EP4565692A2 - Internal ribosome entry sites for improved polynucleotide translation - Google Patents
Internal ribosome entry sites for improved polynucleotide translationInfo
- Publication number
- EP4565692A2 EP4565692A2 EP23851018.4A EP23851018A EP4565692A2 EP 4565692 A2 EP4565692 A2 EP 4565692A2 EP 23851018 A EP23851018 A EP 23851018A EP 4565692 A2 EP4565692 A2 EP 4565692A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- uridine
- methyl
- thio
- nucleic acid
- pseudouridine
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/67—General methods for enhancing the expression
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2840/00—Vectors comprising a special translation-regulating system
- C12N2840/20—Vectors comprising a special translation-regulating system translation of more than one cistron
- C12N2840/203—Vectors comprising a special translation-regulating system translation of more than one cistron having an IRES
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2840/00—Vectors comprising a special translation-regulating system
- C12N2840/60—Vectors comprising a special translation-regulating system from viruses
Definitions
- exogenous nucleic acids has become a particularly effective strategy for delivering polypeptides of interest to a target cell, tissue, or organism, as a single protein-encoding nucleic acid can be translated to yield multiple copies of a desired polypeptide, allowing the administration of a small quantity of nucleic acid to achieve high levels of protein expression.
- steps have been taken to improve the pharmacokinetic properties of nucleic acid molecules. For example, efforts to further augment the half-lives of nucleic acid molecules, such as protein-encoding RNA molecules, have led to modifications that render nucleic acids less susceptible to nucleolytic degradation.
- 5’ cap structures are often included in protein-encoding nucleic acid (e.g., RNA) molecules, as the 5’ cap promotes ribosome binding and, thus, protein translation. Accordingly, although modifications such as 573’ blocking and circularization may confer the benefit of reduced exonuclease-mediated degradation, these modifications may hinder ribosomal recruitment due to the absence of a 5’ cap. There exists a need for improved strategies for effectuating ribosomal entry and the initiation of protein translation, particularly in nucleic acid molecules that lack a 5’ cap.
- nucleic acid molecules such as linear and circular RNA molecules, that are capable of recruiting and binding to ribosomes in a manner that is independent of a 5’ cap structure.
- nucleic acid molecules generally employ 5’ cap structures in order to promote ribosomal binding and, thus, translation of an encoded protein.
- the presence of a 5’ cap that is susceptible to decapping - which, in turn, triggers subsequent degradation of the RNA - precludes the possibility of adding certain chemical modifications that extend the molecule’s half-life.
- Examples of these types of modifications include (i) the presence of 5’ chemical moieties that restrict the access of an exonuclease to the nucleic acid molecule, as well as (ii) circularization of a nucleic acid molecule, which removes 5’ and 3’ ends altogether. Both of these types of modifications provide the benefit of reducing or eliminating exonucleolytic cleavage by way of either chemically protecting, or removing, the 5’ and 3’ ends to which an exonuclease would bind. However, because these types of modifications alter or eliminate the 5’ end, they preclude the inclusion of a 5’ cap.
- the present disclosure features internal ribosome entry sites (IRESs) that can be incorporated into nucleic acids and that promote ribosome recruitment and protein translation in a manner that is independent of the presence of a 5’ cap.
- IRESs internal ribosome entry sites
- the IRES elements of the disclosure can be used in nucleic acids (e.g., RNA molecules) that either lack or contain a 5’ cap, as the present IRES elements confer advantages to both types of molecules.
- the IRES elements of the disclosure can be incorporated into a nucleic acid (e.g., a linear or circular RNA molecule) that lacks a 5’ cap, thereby providing a means by which the nucleic acid molecule may be bound - and translated - by a ribosome, notwithstanding the absence of a 5’ cap structure that would, ordinarily, be regarded as important for the onset of protein biosynthesis.
- the IRES elements of the disclosure can be incorporated into a nucleic acid (e.g., a linear RNA) that contains a 5’ cap.
- the IRES element may provide the benefit of a means by which the nucleic acid may be translated even after the 5’ cap is removed by way of endogenous decapping processes.
- the inclusion of an IRES element of the disclosure can effectively extend the ability of decapped nucleic acids (e.g., decapped linear RNAs) to effectuate protein expression.
- the IRES of the disclosure may recruit translation tractor and/or ribosomes to the nucleic acids described herein in order to promotes translation.
- IRES of the disclosure e.g., SEQ ID NOs: 173-205
- IRES of the disclosure may bind directly to ribosomal subunits (e.g., eukaryotic 60S or 40S subunits) by, e.g., hybridizing directly to ribosomal RNA (rRNA), such as 25S, 28S, 18S, 5.8S, and/or 5S rRNA.
- rRNA ribosomal RNA
- the IRES of the disclosure further provide the advantage of fast and efficient protein expression while reducing energy expenditure on the cell.
- the disclosure provides a nucleic acid comprising:
- an internal ribosome entry site comprising one or more polynucleotide tracts enriched in uridine or a modified uridine; operably linked to
- the IRES comprises from 1 to 20 of the polynucleotide tracts enriched in uridine or a modified uridine (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 of the polynucleotide tracts enriched in uridine or a modified uridine). In some embodiments, the IRES comprises from 2 to 10 of the polynucleotide tracts enriched in uridine or a modified uridine. In some embodiments, the IRES comprises from 3 to 6 of the polynucleotide tracts enriched in uridine or a modified uridine.
- At least 70% of the nucleosides in each of the polynucleotide tracts is a pyrimidine-containing nucleoside, such as a uridine, a modified uridine, a cytidine, or a modified cytidine (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the nucleosides in each of the polynucleotide tracts may be a uridine, a modified uridine, a cytidine, or a modified cytidine).
- a uridine such as a uridine, a modified uridine, a cytidine, or a modified c
- At least 75% of the nucleosides in each of the polynucleotide tracts is a pyrimidine-containing nucleoside, such as a uridine, a modified uridine, a cytidine, or a modified cytidine. In some embodiments, at least 80% of the nucleosides in each of the polynucleotide tracts is a pyrimidine-containing nucleoside, such as a uridine, a modified uridine, a cytidine, or a modified cytidine.
- At least 85% of the nucleosides in each of the polynucleotide tracts is a pyrimidine-containing nucleoside, such as a uridine, a modified uridine, a cytidine, or a modified cytidine.
- at least 90% of the nucleosides in each of the polynucleotide tracts is a pyrimidine-containing nucleoside, such as a uridine, a modified uridine, a cytidine, or a modified cytidine.
- At least 95% of the nucleosides in each of the polynucleotide tracts is a pyrimidine-containing nucleoside, such as a uridine, a modified uridine, a cytidine, or a modified cytidine.
- all of the nucleosides in each of the polynucleotide tracts is a pyrimidine- containing nucleoside, such as a uridine, a modified uridine, a cytidine, or a modified cytidine.
- each polynucleotide tract is from 5 to 20 nucleosides in length (e.g., 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleosides in length). In some embodiments, each polynucleotide tract, independently, is from 5 to 19 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 18 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 17 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 16 nucleosides in length.
- each polynucleotide tract is from 5 to 15 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 14 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 13 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 12 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 11 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 10 nucleosides in length.
- each polynucleotide tract is from 6 to 15 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 14 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 13 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 12 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 11 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 10 nucleosides in length.
- each polynucleotide tract is from 7 to 15 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 7 to 14 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 7 to 13 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 7 to 12 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 7 to 11 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 7 to 10 nucleosides in length. In some embodiments, each polynucleotide tract is 9 nucleosides in length.
- each polynucleotide tract independently, comprises from 5 to 20 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides, such as 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 uridine, modified uridine, cytidine, or modified cytidine nucleosides). In some embodiments, each polynucleotide tract, independently, comprises from 6 to 15 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides).
- each polynucleotide tract independently, comprises from 6 to 14 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides). In some embodiments, each polynucleotide tract, independently, comprises from 6 to 13 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides).
- each polynucleotide tract independently, comprises from 6 to 12 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides). In some embodiments, each polynucleotide tract, independently, comprises from 6 to 1 1 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides).
- each polynucleotide tract independently, comprises from 6 to 10 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides). In some embodiments, each polynucleotide tract, independently, comprises from 7 to 15 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides).
- each polynucleotide tract independently, comprises from 7 to 14 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides). In some embodiments, each polynucleotide tract, independently, comprises from 7 to 13 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides).
- each polynucleotide tract independently, comprises from 7 to 12 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides). In some embodiments, each polynucleotide tract, independently, comprises from 7 to 1 1 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides).
- each polynucleotide tract independently, comprises from 7 to 10 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides).
- pyrimidine-containing nucleosides e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides.
- each polynucleotide tract comprises at least 9 contiguous pyrimidine- containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides). In some embodiments, each polynucleotide tract comprises 9 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides).
- one or more (or all) of the polynucleotide tracts are enriched in modified uridine.
- the modified uridine is 1 -methylpseudouridine.
- the modified uridine is pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5- aza-uridine, 2-thio-uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5- carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-me
- the IRES is 100% modified at uridine, and the modification consists of 1 - methylpseudouridine. In some embodiments, the entire mRNA, including the IRES, is 100% modified at uridine, and the modification consists of 1 -methylpseudouridine.
- the IRES does not contain a chemical modification at uridine. In some embodiments, the IRES does not contain a chemical modification at any of the nucleosides therein.
- the IRES is located within a noncoding region of the nucleic acid.
- the IRES may be located within a 5’ untranslated region (UTR) that is operably linked to the open reading frame.
- the open reading frame is further operably linked to a 3’ UTR.
- the polynucleotide tracts are separated from one another by way of one or more spacers that each, independently, comprise from 5 to 100 nucleosides (e.g., 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 nucleosides).
- each of the spacers independently, comprises from 10 to 40 nucleosides (e.g., 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleosides).
- each of the spacers independently, comprises 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, or 38 nucleosides.
- the IRES is represented by the formula:
- each N is, independently, any nucleoside residue; each t/'is, independently, a pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides), preferably wherein each t/' is, independently, uridine or a modified uridine, even more preferably wherein each t/'is, independently, modified uridine (e.g., 1 - methylpseudouridine); each n is, independently, an integer from 1 to 100 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100); each m is, independently, an integer from 2 to 15 (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13,
- N is, independently, selected from adenosine, a modified adenosine, uridine, a modified uridine, guanosine, a modified guanosine, cytidine, and a modified cytidine.
- each N is, independently, selected from adenosine, uridine, a modified uridine, guanosine, and cytidine.
- the modified uridine of N is 1 -methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine, 4-thio- uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo- uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine, 5- carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl-uridine, 5-methoxycarbonylmethyl- 2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-aminomethyl
- the modified cytidine of N is 5-aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetyl-cytidine, 5-formyl-cytidine, N4-methyl-cytidine, 5-methyl- cytidine, 5-halo-cytidine, 5-hydroxymethyl-cytidine, 1 -methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo- pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1 -methylpseudoisocytidine, 4-thio-1 -methyl-1 -deaza-pseudoisocytidine, 1 -methyl-1 -deaza-pseudoisocytidine, zebularine
- the modified adenosine of N is 2-amino-purine, 2, 6-diaminopurine, 2- amino-6-halo-purine, 6-halo-purine, 2-amino-6-methyl-purine, 8-azido-adenosine, 7-deaza-adenine, 7- deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2,6- diaminopurine, 7-deaza-8-aza-2, 6-diaminopurine, 1 -methyl-adenosine, 2-methyl-adenine, N6-methyl- adenosine, 2-methylthio-N6-methyl-adenosine, N6-isopentenyl-adenosine, 2-methylthio-N6-isopentenyl- adenosine, N6-(cis-hydroxyisopentenyl)a
- the modified guanosine of N is inosine, 1 -methyl-inosine, wyosine, methylwyosine, 4-demethyl-wyosine, isowyosine, wybutosine, peroxywybutosine, hydroxywybutosine, 7- deaza-guanosine, queuosine, epoxyqueuosine, galactosyl-queuosine, mannosyl-queuosine, 7-cyano-7- deaza-guanosine, 7-aminomethyl-7-deaza-guanosine, archaeosine, 7-deaza-8-aza-guanosine, 6-thio- guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7- methyl-guanosine, 7-methyl-inosine, 6-me
- the modified uridine of U’ is 1 -methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine, 4-thio- uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo- uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine, 5- carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl-uridine, 5-methoxycarbonylmethyl- 2-thio-uridine, 5-aminomethyl-2-thio-uridine,
- each n is, independently, an integer from 10 to 40. In some embodiments, each n is, independently, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, or 38. In some embodiments, each m is, independently, an integer from 2 to 15. In some embodiments, each m is, independently, an integer from 7 to 1 1 . In some embodiments, each m is 9. In some embodiments, p is an integer from 2 to 10. In some embodiments, p is an integer from 3 to 6, optionally wherein p is 3 or 6.
- the nucleic acid is RNA. In some embodiments, the nucleic acid is linear. In some embodiments, the nucleic acid is circular. In some embodiments, the open reading from consists of nucleosides selected from adenosine, a modified adenosine, uridine, a modified uridine, guanosine, a modified guanosine, cytidine, and a modified cytidine. In some embodiments, the open reading from consists of nucleosides selected from adenosine, uridine, a modified uridine, guanosine, and cytidine.
- the modified uridine of the open reading frame is 1 -methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio- uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl-uridine, 5- methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-a
- the modified cytidine of N is 5-aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetyl-cytidine, 5-formyl-cytidine, N4-methyl-cytidine, 5-methyl- cytidine, 5-halo-cytidine, 5-hydroxymethyl-cytidine, 1 -methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo- pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1 -methylpseudoisocytidine, 4-thio-1 -methyl-1 -deaza-pseudoisocytidine, 1 -methyl-1 -deaza-pseudoisocytidine, zebularine
- the modified adenosine of N is 2-amino-purine, 2, 6-diaminopurine, 2- amino-6-halo-purine, 6-halo-purine, 2-amino-6-methyl-purine, 8-azido-adenosine, 7-deaza-adenine, 7- deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2,6- diaminopurine, 7-deaza-8-aza-2, 6-diaminopurine, 1 -methyl-adenosine, 2-methyl-adenine, N6-methyl- adenosine, 2-methylthio-N6-methyl-adenosine, N6-isopentenyl-adenosine, 2-methylthio-N6-isopentenyl- adenosine, N6-(cis-hydroxyisopentenyl)a
- the modified guanosine of N is inosine, 1 -methyl-inosine, wyosine, methylwyosine, 4-demethyl-wyosine, isowyosine, wybutosine, peroxywybutosine, hydroxywybutosine, 7- deaza-guanosine, queuosine, epoxyqueuosine, galactosyl-queuosine, mannosyl-queuosine, 7-cyano-7- deaza-guanosine, 7-aminomethyl-7-deaza-guanosine, archaeosine, 7-deaza-8-aza-guanosine, 6-thio- guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7- methyl-guanosine, 7-methyl-inosine, 6-me
- the polypeptide encoded by the open reading frame is a secreted protein, (e.g., a cytokine, a growth factor, an enzyme, an immunomodulator, an antibody or antigen-binding fragment thereof, or a cell-penetrating peptide), an extracellular membrane-bound protein, an intracellular membrane-bound protein, a cytoplasmic protein, a cytoskeletal protein, or a nuclear protein.
- a secreted protein e.g., a cytokine, a growth factor, an enzyme, an immunomodulator, an antibody or antigen-binding fragment thereof, or a cell-penetrating peptide
- an extracellular membrane-bound protein e.g., an extracellular membrane-bound protein, an intracellular membrane-bound protein, a cytoplasmic protein, a cytoskeletal protein, or a nuclear protein.
- the nucleic acid does not comprise a 5’ cap.
- the nucleic acid includes a nucleotide sequence with at least 75% percent sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% percent sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% percent sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% percent sequence identity to any one of SEQ ID NOs: 173-190 and 202-205.
- the nucleic acid includes a nucleotide sequence with at least 95% percent sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In some embodiments, the nucleic acid includes the nucleotide sequence of any one of SEQ ID NOs: 173-190 and 202-205.
- the nucleic acid include a nucleotide sequence with about 70% to about 100% (e.g., about 70% to about 100%, about 75% to about 100%, about 80% to about 100%, about 85% to about 100%, about 90% to about 100%, about 91 % to about 100%, about 92% to about 100%, about 93% to about 100%, about 94% to about 100%, about 95% to about 100%, about 96% to about 100%, about 97% to about 100%, about 98% to about 100%, or about 99% to 100%) sequence identity to an IRES sequence presented in Table 2 (e.g., any one of IRES 1 to IRES 22).
- Table 2 e.g., any one of IRES 1 to IRES 22.
- the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 173. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 173. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 173. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 173. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 173.
- the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 173. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 173. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 173. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 173. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 173.
- the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 173. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 173. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 173. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 173. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 173.
- the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 174. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 174. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 174. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 174. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 174.
- the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 174. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 174. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 174. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 174. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 174.
- the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 174. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 174. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 174. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 174. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 174.
- the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 175. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 175. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 175. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 175. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 175.
- the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 175. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 175. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 175. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 175. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 175.
- the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 175. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 175. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 175. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 175. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 175.
- the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 176. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 176. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 176. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 176. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 176.
- the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 176. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 176. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 176. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 176. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 176.
- the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 176. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 176. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 176. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 176. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 176.
- the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 177. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 177. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 177. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 177. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 177.
- the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 177. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 177. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 177. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 177. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 177.
- the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 177. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 177. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 177. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 177. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 177.
- the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 178. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 178. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 178. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 178. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 178.
- the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 178. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 178. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 178. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 178. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 178.
- the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 178. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 178. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 178. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 178. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 178.
- the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 179. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 179. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 179. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 179. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 179.
- the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 179. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 179. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 179. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 179. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 179.
- the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 179. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 179. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 179. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 179. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 179.
- the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 180. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 180. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 180. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 180. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 180.
- the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 180. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 180. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 180. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 180. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 180.
- the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 180. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 180. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 180. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 180. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 180.
- the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 181. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 181. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 181. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 181. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 181.
- the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 181 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 181. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 181. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 181. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 181.
- the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 181. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 181. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 181. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 181. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 181 .
- the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 182. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 182. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 182. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 182. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 182.
- the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 182. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 182. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 182. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 182. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 182.
- the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 182. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 182. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 182. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 182. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 182.
- the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 183. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 183. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 183. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 183. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 183.
- the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 183. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 183. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 183. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 183. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 183.
- the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 183. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 183. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 183. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 183. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 183.
- the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 184. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 184. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 184. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 184. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 184.
- the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 184. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 184. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 184. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 184. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 184.
- the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 184. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 184. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 184. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 184. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 184.
- the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 185. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 185. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 185. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 185. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 185.
- the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 185. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 185. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 185. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 185. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 185.
- the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 185. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 185. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 185. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 185. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 185.
- the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 186. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 186. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 186. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 186. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 186.
- the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 186. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 186. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 186. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 186. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 186.
- the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 186. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 186. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 186. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 186. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 186.
- the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 187. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 187. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 187. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 187. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 187.
- the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 187. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 187. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 187. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 187. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 187.
- the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 187. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 187. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 187. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 187. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 187.
- the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 188. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 188. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 188. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 188. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 188.
- the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 188. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 188. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 188. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 188. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 188.
- the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 188. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 188. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 188. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 188. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 188.
- the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 189. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 189. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 189. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 189. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 189.
- the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 189. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 189. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 189. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 189. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 189.
- the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 189. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 189. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 189. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 189. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 189.
- the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 190. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 190. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 190. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 190. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 190.
- the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 190. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 190. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 190. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 190. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 190.
- the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 190. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 190. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 190. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 190. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 190.
- the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 202. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 202. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 202. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 202. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 202.
- the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 202. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 202. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 202. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 202. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 202.
- the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 202. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 202. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 202. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 202. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 202.
- the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 203. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 203. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 203. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 203. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 203.
- the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 203. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 203. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 203. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 203. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 203.
- the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 203. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 203. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 203. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 203. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 203.
- the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 204. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 204. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 204. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 204. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 204.
- the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 204. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 204. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 204. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 204. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 204.
- the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 204. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 204. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 204. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 204. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 204.
- the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 205.
- the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 205.
- the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 205. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 205.
- nucleic acid comprising:
- an IRES comprising one or more polynucleotides that specifically bind a translation initiation factor (for example, eukaryotic translation initiation factor 4 G (elF4G), eukaryotic translation initiation factor 4G2 (elF4G2, also referred to as Dap5), eukaryotic translation initiation factor 3 (elF3)), or IRES trans-acting factors (ITAfs), such as a polypyrimidine tract-binding protein (PTBP) or a fusion protein comprising a translation initiation factor (e.g., elF4G, elF4G2, elF3, La protein, or an ITAf, such as La) fused to an RNA-binding protein; operably linked to a translation initiation factor (elF4G), eukaryotic translation initiation factor 4G2 (elF4G2, also referred to as Dap5), eukaryotic translation initiation factor 3 (elF3)), or IRES trans-acting factors (
- the one or more polynucleotides specifically bind elF4G, elF4G2, elF3, La protein, or an ITAF, such as PTBP.
- each of the one or more polynucleotides independently, has a nucleic acid sequence that is at least 75% identical to ACUCACUAUUUGUUUUCGCGCCCAGUUGCAAAAA (SEQ ID NO: 1 ).
- each of the one or more polynucleotides independently, has a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO: 1 (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 1 ). In some embodiments, each of the one or more polynucleotides has the nucleic acid sequence of SEQ ID NO: 1 .
- each U residue in SEQ ID NO: 1 is replaced with a modified uridine, such as 1 -methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2- thio-5-aza-uridine, 2-thio-uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy- uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5- carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl- uridine, 5-methoxycarbonylmethyl-2-thio-uridine
- the IRES comprises one or more polynucleotides that specifically bind to a fusion protein comprising a translation initiation factor (e.g., elF4G, elF4G2, elF3, La protein, or an ITAf, such as PTBP) fused to an RNA-binding protein.
- a translation initiation factor e.g., elF4G, elF4G2, elF3, La protein, or an ITAf, such as PTBP
- RNA-binding protein may be an MS2-binding protein
- the one or more polynucleotides may comprise one or more MS2 RNA hairpins.
- the IRES comprises a plurality of polynucleotides that specifically bind a translation initiation factor (for example, elF4G, elF4G2, elF3, La protein, or an ITAf, such as a PTBP), or a fusion protein comprising a translation initiation factor (e.g., elF4G, elF4G2, elF3, La protein, or an ITAf, such as PTBP) fused to an RNA-binding protein.
- a translation initiation factor for example, elF4G, elF4G2, elF3, La protein, or an ITAf, such as a PTBP
- a translation initiation factor for example, elF4G, elF4G2, elF3, La protein, or an ITAf, such as a PTBP
- a translation initiation factor for example, elF4G, elF4G2, elF3, La
- the IRES comprises from 2 to 20 polynucleotides that specifically bind a translation initiation factor (for example, elF4G, elF4G2, elF3, La protein, or an ITAf, such as a PTBP), or a fusion protein comprising a translation initiation factor (e.g., elF4G, elF4G2, elF3, La protein, or an ITAf, such as PTBP) fused to an RNA-binding protein (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 polynucleotides that specifically bind a translation initiation factor (for example, elF4G, elF4G2, elF3, La protein, or an ITAf, such as a PTBP), or a fusion protein comprising a translation initiation factor (e.g., elF4G, elF4G2, elF3,
- the IRES comprises from 2 to 10 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein).
- RNA-binding protein e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein.
- the IRES comprises from 3 to 9 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein (e.g., 3, 4, 5, 6, 7, 8, or 9 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein).
- RNA-binding protein e.g., 3, 4, 5, 6, 7, 8, or 9 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein.
- the IRES comprises from 4 to 8 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein (e.g., 4, 5, 6, 7, or 8 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein).
- RNA-binding protein e.g., 4, 5, 6, 7, or 8 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein.
- the IRES comprises from 5 to 7 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein (e.g., 5, 6, or 7 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein).
- RNA-binding protein e.g., 5, 6, or 7 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein.
- the IRES comprises 2 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein. In some embodiments, the IRES comprises 3 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein.
- the IRES comprises 4 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein. In some embodiments, the IRES comprises 5 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein.
- the IRES comprises 6 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA- binding protein. In some embodiments, the IRES comprises 7 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein.
- the IRES comprises 8 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein. In some embodiments, the IRES comprises 9 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein.
- the IRES comprises 10 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein.
- the nucleic acid does not comprise a 5’ cap.
- the nucleic acid includes a nucleotide sequence with at least 75% percent sequence identity to any one of SEQ ID NOs: 191 -201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% percent sequence identity to any one of SEQ ID NOs: 191 -201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% percent sequence identity to any one of SEQ ID NOs: 191 -201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% percent sequence identity to any one of SEQ ID NOs: 191 -201 .
- the nucleic acid includes a nucleotide sequence with at least 95% percent sequence identity to any one of SEQ ID NOs: 191 -201 . In some embodiments, the nucleic acid includes the nucleotide sequence of any one of SEQ ID NOs: 191 -201 .
- the nucleic acid include a nucleotide sequence with about 70% to about 100% (e.g., about 70% to about 100%, about 75% to about 100%, about 80% to about 100%, about 85% to about 100%, about 90% to about 100%, about 91 % to about 100%, about 92% to about 100%, about 93% to about 100%, about 94% to about 100%, about 95% to about 100%, about 96% to about 100%, about 97% to about 100%, about 98% to about 100%, or about 99% to 100%) sequence identity to an IRES sequence presented in Table 3 (e.g., any one of IRES 19 to IRES 29).
- the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 191.
- the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 191. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 191. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 191. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 191. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 191 .
- the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 191. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 191. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 191. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 191. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 191.
- the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 191. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 191. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 191. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 191 .
- the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 192. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 192. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 192. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 192. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 192.
- the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 192. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 192. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 192. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 192. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 192.
- the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 192. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 192. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 192. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 192. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 192.
- the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 193. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 193. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 193. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 193. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 193.
- the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 193. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 193. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 193. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 193. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 193.
- the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 193. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 193. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 193. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 193. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 193.
- the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 194. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 194. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 194. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 194. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 194.
- the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 194. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 194. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 194. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 194. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 194.
- the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 194. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 194. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 194. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 194. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 194.
- the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 195. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 195. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 195. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 195. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 195.
- the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 195. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 195. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 195. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 195. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 195.
- the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 195. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 195. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 195. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 195. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 195.
- the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 196. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 196. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 196. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 196. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 196.
- the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 196. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 196. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 196. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 196. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 196.
- the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 196. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 196. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 196. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 196. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 196.
- the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 197. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 197. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 197. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 197. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 197.
- the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 197. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 197. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 197. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 197. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 197.
- the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 197. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 197. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 197. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 197. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 197.
- the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 198. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 198. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 198. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 198. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 198.
- the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 198. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 198. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 198. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 198. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 198.
- the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 198. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 198. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 198. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 198. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 198.
- the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 199. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 199. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 199. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 199. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 199.
- the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 199. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 199. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 199. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 199. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 199.
- the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 199. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 199. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 199. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 199. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 199.
- the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 200. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 200. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 200. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 200. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 200.
- the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 200. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 200. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 200. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 200. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 200.
- the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 200. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 200. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 200. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 200. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 200.
- the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 201 .
- the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 201 .
- the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 201 . In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 201 .
- nucleic acid including:
- an internal ribosome entry site including a nucleotide sequence having complementarity sufficient to hybridize to a region within a ribosomal RNA (rRNA), operably linked to
- the IRES does not specifically bind to ribosomal protein.
- the nucleotide sequence of the IRES has at least 70% complementarity to the region within the rRNA, optionally wherein the IRES has at least 71%, 72%, 73%, 74%, 85%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementarity to the region within the rRNA.
- the nucleotide sequence of the IRES has at least 70% complementarity to at least 10, at least 11 , at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21 , at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or 30 or more contiguous nucleobases within the region of the rRNA.
- the nucleotide sequence of the IRES has at least 75% complementarity to at least 10, at least 11 , at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21 , at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or 30 or more contiguous nucleobases within the region of the rRNA, optionally wherein the nucleic acid sequences has at least 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementarity to the at least 10, at least 11 , at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21 , at least 22, at least 23, at least 24, at least 25, at
- the nucleotide sequence of the IRES includes at least 10, at least 11 , at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21 , at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the rRNA.
- the nucleotide sequence of the IRES includes from 10 to 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the rRNA. In some embodiments, the nucleotide sequence of the IRES includes from 12 to 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the rRNA. In some embodiments, the nucleotide sequence of the IRES includes from 15 to 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the rRNA.
- the nucleotide sequence of the IRES includes from 18 to 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the rRNA. In some embodiments, the nucleotide sequence of the IRES includes from 20 to 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the rRNA. In some embodiments, the nucleotide sequence of the IRES includes from 25 to 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the rRNA.
- the nucleotide sequence of the IRES includes 9 or fewer nucleotide mismatches relative to the region of the rRNA, optionally wherein the antisense strand includes 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer, or only 1 mismatch relative to the region of the rRNA.
- the IRES does not include a chemically modified nucleoside.
- the IRES includes nucleosides selected solely from adenosine, guanosine, cytidine, and uridine.
- the IRES includes one or more chemically modified nucleosides. In some embodiments, the IRES includes one or more chemically modified adenosine, guanosine, cytidine, and/or uridine nucleosides.
- At least 70% of the nucleosides in the IRES are chemically modified (e.g., at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the nucleosides in the IRES are chemically modified).
- At least 70% of the adenosine nucleosides in the IRES are chemically modified (e.g., at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the adenosine nucleosides in the IRES are chemically modified).
- the IRES includes one or more chemically modified adenosine nucleosides.
- the modified adenosine of N is 2-amino-purine, 2, 6-diaminopurine, 2-amino-6-halo-purine, 6-halo-purine, 2-amino-6-methyl-purine, 8-azido-adenosine, 7-deaza-adenine, 7- deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2,6- diaminopurine, 7-deaza-8-aza-2, 6-diaminopurine, 1 -methyl-adenosine, 2-methyl-adenine, N6-methyl- adenosine, 2-methylthio-N6-methyl-adenosine, N6-isopentenyl-adenosine, 2-methylthio-N6
- At least 70% of the guanosine nucleosides in the IRES are chemically modified (e.g., at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the guanosine nucleosides in the IRES are chemically modified).
- the IRES includes one or more chemically modified guanosine nucleosides.
- the modified guanosine of N is inosine, 1 -methyl-inosine, wyosine, methylwyosine, 4-demethyl-wyosine, isowyosine, wybutosine, peroxywybutosine, hydroxywybutosine, 7- deaza-guanosine, queuosine, epoxyqueuosine, galactosyl-queuosine, mannosyl-queuosine, 7-cyano-7- deaza-guanosine, 7-aminomethyl-7-deaza-guanosine, archaeosine, 7-deaza-8-aza-guanosine, 6-thio- guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7- methyl-guanosine, 7-methyl-inosine, 6-me
- At least 70% of the cytidine nucleosides in the IRES are chemically modified (e.g., at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the cytidine nucleosides in the IRES are chemically modified).
- the IRES includes one or more chemically modified cytidine nucleosides.
- the modified cytidine of N is 5-aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3- methyl-cytidine, N4-acetyl-cytidine, 5-formyl-cytidine, N4-methyl-cytidine, 5-methyl-cytidine, 5-halo- cytidine, 5-hydroxymethyl-cytidine, 1 -methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo- pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1 -methylpseudoisocytidine, 4-thio-1 -methyl-1 -deaza-pseudoisocytidine,
- At least 70% of the uridine nucleosides in the IRES are chemically modified (e.g., at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the uridine nucleosides in the IRES are chemically modified).
- the IRES includes one or more chemically modified uridine nucleosides.
- the modified uridine of N is 1 -methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine, 4-thio-uridine, 4-thio- pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl- uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5- carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine, 5- carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl-uridine, 5-methoxycarbonylmethyl- 2-thio
- the IRES includes one or more polynucleotide tracts enriched in uridine or a modified uridine
- the IRES includes from 1 to 20 of the polynucleotide tracts enriched in uridine or a modified uridine. In some embodiments, the IRES includes from 2 to 10 of the polynucleotide tracts enriched in uridine or a modified uridine. In some embodiments, the IRES includes from 3 to 6 of the polynucleotide tracts enriched in uridine or a modified uridine. In some embodiments, the IRES includes 3 of the polynucleotide tracts enriched in uridine or a modified uridine. In some embodiments, the IRES includes 4 of the polynucleotide tracts enriched in uridine or a modified uridine.
- the IRES includes 5 of the polynucleotide tracts enriched in uridine or a modified uridine. In some embodiments, the IRES includes 6 of the polynucleotide tracts enriched in uridine or a modified uridine.
- At least 70% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine. In some embodiments, at least 75% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine. In some embodiments, at least 80% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine. In some embodiments, at least 85% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine.
- At least 90% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine. In some embodiments, at least 95% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine. In some embodiments, all of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine, preferably wherein all of the nucleosides in each of the polynucleotide tracts is a modified uridine.
- each polynucleotide tract is from 5 to 20 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 15 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 7 to 1 1 nucleosides in length. In some embodiments, each polynucleotide tract is 9 nucleosides in length.
- each polynucleotide tract independently, includes from 5 to 20 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract, independently, includes from 6 to 15 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract, independently, includes from 7 to 1 1 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract includes at least 9 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract includes 9 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract is enriched in the modified uridine.
- the modified uridine is 1 -methylpseudouridine, pseudouridine, pyridin-4- one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine, 4-thio-uridine, 4-thio- pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl- uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5- carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine, 5- carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl-uridine, 5-methoxycarbonylmethyl- 2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl-uridine
- the IRES is located within a noncoding region of the nucleic acid (e.g., a 5’ untranslated region (UTR)) that is operably linked to the open reading frame.
- the open reading frame is further operably linked to a 3’ UTR.
- the polynucleotide tracts are separated from one another by way of one or more spacers that each, independently, include from 5 to 100 nucleosides. In some embodiments, each of the spacers, independently, includes from 10 to 40 nucleosides. In some embodiments, each of the spacers, independently, includes 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, or 38 nucleosides.
- the IRES is represented by the formula:
- each N is, independently, any nucleoside residue
- each U’ s, independently, uridine or a modified uridine
- each n is, independently, an integer from 1 to 100
- each m is, independently, an integer from 2 to 15
- p is an integer from 2 to 20.
- each N is, independently, selected from adenosine, a modified adenosine, uridine, a modified uridine, guanosine, a modified guanosine, cytidine, and a modified cytidine. In some embodiments, each N is, independently, selected from adenosine, uridine, a modified uridine, guanosine, and cytidine.
- the modified uridine of N is 1 -methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine, 4-thio- uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo- uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine, 5- carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl-uridine, 5-methoxycarbonylmethyl- 2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-aminomethyl
- the modified cytidine of N is 5-aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetyl-cytidine, 5-formyl-cytidine, N4-methyl-cytidine, 5-methyl- cytidine, 5-halo-cytidine, 5-hydroxymethyl-cytidine, 1 -methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo- pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1 -methylpseudoisocytidine, 4-thio-1 -methyl-1 -deaza-pseudoisocytidine, 1 -methyl-1 -deaza-pseudoisocytidine, zebularine
- the modified adenosine of A/ is 2-amino-purine, 2, 6-diaminopurine, 2- amino-6-halo-purine, 6-halo-purine, 2-amino-6-methyl-purine, 8-azido-adenosine, 7-deaza-adenine, 7- deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2,6- diaminopurine, 7-deaza-8-aza-2, 6-diaminopurine, 1 -methyl-adenosine, 2-methyl-adenine, N6-methyl- adenosine, 2-methylthio-N6-methyl-adenosine, N6-isopentenyl-adenosine, 2-methylthio-N6-isopentenyl- adenosine, N6-(cis-hydroxyisopentenyl)
- the modified guanosine of N is inosine, 1 -methyl-inosine, wyosine, methylwyosine, 4-demethyl-wyosine, isowyosine, wybutosine, peroxywybutosine, hydroxywybutosine, 7- deaza-guanosine, queuosine, epoxyqueuosine, galactosyl-queuosine, mannosyl-queuosine, 7-cyano-7- deaza-guanosine, 7-aminomethyl-7-deaza-guanosine, archaeosine, 7-deaza-8-aza-guanosine, 6-thio- guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7- methyl-guanosine, 7-methyl-inosine, 6-me
- the modified uridine of U’ is 1 -methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine, 4-thio- uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo- uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine, 5- carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl-uridine, 5-methoxycarbonylmethyl- 2-thio-uridine, 5-aminomethyl-2-thio-uridine,
- each n is, independently, an integer from 10 to 40. In some embodiments, each n is, independently, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, or 38. In some embodiments, each m is, independently, an integer from 2 to 15. In some embodiments, each m is, independently, an integer from 7 to 1 1 . In some embodiments, each m is 9.
- p is an integer from 2 to 10. In some embodiments, p is an integer from 3 to 6, optionally wherein p is 3 or 6.
- the nucleic acid is RNA. In some embodiments, the nucleic acid is linear. In some embodiments, the nucleic acid is circular.
- the open reading from consists of nucleosides selected from adenosine, a modified adenosine, uridine, a modified uridine, guanosine, a modified guanosine, cytidine, and a modified cytidine. In some embodiments, the open reading from consists of nucleosides selected from adenosine, uridine, a modified uridine, guanosine, and cytidine.
- the modified uridine of the open reading frame is 1 -methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio- uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl-uridine, 5- methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-a
- the modified cytidine of N is 5-aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetyl-cytidine, 5-formyl-cytidine, N4-methyl-cytidine, 5-methyl- cytidine, 5-halo-cytidine, 5-hydroxymethyl-cytidine, 1 -methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo- pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1 -methylpseudoisocytidine, 4-thio-1 -methyl-1 -deaza-pseudoisocytidine, 1 -methyl-1 -deaza-pseudoisocytidine, zebularine
- the modified adenosine of N is 2-amino-purine, 2, 6-diaminopurine, 2- amino-6-halo-purine, 6-halo-purine, 2-amino-6-methyl-purine, 8-azido-adenosine, 7-deaza-adenine, 7- deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2,6- diaminopurine, 7-deaza-8-aza-2, 6-diaminopurine, 1 -methyl-adenosine, 2-methyl-adenine, N6-methyl- adenosine, 2-methylthio-N6-methyl-adenosine, N6-isopentenyl-adenosine, 2-methylthio-N6-isopentenyl- adenosine, N6-(cis-hydroxyisopentenyl)a
- the modified guanosine of N is inosine, 1 -methyl-inosine, wyosine, methylwyosine, 4-demethyl-wyosine, isowyosine, wybutosine, peroxywybutosine, hydroxywybutosine, 7- deaza-guanosine, queuosine, epoxyqueuosine, galactosyl-queuosine, mannosyl-queuosine, 7-cyano-7- deaza-guanosine, 7-aminomethyl-7-deaza-guanosine, archaeosine, 7-deaza-8-aza-guanosine, 6-thio- guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7- methyl-guanosine, 7-methyl-inosine, 6-me
- the polypeptide encoded by the open reading frame is a secreted protein, a cytokine, a growth factor, an enzyme, an immunomodulator, an antibody or antigen-binding fragment thereof, a cell-penetrating peptide, an extracellular membrane-bound protein, an intracellular membranebound protein, a cytoplasmic protein, a cytoskeletal protein, or a nuclear protein.
- the nucleic acid does not include a 5’ cap. In some embodiments, the nucleic acid includes a 5’ cap.
- the nucleotide sequence of the IRES includes at least 75% sequence identity to SEQ ID NO: 185 or SEQ ID NO: 190. In some embodiments, the nucleotide sequence of the IRES includes at least 80% sequence identity to SEQ ID NO: 185 or SEQ ID NO: 190. In some embodiments, the nucleotide sequence of the IRES includes at least 85% sequence identity to SEQ ID NO: 185 or SEQ ID NO: 190. In some embodiments, the nucleotide sequence of the IRES has at least 90% sequence identity to SEQ ID NO: 185 or SEQ ID NO: 190.
- the nucleotide sequence of the IRES has a at least 95% sequence identity to SEQ ID NO: 185 or SEQ ID NO: 190, optionally wherein the nucleotide sequence of the IRES has at least 96%, 97%, 98%, or 99% sequence identity SEQ ID NO: 185 or SEQ ID NO: 190. In some embodiments, the nucleotide sequence of the IRES is SEQ ID NO: 185 or SEQ ID NO: 190.
- the IRES includes one or more polynucleotides that specifically bind a translation initiation factor (e.g., eukaryotic translation initiation factor 4 G (elF4G), eukaryotic translation initiation factor 4G2 (elF4G2), eukaryotic translation initiation factor 3 (elF3), La protein, or an IRES transacting factors (ITAf)), or a fusion protein including a translation initiation factor (e.g., elF4G, elF4G2, elF3, La protein, or an ITAf) fused to an RNA-binding protein.
- the one or more polynucleotides specifically bind elF4G.
- each of the one or more polynucleotides independently, has a nucleic acid sequence that is at least 75% identical to ACUCACUAUUUGUUUUCGCGCCCAGUUGCAAAAA (SEQ ID NO: 1 ), optionally wherein each U residue in SEQ ID NO: 1 is replaced with 1 - methylpseudouridine.
- each of the one or more polynucleotides independently, has a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO: 1 (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 1 ), optionally wherein each U residue in SEQ ID NO: 1 is replaced with 1 - methylpseudouridine.
- the IRES includes one or more polynucleotides that specifically bind to a fusion protein including a translation initiation factor (e.g., elF4G, elF4G2, elF3, La protein, or an ITAf) fused to an RNA-binding protein, optionally wherein the RNA-binding protein is MS2-binding protein and the one or more polynucleotides include one or more MS2 RNA hairpins.
- a translation initiation factor e.g., elF4G, elF4G2, elF3, La protein, or an ITAf
- the nucleic acid does not include a 5’ cap. In some embodiments, the nucleic acid includes a 5’ cap.
- the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to any one of SEQ ID NO: 191 -201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to any one of SEQ ID NO: 191 -201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to any one of SEQ ID NO: 191 -201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to any one of SEQ ID NO: 191 -201 .
- the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to any one of SEQ ID NO: 191 -201 . In some embodiments, the nucleic acid includes the nucleotide sequence of any one of SEQ ID NO: 191 -201.
- rRNA is a eukaryotic rRNA. In some embodiments, the rRNA is from a 60S or 40S ribosomal subunit, optionally wherein the rRNA is selected from the group consisting of a 25S, 28S, 18S, 5.8S, and 5S rRNA.
- the nucleic acid sequence surrounding (e.g., 5’ and/or 3’ relative to) the IRES has a single stranded RNA structure.
- polypeptide expression system comprising:
- nucleic acid comprising an open reading frame that encodes elF4G, La protein, or a functional variant thereof.
- nucleic acid of (i) and the nucleic acid of (ii) are separate molecules.
- nucleic acid of (ii) comprises, from 5’ to 3’:
- nucleic acid of (ii) further comprises a 5’ cap operably linked to the 5’ UTR.
- the disclosure provides a host cell comprising the nucleic acid or polypeptide expression system of any one of the above aspects or embodiments of the disclosure.
- the host cell is a eukaryotic cell.
- the eukaryotic cell is a mammalian cell.
- the mammalian cell is a human cell.
- the disclosure provides a method of expressing a polypeptide in a subject, the method comprising administering to the subject the nucleic acid or polypeptide expression system of any of the above aspects or embodiments of the disclosure.
- the disclosure provides a method of expressing a polypeptide in a cell or population of cells, the method comprising administering to the subject the nucleic acid or polypeptide expression system of any of the above aspects or embodiments of the disclosure.
- the disclosure provides a method of treating a disease or condition associated with a deficiency in an endogenous polypeptide, the method comprising administering to the subject the nucleic acid or polypeptide expression system of any of the above aspects or embodiments of the disclosure, with the proviso that the polypeptide encoded by the nucleic acid or polypeptide expression system corresponds to the polypeptide whose deficiency is associated with the disease or condition.
- the term “about” refers to a value that is no more than 10% above or below the value being described.
- the term “about 5 nM” indicates a range of from 4.5 nM to 5.5 nM.
- biocompatible means compatible with living cells, tissues, organs or systems posing little to no risk of injury, toxicity or rejection by the immune system.
- biodegradable means capable of being broken down into innocuous products by the action of living things.
- biologically active refers to a characteristic of any substance that has activity in a biological system and/or organism. For instance, a substance that, when administered to an organism, has a biological effect on that organism, is considered to be biologically active.
- a polynucleotide of the present disclosure can be considered biologically active if even a portion of the polynucleotide is biologically active or mimics an activity considered biologically relevant.
- amino acid substitution refers to the replacement of an amino acid residue present in a parent or reference polypeptide (e.g., a target polypeptide described herein) with another amino acid residue.
- An amino acid can be substituted in a parent or reference sequence, for example, via chemical peptide synthesis or through recombinant methods known in the art.
- substitution at position X refers to the substitution of an amino acid present at position X with an alternative amino acid residue.
- substitution patterns can be described according to the scheme AnY, wherein A is the single letter code corresponding to the amino acid naturally or originally present at position n, and Y is the substituting amino acid residue.
- substitution patterns can be described according to the scheme An(YZ), wherein A is the single letter code corresponding to the amino acid residue substituting the amino acid naturally or originally present at position n, and Y and Z are alternative substituting amino acid residue.
- substitutions may be conducted at the nucleic acid level, i.e., substituting an amino acid residue with an alternative amino acid residue may be conducted by substituting the codon encoding the first amino acid with a codon encoding the second amino acid.
- the terms “conservative mutation,” “conservative substitution,” “conservative amino acid substitution,” and the like refer to a substitution of one or more amino acids for one or more different amino acids that exhibit similar physicochemical properties, such as polarity, electrostatic charge, and/or steric volume. These properties are summarized for each of the twenty naturally-occurring amino acids in Table 1 below.
- conservative amino acid families include, e.g., (i) G, A, V, L, I, P, and M; (ii) D and E; (iii) C, S and T; (iv) H, K and R; (v) N and Q; and (vi) F, Y and W.
