each non-coding RNA sequence comprised in the second RNA molecule may be 10-500 nucleotides in length, optionally 10-400, 10-300, 10-200, 10-100, 10-50, 20-400, 20-300, 20-200, 20-100, 20-50, 10-40, 10-30, 20-40, or 20-30 nucleotides in length, optionally 10-100, preferably 10-50 nucleotides in length.
• Exemplary non-coding RNA sequences include miRNAs, shRNAs, siRNAs, and antisense molecules, but the skilled person will be aware of other non-coding RNA sequences capable of regulating gene expression in a cell which may be incorporated into the second replicable RNA molecule.
• the second RNA molecule can be an mRNA.
• the sequence of at least one miRNA can differ in its sequence from at least one other miRNA, preferably wherein the sequence of each miRNA differs from the other.
• the sequences of the miRNAs can be the same sequence.
• the miRNA targets an mRNA and can affect the translation of the mRNA such that the expression of the gene encoding the mRNA can be regulated.
• the miRNA binds the mRNA such that the mRNA cannot be translated.
• the same or different miRNAs can target the same mRNA.
• the different miRNAs target different mRNAs.
• the different miRNAs target 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more different mRNAs, preferably 1-5 different mRNAs.
• each of the miRNA sequences comprised in the second RNA molecule can target a different mRNA.
• the different miRNAs target can different sites on the same mRNA, or wherein the different miRNAs target different sites on two or more mRNAs.
• the target of the miRNA can be an mRNA relevant for the onset or progression of a disease, preferably an mRNA of an oncogene, mutated tumor suppressor gene or of a viral, bacterial or fungal gene.
• the target of the miRNA can be a mutated (non-functional) tumor suppressor gene.
• the mutated tumor suppressor gene is mutated TP53.
• the target of the miRNA can be an interferon stimulated gene, preferably RSAD2 (viperin). These genes can be upregulated upon infection with an alphavirus, which leads to inhibition of the translation machinery.
• the target of the miRNA can be retinoic acid-inducible gene I (RIG-I).
• the target of the miRNA can be the Eukaryotic T ranslation Initiation Factor 2 Alpha Kinase 2 (EIF2AK2) gene encoding protein kinase R (PKR). Not meant to be limiting, but the targeting of RIG-I and/or PKR has the advantage of helping to suppress innate immunity induced by transfection and results in the inhibition of the translation machinery in a cell.
• the target of the miRNA can be DAZ-associated protein 2 (DAZAP2) and/or TGF beta receptor 2 (TGFpR2).
• DAZAP2 DAZ-associated protein 2
• TGFpR2 TGF beta receptor 2
• the sequence of the miRNA can be flanked 5' and/or 3' by flanking and loop sequences from a naturally occurring miRNA, preferably from murine miR-155, which flanking and loop sequences are, as is known in the miRNA art, required for excising the miRNA sequence from the larger sequence of the second RNA molecule.
• the miRNA is preferably an artificial miRNA, in particular a miRNA that is designed to bind completely to its target mRNA.
• the miRNA sequence can be at least one of miR-30 or miR-124.
• the ORF can be flanked by a 5' untranslated region (UTR) and/or a 3' UTR.
• UTR 5' untranslated region
• Exemplary 5' UTR sequences are depicted in SEQ ID NOs: 47, 48 and 52.
• a 5' UTR sequence useful in the RNA molecules described herein is one that is at least 75%, 80%, 85%, 90%, 95%, 98% or 99% homologous to SEQ ID NO: 47 or 48 or 52.
• Exemplary 3' UTR sequences are depicted in SEQ ID Nos: 49, 50 and 51.
• a 3' UTR sequence useful in the RNA molecules described herein is one that is at least 75%, 80%, 85%, 90%, 95%, 98% or 99% homologous to SEQ ID NO: 49 or 50 or 51.
• the protein of interest further comprises a MHC class I trafficking signal (MITD) and/or a HLA-II helper epitope, such as the P2P16 amino acid sequence derived from the tetanus toxoid of Clostridium tetanii.
• MITD MHC class I trafficking signal
• HLA-II helper epitope such as the P2P16 amino acid sequence derived from the tetanus toxoid of Clostridium tetanii.
• An MITD sequence is depicted in SEQ ID NO: 44.
• a MITD sequence useful in the RNA molecules described herein is one that is at least 75%, 80%, 85%, 90%, 95%, 98% or 99% homologous to SEQ ID NO: 44.
• An exemplary P2P16 sequence is depicted in SEQ ID NO: 45.
• a P2P16 sequence useful in the RNA molecules described herein is one that is at least 75%, 80%, 85%, 90%, 95%, 98% or 99% homologous to SEQ ID NO: 45.
• the antigen or epitope is a or is derived from a bacterial, viral, parasitical or fungal antigen.
• the antigen or epitope is or is derived from a tumor antigen. Tumor antigens can be overexpressed in tumors or preferably are expressed only in tumors/tumor tissue.
• the first and/or second RNA molecule can be a modified RNA molecule or unmodified RNA molecule.
• the first and/or second RNA molecule is a modified RNA molecule.
• the first and/or second RNA molecule can be a modified RNA molecule comprising at least one modified uridine.
• at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% of the uridines in the RNA molecules are pseudouridine ( ⁇ ), Nl-methyl-pseudouridine (m1 ⁇ ), or 5-methyl-uridine (m5U), preferably Nl-methyl- pseudouridine (1m ⁇ ).
• the first and/or second RNA molecule can further comprise a 5' cap, a 5' regulatory region, a 5' replication recognition sequence, a 3' replication recognition sequence and/or a poly(A) sequence.
• the first and/or second RNA molecule can comprise a 5' cap, which is a naturally occurring 5' cap or a 5' cap analog.
• the 5' cap analog can be one of ARCA, beta-S-ARCA, beta-S-ARCA(Dl), beta- S-ARCA(D2), CleanCap, CapO, Capl or AU(Capl).
• the 5' cap has the sequence NpppNU, wherein the U in the 5' cap is an unmodified uridine.
• the 5' cap has the sequence NpppAU wherein the U in the 5' cap is an unmodified uridine and the A can be a modified or unmodified adenosine nucleotide.
• the first and/or second RNA molecule comprises a 5' cap comprising a Capl and a cap proximal sequence comprising positions +1, +2, +3, +4, and +5 of the RNA molecule(s), wherein:
• the Capl comprises m 7 G(5')ppp(5')(2'OMeN 1 )pN 2 , wherein N 1 is position +1 of the RNA molecule, and N 2 is position +2 of the RNA molecule, and wherein N 1 and N 2 are each independently chosen from: A, C, G, or U; and (ii) the cap proximal sequence comprises N 1 and N 2 of the Capl, and:
• the first and/or second RNA molecule can comprise a 5' replication recognition sequence, which is characterized in that at least one initiation codon is removed compared to a native 5' replication recognition sequence.
• the 5' replication recognition sequence comprises a sequence homologous to an open reading frame of a non-structural protein or a portion thereof from a self-replicating virus, wherein the sequence homologous to an open reading frame of a non-structural protein or a portion thereof from a self- replicating virus is characterized in that it comprises the removal of at least one initiation codon compared to the native viral sequence.
• sequence homologous to an open reading frame of a non-structural protein or a portion thereof from a self-replicating virus is characterized in that it comprises the removal of at least the native start codon of the open reading frame of a non-structural protein from a self-replicating virus.
• sequence homologous to an open reading frame of a non-structural protein or a portion thereof from a self-replicating virus is characterized in that it comprises the removal of at least one Initiation codon other than the native start codon of the open reading frame of a non-structural protein from a self-replicating virus.
• sequence homologous to an open reading frame of a non-structural protein or a portion thereof from a self-replicating virus is characterized in that it is free of initiation codons.
• sequence homologous to an open reading frame of a non-structural protein or a portion thereof further comprises at least one nucleotide change compensating for nucleotide pairing disruptions within at least one stem loop introduced by the removal of at least one initiation codon.
• the reagent can be conjugated to polysarcosine (pSar), poly(oxazoline) (POX); poly(oxazine) (POZ), poly(vinyl pyrrolidone) (PVP); poly(/V-(2-hydroxypropyl)-methacrylamide) (pHPMA); poly(dehydroalanine) (pDha); poly(aminoethoxy ethoxy acetic acid) (pAEEA) or poly(2-methylaminoethoxy ethoxy acetic acid) (pmAEEA).
• pSar polysarcosine
• POX poly(oxazoline)
• POZ poly(oxazine)
• PVP poly(vinyl pyrrolidone)
• pHPMA poly(/V-(2-hydroxypropyl)-methacrylamide)
• pDha poly(dehydroalanine)
• pAEEA poly(aminoethoxy ethoxy
• the particles formed from the RNA molecules and the reagent can be lipid nanoparticles (LNP), lipoplexes (LPX), liposomes, or polymer-based polyplexes (PLX).
• LNP lipid nanoparticles
• LPX lipoplexes
• PLX polymer-based polyplexes
• the charge ratio of positive charges to negative charges in the nanoparticles is 1.4:1 or less and/or
• the ionic strength of the composition can be 50 mM or less, preferably wherein the concentration of monovalent cationic ions can be 25 mM or less and the concentration of divalent cationic ions can be 20 pM or less.
• the particles formed are polyplexes.
• the polyalkyleneimine comprises the following general formula (I): wherein
• R is H, an acyl group or a group comprising the following general formula (II): wherein Ri is H or a group comprising the following general formula (III): n, m, and I are independently selected from integers from 2 to 10; and p, q, and r are integers, wherein the sum of p, q, and r is such that the average molecular weight of the polymer is 1.5-10 2 to 10 7 Da, preferably 5000 to 10 5 Da, more preferably 10000 to 40000 Da, more preferably 15000 to 30000 Da, even more preferably 20000 to 25000 Da.
• n, m, and I are independently selected from 2, 3, 4, and 5, preferably from 2 and 3.
• R 1 is H.
• R is H or an acyl group.
• the polyalkyleneimine can comprise polyethylenimine and/or polypropylenimine, preferably polyethyleneimine.In an embodiment, at least 92% of the N atoms in the polyalkyleneimine are protonatable.
• system further can comprise one or more peptide-based adjuvants, wherein peptide-based adjuvants optionally comprise immune regulatory molecules, such as cytokines, lymphokines and/or co-stimulatory molecules.
• peptide-based adjuvants optionally comprise immune regulatory molecules, such as cytokines, lymphokines and/or co-stimulatory molecules.
• the system further can comprise one or more additives, wherein the additives optionally are selected from the group consisting of buffering substances, saccharides, stabilizers, cryoprotectants, lyoprotectants, and chelating agents.
• the buffering substances comprise at least one selected from the group consisting of 4-(2-hydroxyethyl)-l-piperazineethanesulfonic acid (HEPES), 2-(N-morpholino)ethanesulfonic acid (MES), 3- morpholino-2-hydroxypropanesulfonic acid (MOPSO), acetic acid, acetate buffers and analogues, phosphoric acid and phosphate buffers, and citric acid and citrate buffers.
• HEPES 4-(2-hydroxyethyl)-l-piperazineethanesulfonic acid
• MES 2-(N-morpholino)ethanesulfonic acid
• MOPSO 3- morpholino-2-hydroxypropanesulfonic acid
• acetic acid acetate buffer
• the saccharides comprise at least one selected from the group consisting of monosaccharides, disaccharides, trisaccharides, oligosaccharides, and polysaccharides preferably from glucose, trehalose, and saccharose.
• the cryoprotectants comprise at least one selected from the group consisting of glycols, such as ethylene glycol, propylene glycol, and glycerol.
• the chelating agent comprises EDTA.
• kits comprising two RNA molecules, wherein the first RNA molecule comprises an open reading frame encoding a functional RNA-dependent RNA polymerase (replicase) and wherein the second RNA molecule is a replicable RNA molecule comprising at least one miRNA sequence, which miRNA sequence is capable of being excised from the second replicable RNA when present in a cell, and is capable of regulating gene expression in a cell, which replicable RNA molecule cis capable of being replicated in trans by the replicase encoded by the first RNA molecule.
• the two RNA molecules are in separate containers contained within the kit.
• RNA molecules comprising two RNA molecules, wherein the first RNA molecule comprises an open reading frame encoding a functional RNA-dependent RNA polymerase (replicase) and wherein the second RNA molecule is a replicable RNA molecule comprising at least one miRNA sequence, which miRNA sequence is capable of being excised from the second replicable RNA when present in a cell, and is capable of regulating gene expression in a cell, which replicable RNA molecule is capable of being replicated in trans by the replicase encoded by the first RNA molecule, and a pharmaceutically acceptable carrier.
• the first RNA molecule comprises an open reading frame encoding a functional RNA-dependent RNA polymerase (replicase)
• the second RNA molecule is a replicable RNA molecule comprising at least one miRNA sequence, which miRNA sequence is capable of being excised from the second replicable RNA when present in a cell, and is capable of regulating gene expression in a cell, which replicable RNA molecule is capable of being replicated
• the first and/or second RNA molecule in the composition preferably the second RNA molecule, further comprises at least one open reading frame (ORF) encoding a protein of interest.
• ORF open reading frame
• the pharmaceutical composition can be formulated for intradermal, subcutaneous, and/or intramuscular administration, such as by injection.
• the kit or the pharmaceutical composition can be for use in therapy.
• the kit or the pharmaceutical composition can be for use in a method of treating or preventing a disease, preferably wherein the subject is a mammal, more preferably wherein the mammal is a human, said method comprising administering a pharmaceutical composition according to the invention to the subject.
