EP4565692A2 - Interne ribosomenzugangsstellen für verbesserte polynukleotidtranslation - Google Patents

Interne ribosomenzugangsstellen für verbesserte polynukleotidtranslation

Info

Publication number
EP4565692A2
EP4565692A2 EP23851018.4A EP23851018A EP4565692A2 EP 4565692 A2 EP4565692 A2 EP 4565692A2 EP 23851018 A EP23851018 A EP 23851018A EP 4565692 A2 EP4565692 A2 EP 4565692A2
Authority
EP
European Patent Office
Prior art keywords
uridine
methyl
thio
nucleic acid
pseudouridine
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
EP23851018.4A
Other languages
English (en)
French (fr)
Inventor
Ruchi Jain
Mihir METKAR
Elizaveta ANDRIANOVA
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
ModernaTx Inc
Original Assignee
ModernaTx Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by ModernaTx Inc filed Critical ModernaTx Inc
Publication of EP4565692A2 publication Critical patent/EP4565692A2/de
Pending legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/67General methods for enhancing the expression
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2840/00Vectors comprising a special translation-regulating system
    • C12N2840/20Vectors comprising a special translation-regulating system translation of more than one cistron
    • C12N2840/203Vectors comprising a special translation-regulating system translation of more than one cistron having an IRES
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2840/00Vectors comprising a special translation-regulating system
    • C12N2840/60Vectors comprising a special translation-regulating system from viruses