- a conservative mutation or substitution is therefore one that substitutes one amino acid for a member of the same amino acid family (e.g., a substitution of Ser for Thr or Lys for Arg).
- conjugate refers to a compound formed by the chemical bonding of a reactive functional group of one molecule with an appropriately reactive functional group of another molecule. Conjugates may additionally be produced, e.g., as two polypeptide domains covalently bound to one another as part of a single polypeptide chain that is synthesized by the translation of a single RNA transcript encoding both polypeptides in frame with one another.
- sequence optimization refers to a process or series of processes by which nucleobases in a reference nucleic acid sequence are replaced with alternative nucleobases, resulting in a nucleic acid sequence with improved properties, e.g., improved protein expression or decreased immunogenicity.
- sequence optimization is to produce a synonymous nucleotide sequence than encodes the same polypeptide sequence encoded by the reference nucleotide sequence.
- references to a "substitution” or “replacement” at a certain location in a nucleic acid sequence (e.g., an mRNA) or within a certain region or subsequence of a nucleic acid sequence (e.g., an mRNA) refer to the substitution of a codon at such location or region with an alternative codon.
- coding region and “region encoding” and grammatical variants thereof, refer to an Open Reading Frame (ORF) in a polynucleotide that upon expression yields a polypeptide or protein.
- ORF Open Reading Frame
- nucleic acid sequence or a portion thereof that need not be fully complementary (e.g., 100% complementary) to a target region or a nucleic acid sequence or a portion thereof that has one or more nucleotide mismatches relative to the target region but that is still capable of hybridizing to the target region under specified conditions.
- the nucleic acid may be, e.g., 95% complementary, 90%, complementary, 85% complementary, 80% complementary, 75% complementary, 70% complementary, 65% complementary, 60% complementary, 55% complementary, 50% complementary, or less, but still form sufficient base pairs with the target so as to hybridize across its length.
- contacting means establishing a physical connection between two or more entities.
- contacting a mammalian cell with a nanoparticle composition means that the mammalian cell and a nanoparticle are made to share a physical connection.
- Methods of contacting cells with external entities both in vivo and ex vivo are well known in the biological arts.
- contacting a nanoparticle composition and a mammalian cell disposed within a mammal can be performed by varied routes of administration (e.g., intravenous, intramuscular, intradermal, and subcutaneous) and can involve varied amounts of nanoparticle compositions.
- routes of administration e.g., intravenous, intramuscular, intradermal, and subcutaneous
- more than one mammalian cell can be contacted by a nanoparticle composition.
- delivering means providing an entity to a destination.
- delivering a polynucleotide to a subject can involve administering a nanoparticle composition including the polynucleotide to the subject (e.g., by an intravenous, intramuscular, intradermal, or subcutaneous route).
- Administration of a nanoparticle composition to a mammal or mammalian cell can involve contacting one or more cells with the nanoparticle composition.
- delivery agent refers to any substance that facilitates, at least in part, the in vivo, in vitro, or ex vivo delivery of a polynucleotide to targeted cells.
- lipid nanoparticle refers to a transfer vehicle including one or more lipids (e.g., cationic lipids, non-cationic lipids, and PEG-modified lipids).
- Exemplary lipid nanoparticles are formulated to deliver one or more mRNA to one or more target cells.
- suitable lipids include, for example, the phosphatidyl compounds (e.g., phosphatidylglycerol, phosphatidylcholine, phosphatidylserine, phosphatidylethanolamine, sphingolipids, cerebrosides, and gangliosides).
- Lipid nanoparticles may contain a cationic lipid, or a lipid species with a net positive charge at a selected pH (e.g., physiological pH), to encapsulate and/or enhance the delivery of mRNA into the target cells.
- helper lipid refers to a compound or molecule that includes a lipidic moiety (for insertion into a lipid layer, e.g., lipid bilayer) and a polar moiety (for interaction with physiologic solution at the surface of the lipid layer).
- the helper lipid is a phospholipid.
- a function of the helper lipid is to “complement” the amino lipid and increase the fusogenicity of the bilayer and/or to help facilitate endosomal escape, e.g., of nucleic acid delivered to cells.
- Helper lipids are also believed to be a key structural component to the surface of the LNP.
- ionizable amino lipid includes those lipids having one, two, three, or more fatty acid or fatty alkyl chains and a pH-titratable amino head group (e.g., an alkylamino or dialkylamino head group).
- An ionizable amino lipid is typically protonated (i.e., positively charged) at a pH below the pKa of the amino head group and is substantially not charged at a pH above the pKa.
- Such ionizable amino lipids include, but are not limited to DLin-MC3-DMA (MC3), (13Z,165Z)-N,N-dimethyl-3- nonydocosa-13-16-dien-1 -amine (L608), and a compound of any one of Formula I, II, and II described herein (e.g., any one of Compound 1-1 , Compound I-2, Compound I-3, or Compound l-VI).
- a "linker” refers to a group of atoms, e.g., 10-1 ,000 atoms, and can be comprised of the atoms or groups such as, but not limited to, carbon, amino, alkylamino, oxygen, sulfur, sulfoxide, sulfonyl, carbonyl, and imine.
- the linker can be attached to a modified nucleoside or nucleotide on the nucleobase or sugar moiety at a first end, and to a payload, e.g., a detectable or therapeutic agent, at a second end.
- the linker can be of sufficient length as to not interfere with incorporation into a nucleic acid sequence.
- the linker can be used for any useful purpose, such as to form polynucleotide multimers (e.g., through linkage of two or more chimeric polynucleotides molecules or IVT polynucleotides) or polynucleotides conjugates, as well as to administer a payload, as described herein.
- Examples of chemical groups that can be incorporated into the linker include, but are not limited to, alkyl, alkenyl, alkynyl, amido, amino, ether, thioether, ester, alkylene, heteroalkylene, aryl, or heterocyclyl, each of which can be optionally substituted, as described herein.
- linkers include, but are not limited to, unsaturated alkanes, polyethylene glycols (e.g., ethylene or propylene glycol monomeric units, e.g., diethylene glycol, dipropylene glycol, triethylene glycol, tripropylene glycol, tetraethylene glycol, or tetraethylene glycol), and dextran polymers and derivatives thereof.
- Non-limiting examples of a selectively cleavable bond include an amido bond can be cleaved for example by the use of tris(2- carboxyethyl)phosphine (TCEP), or other reducing agents, and/or photolysis, as well as an ester bond can be cleaved for example by acidic or basic hydrolysis.
- TCEP tris(2- carboxyethyl)phosphine
- messenger RNA or “mRNA” refer to any polynucleotide which encodes a polypeptide of interest and which is capable of being translated to produce the encoded polypeptide of interest in vitro, in vivo, in situ, or ex vivo.
- mRNA messenger RNA
- the basic components of an mRNA molecule include a coding region, a 5’UTR, a 3’UTR, a 5’ cap, and a poly-A tail.
- modified refers to a changed state or structure of a molecule of the present disclosure.
- Molecules can be modified in many ways, including chemically, structurally, and functionally.
- the mRNA molecules of the present disclosure are modified by the introduction of non-natural nucleosides and/or nucleotides, e.g., as it relates to the natural ribonucleotides A, U, G, and/or C. Examples of “modified” nucleosides are provided herein.
- modified messenger RNA or “modified mRNA” refer to mRNA polynucleotides that include naturally occurring and/or non-naturally occurring modifications, for example, of a sugar, a nucleobase, or an internucleoside linkage (e.g., to a linking phosphate, to a phosphodiester linkage, or to the phosphodiester backbone).
- Non-natural modified nucleotides may be introduced during synthesis of post-synthesis of the polynucleotides to achieve desired functions or properties.
- the modifications may be present on an internucleoside linkage, purine or pyrimidine base, or sugar.
- the modification may be introduced with chemical synthesis or with a polymerase enzyme at the terminal of a chain or anywhere else in the chain. Any of the regions of a polynucleotide may be chemically modified.
- unmodified refers to any substance, compound, or molecule prior to being changed in some way. Unmodified can, but does not always, refer to the wild type or native form of a biomolecule. Molecules can undergo a series of modifications whereby each modified molecule can serve as the "unmodified" starting molecule for a subsequent modification.
- Uracil is one of the four nucleobases in the nucleic acid of RNA, and it is represented by the letter U.
- Uracil can be attached to a ribose ring, or more specifically, a ribofuranose via an Ni-glycosidic bond to yield the nucleoside uridine.
- the nucleoside uridine is also commonly abbreviated according to the one letter code of its nucleobase, i.e., U.
- U when a monomer in a polynucleotide sequence is U, such U is designated interchangeably as a "uracil” or a "uridine.”
- Uridine content or uracil content are interchangeable and refer to the amount of uracil or uridine present in a certain nucleic acid sequence. Uridine content or uracil content can be expressed as an absolute value (total number of uridine or uracil in the sequence) or relative (uridine or uracil percentage respect to the total number of nucleobases in the nucleic acid sequence).
- uridine-modified sequence refers to a sequence optimized nucleic acid (e.g., a synthetic mRNA sequence) with a different overall or local uridine content (higher or lower uridine content) or with different uridine patterns (e.g., gradient distribution or clustering) with respect to the uridine content and/or uridine patterns of a candidate nucleic acid sequence.
- a "high uridine codon” is defined as a codon comprising two or three uridines
- a "low uridine codon” is defined as a codon comprising one uridine
- a "no uridine codon” is a codon without any uridines.
- a uridine-modified sequence comprises substitutions of high uridine codons with low uridine codons, substitutions of high uridine codons with no uridine codons, substitutions of low uridine codons with high uridine codons, substitutions of low uridine codons with no uridine codons, substitution of no uridine codons with low uridine codons, substitutions of no uridine codons with high uridine codons, and combinations thereof.
- a high uridine codon can be replaced with another high uridine codon.
- a low uridine codon can be replaced with another low uridine codon.
- a no uridine codon can be replaced with another no uridine codon.
- a uridine-modified sequence can be uridine enriched or uridine rarefied.
- Uridine enriched and grammatical variants refer to the increase in uridine content (expressed in absolute value or as a percentage value) in a sequence optimized nucleic acid (e.g., a synthetic mRNA sequence) with respect to the uridine content of the corresponding candidate nucleic acid sequence.
- Uridine enrichment can be implemented by substituting codons in the candidate nucleic acid sequence with synonymous codons containing less uridine nucleobases. Uridine enrichment can be global (i.e., relative to the entire length of a candidate nucleic acid sequence) or local (i.e., relative to a subsequence or region of a candidate nucleic acid sequence).
- Uridine rarefied and grammatical variants refer to a decrease in uridine content (expressed in absolute value or as a percentage value) in a sequence optimized nucleic acid (e.g., a synthetic mRNA sequence) with respect to the uridine content of the corresponding candidate nucleic acid sequence.
- Uridine rarefication can be implemented by substituting codons in the candidate nucleic acid sequence with synonymous codons containing less uridine nucleobases. Uridine rarefication can be global (i.e., relative to the entire length of a candidate nucleic acid sequence) or local (i.e., relative to a subsequence or region of a candidate nucleic acid sequence).
- initiation codon refers to the first codon of an open reading frame that is translated by the ribosome and is comprised of a triplet of linked adenine-uracil-guanine nucleobases.
- the initiation codon is depicted by the first letter codes of adenine (A), uracil (U), and guanine (G) and is often written simply as “AUG”.
- A adenine
- U uracil
- G guanine
- alternative initiation codons the initiation codons of polynucleotides described herein use the AUG codon.
- the sequence comprising the initiation codon is recognized via complementary base-pairing to the anticodon of an initiator tRNA (Met-tRNAi Met ) bound by the ribosome.
- Open reading frames may contain more than one AUG initiation codon, which are referred to herein as “alternate initiation codons”.
- the initiation codon plays an important role in translation initiation.
- the initiation codon is the first codon of an open reading frame that is translated by the ribosome.
- the initiation codon comprises the nucleotide triplet AUG, however, in some instances translation initiation can occur at other codons comprised of distinct nucleotides.
- the initiation of translation in eukaryotes is a multistep biochemical process that involves numerous protein-protein, protein-RNA, and RNA-RNA interactions between messenger RNA molecules (mRNAs), the 40S ribosomal subunit, other components of the translation machinery (e.g., eukaryotic initiation factors; elFs).
- the current model of mRNA translation initiation postulates that the pre-initiation complex (alternatively “43S pre-initiation complex”; abbreviated as “PIC”) translocates from the site of recruitment on the mRNA (typically the 5' cap) to the initiation codon by scanning nucleotides in a 5' to 3' direction until the first AUG codon that resides within a specific translation-promotive nucleotide context (the Kozak sequence) is encountered (Kozak (1989) J Cell Biol 108:229-241 ).
- PIC pre-initiation complex
- Kozak sequence refers to a translation initiation enhancer element to enhance expression of a gene or open reading frame, and which in eukaryotes, is located in the 5' UTR.
- Polynucleotides disclosed herein comprise a Kozak consensus sequence, or a derivative or modification thereof.
- nucleobase refers to a purine or pyrimidine heterocyclic compound found in nucleic acids, including any derivatives or analogs of the naturally occurring purines and pyrimidines that confer improved properties (e.g., binding affinity, nuclease resistance, chemical stability) to a nucleic acid or a portion or segment thereof.
- Adenine, cytosine, guanine, thymine, and uracil are the nucleobases predominately found in natural nucleic acids.
- nucleobase sequence of a SEQ ID NO described herein encompasses both natural nucleobases and chemically modified nucleobases (e.g., a “U” designation in a SEQ ID NO encompasses both uracil and chemically modified uracil).
- nucleoside refers to a compound containing a sugar molecule (e.g., a ribose in RNA or a deoxyribose in DNA), or derivative or analog thereof, covalently linked to a nucleobase (e.g., a purine or pyrimidine), or a derivative or analog thereof (also referred to herein as “nucleobase”), but lacking an internucleoside linking group (e.g., a phosphate group).
- a sugar molecule e.g., a ribose in RNA or a deoxyribose in DNA
- nucleobase e.g., a purine or pyrimidine
- internucleoside linking group e.g., a phosphate group
- nucleotide refers to a nucleoside covalently bonded to an internucleoside linking group (e.g., a phosphate group), or any derivative, analog, or modification thereof that confers improved chemical and/or functional properties (e.g., binding affinity, nuclease resistance, chemical stability) to a nucleic acid or a portion or segment thereof.
- internucleoside linking group e.g., a phosphate group
- any derivative, analog, or modification thereof that confers improved chemical and/or functional properties (e.g., binding affinity, nuclease resistance, chemical stability) to a nucleic acid or a portion or segment thereof.
- ORF open reading frame
- the ORF comprises a continuous stretch of non-overlapping, in-frame codons, beginning with the initiation codon and ending with a stop codon, and is translated by the ribosome.
- translational regulatory activity refers to a biological function, mechanism, or process that modulates (e.g., regulates, influences, controls, varies) the activity of the translational apparatus, including the activity of the PIC and/or ribosome.
- the desired translation regulatory activity promotes and/or enhances the translational fidelity of mRNA translation.
- the desired translational regulatory activity reduces and/or inhibits leaky scanning.
- nucleic acid and “polynucleotide” are used interchangeably. In their broadest sense, these terms include any compound and/or substance that comprises a polymer of nucleotides.
- nucleic acids or polynucleotides of the present disclosure include, but are not limited to, ribonucleic acids (RNAs), deoxyribonucleic acids (DNAs), threose nucleic acids (TNAs), glycol nucleic acids (GNAs), peptide nucleic acids (PNAs), locked nucleic acids (LNAs, including LNA having a p- D-ribo configuration, a-LNA having an a-L-ribo configuration (a diastereomer of LNA), 2'-amino-LNA having a 2'-amino functionalization, and 2'-amino- a-LNA having a 2'-amino functionalization), ethylene nucleic acids (ENA), cyclohexenyl nucleic acids (CeNA) or hybrids or combinations thereof.
- RNAs ribonucleic acids
- DNAs deoxyribonucleic acids
- TAAs threose nucleic
- Nucleic acid molecules of the disclosure may be, for example, triple-, double-, or single-stranded deoxyribonucleic acid ("DNA”), as well as triple-, double- and single-stranded ribonucleic acid (“RNA”). This term also includes modified, for example, by alkylation, and/or by capping, and unmodified forms of the corresponding unmodified nucleic acid.
- the nucleic acid comprises an mRNA.
- the mRNA is a synthetic mRNA.
- the synthetic mRNA comprises at least one unnatural nucleobase.
- nucleobases of a certain class have been replaced with unnatural nucleobases (e.g., all uridines in a polynucleotide disclosed herein can be replaced with an unnatural nucleobase, e.g., 1 -methylpseudouridine).
- the polynucleotide e.g., a synthetic RNA or a synthetic DNA
- T bases in the codon maps disclosed herein are present in DNA, whereas the T bases would be replaced by U bases in corresponding RNAs.
- a codon-nucleotide sequence disclosed herein in DNA form e.g., a vector or an in-vitro translation (IVT) template, would have its T bases transcribed as U based in its corresponding transcribed mRNA.
- IVT in-vitro translation
- both codon-optimized DNA sequences (comprising T) and their corresponding mRNA sequences (comprising U) are considered codon-optimized nucleotide sequence of the present disclosure.
- a TTC codon (DNA map) would correspond to a UUC codon (RNA map), which in turn would correspond to a ⁇ C codon (RNA map in which U has been replaced with pseudouridine).
- Standard A-T and G-C base pairs form under conditions which allow the formation of hydrogen bonds between the N3-H and C4-oxy of thymidine and the N1 and C6-NH 2 , respectively, of adenosine and between the C2-oxy, N3 and C4-NH 2 , of cytidine and the C2-NH 2 , N' — H and C6-oxy, respectively, of guanosine.
- guanosine (2-amino-6-oxy-9- ⁇ -D-ribofuranosyl-purine) can be modified to form isoguanosine (2-oxy-6-amino-9-p-D-ribofuranosyl-purine).
- isocytidine can be prepared by the method described by Switzer et al. (1993) Biochemistry 32:10489-10496 and references cited therein; 2'- deoxy-5-methyl-isocytidine can be prepared by the method of Tor et al., 1993, J. Am. Chem. Soc. 115:4461 -4467 and references cited therein; and isoguanine nucleotides can be prepared using the method described by Switzer et al., 1993, supra, and Mantsch et al., 1993, Biochem. 14:5593-5601 , or by the method described in U.S. Pat. No. 5,780,610 to Collins et al.
- Nonnatural base pairs can be synthesized by the method described in Piccirilli et al., 1990, Nature 343:33-37, for the synthesis of 2,6- diaminopyrimidine and its complement (1 -methylpyrazolo-[4,3]pyrimidine-5,7-(4H,6H)-dione.
- Other such modified nucleotide units which form unique base pairs are known, such as those described in Leach et al. (1992) J. Am. Chem. Soc. 114:3675-3683 and Switzer et al., supra.
- Nucleotides are referred to by their commonly accepted single-letter codes. Unless otherwise indicated, nucleic acids are written left to right in 5' to 3' orientation. Nucleobases are referred to herein by their commonly known one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Accordingly, A represents adenine, C represents cytosine, G represents guanine, T represents thymine, U represents uracil.
- nucleic acids or polynucleotides may be “enriched” in certain nucleosides.
- enriched refers to a polynucleotide in which at least 50% of the nucleosides within the polynucleotide are the same.
- a polynucleotide is said to be “enriched” in uridine if at least 50% (e.g., 51%, 52%, 53%, 54%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%) of the nucleosides in the polynucleotide are uridine nucleosides.
- a polynucleotide is said to be “enriched” in a modified uridine nucleoside (e.g., in 1 -methylpseudouridine) if at least 50% (e.g., 51%, 52%, 53%, 54%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%) of the nucleosides in the polynucleotide are the modified uridine nucleoside (e.g., 1 -methylpseudouridine).
- a modified uridine nucleoside e.g., in 1 -methylpseudouridine
- polynuceotides that are “enriched” for certain nucleoside residues may be separated from one another by way of a spacer.
- a “spacer” refers to a polynucleotide that does not code for a polypeptide (i.e. , does not contain a start codon operably linked to a continuous segment of amino acid-encoding codons) and that is not enriched with the same nucleoside as the enriched polynucleotide(s) adjacent to the spacer.
- a spacer may be enriched for a different nucleoside as the enriched polynucleotide(s) adjacent to the spacer.
- Spacers may be, for example, from 5 to 100 nucleosides in length, such as from 10 to 40 nucleosides in length (e.g., 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleosides in length).
- polypeptide polypeptide
- peptide protein
- the terms are used interchangeably herein to refer to polymers of amino acids of any length.
- the polymer can comprise modified amino acids.
- the terms also encompass an amino acid polymer that has been modified naturally or by intervention; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling component.
- polypeptides containing one or more analogs of an amino acid including, for example, unnatural amino acids such as homocysteine, ornithine, p-acetylphenylalanine, D-amino acids, and creatine
- unnatural amino acids such as homocysteine, ornithine, p-acetylphenylalanine, D-amino acids, and creatine
- polypeptides refers to proteins, polypeptides, and peptides of any size, structure, or function.
- Polypeptides include encoded polynucleotide products, naturally occurring polypeptides, synthetic polypeptides, homologs, orthologs, paralogs, fragments and other equivalents, variants, and analogs of the foregoing.
- a polypeptide can be a monomer or can be a multi-molecular complex such as a dimer, trimer or tetramer. They can also comprise single chain or multichain polypeptides. Most commonly disulfide linkages are found in multichain polypeptides.
- polypeptide can also apply to amino acid polymers in which one or more amino acid residues are an artificial chemical analogue of a corresponding naturally occurring amino acid.
- a "peptide" can be less than or equal to 50 amino acids long, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids long.
- Amino acids are referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Unless otherwise indicated, amino acid sequences are written left to right in amino to carboxy orientation.
- Percent (%) sequence complementarity with respect to a reference polynucleotide sequence is defined as the percentage of nucleic acids in a candidate sequence that are complementary to the nucleic acids in the reference polynucleotide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence complementarity.
- a given nucleotide is considered to be “complementary” to a reference nucleotide as described herein if the two nucleotides form canonical Watson-Crick base pairs.
- Watson-Crick base pairs in the context of the present disclosure include adenine-thymine, adenine-uracil, and cytosine-guanine base pairs.
- a proper Watson-Crick base pair is referred to in this context as a “match,” while each unpaired nucleotide, and each incorrectly paired nucleotide, is referred to as a “mismatch.”
- Alignment for purposes of determining percent nucleic acid sequence complementarity can be achieved in various ways that are within the capabilities of one of skill in the art, for example, using publicly available computer software such as BLAST, BLAST-2, or Megalign software. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms needed to achieve maximal complementarity over the full length of the sequences being compared.
- the percent sequence complementarity of a given nucleic acid sequence, A, to a given nucleic acid sequence, B, is calculated as follows:
- a query nucleic acid sequence is considered to be “completely complementary” to a reference nucleic acid sequence if the query nucleic acid sequence has 100% sequence complementarity to the reference nucleic acid sequence.
- percent (%) sequence identity As used herein, the terms “percent (%) sequence identity,” “percent (%) identity,” and the like, with respect to a reference polynucleotide or polypeptide sequence, is defined as the percentage of nucleic acids or amino acids in a candidate sequence that are identical to the nucleic acids or amino acids in the reference polynucleotide or polypeptide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity. Alignment for purposes of determining percent nucleic acid or amino acid sequence identity can be achieved in various ways that are within the capabilities of one of skill in the art, for example, using publicly available computer software such as BLAST, BLAST-2, or Megalign software.
- percent sequence identity values may be generated using the sequence comparison computer program BLAST.
- percent sequence identity of a given nucleic acid or amino acid sequence, A, to, with, or against a given nucleic acid or amino acid sequence, B, (which can alternatively be phrased as a given nucleic acid or amino acid sequence, A that has a certain percent sequence identity to, with, or against a given nucleic acid or amino acid sequence, B) is calculated as follows:
- operatively linked in the context of a polynucleotide fragment is intended to mean that the two polynucleotide fragments are joined such that the amino acid sequences encoded by the two polynucleotide fragments remain in-frame.
- the term "pharmacokinetic” refers to any one or more properties of a molecule or compound as it relates to the determination of the fate of substances administered to a living organism. Pharmacokinetics is divided into several areas including the extent and rate of absorption, distribution, metabolism and excretion. This is commonly referred to as ADME where: (A) Absorption is the process of a substance entering the blood circulation; (D) Distribution is the dispersion or dissemination of substances throughout the fluids and tissues of the body; (M) Metabolism (or Biotransformation) is the irreversible transformation of parent compounds into daughter metabolites; and (E) Excretion (or Elimination) refers to the elimination of the substances from the body. In rare cases, some drugs irreversibly accumulate in body tissue.
- regulatory sequence includes promoters, enhancers, and other expression control elements (e.g., polyadenylation signals) that control the transcription or translation, e.g., of open reading frames described herein.
- expression control elements e.g., polyadenylation signals
- Such regulatory sequences are described, for example, in Goeddel, Gene Expression Technology: Methods in Enzymology 185 (Academic Press, San Diego, CA, 1990); incorporated herein by reference.
- signal sequence As used herein, the phrases “signal sequence,” “signal peptide,” and “transit peptide” are used interchangeably and refer to a sequence that can direct the transport or localization of a protein to a certain organelle, cell compartment, or extracellular export.
- the term encompasses both the signal sequence polypeptide and the nucleic acid sequence encoding the signal sequence.
- references to a signal sequence in the context of a nucleic acid refer in fact to the nucleic acid sequence encoding the signal sequence polypeptide.
- similarity refers to the overall relatedness between polymeric molecules, e.g. between polynucleotide molecules (e.g. DNA molecules and/or RNA molecules) and/or between polypeptide molecules. Calculation of percent similarity of polymeric molecules to one another can be performed in the same manner as a calculation of percent identity, except that calculation of percent similarity takes into account conservative substitutions as is understood in the art.
- the phrase “specifically binds” refers to a binding reaction which is determinative of the presence of an antigen in a heterogeneous population of proteins and other biological molecules that is recognized, e.g., by a protein or nucleic acid with particularity.
- a protein or nucleic acid that specifically binds to an antigen will bind to the antigen with a KD of less than 100 nM.
- a protein or nucleic acid that specifically binds to an antigen will bind to the antigen with a KD of up to 100 nM (e.g., between 1 pM and 100 nM).
- a protein or nucleic acid that does not exhibit specific binding to a particular antigen or epitope thereof will exhibit a KD of greater than 100 nM (e.g., greater than 500 nm, 1 pM, 100 pM, 500 pM, or 1 mM) for that particular antigen or epitope thereof.
- a variety of immunoassay formats may be used to select antibodies specifically immunoreactive with a particular protein or carbohydrate.
- solid-phase ELISA immunoassays are routinely used to select antibodies specifically immunoreactive with a protein or carbohydrate.
- the terms “subject” and “patient” refer to an organism that receives treatment for a particular disease or condition.
- subjects and patients include mammals, such as humans, primates, pigs, goats, rabbits, hamsters, cats, dogs, guinea pigs, members of the bovidae family (such as cattle, bison, buffalo, and yaks, among others), sheep, and horses, among others.
- a patient that may be treated using the compositions and methods described herein may have an established disease, in which case the patient has been diagnosed as having the disease and has shown symptoms of the disease for a prolonged period of time (e.g., over the course of days, weeks, months, or years).
- a patient may be symptomatic for a particular disease, but has yet to be diagnosed with the disease by a physician.
- Other patients that may be treated using the compositions and methods described herein include those that have been diagnosed as having a particular disease, and may or may not be showing symptoms of the disease as of yet.
- a patient eligible for treatment with the compositions and methods described herein may be described as diagnosed but asymptomatic if the patient has received a diagnosis of a disease, even though the patient may not yet be showing symptoms thereof.
- transfection refers to the introduction of a polynucleotide (e.g., exogenous nucleic acids) into a cell wherein a polypeptide encoded by the polynucleotide is expressed (e.g., mRNA) or the polypeptide modulates a cellular function (e.g., siRNA, miRNA).
- expression of a nucleic acid sequence refers to translation of a polynucleotide (e.g., an mRNA) into a polypeptide or protein and/or post-translational modification of a polypeptide or protein. Methods of transfection include, but are not limited to, chemical methods, physical treatments and cationic lipids or mixtures.
- the terms “treat” or “treatment” refer to therapeutic treatment, in which the object is to inhibit or slow down (lessen) an undesired physiological change or disorder.
- Beneficial or desired clinical results of treatment include, without limitation, alleviation of symptoms, diminishment of extent of disease, stabilized (i.e., not worsening) state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable.
- Those in need of treatment include those already having the condition or disorder, as well as those prone to have the condition or disorder or those in which the condition or disorder is to be inhibited.
- an effective amount of an agent is that amount sufficient to effect beneficial or desired results, for example, clinical results, and, as such, an "effective amount” depends upon the context in which it is being applied.
- an effective amount of an agent is, for example, an amount of mRNA expressing sufficient the desired protein to ameliorate, reduce, eliminate, or prevent the symptoms associated with the corresponding protein deficiency, as compared to the severity of the symptom observed without administration of the agent.
- the term "effective amount” can be used interchangeably with “effective dose,” “therapeutically effective amount,” or “therapeutically effective dose.”
- methods of administration can include intravenous, intramuscular, intradermal, subcutaneous, or other methods of delivering a composition to a subject.
- a method of administration can be selected to target delivery (e.g., to specifically deliver) to a specific region or system of a body.
- IRES internal ribosome entry site
- a component of the ribosome e.g., 25S, 28S, 18S, 5.8S, or 5S rRNA
- elF4G e.g., elF3
- IRES elements of the disclosure may be used in conjunction with either a 5’ cap-containing nucleic acid (e.g., a 5’-cap containing mRNA molecule) or a nucleic acid that lacks a 5’ cap (e.g., a circular RNA molecule).
- Exemplary IRES elements of the disclosure include polypyrimidine tracts, such as one or a plurality of polynucleotide tracts in which at least 70% of the nucleosides therein are pyrimidine-containing nucleosides, such as a uridine, a modified uridine, a cytidine, or a modified cytidine (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the nucleosides in each of the polynucleotide tracts may be a uridine, a modified uridine, a cytidine, or a modified cytidine).
- phrases "pharmaceutically acceptable” is employed herein to refer to those compounds, materials, compositions, and/or dosage forms that are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
- phrases "pharmaceutically acceptable excipient,” as used herein, refers any ingredient other than the compounds described herein (for example, a vehicle capable of suspending or dissolving the active compound) and having the properties of being substantially nontoxic and non-inflammatory in a patient.
- Excipients can include, for example: antiadherents, antioxidants, binders, coatings, compression aids, disintegrants, dyes (colors), emollients, emulsifiers, fillers (diluents), film formers or coatings, flavors, fragrances, glidants (flow enhancers), lubricants, preservatives, printing inks, sorbents, suspension or dispersing agents, sweeteners, and waters of hydration.
- excipients include, but are not limited to: butylated hydroxytoluene (BHT), calcium carbonate, calcium phosphate (dibasic), calcium stearate, croscarmellose, crosslinked polyvinyl pyrrolidone, citric acid, crospovidone, cysteine, ethylcellulose, gelatin, hydroxypropyl cellulose, hydroxypropyl methylcellulose, lactose, magnesium stearate, maltitol, mannitol, methionine, methylcellulose, methyl paraben, microcrystalline cellulose, polyethylene glycol, polyvinyl pyrrolidone, povidone, pregelatinized starch, propyl paraben, retinyl palmitate, shellac, silicon dioxide, sodium carboxymethyl cellulose, sodium citrate, sodium starch glycolate, sorbitol, starch (corn), stearic acid, sucrose, talc, titanium dioxide, vitamin A, vitamin E, vitamin C,
- compositions described herein also includes pharmaceutically acceptable salts of the compounds described herein.
- pharmaceutically acceptable salts refers to derivatives of the disclosed compounds wherein the parent compound is modified by converting an existing acid or base moiety to its salt form (e.g., by reacting the free base group with a suitable organic acid).
- pharmaceutically acceptable salts include, but are not limited to, mineral or organic acid salts of basic residues such as amines; alkali or organic salts of acidic residues such as carboxylic acids; and the like.
- Representative acid addition salts include acetate, acetic acid, adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzene sulfonic acid, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, fumarate, glucoheptonate, glycerophosphate, hemisulfate, heptonate, hexanoate, hydrobromide, hydrochloride, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate
- alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like, as well as nontoxic ammonium, quaternary ammonium, and amine cations, including, but not limited to ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, ethylamine, and the like.
- the pharmaceutically acceptable salts of the present disclosure include the conventional non-toxic salts of the parent compound formed, for example, from non-toxic inorganic or organic acids.
- the pharmaceutically acceptable salts of the present disclosure can be synthesized from the parent compound that contains a basic or acidic moiety by conventional chemical methods.
- such salts can be prepared by reacting the free acid or base forms of these compounds with a stoichiometric amount of the appropriate base or acid in water or in an organic solvent, or in a mixture of the two; generally, nonaqueous media like ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are used.
- nonaqueous media like ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are used.
- Lists of suitable salts are found in Flemington's Pharmaceutical Sciences, 17 th ed., Mack Publishing Company, Easton, Pa., 1985, p. 1418, Pharmaceutical Salts: Properties, Selection, and Use, P.H. Stahl and C.G. Wermuth (eds.), Wiley-VCH, 2008, and Berge et al., Journal of Pharmaceutical Science, 66, 1 -19 (1977), each of which is incorporated herein by reference in its entirety.
- solvate means a compound of the present disclosure wherein molecules of a suitable solvent are incorporated in the crystal lattice.
- a suitable solvent is physiologically tolerable at the dosage administered.
- solvates can be prepared by crystallization, recrystallization, or precipitation from a solution that includes organic solvents, water, or a mixture thereof.
- solvents examples include ethanol, water (for example, mono-, di-, and tri-hydrates), A/-methylpyrrolidinone (NMP), dimethyl sulfoxide (DMSO), A/,A/'-dimethylformamide (DMF), A/,A/'-dimethylacetamide (DMAC), 1 ,3-dimethyl-2-imidazolidinone (DMEU), 1 ,3-dimethyl-3, 4,5,6- tetrahydro-2-(1 H)-pyrimidinone (DMPU), acetonitrile (ACN), propylene glycol, ethyl acetate, benzyl alcohol, 2-pyrrolidone, benzyl benzoate, and the like.
- water for example, mono-, di-, and tri-hydrates
- NMP dimethyl sulfoxide
- DMF dimethyl sulfoxide
- DMAC A/,A/'-dimethylacetamide
- DMEU 1,3-dimethyl
- alkyl As used herein, the term “alkyl”, “alkyl group”, or “alkylene” means a linear or branched, saturated hydrocarbon including one or more carbon atoms (e.g., one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, or more carbon atoms), which is optionally substituted.
- C 1-14 alkyl means an optionally substituted linear or branched, saturated hydrocarbon including 1 -14 carbon atoms. Unless otherwise specified, an alkyl group described herein refers to both unsubstituted and substituted alkyl groups.
- alkenyl means a linear or branched hydrocarbon including two or more carbon atoms (e.g., two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, or more carbon atoms) and at least one double bond, which is optionally substituted.
- C 2-14 alkenyl means an optionally substituted linear or branched hydrocarbon including 2-14 carbon atoms and at least one carbon-carbon double bond.
- An alkenyl group may include one, two, three, four, or more carbon-carbon double bonds.
- C 18 alkenyl may include one or more double bonds.
- a C 18 alkenyl group including two double bonds may be a linoleyl group.
- an alkenyl group described herein refers to both unsubstituted and substituted alkenyl groups.
- alkynyl means a linear or branched hydrocarbon including two or more carbon atoms (e.g., two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, or more carbon atoms) and at least one carbon-carbon triple bond, which is optionally substituted.
- C 2-14 alkynyl means an optionally substituted linear or branched hydrocarbon including 2-14 carbon atoms and at least one carbon-carbon triple bond.
- An alkynyl group may include one, two, three, four, or more carbon-carbon triple bonds.
- C 18 alkynyl may include one or more carbon-carbon triple bonds.
- an alkynyl group described herein refers to both unsubstituted and substituted alkynyl groups.
- Carbocycle or “carbocyclic group” means an optionally substituted mono- or multi-cyclic system including one or more rings of carbon atoms. Rings may be three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, or twenty membered rings.
- the notation "C 3-6 carbocycle” means a carbocycle including a single ring having 3-6 carbon atoms. Carbocycles may include one or more carbon-carbon double or triple bonds and may be non-aromatic or aromatic (e.g., cycloalkyl or aryl groups).
- carbocycles include cyclopropyl, cyclopentyl, cyclohexyl, phenyl, naphthyl, and 1 ,2 dihydronaphthyl groups.
- cycloalkyl as used herein means a non-aromatic carbocycle and may or may not include any double or triple bond.
- carbocycles described herein refers to both unsubstituted and substituted carbocycle groups, i.e., optionally substituted carbocycles.
- heterocycle or “heterocyclic group” means an optionally substituted mono- or multi-cyclic system including one or more rings, where at least one ring includes at least one heteroatom.
- Heteroatoms may be, for example, nitrogen, oxygen, or sulfur atoms. Rings may be three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, or fourteen membered rings.
- Heterocycles may include one or more double or triple bonds and may be non-aromatic or aromatic (e.g., heterocycloalkyl or heteroaryl groups).
- heterocycles include imidazolyl, imidazolidinyl, oxazolyl, oxazolidinyl, thiazolyl, thiazolidinyl, pyrazolidinyl, pyrazolyl, isoxazolidinyl, isoxazolyl, isothiazolidinyl, isothiazolyl, morpholinyl, pyrrolyl, pyrrolidinyl, furyl, tetrahydrofuryl, thiophenyl, pyridinyl, piperidinyl, quinolyl, and isoquinolyl groups.
- heterocycloalkyl as used herein means a nonaromatic heterocycle and may or may not include any double or triple bond. Unless otherwise specified, heterocycles described herein refers to both unsubstituted and substituted heterocycle groups, i.e., optionally substituted heterocycles.
- heteroalkyl refers respectively to an alkyl, alkenyl, alkynyl group, as defined herein, which further comprises one or more (e.g., 1 , 2, 3, or 4) heteroatoms (e.g., oxygen, sulfur, nitrogen, boron, silicon, phosphorus) wherein the one or more heteroatoms is inserted between adjacent carbon atoms within the parent carbon chain and/or one or more heteroatoms is inserted between a carbon atom and the parent molecule, i.e., between the point of attachment.
- heteroatoms e.g., oxygen, sulfur, nitrogen, boron, silicon, phosphorus
- heteroalkyls, heteroalkenyls, or heteroalkynyls described herein refers to both unsubstituted and substituted heteroalkyls, heteroalkenyls, or heteroalkynyls, i.e., optionally substituted heteroalkyls, heteroalkenyls, or heteroalkynyls.
- a "biodegradable group” is a group that may facilitate faster metabolism of a lipid in a mammalian entity.
- a biodegradable group may be selected from the group consisting of, but is not limited to, -C(O)O-, -OC(O)-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, - P(O)(OR')O-, -S(O)2-, an aryl group, and a heteroaryl group.
- an "aryl group” is an optionally substituted carbocyclic group including one or more aromatic rings.
- aryl groups include phenyl and naphthyl groups.
- a "heteroaryl group” is an optionally substituted heterocyclic group including one or more aromatic rings.
- heteroaryl groups include pyrrolyl, furyl, thiophenyl, imidazolyl, oxazolyl, and thiazolyl. Both aryl and heteroaryl groups may be optionally substituted.
- M and M' can be selected from the non-limiting group consisting of optionally substituted phenyl, oxazole, and thiazole.
- M and M' can be independently selected from the list of biodegradable groups above.
- aryl or heteroaryl groups described herein refers to both unsubstituted and substituted groups, i.e., optionally substituted aryl or heteroaryl groups.
- Alkyl, alkenyl, and cyclyl (e.g., carbocyclyl and heterocyclyl) groups may be optionally substituted unless otherwise specified.
- R is an alkyl or alkenyl group, as defined herein.
- the substituent groups themselves may be further substituted with, for example, one, two, three, four, five, or six substituents as defined herein.
- a C 1-6 alkyl group may be further substituted with one, two, three, four, five, or six substituents as described herein.
- N-oxides can be converted to N-oxides by treatment with an oxidizing agent (e.g., 3-chloroperoxybenzoic acid (mCPBA) and/or hydrogen peroxides) to afford other compounds of the disclosure.
- an oxidizing agent e.g., 3-chloroperoxybenzoic acid (mCPBA) and/or hydrogen peroxides
- mCPBA 3-chloroperoxybenzoic acid
- hydrogen peroxides e.g., 3-chloroperoxybenzoic acid (mCPBA) and/or hydrogen peroxides
- nitrogen-containing compounds are also considered, when allowed by valency and structure, to cover both the compound as shown and its N-hydroxy (i.e., N- OH) and N-alkoxy (i.e., N-OR, wherein R is substituted or unsubstituted C 1 -C 6 alkyl, C 1 -C 6 alkenyl, C 1 -C 6 alkynyl, 3-14-membered carbocycle or 3-14-membered heterocycle) derivatives.
- N-hydroxy i.e., N- OH
- N-alkoxy i.e., N-OR, wherein R is substituted or unsubstituted C 1 -C 6 alkyl, C 1 -C 6 alkenyl, C 1 -C 6 alkynyl, 3-14-membered carbocycle or 3-14-membered heterocycle
- FIG. 1 A is a schematic illustrating that linear RNA molecules are prone to degradation at the 5’ and/or 3’ ends by way of exonucleases (top). These types of linear RNA molecules often contain a 5’ cap (bottom) in order to promote ribosome recruitment and, ultimately, translation of an open reading frame.
- FIG. 1B is a schematic showing ways in which RNAs may mitigate or avoid exonuclease degradation.
- a linear RNA molecule may be bound to a chemical moiety at the 5’ and/or 3’ ends that blocks the access of exonucleases to the RNA molecule.
- the RNA may be circularized, such that there are no 5’ or 3’ ends available for binding to (and cleavage by) an exonuclease).
- One aspect that has hindered the development of these types of molecules is the absence of a 5’ cap, which would typically be attached to the free 5’ end of a linear RNA molecule in order to promote ribosome binding and open reading frame translation.
- the present disclosure addresses this problem by providing internal ribosome entry (IRES) elements that recruit ribosomes in a cap-independent manner (bottom), allowing for RNAs to simultaneously recruit ribosomes and be modified in ways that remove/modify the cap so as to avoid nucleolytic degradation (e.g., by way of 5’ and/or 3’ blocking moieties or by way of RNA circularization).
- IRS internal ribosome entry
- FIG. 2 is a graph comparing the expression of green fluorescent protein (GFP) from three different, linear RNA constructs in HEK293 cells over the course of 60 hours.
- GFP green fluorescent protein
- Each linear RNA contained an open reading frame encoding GFP, and each RNA lacked a 5’ cap structure.
- the RNA molecules differed in the type of IRES element tested within the 5’ untranslated region (UTR).
- One construct contained a known coxsackievirus B3 (CVB3) IRES sequence in its 5’ UTR (“GO lin, 5’ CVB3,” top of graph); another construct contained three polynucleotide tracts each containing 9 contiguous unmodified uridine residues, each tract separated from one another by two 13-nucleoside spacers (“GO lin, 5’ v1 .1 ,” lower line of graph); and another construct three polynucleotide tracts each containing 9 contiguous 1 - methylpseudouridine residues, each tract separated from one another by two 13-nucleoside spacers (“G5 lin , 5’ 3xU9,” middle of graph).
- CVB3 coxsackievirus B3
- FIG. 2 also includes a table comparing the GFP expression level achieved by the “G5 lin, 5’3xU9” construct as compared to the “G0 lin, 5’ CVB3” construct and a construct having the same composition as “G5 lin, 5’3xU9,” but also containing the known 5’ Cap1 structure.
- FIGS. 3A - 3D are graphs comparing the expression of GFP from three different, linear RNA constructs in various cell types (HeLa (FIG. 3A), HEK293 (FIG. 3B), THP1 (FIG. 3C), and Hep3B (FIG. 3D)).
- Each construct contained an open reading frame encoding GFP, but the constructs differed in the IRES element tested within the 5’ UTR and in the presence/absence of a 5’ cap.
- FIG. 3 also includes a table comparing the GFP expression level achieved by the “3xU9_1 (G5)” and “CVB3 (GO)” construct as compared to the “Cap1 -A100” construct.
- FIG. 4A is a schematic showing an experimental design for the evaluation of erythropoietin (EPO) expression in BALB/c mice injected intravenously with SM86/DMG nanoparticles containing one of five different EPO-encoding RNA constructs: (i) a linear RNA construct containing an EPO-encoding open reading frame and a 5’ Cap1 structure (“Cap1 -A100,” also referred to as “GO Cap1 ”); (ii) a linear RNA construct containing an EPO-encoding open reading frame, a 5’ UTR containing the CVB3 IRES, and a 5’ triphosphate structure (“lin GO CVB3, 5’ PPP”); (iii) a linear RNA construct containing an EPO-encoding open reading frame, a 5’ UTR containing the CVB3 IRES, and a 5’ biotin-triazole structure (“lin GO CVB3, 5’ bA”); (iv) a linear RNA construct containing
- FIG. 4B is a graph comparing the serum EPO concentrations achieved by each construct.
- FIG. 5 is a graph comparing the secretion of IFN-y-inducible protein 10 (IP10) - an immune response marker - in BALB/c mice injected intravenously with one of five different EPO-encoding RNA constructs in the same experiment as Fig. 4, 6 hours after injection.
- a vehicle-only arm (“buffer”) was included as a negative control. Mice were injected with the SM86-DMG nanoparticles intravenously and were subsequently assessed for serum IP10 concentrations.
- FIG. 6A is a graph comparing the expression of luciferase in HeLa cells transfected in the presence of lipofectamine 2000 (L2K) with one of three different luciferase-encoding RNA constructs.