• administering the kit or the pharmaceutical composition comprises intradermal, subcutaneous, or intramuscular administration, such as by intradermal, subcutaneous or intramuscular injection.
• Tthe injection is by use of a needle or is by use of a needleless injection device.
• administering comprises administration by intramuscular injection, preferably with a needle.
• the RNA molecules are administered separately, preferably by the same rout of administration.
• the disease is a bacterial, viral, parasitical or fungal infection, or cancer.
• the subject is preferably a human.
• Also described herein is a method for the treatment or prevention of a bacterial, viral, parasitical or fungal infection in a subject, said method comprising administering to the subject a composition described herein, preferably a pharmaceutical composition. Also described herein is a method for the treatment or prevention of cancer in a subject, said method comprising administering to the subject a composition described herein, preferably a pharmaceutical composition.
• RNA relates to the "half-life" of RNA.
• "Half-life” relates to the period of time which is needed to eliminate half of the activity, amount, or number of molecules.
• the half- life of an RNA is indicative for the stability of said RNA.
• the half-life of RNA may influence the "duration of expression" of the RNA. It can be expected that RNA having a long half-life will be expressed for an extended time period.
• Nucleic acid variants include single or multiple nucleotide deletions, additions, mutations, substitutions and/or insertions in comparison with the reference nucleic acid.
• Deletions include removal of one or more nucleotides from the reference nucleic acid.
• Addition variants comprise 5'- and/or 3'-terminal fusions of one or more nucleotides, such as 1, 2, 3, 5, 10, 20, 30, 50, or more nucleotides.
• substitutions at least one nucleotide in the sequence is removed and at least one other nucleotide is inserted in its place (such as transversions and transitions).
• Mutations include abasic sites, crosslinked sites, and chemically altered or modified bases. Insertions include the addition of at least one nucleotide into the reference nucleic acid.
• nucleotide change can refer to single or multiple nucleotide deletions, additions, mutations, substitutions and/or insertions in comparison with the reference nucleic acid.
• a “nucleotide change” is selected from the group consisting of a deletion of a single nucleotide, the addition of a single nucleotide, the mutation of a single nucleotide, the substitution of a single nucleotide and/or the insertion of a single nucleotide, in comparison with the reference nucleic acid.
• a nucleic acid variant can comprise one or more nucleotide changes in comparison with the reference nucleic acid.
• Variants of specific nucleic acid sequences preferably have at least one functional property of said specific sequences and preferably are functionally equivalent to said specific sequences, e.g., nucleic acid sequences exhibiting properties identical or similar to those of the specific nucleic acid sequences.
• nucleic acid sequences that are homologous to other nucleic acid sequences. These homologous sequences are variants of other nucleic acid sequences.
• sequence similarity indicates the percentage of amino acids that either are identical or that represent conservative amino acid substitutions.
• Sequence identity indicates the percentage of amino acids or nucleotides that are identical between the sequences.
• the term “% identical” is intended to refer, in particular, to a percentage of amino acids or nucleotides which are identical in an optimal alignment between two sequences to be compared, with said percentage being purely statistical, and the differences between the two sequences may be randomly distributed over the entire length of the sequence and the sequence to be compared may comprise additions or deletions in comparison with the reference sequence, in order to obtain optimal alignment between two sequences.
• Comparisons of two sequences are usually carried out by comparing said sequences, after optimal alignment, with respect to a segment or "window of comparison", in order to identify local regions of corresponding sequences.
• the optimal alignment for a comparison may be carried out manually or with the aid of the local homology algorithm by Smith and Waterman, 1981, Ads App. Math. 2:482, with the aid of the local homology algorithm by Needleman and Wunsch, 1970, J. Mol. Biol. 48:443, and with the aid of the similarity search algorithm by Pearson and Lipman, 1988, Proc. Natl Acad. Sci. USA 85:2444 or with the aid of computer programs using said algorithms (GAP, BESTFIT, FASTA, BLAST P, BLAST N and TFASTA in Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Drive, Madison, Wis.).
• Percentage identity is obtained by determining the number of identical positions in which the sequences to be compared correspond, dividing this number by the number of positions compared and multiplying this result by 100.
• BLAST 2 sequences which is available on the website http://www.ncbi.nlm.nih.gov/blast/bl2seq/wblast2.cgi may be used.
• a nucleic acid is “capable of hybridizing” or “hybridizes” to another nucleic acid if the two sequences are complementary with one another.
• a nucleic acid is “complementary” to another nucleic acid if the two sequences are capable of forming a stable duplex with one another.
• hybridization is preferably carried out under conditions which allow specific hybridization between polynucleotides (stringent conditions). Stringent conditions are described, for example, in Molecular Cloning: A Laboratory Manual, J. Sambrook et al., Editors, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989 or Current Protocols in Molecular Biology, F.M.
• Ausubel et al. Editors, John Wiley & Sons, Inc., New York and refer, for example, to hybridization at 65°C in hybridization buffer (3.5 x SSC, 0.02% Ficoll, 0.02% polyvinylpyrrolidone, 0.02% bovine serum albumin, 2.5 mM NaH 2 PO 4 (pH 7), 0.5% SDS, 2 mM EDTA).
• SSC is 0.15 M sodium chloride/0.15 M sodium citrate, pH 7.
• the membrane to which the DNA has been transferred is washed, for example, in 2 x SSC at room temperature and then in 0.1-0.5 x SSC/0.1 x SDS at temperatures of up to 68°C.
• a percent complementarity indicates the percentage of contiguous residues in a nucleic acid molecule that can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 being 50%, 60%, 70%, 80%, 90%, and 100% complementary).
• Perfectly complementary or “fully complementary” means that all the contiguous residues of a nucleic acid sequence will hydrogen bond with the same number of contiguous residues in a second nucleic acid sequence.
• the degree of complementarity according to the invention is at least 70%, preferably at least 75%, preferably at least 80%, more preferably at least 85%, even more preferably at least 90% or most preferably at least 95%, 96%, 97%, 98% or 99%. Most preferably, the degree of complementarity according to the invention is 100%.
• the term “derivative” comprises any chemical derivatization of a nucleic acid on a nucleotide base, on the sugar or on the phosphate.
• the term “derivative” also comprises nucleic acids which contain nucleotides and nucleotide analogs not occurring naturally.
• a derivatization of a nucleic acid increases its stability.
• a "nucleic acid sequence which is derived from a nucleic acid sequence” refers to a nucleic acid which is a variant of the nucleic acid from which it is derived.
• a sequence which is a variant with respect to a specific sequence when it replaces the specific sequence in an RNA molecule retains RNA stability and/or translational efficiency.
• the term "codon” refers to a base triplet in a coding nucleic acid that specifies which amino acid will be added next during protein synthesis at the ribosome.
• transcription and “transcribing” relate to a process during which a nucleic acid molecule with a particular nucleic acid sequence (the “nucleic acid template”) is read by an RNA polymerase so that the RNA polymerase produces a single-stranded RNA molecule.
• the genetic information in a nucleic acid template is transcribed.
• the nucleic acid template may be DNA; however, e.g:, in the case of transcription from an alphaviral nucleic acid template, the template is typically RNA. Subsequently, the transcribed RNA may be translated into protein.
• the term “transcription” comprises “in vitro transcription”, wherein the term “in vitro transcription” relates to a process wherein RNA, in particular mRNA, is in vitro synthesized in a cell- free system.
• cloning vectors are applied for the generation of transcripts. These cloning vectors are generally designated as transcription vectors and are according to the present invention encompassed by the term “vector”.
• the cloning vectors are preferably plasmids.
• RNA preferably is in vitro transcribed RNA (IVT-RNA) and may be obtained by in vitro transcription of an appropriate DNA template.
• the promoter for controlling transcription can be any promoter for any RNA polymerase.
• a DNA template for in vitro transcription may be obtained by cloning of a nucleic acid, in particular cDNA, and introducing it into an appropriate vector for in vitro transcription.
• the cDNA may be obtained by reverse transcription of RNA.
• the single-stranded nucleic acid molecule produced during transcription typically has a nucleic acid sequence that is the complementary sequence of the template.
• template or “nucleic acid template” or “template nucleic acid” generally refer to a nucleic acid sequence that may be replicated or transcribed.
• Nucleic acid sequence transcribed from a nucleic acid sequence refers to a nucleic acid sequence, where appropriate as part of a complete RNA molecule, which is a transcription product of a template nucleic acid sequence. Typically, the transcribed nucleic acid sequence is a single-stranded RNA molecule.
• 3' end of a nucleic acid refers according to the invention to that end which has a free hydroxy group. In a diagrammatic representation of double-stranded nucleic acids, in particular DNA, the 3' end is always on the right- hand side. "5' end of a nucleic acid” refers according to the invention to that end which has a free phosphate group. In a diagrammatic representation of double-strand nucleic acids, in particular DNA, the 5' end is always on the left- hand side.
• core promoter refers to a nucleic acid sequence that is comprised by the promoter.
• the core promoter is typically the minimal portion of the promoter required to properly initiate transcription.
• the core promoter typically includes the transcription start site and a binding site for RNA polymerase.
• a "base pair” is a structural motif of a secondary structure wherein two nucleotide bases associate with each other through hydrogen bonds between donor and acceptor sites on the bases.
• the complementary bases, A:U and G:C form stable base pairs through hydrogen bonds between donor and acceptor sites on the bases; the A:ll and G:C base pairs are called Watson-Crick base pairs.
• a weaker base pair (called Wobble base pair) is formed by the bases G and U (G:U).
• the base pairs A:U and G:C are called canonical base pairs.
• Other base pairs like G:ll (which occurs fairly often in RNA) and other rare base-pairs ⁇ e.g. A:C; U:ll) are called non-canonical base pairs.
• nucleotide pairing refers to two nucleotides that associate with each other so that their bases form a base pair (canonical or non-canonical base pair, preferably canonical base pair, most preferably Watson-Crick base pair).
• the particular secondary structure represented by the stem loop consists of a consecutive nucleic acid sequence comprising a stem and a (terminal) loop, also called hairpin loop, wherein the stem is formed by two neighbored entirely or partially complementary sequence elements; which are separated by a short sequence ⁇ e.g. 3-10 nucleotides), which forms the loop of the stem-loop structure.
• the two neighbored entirely or partially complementary sequences may be defined as, e.g., stem loop elements stem 1 and stem 2.
• the stem loop is formed when these two neighbored entirely or partially reverse complementary sequences, e.g. stem loop elements stem 1 and stem 2, form base-pairs with each other, leading to a double stranded nucleic acid sequence comprising an unpaired loop at its terminal ending formed by the short sequence located between stem loop elements stem 1 and stem 2.
• a given nucleic acid sequence is characterized by a stem loop
• the respective complementary nucleic acid sequence is typically also characterized by a stem loop.
• a stem loop is typically formed by single-stranded RNA molecules. For example, several stem loops are present in the 5' replication recognition sequence of alphaviral genomic RNA.
• a disruption or “disrupt”, with reference to a specific secondary structure of a nucleic acid molecule e.g., a stem loop
• a secondary structure may be disrupted as a consequence of a change of at least one nucleotide that is part of the secondary structure.
• a stem loop may be disrupted by change of one or more nucleotides that form the stem, so that nucleotide pairing is not possible.
• Co-occurrence means presence of both the one or more first nucleotide changes and of the one or more second nucleotide changes.
• the one or more first nucleotide changes and the one or more second nucleotide changes are present together in the same nucleic acid molecule.
• one or more nucleotide changes that compensate for secondary structure disruption is/are one or more nucleotide changes that compensate for one or more nucleotide pairing disruptions.
• “compensating for secondary structure disruption” means “compensating for nucleotide pairing disruptions", i.e. one or more nucleotide pairing disruptions, for example one or more nucleotide pairing disruptions within one or more stem loops.
• substitution of U by G thus compensates for the nucleotide pairing disruption.
• a nucleotide change that compensates for nucleotide pairing disruption may be substitution of C by A, thereby restoring formation of the original A:U nucleotide pairing.
• those nucleotide changes compensating for secondary structure disruption are preferred which do neither restore the original nucleic acid sequence nor create novel AUG triplets.
• the U to G substitution is preferred over the C to A substitution.
• a nucleic acid such as RNA, e.g., rRNA
• RNA may encode a protein
• a transcribable nucleic acid sequence or a transcript thereof may contain an open reading frame (ORF) encoding a protein.
• ORF open reading frame
• nucleic acid encoding a protein means that the nucleic acid, if present in the appropriate environment, preferably within a cell, can direct the assembly of amino acids to produce the protein during the process of translation.
• coding RNA according to the invention is able to interact with the cellular translation machinery allowing translation of the coding RNA to yield a protein.
• peptide comprises oligo- and polypeptides and refers to substances which comprise two or more, preferably 3 or more, preferably 4 or more, preferably 6 or more, preferably 8 or more, preferably 10 or more, preferably 13 or more, preferably 16 or more, preferably 20 or more, and up to preferably 50, preferably 100 or preferably 150, consecutive amino acids linked to one another via peptide bonds.
• peptide and protein are used herein usually as synonyms.
• a self-replicating virus is a virus with a (+) stranded RNA genome which can be directly translated after infection of a cell, and this translation provides an RNA-dependent RNA polymerase which then produces both antisense and sense transcripts from the infected RNA.
• alphavirus-derived vectors as an example of self-replicating virus-derived vectors.
• the present invention is not limited to alphavirus-derived vectors.
• the term "alphavirus" is to be understood broadly and includes any virus particle that has characteristics of alphaviruses.