Definitions

  • exogenous nucleic acids has become a particularly effective strategy for delivering polypeptides of interest to a target cell, tissue, or organism, as a single protein-encoding nucleic acid can be translated to yield multiple copies of a desired polypeptide, allowing the administration of a small quantity of nucleic acid to achieve high levels of protein expression.
  • steps have been taken to improve the pharmacokinetic properties of nucleic acid molecules. For example, efforts to further augment the half-lives of nucleic acid molecules, such as protein-encoding RNA molecules, have led to modifications that render nucleic acids less susceptible to nucleolytic degradation.
  • 5’ cap structures are often included in protein-encoding nucleic acid (e.g., RNA) molecules, as the 5’ cap promotes ribosome binding and, thus, protein translation. Accordingly, although modifications such as 573’ blocking and circularization may confer the benefit of reduced exonuclease-mediated degradation, these modifications may hinder ribosomal recruitment due to the absence of a 5’ cap. There exists a need for improved strategies for effectuating ribosomal entry and the initiation of protein translation, particularly in nucleic acid molecules that lack a 5’ cap.
  • nucleic acid molecules such as linear and circular RNA molecules, that are capable of recruiting and binding to ribosomes in a manner that is independent of a 5’ cap structure.
  • nucleic acid molecules generally employ 5’ cap structures in order to promote ribosomal binding and, thus, translation of an encoded protein.
  • the presence of a 5’ cap that is susceptible to decapping - which, in turn, triggers subsequent degradation of the RNA - precludes the possibility of adding certain chemical modifications that extend the molecule’s half-life.
  • Examples of these types of modifications include (i) the presence of 5’ chemical moieties that restrict the access of an exonuclease to the nucleic acid molecule, as well as (ii) circularization of a nucleic acid molecule, which removes 5’ and 3’ ends altogether. Both of these types of modifications provide the benefit of reducing or eliminating exonucleolytic cleavage by way of either chemically protecting, or removing, the 5’ and 3’ ends to which an exonuclease would bind. However, because these types of modifications alter or eliminate the 5’ end, they preclude the inclusion of a 5’ cap.
  • the present disclosure features internal ribosome entry sites (IRESs) that can be incorporated into nucleic acids and that promote ribosome recruitment and protein translation in a manner that is independent of the presence of a 5’ cap.
  • IRESs internal ribosome entry sites
  • the IRES elements of the disclosure can be used in nucleic acids (e.g., RNA molecules) that either lack or contain a 5’ cap, as the present IRES elements confer advantages to both types of molecules.
  • the IRES elements of the disclosure can be incorporated into a nucleic acid (e.g., a linear or circular RNA molecule) that lacks a 5’ cap, thereby providing a means by which the nucleic acid molecule may be bound - and translated - by a ribosome, notwithstanding the absence of a 5’ cap structure that would, ordinarily, be regarded as important for the onset of protein biosynthesis.
  • the IRES elements of the disclosure can be incorporated into a nucleic acid (e.g., a linear RNA) that contains a 5’ cap.
  • the IRES element may provide the benefit of a means by which the nucleic acid may be translated even after the 5’ cap is removed by way of endogenous decapping processes.
  • the inclusion of an IRES element of the disclosure can effectively extend the ability of decapped nucleic acids (e.g., decapped linear RNAs) to effectuate protein expression.
  • the IRES of the disclosure may recruit translation tractor and/or ribosomes to the nucleic acids described herein in order to promotes translation.
  • IRES of the disclosure e.g., SEQ ID NOs: 173-205
  • IRES of the disclosure may bind directly to ribosomal subunits (e.g., eukaryotic 60S or 40S subunits) by, e.g., hybridizing directly to ribosomal RNA (rRNA), such as 25S, 28S, 18S, 5.8S, and/or 5S rRNA.
  • rRNA ribosomal RNA
  • the IRES of the disclosure further provide the advantage of fast and efficient protein expression while reducing energy expenditure on the cell.
  • the disclosure provides a nucleic acid comprising:
  • an internal ribosome entry site comprising one or more polynucleotide tracts enriched in uridine or a modified uridine; operably linked to
  • the IRES comprises from 1 to 20 of the polynucleotide tracts enriched in uridine or a modified uridine (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 of the polynucleotide tracts enriched in uridine or a modified uridine). In some embodiments, the IRES comprises from 2 to 10 of the polynucleotide tracts enriched in uridine or a modified uridine. In some embodiments, the IRES comprises from 3 to 6 of the polynucleotide tracts enriched in uridine or a modified uridine.
  • At least 70% of the nucleosides in each of the polynucleotide tracts is a pyrimidine-containing nucleoside, such as a uridine, a modified uridine, a cytidine, or a modified cytidine (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the nucleosides in each of the polynucleotide tracts may be a uridine, a modified uridine, a cytidine, or a modified cytidine).
  • a uridine such as a uridine, a modified uridine, a cytidine, or a modified c
  • At least 75% of the nucleosides in each of the polynucleotide tracts is a pyrimidine-containing nucleoside, such as a uridine, a modified uridine, a cytidine, or a modified cytidine. In some embodiments, at least 80% of the nucleosides in each of the polynucleotide tracts is a pyrimidine-containing nucleoside, such as a uridine, a modified uridine, a cytidine, or a modified cytidine.
  • At least 85% of the nucleosides in each of the polynucleotide tracts is a pyrimidine-containing nucleoside, such as a uridine, a modified uridine, a cytidine, or a modified cytidine.
  • at least 90% of the nucleosides in each of the polynucleotide tracts is a pyrimidine-containing nucleoside, such as a uridine, a modified uridine, a cytidine, or a modified cytidine.
  • At least 95% of the nucleosides in each of the polynucleotide tracts is a pyrimidine-containing nucleoside, such as a uridine, a modified uridine, a cytidine, or a modified cytidine.
  • all of the nucleosides in each of the polynucleotide tracts is a pyrimidine- containing nucleoside, such as a uridine, a modified uridine, a cytidine, or a modified cytidine.
  • each polynucleotide tract is from 5 to 20 nucleosides in length (e.g., 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleosides in length). In some embodiments, each polynucleotide tract, independently, is from 5 to 19 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 18 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 17 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 16 nucleosides in length.
  • each polynucleotide tract is from 5 to 15 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 14 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 13 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 12 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 11 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 10 nucleosides in length.
  • each polynucleotide tract is from 6 to 15 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 14 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 13 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 12 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 11 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 10 nucleosides in length.
  • each polynucleotide tract is from 7 to 15 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 7 to 14 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 7 to 13 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 7 to 12 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 7 to 11 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 7 to 10 nucleosides in length. In some embodiments, each polynucleotide tract is 9 nucleosides in length.
  • each polynucleotide tract independently, comprises from 5 to 20 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides, such as 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 uridine, modified uridine, cytidine, or modified cytidine nucleosides). In some embodiments, each polynucleotide tract, independently, comprises from 6 to 15 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides).
  • each polynucleotide tract independently, comprises from 6 to 14 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides). In some embodiments, each polynucleotide tract, independently, comprises from 6 to 13 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides).
  • each polynucleotide tract independently, comprises from 6 to 12 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides). In some embodiments, each polynucleotide tract, independently, comprises from 6 to 1 1 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides).
  • each polynucleotide tract independently, comprises from 6 to 10 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides). In some embodiments, each polynucleotide tract, independently, comprises from 7 to 15 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides).
  • each polynucleotide tract independently, comprises from 7 to 14 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides). In some embodiments, each polynucleotide tract, independently, comprises from 7 to 13 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides).
  • each polynucleotide tract independently, comprises from 7 to 12 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides). In some embodiments, each polynucleotide tract, independently, comprises from 7 to 1 1 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides).
  • each polynucleotide tract independently, comprises from 7 to 10 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides).
  • pyrimidine-containing nucleosides e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides.
  • each polynucleotide tract comprises at least 9 contiguous pyrimidine- containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides). In some embodiments, each polynucleotide tract comprises 9 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides).
  • one or more (or all) of the polynucleotide tracts are enriched in modified uridine.
  • the modified uridine is 1 -methylpseudouridine.
  • the modified uridine is pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5- aza-uridine, 2-thio-uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5- carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-me
  • the IRES is 100% modified at uridine, and the modification consists of 1 - methylpseudouridine. In some embodiments, the entire mRNA, including the IRES, is 100% modified at uridine, and the modification consists of 1 -methylpseudouridine.
  • the IRES does not contain a chemical modification at uridine. In some embodiments, the IRES does not contain a chemical modification at any of the nucleosides therein.
  • the IRES is located within a noncoding region of the nucleic acid.
  • the IRES may be located within a 5’ untranslated region (UTR) that is operably linked to the open reading frame.
  • the open reading frame is further operably linked to a 3’ UTR.
  • the polynucleotide tracts are separated from one another by way of one or more spacers that each, independently, comprise from 5 to 100 nucleosides (e.g., 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 nucleosides).
  • each of the spacers independently, comprises from 10 to 40 nucleosides (e.g., 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleosides).
  • each of the spacers independently, comprises 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, or 38 nucleosides.
  • the IRES is represented by the formula:
  • each N is, independently, any nucleoside residue; each t/'is, independently, a pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides), preferably wherein each t/' is, independently, uridine or a modified uridine, even more preferably wherein each t/'is, independently, modified uridine (e.g., 1 - methylpseudouridine); each n is, independently, an integer from 1 to 100 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100); each m is, independently, an integer from 2 to 15 (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13,
  • N is, independently, selected from adenosine, a modified adenosine, uridine, a modified uridine, guanosine, a modified guanosine, cytidine, and a modified cytidine.
  • each N is, independently, selected from adenosine, uridine, a modified uridine, guanosine, and cytidine.
  • the modified uridine of N is 1 -methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine, 4-thio- uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo- uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine, 5- carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl-uridine, 5-methoxycarbonylmethyl- 2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-aminomethyl
  • the modified cytidine of N is 5-aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetyl-cytidine, 5-formyl-cytidine, N4-methyl-cytidine, 5-methyl- cytidine, 5-halo-cytidine, 5-hydroxymethyl-cytidine, 1 -methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo- pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1 -methylpseudoisocytidine, 4-thio-1 -methyl-1 -deaza-pseudoisocytidine, 1 -methyl-1 -deaza-pseudoisocytidine, zebularine
  • the modified adenosine of N is 2-amino-purine, 2, 6-diaminopurine, 2- amino-6-halo-purine, 6-halo-purine, 2-amino-6-methyl-purine, 8-azido-adenosine, 7-deaza-adenine, 7- deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2,6- diaminopurine, 7-deaza-8-aza-2, 6-diaminopurine, 1 -methyl-adenosine, 2-methyl-adenine, N6-methyl- adenosine, 2-methylthio-N6-methyl-adenosine, N6-isopentenyl-adenosine, 2-methylthio-N6-isopentenyl- adenosine, N6-(cis-hydroxyisopentenyl)a
  • the modified guanosine of N is inosine, 1 -methyl-inosine, wyosine, methylwyosine, 4-demethyl-wyosine, isowyosine, wybutosine, peroxywybutosine, hydroxywybutosine, 7- deaza-guanosine, queuosine, epoxyqueuosine, galactosyl-queuosine, mannosyl-queuosine, 7-cyano-7- deaza-guanosine, 7-aminomethyl-7-deaza-guanosine, archaeosine, 7-deaza-8-aza-guanosine, 6-thio- guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7- methyl-guanosine, 7-methyl-inosine, 6-me
  • the modified uridine of U’ is 1 -methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine, 4-thio- uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo- uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine, 5- carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl-uridine, 5-methoxycarbonylmethyl- 2-thio-uridine, 5-aminomethyl-2-thio-uridine,
  • each n is, independently, an integer from 10 to 40. In some embodiments, each n is, independently, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, or 38. In some embodiments, each m is, independently, an integer from 2 to 15. In some embodiments, each m is, independently, an integer from 7 to 1 1 . In some embodiments, each m is 9. In some embodiments, p is an integer from 2 to 10. In some embodiments, p is an integer from 3 to 6, optionally wherein p is 3 or 6.
  • the nucleic acid is RNA. In some embodiments, the nucleic acid is linear. In some embodiments, the nucleic acid is circular. In some embodiments, the open reading from consists of nucleosides selected from adenosine, a modified adenosine, uridine, a modified uridine, guanosine, a modified guanosine, cytidine, and a modified cytidine. In some embodiments, the open reading from consists of nucleosides selected from adenosine, uridine, a modified uridine, guanosine, and cytidine.
  • the modified uridine of the open reading frame is 1 -methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio- uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl-uridine, 5- methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-a
  • the modified cytidine of N is 5-aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetyl-cytidine, 5-formyl-cytidine, N4-methyl-cytidine, 5-methyl- cytidine, 5-halo-cytidine, 5-hydroxymethyl-cytidine, 1 -methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo- pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1 -methylpseudoisocytidine, 4-thio-1 -methyl-1 -deaza-pseudoisocytidine, 1 -methyl-1 -deaza-pseudoisocytidine, zebularine
  • the modified adenosine of N is 2-amino-purine, 2, 6-diaminopurine, 2- amino-6-halo-purine, 6-halo-purine, 2-amino-6-methyl-purine, 8-azido-adenosine, 7-deaza-adenine, 7- deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2,6- diaminopurine, 7-deaza-8-aza-2, 6-diaminopurine, 1 -methyl-adenosine, 2-methyl-adenine, N6-methyl- adenosine, 2-methylthio-N6-methyl-adenosine, N6-isopentenyl-adenosine, 2-methylthio-N6-isopentenyl- adenosine, N6-(cis-hydroxyisopentenyl)a
  • the modified guanosine of N is inosine, 1 -methyl-inosine, wyosine, methylwyosine, 4-demethyl-wyosine, isowyosine, wybutosine, peroxywybutosine, hydroxywybutosine, 7- deaza-guanosine, queuosine, epoxyqueuosine, galactosyl-queuosine, mannosyl-queuosine, 7-cyano-7- deaza-guanosine, 7-aminomethyl-7-deaza-guanosine, archaeosine, 7-deaza-8-aza-guanosine, 6-thio- guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7- methyl-guanosine, 7-methyl-inosine, 6-me
  • the polypeptide encoded by the open reading frame is a secreted protein, (e.g., a cytokine, a growth factor, an enzyme, an immunomodulator, an antibody or antigen-binding fragment thereof, or a cell-penetrating peptide), an extracellular membrane-bound protein, an intracellular membrane-bound protein, a cytoplasmic protein, a cytoskeletal protein, or a nuclear protein.
  • a secreted protein e.g., a cytokine, a growth factor, an enzyme, an immunomodulator, an antibody or antigen-binding fragment thereof, or a cell-penetrating peptide
  • an extracellular membrane-bound protein e.g., an extracellular membrane-bound protein, an intracellular membrane-bound protein, a cytoplasmic protein, a cytoskeletal protein, or a nuclear protein.
  • the nucleic acid does not comprise a 5’ cap.
  • the nucleic acid includes a nucleotide sequence with at least 75% percent sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% percent sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% percent sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% percent sequence identity to any one of SEQ ID NOs: 173-190 and 202-205.
  • the nucleic acid includes a nucleotide sequence with at least 95% percent sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In some embodiments, the nucleic acid includes the nucleotide sequence of any one of SEQ ID NOs: 173-190 and 202-205.
  • the nucleic acid include a nucleotide sequence with about 70% to about 100% (e.g., about 70% to about 100%, about 75% to about 100%, about 80% to about 100%, about 85% to about 100%, about 90% to about 100%, about 91 % to about 100%, about 92% to about 100%, about 93% to about 100%, about 94% to about 100%, about 95% to about 100%, about 96% to about 100%, about 97% to about 100%, about 98% to about 100%, or about 99% to 100%) sequence identity to an IRES sequence presented in Table 2 (e.g., any one of IRES 1 to IRES 22).
  • Table 2 e.g., any one of IRES 1 to IRES 22.
  • the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 173. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 173. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 173. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 173. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 173.
  • the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 173. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 173. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 173. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 173. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 173.
  • the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 173. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 173. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 173. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 173. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 173.
  • the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 174. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 174. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 174. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 174. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 174.
  • the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 174. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 174. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 174. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 174. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 174.
  • the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 174. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 174. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 174. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 174. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 174.
  • the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 175. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 175. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 175. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 175. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 175.
  • the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 175. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 175. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 175. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 175. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 175.
  • the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 175. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 175. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 175. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 175. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 175.
  • the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 176. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 176. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 176. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 176. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 176.
  • the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 176. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 176. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 176. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 176. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 176.
  • the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 176. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 176. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 176. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 176. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 176.
  • the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 177. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 177. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 177. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 177. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 177.
  • the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 177. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 177. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 177. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 177. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 177.
  • the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 177. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 177. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 177. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 177. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 177.
  • the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 178. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 178. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 178. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 178. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 178.
  • the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 178. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 178. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 178. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 178. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 178.
  • the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 178. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 178. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 178. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 178. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 178.
  • the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 179. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 179. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 179. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 179. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 179.
  • the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 179. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 179. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 179. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 179. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 179.
  • the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 179. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 179. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 179. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 179. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 179.
  • the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 180. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 180. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 180. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 180. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 180.
  • the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 180. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 180. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 180. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 180. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 180.
  • the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 180. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 180. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 180. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 180. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 180.
  • the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 181. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 181. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 181. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 181. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 181.
  • the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 181 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 181. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 181. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 181. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 181.
  • the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 181. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 181. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 181. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 181. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 181 .
  • the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 182. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 182. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 182. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 182. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 182.
  • the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 182. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 182. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 182. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 182. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 182.
  • the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 182. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 182. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 182. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 182. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 182.
  • the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 183. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 183. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 183. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 183. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 183.
  • the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 183. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 183. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 183. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 183. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 183.
  • the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 183. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 183. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 183. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 183. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 183.
  • the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 184. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 184. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 184. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 184. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 184.
  • the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 184. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 184. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 184. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 184. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 184.
  • the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 184. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 184. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 184. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 184. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 184.
  • the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 185. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 185. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 185. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 185. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 185.
  • the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 185. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 185. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 185. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 185. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 185.
  • the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 185. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 185. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 185. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 185. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 185.
  • the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 186. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 186. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 186. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 186. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 186.
  • the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 186. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 186. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 186. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 186. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 186.
  • the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 186. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 186. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 186. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 186. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 186.
  • the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 187. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 187. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 187. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 187. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 187.
  • the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 187. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 187. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 187. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 187. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 187.
  • the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 187. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 187. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 187. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 187. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 187.
  • the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 188. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 188. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 188. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 188. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 188.
  • the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 188. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 188. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 188. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 188. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 188.
  • the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 188. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 188. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 188. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 188. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 188.
  • the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 189. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 189. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 189. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 189. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 189.
  • the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 189. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 189. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 189. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 189. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 189.
  • the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 189. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 189. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 189. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 189. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 189.
  • the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 190. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 190. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 190. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 190. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 190.
  • the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 190. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 190. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 190. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 190. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 190.
  • the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 190. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 190. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 190. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 190. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 190.
  • the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 202. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 202. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 202. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 202. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 202.
  • the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 202. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 202. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 202. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 202. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 202.
  • the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 202. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 202. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 202. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 202. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 202.
  • the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 203. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 203. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 203. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 203. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 203.
  • the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 203. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 203. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 203. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 203. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 203.
  • the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 203. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 203. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 203. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 203. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 203.
  • the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 204. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 204. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 204. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 204. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 204.
  • the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 204. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 204. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 204. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 204. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 204.
  • the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 204. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 204. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 204. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 204. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 204.
  • the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 205.
  • the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 205.
  • the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 205. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 205.
  • nucleic acid comprising:
  • an IRES comprising one or more polynucleotides that specifically bind a translation initiation factor (for example, eukaryotic translation initiation factor 4 G (elF4G), eukaryotic translation initiation factor 4G2 (elF4G2, also referred to as Dap5), eukaryotic translation initiation factor 3 (elF3)), or IRES trans-acting factors (ITAfs), such as a polypyrimidine tract-binding protein (PTBP) or a fusion protein comprising a translation initiation factor (e.g., elF4G, elF4G2, elF3, La protein, or an ITAf, such as La) fused to an RNA-binding protein; operably linked to a translation initiation factor (elF4G), eukaryotic translation initiation factor 4G2 (elF4G2, also referred to as Dap5), eukaryotic translation initiation factor 3 (elF3)), or IRES trans-acting factors (
  • the one or more polynucleotides specifically bind elF4G, elF4G2, elF3, La protein, or an ITAF, such as PTBP.
  • each of the one or more polynucleotides independently, has a nucleic acid sequence that is at least 75% identical to ACUCACUAUUUGUUUUCGCGCCCAGUUGCAAAAA (SEQ ID NO: 1 ).
  • each of the one or more polynucleotides independently, has a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO: 1 (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 1 ). In some embodiments, each of the one or more polynucleotides has the nucleic acid sequence of SEQ ID NO: 1 .
  • each U residue in SEQ ID NO: 1 is replaced with a modified uridine, such as 1 -methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2- thio-5-aza-uridine, 2-thio-uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy- uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5- carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl- uridine, 5-methoxycarbonylmethyl-2-thio-uridine
  • the IRES comprises one or more polynucleotides that specifically bind to a fusion protein comprising a translation initiation factor (e.g., elF4G, elF4G2, elF3, La protein, or an ITAf, such as PTBP) fused to an RNA-binding protein.
  • a translation initiation factor e.g., elF4G, elF4G2, elF3, La protein, or an ITAf, such as PTBP
  • RNA-binding protein may be an MS2-binding protein
  • the one or more polynucleotides may comprise one or more MS2 RNA hairpins.
  • the IRES comprises a plurality of polynucleotides that specifically bind a translation initiation factor (for example, elF4G, elF4G2, elF3, La protein, or an ITAf, such as a PTBP), or a fusion protein comprising a translation initiation factor (e.g., elF4G, elF4G2, elF3, La protein, or an ITAf, such as PTBP) fused to an RNA-binding protein.
  • a translation initiation factor for example, elF4G, elF4G2, elF3, La protein, or an ITAf, such as a PTBP
  • a translation initiation factor for example, elF4G, elF4G2, elF3, La protein, or an ITAf, such as a PTBP
  • a translation initiation factor for example, elF4G, elF4G2, elF3, La
  • the IRES comprises from 2 to 20 polynucleotides that specifically bind a translation initiation factor (for example, elF4G, elF4G2, elF3, La protein, or an ITAf, such as a PTBP), or a fusion protein comprising a translation initiation factor (e.g., elF4G, elF4G2, elF3, La protein, or an ITAf, such as PTBP) fused to an RNA-binding protein (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 polynucleotides that specifically bind a translation initiation factor (for example, elF4G, elF4G2, elF3, La protein, or an ITAf, such as a PTBP), or a fusion protein comprising a translation initiation factor (e.g., elF4G, elF4G2, elF3,
  • the IRES comprises from 2 to 10 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein).
  • RNA-binding protein e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein.
  • the IRES comprises from 3 to 9 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein (e.g., 3, 4, 5, 6, 7, 8, or 9 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein).
  • RNA-binding protein e.g., 3, 4, 5, 6, 7, 8, or 9 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein.
  • the IRES comprises from 4 to 8 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein (e.g., 4, 5, 6, 7, or 8 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein).
  • RNA-binding protein e.g., 4, 5, 6, 7, or 8 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein.
  • the IRES comprises from 5 to 7 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein (e.g., 5, 6, or 7 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein).
  • RNA-binding protein e.g., 5, 6, or 7 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein.
  • the IRES comprises 2 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein. In some embodiments, the IRES comprises 3 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein.
  • the IRES comprises 4 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein. In some embodiments, the IRES comprises 5 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein.
  • the IRES comprises 6 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA- binding protein. In some embodiments, the IRES comprises 7 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein.
  • the IRES comprises 8 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein. In some embodiments, the IRES comprises 9 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein.
  • the IRES comprises 10 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein.
  • the nucleic acid does not comprise a 5’ cap.
  • the nucleic acid includes a nucleotide sequence with at least 75% percent sequence identity to any one of SEQ ID NOs: 191 -201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% percent sequence identity to any one of SEQ ID NOs: 191 -201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% percent sequence identity to any one of SEQ ID NOs: 191 -201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% percent sequence identity to any one of SEQ ID NOs: 191 -201 .
  • the nucleic acid includes a nucleotide sequence with at least 95% percent sequence identity to any one of SEQ ID NOs: 191 -201 . In some embodiments, the nucleic acid includes the nucleotide sequence of any one of SEQ ID NOs: 191 -201 .
  • the nucleic acid include a nucleotide sequence with about 70% to about 100% (e.g., about 70% to about 100%, about 75% to about 100%, about 80% to about 100%, about 85% to about 100%, about 90% to about 100%, about 91 % to about 100%, about 92% to about 100%, about 93% to about 100%, about 94% to about 100%, about 95% to about 100%, about 96% to about 100%, about 97% to about 100%, about 98% to about 100%, or about 99% to 100%) sequence identity to an IRES sequence presented in Table 3 (e.g., any one of IRES 19 to IRES 29).
  • the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 191.
  • the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 191. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 191. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 191. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 191. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 191 .
  • the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 191. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 191. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 191. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 191. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 191.
  • the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 191. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 191. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 191. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 191 .
  • the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 192. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 192. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 192. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 192. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 192.
  • the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 192. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 192. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 192. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 192. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 192.
  • the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 192. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 192. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 192. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 192. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 192.
  • the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 193. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 193. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 193. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 193. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 193.
  • the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 193. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 193. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 193. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 193. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 193.
  • the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 193. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 193. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 193. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 193. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 193.
  • the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 194. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 194. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 194. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 194. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 194.
  • the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 194. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 194. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 194. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 194. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 194.
  • the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 194. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 194. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 194. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 194. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 194.
  • the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 195. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 195. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 195. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 195. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 195.
  • the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 195. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 195. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 195. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 195. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 195.
  • the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 195. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 195. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 195. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 195. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 195.
  • the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 196. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 196. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 196. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 196. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 196.
  • the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 196. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 196. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 196. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 196. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 196.
  • the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 196. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 196. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 196. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 196. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 196.
  • the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 197. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 197. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 197. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 197. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 197.
  • the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 197. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 197. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 197. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 197. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 197.
  • the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 197. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 197. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 197. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 197. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 197.
  • the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 198. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 198. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 198. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 198. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 198.
  • the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 198. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 198. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 198. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 198. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 198.
  • the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 198. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 198. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 198. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 198. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 198.
  • the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 199. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 199. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 199. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 199. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 199.
  • the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 199. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 199. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 199. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 199. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 199.
  • the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 199. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 199. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 199. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 199. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 199.
  • the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 200. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 200. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 200. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 200. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 200.