- the constructs tested were: (i) a linear RNA construct containing a luciferase-encoding open reading frame, a 5’ UTR containing an IRES having three polynucleotide tracts each containing 9 contiguous 1 - methylpseudouridine residues, each tract separated from one another by two 13-nucleoside spacers, and a 5’ triphosphate structure (“G5 lin 5’ PPP_3xU9”); and (ii) a linear RNA construct containing a luciferaseencoding open reading frame, a 5’ UTR containing an IRES having six polynucleotide tracts each containing 9 contiguous 1 -methylpseudouridine residues, the tract
- FIG. 6B is table comparing the luciferase expression of the constructs tested in FIG. 6A in two different cell types: HeLa cells and Hep3B cells.
- FIG. 7A is a graph comparing the expression of luciferase in HeLa cells that were transfected, in accordance with the methodology described in FIG. 6A, with a circular RNA molecule containing a luciferase-encoding open reading frame.
- each RNA molecule each instance of uridine was replaced with 1 -methylpseudouridine.
- the RNA molecule was tethered to one of three proteins by way of MS2 tethering sites within the RNA: (i) LACZ (“t-LACZ”), (ii) eukaryotic translation initiation factor 4 G (“t-elF4G”), or (iii) La protein (“t-La”). Tethering was facilitated by fusing MBP-encoding polypeptide to LACZ(t-Lacz), 4 G (“t-elF4G”), or (iii) La protein (“t-La”).
- FIG. 7B is a graph comparing luciferase expression achieved by linearized versions of the constructs tested in FIG. 7A; in FIG. 7B, each construct contained a 5’ triphosphate structure and a 3’ poly(A) tail in lieu of circularization.
- the data shown in FIGS. 7A and 7B represent the first instance of successful translation of an RNA without a cap, particularly one in which all uridine nucleosides have been replaced with 1 -methylpseudouridine nucleosides.
- IRES elements of the disclosure are capable of effectuating ribosomal recruitment - and successful protein translation - in a manner that is independent of the presence or absence of a 5’ cap.
- IRES elements of the disclosure can effectuate ribosomal recruitment and successful protein translation in a manner that is not dependent upon the presence or absence of a chemical modification of one of the nucleosides of the nucleic acid molecule, particularly because the interaction that mediates the recruitment of the ribosome (i.e. , the interaction between the MS2 tethering site and the MS2-binding protein) is not affected by the presence or absence of a nucleoside modification (in this instance, 1 -methylpseudouridrine).
- FIG. 8A is a graph comparing the expression of mGreenLantern protein in HeLa cells that were transfected with mGreenLantern-encoding RNA constructs in the presence of L2K.
- Three different RNA constructs were tested: (i) a linear RNA construct containing an mGreenLantern-encoding open reading frame, a 5’ UTR containing an IRES having six polynucleotide tracts each containing 9 contiguous 1 - methylpseudouridine residues, the tracts separated from one another by spacers of 18-28 nucleosides in length, and a 5’ triphosphate structure (“G5 lin 5’ Cap1_v2.0”); (ii) a linear RNA construct containing an mGreenLantern-encoding open reading frame, a 5’ UTR containing an IRES having the nucleic acid sequence of SEQ ID NO: 1 , and a 5’ triphosphate structure (“GO lin 5’ PPP_1xAp
- FIG. 8B is a graph comparing the expression of luciferase in HeLa cells that were transfected with luciferase-encoding RNA constructs in the presence of L2K.
- Five different RNA constructs were tested: (i) a linear RNA construct containing a luciferase-encoding open reading frame, a 5’ UTR containing an IRES having three polynucleotide tracts each containing 9 contiguous 1 - methylpseudouridine residues, and a 5’ Cap1 structure (“G5 lin 5’ Cap1_v1.1 ”); (ii) a linear RNA construct containing a luciferase-encoding open reading frame, a 5’ UTR containing an IRES having three polynucleotide tracts each containing 9 contiguous 1 -methylpseudouridine residues, and a 5’ triphosphate structure (“G5 lin 5’ PPP_3xU9”); (ii
- FIG. 9A is a graph comparing the expression of luciferase in HeLa cells transfected with one of eight different luciferase-encoding RNA constructs: (i) a linear RNA construct containing a luciferaseencoding open reading frame and a 5’ Cap1 structure (“C1 ”); (ii) a linear RNA construct containing a luciferase-encoding open reading frame, a 5’ UTR containing an IRES having three polynucleotide tracts each containing 9 contiguous uridine residues, and a 5’-triphosphate structure (“v1 .1 ”); (iii) a linear RNA construct containing a luciferase-encoding open reading frame, a 5’ UTR containing an IRES having six polynucleotide tracts each containing 9 contiguous 1 -methylpseudouridine residues, and a 5’-triphosphate structure (“v2.0 (G5)”); (
- FIG. 9B provides a table reporting the luciferase expression achieved by certain of the constructs shown in FIG. 9A as a percentage of the luciferase expression achieved by the “Cap1 ” construct.
- FIG. 10A is a graph comparing the expression of fluorescent protein in HeLa cells transfected with one of two different fluorescent-protein-encoding RNA constructs.
- the constructs tested were: (i) a linear RNA construct containing a 5’ cap structure, a 5’ UTR containing an IRES having the nucleic acid sequence of GGGAAAUAAGAGAGAAAAGAAGAGuAAGAAGAAAUAUAAGACCCCGGCGCCGCCACC (SEQ ID NO: 3, “UTR1 ”), and a GFP-encoding open reading frame fused to a degron domain and; and (ii) an RNA construct containing a 5’ cap structure, a 5’ UTR containing an IRES having the nucleic acid sequence of GGGAAAUUUUUUUGAUAUUAUAAGAGUUUUUUUUGAUAUUAAGAAAAUUUUUUUUGAUAUU AGAAGAGUAAGAAGAAAUAUAAGACCCCGGCGCCGCCACC (SEQ ID NO: 4,
- FIG. 10B is a graph demonstrating the results of an experiment conducted as outlined in FIG. 10A, but in HEK293 cells in lieu of HeLa cells.
- FIG. 10C provides a set of graphs comparing the expression of luciferase in BALB/c mice transfected with one of two different luciferase-encoding RNA constructs: (i) a linear RNA construct containing a 5’ cap structure, a 5’ UTR containing an IRES having the nucleic acid sequence of “UTR1 ” (as in FIGS. 10A and 10B), and a luciferase-encoding open reading frame; and (ii) a linear RNA construct containing a 5’ cap structure, a 5’ UTR containing an IRES having the nucleic acid sequence of “UTR 2 ” (as in FIGS. 10A and 10B), and a luciferase-encoding open reading frame.
- a negative control (“PBS”) was included for comparison purposes.
- FIG. 10D provides a set of graphs comparing the expression of erythropoietin in BALB/c mice transfected with one of two different erythropoietin-encoding RNA constructs: (i) a linear RNA construct containing a 5’ cap structure, a 5’ UTR containing an IRES having the nucleic acid sequence of “UTR1 ” (as in FIGS. 10A and 10B), and an erythropoietin-encoding open reading frame; and (ii) a linear RNA construct containing a 5’ cap structure, a 5’ UTR containing an IRES having the nucleic acid sequence of “UTR 2 ” (as in FIGS. 10A and 10B), and an erythropoietin-encoding open reading frame.
- a negative control (“PBS”) was included for comparison purposes.
- FIG. 11 A is a graph comparing the expression of luciferase in Hep3b cells transfected in the presence of L2K with luciferase-encoding RNA constructs containing the indicated elements (e.g., see the x-axis).
- the sequence of these elements is provided in Table 14 (e.g., see Example 7).
- the three bars for each element represents, from left to right, luciferase expression measured at 2 hour, 5 hours, and 24 hours post-transfection.
- Luminescence expression data shows that 5’ hulRES9 (e.g., SEQ ID NO: 173) has the highest luciferase expression. This is an improvement over 5’ 3xU9 (SEQ ID NO: 202).
- FIG. 11 B is a graph comparing the expression of luciferase in HeLa cells transfected in the presence of L2K with luciferase-encoding RNA constructs containing the indicated elements.
- the sequence of these elements is provided in Table 14 (e.g., see Example 7).
- the three bars for each element represents, from left to right, luciferase expression measured at 2 hour, 5 hours, and 24 hours post-transfection.
- Luminescence expression data shows that 5’ 6xU9 (SEQ ID NO: 203) has the highest luciferase expression and 5’ hulRES9 (e.g., SEQ ID NO: 173) has the next highest luciferase expression. This is an improvement over 5’ 3xU9 (SEQ ID NO: 202).
- FIG. 12 is a graph comparing the expression of GFP in HeLa cells transfected in the presence of L2K with GFP-encoding RNA constructs containing the indicated elements; in this case, the GFP is fused to a degron domain.
- the sequence of these elements is provided in Table 15 (e.g., see Example 7).
- the green integrated density of the inlet graph shows that 5’ Shape 1 (SEQ ID NO: 174) and 5’ Shape 3 (SEQ ID NO: 176) show the highest expression, well above 5’ 6xU9 (SEQ ID NO: 203). Further, 5’ Shape 2 (SEQ ID NO: 175) outperforms 5’ Shape 4 (SEQ ID NO: 177) and 5’ 6xU9.
- FIG. 13 is a graph comparing the expression of GFP in HeLa cells transfected in the presence of L2K with GFP-encoding RNA constructs containing the indicated elements; in this case, the GFP is fused to a degron domain.
- the sequence of these elements is provided in Table 15 (e.g., see Example 7).
- the green integrated density of the inlet graph shows that 5’ Shape 2 (SEQ ID NO: 175) outperforms 5’ Shape 4 (SEQ ID NO: 177) and 5’ 6xU9 (SEQ ID NO: 203).
- FIG. 14 is a graph comparing the expression of GFP in HeLa cells transfected in the presence of L2K with GFP-encoding RNA constructs containing the indicated elements; in this case, the GFP is fused to a degron domain.
- the sequence of these elements is provided in Table 15 (e.g., see Example 7).
- the green integrated density of the inlet graph shows that 5’ Shape 5 (SEQ ID NO: 178) and 5’ Shape 8 (SEQ ID NO: 180) perform similarly to 5’ 3xU9 (SEQ ID NO: 202).
- FIG. 15 is a graph comparing the expression of GFP in HeLa cells transfected in the presence of L2K with GFP-encoding RNA constructs containing the indicated elements; in this case, the GFP is fused to a degron domain.
- the sequence of these elements is provided in Table 15 (e.g., see Example 7).
- the green integrated density reveals that 5’ Shape 1 (SEQ ID NO: 174), 5’ Shape 2 (SEQ ID NO: 175), 5’ Shape 3 (SEQ ID NO: 176), and 5’ Shape 4 (SEQ ID NO: 177) outperform 5’ 6xU9 (SEQ ID NO: 203) and 5’ 3xU9 (SEQ ID NO: 202), which outperform 5’ Shape 7 (SEQ ID NO: 179) and 5’ Shape 8 (SEQ ID NO: 180).
- 5’ Shape 9 (SEQ ID NO: 181 ) performs similar to baseline and uncapped control.
- FIG. 16 is a graph comparing the expression of GFP in HeLa cells transfected in the presence of L2K with GFP-encoding RNA constructs containing the indicated elements; in this case, the GFP is fused to a degron domain.
- the sequence of these elements is provided in Table 15 (e.g., see Example 7).
- the green integrated density of the two inlet graphs shows that 5’ Shape 5 (SEQ ID NO: 178) and 5’ Shape 8 (SEQ ID NO: 180) have similar performance, while 5’ Shape 9 (SEQ ID NO: 181 ) and 5’ Shape 7 (SEQ ID NO: 179) are expressing closer to baseline.
- FIG. 17 is a graph comparing the expression of GFP in HeLa cells transfected in the presence of L2K with GFP-encoding RNA constructs containing the indicated elements; in this case, the GFP is fused to a degron domain.
- the sequence of these elements is provided in Table 18 (e.g., see Example 7).
- the green integrated density of the two inlet graphs shows that 5’ Apt17+5xU9 (SEQ ID NO: 183 or SEQ ID NO: 184) constructs and 5’ 5xU9+CCND1 (SEQ ID NO: 182) constructs have an increased Cmax, suggesting that combining different IRES elements disclosed herein can increase gene expression.
- FIG. 18 is a graph comparing the expression of GFP in HeLa cells transfected in the presence of L2K with GFP-encoding RNA constructs containing the indicated elements; in this case, the GFP is fused to a degron domain.
- the sequence of these elements is provided in Table 18 (e.g., see Example 7).
- the green integrated density data shows that 5’ 1XApt17 substantially outperforms 5’ 1xAUAU4 (SEQ ID NO: 194) and 5’ 1xPDCD4 (SEQ ID NO: 198), with the later having similar temporal expression and Cmax values.
- FIG. 19 is a graph comparing the expression of GFP in HeLa cells transfected in the presence of L2K with GFP-encoding RNA constructs containing the indicated elements; in this case, the GFP is fused to a degron domain.
- the sequence of these elements is provided in Table 18 (e.g., see Example 7).
- the green integrated density data shows that constructs with 5’ Apt17+5xU9 (SEQ ID NO: 183 or SEQ ID NO: 184) and constructs with 5’ 5xU9+CCND1 (SEQ ID NO: 182) have similar expression to constructs with 5’ 6xU9 (SEQ ID NO: 203). This data suggests that combining different IRES elements disclosed herein can increase gene expression.
- FIG. 20 is a graph comparing the expression of GFP in HeLa cells transfected in the presence of L2K with GFP-encoding RNA constructs containing the indicated elements; in this case, the GFP is fused to a degron domain.
- the sequence of these elements is provided in Table 18 (e.g., see Example 7).
- the green integrated density data shows that constructs with elements 5’ 6xPDCD4 (SEQ ID NO: 198) have appreciable expression. Also, constructs with element 5’ 1xApt17 (SEQ ID NO: 193) show expression above background.
- FIG. 21 A is a bar graph comparing the expression of luciferase in THP-1 cells transfected in the presence of L2K with luciferase-encoding RNA constructs containing the indicated elements.
- the sequence of these elements is provided in Table 18 (e.g., see Example 7).
- Luminescence expression data shows that 5’ 6xU9_v3 (SEQ ID NO: 189), 5’ 6xU9_v4 (SEQ ID NO: 205), and 5’ 6xU9_v5 (SEQ ID NO: 205) have the highest luciferase expression.
- FIG. 21 B is the same bar graph as in FIG. 21 A, but without the capped control and the uncapped control (to better show the Y axis values).
- FIG. 22A is a bar graph comparing the expression of luciferase in Hep3b cells transfected in the presence of L2K with luciferase-encoding RNA constructs containing the indicated elements.
- the sequence of these elements is provided in Table 18 (e.g., see Example 7).
- the two bars for each element represents, from left to right, luciferase expression measured at 4 and 24 hours post-transfection.
- Luminescence expression data shows that 5’ 6xU9_v3 (SEQ ID NO: 189), 5’ 6xU9_v4 (SEQ ID NO: 204), and 5’ 6xU9_v5 (SEQ ID NO: 205) have the highest luciferase expression.
- FIG. 22B is the same bar graph as in FIG. 22A, but without the capped control and the uncapped control (to better show the Y axis values).
- FIG. 23A is a bar graph comparing the expression of luciferase in HeLa cells transfected in the presence of L2K with luciferase-encoding RNA constructs containing the indicated elements.
- the sequence of these elements is provided in Table 18 (e.g., see Example 7).
- the two bars for each element represents, from left to right, luciferase expression measured at 4 and 24 hours post-transfection.
- Luminescence expression data shows that 5’ 6xU9_v3 (SEQ ID NO: 189), 5’ 6xU9_v4 (SEQ ID NO: 204), 5’ 6xU9_v5 (SEQ ID NO: 205), and 5’ 6xU9_v1 (SEQ ID NO: 187) have the highest luciferase expression.
- FIG. 23B is the same bar graph as in FIG. 23A, but without the capped control and the uncapped control (to better show the Y axis values).
- nucleic acid molecules e.g., RNA molecules, such as linear or circular RNA molecules
- Nucleic acid molecules often use 5’ cap structures as a means for promoting ribosomal binding and, ultimately, open reading frame translation.
- the presence of a 5’ cap that is susceptible to decapping and subsequent degradation of the RNA may preclude the possibility of instead having chemical modifications that extend the molecule’s half-life.
- the present disclosure addresses this problem by providing means for nucleic acid molecules to recruit and bind ribosome without the need for a 5’ cap structure, thus providing the advantage of simultaneously allowing the nucleic acid molecules to be translatable and to be modified in ways that mitigate nucleolytic degradation.
- nucleic acid modifications that reduce or avoid nucleolytic degradation, but that also preclude the inclusion of a 5’ cap, include (i) the presence of 5’ chemical moieties that restrict the access of an exonuclease to the nucleic acid molecule, as well as (ii) circularization of a nucleic acid molecule, which removes 5’ and 3’ ends altogether. Both of these types of modifications provide the benefit of reducing or eliminating exonucleolytic cleavage by way of either chemically protecting, or removing, the 5’ and 3’ ends to which an exonuclease would bind. However, because these types of modifications alter or eliminate the 5’ end, they preclude the inclusion of a 5’ cap.
- the present disclosure features internal ribosome entry sites (IRESs) that can be incorporated into nucleic acids and that promote ribosome recruitment and protein translation in the absence of a 5’ cap.
- the present IRES elements are also compatible with chemically modified uridine nucleosides, particularly 1 -methylpseudouridine nucleosides.
- chemically modified uridine nucleosides particularly 1 -methylpseudouridine nucleosides.
- modified uridine residues particularly 1 -methylpseudouridine
- IRES elements that are compatible with 1 - methylpseudoridine are particularly advantageous.
- the IRES of the disclosure may recruit translation tractor and/or ribosomes to the nucleic acids described herein in order to promote translation.
- IRES of the disclosure e.g., SEQ ID NOs: 173-205
- IRES of the disclosure may bind directly to ribosomal subunits (e.g., eukaryotic 60S or 40S subunits) by, e.g., hybridizing directly to ribosomal RNA (rRNA), such as 25S, 28S, 18S, 5.8S, and/or 5S rRNA.
- ribosomal subunits e.g., eukaryotic 60S or 40S subunits
- rRNA ribosomal RNA
- the IRES elements described herein thus provide multiple benefits: not only do the present IRES elements allow the types of half-life-extending nucleic acid modifications that would preclude a 5’ cap group, but they also function with a uridine modification that significantly suppresses immunogenicity of the nucleic acid molecule. Furthermore, by binding to ribosomes or hybridizing directly with ribosomal RNA, IRES’ of the disclosure provide the advantage of fast and efficient protein expression while reducing energy expenditure on the cell.
- nucleic acids of the disclosure are those that contain:
- an internal ribosome entry site comprising one or more polynucleotide tracts enriched in uridine or a modified uridine; operably linked to (ii) an open reading frame encoding a polypeptide.
- the IRES comprises from 1 to 20 of the polynucleotide tracts enriched in uridine or a modified uridine (e.g.. 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 of the polynucleotide tracts enriched in uridine or a modified uridine).
- the IRES may, for example, comprise from 2 to 10 of the polynucleotide tracts enriched in uridine or a modified uridine.
- the IRES comprises from 3 to 6 of the polynucleotide tracts enriched in uridine or a modified uridine.
- At least 70% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine (e.g.. 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the nucleosides in each of the polynucleotide tracts may be uridine or a modified uridine).
- a modified uridine e.g. 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 9
- At least 75% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine. In some embodiments, at least 80% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine. In some embodiments, at least 85% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine. In some embodiments, at least 90% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine.
- At least 95% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine. In some embodiments, all of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine.
- each polynucleotide tract is from 5 to 20 nucleosides in length (e.g., 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleosides in length). In some embodiments, each polynucleotide tract, independently, is from 5 to 19 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 18 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 17 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 16 nucleosides in length.
- each polynucleotide tract is from 5 to 15 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 14 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 13 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 12 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 11 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 10 nucleosides in length.
- each polynucleotide tract is from 6 to 15 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 14 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 13 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 12 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 11 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 10 nucleosides in length.
- each polynucleotide tract is from 7 to 15 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 7 to 14 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 7 to 13 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 7 to 12 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 7 to 11 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 7 to 10 nucleosides in length. In some embodiments, each polynucleotide tract is 9 nucleosides in length.
- each polynucleotide tract independently, comprises from 5 to 20 contiguous uridine or modified uridine nucleosides (e.g. 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 uridine or modified uridine nucleosides). In some embodiments, each polynucleotide tract, independently, comprises from 6 to 15 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract, independently, comprises from 6 to 14 contiguous uridine or modified uridine nucleosides.
- each polynucleotide tract independently, comprises from 6 to 13 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract, independently, comprises from 6 to 12 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract, independently, comprises from 6 to 11 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract, independently, comprises from 6 to 10 contiguous uridine or modified uridine nucleosides.
- each polynucleotide tract independently, comprises from 7 to 15 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract, independently, comprises from 7 to 14 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract, independently, comprises from 7 to 13 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract, independently, comprises from 7 to 12 contiguous uridine or modified uridine nucleosides.
- each polynucleotide tract independently, comprises from 7 to 11 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract, independently, comprises from 7 to 10 contiguous uridine or modified uridine nucleosides.
- each polynucleotide tract comprises at least 9 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract comprises 9 contiguous uridine or modified uridine nucleosides.
- one or more (or all) of the polynucleotide tracts are enriched in modified uridine.
- the modified uridine is 1 -methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio- uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbony
- the IRES is located within a noncoding region of the nucleic acid, such as a 5’ untranslated region (UTR) that is operably linked to the open reading frame.
- UTR untranslated region
- the open reading frame is further operably linked to a 3’ UTR.
- the polynucleotide tracts are separated from one another by way of one or more spacers that each, independently, comprise from 5 to 100 nucleosides (e.g., 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 nucleosides).
- 5 to 100 nucleosides e.g., 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 nucleosides.
- each of the spacers independently, comprises from 10 to 40 nucleosides (e.g., 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleosides). In some embodiments, each of the spacers, independently, comprises 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, or 38 nucleosides.
- the IRES is represented by the formula: [(N)n - (U') m ]p wherein: each N is, independently, any nucleoside residue; each U' is, independently, uridine or a modified uridine; each n is, independently, an integer from 1 to 100 e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14,
- each m is, independently, an integer from 2 to 15 (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, or
- p is an integer from 2 to 20 (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, or 20).
- N is, independently, selected from adenosine, a modified adenosine, uridine, a modified uridine, guanosine, a modified guanosine, cytidine, and a modified cytidine.
- each N is, independently, selected from adenosine, uridine, a modified uridine, guanosine, and cytidine.
- the modified uridine of N is 1 -methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio- uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl-uridine, 5- methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thi
- the modified cytidine of N is 5-aza-cytidine, 6-aza- cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetyl-cytidine, 5-formyl-cytidine, N4-methyl-cytidine, 5- methyl-cytidine, 5-halo-cytidine, 5-hydroxymethyl-cytidine, 1 -methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1 - methyl-pseudoisocytidine, 4-thio- 1 -methyl-1 -deaza-pseudoisocytidine, 1 -methyl-1 -deaza- pseudoiso
- the modified adenosine of N is 2-amino-purine, 2, 6- diaminopurine, 2-amino-6-halo-purine, 6-halo-purine, 2-amino-6-methyl-purine, 8-azido-adenosine, 7- deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7- deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1 -methyl-adenosine, 2-methyl-adenine, N6- methyl-adenosine, 2-methylthio-N6-methyl-adenosine, N6-isopentenyl-adenosine, 2-methylthio-N6- isopentenyl-adenosine, N6-(cis-
- the modified guanosine of N is inosine, 1 -methylinosine, wyosine, methylwyosine, 4-demethyl-wyosine, isowyosine, wybutosine, peroxywybutosine, hydroxywybutosine, 7-deaza-guanosine, queuosine, epoxyqueuosine, galactosyl-queuosine, mannosyl- queuosine, 7-cyano-7-deaza-guanosine, 7-aminomethyl-7-deaza-guanosine, archaeosine, 7-deaza-8- aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl- guanosine, 6-thio-7-methyl-guanosine, 7-methyl-inosine, 7-methyl- gua
- the modified uridine of U’ is 1 -methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio- uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl-uridine, 5- methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-
- each n is, independently, an integer from 10 to 40. In some embodiments, each n is, independently, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, or 38. In some embodiments, each m is, independently, an integer from 2 to 15. In some embodiments, each m is, independently, an integer from 7 to 1 1 . In some embodiments, each m is 9. In some embodiments, p is an integer from 2 to 10. In some embodiments, p is an integer from 3 to 6, optionally wherein p is 3 or 6.
- the nucleic acid is RNA. In some embodiments, the nucleic acid is linear. In some embodiments, the nucleic acid is circular. In some embodiments, the open reading from consists of nucleosides selected from adenosine, a modified adenosine, uridine, a modified uridine, guanosine, a modified guanosine, cytidine, and a modified cytidine. In some embodiments, the open reading from consists of nucleosides selected from adenosine, uridine, a modified uridine, guanosine, and cytidine.
- the modified uridine of the open reading frame is 1 - methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5- aza-uridine, 2-thio-uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5- carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl- uridine, 5-methoxycarbonylmethyl-2-thio-uridine, 5-amino
- the modified cytidine of N is 5-aza-cytidine, 6-aza- cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetyl-cytidine, 5-formyl-cytidine, N4-methyl-cytidine, 5- methyl-cytidine, 5-halo-cytidine, 5-hydroxymethyl-cytidine, 1 -methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1 - methyl-pseudoisocytidine, 4-thio- 1 -methyl-1 -deaza-pseudoisocytidine, 1 -methyl-1 -deaza- pseudoiso
- the modified adenosine of N is 2-amino-purine, 2, 6- diaminopurine, 2-amino-6-halo-purine, 6-halo-purine, 2-amino-6-methyl-purine, 8-azido-adenosine, 7- deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7- deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1 -methyl-adenosine, 2-methyl-adenine, N6- methyl-adenosine, 2-methylthio-N6-methyl-adenosine, N6-isopentenyl-adenosine, 2-methylthio-N6- isopentenyl-adenosine, N6-(cis-
- the modified guanosine of N is inosine, 1 -methylinosine, wyosine, methylwyosine, 4-demethyl-wyosine, isowyosine, wybutosine, peroxywybutosine, hydroxywybutosine, 7-deaza-guanosine, queuosine, epoxyqueuosine, galactosyl-queuosine, mannosyl- queuosine, 7-cyano-7-deaza-guanosine, 7-aminomethyl-7-deaza-guanosine, archaeosine, 7-deaza-8- aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl- guanosine, 6-thio-7-methyl-guanosine, 7-methyl-inosine, 7-methyl- gua
- the polypeptide encoded by the open reading frame is a secreted protein, a cytokine, a growth factor, an enzyme, an immunomodulator, an antibody or antigen-binding fragment thereof, a cell-penetrating peptide, an extracellular membrane-bound protein, an intracellular membrane-bound protein, a cytoplasmic protein, a cytoskeletal protein, or a nuclear protein.
- the IRES contains a nucleotide sequence with about 70% to about 100% (e.g., about 70% to about 100%, about 75% to about 100%, about 80% to about 100%, about 85% to about 100%, about 90% to about 100%, about 91 % to about 100%, about 92% to about 100%, about 93% to about 100%, about 94% to about 100%, about 95% to about 100%, about 96% to about 100%, about 97% to about 100%, about 98% to about 100%, or about 99% to 100%) sequence identity to an IRES presented in Table 2 (e.g., any one of IRES 1 to IRES 22).
- Table 2 e.g., any one of IRES 1 to IRES 22.
- the IRES contains a nucleotide sequence with at least 70% sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 75% sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 80% sequence identity to any one of SEQ ID NOs: 173-190 and 202-205.
- the IRES contains a nucleotide sequence with at least 85% sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 90% sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 91 % sequence identity to any one of SEQ ID NOs: 173-190 and 202-205.
- the IRES contains a nucleotide sequence with at least 92% sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 93% sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 94% sequence identity to any one of SEQ ID NOs: 173-190 and 202-205.
- the IRES contains a nucleotide sequence with at least 95% sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 96% sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 97% sequence identity to any one of SEQ ID NOs: 173-190 and 202-205.
- the IRES contains a nucleotide sequence with at least 98% sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 99% sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with 100% sequence identity to any one of SEQ ID NOs: 173-190 and 202-205.
- nucleic acid does not comprise a 5’ cap.
- nucleic acid comprising:
- an IRES comprising one or more polynucleotides that specifically bind a RNA binding protein, a translation initiation factor (for example, eukaryotic translation initiation factor 4 G (elF4G), eukaryotic translation initiation factor 4G2 (elF4G2, also referred to as Dap5), eukaryotic translation initiation factor 3 (elF3)), or IRES trans-acting factors (ITAfs), such as a polypyrimidine tract-binding protein (PTBP); or (b) a fusion protein comprising a translation initiation factor (e.g., elF4G, elF4G2, elF3, La protein, or an ITAf, such as La) fused to an RNA-binding protein; operably linked to
- a translation initiation factor for example, eukaryotic translation initiation factor 4 G (elF4G), eukaryotic translation initiation factor 4G2 (elF4G2, also referred to as Dap5)
- the one or more polynucleotides specifically bind elF4G.
- each of the one or more polynucleotides independently, has a nucleic acid sequence that is at least 75% identical to ACUCACUAUUUGUUUUCGCGCCCAGUUGCAAAAA (SEQ ID NO: 1 ).
- each of the one or more polynucleotides independently, has a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO: 1 (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 1 ).
- each of the one or more polynucleotides has the nucleic acid sequence of SEQ ID NO: 1 .
- the nucleic acid does not comprise a 5’ cap.
- polypeptide expression system comprising:
- nucleic acid comprising an open reading frame that encodes elF4G, La protein, or a functional variant thereof.
- nucleic acid of (i) and the nucleic acid of (ii) are separate molecules.
- nucleic acid of (ii) comprises, from 5’ to 3’:
- nucleic acid of (ii) further comprises a 5’ cap operably linked to the 5’ UTR.
- the IRES contains a nucleotide sequence with about 70% to about 100% (e.g., about 70% to about 100%, about 75% to about 100%, about 80% to about 100%, about 85% to about 100%, about 90% to about 100%, about 91 % to about 100%, about 92% to about 100%, about 93% to about 100%, about 94% to about 100%, about 95% to about 100%, about 96% to about 100%, about 97% to about 100%, about 98% to about 100%, or about 99% to 100%) sequence identity to an IRES presented in Table 3 (e.g., any one of IRES 23 to IRES 33).
- Table 3 e.g., any one of IRES 23 to IRES 33.
- the IRES contains a nucleotide sequence with at least 70% sequence identity to any one of SEQ ID NOs: 191 -201 . In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 75% sequence identity to any one of SEQ ID NOs: 191 -201 . In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 80% sequence identity to any one of SEQ ID NOs: 191 -201 . In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 85% sequence identity to any one of SEQ ID NOs: 191 -201 .
- the IRES contains a nucleotide sequence with at least 90% sequence identity to any one of SEQ ID NOs: 191 -201 . In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 91% sequence identity to any one of SEQ ID NOs: 191 -201 . In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 92% sequence identity to any one of SEQ ID NOs: 191 -201 . In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 93% sequence identity to any one of SEQ ID NOs: 191 -201 .
- the IRES contains a nucleotide sequence with at least 94% sequence identity to any one of SEQ ID NOs: 191 -201 . In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 95% sequence identity to any one of SEQ ID NOs: 191 -201 . In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 96% sequence identity to any one of SEQ ID NOs: 191 -201 . In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 97% sequence identity to any one of SEQ ID NOs: 191 -201 .
- the IRES contains a nucleotide sequence with at least 98% sequence identity to any one of SEQ ID NOs: 191 -201 . In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 99% sequence identity to any one of SEQ ID NOs: 191 -201 . In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with 100% sequence identity to any one of SEQ ID NOs: 191 -201 . Table 3. Exemplary translation initiation elements 2. Chemically Modified Nucleic Acids
- the IRES elements of the disclosure may have one or more chemical modifications.
- Aduri et al. (Aduri, R. et al., AMBER force field parameters for the naturally occurring modified nucleosides in RNA. Journal of Chemical Theory and Computation. 2006.
- nucleosides there are 107 naturally occurring nucleosides, including 1 -methyladenosine, 2-methylthio-N6-hydroxynorvalyl carbamoyladenosine, 2-methyladenosine, 2-O-ribosylphosphate adenosine, N6-methyl-N6- threonylcarbamoyladenosine, N6-acetyladenosine, N6-glycinylcarbamoyladenosine, N6- isopentenyladenosine, N6-methyladenosine, N6-threonylcarbamoyladenosine, N6,N6-dimethyladenosine, N6-(cis-hydroxyisopentenyl)adenosine, N6-hydroxynorvalylcarbamoyladenosine, 1 ,2-0- dimethyladenosine, N6,2-O-dimethyladenosine, 2-O
- nucleosides and nucleotides e.g., building block molecules
- a polynucleotide e.g., RNA or mRNA, as described herein
- RNA or mRNA as described herein
- the 2' hydroxyl group (OH) can be modified or replaced with a number of different substituents.
- substitutions at the 2'-position include, but are not limited to, H, halo, optionally substituted C 1-6 alkyl; optionally substituted C 1-6 alkoxy; optionally substituted C 6-1 0 aryloxy; optionally substituted C 3-8 cycloalkyl; optionally substituted C 3-8 cycloalkoxy; optionally substituted C 6-10 aryloxy; optionally substituted C 6-1 0 aryl- C 1-6 alkoxy, optionally substituted C 1-12 (heterocyclyl)oxy; a sugar (e.g., ribose, pentose, or any described herein); a polyethyleneglycol (PEG), - O(CH 2 CH 2 O)nCH 2 CH 2 OR, where R is H or optionally substituted alkyl, and n is an integer from 0 to 20 (e.g., from 0 to 4, from 0 to 8, from 0 to 10, from 0 to 16, from 1 to 4, from 1 to 8, from 1 to 10, from 1
- RNA includes the sugar group ribose, which is a 5-membered ring having an oxygen.
- exemplary, non-limiting alternative nucleotides include replacement of the oxygen in ribose (e.g., with S, Se, or alkylene, such as methylene or ethylene); addition of a double bond (e.g., to replace ribose with cyclopentenyl or cyclohexenyl); ring contraction of ribose (e.g., to form a 4-membered ring of cyclobutane or oxetane); ring expansion of ribose (e.g., to form a 6- or 7-membered ring having an additional carbon or heteroatom, such as for anhydrohexitol, altritol, mannitol, cyclohexanyl, cyclohexenyl, and morpholino that also has a phosphoramidate backbone); multicyclic forms (e.
- the sugar group can also contain one or more carbons that possess the opposite stereochemical configuration than that of the corresponding carbon in ribose.
- a polynucleotide molecule can include nucleotides containing, e.g., arabinose, as the sugar. b. Alterations on the nucleobase
- nucleoside is defined as a compound containing a sugar molecule (e.g., a pentose or ribose) or derivative thereof in combination with an organic base (e.g., a purine or pyrimidine) or a derivative thereof (also referred to herein as “nucleobase”).
- organic base e.g., a purine or pyrimidine
- nucleotide is defined as a nucleoside including a phosphate group.
- Exemplary non-limiting alterations include an amino group, a thiol group, an alkyl group, a halo group, or any described herein.
- the alternative nucleotides may by synthesized by any useful method, as described herein (e.g., chemically, enzymatically, or recombinantly to include one or more alternative or alternative nucleosides).
- a nucleic acid of the invention includes one or more 2’-OMe nucleotides, 2’-methoxyethyl nucleotides (2’-MOE nucleotides), 2’-F nucleotide, 2’-NH 2 nucleotide, 2’fluoroarabino nucleotides (FANA nucleotides), locked nucleic acid nucleotides (LNA nucleotides), or 4’-S nucleotides.
- 2’-OMe nucleotides 2’-methoxyethyl nucleotides
- 2’-MOE nucleotides 2’-F nucleotide
- 2’-NH 2 nucleotide 2’fluoroarabino nucleotides
- FANA nucleotides locked nucleic acid nucleotides
- LNA nucleotides locked nucleic acid nucleotides
- the alternative nucleotide base pairing encompasses not only the standard adenosine-thymine, adenosine-uracil, and guanosine-cytosine base pairs, but also base pairs formed between nucleotides and/or alternative nucleotides including non-standard or alternative bases, wherein the arrangement of hydrogen bond donors and hydrogen bond acceptors permits hydrogen bonding between a non-standard base and a standard base or between two complementary non-standard base structures.
- non-standard base pairing is the base pairing between the alternative nucleotide inosine and adenine, cytosine, or uracil.
- the alternative nucleosides and nucleotides can include an alternative nucleobase.
- nucleobases found in RNA include, but are not limited to, adenine, guanine, cytosine, and uracil.
- nucleobase found in DNA include, but are not limited to, adenine, guanine, cytosine, and thymine. These nucleobases can be altered or wholly replaced to provide polynucleotide molecules having enhanced properties (e.g., resistance to nucleases and stability), and these properties may manifest through disruption of the binding of a major groove binding partner.
- the alternative nucleobase is an alternative uracil.
- Exemplary nucleobases and nucleosides having an alternative uracil include pseudouridine (ip), pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine (s 2 U), 4-thio-uridine (s 4 U), 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine (ho 5 U), 5-aminoallyl-uridine, 5-halo-uridine (e.g., 5-iodo-uridineor 5-bromo-uridine), 3-methyl-uridine (m 3 U), 5-methoxy-uridine (mo 5 U), uridine 5- oxyacetic acid (cmo 5 U), uridine 5-oxyacetic acid methyl ester (mcmo 5 U), 5-carboxymethyl-uridine (cm 5 U), 1
- the alternative nucleobase is an alternative cytosine.
- Exemplary nucleobases and nucleosides having an alternative cytosine include 5-aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine (m 3 C), N4-acetyl-cytidine (ac 4 C), 5-formyl-cytidine (f 5 C), N4-methyl- cytidine (m 4 C), 5-methyl-cytidine (m 5 C), 5-halo-cytidine (e.g., 5-iodo-cytidine), 5-hydroxymethyl-cytidine (hm 5 C), 1 -methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine (s 2 C), 2- thio-5-methyl-cytidine, 4-thio-pseudoiso
- the alternative nucleobase is an alternative adenine.
- Exemplary nucleobases and nucleosides having an alternative adenine include 2-amino-purine, 2, 6-diaminopurine, 2-amino-6-halo-purine (e.g., 2-amino-6-chloro-purine), 6-halo-purine (e.g., 6-chloro-purine), 2-amino-6- methyl-purine, 8-azido-adenosine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7- deaza-8-aza-2-amino-purine, 7-deaza-2, 6-diaminopurine, 7-deaza-8-aza-2, 6-diaminopurine, 1 -methyladenosine (m 1 A), 2-methyl-adenine (m 2 A), N6-methyl-adenosine (m 6 A)
- the alternative nucleobase is an alternative guanine.
- Exemplary nucleobases and nucleosides having an alternative guanine include inosine (I), 1 -methyl-inosine (m 1 l), wyosine (imG), methylwyosine (mimG), 4-demethyl-wyosine (imG-14), isowyosine (imG2), wybutosine (yW), peroxywybutosine (02yW), hydroxywybutosine (OhyW), undermodified hydroxywybutosine (OhyW*), 7-deaza-guanosine, queuosine (Q), epoxyqueuosine (oQ), galactosyl-queuosine (galQ), mannosyl-queuosine (manQ), 7-cyano-7-deaza-guanosine (preQ0), 7-aminomethyl-7-deaza-guanosine (preQ
- the nucleobase of the nucleotide can be independently selected from a purine, a pyrimidine, a purine, or pyrimidine analog.
- the nucleobase can each be independently selected from adenine, cytosine, guanine, uracil, or hypoxanthine.
- the nucleobase can also include, for example, naturally-occurring and synthetic derivatives of a base, including pyrazolo[3,4- d]pyrimidines, 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2- aminoadenine, 6-methyl, and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo (e.g., 8-bromo), 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines
- each letter refers to the representative base and/or derivatives thereof (e.g., A includes adenine or adenine analogs (e.g., 7-deaza adenine)).
- the polynucleotides of the invention contain 5-methoxy-uracil, uracil, 5- methyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uracil, uracil, 5-trifluoromethyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5- methoxy-uracil, uracil, 5-hydroxymethyl-cytosine, and cytosine as the only uracils and cytosines.
- the polynucleotides of the invention contain 5-methoxy-uracil, uracil, 5-bromo-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uracil, uracil, 5-iodo-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uracil, uracil, 5-methoxy- cytosine, and cytosine as the only uracils and cytosines.
- the polynucleotides of the invention contain 5-methoxy-uracil, uracil, 5-ethyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uracil, uracil, 5- phenyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uracil, uracil, 5-ethnyl-cytosine, and cytosine as the only uracils and cytosines.
- the polynucleotides of the invention contain 5- methoxy-uracil, uracil, N4-methyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uracil, uracil, 5-fluoro-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uracil, uracil, N4-acetyl-cytosine, and cytosine as the only uracils and cytosines.
- the polynucleotides of the invention contain 5-methoxy-uracil, uracil, pseudoisocytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uracil, uracil, 5-formyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5- methoxy-uracil, uracil, 5-aminoallyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uracil, uracil, 5-carboxy-cytosine, and cytosine as the only uracils and cytosines.
- the polynucleotides of the invention contain 1 -methyl-pseudouracil, uracil, 5-methyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouracil, uracil, 5-trifluoromethyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouracil, uracil, 5-hydroxymethyl-cytosine, and cytosine as the only uracils and cytosines.
- the polynucleotides of the invention contain 1 -methyl-pseudouracil, uracil, 5-bromo-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouracil, uracil, 5-iodo-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1 - methyl-pseudouracil, uracil, 5-methoxy-cytosine, and cytosine as the only uracils and cytosines.
- the polynucleotides of the invention contain 1 -methyl-pseudouracil, uracil, 5-ethyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouracil, uracil, 5-phenyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouracil, uracil, 5-ethnyl-cytosine, and cytosine as the only uracils and cytosines.
- the polynucleotides of the invention contain 1 -methyl-pseudouracil, uracil, N4-methyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1 - methyl-pseudouracil, uracil, 5-fluoro-cytosine, and cytosine as the only uracils and cytosines.
- the polynucleotides of the invention contain 1 -methyl-pseudouracil, uracil, N4-acetyl- cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouracil, uracil, pseudoisocytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1 -methyl- pseudouracil, uracil, 5-formyl-cytosine, and cytosine as the only uracils and cytosines.
- the polynucleotides of the invention contain 1 -methyl-pseudouracil, uracil, 5-aminoallyl- cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouracil, uracil, 5-carboxy-cytosine, and cytosine as the only uracils and cytosines.
- the polynucleotides of the invention contain 5-methoxy-uridine, uridine, 5- methyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uridine, uridine, 5-trifluoromethyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 5- methoxy-uridine, uridine, 5-hydroxymethyl-cytidine, and cytidine as the only uridines and cytidines.
- the polynucleotides of the invention contain 5-methoxy-uridine, uridine, 5-bromo- cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uridine, uridine, 5-iodo-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uridine, uridine, 5-methoxy-cytidine, and cytidine as the only uridines and cytidines.
- the polynucleotides of the invention contain 5-methoxy-uridine, uridine, 5-ethyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 5- methoxy-uridine, uridine, 5-phenyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uridine, uridine, 5-ethnyl-cytidine, and cytidine as the only uridines and cytidines.
- the polynucleotides of the invention contain 5-methoxy-uridine, uridine, N4-methyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uridine, uridine, 5-fluoro-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uridine, uridine, N4-acetyl-cytidine, and cytidine as the only uridines and cytidines.
- the polynucleotides of the invention contain 5- methoxy-uridine, uridine, pseudoisocytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uridine, uridine, 5-formyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uridine, uridine, 5-aminoallyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uridine, uridine, 5-carboxy-cytidine, and cytidine as the only uridines and cytidines.
- the polynucleotides of the invention contain 1 -methyl-pseudouridine, uridine, 5-methyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouridine, uridine, 5-trifluoromethyl-cytidine, and cytidine as the only uridines and cytidines.
- the polynucleotides of the invention contain 1 -methyl-pseudouridine, uridine, 5-hydroxymethyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouridine, uridine, 5-bromo-cytidine, and cytidine as the only uridines and cytidines.
- the polynucleotides of the invention contain 1 -methyl-pseudouridine, uridine, 5-iodo-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 1 - methyl-pseudouridine, uridine, 5-methoxy-cytidine, and cytidine as the only uridines and cytidines.
- the polynucleotides of the invention contain 1 -methyl-pseudouridine, uridine, 5-ethyl- cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouridine, uridine, 5-phenyl-cytidine, and cytidine as the only uridines and cytidines.
- the polynucleotides of the invention contain 1 -methyl- pseudouridine, uridine, 5-ethnyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouridine, uridine, N4-methyl- cytidine, and cytidine as the only uridines and cytidines.
- the polynucleotides of the invention contain 1 -methyl-pseudouridine, uridine, 5-fluoro-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 1 -methyl- pseudouridine, uridine, N4-acetyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouridine, uridine, pseudoisocytidine, and cytidine as the only uridines and cytidines.
- the polynucleotides of the invention contain 1 -methyl-pseudouridine, uridine, 5-formyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 1 - methyl-pseudouridine, uridine, 5-aminoallyl-cytidine, and cytidine as the only uridines and cytidines.
- the polynucleotides of the invention contain 1 -methyl-pseudouridine, uridine, 5- carboxy-cytidine, and cytidine as the only uridines and cytidines.
- the polynucleotides of the invention contain the uracil of one of the nucleosides of Table 4 and uracil as the only uracils. In other embodiments, the polynucleotides of the invention contain a uridine of Table 4 and uridine as the only uridines. Table 4. Exemplary modified uridine nucleosides
- the polynucleotides of the invention contain the cytosine of one of the nucleosides of Table 5 and cytosine as the only cytosines. In other embodiments, the polynucleotides of the invention contain a cytidine of Table 5 and cytidine as the only cytidines. Table 5. Exemplary modified cytidine nucleosides c. Alterations on the internucleoside linkage
- nucleotides which may be incorporated into a polynucleotide molecule, can be altered on the internucleoside linkage (e.g., phosphate backbone).
- phosphate backbone the phrases “phosphate” and “phosphodiester” are used interchangeably.