• alphavirus Characteristics of alphavirus include the presence of a (+) stranded RNA which encodes genetic information suitable for replication in a host cell, including RNA polymerase activity. Further characteristics of many alphaviruses are described, e.g., in Strauss & Strauss, 1994, Microbiol. Rev. 58:491-562.
• the term "alphavirus” includes alphavirus found in nature, as well as any variant or derivative thereof. In some embodiments, a variant or derivative is not found in nature.
• An alphavirus found in nature is preferably selected from the group consisting of the following: Barmah Forest virus complex (comprising Barmah Forest virus); Eastern equine encephalitis complex (comprising seven antigenic types of Eastern equine encephalitis virus); Middelburg virus complex (comprising Middelburg virus); Ndumu virus complex (comprising Ndumu virus); Semliki Forest virus complex (comprising Bebaru virus, Chikungunya virus, Mayaro virus and its subtype Una virus, O'Nyong Nyong virus, and its subtype Igbo-Ora virus, Ross River virus and its subtypes Bebaru virus, Getah virus, Sagiyama virus, Semliki Forest virus and its subtype Me Tri virus); Venezuelan equine encephalitis complex (comprising Cabassou virus, Everglades virus, Mosso das Pedras virus, Mucambo virus, Paramana virus, Pixuna virus, Rio Negro
• the alphavirus is selected from the group consisting of Semliki Forest virus complex (comprising the virus types as indicated above, including Semliki Forest virus), Western equine encephalitis complex (comprising the virus types as indicated above, including Sindbis virus), Eastern equine encephalitis virus (comprising the virus types as indicated above), Venezuelan equine encephalitis complex (comprising the virus types as indicated above, including Venezuelan equine encephalitis virus).
• Semliki Forest virus complex comprising the virus types as indicated above, including Semliki Forest virus
• Western equine encephalitis complex comprising the virus types as indicated above, including Sindbis virus
• Eastern equine encephalitis virus comprising the virus types as indicated above
• Venezuelan equine encephalitis complex comprising the virus types as indicated above, including Venezuelan equine encephalitis virus.
• the alphavirus is Semliki Forest virus. In an alternative further preferred embodiment, the alphavirus is Sindbis virus. In an alternative further preferred embodiment, the alphavirus is Venezuelan equine encephalitis virus.
• the alphavirus is not an alphavirus found in nature.
• an alphavirus not found in nature is a variant or derivative of an alphavirus found in nature, that is distinguished from an alphavirus found in nature by at least one mutation in the nucleotide sequence, i.e., the genomic RNA.
• the mutation in the nucleotide sequence may be selected from an insertion, a substitution or a deletion of one or more nucleotides, compared to an alphavirus found in nature.
• a mutation in the nucleotide sequence may or may not be associated with a mutation in a polypeptide or protein encoded by the nucleotide sequence.
• an alphavirus not found in nature may be an attenuated alphavirus.
• An attenuated alphavirus not found in nature is an alphavirus that typically has at least one mutation in its nucleotide sequence by which it is distinguished from an alphavirus found in nature, and that is either not infectious at all, or that is infectious but has a lower disease- producing ability or no disease-producing ability at all.
• TC83 is an attenuated alphavirus that is distinguished from the Venezuelan equine encephalitis virus (VEEV) found in nature (McKinney et al., 1963, Am. J. Trap. Med. Hyg. 12:597-603).
• VEEV Venezuelan equine encephalitis virus
• Members of the alphavirus genus may also be classified based on their relative clinical features in humans: alphaviruses associated primarily with encephalitis, and alphaviruses associated primarily with fever, rash, and polyarthritis.
• alphaviral means found in an alphavirus, or originating from an alphavirus or derived from an alphavirus, e.g., by genetic engineering.
• SFV Semliki Forest virus.
• SIN Semliki Forest virus.
• SINV Sindbis virus.
• VEE Venezuelan equine encephalitis virus.
• RNA of the present invention is modified with the beta-S-ARCA(D2) diastereomer.
• the two diastereomers of beta-S-ARCA differ in sensitivity against nucleases. It has been shown that RNA carrying the D2 diastereomer of beta-S-ARCA is almost fully resistant against Dcp2 cleavage (only 6% cleavage compared to RNA which has been synthesized in presence of the unmodified ARCA 5‘- cap), whereas RNA with the beta-S-ARCA(Dl) 5'-cap exhibits an intermediary sensitivity to Dcp2 cleavage (71% cleavage).
• RNA of the present invention is modified with a cap analog according to Formula (I), characterized by a stereochemical configuration at the P atom comprising the substituent R 5 in Formula (I) that corresponds to that at the P ⁇ atom of the DI diastereomer of beta-S-ARCA.
• a cap analog according to Formula (I) characterized by a stereochemical configuration at the P atom comprising the substituent R 5 in Formula (I) that corresponds to that at the P ⁇ atom of the DI diastereomer of beta-S-ARCA.
• R s in Formula (I) is S; and R 4 and R 6 are O.
• at least one of R 2 or R 3 in Formula (I) is preferably not OH, preferably one among R 2 and R 3 Is methoxy (OCH3), and the other one among R 2 and R 3 is preferably OH.
• RNA of the present invention is modified with a 5'-cap structure according to Formula (I) wherein any one phosphate group is replaced by a boranophosphate group or a phosphoroselenoate group.
• caps have increased stability both in vitro and in vivo.
• the respective compound has a 2'-O- or 3'-O-alkyl group (wherein alkyl is preferably methyl); respective cap analogs are termed BH3-ARCAS or Se-ARCAs.
• Compounds that are particularly suitable for capping of mRNA include the ⁇ -BH3-ARCAS and ⁇ -Se-ARCAs, as described in WO 2009/149253 A2.
• a stereochemical configuration at the P atom comprising the substituent R 5 in Formula (I) that corresponds to that at the P ⁇ atom of the DI diastereomer of beta-S-ARCA is preferred.
• the 5' cap can be a CleanCap supplied by Trillnk Biotechnologies, San Diego, CA having the following structure:
• the 5' cap can be a CleanCap supplied by Trilink Biotechnologies, San Diego, CA having the following structure:
• a modified RNA molecule comprises a 5'-cap and wherein at least one of the uridines in the molecule is a modified uridine, preferably Nl-methyl-pseudouridine (1m ⁇ ), and wherein the molecule comprises a 5' cap having the sequence NpppNU, wherein the U in the 5' cap is an unmodified uridine.
• the 5' cap has the sequence NpppAU with A representing a modified or unmodified adenosine nucleotide.
• a modified nucleotide N or A 3' to the triphosphate linkage may have a modified ribose structure such as a 2'-O- methylated ribose (Nm or Am) resulting in a so-called "Cap 1".
• a cap comprising a nucleotide N or A 3' to the triphosphate linkage having an unmethylated ribose is usually referred to as "Cap 0".
• the modified adenosine is selected from the group consisting of 2-aminopurine, 2,6- diaminopurine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-aminopurine, 7-deaza-8-aza-2-aminopurine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diamino- purine, 1-methyladenosine, N6-methyladenosine, N6- isopentenyladenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, N6-glycinylcarbamoyladenosine, N6-threonylcarbamoyladenosine, 2-methyl-thio-N6-threonylcarbamoyladenosine, 2-
• untranslated region relates to a region in a DNA molecule which is transcribed but is not translated into an amino acid sequence, or to the corresponding region in an RNA molecule, such as an mRNA molecule.
• An untranslated region (UTR) can be present 5' (upstream) of an open reading frame (5 -UTR) and/or 3' (downstream) of an open reading frame (3'-UTR).
• a 3 -UTR if present, is located at the 3' end of a gene, downstream of the termination codon of a protein-encoding region, but the term "3'-UTR" does preferably not include the poly(A) tail.
• the 3'-UTR is upstream of the poly(A) tail (if present), e.g. directly adjacent to the poly(A) tail.
• a 5'-UTR if present, is located at the 5’ end of a gene, upstream of the start codon of a protein-encoding region.
• a 5'-UTR is downstream of the 5'-cap (if present), e.g. directly adjacent to the 5'-cap.
• 5'- and/or 3'-untranslated regions may, according to the invention, be functionally linked to an open reading frame, so as for these regions to be associated with the open reading frame in such a way that the stability and/or translation efficiency of the RNA comprising said open reading frame are increased.
• the RNA molecules according to the present invention comprise a 5'-UTR and/or a 3'-UTR.
• the at least one miRNA sequence as described herein is located or comprised within the 3 - UTR of the second RNA molecule.
• UTRs are implicated in stability and translation efficiency of RNA. Both can be improved, besides structural modifications concerning the 5'-cap and/or the 3' poly(A)-tail as described herein, by selecting specific 5' and/or 3' untranslated regions (UTRs). Sequence elements within the UTRs are generally understood to influence translational efficiency (mainly 5'-UTR) and RNA stability (mainly 3 -UTR).
• first nucleic acid sequence e.g. a UTR
• first nucleic acid sequence e.g. a UTR
• the RNA molecules according to the present invention comprise a 5 -UTR and/or a 3'-UTR which is heterologous or non-native to the alphavirus from which the functional alphavirus replicase is derived.
• This allows the untranslated regions to be designed according to the desired translation efficiency and RNA stability.
• heterologous or non-native UTRs allow for a high degree of flexibility, and this flexibility is advantageous compared to native alphaviral UTRs.
• the RNA molecules according to the present invention comprise a 5 -UTR and/or a 3'-UTR that is not of virus origin; particularly not of alphavirus origin.
• the RNA molecules comprise a 5 -UTR derived from a eukaryotic 5'-UTR and/or a 3'-UTR derived from a eukaryotic 3 -UTR.
• a 5 -UTR according to the present invention can comprise any combination of more than one nucleic acid sequence, optionally separated by a linker.
• a 3 -UTR according to the present invention can comprise any combination of more than one nucleic acid sequence, optionally separated by a linker.
• linker relates to a nucleic acid sequence added between two nucleic acid sequences to connect said two nucleic acid sequences. There is no particular limitation regarding the linker sequence.
• a 3'-UTR typically has a length of 200 to 2000 nucleotides, e.g. 500 to 1500 nucleotides.
• the 3'-untranslated regions of immunoglobulin mRNAs are relatively short (fewer than about 300 nucleotides), while the 3 -untranslated regions of other genes are relatively long.
• the 3'-untranslated region of tPA is about 800 nucleotides in length
• that of factor VIII is about 1800 nucleotides in length
• that of erythropoietin is about 560 nucleotides in length.
• the 3'-UTR of the second RNA molecule further comprises at least one miRNA sequence as described herein.
• Each miRNA sequence may be 10-200 nucleotides in length, optionally 10-100, 10-90, 10-80, 10- 70, 10-60, 10-50, 10-40, 10-30, 20-100, 20-90, 20-80, 20-70, 20-60, 20-50, 20-40, or 20-30 nucleotides in length, optionally 10-50, preferably 10-30 nucleotides in length.
• uracil describes one of the nucleobases that can occur in the nucleic acid of RNA.
• the structure of uracil is:
• m5U 5-methyl-uridine
• RNA may comprise more than one type of modified nucleoside, and the modified nucleosides are independently selected from pseudouridine ( ⁇ ), Nl-methyl-pseudouridine (m1 ⁇ ), and 5-methyl-uridine (m5U).
• the modified nucleosides comprise pseudouridine ( ⁇ ) and Nl-methyl-pseudouridine (m1 ⁇ ).
• the modified nucleosides comprise pseudouridine ( ⁇ ) and 5-methyl-uridine (m5U).
• the modified nucleosides comprise Nl-methyl-pseudouridine (m1 ⁇ ) and 5-methyl-uridine (m5U).
• the modified nucleosides comprise pseudouridine ( ⁇ ), Nl-methyl-pseudouridine (m1 ⁇ ), and 5-methyl-uridine (m5U).
• the second RNA molecule comprises a modified nucleoside in place of at least one uridine, preferably in place of each uridine; preferably wherein the modified nucleoside is independently selected from pseudouridine ( ⁇ ), Nl- methyl-pseudouridine (m1 ⁇ ), and 5-methyl-uridine (m5U).
• pseudouridine ⁇
• Nl- methyl-pseudouridine m1 ⁇
• m5U 5-methyl-uridine
• the RNA comprises other modified nucleosides or comprises further modified nucleosides, e.g., modified cytidine such as those described above.
• modified cytidine such as those described above.
• the RNA in the RNA 5-methylcytidine is substituted partially or completely, preferably completely, for cytidine.
• the RNA comprises 5- methylcytidine and one or more selected from pseudouridine ( ⁇ ), Nl-methyl-pseudouridine (m1 ⁇ ), and 5-methyl- uridine (m5U).
• the RNA comprises 5-methylcytidine and Nl-methyl-pseudouridine (m1 ⁇ ).
• the RNA comprises 5-methylcytidine in place of each cytidine and Nl-methyl-pseudouridine (m1 ⁇ ) in place of each uridine.
• the first RNA molecule comprises an open reading frame encoding a functional RNA-dependent RNA polymerase (replicase).
• the first RNA molecule is a replicon, which can be replicated by its encoded replicase.
• the first RNA molecule comprises nucleotide sequences that can be recognized by the replicase such that the RNA is replicated.
• the first RNA molecule can further comprise other features.
• the first RNA molecule comprises an open reading frame encoding a functional replicase and a further open reading frame encoding a protein of interest.
• non-structural protein relates to a protein encoded by a virus but that is not part of the viral particle. This term typically includes the various enzymes and transcription factors the virus uses to replicate itself, such as RNA replicase or other template-directed polymerases.