  • the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 200. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 200. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 200. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 200. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 200.
  • the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 200. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 200. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 200. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 200. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 200.
  • the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 201 .
  • the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 201 .
  • the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 201 . In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 201 .
  • nucleic acid including:
  • an internal ribosome entry site including a nucleotide sequence having complementarity sufficient to hybridize to a region within a ribosomal RNA (rRNA), operably linked to
  • the IRES does not specifically bind to ribosomal protein.
  • the nucleotide sequence of the IRES has at least 70% complementarity to the region within the rRNA, optionally wherein the IRES has at least 71%, 72%, 73%, 74%, 85%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementarity to the region within the rRNA.
  • the nucleotide sequence of the IRES has at least 70% complementarity to at least 10, at least 11 , at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21 , at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or 30 or more contiguous nucleobases within the region of the rRNA.
  • the nucleotide sequence of the IRES has at least 75% complementarity to at least 10, at least 11 , at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21 , at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or 30 or more contiguous nucleobases within the region of the rRNA, optionally wherein the nucleic acid sequences has at least 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementarity to the at least 10, at least 11 , at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21 , at least 22, at least 23, at least 24, at least 25, at
  • the nucleotide sequence of the IRES includes at least 10, at least 11 , at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21 , at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the rRNA.
  • the nucleotide sequence of the IRES includes from 10 to 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the rRNA. In some embodiments, the nucleotide sequence of the IRES includes from 12 to 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the rRNA. In some embodiments, the nucleotide sequence of the IRES includes from 15 to 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the rRNA.
  • the nucleotide sequence of the IRES includes from 18 to 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the rRNA. In some embodiments, the nucleotide sequence of the IRES includes from 20 to 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the rRNA. In some embodiments, the nucleotide sequence of the IRES includes from 25 to 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the rRNA.
  • the nucleotide sequence of the IRES includes 9 or fewer nucleotide mismatches relative to the region of the rRNA, optionally wherein the antisense strand includes 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer, or only 1 mismatch relative to the region of the rRNA.
  • the IRES does not include a chemically modified nucleoside.
  • the IRES includes nucleosides selected solely from adenosine, guanosine, cytidine, and uridine.
  • the IRES includes one or more chemically modified nucleosides. In some embodiments, the IRES includes one or more chemically modified adenosine, guanosine, cytidine, and/or uridine nucleosides.
  • At least 70% of the nucleosides in the IRES are chemically modified (e.g., at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the nucleosides in the IRES are chemically modified).
  • At least 70% of the adenosine nucleosides in the IRES are chemically modified (e.g., at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the adenosine nucleosides in the IRES are chemically modified).
  • the IRES includes one or more chemically modified adenosine nucleosides.
  • the modified adenosine of N is 2-amino-purine, 2, 6-diaminopurine, 2-amino-6-halo-purine, 6-halo-purine, 2-amino-6-methyl-purine, 8-azido-adenosine, 7-deaza-adenine, 7- deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2,6- diaminopurine, 7-deaza-8-aza-2, 6-diaminopurine, 1 -methyl-adenosine, 2-methyl-adenine, N6-methyl- adenosine, 2-methylthio-N6-methyl-adenosine, N6-isopentenyl-adenosine, 2-methylthio-N6
  • At least 70% of the guanosine nucleosides in the IRES are chemically modified (e.g., at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the guanosine nucleosides in the IRES are chemically modified).
  • the IRES includes one or more chemically modified guanosine nucleosides.
  • the modified guanosine of N is inosine, 1 -methyl-inosine, wyosine, methylwyosine, 4-demethyl-wyosine, isowyosine, wybutosine, peroxywybutosine, hydroxywybutosine, 7- deaza-guanosine, queuosine, epoxyqueuosine, galactosyl-queuosine, mannosyl-queuosine, 7-cyano-7- deaza-guanosine, 7-aminomethyl-7-deaza-guanosine, archaeosine, 7-deaza-8-aza-guanosine, 6-thio- guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7- methyl-guanosine, 7-methyl-inosine, 6-me
  • At least 70% of the cytidine nucleosides in the IRES are chemically modified (e.g., at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the cytidine nucleosides in the IRES are chemically modified).
  • the IRES includes one or more chemically modified cytidine nucleosides.
  • the modified cytidine of N is 5-aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3- methyl-cytidine, N4-acetyl-cytidine, 5-formyl-cytidine, N4-methyl-cytidine, 5-methyl-cytidine, 5-halo- cytidine, 5-hydroxymethyl-cytidine, 1 -methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo- pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1 -methylpseudoisocytidine, 4-thio-1 -methyl-1 -deaza-pseudoisocytidine,
  • At least 70% of the uridine nucleosides in the IRES are chemically modified (e.g., at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the uridine nucleosides in the IRES are chemically modified).
  • the IRES includes one or more chemically modified uridine nucleosides.
  • the modified uridine of N is 1 -methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine, 4-thio-uridine, 4-thio- pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl- uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5- carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine, 5- carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl-uridine, 5-methoxycarbonylmethyl- 2-thio
  • the IRES includes one or more polynucleotide tracts enriched in uridine or a modified uridine
  • the IRES includes from 1 to 20 of the polynucleotide tracts enriched in uridine or a modified uridine. In some embodiments, the IRES includes from 2 to 10 of the polynucleotide tracts enriched in uridine or a modified uridine. In some embodiments, the IRES includes from 3 to 6 of the polynucleotide tracts enriched in uridine or a modified uridine. In some embodiments, the IRES includes 3 of the polynucleotide tracts enriched in uridine or a modified uridine. In some embodiments, the IRES includes 4 of the polynucleotide tracts enriched in uridine or a modified uridine.
  • the IRES includes 5 of the polynucleotide tracts enriched in uridine or a modified uridine. In some embodiments, the IRES includes 6 of the polynucleotide tracts enriched in uridine or a modified uridine.
  • At least 70% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine. In some embodiments, at least 75% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine. In some embodiments, at least 80% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine. In some embodiments, at least 85% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine.
  • At least 90% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine. In some embodiments, at least 95% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine. In some embodiments, all of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine, preferably wherein all of the nucleosides in each of the polynucleotide tracts is a modified uridine.
  • each polynucleotide tract is from 5 to 20 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 15 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 7 to 1 1 nucleosides in length. In some embodiments, each polynucleotide tract is 9 nucleosides in length.
  • each polynucleotide tract independently, includes from 5 to 20 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract, independently, includes from 6 to 15 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract, independently, includes from 7 to 1 1 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract includes at least 9 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract includes 9 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract is enriched in the modified uridine.
  • the modified uridine is 1 -methylpseudouridine, pseudouridine, pyridin-4- one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine, 4-thio-uridine, 4-thio- pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl- uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5- carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine, 5- carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl-uridine, 5-methoxycarbonylmethyl- 2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl-uridine
  • the IRES is located within a noncoding region of the nucleic acid (e.g., a 5’ untranslated region (UTR)) that is operably linked to the open reading frame.
  • the open reading frame is further operably linked to a 3’ UTR.
  • the polynucleotide tracts are separated from one another by way of one or more spacers that each, independently, include from 5 to 100 nucleosides. In some embodiments, each of the spacers, independently, includes from 10 to 40 nucleosides. In some embodiments, each of the spacers, independently, includes 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, or 38 nucleosides.
  • the IRES is represented by the formula:
  • each N is, independently, any nucleoside residue
  • each U’ s, independently, uridine or a modified uridine
  • each n is, independently, an integer from 1 to 100
  • each m is, independently, an integer from 2 to 15
  • p is an integer from 2 to 20.
  • each N is, independently, selected from adenosine, a modified adenosine, uridine, a modified uridine, guanosine, a modified guanosine, cytidine, and a modified cytidine. In some embodiments, each N is, independently, selected from adenosine, uridine, a modified uridine, guanosine, and cytidine.
  • the modified uridine of N is 1 -methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine, 4-thio- uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo- uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine, 5- carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl-uridine, 5-methoxycarbonylmethyl- 2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-aminomethyl
  • the modified cytidine of N is 5-aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetyl-cytidine, 5-formyl-cytidine, N4-methyl-cytidine, 5-methyl- cytidine, 5-halo-cytidine, 5-hydroxymethyl-cytidine, 1 -methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo- pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1 -methylpseudoisocytidine, 4-thio-1 -methyl-1 -deaza-pseudoisocytidine, 1 -methyl-1 -deaza-pseudoisocytidine, zebularine
  • the modified adenosine of A/ is 2-amino-purine, 2, 6-diaminopurine, 2- amino-6-halo-purine, 6-halo-purine, 2-amino-6-methyl-purine, 8-azido-adenosine, 7-deaza-adenine, 7- deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2,6- diaminopurine, 7-deaza-8-aza-2, 6-diaminopurine, 1 -methyl-adenosine, 2-methyl-adenine, N6-methyl- adenosine, 2-methylthio-N6-methyl-adenosine, N6-isopentenyl-adenosine, 2-methylthio-N6-isopentenyl- adenosine, N6-(cis-hydroxyisopentenyl)
  • the modified guanosine of N is inosine, 1 -methyl-inosine, wyosine, methylwyosine, 4-demethyl-wyosine, isowyosine, wybutosine, peroxywybutosine, hydroxywybutosine, 7- deaza-guanosine, queuosine, epoxyqueuosine, galactosyl-queuosine, mannosyl-queuosine, 7-cyano-7- deaza-guanosine, 7-aminomethyl-7-deaza-guanosine, archaeosine, 7-deaza-8-aza-guanosine, 6-thio- guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7- methyl-guanosine, 7-methyl-inosine, 6-me
  • the modified uridine of U’ is 1 -methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine, 4-thio- uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo- uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine, 5- carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl-uridine, 5-methoxycarbonylmethyl- 2-thio-uridine, 5-aminomethyl-2-thio-uridine,
  • each n is, independently, an integer from 10 to 40. In some embodiments, each n is, independently, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, or 38. In some embodiments, each m is, independently, an integer from 2 to 15. In some embodiments, each m is, independently, an integer from 7 to 1 1 . In some embodiments, each m is 9.
  • p is an integer from 2 to 10. In some embodiments, p is an integer from 3 to 6, optionally wherein p is 3 or 6.
  • the nucleic acid is RNA. In some embodiments, the nucleic acid is linear. In some embodiments, the nucleic acid is circular.
  • the open reading from consists of nucleosides selected from adenosine, a modified adenosine, uridine, a modified uridine, guanosine, a modified guanosine, cytidine, and a modified cytidine. In some embodiments, the open reading from consists of nucleosides selected from adenosine, uridine, a modified uridine, guanosine, and cytidine.
  • the modified uridine of the open reading frame is 1 -methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio- uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl-uridine, 5- methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-a
  • the modified cytidine of N is 5-aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetyl-cytidine, 5-formyl-cytidine, N4-methyl-cytidine, 5-methyl- cytidine, 5-halo-cytidine, 5-hydroxymethyl-cytidine, 1 -methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo- pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1 -methylpseudoisocytidine, 4-thio-1 -methyl-1 -deaza-pseudoisocytidine, 1 -methyl-1 -deaza-pseudoisocytidine, zebularine
  • the modified adenosine of N is 2-amino-purine, 2, 6-diaminopurine, 2- amino-6-halo-purine, 6-halo-purine, 2-amino-6-methyl-purine, 8-azido-adenosine, 7-deaza-adenine, 7- deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2,6- diaminopurine, 7-deaza-8-aza-2, 6-diaminopurine, 1 -methyl-adenosine, 2-methyl-adenine, N6-methyl- adenosine, 2-methylthio-N6-methyl-adenosine, N6-isopentenyl-adenosine, 2-methylthio-N6-isopentenyl- adenosine, N6-(cis-hydroxyisopentenyl)a
  • the modified guanosine of N is inosine, 1 -methyl-inosine, wyosine, methylwyosine, 4-demethyl-wyosine, isowyosine, wybutosine, peroxywybutosine, hydroxywybutosine, 7- deaza-guanosine, queuosine, epoxyqueuosine, galactosyl-queuosine, mannosyl-queuosine, 7-cyano-7- deaza-guanosine, 7-aminomethyl-7-deaza-guanosine, archaeosine, 7-deaza-8-aza-guanosine, 6-thio- guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7- methyl-guanosine, 7-methyl-inosine, 6-me
  • the polypeptide encoded by the open reading frame is a secreted protein, a cytokine, a growth factor, an enzyme, an immunomodulator, an antibody or antigen-binding fragment thereof, a cell-penetrating peptide, an extracellular membrane-bound protein, an intracellular membranebound protein, a cytoplasmic protein, a cytoskeletal protein, or a nuclear protein.
  • the nucleic acid does not include a 5’ cap. In some embodiments, the nucleic acid includes a 5’ cap.
  • the nucleotide sequence of the IRES includes at least 75% sequence identity to SEQ ID NO: 185 or SEQ ID NO: 190. In some embodiments, the nucleotide sequence of the IRES includes at least 80% sequence identity to SEQ ID NO: 185 or SEQ ID NO: 190. In some embodiments, the nucleotide sequence of the IRES includes at least 85% sequence identity to SEQ ID NO: 185 or SEQ ID NO: 190. In some embodiments, the nucleotide sequence of the IRES has at least 90% sequence identity to SEQ ID NO: 185 or SEQ ID NO: 190.
  • the nucleotide sequence of the IRES has a at least 95% sequence identity to SEQ ID NO: 185 or SEQ ID NO: 190, optionally wherein the nucleotide sequence of the IRES has at least 96%, 97%, 98%, or 99% sequence identity SEQ ID NO: 185 or SEQ ID NO: 190. In some embodiments, the nucleotide sequence of the IRES is SEQ ID NO: 185 or SEQ ID NO: 190.
  • the IRES includes one or more polynucleotides that specifically bind a translation initiation factor (e.g., eukaryotic translation initiation factor 4 G (elF4G), eukaryotic translation initiation factor 4G2 (elF4G2), eukaryotic translation initiation factor 3 (elF3), La protein, or an IRES transacting factors (ITAf)), or a fusion protein including a translation initiation factor (e.g., elF4G, elF4G2, elF3, La protein, or an ITAf) fused to an RNA-binding protein.
  • the one or more polynucleotides specifically bind elF4G.
  • each of the one or more polynucleotides independently, has a nucleic acid sequence that is at least 75% identical to ACUCACUAUUUGUUUUCGCGCCCAGUUGCAAAAA (SEQ ID NO: 1 ), optionally wherein each U residue in SEQ ID NO: 1 is replaced with 1 - methylpseudouridine.
  • each of the one or more polynucleotides independently, has a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO: 1 (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 1 ), optionally wherein each U residue in SEQ ID NO: 1 is replaced with 1 - methylpseudouridine.
  • the IRES includes one or more polynucleotides that specifically bind to a fusion protein including a translation initiation factor (e.g., elF4G, elF4G2, elF3, La protein, or an ITAf) fused to an RNA-binding protein, optionally wherein the RNA-binding protein is MS2-binding protein and the one or more polynucleotides include one or more MS2 RNA hairpins.
  • a translation initiation factor e.g., elF4G, elF4G2, elF3, La protein, or an ITAf
  • the nucleic acid does not include a 5’ cap. In some embodiments, the nucleic acid includes a 5’ cap.
  • the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to any one of SEQ ID NO: 191 -201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to any one of SEQ ID NO: 191 -201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to any one of SEQ ID NO: 191 -201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to any one of SEQ ID NO: 191 -201 .
  • the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to any one of SEQ ID NO: 191 -201 . In some embodiments, the nucleic acid includes the nucleotide sequence of any one of SEQ ID NO: 191 -201.
  • rRNA is a eukaryotic rRNA. In some embodiments, the rRNA is from a 60S or 40S ribosomal subunit, optionally wherein the rRNA is selected from the group consisting of a 25S, 28S, 18S, 5.8S, and 5S rRNA.
  • the nucleic acid sequence surrounding (e.g., 5’ and/or 3’ relative to) the IRES has a single stranded RNA structure.
  • polypeptide expression system comprising:
  • nucleic acid comprising an open reading frame that encodes elF4G, La protein, or a functional variant thereof.
  • nucleic acid of (i) and the nucleic acid of (ii) are separate molecules.
  • nucleic acid of (ii) comprises, from 5’ to 3’:
  • nucleic acid of (ii) further comprises a 5’ cap operably linked to the 5’ UTR.
  • the disclosure provides a host cell comprising the nucleic acid or polypeptide expression system of any one of the above aspects or embodiments of the disclosure.
  • the host cell is a eukaryotic cell.
  • the eukaryotic cell is a mammalian cell.
  • the mammalian cell is a human cell.
  • the disclosure provides a method of expressing a polypeptide in a subject, the method comprising administering to the subject the nucleic acid or polypeptide expression system of any of the above aspects or embodiments of the disclosure.
  • the disclosure provides a method of expressing a polypeptide in a cell or population of cells, the method comprising administering to the subject the nucleic acid or polypeptide expression system of any of the above aspects or embodiments of the disclosure.
  • the disclosure provides a method of treating a disease or condition associated with a deficiency in an endogenous polypeptide, the method comprising administering to the subject the nucleic acid or polypeptide expression system of any of the above aspects or embodiments of the disclosure, with the proviso that the polypeptide encoded by the nucleic acid or polypeptide expression system corresponds to the polypeptide whose deficiency is associated with the disease or condition.
  • the term “about” refers to a value that is no more than 10% above or below the value being described.
  • the term “about 5 nM” indicates a range of from 4.5 nM to 5.5 nM.
  • biocompatible means compatible with living cells, tissues, organs or systems posing little to no risk of injury, toxicity or rejection by the immune system.
  • biodegradable means capable of being broken down into innocuous products by the action of living things.
  • biologically active refers to a characteristic of any substance that has activity in a biological system and/or organism. For instance, a substance that, when administered to an organism, has a biological effect on that organism, is considered to be biologically active.
  • a polynucleotide of the present disclosure can be considered biologically active if even a portion of the polynucleotide is biologically active or mimics an activity considered biologically relevant.
  • amino acid substitution refers to the replacement of an amino acid residue present in a parent or reference polypeptide (e.g., a target polypeptide described herein) with another amino acid residue.
  • An amino acid can be substituted in a parent or reference sequence, for example, via chemical peptide synthesis or through recombinant methods known in the art.
  • substitution at position X refers to the substitution of an amino acid present at position X with an alternative amino acid residue.
  • substitution patterns can be described according to the scheme AnY, wherein A is the single letter code corresponding to the amino acid naturally or originally present at position n, and Y is the substituting amino acid residue.
  • substitution patterns can be described according to the scheme An(YZ), wherein A is the single letter code corresponding to the amino acid residue substituting the amino acid naturally or originally present at position n, and Y and Z are alternative substituting amino acid residue.
  • substitutions may be conducted at the nucleic acid level, i.e., substituting an amino acid residue with an alternative amino acid residue may be conducted by substituting the codon encoding the first amino acid with a codon encoding the second amino acid.
  • the terms “conservative mutation,” “conservative substitution,” “conservative amino acid substitution,” and the like refer to a substitution of one or more amino acids for one or more different amino acids that exhibit similar physicochemical properties, such as polarity, electrostatic charge, and/or steric volume. These properties are summarized for each of the twenty naturally-occurring amino acids in Table 1 below.
  • conservative amino acid families include, e.g., (i) G, A, V, L, I, P, and M; (ii) D and E; (iii) C, S and T; (iv) H, K and R; (v) N and Q; and (vi) F, Y and W.
  • a conservative mutation or substitution is therefore one that substitutes one amino acid for a member of the same amino acid family (e.g., a substitution of Ser for Thr or Lys for Arg).
  • conjugate refers to a compound formed by the chemical bonding of a reactive functional group of one molecule with an appropriately reactive functional group of another molecule. Conjugates may additionally be produced, e.g., as two polypeptide domains covalently bound to one another as part of a single polypeptide chain that is synthesized by the translation of a single RNA transcript encoding both polypeptides in frame with one another.
  • sequence optimization refers to a process or series of processes by which nucleobases in a reference nucleic acid sequence are replaced with alternative nucleobases, resulting in a nucleic acid sequence with improved properties, e.g., improved protein expression or decreased immunogenicity.
  • sequence optimization is to produce a synonymous nucleotide sequence than encodes the same polypeptide sequence encoded by the reference nucleotide sequence.
  • references to a "substitution” or “replacement” at a certain location in a nucleic acid sequence (e.g., an mRNA) or within a certain region or subsequence of a nucleic acid sequence (e.g., an mRNA) refer to the substitution of a codon at such location or region with an alternative codon.
  • coding region and “region encoding” and grammatical variants thereof, refer to an Open Reading Frame (ORF) in a polynucleotide that upon expression yields a polypeptide or protein.
  • ORF Open Reading Frame
  • nucleic acid sequence or a portion thereof that need not be fully complementary (e.g., 100% complementary) to a target region or a nucleic acid sequence or a portion thereof that has one or more nucleotide mismatches relative to the target region but that is still capable of hybridizing to the target region under specified conditions.
  • the nucleic acid may be, e.g., 95% complementary, 90%, complementary, 85% complementary, 80% complementary, 75% complementary, 70% complementary, 65% complementary, 60% complementary, 55% complementary, 50% complementary, or less, but still form sufficient base pairs with the target so as to hybridize across its length.
  • contacting means establishing a physical connection between two or more entities.
  • contacting a mammalian cell with a nanoparticle composition means that the mammalian cell and a nanoparticle are made to share a physical connection.
  • Methods of contacting cells with external entities both in vivo and ex vivo are well known in the biological arts.
  • contacting a nanoparticle composition and a mammalian cell disposed within a mammal can be performed by varied routes of administration (e.g., intravenous, intramuscular, intradermal, and subcutaneous) and can involve varied amounts of nanoparticle compositions.
  • routes of administration e.g., intravenous, intramuscular, intradermal, and subcutaneous
  • more than one mammalian cell can be contacted by a nanoparticle composition.
  • delivering means providing an entity to a destination.
  • delivering a polynucleotide to a subject can involve administering a nanoparticle composition including the polynucleotide to the subject (e.g., by an intravenous, intramuscular, intradermal, or subcutaneous route).
  • Administration of a nanoparticle composition to a mammal or mammalian cell can involve contacting one or more cells with the nanoparticle composition.
  • delivery agent refers to any substance that facilitates, at least in part, the in vivo, in vitro, or ex vivo delivery of a polynucleotide to targeted cells.
  • lipid nanoparticle refers to a transfer vehicle including one or more lipids (e.g., cationic lipids, non-cationic lipids, and PEG-modified lipids).
  • Exemplary lipid nanoparticles are formulated to deliver one or more mRNA to one or more target cells.
  • suitable lipids include, for example, the phosphatidyl compounds (e.g., phosphatidylglycerol, phosphatidylcholine, phosphatidylserine, phosphatidylethanolamine, sphingolipids, cerebrosides, and gangliosides).
  • Lipid nanoparticles may contain a cationic lipid, or a lipid species with a net positive charge at a selected pH (e.g., physiological pH), to encapsulate and/or enhance the delivery of mRNA into the target cells.
  • helper lipid refers to a compound or molecule that includes a lipidic moiety (for insertion into a lipid layer, e.g., lipid bilayer) and a polar moiety (for interaction with physiologic solution at the surface of the lipid layer).
  • the helper lipid is a phospholipid.
  • a function of the helper lipid is to “complement” the amino lipid and increase the fusogenicity of the bilayer and/or to help facilitate endosomal escape, e.g., of nucleic acid delivered to cells.
  • Helper lipids are also believed to be a key structural component to the surface of the LNP.
  • ionizable amino lipid includes those lipids having one, two, three, or more fatty acid or fatty alkyl chains and a pH-titratable amino head group (e.g., an alkylamino or dialkylamino head group).
  • An ionizable amino lipid is typically protonated (i.e., positively charged) at a pH below the pKa of the amino head group and is substantially not charged at a pH above the pKa.
  • Such ionizable amino lipids include, but are not limited to DLin-MC3-DMA (MC3), (13Z,165Z)-N,N-dimethyl-3- nonydocosa-13-16-dien-1 -amine (L608), and a compound of any one of Formula I, II, and II described herein (e.g., any one of Compound 1-1 , Compound I-2, Compound I-3, or Compound l-VI).
  • a "linker” refers to a group of atoms, e.g., 10-1 ,000 atoms, and can be comprised of the atoms or groups such as, but not limited to, carbon, amino, alkylamino, oxygen, sulfur, sulfoxide, sulfonyl, carbonyl, and imine.
  • the linker can be attached to a modified nucleoside or nucleotide on the nucleobase or sugar moiety at a first end, and to a payload, e.g., a detectable or therapeutic agent, at a second end.
  • the linker can be of sufficient length as to not interfere with incorporation into a nucleic acid sequence.
  • the linker can be used for any useful purpose, such as to form polynucleotide multimers (e.g., through linkage of two or more chimeric polynucleotides molecules or IVT polynucleotides) or polynucleotides conjugates, as well as to administer a payload, as described herein.
  • Examples of chemical groups that can be incorporated into the linker include, but are not limited to, alkyl, alkenyl, alkynyl, amido, amino, ether, thioether, ester, alkylene, heteroalkylene, aryl, or heterocyclyl, each of which can be optionally substituted, as described herein.
  • linkers include, but are not limited to, unsaturated alkanes, polyethylene glycols (e.g., ethylene or propylene glycol monomeric units, e.g., diethylene glycol, dipropylene glycol, triethylene glycol, tripropylene glycol, tetraethylene glycol, or tetraethylene glycol), and dextran polymers and derivatives thereof.
  • Non-limiting examples of a selectively cleavable bond include an amido bond can be cleaved for example by the use of tris(2- carboxyethyl)phosphine (TCEP), or other reducing agents, and/or photolysis, as well as an ester bond can be cleaved for example by acidic or basic hydrolysis.
  • TCEP tris(2- carboxyethyl)phosphine
  • messenger RNA or “mRNA” refer to any polynucleotide which encodes a polypeptide of interest and which is capable of being translated to produce the encoded polypeptide of interest in vitro, in vivo, in situ, or ex vivo.
  • mRNA messenger RNA
  • the basic components of an mRNA molecule include a coding region, a 5’UTR, a 3’UTR, a 5’ cap, and a poly-A tail.
  • modified refers to a changed state or structure of a molecule of the present disclosure.
  • Molecules can be modified in many ways, including chemically, structurally, and functionally.
  • the mRNA molecules of the present disclosure are modified by the introduction of non-natural nucleosides and/or nucleotides, e.g., as it relates to the natural ribonucleotides A, U, G, and/or C. Examples of “modified” nucleosides are provided herein.
  • modified messenger RNA or “modified mRNA” refer to mRNA polynucleotides that include naturally occurring and/or non-naturally occurring modifications, for example, of a sugar, a nucleobase, or an internucleoside linkage (e.g., to a linking phosphate, to a phosphodiester linkage, or to the phosphodiester backbone).
  • Non-natural modified nucleotides may be introduced during synthesis of post-synthesis of the polynucleotides to achieve desired functions or properties.
  • the modifications may be present on an internucleoside linkage, purine or pyrimidine base, or sugar.
  • the modification may be introduced with chemical synthesis or with a polymerase enzyme at the terminal of a chain or anywhere else in the chain. Any of the regions of a polynucleotide may be chemically modified.
  • unmodified refers to any substance, compound, or molecule prior to being changed in some way. Unmodified can, but does not always, refer to the wild type or native form of a biomolecule. Molecules can undergo a series of modifications whereby each modified molecule can serve as the "unmodified" starting molecule for a subsequent modification.
  • Uracil is one of the four nucleobases in the nucleic acid of RNA, and it is represented by the letter U.
  • Uracil can be attached to a ribose ring, or more specifically, a ribofuranose via an Ni-glycosidic bond to yield the nucleoside uridine.
  • the nucleoside uridine is also commonly abbreviated according to the one letter code of its nucleobase, i.e., U.
  • U when a monomer in a polynucleotide sequence is U, such U is designated interchangeably as a "uracil” or a "uridine.”
  • Uridine content or uracil content are interchangeable and refer to the amount of uracil or uridine present in a certain nucleic acid sequence. Uridine content or uracil content can be expressed as an absolute value (total number of uridine or uracil in the sequence) or relative (uridine or uracil percentage respect to the total number of nucleobases in the nucleic acid sequence).
  • uridine-modified sequence refers to a sequence optimized nucleic acid (e.g., a synthetic mRNA sequence) with a different overall or local uridine content (higher or lower uridine content) or with different uridine patterns (e.g., gradient distribution or clustering) with respect to the uridine content and/or uridine patterns of a candidate nucleic acid sequence.
  • a "high uridine codon” is defined as a codon comprising two or three uridines
  • a "low uridine codon” is defined as a codon comprising one uridine
  • a "no uridine codon” is a codon without any uridines.
  • a uridine-modified sequence comprises substitutions of high uridine codons with low uridine codons, substitutions of high uridine codons with no uridine codons, substitutions of low uridine codons with high uridine codons, substitutions of low uridine codons with no uridine codons, substitution of no uridine codons with low uridine codons, substitutions of no uridine codons with high uridine codons, and combinations thereof.
  • a high uridine codon can be replaced with another high uridine codon.
  • a low uridine codon can be replaced with another low uridine codon.
  • a no uridine codon can be replaced with another no uridine codon.
  • a uridine-modified sequence can be uridine enriched or uridine rarefied.
  • Uridine enriched and grammatical variants refer to the increase in uridine content (expressed in absolute value or as a percentage value) in a sequence optimized nucleic acid (e.g., a synthetic mRNA sequence) with respect to the uridine content of the corresponding candidate nucleic acid sequence.
  • Uridine enrichment can be implemented by substituting codons in the candidate nucleic acid sequence with synonymous codons containing less uridine nucleobases. Uridine enrichment can be global (i.e., relative to the entire length of a candidate nucleic acid sequence) or local (i.e., relative to a subsequence or region of a candidate nucleic acid sequence).
  • Uridine rarefied and grammatical variants refer to a decrease in uridine content (expressed in absolute value or as a percentage value) in a sequence optimized nucleic acid (e.g., a synthetic mRNA sequence) with respect to the uridine content of the corresponding candidate nucleic acid sequence.
  • Uridine rarefication can be implemented by substituting codons in the candidate nucleic acid sequence with synonymous codons containing less uridine nucleobases. Uridine rarefication can be global (i.e., relative to the entire length of a candidate nucleic acid sequence) or local (i.e., relative to a subsequence or region of a candidate nucleic acid sequence).
  • initiation codon refers to the first codon of an open reading frame that is translated by the ribosome and is comprised of a triplet of linked adenine-uracil-guanine nucleobases.
  • the initiation codon is depicted by the first letter codes of adenine (A), uracil (U), and guanine (G) and is often written simply as “AUG”.
  • A adenine
  • U uracil
  • G guanine
  • alternative initiation codons the initiation codons of polynucleotides described herein use the AUG codon.
  • the sequence comprising the initiation codon is recognized via complementary base-pairing to the anticodon of an initiator tRNA (Met-tRNAi Met ) bound by the ribosome.
  • Open reading frames may contain more than one AUG initiation codon, which are referred to herein as “alternate initiation codons”.
  • the initiation codon plays an important role in translation initiation.
  • the initiation codon is the first codon of an open reading frame that is translated by the ribosome.
  • the initiation codon comprises the nucleotide triplet AUG, however, in some instances translation initiation can occur at other codons comprised of distinct nucleotides.
  • the initiation of translation in eukaryotes is a multistep biochemical process that involves numerous protein-protein, protein-RNA, and RNA-RNA interactions between messenger RNA molecules (mRNAs), the 40S ribosomal subunit, other components of the translation machinery (e.g., eukaryotic initiation factors; elFs).
  • the current model of mRNA translation initiation postulates that the pre-initiation complex (alternatively “43S pre-initiation complex”; abbreviated as “PIC”) translocates from the site of recruitment on the mRNA (typically the 5' cap) to the initiation codon by scanning nucleotides in a 5' to 3' direction until the first AUG codon that resides within a specific translation-promotive nucleotide context (the Kozak sequence) is encountered (Kozak (1989) J Cell Biol 108:229-241 ).
  • PIC pre-initiation complex
  • Kozak sequence refers to a translation initiation enhancer element to enhance expression of a gene or open reading frame, and which in eukaryotes, is located in the 5' UTR.
  • Polynucleotides disclosed herein comprise a Kozak consensus sequence, or a derivative or modification thereof.
  • nucleobase refers to a purine or pyrimidine heterocyclic compound found in nucleic acids, including any derivatives or analogs of the naturally occurring purines and pyrimidines that confer improved properties (e.g., binding affinity, nuclease resistance, chemical stability) to a nucleic acid or a portion or segment thereof.
  • Adenine, cytosine, guanine, thymine, and uracil are the nucleobases predominately found in natural nucleic acids.
  • nucleobase sequence of a SEQ ID NO described herein encompasses both natural nucleobases and chemically modified nucleobases (e.g., a “U” designation in a SEQ ID NO encompasses both uracil and chemically modified uracil).
  • nucleoside refers to a compound containing a sugar molecule (e.g., a ribose in RNA or a deoxyribose in DNA), or derivative or analog thereof, covalently linked to a nucleobase (e.g., a purine or pyrimidine), or a derivative or analog thereof (also referred to herein as “nucleobase”), but lacking an internucleoside linking group (e.g., a phosphate group).
  • a sugar molecule e.g., a ribose in RNA or a deoxyribose in DNA
  • nucleobase e.g., a purine or pyrimidine
  • internucleoside linking group e.g., a phosphate group
  • nucleotide refers to a nucleoside covalently bonded to an internucleoside linking group (e.g., a phosphate group), or any derivative, analog, or modification thereof that confers improved chemical and/or functional properties (e.g., binding affinity, nuclease resistance, chemical stability) to a nucleic acid or a portion or segment thereof.
  • internucleoside linking group e.g., a phosphate group
  • any derivative, analog, or modification thereof that confers improved chemical and/or functional properties (e.g., binding affinity, nuclease resistance, chemical stability) to a nucleic acid or a portion or segment thereof.
  • ORF open reading frame
  • the ORF comprises a continuous stretch of non-overlapping, in-frame codons, beginning with the initiation codon and ending with a stop codon, and is translated by the ribosome.
  • translational regulatory activity refers to a biological function, mechanism, or process that modulates (e.g., regulates, influences, controls, varies) the activity of the translational apparatus, including the activity of the PIC and/or ribosome.
  • the desired translation regulatory activity promotes and/or enhances the translational fidelity of mRNA translation.
  • the desired translational regulatory activity reduces and/or inhibits leaky scanning.
  • nucleic acid and “polynucleotide” are used interchangeably. In their broadest sense, these terms include any compound and/or substance that comprises a polymer of nucleotides.
  • nucleic acids or polynucleotides of the present disclosure include, but are not limited to, ribonucleic acids (RNAs), deoxyribonucleic acids (DNAs), threose nucleic acids (TNAs), glycol nucleic acids (GNAs), peptide nucleic acids (PNAs), locked nucleic acids (LNAs, including LNA having a p- D-ribo configuration, a-LNA having an a-L-ribo configuration (a diastereomer of LNA), 2'-amino-LNA having a 2'-amino functionalization, and 2'-amino- a-LNA having a 2'-amino functionalization), ethylene nucleic acids (ENA), cyclohexenyl nucleic acids (CeNA) or hybrids or combinations thereof.
  • RNAs ribonucleic acids
  • DNAs deoxyribonucleic acids
  • TAAs threose nucleic
  • Nucleic acid molecules of the disclosure may be, for example, triple-, double-, or single-stranded deoxyribonucleic acid ("DNA”), as well as triple-, double- and single-stranded ribonucleic acid (“RNA”). This term also includes modified, for example, by alkylation, and/or by capping, and unmodified forms of the corresponding unmodified nucleic acid.
  • the nucleic acid comprises an mRNA.
  • the mRNA is a synthetic mRNA.
  • the synthetic mRNA comprises at least one unnatural nucleobase.
  • nucleobases of a certain class have been replaced with unnatural nucleobases (e.g., all uridines in a polynucleotide disclosed herein can be replaced with an unnatural nucleobase, e.g., 1 -methylpseudouridine).
  • the polynucleotide e.g., a synthetic RNA or a synthetic DNA
  • T bases in the codon maps disclosed herein are present in DNA, whereas the T bases would be replaced by U bases in corresponding RNAs.
  • a codon-nucleotide sequence disclosed herein in DNA form e.g., a vector or an in-vitro translation (IVT) template, would have its T bases transcribed as U based in its corresponding transcribed mRNA.
  • IVT in-vitro translation
  • both codon-optimized DNA sequences (comprising T) and their corresponding mRNA sequences (comprising U) are considered codon-optimized nucleotide sequence of the present disclosure.
  • a TTC codon (DNA map) would correspond to a UUC codon (RNA map), which in turn would correspond to a ⁇ C codon (RNA map in which U has been replaced with pseudouridine).
  • Standard A-T and G-C base pairs form under conditions which allow the formation of hydrogen bonds between the N3-H and C4-oxy of thymidine and the N1 and C6-NH 2 , respectively, of adenosine and between the C2-oxy, N3 and C4-NH 2 , of cytidine and the C2-NH 2 , N' — H and C6-oxy, respectively, of guanosine.
  • guanosine (2-amino-6-oxy-9- ⁇ -D-ribofuranosyl-purine) can be modified to form isoguanosine (2-oxy-6-amino-9-p-D-ribofuranosyl-purine).
  • isocytidine can be prepared by the method described by Switzer et al. (1993) Biochemistry 32:10489-10496 and references cited therein; 2'- deoxy-5-methyl-isocytidine can be prepared by the method of Tor et al., 1993, J. Am. Chem. Soc. 115:4461 -4467 and references cited therein; and isoguanine nucleotides can be prepared using the method described by Switzer et al., 1993, supra, and Mantsch et al., 1993, Biochem. 14:5593-5601 , or by the method described in U.S. Pat. No. 5,780,610 to Collins et al.
  • Nonnatural base pairs can be synthesized by the method described in Piccirilli et al., 1990, Nature 343:33-37, for the synthesis of 2,6- diaminopyrimidine and its complement (1 -methylpyrazolo-[4,3]pyrimidine-5,7-(4H,6H)-dione.
  • Other such modified nucleotide units which form unique base pairs are known, such as those described in Leach et al. (1992) J. Am. Chem. Soc. 114:3675-3683 and Switzer et al., supra.
  • Nucleotides are referred to by their commonly accepted single-letter codes. Unless otherwise indicated, nucleic acids are written left to right in 5' to 3' orientation. Nucleobases are referred to herein by their commonly known one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Accordingly, A represents adenine, C represents cytosine, G represents guanine, T represents thymine, U represents uracil.
  • nucleic acids or polynucleotides may be “enriched” in certain nucleosides.
  • enriched refers to a polynucleotide in which at least 50% of the nucleosides within the polynucleotide are the same.
  • a polynucleotide is said to be “enriched” in uridine if at least 50% (e.g., 51%, 52%, 53%, 54%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%) of the nucleosides in the polynucleotide are uridine nucleosides.
  • a polynucleotide is said to be “enriched” in a modified uridine nucleoside (e.g., in 1 -methylpseudouridine) if at least 50% (e.g., 51%, 52%, 53%, 54%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%) of the nucleosides in the polynucleotide are the modified uridine nucleoside (e.g., 1 -methylpseudouridine).
  • a modified uridine nucleoside e.g., in 1 -methylpseudouridine
  • polynuceotides that are “enriched” for certain nucleoside residues may be separated from one another by way of a spacer.
  • a “spacer” refers to a polynucleotide that does not code for a polypeptide (i.e. , does not contain a start codon operably linked to a continuous segment of amino acid-encoding codons) and that is not enriched with the same nucleoside as the enriched polynucleotide(s) adjacent to the spacer.
  • a spacer may be enriched for a different nucleoside as the enriched polynucleotide(s) adjacent to the spacer.
  • Spacers may be, for example, from 5 to 100 nucleosides in length, such as from 10 to 40 nucleosides in length (e.g., 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleosides in length).
  • polypeptide polypeptide
  • peptide protein
  • the terms are used interchangeably herein to refer to polymers of amino acids of any length.
  • the polymer can comprise modified amino acids.
  • the terms also encompass an amino acid polymer that has been modified naturally or by intervention; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling component.
  • polypeptides containing one or more analogs of an amino acid including, for example, unnatural amino acids such as homocysteine, ornithine, p-acetylphenylalanine, D-amino acids, and creatine
  • unnatural amino acids such as homocysteine, ornithine, p-acetylphenylalanine, D-amino acids, and creatine
  • polypeptides refers to proteins, polypeptides, and peptides of any size, structure, or function.
  • Polypeptides include encoded polynucleotide products, naturally occurring polypeptides, synthetic polypeptides, homologs, orthologs, paralogs, fragments and other equivalents, variants, and analogs of the foregoing.
  • a polypeptide can be a monomer or can be a multi-molecular complex such as a dimer, trimer or tetramer. They can also comprise single chain or multichain polypeptides. Most commonly disulfide linkages are found in multichain polypeptides.
  • polypeptide can also apply to amino acid polymers in which one or more amino acid residues are an artificial chemical analogue of a corresponding naturally occurring amino acid.
  • a "peptide" can be less than or equal to 50 amino acids long, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids long.
  • Amino acids are referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Unless otherwise indicated, amino acid sequences are written left to right in amino to carboxy orientation.
  • Percent (%) sequence complementarity with respect to a reference polynucleotide sequence is defined as the percentage of nucleic acids in a candidate sequence that are complementary to the nucleic acids in the reference polynucleotide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence complementarity.
  • a given nucleotide is considered to be “complementary” to a reference nucleotide as described herein if the two nucleotides form canonical Watson-Crick base pairs.
  • Watson-Crick base pairs in the context of the present disclosure include adenine-thymine, adenine-uracil, and cytosine-guanine base pairs.
  • a proper Watson-Crick base pair is referred to in this context as a “match,” while each unpaired nucleotide, and each incorrectly paired nucleotide, is referred to as a “mismatch.”
  • Alignment for purposes of determining percent nucleic acid sequence complementarity can be achieved in various ways that are within the capabilities of one of skill in the art, for example, using publicly available computer software such as BLAST, BLAST-2, or Megalign software. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms needed to achieve maximal complementarity over the full length of the sequences being compared.
  • the percent sequence complementarity of a given nucleic acid sequence, A, to a given nucleic acid sequence, B, is calculated as follows:
  • a query nucleic acid sequence is considered to be “completely complementary” to a reference nucleic acid sequence if the query nucleic acid sequence has 100% sequence complementarity to the reference nucleic acid sequence.
  • percent (%) sequence identity As used herein, the terms “percent (%) sequence identity,” “percent (%) identity,” and the like, with respect to a reference polynucleotide or polypeptide sequence, is defined as the percentage of nucleic acids or amino acids in a candidate sequence that are identical to the nucleic acids or amino acids in the reference polynucleotide or polypeptide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity. Alignment for purposes of determining percent nucleic acid or amino acid sequence identity can be achieved in various ways that are within the capabilities of one of skill in the art, for example, using publicly available computer software such as BLAST, BLAST-2, or Megalign software.
  • percent sequence identity values may be generated using the sequence comparison computer program BLAST.
  • percent sequence identity of a given nucleic acid or amino acid sequence, A, to, with, or against a given nucleic acid or amino acid sequence, B, (which can alternatively be phrased as a given nucleic acid or amino acid sequence, A that has a certain percent sequence identity to, with, or against a given nucleic acid or amino acid sequence, B) is calculated as follows:
  • operatively linked in the context of a polynucleotide fragment is intended to mean that the two polynucleotide fragments are joined such that the amino acid sequences encoded by the two polynucleotide fragments remain in-frame.
  • the term "pharmacokinetic” refers to any one or more properties of a molecule or compound as it relates to the determination of the fate of substances administered to a living organism. Pharmacokinetics is divided into several areas including the extent and rate of absorption, distribution, metabolism and excretion. This is commonly referred to as ADME where: (A) Absorption is the process of a substance entering the blood circulation; (D) Distribution is the dispersion or dissemination of substances throughout the fluids and tissues of the body; (M) Metabolism (or Biotransformation) is the irreversible transformation of parent compounds into daughter metabolites; and (E) Excretion (or Elimination) refers to the elimination of the substances from the body. In rare cases, some drugs irreversibly accumulate in body tissue.
  • regulatory sequence includes promoters, enhancers, and other expression control elements (e.g., polyadenylation signals) that control the transcription or translation, e.g., of open reading frames described herein.
  • expression control elements e.g., polyadenylation signals
  • Such regulatory sequences are described, for example, in Goeddel, Gene Expression Technology: Methods in Enzymology 185 (Academic Press, San Diego, CA, 1990); incorporated herein by reference.
  • signal sequence As used herein, the phrases “signal sequence,” “signal peptide,” and “transit peptide” are used interchangeably and refer to a sequence that can direct the transport or localization of a protein to a certain organelle, cell compartment, or extracellular export.