- Backbone phosphate groups can be altered by replacing one or more of the oxygen atoms with a different substituent.
- the alternative nucleosides and nucleotides can include the wholesale replacement of an unaltered phosphate moiety with another internucleoside linkage as described herein.
- alternative phosphate groups include, but are not limited to, phosphorothioate, phosphoroselenates, boranophosphates, boranophosphate esters, hydrogen phosphonates, phosphoramidates, phosphorodiamidates, alkyl or aryl phosphonates, and phosphotriesters.
- Phosphorodithioates have both non-linking oxygens replaced by sulfur.
- the phosphate linker can also be altered by the replacement of a linking oxygen with nitrogen (bridged phosphoramidates), sulfur (bridged phosphorothioates), and carbon (bridged methylene-phosphonates).
- the alternative nucleosides and nucleotides can include the replacement of one or more of the non-bridging oxygens with a borane moiety (BH3), sulfur (thio), methyl, ethyl and/or methoxy.
- BH3 borane moiety
- sulfur (thio) methyl, ethyl and/or methoxy.
- two non-bridging oxygens at the same position e.g., the alpha ( ⁇ ), beta ( ⁇ ) or gamma (y) position
- the replacement of one or more of the oxygen atoms at the a position of the phosphate moiety is provided to confer stability (such as against exonucleases and endonucleases) to RNA and DNA through the unnatural phosphorothioate backbone linkages.
- Phosphorothioate DNA and RNA have increased nuclease resistance and subsequently a longer half-life in a cellular environment. While not wishing to be bound by theory, phosphorothioate linked polynucleotide molecules are expected to also reduce the innate immune response through weaker binding/activation of cellular innate immune molecules.
- an alternative nucleoside includes an alpha-thio-nucleoside (e.g., 5'-O- (1 -thiophosphate)-adenosine, 5'-O-(1 -thiophosphate)-cytidine (a-thio-cytidine), 5'-O-(1 -thiophosphate)- guanosine, 5'-O-(1 -thiophosphate)-uridine, or 5'-O-(1 -thiophosphate)-pseudouridine).
- alpha-thio-nucleoside e.g., 5'-O- (1 -thiophosphate)-adenosine, 5'-O-(1 -thiophosphate)-cytidine (a-thio-cytidine), 5'-O-(1 -thiophosphate)- guanosine, 5'-O-(1 -thiophosphate)-uridine, or 5'-O-(1
- internucleoside linkages that may be employed according to the present invention, including internucleoside linkages which do not contain a phosphorous atom, are described herein below. d. Combinations of alternative sugars, nucleobases, and internucleoside linkages
- the polynucleotides of the invention can include a combination of alterations to the sugar, the nucleobase, and/or the internucleoside linkage. These combinations can include any one or more alterations described herein.
- the present disclosure provides LNP compositions that encapsulate a nucleic acid molecule (e.g., linear or circular RNA molecule) described herein.
- the LNPs of the disclosure may confer one or more advantageous properties.
- the lipid nanoparticle compositions described herein may be used for the delivery of therapeutic and/or prophylactic agents, e.g., mRNAs, to mammalian cells or organs.
- the lipid nanoparticles described herein have little or no immunogenicity.
- the lipid compounds disclosed herein have a lower immunogenicity as compared to a reference lipid (e.g., MC3, KC2, or DLinDMA).
- a formulation comprising a lipid disclosed herein and a therapeutic or prophylactic agent, e.g., mRNA, has an increased therapeutic index as compared to a corresponding formulation which comprises a reference lipid (e.g., MC3, KC2, or DLinDMA) and the same therapeutic or prophylactic agent.
- a reference lipid e.g., MC3, KC2, or DLinDMA
- compositions comprising:
- polynucleotides of the present disclosure are included in a lipid nanoparticle (LNP).
- Lipid nanoparticles according to the present disclosure may comprise: (i) an ionizable lipid (e.g., an ionizable amino lipid); (ii) a sterol or other structural lipid; (iii) a non-cationic helper lipid or phospholipid; and (iv) a PEG-modified lipid.
- lipid nanoparticles according to the present disclosure further comprise one or more polynucleotides of the present disclosure (e.g., a linear or circular RNA encoding a therapeutic polypeptide, such as a therapeutic polypeptide disclosed herein).
- lipid nanoparticles according to the present disclosure can be generated using components, compositions, and methods as are generally known in the art, see for example PCT/US2016/052352; PCT/US2016/068300; PCT/US2017/037551 ; PCT/US2015/027400; PCT/US2016/047406; PCT/US2016000129; PCT/US2016/014280; PCT/US2016/014280; PCT/US2017/038426; PCT/US2014/027077; PCT/US2014/055394; PCT/US2016/52117; PCT/US2012/069610;
- the lipid nanoparticle comprises an ionizable cationic lipid (e.g., an ionizable amino lipid) at a content of 20-60 mol.%, 25-60 mol.%, 30-60 mol.%, 35-60 mol.%, 40-60 mol.%, 45-60 mol.%, 20-55 mol.%, 25-55 mol.%, 30-55 mol.%, 35-55 mol.%, 40-55 mol.%, 45-55 mol.%, 20-50 mol.%, 25-50 mol.%, 30-50 mol.%, 35-50 mol.%, or 40-50 mol.%.
- an ionizable cationic lipid e.g., an ionizable amino lipid
- the lipid nanoparticle may comprise an ionizable cationic lipid (e.g., an ionizable amino lipid) at a content of 40-50 mol.%, 45-50 mol.%, 45-46 mol.%, 46-47 mol.%, 47-48 mol.%, 48-49 mol.%, or 49-50 mol.%, for example about 45 mol.%, about 45.5 mol.%, about 46 mol.%, about 46.5 mol.%, about 47 mol.%, about 47.5 mol.%, about 48 mol.%, about 48.5 mol.%, about 49 mol.%, or about 49.5 mol.% ionizable cationic lipid (e.g., an ionizable amino lipid).
- an ionizable cationic lipid e.g., an ionizable amino lipid
- the lipid nanoparticle comprises a non-cationic helper lipid or phospholipid at a content of 5-25 mol.%.
- the lipid nanoparticle may comprise a non-cationic helper lipid or phospholipid at a content of molar ratio of 5-25 mol.%, 5-20 mol.%, 5-15 mol.%, 10-25 mol.%, 10-20 mol.%, 10-15 mol.%, 5-6 mol.%, 6-7 mol.%, 7-8 mol.%, 8-9 mol.%, 9-10 mol.%, 10-1 1 mol.%, 1 1 -12 mol.%, 12-13 mol.%, 13-14 mol.%, 14-15 mol.%, 10-14 mol.%, 10-13 mol.%, 10-12 mol.%, 10-1 1 mol.%, 9-15 mol.%, 9-14 mol.%, 9-13 mol.%, 9-12 mol.%, or 9-1 1 mol.% non-cati
- the lipid nanoparticle comprises a sterol or other structural lipid at a content molar ratio of 25-55 mol.%, 25-50 mol.%, 25-45 mol.%, 25-40 mol.%, 25-35 mol.%, 30-55 mol.%, 30-50 mol.%, 30-45 mol.%, 30-40 mol.%, 30-35 mol.%, 35-55 mol.%, 35-50 mol.%, 35-45 mol.%, 35-40 mol.%, 25-30 mol.%, 30-35 mol.%, 25-28 mol.%, 28-30 mol.%, 30-33 mol.%, 35-38 mol.%, 38-40 mol.%, 36-40 mol.%, 37-40 mol.%, 38-40 mol.%, 38-39 mol.%, 36-40 mol.%, 37-40 mol.%, 36-39 mol.%, 36-39 mol.%, or 37- 39 mol.%.
- the lipid nanoparticle may comprise a sterol or other structural lipid at a content of about 30 mol.%, about 30.5 mol.%, about 31 .0 mol.%, about 31 .5 mol.%, about 32.0 mol.%, about 32.5 mol.%, about 33.0 mol.%, about 33.5 mol.%, about 34.0 mol.%, about 34.5 mol.%, about 35.0 mol.%, about 35.5 mol.%, about 36.0 mol.%, about 36.5 mol.%, about 37.0 mol.%, about 37.5 mol.%, about 38.0 mol.%, about 38.5 mol.%, about 39.0 mol.%, about 39.5 mol.%, about 40.0 mol.%, about 40.5 mol.%, about 41 .0 mol.%, about 41 .5 mol.%, about 42.0 mol.%, about 42.5 mol.%, about 43.0 mol.%, about 43.5
- the lipid nanoparticle comprises a PEG-modified lipid at a content of 0.5- 15 mol.%, 1 .0-15 mol.%, 1 .5-15 mol.%, 2.0-15 mol.%, 2.5-15 mol.%, 3.0-15 mol.%, 3.5-15 mol.%, 4.0-15 mol.%, 4.5-15 mol.%, 5.0-15 mol.%, 10-15 mol.%, 0.5-10 mol.%, 0.5-5 mol.%, 0.5-4.5 mol.%, 0.5-4.0 mol.%, 0.5-3.5 mol.%, 0.5-3.0 mol.%, 0.5-2.5 mol.%, 0.5-2.0 mol.%, 0.5-1 .5 mol.%, 0.5-1 .0 mol.%, 1 .0-10 mol.%, 1 .0-5 mol.%, 1 .0-4.5 mol.%, 1 .0-4.0 mol.%, 1 .0-3.5 mol
- the lipid nanoparticle may comprise a PEG-modified lipid at a content of a about 0.5 mol.%, about 1 .0 mol.%, about 1 .5 mol.%, about 2.0 mol.%, about 2.5 mol.%, about 3.0 mol.%, about 3.5 mol.%, about 4.0 mol.%, about 4.5 mol.%, about 5.0 mol.%, about 6.0 mol.%, about 7.0 mol.%, about 8.0 mol.%, about 9.0 mol.%, about 10.0 mol.%, or about 15.0 mol.%.
- the lipid nanoparticle comprises: (i) 20 to 60 mol.% ionizable cationic lipid
- the lipid nanoparticle comprises: (i) 40 to 50 mol.% ionizable cationic lipid (e.g. ionizable amino lipid), (ii) 30 to 45 mol.% sterol or other structural lipid, (Hi) 5 to 15 mol.% noncationic lipid (e.g., phospholipid), and (iv) 1 to 5 mol.% PEG-modified lipid.
- the lipid nanoparticle comprises: (i) 45 to 50 mol.% ionizable cationic lipid (e.g. ionizable amino lipid), (ii) 35 to 45 mol.% sterol or other structural lipid, (Hi) 8 to 12 mol.% noncationic lipid (e.g., phospholipid), and (iv) 1 .5 to 3.5 mol.% PEG-modified lipid.
- ionizable cationic lipid e.g. ionizable amino lipid
- ii 35 to 45 mol.% sterol or other structural lipid
- Hi 8 to 12 mol.% noncationic lipid (e.g., phospholipid)
- 1 .5 to 3.5 mol.% PEG-modified lipid e.g. phospholipid
- the lipid nanoparticle of the present disclosure comprises an ionizable cationic lipid (e.g., an ionizable amino lipid) that is a compound of Formula (I): (I) or its N-oxide, or a salt or isomer thereof, wherein R’ a is R' branched ; wherein denotes a point of attachment; wherein R a ⁇ , R a ⁇ , R ay and R a ⁇ are each independently selected from the group consisting of H, C 2-12 alkyl, and C 2-12 alkenyl;
- an ionizable cationic lipid e.g., an ionizable amino lipid
- R’ a is R' branched ; wherein denotes a point of attachment
- R a ⁇ , R a ⁇ , R ay and R a ⁇ are each independently selected from the group consisting of H, C 2-12 alkyl, and C 2-12 alkenyl;
- R 2 and R 3 are each independently selected from the group consisting of C 1-14 alkyl and C 2-14 alkenyl;
- R 4 is selected from the group consisting of -(CH 2 )nOH, wherein n is selected from the group consisting of 1 , 2, 3, 4, and 5, and wherein denotes a point of attachment;
- R 10 is N(R)2; each R is independently selected from the group consisting of C 1-6 alkyl, C 2-3 alkenyl, and H; and n2 is selected from the group consisting of 1 , 2, 3, 4, 5, 6, 7, 8, 9, and 10; each R 5 is independently selected from the group consisting of C 1-3 alkyl,
- each R 6 is independently selected from the group consisting of C 1-3 alkyl,
- M and M’ are each independently selected from the group consisting of -C(O)O- and
- R’ is a C 1-12 alkyl or C 2-12 alkenyl
- I is selected from the group consisting of 1 , 2, 3, 4, and 5; and m is selected from the group consisting of 5, 6, 7, 8, 9, 10, 1 1 , 12, and 13.
- R’ a is R’ branched ;
- R’ branched is denotes a point of attachment;
- R a ⁇ , R a ⁇ , R ay and R a ⁇ are each H;
- R 2 and R 3 are each C 1-14 alkyl;
- R 4 is - (CH 2 )nOH;
- n is 2;
- each R 5 is H;
- each R 6 is H;
- M and M’ are each -C(O)O-;
- R’ is a C 1-12 alkyl; I is 5; and m is 7.
- R’ a is R’ branched ;
- R’ branched is denotes a point of attachment;
- R a ⁇ , R a ⁇ , R ay and R a ⁇ are each H;
- R 2 and R 3 are each C 1-14 alkyl;
- R 4 is -(CH 2 )nOH;
- n is 2;
- each R 5 is H;
- each R 6 is H;
- M and M’ are each -
- R’ is a C 1-12 alkyl; I is 3; and m is 7.
- R’ a is R’ branched ; R’ branched ; s denotes a point of attachment; R aa is C 2-12 alkyl; R a ⁇ , R a ⁇ , R ay and a Rre a ⁇ each H;
- R 2 and R 3 are each C 1-14 alkyl;
- R 4 is R 10 is NH( C 1-6 alkyl); n2 is 2;
- R 5 is H; each R 6 is H;
- M and M’ are each -C(O)O-;
- R’ is a C 1-12 alkyl; I is 5; and m is 7.
- R’ a is R’ branched ;
- R' branched is denotes a point of attachment;
- R a ⁇ , R a ⁇ , and R a ⁇ are each H;
- R av is C 2-12 alkyl;
- R 2 and R 3 are each C 1-14 alkyl;
- R 4 is -(CH 2 )nOH;
- n is 2;
- each R 5 is H; each R 6 is H;
- M and M’ are each -C(O)O-;
- R’ is a C 1-12 alkyl; I is 5; and m is 7.
- the compound of Formula (I) is selected from: (Compound 1-1 ),
- the compound of Formula (I) is:
- the disclosure relates to a compound of Formula (la): (la) or its N-oxide, or a salt or isomer thereof, wherein R’ a is R' branched ; wherein
- R' branched is ; denotes a point of attachment; wherein R a ⁇ , R a ⁇ , R ay and a Rre a ⁇ each independently selected from the group consisting of H, C 2-12 alkyl, and C 2-12 alkenyl;
- R 2 and R 3 are each independently selected from the group consisting of C 1-14 alkyl and C 2-14 alkenyl;
- R 4 is selected from the group consisting of -(CH 2 )nOH wherein n is selected from the group consisting of 1 , 2, 3, 4, and 5, and wherein denotes a point of attachment;
- R 10 is N(R)2; each R is independently selected from the group consisting of C 1-6 alkyl, C 2-3 alkenyl, and H; and n2 is selected from the group consisting of 1 , 2, 3, 4, 5, 6, 7, 8, 9, and 10; each R 5 is independently selected from the group consisting of C 1-3 alkyl,
- each R 6 is independently selected from the group consisting of C 1-3 alkyl,
- M and M’ are each independently selected from the group consisting of -C(O)O- and -OC(O)-;
- R’ is a C 1-12 alkyl or C 2-12 alkenyl
- I is selected from the group consisting of 1 , 2, 3, 4, and 5; and m is selected from the group consisting of 5, 6, 7, 8, 9, 10, 1 1 , 12, and 13.
- the disclosure relates to a compound of Formula (lb): (lb) or its N-oxide, or a salt or isomer thereof, wherein R’ a is R' branched ; wherein
- R' branched is ; wherein denotes a point of attachment; wherein R aa , R a ⁇ , R a ⁇ , R ay and a Rre a ⁇ each independently selected from the group consisting of H, C 2-12 alkyl, and C 2-12 alkenyl;
- R 2 and R 3 are each independently selected from the group consisting of C 1-14 alkyl and C 2-14 alkenyl;
- R 4 is -(CH 2 )nOH, wherein n is selected from the group consisting of 1 , 2, 3, 4, and 5; each R 5 is independently selected from the group consisting of C 1-3 alkyl,
- each R 6 is independently selected from the group consisting of C 1-3 alkyl,
- M and M’ are each independently selected from the group consisting of -C(O)O- and -OC(O)-;
- R’ is a C 1-12 alkyl or C 2-12 alkenyl
- I is selected from the group consisting of 1 , 2, 3, 4, and 5; and m is selected from the group consisting of 5, 6, 7, 8, 9, 10, 1 1 , 12, and 13.
- R’ a is R' branched ;
- R' branched is denotes a point of attachment;
- R a ⁇ , R ay , and R a ⁇ are each H;
- R 2 and R 3 are each C 1-14 alkyl;
- R 4 is - (CH 2 )nOH; n is 2;
- each R 5 is H;
- each R 6 is H;
- M and M’ are each -C(O)O-;
- R’ is a C 1-12 alkyl; I is 5; and m is 7.
- R’ a is R' branched ; is ; R' branched is ; denotes a point of attachment; R a ⁇ and R a ⁇ are each H; R ay is C 2-12 alkyl; R 2 and R 3 are each C 1-14 alkyl;
- R 4 is -(CH 2 )nOH; n is 2; each R 5 is H; each R 6 is H; M and M’ are each -C(O)O-; R’ is a C 1-12 alkyl; I is 5; and m is 7.
- the disclosure relates to a compound of Formula (Ic): (Ic) or its N-oxide, or a salt or isomer thereof, wherein R’ a is R' branched w is ;herein
- R' branched is ; wherein denotes a point of attachment; wherein R a ⁇ , R a ⁇ , R ay and R a ⁇ are each independently selected from the group consisting of H, C 2-12 alkyl, and C 2-12 alkenyl;
- R 2 and R 3 are each independently selected from the group consisting of C 1-14 alkyl and C 2-14 alkenyl; wherein denotes a point of attachment; wherein
- R 10 is N(R)2; each R is independently selected from the group consisting of C 1-6 alkyl, C 2-3 alkenyl, and H; n2 is selected from the group consisting of 1 , 2, 3, 4, 5, 6, 7, 8, 9, and 10; each R 5 is independently selected from the group consisting of C 1-3 alkyl,
- each R 6 is independently selected from the group consisting of C 1-3 alkyl,
- M and M’ are each independently selected from the group consisting of -C(O)O- and -OC(O)-;
- R’ is a C 1-12 alkyl or C 2-12 alkenyl
- I is selected from the group consisting of 1 , 2, 3, 4, and 5; and m is selected from the group consisting of 5, 6, 7, 8, 9, 10, 1 1 , 12, and 13. attachment; R aP , R av , and R a ⁇ are each H; R aa is C 2-12 alkyl; R 2 and R 3 are each C 1-14 alkyl; R 4 is denotes a point of attachment; R 10 is NH(C 1-6 alkyl); n2 is 2; each R 5 is H; each R 6 is H; M and M’ are each -C(O)O-; R’ is a C 1-12 alkyl; I is 5; and m is 7.
- the compound of Formula (Ic) is: (Compound I-2).
- the disclosure relates to a compound of Formula (II): (II) or its N-oxide, or a salt or isomer thereof, wherein R’ a is R’ branched or R’ cyclic ; wherein
- R ay and R a ⁇ are each independently selected from the group consisting of H, C 1-12 alkyl, and C 2-12 alkenyl, wherein at least one of R ay and R a ⁇ is selected from the group consisting of C 1-12 alkyl and C 2-12 alkenyl;
- R by and R b ⁇ are each independently selected from the group consisting of H, C 1-12 alkyl, and C 2-12 alkenyl, wherein at least one of R by and R b ⁇ is selected from the group consisting of C 1-12 alkyl and C 2-12 alkenyl;
- R 2 and R 3 are each independently selected from the group consisting of C 1-14 alkyl and C 2-14 alkenyl;
- R 4 is selected from the group consisting of -(CH 2 )nOH wherein n is selected from the group consisting of 1 , 2, 3, 4, and 5, and wherein denotes a point of attachment;
- R 10 is N(R)2; each R is independently selected from the group consisting of C 1-6 alkyl, C 2-3 alkenyl, and H; and n2 is selected from the group consisting of 1 , 2, 3, 4, 5, 6, 7, 8, 9, and 10; each R’ independently is a C 1-12 alkyl or C 2-12 alkenyl;
- Y a is a C3-6 carbocycle
- R*” a is selected from the group consisting of C 1 -15 alkyl and C 2 -15 alkenyl; and s is 2 or 3; m is selected from 1 , 2, 3, 4, 5, 6, 7, 8, and 9;
- I is selected from 1 , 2, 3, 4, 5, 6, 7, 8, and 9.
- the disclosure relates to a compound of Formula (I l-a) : (ll-a) or its N-oxide, or a salt or isomer thereof, wherein R’ a is R’ branched or R’ cyclic ; wherein wherein denotes a point of attachment; R ay and R a ⁇ are each independently selected from the group consisting of H, C 1-12 alkyl, and C 2-12 alkenyl, wherein at least one of R ay and R a ⁇ is selected from the group consisting of C 1-12 alkyl and C 2-12 alkenyl;
- R by and R b ⁇ are each independently selected from the group consisting of H, C 1-12 alkyl, and C 2-12 alkenyl, wherein at least one of R by and R b ⁇ is selected from the group consisting of C 1-12 alkyl and C 2-12 alkenyl;
- R 2 and R 3 are each independently selected from the group consisting of C 1-14 alkyl and C 2-14 alkenyl;
- R 4 is selected from the group consisting of -(CH 2 )nOH wherein n is selected from the group consisting of 1 , 2, 3, 4, and 5 and wherein denotes a point of attachment;
- R 10 is N(R)2; each R is independently selected from the group consisting of C 1-6 alkyl, C 2-3 alkenyl, and H; and n2 is selected from the group consisting of 1 , 2, 3, 4, 5, 6, 7, 8, 9, and 10; each R’ independently is a C 1-12 alkyl or C 2-12 alkenyl; m is selected from 1 , 2, 3, 4, 5, 6, 7, 8, and 9;
- I is selected from 1 , 2, 3, 4, 5, 6, 7, 8, and 9.
- the disclosure relates to a compound of Formula (I l-b) : (ll-b) or its N-oxide, or a salt or isomer thereof, wherein R’ a is R’ branched or R’ cyclic ; wherein wherein denotes a point of attachment; R ay and R by are each independently selected from the group consisting of C 1-12 alkyl and C 2-12 alkenyl;
- R 2 and R 3 are each independently selected from the group consisting of C 1-14 alkyl and C 2-14 alkenyl;
- R 4 is selected from the group consisting of -(CH 2 )nOH wherein n is selected from the group consisting of 1 , 2, 3, 4, and 5, and wherein denotes a point of attachment;
- R 10 is N(R)2; each R is independently selected from the group consisting of C 1-6 alkyl, C 2-3 alkenyl, and H; and n2 is selected from the group consisting of 1 , 2, 3, 4, 5, 6, 7, 8, 9, and 10; each R’ independently is a C 1-12 alkyl or C 2-12 alkenyl; m is selected from 1 , 2, 3, 4, 5, 6, 7, 8, and 9;
- I is selected from 1 , 2, 3, 4, 5, 6, 7, 8, and 9.
- the disclosure relates to a compound of Formula (I l-c) : (ll-c) or its N-oxide, or a salt or isomer thereof, wherein R’ a is R’ branched or R’ cyclic ; wherein
- R' branched jg - and R’ b is: wherein denotes a point of attachment; wherein R av is selected from the group consisting of C 1-12 alkyl and C 2-12 alkenyl;
- R 2 and R 3 are each independently selected from the group consisting of C 1-14 alkyl and C 2-14 alkenyl;
- R 4 is selected from the group consisting of -(CH 2 )nOH wherein n is selected from the group consisting of 1 , 2, 3, 4, and 5, and wherein denotes a point of attachment;
- R 10 is N(R)2; each R is independently selected from the group consisting of C 1-6 alkyl, C 2-3 alkenyl, and H; and n2 is selected from the group consisting of 1 , 2, 3, 4, 5, 6, 7, 8, 9, and 10; R’ is a C 1-12 alkyl or C 2-12 alkenyl; m is selected from 1 , 2, 3, 4, 5, 6, 7, 8, and 9;
- I is selected from 1 , 2, 3, 4, 5, 6, 7, 8, and 9.
- the disclosure relates to a compound of Formula (I l-d) : (ll-d) or its N-oxide, or a salt or isomer thereof, wherein R’ a is R’ branched or R’ cyclic ; wherein
- R’ branched is : and R’b is wherein denotes a point of attachment; wherein R ay and R by are each independently selected from the group consisting of C 1-12 alkyl and C 2-12 alkenyl;
- R 4 is selected from the group consisting of -(CH 2 )nOH wherein n is selected from the group consisting of 1 , 2, 3, 4, and 5, and wherein denotes a point of attachment;
- R 10 is N(R)2; each R is independently selected from the group consisting of C 1-6 alkyl, C 2-3 alkenyl, and H; and n2 is selected from the group consisting of 1 , 2, 3, 4, 5, 6, 7, 8, 9, and 10; each R’ independently is a C 1-12 alkyl or C 2-12 alkenyl; m is selected from 1 , 2, 3, 4, 5, 6, 7, 8, and 9;
- I is selected from 1 , 2, 3, 4, 5, 6, 7, 8, and 9.
- the disclosure relates to a compound of Formula (ll-e): (ll-e) or its N-oxide, or a salt or isomer thereof, wherein R’ a is R’ branched or R’ cyclic ; wherein
- R’ branched is ; wherein denotes a point of attachment; wherein R a * is selected from the group consisting of C 1-12 alkyl and C 2-12 alkenyl;
- R 2 and R 3 are each independently selected from the group consisting of C 1-14 alkyl and C 2-14 alkenyl;
- R 4 is -(CH 2 )nOH wherein n is selected from the group consisting of 1 , 2, 3, 4, and 5;
- R’ is a C 1-12 alkyl or C 2-12 alkenyl; m is selected from 1 , 2, 3, 4, 5, 6, 7, 8, and 9;
- I is selected from 1 , 2, 3, 4, 5, 6, 7, 8, and 9.
- m and I are each independently selected from 4, 5, and 6. In some embodiments of the compound of Formula (II), (ll-a), (ll-b), (ll-c), (ll-d), or (ll-e), m and I are each 5.
- each R’ independently is a C 1-12 alkyl. In some embodiments of the compound of Formula (II), (ll-a), (ll-b), (ll-c), (ll-d), or (ll-e), each R’ independently is a C 2-5 alkyl.
- R’ b is: and R 2 and R 3 are each independently a C 1-14 alkyl. In some embodiments of the compound of Formula (II), (ll-a), (ll-b), (ll-c), (ll-d), or (ll-e), R’ b is: and R 2 and R 3 are each independently a C 6-1 0 alkyl.
- R’ b is: r3 ⁇ r2 and R 2 and R 3 are each a C 8 alkyl.
- R’ branched is and R’ b is: R , R av is a C 1-12 alkyl and R 2 and R 3 are each independently a C 6-1 0 alkyl.
- R av is a C 1-12 alkyl
- R 2 and R 3 are each independently a C 6-1 0 alkyl.
- R’ branched is : anc
- R’b is : Ray is a C 2-6 a
- R’ branched is : and R’b is : Ray is a C 2-6 alkyl, and R 2 and R 3 are each a C 8 alkyl.
- R’ branched is: anc l Ray anc
- Rby branched is : and R ay and R by are each a C 2-6 alkyl.
- m and I are each independently selected from 4, 5, and 6 and each R’ independently is a C 1-12 alkyl. In some embodiments of the compound of Formula (II), (ll-a), (ll-b), (ll-c), (ll-d), or (ll-e), m and I are each 5 and each R’ independently is a C 2-5 alkyl.
- R’branched is: m and I are each independently selected from 4, 5, and 6, each R’ independently is a C 1-12 alkyl, and R ay and R by are each a C 1-12 alkyl.
- R’branched is : m and I are each 5, each R’ independently is a C 2-5 alkyl, and R ay and R by are each a C 2-6 alkyl.
- R’ is a C 1-12 alkyl
- R a * is a C 1-12 alkyl
- R 2 and R 3 are each independently a C 6-10 alkyl.
- R’ branched is: m and I are each 5, R’ is a C 2-5 alkyl, R av is a C 2-6 alkyl, and R 2 and R 3 are each a C 8 alkyl.
- R 4 is wherein R 10 is NH(C 1-6 alkyl) and n2 is 2. In some embodiments of the compound of Formula (II), (ll-a), (ll-b), (ll-c), (ll-d), or (ll-e), R 4 is wherein R 10 is NH(CHs) and n2 is 2.
- R’branched is: m and I are each independently selected from 4, 5, and 6, each R’ independently is a C 1-12 alkyl, R a * and R by are each a C 1-12 alkyl, and R 4 is , wherein R 10 is NH(C 1-6 alkyl), and n2 is 2.
- R’ branched is: is: m and I are each 5, each R’ independently is a C 2-5 alkyl, R ay and R by are each a C 2-6 alkyl, and R 4 is , wherein R 10 is NH(CHs) and n2 is 2.
- R’ is a C 1-12 alkyl
- R 2 and R 3 are each independently a C 6-10 alkyl
- R av is a C 1-12 alkyl
- R 4 is wherein R 10 is NH(C 1-6 alkyl) and n2 is 2.
- R’ branched is: and I are each 5, R’ is a C 2-5 alkyl, R a * is a C 2-6 alkyl, R 2 and R 3 are each a C 8 alkyl, and R 4 is wherein R 10 is NH(CHs) and n2 is 2.
- R 4 is - (CH 2 )nOH and n is 2, 3, or 4. In some embodiments of the compound of Formula (II), (ll-a), (ll-b), (ll-c), (ll-d), or (ll-e), R 4 is -(CH 2 )nOH and n is 2.
- R’ branched is: m and I are each independently selected from 4, 5, and 6, each R’ independently is a C 1-12 alkyl, R ay and R by are each a C 1-12 alkyl, R 4 is -(CH 2 )nOH, and n is 2, 3, or 4.
- R 4 is -(CH 2 )nOH, and n is 2, 3, or 4.
- R’ branched is : m and I are each 5, each R’ independently is a C 2-5 alkyl, R ay and R by are each a C 2-6 alkyl, R 4 is -(CH 2 )nOH, and n is 2.
- the disclosure relates to a compound of Formula (ll-f): (ll-f) or its N-oxide, or a salt or isomer thereof, wherein R’ a is R’ branched or R’ cyclic ; wherein R’ branched is and wherein denotes a point of attachment;
- R av is a C 1-12 alkyl
- R 2 and R 3 are each independently a C 1-14 alkyl
- R 4 is -(CH 2 )nOH wherein n is selected from the group consisting of 1 , 2, 3, 4, and 5;
- R’ is a C 1-12 alkyl; m is selected from 4, 5, and 6; and
- I is selected from 4, 5, and 6.
- m and I are each 5, and n is 2, 3, or 4.
- R’ is a C 2-5 alkyl
- R av is a C 2-6 alkyl
- R 2 and R 3 are each a C 6-10 alkyl.
- m and I are each 5, n is 2, 3, or 4, R’ is a C 2-5 alkyl, R a * is a C 2-6 alkyl, and R 2 and R 3 are each a C 6-10 alkyl.
- the disclosure relates to a compound of Formula (I l-g) :
- R’ is a C 2-5 alkyl
- R 4 is selected from the group consisting of -(CH 2 )nOH wherein n is selected from the group consisting of 3, 4, and 5, and wherein denotes a point of attachment, R 10 is NH(C 1-6 alkyl), and n2 is selected from the group consisting of 1 , 2, and 3.
- the disclosure relates to a compound of Formula (I l-h) :
- R ay and R by are each independently a C 2-6 alkyl; each R’ independently is a C 2-5 alkyl; and
- R 4 is selected from the group consisting of -(CH 2 )nOH wherein n is selected from the group consisting of 3, 4, and 5, and wherein denotes a point of attachment,
- R 10 is NH(C 1-6 alkyl), and n2 is selected from the group consisting of 1 , 2, and 3.
- R 4 is wherein
- R 10 is NH(CH 3 ) and n2 is 2.
- R 4 is -(CH 2 )2OH.
- the disclosure relates to a compound having the Formula (III): or a salt or isomer thereof, wherein
- R1 , R 2 , R 3 , R 4 , and Rs are independently selected from the group consisting of C5-20 alkyl, C5-20 alkenyl, -R”MR’, -R*YR”, -YR”, and -R*OR”; each M is independently selected from the group consisting of -C(O)O-, -OC(O)-, -OC(O)O-, -C(O)N(R’)-, -N(R’)C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR’)O-, -S(O) 2 -, an aryl group, and a heteroaryl group;
- X 1 , X 2 , and X 3 are independently selected from the group consisting of a bond, -CH 2 -, -(CH 2 ) 2 -, -CHR-, -CHY-, -C(O)-, -C(O)O-, -OC(O)-, -C(O)-CH 2 -, -CH 2 -C(O)-, -C(O)O-CH 2 -, -OC(O)-CH 2 -, -CH 2 -C(O)O-, -CH 2 -OC(O)-, -CH(OH)-, -C(S)-, and -CH(SH)-; each Y is independently a C3-6 carbocycle; each R* is independently selected from the group consisting of C 1-12 alkyl and C 2-12 alkenyl; each R is independently selected from the group consisting of C 1-3 alkyl and a C3-6 carbocycle; each R’ is independently selected from
- R1 , R 2 , R 3 , R 4 , and Rs are each C5-20 alkyl; X 1 is -CH 2 -; and X 2 and X 3 are each -C(O)-.
- the compound of Formula (III) is: (Compound l-VI), or a salt or isomer thereof. c. Phospholipids
- the lipid composition of the lipid nanoparticle composition disclosed herein can comprise one or more phospholipids, for example, one or more saturated or (poly)unsaturated phospholipids or a combination thereof.
- phospholipids comprise a phospholipid moiety and one or more fatty acid moieties.
- a phospholipid moiety can be selected, for example, from the non-limiting group consisting of phosphatidyl choline, phosphatidyl ethanolamine, phosphatidyl glycerol, phosphatidyl serine, phosphatidic acid, 2-lysophosphatidyl choline, and a sphingomyelin.
- a fatty acid moiety can be selected, for example, from the non-limiting group consisting of lauric acid, myristic acid, myristoleic acid, palmitic acid, palmitoleic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, erucic acid, phytanoic acid, arachidic acid, arachidonic acid, eicosapentaenoic acid, behenic acid, docosapentaenoic acid, and docosahexaenoic acid.
- Particular phospholipids can facilitate fusion to a membrane.
- a cationic phospholipid can interact with one or more negatively charged phospholipids of a membrane (e.g., a cellular or intracellular membrane). Fusion of a phospholipid to a membrane can allow one or more elements (e.g., a therapeutic agent) of a lipid-containing composition (e.g., LNPs) to pass through the membrane permitting, e.g., delivery of the one or more elements to a target tissue.
- a cationic phospholipid can interact with one or more negatively charged phospholipids of a membrane (e.g., a cellular or intracellular membrane). Fusion of a phospholipid to a membrane can allow one or more elements (e.g., a therapeutic agent) of a lipid-containing composition (e.g., LNPs) to pass through the membrane permitting, e.g., delivery of the one or more elements to a target tissue.
- elements e.g., a therapeutic agent
- Non-natural phospholipid species including natural species with modifications and substitutions including branching, oxidation, cyclization, and alkynes are also contemplated.
- a phospholipid can be functionalized with or cross-linked to one or more alkynes (e.g., an alkenyl group in which one or more double bonds is replaced with a triple bond).
- an alkyne group can undergo a copper-catalyzed cycloaddition upon exposure to an azide.
- Such reactions can be useful in functionalizing a lipid bilayer of a nanoparticle composition to facilitate membrane permeation or cellular recognition or in conjugating a nanoparticle composition to a useful component such as a targeting or imaging moiety (e.g., a dye).
- Phospholipids include, but are not limited to, glycerophospholipids such as phosphatidylcholines, phosphatidylethanolamines, phosphatidylserines, phosphatidylinositols, phosphatidy glycerols, and phosphatidic acids. Phospholipids also include phosphosphingolipid, such as sphingomyelin.
- a phospholipid of the present disclosure comprises 1 ,2-distearoyl-sn- glycero-3-phosphocholine (DSPC), 1 ,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1 ,2- dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1 ,2-dimyristoyl-sn-gly cero-phosphocholine (DMPC),
- DOPC 1,3-dioleoyl-sn-glycero-3-phosphocholine
- DPPC l,2-dipalmitoyl-sn-glycero-3-phosphocholine
- 1 .2-diundecanoyl-sn-glycero-phosphocholine (DUPC), 1 -palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1 ,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 Diether PC), 1 -oleoyl-2 cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), 1 -hexadecyl-sn-glycero-3- phosphocholine (C16 Lyso PC), 1 ,2-dilinolenoyl-sn-glycero-3-phosphocholine,1 ,2-diarachidonoyl-sn- glycero-3-phosphocholine, 1 ,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1
- a phospholipid useful or potentially useful in the present disclosure is an analog or variant of DSPC. In certain embodiments, a phospholipid useful or potentially useful in the present disclosure is a compound of Formula (IV):
- each R 1 is independently optionally substituted alkyl; or optionally two R 1 are joined together with the intervening atoms to form optionally substituted monocyclic carbocyclyl or optionally substituted monocyclic heterocyclyl; or optionally three R 1 are joined together with the intervening atoms to form optionally substituted bicyclic carbocyclyl or optionally substitute bicyclic heterocyclyl; n is 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10; m is 0, 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10;
- each instance of L 2 is independently a bond or optionally substituted C 1-6 alkylene, wherein one methylene unit of the optionally substituted C 1-6 alkylene is optionally replaced with O, N(R N ), S, C(O), - C(O)N(R N ), NR N C(O), C(O)O, OC(O), OC(O)O, OC(O)N(R N ), NR N C(O)O, or NR N C(O)N(R N ); each instance of R 2 is independently optionally substituted C 1-3 0 alkyl, optionally substituted C 1-3 0 alkenyl, or optionally substituted C 1-3 0 alkynyl; optionally wherein one or more methylene units of R 2 are independently replaced with optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(R N ), O, S, C(O), C
- Ring B is optionally substituted carbocyclyl, optionally substituted heterocyclyl, optionally substituted aryl, or optionally substituted heteroaryl; and p is 1 or 2; provided that the compound is not of the Formula: wherein each instance of R 2 is independently unsubstituted alkyl, unsubstituted alkenyl, or unsubstituted alkynyl.
- the phospholipids may be one or more of the phospholipids described in U.S. Application No. 62/520,530. i. Phospholipid Head Modifications
- a phospholipid useful or potentially useful in the present disclosure comprises a modified phospholipid head (e.g., a modified choline group).
- a phospholipid with a modified head is DSPC, or analog thereof, with a modified quaternary amine.
- at least one of R 1 is not methyl. In certain embodiments, at least one of R 1 is not hydrogen or methyl.
- the compound of Formula (IV) is of one of the following Formulae: or a salt thereof, wherein: each t is independently 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10; each u is independently 0, 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10; and each v is independently 1 , 2, or 3.
- a compound of Formula (IV) is of Formula (IV-a):
- a phospholipid useful or potentially useful in the present disclosure comprises a cyclic moiety in place of the glyceride moiety.
- a phospholipid useful in the present disclosure is DSPC, or analog thereof, with a cyclic moiety in place of the glyceride moiety.
- the compound of Formula (IV) is of Formula (IV-b): or a salt thereof. ii. Phospholipid Tail Modifications
- a phospholipid useful or potentially useful in the present disclosure comprises a modified tail.
- a phospholipid useful or potentially useful in the present disclosure is DSPC, or analog thereof, with a modified tail.
- a “modified tail” may be a tail with shorter or longer aliphatic chains, aliphatic chains with branching introduced, aliphatic chains with substituents introduced, aliphatic chains wherein one or more methylenes are replaced by cyclic or heteroatom groups, or any combination thereof.
- a phospholipid useful or potentially useful in the present disclosure comprises a modified phosphocholine moiety, wherein the alkyl chain linking the quaternary amine to the phosphoryl group is not ethylene (e.g., n is not 2). Therefore, in certain embodiments, a phospholipid useful or potentially useful in the present disclosure is a compound of Formula (IV), wherein n is 1 , 3, 4, 5, 6, 7, 8, 9, or 10.
- a compound of Formula (IV) is of one of the following Formulae: or a salt thereof.
- a phospholipid useful or potentially useful in the present disclosure comprises a modified phosphocholine moiety, wherein the alkyl chain linking the quaternary amine to the phosphoryl group is not ethylene (e.g., n is not 2). Therefore, in certain embodiments, a phospholipid useful.
- an alternative lipid is used in place of a phospholipid of the present disclosure.
- an alternative lipid of the present disclosure is oleic acid.
- the alternative lipid is one of the following: d. Structural Lipids
- the lipid composition of a pharmaceutical composition disclosed herein can comprise one or more structural lipids.
- structural lipid refers to sterols and also to lipids containing sterol moieties.
- Structural lipids can be selected from the group including but not limited to, cholesterol, fecosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, tomatine, ursolic acid, alpha-tocopherol, hopanoids, phytosterols, steroids, and mixtures thereof.
- the structural lipid is a sterol.
- sterols are a subgroup of steroids consisting of steroid alcohols.
- the structural lipid is a steroid.
- the structural lipid is cholesterol.
- the structural lipid is an analog of cholesterol.
- the structural lipid is alpha-tocopherol.
- the structural lipids may be one or more of the structural lipids described in U.S. Application No. 62/520,530. e. Polyetylene Glycol-Lipids
- the lipid composition of a pharmaceutical composition disclosed herein can comprise one or more a polyethylene glycol (PEG) lipid.
- PEG polyethylene glycol
- PEG-lipid refers to polyethylene glycol (PEG)-modified lipids.
- PEG-lipids include PEG-modified phosphatidylethanolamine and phosphatidic acid, PEG-ceramide conjugates (e.g., PEG-CerC14 or PEG-CerC20), PEG-modified dialkylamines and PEG- modified 1 ,2-diacyloxypropan-3-amines.
- PEG-lipids are also referred to as PEGylated lipids.
- a PEG lipid can be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, or a PEG-DSPE lipid.
- the PEG-lipid includes, but not limited to 1 ,2-dimyristoyl-sn-glycerol methoxypolyethylene glycol (PEG-DMG), 1 ,2-distearoyl-sn-glycero-3-phosphoethanolamine-N- [amino(polyethylene glycol)] (PEG-DSPE), PEG-disteryl glycerol (PEG-DSG), PEG-dipalmetoleyl, PEG- dioleyl, PEG-distearyl, PEG-diacylglycamide (PEG-DAG), PEG-dipalmitoyl phosphatidylethanolamine (PEG-DPPE), or PEG-l,2-dimyristyloxlpropyl-3
- the PEG-lipid is selected from the group consisting of a PEG-modified phosphatidylethanolamine, a PEG-modified phosphatidic acid, a PEG-modified ceramide, a PEG- modified dialkylamine, a PEG-modified diacylglycerol, a PEG-modified dialkylglycerol, and mixtures thereof.
- the lipid moiety of the PEG-lipids includes those having lengths of from about Cuto about C22, preferably from about Cuto about C .
- a PEG moiety for example an mPEG-NH 2 , has a size of about 1000, 2000, 5000, 10,000, 15,000 or 20,000 daltons.
- the PEG-lipid is PEG2k-DMG.
- the lipid nanoparticles described herein can comprise a PEG lipid which is a non-diffusible PEG.
- PEG lipid which is a non-diffusible PEG.
- non-diffusible PEGs include PEG-DSG and PEG-DSPE.
- PEG-lipids are known in the art, such as those described in U.S. Patent No. 8,158,601 and International Publ. No. WO 2015/130584 A2, which are incorporated herein by reference in their entirety.
- the lipid component of a lipid nanoparticle composition may include one or more molecules comprising polyethylene glycol, such as PEG or PEG-modified lipids. Such species may be alternately referred to as PEGylated lipids.
- a PEG lipid is a lipid modified with polyethylene glycol.
- a PEG lipid may be selected from the non-limiting group including PEG-modified phosphatidylethanolamines, PEG- modified phosphatidic acids, PEG-modified ceramides, PEG-modified dialkylamines, PEG-modified diacylglycerols, PEG-modified dialkylglycerols, and mixtures thereof.
- a PEG lipid may be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, or a PEG-DSPE lipid.
- PEG-modified lipids are a modified form of PEG DMG.
- PEG-DMG has the following structure:
- PEG lipids useful in the present disclosure can be PEGylated lipids described in International Publication No. WO2012099755, the contents of which is herein incorporated by reference in its entirety. Any of these exemplary PEG lipids described herein may be modified to comprise a hydroxyl group on the PEG chain.
- the PEG lipid is a PEG-OH lipid.
- a “PEG-OH lipid” (also referred to herein as “hydroxy-PEGylated lipid”) is a PEGylated lipid having one or more hydroxyl (-OH) groups on the lipid.
- the PEG-OH lipid includes one or more hydroxyl groups on the PEG chain.
- a PEG- OH or hydroxy-PEGylated lipid comprises an -OH group at the terminus of the PEG chain.
- a PEG lipid useful in the present disclosure is a compound of Formula (V).