• non-structural protein includes each and every co- or post-translationally modified form, including carbohydrate-modified (such as glycosylated) and lipid-modified forms of a non-structural protein and preferably relates to an "alphavirus non-structural protein".
• alphavirus non-structural protein refers to any one or more of individual non- structural proteins of alphavirus origin (nsPl, nsP2, nsP3, nsP4), or to a poly-protein comprising the polypeptide sequence of more than one non-structural protein of alphavirus origin.
• alphavirus non- structural protein refers to nsP123 and/or to nsP4. In other embodiments, “alphavirus non-structural protein” refers to nsP1234.
• the protein of interest encoded by an open reading frame consists of all of nsPl, nsP2, nsP3 and nsP4 as one single, optionally cleavable poly-protein: nsP1234.
• the protein of interest encoded by an open reading frame consists of nsPl, nsP2 and nsP3 as one single, optionally cleavable polyprotein: nsP123.
• nsP4 may be a further protein of interest and may be encoded by a further open reading frame.
• non-structural protein is capable of forming a complex or association, e.g., in a host cell.
• "alphavirus non-structural protein” refers to a complex or association of nsP123 (synonymously P123) and nsP4.
• "alphavirus non-structural protein” refers to a complex or association of nsPl, nsP2, and nsP3.
• "alphavirus non-structural protein” refers to a complex or association of nsPl, nsP2, nsP3 and nsP4.
• alphavirus non-structural protein refers to a complex or association of any one or more selected from the group consisting of nsPl, nsP2, nsP3 and nsP4. In some embodiments, the alphavirus non-structural protein comprises at least nsP4.
• the term "functional non-structural protein” includes non-structural protein that has replicase function.
• “functional non-structural protein” includes alphavirus replicase.
• "Replicase function” comprises the function of an RNA-dependent RNA polymerase (RdRP), i.e., an enzyme which is capable to catalyze the synthesis of (-) strand RNA based on a (+) strand RNA template, and/or which is capable to catalyze the synthesis of (+) strand RNA based on a (-) strand RNA template.
• RdRP RNA-dependent RNA polymerase
• the term “functional non-structural protein” can refer to a protein or complex that synthesizes (-) stranded RNA, using the (+) stranded (e.g.
• genomic RNA as template, to a protein or complex that synthesizes new (+) stranded RNA, using the (-) stranded complement of genomic RNA as template, and/or to a protein or complex that synthesizes a subgenomic transcript, using a fragment of the (-) stranded complement of genomic RNA as template.
• the functional non-structural protein may additionally have one or more additional functions, such as, e.g., a protease (for auto-cleavage), helicase, terminal adenylyltransferase (for poly(A) tail addition), methyltransferase and guanylyltransferase (for providing a nucleic acid with a 5'-cap), nuclear localization sites, triphosphatase (Gould et al., 2010, Antiviral Res. 87:111-124; Rupp eta!., 2015, J. Gen. Virol. 96:2483-500).
• additional functions such as, e.g., a protease (for auto-cleavage), helicase, terminal adenylyltransferase (for poly(A) tail addition), methyltransferase and guanylyltransferase (for providing a nucleic acid with a 5'-cap), nuclear localization sites, triphosphatas
• RNA-dependent RNA polymerase includes RNA-dependent RNA polymerase.
• the term “replicase” includes "alphavirus replicase”, including a RNA-dependent RNA polymerase from a naturally occurring alphavirus (alphavirus found in nature) and a RNA-dependent RNA polymerase from a variant or derivative of an alphavirus, such as from an attenuated alphavirus.
• the term “replicase” may also include a RNA-dependent RNA polymerase from other self-replicating viruses, such as a self-replicating single-stranded RNA virus, optionally a positive-sense, single-stranded RNA virus (e.g., alphavirus, flavivirus, etc.).
• replicase comprises all variants, in particular post-translationally modified variants, conformations, isoforms and homologs of alphavirus replicase, which are expressed by alphavirus-infected cells or which are expressed by cells that have been transfected with a nucleic acid that codes for alphavirus replicase. Moreover, the term “replicase” comprises all forms of replicase that have been produced and can be produced by recombinant methods.
• a replicase comprising a tag that facilitates detection and/or purification of the replicase in the laboratory, e.g.,- a myc-tag, a HA-tag or an oligohistidine tag (His-tag) may be produced by recombinant methods.
• the alphavirus replicase is additionally functionally defined by the capacity of binding to any one or more of alphavirus conserved sequence element 1 (CSE 1) or complementary sequence thereof, conserved sequence element 2 (CSE 2) or complementary sequence thereof, conserved sequence element 3 (CSE 3) or complementary sequence thereof, conserved sequence element 4 (CSE 4) or complementary sequence thereof.
• the replicase is capable of binding to CSE 2 [i.e., to the (+) strand] and/or to CSE 4 [i.e., to the (+) strand], or of binding to the complement of CSE 1 [i.e. to the (-) strand] and/or to the complement of CSE 3 [i.e., to the (-) strand].
• the origin of the alphavirus replicase is not limited to any particular alphavirus.
• the alphavirus replicase comprises non-structural protein from Semliki Forest virus, including a naturally occurring Semliki Forest virus and a variant or derivative of Semliki Forest virus, such as an attenuated Semliki Forest virus.
• the alphavirus replicase comprises non-structural protein from Sindbis virus, including a naturally occurring Sindbis virus and a variant or derivative of Sindbis virus, such as an attenuated Sindbis virus.
• the alphavirus replicase comprises non-structural protein from Venezuelan equine encephalitis virus (VEEV), including a naturally occurring VEEV and a variant or derivative of VEEV, such as an attenuated VEEV.
• VEEV Venezuelan equine encephalitis virus
• the alphavirus replicase comprises non-structural protein from chikungunya virus (CHIKV), including a naturally occurring CHIKV and a variant or derivative of CHIKV, such as an attenuated CHIKV.
• CHIKV chikungunya virus
• replicase can also comprise non-structural proteins from more than one virus, e.g., from more than one alphavirus.
• replicase may comprise one or more non-structural proteins ⁇ e.g., nsPl, nsP2) from a first alphavirus, and one or more non- structural proteins (nsP3, nsP4) from a second alphavirus.
• Non-structural proteins from more than one different alphavirus may be encoded by separate open reading frames, or may be encoded by a single open reading frame as poly-protein, e.g., nsP1234.
• the 5' replication recognition sequence of an rRNA according to the invention is characterized by a secondary structure that is equivalent to the secondary structure of the 5' replication recognition sequence of alphaviral genomic RNA.
• the 5' replication recognition sequence of an rRNA according to the invention is characterized by a predicted secondary structure that is equivalent to the predicted secondary structure of the 5' replication recognition sequence of alphaviral genomic RNA.
• the secondary structure of an RNA molecule is preferably predicted by the web server for RNA secondary structure prediction http://rna.urmc.rochester.edu/RNAstructureWeb/Servers/Predictl/Predictl.html.
• one or more stem loops of the 5' replication recognition sequence are not deleted or disrupted. More preferably, stem loops 3 and 4 are not deleted or disrupted. Preferably, none of the stem loops of the 5' replication recognition sequence is deleted or disrupted.
• an rRNA according to the invention comprises one or more nucleotide changes compensating for nucleotide pairing disruptions within one or more stem loops introduced by the removal of at least one initiation codon.
• nucleotide pairing disruption within a stem loop, compared to a native 5' replication recognition sequence, one or more nucleotide changes may be introduced which are expected to compensate for the nucleotide pairing disruption, and the secondary structure or predicted secondary structure obtained thereby may be compared to a native 5' replication recognition sequence.
• nucleotide changes can be expected by the skilled person to compensate for nucleotide pairing disruptions. For example, if a base pair is disrupted at a given position of the secondary structure or predicted secondary structure of a given 5' replication recognition sequence of an rRNA characterized by the removal of at least one initiation codon, compared to the native 5' replication recognition sequence, a nucleotide change that restores a base pair at that position, preferably without re-introducing an initiation codon, is expected to compensate for the nucleotide pairing disruption.
• the 5' replication recognition sequence of an rRNA according to the invention does not overlap with, or does not comprise, a translatable nucleic acid sequence, i.e. translatable into a peptide or protein, in particular an nsP, in particular nsPl, or a fragment of any thereof.
• a nucleotide sequence to be "translatable” it requires the presence of an initiation codon; the initiation codon encodes the most N-terminal amino acid residue of the peptide or protein.
• the 5' replication recognition sequence of an rRNA according to the invention does not overlap with, or does not comprise, a translatable nucleic acid sequence encoding an N-terminal fragment of nsPl.
• an rRNA comprises at least one subgenomic promoter.
• the subgenomic promoter of the rRNA does not overlap with, or does not comprise, a translatable nucleic acid sequence, i.e. translatable into a peptide or protein, in particular an nsP, in particular nsP4, or a fragment of any thereof.
• the subgenomic promoter of an rRNA does not overlap with, or does not comprise, a translatable nucleic acid sequence that encodes a C-terminal fragment of nsP4.
• An rRNA having a subgenomic promoter that does not overlap with, or does not comprise, a translatable nucleic acid sequence e.g.
• translatable into the C- terminal fragment of nsP4 may be generated by deleting part of the coding sequence for nsP4 (typically the part encoding the N-terminal part of nsP4), and/or by removing AUG base triplets in the part of the coding sequence for nsP4 that has not been deleted. If AUG base triplets in the coding sequence for nsP4 or a part thereof are removed, the AUG base triplets that are removed are preferably potential initiation codons. Alternatively, if the subgenomic promoter does not overlap with a nucleic acid sequence that encodes nsP4, the entire nucleic acid sequence encoding nsP4 may be deleted.
• an rRNA according to the invention does not comprise an open reading frame encoding solely the N-terminal fragment of nsPl, and optionally does not comprise an open reading frame encoding solely the C- terminal fragment of nsP4.
• an rRNA according to the present invention does not comprise stem loop 2 (SL2) of the 5' terminus of the genome of an alphavirus. According to Frolov et a/., supra, stem loop 2 is a conserved secondary structure found at the 5' terminus of the genome of an alphavirus, upstream of CSE 2, but is dispensable for replication.
• An rRNA according to the present invention is preferably a single stranded RNA molecule.
• An rRNA according to the present invention is typically a (+) stranded RNA molecule.
• an rRNA of the present invention is an isolated nucleic acid molecule.
• An rRNA according to the present invention comprises at least one modified nucleotide, and preferably comprises one or more sequence changes, in particular those detected by the methods disclosed herein for identifying sequence changes that restore or improve the function of an rRNA comprising at least one modified nucleotide.
• an rRNA comprises a modified 5' regulatory region of a self-replicating RNA virus of SEQ ID NO: 1, which is preferably a modified version of the 5' regulatory region of VEEV Trinidad donkey strain (Accession No. L01442), and which modified regulatory region comprises a point mutation at one or more of positions 67, 244, 245, 246, 248 of the 5' regulatory region (SEQ ID NO: 1).
• the 5' regulatory region further comprises a point mutation at position 4 of the 5' regulatory region (SEQ ID NO: 1).
• the point mutation is preferably G4A, A67C, G244A, C245A, G246A, or C248A.
• the replicons of the present invention are not particle-forming. This means that, following inoculation of a host cell by a replicon of the present invention, the host cell does not produce virus particles, such as next generation virus particles.
• an RNA replicon according to the invention is completely free of genetic information encoding any virus structural protein, e.g., alphavirus structural protein, such as core nucleocapsid protein C, envelope protein P62, and/or envelope protein El.
• the replicon according to the present invention does not comprise a virus packaging signal, e.g., an alphavirus packaging signal.
• the alphavirus packaging signal comprised in the coding region of nsP2 of SFV may be removed, e.g. by deletion or mutation.
• a suitable way of removing the alphavirus packaging signal includes adaptation of the codon usage of the coding region of nsP2.
• the degeneration of the genetic code may allow to delete the function of the packaging signal without affecting the amino acid sequence of the encoded nsP2.
• the second RNA molecule of the present invention comprises, optionally encodes, at least one miRNA sequence, which miRNA sequence is capable of being excised from the second replicable RNA molecule when present in a cell, and is capable of regulating gene expression in a cell.
• the second RNA molecule of the present invention comprises, optionally encodes, at least one non-coding RNA sequence, which non-coding RNA sequence is capable of being excised from the second replicable RNA molecule when present in a cell, and is capable of regulating gene expression in a cell.
• the cell is a eukaryotic cell, preferably a mammalian, preferably a human cell.
• the cell in which the second RNA is to be present for excision typically has to be capable of excising the miRNA sequence from the second RNA molecule, for example it has to have the required enzymes such as Drosha and Dicer.
• the cell may endogenously (i.e., naturally) express the required factors (typically enzymes), or alternatively may have been modified to express the required factors (typically enzymes), needed for excising the non-coding RNA sequence, preferably the miRNA sequence, from the second RNA molecule.
• factors typically enzymes, may be capable of excising a sequence containing the miRNA sequence from the second RNA molecule and may further processes the sequence as required to provide a functional miRNA sequence.
• the miRNA capable of being excised from the second RNA molecule inside a cell is typically flanked by flanking sequences up- and/or downstream of the miRNA. These flanking sequences serve as or comprise recognition sequences for excision of the miRNA from the second RNA molecule. Thus, the factors or enzymes as described above may target the recognition sequences in the flanking sequences to effect excision of the miRNA from the second RNA molecule.
• flanking sequences up- and/or downstream of the at least one miRNA sequence are flanking sequences that are naturally occurring flanking sequences, for example, sequences that flank naturally occurring miRNAs, such as from murine miR-155.