  • the term encompasses both the signal sequence polypeptide and the nucleic acid sequence encoding the signal sequence.
  • references to a signal sequence in the context of a nucleic acid refer in fact to the nucleic acid sequence encoding the signal sequence polypeptide.
  • similarity refers to the overall relatedness between polymeric molecules, e.g. between polynucleotide molecules (e.g. DNA molecules and/or RNA molecules) and/or between polypeptide molecules. Calculation of percent similarity of polymeric molecules to one another can be performed in the same manner as a calculation of percent identity, except that calculation of percent similarity takes into account conservative substitutions as is understood in the art.
  • the phrase “specifically binds” refers to a binding reaction which is determinative of the presence of an antigen in a heterogeneous population of proteins and other biological molecules that is recognized, e.g., by a protein or nucleic acid with particularity.
  • a protein or nucleic acid that specifically binds to an antigen will bind to the antigen with a KD of less than 100 nM.
  • a protein or nucleic acid that specifically binds to an antigen will bind to the antigen with a KD of up to 100 nM (e.g., between 1 pM and 100 nM).
  • a protein or nucleic acid that does not exhibit specific binding to a particular antigen or epitope thereof will exhibit a KD of greater than 100 nM (e.g., greater than 500 nm, 1 pM, 100 pM, 500 pM, or 1 mM) for that particular antigen or epitope thereof.
  • a variety of immunoassay formats may be used to select antibodies specifically immunoreactive with a particular protein or carbohydrate.
  • solid-phase ELISA immunoassays are routinely used to select antibodies specifically immunoreactive with a protein or carbohydrate.
  • the terms “subject” and “patient” refer to an organism that receives treatment for a particular disease or condition.
  • subjects and patients include mammals, such as humans, primates, pigs, goats, rabbits, hamsters, cats, dogs, guinea pigs, members of the bovidae family (such as cattle, bison, buffalo, and yaks, among others), sheep, and horses, among others.
  • a patient that may be treated using the compositions and methods described herein may have an established disease, in which case the patient has been diagnosed as having the disease and has shown symptoms of the disease for a prolonged period of time (e.g., over the course of days, weeks, months, or years).
  • a patient may be symptomatic for a particular disease, but has yet to be diagnosed with the disease by a physician.
  • Other patients that may be treated using the compositions and methods described herein include those that have been diagnosed as having a particular disease, and may or may not be showing symptoms of the disease as of yet.
  • a patient eligible for treatment with the compositions and methods described herein may be described as diagnosed but asymptomatic if the patient has received a diagnosis of a disease, even though the patient may not yet be showing symptoms thereof.
  • transfection refers to the introduction of a polynucleotide (e.g., exogenous nucleic acids) into a cell wherein a polypeptide encoded by the polynucleotide is expressed (e.g., mRNA) or the polypeptide modulates a cellular function (e.g., siRNA, miRNA).
  • expression of a nucleic acid sequence refers to translation of a polynucleotide (e.g., an mRNA) into a polypeptide or protein and/or post-translational modification of a polypeptide or protein. Methods of transfection include, but are not limited to, chemical methods, physical treatments and cationic lipids or mixtures.
  • the terms “treat” or “treatment” refer to therapeutic treatment, in which the object is to inhibit or slow down (lessen) an undesired physiological change or disorder.
  • Beneficial or desired clinical results of treatment include, without limitation, alleviation of symptoms, diminishment of extent of disease, stabilized (i.e., not worsening) state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable.
  • Those in need of treatment include those already having the condition or disorder, as well as those prone to have the condition or disorder or those in which the condition or disorder is to be inhibited.
  • an effective amount of an agent is that amount sufficient to effect beneficial or desired results, for example, clinical results, and, as such, an "effective amount” depends upon the context in which it is being applied.
  • an effective amount of an agent is, for example, an amount of mRNA expressing sufficient the desired protein to ameliorate, reduce, eliminate, or prevent the symptoms associated with the corresponding protein deficiency, as compared to the severity of the symptom observed without administration of the agent.
  • the term "effective amount” can be used interchangeably with “effective dose,” “therapeutically effective amount,” or “therapeutically effective dose.”
  • methods of administration can include intravenous, intramuscular, intradermal, subcutaneous, or other methods of delivering a composition to a subject.
  • a method of administration can be selected to target delivery (e.g., to specifically deliver) to a specific region or system of a body.
  • IRES internal ribosome entry site
  • a component of the ribosome e.g., 25S, 28S, 18S, 5.8S, or 5S rRNA
  • elF4G e.g., elF3
  • IRES elements of the disclosure may be used in conjunction with either a 5’ cap-containing nucleic acid (e.g., a 5’-cap containing mRNA molecule) or a nucleic acid that lacks a 5’ cap (e.g., a circular RNA molecule).
  • Exemplary IRES elements of the disclosure include polypyrimidine tracts, such as one or a plurality of polynucleotide tracts in which at least 70% of the nucleosides therein are pyrimidine-containing nucleosides, such as a uridine, a modified uridine, a cytidine, or a modified cytidine (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the nucleosides in each of the polynucleotide tracts may be a uridine, a modified uridine, a cytidine, or a modified cytidine).
  • phrases "pharmaceutically acceptable” is employed herein to refer to those compounds, materials, compositions, and/or dosage forms that are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
  • phrases "pharmaceutically acceptable excipient,” as used herein, refers any ingredient other than the compounds described herein (for example, a vehicle capable of suspending or dissolving the active compound) and having the properties of being substantially nontoxic and non-inflammatory in a patient.
  • Excipients can include, for example: antiadherents, antioxidants, binders, coatings, compression aids, disintegrants, dyes (colors), emollients, emulsifiers, fillers (diluents), film formers or coatings, flavors, fragrances, glidants (flow enhancers), lubricants, preservatives, printing inks, sorbents, suspension or dispersing agents, sweeteners, and waters of hydration.
  • excipients include, but are not limited to: butylated hydroxytoluene (BHT), calcium carbonate, calcium phosphate (dibasic), calcium stearate, croscarmellose, crosslinked polyvinyl pyrrolidone, citric acid, crospovidone, cysteine, ethylcellulose, gelatin, hydroxypropyl cellulose, hydroxypropyl methylcellulose, lactose, magnesium stearate, maltitol, mannitol, methionine, methylcellulose, methyl paraben, microcrystalline cellulose, polyethylene glycol, polyvinyl pyrrolidone, povidone, pregelatinized starch, propyl paraben, retinyl palmitate, shellac, silicon dioxide, sodium carboxymethyl cellulose, sodium citrate, sodium starch glycolate, sorbitol, starch (corn), stearic acid, sucrose, talc, titanium dioxide, vitamin A, vitamin E, vitamin C,
  • compositions described herein also includes pharmaceutically acceptable salts of the compounds described herein.
  • pharmaceutically acceptable salts refers to derivatives of the disclosed compounds wherein the parent compound is modified by converting an existing acid or base moiety to its salt form (e.g., by reacting the free base group with a suitable organic acid).
  • pharmaceutically acceptable salts include, but are not limited to, mineral or organic acid salts of basic residues such as amines; alkali or organic salts of acidic residues such as carboxylic acids; and the like.
  • Representative acid addition salts include acetate, acetic acid, adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzene sulfonic acid, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, fumarate, glucoheptonate, glycerophosphate, hemisulfate, heptonate, hexanoate, hydrobromide, hydrochloride, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate
  • alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like, as well as nontoxic ammonium, quaternary ammonium, and amine cations, including, but not limited to ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, ethylamine, and the like.
  • the pharmaceutically acceptable salts of the present disclosure include the conventional non-toxic salts of the parent compound formed, for example, from non-toxic inorganic or organic acids.
  • the pharmaceutically acceptable salts of the present disclosure can be synthesized from the parent compound that contains a basic or acidic moiety by conventional chemical methods.
  • such salts can be prepared by reacting the free acid or base forms of these compounds with a stoichiometric amount of the appropriate base or acid in water or in an organic solvent, or in a mixture of the two; generally, nonaqueous media like ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are used.
  • nonaqueous media like ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are used.
  • Lists of suitable salts are found in Flemington's Pharmaceutical Sciences, 17 th ed., Mack Publishing Company, Easton, Pa., 1985, p. 1418, Pharmaceutical Salts: Properties, Selection, and Use, P.H. Stahl and C.G. Wermuth (eds.), Wiley-VCH, 2008, and Berge et al., Journal of Pharmaceutical Science, 66, 1 -19 (1977), each of which is incorporated herein by reference in its entirety.
  • solvate means a compound of the present disclosure wherein molecules of a suitable solvent are incorporated in the crystal lattice.
  • a suitable solvent is physiologically tolerable at the dosage administered.
  • solvates can be prepared by crystallization, recrystallization, or precipitation from a solution that includes organic solvents, water, or a mixture thereof.
  • solvents examples include ethanol, water (for example, mono-, di-, and tri-hydrates), A/-methylpyrrolidinone (NMP), dimethyl sulfoxide (DMSO), A/,A/'-dimethylformamide (DMF), A/,A/'-dimethylacetamide (DMAC), 1 ,3-dimethyl-2-imidazolidinone (DMEU), 1 ,3-dimethyl-3, 4,5,6- tetrahydro-2-(1 H)-pyrimidinone (DMPU), acetonitrile (ACN), propylene glycol, ethyl acetate, benzyl alcohol, 2-pyrrolidone, benzyl benzoate, and the like.
  • water for example, mono-, di-, and tri-hydrates
  • NMP dimethyl sulfoxide
  • DMF dimethyl sulfoxide
  • DMAC A/,A/'-dimethylacetamide
  • DMEU 1,3-dimethyl
  • alkyl As used herein, the term “alkyl”, “alkyl group”, or “alkylene” means a linear or branched, saturated hydrocarbon including one or more carbon atoms (e.g., one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, or more carbon atoms), which is optionally substituted.
  • C 1-14 alkyl means an optionally substituted linear or branched, saturated hydrocarbon including 1 -14 carbon atoms. Unless otherwise specified, an alkyl group described herein refers to both unsubstituted and substituted alkyl groups.
  • alkenyl means a linear or branched hydrocarbon including two or more carbon atoms (e.g., two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, or more carbon atoms) and at least one double bond, which is optionally substituted.
  • C 2-14 alkenyl means an optionally substituted linear or branched hydrocarbon including 2-14 carbon atoms and at least one carbon-carbon double bond.
  • An alkenyl group may include one, two, three, four, or more carbon-carbon double bonds.
  • C 18 alkenyl may include one or more double bonds.
  • a C 18 alkenyl group including two double bonds may be a linoleyl group.
  • an alkenyl group described herein refers to both unsubstituted and substituted alkenyl groups.
  • alkynyl means a linear or branched hydrocarbon including two or more carbon atoms (e.g., two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, or more carbon atoms) and at least one carbon-carbon triple bond, which is optionally substituted.
  • C 2-14 alkynyl means an optionally substituted linear or branched hydrocarbon including 2-14 carbon atoms and at least one carbon-carbon triple bond.
  • An alkynyl group may include one, two, three, four, or more carbon-carbon triple bonds.
  • C 18 alkynyl may include one or more carbon-carbon triple bonds.
  • an alkynyl group described herein refers to both unsubstituted and substituted alkynyl groups.
  • Carbocycle or “carbocyclic group” means an optionally substituted mono- or multi-cyclic system including one or more rings of carbon atoms. Rings may be three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, or twenty membered rings.
  • the notation "C 3-6 carbocycle” means a carbocycle including a single ring having 3-6 carbon atoms. Carbocycles may include one or more carbon-carbon double or triple bonds and may be non-aromatic or aromatic (e.g., cycloalkyl or aryl groups).
  • carbocycles include cyclopropyl, cyclopentyl, cyclohexyl, phenyl, naphthyl, and 1 ,2 dihydronaphthyl groups.
  • cycloalkyl as used herein means a non-aromatic carbocycle and may or may not include any double or triple bond.
  • carbocycles described herein refers to both unsubstituted and substituted carbocycle groups, i.e., optionally substituted carbocycles.
  • heterocycle or “heterocyclic group” means an optionally substituted mono- or multi-cyclic system including one or more rings, where at least one ring includes at least one heteroatom.
  • Heteroatoms may be, for example, nitrogen, oxygen, or sulfur atoms. Rings may be three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, or fourteen membered rings.
  • Heterocycles may include one or more double or triple bonds and may be non-aromatic or aromatic (e.g., heterocycloalkyl or heteroaryl groups).
  • heterocycles include imidazolyl, imidazolidinyl, oxazolyl, oxazolidinyl, thiazolyl, thiazolidinyl, pyrazolidinyl, pyrazolyl, isoxazolidinyl, isoxazolyl, isothiazolidinyl, isothiazolyl, morpholinyl, pyrrolyl, pyrrolidinyl, furyl, tetrahydrofuryl, thiophenyl, pyridinyl, piperidinyl, quinolyl, and isoquinolyl groups.
  • heterocycloalkyl as used herein means a nonaromatic heterocycle and may or may not include any double or triple bond. Unless otherwise specified, heterocycles described herein refers to both unsubstituted and substituted heterocycle groups, i.e., optionally substituted heterocycles.
  • heteroalkyl refers respectively to an alkyl, alkenyl, alkynyl group, as defined herein, which further comprises one or more (e.g., 1 , 2, 3, or 4) heteroatoms (e.g., oxygen, sulfur, nitrogen, boron, silicon, phosphorus) wherein the one or more heteroatoms is inserted between adjacent carbon atoms within the parent carbon chain and/or one or more heteroatoms is inserted between a carbon atom and the parent molecule, i.e., between the point of attachment.
  • heteroatoms e.g., oxygen, sulfur, nitrogen, boron, silicon, phosphorus
  • heteroalkyls, heteroalkenyls, or heteroalkynyls described herein refers to both unsubstituted and substituted heteroalkyls, heteroalkenyls, or heteroalkynyls, i.e., optionally substituted heteroalkyls, heteroalkenyls, or heteroalkynyls.
  • a "biodegradable group” is a group that may facilitate faster metabolism of a lipid in a mammalian entity.
  • a biodegradable group may be selected from the group consisting of, but is not limited to, -C(O)O-, -OC(O)-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, - P(O)(OR')O-, -S(O)2-, an aryl group, and a heteroaryl group.
  • an "aryl group” is an optionally substituted carbocyclic group including one or more aromatic rings.
  • aryl groups include phenyl and naphthyl groups.
  • a "heteroaryl group” is an optionally substituted heterocyclic group including one or more aromatic rings.
  • heteroaryl groups include pyrrolyl, furyl, thiophenyl, imidazolyl, oxazolyl, and thiazolyl. Both aryl and heteroaryl groups may be optionally substituted.
  • M and M' can be selected from the non-limiting group consisting of optionally substituted phenyl, oxazole, and thiazole.
  • M and M' can be independently selected from the list of biodegradable groups above.
  • aryl or heteroaryl groups described herein refers to both unsubstituted and substituted groups, i.e., optionally substituted aryl or heteroaryl groups.
  • Alkyl, alkenyl, and cyclyl (e.g., carbocyclyl and heterocyclyl) groups may be optionally substituted unless otherwise specified.
  • R is an alkyl or alkenyl group, as defined herein.
  • the substituent groups themselves may be further substituted with, for example, one, two, three, four, five, or six substituents as defined herein.
  • a C 1-6 alkyl group may be further substituted with one, two, three, four, five, or six substituents as described herein.
  • N-oxides can be converted to N-oxides by treatment with an oxidizing agent (e.g., 3-chloroperoxybenzoic acid (mCPBA) and/or hydrogen peroxides) to afford other compounds of the disclosure.
  • an oxidizing agent e.g., 3-chloroperoxybenzoic acid (mCPBA) and/or hydrogen peroxides
  • mCPBA 3-chloroperoxybenzoic acid
  • hydrogen peroxides e.g., 3-chloroperoxybenzoic acid (mCPBA) and/or hydrogen peroxides
  • nitrogen-containing compounds are also considered, when allowed by valency and structure, to cover both the compound as shown and its N-hydroxy (i.e., N- OH) and N-alkoxy (i.e., N-OR, wherein R is substituted or unsubstituted C 1 -C 6 alkyl, C 1 -C 6 alkenyl, C 1 -C 6 alkynyl, 3-14-membered carbocycle or 3-14-membered heterocycle) derivatives.
  • N-hydroxy i.e., N- OH
  • N-alkoxy i.e., N-OR, wherein R is substituted or unsubstituted C 1 -C 6 alkyl, C 1 -C 6 alkenyl, C 1 -C 6 alkynyl, 3-14-membered carbocycle or 3-14-membered heterocycle
  • FIG. 1 A is a schematic illustrating that linear RNA molecules are prone to degradation at the 5’ and/or 3’ ends by way of exonucleases (top). These types of linear RNA molecules often contain a 5’ cap (bottom) in order to promote ribosome recruitment and, ultimately, translation of an open reading frame.
  • FIG. 1B is a schematic showing ways in which RNAs may mitigate or avoid exonuclease degradation.
  • a linear RNA molecule may be bound to a chemical moiety at the 5’ and/or 3’ ends that blocks the access of exonucleases to the RNA molecule.
  • the RNA may be circularized, such that there are no 5’ or 3’ ends available for binding to (and cleavage by) an exonuclease).
  • One aspect that has hindered the development of these types of molecules is the absence of a 5’ cap, which would typically be attached to the free 5’ end of a linear RNA molecule in order to promote ribosome binding and open reading frame translation.
  • the present disclosure addresses this problem by providing internal ribosome entry (IRES) elements that recruit ribosomes in a cap-independent manner (bottom), allowing for RNAs to simultaneously recruit ribosomes and be modified in ways that remove/modify the cap so as to avoid nucleolytic degradation (e.g., by way of 5’ and/or 3’ blocking moieties or by way of RNA circularization).
  • IRS internal ribosome entry
  • FIG. 2 is a graph comparing the expression of green fluorescent protein (GFP) from three different, linear RNA constructs in HEK293 cells over the course of 60 hours.
  • GFP green fluorescent protein
  • Each linear RNA contained an open reading frame encoding GFP, and each RNA lacked a 5’ cap structure.
  • the RNA molecules differed in the type of IRES element tested within the 5’ untranslated region (UTR).
  • One construct contained a known coxsackievirus B3 (CVB3) IRES sequence in its 5’ UTR (“GO lin, 5’ CVB3,” top of graph); another construct contained three polynucleotide tracts each containing 9 contiguous unmodified uridine residues, each tract separated from one another by two 13-nucleoside spacers (“GO lin, 5’ v1 .1 ,” lower line of graph); and another construct three polynucleotide tracts each containing 9 contiguous 1 - methylpseudouridine residues, each tract separated from one another by two 13-nucleoside spacers (“G5 lin , 5’ 3xU9,” middle of graph).
  • CVB3 coxsackievirus B3
  • FIG. 2 also includes a table comparing the GFP expression level achieved by the “G5 lin, 5’3xU9” construct as compared to the “G0 lin, 5’ CVB3” construct and a construct having the same composition as “G5 lin, 5’3xU9,” but also containing the known 5’ Cap1 structure.
  • FIGS. 3A - 3D are graphs comparing the expression of GFP from three different, linear RNA constructs in various cell types (HeLa (FIG. 3A), HEK293 (FIG. 3B), THP1 (FIG. 3C), and Hep3B (FIG. 3D)).
  • Each construct contained an open reading frame encoding GFP, but the constructs differed in the IRES element tested within the 5’ UTR and in the presence/absence of a 5’ cap.
  • FIG. 3 also includes a table comparing the GFP expression level achieved by the “3xU9_1 (G5)” and “CVB3 (GO)” construct as compared to the “Cap1 -A100” construct.
  • FIG. 4A is a schematic showing an experimental design for the evaluation of erythropoietin (EPO) expression in BALB/c mice injected intravenously with SM86/DMG nanoparticles containing one of five different EPO-encoding RNA constructs: (i) a linear RNA construct containing an EPO-encoding open reading frame and a 5’ Cap1 structure (“Cap1 -A100,” also referred to as “GO Cap1 ”); (ii) a linear RNA construct containing an EPO-encoding open reading frame, a 5’ UTR containing the CVB3 IRES, and a 5’ triphosphate structure (“lin GO CVB3, 5’ PPP”); (iii) a linear RNA construct containing an EPO-encoding open reading frame, a 5’ UTR containing the CVB3 IRES, and a 5’ biotin-triazole structure (“lin GO CVB3, 5’ bA”); (iv) a linear RNA construct containing
  • FIG. 4B is a graph comparing the serum EPO concentrations achieved by each construct.
  • FIG. 5 is a graph comparing the secretion of IFN-y-inducible protein 10 (IP10) - an immune response marker - in BALB/c mice injected intravenously with one of five different EPO-encoding RNA constructs in the same experiment as Fig. 4, 6 hours after injection.
  • a vehicle-only arm (“buffer”) was included as a negative control. Mice were injected with the SM86-DMG nanoparticles intravenously and were subsequently assessed for serum IP10 concentrations.
  • FIG. 6A is a graph comparing the expression of luciferase in HeLa cells transfected in the presence of lipofectamine 2000 (L2K) with one of three different luciferase-encoding RNA constructs.
  • the constructs tested were: (i) a linear RNA construct containing a luciferase-encoding open reading frame, a 5’ UTR containing an IRES having three polynucleotide tracts each containing 9 contiguous 1 - methylpseudouridine residues, each tract separated from one another by two 13-nucleoside spacers, and a 5’ triphosphate structure (“G5 lin 5’ PPP_3xU9”); and (ii) a linear RNA construct containing a luciferaseencoding open reading frame, a 5’ UTR containing an IRES having six polynucleotide tracts each containing 9 contiguous 1 -methylpseudouridine residues, the tract
  • FIG. 6B is table comparing the luciferase expression of the constructs tested in FIG. 6A in two different cell types: HeLa cells and Hep3B cells.
  • FIG. 7A is a graph comparing the expression of luciferase in HeLa cells that were transfected, in accordance with the methodology described in FIG. 6A, with a circular RNA molecule containing a luciferase-encoding open reading frame.
  • each RNA molecule each instance of uridine was replaced with 1 -methylpseudouridine.
  • the RNA molecule was tethered to one of three proteins by way of MS2 tethering sites within the RNA: (i) LACZ (“t-LACZ”), (ii) eukaryotic translation initiation factor 4 G (“t-elF4G”), or (iii) La protein (“t-La”). Tethering was facilitated by fusing MBP-encoding polypeptide to LACZ(t-Lacz), 4 G (“t-elF4G”), or (iii) La protein (“t-La”).
  • FIG. 7B is a graph comparing luciferase expression achieved by linearized versions of the constructs tested in FIG. 7A; in FIG. 7B, each construct contained a 5’ triphosphate structure and a 3’ poly(A) tail in lieu of circularization.
  • the data shown in FIGS. 7A and 7B represent the first instance of successful translation of an RNA without a cap, particularly one in which all uridine nucleosides have been replaced with 1 -methylpseudouridine nucleosides.
  • IRES elements of the disclosure are capable of effectuating ribosomal recruitment - and successful protein translation - in a manner that is independent of the presence or absence of a 5’ cap.
  • IRES elements of the disclosure can effectuate ribosomal recruitment and successful protein translation in a manner that is not dependent upon the presence or absence of a chemical modification of one of the nucleosides of the nucleic acid molecule, particularly because the interaction that mediates the recruitment of the ribosome (i.e. , the interaction between the MS2 tethering site and the MS2-binding protein) is not affected by the presence or absence of a nucleoside modification (in this instance, 1 -methylpseudouridrine).
  • FIG. 8A is a graph comparing the expression of mGreenLantern protein in HeLa cells that were transfected with mGreenLantern-encoding RNA constructs in the presence of L2K.
  • Three different RNA constructs were tested: (i) a linear RNA construct containing an mGreenLantern-encoding open reading frame, a 5’ UTR containing an IRES having six polynucleotide tracts each containing 9 contiguous 1 - methylpseudouridine residues, the tracts separated from one another by spacers of 18-28 nucleosides in length, and a 5’ triphosphate structure (“G5 lin 5’ Cap1_v2.0”); (ii) a linear RNA construct containing an mGreenLantern-encoding open reading frame, a 5’ UTR containing an IRES having the nucleic acid sequence of SEQ ID NO: 1 , and a 5’ triphosphate structure (“GO lin 5’ PPP_1xAp
  • FIG. 8B is a graph comparing the expression of luciferase in HeLa cells that were transfected with luciferase-encoding RNA constructs in the presence of L2K.
  • Five different RNA constructs were tested: (i) a linear RNA construct containing a luciferase-encoding open reading frame, a 5’ UTR containing an IRES having three polynucleotide tracts each containing 9 contiguous 1 - methylpseudouridine residues, and a 5’ Cap1 structure (“G5 lin 5’ Cap1_v1.1 ”); (ii) a linear RNA construct containing a luciferase-encoding open reading frame, a 5’ UTR containing an IRES having three polynucleotide tracts each containing 9 contiguous 1 -methylpseudouridine residues, and a 5’ triphosphate structure (“G5 lin 5’ PPP_3xU9”); (ii
  • FIG. 9A is a graph comparing the expression of luciferase in HeLa cells transfected with one of eight different luciferase-encoding RNA constructs: (i) a linear RNA construct containing a luciferaseencoding open reading frame and a 5’ Cap1 structure (“C1 ”); (ii) a linear RNA construct containing a luciferase-encoding open reading frame, a 5’ UTR containing an IRES having three polynucleotide tracts each containing 9 contiguous uridine residues, and a 5’-triphosphate structure (“v1 .1 ”); (iii) a linear RNA construct containing a luciferase-encoding open reading frame, a 5’ UTR containing an IRES having six polynucleotide tracts each containing 9 contiguous 1 -methylpseudouridine residues, and a 5’-triphosphate structure (“v2.0 (G5)”); (
  • FIG. 9B provides a table reporting the luciferase expression achieved by certain of the constructs shown in FIG. 9A as a percentage of the luciferase expression achieved by the “Cap1 ” construct.
  • FIG. 10A is a graph comparing the expression of fluorescent protein in HeLa cells transfected with one of two different fluorescent-protein-encoding RNA constructs.
  • the constructs tested were: (i) a linear RNA construct containing a 5’ cap structure, a 5’ UTR containing an IRES having the nucleic acid sequence of GGGAAAUAAGAGAGAAAAGAAGAGuAAGAAGAAAUAUAAGACCCCGGCGCCGCCACC (SEQ ID NO: 3, “UTR1 ”), and a GFP-encoding open reading frame fused to a degron domain and; and (ii) an RNA construct containing a 5’ cap structure, a 5’ UTR containing an IRES having the nucleic acid sequence of GGGAAAUUUUUUUGAUAUUAUAAGAGUUUUUUUUGAUAUUAAGAAAAUUUUUUUUGAUAUU AGAAGAGUAAGAAGAAAUAUAAGACCCCGGCGCCGCCACC (SEQ ID NO: 4,
  • FIG. 10B is a graph demonstrating the results of an experiment conducted as outlined in FIG. 10A, but in HEK293 cells in lieu of HeLa cells.
  • FIG. 10C provides a set of graphs comparing the expression of luciferase in BALB/c mice transfected with one of two different luciferase-encoding RNA constructs: (i) a linear RNA construct containing a 5’ cap structure, a 5’ UTR containing an IRES having the nucleic acid sequence of “UTR1 ” (as in FIGS. 10A and 10B), and a luciferase-encoding open reading frame; and (ii) a linear RNA construct containing a 5’ cap structure, a 5’ UTR containing an IRES having the nucleic acid sequence of “UTR 2 ” (as in FIGS. 10A and 10B), and a luciferase-encoding open reading frame.
  • a negative control (“PBS”) was included for comparison purposes.
  • FIG. 10D provides a set of graphs comparing the expression of erythropoietin in BALB/c mice transfected with one of two different erythropoietin-encoding RNA constructs: (i) a linear RNA construct containing a 5’ cap structure, a 5’ UTR containing an IRES having the nucleic acid sequence of “UTR1 ” (as in FIGS. 10A and 10B), and an erythropoietin-encoding open reading frame; and (ii) a linear RNA construct containing a 5’ cap structure, a 5’ UTR containing an IRES having the nucleic acid sequence of “UTR 2 ” (as in FIGS. 10A and 10B), and an erythropoietin-encoding open reading frame.
  • a negative control (“PBS”) was included for comparison purposes.
  • FIG. 11 A is a graph comparing the expression of luciferase in Hep3b cells transfected in the presence of L2K with luciferase-encoding RNA constructs containing the indicated elements (e.g., see the x-axis).
  • the sequence of these elements is provided in Table 14 (e.g., see Example 7).
  • the three bars for each element represents, from left to right, luciferase expression measured at 2 hour, 5 hours, and 24 hours post-transfection.
  • Luminescence expression data shows that 5’ hulRES9 (e.g., SEQ ID NO: 173) has the highest luciferase expression. This is an improvement over 5’ 3xU9 (SEQ ID NO: 202).
  • FIG. 11 B is a graph comparing the expression of luciferase in HeLa cells transfected in the presence of L2K with luciferase-encoding RNA constructs containing the indicated elements.
  • the sequence of these elements is provided in Table 14 (e.g., see Example 7).
  • the three bars for each element represents, from left to right, luciferase expression measured at 2 hour, 5 hours, and 24 hours post-transfection.
  • Luminescence expression data shows that 5’ 6xU9 (SEQ ID NO: 203) has the highest luciferase expression and 5’ hulRES9 (e.g., SEQ ID NO: 173) has the next highest luciferase expression. This is an improvement over 5’ 3xU9 (SEQ ID NO: 202).
  • FIG. 12 is a graph comparing the expression of GFP in HeLa cells transfected in the presence of L2K with GFP-encoding RNA constructs containing the indicated elements; in this case, the GFP is fused to a degron domain.
  • the sequence of these elements is provided in Table 15 (e.g., see Example 7).
  • the green integrated density of the inlet graph shows that 5’ Shape 1 (SEQ ID NO: 174) and 5’ Shape 3 (SEQ ID NO: 176) show the highest expression, well above 5’ 6xU9 (SEQ ID NO: 203). Further, 5’ Shape 2 (SEQ ID NO: 175) outperforms 5’ Shape 4 (SEQ ID NO: 177) and 5’ 6xU9.
  • FIG. 13 is a graph comparing the expression of GFP in HeLa cells transfected in the presence of L2K with GFP-encoding RNA constructs containing the indicated elements; in this case, the GFP is fused to a degron domain.
  • the sequence of these elements is provided in Table 15 (e.g., see Example 7).
  • the green integrated density of the inlet graph shows that 5’ Shape 2 (SEQ ID NO: 175) outperforms 5’ Shape 4 (SEQ ID NO: 177) and 5’ 6xU9 (SEQ ID NO: 203).
  • FIG. 14 is a graph comparing the expression of GFP in HeLa cells transfected in the presence of L2K with GFP-encoding RNA constructs containing the indicated elements; in this case, the GFP is fused to a degron domain.
  • the sequence of these elements is provided in Table 15 (e.g., see Example 7).
  • the green integrated density of the inlet graph shows that 5’ Shape 5 (SEQ ID NO: 178) and 5’ Shape 8 (SEQ ID NO: 180) perform similarly to 5’ 3xU9 (SEQ ID NO: 202).
  • FIG. 15 is a graph comparing the expression of GFP in HeLa cells transfected in the presence of L2K with GFP-encoding RNA constructs containing the indicated elements; in this case, the GFP is fused to a degron domain.
  • the sequence of these elements is provided in Table 15 (e.g., see Example 7).
  • the green integrated density reveals that 5’ Shape 1 (SEQ ID NO: 174), 5’ Shape 2 (SEQ ID NO: 175), 5’ Shape 3 (SEQ ID NO: 176), and 5’ Shape 4 (SEQ ID NO: 177) outperform 5’ 6xU9 (SEQ ID NO: 203) and 5’ 3xU9 (SEQ ID NO: 202), which outperform 5’ Shape 7 (SEQ ID NO: 179) and 5’ Shape 8 (SEQ ID NO: 180).
  • 5’ Shape 9 (SEQ ID NO: 181 ) performs similar to baseline and uncapped control.
  • FIG. 16 is a graph comparing the expression of GFP in HeLa cells transfected in the presence of L2K with GFP-encoding RNA constructs containing the indicated elements; in this case, the GFP is fused to a degron domain.
  • the sequence of these elements is provided in Table 15 (e.g., see Example 7).
  • the green integrated density of the two inlet graphs shows that 5’ Shape 5 (SEQ ID NO: 178) and 5’ Shape 8 (SEQ ID NO: 180) have similar performance, while 5’ Shape 9 (SEQ ID NO: 181 ) and 5’ Shape 7 (SEQ ID NO: 179) are expressing closer to baseline.
  • FIG. 17 is a graph comparing the expression of GFP in HeLa cells transfected in the presence of L2K with GFP-encoding RNA constructs containing the indicated elements; in this case, the GFP is fused to a degron domain.
  • the sequence of these elements is provided in Table 18 (e.g., see Example 7).
  • the green integrated density of the two inlet graphs shows that 5’ Apt17+5xU9 (SEQ ID NO: 183 or SEQ ID NO: 184) constructs and 5’ 5xU9+CCND1 (SEQ ID NO: 182) constructs have an increased Cmax, suggesting that combining different IRES elements disclosed herein can increase gene expression.
  • FIG. 18 is a graph comparing the expression of GFP in HeLa cells transfected in the presence of L2K with GFP-encoding RNA constructs containing the indicated elements; in this case, the GFP is fused to a degron domain.
  • the sequence of these elements is provided in Table 18 (e.g., see Example 7).
  • the green integrated density data shows that 5’ 1XApt17 substantially outperforms 5’ 1xAUAU4 (SEQ ID NO: 194) and 5’ 1xPDCD4 (SEQ ID NO: 198), with the later having similar temporal expression and Cmax values.
  • FIG. 19 is a graph comparing the expression of GFP in HeLa cells transfected in the presence of L2K with GFP-encoding RNA constructs containing the indicated elements; in this case, the GFP is fused to a degron domain.
  • the sequence of these elements is provided in Table 18 (e.g., see Example 7).
  • the green integrated density data shows that constructs with 5’ Apt17+5xU9 (SEQ ID NO: 183 or SEQ ID NO: 184) and constructs with 5’ 5xU9+CCND1 (SEQ ID NO: 182) have similar expression to constructs with 5’ 6xU9 (SEQ ID NO: 203). This data suggests that combining different IRES elements disclosed herein can increase gene expression.
  • FIG. 20 is a graph comparing the expression of GFP in HeLa cells transfected in the presence of L2K with GFP-encoding RNA constructs containing the indicated elements; in this case, the GFP is fused to a degron domain.
  • the sequence of these elements is provided in Table 18 (e.g., see Example 7).
  • the green integrated density data shows that constructs with elements 5’ 6xPDCD4 (SEQ ID NO: 198) have appreciable expression. Also, constructs with element 5’ 1xApt17 (SEQ ID NO: 193) show expression above background.
  • FIG. 21 A is a bar graph comparing the expression of luciferase in THP-1 cells transfected in the presence of L2K with luciferase-encoding RNA constructs containing the indicated elements.
  • the sequence of these elements is provided in Table 18 (e.g., see Example 7).
  • Luminescence expression data shows that 5’ 6xU9_v3 (SEQ ID NO: 189), 5’ 6xU9_v4 (SEQ ID NO: 205), and 5’ 6xU9_v5 (SEQ ID NO: 205) have the highest luciferase expression.
  • FIG. 21 B is the same bar graph as in FIG. 21 A, but without the capped control and the uncapped control (to better show the Y axis values).
  • FIG. 22A is a bar graph comparing the expression of luciferase in Hep3b cells transfected in the presence of L2K with luciferase-encoding RNA constructs containing the indicated elements.
  • the sequence of these elements is provided in Table 18 (e.g., see Example 7).
  • the two bars for each element represents, from left to right, luciferase expression measured at 4 and 24 hours post-transfection.
  • Luminescence expression data shows that 5’ 6xU9_v3 (SEQ ID NO: 189), 5’ 6xU9_v4 (SEQ ID NO: 204), and 5’ 6xU9_v5 (SEQ ID NO: 205) have the highest luciferase expression.
  • FIG. 22B is the same bar graph as in FIG. 22A, but without the capped control and the uncapped control (to better show the Y axis values).
  • FIG. 23A is a bar graph comparing the expression of luciferase in HeLa cells transfected in the presence of L2K with luciferase-encoding RNA constructs containing the indicated elements.
  • the sequence of these elements is provided in Table 18 (e.g., see Example 7).
  • the two bars for each element represents, from left to right, luciferase expression measured at 4 and 24 hours post-transfection.
  • Luminescence expression data shows that 5’ 6xU9_v3 (SEQ ID NO: 189), 5’ 6xU9_v4 (SEQ ID NO: 204), 5’ 6xU9_v5 (SEQ ID NO: 205), and 5’ 6xU9_v1 (SEQ ID NO: 187) have the highest luciferase expression.
  • FIG. 23B is the same bar graph as in FIG. 23A, but without the capped control and the uncapped control (to better show the Y axis values).
  • nucleic acid molecules e.g., RNA molecules, such as linear or circular RNA molecules
  • Nucleic acid molecules often use 5’ cap structures as a means for promoting ribosomal binding and, ultimately, open reading frame translation.
  • the presence of a 5’ cap that is susceptible to decapping and subsequent degradation of the RNA may preclude the possibility of instead having chemical modifications that extend the molecule’s half-life.
  • the present disclosure addresses this problem by providing means for nucleic acid molecules to recruit and bind ribosome without the need for a 5’ cap structure, thus providing the advantage of simultaneously allowing the nucleic acid molecules to be translatable and to be modified in ways that mitigate nucleolytic degradation.
  • nucleic acid modifications that reduce or avoid nucleolytic degradation, but that also preclude the inclusion of a 5’ cap, include (i) the presence of 5’ chemical moieties that restrict the access of an exonuclease to the nucleic acid molecule, as well as (ii) circularization of a nucleic acid molecule, which removes 5’ and 3’ ends altogether. Both of these types of modifications provide the benefit of reducing or eliminating exonucleolytic cleavage by way of either chemically protecting, or removing, the 5’ and 3’ ends to which an exonuclease would bind. However, because these types of modifications alter or eliminate the 5’ end, they preclude the inclusion of a 5’ cap.
  • the present disclosure features internal ribosome entry sites (IRESs) that can be incorporated into nucleic acids and that promote ribosome recruitment and protein translation in the absence of a 5’ cap.
  • the present IRES elements are also compatible with chemically modified uridine nucleosides, particularly 1 -methylpseudouridine nucleosides.
  • chemically modified uridine nucleosides particularly 1 -methylpseudouridine nucleosides.
  • modified uridine residues particularly 1 -methylpseudouridine
  • IRES elements that are compatible with 1 - methylpseudoridine are particularly advantageous.
  • the IRES of the disclosure may recruit translation tractor and/or ribosomes to the nucleic acids described herein in order to promote translation.
  • IRES of the disclosure e.g., SEQ ID NOs: 173-205
  • IRES of the disclosure may bind directly to ribosomal subunits (e.g., eukaryotic 60S or 40S subunits) by, e.g., hybridizing directly to ribosomal RNA (rRNA), such as 25S, 28S, 18S, 5.8S, and/or 5S rRNA.
  • ribosomal subunits e.g., eukaryotic 60S or 40S subunits
  • rRNA ribosomal RNA
  • the IRES elements described herein thus provide multiple benefits: not only do the present IRES elements allow the types of half-life-extending nucleic acid modifications that would preclude a 5’ cap group, but they also function with a uridine modification that significantly suppresses immunogenicity of the nucleic acid molecule. Furthermore, by binding to ribosomes or hybridizing directly with ribosomal RNA, IRES’ of the disclosure provide the advantage of fast and efficient protein expression while reducing energy expenditure on the cell.
  • nucleic acids of the disclosure are those that contain:
  • an internal ribosome entry site comprising one or more polynucleotide tracts enriched in uridine or a modified uridine; operably linked to (ii) an open reading frame encoding a polypeptide.
  • the IRES comprises from 1 to 20 of the polynucleotide tracts enriched in uridine or a modified uridine (e.g.. 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 of the polynucleotide tracts enriched in uridine or a modified uridine).
  • the IRES may, for example, comprise from 2 to 10 of the polynucleotide tracts enriched in uridine or a modified uridine.
  • the IRES comprises from 3 to 6 of the polynucleotide tracts enriched in uridine or a modified uridine.
  • At least 70% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine (e.g.. 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the nucleosides in each of the polynucleotide tracts may be uridine or a modified uridine).
  • a modified uridine e.g. 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 9
  • At least 75% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine. In some embodiments, at least 80% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine. In some embodiments, at least 85% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine. In some embodiments, at least 90% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine.
  • At least 95% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine. In some embodiments, all of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine.
  • each polynucleotide tract is from 5 to 20 nucleosides in length (e.g., 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleosides in length). In some embodiments, each polynucleotide tract, independently, is from 5 to 19 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 18 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 17 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 16 nucleosides in length.
  • each polynucleotide tract is from 5 to 15 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 14 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 13 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 12 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 11 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 10 nucleosides in length.
  • each polynucleotide tract is from 6 to 15 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 14 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 13 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 12 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 11 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 10 nucleosides in length.
  • each polynucleotide tract is from 7 to 15 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 7 to 14 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 7 to 13 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 7 to 12 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 7 to 11 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 7 to 10 nucleosides in length. In some embodiments, each polynucleotide tract is 9 nucleosides in length.
  • each polynucleotide tract independently, comprises from 5 to 20 contiguous uridine or modified uridine nucleosides (e.g. 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 uridine or modified uridine nucleosides). In some embodiments, each polynucleotide tract, independently, comprises from 6 to 15 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract, independently, comprises from 6 to 14 contiguous uridine or modified uridine nucleosides.
  • each polynucleotide tract independently, comprises from 6 to 13 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract, independently, comprises from 6 to 12 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract, independently, comprises from 6 to 11 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract, independently, comprises from 6 to 10 contiguous uridine or modified uridine nucleosides.
  • each polynucleotide tract independently, comprises from 7 to 15 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract, independently, comprises from 7 to 14 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract, independently, comprises from 7 to 13 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract, independently, comprises from 7 to 12 contiguous uridine or modified uridine nucleosides.
  • each polynucleotide tract independently, comprises from 7 to 11 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract, independently, comprises from 7 to 10 contiguous uridine or modified uridine nucleosides.
  • each polynucleotide tract comprises at least 9 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract comprises 9 contiguous uridine or modified uridine nucleosides.
  • one or more (or all) of the polynucleotide tracts are enriched in modified uridine.
  • the modified uridine is 1 -methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio- uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbony
  • the IRES is located within a noncoding region of the nucleic acid, such as a 5’ untranslated region (UTR) that is operably linked to the open reading frame.
  • UTR untranslated region
  • the open reading frame is further operably linked to a 3’ UTR.
  • the polynucleotide tracts are separated from one another by way of one or more spacers that each, independently, comprise from 5 to 100 nucleosides (e.g., 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 nucleosides).
  • 5 to 100 nucleosides e.g., 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 nucleosides.
  • each of the spacers independently, comprises from 10 to 40 nucleosides (e.g., 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleosides). In some embodiments, each of the spacers, independently, comprises 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, or 38 nucleosides.
  • the IRES is represented by the formula: [(N)n - (U') m ]p wherein: each N is, independently, any nucleoside residue; each U' is, independently, uridine or a modified uridine; each n is, independently, an integer from 1 to 100 e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14,
  • each m is, independently, an integer from 2 to 15 (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, or
  • p is an integer from 2 to 20 (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, or 20).
  • N is, independently, selected from adenosine, a modified adenosine, uridine, a modified uridine, guanosine, a modified guanosine, cytidine, and a modified cytidine.
  • each N is, independently, selected from adenosine, uridine, a modified uridine, guanosine, and cytidine.
  • the modified uridine of N is 1 -methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio- uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl-uridine, 5- methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thi
  • the modified cytidine of N is 5-aza-cytidine, 6-aza- cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetyl-cytidine, 5-formyl-cytidine, N4-methyl-cytidine, 5- methyl-cytidine, 5-halo-cytidine, 5-hydroxymethyl-cytidine, 1 -methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1 - methyl-pseudoisocytidine, 4-thio- 1 -methyl-1 -deaza-pseudoisocytidine, 1 -methyl-1 -deaza- pseudoiso
  • the modified adenosine of N is 2-amino-purine, 2, 6- diaminopurine, 2-amino-6-halo-purine, 6-halo-purine, 2-amino-6-methyl-purine, 8-azido-adenosine, 7- deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7- deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1 -methyl-adenosine, 2-methyl-adenine, N6- methyl-adenosine, 2-methylthio-N6-methyl-adenosine, N6-isopentenyl-adenosine, 2-methylthio-N6- isopentenyl-adenosine, N6-(cis-
  • the modified guanosine of N is inosine, 1 -methylinosine, wyosine, methylwyosine, 4-demethyl-wyosine, isowyosine, wybutosine, peroxywybutosine, hydroxywybutosine, 7-deaza-guanosine, queuosine, epoxyqueuosine, galactosyl-queuosine, mannosyl- queuosine, 7-cyano-7-deaza-guanosine, 7-aminomethyl-7-deaza-guanosine, archaeosine, 7-deaza-8- aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl- guanosine, 6-thio-7-methyl-guanosine, 7-methyl-inosine, 7-methyl- gua
  • the modified uridine of U’ is 1 -methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio- uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl-uridine, 5- methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-
  • each n is, independently, an integer from 10 to 40. In some embodiments, each n is, independently, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, or 38. In some embodiments, each m is, independently, an integer from 2 to 15. In some embodiments, each m is, independently, an integer from 7 to 1 1 . In some embodiments, each m is 9. In some embodiments, p is an integer from 2 to 10. In some embodiments, p is an integer from 3 to 6, optionally wherein p is 3 or 6.
  • the nucleic acid is RNA. In some embodiments, the nucleic acid is linear. In some embodiments, the nucleic acid is circular. In some embodiments, the open reading from consists of nucleosides selected from adenosine, a modified adenosine, uridine, a modified uridine, guanosine, a modified guanosine, cytidine, and a modified cytidine. In some embodiments, the open reading from consists of nucleosides selected from adenosine, uridine, a modified uridine, guanosine, and cytidine.
  • the modified uridine of the open reading frame is 1 - methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5- aza-uridine, 2-thio-uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5- carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl- uridine, 5-methoxycarbonylmethyl-2-thio-uridine, 5-amino
  • the modified cytidine of N is 5-aza-cytidine, 6-aza- cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetyl-cytidine, 5-formyl-cytidine, N4-methyl-cytidine, 5- methyl-cytidine, 5-halo-cytidine, 5-hydroxymethyl-cytidine, 1 -methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1 - methyl-pseudoisocytidine, 4-thio- 1 -methyl-1 -deaza-pseudoisocytidine, 1 -methyl-1 -deaza- pseudoiso
  • the modified adenosine of N is 2-amino-purine, 2, 6- diaminopurine, 2-amino-6-halo-purine, 6-halo-purine, 2-amino-6-methyl-purine, 8-azido-adenosine, 7- deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7- deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1 -methyl-adenosine, 2-methyl-adenine, N6- methyl-adenosine, 2-methylthio-N6-methyl-adenosine, N6-isopentenyl-adenosine, 2-methylthio-N6- isopentenyl-adenosine, N6-(cis-
  • the modified guanosine of N is inosine, 1 -methylinosine, wyosine, methylwyosine, 4-demethyl-wyosine, isowyosine, wybutosine, peroxywybutosine, hydroxywybutosine, 7-deaza-guanosine, queuosine, epoxyqueuosine, galactosyl-queuosine, mannosyl- queuosine, 7-cyano-7-deaza-guanosine, 7-aminomethyl-7-deaza-guanosine, archaeosine, 7-deaza-8- aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl- guanosine, 6-thio-7-methyl-guanosine, 7-methyl-inosine, 7-methyl- gua
  • the polypeptide encoded by the open reading frame is a secreted protein, a cytokine, a growth factor, an enzyme, an immunomodulator, an antibody or antigen-binding fragment thereof, a cell-penetrating peptide, an extracellular membrane-bound protein, an intracellular membrane-bound protein, a cytoplasmic protein, a cytoskeletal protein, or a nuclear protein.
  • the IRES contains a nucleotide sequence with about 70% to about 100% (e.g., about 70% to about 100%, about 75% to about 100%, about 80% to about 100%, about 85% to about 100%, about 90% to about 100%, about 91 % to about 100%, about 92% to about 100%, about 93% to about 100%, about 94% to about 100%, about 95% to about 100%, about 96% to about 100%, about 97% to about 100%, about 98% to about 100%, or about 99% to 100%) sequence identity to an IRES presented in Table 2 (e.g., any one of IRES 1 to IRES 22).