- R 3 is -OR 0 ;
- R° is hydrogen, optionally substituted alkyl, or an oxygen protecting group; r is an integer between 1 and 100, inclusive;
- L 1 is optionally substituted C 1 -10 alkylene, wherein at least one methylene of the optionally substituted C 1 -10 alkylene is independently replaced with optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, O, N(R N ), S, C(O), C(O)N(R N ), NR N C(O), C(O)O, OC(O), 00(O)0, 0C(O)N(R N ), NR N C(O)0, or NR N C(O)N(R N );
- D is a moiety obtained by click chemistry or a moiety cleavable under physiological conditions; m is 0, 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10;
- each instance of L 2 is independently a bond or optionally substituted C 1-6 alkylene, wherein one methylene unit of the optionally substituted C 1-6 alkylene is optionally replaced with O, N(R N ), S, C(O), - C(O)N(R N ), NR N C(O), 0(O)0, 00(O), 00(O)0, 0C(O)N(R N ), NR N C(O)0, or NR N C(O)N(R N ); each instance of R 2 is independently optionally substituted C 1-3 0 alkyl, optionally substituted C 1-3 0 alkenyl, or optionally substituted C 1-3 0 alkynyl; optionally wherein one or more methylene units of R 2 are independently replaced with optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(R N ), O, S, C(O), - C(
- Ring B is optionally substituted carbocyclyl, optionally substituted heterocyclyl, optionally substituted aryl, or optionally substituted heteroaryl; and p is 1 or 2.
- the compound of Fomula (V) is a PEG-OH lipid (i.e., R 3 is -OR 0 , and R° is hydrogen).
- the compound of Formula (V) is of Formula (V-OH): (V-OH), or a salt thereof.
- a PEG lipid useful in the present disclosure is a PEGylated fatty acid.
- a PEG lipid useful in the present disclosure is a compound of Formula (VI).
- R 3 is-OR°
- R° is hydrogen, optionally substituted alkyl or an oxygen protecting group; r is an integer between 1 and 100, inclusive;
- the compound of Formula (VI) is of Formula (VI-OH): or a salt thereof. In some embodiments, r is 45.
- the compound of Formula (VI) is: or a salt thereof. In one embodiment, r is 40-50.
- the compound of Formula (VI) is N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl-N-(2-aminoethyl)-2-aminoethyl
- the lipid composition of the pharmaceutical compositions disclosed herein does not comprise a PEG-lipid.
- the PEG-lipids may be one or more of the PEG lipids described in U.S. Application No. 62/520,530.
- a PEG lipid of the present disclosure comprises a PEG-modified phosphatidylethanolamine, a PEG-modified phosphatidic acid, a PEG-modified ceramide, a PEG- modified dialkylamine, a PEG-modified diacylglycerol, a PEG-modified dialkylglycerol, and mixtures thereof.
- the PEG-modified lipid is PEG-DMG, PEG-c-DOMG (also referred to as PEG-DOMG), PEG-DSG and/or PEG-DPG.
- a LNP of the present disclosure comprises an ionizable cationic lipid of any of Formula I, II or III, a phospholipid comprising DSPC, a structural lipid, and a PEG lipid comprising PEG-DMG.
- a LNP of the present disclosure comprises an ionizable cationic lipid of any of Formula I, II or III, a phospholipid comprising DSPC, a structural lipid, and a PEG lipid comprising a compound having Formula VI.
- a LNP of the present disclosure comprises an ionizable cationic lipid of Formula I, II or III, a phospholipid comprising a compound having Formula IV, a structural lipid, and the PEG lipid comprising a compound having Formula V or VI.
- a LNP of the present disclosure comprises an ionizable cationic lipid of Formula I, II or III, a phospholipid comprising a compound having Formula IV, a structural lipid, and the PEG lipid comprising a compound having Formula V or VI.
- a LNP of the present disclosure comprises an ionizable cationic lipid of Formula I, II or III, a phospholipid having Formula IV, a structural lipid, and a PEG lipid comprising a compound having Formula VI.
- a LNP of the present disclosure comprises an ionizable cationic lipid of and a PEG lipid comprising Formula VI.
- a LNP of the present disclosure comprises an ionizable cationic lipid of and an alternative lipid comprising oleic acid.
- a LNP of the present disclosure comprises an ionizable cationic lipid of an alternative lipid comprising oleic acid, a structural lipid comprising cholesterol, and a PEG lipid comprising a compound having Formula VI.
- a LNP of the present disclosure comprises an ionizable cationic lipid of a phospholipid comprising DOPE, a structural lipid comprising cholesterol, and a PEG lipid comprising a compound having Formula VI.
- a LNP of the present disclosure comprises an ionizable cationic lipid of a phospholipid comprising DOPE, a structural lipid comprising cholesterol, and a PEG lipid comprising a compound having Formula VI.
- a LNP of the present disclosure comprises an N:P ratio of from about 2:1 to about 30:1 .
- a LNP of the present disclosure comprises an N:P ratio of about 6:1 .
- a LNP of the present disclosure comprises an N:P ratio of about 3:1 .
- a LNP of the present disclosure comprises a wt/wt ratio of the ionizable cationic lipid component to the RNA of from about 10:1 to about 100:1 .
- a LNP of the present disclosure comprises a wt/wt ratio of the ionizable cationic lipid component to the RNA of about 20:1 .
- a LNP of the present disclosure comprises a wt/wt ratio of the ionizable cationic lipid component to the RNA of about 10:1 .
- a LNP of the present disclosure has a mean diameter from about 50nm to about 150nm.
- a LNP of the present disclosure has a mean diameter from about 70nm to about 120nm.
- alkyl As used herein, the term “alkyl”, “alkyl group”, or “alkylene” means a linear or branched, saturated hydrocarbon including one or more carbon atoms (e.g., one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, or more carbon atoms), which is optionally substituted.
- the notation "Ci i4 alkyl” means an optionally substituted linear or branched, saturated hydrocarbon including 1 -14 carbon atoms. Unless otherwise specified, an alkyl group described herein refers to both unsubstituted and substituted alkyl groups.
- alkenyl means a linear or branched hydrocarbon including two or more carbon atoms (e.g., two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, or more carbon atoms) and at least one double bond, which is optionally substituted.
- C 2-14 alkenyl means an optionally substituted linear or branched hydrocarbon including 2-14 carbon atoms and at least one carbon-carbon double bond.
- An alkenyl group may include one, two, three, four, or more carbon-carbon double bonds.
- C 18 alkenyl may include one or more double bonds.
- a C 18 alkenyl group including two double bonds may be a linoleyl group.
- an alkenyl group described herein refers to both unsubstituted and substituted alkenyl groups.
- alkynyl means a linear or branched hydrocarbon including two or more carbon atoms (e.g., two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, or more carbon atoms) and at least one carbon-carbon triple bond, which is optionally substituted.
- C 2-14 alkynyl means an optionally substituted linear or branched hydrocarbon including 2-14 carbon atoms and at least one carbon-carbon triple bond.
- An alkynyl group may include one, two, three, four, or more carbon-carbon triple bonds.
- C 18 alkynyl may include one or more carbon-carbon triple bonds.
- an alkynyl group described herein refers to both unsubstituted and substituted alkynyl groups.
- Carbocycle or “carbocyclic group” means an optionally substituted mono- or multi-cyclic system including one or more rings of carbon atoms. Rings may be three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, or twenty membered rings.
- C3-6 carbocycle means a carbocycle including a single ring having 3-6 carbon atoms. Carbocycles may include one or more carbon-carbon double or triple bonds and may be non-aromatic or aromatic (e.g., cycloalkyl or aryl groups).
- carbocycles include cyclopropyl, cyclopentyl, cyclohexyl, phenyl, naphthyl, and 1 ,2 dihydronaphthyl groups.
- cycloalkyl as used herein means a non-aromatic carbocycle and may or may not include any double or triple bond.
- carbocycles described herein refers to both unsubstituted and substituted carbocycle groups, i.e., optionally substituted carbocycles.
- heterocycle or “heterocyclic group” means an optionally substituted mono- or multi-cyclic system including one or more rings, where at least one ring includes at least one heteroatom.
- Heteroatoms may be, for example, nitrogen, oxygen, or sulfur atoms. Rings may be three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, or fourteen membered rings.
- Heterocycles may include one or more double or triple bonds and may be non-aromatic or aromatic (e.g., heterocycloalkyl or heteroaryl groups).
- heterocycles include imidazolyl, imidazolidinyl, oxazolyl, oxazolidinyl, thiazolyl, thiazolidinyl, pyrazolidinyl, pyrazolyl, isoxazolidinyl, isoxazolyl, isothiazolidinyl, isothiazolyl, morpholinyl, pyrrolyl, pyrrolidinyl, furyl, tetrahydrofuryl, thiophenyl, pyridinyl, piperidinyl, quinolyl, and isoquinolyl groups.
- heterocycloalkyl as used herein means a non- aromatic heterocycle and may or may not include any double or triple bond. Unless otherwise specified, heterocycles described herein refers to both unsubstituted and substituted heterocycle groups, i.e., optionally substituted heterocycles.
- heteroalkyl refers respectively to an alkyl, alkenyl, alkynyl group, as defined herein, which further comprises one or more (e.g., 1 , 2, 3, or 4) heteroatoms (e.g., oxygen, sulfur, nitrogen, boron, silicon, phosphorus) wherein the one or more heteroatoms is inserted between adjacent carbon atoms within the parent carbon chain and/or one or more heteroatoms is inserted between a carbon atom and the parent molecule, i.e., between the point of attachment.
- heteroatoms e.g., oxygen, sulfur, nitrogen, boron, silicon, phosphorus
- heteroalkyls, heteroalkenyls, or heteroalkynyls described herein refers to both unsubstituted and substituted heteroalkyls, heteroalkenyls, or heteroalkynyls, i.e., optionally substituted heteroalkyls, heteroalkenyls, or heteroalkynyls.
- a "biodegradable group” is a group that may facilitate faster metabolism of a lipid in a mammalian entity.
- a biodegradable group may be selected from the group consisting of, but is not limited to, -C(O)O-, -OC(O)-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, - P(O)(OR')O-, -S(O)2-, an aryl group, and a heteroaryl group.
- an "aryl group” is an optionally substituted carbocyclic group including one or more aromatic rings.
- aryl groups include phenyl and naphthyl groups.
- a "heteroaryl group” is an optionally substituted heterocyclic group including one or more aromatic rings.
- heteroaryl groups include pyrrolyl, furyl, thiophenyl, imidazolyl, oxazolyl, and thiazolyl. Both aryl and heteroaryl groups may be optionally substituted.
- M and M' can be selected from the non-limiting group consisting of optionally substituted phenyl, oxazole, and thiazole.
- M and M' can be independently selected from the list of biodegradable groups above.
- aryl or heteroaryl groups described herein refers to both unsubstituted and substituted groups, i.e., optionally substituted aryl or heteroaryl groups.
- Alkyl, alkenyl, and cyclyl (e.g., carbocyclyl and heterocyclyl) groups may be optionally substituted unless otherwise specified.
- R is an alkyl or alkenyl group, as defined herein.
- the substituent groups themselves may be further substituted with, for example, one, two, three, four, five, or six substituents as defined herein.
- a C 1-6 alkyl group may be further substituted with one, two, three, four, five, or six substituents as described herein.
- N-oxides can be converted to N-oxides by treatment with an oxidizing agent (e.g., 3-chloroperoxybenzoic acid (mCPBA) and/or hydrogen peroxides) to afford other compounds of the disclosure.
- an oxidizing agent e.g., 3-chloroperoxybenzoic acid (mCPBA) and/or hydrogen peroxides
- mCPBA 3-chloroperoxybenzoic acid
- hydrogen peroxides e.g., 3-chloroperoxybenzoic acid (mCPBA) and/or hydrogen peroxides
- N-OH N-hydroxy
- N-alkoxy i.e., N-OR, wherein R is substituted or unsubstituted C 1 -C 6 alkyl, C 1 -C 6 alkenyl, C 1 -C 6 alkynyl, 3-14-membered carbocycle or 3-14-membered heterocycle
- R is substituted or unsubstituted C 1 -C 6 alkyl, C 1 -C 6 alkenyl, C 1 -C 6 alkynyl, 3-14-membered carbocycle or 3-14-membered heterocycle
- the lipid composition of a pharmaceutical composition disclosed herein can include one or more components in addition to those described above.
- the lipid composition can include one or more permeability enhancer molecules, carbohydrates, polymers, surface altering agents (e.g., surfactants), or other components.
- a permeability enhancer molecule can be a molecule described by U.S. Patent Application Publication No. 2005/0222064.
- Carbohydrates can include simple sugars (e.g., glucose) and polysaccharides (e.g., glycogen and derivatives and analogs thereof).
- a polymer can be included in and/or used to encapsulate or partially encapsulate a pharmaceutical composition disclosed herein (e.g., a pharmaceutical composition in lipid nanoparticle form).
- a polymer can be biodegradable and/or biocompatible.
- a polymer can be selected from, but is not limited to, polyamines, polyethers, polyamides, polyesters, polycarbamates, polyureas, polycarbonates, polystyrenes, polyimides, polysulfones, polyurethanes, polyacetylenes, polyethylenes, polyethyleneimines, polyisocyanates, polyacrylates, polymethacrylates, polyacrylonitriles, and polyarylates.
- the ratio between the lipid composition and the polynucleotide range can be from about 10:1 to about 60:1 (wt/wt).
- the ratio between the lipid composition and the polynucleotide can be about 10:1 , 11 :1 , 12:1 , 13:1 , 14:1 , 15:1 , 16:1 , 17:1 , 18:1 , 19:1 , 20:1 , 21 :1 , 22:1 , 23:1 , 24:1 , 25:1 , 26:1 , 27:1 , 28:1 , 29:1 , 30:1 , 31 :1 , 32:1 , 33:1 , 34:1 , 35:1 , 36:1 , 37:1 , 38:1 , 39:1 , 40:1 , 41 :1 , 42:1 , 43:1 , 44:1 , 45:1 , 46:1 , 47:1 , 48:1 , 49:1 , 50:1 , 51 :1 , 52:1 , 53:1 , 54:1 , 55
- the pharmaceutical composition disclosed herein can contain more than one polypeptide.
- a pharmaceutical composition disclosed herein can contain two or more polynucleotides (e.g., RNA, e.g., mRNA).
- the lipid nanoparticles described herein can comprise polynucleotides (e.g., mRNA) in a lipid polynucleotide weight ratio of 5:1 , 10:1 , 15:1 , 20:1 , 25:1 , 30:1 , 35:1 , 40:1 , 45:1 , 50:1 , 55:1 , 60:1 or 70:1 , or a range or any of these ratios such as, but not limited to, 5:1 to about 10:1 , from about 5:1 to about 15:1 , from about 5:1 to about 20:1 , from about 5:1 to about 25:1 , from about 5:1 to about 30:1 , from about 5:1 to about 35:1 , from about 5:1 to about 40:1 , from about 5:1 to about 45:1 , from about 5:1 to about 50:1 , from about 5:1 to about 55:1 , from about 5:1 to
- the lipid nanoparticles described herein can comprise the polynucleotide in a concentration from approximately 0.1 mg/ml to 2 mg/ml such as, but not limited to, 0.1 mg/ml, 0.2 mg/ml, 0.3 mg/ml, 0.4 mg/ml, 0.5 mg/ml, 0.6 mg/ml, 0.7 mg/ml, 0.8 mg/ml, 0.9 mg/ml, 1 .0 mg/ml, 1 .1 mg/ml, 1 .2 mg/ml, 1 .3 mg/ml, 1 .4 mg/ml, 1 .5 mg/ml, 1 .6 mg/ml, 1 .7 mg/ml, 1 .8 mg/ml, 1 .9 mg/ml, 2.0 mg/ml or greater than 2.0 mg/ml.
- Nanoparticle Compositions 1 .0 mg/ml, 1 .1 mg/ml, 1 .2 mg/ml, 1 .3 mg/
- the pharmaceutical compositions disclosed herein are Formulated as lipid nanoparticles (LNP). Accordingly, the present disclosure also provides nanoparticle compositions comprising (i) a lipid composition comprising a delivery agent such as compound as described herein, and (ii) a polynucleotide containing an IRES described herein and encoding a polypeptide of interest. In such nanoparticle composition, the lipid composition disclosed herein can encapsulate the polynucleotide containing the IRES and encoding the polypeptide.
- Nanoparticle compositions are typically sized on the order of micrometers or smaller and can include a lipid bilayer.
- Nanoparticle compositions encompass lipid nanoparticles (LNPs), liposomes (e.g., lipid vesicles), and lipoplexes.
- LNPs lipid nanoparticles
- liposomes e.g., lipid vesicles
- lipoplexes e.g., lipoplexes.
- a nanoparticle composition can be a liposome having a lipid bilayer with a diameter of 500 nm or less.
- Nanoparticle compositions include, for example, lipid nanoparticles (LNPs), liposomes, and lipoplexes.
- LNPs lipid nanoparticles
- nanoparticle compositions are vesicles including one or more lipid bilayers.
- a nanoparticle composition includes two or more concentric bilayers separated by aqueous compartments.
- Lipid bilayers can be functionalized and/or crosslinked to one another.
- Lipid bilayers can include one or more ligands, proteins, or channels.
- a lipid nanoparticle comprises an ionizable amino lipid, a structural lipid, a phospholipid, and mRNA.
- the LNP comprises an ionizable amino lipid, a PEG- modified lipid, a sterol and a structural lipid.
- the LNP has a molar ratio of about 40-50% ionizable amino lipid; about 5-15% structural lipid; about 30-45% sterol; and about 1 -5% PEG- modified lipid.
- the lipid nanoparticle comprises 47-49 mol.% ionizable cationic lipid (e.g. ionizable amino lipid, e.g., Compound 1-1 , Compound I-2, or Compound I-3), 10-12 mol.% non-cationic lipid (e.g., phospholipid, e.g., DSPC), 38-40 mol.% sterol (e.g., cholesterol) or other structural lipid, and 1 - 3 mol.% PEG-modified lipid (e.g., PEG-DMG or Compound P-l).
- ionizable cationic lipid e.g. ionizable amino lipid, e.g., Compound 1-1 , Compound I-2, or Compound I-3
- 10-12 mol.% non-cationic lipid e.g., phospholipid, e.g., DSPC
- 38-40 mol.% sterol e.g., cholesterol
- the lipid nanoparticle (“LNP-1 ”) may comprise the following components at the following molar ratios:
- sterol e.g., cholesterol
- PEG-lipid e.g., Compound P-l or PEG-DMG.
- the lipid nanoparticle (“LNP-1 A”) may comprise the following components at the following molar ratios: (i) 45-50 mol.% Compound 1-1
- the lipid nanoparticle (“LNP-1 B”) may comprise the following components at the following molar ratios:
- the lipid nanoparticle (“LNP-2”) may comprise the following:
- sterol e.g., Cholesterol
- PEG-lipid e.g., Compound P-l or PEG-DMG.
- the lipid nanoparticle (“LNP-2A”) may comprise the following:
- the lipid nanoparticle (“LNP-2B”) may comprise the following components at the following molar ratios:
- the lipid nanoparticle (“LNP-3”) may comprise the following:
- sterol e.g., Cholesterol
- PEG-lipid e.g., Compound P-l or PEG-DMG.
- the lipid nanoparticle (“LNP-3A”) may comprise the following:
- the lipid nanoparticle (“LNP-3B”) may comprise the following:
- the LNP has a polydispersity value of less than 0.4. In some embodiments, the LNP has a net neutral charge at a neutral pH. In some embodiments, the LNP has a mean diameter of 50-150 nm. In some embodiments, the LNP has a mean diameter of 80-100 nm.
- lipid refers to a small molecule that has hydrophobic or amphiphilic properties. Lipids may be naturally occurring or synthetic. Examples of classes of lipids include, but are not limited to, fats, waxes, sterol-containing metabolites, vitamins, fatty acids, glycerolipids, glycerophospholipids, sphingolipids, saccharolipids, and polyketides, and prenol lipids. In some instances, the amphiphilic properties of some lipids leads them to form liposomes, vesicles, or membranes in aqueous media.
- a lipid nanoparticle may comprise an ionizable amino lipid.
- the term “ionizable amino lipid” has its ordinary meaning in the art and may refer to a lipid comprising one or more charged moieties.
- an ionizable amino lipid may be positively charged or negatively charged.
- An ionizable amino lipid may be positively charged, in which case it can be referred to as “cationic lipid”.
- an ionizable amino lipid molecule may comprise an amine group, and can be referred to as an ionizable amino lipid.
- a “charged moiety” is a chemical moiety that carries a formal electronic charge, e.g., monovalent (+1 , or -1 ), divalent (+2, or -2), trivalent (+3, or -3), etc.
- the charged moiety may be anionic (i.e., negatively charged) or cationic (i.e., positively charged).
- positively-charged moieties include amine groups (e.g., primary, secondary, and/or tertiary amines), ammonium groups, pyridinium groups, guanidine groups, and imidizolium groups.
- the charged moieties comprise amine groups.
- negatively- charged groups or precursors thereof include carboxylate groups, sulfonate groups, sulfate groups, phosphonate groups, phosphate groups, hydroxyl groups, and the like.
- the charge of the charged moiety may vary, in some cases, with the environmental conditions, for example, changes in pH may alter the charge of the moiety, and/or cause the moiety to become charged or uncharged. In general, the charge density of the molecule may be selected as desired.
- charge does not refer to a “partial negative charge” or “partial positive charge” on a molecule.
- the terms “partial negative charge” and “partial positive charge” are given their ordinary meaning in the art.
- a “partial negative charge” may result when a functional group comprises a bond that becomes polarized such that electron density is pulled toward one atom of the bond, creating a partial negative charge on the atom.
- the ionizable amino lipid is sometimes referred to in the art as an “ionizable cationic lipid”.
- the ionizable amino lipid may have a positively charged hydrophilic head and a hydrophobic tail that are connected via a linker structure.
- an ionizable amino lipid may also be a lipid including a cyclic amine group.
- the ionizable amino lipid may be selected from, but not limited to, an ionizable amino lipid described in International Publication Nos. WO2013086354 and WO2013116126; the contents of each of which are herein incorporated by reference in their entirety.
- the ionizable amino lipid may be selected from, but not limited to, Formula CLI-CLXXXII of US Patent No. 7,404,969; each of which is herein incorporated by reference in their entirety.
- the lipid may be a cleavable lipid such as those described in International Publication No. WO2012170889, herein incorporated by reference in its entirety.
- the lipid may be synthesized by methods known in the art and/or as described in International Publication Nos. WO2013086354; the contents of each of which are herein incorporated by reference in their entirety.
- Nanoparticle compositions can be characterized by a variety of methods. For example, microscopy (e.g., transmission electron microscopy or scanning electron microscopy) can be used to examine the morphology and size distribution of a nanoparticle composition. Dynamic light scattering or potentiometry (e.g., potentiometric titrations) can be used to measure zeta potentials. Dynamic light scattering can also be utilized to determine particle sizes. Instruments such as the Zetasizer Nano ZS (Malvern Instruments Ltd, Malvern, Worcestershire, UK) can also be used to measure multiple characteristics of a nanoparticle composition, such as particle size, polydispersity index, and zeta potential.
- microscopy e.g., transmission electron microscopy or scanning electron microscopy
- Dynamic light scattering or potentiometry e.g., potentiometric titrations
- Dynamic light scattering can also be utilized to determine particle sizes.
- Instruments such as the Ze
- the size of the nanoparticles can help counter biological reactions such as, but not limited to, inflammation, or can increase the biological effect of the polynucleotide.
- size or “mean size” in the context of nanoparticle compositions refers to the mean diameter of a nanoparticle composition.
- a polynucleotide of the disclosure is formulated in lipid nanoparticles having a diameter from about 10 to about 100 nm such as, but not limited to, about 10 to about 20 nm, about 10 to about 30 nm, about 10 to about 40 nm, about 10 to about 50 nm, about 10 to about 60 nm, about 10 to about 70 nm, about 10 to about 80 nm, about 10 to about 90 nm, about 20 to about 30 nm, about 20 to about 40 nm, about 20 to about 50 nm, about 20 to about 60 nm, about 20 to about 70 nm, about 20 to about 80 nm, about 20 to about 90 nm, about 20 to about 100 nm, about 30 to about 40 nm, about 30 to about 50 nm, about 30 to about 60 nm, about 30 to about 70 nm, about 30 to about 80 nm, about 30 to about 90 nm, about 30 to about 100 nm, about 30 to about
- the nanoparticles have a diameter from about 10 to 500 nm. In some embodiments, the nanoparticle has a diameter greater than 100 nm, greater than 150 nm, greater than 200 nm, greater than 250 nm, greater than 300 nm, greater than 350 nm, greater than 400 nm, greater than 450 nm, greater than 500 nm, greater than 550 nm, greater than 600 nm, greater than 650 nm, greater than 700 nm, greater than 750 nm, greater than 800 nm, greater than 850 nm, greater than 900 nm, greater than 950 nm or greater than 1000 nm.
- the largest dimension of a nanoparticle composition is 1 pm or shorter (e.g., 1 pm, 900 nm, 800 nm, 700 nm, 600 nm, 500 nm, 400 nm, 300 nm, 200 nm, 175 nm, 150 nm, 125 nm, 100 nm, 75 nm, 50 nm, or shorter).
- a nanoparticle composition can be relatively homogenous.
- a polydispersity index can be used to indicate the homogeneity of a nanoparticle composition, e.g., the particle size distribution of the nanoparticle composition.
- a small (e.g., less than 0.3) polydispersity index generally indicates a narrow particle size distribution.
- a nanoparticle composition can have a polydispersity index from about 0 to about 0.25, such as 0.01 , 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11 , 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21 , 0.22, 0.23, 0.24, or 0.25.
- the polydispersity index of a nanoparticle composition disclosed herein can be from about 0.10 to about 0.20.
- the zeta potential of a nanoparticle composition can be used to indicate the electrokinetic potential of the composition.
- the zeta potential can describe the surface charge of a nanoparticle composition.
- Nanoparticle compositions with relatively low charges, positive or negative, are generally desirable, as more highly charged species can interact undesirably with cells, tissues, and other elements in the body.
- the zeta potential of a nanoparticle composition disclosed herein can be from about -10 mV to about +20 mV, from about -10 mV to about +15 mV, from about 10 mV to about +10 mV, from about -10 mV to about +5 mV, from about -10 mV to about 0 mV, from about - 10 mV to about -5 mV, from about -5 mV to about +20 mV, from about -5 mV to about +15 mV, from about -5 mV to about +10 mV, from about -5 mV to about +5 mV, from about -5 mV to about 0 mV, from about 0 mV to about +20 mV, from about 0 mV to about +15 mV, from about 0 mV to about +10 mV, from about 0 mV to about +5 mV, from about 0 mV to about +20
- the zeta potential of the lipid nanoparticles can be from about 0 mV to about 100 mV, from about 0 mV to about 90 mV, from about 0 mV to about 80 mV, from about 0 mV to about 70 mV, from about 0 mV to about 60 mV, from about 0 mV to about 50 mV, from about 0 mV to about 40 mV, from about 0 mV to about 30 mV, from about 0 mV to about 20 mV, from about 0 mV to about 10 mV, from about 10 mV to about 100 mV, from about 10 mV to about 90 mV, from about 10 mV to about 80 mV, from about 10 mV to about 70 mV, from about 10 mV to about 60 mV, from about 10 mV to about 50 mV, from about 10 mV to about 40 mV, from about 10
- the zeta potential of the lipid nanoparticles can be from about 10 mV to about 50 mV, from about 15 mV to about 45 mV, from about 20 mV to about 40 mV, and from about 25 mV to about 35 mV. In some embodiments, the zeta potential of the lipid nanoparticles can be about 10 mV, about 20 mV, about 30 mV, about 40 mV, about 50 mV, about 60 mV, about 70 mV, about 80 mV, about 90 mV, and about 100 mV.
- encapsulation efficiency of a polynucleotide describes the amount of the polynucleotide that is encapsulated by or otherwise associated with a nanoparticle composition after preparation, relative to the initial amount provided.
- encapsulation can refer to complete, substantial, or partial enclosure, confinement, surrounding, or encasement.
- Encapsulation efficiency is desirably high (e.g., close to 100%).
- the encapsulation efficiency can be measured, for example, by comparing the amount of the polynucleotide in a solution containing the nanoparticle composition before and after breaking up the nanoparticle composition with one or more organic solvents or detergents.
- the encapsulation efficiency of a polynucleotide can be at least 50%, for example 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the encapsulation efficiency can be at least 80%. In certain embodiments, the encapsulation efficiency can be at least 90%.
- the amount of a polynucleotide present in a pharmaceutical composition disclosed herein can depend on multiple factors such as the size of the polynucleotide, desired target and/or application, or other properties of the nanoparticle composition as well as on the properties of the polynucleotide.
- the amount of an mRNA useful in a nanoparticle composition can depend on the size (expressed as length, or molecular mass), sequence, and other characteristics of the mRNA.
- the relative amounts of a polynucleotide in a nanoparticle composition can also vary.
- the relative amounts of the lipid composition and the polynucleotide present in a lipid nanoparticle composition of the present disclosure can be optimized according to considerations of efficacy and tolerability.
- the N:P ratio can serve as a useful metric.
- N:P ratio of a nanoparticle composition controls both expression and tolerability
- nanoparticle compositions with low N:P ratios and strong expression are desirable.
- N:P ratios vary according to the ratio of lipids to RNA in a nanoparticle composition.
- RNA, lipids, and amounts thereof can be selected to provide an N:P ratio from about 2:1 to about 30:1 , such as 2:1 , 3:1 , 4:1 , 5:1 , 6:1 , 7:1 , 8:1 , 9:1 , 10:1 , 12:1 , 14:1 , 16:1 , 18:1 , 20:1 , 22:1 , 24:1 , 26:1 , 28:1 , or 30:1 .
- the N:P ratio can be from about 2:1 to about 8:1 .
- the N:P ratio is from about 5:1 to about 8:1 .
- the N:P ratio is between 5:1 and 6:1 .
- the N:P ratio is about is about 5.67:1 .
- the present disclosure also provides methods of producing lipid nanoparticles comprising encapsulating a polynucleotide.
- Such method comprises using any of the pharmaceutical compositions disclosed herein and producing lipid nanoparticles in accordance with methods of production of lipid nanoparticles known in the art. See, e.g., Wang et al. (2015) “Delivery of oligonucleotides with lipid nanoparticles” Adv. Drug Deliv. Rev. 87:68-80; Silva et al. (2015) “Delivery Systems for Biopharmaceuticals. Part I: Nanoparticles and Microparticles” Curr. Pharm. Technol. 16: 940-954; Naseri et al.
- the LNP formulations described herein can additionally comprise a permeability enhancer molecule.
- permeability enhancer molecules are described in U.S. Pub. No. US20050222064, herein incorporated by reference in its entirety.
- the LNP formulations can further contain a phosphate conjugate.
- the phosphate conjugate can increase in vivo circulation times and/or increase the targeted delivery of the nanoparticle.
- Phosphate conjugates can be made by the methods described in, e.g., Inti. Pub. No. WO2013033438 or U.S. Pub. No. US20130196948.
- the LNP formulation can also contain a polymer conjugate (e.g., a water soluble conjugate) as described in, e.g., U.S. Pub. Nos. US20130059360, US20130196948, and US20130072709. Each of the references is herein incorporated by reference in its entirety.
- the LNP formulations can comprise a conjugate to enhance the delivery of nanoparticles of the present disclosure in a subject. Further, the conjugate can inhibit phagocytic clearance of the nanoparticles in a subject.
- the conjugate can be a "self" peptide designed from the human membrane protein CD47 (e.g., the "self” particles described by Rodriguez et al, Science 2013 339, 971 -975, herein incorporated by reference in its entirety). As shown by Rodriguez et al., the self peptides delayed macrophage-mediated clearance of nanoparticles which enhanced delivery of the nanoparticles.
- the LNP formulations can comprise a carbohydrate carrier.
- the carbohydrate carrier can include, but is not limited to, an anhydride-modified phytoglycogen or glycogentype material, phytoglycogen octenyl succinate, phytoglycogen beta-dextrin, anhydride-modified phytoglycogen beta-dextrin (e.g., Inti. Pub. No. W02012109121 , herein incorporated by reference in its entirety).
- the LNP formulations can be coated with a surfactant or polymer to improve the delivery of the particle.
- the LNP can be coated with a hydrophilic coating such as, but not limited to, PEG coatings and/or coatings that have a neutral surface charge as described in U.S. Pub. No. US20130183244, herein incorporated by reference in its entirety.
- the LNP formulations can be engineered to alter the surface properties of particles so that the lipid nanoparticles can penetrate the mucosal barrier as described in U.S. Pat. No. 8,241 ,670 or Inti. Pub. No. WO2013110028, each of which is herein incorporated by reference in its entirety.
- the LNP engineered to penetrate mucus can comprise a polymeric material (i.e., a polymeric core) and/or a polymer-vitamin conjugate and/or a tri-block co-polymer.
- the polymeric material can include, but is not limited to, polyamines, polyethers, polyamides, polyesters, polycarbamates, polyureas, polycarbonates, poly(styrenes), polyimides, polysulfones, polyurethanes, polyacetylenes, polyethylenes, polyethyeneimines, polyisocyanates, polyacrylates, polymethacrylates, polyacrylonitriles, and polyarylates.
- LNP engineered to penetrate mucus can also include surface altering agents such as, but not limited to, polynucleotides, anionic proteins (e.g., bovine serum albumin), surfactants (e.g., cationic surfactants such as for example dimethyldioctadecyl-ammonium bromide), sugars or sugar derivatives (e.g., cyclodextrin), nucleic acids, polymers (e.g., heparin, polyethylene glycol and poloxamer), mucolytic agents (e.g., N-acetylcysteine, mugwort, bromelain, papain, clerodendrum, acetylcysteine, bromhexine, carbocisteine, eprazinone, mesna, ambroxol, sobrerol, domiodol, letosteine, stepronin, tiopronin, gelsolin, thymosin p4 do
- the mucus penetrating LNP can be a hypotonic formulation comprising a mucosal penetration enhancing coating.
- the formulation can be hypotonic for the epithelium to which it is being delivered.
- hypotonic formulations can be found in, e.g., Inti. Pub. No. WO2013110028, herein incorporated by reference in its entirety.
- the polynucleotide described herein is Formulated as a lipoplex, such as, without limitation, the ATUPLEXTM system, the DACC system, the DBTC system and other siRNA- lipoplex technology from Silence Therapeutics (London, United Kingdom), STEMFECTTM from STEMGENT® (Cambridge, MA), and polyethylenimine (PEI) or protamine-based targeted and nontargeted delivery of nucleic acids (Aleku et al. Cancer Res. 2008 68:9788-9798; Strumberg et al.
- a lipoplex such as, without limitation, the ATUPLEXTM system, the DACC system, the DBTC system and other siRNA- lipoplex technology from Silence Therapeutics (London, United Kingdom), STEMFECTTM from STEMGENT® (Cambridge, MA), and polyethylenimine (PEI) or protamine-based targeted and nontargeted delivery of nucleic acids (Aleku et al. Cancer Res. 2008 68:9788
- the polynucleotides described herein are Formulated as a solid lipid nanoparticle (SLN), which can be spherical with an average diameter between 10 to 1000 nm.
- SLN possess a solid lipid core matrix that can solubilize lipophilic molecules and can be stabilized with surfactants and/or emulsifiers.
- Exemplary SLN can be those as described in Inti. Pub. No. W02013105101 , herein incorporated by reference in its entirety.
- the polynucleotides described herein can be Formulated for controlled release and/or targeted delivery.
- controlled release refers to a pharmaceutical composition or compound release profile that conforms to a particular pattern of release to effect a therapeutic outcome.
- the polynucleotides can be encapsulated into a delivery agent described herein and/or known in the art for controlled release and/or targeted delivery.
- encapsulate means to enclose, surround or encase. As it relates to the formulation of the compounds of the present disclosure, encapsulation can be substantial, complete or partial.
- substantially encapsulated means that at least greater than 50, 60, 70, 80, 85, 90, 95, 96, 97, 98, 99, or greater than 99% of the pharmaceutical composition or compound of the present disclosure can be enclosed, surrounded or encased within the delivery agent.
- Partial encapsulation or “partially encapsulate” means that less than 10, 10, 20, 30, 40 50 or less of the pharmaceutical composition or compound of the present disclosure can be enclosed, surrounded or encased within the delivery agent.
- encapsulation can be determined by measuring the escape or the activity of the pharmaceutical composition or compound of the present disclosure using fluorescence and/or electron micrograph. For example, at least 1 , 5, 10, 20, 30, 40, 50, 60, 70, 80, 85, 90, 95, 96, 97, 98, 99, 99.9, or greater than 99% of the pharmaceutical composition or compound of the present disclosure are encapsulated in the delivery agent.
- the polynucleotides described herein can be encapsulated in a therapeutic nanoparticle, referred to herein as "therapeutic nanoparticle polynucleotides.”
- Therapeutic nanoparticles can be Formulated by methods described in, e.g., Inti. Pub. Nos. WO2010005740, WO2010030763, WO2010005721 , WO2010005723, and WO2012054923; and U.S. Pub. Nos.
- the therapeutic nanoparticle polynucleotide can be Formulated for sustained release.
- sustained release refers to a pharmaceutical composition or compound that conforms to a release rate over a specific period of time.
- the period of time can include, but is not limited to, hours, days, weeks, months and years.
- the sustained release nanoparticle of the polynucleotides described herein can be Formulated as disclosed in Inti. Pub. No. WO2010075072 and U.S. Pub. Nos. US20100216804, US20110217377, US20120201859 and US20130150295, each of which is herein incorporated by reference in their entirety.
- the therapeutic nanoparticle polynucleotide can be Formulated to be target specific, such as those described in Inti. Pub. Nos. WO2008121949, WO2010005726, WO2010005725, WO2011084521 and WO2011084518; and U.S. Pub. Nos. US20100069426, US20120004293 and US20100104655, each of which is herein incorporated by reference in its entirety.
- the LNPs can be prepared using microfluidic mixers or micromixers.
- Exemplary microfluidic mixers can include, but are not limited to, a slit interdigital micromixer including, but not limited to those manufactured by Microinnova (Allerheiligen bei Wildon, Austria) and/or a staggered herringbone micromixer (SHM) (see Zhigaltsevet al., "Bottom-up design and synthesis of limit size lipid nanoparticle systems with aqueous and triglyceride cores using millisecond microfluidic mixing," Langmuir 28:3633-40 (2012); Belliveau et al., "Microfluidic synthesis of highly potent limit-size lipid nanoparticles for in vivo delivery of siRNA," Molecular Therapy-Nucleic Acids.
- micromixers include Slit Interdigital Microstructured Mixer (SIMM-V2) or a Standard Slit Interdigital Micro Mixer (SSIMM) or Caterpillar (CPMM) or Impinging-jet (IJMM,) from the Institut fur Mikrotechnik Mainz GmbH, Mainz Germany.
- methods of making LNP using SHM further comprise mixing at least two input streams wherein mixing occurs by microstructure-induced chaotic advection (MICA).
- MICA microstructure-induced chaotic advection
- fluid streams flow through channels present in a herringbone pattern causing rotational flow and folding the fluids around each other.
- This method can also comprise a surface for fluid mixing wherein the surface changes orientations during fluid cycling.
- Methods of generating LNPs using SHM include those disclosed in U.S. Pub. Nos. US20040262223 and US20120276209, each of which is incorporated herein by reference in their entirety.
- the polynucleotides described herein can be Formulated in lipid nanoparticles using microfluidic technology (see Whitesides, George M., “The Origins and the Future of Microfluidics,” Nature 442: 368-373 (2006); and Abraham et al., "Chaotic Mixer for Microchannels,” Science 295: 647-651 (2002); each of which is herein incorporated by reference in its entirety).
- the polynucleotides can be Formulated in lipid nanoparticles using a micromixer chip such as, but not limited to, those from Harvard Apparatus (Holliston, MA) or Dolomite Microfluidics (Royston, UK).
- a micromixer chip can be used for rapid mixing of two or more fluid streams with a split and recombine mechanism.
- the polynucleotides described herein can be Formulated in lipid nanoparticles having a diameter from about 1 nm to about 100 nm such as, but not limited to, about 1 nm to about 20 nm, from about 1 nm to about 30 nm, from about 1 nm to about 40 nm, from about 1 nm to about 50 nm, from about 1 nm to about 60 nm, from about 1 nm to about 70 nm, from about 1 nm to about 80 nm, from about 1 nm to about 90 nm, from about 5 nm to about from 100 nm, from about 5 nm to about 10 nm, about 5 nm to about 20 nm, from about 5 nm to about 30 nm, from about 5 nm to about 40 nm, from about 5 nm to about 50 nm, from about 5 nm to about 60 nm, from about 5 nm to about 70
- the lipid nanoparticles can have a diameter from about 10 to 500 nm. In some embodiments, the lipid nanoparticle can have a diameter greater than 100 nm, greater than 150 nm, greater than 200 nm, greater than 250 nm, greater than 300 nm, greater than 350 nm, greater than 400 nm, greater than 450 nm, greater than 500 nm, greater than 550 nm, greater than 600 nm, greater than 650 nm, greater than 700 nm, greater than 750 nm, greater than 800 nm, greater than 850 nm, greater than 900 nm, greater than 950 nm or greater than 1000 nm.
- the polynucleotides can be delivered using smaller LNPs.
- Such particles can comprise a diameter from below 0.1 pm up to 100 nm such as, but not limited to, less than 0.1 pm, less than 1 .0 pm, less than 5pm, less than 10 pm, less than 15 urn, less than 20 urn, less than 25 urn, less than 30 urn, less than 35 urn, less than 40 urn, less than 50 urn, less than 55 urn, less than 60 urn, less than 65 urn, less than 70 urn, less than 75 urn, less than 80 urn, less than 85 urn, less than 90 urn, less than 95 urn, less than 100 urn, less than 125 urn, less than 150 urn, less than 175 urn, less than 200 urn, less than 225 urn, less than 250 urn, less than 275 urn, less than 300 urn, less than 325
- the nanoparticles and microparticles described herein can be geometrically engineered to modulate macrophage and/or the immune response.
- the geometrically engineered particles can have varied shapes, sizes and/or surface charges to incorporate the polynucleotides described herein for targeted delivery such as, but not limited to, pulmonary delivery (see, e.g., Inti. Pub. No. WO20130821 1 1 , herein incorporated by reference in its entirety).
- Other physical features the geometrically engineering particles can include, but are not limited to, fenestrations, angled arms, asymmetry and surface roughness, charge that can alter the interactions with cells and tissues.
- the nanoparticles described herein are stealth nanoparticles or targetspecific stealth nanoparticles such as, but not limited to, those described in U.S. Pub. No.
- the stealth or target-specific stealth nanoparticles can comprise a polymeric matrix, which can comprise two or more polymers such as, but not limited to, polyethylenes, polycarbonates, polyanhydrides, polyhydroxyacids, polypropylfumerates, polycaprolactones, polyamides, polyacetals, polyethers, polyesters, poly(orthoesters), polycyanoacrylates, polyvinyl alcohols, polyurethanes, polyphosphazenes, polyacrylates, polymethacrylates, polycyanoacrylates, polyureas, polystyrenes, polyamines, polyesters, polyanhydrides, polyethers, polyurethanes, polymethacrylates, polyacrylates, polycyanoacrylates, or combinations thereof.
- polymers such as, but not limited to, polyethylenes, polycarbonates, polyanhydrides, polyhydroxyacids, polypropylfumerates, polycaprolactones, polyamides, polyacetals, polyethers, polyester
- the polynucleotides described herein may encode a therapeutic polypeptide, such as a polypeptide that, when provided to a subject (e.g., a mammalian subject, such as a human), exerts a beneficial effect, such as the alleviation of one or more symptoms of a disease, diminishment of extent of a disease, stabilized (i.e. , not worsening) state of a disease, delay or slowing of progression of a disease, or amelioration or palliation of a state of a disease.
- a subject e.g., a mammalian subject, such as a human
- a beneficial effect such as the alleviation of one or more symptoms of a disease, diminishment of extent of a disease, stabilized (i.e. , not worsening) state of a disease, delay or slowing of progression of a disease, or amelioration or palliation of a state of a disease.
- the disease may be one that is associated with a defici
- the polypeptide encoded by the open reading frame is a secreted protein, (e.g., a cytokine, a growth factor, an enzyme, an immunomodulator, an antibody or antigen-binding fragment thereof, or a cell-penetrating peptide), an extracellular membrane-bound protein, an intracellular membrane-bound protein, a cytoplasmic protein, a cytoskeletal protein, or a nuclear protein.
- a secreted protein e.g., a cytokine, a growth factor, an enzyme, an immunomodulator, an antibody or antigen-binding fragment thereof, or a cell-penetrating peptide
- an extracellular membrane-bound protein e.g., an extracellular membrane-bound protein, an intracellular membrane-bound protein, a cytoplasmic protein, a cytoskeletal protein, or a nuclear protein.
- the polypeptide is a protein of the human proteome.
- the polypeptide may have the amino acid sequence of any one of SEQ ID NOs: 769 to 1392 of PCT/US2013/030062; SEQ ID NOs: 884 to 1611 of PCT/US2013/030068; SEQ ID NOs: 1827 to 3497 of PCT/US2013/030064; SEQ ID NOs: 3858 to 7559 of PCT/US2013/030067; SEQ ID NOs: 4672 to 9187 of PCT/US2013/030066; SEQ ID NOs: 4704 to 9203 of PCT/US2013/030070; SEQ ID NOs: 8144 to 16131 of PCT/US2013/030059; SEQ ID NOs: 8922 to 17687 of PCT/US2013/030060; and SEQ ID NOs: 35608 to 45601 of PCT/US2013/030061 , the disclosures of each of such applications are incorporated herein by reference
- the polypeptide has an amino acid sequence that is at least 70% identical to the amino acid sequence of any one of SEQ ID NOs: 769 to 1392 of PCT/US2013/030062; SEQ ID NOs: 884 to 1611 of PCT/US2013/030068; SEQ ID NOs: 1827 to 3497 of PCT/US2013/030064; SEQ ID NOs: 3858 to 7559 of PCT/US2013/030067; SEQ ID NOs: 4672 to 9187 of PCT/US2013/030066; SEQ ID NOs: 4704 to 9203 of PCT/US2013/030070; SEQ ID NOs: 8144 to 16131 of PCT/US2013/030059; SEQ ID NOs: 8922 to 17687 of PCT/US2013/030060; and SEQ ID NOs: 35608 to 45601 of PCT/US2013/030061.