• the flanking sequences can be flanking sequences that also flank the miRNA sequence in nature or they can be flanking sequences that do not flank the miRNA in nature, such as flanking sequences that flank other miRNA sequences.
• the flanking sequences can be from the same or from different organisms as the miRNA sequence.
• flanking sequences up- and/or downstream of the at least one miRNA sequence are artificial flanking sequences.
• the term "capable of regulating gene expression” means that the miRNA is influencing the expression level of a certain gene product, such as a gene-encoded a protein, whereby the level of the protein is regulated.
• the regulation can be a complete stop of the expression, also known as silencing, of a gene or the attenuation of expression, which means that less of the gene is expressed, or enhancing expression.
• Preferably regulation is done by targeting an mRNA to prevent its translation.
• the target of the miRNA is not particularly limited.
• the target is of particular interest for the onset or progression of a disease or disorder and its regulation helps in treating or preventing this disease or disorder.
• the target can also be relevant for inducing pluripotency.
• targeting means according to the invention binding of the miRNA to an at least partially complementary sequence, preferably of an mRNA, and regulating the expression from the mRNA.
• the origin of the miRNA sequence can be natural or artificial.
• a natural miRNA sequence originates preferably from the same organism in which the RNA molecules of the present invention are to be introduced.
• the miRNA is preferably of human origin.
• An artificial pre-miRNA sequence can also comprise a naturally occurring mature miRNA sequence.
• the sequence of a naturally occurring mature miRNA is included in an artificial pre-miRNA where the flanking and loop sequences are not those naturally associated with this mature miRNA.
• an miRNA sequence also may be designed to be at least partially complementary to, for example capable of binding to, a particular mRNA of interest, i.e., a target mRNA.
• the second RNA molecule may comprise a miRNA sequence which is at least partially complementary to (Ze., targets) an mRNA of interest, optionally further comprising flanking sequences as described herein.
• mature miRNA or “functional miRNA” are used interchangeably in this application. They refer to an miRNA of about 22 nucleotides which is capable of directly regulating gene expression by binding together with proteins to its target, e.g., target mRNA.
• the miRNA sequence comprised on the second RNA molecule may be 10-200 nucleotides in length, optionally 10-100, 10-90, 10-80, 10-70, 10-60, 10-50, 10-40, 10-30, 20-100, 20-90, 20-80, 20-70, 20-60, 20-50, 20-40, or 20-30 nucleotides in length, optionally 10-50, preferably 10-30 nucleotides in length.
• At least one open reading frame encoding at least one gene product of interest
• the first and/or second RNA according to the present invention comprises at least one open reading frame encoding a gene product of interest, such as a protein of interest.
• the protein of interest is encoded by a heterologous nucleic acid sequence.
• the gene encoding the protein of interest is synonymously termed "gene of interest” or "transgene”.
• the protein of interest is encoded by a heterologous nucleic acid sequence.
• heterologous refers preferably to the fact that a nucleic acid sequence is not naturally functionally or structurally linked to a virus nucleic acid sequence, e.g., an alphavirus nucleic acid sequence.
• the first and/or second RNA according to the present invention may comprise more than one open reading frames encoding a protein of interest, each of which may independently be selected to be under the control of a subgenomic promoter or not.
• a poly-protein or fusion polypeptide comprises individual polypeptides separated by a 2A self-cleaving peptides (e.g. from foot-and-mouth disease virus 2A protein), or protease cleavage site or an intein.
• the first and second RNA are suitable for expression of one or more genes encoding a protein of interest, optionally under control of a subgenomic promoter.
• One or more open reading frames, each encoding a protein of interest can be present on the first and/or second RNA, preferably the second RNA.
• the most upstream open reading frame of each RNA is referred to as "first open reading frame”.
• the one or more open reading frame encoding a protein of interest is located downstream of the open reading frame encoding a functional non-structural protein.
• the first open reading frame Is under control of a subgenomic promoter.
• the gene encoded by the first open reading frame can be expressed both from the RNA as well as from a subgenomic transcript thereof (the latter in the presence of functional alphavirus replicase).
• One or more further open reading frames, each under control of a subgenomic promoter may be present downstream of the first open reading frame that may be under control of a subgenomic promoter.
• the proteins encoded by the one or more further open reading frames e.g. by the second open reading frame, may be translated from one or more subgenomic transcripts, each under control of a subgenomic promoter.
• the first RNA may comprise a subgenomic promoter controlling production of a transcript that encodes a third protein of interest.
• a first RNA may comprise an internal ribosome entry site (IRES) and an open reading frame encoding one or more non-structural proteins from a self-replicating virus, wherein the IRES controls expression of the one or more non-structural proteins, e.g., nspl234.
• the first and/or second rRNA contains sequence elements allowing replication by a functional replicase.
• the self-replicating virus is an alphavirus and the sequence elements allowing replication by the functional replicase are derived from an alphavirus.
• Alphavirus replicases have a capping enzyme function, and, typically, genomic as well as subgenomic (+) stranded RNAs are capped.
• the 5'-cap serves to protect mRNA from degradation, and to direct the ribosomal subunits as well as cellular factors to the mRNA in order to form a ribonucleoprotein complex on the mRNA that then can start translation from a nearby start codon.
• This complex process is extensively described in the literature (Jackson et a!., 2010, Nat Rev Mol Biol; Vol 10:113-127).
• cells Despite the very elaborated and efficient mechanism of cap dependent translation, cells have means to initiate translation fully or partially independently from the 5’ cap (Thompson 2012; Trends in Microbiology 20:558-566). Thereby, in situations of cellular stress that lead to a global down regulation of cap-dependent translation, the cells may still express selected genes preferentially, often with the help of an IRES.
• Viruses also evolved different means to exploit the cells machinery for translation of the viral genes. Since a viral infection is often sensed by the cell which leads to cellular antiviral response (interferon response; stress response), many viruses also make use of cap-independent translation, especially RNA viruses. Cap independent translation ensure an advantage for the viral RNA translation upon cellular stress response giving the viruses the opportunity to fulfil their life cycle and be released from infected cells.
• IRESs Internal ribosomal entry sites
• EMCV encephalomyocarditis virus
• HCV hepatitis C virus
• IV the IRES found in the intergenlc regions of dicistroviruses
• Type I to III IRESs have in common that they initiate translation at AUG start codons, whereas type IV IRES initiate at non-AUG codons ⁇ e.g., GCU). Thereby Type I to III require the initiator tRNA that delivers methionine by the help of eIF2/GTP (eIF2/GTP/Met-tRNAiMet). Activation of eIF2 kinases under stress phosphorylates the alpha subunit of eIF2 which inhibits translation that initiates at AUG. Thereby translation directed by type IV IRESs are not inhibited by eIF2 phosphorylation.
• IRES internal ribosome entry site
• ORFs open reading frames
• IRESs are commonly located in the 5'-UTR of RNA viruses.
• mRNAs of viruses from dicistroviridae family possess two open reading frames (ORFs), and translation of each is directed by two distinct IRESs.
• ORFs open reading frames
• IRESs some mammalian cellular mRNAs also have IRESs. These cellular IRES elements are thought to be located in eukaryotic mRNAs encoding genes involved in stress survival, and other processes critical to survival. The location for IRES elements is often in the 5 -UTR, but can also occur elsewhere in mRNAs.
• Type I and Type II Two groups of viral IRESs, Type I and Type II, cannot bind to the 40S small ribosomal subunit directly. Instead, they recruit the 40S small ribosomal subunit through different ITAFs and require canonical IFs in the cap-dependent translation (i.e., eIF2, eIF3, eIF4A, eIF4B, and eIF4G).
• the major difference between Type I and Type II IRESs is the requirement of 40S ribosome scanning, with 40S ribosome scanning being unnecessary for Type II IRES.
• Type IRESs include IRESs found in poliovirus (PV) and rhinovirus.
• Type II IRESs include IRESs found in encephalomyocarditis virus (EMCV), foot-and-mouth disease virus (FMDV) and Theiler's murine encephalomyelitis viruses (TMEV).
• Type IV viral IRESs generally have strong activities and can initiate translation from a non-AUG start codon without additional ITAFs or even eIF2/Met-tRNAi/GTP ternary complex. These IRESs are folded to a compact structure that directly interacts with the 40S small ribosomal subunit. Examples include IRESs found in dicistroviruses such as cricket paralysis virus (CrPV), plautia stall intestine virus (PSIV), and Taura-Syndrom-Virus (TSV).
• CrPV cricket paralysis virus
• PSIV plautia stall intestine virus
• TSV Taura-Syndrom-Virus
• IRESs interleukin-1 ribosome entry site
• ITAFs that bound on the cis-elements, e.g., RNA binding motifs and N-6- methyladenosine (m6A) modification
• Type II IRESs contain a short cis-element that pairs with 18S rRNA to recruit ribosomes.
• Proteins of interest may, e.g., be selected from the group consisting of reporter proteins, pharmaceutically active peptides or proteins, inhibitors of intracellular interferon (IFN) signaling, pluripotency factors, differentiation factors, vaccinia virus immune evasion proteins or antigens or epitopes thereof.
• IFN intracellular interferon
• a protein of interest preferably does not include functional non-structural proteins from a self-replicating virus, e.g., functional alphavirus non-structural proteins.
• an open reading frame encodes a reporter protein, e.g., a cell-surface expressed protein such as CD90.
• the open reading frame comprises a reporter gene.
• Certain genes may be chosen as reporters because the characteristics they confer on cells or organisms expressing them may be readily identified and measured, or because they are selectable markers. Reporter genes are often used as an indication of whether a certain gene has been taken up by or expressed in the cell or organism population.
• the expression product of the reporter gene is visually detectable. Common visually detectable reporter proteins typically possess fluorescent or luminescent proteins.
• reporter genes examples include the gene that encodes jellyfish green fluorescent protein (GFP), which causes cells that express it to glow green under blue light, the enzyme luciferase (Luc), which catalyzes a reaction with luciferin to produce light, and the red fluorescent protein (RFP). Variants of any of these specific reporter genes are possible, as long as the variants possess visually detectable properties. For example, eGFP is a point mutant variant of GFP.
• the reporter protein embodiment is particularly suitable for testing expression.
• the first and/or second RNA comprises or consists of pharmaceutically active RNA.
• a "pharmaceutically active RNA” may be RNA that encodes a pharmaceutically active peptide or protein.
• the RNA according to the present invention encodes a pharmaceutically active peptide or protein.
• the RNA according to the present invention comprises a pharmaceutically active miRNA.
• the system according to the present invention encodes a pharmaceutically active peptide or protein, and a pharmaceutically active miRNA.
• the first RNA molecule encodes a replicase as described herein
• the second replicable RNA molecule which is capable of being replicated in trans by the replicase encoded by the first RNA molecule, encodes a pharmaceutically active peptide or protein, and a pharmaceutically active miRNA.
• an open reading frame encodes a pharmaceutically active peptide or protein.
• the RNA comprises an open reading frame that encodes a pharmaceutically active peptide or protein, optionally under control of the subgenomic promoter.
• a "pharmaceutically active peptide or protein” or a “pharmaceutically active miRNA” has a positive or advantageous effect on the condition or disease state of a subject when administered to the subject in a therapeutically effective amount.
• a pharmaceutically active peptide or protein or a pharmaceutically active miRNA has curative or palliative properties and may be administered to ameliorate, relieve, alleviate, reverse, delay onset of or lessen the severity of one or more symptoms of a disease or disorder.
• a pharmaceutically active peptide or protein or a pharmaceutically active miRNA may have prophylactic properties and may be used to delay the onset of a disease or to lessen the severity of such disease or pathological condition.
• pharmaceutically active peptide or protein includes entire proteins or polypeptides, and can also refer to pharmaceutically active fragments thereof. It can also include pharmaceutically active analogs of a peptide or protein.
• pharmaceutically active peptide or protein includes peptides and proteins that are antigens, i.e., the peptide or protein elicits an immune response in a subject which may be therapeutic or partially or fully protective.
• the pharmaceutically active peptide or protein is or comprises an immunologically active compound or an antigen or an epitope.
• the term "immunologically active compound” relates to any compound altering an immune response, preferably by inducing and/or suppressing maturation of immune cells, inducing and/or suppressing cytokine biosynthesis, and/or altering humoral immunity by stimulating antibody production by B cells.
• the immune response involves stimulation of an antibody response (usually including immunoglobulin G (IgG)).
• Immunologically active compounds possess potent immunostimulating activity including, but not limited to, antiviral and antitumor activity, and can also down-regulate other aspects of the immune response, for example shifting the immune response away from a Th2 immune response, which is useful for treating a wide range of Th2 mediated diseases.
• the term “antigen” or “immunogen” covers any substance that will elicit an immune response.
• an “antigen” relates to any substance that reacts specifically with antibodies or T- lymphocytes (T-cells).
• the term “antigen” comprises any molecule which comprises at least one epitope.
• an antigen in the context of the present invention is a molecule which, optionally after processing, induces an immune reaction, which is preferably specific for the antigen.
• any suitable antigen may be used, which is a candidate for an immune reaction, wherein the immune reaction may be both a humoral as well as a cellular immune reaction.
• the antigen is preferably presented by a cell, preferably by an antigen presenting cell, in the context of MHC molecules, which results in an immune reaction against the antigen.
• An antigen is preferably a product which corresponds to or is derived from a naturally occurring antigen.
• Naturally occurring antigens may include or may be derived from allergens, viruses, bacteria, fungi, parasites and other infectious agents and pathogens or an antigen may also be a tumor antigen.