  • Table 2 e.g., any one of IRES 1 to IRES 22.
  • the IRES contains a nucleotide sequence with at least 70% sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 75% sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 80% sequence identity to any one of SEQ ID NOs: 173-190 and 202-205.
  • the IRES contains a nucleotide sequence with at least 85% sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 90% sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 91 % sequence identity to any one of SEQ ID NOs: 173-190 and 202-205.
  • the IRES contains a nucleotide sequence with at least 92% sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 93% sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 94% sequence identity to any one of SEQ ID NOs: 173-190 and 202-205.
  • the IRES contains a nucleotide sequence with at least 95% sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 96% sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 97% sequence identity to any one of SEQ ID NOs: 173-190 and 202-205.
  • the IRES contains a nucleotide sequence with at least 98% sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 99% sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with 100% sequence identity to any one of SEQ ID NOs: 173-190 and 202-205.
  • nucleic acid does not comprise a 5’ cap.
  • nucleic acid comprising:
  • an IRES comprising one or more polynucleotides that specifically bind a RNA binding protein, a translation initiation factor (for example, eukaryotic translation initiation factor 4 G (elF4G), eukaryotic translation initiation factor 4G2 (elF4G2, also referred to as Dap5), eukaryotic translation initiation factor 3 (elF3)), or IRES trans-acting factors (ITAfs), such as a polypyrimidine tract-binding protein (PTBP); or (b) a fusion protein comprising a translation initiation factor (e.g., elF4G, elF4G2, elF3, La protein, or an ITAf, such as La) fused to an RNA-binding protein; operably linked to
  • a translation initiation factor for example, eukaryotic translation initiation factor 4 G (elF4G), eukaryotic translation initiation factor 4G2 (elF4G2, also referred to as Dap5)
  • the one or more polynucleotides specifically bind elF4G.
  • each of the one or more polynucleotides independently, has a nucleic acid sequence that is at least 75% identical to ACUCACUAUUUGUUUUCGCGCCCAGUUGCAAAAA (SEQ ID NO: 1 ).
  • each of the one or more polynucleotides independently, has a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO: 1 (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 1 ).
  • each of the one or more polynucleotides has the nucleic acid sequence of SEQ ID NO: 1 .
  • the nucleic acid does not comprise a 5’ cap.
  • polypeptide expression system comprising:
  • nucleic acid comprising an open reading frame that encodes elF4G, La protein, or a functional variant thereof.
  • nucleic acid of (i) and the nucleic acid of (ii) are separate molecules.
  • nucleic acid of (ii) comprises, from 5’ to 3’:
  • nucleic acid of (ii) further comprises a 5’ cap operably linked to the 5’ UTR.
  • the IRES contains a nucleotide sequence with about 70% to about 100% (e.g., about 70% to about 100%, about 75% to about 100%, about 80% to about 100%, about 85% to about 100%, about 90% to about 100%, about 91 % to about 100%, about 92% to about 100%, about 93% to about 100%, about 94% to about 100%, about 95% to about 100%, about 96% to about 100%, about 97% to about 100%, about 98% to about 100%, or about 99% to 100%) sequence identity to an IRES presented in Table 3 (e.g., any one of IRES 23 to IRES 33).
  • Table 3 e.g., any one of IRES 23 to IRES 33.
  • the IRES contains a nucleotide sequence with at least 70% sequence identity to any one of SEQ ID NOs: 191 -201 . In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 75% sequence identity to any one of SEQ ID NOs: 191 -201 . In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 80% sequence identity to any one of SEQ ID NOs: 191 -201 . In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 85% sequence identity to any one of SEQ ID NOs: 191 -201 .
  • the IRES contains a nucleotide sequence with at least 90% sequence identity to any one of SEQ ID NOs: 191 -201 . In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 91% sequence identity to any one of SEQ ID NOs: 191 -201 . In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 92% sequence identity to any one of SEQ ID NOs: 191 -201 . In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 93% sequence identity to any one of SEQ ID NOs: 191 -201 .
  • the IRES contains a nucleotide sequence with at least 94% sequence identity to any one of SEQ ID NOs: 191 -201 . In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 95% sequence identity to any one of SEQ ID NOs: 191 -201 . In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 96% sequence identity to any one of SEQ ID NOs: 191 -201 . In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 97% sequence identity to any one of SEQ ID NOs: 191 -201 .
  • the IRES contains a nucleotide sequence with at least 98% sequence identity to any one of SEQ ID NOs: 191 -201 . In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 99% sequence identity to any one of SEQ ID NOs: 191 -201 . In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with 100% sequence identity to any one of SEQ ID NOs: 191 -201 . Table 3. Exemplary translation initiation elements 2. Chemically Modified Nucleic Acids
  • the IRES elements of the disclosure may have one or more chemical modifications.
  • Aduri et al. (Aduri, R. et al., AMBER force field parameters for the naturally occurring modified nucleosides in RNA. Journal of Chemical Theory and Computation. 2006.
  • nucleosides there are 107 naturally occurring nucleosides, including 1 -methyladenosine, 2-methylthio-N6-hydroxynorvalyl carbamoyladenosine, 2-methyladenosine, 2-O-ribosylphosphate adenosine, N6-methyl-N6- threonylcarbamoyladenosine, N6-acetyladenosine, N6-glycinylcarbamoyladenosine, N6- isopentenyladenosine, N6-methyladenosine, N6-threonylcarbamoyladenosine, N6,N6-dimethyladenosine, N6-(cis-hydroxyisopentenyl)adenosine, N6-hydroxynorvalylcarbamoyladenosine, 1 ,2-0- dimethyladenosine, N6,2-O-dimethyladenosine, 2-O
  • nucleosides and nucleotides e.g., building block molecules
  • a polynucleotide e.g., RNA or mRNA, as described herein
  • RNA or mRNA as described herein
  • the 2' hydroxyl group (OH) can be modified or replaced with a number of different substituents.
  • substitutions at the 2'-position include, but are not limited to, H, halo, optionally substituted C 1-6 alkyl; optionally substituted C 1-6 alkoxy; optionally substituted C 6-1 0 aryloxy; optionally substituted C 3-8 cycloalkyl; optionally substituted C 3-8 cycloalkoxy; optionally substituted C 6-10 aryloxy; optionally substituted C 6-1 0 aryl- C 1-6 alkoxy, optionally substituted C 1-12 (heterocyclyl)oxy; a sugar (e.g., ribose, pentose, or any described herein); a polyethyleneglycol (PEG), - O(CH 2 CH 2 O)nCH 2 CH 2 OR, where R is H or optionally substituted alkyl, and n is an integer from 0 to 20 (e.g., from 0 to 4, from 0 to 8, from 0 to 10, from 0 to 16, from 1 to 4, from 1 to 8, from 1 to 10, from 1
  • RNA includes the sugar group ribose, which is a 5-membered ring having an oxygen.
  • exemplary, non-limiting alternative nucleotides include replacement of the oxygen in ribose (e.g., with S, Se, or alkylene, such as methylene or ethylene); addition of a double bond (e.g., to replace ribose with cyclopentenyl or cyclohexenyl); ring contraction of ribose (e.g., to form a 4-membered ring of cyclobutane or oxetane); ring expansion of ribose (e.g., to form a 6- or 7-membered ring having an additional carbon or heteroatom, such as for anhydrohexitol, altritol, mannitol, cyclohexanyl, cyclohexenyl, and morpholino that also has a phosphoramidate backbone); multicyclic forms (e.
  • the sugar group can also contain one or more carbons that possess the opposite stereochemical configuration than that of the corresponding carbon in ribose.
  • a polynucleotide molecule can include nucleotides containing, e.g., arabinose, as the sugar. b. Alterations on the nucleobase
  • nucleoside is defined as a compound containing a sugar molecule (e.g., a pentose or ribose) or derivative thereof in combination with an organic base (e.g., a purine or pyrimidine) or a derivative thereof (also referred to herein as “nucleobase”).
  • organic base e.g., a purine or pyrimidine
  • nucleotide is defined as a nucleoside including a phosphate group.
  • Exemplary non-limiting alterations include an amino group, a thiol group, an alkyl group, a halo group, or any described herein.
  • the alternative nucleotides may by synthesized by any useful method, as described herein (e.g., chemically, enzymatically, or recombinantly to include one or more alternative or alternative nucleosides).
  • a nucleic acid of the invention includes one or more 2’-OMe nucleotides, 2’-methoxyethyl nucleotides (2’-MOE nucleotides), 2’-F nucleotide, 2’-NH 2 nucleotide, 2’fluoroarabino nucleotides (FANA nucleotides), locked nucleic acid nucleotides (LNA nucleotides), or 4’-S nucleotides.
  • 2’-OMe nucleotides 2’-methoxyethyl nucleotides
  • 2’-MOE nucleotides 2’-F nucleotide
  • 2’-NH 2 nucleotide 2’fluoroarabino nucleotides
  • FANA nucleotides locked nucleic acid nucleotides
  • LNA nucleotides locked nucleic acid nucleotides
  • the alternative nucleotide base pairing encompasses not only the standard adenosine-thymine, adenosine-uracil, and guanosine-cytosine base pairs, but also base pairs formed between nucleotides and/or alternative nucleotides including non-standard or alternative bases, wherein the arrangement of hydrogen bond donors and hydrogen bond acceptors permits hydrogen bonding between a non-standard base and a standard base or between two complementary non-standard base structures.
  • non-standard base pairing is the base pairing between the alternative nucleotide inosine and adenine, cytosine, or uracil.
  • the alternative nucleosides and nucleotides can include an alternative nucleobase.
  • nucleobases found in RNA include, but are not limited to, adenine, guanine, cytosine, and uracil.
  • nucleobase found in DNA include, but are not limited to, adenine, guanine, cytosine, and thymine. These nucleobases can be altered or wholly replaced to provide polynucleotide molecules having enhanced properties (e.g., resistance to nucleases and stability), and these properties may manifest through disruption of the binding of a major groove binding partner.
  • the alternative nucleobase is an alternative uracil.
  • Exemplary nucleobases and nucleosides having an alternative uracil include pseudouridine (ip), pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine (s 2 U), 4-thio-uridine (s 4 U), 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine (ho 5 U), 5-aminoallyl-uridine, 5-halo-uridine (e.g., 5-iodo-uridineor 5-bromo-uridine), 3-methyl-uridine (m 3 U), 5-methoxy-uridine (mo 5 U), uridine 5- oxyacetic acid (cmo 5 U), uridine 5-oxyacetic acid methyl ester (mcmo 5 U), 5-carboxymethyl-uridine (cm 5 U), 1
  • the alternative nucleobase is an alternative cytosine.
  • Exemplary nucleobases and nucleosides having an alternative cytosine include 5-aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine (m 3 C), N4-acetyl-cytidine (ac 4 C), 5-formyl-cytidine (f 5 C), N4-methyl- cytidine (m 4 C), 5-methyl-cytidine (m 5 C), 5-halo-cytidine (e.g., 5-iodo-cytidine), 5-hydroxymethyl-cytidine (hm 5 C), 1 -methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine (s 2 C), 2- thio-5-methyl-cytidine, 4-thio-pseudoiso
  • the alternative nucleobase is an alternative adenine.
  • Exemplary nucleobases and nucleosides having an alternative adenine include 2-amino-purine, 2, 6-diaminopurine, 2-amino-6-halo-purine (e.g., 2-amino-6-chloro-purine), 6-halo-purine (e.g., 6-chloro-purine), 2-amino-6- methyl-purine, 8-azido-adenosine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7- deaza-8-aza-2-amino-purine, 7-deaza-2, 6-diaminopurine, 7-deaza-8-aza-2, 6-diaminopurine, 1 -methyladenosine (m 1 A), 2-methyl-adenine (m 2 A), N6-methyl-adenosine (m 6 A)
  • the alternative nucleobase is an alternative guanine.
  • Exemplary nucleobases and nucleosides having an alternative guanine include inosine (I), 1 -methyl-inosine (m 1 l), wyosine (imG), methylwyosine (mimG), 4-demethyl-wyosine (imG-14), isowyosine (imG2), wybutosine (yW), peroxywybutosine (02yW), hydroxywybutosine (OhyW), undermodified hydroxywybutosine (OhyW*), 7-deaza-guanosine, queuosine (Q), epoxyqueuosine (oQ), galactosyl-queuosine (galQ), mannosyl-queuosine (manQ), 7-cyano-7-deaza-guanosine (preQ0), 7-aminomethyl-7-deaza-guanosine (preQ
  • the nucleobase of the nucleotide can be independently selected from a purine, a pyrimidine, a purine, or pyrimidine analog.
  • the nucleobase can each be independently selected from adenine, cytosine, guanine, uracil, or hypoxanthine.
  • the nucleobase can also include, for example, naturally-occurring and synthetic derivatives of a base, including pyrazolo[3,4- d]pyrimidines, 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2- aminoadenine, 6-methyl, and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo (e.g., 8-bromo), 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines
  • each letter refers to the representative base and/or derivatives thereof (e.g., A includes adenine or adenine analogs (e.g., 7-deaza adenine)).
  • the polynucleotides of the invention contain 5-methoxy-uracil, uracil, 5- methyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uracil, uracil, 5-trifluoromethyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5- methoxy-uracil, uracil, 5-hydroxymethyl-cytosine, and cytosine as the only uracils and cytosines.
  • the polynucleotides of the invention contain 5-methoxy-uracil, uracil, 5-bromo-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uracil, uracil, 5-iodo-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uracil, uracil, 5-methoxy- cytosine, and cytosine as the only uracils and cytosines.
  • the polynucleotides of the invention contain 5-methoxy-uracil, uracil, 5-ethyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uracil, uracil, 5- phenyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uracil, uracil, 5-ethnyl-cytosine, and cytosine as the only uracils and cytosines.
  • the polynucleotides of the invention contain 5- methoxy-uracil, uracil, N4-methyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uracil, uracil, 5-fluoro-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uracil, uracil, N4-acetyl-cytosine, and cytosine as the only uracils and cytosines.
  • the polynucleotides of the invention contain 5-methoxy-uracil, uracil, pseudoisocytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uracil, uracil, 5-formyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5- methoxy-uracil, uracil, 5-aminoallyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uracil, uracil, 5-carboxy-cytosine, and cytosine as the only uracils and cytosines.
  • the polynucleotides of the invention contain 1 -methyl-pseudouracil, uracil, 5-methyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouracil, uracil, 5-trifluoromethyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouracil, uracil, 5-hydroxymethyl-cytosine, and cytosine as the only uracils and cytosines.
  • the polynucleotides of the invention contain 1 -methyl-pseudouracil, uracil, 5-bromo-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouracil, uracil, 5-iodo-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1 - methyl-pseudouracil, uracil, 5-methoxy-cytosine, and cytosine as the only uracils and cytosines.
  • the polynucleotides of the invention contain 1 -methyl-pseudouracil, uracil, 5-ethyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouracil, uracil, 5-phenyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouracil, uracil, 5-ethnyl-cytosine, and cytosine as the only uracils and cytosines.
  • the polynucleotides of the invention contain 1 -methyl-pseudouracil, uracil, N4-methyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1 - methyl-pseudouracil, uracil, 5-fluoro-cytosine, and cytosine as the only uracils and cytosines.
  • the polynucleotides of the invention contain 1 -methyl-pseudouracil, uracil, N4-acetyl- cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouracil, uracil, pseudoisocytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1 -methyl- pseudouracil, uracil, 5-formyl-cytosine, and cytosine as the only uracils and cytosines.
  • the polynucleotides of the invention contain 1 -methyl-pseudouracil, uracil, 5-aminoallyl- cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouracil, uracil, 5-carboxy-cytosine, and cytosine as the only uracils and cytosines.
  • the polynucleotides of the invention contain 5-methoxy-uridine, uridine, 5- methyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uridine, uridine, 5-trifluoromethyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 5- methoxy-uridine, uridine, 5-hydroxymethyl-cytidine, and cytidine as the only uridines and cytidines.
  • the polynucleotides of the invention contain 5-methoxy-uridine, uridine, 5-bromo- cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uridine, uridine, 5-iodo-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uridine, uridine, 5-methoxy-cytidine, and cytidine as the only uridines and cytidines.
  • the polynucleotides of the invention contain 5-methoxy-uridine, uridine, 5-ethyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 5- methoxy-uridine, uridine, 5-phenyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uridine, uridine, 5-ethnyl-cytidine, and cytidine as the only uridines and cytidines.
  • the polynucleotides of the invention contain 5-methoxy-uridine, uridine, N4-methyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uridine, uridine, 5-fluoro-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uridine, uridine, N4-acetyl-cytidine, and cytidine as the only uridines and cytidines.
  • the polynucleotides of the invention contain 5- methoxy-uridine, uridine, pseudoisocytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uridine, uridine, 5-formyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uridine, uridine, 5-aminoallyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uridine, uridine, 5-carboxy-cytidine, and cytidine as the only uridines and cytidines.
  • the polynucleotides of the invention contain 1 -methyl-pseudouridine, uridine, 5-methyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouridine, uridine, 5-trifluoromethyl-cytidine, and cytidine as the only uridines and cytidines.
  • the polynucleotides of the invention contain 1 -methyl-pseudouridine, uridine, 5-hydroxymethyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouridine, uridine, 5-bromo-cytidine, and cytidine as the only uridines and cytidines.
  • the polynucleotides of the invention contain 1 -methyl-pseudouridine, uridine, 5-iodo-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 1 - methyl-pseudouridine, uridine, 5-methoxy-cytidine, and cytidine as the only uridines and cytidines.
  • the polynucleotides of the invention contain 1 -methyl-pseudouridine, uridine, 5-ethyl- cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouridine, uridine, 5-phenyl-cytidine, and cytidine as the only uridines and cytidines.
  • the polynucleotides of the invention contain 1 -methyl- pseudouridine, uridine, 5-ethnyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouridine, uridine, N4-methyl- cytidine, and cytidine as the only uridines and cytidines.
  • the polynucleotides of the invention contain 1 -methyl-pseudouridine, uridine, 5-fluoro-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 1 -methyl- pseudouridine, uridine, N4-acetyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouridine, uridine, pseudoisocytidine, and cytidine as the only uridines and cytidines.
  • the polynucleotides of the invention contain 1 -methyl-pseudouridine, uridine, 5-formyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 1 - methyl-pseudouridine, uridine, 5-aminoallyl-cytidine, and cytidine as the only uridines and cytidines.
  • the polynucleotides of the invention contain 1 -methyl-pseudouridine, uridine, 5- carboxy-cytidine, and cytidine as the only uridines and cytidines.
  • the polynucleotides of the invention contain the uracil of one of the nucleosides of Table 4 and uracil as the only uracils. In other embodiments, the polynucleotides of the invention contain a uridine of Table 4 and uridine as the only uridines. Table 4. Exemplary modified uridine nucleosides
  • the polynucleotides of the invention contain the cytosine of one of the nucleosides of Table 5 and cytosine as the only cytosines. In other embodiments, the polynucleotides of the invention contain a cytidine of Table 5 and cytidine as the only cytidines. Table 5. Exemplary modified cytidine nucleosides c. Alterations on the internucleoside linkage
  • nucleotides which may be incorporated into a polynucleotide molecule, can be altered on the internucleoside linkage (e.g., phosphate backbone).
  • phosphate backbone the phrases “phosphate” and “phosphodiester” are used interchangeably.
  • Backbone phosphate groups can be altered by replacing one or more of the oxygen atoms with a different substituent.
  • the alternative nucleosides and nucleotides can include the wholesale replacement of an unaltered phosphate moiety with another internucleoside linkage as described herein.
  • alternative phosphate groups include, but are not limited to, phosphorothioate, phosphoroselenates, boranophosphates, boranophosphate esters, hydrogen phosphonates, phosphoramidates, phosphorodiamidates, alkyl or aryl phosphonates, and phosphotriesters.
  • Phosphorodithioates have both non-linking oxygens replaced by sulfur.
  • the phosphate linker can also be altered by the replacement of a linking oxygen with nitrogen (bridged phosphoramidates), sulfur (bridged phosphorothioates), and carbon (bridged methylene-phosphonates).
  • the alternative nucleosides and nucleotides can include the replacement of one or more of the non-bridging oxygens with a borane moiety (BH3), sulfur (thio), methyl, ethyl and/or methoxy.
  • BH3 borane moiety
  • sulfur (thio) methyl, ethyl and/or methoxy.
  • two non-bridging oxygens at the same position e.g., the alpha ( ⁇ ), beta ( ⁇ ) or gamma (y) position
  • the replacement of one or more of the oxygen atoms at the a position of the phosphate moiety is provided to confer stability (such as against exonucleases and endonucleases) to RNA and DNA through the unnatural phosphorothioate backbone linkages.
  • Phosphorothioate DNA and RNA have increased nuclease resistance and subsequently a longer half-life in a cellular environment. While not wishing to be bound by theory, phosphorothioate linked polynucleotide molecules are expected to also reduce the innate immune response through weaker binding/activation of cellular innate immune molecules.
  • an alternative nucleoside includes an alpha-thio-nucleoside (e.g., 5'-O- (1 -thiophosphate)-adenosine, 5'-O-(1 -thiophosphate)-cytidine (a-thio-cytidine), 5'-O-(1 -thiophosphate)- guanosine, 5'-O-(1 -thiophosphate)-uridine, or 5'-O-(1 -thiophosphate)-pseudouridine).
  • alpha-thio-nucleoside e.g., 5'-O- (1 -thiophosphate)-adenosine, 5'-O-(1 -thiophosphate)-cytidine (a-thio-cytidine), 5'-O-(1 -thiophosphate)- guanosine, 5'-O-(1 -thiophosphate)-uridine, or 5'-O-(1
  • internucleoside linkages that may be employed according to the present invention, including internucleoside linkages which do not contain a phosphorous atom, are described herein below. d. Combinations of alternative sugars, nucleobases, and internucleoside linkages
  • the polynucleotides of the invention can include a combination of alterations to the sugar, the nucleobase, and/or the internucleoside linkage. These combinations can include any one or more alterations described herein.
  • the present disclosure provides LNP compositions that encapsulate a nucleic acid molecule (e.g., linear or circular RNA molecule) described herein.
  • the LNPs of the disclosure may confer one or more advantageous properties.
  • the lipid nanoparticle compositions described herein may be used for the delivery of therapeutic and/or prophylactic agents, e.g., mRNAs, to mammalian cells or organs.
  • the lipid nanoparticles described herein have little or no immunogenicity.
  • the lipid compounds disclosed herein have a lower immunogenicity as compared to a reference lipid (e.g., MC3, KC2, or DLinDMA).
  • a formulation comprising a lipid disclosed herein and a therapeutic or prophylactic agent, e.g., mRNA, has an increased therapeutic index as compared to a corresponding formulation which comprises a reference lipid (e.g., MC3, KC2, or DLinDMA) and the same therapeutic or prophylactic agent.
  • a reference lipid e.g., MC3, KC2, or DLinDMA
  • compositions comprising:
  • polynucleotides of the present disclosure are included in a lipid nanoparticle (LNP).
  • Lipid nanoparticles according to the present disclosure may comprise: (i) an ionizable lipid (e.g., an ionizable amino lipid); (ii) a sterol or other structural lipid; (iii) a non-cationic helper lipid or phospholipid; and (iv) a PEG-modified lipid.
  • lipid nanoparticles according to the present disclosure further comprise one or more polynucleotides of the present disclosure (e.g., a linear or circular RNA encoding a therapeutic polypeptide, such as a therapeutic polypeptide disclosed herein).
  • lipid nanoparticles according to the present disclosure can be generated using components, compositions, and methods as are generally known in the art, see for example PCT/US2016/052352; PCT/US2016/068300; PCT/US2017/037551 ; PCT/US2015/027400; PCT/US2016/047406; PCT/US2016000129; PCT/US2016/014280; PCT/US2016/014280; PCT/US2017/038426; PCT/US2014/027077; PCT/US2014/055394; PCT/US2016/52117; PCT/US2012/069610;
  • the lipid nanoparticle comprises an ionizable cationic lipid (e.g., an ionizable amino lipid) at a content of 20-60 mol.%, 25-60 mol.%, 30-60 mol.%, 35-60 mol.%, 40-60 mol.%, 45-60 mol.%, 20-55 mol.%, 25-55 mol.%, 30-55 mol.%, 35-55 mol.%, 40-55 mol.%, 45-55 mol.%, 20-50 mol.%, 25-50 mol.%, 30-50 mol.%, 35-50 mol.%, or 40-50 mol.%.
  • an ionizable cationic lipid e.g., an ionizable amino lipid
  • the lipid nanoparticle may comprise an ionizable cationic lipid (e.g., an ionizable amino lipid) at a content of 40-50 mol.%, 45-50 mol.%, 45-46 mol.%, 46-47 mol.%, 47-48 mol.%, 48-49 mol.%, or 49-50 mol.%, for example about 45 mol.%, about 45.5 mol.%, about 46 mol.%, about 46.5 mol.%, about 47 mol.%, about 47.5 mol.%, about 48 mol.%, about 48.5 mol.%, about 49 mol.%, or about 49.5 mol.% ionizable cationic lipid (e.g., an ionizable amino lipid).
  • an ionizable cationic lipid e.g., an ionizable amino lipid
  • the lipid nanoparticle comprises a non-cationic helper lipid or phospholipid at a content of 5-25 mol.%.
  • the lipid nanoparticle may comprise a non-cationic helper lipid or phospholipid at a content of molar ratio of 5-25 mol.%, 5-20 mol.%, 5-15 mol.%, 10-25 mol.%, 10-20 mol.%, 10-15 mol.%, 5-6 mol.%, 6-7 mol.%, 7-8 mol.%, 8-9 mol.%, 9-10 mol.%, 10-1 1 mol.%, 1 1 -12 mol.%, 12-13 mol.%, 13-14 mol.%, 14-15 mol.%, 10-14 mol.%, 10-13 mol.%, 10-12 mol.%, 10-1 1 mol.%, 9-15 mol.%, 9-14 mol.%, 9-13 mol.%, 9-12 mol.%, or 9-1 1 mol.% non-cati
  • the lipid nanoparticle comprises a sterol or other structural lipid at a content molar ratio of 25-55 mol.%, 25-50 mol.%, 25-45 mol.%, 25-40 mol.%, 25-35 mol.%, 30-55 mol.%, 30-50 mol.%, 30-45 mol.%, 30-40 mol.%, 30-35 mol.%, 35-55 mol.%, 35-50 mol.%, 35-45 mol.%, 35-40 mol.%, 25-30 mol.%, 30-35 mol.%, 25-28 mol.%, 28-30 mol.%, 30-33 mol.%, 35-38 mol.%, 38-40 mol.%, 36-40 mol.%, 37-40 mol.%, 38-40 mol.%, 38-39 mol.%, 36-40 mol.%, 37-40 mol.%, 36-39 mol.%, 36-39 mol.%, or 37- 39 mol.%.
  • the lipid nanoparticle may comprise a sterol or other structural lipid at a content of about 30 mol.%, about 30.5 mol.%, about 31 .0 mol.%, about 31 .5 mol.%, about 32.0 mol.%, about 32.5 mol.%, about 33.0 mol.%, about 33.5 mol.%, about 34.0 mol.%, about 34.5 mol.%, about 35.0 mol.%, about 35.5 mol.%, about 36.0 mol.%, about 36.5 mol.%, about 37.0 mol.%, about 37.5 mol.%, about 38.0 mol.%, about 38.5 mol.%, about 39.0 mol.%, about 39.5 mol.%, about 40.0 mol.%, about 40.5 mol.%, about 41 .0 mol.%, about 41 .5 mol.%, about 42.0 mol.%, about 42.5 mol.%, about 43.0 mol.%, about 43.5
  • the lipid nanoparticle comprises a PEG-modified lipid at a content of 0.5- 15 mol.%, 1 .0-15 mol.%, 1 .5-15 mol.%, 2.0-15 mol.%, 2.5-15 mol.%, 3.0-15 mol.%, 3.5-15 mol.%, 4.0-15 mol.%, 4.5-15 mol.%, 5.0-15 mol.%, 10-15 mol.%, 0.5-10 mol.%, 0.5-5 mol.%, 0.5-4.5 mol.%, 0.5-4.0 mol.%, 0.5-3.5 mol.%, 0.5-3.0 mol.%, 0.5-2.5 mol.%, 0.5-2.0 mol.%, 0.5-1 .5 mol.%, 0.5-1 .0 mol.%, 1 .0-10 mol.%, 1 .0-5 mol.%, 1 .0-4.5 mol.%, 1 .0-4.0 mol.%, 1 .0-3.5 mol
  • the lipid nanoparticle may comprise a PEG-modified lipid at a content of a about 0.5 mol.%, about 1 .0 mol.%, about 1 .5 mol.%, about 2.0 mol.%, about 2.5 mol.%, about 3.0 mol.%, about 3.5 mol.%, about 4.0 mol.%, about 4.5 mol.%, about 5.0 mol.%, about 6.0 mol.%, about 7.0 mol.%, about 8.0 mol.%, about 9.0 mol.%, about 10.0 mol.%, or about 15.0 mol.%.
  • the lipid nanoparticle comprises: (i) 20 to 60 mol.% ionizable cationic lipid
  • the lipid nanoparticle comprises: (i) 40 to 50 mol.% ionizable cationic lipid (e.g. ionizable amino lipid), (ii) 30 to 45 mol.% sterol or other structural lipid, (Hi) 5 to 15 mol.% noncationic lipid (e.g., phospholipid), and (iv) 1 to 5 mol.% PEG-modified lipid.
  • the lipid nanoparticle comprises: (i) 45 to 50 mol.% ionizable cationic lipid (e.g. ionizable amino lipid), (ii) 35 to 45 mol.% sterol or other structural lipid, (Hi) 8 to 12 mol.% noncationic lipid (e.g., phospholipid), and (iv) 1 .5 to 3.5 mol.% PEG-modified lipid.
  • ionizable cationic lipid e.g. ionizable amino lipid
  • ii 35 to 45 mol.% sterol or other structural lipid
  • Hi 8 to 12 mol.% noncationic lipid (e.g., phospholipid)
  • 1 .5 to 3.5 mol.% PEG-modified lipid e.g. phospholipid
  • the lipid nanoparticle of the present disclosure comprises an ionizable cationic lipid (e.g., an ionizable amino lipid) that is a compound of Formula (I): (I) or its N-oxide, or a salt or isomer thereof, wherein R’ a is R' branched ; wherein denotes a point of attachment; wherein R a ⁇ , R a ⁇ , R ay and R a ⁇ are each independently selected from the group consisting of H, C 2-12 alkyl, and C 2-12 alkenyl;
  • an ionizable cationic lipid e.g., an ionizable amino lipid
  • R’ a is R' branched ; wherein denotes a point of attachment
  • R a ⁇ , R a ⁇ , R ay and R a ⁇ are each independently selected from the group consisting of H, C 2-12 alkyl, and C 2-12 alkenyl;
  • R 2 and R 3 are each independently selected from the group consisting of C 1-14 alkyl and C 2-14 alkenyl;
  • R 4 is selected from the group consisting of -(CH 2 )nOH, wherein n is selected from the group consisting of 1 , 2, 3, 4, and 5, and wherein denotes a point of attachment;
  • R 10 is N(R)2; each R is independently selected from the group consisting of C 1-6 alkyl, C 2-3 alkenyl, and H; and n2 is selected from the group consisting of 1 , 2, 3, 4, 5, 6, 7, 8, 9, and 10; each R 5 is independently selected from the group consisting of C 1-3 alkyl,
  • each R 6 is independently selected from the group consisting of C 1-3 alkyl,
  • M and M’ are each independently selected from the group consisting of -C(O)O- and
  • R’ is a C 1-12 alkyl or C 2-12 alkenyl
  • I is selected from the group consisting of 1 , 2, 3, 4, and 5; and m is selected from the group consisting of 5, 6, 7, 8, 9, 10, 1 1 , 12, and 13.
  • R’ a is R’ branched ;
  • R’ branched is denotes a point of attachment;
  • R a ⁇ , R a ⁇ , R ay and R a ⁇ are each H;
  • R 2 and R 3 are each C 1-14 alkyl;
  • R 4 is - (CH 2 )nOH;
  • n is 2;
  • each R 5 is H;
  • each R 6 is H;
  • M and M’ are each -C(O)O-;
  • R’ is a C 1-12 alkyl; I is 5; and m is 7.
  • R’ a is R’ branched ;
  • R’ branched is denotes a point of attachment;
  • R a ⁇ , R a ⁇ , R ay and R a ⁇ are each H;
  • R 2 and R 3 are each C 1-14 alkyl;
  • R 4 is -(CH 2 )nOH;
  • n is 2;
  • each R 5 is H;
  • each R 6 is H;
  • M and M’ are each -
  • R’ is a C 1-12 alkyl; I is 3; and m is 7.
  • R’ a is R’ branched ; R’ branched ; s denotes a point of attachment; R aa is C 2-12 alkyl; R a ⁇ , R a ⁇ , R ay and a Rre a ⁇ each H;
  • R 2 and R 3 are each C 1-14 alkyl;
  • R 4 is R 10 is NH( C 1-6 alkyl); n2 is 2;
  • R 5 is H; each R 6 is H;
  • M and M’ are each -C(O)O-;
  • R’ is a C 1-12 alkyl; I is 5; and m is 7.
  • R’ a is R’ branched ;
  • R' branched is denotes a point of attachment;
  • R a ⁇ , R a ⁇ , and R a ⁇ are each H;
  • R av is C 2-12 alkyl;
  • R 2 and R 3 are each C 1-14 alkyl;
  • R 4 is -(CH 2 )nOH;
  • n is 2;
  • each R 5 is H; each R 6 is H;
  • M and M’ are each -C(O)O-;
  • R’ is a C 1-12 alkyl; I is 5; and m is 7.
  • the compound of Formula (I) is selected from: (Compound 1-1 ),
  • the compound of Formula (I) is:
  • the disclosure relates to a compound of Formula (la): (la) or its N-oxide, or a salt or isomer thereof, wherein R’ a is R' branched ; wherein
  • R' branched is ; denotes a point of attachment; wherein R a ⁇ , R a ⁇ , R ay and a Rre a ⁇ each independently selected from the group consisting of H, C 2-12 alkyl, and C 2-12 alkenyl;
  • R 2 and R 3 are each independently selected from the group consisting of C 1-14 alkyl and C 2-14 alkenyl;
  • R 4 is selected from the group consisting of -(CH 2 )nOH wherein n is selected from the group consisting of 1 , 2, 3, 4, and 5, and wherein denotes a point of attachment;
  • R 10 is N(R)2; each R is independently selected from the group consisting of C 1-6 alkyl, C 2-3 alkenyl, and H; and n2 is selected from the group consisting of 1 , 2, 3, 4, 5, 6, 7, 8, 9, and 10; each R 5 is independently selected from the group consisting of C 1-3 alkyl,
  • each R 6 is independently selected from the group consisting of C 1-3 alkyl,
  • M and M’ are each independently selected from the group consisting of -C(O)O- and -OC(O)-;
  • R’ is a C 1-12 alkyl or C 2-12 alkenyl
  • I is selected from the group consisting of 1 , 2, 3, 4, and 5; and m is selected from the group consisting of 5, 6, 7, 8, 9, 10, 1 1 , 12, and 13.
  • the disclosure relates to a compound of Formula (lb): (lb) or its N-oxide, or a salt or isomer thereof, wherein R’ a is R' branched ; wherein
  • R' branched is ; wherein denotes a point of attachment; wherein R aa , R a ⁇ , R a ⁇ , R ay and a Rre a ⁇ each independently selected from the group consisting of H, C 2-12 alkyl, and C 2-12 alkenyl;
  • R 2 and R 3 are each independently selected from the group consisting of C 1-14 alkyl and C 2-14 alkenyl;
  • R 4 is -(CH 2 )nOH, wherein n is selected from the group consisting of 1 , 2, 3, 4, and 5; each R 5 is independently selected from the group consisting of C 1-3 alkyl,
  • each R 6 is independently selected from the group consisting of C 1-3 alkyl,
  • M and M’ are each independently selected from the group consisting of -C(O)O- and -OC(O)-;
  • R’ is a C 1-12 alkyl or C 2-12 alkenyl
  • I is selected from the group consisting of 1 , 2, 3, 4, and 5; and m is selected from the group consisting of 5, 6, 7, 8, 9, 10, 1 1 , 12, and 13.
  • R’ a is R' branched ;
  • R' branched is denotes a point of attachment;
  • R a ⁇ , R ay , and R a ⁇ are each H;
  • R 2 and R 3 are each C 1-14 alkyl;
  • R 4 is - (CH 2 )nOH; n is 2;
  • each R 5 is H;
  • each R 6 is H;
  • M and M’ are each -C(O)O-;
  • R’ is a C 1-12 alkyl; I is 5; and m is 7.
  • R’ a is R' branched ; is ; R' branched is ; denotes a point of attachment; R a ⁇ and R a ⁇ are each H; R ay is C 2-12 alkyl; R 2 and R 3 are each C 1-14 alkyl;
  • R 4 is -(CH 2 )nOH; n is 2; each R 5 is H; each R 6 is H; M and M’ are each -C(O)O-; R’ is a C 1-12 alkyl; I is 5; and m is 7.
  • the disclosure relates to a compound of Formula (Ic): (Ic) or its N-oxide, or a salt or isomer thereof, wherein R’ a is R' branched w is ;herein
  • R' branched is ; wherein denotes a point of attachment; wherein R a ⁇ , R a ⁇ , R ay and R a ⁇ are each independently selected from the group consisting of H, C 2-12 alkyl, and C 2-12 alkenyl;
  • R 2 and R 3 are each independently selected from the group consisting of C 1-14 alkyl and C 2-14 alkenyl; wherein denotes a point of attachment; wherein
  • R 10 is N(R)2; each R is independently selected from the group consisting of C 1-6 alkyl, C 2-3 alkenyl, and H; n2 is selected from the group consisting of 1 , 2, 3, 4, 5, 6, 7, 8, 9, and 10; each R 5 is independently selected from the group consisting of C 1-3 alkyl,
  • each R 6 is independently selected from the group consisting of C 1-3 alkyl,
  • M and M’ are each independently selected from the group consisting of -C(O)O- and -OC(O)-;
  • R’ is a C 1-12 alkyl or C 2-12 alkenyl
  • I is selected from the group consisting of 1 , 2, 3, 4, and 5; and m is selected from the group consisting of 5, 6, 7, 8, 9, 10, 1 1 , 12, and 13. attachment; R aP , R av , and R a ⁇ are each H; R aa is C 2-12 alkyl; R 2 and R 3 are each C 1-14 alkyl; R 4 is denotes a point of attachment; R 10 is NH(C 1-6 alkyl); n2 is 2; each R 5 is H; each R 6 is H; M and M’ are each -C(O)O-; R’ is a C 1-12 alkyl; I is 5; and m is 7.
  • the compound of Formula (Ic) is: (Compound I-2).
  • the disclosure relates to a compound of Formula (II): (II) or its N-oxide, or a salt or isomer thereof, wherein R’ a is R’ branched or R’ cyclic ; wherein
  • R ay and R a ⁇ are each independently selected from the group consisting of H, C 1-12 alkyl, and C 2-12 alkenyl, wherein at least one of R ay and R a ⁇ is selected from the group consisting of C 1-12 alkyl and C 2-12 alkenyl;
  • R by and R b ⁇ are each independently selected from the group consisting of H, C 1-12 alkyl, and C 2-12 alkenyl, wherein at least one of R by and R b ⁇ is selected from the group consisting of C 1-12 alkyl and C 2-12 alkenyl;
  • R 2 and R 3 are each independently selected from the group consisting of C 1-14 alkyl and C 2-14 alkenyl;
  • R 4 is selected from the group consisting of -(CH 2 )nOH wherein n is selected from the group consisting of 1 , 2, 3, 4, and 5, and wherein denotes a point of attachment;
  • R 10 is N(R)2; each R is independently selected from the group consisting of C 1-6 alkyl, C 2-3 alkenyl, and H; and n2 is selected from the group consisting of 1 , 2, 3, 4, 5, 6, 7, 8, 9, and 10; each R’ independently is a C 1-12 alkyl or C 2-12 alkenyl;
  • Y a is a C3-6 carbocycle
  • R*” a is selected from the group consisting of C 1 -15 alkyl and C 2 -15 alkenyl; and s is 2 or 3; m is selected from 1 , 2, 3, 4, 5, 6, 7, 8, and 9;
  • I is selected from 1 , 2, 3, 4, 5, 6, 7, 8, and 9.
  • the disclosure relates to a compound of Formula (I l-a) : (ll-a) or its N-oxide, or a salt or isomer thereof, wherein R’ a is R’ branched or R’ cyclic ; wherein wherein denotes a point of attachment; R ay and R a ⁇ are each independently selected from the group consisting of H, C 1-12 alkyl, and C 2-12 alkenyl, wherein at least one of R ay and R a ⁇ is selected from the group consisting of C 1-12 alkyl and C 2-12 alkenyl;
  • R by and R b ⁇ are each independently selected from the group consisting of H, C 1-12 alkyl, and C 2-12 alkenyl, wherein at least one of R by and R b ⁇ is selected from the group consisting of C 1-12 alkyl and C 2-12 alkenyl;
  • R 2 and R 3 are each independently selected from the group consisting of C 1-14 alkyl and C 2-14 alkenyl;
  • R 4 is selected from the group consisting of -(CH 2 )nOH wherein n is selected from the group consisting of 1 , 2, 3, 4, and 5 and wherein denotes a point of attachment;
  • R 10 is N(R)2; each R is independently selected from the group consisting of C 1-6 alkyl, C 2-3 alkenyl, and H; and n2 is selected from the group consisting of 1 , 2, 3, 4, 5, 6, 7, 8, 9, and 10; each R’ independently is a C 1-12 alkyl or C 2-12 alkenyl; m is selected from 1 , 2, 3, 4, 5, 6, 7, 8, and 9;
  • I is selected from 1 , 2, 3, 4, 5, 6, 7, 8, and 9.
  • the disclosure relates to a compound of Formula (I l-b) : (ll-b) or its N-oxide, or a salt or isomer thereof, wherein R’ a is R’ branched or R’ cyclic ; wherein wherein denotes a point of attachment; R ay and R by are each independently selected from the group consisting of C 1-12 alkyl and C 2-12 alkenyl;
  • R 2 and R 3 are each independently selected from the group consisting of C 1-14 alkyl and C 2-14 alkenyl;
  • R 4 is selected from the group consisting of -(CH 2 )nOH wherein n is selected from the group consisting of 1 , 2, 3, 4, and 5, and wherein denotes a point of attachment;
  • R 10 is N(R)2; each R is independently selected from the group consisting of C 1-6 alkyl, C 2-3 alkenyl, and H; and n2 is selected from the group consisting of 1 , 2, 3, 4, 5, 6, 7, 8, 9, and 10; each R’ independently is a C 1-12 alkyl or C 2-12 alkenyl; m is selected from 1 , 2, 3, 4, 5, 6, 7, 8, and 9;
  • I is selected from 1 , 2, 3, 4, 5, 6, 7, 8, and 9.
  • the disclosure relates to a compound of Formula (I l-c) : (ll-c) or its N-oxide, or a salt or isomer thereof, wherein R’ a is R’ branched or R’ cyclic ; wherein
  • R' branched jg - and R’ b is: wherein denotes a point of attachment; wherein R av is selected from the group consisting of C 1-12 alkyl and C 2-12 alkenyl;
  • R 2 and R 3 are each independently selected from the group consisting of C 1-14 alkyl and C 2-14 alkenyl;
  • R 4 is selected from the group consisting of -(CH 2 )nOH wherein n is selected from the group consisting of 1 , 2, 3, 4, and 5, and wherein denotes a point of attachment;
  • R 10 is N(R)2; each R is independently selected from the group consisting of C 1-6 alkyl, C 2-3 alkenyl, and H; and n2 is selected from the group consisting of 1 , 2, 3, 4, 5, 6, 7, 8, 9, and 10; R’ is a C 1-12 alkyl or C 2-12 alkenyl; m is selected from 1 , 2, 3, 4, 5, 6, 7, 8, and 9;
  • I is selected from 1 , 2, 3, 4, 5, 6, 7, 8, and 9.
  • the disclosure relates to a compound of Formula (I l-d) : (ll-d) or its N-oxide, or a salt or isomer thereof, wherein R’ a is R’ branched or R’ cyclic ; wherein
  • R’ branched is : and R’b is wherein denotes a point of attachment; wherein R ay and R by are each independently selected from the group consisting of C 1-12 alkyl and C 2-12 alkenyl;
  • R 4 is selected from the group consisting of -(CH 2 )nOH wherein n is selected from the group consisting of 1 , 2, 3, 4, and 5, and wherein denotes a point of attachment;
  • R 10 is N(R)2; each R is independently selected from the group consisting of C 1-6 alkyl, C 2-3 alkenyl, and H; and n2 is selected from the group consisting of 1 , 2, 3, 4, 5, 6, 7, 8, 9, and 10; each R’ independently is a C 1-12 alkyl or C 2-12 alkenyl; m is selected from 1 , 2, 3, 4, 5, 6, 7, 8, and 9;
  • I is selected from 1 , 2, 3, 4, 5, 6, 7, 8, and 9.
  • the disclosure relates to a compound of Formula (ll-e): (ll-e) or its N-oxide, or a salt or isomer thereof, wherein R’ a is R’ branched or R’ cyclic ; wherein
  • R’ branched is ; wherein denotes a point of attachment; wherein R a * is selected from the group consisting of C 1-12 alkyl and C 2-12 alkenyl;
  • R 2 and R 3 are each independently selected from the group consisting of C 1-14 alkyl and C 2-14 alkenyl;
  • R 4 is -(CH 2 )nOH wherein n is selected from the group consisting of 1 , 2, 3, 4, and 5;
  • R’ is a C 1-12 alkyl or C 2-12 alkenyl; m is selected from 1 , 2, 3, 4, 5, 6, 7, 8, and 9;
  • I is selected from 1 , 2, 3, 4, 5, 6, 7, 8, and 9.
  • m and I are each independently selected from 4, 5, and 6. In some embodiments of the compound of Formula (II), (ll-a), (ll-b), (ll-c), (ll-d), or (ll-e), m and I are each 5.
  • each R’ independently is a C 1-12 alkyl. In some embodiments of the compound of Formula (II), (ll-a), (ll-b), (ll-c), (ll-d), or (ll-e), each R’ independently is a C 2-5 alkyl.
  • R’ b is: and R 2 and R 3 are each independently a C 1-14 alkyl. In some embodiments of the compound of Formula (II), (ll-a), (ll-b), (ll-c), (ll-d), or (ll-e), R’ b is: and R 2 and R 3 are each independently a C 6-1 0 alkyl.
  • R’ b is: r3 ⁇ r2 and R 2 and R 3 are each a C 8 alkyl.
  • R’ branched is and R’ b is: R , R av is a C 1-12 alkyl and R 2 and R 3 are each independently a C 6-1 0 alkyl.
  • R av is a C 1-12 alkyl
  • R 2 and R 3 are each independently a C 6-1 0 alkyl.
  • R’ branched is : anc
  • R’b is : Ray is a C 2-6 a
  • R’ branched is : and R’b is : Ray is a C 2-6 alkyl, and R 2 and R 3 are each a C 8 alkyl.
  • R’ branched is: anc l Ray anc
  • Rby branched is : and R ay and R by are each a C 2-6 alkyl.
  • m and I are each independently selected from 4, 5, and 6 and each R’ independently is a C 1-12 alkyl. In some embodiments of the compound of Formula (II), (ll-a), (ll-b), (ll-c), (ll-d), or (ll-e), m and I are each 5 and each R’ independently is a C 2-5 alkyl.
  • R’branched is: m and I are each independently selected from 4, 5, and 6, each R’ independently is a C 1-12 alkyl, and R ay and R by are each a C 1-12 alkyl.
  • R’branched is : m and I are each 5, each R’ independently is a C 2-5 alkyl, and R ay and R by are each a C 2-6 alkyl.
  • R’ is a C 1-12 alkyl
  • R a * is a C 1-12 alkyl
  • R 2 and R 3 are each independently a C 6-10 alkyl.
  • R’ branched is: m and I are each 5, R’ is a C 2-5 alkyl, R av is a C 2-6 alkyl, and R 2 and R 3 are each a C 8 alkyl.
  • R 4 is wherein R 10 is NH(C 1-6 alkyl) and n2 is 2. In some embodiments of the compound of Formula (II), (ll-a), (ll-b), (ll-c), (ll-d), or (ll-e), R 4 is wherein R 10 is NH(CHs) and n2 is 2.
  • R’branched is: m and I are each independently selected from 4, 5, and 6, each R’ independently is a C 1-12 alkyl, R a * and R by are each a C 1-12 alkyl, and R 4 is , wherein R 10 is NH(C 1-6 alkyl), and n2 is 2.
  • R’ branched is: is: m and I are each 5, each R’ independently is a C 2-5 alkyl, R ay and R by are each a C 2-6 alkyl, and R 4 is , wherein R 10 is NH(CHs) and n2 is 2.
  • R’ is a C 1-12 alkyl
  • R 2 and R 3 are each independently a C 6-10 alkyl
  • R av is a C 1-12 alkyl
  • R 4 is wherein R 10 is NH(C 1-6 alkyl) and n2 is 2.
  • R’ branched is: and I are each 5, R’ is a C 2-5 alkyl, R a * is a C 2-6 alkyl, R 2 and R 3 are each a C 8 alkyl, and R 4 is wherein R 10 is NH(CHs) and n2 is 2.
  • R 4 is - (CH 2 )nOH and n is 2, 3, or 4. In some embodiments of the compound of Formula (II), (ll-a), (ll-b), (ll-c), (ll-d), or (ll-e), R 4 is -(CH 2 )nOH and n is 2.
  • R’ branched is: m and I are each independently selected from 4, 5, and 6, each R’ independently is a C 1-12 alkyl, R ay and R by are each a C 1-12 alkyl, R 4 is -(CH 2 )nOH, and n is 2, 3, or 4.
  • R 4 is -(CH 2 )nOH, and n is 2, 3, or 4.
  • R’ branched is : m and I are each 5, each R’ independently is a C 2-5 alkyl, R ay and R by are each a C 2-6 alkyl, R 4 is -(CH 2 )nOH, and n is 2.
  • the disclosure relates to a compound of Formula (ll-f): (ll-f) or its N-oxide, or a salt or isomer thereof, wherein R’ a is R’ branched or R’ cyclic ; wherein R’ branched is and wherein denotes a point of attachment;
  • R av is a C 1-12 alkyl
  • R 2 and R 3 are each independently a C 1-14 alkyl
  • R 4 is -(CH 2 )nOH wherein n is selected from the group consisting of 1 , 2, 3, 4, and 5;
  • R’ is a C 1-12 alkyl; m is selected from 4, 5, and 6; and
  • I is selected from 4, 5, and 6.
  • m and I are each 5, and n is 2, 3, or 4.
  • R’ is a C 2-5 alkyl
  • R av is a C 2-6 alkyl
  • R 2 and R 3 are each a C 6-10 alkyl.
  • m and I are each 5, n is 2, 3, or 4, R’ is a C 2-5 alkyl, R a * is a C 2-6 alkyl, and R 2 and R 3 are each a C 6-10 alkyl.
  • the disclosure relates to a compound of Formula (I l-g) :
  • R’ is a C 2-5 alkyl
  • R 4 is selected from the group consisting of -(CH 2 )nOH wherein n is selected from the group consisting of 3, 4, and 5, and wherein denotes a point of attachment, R 10 is NH(C 1-6 alkyl), and n2 is selected from the group consisting of 1 , 2, and 3.
  • the disclosure relates to a compound of Formula (I l-h) :
  • R ay and R by are each independently a C 2-6 alkyl; each R’ independently is a C 2-5 alkyl; and
  • R 4 is selected from the group consisting of -(CH 2 )nOH wherein n is selected from the group consisting of 3, 4, and 5, and wherein denotes a point of attachment,
  • R 10 is NH(C 1-6 alkyl), and n2 is selected from the group consisting of 1 , 2, and 3.
  • R 4 is wherein
  • R 10 is NH(CH 3 ) and n2 is 2.
  • R 4 is -(CH 2 )2OH.
  • the disclosure relates to a compound having the Formula (III): or a salt or isomer thereof, wherein
  • R1 , R 2 , R 3 , R 4 , and Rs are independently selected from the group consisting of C5-20 alkyl, C5-20 alkenyl, -R”MR’, -R*YR”, -YR”, and -R*OR”; each M is independently selected from the group consisting of -C(O)O-, -OC(O)-, -OC(O)O-, -C(O)N(R’)-, -N(R’)C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR’)O-, -S(O) 2 -, an aryl group, and a heteroaryl group;
  • X 1 , X 2 , and X 3 are independently selected from the group consisting of a bond, -CH 2 -, -(CH 2 ) 2 -, -CHR-, -CHY-, -C(O)-, -C(O)O-, -OC(O)-, -C(O)-CH 2 -, -CH 2 -C(O)-, -C(O)O-CH 2 -, -OC(O)-CH 2 -, -CH 2 -C(O)O-, -CH 2 -OC(O)-, -CH(OH)-, -C(S)-, and -CH(SH)-; each Y is independently a C3-6 carbocycle; each R* is independently selected from the group consisting of C 1-12 alkyl and C 2-12 alkenyl; each R is independently selected from the group consisting of C 1-3 alkyl and a C3-6 carbocycle; each R’ is independently selected from
  • R1 , R 2 , R 3 , R 4 , and Rs are each C5-20 alkyl; X 1 is -CH 2 -; and X 2 and X 3 are each -C(O)-.
  • the compound of Formula (III) is: (Compound l-VI), or a salt or isomer thereof. c. Phospholipids
  • the lipid composition of the lipid nanoparticle composition disclosed herein can comprise one or more phospholipids, for example, one or more saturated or (poly)unsaturated phospholipids or a combination thereof.
  • phospholipids comprise a phospholipid moiety and one or more fatty acid moieties.
  • a phospholipid moiety can be selected, for example, from the non-limiting group consisting of phosphatidyl choline, phosphatidyl ethanolamine, phosphatidyl glycerol, phosphatidyl serine, phosphatidic acid, 2-lysophosphatidyl choline, and a sphingomyelin.
  • a fatty acid moiety can be selected, for example, from the non-limiting group consisting of lauric acid, myristic acid, myristoleic acid, palmitic acid, palmitoleic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, erucic acid, phytanoic acid, arachidic acid, arachidonic acid, eicosapentaenoic acid, behenic acid, docosapentaenoic acid, and docosahexaenoic acid.
  • Particular phospholipids can facilitate fusion to a membrane.
  • a cationic phospholipid can interact with one or more negatively charged phospholipids of a membrane (e.g., a cellular or intracellular membrane). Fusion of a phospholipid to a membrane can allow one or more elements (e.g., a therapeutic agent) of a lipid-containing composition (e.g., LNPs) to pass through the membrane permitting, e.g., delivery of the one or more elements to a target tissue.
  • a cationic phospholipid can interact with one or more negatively charged phospholipids of a membrane (e.g., a cellular or intracellular membrane). Fusion of a phospholipid to a membrane can allow one or more elements (e.g., a therapeutic agent) of a lipid-containing composition (e.g., LNPs) to pass through the membrane permitting, e.g., delivery of the one or more elements to a target tissue.
  • elements e.g., a therapeutic agent
  • Non-natural phospholipid species including natural species with modifications and substitutions including branching, oxidation, cyclization, and alkynes are also contemplated.
  • a phospholipid can be functionalized with or cross-linked to one or more alkynes (e.g., an alkenyl group in which one or more double bonds is replaced with a triple bond).
  • an alkyne group can undergo a copper-catalyzed cycloaddition upon exposure to an azide.
  • Such reactions can be useful in functionalizing a lipid bilayer of a nanoparticle composition to facilitate membrane permeation or cellular recognition or in conjugating a nanoparticle composition to a useful component such as a targeting or imaging moiety (e.g., a dye).
  • Phospholipids include, but are not limited to, glycerophospholipids such as phosphatidylcholines, phosphatidylethanolamines, phosphatidylserines, phosphatidylinositols, phosphatidy glycerols, and phosphatidic acids. Phospholipids also include phosphosphingolipid, such as sphingomyelin.
  • a phospholipid of the present disclosure comprises 1 ,2-distearoyl-sn- glycero-3-phosphocholine (DSPC), 1 ,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1 ,2- dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1 ,2-dimyristoyl-sn-gly cero-phosphocholine (DMPC),
  • DOPC 1,3-dioleoyl-sn-glycero-3-phosphocholine
  • DPPC l,2-dipalmitoyl-sn-glycero-3-phosphocholine
  • 1 .2-diundecanoyl-sn-glycero-phosphocholine (DUPC), 1 -palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1 ,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 Diether PC), 1 -oleoyl-2 cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), 1 -hexadecyl-sn-glycero-3- phosphocholine (C16 Lyso PC), 1 ,2-dilinolenoyl-sn-glycero-3-phosphocholine,1 ,2-diarachidonoyl-sn- glycero-3-phosphocholine, 1 ,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1