- the polypeptide has an amino acid sequence that is at least 75% identical to the amino acid sequence of any one of SEQ ID NOs: 769 to 1392 of PCT/US2013/030062; SEQ ID NOs: 884 to 1611 of PCT/US2013/030068; SEQ ID NOs: 1827 to 3497 of PCT/US2013/030064; SEQ ID NOs: 3858 to 7559 of PCT/US2013/030067; SEQ ID NOs: 4672 to 9187 of PCT/US2013/030066; SEQ ID NOs: 4704 to 9203 of PCT/US2013/030070; SEQ ID NOs: 8144 to 16131 of PCT/US2013/030059; SEQ ID NOs: 8922 to 17687 of PCT/US2013/030060; and SEQ ID NOs: 35608 to 45601 of PCT/US2013/030061 .
- the polypeptide has an amino acid sequence that is at least 80% identical to the amino acid sequence of any one of SEQ ID NOs: 769 to 1392 of PCT/US2013/030062; SEQ ID NOs: 884 to 161 1 of PCT/US2013/030068; SEQ ID NOs: 1827 to 3497 of PCT/US2013/030064; SEQ ID NOs: 3858 to 7559 of PCT/US2013/030067; SEQ ID NOs: 4672 to 9187 of PCT/US2013/030066; SEQ ID NOs: 4704 to 9203 of PCT/US2013/030070; SEQ ID NOs: 8144 to 16131 of PCT/US2013/030059; SEQ ID NOs: 8922 to 17687 of PCT/US2013/030060; and SEQ ID NOs: 35608 to 45601 of PCT/US2013/030061 .
- the polypeptide has an amino acid sequence that is at least 85% identical to the amino acid sequence of any one of SEQ ID NOs: 769 to 1392 of PCT/US2013/030062; SEQ ID NOs: 884 to 161 1 of PCT/US2013/030068; SEQ ID NOs: 1827 to 3497 of PCT/US2013/030064; SEQ ID NOs: 3858 to 7559 of PCT/US2013/030067; SEQ ID NOs: 4672 to 9187 of PCT/US2013/030066; SEQ ID NOs: 4704 to 9203 of PCT/US2013/030070; SEQ ID NOs: 8144 to 16131 of PCT/US2013/030059; SEQ ID NOs: 8922 to 17687 of PCT/US2013/030060; and SEQ ID NOs: 35608 to 45601 of PCT/US2013/030061 .
- the polypeptide has an amino acid sequence that is at least 90% identical to the amino acid sequence of any one of SEQ ID NOs: 769 to 1392 of PCT/US2013/030062; SEQ ID NOs: 884 to 161 1 of PCT/US2013/030068; SEQ ID NOs: 1827 to 3497 of PCT/US2013/030064; SEQ ID NOs: 3858 to 7559 of PCT/US2013/030067; SEQ ID NOs: 4672 to 9187 of PCT/US2013/030066; SEQ ID NOs: 4704 to 9203 of PCT/US2013/030070; SEQ ID NOs: 8144 to 16131 of PCT/US2013/030059; SEQ ID NOs: 8922 to 17687 of PCT/US2013/030060; and SEQ ID NOs: 35608 to 45601 of PCT/US2013/030061 .
- the polypeptide has an amino acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the amino acid sequence of any one of SEQ ID NOs: 769 to 1392 of PCT/US2013/030062; SEQ ID NOs: 884 to 161 1 of PCT/US2013/030068; SEQ ID NOs: 1827 to 3497 of PCT/US2013/030064; SEQ ID NOs: 3858 to 7559 of PCT/US2013/030067; SEQ ID NOs: 4672 to 9187 of PCT/US2013/030066; SEQ ID NOs: 4704 to 9203 of PCT/US2013/030070; SEQ ID NOs: 8144 to 16131 of PCT/US2013/030059; SEQ ID NOs: 8922 to 17687 of PCT/US2013/030060; and SEQ ID NOs: 35608 to 45601 of PCT/US2013/
- the polypeptide has an amino acid sequence that is at least 96% identical (e.g., 96%, 97%, 98%, 99%, or 100% identical) to the amino acid sequence of any one of SEQ ID NOs: 769 to 1392 of PCT/US2013/030062; SEQ ID NOs: 884 to 161 1 of PCT/US2013/030068; SEQ ID NOs: 1827 to 3497 of PCT/US2013/030064; SEQ ID NOs: 3858 to 7559 of PCT/US2013/030067; SEQ ID NOs: 4672 to 9187 of PCT/US2013/030066; SEQ ID NOs: 4704 to 9203 of PCT/US2013/030070; SEQ ID NOs: 8144 to 16131 of PCT/US2013/030059; SEQ ID NOs: 8922 to 17687 of PCT/US2013/030060; and SEQ ID NOs: 35608 to 45601 of PCT/US2013/030061
- the polypeptide has an amino acid sequence that is at least 97% identical (e.g., 97%, 98%, 99%, or 100% identical) to the amino acid sequence of any one of SEQ ID NOs: 769 to 1392 of PCT/US2013/030062; SEQ ID NOs: 884 to 161 1 of PCT/US2013/030068; SEQ ID NOs: 1827 to 3497 of PCT/US2013/030064; SEQ ID NOs: 3858 to 7559 of PCT/US2013/030067; SEQ ID NOs: 4672 to 9187 of PCT/US2013/030066; SEQ ID NOs: 4704 to 9203 of PCT/US2013/030070; SEQ ID NOs: 8144 to 16131 of PCT/US2013/030059; SEQ ID NOs: 8922 to 17687 of PCT/US2013/030060; and SEQ ID NOs: 35608 to 45601 of PCT/US2013/030061 .
- the polypeptide has an amino acid sequence that is at least 98% identical (e.g., 98%, 99%, or 100% identical) to the amino acid sequence of any one of SEQ ID NOs: 769 to 1392 of PCT/US2013/030062; SEQ ID NOs: 884 to 1611 of PCT/US2013/030068; SEQ ID NOs: 1827 to 3497 of PCT/US2013/030064; SEQ ID NOs: 3858 to 7559 of PCT/US2013/030067; SEQ ID NOs: 4672 to 9187 of PCT/US2013/030066; SEQ ID NOs: 4704 to 9203 of PCT/US2013/030070; SEQ ID NOs: 8144 to 16131 of PCT/US2013/030059; SEQ ID NOs: 8922 to 17687 of PCT/US2013/030060; and SEQ ID NOs: 35608 to 45601 of PCT/US2013/030061 .
- the polypeptide has an amino acid sequence that is at least 99% identical (e.g., 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100% identical) to the amino acid sequence of any one of SEQ ID NOs: 769 to 1392 of PCT/US2013/030062; SEQ ID NOs: 884 to 1611 of PCT/US2013/030068; SEQ ID NOs: 1827 to 3497 of PCT/US2013/030064; SEQ ID NOs: 3858 to 7559 of PCT/US2013/030067; SEQ ID NOs: 4672 to 9187 of PCT/US2013/030066; SEQ ID NOs: 4704 to 9203 of PCT/US2013/030070; SEQ ID NOs: 8144 to 16131 of PCT/US2013/030059; SEQ ID NOs: 8922 to 17687 of PCT/US2013/0300
- the polynucleotides e.g., a RNA, e.g., an mRNA
- One such feature that aids in protein trafficking is the signal sequence, or targeting sequence.
- the peptides encoded by these signal sequences are known by a variety of names, including targeting peptides, transit peptides, and signal peptides.
- the polynucleotide (e.g., a RNA, e.g., an mRNA) comprises a nucleotide sequence (e.g., an ORF) that encodes a signal peptide operably linked to a nucleotide sequence that encodes a polypeptide of interest.
- a nucleotide sequence e.g., an ORF
- the "signal sequence” or “signal peptide” is a polynucleotide or polypeptide, respectively, which is from about 30-210, e.g., about 45-80 or 15-60 nucleotides (e.g., about 20, 30, 40, 50, 60, or 70 amino acids) in length that, optionally, is incorporated at the 5' (or N-terminus) of the coding region or the polypeptide, respectively. Addition of these sequences results in trafficking the encoded polypeptide to a desired site, such as the endoplasmic reticulum or the mitochondria through one or more targeting pathways. Some signal peptides are cleaved from the protein, for example by a signal peptidase after the proteins are transported to the desired site.
- a polynucleotide (e.g., a RNA, e.g., an mRNA) of the present disclosure is sequence optimized.
- the polynucleotide (e.g., a RNA, e.g., an mRNA) of the present disclosure comprises a nucleotide sequence (e.g., an ORF) encoding a therapeutic polypeptide (e.g., a therapeutic polypeptide described above), optionally, a nucleotide sequence (e.g, an ORF) encoding another polypeptide of interest, a 5'-UTR, a 3'-UTR, the 5' UTR or 3' UTR optionally comprising at least one microRNA binding site, optionally a nucleotide sequence encoding a linker, a polyA tail, or any combination thereof), in which the ORF(s) are sequence optimized.
- a sequence-optimized nucleotide sequence e.g., a codon-optimized RNA sequence encoding a therapeutic polypeptide, is a sequence comprising at least one synonymous nucleobase substitution with respect to a reference sequence (e.g., a wild type nucleotide sequence encoding the therapeutic polypeptide of interest).
- a sequence-optimized nucleotide sequence can be partially or completely different in sequence from the reference sequence.
- a reference sequence encoding polyserine uniformly encoded by UCU codons can be sequence-optimized by having 100% of its nucleobases substituted (for each codon, U in position 1 replaced by A, C in position 2 replaced by G, and U in position 3 replaced by C) to yield a sequence encoding polyserine which would be uniformly encoded by AGO codons.
- the percentage of sequence identity obtained from a global pairwise alignment between the reference polyserine nucleic acid sequence and the sequence-optimized polyserine nucleic acid sequence would be 0%.
- the protein products from both sequences would be 100% identical.
- sequence optimization also sometimes referred to codon optimization
- results can include, e.g., matching codon frequencies in certain tissue targets and/or host organisms to ensure proper folding; biasing G/C content to increase mRNA stability or reduce secondary structures; minimizing tandem repeat codons or base runs that can impair gene construction or expression; customizing transcriptional and translational control regions; inserting or removing protein trafficking sequences; removing/adding post translation modification sites in an encoded protein (e.g., glycosylation sites); adding, removing or shuffling protein domains; inserting or deleting restriction sites; modifying ribosome binding sites and mRNA degradation sites; adjusting translational rates to allow the various domains of the protein to fold properly; and/or reducing or eliminating problem secondary structures within the polynucleotide.
- Sequence optimization tools, algorithms and services are known in the art, non-limiting examples include services from GeneArt (Life Technologies), DNA2.0 (
- a polynucleotide e.g., a RNA, e.g., an mRNA
- a sequence-optimized nucleotide sequence e.g., an ORF
- the therapeutic polypeptide, functional fragment, or a variant thereof encoded by the sequence-optimized nucleotide sequence has improved properties (e.g., compared to a therapeutic polypeptide, functional fragment, or a variant thereof encoded by a reference nucleotide sequence that is not sequence optimized), e.g., improved properties related to expression efficacy after administration in vivo.
- Such properties include, but are not limited to, improving nucleic acid stability (e.g., mRNA stability), increasing translation efficacy in the target tissue, reducing the number of truncated proteins expressed, improving the folding or prevent misfolding of the expressed proteins, reducing toxicity of the expressed products, reducing cell death caused by the expressed products, increasing and/or decreasing protein aggregation.
- nucleic acid stability e.g., mRNA stability
- increasing translation efficacy in the target tissue reducing the number of truncated proteins expressed, improving the folding or prevent misfolding of the expressed proteins, reducing toxicity of the expressed products, reducing cell death caused by the expressed products, increasing and/or decreasing protein aggregation.
- sequence-optimized nucleotide sequence (e.g., an ORF) is codon optimized for expression in human subjects, having structural and/or chemical features that avoid one or more of the problems in the art, for example, features which are useful for optimizing formulation and delivery of nucleic acid-based therapeutics while retaining structural and functional integrity; overcoming a threshold of expression; improving expression rates; half-life and/or protein concentrations; optimizing protein localization; and avoiding deleterious bio-responses such as the immune response and/or degradation pathways.
- an ORF codon optimized for expression in human subjects, having structural and/or chemical features that avoid one or more of the problems in the art, for example, features which are useful for optimizing formulation and delivery of nucleic acid-based therapeutics while retaining structural and functional integrity; overcoming a threshold of expression; improving expression rates; half-life and/or protein concentrations; optimizing protein localization; and avoiding deleterious bio-responses such as the immune response and/or degradation pathways.
- the polynucleotides of the present disclosure comprise a nucleotide sequence (e.g., a nucleotide sequence (e.g., an ORF) encoding a therapeutic polypeptide, a nucleotide sequence (e.g., an ORF) encoding another polypeptide of interest, a 5'-UTR, a 3'-UTR, a microRNA binding site, a nucleic acid sequence encoding a linker, or any combination thereof) that is sequence- optimized according to a method comprising:
- sequence-optimized nucleotide sequence e.g., an ORF encoding a therapeutic polypeptide
- the sequence optimization method is multiparametric and comprises one, two, three, four, or more methods disclosed herein and/or other optimization methods known in the art.
- regions of the polynucleotide can be encoded by or within regions of the polynucleotide and such regions can be upstream (5') to, downstream (3') to, or within the region that encodes the therapeutic polypeptide. These regions can be incorporated into the polynucleotide before and/or after sequence-optimization of the protein encoding region or open reading frame (ORF). Examples of such features include, but are not limited to, untranslated regions (UTRs), microRNA sequences, Kozak sequences, oligo(dT) sequences, poly-A tail, and detectable tags and can include multiple cloning sites that can have Xbal recognition.
- UTRs untranslated regions
- microRNA sequences microRNA sequences
- Kozak sequences oligo(dT) sequences
- poly-A tail poly-A tail
- detectable tags can include multiple cloning sites that can have Xbal recognition.
- the polynucleotide of the present disclosure comprises a 5' UTR, a 3' UTR and/or a microRNA binding site. In some embodiments, the polynucleotide comprises two or more 5' UTRs and/or 3' UTRs, which can be the same or different sequences. In some embodiments, the polynucleotide comprises two or more microRNA binding sites, which can be the same or different sequences. Any portion of the 5' UTR, 3' UTR, and/or microRNA binding site, including none, can be sequence-optimized and can independently contain one or more different structural or chemical modifications, before and/or after sequence optimization.
- the polynucleotide is reconstituted and transformed into a vector such as, but not limited to, plasmids, viruses, cosmids, and artificial chromosomes.
- a vector such as, but not limited to, plasmids, viruses, cosmids, and artificial chromosomes.
- the optimized polynucleotide can be reconstituted and transformed into chemically competent E. coli, yeast, neurospora, maize, drosophila, etc. where high copy plasmid-like or chromosome structures occur by methods described herein.
- the polynucleotide of the present disclosure comprises a sequence- optimized nucleotide sequence encoding a therapeutic polypeptide disclosed herein.
- the polynucleotide of the present disclosure comprises an open reading frame (ORF) encoding a therapeutic polypeptide, wherein the ORF has been sequence optimized.
- ORF open reading frame
- the sequence-optimized nucleotide sequences disclosed herein may be distinct from the corresponding wild type nucleotide acid sequences and from other known sequence-optimized nucleotide sequences, e.g., these sequence-optimized nucleic acids have unique compositional characteristics.
- the percentage of uracil or thymine nucleobases in a sequence-optimized nucleotide sequence is modified (e.g., reduced) with respect to the percentage of uracil or thymine nucleobases in the reference wild-type nucleotide sequence.
- a sequence-optimized nucleotide sequence e.g., encoding a therapeutic polypeptide, a functional fragment, or a variant thereof
- Such a sequence is referred to as a uracil-modified or thymine- modified sequence.
- the percentage of uracil or thymine content in a nucleotide sequence can be determined by dividing the number of uracils or thymines in a sequence by the total number of nucleotides and multiplying by 100.
- the sequence-optimized nucleotide sequence has a lower uracil or thymine content than the uracil or thymine content in the reference wild-type sequence.
- the uracil or thymine content in a sequence-optimized nucleotide sequence of the present disclosure is greater than the uracil or thymine content in the reference wild-type sequence and still maintain beneficial effects, e.g., increased expression and/or reduced Toll-Like Receptor (TLR) response when compared to the reference wild-type sequence.
- beneficial effects e.g., increased expression and/or reduced Toll-Like Receptor (TLR) response when compared to the reference wild-type sequence.
- an ORF of any one or more of the sequences provided herein may be codon optimized.
- Codon optimization in some embodiments, may be used to match codon frequencies in target and host organisms to ensure proper folding; bias GC content to increase mRNA stability or reduce secondary structures; minimize tandem repeat codons or base runs that may impair gene construction or expression; customize transcriptional and translational control regions; insert or remove protein trafficking sequences; remove/add post translation modification sites in encoded protein (e.g., glycosylation sites); add, remove or shuffle protein domains; insert or delete restriction sites; modify ribosome binding sites and mRNA degradation sites; adjust translational rates to allow the various domains of the protein to fold properly; or reduce or eliminate problem secondary structures within the polynucleotide.
- Codon optimization tools, algorithms and services are known in the art - non-limiting examples include services from GeneArt (Life Technologies), DNA2.0 (Menlo Park CA) and/or proprietary methods.
- the open reading frame (ORF) sequence is optimized using optimization algorithms.
- the polynucleotide e.g., a RNA, e.g., an mRNA
- a sequence optimized nucleic acid disclosed herein encoding a therapeutic polypeptide can be tested to determine whether at least one nucleic acid sequence property (e.g., stability when exposed to nucleases) or expression property has been improved with respect to the non-sequence optimized nucleic acid.
- expression property refers to a property of a nucleic acid sequence either in vivo (e.g., translation efficacy of a synthetic mRNA after administration to a subject in need thereof) or in vitro (e.g., translation efficacy of a synthetic mRNA tested in an in vitro model system).
- Expression properties include but are not limited to the amount of protein produced by an mRNA encoding a therapeutic polypeptide after administration, and the amount of soluble or otherwise functional protein produced.
- sequence optimized nucleic acids disclosed herein can be evaluated according to the viability of the cells expressing a protein encoded by a sequence optimized nucleic acid sequence (e.g., a RNA, e.g., an mRNA) encoding a therapeutic polypeptide disclosed herein.
- a sequence optimized nucleic acid sequence e.g., a RNA, e.g., an mRNA
- a plurality of sequence optimized nucleic acids disclosed herein e.g., a RNA, e.g., an mRNA
- a property of interest for example an expression property in an in vitro model system, or in vivo in a target tissue or cell.
- the desired property of the polynucleotide is an intrinsic property of the nucleic acid sequence.
- the nucleotide sequence e.g., a RNA, e.g., an mRNA
- the nucleotide sequence can be sequence optimized for in vivo or in vitro stability.
- the nucleotide sequence can be sequence optimized for expression in a given target tissue or cell.
- the nucleic acid sequence is sequence optimized to increase its plasma half-life by preventing its degradation by endo and exonucleases.
- the nucleic acid sequence is sequence optimized to increase its resistance to hydrolysis in solution, for example, to lengthen the time that the sequence optimized nucleic acid or a pharmaceutical composition comprising the sequence optimized nucleic acid can be stored under aqueous conditions with minimal degradation.
- sequence optimized nucleic acid can be optimized to increase its resistance to hydrolysis in dry storage conditions, for example, to lengthen the time that the sequence optimized nucleic acid can be stored after lyophilization with minimal degradation.
- the desired property of the polynucleotide is the level of expression of a therapeutic polypeptide encoded by a sequence optimized sequence disclosed herein.
- Protein expression levels can be measured using one or more expression systems.
- expression can be measured in cell culture systems, e.g., CHO cells or HEK293 cells.
- expression can be measured using in vitro expression systems prepared from extracts of living cells, e.g., rabbit reticulocyte lysates, or in vitro expression systems prepared by assembly of purified individual components.
- the protein expression is measured in an in vivo system, e.g., mouse, rabbit, monkey, etc.
- protein expression in solution form can be desirable.
- a reference sequence can be sequence optimized to yield a sequence optimized nucleic acid sequence having optimized levels of expressed proteins in soluble form.
- Levels of protein expression and other properties such as solubility, levels of aggregation, and the presence of truncation products (i.e., fragments due to proteolysis, hydrolysis, or defective translation) can be measured according to methods known in the art, for example, using electrophoresis (e.g., native or SDS-PAGE) or chromatographic methods (e.g., HPLC, size exclusion chromatography, etc.).
- heterologous therapeutic proteins encoded by a nucleic acid sequence can have deleterious effects in the target tissue or cell, reducing protein yield, or reducing the quality of the expressed product (e.g., due to the presence of protein fragments or precipitation of the expressed protein in inclusion bodies), or causing toxicity.
- sequence optimization of a nucleic acid sequence disclosed herein can be used to increase the viability of target cells expressing the protein encoded by the sequence optimized nucleic acid.
- Heterologous protein expression can also be deleterious to cells transfected with a nucleic acid sequence for autologous or heterologous transplantation. Accordingly, in some embodiments of the present disclosure the sequence optimization of a nucleic acid sequence disclosed herein can be used to increase the viability of target cells expressing the protein encoded by the sequence optimized nucleic acid sequence. Changes in cell or tissue viability, toxicity, and other physiological reactions can be measured according to methods known in the art. d. Reduction of Immune and/or Inflammatory Response
- the administration of a sequence optimized nucleic acid encoding a therapeutic polypeptide or a functional fragment thereof can trigger an immune response, which could be caused by (i) the therapeutic agent (e.g., an mRNA encoding a therapeutic polypeptide), or (ii) the expression product of such therapeutic agent (e.g., the therapeutic polypeptide encoded by the mRNA), or (iv) a combination thereof.
- the therapeutic agent e.g., an mRNA encoding a therapeutic polypeptide
- the expression product of such therapeutic agent e.g., the therapeutic polypeptide encoded by the mRNA
- nucleic acid sequence e.g., an mRNA
- sequence optimization of nucleic acid sequence can be used to decrease an immune or inflammatory response triggered by the administration of a nucleic acid encoding a therapeutic polypeptide or by the expression product of a therapeutic polypeptide encoded by such nucleic acid.
- an inflammatory response can be measured by detecting increased levels of one or more inflammatory cytokines using methods known in the art, e.g., ELISA.
- inflammatory cytokine refers to cytokines that are elevated in an inflammatory response.
- inflammatory cytokines include interleukin-6 (IL-6), CXCL1 (chemokine (C-X-C motif) ligand 1 ; interferon-y (IFNy), tumor necrosis factor a (TNFa), interferon y-induced protein 10 (IP-10), or granulocyte-colony stimulating factor (G-CSF).
- inflammatory cytokines includes also other cytokines associated with inflammatory responses known in the art, e.g., interleukin-1 (IL-1 ), interleukin-8 (IL-8), interleukin-12 (IL- 12), interleukin-13 (11-13), interferon a (IFN-a), etc.
- IL-1 interleukin-1
- IL-8 interleukin-8
- IL-12 interleukin-12
- IFN-a interferon a
- the polynucleotide (e.g., a RNA, e.g., an mRNA) of the present disclosure comprises a chemically modified nucleobase, for example, a chemically modified uracil, e.g., pseudouracil, N1 -methylpseudouracil, 5-methoxyuracil, or the like.
- a chemically modified uracil e.g., pseudouracil, N1 -methylpseudouracil, 5-methoxyuracil, or the like.
- the mRNA is a uracil-modified sequence comprising an ORF encoding a therapeutic polypeptide, wherein the mRNA comprises a chemically modified nucleobase, for example, a chemically modified uracil, e.g., pseudouracil, N1 -methylpseudouracil, or 5-methoxyuracil.
- a chemically modified uracil e.g., pseudouracil, N1 -methylpseudouracil, or 5-methoxyuracil.
- the modified uracil base is connected to a ribose sugar, as it is in polynucleotides, the resulting modified nucleoside or nucleotide is referred to as modified uridine.
- uracil in the polynucleotide is at least about 25%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least 90%, at least 95%, at least 99%, or about 100% modified uracil. In some embodiments, uracil in the polynucleotide is at least 95% modified uracil. In some embodiments, uracil in the polynucleotide is 100% modified uracil.
- modified uracil content of the ORF is between about 100% and about 150%, between about 100% and about 110%, between about 105% and about 115%, between about 110% and about 120%, between about 115% and about 125%, between about 120% and about 130%, between about 125% and about 135%, between about 130% and about 140%, between about 135% and about 145%, between about 140% and about 150% of the theoretical minimum uracil content in the corresponding wild-type ORF (%UTM).
- the uracil content of the ORF is between about 121% and about 136% or between 123% and 134% of the %UTM. In some embodiments, the uracil content of the ORF encoding a therapeutic polypeptide is about 115%, about 120%, about 125%, about 130%, about 135%, about 140%, about 145%, or about 150% of the %UTM.
- uracil can refer to modified uracil and/or naturally occurring uracil.
- the uracil content in the ORF of the mRNA encoding a therapeutic polypeptide of the present disclosure is less than about 30%, about 25%, about 20%, about 15%, or about 10% of the total nucleobase content in the ORF. In some embodiments, the uracil content in the ORF is between about 10% and about 20% of the total nucleobase content in the ORF. In other embodiments, the uracil content in the ORF is between about 10% and about 25% of the total nucleobase content in the ORF. In some embodiments, the uracil content in the ORF of the mRNA encoding a therapeutic polypeptide is less than about 20% of the total nucleobase content in the open reading frame. In this context, the term "uracil" can refer to modified uracil and/or naturally occurring uracil.
- the ORF of the mRNA encoding a therapeutic polypeptide having modified uracil and adjusted uracil content has increased Cytosine (C), Guanine (G), or Guanine/Cytosine (G/C) content (absolute or relative).
- the overall increase in C, G, or G/C content (absolute or relative) of the ORF is at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 6%, at least about 7%, at least about 10%, at least about 15%, at least about 20%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, or at least about 100% relative to the G/C content (absolute or relative) of the wild-type ORF.
- the G, the C, or the G/C content in the ORF is less than about 100%, less than about 90%, less than about 85%, or less than about 80% of the theoretical maximum G, C, or G/C content of the corresponding wild type nucleotide sequence encoding the therapeutic polypeptide (%GTMX; %CTMX, or %G/CTMX).
- the increases in G and/or C content (absolute or relative) described herein can be conducted by replacing synonymous codons with low G, C, or G/C content with synonymous codons having higher G, C, or G/C content.
- the increase in G and/or C content (absolute or relative) is conducted by replacing a codon ending with U with a synonymous codon ending with G or C.
- the ORF of the mRNA encoding a therapeutic polypeptide of the present disclosure comprises modified uracil and has an adjusted uracil content containing less uracil pairs (UU) and/or uracil triplets (UUU) and/or uracil quadruplets (UUUU) than the corresponding wild-type nucleotide sequence encoding the therapeutic polypeptide.
- the ORF of the mRNA encoding a therapeutic polypeptide of the present disclosure contains no uracil pairs and/or uracil triplets and/or uracil quadruplets.
- uracil pairs and/or uracil triplets and/or uracil quadruplets are reduced below a certain threshold, e.g., no more than 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 occurrences in the ORF of the mRNA encoding the therapeutic polypeptide.
- the ORF of the mRNA encoding the therapeutic polypeptide of the present disclosure contains less than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11 , 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nonphenylalanine uracil pairs and/or triplets.
- the ORF of the mRNA encoding the therapeutic polypeptide contains no non-phenylalanine uracil pairs and/or triplets.
- the ORF of the mRNA encoding a therapeutic polypeptide of the present disclosure comprises modified uracil and has an adjusted uracil content containing less uracil-rich clusters than the corresponding wild-type nucleotide sequence encoding the therapeutic polypeptide.
- the ORF of the mRNA encoding the therapeutic polypeptide of the present disclosure contains uracil-rich clusters that are shorter in length than corresponding uracil-rich clusters in the corresponding wild-type nucleotide sequence encoding the therapeutic polypeptide.
- alternative lower frequency codons are employed. At least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 99%, or 100% of the codons in the therapeutic polypeptide-encoding ORF of the modified uracil-comprising mRNA are substituted with alternative codons, each alternative codon having a codon frequency lower than the codon frequency of the substituted codon in the synonymous codon set.
- the ORF also has adjusted uracil content, as described above.
- at least one codon in the ORF of the mRNA encoding the therapeutic polypeptide is substituted with an alternative codon having a codon frequency lower than the codon frequency of the substituted codon in the synonymous codon set.
- the adjusted uracil content, therapeutic polypeptide-encoding ORF of the modified uracil-comprising mRNA exhibits expression levels of therapeutic polypeptide when administered to a mammalian cell that are higher than expression levels of therapeutic polypeptide from the corresponding wild-type mRNA.
- the mammalian cell is a mouse cell, a rat cell, or a rabbit cell.
- the mammalian cell is a monkey cell or a human cell.
- the human cell is a HeLa cell, a BJ fibroblast cell, or a peripheral blood mononuclear cell (PBMC).
- PBMC peripheral blood mononuclear cell
- a therapeutic polypeptide of the disclosure is expressed at a level higher than expression levels of the same polypeptide from the corresponding wild-type mRNA when the mRNA is administered to a mammalian cell in vivo.
- the mRNA is administered to mice, rabbits, rats, monkeys, or humans.
- mice are null mice.
- the mRNA is administered to mice in an amount of about 0.01 mg/kg, about 0.05 mg/kg, about 0.1 mg/kg, or 0.2 mg/kg or about 0.5 mg/kg.
- the mRNA is administered intravenously or intramuscularly.
- the therapeutic polypeptide is expressed when the mRNA is administered to a mammalian cell in vitro.
- the expression is increased by at least about 2-fold, at least about 5-fold, at least about 10-fold, at least about 50-fold, at least about 500-fold, at least about 1500-fold, or at least about 3000-fold.
- the expression is increased by at least about 10%, about 20%, about 30%, about 40%, about 50%, 60%, about 70%, about 80%, about 90%, or about 100%.
- adjusted uracil content, therapeutic polypeptide-encoding ORF of the modified uracil-comprising mRNA exhibits increased stability.
- the mRNA exhibits increased stability in a cell relative to the stability of a corresponding wild-type mRNA under the same conditions.
- the mRNA exhibits increased stability including resistance to nucleases, thermal stability, and/or increased stabilization of secondary structure.
- increased stability exhibited by the mRNA is measured by determining the half-life of the mRNA (e.g., in a plasma, serum, cell, or tissue sample) and/or determining the area under the curve (AUC) of the protein expression by the mRNA over time (e.g., in vitro or in vivo).
- An mRNA is identified as having increased stability if the half-life and/or the AUC is greater than the half-life and/or the AUC of a corresponding wildtype mRNA under the same conditions.
- the mRNA of the present disclosure induces a detectably lower immune response (e.g., innate or acquired) relative to the immune response induced by a corresponding wild-type mRNA under the same conditions.
- the mRNA of the present disclosure induces a detectably lower immune response (e.g., innate or acquired) relative to the immune response induced by an mRNA that encodes for a therapeutic polypeptide but does not comprise modified uracil under the same conditions, or relative to the immune response induced by an mRNA that encodes for a therapeutic polypeptide and that comprises modified uracil but that does not have adjusted uracil content under the same conditions.
- the innate immune response can be manifested by increased expression of pro- inflammatory cytokines, activation of intracellular PRRs (RIG-I, MDA5, etc.), cell death, and/or termination or reduction in protein translation.
- a reduction in the innate immune response can be measured by expression or activity level of Type 1 interferons (e.g., IFN-a, IFN-p, IFN-K, IFN-b, IFN-E, IFN-T, IFN-W, and IFN- ⁇ ) or the expression of interferon-regulated genes such as the toll-like receptors (e.g., TLR7 and TLR8), and/or by decreased cell death following one or more administrations of the mRNA of the present disclosure into a cell.
- Type 1 interferons e.g., IFN-a, IFN-p, IFN-K, IFN-b, IFN-E, IFN-T, IFN-W, and IFN- ⁇
- interferon-regulated genes such as the
- the expression of Type-1 interferons by a mammalian cell in response to the mRNA of the present disclosure is reduced by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 99.9%, or greater than 99.9% relative to a corresponding wild-type mRNA, to an mRNA that encodes a therapeutic polypeptide but does not comprise modified uracil, or to an mRNA that encodes a therapeutic polypeptide and that comprises modified uracil but that does not have adjusted uracil content.
- the interferon is IFN-p.
- cell death frequency caused by administration of mRNA of the present disclosure to a mammalian cell is 10%, 25%, 50%, 75%, 85%, 90%, 95%, or over 95% less than the cell death frequency observed with a corresponding wild-type mRNA, an mRNA that encodes for a therapeutic polypeptide but does not comprise modified uracil, or an mRNA that encodes for a therapeutic polypeptide and that comprises modified uracil but that does not have adjusted uracil content.
- the mammalian cell is a BJ fibroblast cell.
- the mammalian cell is a splenocyte.
- the mammalian cell is that of a mouse or a rat.
- the mammalian cell is that of a human.
- the mRNA of the present disclosure does not substantially induce an innate immune response of a mammalian cell into which the mRNA is introduced.
- the disclosure includes modified polynucleotides comprising a polynucleotide described herein (e.g., a polynucleotide, e.g. mRNA, comprising a nucleotide sequence encoding a therapeutic polypeptide).
- the modified polynucleotides can be chemically modified and/or structurally modified.
- the polynucleotides of the present disclosure are chemically and/or structurally modified the polynucleotides can be referred to as "modified polynucleotides.”
- nucleosides and nucleotides of a polynucleotide e.g., RNA polynucleotides, such as mRNA polynucleotides
- a “nucleoside” refers to a compound containing a sugar molecule (e.g., a pentose or ribose) or a derivative thereof in combination with an organic base (e.g., a purine or pyrimidine) or a derivative thereof (also referred to herein as "nucleobase”).
- a “nucleotide” refers to a nucleoside including a phosphate group.
- Modified nucleotides can be synthesized by any useful method, such as, for example, chemically, enzymatically, or recombinantly, to include one or more modified or non-natural nucleosides.
- Polynucleotides can comprise a region or regions of linked nucleosides. Such regions can have variable backbone linkages. The linkages can be standard phosphodiester linkages, in which case the polynucleotides would comprise regions of nucleotides.
- modified polynucleotides disclosed herein can comprise various distinct modifications.
- the modified polynucleotides contain one, two, or more (optionally different) nucleoside or nucleotide modifications.
- a modified polynucleotide, introduced to a cell can exhibit one or more desirable properties, e.g., improved protein expression, reduced immunogenicity, or reduced degradation in the cell, as compared to an unmodified polynucleotide.
- a polynucleotide of the present disclosure is structurally modified.
- a "structural" modification is one in which two or more linked nucleosides are inserted, deleted, duplicated, inverted or randomized in a polynucleotide without significant chemical modification to the nucleotides themselves. Because chemical bonds will necessarily be broken and reformed to effect a structural modification, structural modifications are of a chemical nature and hence are chemical modifications. However, structural modifications will result in a different sequence of nucleotides.
- the polynucleotide "ATCG” can be chemically modified to "AT-5meC-G".
- the same polynucleotide can be structurally modified from “ATCG” to "ATCCCG”.
- the dinucleotide "CC” has been inserted, resulting in a structural modification to the polynucleotide.
- compositions of the present disclosure comprise, in some embodiments, at least one nucleic acid (e.g., RNA) having an open reading frame encoding a therapeutic polypeptide, a fragment thereof, or a variant thereof, wherein the nucleic acid comprises nucleotides and/or nucleosides that can be standard (unmodified) or modified as is known in the art.
- nucleotides and nucleosides of the present disclosure comprise modified nucleotides or nucleosides.
- modified nucleotides and nucleosides can be naturally-occurring modified nucleotides and nucleosides or non- naturally occurring modified nucleotides and nucleosides.
- modifications can include those at the sugar, backbone, or nucleobase portion of the nucleotide and/or nucleoside as are recognized in the art.
- a naturally-occurring modified nucleotide or nucleotide of the disclosure is one as is generally known or recognized in the art.
- Non-limiting examples of such naturally occurring modified nucleotides and nucleotides can be found, inter alia, in the widely recognized MODOMICS database.
- a non-naturally occurring modified nucleotide or nucleoside of the disclosure is one as is generally known or recognized in the art.
- Non-limiting examples of such non-natural occurring modified nucleotides and nucleosides can be found, inter alia, in published US Application Nos. PCT/US2012/058519; PCT/US2013/075177; PCT/US2014/058897;
- PCT/US2014/058891 PCT/US2014/070413; PCT/US2015/36773; PCT/US2015/36759;
- PCT/US2015/36771 or PCT/IB2017/051367 all of which are incorporated by reference herein.
- RNA e.g., mRNA
- nucleotides and nucleosides of the present disclosure comprise standard nucleoside residues such as those present in transcribed RNA (e.g. A, G, C, or U).
- nucleotides and nucleosides of the present disclosure comprise standard deoxyribonucleosides such as those present in DNA (e.g. dA, dG, dC, or dT).
- nucleic acids of the disclosure can comprise standard nucleotides and nucleosides, naturally-occurring nucleotides and nucleosides, non-naturally-occurring nucleotides and nucleosides, or any combination thereof.
- Nucleic acids of the disclosure e.g., DNA nucleic acids and RNA nucleic acids, such as mRNA nucleic acids
- Nucleic acids of the disclosure comprise various (more than one) different types of standard and/or modified nucleotides and nucleosides.
- a particular region of a nucleic acid contains one, two or more (optionally different) types of standard and/or modified nucleotides and nucleosides.
- a modified RNA nucleic acid e.g., a modified mRNA nucleic acid
- introduced to a cell or organism exhibits reduced degradation in the cell or organism, respectively, relative to an unmodified nucleic acid comprising standard nucleotides and nucleosides.
- a modified RNA nucleic acid (e.g., a modified mRNA nucleic acid), introduced into a cell or organism, may exhibit reduced immunogenicity in the cell or organism, respectively (e.g., a reduced innate response) relative to an unmodified nucleic acid comprising standard nucleotides and nucleosides.
- Nucleic acids e.g., RNA nucleic acids, such as mRNA nucleic acids
- Nucleic acids in some embodiments, comprise non-natural modified nucleotides that are introduced during synthesis or post-synthesis of the nucleic acids to achieve desired functions or properties.
- the modifications may be present on internucleoside linkages, purine or pyrimidine bases, or sugars.
- the modification may be introduced with chemical synthesis or with a polymerase enzyme at the terminal of a chain or anywhere else in the chain. Any of the regions of a nucleic acid may be chemically modified.
- nucleic acid e.g., RNA nucleic acids, such as mRNA nucleic acids.
- a “nucleoside” refers to a compound containing a sugar molecule (e.g., a pentose or ribose) or a derivative thereof in combination with an organic base (e.g., a purine or pyrimidine) or a derivative thereof (also referred to herein as “nucleobase”).
- nucleotide refers to a nucleoside, including a phosphate group.
- Modified nucleotides may by synthesized by any useful method, such as, for example, chemically, enzymatically, or recombinantly, to include one or more modified or non-natural nucleosides.
- Nucleic acids can comprise a region or regions of linked nucleosides. Such regions may have variable backbone linkages. The linkages can be standard phosphodiester linkages, in which case the nucleic acids would comprise regions of nucleotides.
- Modified nucleotide base pairing encompasses not only the standard adenosine-thymine, adenosine-uracil, or guanosine-cytosine base pairs, but also base pairs formed between nucleotides and/or modified nucleotides comprising non-standard or modified bases, wherein the arrangement of hydrogen bond donors and hydrogen bond acceptors permits hydrogen bonding between a non-standard base and a standard base or between two complementary non-standard base structures, such as, for example, in those nucleic acids having at least one chemical modification.
- One example of such nonstandard base pairing is the base pairing between the modified nucleotide inosine and adenine, cytosine or uracil. Any combination of base/sugar or linker may be incorporated into nucleic acids of the present disclosure.
- modified nucleobases in nucleic acids comprise N1 -methyl-pseudouridine (m1 ip), 1 -ethyl-pseudouridine (e1 ip), 5-methoxy- uridine (mo5U), 5-methyl-cytidine (m5C), and/or pseudouridine (ip).
- modified nucleobases in nucleic acids comprise 5- methoxymethyl uridine, 5-methylthio uridine, 1 -methoxymethyl pseudouridine, 5-methyl cytidine, and/or 5- methoxy cytidine.
- the polyribonucleotide includes a combination of at least two (e.g., 2, 3, 4 or more) of any of the aforementioned modified nucleobases, including but not limited to chemical modifications.
- a RNA nucleic acid of the disclosure comprises N1 -methyl-pseudouridine (ml ip) substitutions at one or more or all uridine positions of the nucleic acid.
- a RNA nucleic acid of the disclosure comprises N1 -methyl-pseudouridine (ml ip) substitutions at one or more or all uridine positions of the nucleic acid and 5-methyl cytidine substitutions at one or more or all cytidine positions of the nucleic acid.
- ml ip N1 -methyl-pseudouridine
- a RNA nucleic acid of the disclosure comprises pseudouridine (ip) substitutions at one or more or all uridine positions of the nucleic acid.
- a RNA nucleic acid of the disclosure comprises pseudouridine (ip) substitutions at one or more or all uridine positions of the nucleic acid and 5-methyl cytidine substitutions at one or more or all cytidine positions of the nucleic acid.
- a RNA nucleic acid of the disclosure comprises uridine at one or more or all uridine positions of the nucleic acid.
- nucleic acids e.g., RNA nucleic acids, such as mRNA nucleic acids
- nucleic acids are uniformly modified (e.g., fully modified, modified throughout the entire sequence) for a particular modification.
- a nucleic acid can be uniformly modified with N1 -methyl-pseudouridine, meaning that all uridine residues in the mRNA sequence are replaced with N1 -methyl-pseudouridine.
- a nucleic acid can be uniformly modified for any type of nucleoside residue present in the sequence by replacement with a modified residue such as those set forth above.
- nucleic acids of the present disclosure may be partially or fully modified along the entire length of the molecule.
- one or more or all or a given type of nucleotide e.g., purine or pyrimidine, or any one or more or all of A, G, U, C
- nucleotides X in a nucleic acid of the present disclosure are modified nucleotides, wherein X may be any one of nucleotides A, G, U, C, or any one of the combinations A+G, A+U, A+C, G+U, G+C, U+C, A+G+U, A+G+C, G+U+C or A+G+C.
- the nucleic acid may contain from about 1 % to about 100% modified nucleotides (either in relation to overall nucleotide content, or in relation to one or more types of nucleotide, i.e., any one or more of A, G, U or C) or any intervening percentage (e.g., from 1 % to 20%, from 1 % to 25%, from 1 % to 50%, from 1 % to 60%, from 1 % to 70%, from 1 % to 80%, from 1 % to 90%, from 1 % to 95%, from 10% to 20%, from 10% to 25%, from 10% to 50%, from 10% to 60%, from 10% to 70%, from 10% to 80%, from 10% to 90%, from 10% to 95%, from 10% to 100%, from 20% to 25%, from 20% to 50%, from 20% to 60%, from 20% to 70%, from 20% to 80%, from 20% to 90%, from 20% to 95%, from 20% to 100%, from 50% to 60%, from 50% to 70%, from 50% to 80%, from 50% to 90%, from 20% to 95%,
- the nucleic acids may contain at a minimum 1 % and at maximum 100% modified nucleotides, or any intervening percentage, such as at least 5% modified nucleotides, at least 10% modified nucleotides, at least 25% modified nucleotides, at least 50% modified nucleotides, at least 80% modified nucleotides, or at least 90% modified nucleotides.
- the nucleic acids may contain a modified pyrimidine such as a modified uracil or cytosine.
- At least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90% or 100% of the uracil in the nucleic acid is replaced with a modified uracil (e.g., a 5-substituted uracil).
- the modified uracil can be replaced by a compound having a single unique structure, or can be replaced by a plurality of compounds having different structures (e.g., 2, 3, 4 or more unique structures).
- cytosine in the nucleic acid is replaced with a modified cytosine (e.g., a 5-substituted cytosine).
- the modified cytosine can be replaced by a compound having a single unique structure, or can be replaced by a plurality of compounds having different structures (e.g., 2, 3, 4 or more unique structures).
- Untranslated regions are nucleic acid sections of a polynucleotide before a start codon (5' UTR) and after a stop codon (3' UTR) that are not translated.
- a polynucleotide e.g., a ribonucleic acid (RNA), e.g., a messenger RNA (mRNA)
- RNA ribonucleic acid
- mRNA messenger RNA
- ORF open reading frame
- encoding a therapeutic polypeptide further comprises a UTR (e.g., a 5' UTR or functional fragment thereof, a 3' UTR or functional fragment thereof, or a combination thereof).
- a UTR (e.g., 5' UTR or 3' UTR) can be homologous or heterologous to the coding region in a polynucleotide.
- the UTR is homologous to the ORF encoding the therapeutic polypeptide.
- the UTR is heterologous to the ORF encoding the therapeutic polypeptide.
- the polynucleotide comprises two or more 5' UTRs or functional fragments thereof, each of which has the same or different nucleotide sequences. In some embodiments, the polynucleotide comprises two or more 3' UTRs or functional fragments thereof, each of which has the same or different nucleotide sequences.
- the 5' UTR or functional fragment thereof, 3' UTR or functional fragment thereof, or any combination thereof is sequence optimized.
- the 5'UTR or functional fragment thereof, 3' UTR or functional fragment thereof, or any combination thereof comprises at least one chemically modified nucleobase, e.g., N1 -methylpseudouracil or 5-methoxyuracil.
- UTRs can have features that provide a regulatory role, e.g., increased or decreased stability, localization and/or translation efficiency.
- a polynucleotide comprising a UTR can be administered to a cell, tissue, or organism, and one or more regulatory features can be measured using routine methods.
- a functional fragment of a 5' UTR or 3' UTR comprises one or more regulatory features of a full length 5' or 3' UTR, respectively.