• an antigen may correspond to a naturally occurring product, for example, a viral protein, or a part thereof.
• the antigen is a surface polypeptide, i.e.
• a polypeptide naturally displayed on the surface of a cell a pathogen, a bacterium, a virus, a fungus, a parasite, an allergen, or a tumor.
• the antigen may elicit an immune response against a cell, a pathogen, a bacterium, a virus, a fungus, a parasite, an allergen, or a tumor.
• pathogen refers to pathogenic biological material capable of causing disease in an organism, preferably a vertebrate organism. Pathogens include microorganisms such as bacteria, unicellular eukaryotic organisms (protozoa), fungi, parasites as well as viruses.
• epitope refers to an antigenic determinant in a molecule such as an antigen, i.e., to a part in or fragment of an immunologically active compound that is recognized by the immune system, for example, that is recognized by a T cell, in particular when presented in the context of MHC molecules.
• the DNA is double-stranded.
• the DNA of the present invention is an isolated nucleic acid molecule.
• the system described herein may be present in the form of a composition or two separate compositions.
• the system may comprise further components.
• the following embodiments relating to a system apply to embodiments wherein the system is a composition or separate compositions wherein, for example, only one of the RNAs is present.
• a system can further comprise a solvent such as an aqueous solvent or any solvent that makes it possible to preserve the integrity of the RNA.
• the system is an aqueous solution comprising RNA.
• the aqueous solution may optionally comprise solutes, e.g. salts.
• the system is in the form of a freeze-dried composition or at least two freeze-dried compositions.
• a freeze-dried composition is obtainable by freeze-drying a respective aqueous composition.
• the systems as described herein may further comprise a reagent capable of forming particles with the RNA molecules.
• a system described herein may additionally comprise salts, buffers, or other components as further described below.
• a salt for use in the systems described herein comprises sodium chloride.
• sodium chloride functions as an ionic osmolality agent for preconditioning RNA prior to mixing with lipids.
• the systems described herein may comprise alternative organic or inorganic salts.
• Alternative salts include, without limitation, potassium chloride, dipotassium phosphate, monopotassium phosphate, potassium acetate, potassium bicarbonate, potassium sulfate, disodium phosphate, monosodium phosphate, sodium acetate, sodium bicarbonate, sodium sulfate, lithium chloride, magnesium chloride, magnesium phosphate, calcium chloride, and sodium salts of ethylenediaminetetraacetic acid (EDTA).
• potassium chloride dipotassium phosphate, monopotassium phosphate, potassium acetate, potassium bicarbonate, potassium sulfate, disodium phosphate, monosodium phosphate, sodium acetate, sodium bicarbonate, sodium sulfate, lithium chloride, magnesium chloride, magnesium phosphate, calcium chloride, and sodium salts of ethylenediaminetetraacetic acid (EDTA).
• EDTA ethylenediaminetetraacetic acid
• systems or compositions for storing RNA particles such as for freezing RNA particles comprise low sodium chloride concentrations, or comprises a low ionic strength.
• the sodium chloride is at a concentration from 0 mM to about 50 mM, from 0 mM to about 40 mM, or from about 10 mM to about 50 mM.
• the systems described herein have a pH suitable for the stability of the RNA particles and, in particular, for the stability of the RNA.
• a buffer system maintains the pH of the particle compositions described herein during manufacturing, storage and use of the compositions.
• the buffer system may comprise a solvent (in particular, water, such as deionized water, in particular water for injection) and a buffering substance.
• the buffering substance may be selected from 2-[4-(2-hydroxyethyl)piperazin-l-yl]ethanesulfonic acid (HEPES), 2-amino-2- (hydroxymethyl)propane-l,3-diol (Tris), acetate, and histidine.
• HEPES 2-[4-(2-hydroxyethyl)piperazin-l-yl]ethanesulfonic acid
• Tris 2-amino-2- (hydroxymethyl)propane-l,3-diol
• acetate 2-amino-2- (hydroxymethyl)propane-l,3-diol
• histidine 2-amino-2- (hydroxymethyl)propane-l,3-diol
• a preferred buffering substance is HEPES.
• Systems described herein may also comprise a cryoprotectant and/or a surfactant as stabilizer to avoid substantial loss of the product quality and, in particular, substantial loss of RNA activity during storage, freezing, spray-drying and/or lyophilization, for example to reduce or prevent aggregation, particle collapse, RNA degradation and/or other types of damage.
• cryoprotectant is a carbohydrate.
• carbohydrate refers to and encompasses monosaccharides, disaccharides, trisaccharides, oligosaccharides and polysaccharides.
• the cryoprotectant is a monosaccharide.
• monosaccharide refers to a single carbohydrate unit (e.g., a simple sugar) that cannot be hydrolyzed to simpler carbohydrate units.
• monosaccharide cryoprotectants include glucose, fructose, galactose, xylose, ribose and the like.
• the cryoprotectant is a disaccharide.
• disaccharide refers to a compound or a chemical moiety formed by 2 monosaccharide units that are bonded together through a glycosidic linkage, for example through 1-4 linkages or 1-6 linkages. A disaccharide may be hydrolyzed into two monosaccharides.
• Exemplary disaccharide cryoprotectants include sucrose, trehalose, lactose, maltose and the like.
• trisaccharide means three sugars linked together to form one molecule. Examples of a trisaccharides include raffinose and melezitose.
• the cryoprotectant is an oligosaccharide.
• oligosaccharide refers to a compound or a chemical moiety formed by 3 to about 15, such as 3 to about 10 monosaccharide units that are bonded together through glycosidic linkages, for example through 1-4 linkages or 1-6 linkages, to form a linear, branched or cyclic structure.
• Exemplary oligosaccharide cryoprotectants include cyclodextrins, raffinose, melezitose, maltotriose, stachyose, acarbose, and the like. An oligosaccharide can be oxidized or reduced.
• the cryoprotectant is a cyclic oligosaccharide.
• cyclic oligosaccharide refers to a compound or a chemical moiety formed by 3 to about 15, such as 6, 7, 8, 9, or 10 monosaccharide units that are bonded together through glycosidic linkages, for example through 1-4 linkages or 1-6 linkages, to form a cyclic structure.
• Exemplary cyclic oligosaccharide cryoprotectants include cyclic oligosaccharides that are discrete compounds, such as a cyclodextrin, p cyclodextrin, or y cyclodextrin.
• An exemplary cryoprotectant is a polysaccharide.
• polysaccharide refers to a compound or a chemical moiety formed by at least 16 monosaccharide units that are bonded together through glycosidic linkages, for example through 1-4 linkages or 1-6 linkages, to form a linear, branched or cyclic structure, and includes polymers that comprise polysaccharides as part of their backbone structure. In backbones, the polysaccharide can be linear or cyclic.
• Exemplary polysaccharide cryoprotectants include glycogen, amylase, cellulose, dextran, maltodextrin and the like.
• the neutral lipid is present in a concentration ranging from 5 to 15 mol percent, from 7 to 13 mol percent, or from 9 to 11 mol percent. In one embodiment, the neutral lipid is present in a concentration of about 9.5, 10 or 10.5 mol percent.
• the neutral lipid is selected from the group consisting of DSPC, DPPC, DMPC, DOPC, POPC, DOPE, DOPG, DPPG, POPE, DPPE, DMPE, DSPE, and SM. In one embodiment, the neutral lipid is selected from the group consisting of DSPC, DPPC, DMPC, DOPC, POPC, DOPE and SM. In one embodiment, the neutral lipid is DSPC.
• the polymer conjugated lipid is not a pegylated lipid.
• G 1 and G 2 are each independently unsubstituted C 1 -C 12 alkylene or C 1 -C 12 alkenylene;
• G 3 is C 1 -C 24 alkylene, C 1 -C 24 alkenylene, C 3 -C 8 cycloalkylene, C 3 -C 8 cycloalkenylene;
• the lipid has structure (IIIA), and in other embodiments, the lipid has structure (IIIB).
• the lipid has one of the following structures (IIIG), (IIIH),
• n is an integer ranging from 2 to 12, for example from 2 to 8 or from 2 to 4.
• n is 3, 4, 5 or 6.
• n is 3.
• n is 4.
• n is 5.
• n is 6.
• G 3 is unsubstituted. In other embodiments, G3 is substituted. In various different embodiments, G 3 is linear C 1 -C 24 alkylene or linear C 1 -C 24 alkenylene.
• R 1 or R 2 is C 6 -C 24 alkenyl.
• R 1 and R 2 each, independently have the following structure: wherein:
• At least one occurrence of R 7a is H.
• R 7a is H at each occurrence.
• at least one occurrence of R 7b is C 1 -C 8 alkyl.
• C 1 -C 8 alkyl is methyl, ethyl, n-propyl, iso-propyl, n-butyl, iso-butyl, tert-butyl, n-hexyl or n-octyl.
• R 4 is methyl or ethyl.
• the cationic lipid of Formula (III) has one of the structures set forth in the table below. Representative Compounds of Formula (III).
• the LNP comprises a lipid of Formula (III), RNA, a neutral lipid, a steroid and a pegylated lipid.
• the lipid of Formula (III) is compound III-3.
• the neutral lipid is DSPC.
• the steroid is cholesterol.
• the pegylated lipid is ALC-0159.
• the cationic lipid is present in the LNP in an amount from about 40 to about 50 mole percent. In one embodiment, the neutral lipid is present in the LNP in an amount from about 5 to about 15 mole percent. In one embodiment, the steroid is present in the LNP in an amount from about 35 to about 45 mole percent. In one embodiment, the pegylated lipid is present in the LNP in an amount from about 1 to about 10 mole percent.
• the LNP comprises compound III-3 in an amount from about 40 to about 50 mole percent, DSPC in an amount from about 5 to about 15 mole percent, cholesterol in an amount from about 35 to about 45 mole percent, and ALC-0159 in an amount from about 1 to about 10 mole percent.
• the LNP comprises compound III-3 in an amount of about 47.5 mole percent, DSPC in an amount of about 10 mole percent, cholesterol in an amount of about 40.7 mole percent, and ALC-0159 in an amount of about 1.8 mole percent.
• the N/P value is preferably at least about 4. In some embodiments, the N/P value ranges from 4 to 20, 4 to 12, 4 to 10, 4 to 8, or 5 to 7. In one embodiment, the N/P value Is about 6.
• RNA disclosed herein e.g., RNA encoding vaccine antigens and/or immunostimulants.
• the disclosure involves targeting lung.
• Targeting lung is In particular preferred if the RNA administered is RNA encoding vaccine antigen or a miRNA relevant in the treatment of an Infectious disease in the lungs.
• RNA may be delivered to lung, for example, by administering the RNA which may be formulated as particles as described herein, e.g., lipid particles, by inhalation.
• the disclosure Involves targeting the lymphatic system, in particular secondary lymphoid organs, more specifically spleen.
• Targeting the lymphatic system, in particular secondary lymphoid organs, more specifically spleen is in particular preferred if the RNA administered is RNA encoding vaccine antigen.
• the target cell is a spleen cell.
• the target cell is an antigen presenting cell such as a professional antigen presenting cell in the spleen.
• the target cell is a dendritic cell in the spleen.
• the "lymphatic system" is part of the circulatory system and an important part of the immune system, comprising a network of lymphatic vessels that carry lymph.
• the lymphatic system consists of lymphatic organs, a conducting network of lymphatic vessels, and the circulating lymph.
• the primary or central lymphoid organs generate lymphocytes from immature progenitor cells.
• the thymus and the bone marrow constitute the primary lymphoid organs.
• Secondary or peripheral lymphoid organs which include lymph nodes and the spleen, maintain mature naive lymphocytes and initiate an adaptive immune response.
• RNA may be delivered to spleen by so-called lipoplex formulations, in which the RNA is bound to liposomes comprising a cationic lipid and optionally an additional or helper lipid to form injectable nanoparticle formulations.
• the liposomes may be obtained by injecting a solution of the lipids in ethanol into water or a suitable aqueous phase.
• RNA lipoplex particles may be prepared by mixing the liposomes with RNA. Spleen targeting RNA lipoplex particles are described in WO 2013/143683, herein incorporated by reference.
• RNA lipoplex particles having a net negative charge may be used to preferentially target spleen tissue or spleen cells such as antigen-presenting cells, in particular dendritic cells. Accordingly, following administration of the RNA lipoplex particles, RNA accumulation and/or RNA expression in the spleen occurs. Thus, RNA lipoplex particles of the disclosure may be used for expressing RNA in the spleen. In an embodiment, after administration of the RNA lipoplex particles, no or essentially no RNA accumulation and/or RNA expression in the lung and/or liver occurs.
• RNA lipoplex particles of the disclosure may be used for expressing RNA in such antigen presenting cells.
• the antigen presenting cells are dendritic cells and/or macrophages.
• the electric charge of the RNA lipoplex particles of the present disclosure is the sum of the electric charges present in the at least one cationic lipid and the electric charges present in the RNA.
• the charge ratio is the ratio of the positive charges present in the at least one cationic lipid to the negative charges present in the RNA.
• the spleen targeting RNA lipoplex particles described herein at physiological pH preferably have a net negative charge such as a charge ratio of positive charges to negative charges from about 1.9:2 to about 1:2, or about 1.6:2 to about 1:2, or about 1.6:2 to about 1.1:2.
• the charge ratio of positive charges to negative charges in the RNA lipoplex particles at physiological pH is about 1.9:2.0, about 1.8:2.0, about 1.7:2.0, about 1.6:2.0, about 1.5:2.0, about 1.4:2.0, about 1.3:2.0, about 1.2:2.0, about 1.1:2.0, or about 1:2.0.