  • a phospholipid useful or potentially useful in the present disclosure is an analog or variant of DSPC. In certain embodiments, a phospholipid useful or potentially useful in the present disclosure is a compound of Formula (IV):
  • each R 1 is independently optionally substituted alkyl; or optionally two R 1 are joined together with the intervening atoms to form optionally substituted monocyclic carbocyclyl or optionally substituted monocyclic heterocyclyl; or optionally three R 1 are joined together with the intervening atoms to form optionally substituted bicyclic carbocyclyl or optionally substitute bicyclic heterocyclyl; n is 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10; m is 0, 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10;
  • each instance of L 2 is independently a bond or optionally substituted C 1-6 alkylene, wherein one methylene unit of the optionally substituted C 1-6 alkylene is optionally replaced with O, N(R N ), S, C(O), - C(O)N(R N ), NR N C(O), C(O)O, OC(O), OC(O)O, OC(O)N(R N ), NR N C(O)O, or NR N C(O)N(R N ); each instance of R 2 is independently optionally substituted C 1-3 0 alkyl, optionally substituted C 1-3 0 alkenyl, or optionally substituted C 1-3 0 alkynyl; optionally wherein one or more methylene units of R 2 are independently replaced with optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(R N ), O, S, C(O), C
  • Ring B is optionally substituted carbocyclyl, optionally substituted heterocyclyl, optionally substituted aryl, or optionally substituted heteroaryl; and p is 1 or 2; provided that the compound is not of the Formula: wherein each instance of R 2 is independently unsubstituted alkyl, unsubstituted alkenyl, or unsubstituted alkynyl.
  • the phospholipids may be one or more of the phospholipids described in U.S. Application No. 62/520,530. i. Phospholipid Head Modifications
  • a phospholipid useful or potentially useful in the present disclosure comprises a modified phospholipid head (e.g., a modified choline group).
  • a phospholipid with a modified head is DSPC, or analog thereof, with a modified quaternary amine.
  • at least one of R 1 is not methyl. In certain embodiments, at least one of R 1 is not hydrogen or methyl.
  • the compound of Formula (IV) is of one of the following Formulae: or a salt thereof, wherein: each t is independently 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10; each u is independently 0, 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10; and each v is independently 1 , 2, or 3.
  • a compound of Formula (IV) is of Formula (IV-a):
  • a phospholipid useful or potentially useful in the present disclosure comprises a cyclic moiety in place of the glyceride moiety.
  • a phospholipid useful in the present disclosure is DSPC, or analog thereof, with a cyclic moiety in place of the glyceride moiety.
  • the compound of Formula (IV) is of Formula (IV-b): or a salt thereof. ii. Phospholipid Tail Modifications
  • a phospholipid useful or potentially useful in the present disclosure comprises a modified tail.
  • a phospholipid useful or potentially useful in the present disclosure is DSPC, or analog thereof, with a modified tail.
  • a “modified tail” may be a tail with shorter or longer aliphatic chains, aliphatic chains with branching introduced, aliphatic chains with substituents introduced, aliphatic chains wherein one or more methylenes are replaced by cyclic or heteroatom groups, or any combination thereof.
  • a phospholipid useful or potentially useful in the present disclosure comprises a modified phosphocholine moiety, wherein the alkyl chain linking the quaternary amine to the phosphoryl group is not ethylene (e.g., n is not 2). Therefore, in certain embodiments, a phospholipid useful or potentially useful in the present disclosure is a compound of Formula (IV), wherein n is 1 , 3, 4, 5, 6, 7, 8, 9, or 10.
  • a compound of Formula (IV) is of one of the following Formulae: or a salt thereof.
  • a phospholipid useful or potentially useful in the present disclosure comprises a modified phosphocholine moiety, wherein the alkyl chain linking the quaternary amine to the phosphoryl group is not ethylene (e.g., n is not 2). Therefore, in certain embodiments, a phospholipid useful.
  • an alternative lipid is used in place of a phospholipid of the present disclosure.
  • an alternative lipid of the present disclosure is oleic acid.
  • the alternative lipid is one of the following: d. Structural Lipids
  • the lipid composition of a pharmaceutical composition disclosed herein can comprise one or more structural lipids.
  • structural lipid refers to sterols and also to lipids containing sterol moieties.
  • Structural lipids can be selected from the group including but not limited to, cholesterol, fecosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, tomatine, ursolic acid, alpha-tocopherol, hopanoids, phytosterols, steroids, and mixtures thereof.
  • the structural lipid is a sterol.
  • sterols are a subgroup of steroids consisting of steroid alcohols.
  • the structural lipid is a steroid.
  • the structural lipid is cholesterol.
  • the structural lipid is an analog of cholesterol.
  • the structural lipid is alpha-tocopherol.
  • the structural lipids may be one or more of the structural lipids described in U.S. Application No. 62/520,530. e. Polyetylene Glycol-Lipids
  • the lipid composition of a pharmaceutical composition disclosed herein can comprise one or more a polyethylene glycol (PEG) lipid.
  • PEG polyethylene glycol
  • PEG-lipid refers to polyethylene glycol (PEG)-modified lipids.
  • PEG-lipids include PEG-modified phosphatidylethanolamine and phosphatidic acid, PEG-ceramide conjugates (e.g., PEG-CerC14 or PEG-CerC20), PEG-modified dialkylamines and PEG- modified 1 ,2-diacyloxypropan-3-amines.
  • PEG-lipids are also referred to as PEGylated lipids.
  • a PEG lipid can be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, or a PEG-DSPE lipid.
  • the PEG-lipid includes, but not limited to 1 ,2-dimyristoyl-sn-glycerol methoxypolyethylene glycol (PEG-DMG), 1 ,2-distearoyl-sn-glycero-3-phosphoethanolamine-N- [amino(polyethylene glycol)] (PEG-DSPE), PEG-disteryl glycerol (PEG-DSG), PEG-dipalmetoleyl, PEG- dioleyl, PEG-distearyl, PEG-diacylglycamide (PEG-DAG), PEG-dipalmitoyl phosphatidylethanolamine (PEG-DPPE), or PEG-l,2-dimyristyloxlpropyl-3
  • the PEG-lipid is selected from the group consisting of a PEG-modified phosphatidylethanolamine, a PEG-modified phosphatidic acid, a PEG-modified ceramide, a PEG- modified dialkylamine, a PEG-modified diacylglycerol, a PEG-modified dialkylglycerol, and mixtures thereof.
  • the lipid moiety of the PEG-lipids includes those having lengths of from about Cuto about C22, preferably from about Cuto about C .
  • a PEG moiety for example an mPEG-NH 2 , has a size of about 1000, 2000, 5000, 10,000, 15,000 or 20,000 daltons.
  • the PEG-lipid is PEG2k-DMG.
  • the lipid nanoparticles described herein can comprise a PEG lipid which is a non-diffusible PEG.
  • PEG lipid which is a non-diffusible PEG.
  • non-diffusible PEGs include PEG-DSG and PEG-DSPE.
  • PEG-lipids are known in the art, such as those described in U.S. Patent No. 8,158,601 and International Publ. No. WO 2015/130584 A2, which are incorporated herein by reference in their entirety.
  • the lipid component of a lipid nanoparticle composition may include one or more molecules comprising polyethylene glycol, such as PEG or PEG-modified lipids. Such species may be alternately referred to as PEGylated lipids.
  • a PEG lipid is a lipid modified with polyethylene glycol.
  • a PEG lipid may be selected from the non-limiting group including PEG-modified phosphatidylethanolamines, PEG- modified phosphatidic acids, PEG-modified ceramides, PEG-modified dialkylamines, PEG-modified diacylglycerols, PEG-modified dialkylglycerols, and mixtures thereof.
  • a PEG lipid may be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, or a PEG-DSPE lipid.
  • PEG-modified lipids are a modified form of PEG DMG.
  • PEG-DMG has the following structure:
  • PEG lipids useful in the present disclosure can be PEGylated lipids described in International Publication No. WO2012099755, the contents of which is herein incorporated by reference in its entirety. Any of these exemplary PEG lipids described herein may be modified to comprise a hydroxyl group on the PEG chain.
  • the PEG lipid is a PEG-OH lipid.
  • a “PEG-OH lipid” (also referred to herein as “hydroxy-PEGylated lipid”) is a PEGylated lipid having one or more hydroxyl (-OH) groups on the lipid.
  • the PEG-OH lipid includes one or more hydroxyl groups on the PEG chain.
  • a PEG- OH or hydroxy-PEGylated lipid comprises an -OH group at the terminus of the PEG chain.
  • a PEG lipid useful in the present disclosure is a compound of Formula (V).
  • R 3 is -OR 0 ;
  • is hydrogen, optionally substituted alkyl, or an oxygen protecting group; r is an integer between 1 and 100, inclusive;
  • L 1 is optionally substituted C 1 -10 alkylene, wherein at least one methylene of the optionally substituted C 1 -10 alkylene is independently replaced with optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, O, N(R N ), S, C(O), C(O)N(R N ), NR N C(O), C(O)O, OC(O), 00(O)0, 0C(O)N(R N ), NR N C(O)0, or NR N C(O)N(R N );
  • D is a moiety obtained by click chemistry or a moiety cleavable under physiological conditions; m is 0, 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10;
  • each instance of L 2 is independently a bond or optionally substituted C 1-6 alkylene, wherein one methylene unit of the optionally substituted C 1-6 alkylene is optionally replaced with O, N(R N ), S, C(O), - C(O)N(R N ), NR N C(O), 0(O)0, 00(O), 00(O)0, 0C(O)N(R N ), NR N C(O)0, or NR N C(O)N(R N ); each instance of R 2 is independently optionally substituted C 1-3 0 alkyl, optionally substituted C 1-3 0 alkenyl, or optionally substituted C 1-3 0 alkynyl; optionally wherein one or more methylene units of R 2 are independently replaced with optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(R N ), O, S, C(O), - C(
  • Ring B is optionally substituted carbocyclyl, optionally substituted heterocyclyl, optionally substituted aryl, or optionally substituted heteroaryl; and p is 1 or 2.
  • the compound of Fomula (V) is a PEG-OH lipid (i.e., R 3 is -OR 0 , and R° is hydrogen).
  • the compound of Formula (V) is of Formula (V-OH): (V-OH), or a salt thereof.
  • a PEG lipid useful in the present disclosure is a PEGylated fatty acid.
  • a PEG lipid useful in the present disclosure is a compound of Formula (VI).
  • R 3 is-OR°
  • is hydrogen, optionally substituted alkyl or an oxygen protecting group; r is an integer between 1 and 100, inclusive;
  • the compound of Formula (VI) is of Formula (VI-OH): or a salt thereof. In some embodiments, r is 45.
  • the compound of Formula (VI) is: or a salt thereof. In one embodiment, r is 40-50.
  • the compound of Formula (VI) is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl
  • the lipid composition of the pharmaceutical compositions disclosed herein does not comprise a PEG-lipid.
  • the PEG-lipids may be one or more of the PEG lipids described in U.S. Application No. 62/520,530.
  • a PEG lipid of the present disclosure comprises a PEG-modified phosphatidylethanolamine, a PEG-modified phosphatidic acid, a PEG-modified ceramide, a PEG- modified dialkylamine, a PEG-modified diacylglycerol, a PEG-modified dialkylglycerol, and mixtures thereof.
  • the PEG-modified lipid is PEG-DMG, PEG-c-DOMG (also referred to as PEG-DOMG), PEG-DSG and/or PEG-DPG.
  • a LNP of the present disclosure comprises an ionizable cationic lipid of any of Formula I, II or III, a phospholipid comprising DSPC, a structural lipid, and a PEG lipid comprising PEG-DMG.
  • a LNP of the present disclosure comprises an ionizable cationic lipid of any of Formula I, II or III, a phospholipid comprising DSPC, a structural lipid, and a PEG lipid comprising a compound having Formula VI.
  • a LNP of the present disclosure comprises an ionizable cationic lipid of Formula I, II or III, a phospholipid comprising a compound having Formula IV, a structural lipid, and the PEG lipid comprising a compound having Formula V or VI.
  • a LNP of the present disclosure comprises an ionizable cationic lipid of Formula I, II or III, a phospholipid comprising a compound having Formula IV, a structural lipid, and the PEG lipid comprising a compound having Formula V or VI.
  • a LNP of the present disclosure comprises an ionizable cationic lipid of Formula I, II or III, a phospholipid having Formula IV, a structural lipid, and a PEG lipid comprising a compound having Formula VI.
  • a LNP of the present disclosure comprises an ionizable cationic lipid of and a PEG lipid comprising Formula VI.
  • a LNP of the present disclosure comprises an ionizable cationic lipid of and an alternative lipid comprising oleic acid.
  • a LNP of the present disclosure comprises an ionizable cationic lipid of an alternative lipid comprising oleic acid, a structural lipid comprising cholesterol, and a PEG lipid comprising a compound having Formula VI.
  • a LNP of the present disclosure comprises an ionizable cationic lipid of a phospholipid comprising DOPE, a structural lipid comprising cholesterol, and a PEG lipid comprising a compound having Formula VI.
  • a LNP of the present disclosure comprises an ionizable cationic lipid of a phospholipid comprising DOPE, a structural lipid comprising cholesterol, and a PEG lipid comprising a compound having Formula VI.
  • a LNP of the present disclosure comprises an N:P ratio of from about 2:1 to about 30:1 .
  • a LNP of the present disclosure comprises an N:P ratio of about 6:1 .
  • a LNP of the present disclosure comprises an N:P ratio of about 3:1 .
  • a LNP of the present disclosure comprises a wt/wt ratio of the ionizable cationic lipid component to the RNA of from about 10:1 to about 100:1 .
  • a LNP of the present disclosure comprises a wt/wt ratio of the ionizable cationic lipid component to the RNA of about 20:1 .
  • a LNP of the present disclosure comprises a wt/wt ratio of the ionizable cationic lipid component to the RNA of about 10:1 .
  • a LNP of the present disclosure has a mean diameter from about 50nm to about 150nm.
  • a LNP of the present disclosure has a mean diameter from about 70nm to about 120nm.
  • alkyl As used herein, the term “alkyl”, “alkyl group”, or “alkylene” means a linear or branched, saturated hydrocarbon including one or more carbon atoms (e.g., one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, or more carbon atoms), which is optionally substituted.
  • the notation "Ci i4 alkyl” means an optionally substituted linear or branched, saturated hydrocarbon including 1 -14 carbon atoms. Unless otherwise specified, an alkyl group described herein refers to both unsubstituted and substituted alkyl groups.
  • alkenyl means a linear or branched hydrocarbon including two or more carbon atoms (e.g., two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, or more carbon atoms) and at least one double bond, which is optionally substituted.
  • C 2-14 alkenyl means an optionally substituted linear or branched hydrocarbon including 2-14 carbon atoms and at least one carbon-carbon double bond.
  • An alkenyl group may include one, two, three, four, or more carbon-carbon double bonds.
  • C 18 alkenyl may include one or more double bonds.
  • a C 18 alkenyl group including two double bonds may be a linoleyl group.
  • an alkenyl group described herein refers to both unsubstituted and substituted alkenyl groups.
  • alkynyl means a linear or branched hydrocarbon including two or more carbon atoms (e.g., two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, or more carbon atoms) and at least one carbon-carbon triple bond, which is optionally substituted.
  • C 2-14 alkynyl means an optionally substituted linear or branched hydrocarbon including 2-14 carbon atoms and at least one carbon-carbon triple bond.
  • An alkynyl group may include one, two, three, four, or more carbon-carbon triple bonds.
  • C 18 alkynyl may include one or more carbon-carbon triple bonds.
  • an alkynyl group described herein refers to both unsubstituted and substituted alkynyl groups.
  • Carbocycle or “carbocyclic group” means an optionally substituted mono- or multi-cyclic system including one or more rings of carbon atoms. Rings may be three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, or twenty membered rings.
  • C3-6 carbocycle means a carbocycle including a single ring having 3-6 carbon atoms. Carbocycles may include one or more carbon-carbon double or triple bonds and may be non-aromatic or aromatic (e.g., cycloalkyl or aryl groups).
  • carbocycles include cyclopropyl, cyclopentyl, cyclohexyl, phenyl, naphthyl, and 1 ,2 dihydronaphthyl groups.
  • cycloalkyl as used herein means a non-aromatic carbocycle and may or may not include any double or triple bond.
  • carbocycles described herein refers to both unsubstituted and substituted carbocycle groups, i.e., optionally substituted carbocycles.
  • heterocycle or “heterocyclic group” means an optionally substituted mono- or multi-cyclic system including one or more rings, where at least one ring includes at least one heteroatom.
  • Heteroatoms may be, for example, nitrogen, oxygen, or sulfur atoms. Rings may be three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, or fourteen membered rings.
  • Heterocycles may include one or more double or triple bonds and may be non-aromatic or aromatic (e.g., heterocycloalkyl or heteroaryl groups).
  • heterocycles include imidazolyl, imidazolidinyl, oxazolyl, oxazolidinyl, thiazolyl, thiazolidinyl, pyrazolidinyl, pyrazolyl, isoxazolidinyl, isoxazolyl, isothiazolidinyl, isothiazolyl, morpholinyl, pyrrolyl, pyrrolidinyl, furyl, tetrahydrofuryl, thiophenyl, pyridinyl, piperidinyl, quinolyl, and isoquinolyl groups.
  • heterocycloalkyl as used herein means a non- aromatic heterocycle and may or may not include any double or triple bond. Unless otherwise specified, heterocycles described herein refers to both unsubstituted and substituted heterocycle groups, i.e., optionally substituted heterocycles.
  • heteroalkyl refers respectively to an alkyl, alkenyl, alkynyl group, as defined herein, which further comprises one or more (e.g., 1 , 2, 3, or 4) heteroatoms (e.g., oxygen, sulfur, nitrogen, boron, silicon, phosphorus) wherein the one or more heteroatoms is inserted between adjacent carbon atoms within the parent carbon chain and/or one or more heteroatoms is inserted between a carbon atom and the parent molecule, i.e., between the point of attachment.
  • heteroatoms e.g., oxygen, sulfur, nitrogen, boron, silicon, phosphorus
  • heteroalkyls, heteroalkenyls, or heteroalkynyls described herein refers to both unsubstituted and substituted heteroalkyls, heteroalkenyls, or heteroalkynyls, i.e., optionally substituted heteroalkyls, heteroalkenyls, or heteroalkynyls.
  • a "biodegradable group” is a group that may facilitate faster metabolism of a lipid in a mammalian entity.
  • a biodegradable group may be selected from the group consisting of, but is not limited to, -C(O)O-, -OC(O)-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, - P(O)(OR')O-, -S(O)2-, an aryl group, and a heteroaryl group.
  • an "aryl group” is an optionally substituted carbocyclic group including one or more aromatic rings.
  • aryl groups include phenyl and naphthyl groups.
  • a "heteroaryl group” is an optionally substituted heterocyclic group including one or more aromatic rings.
  • heteroaryl groups include pyrrolyl, furyl, thiophenyl, imidazolyl, oxazolyl, and thiazolyl. Both aryl and heteroaryl groups may be optionally substituted.
  • M and M' can be selected from the non-limiting group consisting of optionally substituted phenyl, oxazole, and thiazole.
  • M and M' can be independently selected from the list of biodegradable groups above.
  • aryl or heteroaryl groups described herein refers to both unsubstituted and substituted groups, i.e., optionally substituted aryl or heteroaryl groups.
  • Alkyl, alkenyl, and cyclyl (e.g., carbocyclyl and heterocyclyl) groups may be optionally substituted unless otherwise specified.
  • R is an alkyl or alkenyl group, as defined herein.
  • the substituent groups themselves may be further substituted with, for example, one, two, three, four, five, or six substituents as defined herein.
  • a C 1-6 alkyl group may be further substituted with one, two, three, four, five, or six substituents as described herein.
  • N-oxides can be converted to N-oxides by treatment with an oxidizing agent (e.g., 3-chloroperoxybenzoic acid (mCPBA) and/or hydrogen peroxides) to afford other compounds of the disclosure.
  • an oxidizing agent e.g., 3-chloroperoxybenzoic acid (mCPBA) and/or hydrogen peroxides
  • mCPBA 3-chloroperoxybenzoic acid
  • hydrogen peroxides e.g., 3-chloroperoxybenzoic acid (mCPBA) and/or hydrogen peroxides
  • N-OH N-hydroxy
  • N-alkoxy i.e., N-OR, wherein R is substituted or unsubstituted C 1 -C 6 alkyl, C 1 -C 6 alkenyl, C 1 -C 6 alkynyl, 3-14-membered carbocycle or 3-14-membered heterocycle
  • R is substituted or unsubstituted C 1 -C 6 alkyl, C 1 -C 6 alkenyl, C 1 -C 6 alkynyl, 3-14-membered carbocycle or 3-14-membered heterocycle
  • the lipid composition of a pharmaceutical composition disclosed herein can include one or more components in addition to those described above.
  • the lipid composition can include one or more permeability enhancer molecules, carbohydrates, polymers, surface altering agents (e.g., surfactants), or other components.
  • a permeability enhancer molecule can be a molecule described by U.S. Patent Application Publication No. 2005/0222064.
  • Carbohydrates can include simple sugars (e.g., glucose) and polysaccharides (e.g., glycogen and derivatives and analogs thereof).
  • a polymer can be included in and/or used to encapsulate or partially encapsulate a pharmaceutical composition disclosed herein (e.g., a pharmaceutical composition in lipid nanoparticle form).
  • a polymer can be biodegradable and/or biocompatible.
  • a polymer can be selected from, but is not limited to, polyamines, polyethers, polyamides, polyesters, polycarbamates, polyureas, polycarbonates, polystyrenes, polyimides, polysulfones, polyurethanes, polyacetylenes, polyethylenes, polyethyleneimines, polyisocyanates, polyacrylates, polymethacrylates, polyacrylonitriles, and polyarylates.
  • the ratio between the lipid composition and the polynucleotide range can be from about 10:1 to about 60:1 (wt/wt).
  • the ratio between the lipid composition and the polynucleotide can be about 10:1 , 11 :1 , 12:1 , 13:1 , 14:1 , 15:1 , 16:1 , 17:1 , 18:1 , 19:1 , 20:1 , 21 :1 , 22:1 , 23:1 , 24:1 , 25:1 , 26:1 , 27:1 , 28:1 , 29:1 , 30:1 , 31 :1 , 32:1 , 33:1 , 34:1 , 35:1 , 36:1 , 37:1 , 38:1 , 39:1 , 40:1 , 41 :1 , 42:1 , 43:1 , 44:1 , 45:1 , 46:1 , 47:1 , 48:1 , 49:1 , 50:1 , 51 :1 , 52:1 , 53:1 , 54:1 , 55
  • the pharmaceutical composition disclosed herein can contain more than one polypeptide.
  • a pharmaceutical composition disclosed herein can contain two or more polynucleotides (e.g., RNA, e.g., mRNA).
  • the lipid nanoparticles described herein can comprise polynucleotides (e.g., mRNA) in a lipid polynucleotide weight ratio of 5:1 , 10:1 , 15:1 , 20:1 , 25:1 , 30:1 , 35:1 , 40:1 , 45:1 , 50:1 , 55:1 , 60:1 or 70:1 , or a range or any of these ratios such as, but not limited to, 5:1 to about 10:1 , from about 5:1 to about 15:1 , from about 5:1 to about 20:1 , from about 5:1 to about 25:1 , from about 5:1 to about 30:1 , from about 5:1 to about 35:1 , from about 5:1 to about 40:1 , from about 5:1 to about 45:1 , from about 5:1 to about 50:1 , from about 5:1 to about 55:1 , from about 5:1 to
  • the lipid nanoparticles described herein can comprise the polynucleotide in a concentration from approximately 0.1 mg/ml to 2 mg/ml such as, but not limited to, 0.1 mg/ml, 0.2 mg/ml, 0.3 mg/ml, 0.4 mg/ml, 0.5 mg/ml, 0.6 mg/ml, 0.7 mg/ml, 0.8 mg/ml, 0.9 mg/ml, 1 .0 mg/ml, 1 .1 mg/ml, 1 .2 mg/ml, 1 .3 mg/ml, 1 .4 mg/ml, 1 .5 mg/ml, 1 .6 mg/ml, 1 .7 mg/ml, 1 .8 mg/ml, 1 .9 mg/ml, 2.0 mg/ml or greater than 2.0 mg/ml.
  • Nanoparticle Compositions 1 .0 mg/ml, 1 .1 mg/ml, 1 .2 mg/ml, 1 .3 mg/
  • the pharmaceutical compositions disclosed herein are Formulated as lipid nanoparticles (LNP). Accordingly, the present disclosure also provides nanoparticle compositions comprising (i) a lipid composition comprising a delivery agent such as compound as described herein, and (ii) a polynucleotide containing an IRES described herein and encoding a polypeptide of interest. In such nanoparticle composition, the lipid composition disclosed herein can encapsulate the polynucleotide containing the IRES and encoding the polypeptide.
  • Nanoparticle compositions are typically sized on the order of micrometers or smaller and can include a lipid bilayer.
  • Nanoparticle compositions encompass lipid nanoparticles (LNPs), liposomes (e.g., lipid vesicles), and lipoplexes.
  • LNPs lipid nanoparticles
  • liposomes e.g., lipid vesicles
  • lipoplexes e.g., lipoplexes.
  • a nanoparticle composition can be a liposome having a lipid bilayer with a diameter of 500 nm or less.
  • Nanoparticle compositions include, for example, lipid nanoparticles (LNPs), liposomes, and lipoplexes.
  • LNPs lipid nanoparticles
  • nanoparticle compositions are vesicles including one or more lipid bilayers.
  • a nanoparticle composition includes two or more concentric bilayers separated by aqueous compartments.
  • Lipid bilayers can be functionalized and/or crosslinked to one another.
  • Lipid bilayers can include one or more ligands, proteins, or channels.
  • a lipid nanoparticle comprises an ionizable amino lipid, a structural lipid, a phospholipid, and mRNA.
  • the LNP comprises an ionizable amino lipid, a PEG- modified lipid, a sterol and a structural lipid.
  • the LNP has a molar ratio of about 40-50% ionizable amino lipid; about 5-15% structural lipid; about 30-45% sterol; and about 1 -5% PEG- modified lipid.
  • the lipid nanoparticle comprises 47-49 mol.% ionizable cationic lipid (e.g. ionizable amino lipid, e.g., Compound 1-1 , Compound I-2, or Compound I-3), 10-12 mol.% non-cationic lipid (e.g., phospholipid, e.g., DSPC), 38-40 mol.% sterol (e.g., cholesterol) or other structural lipid, and 1 - 3 mol.% PEG-modified lipid (e.g., PEG-DMG or Compound P-l).
  • ionizable cationic lipid e.g. ionizable amino lipid, e.g., Compound 1-1 , Compound I-2, or Compound I-3
  • 10-12 mol.% non-cationic lipid e.g., phospholipid, e.g., DSPC
  • 38-40 mol.% sterol e.g., cholesterol
  • the lipid nanoparticle (“LNP-1 ”) may comprise the following components at the following molar ratios:
  • sterol e.g., cholesterol
  • PEG-lipid e.g., Compound P-l or PEG-DMG.
  • the lipid nanoparticle (“LNP-1 A”) may comprise the following components at the following molar ratios: (i) 45-50 mol.% Compound 1-1
  • the lipid nanoparticle (“LNP-1 B”) may comprise the following components at the following molar ratios:
  • the lipid nanoparticle (“LNP-2”) may comprise the following:
  • sterol e.g., Cholesterol
  • PEG-lipid e.g., Compound P-l or PEG-DMG.
  • the lipid nanoparticle (“LNP-2A”) may comprise the following:
  • the lipid nanoparticle (“LNP-2B”) may comprise the following components at the following molar ratios:
  • the lipid nanoparticle (“LNP-3”) may comprise the following:
  • sterol e.g., Cholesterol
  • PEG-lipid e.g., Compound P-l or PEG-DMG.
  • the lipid nanoparticle (“LNP-3A”) may comprise the following:
  • the lipid nanoparticle (“LNP-3B”) may comprise the following:
  • the LNP has a polydispersity value of less than 0.4. In some embodiments, the LNP has a net neutral charge at a neutral pH. In some embodiments, the LNP has a mean diameter of 50-150 nm. In some embodiments, the LNP has a mean diameter of 80-100 nm.
  • lipid refers to a small molecule that has hydrophobic or amphiphilic properties. Lipids may be naturally occurring or synthetic. Examples of classes of lipids include, but are not limited to, fats, waxes, sterol-containing metabolites, vitamins, fatty acids, glycerolipids, glycerophospholipids, sphingolipids, saccharolipids, and polyketides, and prenol lipids. In some instances, the amphiphilic properties of some lipids leads them to form liposomes, vesicles, or membranes in aqueous media.
  • a lipid nanoparticle may comprise an ionizable amino lipid.
  • the term “ionizable amino lipid” has its ordinary meaning in the art and may refer to a lipid comprising one or more charged moieties.
  • an ionizable amino lipid may be positively charged or negatively charged.
  • An ionizable amino lipid may be positively charged, in which case it can be referred to as “cationic lipid”.
  • an ionizable amino lipid molecule may comprise an amine group, and can be referred to as an ionizable amino lipid.
  • a “charged moiety” is a chemical moiety that carries a formal electronic charge, e.g., monovalent (+1 , or -1 ), divalent (+2, or -2), trivalent (+3, or -3), etc.
  • the charged moiety may be anionic (i.e., negatively charged) or cationic (i.e., positively charged).
  • positively-charged moieties include amine groups (e.g., primary, secondary, and/or tertiary amines), ammonium groups, pyridinium groups, guanidine groups, and imidizolium groups.
  • the charged moieties comprise amine groups.
  • negatively- charged groups or precursors thereof include carboxylate groups, sulfonate groups, sulfate groups, phosphonate groups, phosphate groups, hydroxyl groups, and the like.
  • the charge of the charged moiety may vary, in some cases, with the environmental conditions, for example, changes in pH may alter the charge of the moiety, and/or cause the moiety to become charged or uncharged. In general, the charge density of the molecule may be selected as desired.
  • charge does not refer to a “partial negative charge” or “partial positive charge” on a molecule.
  • the terms “partial negative charge” and “partial positive charge” are given their ordinary meaning in the art.
  • a “partial negative charge” may result when a functional group comprises a bond that becomes polarized such that electron density is pulled toward one atom of the bond, creating a partial negative charge on the atom.
  • the ionizable amino lipid is sometimes referred to in the art as an “ionizable cationic lipid”.
  • the ionizable amino lipid may have a positively charged hydrophilic head and a hydrophobic tail that are connected via a linker structure.
  • an ionizable amino lipid may also be a lipid including a cyclic amine group.
  • the ionizable amino lipid may be selected from, but not limited to, an ionizable amino lipid described in International Publication Nos. WO2013086354 and WO2013116126; the contents of each of which are herein incorporated by reference in their entirety.
  • the ionizable amino lipid may be selected from, but not limited to, Formula CLI-CLXXXII of US Patent No. 7,404,969; each of which is herein incorporated by reference in their entirety.
  • the lipid may be a cleavable lipid such as those described in International Publication No. WO2012170889, herein incorporated by reference in its entirety.
  • the lipid may be synthesized by methods known in the art and/or as described in International Publication Nos. WO2013086354; the contents of each of which are herein incorporated by reference in their entirety.
  • Nanoparticle compositions can be characterized by a variety of methods. For example, microscopy (e.g., transmission electron microscopy or scanning electron microscopy) can be used to examine the morphology and size distribution of a nanoparticle composition. Dynamic light scattering or potentiometry (e.g., potentiometric titrations) can be used to measure zeta potentials. Dynamic light scattering can also be utilized to determine particle sizes. Instruments such as the Zetasizer Nano ZS (Malvern Instruments Ltd, Malvern, Worcestershire, UK) can also be used to measure multiple characteristics of a nanoparticle composition, such as particle size, polydispersity index, and zeta potential.
  • microscopy e.g., transmission electron microscopy or scanning electron microscopy
  • Dynamic light scattering or potentiometry e.g., potentiometric titrations
  • Dynamic light scattering can also be utilized to determine particle sizes.
  • Instruments such as the Ze
  • the size of the nanoparticles can help counter biological reactions such as, but not limited to, inflammation, or can increase the biological effect of the polynucleotide.
  • size or “mean size” in the context of nanoparticle compositions refers to the mean diameter of a nanoparticle composition.
  • a polynucleotide of the disclosure is formulated in lipid nanoparticles having a diameter from about 10 to about 100 nm such as, but not limited to, about 10 to about 20 nm, about 10 to about 30 nm, about 10 to about 40 nm, about 10 to about 50 nm, about 10 to about 60 nm, about 10 to about 70 nm, about 10 to about 80 nm, about 10 to about 90 nm, about 20 to about 30 nm, about 20 to about 40 nm, about 20 to about 50 nm, about 20 to about 60 nm, about 20 to about 70 nm, about 20 to about 80 nm, about 20 to about 90 nm, about 20 to about 100 nm, about 30 to about 40 nm, about 30 to about 50 nm, about 30 to about 60 nm, about 30 to about 70 nm, about 30 to about 80 nm, about 30 to about 90 nm, about 30 to about 100 nm, about 30 to about
  • the nanoparticles have a diameter from about 10 to 500 nm. In some embodiments, the nanoparticle has a diameter greater than 100 nm, greater than 150 nm, greater than 200 nm, greater than 250 nm, greater than 300 nm, greater than 350 nm, greater than 400 nm, greater than 450 nm, greater than 500 nm, greater than 550 nm, greater than 600 nm, greater than 650 nm, greater than 700 nm, greater than 750 nm, greater than 800 nm, greater than 850 nm, greater than 900 nm, greater than 950 nm or greater than 1000 nm.
  • the largest dimension of a nanoparticle composition is 1 pm or shorter (e.g., 1 pm, 900 nm, 800 nm, 700 nm, 600 nm, 500 nm, 400 nm, 300 nm, 200 nm, 175 nm, 150 nm, 125 nm, 100 nm, 75 nm, 50 nm, or shorter).
  • a nanoparticle composition can be relatively homogenous.
  • a polydispersity index can be used to indicate the homogeneity of a nanoparticle composition, e.g., the particle size distribution of the nanoparticle composition.
  • a small (e.g., less than 0.3) polydispersity index generally indicates a narrow particle size distribution.
  • a nanoparticle composition can have a polydispersity index from about 0 to about 0.25, such as 0.01 , 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11 , 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21 , 0.22, 0.23, 0.24, or 0.25.
  • the polydispersity index of a nanoparticle composition disclosed herein can be from about 0.10 to about 0.20.
  • the zeta potential of a nanoparticle composition can be used to indicate the electrokinetic potential of the composition.
  • the zeta potential can describe the surface charge of a nanoparticle composition.
  • Nanoparticle compositions with relatively low charges, positive or negative, are generally desirable, as more highly charged species can interact undesirably with cells, tissues, and other elements in the body.
  • the zeta potential of a nanoparticle composition disclosed herein can be from about -10 mV to about +20 mV, from about -10 mV to about +15 mV, from about 10 mV to about +10 mV, from about -10 mV to about +5 mV, from about -10 mV to about 0 mV, from about - 10 mV to about -5 mV, from about -5 mV to about +20 mV, from about -5 mV to about +15 mV, from about -5 mV to about +10 mV, from about -5 mV to about +5 mV, from about -5 mV to about 0 mV, from about 0 mV to about +20 mV, from about 0 mV to about +15 mV, from about 0 mV to about +10 mV, from about 0 mV to about +5 mV, from about 0 mV to about +20
  • the zeta potential of the lipid nanoparticles can be from about 0 mV to about 100 mV, from about 0 mV to about 90 mV, from about 0 mV to about 80 mV, from about 0 mV to about 70 mV, from about 0 mV to about 60 mV, from about 0 mV to about 50 mV, from about 0 mV to about 40 mV, from about 0 mV to about 30 mV, from about 0 mV to about 20 mV, from about 0 mV to about 10 mV, from about 10 mV to about 100 mV, from about 10 mV to about 90 mV, from about 10 mV to about 80 mV, from about 10 mV to about 70 mV, from about 10 mV to about 60 mV, from about 10 mV to about 50 mV, from about 10 mV to about 40 mV, from about 10
  • the zeta potential of the lipid nanoparticles can be from about 10 mV to about 50 mV, from about 15 mV to about 45 mV, from about 20 mV to about 40 mV, and from about 25 mV to about 35 mV. In some embodiments, the zeta potential of the lipid nanoparticles can be about 10 mV, about 20 mV, about 30 mV, about 40 mV, about 50 mV, about 60 mV, about 70 mV, about 80 mV, about 90 mV, and about 100 mV.
  • encapsulation efficiency of a polynucleotide describes the amount of the polynucleotide that is encapsulated by or otherwise associated with a nanoparticle composition after preparation, relative to the initial amount provided.
  • encapsulation can refer to complete, substantial, or partial enclosure, confinement, surrounding, or encasement.
  • Encapsulation efficiency is desirably high (e.g., close to 100%).
  • the encapsulation efficiency can be measured, for example, by comparing the amount of the polynucleotide in a solution containing the nanoparticle composition before and after breaking up the nanoparticle composition with one or more organic solvents or detergents.
  • the encapsulation efficiency of a polynucleotide can be at least 50%, for example 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the encapsulation efficiency can be at least 80%. In certain embodiments, the encapsulation efficiency can be at least 90%.
  • the amount of a polynucleotide present in a pharmaceutical composition disclosed herein can depend on multiple factors such as the size of the polynucleotide, desired target and/or application, or other properties of the nanoparticle composition as well as on the properties of the polynucleotide.
  • the amount of an mRNA useful in a nanoparticle composition can depend on the size (expressed as length, or molecular mass), sequence, and other characteristics of the mRNA.
  • the relative amounts of a polynucleotide in a nanoparticle composition can also vary.
  • the relative amounts of the lipid composition and the polynucleotide present in a lipid nanoparticle composition of the present disclosure can be optimized according to considerations of efficacy and tolerability.
  • the N:P ratio can serve as a useful metric.
  • N:P ratio of a nanoparticle composition controls both expression and tolerability
  • nanoparticle compositions with low N:P ratios and strong expression are desirable.
  • N:P ratios vary according to the ratio of lipids to RNA in a nanoparticle composition.
  • RNA, lipids, and amounts thereof can be selected to provide an N:P ratio from about 2:1 to about 30:1 , such as 2:1 , 3:1 , 4:1 , 5:1 , 6:1 , 7:1 , 8:1 , 9:1 , 10:1 , 12:1 , 14:1 , 16:1 , 18:1 , 20:1 , 22:1 , 24:1 , 26:1 , 28:1 , or 30:1 .
  • the N:P ratio can be from about 2:1 to about 8:1 .
  • the N:P ratio is from about 5:1 to about 8:1 .
  • the N:P ratio is between 5:1 and 6:1 .
  • the N:P ratio is about is about 5.67:1 .
  • the present disclosure also provides methods of producing lipid nanoparticles comprising encapsulating a polynucleotide.
  • Such method comprises using any of the pharmaceutical compositions disclosed herein and producing lipid nanoparticles in accordance with methods of production of lipid nanoparticles known in the art. See, e.g., Wang et al. (2015) “Delivery of oligonucleotides with lipid nanoparticles” Adv. Drug Deliv. Rev. 87:68-80; Silva et al. (2015) “Delivery Systems for Biopharmaceuticals. Part I: Nanoparticles and Microparticles” Curr. Pharm. Technol. 16: 940-954; Naseri et al.
  • the LNP formulations described herein can additionally comprise a permeability enhancer molecule.
  • permeability enhancer molecules are described in U.S. Pub. No. US20050222064, herein incorporated by reference in its entirety.
  • the LNP formulations can further contain a phosphate conjugate.
  • the phosphate conjugate can increase in vivo circulation times and/or increase the targeted delivery of the nanoparticle.
  • Phosphate conjugates can be made by the methods described in, e.g., Inti. Pub. No. WO2013033438 or U.S. Pub. No. US20130196948.
  • the LNP formulation can also contain a polymer conjugate (e.g., a water soluble conjugate) as described in, e.g., U.S. Pub. Nos. US20130059360, US20130196948, and US20130072709. Each of the references is herein incorporated by reference in its entirety.
  • the LNP formulations can comprise a conjugate to enhance the delivery of nanoparticles of the present disclosure in a subject. Further, the conjugate can inhibit phagocytic clearance of the nanoparticles in a subject.
  • the conjugate can be a "self" peptide designed from the human membrane protein CD47 (e.g., the "self” particles described by Rodriguez et al, Science 2013 339, 971 -975, herein incorporated by reference in its entirety). As shown by Rodriguez et al., the self peptides delayed macrophage-mediated clearance of nanoparticles which enhanced delivery of the nanoparticles.
  • the LNP formulations can comprise a carbohydrate carrier.
  • the carbohydrate carrier can include, but is not limited to, an anhydride-modified phytoglycogen or glycogentype material, phytoglycogen octenyl succinate, phytoglycogen beta-dextrin, anhydride-modified phytoglycogen beta-dextrin (e.g., Inti. Pub. No. W02012109121 , herein incorporated by reference in its entirety).
  • the LNP formulations can be coated with a surfactant or polymer to improve the delivery of the particle.
  • the LNP can be coated with a hydrophilic coating such as, but not limited to, PEG coatings and/or coatings that have a neutral surface charge as described in U.S. Pub. No. US20130183244, herein incorporated by reference in its entirety.
  • the LNP formulations can be engineered to alter the surface properties of particles so that the lipid nanoparticles can penetrate the mucosal barrier as described in U.S. Pat. No. 8,241 ,670 or Inti. Pub. No. WO2013110028, each of which is herein incorporated by reference in its entirety.
  • the LNP engineered to penetrate mucus can comprise a polymeric material (i.e., a polymeric core) and/or a polymer-vitamin conjugate and/or a tri-block co-polymer.
  • the polymeric material can include, but is not limited to, polyamines, polyethers, polyamides, polyesters, polycarbamates, polyureas, polycarbonates, poly(styrenes), polyimides, polysulfones, polyurethanes, polyacetylenes, polyethylenes, polyethyeneimines, polyisocyanates, polyacrylates, polymethacrylates, polyacrylonitriles, and polyarylates.
  • LNP engineered to penetrate mucus can also include surface altering agents such as, but not limited to, polynucleotides, anionic proteins (e.g., bovine serum albumin), surfactants (e.g., cationic surfactants such as for example dimethyldioctadecyl-ammonium bromide), sugars or sugar derivatives (e.g., cyclodextrin), nucleic acids, polymers (e.g., heparin, polyethylene glycol and poloxamer), mucolytic agents (e.g., N-acetylcysteine, mugwort, bromelain, papain, clerodendrum, acetylcysteine, bromhexine, carbocisteine, eprazinone, mesna, ambroxol, sobrerol, domiodol, letosteine, stepronin, tiopronin, gelsolin, thymosin p4 do
  • the mucus penetrating LNP can be a hypotonic formulation comprising a mucosal penetration enhancing coating.
  • the formulation can be hypotonic for the epithelium to which it is being delivered.
  • hypotonic formulations can be found in, e.g., Inti. Pub. No. WO2013110028, herein incorporated by reference in its entirety.
  • the polynucleotide described herein is Formulated as a lipoplex, such as, without limitation, the ATUPLEXTM system, the DACC system, the DBTC system and other siRNA- lipoplex technology from Silence Therapeutics (London, United Kingdom), STEMFECTTM from STEMGENT® (Cambridge, MA), and polyethylenimine (PEI) or protamine-based targeted and nontargeted delivery of nucleic acids (Aleku et al. Cancer Res. 2008 68:9788-9798; Strumberg et al.
  • a lipoplex such as, without limitation, the ATUPLEXTM system, the DACC system, the DBTC system and other siRNA- lipoplex technology from Silence Therapeutics (London, United Kingdom), STEMFECTTM from STEMGENT® (Cambridge, MA), and polyethylenimine (PEI) or protamine-based targeted and nontargeted delivery of nucleic acids (Aleku et al. Cancer Res. 2008 68:9788
  • the polynucleotides described herein are Formulated as a solid lipid nanoparticle (SLN), which can be spherical with an average diameter between 10 to 1000 nm.
  • SLN possess a solid lipid core matrix that can solubilize lipophilic molecules and can be stabilized with surfactants and/or emulsifiers.
  • Exemplary SLN can be those as described in Inti. Pub. No. W02013105101 , herein incorporated by reference in its entirety.
  • the polynucleotides described herein can be Formulated for controlled release and/or targeted delivery.
  • controlled release refers to a pharmaceutical composition or compound release profile that conforms to a particular pattern of release to effect a therapeutic outcome.
  • the polynucleotides can be encapsulated into a delivery agent described herein and/or known in the art for controlled release and/or targeted delivery.
  • encapsulate means to enclose, surround or encase. As it relates to the formulation of the compounds of the present disclosure, encapsulation can be substantial, complete or partial.
  • substantially encapsulated means that at least greater than 50, 60, 70, 80, 85, 90, 95, 96, 97, 98, 99, or greater than 99% of the pharmaceutical composition or compound of the present disclosure can be enclosed, surrounded or encased within the delivery agent.
  • Partial encapsulation or “partially encapsulate” means that less than 10, 10, 20, 30, 40 50 or less of the pharmaceutical composition or compound of the present disclosure can be enclosed, surrounded or encased within the delivery agent.
  • encapsulation can be determined by measuring the escape or the activity of the pharmaceutical composition or compound of the present disclosure using fluorescence and/or electron micrograph. For example, at least 1 , 5, 10, 20, 30, 40, 50, 60, 70, 80, 85, 90, 95, 96, 97, 98, 99, 99.9, or greater than 99% of the pharmaceutical composition or compound of the present disclosure are encapsulated in the delivery agent.
  • the polynucleotides described herein can be encapsulated in a therapeutic nanoparticle, referred to herein as "therapeutic nanoparticle polynucleotides.”
  • Therapeutic nanoparticles can be Formulated by methods described in, e.g., Inti. Pub. Nos. WO2010005740, WO2010030763, WO2010005721 , WO2010005723, and WO2012054923; and U.S. Pub. Nos.
  • the therapeutic nanoparticle polynucleotide can be Formulated for sustained release.
  • sustained release refers to a pharmaceutical composition or compound that conforms to a release rate over a specific period of time.
  • the period of time can include, but is not limited to, hours, days, weeks, months and years.
  • the sustained release nanoparticle of the polynucleotides described herein can be Formulated as disclosed in Inti. Pub. No. WO2010075072 and U.S. Pub. Nos. US20100216804, US20110217377, US20120201859 and US20130150295, each of which is herein incorporated by reference in their entirety.
  • the therapeutic nanoparticle polynucleotide can be Formulated to be target specific, such as those described in Inti. Pub. Nos. WO2008121949, WO2010005726, WO2010005725, WO2011084521 and WO2011084518; and U.S. Pub. Nos. US20100069426, US20120004293 and US20100104655, each of which is herein incorporated by reference in its entirety.
  • the LNPs can be prepared using microfluidic mixers or micromixers.
  • Exemplary microfluidic mixers can include, but are not limited to, a slit interdigital micromixer including, but not limited to those manufactured by Microinnova (Allerheiligen bei Wildon, Austria) and/or a staggered herringbone micromixer (SHM) (see Zhigaltsevet al., "Bottom-up design and synthesis of limit size lipid nanoparticle systems with aqueous and triglyceride cores using millisecond microfluidic mixing," Langmuir 28:3633-40 (2012); Belliveau et al., "Microfluidic synthesis of highly potent limit-size lipid nanoparticles for in vivo delivery of siRNA," Molecular Therapy-Nucleic Acids.
  • micromixers include Slit Interdigital Microstructured Mixer (SIMM-V2) or a Standard Slit Interdigital Micro Mixer (SSIMM) or Caterpillar (CPMM) or Impinging-jet (IJMM,) from the Institut fur Mikrotechnik Mainz GmbH, Mainz Germany.
  • methods of making LNP using SHM further comprise mixing at least two input streams wherein mixing occurs by microstructure-induced chaotic advection (MICA).
  • MICA microstructure-induced chaotic advection
  • fluid streams flow through channels present in a herringbone pattern causing rotational flow and folding the fluids around each other.
  • This method can also comprise a surface for fluid mixing wherein the surface changes orientations during fluid cycling.
  • Methods of generating LNPs using SHM include those disclosed in U.S. Pub. Nos. US20040262223 and US20120276209, each of which is incorporated herein by reference in their entirety.
  • the polynucleotides described herein can be Formulated in lipid nanoparticles using microfluidic technology (see Whitesides, George M., “The Origins and the Future of Microfluidics,” Nature 442: 368-373 (2006); and Abraham et al., "Chaotic Mixer for Microchannels,” Science 295: 647-651 (2002); each of which is herein incorporated by reference in its entirety).
  • the polynucleotides can be Formulated in lipid nanoparticles using a micromixer chip such as, but not limited to, those from Harvard Apparatus (Holliston, MA) or Dolomite Microfluidics (Royston, UK).
  • a micromixer chip can be used for rapid mixing of two or more fluid streams with a split and recombine mechanism.
  • the polynucleotides described herein can be Formulated in lipid nanoparticles having a diameter from about 1 nm to about 100 nm such as, but not limited to, about 1 nm to about 20 nm, from about 1 nm to about 30 nm, from about 1 nm to about 40 nm, from about 1 nm to about 50 nm, from about 1 nm to about 60 nm, from about 1 nm to about 70 nm, from about 1 nm to about 80 nm, from about 1 nm to about 90 nm, from about 5 nm to about from 100 nm, from about 5 nm to about 10 nm, about 5 nm to about 20 nm, from about 5 nm to about 30 nm, from about 5 nm to about 40 nm, from about 5 nm to about 50 nm, from about 5 nm to about 60 nm, from about 5 nm to about 70
  • the lipid nanoparticles can have a diameter from about 10 to 500 nm. In some embodiments, the lipid nanoparticle can have a diameter greater than 100 nm, greater than 150 nm, greater than 200 nm, greater than 250 nm, greater than 300 nm, greater than 350 nm, greater than 400 nm, greater than 450 nm, greater than 500 nm, greater than 550 nm, greater than 600 nm, greater than 650 nm, greater than 700 nm, greater than 750 nm, greater than 800 nm, greater than 850 nm, greater than 900 nm, greater than 950 nm or greater than 1000 nm.
  • the polynucleotides can be delivered using smaller LNPs.
  • Such particles can comprise a diameter from below 0.1 pm up to 100 nm such as, but not limited to, less than 0.1 pm, less than 1 .0 pm, less than 5pm, less than 10 pm, less than 15 urn, less than 20 urn, less than 25 urn, less than 30 urn, less than 35 urn, less than 40 urn, less than 50 urn, less than 55 urn, less than 60 urn, less than 65 urn, less than 70 urn, less than 75 urn, less than 80 urn, less than 85 urn, less than 90 urn, less than 95 urn, less than 100 urn, less than 125 urn, less than 150 urn, less than 175 urn, less than 200 urn, less than 225 urn, less than 250 urn, less than 275 urn, less than 300 urn, less than 325
  • the nanoparticles and microparticles described herein can be geometrically engineered to modulate macrophage and/or the immune response.
  • the geometrically engineered particles can have varied shapes, sizes and/or surface charges to incorporate the polynucleotides described herein for targeted delivery such as, but not limited to, pulmonary delivery (see, e.g., Inti. Pub. No. WO20130821 1 1 , herein incorporated by reference in its entirety).
  • Other physical features the geometrically engineering particles can include, but are not limited to, fenestrations, angled arms, asymmetry and surface roughness, charge that can alter the interactions with cells and tissues.
  • the nanoparticles described herein are stealth nanoparticles or targetspecific stealth nanoparticles such as, but not limited to, those described in U.S. Pub. No.