Landscapes
- Genetics & Genomics (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Saccharide Compounds (AREA)
Abstract
This disclosure relates to internal ribosome entry site (IRES) elements that are capable of effectuating expression of a desired polynucleotide even in the absence of a 5' cap structure. The disclosure also provides polynucleotides (e.g., RNA molecules, such as circular or linear RNA molecules) containing such IRES elements. In some embodiments of the disclosure, the IRES element contains one or more nucleic acid segments that are enriched in uridine nucleosides or modified uridine nucleosides, such as 1 -methylpseudouridine nucleosides. In some embodiments, the IRES element contains one or more nucleic acid segments that feature a plurality of contiguous uridine nucleosides or modified uridine nucleosides (e.g., 1 -methylpseudouridine nucleosides). In some embodiments, the IRES elements described herein can recruit ribosomes and/or translation initiation factors by, e.g., binding to ribosomes, hybridizing to the ribosomal RNA of a ribosome, or binding to translation initiation factors. The polynucleotides (e.g., circular or linear RNA molecules) of the disclosure may be used to express a desired polypeptide in a subject, such as a subject having a disease or condition associated with a deficiency in the corresponding endogenous polypeptide.
Description
INTERNAL RIBOSOME ENTRY SITES FOR IMPROVED POLYNUCLEOTIDE TRANSLATION
SEQUENCE LISTING
The instant application contains a Sequence Listing which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. Said XML copy, created on August 4, 2023, is named “50858-124WO2_Sequence_Listing_8_4_23” and is 315,392 bytes in size.
BACKGROUND
The use of exogenous nucleic acids has become a particularly effective strategy for delivering polypeptides of interest to a target cell, tissue, or organism, as a single protein-encoding nucleic acid can be translated to yield multiple copies of a desired polypeptide, allowing the administration of a small quantity of nucleic acid to achieve high levels of protein expression. As the nucleic acid therapeutic field has grown, steps have been taken to improve the pharmacokinetic properties of nucleic acid molecules. For example, efforts to further augment the half-lives of nucleic acid molecules, such as protein-encoding RNA molecules, have led to modifications that render nucleic acids less susceptible to nucleolytic degradation. Examples of these modifications are the inclusion of 5’ and/or 3’ chemical groups that sterically restrict the access of exonucleases to the 5’ and/or 3’ end of a nucleic acid, as well as nucleic acid circularization, which altogether removes the 5’ and 3’ ends that would otherwise be available for an exonuclease to engage and cleave.
Although the foregoing modifications promote nucleic acid stability by mitigating nucleolytic degradation, these modifications generally preclude the inclusion of a 5’ cap structure. 5’ cap structures are often included in protein-encoding nucleic acid (e.g., RNA) molecules, as the 5’ cap promotes ribosome binding and, thus, protein translation. Accordingly, although modifications such as 573’ blocking and circularization may confer the benefit of reduced exonuclease-mediated degradation, these modifications may hinder ribosomal recruitment due to the absence of a 5’ cap. There exists a need for improved strategies for effectuating ribosomal entry and the initiation of protein translation, particularly in nucleic acid molecules that lack a 5’ cap.
SUMMARY
The present disclosure features nucleic acid molecules, such as linear and circular RNA molecules, that are capable of recruiting and binding to ribosomes in a manner that is independent of a 5’ cap structure. Without being limited by mechanism, nucleic acid molecules generally employ 5’ cap structures in order to promote ribosomal binding and, thus, translation of an encoded protein. The presence of a 5’ cap that is susceptible to decapping - which, in turn, triggers subsequent degradation of the RNA - precludes the possibility of adding certain chemical modifications that extend the molecule’s half-life. Examples of these types of modifications include (i) the presence of 5’ chemical moieties that restrict the access of an exonuclease to the nucleic acid molecule, as well as (ii) circularization of a nucleic acid molecule, which removes 5’ and 3’ ends altogether. Both of these types of modifications provide the benefit of reducing or eliminating exonucleolytic cleavage by way of either chemically protecting, or removing, the 5’ and 3’ ends to which an exonuclease would bind. However, because these types of modifications alter or eliminate the 5’ end, they preclude the inclusion of a 5’ cap.
The present disclosure features internal ribosome entry sites (IRESs) that can be incorporated into nucleic acids and that promote ribosome recruitment and protein translation in a manner that is independent of the presence of a 5’ cap. Significantly, the IRES elements of the disclosure can be used in nucleic acids (e.g., RNA molecules) that either lack or contain a 5’ cap, as the present IRES elements confer advantages to both types of molecules. For example, the IRES elements of the disclosure can be incorporated into a nucleic acid (e.g., a linear or circular RNA molecule) that lacks a 5’ cap, thereby providing a means by which the nucleic acid molecule may be bound - and translated - by a ribosome, notwithstanding the absence of a 5’ cap structure that would, ordinarily, be regarded as important for the onset of protein biosynthesis. In another example, the IRES elements of the disclosure can be incorporated into a nucleic acid (e.g., a linear RNA) that contains a 5’ cap. In this setting, the IRES element may provide the benefit of a means by which the nucleic acid may be translated even after the 5’ cap is removed by way of endogenous decapping processes. In this way, the inclusion of an IRES element of the disclosure can effectively extend the ability of decapped nucleic acids (e.g., decapped linear RNAs) to effectuate protein expression.
The IRES of the disclosure may recruit translation tractor and/or ribosomes to the nucleic acids described herein in order to promotes translation. For example, IRES of the disclosure (e.g., SEQ ID NOs: 173-205) may bind to translation initiation factors, thereby recruiting the molecular machinery needed for initiating translation of the nucleic acid. In another example, IRES of the disclosure (e.g., SEQ ID NOs: 185, 190, and 199-201 ) may bind directly to ribosomal subunits (e.g., eukaryotic 60S or 40S subunits) by, e.g., hybridizing directly to ribosomal RNA (rRNA), such as 25S, 28S, 18S, 5.8S, and/or 5S rRNA. By hybridizing directly with the ribosome, the IRES of the disclosure further provide the advantage of fast and efficient protein expression while reducing energy expenditure on the cell.
In one aspect, the disclosure provides a nucleic acid comprising:
(i) an internal ribosome entry site (IRES) comprising one or more polynucleotide tracts enriched in uridine or a modified uridine; operably linked to
(ii) an open reading frame encoding a polypeptide.
In some embodiments, the IRES comprises from 1 to 20 of the polynucleotide tracts enriched in uridine or a modified uridine (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 of the polynucleotide tracts enriched in uridine or a modified uridine). In some embodiments, the IRES comprises from 2 to 10 of the polynucleotide tracts enriched in uridine or a modified uridine. In some embodiments, the IRES comprises from 3 to 6 of the polynucleotide tracts enriched in uridine or a modified uridine.
In some embodiments, at least 70% of the nucleosides in each of the polynucleotide tracts is a pyrimidine-containing nucleoside, such as a uridine, a modified uridine, a cytidine, or a modified cytidine (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the nucleosides in each of the polynucleotide tracts may be a uridine, a modified uridine, a cytidine, or a modified cytidine). In some embodiments, at least 75% of the nucleosides in each of the polynucleotide tracts is a pyrimidine-containing nucleoside, such as a uridine, a modified uridine, a cytidine, or a modified cytidine. In some embodiments, at least 80% of the nucleosides in each of the polynucleotide tracts is a pyrimidine-containing nucleoside, such as a uridine, a modified uridine, a cytidine, or a modified cytidine.
In some embodiments, at least 85% of the nucleosides in each of the polynucleotide tracts is a pyrimidine-containing nucleoside, such as a uridine, a modified uridine, a cytidine, or a modified cytidine. In some embodiments, at least 90% of the nucleosides in each of the polynucleotide tracts is a pyrimidine-containing nucleoside, such as a uridine, a modified uridine, a cytidine, or a modified cytidine. In some embodiments, at least 95% of the nucleosides in each of the polynucleotide tracts is a pyrimidine-containing nucleoside, such as a uridine, a modified uridine, a cytidine, or a modified cytidine. In some embodiments, all of the nucleosides in each of the polynucleotide tracts is a pyrimidine- containing nucleoside, such as a uridine, a modified uridine, a cytidine, or a modified cytidine.
In some embodiments, each polynucleotide tract, independently, is from 5 to 20 nucleosides in length (e.g., 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleosides in length). In some embodiments, each polynucleotide tract, independently, is from 5 to 19 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 18 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 17 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 16 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 15 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 14 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 13 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 12 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 11 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 10 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 15 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 14 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 13 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 12 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 11 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 10 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 7 to 15 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 7 to 14 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 7 to 13 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 7 to 12 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 7 to 11 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 7 to 10 nucleosides in length. In some embodiments, each polynucleotide tract is 9 nucleosides in length.
In some embodiments, each polynucleotide tract, independently, comprises from 5 to 20 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides, such as 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 uridine, modified uridine, cytidine, or modified cytidine nucleosides). In some embodiments, each polynucleotide tract, independently, comprises from 6 to 15 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides). In some embodiments, each polynucleotide tract, independently, comprises from 6 to 14 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides). In some embodiments, each polynucleotide
tract, independently, comprises from 6 to 13 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides). In some embodiments, each polynucleotide tract, independently, comprises from 6 to 12 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides). In some embodiments, each polynucleotide tract, independently, comprises from 6 to 1 1 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides). In some embodiments, each polynucleotide tract, independently, comprises from 6 to 10 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides). In some embodiments, each polynucleotide tract, independently, comprises from 7 to 15 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides). In some embodiments, each polynucleotide tract, independently, comprises from 7 to 14 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides). In some embodiments, each polynucleotide tract, independently, comprises from 7 to 13 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides). In some embodiments, each polynucleotide tract, independently, comprises from 7 to 12 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides). In some embodiments, each polynucleotide tract, independently, comprises from 7 to 1 1 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides). In some embodiments, each polynucleotide tract, independently, comprises from 7 to 10 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides).
In some embodiments, each polynucleotide tract comprises at least 9 contiguous pyrimidine- containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides). In some embodiments, each polynucleotide tract comprises 9 contiguous pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides).
In some embodiments, one or more (or all) of the polynucleotide tracts are enriched in modified uridine. In some embodiments, the modified uridine is 1 -methylpseudouridine. In other embodiments, the modified uridine is pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5- aza-uridine, 2-thio-uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5- carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl- uridine, 5-methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl- uridine, 5-methylaminomethyl-2-thio-uridine, 5-methylaminomethyl-2-seleno-uridine, 5-carbamoylmethyl- uridine, 5-carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl- uridine, 1 -propynyl-pseudouridine, 5-taurinomethyl-uridine, 1 -taurinomethyl-pseudouridine, 5- taurinomethyl-2-thio-uridine, 1 -taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine, 5-methyl-2-thio- uridine, 1 -methyl-4-thio-pseudouridine, 4-thio-1 -methyl-pseudouridine, 3-methylpseudouridine, 2-thio-1 - methyl-pseudouridine, 1 -methyl-1 -deaza-pseudouridine, 2-thio-1 -methyl-1 -deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4- methoxy-2-thio-pseudouridine, N1 -methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1 -methyl-3-
(3-amino-3-carboxypropyl)pseudouridine, 5-(isopentenylaminomethyl)uridine, 5- (isopentenylaminomethyl)-2-thio-uridine, a-thio-uridine, 2'-O-methyl-uridine, 5,2'-O-dimethyl-uridine, 2'-O- methyl-pseudouridine, 2-thio-2'-O-methyl-uridine, 5-methoxycarbonylmethyl-2'-O-methyl-uridine, 5- carbamoylmethyl-2'-O-methyl-uridine, 5-carboxymethylaminomethyl-2'-O-methyl-uridine, 3,2'-O-dimethyl- uridine, 5-(isopentenylaminomethyl)-2'-O-methyl-uridine, 1 -thio-uridine, deoxythymidine, 2’-F-ara-uridine, 2’-F-uridine, 2’-OH-ara-uridine, 5-(2-carbomethoxyvinyl) uridine, or 5-[3-(1 -E-propenylamino)uridine. In preferred embodiments, the modified uridine is 1 -methylpseudouridine.
In some embodiments, the IRES is 100% modified at uridine, and the modification consists of 1 - methylpseudouridine. In some embodiments, the entire mRNA, including the IRES, is 100% modified at uridine, and the modification consists of 1 -methylpseudouridine.
In some embodiments, the IRES does not contain a chemical modification at uridine. In some embodiments, the IRES does not contain a chemical modification at any of the nucleosides therein.
In some embodiments, the IRES is located within a noncoding region of the nucleic acid. For example, the IRES may be located within a 5’ untranslated region (UTR) that is operably linked to the open reading frame. In some embodiments, the open reading frame is further operably linked to a 3’ UTR.
In some embodiments, the polynucleotide tracts are separated from one another by way of one or more spacers that each, independently, comprise from 5 to 100 nucleosides (e.g., 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 nucleosides). In some embodiments, each of the spacers, independently, comprises from 10 to 40 nucleosides (e.g., 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleosides). In some embodiments, each of the spacers, independently, comprises 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, or 38 nucleosides.
In some embodiments, the IRES is represented by the formula:
[(N)n - ( U')m]p wherein: each N is, independently, any nucleoside residue; each t/'is, independently, a pyrimidine-containing nucleosides (e.g., uridine, modified uridine, cytidine, or modified cytidine nucleosides), preferably wherein each t/' is, independently, uridine or a modified uridine, even more preferably wherein each t/'is, independently, modified uridine (e.g., 1 - methylpseudouridine); each n is, independently, an integer from 1 to 100 (e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100); each m is, independently, an integer from 2 to 15 (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, or 15); and p is an integer from 2 to 20 (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, or 20).
In some embodiments, N is, independently, selected from adenosine, a modified adenosine, uridine, a modified uridine, guanosine, a modified guanosine, cytidine, and a modified cytidine. In some
embodiments, each N is, independently, selected from adenosine, uridine, a modified uridine, guanosine, and cytidine.
In some embodiments, the modified uridine of N is 1 -methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine, 4-thio- uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo- uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine, 5- carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl-uridine, 5-methoxycarbonylmethyl- 2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl-uridine, 5-methylaminomethyl-2-thio- uridine, 5-methylaminomethyl-2-seleno-uridine, 5-carbamoylmethyl-uridine, 5- carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl-uridine, 1 - propynyl-pseudouridine, 5-taurinomethyl-uridine, 1 -taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio- uridine, 1 -taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine, 5-methyl-2-thio-uridine, 1 -methyl-4-thio- pseudouridine, 4-thio-1 -methyl-pseudouridine, 3-methylpseudouridine, 2-thio-1 -methyl-pseudouridine, 1 - methyl-1 -deaza-pseudouridine, 2-thio-1 -methyl-1 -deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio- dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4- methoxy-2-thio-pseudouridine, N1 -methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1 -methyl-3- (3-amino-3-carboxypropyl)pseudouridine, 5-(isopentenylaminomethyl)uridine, 5- (isopentenylaminomethyl)-2-thio-uridine, a-thio-uridine, 2'-O-methyl-uridine, 5,2'-O-dimethyl-uridine, 2'-O- methyl-pseudouridine, 2-thio-2'-O-methyl-uridine, 5-methoxycarbonylmethyl-2'-O-methyl-uridine, 5- carbamoylmethyl-2'-O-methyl-uridine, 5-carboxymethylaminomethyl-2'-O-methyl-uridine, 3,2'-O-dimethyl- uridine, 5-(isopentenylaminomethyl)-2'-O-methyl-uridine, 1 -thio-uridine, deoxythymidine, 2’-F-ara-uridine, 2’-F-uridine, 2’-OH-ara-uridine, 5-(2-carbomethoxyvinyl) uridine, or 5-[3-(1 -E-propenylamino)uridine.
In some embodiments, the modified cytidine of N is 5-aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetyl-cytidine, 5-formyl-cytidine, N4-methyl-cytidine, 5-methyl- cytidine, 5-halo-cytidine, 5-hydroxymethyl-cytidine, 1 -methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo- pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1 -methylpseudoisocytidine, 4-thio-1 -methyl-1 -deaza-pseudoisocytidine, 1 -methyl-1 -deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy- cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, 4-methoxy-1 -methyl- pseudoisocytidine, lysidine, a-thio-cytidine, 2'-O-methyl-cytidine, 5,2'-O-dimethyl-cytidine, N4-acetyl-2'-O- methyl-cytidine, N4,2'-O-dimethyl-cytidine, 5-formyl-2'-O-methyl-cytidine, N4,N4,2'-O-trimethyl-cytidine, 1 - thio-cytidine, 2’-F-ara-cytidine, 2’-F-cytidine, or 2’-OH-ara-cytidine.
In some embodiments, the modified adenosine of N is 2-amino-purine, 2, 6-diaminopurine, 2- amino-6-halo-purine, 6-halo-purine, 2-amino-6-methyl-purine, 8-azido-adenosine, 7-deaza-adenine, 7- deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2,6- diaminopurine, 7-deaza-8-aza-2, 6-diaminopurine, 1 -methyl-adenosine, 2-methyl-adenine, N6-methyl- adenosine, 2-methylthio-N6-methyl-adenosine, N6-isopentenyl-adenosine, 2-methylthio-N6-isopentenyl- adenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, N6-glycinylcarbamoyl-adenosine, N6-threonylcarbamoyl-adenosine, N6-methyl-N6-threonylcarbamoyl-
adenosine, 2-methylthio-N6-threonylcarbamoyl-adenosine, N6,N6-dimethyl-adenosine, N6- hydroxynorvalylcarbamoyl-adenosine, 2-methylthio-N6-hydroxynorvalylcarbamoyl-adenosine, N6-acetyl- adenosine, 7-methyl-adenine, 2-methylthio-adenine, 2-methoxy-adenine, a-thio-adenosine, 2'-O-methyl- adenosine, N6,2'-O-dimethyl-adenosine, N6,N6,2'-O-trimethyl-adenosine, 1 ,2'-O-dimethyl-adenosine, 2'- O-ribosyladenosine, 2-amino-N6-methyl-purine, 1 -thio-adenosine, 8-azido-adenosine, 2’-F-ara- adenosine, 2’-F-adenosine, 2’-OH-ara-adenosine, or N6-(19-amino-pentaoxanonadecyl)-adenosine.
In some embodiments, the modified guanosine of N is inosine, 1 -methyl-inosine, wyosine, methylwyosine, 4-demethyl-wyosine, isowyosine, wybutosine, peroxywybutosine, hydroxywybutosine, 7- deaza-guanosine, queuosine, epoxyqueuosine, galactosyl-queuosine, mannosyl-queuosine, 7-cyano-7- deaza-guanosine, 7-aminomethyl-7-deaza-guanosine, archaeosine, 7-deaza-8-aza-guanosine, 6-thio- guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7- methyl-guanosine, 7-methyl-inosine, 6-methoxy-guanosine, 1 -methyl-guanosine, N2-methyl-guanosine, N2,N2-dimethyl-guanosine, N2,7-dimethyl-guanosine, N2, N2,7-dimethyl-guanosine, 8-oxo-guanosine, 7- methyl-8-oxo-guanosine, 1 -methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, N2,N2-dimethyl-6-thio- guanosine, a-thio-guanosine, 2'-O-methyl-guanosine, N2-methyl-2'-O-methyl-guanosine, N2,N2-dimethyl- 2'-O-methyl-guanosine, 1 -methyl-2'-O-methyl-guanosine, N2,7-dimethyl-2'-O-methyl-guanosine, 2'-O- methyl-inosine, 1 ,2'-O-dimethyl-inosine, 2'-O-ribosylguanosine, 1 -thio-guanosine, O6-methyl-guanosine, 2’-F-ara-guanosine, or 2’-F-guanosine.
In some embodiments, the modified uridine of U’ is 1 -methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine, 4-thio- uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo- uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine, 5- carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl-uridine, 5-methoxycarbonylmethyl- 2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl-uridine, 5-methylaminomethyl-2-thio- uridine, 5-methylaminomethyl-2-seleno-uridine, 5-carbamoylmethyl-uridine, 5- carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl-uridine, 1 - propynyl-pseudouridine, 5-taurinomethyl-uridine, 1 -taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio- uridine, 1 -taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine, 5-methyl-2-thio-uridine, 1 -methyl-4-thio- pseudouridine, 4-thio-1 -methyl-pseudouridine, 3-methylpseudouridine, 2-thio-1 -methyl-pseudouridine, 1 - methyl-1 -deaza-pseudouridine, 2-thio-1 -methyl-1 -deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio- dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4- methoxy-2-thio-pseudouridine, N1 -methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1 -methyl-3- (3-amino-3-carboxypropyl)pseudouridine, 5-(isopentenylaminomethyl)uridine, 5- (isopentenylaminomethyl)-2-thio-uridine, a-thio-uridine, 2'-O-methyl-uridine, 5,2'-O-dimethyl-uridine, 2'-O- methyl-pseudouridine, 2-thio-2'-O-methyl-uridine, 5-methoxycarbonylmethyl-2'-O-methyl-uridine, 5- carbamoylmethyl-2'-O-methyl-uridine, 5-carboxymethylaminomethyl-2'-O-methyl-uridine, 3,2'-O-dimethyl- uridine, 5-(isopentenylaminomethyl)-2'-O-methyl-uridine, 1 -thio-uridine, deoxythymidine, 2’-F-ara-uridine, 2’-F-uridine, 2’-OH-ara-uridine, 5-(2-carbomethoxyvinyl) uridine, or 5-[3-(1 -E-propenylamino)uridine.
In some embodiments, each n is, independently, an integer from 10 to 40. In some embodiments, each n is, independently, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, or 38. In some embodiments, each m is, independently, an integer from 2 to 15. In some embodiments, each m is, independently, an integer from 7 to 1 1 . In some embodiments, each m is 9. In some embodiments, p is an integer from 2 to 10. In some embodiments, p is an integer from 3 to 6, optionally wherein p is 3 or 6.
In some embodiments, the nucleic acid is RNA. In some embodiments, the nucleic acid is linear. In some embodiments, the nucleic acid is circular. In some embodiments, the open reading from consists of nucleosides selected from adenosine, a modified adenosine, uridine, a modified uridine, guanosine, a modified guanosine, cytidine, and a modified cytidine. In some embodiments, the open reading from consists of nucleosides selected from adenosine, uridine, a modified uridine, guanosine, and cytidine.
In some embodiments, the modified uridine of the open reading frame is 1 -methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio- uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl-uridine, 5- methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl-uridine, 5- methylaminomethyl-2-thio-uridine, 5-methylaminomethyl-2-seleno-uridine, 5-carbamoylmethyl-uridine, 5- carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl-uridine, 1 - propynyl-pseudouridine, 5-taurinomethyl-uridine, 1 -taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio- uridine, 1 -taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine, 5-methyl-2-thio-uridine, 1 -methyl-4-thio- pseudouridine, 4-thio-1 -methyl-pseudouridine, 3-methylpseudouridine, 2-thio-1 -methyl-pseudouridine, 1 - methyl-1 -deaza-pseudouridine, 2-thio-1 -methyl-1 -deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio- dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4- methoxy-2-thio-pseudouridine, N1 -methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1 -methyl-3- (3-amino-3-carboxypropyl)pseudouridine, 5-(isopentenylaminomethyl)uridine, 5- (isopentenylaminomethyl)-2-thio-uridine, a-thio-uridine, 2'-O-methyl-uridine, 5,2'-O-dimethyl-uridine, 2'-O- methyl-pseudouridine, 2-thio-2'-O-methyl-uridine, 5-methoxycarbonylmethyl-2'-O-methyl-uridine, 5- carbamoylmethyl-2'-O-methyl-uridine, 5-carboxymethylaminomethyl-2'-O-methyl-uridine, 3,2'-O-dimethyl- uridine, 5-(isopentenylaminomethyl)-2'-O-methyl-uridine, 1 -thio-uridine, deoxythymidine, 2’-F-ara-uridine, 2’-F-uridine, 2’-OH-ara-uridine, 5-(2-carbomethoxyvinyl) uridine, or 5-[3-(1 -E-propenylamino)uridine. In some embodiments, the modified uridine of the open reading frame is 1 -methylpseudouridine.
In some embodiments, the modified cytidine of N is 5-aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetyl-cytidine, 5-formyl-cytidine, N4-methyl-cytidine, 5-methyl- cytidine, 5-halo-cytidine, 5-hydroxymethyl-cytidine, 1 -methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo- pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1 -methylpseudoisocytidine, 4-thio-1 -methyl-1 -deaza-pseudoisocytidine, 1 -methyl-1 -deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy- cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, 4-methoxy-1 -methyl-
pseudoisocytidine, lysidine, a-thio-cytidine, 2'-O-methyl-cytidine, 5,2'-O-dimethyl-cytidine, N4-acetyl-2'-O- methyl-cytidine, N4,2'-O-dimethyl-cytidine, 5-formyl-2'-O-methyl-cytidine, N4,N4,2'-O-trimethyl-cytidine, 1 - thio-cytidine, 2’-F-ara-cytidine, 2’-F-cytidine, or 2’-OH-ara-cytidine.
In some embodiments, the modified adenosine of N is 2-amino-purine, 2, 6-diaminopurine, 2- amino-6-halo-purine, 6-halo-purine, 2-amino-6-methyl-purine, 8-azido-adenosine, 7-deaza-adenine, 7- deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2,6- diaminopurine, 7-deaza-8-aza-2, 6-diaminopurine, 1 -methyl-adenosine, 2-methyl-adenine, N6-methyl- adenosine, 2-methylthio-N6-methyl-adenosine, N6-isopentenyl-adenosine, 2-methylthio-N6-isopentenyl- adenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, N6-glycinylcarbamoyl-adenosine, N6-threonylcarbamoyl-adenosine, N6-methyl-N6-threonylcarbamoyl- adenosine, 2-methylthio-N6-threonylcarbamoyl-adenosine, N6,N6-dimethyl-adenosine, N6- hydroxynorvalylcarbamoyl-adenosine, 2-methylthio-N6-hydroxynorvalylcarbamoyl-adenosine, N6-acetyl- adenosine, 7-methyl-adenine, 2-methylthio-adenine, 2-methoxy-adenine, a-thio-adenosine, 2'-O-methyl- adenosine, N6,2'-O-dimethyl-adenosine, N6,N6,2'-O-trimethyl-adenosine, 1 ,2'-O-dimethyl-adenosine, 2'- O-ribosyladenosine, 2-amino-N6-methyl-purine, 1 -thio-adenosine, 8-azido-adenosine, 2’-F-ara- adenosine, 2’-F-adenosine, 2’-OH-ara-adenosine, or N6-(19-amino-pentaoxanonadecyl)-adenosine.
In some embodiments, the modified guanosine of N is inosine, 1 -methyl-inosine, wyosine, methylwyosine, 4-demethyl-wyosine, isowyosine, wybutosine, peroxywybutosine, hydroxywybutosine, 7- deaza-guanosine, queuosine, epoxyqueuosine, galactosyl-queuosine, mannosyl-queuosine, 7-cyano-7- deaza-guanosine, 7-aminomethyl-7-deaza-guanosine, archaeosine, 7-deaza-8-aza-guanosine, 6-thio- guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7- methyl-guanosine, 7-methyl-inosine, 6-methoxy-guanosine, 1 -methyl-guanosine, N2-methyl-guanosine, N2,N2-dimethyl-guanosine, N2,7-dimethyl-guanosine, N2, N2,7-dimethyl-guanosine, 8-oxo-guanosine, 7- methyl-8-oxo-guanosine, 1 -methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, N2,N2-dimethyl-6-thio- guanosine, a-thio-guanosine, 2'-O-methyl-guanosine, N2-methyl-2'-O-methyl-guanosine, N2,N2-dimethyl- 2'-O-methyl-guanosine, 1 -methyl-2'-O-methyl-guanosine, N2,7-dimethyl-2'-O-methyl-guanosine, 2'-O- methyl-inosine, 1 ,2'-O-dimethyl-inosine, 2'-O-ribosylguanosine, 1 -thio-guanosine, O6-methyl-guanosine, 2’-F-ara-guanosine, or 2’-F-guanosine.
In some embodiments, the polypeptide encoded by the open reading frame is a secreted protein, (e.g., a cytokine, a growth factor, an enzyme, an immunomodulator, an antibody or antigen-binding fragment thereof, or a cell-penetrating peptide), an extracellular membrane-bound protein, an intracellular membrane-bound protein, a cytoplasmic protein, a cytoskeletal protein, or a nuclear protein.
In some embodiments, the nucleic acid does not comprise a 5’ cap.
In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% percent sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% percent sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% percent sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% percent sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% percent sequence identity to any one of SEQ ID NOs:
173-190 and 202-205. In some embodiments, the nucleic acid includes the nucleotide sequence of any one of SEQ ID NOs: 173-190 and 202-205.
In some embodiments, the nucleic acid include a nucleotide sequence with about 70% to about 100% (e.g., about 70% to about 100%, about 75% to about 100%, about 80% to about 100%, about 85% to about 100%, about 90% to about 100%, about 91 % to about 100%, about 92% to about 100%, about 93% to about 100%, about 94% to about 100%, about 95% to about 100%, about 96% to about 100%, about 97% to about 100%, about 98% to about 100%, or about 99% to 100%) sequence identity to an IRES sequence presented in Table 2 (e.g., any one of IRES 1 to IRES 22).
In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 173. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 173. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 173. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 173. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 173. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 173. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 173. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 173. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 173. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 173. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 173. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 173. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 173. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 173. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 173.
In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 174. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 174. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 174. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 174. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 174. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 174. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 174. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 174. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 174. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 174. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 174. In some
embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 174. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 174. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 174. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 174.
In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 175. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 175. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 175. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 175. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 175. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 175. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 175. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 175. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 175. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 175. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 175. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 175. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 175. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 175. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 175.
In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 176. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 176. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 176. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 176. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 176. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 176. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 176. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 176. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 176. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 176. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 176. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 176. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 176. In some embodiments, the nucleic acid includes a nucleotide
sequence with at least 99% sequence identity to SEQ ID NO: 176. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 176.
In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 177. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 177. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 177. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 177. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 177. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 177. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 177. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 177. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 177. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 177. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 177. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 177. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 177. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 177. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 177.
In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 178. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 178. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 178. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 178. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 178. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 178. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 178. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 178. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 178. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 178. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 178. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 178. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 178. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 178. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 178.
In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 179. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 179. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 179. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 179. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 179. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 179. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 179. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 179. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 179. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 179. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 179. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 179. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 179. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 179. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 179.
In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 180. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 180. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 180. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 180. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 180. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 180. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 180. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 180. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 180. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 180. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 180. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 180. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 180. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 180. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 180.
In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 181. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 181. In some embodiments, the nucleic
acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 181. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 181. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 181. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 181 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 181. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 181. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 181. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 181. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 181. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 181. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 181. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 181. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 181 .
In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 182. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 182. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 182. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 182. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 182. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 182. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 182. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 182. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 182. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 182. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 182. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 182. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 182. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 182. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 182.
In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 183. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 183. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 183. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 183. In some embodiments, the nucleic acid includes a nucleotide sequence with at least
90% sequence identity to SEQ ID NO: 183. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 183. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 183. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 183. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 183. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 183. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 183. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 183. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 183. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 183. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 183.
In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 184. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 184. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 184. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 184. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 184. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 184. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 184. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 184. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 184. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 184. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 184. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 184. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 184. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 184. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 184.
In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 185. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 185. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 185. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 185. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 185. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 185. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 185. In some
embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 185. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 185. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 185. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 185. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 185. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 185. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 185. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 185.
In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 186. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 186. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 186. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 186. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 186. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 186. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 186. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 186. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 186. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 186. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 186. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 186. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 186. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 186. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 186.
In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 187. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 187. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 187. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 187. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 187. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 187. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 187. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 187. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 187. In some embodiments, the nucleic acid includes a nucleotide
sequence with at least 95% sequence identity to SEQ ID NO: 187. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 187. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 187. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 187. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 187. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 187.
In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 188. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 188. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 188. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 188. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 188. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 188. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 188. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 188. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 188. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 188. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 188. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 188. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 188. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 188. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 188.
In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 189. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 189. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 189. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 189. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 189. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 189. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 189. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 189. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 189. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 189. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 189. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to
SEQ ID NO: 189. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 189. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 189. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 189.
In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 190. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 190. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 190. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 190. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 190. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 190. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 190. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 190. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 190. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 190. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 190. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 190. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 190. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 190. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 190.
In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 202. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 202. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 202. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 202. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 202. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 202. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 202. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 202. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 202. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 202. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 202. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 202. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 202. In some embodiments, the nucleic acid includes a nucleotide
sequence with at least 99% sequence identity to SEQ ID NO: 202. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 202.
In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 203. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 203. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 203. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 203. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 203. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 203. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 203. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 203. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 203. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 203. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 203. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 203. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 203. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 203. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 203.
In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 204. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 204. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 204. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 204. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 204. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 204. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 204. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 204. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 204. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 204. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 204. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 204. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 204. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 204. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 204.
In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 205. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 205. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 205.
In another aspect, the disclosure provides a nucleic acid comprising:
(i) an IRES comprising one or more polynucleotides that specifically bind a translation initiation factor (for example, eukaryotic translation initiation factor 4 G (elF4G), eukaryotic translation initiation factor 4G2 (elF4G2, also referred to as Dap5), eukaryotic translation initiation factor 3 (elF3)), or IRES trans-acting factors (ITAfs), such as a polypyrimidine tract-binding protein (PTBP) or a fusion protein comprising a translation initiation factor (e.g., elF4G, elF4G2, elF3, La protein, or an ITAf, such as La) fused to an RNA-binding protein; operably linked to
(ii) an open reading frame encoding a polypeptide.
In some embodiments, the one or more polynucleotides specifically bind elF4G, elF4G2, elF3, La protein, or an ITAF, such as PTBP. In some embodiments, each of the one or more polynucleotides, independently, has a nucleic acid sequence that is at least 75% identical to ACUCACUAUUUGUUUUCGCGCCCAGUUGCAAAAA (SEQ ID NO: 1 ). In some embodiments, each of the one or more polynucleotides, independently, has a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO: 1 (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 1 ). In some embodiments, each of the one or more polynucleotides has the nucleic acid sequence of SEQ ID NO: 1 .
In some embodiments, each U residue in SEQ ID NO: 1 is replaced with a modified uridine, such as 1 -methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2- thio-5-aza-uridine, 2-thio-uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy- uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5- carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl-
uridine, 5-methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl- uridine, 5-methylaminomethyl-2-thio-uridine, 5-methylaminomethyl-2-seleno-uridine, 5-carbamoylmethyl- uridine, 5-carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl- uridine, 1 -propynyl-pseudouridine, 5-taurinomethyl-uridine, 1 -taurinomethyl-pseudouridine, 5- taurinomethyl-2-thio-uridine, 1 -taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine, 5-methyl-2-thio- uridine, 1 -methyl-4-thio-pseudouridine, 4-thio-1 -methyl-pseudouridine, 3-methylpseudouridine, 2-thio-1 - methyl-pseudouridine, 1 -methyl-1 -deaza-pseudouridine, 2-thio-1 -methyl-1 -deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4- methoxy-2-thio-pseudouridine, N1 -methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1 -methyl-3- (3-amino-3-carboxypropyl)pseudouridine, 5-(isopentenylaminornethyl)uridine, 5- (isopentenylaminornethyl)-2-thio-uridine, a-thio-uridine, 2'-O-methyl-uridine, 5,2'-O-dimethyl-uridine, 2'-O- methyl-pseudouridine, 2-thio-2'-O-methyl-uridine, 5-rnethoxycarbonylmethyl-2'-O-rnethyl-uridine, 5- carbarnoylmethyl-2'-O-rnethyl-uridine, 5-carboxymethylaminomethyl-2'-O-methyl-uridine, 3,2'-O-dimethyl- uridine, 5-(isopentenylarninomethyl)-2'-O-rnethyl-uridine, 1 -thio-uridine, deoxythymidine, 2’-F-ara-uridine, 2’-F-uridine, 2’-OH-ara-uridine, 5-(2-carbomethoxyvinyl) uridine, or 5-[3-(1 -E-propenylamino)uridine. In some embodiments, each U residue in SEQ ID NO: 1 is replaced with 1 -methylpseudouridine.
In some embodiments, the IRES comprises one or more polynucleotides that specifically bind to a fusion protein comprising a translation initiation factor (e.g., elF4G, elF4G2, elF3, La protein, or an ITAf, such as PTBP) fused to an RNA-binding protein. As a non-limiting example, the RNA-binding protein may be an MS2-binding protein, and the one or more polynucleotides may comprise one or more MS2 RNA hairpins.
In some embodiments, the IRES comprises a plurality of polynucleotides that specifically bind a translation initiation factor (for example, elF4G, elF4G2, elF3, La protein, or an ITAf, such as a PTBP), or a fusion protein comprising a translation initiation factor (e.g., elF4G, elF4G2, elF3, La protein, or an ITAf, such as PTBP) fused to an RNA-binding protein. In some embodiments, the IRES comprises from 2 to 20 polynucleotides that specifically bind a translation initiation factor (for example, elF4G, elF4G2, elF3, La protein, or an ITAf, such as a PTBP), or a fusion protein comprising a translation initiation factor (e.g., elF4G, elF4G2, elF3, La protein, or an ITAf, such as PTBP) fused to an RNA-binding protein (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 polynucleotides that specifically bind a translation initiation factor (for example, elF4G, elF4G2, elF3, La protein, or an ITAf, such as a PTBP), or a fusion protein comprising a translation initiation factor (e.g., elF4G, elF4G2, elF3, La protein, or an ITAf, such as PTBP) fused to an RNA-binding protein).
In some embodiments, the IRES comprises from 2 to 10 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein).
In some embodiments, the IRES comprises from 3 to 9 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein (e.g., 3, 4, 5, 6, 7, 8, or 9 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein).
In some embodiments, the IRES comprises from 4 to 8 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein (e.g., 4, 5, 6, 7, or 8 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein).
In some embodiments, the IRES comprises from 5 to 7 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein (e.g., 5, 6, or 7 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein).
In some embodiments, the IRES comprises 2 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein. In some embodiments, the IRES comprises 3 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein. In some embodiments, the IRES comprises 4 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein. In some embodiments, the IRES comprises 5 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein. In some embodiments, the IRES comprises 6 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA- binding protein. In some embodiments, the IRES comprises 7 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein. In some embodiments, the IRES comprises 8 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein. In some embodiments, the IRES comprises 9 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein. In some embodiments, the IRES comprises 10 polynucleotides that specifically bind (a) elF4G, (b) La protein, or (c) a fusion protein comprising elF4G or La fused to an RNA-binding protein.
In some embodiments, the nucleic acid does not comprise a 5’ cap.
In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% percent sequence identity to any one of SEQ ID NOs: 191 -201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% percent sequence identity to any one of SEQ ID NOs: 191 -201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% percent sequence identity to any one of SEQ ID NOs: 191 -201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% percent sequence identity to any one of SEQ ID NOs: 191 -201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% percent sequence identity to any one of SEQ ID NOs: 191 -201 . In some embodiments, the nucleic acid includes the nucleotide sequence of any one of SEQ ID NOs: 191 -201 .
In some embodiments, the nucleic acid include a nucleotide sequence with about 70% to about 100% (e.g., about 70% to about 100%, about 75% to about 100%, about 80% to about 100%, about 85% to about 100%, about 90% to about 100%, about 91 % to about 100%, about 92% to about 100%, about 93% to about 100%, about 94% to about 100%, about 95% to about 100%, about 96% to about 100%, about 97% to about 100%, about 98% to about 100%, or about 99% to 100%) sequence identity to an IRES sequence presented in Table 3 (e.g., any one of IRES 19 to IRES 29).
In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 191. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 191. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 191. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 191. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 191. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 191 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 191. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 191. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 191. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 191. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 191. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 191. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 191. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 191. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 191 .
In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 192. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 192. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 192. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 192. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 192. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 192. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 192. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 192. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 192. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 192. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 192. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 192. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 192. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 192. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 192.
In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 193. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 193. In some embodiments, the nucleic
acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 193. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 193. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 193. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 193. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 193. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 193. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 193. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 193. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 193. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 193. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 193. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 193. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 193.
In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 194. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 194. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 194. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 194. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 194. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 194. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 194. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 194. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 194. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 194. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 194. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 194. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 194. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 194. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 194.
In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 195. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 195. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 195. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 195. In some embodiments, the nucleic acid includes a nucleotide sequence with at least
90% sequence identity to SEQ ID NO: 195. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 195. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 195. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 195. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 195. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 195. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 195. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 195. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 195. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 195. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 195.
In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 196. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 196. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 196. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 196. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 196. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 196. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 196. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 196. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 196. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 196. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 196. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 196. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 196. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 196. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 196.
In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 197. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 197. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 197. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 197. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 197. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 197. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 197. In some
embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 197. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 197. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 197. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 197. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 197. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 197. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 197. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 197.
In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 198. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 198. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 198. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 198. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 198. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 198. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 198. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 198. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 198. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 198. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 198. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 198. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 198. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 198. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 198.
In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 199. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 199. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 199. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 199. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 199. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 199. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 199. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 199. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 199. In some embodiments, the nucleic acid includes a nucleotide
sequence with at least 95% sequence identity to SEQ ID NO: 199. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 199. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 199. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 199. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 199. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 199.
In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 200. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 200. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 200. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 200. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 200. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 200. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 200. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 200. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 200. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 200. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 200. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to SEQ ID NO: 200. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 200. In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 200. In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 200.
In some embodiments, the nucleic acid includes a nucleotide sequence with at least 70% sequence identity to SEQ ID NO: 201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to SEQ ID NO: 201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to SEQ ID NO: 201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to SEQ ID NO: 201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to SEQ ID NO: 201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 91% sequence identity to SEQ ID NO: 201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 92% sequence identity to SEQ ID NO: 201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 93% sequence identity to SEQ ID NO: 201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 94% sequence identity to SEQ ID NO: 201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to SEQ ID NO: 201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 96% sequence identity to SEQ ID NO: 201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 97% sequence identity to
SEQ ID NO: 201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 99% sequence identity to SEQ ID NO: 201 . In some embodiments, the nucleic acid includes a nucleotide sequence with 100% sequence identity to SEQ ID NO: 201 .
In another aspect, the disclosure provides nucleic acid including:
(i) an internal ribosome entry site (IRES) including a nucleotide sequence having complementarity sufficient to hybridize to a region within a ribosomal RNA (rRNA), operably linked to
(ii) an open reading frame encoding a polypeptide.
In some embodiments, the IRES does not specifically bind to ribosomal protein.
In some embodiments, the nucleotide sequence of the IRES has at least 70% complementarity to the region within the rRNA, optionally wherein the IRES has at least 71%, 72%, 73%, 74%, 85%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementarity to the region within the rRNA.
In some embodiments, the nucleotide sequence of the IRES has at least 70% complementarity to at least 10, at least 11 , at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21 , at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or 30 or more contiguous nucleobases within the region of the rRNA.
In some embodiments, the nucleotide sequence of the IRES has at least 75% complementarity to at least 10, at least 11 , at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21 , at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or 30 or more contiguous nucleobases within the region of the rRNA, optionally wherein the nucleic acid sequences has at least 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementarity to the at least 10, at least 11 , at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21 , at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or 30 or more contiguous nucleobases within the region of the rRNA.
In some embodiments, the nucleotide sequence of the IRES includes at least 10, at least 11 , at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21 , at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the rRNA.
In some embodiments, the nucleotide sequence of the IRES includes from 10 to 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the rRNA. In some embodiments, the nucleotide sequence of the IRES includes from 12 to 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the rRNA. In some embodiments, the nucleotide sequence of the IRES includes from 15 to 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the rRNA. In some embodiments, the nucleotide sequence of the IRES includes from 18 to 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the rRNA. In
some embodiments, the nucleotide sequence of the IRES includes from 20 to 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the rRNA. In some embodiments, the nucleotide sequence of the IRES includes from 25 to 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the rRNA.
In some embodiments, the nucleotide sequence of the IRES includes 9 or fewer nucleotide mismatches relative to the region of the rRNA, optionally wherein the antisense strand includes 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer, or only 1 mismatch relative to the region of the rRNA.
In some embodiments, the IRES does not include a chemically modified nucleoside. For example, in some embodiments the IRES includes nucleosides selected solely from adenosine, guanosine, cytidine, and uridine.
In some embodiments, the IRES includes one or more chemically modified nucleosides. In some embodiments, the IRES includes one or more chemically modified adenosine, guanosine, cytidine, and/or uridine nucleosides.
In some embodiments, at least 70% of the nucleosides in the IRES are chemically modified (e.g., at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the nucleosides in the IRES are chemically modified).
In some embodiments, at least 70% of the adenosine nucleosides in the IRES are chemically modified (e.g., at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the adenosine nucleosides in the IRES are chemically modified).
In some embodiments, the IRES includes one or more chemically modified adenosine nucleosides. In some embodiments, the modified adenosine of N is 2-amino-purine, 2, 6-diaminopurine, 2-amino-6-halo-purine, 6-halo-purine, 2-amino-6-methyl-purine, 8-azido-adenosine, 7-deaza-adenine, 7- deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2,6- diaminopurine, 7-deaza-8-aza-2, 6-diaminopurine, 1 -methyl-adenosine, 2-methyl-adenine, N6-methyl- adenosine, 2-methylthio-N6-methyl-adenosine, N6-isopentenyl-adenosine, 2-methylthio-N6-isopentenyl- adenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, N6-glycinylcarbamoyl-adenosine, N6-threonylcarbamoyl-adenosine, N6-methyl-N6-threonylcarbamoyl- adenosine, 2-methylthio-N6-threonylcarbamoyl-adenosine, N6,N6-dimethyl-adenosine, N6- hydroxynorvalylcarbamoyl-adenosine, 2-methylthio-N6-hydroxynorvalylcarbamoyl-adenosine, N6-acetyl- adenosine, 7-methyl-adenine, 2-methylthio-adenine, 2-methoxy-adenine, a-thio-adenosine, 2'-O-methyl- adenosine, N6,2'-O-dimethyl-adenosine, N6,N6,2'-O-trimethyl-adenosine, 1 ,2'-O-dimethyl-adenosine, 2'- O-ribosyladenosine, 2-amino-N6-methyl-purine, 1 -thio-adenosine, 8-azido-adenosine, 2’-F-ara- adenosine, 2’-F-adenosine, 2’-OH-ara-adenosine, or N6-(19-amino-pentaoxanonadecyl)-adenosine.