• Immunostimulants may be provided to a subject by administering to the subject RNA encoding an immunostimulant in a formulation for preferential delivery of RNA to liver or liver tissue.
• RNA encoding an immunostimulant in a formulation for preferential delivery of RNA to liver or liver tissue.
• the delivery of RNA to such target organ or tissue is preferred, in particular, if it is desired to express large amounts of the immunostimulant and/or if systemic presence of the immunostimulant, in particular in significant amounts, is desired or required.
• RNA delivery systems have an inherent preference to the liver. This pertains to lipid-based particles, cationic and neutral nanoparticles, in particular lipid nanoparticles such as liposomes, nanomicelles and lipophilic ligands in bioconjugates. Liver accumulation is caused by the discontinuous nature of the hepatic vasculature or the lipid metabolism (liposomes and lipid or cholesterol conjugates).
• a drug delivery system may be used to transport the RNA into the liver by preventing its degradation.
• polyplex nanomicelles consisting of a poly(ethylene glycol) (PEG)-coated surface and an mRNA-containing core is a useful system because the nanomicelles provide excellent in vivo stability of the RNA, under physiological conditions. Furthermore, the stealth property provided by the polyplex nanomicelle surface, composed of dense PEG palisades, effectively evades host immune defenses.
• PEG poly(ethylene glycol)
• cytokines involved in T cell proliferation and/or maintenance.
• suitable cytokines include IL2 or IL7, fragments and variants thereof, and fusion proteins of these cytokines, fragments and variants, such as extended-PK cytokines.
• RNA encoding an immunostimulant may be administered in a formulation for preferential delivery of RNA to the lymphatic system, in particular secondary lymphoid organs, more specifically spleen.
• the delivery of an immunostimulant to such target tissue is preferred, in particular, if presence of the immunostimulant in this organ or tissue is desired e.g., for inducing an immune response, in particular in case immunostimulants such as cytokines are required during T-cell priming or for activation of resident immune cells), while it is not desired that the immunostimulant is present systemically, in particular in significant amounts e.g., because the immunostimulant has systemic toxicity).
• suitable immunostimulants are cytokines involved in T cell priming.
• suitable cytokines include IL12, IL15, IFN-a, or IFN-p, fragments and variants thereof, and fusion proteins of these cytokines, fragments and variants, such as extended-PK cytokines.
• the particles formed from the RNA and the polymer are polymer-based polyplexes.
• polymers are commonly used materials for nanoparticle-based delivery.
• cationic polymers are used to electrostatically condense the negatively charged nucleic acid into nanoparticles.
• These positively charged groups often consist of amines that change their state of protonation in the pH range between 5.5 and 7.5, thought to lead to an ion imbalance that results in endosomal rupture.
• Polymers such as poly-L-lysine, polyamidoamine, protamine and polyethylenimine, as well as naturally occurring polymers such as chitosan have all been applied to nucleic acid delivery and are suitable as cationic polymers herein.
• some investigators have synthesized polymers specifically for nucleic acid delivery. Poly( ⁇ -amino esters), in particular, have gained widespread use in nucleic acid delivery owing to their ease of synthesis and biodegradability.
• Such synthetic polymers are also suitable as cationic polymers herein.
• a "polymer,” as used herein, is given its ordinary meaning, i.e., a molecular structure comprising one or more repeat units (monomers), connected by covalent bonds.
• the repeat units can all be identical, or in some cases, there can be more than one type of repeat unit present within the polymer.
• the polymer is biologically derived, i.e., a biopolymer such as a protein.
• additional moieties can also be present in the polymer, for example targeting moieties.
• the polymer is said to be a "copolymer.” It is to be understood that the polymer being employed herein can be a copolymer.
• the repeat units forming the copolymer can be arranged in any fashion. For example, the repeat units can be arranged in a random order, in an alternating order, or as a "block" copolymer, i.e., comprising one or more regions each comprising a first repeat unit (e.g., a first block), and one or more regions each comprising a second repeat unit (e.g., a second block), etc.
• Block copolymers can have two (a diblock copolymer), three (a triblock copolymer), or more numbers of distinct blocks.
• the polymer is biocompatible.
• Biocompatible polymers are polymers that typically do not result in significant cell death at moderate concentrations.
• the biocompatible polymer is biodegradable, i.e., the polymer is able to degrade, chemically and/or biologically, within a physiological environment, such as within the body.
• polymer may be protamine or polyalkyleneimine.
• protamine refers to any of various strongly basic proteins of relatively low molecular weight that are rich in arginine and are found associated especially with DNA in place of somatic histones in the sperm cells of various animals (as fish).
• protamine refers to proteins found in fish sperm that are strongly basic, are soluble in water, are not coagulated by heat, and yield chiefly arginine upon hydrolysis. In purified form, they are used in a long-acting formulation of insulin and to neutralize the anticoagulant effects of heparin.
• protamine as used herein is meant to comprise any protamine amino acid sequence obtained or derived from natural or biological sources including fragments thereof and multimeric forms of said amino acid sequence or fragment thereof as well as (synthesized) polypeptides which are artificial and specifically designed for specific purposes and cannot be isolated from native or biological sources.
• the polyalkyleneimine comprises polyethylenimine and/or polypropyleneimine, preferably polyethylenimine.
• a preferred polyalkyleneimine is polyethylenimine (PEI).
• the average molecular weight of PEI is preferably 0.75- 10 2 to 10 7 Da, preferably 1000 to 10 5 Da, more preferably 10000 to 40000 Da, more preferably 15000 to 30000 Da, even more preferably 20000 to 25000 Da.
• Particles described herein may also comprise polymers other than cationic polymers, i.e., non-cationic polymers and/or anionic polymers. Collectively, anionic and neutral polymers are referred to herein as non-cationic polymers.
• polyalkyleneimine can comprise the following general formula (I): wherein
• R is H, an acyl group or a group comprising the following general formula (II): wherein R 1 is H or a group comprising the following general formula (III): n, m, and I are independently selected from integers from 2 to 10; and p, q, and r are integers, wherein the sum of p, q, and r is such that the average molecular weight of the polymer is 1.5-10 2 to 10 7 Da, preferably 5000 to 10 5 Da, more preferably 10000 to 40000 Da, more preferably 15000 to 30000 Da, even more preferably 20000 to 25000 Da.
• n, m, and I can be independently selected from 2, 3, 4, and 5, preferably from 2 and 3 and/or Ri can be H.
• R can be H or an acyl group.
• the polyalkyleneimine can comprise polyethylenimine and/or polypropylenimine, preferably polyethylenimine. In an embodiment, at least 92% of the N atoms in the polyalkyleneimine can be protonatable.
• a pharmaceutical composition according to the invention may comprise at least one nucleic acid molecule according to the present invention.
• a pharmaceutical composition according to the invention comprises a pharmaceutically acceptable diluent and/or a pharmaceutically acceptable excipient and/or a pharmaceutically acceptable carrier and/or a pharmaceutically acceptable vehicle.
• the choice of pharmaceutically acceptable carrier, vehicle, excipient or diluent is not particularly limited. Any suitable pharmaceutically acceptable carrier, vehicle, excipient or diluent known in the art may be used.
• a pharmaceutical composition can further comprise a solvent such as an aqueous solvent or any solvent that makes it possible to preserve the integrity of the RNA.
• the pharmaceutical composition is an aqueous solution comprising RNA.
• the aqueous solution may optionally comprise solutes, e.g. salts.
• each of the RNA molecules according to the invention, the system according to the invention or the kit according to the invention, or the pharmaceutical composition according to the invention may be referred to as “medicament", a "medical preparation” or the like.
• the present invention foresees that the first RNA molecule, the second RNA molecule the kit, the pharmaceutical composition or the system of the present invention is provided for use as a medicament.
• the medicament can be used to treat a subject.
• treat is meant to administer a compound or composition or other entity as described herein to a subject.
• the term includes methods for treatment of the human or animal body by therapy.
• the above described medicament does typically not comprise a DNA, and is thus associated with additional safety features compared to DNA based medicaments, e.g., vaccines, described in the prior art ⁇ e.g. WO 2008/119827 Al).
• the medicament according to the present invention may be administered to a subject in need thereof.
• the medicament of the present invention can be used in prophylactic as well as in therapeutic methods of treatment of a subject.
• the medicament according to the invention is administered in an effective amount.
• An "effective amount” concerns an amount that is sufficient, alone or together with other doses, to cause a reaction or a desired effect.
• the desired effect is the inhibition of disease progression. This includes the deceleration of disease progression, in particular the interruption of disease progression.
• the desired effect in the treatment of a disease or a condition can also be a delay of disease outbreak or the inhibition of disease outbreak.
• the effective amount will depend on the condition being treated, the severity of the disease, the individual parameters of the patient, including age, physiological condition, size and weight, duration of the treatment, type of accompanying therapy (if any), the specific mode of administration and other factors.
• the methods for the treatment or prevention of cancer in a subject comprising administering to the subject a pharmaceutical composition as described herein.
• the methods for treatment described herein are vaccinations, in particular against infectious diseases, such as by a bacterium, virus, fungus or parasite, or cancer.
• RNA molecule and a second RNA molecule for use in a method for (i) the treatment or prevention of a bacterial, viral, parasitical or fungal infection, (ii) the treatment or prevention of cancer, or (ii) vaccination, in particular against infectious diseases, such as by a bacterium, virus, fungus or parasite, or cancer, in a subject; said method comprising administering to the subject the first RNA molecule and the second RNA molecule.
• RNA molecule for use in a method of treatment in a subject as described herein, said method comprising administering to the subject the first RNA molecule, wherein the subject is or has been also administered a second RNA molecule as described herein.
• a second RNA molecule for use in a method of treatment in a subject as described herein, said method comprising administering to the subject the second RNA molecule, wherein the subject is or has been also administered a first RNA molecule as described herein.
• a treatment particularly a prophylactic treatment, is or comprises preferably a treatment aiming to induce or enhance an immune response of a subject, e.g. against one or more antigens. If, according to the present invention, it is desired to induce or enhance an immune response by using RNA as described herein, the immune response may be triggered or enhanced by the RNA.
• the invention provides a prophylactic treatment which is or comprises preferably the vaccination of a subject.
• An embodiment of the present invention wherein the replicon comprises at least one miRNA and encodes, as a protein of interest, a pharmaceutically active peptide or protein which is an immunologically active compound or an antigen is particularly useful for vaccination.
• RNA has been previously described for vaccination against foreign agents including pathogens or cancer (reviewed recently by Ulmer et a!., 2012, Vaccine 30:4414-4418).
• the replicon according to the present invention is a particularly suitable element for efficient treatment or prevention, in particular vaccination, because of the ability to be replicated by functional alphavirus non-structural protein as described herein.
• the treatment or prevention, in particular vaccination, according to the present invention can be used for example for induction of an immune response to weakly immunogenic proteins.
• the protein antigen is never exposed to serum antibodies, but is produced by transfected cells themselves after translation of the RNA. Therefore, anaphylaxis should not be a problem. The invention therefore permits the repeated immunization of a patient without risk of allergic reactions.
• the miRNA and optionally protein of interest encoded by the replicon according to the present invention codes for example for a miRNA beneficial for the treatment or prevention of a bacterial infection, a viral infection, fungal infection or cancer and optionally a bacterial antigen, against which an immune response is to be directed, or for a viral antigen, against which an immune response is to be directed, or for a cancer antigen, against which an immune response is to be directed, or for an antigen of a unicellular organism, against which an immune response is to be directed.
• the efficacy of treatment, in particular vaccination can be assessed by known standard methods such as by measurement of antigen-specific IgG antibodies from the organism.
• the medicament can be administered more than once. Multiple doses can be administered such that individual doses can be administered at different intervals. For example, a dose can be administered 14 to 35 days after the previous dose has been administered. In an embodiment, a dose is administered 21 days after the previous dose. In an embodiment, a dose is administered 35 days after the previous dose.
• the system used as a medicament when administered to a subject, does preferably not comprise sequences from a type of virus, e.g., alphavirus, that is infectious to the species or genus to which the treated subject belongs.
• the replicon does not comprise any nucleotide sequence from an alphavirus that can infect the respective species or genus.
• This embodiment bears the advantage that no recombination with infectious (e.g. fully functional or wild-type) alphavirus is possible, even if the subject to which the RNA is administered is (e.g. accidentally) affected by infectious alphavirus.
• the system used does not comprise any nucleotide sequence from an alphavirus that can infect pigs.
• the medicament may be administered systemically, for example intravenously (i.v.), intramuscularly (i.m.), subcutaneously (s.c.), intradermally (i.d.) or by inhalation.
• intravenously i.v.
• intramuscularly i.m.
• subcutaneously s.c.
• intradermally i.d.
• inhalation i.v.
• the system, in particular medicament, according to the present invention is administered to muscle tissue, such as skeletal muscle, or skin, e.g. subcutaneously.
• muscle tissue such as skeletal muscle, or skin
• RNA transfer of RNA into the skin or muscles leads to high and sustained local expression, paralleled by a strong induction of humoral and cellular immune responses (Johansson eta!., 2012, PLoS. One. 7:e29732; Geall eta!., 2012, Proc. Natl. Acad. Sci. U.S.A 109:14604-14609).
• taRNA-miR vector comprises two capped and poly(A)-tailed RNA molecules.
• NTR nano-transreplicon
• the guide strand is from 14 nt to 34 nt and the passenger strand from 54 nt to 72 nt.
• a black solid and dashed line respectively surrounds the guide and passenger strand.