  • the stealth or target-specific stealth nanoparticles can comprise a polymeric matrix, which can comprise two or more polymers such as, but not limited to, polyethylenes, polycarbonates, polyanhydrides, polyhydroxyacids, polypropylfumerates, polycaprolactones, polyamides, polyacetals, polyethers, polyesters, poly(orthoesters), polycyanoacrylates, polyvinyl alcohols, polyurethanes, polyphosphazenes, polyacrylates, polymethacrylates, polycyanoacrylates, polyureas, polystyrenes, polyamines, polyesters, polyanhydrides, polyethers, polyurethanes, polymethacrylates, polyacrylates, polycyanoacrylates, or combinations thereof.
  • polymers such as, but not limited to, polyethylenes, polycarbonates, polyanhydrides, polyhydroxyacids, polypropylfumerates, polycaprolactones, polyamides, polyacetals, polyethers, polyester
  • the polynucleotides described herein may encode a therapeutic polypeptide, such as a polypeptide that, when provided to a subject (e.g., a mammalian subject, such as a human), exerts a beneficial effect, such as the alleviation of one or more symptoms of a disease, diminishment of extent of a disease, stabilized (i.e. , not worsening) state of a disease, delay or slowing of progression of a disease, or amelioration or palliation of a state of a disease.
  • a subject e.g., a mammalian subject, such as a human
  • a beneficial effect such as the alleviation of one or more symptoms of a disease, diminishment of extent of a disease, stabilized (i.e. , not worsening) state of a disease, delay or slowing of progression of a disease, or amelioration or palliation of a state of a disease.
  • the disease may be one that is associated with a defici
  • the polypeptide encoded by the open reading frame is a secreted protein, (e.g., a cytokine, a growth factor, an enzyme, an immunomodulator, an antibody or antigen-binding fragment thereof, or a cell-penetrating peptide), an extracellular membrane-bound protein, an intracellular membrane-bound protein, a cytoplasmic protein, a cytoskeletal protein, or a nuclear protein.
  • a secreted protein e.g., a cytokine, a growth factor, an enzyme, an immunomodulator, an antibody or antigen-binding fragment thereof, or a cell-penetrating peptide
  • an extracellular membrane-bound protein e.g., an extracellular membrane-bound protein, an intracellular membrane-bound protein, a cytoplasmic protein, a cytoskeletal protein, or a nuclear protein.
  • the polypeptide is a protein of the human proteome.
  • the polypeptide may have the amino acid sequence of any one of SEQ ID NOs: 769 to 1392 of PCT/US2013/030062; SEQ ID NOs: 884 to 1611 of PCT/US2013/030068; SEQ ID NOs: 1827 to 3497 of PCT/US2013/030064; SEQ ID NOs: 3858 to 7559 of PCT/US2013/030067; SEQ ID NOs: 4672 to 9187 of PCT/US2013/030066; SEQ ID NOs: 4704 to 9203 of PCT/US2013/030070; SEQ ID NOs: 8144 to 16131 of PCT/US2013/030059; SEQ ID NOs: 8922 to 17687 of PCT/US2013/030060; and SEQ ID NOs: 35608 to 45601 of PCT/US2013/030061 , the disclosures of each of such applications are incorporated herein by reference
  • the polypeptide has an amino acid sequence that is at least 70% identical to the amino acid sequence of any one of SEQ ID NOs: 769 to 1392 of PCT/US2013/030062; SEQ ID NOs: 884 to 1611 of PCT/US2013/030068; SEQ ID NOs: 1827 to 3497 of PCT/US2013/030064; SEQ ID NOs: 3858 to 7559 of PCT/US2013/030067; SEQ ID NOs: 4672 to 9187 of PCT/US2013/030066; SEQ ID NOs: 4704 to 9203 of PCT/US2013/030070; SEQ ID NOs: 8144 to 16131 of PCT/US2013/030059; SEQ ID NOs: 8922 to 17687 of PCT/US2013/030060; and SEQ ID NOs: 35608 to 45601 of PCT/US2013/030061.
  • the polypeptide has an amino acid sequence that is at least 75% identical to the amino acid sequence of any one of SEQ ID NOs: 769 to 1392 of PCT/US2013/030062; SEQ ID NOs: 884 to 1611 of PCT/US2013/030068; SEQ ID NOs: 1827 to 3497 of PCT/US2013/030064; SEQ ID NOs: 3858 to 7559 of PCT/US2013/030067; SEQ ID NOs: 4672 to 9187 of PCT/US2013/030066; SEQ ID NOs: 4704 to 9203 of PCT/US2013/030070; SEQ ID NOs: 8144 to 16131 of PCT/US2013/030059; SEQ ID NOs: 8922 to 17687 of PCT/US2013/030060; and SEQ ID NOs: 35608 to 45601 of PCT/US2013/030061 .
  • the polypeptide has an amino acid sequence that is at least 80% identical to the amino acid sequence of any one of SEQ ID NOs: 769 to 1392 of PCT/US2013/030062; SEQ ID NOs: 884 to 161 1 of PCT/US2013/030068; SEQ ID NOs: 1827 to 3497 of PCT/US2013/030064; SEQ ID NOs: 3858 to 7559 of PCT/US2013/030067; SEQ ID NOs: 4672 to 9187 of PCT/US2013/030066; SEQ ID NOs: 4704 to 9203 of PCT/US2013/030070; SEQ ID NOs: 8144 to 16131 of PCT/US2013/030059; SEQ ID NOs: 8922 to 17687 of PCT/US2013/030060; and SEQ ID NOs: 35608 to 45601 of PCT/US2013/030061 .
  • the polypeptide has an amino acid sequence that is at least 85% identical to the amino acid sequence of any one of SEQ ID NOs: 769 to 1392 of PCT/US2013/030062; SEQ ID NOs: 884 to 161 1 of PCT/US2013/030068; SEQ ID NOs: 1827 to 3497 of PCT/US2013/030064; SEQ ID NOs: 3858 to 7559 of PCT/US2013/030067; SEQ ID NOs: 4672 to 9187 of PCT/US2013/030066; SEQ ID NOs: 4704 to 9203 of PCT/US2013/030070; SEQ ID NOs: 8144 to 16131 of PCT/US2013/030059; SEQ ID NOs: 8922 to 17687 of PCT/US2013/030060; and SEQ ID NOs: 35608 to 45601 of PCT/US2013/030061 .
  • the polypeptide has an amino acid sequence that is at least 90% identical to the amino acid sequence of any one of SEQ ID NOs: 769 to 1392 of PCT/US2013/030062; SEQ ID NOs: 884 to 161 1 of PCT/US2013/030068; SEQ ID NOs: 1827 to 3497 of PCT/US2013/030064; SEQ ID NOs: 3858 to 7559 of PCT/US2013/030067; SEQ ID NOs: 4672 to 9187 of PCT/US2013/030066; SEQ ID NOs: 4704 to 9203 of PCT/US2013/030070; SEQ ID NOs: 8144 to 16131 of PCT/US2013/030059; SEQ ID NOs: 8922 to 17687 of PCT/US2013/030060; and SEQ ID NOs: 35608 to 45601 of PCT/US2013/030061 .
  • the polypeptide has an amino acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the amino acid sequence of any one of SEQ ID NOs: 769 to 1392 of PCT/US2013/030062; SEQ ID NOs: 884 to 161 1 of PCT/US2013/030068; SEQ ID NOs: 1827 to 3497 of PCT/US2013/030064; SEQ ID NOs: 3858 to 7559 of PCT/US2013/030067; SEQ ID NOs: 4672 to 9187 of PCT/US2013/030066; SEQ ID NOs: 4704 to 9203 of PCT/US2013/030070; SEQ ID NOs: 8144 to 16131 of PCT/US2013/030059; SEQ ID NOs: 8922 to 17687 of PCT/US2013/030060; and SEQ ID NOs: 35608 to 45601 of PCT/US2013/
  • the polypeptide has an amino acid sequence that is at least 96% identical (e.g., 96%, 97%, 98%, 99%, or 100% identical) to the amino acid sequence of any one of SEQ ID NOs: 769 to 1392 of PCT/US2013/030062; SEQ ID NOs: 884 to 161 1 of PCT/US2013/030068; SEQ ID NOs: 1827 to 3497 of PCT/US2013/030064; SEQ ID NOs: 3858 to 7559 of PCT/US2013/030067; SEQ ID NOs: 4672 to 9187 of PCT/US2013/030066; SEQ ID NOs: 4704 to 9203 of PCT/US2013/030070; SEQ ID NOs: 8144 to 16131 of PCT/US2013/030059; SEQ ID NOs: 8922 to 17687 of PCT/US2013/030060; and SEQ ID NOs: 35608 to 45601 of PCT/US2013/030061
  • the polypeptide has an amino acid sequence that is at least 97% identical (e.g., 97%, 98%, 99%, or 100% identical) to the amino acid sequence of any one of SEQ ID NOs: 769 to 1392 of PCT/US2013/030062; SEQ ID NOs: 884 to 161 1 of PCT/US2013/030068; SEQ ID NOs: 1827 to 3497 of PCT/US2013/030064; SEQ ID NOs: 3858 to 7559 of PCT/US2013/030067; SEQ ID NOs: 4672 to 9187 of PCT/US2013/030066; SEQ ID NOs: 4704 to 9203 of PCT/US2013/030070; SEQ ID NOs: 8144 to 16131 of PCT/US2013/030059; SEQ ID NOs: 8922 to 17687 of PCT/US2013/030060; and SEQ ID NOs: 35608 to 45601 of PCT/US2013/030061 .
  • the polypeptide has an amino acid sequence that is at least 98% identical (e.g., 98%, 99%, or 100% identical) to the amino acid sequence of any one of SEQ ID NOs: 769 to 1392 of PCT/US2013/030062; SEQ ID NOs: 884 to 1611 of PCT/US2013/030068; SEQ ID NOs: 1827 to 3497 of PCT/US2013/030064; SEQ ID NOs: 3858 to 7559 of PCT/US2013/030067; SEQ ID NOs: 4672 to 9187 of PCT/US2013/030066; SEQ ID NOs: 4704 to 9203 of PCT/US2013/030070; SEQ ID NOs: 8144 to 16131 of PCT/US2013/030059; SEQ ID NOs: 8922 to 17687 of PCT/US2013/030060; and SEQ ID NOs: 35608 to 45601 of PCT/US2013/030061 .
  • the polypeptide has an amino acid sequence that is at least 99% identical (e.g., 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100% identical) to the amino acid sequence of any one of SEQ ID NOs: 769 to 1392 of PCT/US2013/030062; SEQ ID NOs: 884 to 1611 of PCT/US2013/030068; SEQ ID NOs: 1827 to 3497 of PCT/US2013/030064; SEQ ID NOs: 3858 to 7559 of PCT/US2013/030067; SEQ ID NOs: 4672 to 9187 of PCT/US2013/030066; SEQ ID NOs: 4704 to 9203 of PCT/US2013/030070; SEQ ID NOs: 8144 to 16131 of PCT/US2013/030059; SEQ ID NOs: 8922 to 17687 of PCT/US2013/0300
  • the polynucleotides e.g., a RNA, e.g., an mRNA
  • One such feature that aids in protein trafficking is the signal sequence, or targeting sequence.
  • the peptides encoded by these signal sequences are known by a variety of names, including targeting peptides, transit peptides, and signal peptides.
  • the polynucleotide (e.g., a RNA, e.g., an mRNA) comprises a nucleotide sequence (e.g., an ORF) that encodes a signal peptide operably linked to a nucleotide sequence that encodes a polypeptide of interest.
  • a nucleotide sequence e.g., an ORF
  • the "signal sequence” or “signal peptide” is a polynucleotide or polypeptide, respectively, which is from about 30-210, e.g., about 45-80 or 15-60 nucleotides (e.g., about 20, 30, 40, 50, 60, or 70 amino acids) in length that, optionally, is incorporated at the 5' (or N-terminus) of the coding region or the polypeptide, respectively. Addition of these sequences results in trafficking the encoded polypeptide to a desired site, such as the endoplasmic reticulum or the mitochondria through one or more targeting pathways. Some signal peptides are cleaved from the protein, for example by a signal peptidase after the proteins are transported to the desired site.
  • a polynucleotide (e.g., a RNA, e.g., an mRNA) of the present disclosure is sequence optimized.
  • the polynucleotide (e.g., a RNA, e.g., an mRNA) of the present disclosure comprises a nucleotide sequence (e.g., an ORF) encoding a therapeutic polypeptide (e.g., a therapeutic polypeptide described above), optionally, a nucleotide sequence (e.g, an ORF) encoding another polypeptide of interest, a 5'-UTR, a 3'-UTR, the 5' UTR or 3' UTR optionally comprising at least one microRNA binding site, optionally a nucleotide sequence encoding a linker, a polyA tail, or any combination thereof), in which the ORF(s) are sequence optimized.
  • a sequence-optimized nucleotide sequence e.g., a codon-optimized RNA sequence encoding a therapeutic polypeptide, is a sequence comprising at least one synonymous nucleobase substitution with respect to a reference sequence (e.g., a wild type nucleotide sequence encoding the therapeutic polypeptide of interest).
  • a sequence-optimized nucleotide sequence can be partially or completely different in sequence from the reference sequence.
  • a reference sequence encoding polyserine uniformly encoded by UCU codons can be sequence-optimized by having 100% of its nucleobases substituted (for each codon, U in position 1 replaced by A, C in position 2 replaced by G, and U in position 3 replaced by C) to yield a sequence encoding polyserine which would be uniformly encoded by AGO codons.
  • the percentage of sequence identity obtained from a global pairwise alignment between the reference polyserine nucleic acid sequence and the sequence-optimized polyserine nucleic acid sequence would be 0%.
  • the protein products from both sequences would be 100% identical.
  • sequence optimization also sometimes referred to codon optimization
  • results can include, e.g., matching codon frequencies in certain tissue targets and/or host organisms to ensure proper folding; biasing G/C content to increase mRNA stability or reduce secondary structures; minimizing tandem repeat codons or base runs that can impair gene construction or expression; customizing transcriptional and translational control regions; inserting or removing protein trafficking sequences; removing/adding post translation modification sites in an encoded protein (e.g., glycosylation sites); adding, removing or shuffling protein domains; inserting or deleting restriction sites; modifying ribosome binding sites and mRNA degradation sites; adjusting translational rates to allow the various domains of the protein to fold properly; and/or reducing or eliminating problem secondary structures within the polynucleotide.
  • Sequence optimization tools, algorithms and services are known in the art, non-limiting examples include services from GeneArt (Life Technologies), DNA2.0 (
  • a polynucleotide e.g., a RNA, e.g., an mRNA
  • a sequence-optimized nucleotide sequence e.g., an ORF
  • the therapeutic polypeptide, functional fragment, or a variant thereof encoded by the sequence-optimized nucleotide sequence has improved properties (e.g., compared to a therapeutic polypeptide, functional fragment, or a variant thereof encoded by a reference nucleotide sequence that is not sequence optimized), e.g., improved properties related to expression efficacy after administration in vivo.
  • Such properties include, but are not limited to, improving nucleic acid stability (e.g., mRNA stability), increasing translation efficacy in the target tissue, reducing the number of truncated proteins expressed, improving the folding or prevent misfolding of the expressed proteins, reducing toxicity of the expressed products, reducing cell death caused by the expressed products, increasing and/or decreasing protein aggregation.
  • nucleic acid stability e.g., mRNA stability
  • increasing translation efficacy in the target tissue reducing the number of truncated proteins expressed, improving the folding or prevent misfolding of the expressed proteins, reducing toxicity of the expressed products, reducing cell death caused by the expressed products, increasing and/or decreasing protein aggregation.
  • sequence-optimized nucleotide sequence (e.g., an ORF) is codon optimized for expression in human subjects, having structural and/or chemical features that avoid one or more of the problems in the art, for example, features which are useful for optimizing formulation and delivery of nucleic acid-based therapeutics while retaining structural and functional integrity; overcoming a threshold of expression; improving expression rates; half-life and/or protein concentrations; optimizing protein localization; and avoiding deleterious bio-responses such as the immune response and/or degradation pathways.
  • an ORF codon optimized for expression in human subjects, having structural and/or chemical features that avoid one or more of the problems in the art, for example, features which are useful for optimizing formulation and delivery of nucleic acid-based therapeutics while retaining structural and functional integrity; overcoming a threshold of expression; improving expression rates; half-life and/or protein concentrations; optimizing protein localization; and avoiding deleterious bio-responses such as the immune response and/or degradation pathways.
  • the polynucleotides of the present disclosure comprise a nucleotide sequence (e.g., a nucleotide sequence (e.g., an ORF) encoding a therapeutic polypeptide, a nucleotide sequence (e.g., an ORF) encoding another polypeptide of interest, a 5'-UTR, a 3'-UTR, a microRNA binding site, a nucleic acid sequence encoding a linker, or any combination thereof) that is sequence- optimized according to a method comprising:
  • sequence-optimized nucleotide sequence e.g., an ORF encoding a therapeutic polypeptide
  • the sequence optimization method is multiparametric and comprises one, two, three, four, or more methods disclosed herein and/or other optimization methods known in the art.
  • regions of the polynucleotide can be encoded by or within regions of the polynucleotide and such regions can be upstream (5') to, downstream (3') to, or within the region that encodes the therapeutic polypeptide. These regions can be incorporated into the polynucleotide before and/or after sequence-optimization of the protein encoding region or open reading frame (ORF). Examples of such features include, but are not limited to, untranslated regions (UTRs), microRNA sequences, Kozak sequences, oligo(dT) sequences, poly-A tail, and detectable tags and can include multiple cloning sites that can have Xbal recognition.
  • UTRs untranslated regions
  • microRNA sequences microRNA sequences
  • Kozak sequences oligo(dT) sequences
  • poly-A tail poly-A tail
  • detectable tags can include multiple cloning sites that can have Xbal recognition.
  • the polynucleotide of the present disclosure comprises a 5' UTR, a 3' UTR and/or a microRNA binding site. In some embodiments, the polynucleotide comprises two or more 5' UTRs and/or 3' UTRs, which can be the same or different sequences. In some embodiments, the polynucleotide comprises two or more microRNA binding sites, which can be the same or different sequences. Any portion of the 5' UTR, 3' UTR, and/or microRNA binding site, including none, can be sequence-optimized and can independently contain one or more different structural or chemical modifications, before and/or after sequence optimization.
  • the polynucleotide is reconstituted and transformed into a vector such as, but not limited to, plasmids, viruses, cosmids, and artificial chromosomes.
  • a vector such as, but not limited to, plasmids, viruses, cosmids, and artificial chromosomes.
  • the optimized polynucleotide can be reconstituted and transformed into chemically competent E. coli, yeast, neurospora, maize, drosophila, etc. where high copy plasmid-like or chromosome structures occur by methods described herein.
  • the polynucleotide of the present disclosure comprises a sequence- optimized nucleotide sequence encoding a therapeutic polypeptide disclosed herein.
  • the polynucleotide of the present disclosure comprises an open reading frame (ORF) encoding a therapeutic polypeptide, wherein the ORF has been sequence optimized.
  • ORF open reading frame
  • the sequence-optimized nucleotide sequences disclosed herein may be distinct from the corresponding wild type nucleotide acid sequences and from other known sequence-optimized nucleotide sequences, e.g., these sequence-optimized nucleic acids have unique compositional characteristics.
  • the percentage of uracil or thymine nucleobases in a sequence-optimized nucleotide sequence is modified (e.g., reduced) with respect to the percentage of uracil or thymine nucleobases in the reference wild-type nucleotide sequence.
  • a sequence-optimized nucleotide sequence e.g., encoding a therapeutic polypeptide, a functional fragment, or a variant thereof
  • Such a sequence is referred to as a uracil-modified or thymine- modified sequence.
  • the percentage of uracil or thymine content in a nucleotide sequence can be determined by dividing the number of uracils or thymines in a sequence by the total number of nucleotides and multiplying by 100.
  • the sequence-optimized nucleotide sequence has a lower uracil or thymine content than the uracil or thymine content in the reference wild-type sequence.
  • the uracil or thymine content in a sequence-optimized nucleotide sequence of the present disclosure is greater than the uracil or thymine content in the reference wild-type sequence and still maintain beneficial effects, e.g., increased expression and/or reduced Toll-Like Receptor (TLR) response when compared to the reference wild-type sequence.
  • beneficial effects e.g., increased expression and/or reduced Toll-Like Receptor (TLR) response when compared to the reference wild-type sequence.
  • an ORF of any one or more of the sequences provided herein may be codon optimized.
  • Codon optimization in some embodiments, may be used to match codon frequencies in target and host organisms to ensure proper folding; bias GC content to increase mRNA stability or reduce secondary structures; minimize tandem repeat codons or base runs that may impair gene construction or expression; customize transcriptional and translational control regions; insert or remove protein trafficking sequences; remove/add post translation modification sites in encoded protein (e.g., glycosylation sites); add, remove or shuffle protein domains; insert or delete restriction sites; modify ribosome binding sites and mRNA degradation sites; adjust translational rates to allow the various domains of the protein to fold properly; or reduce or eliminate problem secondary structures within the polynucleotide.
  • Codon optimization tools, algorithms and services are known in the art - non-limiting examples include services from GeneArt (Life Technologies), DNA2.0 (Menlo Park CA) and/or proprietary methods.
  • the open reading frame (ORF) sequence is optimized using optimization algorithms.
  • the polynucleotide e.g., a RNA, e.g., an mRNA
  • a sequence optimized nucleic acid disclosed herein encoding a therapeutic polypeptide can be tested to determine whether at least one nucleic acid sequence property (e.g., stability when exposed to nucleases) or expression property has been improved with respect to the non-sequence optimized nucleic acid.
  • expression property refers to a property of a nucleic acid sequence either in vivo (e.g., translation efficacy of a synthetic mRNA after administration to a subject in need thereof) or in vitro (e.g., translation efficacy of a synthetic mRNA tested in an in vitro model system).
  • Expression properties include but are not limited to the amount of protein produced by an mRNA encoding a therapeutic polypeptide after administration, and the amount of soluble or otherwise functional protein produced.
  • sequence optimized nucleic acids disclosed herein can be evaluated according to the viability of the cells expressing a protein encoded by a sequence optimized nucleic acid sequence (e.g., a RNA, e.g., an mRNA) encoding a therapeutic polypeptide disclosed herein.
  • a sequence optimized nucleic acid sequence e.g., a RNA, e.g., an mRNA
  • a plurality of sequence optimized nucleic acids disclosed herein e.g., a RNA, e.g., an mRNA
  • a property of interest for example an expression property in an in vitro model system, or in vivo in a target tissue or cell.
  • the desired property of the polynucleotide is an intrinsic property of the nucleic acid sequence.
  • the nucleotide sequence e.g., a RNA, e.g., an mRNA
  • the nucleotide sequence can be sequence optimized for in vivo or in vitro stability.
  • the nucleotide sequence can be sequence optimized for expression in a given target tissue or cell.
  • the nucleic acid sequence is sequence optimized to increase its plasma half-life by preventing its degradation by endo and exonucleases.
  • the nucleic acid sequence is sequence optimized to increase its resistance to hydrolysis in solution, for example, to lengthen the time that the sequence optimized nucleic acid or a pharmaceutical composition comprising the sequence optimized nucleic acid can be stored under aqueous conditions with minimal degradation.
  • sequence optimized nucleic acid can be optimized to increase its resistance to hydrolysis in dry storage conditions, for example, to lengthen the time that the sequence optimized nucleic acid can be stored after lyophilization with minimal degradation.
  • the desired property of the polynucleotide is the level of expression of a therapeutic polypeptide encoded by a sequence optimized sequence disclosed herein.
  • Protein expression levels can be measured using one or more expression systems.
  • expression can be measured in cell culture systems, e.g., CHO cells or HEK293 cells.
  • expression can be measured using in vitro expression systems prepared from extracts of living cells, e.g., rabbit reticulocyte lysates, or in vitro expression systems prepared by assembly of purified individual components.
  • the protein expression is measured in an in vivo system, e.g., mouse, rabbit, monkey, etc.
  • protein expression in solution form can be desirable.
  • a reference sequence can be sequence optimized to yield a sequence optimized nucleic acid sequence having optimized levels of expressed proteins in soluble form.
  • Levels of protein expression and other properties such as solubility, levels of aggregation, and the presence of truncation products (i.e., fragments due to proteolysis, hydrolysis, or defective translation) can be measured according to methods known in the art, for example, using electrophoresis (e.g., native or SDS-PAGE) or chromatographic methods (e.g., HPLC, size exclusion chromatography, etc.).
  • heterologous therapeutic proteins encoded by a nucleic acid sequence can have deleterious effects in the target tissue or cell, reducing protein yield, or reducing the quality of the expressed product (e.g., due to the presence of protein fragments or precipitation of the expressed protein in inclusion bodies), or causing toxicity.
  • sequence optimization of a nucleic acid sequence disclosed herein can be used to increase the viability of target cells expressing the protein encoded by the sequence optimized nucleic acid.
  • Heterologous protein expression can also be deleterious to cells transfected with a nucleic acid sequence for autologous or heterologous transplantation. Accordingly, in some embodiments of the present disclosure the sequence optimization of a nucleic acid sequence disclosed herein can be used to increase the viability of target cells expressing the protein encoded by the sequence optimized nucleic acid sequence. Changes in cell or tissue viability, toxicity, and other physiological reactions can be measured according to methods known in the art. d. Reduction of Immune and/or Inflammatory Response
  • the administration of a sequence optimized nucleic acid encoding a therapeutic polypeptide or a functional fragment thereof can trigger an immune response, which could be caused by (i) the therapeutic agent (e.g., an mRNA encoding a therapeutic polypeptide), or (ii) the expression product of such therapeutic agent (e.g., the therapeutic polypeptide encoded by the mRNA), or (iv) a combination thereof.
  • the therapeutic agent e.g., an mRNA encoding a therapeutic polypeptide
  • the expression product of such therapeutic agent e.g., the therapeutic polypeptide encoded by the mRNA
  • nucleic acid sequence e.g., an mRNA
  • sequence optimization of nucleic acid sequence can be used to decrease an immune or inflammatory response triggered by the administration of a nucleic acid encoding a therapeutic polypeptide or by the expression product of a therapeutic polypeptide encoded by such nucleic acid.
  • an inflammatory response can be measured by detecting increased levels of one or more inflammatory cytokines using methods known in the art, e.g., ELISA.
  • inflammatory cytokine refers to cytokines that are elevated in an inflammatory response.
  • inflammatory cytokines include interleukin-6 (IL-6), CXCL1 (chemokine (C-X-C motif) ligand 1 ; interferon-y (IFNy), tumor necrosis factor a (TNFa), interferon y-induced protein 10 (IP-10), or granulocyte-colony stimulating factor (G-CSF).
  • inflammatory cytokines includes also other cytokines associated with inflammatory responses known in the art, e.g., interleukin-1 (IL-1 ), interleukin-8 (IL-8), interleukin-12 (IL- 12), interleukin-13 (11-13), interferon a (IFN-a), etc.
  • IL-1 interleukin-1
  • IL-8 interleukin-8
  • IL-12 interleukin-12
  • IFN-a interferon a
  • the polynucleotide (e.g., a RNA, e.g., an mRNA) of the present disclosure comprises a chemically modified nucleobase, for example, a chemically modified uracil, e.g., pseudouracil, N1 -methylpseudouracil, 5-methoxyuracil, or the like.
  • a chemically modified uracil e.g., pseudouracil, N1 -methylpseudouracil, 5-methoxyuracil, or the like.
  • the mRNA is a uracil-modified sequence comprising an ORF encoding a therapeutic polypeptide, wherein the mRNA comprises a chemically modified nucleobase, for example, a chemically modified uracil, e.g., pseudouracil, N1 -methylpseudouracil, or 5-methoxyuracil.
  • a chemically modified uracil e.g., pseudouracil, N1 -methylpseudouracil, or 5-methoxyuracil.
  • the modified uracil base is connected to a ribose sugar, as it is in polynucleotides, the resulting modified nucleoside or nucleotide is referred to as modified uridine.
  • uracil in the polynucleotide is at least about 25%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least 90%, at least 95%, at least 99%, or about 100% modified uracil. In some embodiments, uracil in the polynucleotide is at least 95% modified uracil. In some embodiments, uracil in the polynucleotide is 100% modified uracil.
  • modified uracil content of the ORF is between about 100% and about 150%, between about 100% and about 110%, between about 105% and about 115%, between about 110% and about 120%, between about 115% and about 125%, between about 120% and about 130%, between about 125% and about 135%, between about 130% and about 140%, between about 135% and about 145%, between about 140% and about 150% of the theoretical minimum uracil content in the corresponding wild-type ORF (%UTM).
  • the uracil content of the ORF is between about 121% and about 136% or between 123% and 134% of the %UTM. In some embodiments, the uracil content of the ORF encoding a therapeutic polypeptide is about 115%, about 120%, about 125%, about 130%, about 135%, about 140%, about 145%, or about 150% of the %UTM.
  • uracil can refer to modified uracil and/or naturally occurring uracil.
  • the uracil content in the ORF of the mRNA encoding a therapeutic polypeptide of the present disclosure is less than about 30%, about 25%, about 20%, about 15%, or about 10% of the total nucleobase content in the ORF. In some embodiments, the uracil content in the ORF is between about 10% and about 20% of the total nucleobase content in the ORF. In other embodiments, the uracil content in the ORF is between about 10% and about 25% of the total nucleobase content in the ORF. In some embodiments, the uracil content in the ORF of the mRNA encoding a therapeutic polypeptide is less than about 20% of the total nucleobase content in the open reading frame. In this context, the term "uracil" can refer to modified uracil and/or naturally occurring uracil.
  • the ORF of the mRNA encoding a therapeutic polypeptide having modified uracil and adjusted uracil content has increased Cytosine (C), Guanine (G), or Guanine/Cytosine (G/C) content (absolute or relative).
  • the overall increase in C, G, or G/C content (absolute or relative) of the ORF is at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 6%, at least about 7%, at least about 10%, at least about 15%, at least about 20%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, or at least about 100% relative to the G/C content (absolute or relative) of the wild-type ORF.
  • the G, the C, or the G/C content in the ORF is less than about 100%, less than about 90%, less than about 85%, or less than about 80% of the theoretical maximum G, C, or G/C content of the corresponding wild type nucleotide sequence encoding the therapeutic polypeptide (%GTMX; %CTMX, or %G/CTMX).
  • the increases in G and/or C content (absolute or relative) described herein can be conducted by replacing synonymous codons with low G, C, or G/C content with synonymous codons having higher G, C, or G/C content.
  • the increase in G and/or C content (absolute or relative) is conducted by replacing a codon ending with U with a synonymous codon ending with G or C.
  • the ORF of the mRNA encoding a therapeutic polypeptide of the present disclosure comprises modified uracil and has an adjusted uracil content containing less uracil pairs (UU) and/or uracil triplets (UUU) and/or uracil quadruplets (UUUU) than the corresponding wild-type nucleotide sequence encoding the therapeutic polypeptide.
  • the ORF of the mRNA encoding a therapeutic polypeptide of the present disclosure contains no uracil pairs and/or uracil triplets and/or uracil quadruplets.
  • uracil pairs and/or uracil triplets and/or uracil quadruplets are reduced below a certain threshold, e.g., no more than 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 occurrences in the ORF of the mRNA encoding the therapeutic polypeptide.
  • the ORF of the mRNA encoding the therapeutic polypeptide of the present disclosure contains less than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11 , 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nonphenylalanine uracil pairs and/or triplets.
  • the ORF of the mRNA encoding the therapeutic polypeptide contains no non-phenylalanine uracil pairs and/or triplets.
  • the ORF of the mRNA encoding a therapeutic polypeptide of the present disclosure comprises modified uracil and has an adjusted uracil content containing less uracil-rich clusters than the corresponding wild-type nucleotide sequence encoding the therapeutic polypeptide.
  • the ORF of the mRNA encoding the therapeutic polypeptide of the present disclosure contains uracil-rich clusters that are shorter in length than corresponding uracil-rich clusters in the corresponding wild-type nucleotide sequence encoding the therapeutic polypeptide.
  • alternative lower frequency codons are employed. At least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 99%, or 100% of the codons in the therapeutic polypeptide-encoding ORF of the modified uracil-comprising mRNA are substituted with alternative codons, each alternative codon having a codon frequency lower than the codon frequency of the substituted codon in the synonymous codon set.
  • the ORF also has adjusted uracil content, as described above.
  • at least one codon in the ORF of the mRNA encoding the therapeutic polypeptide is substituted with an alternative codon having a codon frequency lower than the codon frequency of the substituted codon in the synonymous codon set.
  • the adjusted uracil content, therapeutic polypeptide-encoding ORF of the modified uracil-comprising mRNA exhibits expression levels of therapeutic polypeptide when administered to a mammalian cell that are higher than expression levels of therapeutic polypeptide from the corresponding wild-type mRNA.
  • the mammalian cell is a mouse cell, a rat cell, or a rabbit cell.
  • the mammalian cell is a monkey cell or a human cell.
  • the human cell is a HeLa cell, a BJ fibroblast cell, or a peripheral blood mononuclear cell (PBMC).
  • PBMC peripheral blood mononuclear cell
  • a therapeutic polypeptide of the disclosure is expressed at a level higher than expression levels of the same polypeptide from the corresponding wild-type mRNA when the mRNA is administered to a mammalian cell in vivo.
  • the mRNA is administered to mice, rabbits, rats, monkeys, or humans.
  • mice are null mice.
  • the mRNA is administered to mice in an amount of about 0.01 mg/kg, about 0.05 mg/kg, about 0.1 mg/kg, or 0.2 mg/kg or about 0.5 mg/kg.
  • the mRNA is administered intravenously or intramuscularly.
  • the therapeutic polypeptide is expressed when the mRNA is administered to a mammalian cell in vitro.
  • the expression is increased by at least about 2-fold, at least about 5-fold, at least about 10-fold, at least about 50-fold, at least about 500-fold, at least about 1500-fold, or at least about 3000-fold.
  • the expression is increased by at least about 10%, about 20%, about 30%, about 40%, about 50%, 60%, about 70%, about 80%, about 90%, or about 100%.
  • adjusted uracil content, therapeutic polypeptide-encoding ORF of the modified uracil-comprising mRNA exhibits increased stability.
  • the mRNA exhibits increased stability in a cell relative to the stability of a corresponding wild-type mRNA under the same conditions.
  • the mRNA exhibits increased stability including resistance to nucleases, thermal stability, and/or increased stabilization of secondary structure.
  • increased stability exhibited by the mRNA is measured by determining the half-life of the mRNA (e.g., in a plasma, serum, cell, or tissue sample) and/or determining the area under the curve (AUC) of the protein expression by the mRNA over time (e.g., in vitro or in vivo).
  • An mRNA is identified as having increased stability if the half-life and/or the AUC is greater than the half-life and/or the AUC of a corresponding wildtype mRNA under the same conditions.
  • the mRNA of the present disclosure induces a detectably lower immune response (e.g., innate or acquired) relative to the immune response induced by a corresponding wild-type mRNA under the same conditions.
  • the mRNA of the present disclosure induces a detectably lower immune response (e.g., innate or acquired) relative to the immune response induced by an mRNA that encodes for a therapeutic polypeptide but does not comprise modified uracil under the same conditions, or relative to the immune response induced by an mRNA that encodes for a therapeutic polypeptide and that comprises modified uracil but that does not have adjusted uracil content under the same conditions.
  • the innate immune response can be manifested by increased expression of pro- inflammatory cytokines, activation of intracellular PRRs (RIG-I, MDA5, etc.), cell death, and/or termination or reduction in protein translation.
  • a reduction in the innate immune response can be measured by expression or activity level of Type 1 interferons (e.g., IFN-a, IFN-p, IFN-K, IFN-b, IFN-E, IFN-T, IFN-W, and IFN- ⁇ ) or the expression of interferon-regulated genes such as the toll-like receptors (e.g., TLR7 and TLR8), and/or by decreased cell death following one or more administrations of the mRNA of the present disclosure into a cell.
  • Type 1 interferons e.g., IFN-a, IFN-p, IFN-K, IFN-b, IFN-E, IFN-T, IFN-W, and IFN- ⁇
  • interferon-regulated genes such as the
  • the expression of Type-1 interferons by a mammalian cell in response to the mRNA of the present disclosure is reduced by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 99.9%, or greater than 99.9% relative to a corresponding wild-type mRNA, to an mRNA that encodes a therapeutic polypeptide but does not comprise modified uracil, or to an mRNA that encodes a therapeutic polypeptide and that comprises modified uracil but that does not have adjusted uracil content.
  • the interferon is IFN-p.
  • cell death frequency caused by administration of mRNA of the present disclosure to a mammalian cell is 10%, 25%, 50%, 75%, 85%, 90%, 95%, or over 95% less than the cell death frequency observed with a corresponding wild-type mRNA, an mRNA that encodes for a therapeutic polypeptide but does not comprise modified uracil, or an mRNA that encodes for a therapeutic polypeptide and that comprises modified uracil but that does not have adjusted uracil content.
  • the mammalian cell is a BJ fibroblast cell.
  • the mammalian cell is a splenocyte.
  • the mammalian cell is that of a mouse or a rat.
  • the mammalian cell is that of a human.
  • the mRNA of the present disclosure does not substantially induce an innate immune response of a mammalian cell into which the mRNA is introduced.
  • the disclosure includes modified polynucleotides comprising a polynucleotide described herein (e.g., a polynucleotide, e.g. mRNA, comprising a nucleotide sequence encoding a therapeutic polypeptide).
  • the modified polynucleotides can be chemically modified and/or structurally modified.
  • the polynucleotides of the present disclosure are chemically and/or structurally modified the polynucleotides can be referred to as "modified polynucleotides.”
  • nucleosides and nucleotides of a polynucleotide e.g., RNA polynucleotides, such as mRNA polynucleotides
  • a “nucleoside” refers to a compound containing a sugar molecule (e.g., a pentose or ribose) or a derivative thereof in combination with an organic base (e.g., a purine or pyrimidine) or a derivative thereof (also referred to herein as "nucleobase”).
  • a “nucleotide” refers to a nucleoside including a phosphate group.
  • Modified nucleotides can be synthesized by any useful method, such as, for example, chemically, enzymatically, or recombinantly, to include one or more modified or non-natural nucleosides.
  • Polynucleotides can comprise a region or regions of linked nucleosides. Such regions can have variable backbone linkages. The linkages can be standard phosphodiester linkages, in which case the polynucleotides would comprise regions of nucleotides.
  • modified polynucleotides disclosed herein can comprise various distinct modifications.
  • the modified polynucleotides contain one, two, or more (optionally different) nucleoside or nucleotide modifications.
  • a modified polynucleotide, introduced to a cell can exhibit one or more desirable properties, e.g., improved protein expression, reduced immunogenicity, or reduced degradation in the cell, as compared to an unmodified polynucleotide.
  • a polynucleotide of the present disclosure is structurally modified.
  • a "structural" modification is one in which two or more linked nucleosides are inserted, deleted, duplicated, inverted or randomized in a polynucleotide without significant chemical modification to the nucleotides themselves. Because chemical bonds will necessarily be broken and reformed to effect a structural modification, structural modifications are of a chemical nature and hence are chemical modifications. However, structural modifications will result in a different sequence of nucleotides.
  • the polynucleotide "ATCG” can be chemically modified to "AT-5meC-G".
  • the same polynucleotide can be structurally modified from “ATCG” to "ATCCCG”.
  • the dinucleotide "CC” has been inserted, resulting in a structural modification to the polynucleotide.
  • compositions of the present disclosure comprise, in some embodiments, at least one nucleic acid (e.g., RNA) having an open reading frame encoding a therapeutic polypeptide, a fragment thereof, or a variant thereof, wherein the nucleic acid comprises nucleotides and/or nucleosides that can be standard (unmodified) or modified as is known in the art.
  • nucleotides and nucleosides of the present disclosure comprise modified nucleotides or nucleosides.
  • modified nucleotides and nucleosides can be naturally-occurring modified nucleotides and nucleosides or non- naturally occurring modified nucleotides and nucleosides.
  • modifications can include those at the sugar, backbone, or nucleobase portion of the nucleotide and/or nucleoside as are recognized in the art.
  • a naturally-occurring modified nucleotide or nucleotide of the disclosure is one as is generally known or recognized in the art.
  • Non-limiting examples of such naturally occurring modified nucleotides and nucleotides can be found, inter alia, in the widely recognized MODOMICS database.
  • a non-naturally occurring modified nucleotide or nucleoside of the disclosure is one as is generally known or recognized in the art.
  • Non-limiting examples of such non-natural occurring modified nucleotides and nucleosides can be found, inter alia, in published US Application Nos. PCT/US2012/058519; PCT/US2013/075177; PCT/US2014/058897;
  • PCT/US2014/058891 PCT/US2014/070413; PCT/US2015/36773; PCT/US2015/36759;
  • PCT/US2015/36771 or PCT/IB2017/051367 all of which are incorporated by reference herein.
  • RNA e.g., mRNA
  • nucleotides and nucleosides of the present disclosure comprise standard nucleoside residues such as those present in transcribed RNA (e.g. A, G, C, or U).
  • nucleotides and nucleosides of the present disclosure comprise standard deoxyribonucleosides such as those present in DNA (e.g. dA, dG, dC, or dT).
  • nucleic acids of the disclosure can comprise standard nucleotides and nucleosides, naturally-occurring nucleotides and nucleosides, non-naturally-occurring nucleotides and nucleosides, or any combination thereof.
  • Nucleic acids of the disclosure e.g., DNA nucleic acids and RNA nucleic acids, such as mRNA nucleic acids
  • Nucleic acids of the disclosure comprise various (more than one) different types of standard and/or modified nucleotides and nucleosides.
  • a particular region of a nucleic acid contains one, two or more (optionally different) types of standard and/or modified nucleotides and nucleosides.
  • a modified RNA nucleic acid e.g., a modified mRNA nucleic acid
  • introduced to a cell or organism exhibits reduced degradation in the cell or organism, respectively, relative to an unmodified nucleic acid comprising standard nucleotides and nucleosides.
  • a modified RNA nucleic acid (e.g., a modified mRNA nucleic acid), introduced into a cell or organism, may exhibit reduced immunogenicity in the cell or organism, respectively (e.g., a reduced innate response) relative to an unmodified nucleic acid comprising standard nucleotides and nucleosides.
  • Nucleic acids e.g., RNA nucleic acids, such as mRNA nucleic acids
  • Nucleic acids in some embodiments, comprise non-natural modified nucleotides that are introduced during synthesis or post-synthesis of the nucleic acids to achieve desired functions or properties.
  • the modifications may be present on internucleoside linkages, purine or pyrimidine bases, or sugars.
  • the modification may be introduced with chemical synthesis or with a polymerase enzyme at the terminal of a chain or anywhere else in the chain. Any of the regions of a nucleic acid may be chemically modified.
  • nucleic acid e.g., RNA nucleic acids, such as mRNA nucleic acids.
  • a “nucleoside” refers to a compound containing a sugar molecule (e.g., a pentose or ribose) or a derivative thereof in combination with an organic base (e.g., a purine or pyrimidine) or a derivative thereof (also referred to herein as “nucleobase”).
  • nucleotide refers to a nucleoside, including a phosphate group.
  • Modified nucleotides may by synthesized by any useful method, such as, for example, chemically, enzymatically, or recombinantly, to include one or more modified or non-natural nucleosides.
  • Nucleic acids can comprise a region or regions of linked nucleosides. Such regions may have variable backbone linkages. The linkages can be standard phosphodiester linkages, in which case the nucleic acids would comprise regions of nucleotides.
  • Modified nucleotide base pairing encompasses not only the standard adenosine-thymine, adenosine-uracil, or guanosine-cytosine base pairs, but also base pairs formed between nucleotides and/or modified nucleotides comprising non-standard or modified bases, wherein the arrangement of hydrogen bond donors and hydrogen bond acceptors permits hydrogen bonding between a non-standard base and a standard base or between two complementary non-standard base structures, such as, for example, in those nucleic acids having at least one chemical modification.
  • One example of such nonstandard base pairing is the base pairing between the modified nucleotide inosine and adenine, cytosine or uracil. Any combination of base/sugar or linker may be incorporated into nucleic acids of the present disclosure.
  • modified nucleobases in nucleic acids comprise N1 -methyl-pseudouridine (m1 ip), 1 -ethyl-pseudouridine (e1 ip), 5-methoxy- uridine (mo5U), 5-methyl-cytidine (m5C), and/or pseudouridine (ip).
  • modified nucleobases in nucleic acids comprise 5- methoxymethyl uridine, 5-methylthio uridine, 1 -methoxymethyl pseudouridine, 5-methyl cytidine, and/or 5- methoxy cytidine.
  • the polyribonucleotide includes a combination of at least two (e.g., 2, 3, 4 or more) of any of the aforementioned modified nucleobases, including but not limited to chemical modifications.
  • a RNA nucleic acid of the disclosure comprises N1 -methyl-pseudouridine (ml ip) substitutions at one or more or all uridine positions of the nucleic acid.
  • a RNA nucleic acid of the disclosure comprises N1 -methyl-pseudouridine (ml ip) substitutions at one or more or all uridine positions of the nucleic acid and 5-methyl cytidine substitutions at one or more or all cytidine positions of the nucleic acid.
  • ml ip N1 -methyl-pseudouridine
  • a RNA nucleic acid of the disclosure comprises pseudouridine (ip) substitutions at one or more or all uridine positions of the nucleic acid.
  • a RNA nucleic acid of the disclosure comprises pseudouridine (ip) substitutions at one or more or all uridine positions of the nucleic acid and 5-methyl cytidine substitutions at one or more or all cytidine positions of the nucleic acid.
  • a RNA nucleic acid of the disclosure comprises uridine at one or more or all uridine positions of the nucleic acid.
  • nucleic acids e.g., RNA nucleic acids, such as mRNA nucleic acids
  • nucleic acids are uniformly modified (e.g., fully modified, modified throughout the entire sequence) for a particular modification.
  • a nucleic acid can be uniformly modified with N1 -methyl-pseudouridine, meaning that all uridine residues in the mRNA sequence are replaced with N1 -methyl-pseudouridine.
  • a nucleic acid can be uniformly modified for any type of nucleoside residue present in the sequence by replacement with a modified residue such as those set forth above.
  • nucleic acids of the present disclosure may be partially or fully modified along the entire length of the molecule.
  • one or more or all or a given type of nucleotide e.g., purine or pyrimidine, or any one or more or all of A, G, U, C
  • nucleotides X in a nucleic acid of the present disclosure are modified nucleotides, wherein X may be any one of nucleotides A, G, U, C, or any one of the combinations A+G, A+U, A+C, G+U, G+C, U+C, A+G+U, A+G+C, G+U+C or A+G+C.
  • the nucleic acid may contain from about 1 % to about 100% modified nucleotides (either in relation to overall nucleotide content, or in relation to one or more types of nucleotide, i.e., any one or more of A, G, U or C) or any intervening percentage (e.g., from 1 % to 20%, from 1 % to 25%, from 1 % to 50%, from 1 % to 60%, from 1 % to 70%, from 1 % to 80%, from 1 % to 90%, from 1 % to 95%, from 10% to 20%, from 10% to 25%, from 10% to 50%, from 10% to 60%, from 10% to 70%, from 10% to 80%, from 10% to 90%, from 10% to 95%, from 10% to 100%, from 20% to 25%, from 20% to 50%, from 20% to 60%, from 20% to 70%, from 20% to 80%, from 20% to 90%, from 20% to 95%, from 20% to 100%, from 50% to 60%, from 50% to 70%, from 50% to 80%, from 50% to 90%, from 20% to 95%,
  • the nucleic acids may contain at a minimum 1 % and at maximum 100% modified nucleotides, or any intervening percentage, such as at least 5% modified nucleotides, at least 10% modified nucleotides, at least 25% modified nucleotides, at least 50% modified nucleotides, at least 80% modified nucleotides, or at least 90% modified nucleotides.
  • the nucleic acids may contain a modified pyrimidine such as a modified uracil or cytosine.
  • At least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90% or 100% of the uracil in the nucleic acid is replaced with a modified uracil (e.g., a 5-substituted uracil).
  • the modified uracil can be replaced by a compound having a single unique structure, or can be replaced by a plurality of compounds having different structures (e.g., 2, 3, 4 or more unique structures).
  • cytosine in the nucleic acid is replaced with a modified cytosine (e.g., a 5-substituted cytosine).
  • the modified cytosine can be replaced by a compound having a single unique structure, or can be replaced by a plurality of compounds having different structures (e.g., 2, 3, 4 or more unique structures).
  • Untranslated regions are nucleic acid sections of a polynucleotide before a start codon (5' UTR) and after a stop codon (3' UTR) that are not translated.
  • a polynucleotide e.g., a ribonucleic acid (RNA), e.g., a messenger RNA (mRNA)
  • RNA ribonucleic acid
  • mRNA messenger RNA
  • ORF open reading frame
  • encoding a therapeutic polypeptide further comprises a UTR (e.g., a 5' UTR or functional fragment thereof, a 3' UTR or functional fragment thereof, or a combination thereof).
  • a UTR (e.g., 5' UTR or 3' UTR) can be homologous or heterologous to the coding region in a polynucleotide.
  • the UTR is homologous to the ORF encoding the therapeutic polypeptide.
  • the UTR is heterologous to the ORF encoding the therapeutic polypeptide.
  • the polynucleotide comprises two or more 5' UTRs or functional fragments thereof, each of which has the same or different nucleotide sequences. In some embodiments, the polynucleotide comprises two or more 3' UTRs or functional fragments thereof, each of which has the same or different nucleotide sequences.
  • the 5' UTR or functional fragment thereof, 3' UTR or functional fragment thereof, or any combination thereof is sequence optimized.
  • the 5'UTR or functional fragment thereof, 3' UTR or functional fragment thereof, or any combination thereof comprises at least one chemically modified nucleobase, e.g., N1 -methylpseudouracil or 5-methoxyuracil.
  • UTRs can have features that provide a regulatory role, e.g., increased or decreased stability, localization and/or translation efficiency.
  • a polynucleotide comprising a UTR can be administered to a cell, tissue, or organism, and one or more regulatory features can be measured using routine methods.
  • a functional fragment of a 5' UTR or 3' UTR comprises one or more regulatory features of a full length 5' or 3' UTR, respectively.

Landscapes

  • Genetics & Genomics (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Saccharide Compounds (AREA)
EP23851018.4A 2022-08-05 2023-08-04 Interne ribosomenzugangsstellen für verbesserte polynukleotidtranslation Pending EP4565692A2 (de)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202263395614P 2022-08-05 2022-08-05
PCT/US2023/071742 WO2024031087A2 (en) 2022-08-05 2023-08-04 Internal ribosome entry sites for improved polynucleotide translation

Publications (1)

Publication Number Publication Date
EP4565692A2 true EP4565692A2 (de) 2025-06-11

Family

ID=89849952

Family Applications (1)

Application Number Title Priority Date Filing Date
EP23851018.4A Pending EP4565692A2 (de) 2022-08-05 2023-08-04 Interne ribosomenzugangsstellen für verbesserte polynukleotidtranslation

Country Status (3)

Country Link
EP (1) EP4565692A2 (de)
TW (1) TW202417629A (de)
WO (1) WO2024031087A2 (de)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2025249560A1 (ja) * 2024-05-31 2025-12-04 国立大学法人京都大学 核酸アプタマー、rna分子、医薬組成物、及び鋳型dna分子

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE19216461T1 (de) * 2011-10-03 2021-10-07 Modernatx, Inc. Modifizierte nukleoside, nukleotide und nukleinsäuren und verwendungen davon

Also Published As

Publication number Publication date
WO2024031087A2 (en) 2024-02-08
TW202417629A (zh) 2024-05-01
WO2024031087A3 (en) 2024-04-25

Similar Documents

Publication Publication Date Title
US20230398074A1 (en) Nucleic Acid-Based Therapy of Muscular Dystrophies
US12239742B2 (en) Polynucleotides encoding Citrin for the treatment of Citrullinemia type 2
US12252704B2 (en) Polynucleotides encoding galactose-1-phosphate uridylyltransferase for the treatment of galactosemia type 1
EP3458107B1 (de) Für jagged1 codierende polynukleotide zur behandlung von alagille-syndrom
US20240318187A1 (en) Polyribonucleotides containing reduced uracil content and uses thereof
US20200085916A1 (en) Polynucleotides encoding porphobilinogen deaminase for the treatment of acute intermittent porphyria
US20190298657A1 (en) Polynucleotides Encoding Acyl-CoA Dehydrogenase, Very Long-Chain for the Treatment of Very Long-Chain Acyl-CoA Dehydrogenase Deficiency
US20250170070A1 (en) Polynucleotides encoding glucose-6-phosphatase for the treatment of glycogen storage disease
EP3458106A1 (de) Polynukleotide zur codierung von lipoproteinlipase zur behandlung von hyperlipidämie
AU2017266948A1 (en) Polynucleotides encoding porphobilinogen deaminase for the treatment of acute intermittent porphyria
AU2017268394A1 (en) Polynucleotides encoding relaxin
JP2023527875A (ja) フェニルアラニンヒドロキシラーゼバリアント及びその使用
US20250262320A1 (en) Polynucleotides encoding uridine diphosphate glycosyltransferase 1 family, polypeptide a1 for the treatment of crigler-najjar syndrome
WO2024031087A2 (en) Internal ribosome entry sites for improved polynucleotide translation
EP4634380A1 (de) Interne ribosomenzugangsstellen für verbesserte polynukleotidtranslation
WO2025175176A1 (en) Synthetic nucleic acids and methods of using the same for improved polypeptide production
WO2025137275A1 (en) Novel cas nucleases and polynucleotides encoding the same
WO2025231360A1 (en) Novel cas nucleases and polynucleotides encoding the same
WO2022271776A1 (en) Polynucleotides encoding uridine diphosphate glycosyltransferase 1 family, polypeptide a1 for the treatment of crigler-najjar syndrome

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20250219

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR

DAV Request for validation of the european patent (deleted)
DAX Request for extension of the european patent (deleted)