• Microprocessor cleavage sites are marked with black arrows.
• Dicer cleavage sites are marked with white arrows.
• CSE conserved sequence element, UTR, untranslated region.
• FIG. 2 Stable overexpression of miR-lacZ leads to efficient knock-down of ⁇ -galactosidase.
• A BHK21 cells were transduced with lacZ-encoding lentiviruses. 48 hours after transduction, luminescence-based assays were performed to measure reporter protein expression in transduced and mock cells, respectively. The graph shows mean (SD) of quintuplicates.
• B,C BHK-lacZ cells were then transduced with the lentivirus containing miR-neco (negative control) or miR-lacZ or left untransduced (mock).
• FIG. 3.1 Inserting miRNA into replicating RNA does not affect protein expression in cells.
• BHK-lacZ cells were electroporated with 2 pg of the indicated saRNA or 5 pg of taRNA (lpg NTR-emGFP-miR) or without RNA (mock). 24h after transfection GFP-expression was assessed by flow cytometry.
• FSC and SSC Forward versus side scatter
• A Forward versus side scatter
• GFP-fluorescence of gated cells was plotted against an irrelevant channel (APC-Cy7).
• Figure 3.2 Alphaviral miRNA delivery leads to knockdown of lacZ.
• BHK-lacZ cells were electroporated with 2 pg of the indicated saRNA or 5 pg of taRNA (lpg NTR-emGFP-miR) or left untreated (mock).
• Statistical analysis was a two-way ANOVA.
• C, F qRT-PCR-based quantification of lacZ transcripts was performed with total RNAs harvested 72h after transfection
• FIG. 4 taRNA-miR-luc is non-cytotoxic and downregulates luciferase expression only when actively replicated.
• A BHK21 cells were transduced with luciferase-encoding lentiviruses. 48 hours after transduction, luciferase expression was measured in transduced and mock cells, respectively. The graph shows mean (SD) of quintuplicates.
• B - E BHK-luc cells were electroporated with 0.5 pg of the indicated NTR constructs alone (- replicase), or co-delivered with 1 pg replicase mRNA (+ replicase). Controls were left untransfected (mock).
• FIG. 5 taRNA-miR against TP53 downregulates endogenous p53 expression.
• a - C HDFn cells were electroporated with the indicated taRNA-miR constructs (0.787 pmol/RNA) and 0.5 pg E3 mRNA and 0.5pg B18R mRNA. Control cells were electroporated without RNA (mock). For siRNA transfection, cells were lipofected with 30 nM of a TP53 targeting pool of 3 - 5 different siRNAs, or 30 nM of a scrambled siRNA control.
• taRNA-miR-p53-2 is processed into mature miR-p53-2.
• HDFn cells were electroporated with the different taRNA-miR constructs (as indicated, either with active (VEE-repI) or inactive (GAA-) replicase, respectively; 0.787pmol/RNA) or without RNA (mock).
• VEE-repI active
• GAA- inactive replicase
• FIG. 9 Incorporation of pre-miRNA into the 3'UTR of protein-coding transreplicons preserves high protein expression and enables target gene regulation.
• A Scheme of a taRNA-miR vector.
• taRNA comprises two capped and poly-adenylated RNA molecules, one non-replicative mRNA coding for the VEEV replicase (nrRNA-REPL) and a short transreplicon (STR-miR) that is replicated by the VEEV-replicase, and coding for a transgene (TG) alongside a miRNA upstream of its 3' untranslated region (UTR) and conserved sequence element (CSE).
• nrRNA-REPL non-replicative mRNA coding for the VEEV replicase
• STR-miR short transreplicon
• FIG. 10 Replication of STR-miR is required for target knockdown and replicase activity determines the extent of knockdown.
• BHK-21 cells stably expressing firefly luciferase (BHK-luc) were electroporated with 1.1 pM of indicated STR-miR and co-delivered with 0.4 pM of either inactive replicase (inactive-REPL), replicase of VEEV-TRD (TRD-REPL) or hyperactive replicase (hyper-REPL). Control cells were electroporated without RNA (mock).
• (C) TP53 transcript level over time Total cellular RNA was harvested at indicated time points after transfection to quantify relative transcript levels of TP53 normalized to that of HPRT by qRT-PCR. Mock-electroporated cells served to determine mean fold changes. Statistical analysis was a two-way ANOVA; ** P ⁇ 0.01; ***, P ⁇ 0.001; ****, p ⁇ 0.0001 and ns, not significant corresponding to mock (D) STR- miR RNA level over time. Total cellular RNA was harvested at indicated time points after transfection to quantify relative transcript levels of STR-miR normalized to that of HPRT by qRT-PCR.
• Figure 13 Replication steps of TR and STR RNA.
• IVT ⁇ transcribed non-replicative mRNA coding for the VEEV replicase
• nrRNA-REPL immature replicase
• REPL negative-strand-specific replicase complex
• (+) REPL fully mature positive-strand replicase complex
• TR transreplicon
• STR short transreplicon
• FIG 14 Stable overexpression of miR-lacZ leads to efficient knockdown of ⁇ -galactosidase in a stable reporter cell line.
• BHK-lacZ cells expressing ⁇ -galactosidase were transduced with a lentivirus containing the emGFP-pre-miR-neco or -lacZ expression cassette or left untreated.
• Figure 15 Predicted secondary structures of pre-miR-lacZ.
• Predicted secondary structure of pre-miR-lacZ and pre-miR-scrambled using mFOLD version 2.3 (default settings applied and assessed in February 21 st , 2023).
• the guide and passenger strands are highlighted in blue and grey, respectively.
• Drosha cleavage sites are market with black arrows.
• Dicer cleavage sites are marked with white arrows.
• the online software tool "Shuffle DNA" on bioinformatics.org was used to create a sequence scramble of the pre-miR-lacZ sequence.
• Figure 16 Enhanced STR-miR-mediated emGFP expression in cells co-transfected with hyperactive replicase.
• BHK-21 cells stably expressing firefly luciferase (BHK-luc) were electroporated with 1.1 pM of indicated STR-miR and co-delivered with 0.4 pM of either inactive replicase (inactive-REPL), wild-type replicase (TRD-REPL) or hyperactive replicase (hyper-REPL) or without RNA (mock).
• inactive-REPL inactive replicase
• TRD-REPL wild-type replicase
• hyperactive replicase hyperactive replicase
• RNA RNA
• FIG. 17 Co-transfection of E3 and B18R nrRNA enhances transgene expression of taRNA and reduces toxicity in primary cells.
• Human foreskin fibroblasts were electroporated with 0.8 pM STR-luc or taRNA (including 0.8 pM STR-luc and 0.4 pM VEEV replicase) co-transfected with or without 0.3 pM E3 and 0.5 pM B18R nrRNA (EB). Control cells were electroporated without RNA (mock).
• B Cell Viability.
• Example 3.2 Alphaviral miRNA delivery leads to knockdown of lacZ.
• both saRNA-miR-lacZ and taRNA-miR-lacZ could reduce lacZ transcript levels by 70% relative to mock transfected cells ( Figure 3.2C,F).
• saRNA-miR transfections caused cytotoxicity with up to 70% viability loss ( Figure 3.2A).
• taRNA-miR transfections had only a minimal impact on cell viability ( Figure 3.2D).
• Alphaviral miRNA delivery with taRNA-miR leads to 70% target RNA knockdown and 50% reduced protein expression. While saRNA-miR transfection impairs viability, taRNA-miR does not.
• taRNA-miR-luc is non-cytotoxic. It downregulates luciferase expression only when actively replicated.
• taRNA-miR constructs were designed comprising miRNA sequences against human TP53.
• Primary human fibroblasts were transfected with the respective constructs and TP53 RNA levels and p53 protein expression levels were examined 72h post-transfection.
• P53 siRNA- transfected cells served here as a knockdown control. All taRNA-miR-p53 constructs were able to significantly downregulate endogenous p53 levels compared to taRNA-miR-neco or mock cells ( Figure 5A, B).
• taRNA-miR-p53-2 comprising inactive replicase (GDD to GAA mutation in the catalytic site of nsP4) instead of active replicase.
• Total RNA was extracted 72h after transfection.
• TP53 knockdown was achieved with all three taRNA-miR-p53, with p53-2 being the most effective as before.
• taRNA-miR-p53-2 made with inactive replicase was unable to regulate TP53 (Figure 6A), although mature miR-p53-2 was detectable.
• the level of mature miR- p53-2 was much greater. This proves that NTR-miR replication is required to achieve an effective miRNA level in the cells, leading to miR-specific target suppression (Figure 6B).
• Example 7 taRNA-miR-VIPs suppress RSAD2 (viperin) expression which is induced by taRNA-miR transfection.
• RSAD2 is an interferon stimulated gene (ISG), also known as viperin (VIP), that is highly upregulated upon alphaviral infection.
• ISG interferon stimulated gene
• VIP viperin
• Primary human fibroblasts were transfected with two different taRNA-miR-VIP constructs targeting RSAD2/viperin.
• taRNA-miR-neco transfected cells served again as control inducing a about 10,000-fold upregulation of RSAD2 transcript levels compared to mock cells.
• taRNA-miR-VIPl or -VIP2 transfected cells showed 40 - 60 % reduced RSAD2 levels compared to taRNA-miR-neco.
• Combining NTR-miR-VIPl and -VIP2 with replicase mRNA reduced RSAD2 transcript levels even further (> 80 % 72h after transfection) showing a synergistic effect (Figure 7).
• Example 8 Incorporating endogenous miR-302/367 cluster into taRNA-miR leads to downregulation of target genes
• the taRNA-miR vector system can be used to deliver a natural miRNA cluster.
• the endogenous miR-302/367 cluster expressed in embryonic stem cells and induced pluripotent stem cells, is composed of five miRNAs, namely miR-302a - d and -367.
• the whole cluster sequence into the taRNA vector comparable to the synthetic miR-155 backbone before ( Figure 8A).
• This cluster regulates a plethora of genes and is involved in cell signaling, cell cycle, epigenetic regulation and glucose metabolism, among others.
• Two known targets are the genes DAZAP2 and TGF ⁇ R2.
• the mature miRNA sequence targeting either bacterial iacZ gene or predicted to be non-targeting is flanked by loop sequences from the murine miR-155 sequence, 50 which directs the excision of the engineered miRNA from a longer Pol II transcript (pri-miRNA). All other artificial miRNA sequences made for the insertion into the miR-155 backbone were designed using the BLOCK- iT RNAi designer, a companion online tool (https://rnaidesigner.thermofisher.com/rnaiexpress/).
• miR-neco AAATGTACTGCGCGTGGAGAC (SEQ ID NO: 53); miR-lacZ: AAATCGCTGATTTGTGTAGTC (SEQ ID NO: 54); miR-lucl: AGCCCATATCGTTTCATAGCT (SEQ ID NO: 55); miR-luc2: ATACCTGGCAGATGGAACCTC (SEQ ID NO: 56); miR-p53-l: TCCACACGCAAATTTCCTTCC (SEQ ID NO: 57); miR- p53-2: AGTAGATTACCACTGGAGTCT (SEQ ID NO: 58); miR-p53-3: CAAACACGCACCTCAAAGCTG (SEQ ID NO: 59).
• RNA cassettes were ordered by custom gene synthesis (Genewiz) and cloned between the transgene-coding sequence and the alphaviral 3' conserved sequence elements of the STR-plasmid. Synthesis and purification of RNA were previously described. 511 52 Concentration, purity and integrity of synthetic RNA was assessed by spectrophotometry (NanoDrop 2000c, ThermoFisher Scientific) and capillary electrophoresis (Fragment Analyzer; Agilent).
• FCS Fetal calf serum
• RNAi therapeutics A potential new class of pharmaceutical drugs. Nature chemical biology 2, 711-719.
• a taRNA vaccine candidate induces a specific immune response that protects mice against Chikungunya virus infections. Molecular therapy. Nucleic acids 28, 743-754.

Landscapes

• Health & Medical Sciences (AREA)
• Genetics & Genomics (AREA)
• Engineering & Computer Science (AREA)
• Life Sciences & Earth Sciences (AREA)
• Biomedical Technology (AREA)
• Wood Science & Technology (AREA)
• Organic Chemistry (AREA)
• Chemical & Material Sciences (AREA)
• Biotechnology (AREA)
• General Engineering & Computer Science (AREA)
• Zoology (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Molecular Biology (AREA)
• Microbiology (AREA)
• Plant Pathology (AREA)
• Biophysics (AREA)
• Biochemistry (AREA)
• General Health & Medical Sciences (AREA)
• Physics & Mathematics (AREA)
• Virology (AREA)
• Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
• Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
• Medicinal Preparation (AREA)

Applications Claiming Priority (3)

Publications (1)

Family

ID=88092954

Family Applications (1)

Country Status (7)

Families Citing this family (1)

Family Cites Families (22)

• 2023
  • 2023-09-15 CA CA3267295A patent/CA3267295A1/en active Pending
  • 2023-09-15 IL IL319427A patent/IL319427A/en unknown
  • 2023-09-15 WO PCT/EP2023/075427 patent/WO2024056856A1/en not_active Ceased
  • 2023-09-15 JP JP2025515766A patent/JP2025532591A/ja active Pending
  • 2023-09-15 EP EP23772228.5A patent/EP4587579A1/de active Pending
  • 2023-09-15 CN CN202380078690.XA patent/CN120239748A/zh active Pending
  • 2023-09-15 AU AU2023342641A patent/AU2023342641A1/en active Pending

Also Published As

Similar Documents

Legal Events