In some embodiments, at least 70% of the guanosine nucleosides in the IRES are chemically modified (e.g., at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the guanosine nucleosides in the IRES are chemically modified).
In some embodiments, the IRES includes one or more chemically modified guanosine nucleosides. In some embodiments, the modified guanosine of N is inosine, 1 -methyl-inosine, wyosine, methylwyosine, 4-demethyl-wyosine, isowyosine, wybutosine, peroxywybutosine, hydroxywybutosine, 7- deaza-guanosine, queuosine, epoxyqueuosine, galactosyl-queuosine, mannosyl-queuosine, 7-cyano-7- deaza-guanosine, 7-aminomethyl-7-deaza-guanosine, archaeosine, 7-deaza-8-aza-guanosine, 6-thio- guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7- methyl-guanosine, 7-methyl-inosine, 6-methoxy-guanosine, 1 -methyl-guanosine, N2-methyl-guanosine, N2,N2-dimethyl-guanosine, N2,7-dimethyl-guanosine, N2, N2,7-dimethyl-guanosine, 8-oxo-guanosine, 7- methyl-8-oxo-guanosine, 1 -methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, N2,N2-dimethyl-6-thio- guanosine, a-thio-guanosine, 2'-O-methyl-guanosine, N2-methyl-2'-O-methyl-guanosine, N2,N2-dimethyl- 2'-O-methyl-guanosine, 1 -methyl-2'-O-methyl-guanosine, N2,7-dimethyl-2'-O-methyl-guanosine, 2'-O- methyl-inosine, 1 ,2'-O-dimethyl-inosine, 2'-O-ribosylguanosine, 1 -thio-guanosine, O6-methyl-guanosine, 2’-F-ara-guanosine, or 2’-F-guanosine.
In some embodiments, at least 70% of the cytidine nucleosides in the IRES are chemically modified (e.g., at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the cytidine nucleosides in the IRES are chemically modified).
In some embodiments, the IRES includes one or more chemically modified cytidine nucleosides. In some embodiments, the modified cytidine of N is 5-aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3- methyl-cytidine, N4-acetyl-cytidine, 5-formyl-cytidine, N4-methyl-cytidine, 5-methyl-cytidine, 5-halo- cytidine, 5-hydroxymethyl-cytidine, 1 -methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo- pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1 -methylpseudoisocytidine, 4-thio-1 -methyl-1 -deaza-pseudoisocytidine, 1 -methyl-1 -deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy- cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, 4-methoxy-1 -methyl- pseudoisocytidine, lysidine, a-thio-cytidine, 2'-O-methyl-cytidine, 5,2'-O-dimethyl-cytidine, N4-acetyl-2'-O- methyl-cytidine, N4,2'-O-dimethyl-cytidine, 5-formyl-2'-O-methyl-cytidine, N4,N4,2'-O-trimethyl-cytidine, 1 - thio-cytidine, 2’-F-ara-cytidine, 2’-F-cytidine, or 2’-OH-ara-cytidine.
In some embodiments, at least 70% of the uridine nucleosides in the IRES are chemically modified (e.g., at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the uridine nucleosides in the IRES are chemically modified).
In some embodiments, the IRES includes one or more chemically modified uridine nucleosides. In some embodiments, the modified uridine of N is 1 -methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine, 4-thio-uridine, 4-thio- pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl- uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5- carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine, 5- carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl-uridine, 5-methoxycarbonylmethyl- 2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl-uridine, 5-methylaminomethyl-2-thio- uridine, 5-methylaminomethyl-2-seleno-uridine, 5-carbamoylmethyl-uridine, 5-
carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl-uridine, 1 - propynyl-pseudouridine, 5-taurinomethyl-uridine, 1 -taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio- uridine, 1 -taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine, 5-methyl-2-thio-uridine, 1 -methyl-4-thio- pseudouridine, 4-thio-1 -methyl-pseudouridine, 3-methylpseudouridine, 2-thio-1 -methyl-pseudouridine, 1 - methyl-1 -deaza-pseudouridine, 2-thio-1 -methyl-1 -deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio- dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4- methoxy-2-thio-pseudouridine, N1 -methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1 -methyl-3- (3-amino-3-carboxypropyl)pseudouridine, 5-(isopentenylaminomethyl)uridine, 5- (isopentenylaminomethyl)-2-thio-uridine, a-thio-uridine, 2'-O-methyl-uridine, 5,2'-O-dimethyl-uridine, 2'-O- methyl-pseudouridine, 2-thio-2'-O-methyl-uridine, 5-methoxycarbonylmethyl-2'-O-methyl-uridine, 5- carbamoylmethyl-2'-O-methyl-uridine, 5-carboxymethylaminomethyl-2'-O-methyl-uridine, 3,2'-O-dimethyl- uridine, 5-(isopentenylaminomethyl)-2'-O-methyl-uridine, 1 -thio-uridine, deoxythymidine, 2’-F-ara-uridine, 2’-F-uridine, 2’-OH-ara-uridine, 5-(2-carbomethoxyvinyl) uridine, or 5-[3-(1 -E-propenylamino)uridine.
In some embodiments, the IRES includes one or more polynucleotide tracts enriched in uridine or a modified uridine
In some embodiments, the IRES includes from 1 to 20 of the polynucleotide tracts enriched in uridine or a modified uridine. In some embodiments, the IRES includes from 2 to 10 of the polynucleotide tracts enriched in uridine or a modified uridine. In some embodiments, the IRES includes from 3 to 6 of the polynucleotide tracts enriched in uridine or a modified uridine. In some embodiments, the IRES includes 3 of the polynucleotide tracts enriched in uridine or a modified uridine. In some embodiments, the IRES includes 4 of the polynucleotide tracts enriched in uridine or a modified uridine. In some embodiments, the IRES includes 5 of the polynucleotide tracts enriched in uridine or a modified uridine. In some embodiments, the IRES includes 6 of the polynucleotide tracts enriched in uridine or a modified uridine.
In some embodiments, at least 70% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine. In some embodiments, at least 75% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine. In some embodiments, at least 80% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine. In some embodiments, at least 85% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine. In some embodiments, at least 90% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine. In some embodiments, at least 95% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine. In some embodiments, all of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine, preferably wherein all of the nucleosides in each of the polynucleotide tracts is a modified uridine.
In some embodiments, each polynucleotide tract, independently, is from 5 to 20 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 15 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 7 to 1 1 nucleosides in length. In some embodiments, each polynucleotide tract is 9 nucleosides in length.
In some embodiments, each polynucleotide tract, independently, includes from 5 to 20 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract,
independently, includes from 6 to 15 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract, independently, includes from 7 to 1 1 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract includes at least 9 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract includes 9 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract is enriched in the modified uridine.
In some embodiments, the modified uridine is 1 -methylpseudouridine, pseudouridine, pyridin-4- one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine, 4-thio-uridine, 4-thio- pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl- uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5- carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine, 5- carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl-uridine, 5-methoxycarbonylmethyl- 2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl-uridine, 5-methylaminomethyl-2-thio- uridine, 5-methylaminomethyl-2-seleno-uridine, 5-carbamoylmethyl-uridine, 5- carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl-uridine, 1 - propynyl-pseudouridine, 5-taurinomethyl-uridine, 1 -taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio- uridine, 1 -taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine, 5-methyl-2-thio-uridine, 1 -methyl-4-thio- pseudouridine, 4-thio-1 -methyl-pseudouridine, 3-methylpseudouridine, 2-thio-1 -methyl-pseudouridine, 1 - methyl-1 -deaza-pseudouridine, 2-thio-1 -methyl-1 -deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio- dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4- methoxy-2-thio-pseudouridine, N1 -methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1 -methyl-3- (3-amino-3-carboxypropyl)pseudouridine, 5-(isopentenylaminomethyl)uridine, 5- (isopentenylaminomethyl)-2-thio-uridine, a-thio-uridine, 2'-O-methyl-uridine, 5,2'-O-dimethyl-uridine, 2'-O- methyl-pseudouridine, 2-thio-2'-O-methyl-uridine, 5-methoxycarbonylmethyl-2'-O-methyl-uridine, 5- carbamoylmethyl-2'-O-methyl-uridine, 5-carboxymethylaminomethyl-2'-O-methyl-uridine, 3,2'-O-dimethyl- uridine, 5-(isopentenylaminomethyl)-2'-O-methyl-uridine, 1 -thio-uridine, deoxythymidine, 2’-F-ara-uridine, 2’-F-uridine, 2’-OH-ara-uridine, 5-(2-carbomethoxyvinyl) uridine, or 5-[3-(1 -E-propenylamino)uridine. In some embodiments, the modified uridine is 1 -methylpseudouridine.
In some embodiments, the IRES is located within a noncoding region of the nucleic acid (e.g., a 5’ untranslated region (UTR)) that is operably linked to the open reading frame. In some embodiments, the open reading frame is further operably linked to a 3’ UTR.
In some embodiments, the polynucleotide tracts are separated from one another by way of one or more spacers that each, independently, include from 5 to 100 nucleosides. In some embodiments, each of the spacers, independently, includes from 10 to 40 nucleosides. In some embodiments, each of the spacers, independently, includes 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, or 38 nucleosides.
In some embodiments, the IRES is represented by the formula:
[(A n - ( CT)m]p wherein: each N is, independently, any nucleoside residue;
each U’ s, independently, uridine or a modified uridine; each n is, independently, an integer from 1 to 100; each m is, independently, an integer from 2 to 15; and p is an integer from 2 to 20.
In some embodiments, each N is, independently, selected from adenosine, a modified adenosine, uridine, a modified uridine, guanosine, a modified guanosine, cytidine, and a modified cytidine. In some embodiments, each N is, independently, selected from adenosine, uridine, a modified uridine, guanosine, and cytidine.
In some embodiments, the modified uridine of N is 1 -methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine, 4-thio- uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo- uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine, 5- carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl-uridine, 5-methoxycarbonylmethyl- 2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl-uridine, 5-methylaminomethyl-2-thio- uridine, 5-methylaminomethyl-2-seleno-uridine, 5-carbamoylmethyl-uridine, 5- carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl-uridine, 1 - propynyl-pseudouridine, 5-taurinomethyl-uridine, 1 -taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio- uridine, 1 -taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine, 5-methyl-2-thio-uridine, 1 -methyl-4-thio- pseudouridine, 4-thio-1 -methyl-pseudouridine, 3-methylpseudouridine, 2-thio-1 -methyl-pseudouridine, 1 - methyl-1 -deaza-pseudouridine, 2-thio-1 -methyl-1 -deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio- dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4- methoxy-2-thio-pseudouridine, N1 -methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1 -methyl-3- (3-amino-3-carboxypropyl)pseudouridine, 5-(isopentenylaminomethyl)uridine, 5- (isopentenylaminomethyl)-2-thio-uridine, a-thio-uridine, 2'-O-methyl-uridine, 5,2'-O-dimethyl-uridine, 2'-O- methyl-pseudouridine, 2-thio-2'-O-methyl-uridine, 5-methoxycarbonylmethyl-2'-O-methyl-uridine, 5- carbamoylmethyl-2'-O-methyl-uridine, 5-carboxymethylaminomethyl-2'-O-methyl-uridine, 3,2'-O-dimethyl- uridine, 5-(isopentenylaminomethyl)-2'-O-methyl-uridine, 1 -thio-uridine, deoxythymidine, 2’-F-ara-uridine, 2’-F-uridine, 2’-OH-ara-uridine, 5-(2-carbomethoxyvinyl) uridine, or 5-[3-(1 -E-propenylamino)uridine. In some embodiments, the modified uridine of N is 1 -methylpseudouridine.
In some embodiments, the modified cytidine of N is 5-aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetyl-cytidine, 5-formyl-cytidine, N4-methyl-cytidine, 5-methyl- cytidine, 5-halo-cytidine, 5-hydroxymethyl-cytidine, 1 -methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo- pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1 -methylpseudoisocytidine, 4-thio-1 -methyl-1 -deaza-pseudoisocytidine, 1 -methyl-1 -deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy- cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, 4-methoxy-1 -methyl- pseudoisocytidine, lysidine, a-thio-cytidine, 2'-O-methyl-cytidine, 5,2'-O-dimethyl-cytidine, N4-acetyl-2'-O- methyl-cytidine, N4,2'-O-dimethyl-cytidine, 5-formyl-2'-O-methyl-cytidine, N4,N4,2'-O-trimethyl-cytidine, 1 - thio-cytidine, 2’-F-ara-cytidine, 2’-F-cytidine, or 2’-OH-ara-cytidine.
In some embodiments, the modified adenosine of A/ is 2-amino-purine, 2, 6-diaminopurine, 2- amino-6-halo-purine, 6-halo-purine, 2-amino-6-methyl-purine, 8-azido-adenosine, 7-deaza-adenine, 7- deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2,6- diaminopurine, 7-deaza-8-aza-2, 6-diaminopurine, 1 -methyl-adenosine, 2-methyl-adenine, N6-methyl- adenosine, 2-methylthio-N6-methyl-adenosine, N6-isopentenyl-adenosine, 2-methylthio-N6-isopentenyl- adenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, N6-glycinylcarbamoyl-adenosine, N6-threonylcarbamoyl-adenosine, N6-methyl-N6-threonylcarbamoyl- adenosine, 2-methylthio-N6-threonylcarbamoyl-adenosine, N6,N6-dimethyl-adenosine, N6- hydroxynorvalylcarbamoyl-adenosine, 2-methylthio-N6-hydroxynorvalylcarbamoyl-adenosine, N6-acetyl- adenosine, 7-methyl-adenine, 2-methylthio-adenine, 2-methoxy-adenine, a-thio-adenosine, 2'-O-methyl- adenosine, N6,2'-O-dimethyl-adenosine, N6,N6,2'-O-trimethyl-adenosine, 1 ,2'-O-dimethyl-adenosine, 2'- O-ribosyladenosine, 2-amino-N6-methyl-purine, 1 -thio-adenosine, 8-azido-adenosine, 2’-F-ara- adenosine, 2’-F-adenosine, 2’-OH-ara-adenosine, or N6-(19-amino-pentaoxanonadecyl)-adenosine.
In some embodiments, the modified guanosine of N is inosine, 1 -methyl-inosine, wyosine, methylwyosine, 4-demethyl-wyosine, isowyosine, wybutosine, peroxywybutosine, hydroxywybutosine, 7- deaza-guanosine, queuosine, epoxyqueuosine, galactosyl-queuosine, mannosyl-queuosine, 7-cyano-7- deaza-guanosine, 7-aminomethyl-7-deaza-guanosine, archaeosine, 7-deaza-8-aza-guanosine, 6-thio- guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7- methyl-guanosine, 7-methyl-inosine, 6-methoxy-guanosine, 1 -methyl-guanosine, N2-methyl-guanosine, N2,N2-dimethyl-guanosine, N2,7-dimethyl-guanosine, N2, N2,7-dimethyl-guanosine, 8-oxo-guanosine, 7- methyl-8-oxo-guanosine, 1 -methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, N2,N2-dimethyl-6-thio- guanosine, a-thio-guanosine, 2'-O-methyl-guanosine, N2-methyl-2'-O-methyl-guanosine, N2,N2-dimethyl- 2'-O-methyl-guanosine, 1 -methyl-2'-O-methyl-guanosine, N2,7-dimethyl-2'-O-methyl-guanosine, 2'-O- methyl-inosine, 1 ,2'-O-dimethyl-inosine, 2'-O-ribosylguanosine, 1 -thio-guanosine, O6-methyl-guanosine, 2’-F-ara-guanosine, or 2’-F-guanosine.
In some embodiments, the modified uridine of U’ is 1 -methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine, 4-thio- uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo- uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine, 5- carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl-uridine, 5-methoxycarbonylmethyl- 2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl-uridine, 5-methylaminomethyl-2-thio- uridine, 5-methylaminomethyl-2-seleno-uridine, 5-carbamoylmethyl-uridine, 5- carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl-uridine, 1 - propynyl-pseudouridine, 5-taurinomethyl-uridine, 1 -taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio- uridine, 1 -taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine, 5-methyl-2-thio-uridine, 1 -methyl-4-thio- pseudouridine, 4-thio-1 -methyl-pseudouridine, 3-methylpseudouridine, 2-thio-1 -methyl-pseudouridine, 1 - methyl-1 -deaza-pseudouridine, 2-thio-1 -methyl-1 -deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio- dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4- methoxy-2-thio-pseudouridine, N1 -methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1 -methyl-3-
(3-amino-3-carboxypropyl)pseudouridine, 5-(isopentenylaminomethyl)uridine, 5- (isopentenylaminomethyl)-2-thio-uridine, a-thio-uridine, 2'-O-methyl-uridine, 5,2'-O-dimethyl-uridine, 2'-O- methyl-pseudouridine, 2-thio-2'-O-methyl-uridine, 5-methoxycarbonylmethyl-2'-O-methyl-uridine, 5- carbamoylmethyl-2'-O-methyl-uridine, 5-carboxymethylaminomethyl-2'-O-methyl-uridine, 3,2'-O-dimethyl- uridine, 5-(isopentenylaminomethyl)-2'-O-methyl-uridine, 1 -thio-uridine, deoxythymidine, 2’-F-ara-uridine, 2’-F-uridine, 2’-OH-ara-uridine, 5-(2-carbomethoxyvinyl) uridine, or 5-[3-(1 -E-propenylamino)uridine. In some embodiments, the modified uridine of U’ is 1 -methylpseudouridine.
In some embodiments, each n is, independently, an integer from 10 to 40. In some embodiments, each n is, independently, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, or 38. In some embodiments, each m is, independently, an integer from 2 to 15. In some embodiments, each m is, independently, an integer from 7 to 1 1 . In some embodiments, each m is 9.
In some embodiments, p is an integer from 2 to 10. In some embodiments, p is an integer from 3 to 6, optionally wherein p is 3 or 6.
In some embodiments, the nucleic acid is RNA. In some embodiments, the nucleic acid is linear. In some embodiments, the nucleic acid is circular.
In some embodiments, the open reading from consists of nucleosides selected from adenosine, a modified adenosine, uridine, a modified uridine, guanosine, a modified guanosine, cytidine, and a modified cytidine. In some embodiments, the open reading from consists of nucleosides selected from adenosine, uridine, a modified uridine, guanosine, and cytidine.
In some embodiments, the modified uridine of the open reading frame is 1 -methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio- uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl-uridine, 5- methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl-uridine, 5- methylaminomethyl-2-thio-uridine, 5-methylaminomethyl-2-seleno-uridine, 5-carbamoylmethyl-uridine, 5- carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl-uridine, 1 - propynyl-pseudouridine, 5-taurinomethyl-uridine, 1 -taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio- uridine, 1 -taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine, 5-methyl-2-thio-uridine, 1 -methyl-4-thio- pseudouridine, 4-thio-1 -methyl-pseudouridine, 3-methylpseudouridine, 2-thio-1 -methyl-pseudouridine, 1 - methyl-1 -deaza-pseudouridine, 2-thio-1 -methyl-1 -deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio- dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4- methoxy-2-thio-pseudouridine, N1 -methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1 -methyl-3- (3-amino-3-carboxypropyl)pseudouridine, 5-(isopentenylaminomethyl)uridine, 5- (isopentenylaminomethyl)-2-thio-uridine, a-thio-uridine, 2'-O-methyl-uridine, 5,2'-O-dimethyl-uridine, 2'-O- methyl-pseudouridine, 2-thio-2'-O-methyl-uridine, 5-methoxycarbonylmethyl-2'-O-methyl-uridine, 5- carbamoylmethyl-2'-O-methyl-uridine, 5-carboxymethylaminomethyl-2'-O-methyl-uridine, 3,2'-O-dimethyl- uridine, 5-(isopentenylaminomethyl)-2'-O-methyl-uridine, 1 -thio-uridine, deoxythymidine, 2’-F-ara-uridine,
2’-F-uridine, 2’-0H-ara-uridine, 5-(2-carbomethoxyvinyl) uridine, or 5-[3-(1 -E-propenylamino)uridine. In some embodiments, the modified uridine of the open reading frame is 1 -methylpseudouridine.
In some embodiments, the modified cytidine of N is 5-aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetyl-cytidine, 5-formyl-cytidine, N4-methyl-cytidine, 5-methyl- cytidine, 5-halo-cytidine, 5-hydroxymethyl-cytidine, 1 -methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo- pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1 -methylpseudoisocytidine, 4-thio-1 -methyl-1 -deaza-pseudoisocytidine, 1 -methyl-1 -deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy- cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, 4-methoxy-1 -methyl- pseudoisocytidine, lysidine, a-thio-cytidine, 2'-O-methyl-cytidine, 5,2'-O-dimethyl-cytidine, N4-acetyl-2'-O- methyl-cytidine, N4,2'-O-dimethyl-cytidine, 5-formyl-2'-O-methyl-cytidine, N4,N4,2'-O-trimethyl-cytidine, 1 - thio-cytidine, 2’-F-ara-cytidine, 2’-F-cytidine, or 2’-OH-ara-cytidine.
In some embodiments, the modified adenosine of N is 2-amino-purine, 2, 6-diaminopurine, 2- amino-6-halo-purine, 6-halo-purine, 2-amino-6-methyl-purine, 8-azido-adenosine, 7-deaza-adenine, 7- deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2,6- diaminopurine, 7-deaza-8-aza-2, 6-diaminopurine, 1 -methyl-adenosine, 2-methyl-adenine, N6-methyl- adenosine, 2-methylthio-N6-methyl-adenosine, N6-isopentenyl-adenosine, 2-methylthio-N6-isopentenyl- adenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, N6-glycinylcarbamoyl-adenosine, N6-threonylcarbamoyl-adenosine, N6-methyl-N6-threonylcarbamoyl- adenosine, 2-methylthio-N6-threonylcarbamoyl-adenosine, N6,N6-dimethyl-adenosine, N6- hydroxynorvalylcarbamoyl-adenosine, 2-methylthio-N6-hydroxynorvalylcarbamoyl-adenosine, N6-acetyl- adenosine, 7-methyl-adenine, 2-methylthio-adenine, 2-methoxy-adenine, a-thio-adenosine, 2'-O-methyl- adenosine, N6,2'-O-dimethyl-adenosine, N6,N6,2'-O-trimethyl-adenosine, 1 ,2'-O-dimethyl-adenosine, 2'- O-ribosyladenosine, 2-amino-N6-methyl-purine, 1 -thio-adenosine, 8-azido-adenosine, 2’-F-ara- adenosine, 2’-F-adenosine, 2’-OH-ara-adenosine, or N6-(19-amino-pentaoxanonadecyl)-adenosine.
In some embodiments, the modified guanosine of N is inosine, 1 -methyl-inosine, wyosine, methylwyosine, 4-demethyl-wyosine, isowyosine, wybutosine, peroxywybutosine, hydroxywybutosine, 7- deaza-guanosine, queuosine, epoxyqueuosine, galactosyl-queuosine, mannosyl-queuosine, 7-cyano-7- deaza-guanosine, 7-aminomethyl-7-deaza-guanosine, archaeosine, 7-deaza-8-aza-guanosine, 6-thio- guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7- methyl-guanosine, 7-methyl-inosine, 6-methoxy-guanosine, 1 -methyl-guanosine, N2-methyl-guanosine, N2,N2-dimethyl-guanosine, N2,7-dimethyl-guanosine, N2, N2,7-dimethyl-guanosine, 8-oxo-guanosine, 7- methyl-8-oxo-guanosine, 1 -methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, N2,N2-dimethyl-6-thio- guanosine, a-thio-guanosine, 2'-O-methyl-guanosine, N2-methyl-2'-O-methyl-guanosine, N2,N2-dimethyl- 2'-O-methyl-guanosine, 1 -methyl-2'-O-methyl-guanosine, N2,7-dimethyl-2'-O-methyl-guanosine, 2'-O- methyl-inosine, 1 ,2'-O-dimethyl-inosine, 2'-O-ribosylguanosine, 1 -thio-guanosine, O6-methyl-guanosine, 2’-F-ara-guanosine, or 2’-F-guanosine.
In some embodiments, the polypeptide encoded by the open reading frame is a secreted protein, a cytokine, a growth factor, an enzyme, an immunomodulator, an antibody or antigen-binding fragment thereof, a cell-penetrating peptide, an extracellular membrane-bound protein, an intracellular membranebound protein, a cytoplasmic protein, a cytoskeletal protein, or a nuclear protein.
In some embodiments, the nucleic acid does not include a 5’ cap. In some embodiments, the nucleic acid includes a 5’ cap.
In some embodiments, the nucleotide sequence of the IRES includes at least 75% sequence identity to SEQ ID NO: 185 or SEQ ID NO: 190. In some embodiments, the nucleotide sequence of the IRES includes at least 80% sequence identity to SEQ ID NO: 185 or SEQ ID NO: 190. In some embodiments, the nucleotide sequence of the IRES includes at least 85% sequence identity to SEQ ID NO: 185 or SEQ ID NO: 190. In some embodiments, the nucleotide sequence of the IRES has at least 90% sequence identity to SEQ ID NO: 185 or SEQ ID NO: 190. In some embodiments, the nucleotide sequence of the IRES has a at least 95% sequence identity to SEQ ID NO: 185 or SEQ ID NO: 190, optionally wherein the nucleotide sequence of the IRES has at least 96%, 97%, 98%, or 99% sequence identity SEQ ID NO: 185 or SEQ ID NO: 190. In some embodiments, the nucleotide sequence of the IRES is SEQ ID NO: 185 or SEQ ID NO: 190.
In some embodiments, the IRES includes one or more polynucleotides that specifically bind a translation initiation factor (e.g., eukaryotic translation initiation factor 4 G (elF4G), eukaryotic translation initiation factor 4G2 (elF4G2), eukaryotic translation initiation factor 3 (elF3), La protein, or an IRES transacting factors (ITAf)), or a fusion protein including a translation initiation factor (e.g., elF4G, elF4G2, elF3, La protein, or an ITAf) fused to an RNA-binding protein. In some embodiments, the one or more polynucleotides specifically bind elF4G.
In some embodiments, each of the one or more polynucleotides, independently, has a nucleic acid sequence that is at least 75% identical to ACUCACUAUUUGUUUUCGCGCCCAGUUGCAAAAA (SEQ ID NO: 1 ), optionally wherein each U residue in SEQ ID NO: 1 is replaced with 1 - methylpseudouridine.
In some embodiments, each of the one or more polynucleotides, independently, has a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO: 1 (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 1 ), optionally wherein each U residue in SEQ ID NO: 1 is replaced with 1 - methylpseudouridine.
In some embodiments, the IRES includes one or more polynucleotides that specifically bind to a fusion protein including a translation initiation factor (e.g., elF4G, elF4G2, elF3, La protein, or an ITAf) fused to an RNA-binding protein, optionally wherein the RNA-binding protein is MS2-binding protein and the one or more polynucleotides include one or more MS2 RNA hairpins.
In some embodiments, the nucleic acid does not include a 5’ cap. In some embodiments, the nucleic acid includes a 5’ cap.
In some embodiments, the nucleic acid includes a nucleotide sequence with at least 75% sequence identity to any one of SEQ ID NO: 191 -201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 80% sequence identity to any one of SEQ ID NO: 191 -201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 85% sequence identity to any one of SEQ ID NO: 191 -201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 90% sequence identity to any one of SEQ ID NO: 191 -201 . In some embodiments, the nucleic acid includes a nucleotide sequence with at least 95% sequence identity to any one of SEQ ID
NO: 191 -201 . In some embodiments, the nucleic acid includes the nucleotide sequence of any one of SEQ ID NO: 191 -201.
In some embodiments, rRNA is a eukaryotic rRNA. In some embodiments, the rRNA is from a 60S or 40S ribosomal subunit, optionally wherein the rRNA is selected from the group consisting of a 25S, 28S, 18S, 5.8S, and 5S rRNA.
In some embodiments, in any of any of the foregoing aspects or embodiments of the disclosure, the nucleic acid sequence surrounding (e.g., 5’ and/or 3’ relative to) the IRES has a single stranded RNA structure.
In a further aspect, the disclosure provides a polypeptide expression system comprising:
(i) the nucleic acid of the foregoing aspect (or any of the above embodiments thereof); and
(ii) a nucleic acid comprising an open reading frame that encodes elF4G, La protein, or a functional variant thereof.
In some embodiments, the nucleic acid of (i) and the nucleic acid of (ii) are separate molecules.
In some embodiments, the nucleic acid of (ii) comprises, from 5’ to 3’:
(i) a 5’ UTR;
(ii) the open reading frame encoding the elF4G, La protein, or functional variant thereof; and
(iii) a 3’ UTR.
In some embodiments, the nucleic acid of (ii) further comprises a 5’ cap operably linked to the 5’ UTR.
In a further aspect, the disclosure provides a host cell comprising the nucleic acid or polypeptide expression system of any one of the above aspects or embodiments of the disclosure. In some embodiments, the host cell is a eukaryotic cell. In some embodiments, the eukaryotic cell is a mammalian cell. In some embodiments, the mammalian cell is a human cell.
In another aspect, the disclosure provides a method of expressing a polypeptide in a subject, the method comprising administering to the subject the nucleic acid or polypeptide expression system of any of the above aspects or embodiments of the disclosure.
In another aspect, the disclosure provides a method of expressing a polypeptide in a cell or population of cells, the method comprising administering to the subject the nucleic acid or polypeptide expression system of any of the above aspects or embodiments of the disclosure.
In another aspect, the disclosure provides a method of treating a disease or condition associated with a deficiency in an endogenous polypeptide, the method comprising administering to the subject the nucleic acid or polypeptide expression system of any of the above aspects or embodiments of the disclosure, with the proviso that the polypeptide encoded by the nucleic acid or polypeptide expression system corresponds to the polypeptide whose deficiency is associated with the disease or condition.
DEFINITIONS
In order that the present disclosure can be more readily understood, certain terms are first defined. As used in this application, except as otherwise expressly provided herein, each of the following terms shall have the meaning set forth below. Additional definitions are set forth throughout the application.
The present disclosure includes embodiments in which exactly one member of the group is present in, employed in, or otherwise relevant to a given product or process. The invention includes embodiments in which more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process.
In this specification and the appended claims, the singular forms "a", "an" and "the" include plural referents unless the context clearly dictates otherwise. The terms "a" (or "an"), as well as the terms "one or more," and "at least one" can be used interchangeably herein. In certain aspects, the term "a" or "an" means "single." In other aspects, the term "a" or "an" includes "two or more" or "multiple."
Furthermore, "and/or" where used herein is to be taken as specific disclosure of each of the two specified features or components with or without the other. Thus, the term "and/or" as used in a phrase such as "A and/or B" herein is intended to include "A and B," "A or B," "A" (alone), and "B" (alone). Likewise, the term "and/or" as used in a phrase such as "A, B, and/or C" is intended to encompass each of the following aspects: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure is related. For example, the Concise Dictionary of Biomedicine and Molecular Biology, Juo, Pei-Show, 2nd ed., 2002, CRC Press; The Dictionary of Cell and Molecular Biology, 3rd ed., 1999, Academic Press; and the Oxford Dictionary of Biochemistry and Molecular Biology, Revised, 2000, Oxford University Press, provide one of skill with a general dictionary of many of the terms used in this disclosure.
Wherever aspects are described herein with the language "comprising," otherwise analogous aspects described in terms of "consisting of" and/or "consisting essentially of" are also provided.
Where ranges are given, endpoints are included. Furthermore, unless otherwise indicated or otherwise evident from the context and understanding of one of ordinary skill in the art, values that are expressed as ranges can assume any specific value or subrange within the stated ranges in different embodiments of the present disclosure, to the tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise.
Units, prefixes, and symbols are denoted in their Systeme International de Unites (SI) accepted form. Numeric ranges are inclusive of the numbers defining the range. Where a range of values is recited, it is to be understood that each intervening integer value, and each fraction thereof, between the recited upper and lower limits of that range is also specifically disclosed, along with each subrange between such values. The upper and lower limits of any range can independently be included in or excluded from the range, and each range where either, neither or both limits are included is also encompassed within the invention. Where a value is explicitly recited, it is to be understood that values which are about the same quantity or amount as the recited value are also within the scope of the present disclosure. Where a combination is disclosed, each subcombination of the elements of that combination is also specifically disclosed and is within the scope of the present disclosure. Conversely, where different elements or groups of elements are individually disclosed, combinations thereof are also disclosed. Where any element of an invention is disclosed as having a plurality of alternatives, examples of that invention in which each alternative is excluded singly or in any combination with the other alternatives are also hereby
disclosed; more than one element of an invention can have such exclusions, and all combinations of elements having such exclusions are hereby disclosed.
As used herein, the term “about” refers to a value that is no more than 10% above or below the value being described. For example, the term “about 5 nM” indicates a range of from 4.5 nM to 5.5 nM.
As used herein, the term "biocompatible" means compatible with living cells, tissues, organs or systems posing little to no risk of injury, toxicity or rejection by the immune system.
As used herein, the term "biodegradable" means capable of being broken down into innocuous products by the action of living things.
As used herein, the phrase "biologically active" refers to a characteristic of any substance that has activity in a biological system and/or organism. For instance, a substance that, when administered to an organism, has a biological effect on that organism, is considered to be biologically active. In particular embodiments, a polynucleotide of the present disclosure can be considered biologically active if even a portion of the polynucleotide is biologically active or mimics an activity considered biologically relevant.
As used herein, the term "amino acid substitution" refers to the replacement of an amino acid residue present in a parent or reference polypeptide (e.g., a target polypeptide described herein) with another amino acid residue. An amino acid can be substituted in a parent or reference sequence, for example, via chemical peptide synthesis or through recombinant methods known in the art. Accordingly, a reference to a "substitution at position X" refers to the substitution of an amino acid present at position X with an alternative amino acid residue. In some aspects, substitution patterns can be described according to the scheme AnY, wherein A is the single letter code corresponding to the amino acid naturally or originally present at position n, and Y is the substituting amino acid residue. In some aspects, substitution patterns can be described according to the scheme An(YZ), wherein A is the single letter code corresponding to the amino acid residue substituting the amino acid naturally or originally present at position n, and Y and Z are alternative substituting amino acid residue.
In the context of the present disclosure, substitutions (even when they referred to as amino acid substitution) may be conducted at the nucleic acid level, i.e., substituting an amino acid residue with an alternative amino acid residue may be conducted by substituting the codon encoding the first amino acid with a codon encoding the second amino acid.
As used herein, the terms “conservative mutation,” “conservative substitution,” “conservative amino acid substitution,” and the like refer to a substitution of one or more amino acids for one or more different amino acids that exhibit similar physicochemical properties, such as polarity, electrostatic charge, and/or steric volume. These properties are summarized for each of the twenty naturally-occurring amino acids in Table 1 below.
Table 1. Representative physicochemical properties of naturally-occurring amino acids
From this table it is appreciated that the conservative amino acid families include, e.g., (i) G, A, V, L, I, P, and M; (ii) D and E; (iii) C, S and T; (iv) H, K and R; (v) N and Q; and (vi) F, Y and W. A conservative mutation or substitution is therefore one that substitutes one amino acid for a member of the same amino acid family (e.g., a substitution of Ser for Thr or Lys for Arg).
As used herein, the term “conjugate” refers to a compound formed by the chemical bonding of a reactive functional group of one molecule with an appropriately reactive functional group of another molecule. Conjugates may additionally be produced, e.g., as two polypeptide domains covalently bound to one another as part of a single polypeptide chain that is synthesized by the translation of a single RNA transcript encoding both polypeptides in frame with one another.
As used herein, the term "sequence optimization" refers to a process or series of processes by which nucleobases in a reference nucleic acid sequence are replaced with alternative nucleobases, resulting in a nucleic acid sequence with improved properties, e.g., improved protein expression or decreased immunogenicity. In general, the goal in sequence optimization is to produce a synonymous nucleotide sequence than encodes the same polypeptide sequence encoded by the reference nucleotide sequence. Thus, there are no amino acid substitutions (as a result of codon optimization) in the polypeptide encoded by
the codon optimized nucleotide sequence with respect to the polypeptide encoded by the reference nucleotide sequence.
As used herein, the terms "codon substitution" or "codon replacement" in the context of sequence optimization refer to replacing a codon present in a reference nucleic acid sequence with another codon. A codon can be substituted in a reference nucleic acid sequence, for example, via chemical peptide synthesis or through recombinant methods known in the art. Accordingly, references to a "substitution" or "replacement" at a certain location in a nucleic acid sequence (e.g., an mRNA) or within a certain region or subsequence of a nucleic acid sequence (e.g., an mRNA) refer to the substitution of a codon at such location or region with an alternative codon.
As used herein, the terms "coding region" and "region encoding" and grammatical variants thereof, refer to an Open Reading Frame (ORF) in a polynucleotide that upon expression yields a polypeptide or protein.
The term “complementarity sufficient to hybridize,” as used herein, refers to a nucleic acid sequence or a portion thereof that need not be fully complementary (e.g., 100% complementary) to a target region or a nucleic acid sequence or a portion thereof that has one or more nucleotide mismatches relative to the target region but that is still capable of hybridizing to the target region under specified conditions. For example, the nucleic acid may be, e.g., 95% complementary, 90%, complementary, 85% complementary, 80% complementary, 75% complementary, 70% complementary, 65% complementary, 60% complementary, 55% complementary, 50% complementary, or less, but still form sufficient base pairs with the target so as to hybridize across its length.
As used herein, the term “contacting” means establishing a physical connection between two or more entities. For example, contacting a mammalian cell with a nanoparticle composition means that the mammalian cell and a nanoparticle are made to share a physical connection. Methods of contacting cells with external entities both in vivo and ex vivo are well known in the biological arts. For example, contacting a nanoparticle composition and a mammalian cell disposed within a mammal can be performed by varied routes of administration (e.g., intravenous, intramuscular, intradermal, and subcutaneous) and can involve varied amounts of nanoparticle compositions. Moreover, more than one mammalian cell can be contacted by a nanoparticle composition.
As used herein, the term “delivering” means providing an entity to a destination. For example, delivering a polynucleotide to a subject can involve administering a nanoparticle composition including the polynucleotide to the subject (e.g., by an intravenous, intramuscular, intradermal, or subcutaneous route). Administration of a nanoparticle composition to a mammal or mammalian cell can involve contacting one or more cells with the nanoparticle composition.
As used herein, "delivery agent" refers to any substance that facilitates, at least in part, the in vivo, in vitro, or ex vivo delivery of a polynucleotide to targeted cells.
As used herein, "expression" of a nucleic acid sequence refers to one or more of the following events: (1 ) production of an mRNA template from a DNA sequence (e.g., by transcription); (2) processing of an mRNA transcript (e.g., by splicing, editing, 5' cap formation, and/or 3' end processing); (3) translation of an mRNA into a polypeptide or protein; and (4) post-translational modification of a polypeptide or protein.
As used herein, the term “lipid nanoparticle” refers to a transfer vehicle including one or more lipids (e.g., cationic lipids, non-cationic lipids, and PEG-modified lipids). Exemplary lipid nanoparticles are formulated to deliver one or more mRNA to one or more target cells. Examples of suitable lipids include, for example, the phosphatidyl compounds (e.g., phosphatidylglycerol, phosphatidylcholine, phosphatidylserine, phosphatidylethanolamine, sphingolipids, cerebrosides, and gangliosides). Lipid nanoparticles may contain a cationic lipid, or a lipid species with a net positive charge at a selected pH (e.g., physiological pH), to encapsulate and/or enhance the delivery of mRNA into the target cells.
As used herein, the term “helper lipid” refers to a compound or molecule that includes a lipidic moiety (for insertion into a lipid layer, e.g., lipid bilayer) and a polar moiety (for interaction with physiologic solution at the surface of the lipid layer). Typically the helper lipid is a phospholipid. A function of the helper lipid is to “complement” the amino lipid and increase the fusogenicity of the bilayer and/or to help facilitate endosomal escape, e.g., of nucleic acid delivered to cells. Helper lipids are also believed to be a key structural component to the surface of the LNP.
As used herein, the term “ionizable amino lipid” includes those lipids having one, two, three, or more fatty acid or fatty alkyl chains and a pH-titratable amino head group (e.g., an alkylamino or dialkylamino head group). An ionizable amino lipid is typically protonated (i.e., positively charged) at a pH below the pKa of the amino head group and is substantially not charged at a pH above the pKa. Such ionizable amino lipids include, but are not limited to DLin-MC3-DMA (MC3), (13Z,165Z)-N,N-dimethyl-3- nonydocosa-13-16-dien-1 -amine (L608), and a compound of any one of Formula I, II, and II described herein (e.g., any one of Compound 1-1 , Compound I-2, Compound I-3, or Compound l-VI).
As used herein, a "linker" refers to a group of atoms, e.g., 10-1 ,000 atoms, and can be comprised of the atoms or groups such as, but not limited to, carbon, amino, alkylamino, oxygen, sulfur, sulfoxide, sulfonyl, carbonyl, and imine. The linker can be attached to a modified nucleoside or nucleotide on the nucleobase or sugar moiety at a first end, and to a payload, e.g., a detectable or therapeutic agent, at a second end. The linker can be of sufficient length as to not interfere with incorporation into a nucleic acid sequence. The linker can be used for any useful purpose, such as to form polynucleotide multimers (e.g., through linkage of two or more chimeric polynucleotides molecules or IVT polynucleotides) or polynucleotides conjugates, as well as to administer a payload, as described herein. Examples of chemical groups that can be incorporated into the linker include, but are not limited to, alkyl, alkenyl, alkynyl, amido, amino, ether, thioether, ester, alkylene, heteroalkylene, aryl, or heterocyclyl, each of which can be optionally substituted, as described herein. Examples of linkers include, but are not limited to, unsaturated alkanes, polyethylene glycols (e.g., ethylene or propylene glycol monomeric units, e.g., diethylene glycol, dipropylene glycol, triethylene glycol, tripropylene glycol, tetraethylene glycol, or tetraethylene glycol), and dextran polymers and derivatives thereof., Other examples include, but are not limited to, cleavable moieties within the linker, such as, for example, a disulfide bond (-S-S-) or an azo bond (-N=N-), which can be cleaved using a reducing agent or photolysis. Non-limiting examples of a selectively cleavable bond include an amido bond can be cleaved for example by the use of tris(2- carboxyethyl)phosphine (TCEP), or other reducing agents, and/or photolysis, as well as an ester bond can be cleaved for example by acidic or basic hydrolysis.
As used herein, the terms “messenger RNA” or “mRNA” refer to any polynucleotide which encodes a polypeptide of interest and which is capable of being translated to produce the encoded
polypeptide of interest in vitro, in vivo, in situ, or ex vivo. Traditionally, the basic components of an mRNA molecule include a coding region, a 5’UTR, a 3’UTR, a 5’ cap, and a poly-A tail.
As used herein the term "modified" refers to a changed state or structure of a molecule of the present disclosure. Molecules can be modified in many ways, including chemically, structurally, and functionally. In some embodiments, the mRNA molecules of the present disclosure are modified by the introduction of non-natural nucleosides and/or nucleotides, e.g., as it relates to the natural ribonucleotides A, U, G, and/or C. Examples of “modified” nucleosides are provided herein.
As used herein, the terms “modified messenger RNA” or “modified mRNA” refer to mRNA polynucleotides that include naturally occurring and/or non-naturally occurring modifications, for example, of a sugar, a nucleobase, or an internucleoside linkage (e.g., to a linking phosphate, to a phosphodiester linkage, or to the phosphodiester backbone). Non-natural modified nucleotides may be introduced during synthesis of post-synthesis of the polynucleotides to achieve desired functions or properties. The modifications may be present on an internucleoside linkage, purine or pyrimidine base, or sugar. The modification may be introduced with chemical synthesis or with a polymerase enzyme at the terminal of a chain or anywhere else in the chain. Any of the regions of a polynucleotide may be chemically modified.
As used herein, "unmodified" refers to any substance, compound, or molecule prior to being changed in some way. Unmodified can, but does not always, refer to the wild type or native form of a biomolecule. Molecules can undergo a series of modifications whereby each modified molecule can serve as the "unmodified" starting molecule for a subsequent modification.
Uracil is one of the four nucleobases in the nucleic acid of RNA, and it is represented by the letter U. Uracil can be attached to a ribose ring, or more specifically, a ribofuranose via an Ni-glycosidic bond to yield the nucleoside uridine. The nucleoside uridine is also commonly abbreviated according to the one letter code of its nucleobase, i.e., U. Thus, in the context of the present disclosure, when a monomer in a polynucleotide sequence is U, such U is designated interchangeably as a "uracil" or a "uridine."
The terms "uridine content" or "uracil content" are interchangeable and refer to the amount of uracil or uridine present in a certain nucleic acid sequence. Uridine content or uracil content can be expressed as an absolute value (total number of uridine or uracil in the sequence) or relative (uridine or uracil percentage respect to the total number of nucleobases in the nucleic acid sequence).
The terms "uridine-modified sequence" refers to a sequence optimized nucleic acid (e.g., a synthetic mRNA sequence) with a different overall or local uridine content (higher or lower uridine content) or with different uridine patterns (e.g., gradient distribution or clustering) with respect to the uridine content and/or uridine patterns of a candidate nucleic acid sequence. In the content of the present disclosure, the terms "uridine-modified sequence" and "uracil-modified sequence" are considered equivalent and interchangeable.
A "high uridine codon" is defined as a codon comprising two or three uridines, a "low uridine codon" is defined as a codon comprising one uridine, and a "no uridine codon" is a codon without any uridines. In some embodiments, a uridine-modified sequence comprises substitutions of high uridine codons with low uridine codons, substitutions of high uridine codons with no uridine codons, substitutions of low uridine codons with high uridine codons, substitutions of low uridine codons with no uridine codons, substitution of no uridine codons with low uridine codons, substitutions of no uridine codons with high uridine codons, and combinations thereof. In some embodiments, a high uridine codon can be replaced
with another high uridine codon. In some embodiments, a low uridine codon can be replaced with another low uridine codon. In some embodiments, a no uridine codon can be replaced with another no uridine codon. A uridine-modified sequence can be uridine enriched or uridine rarefied.
As used herein, the terms "uridine enriched" and grammatical variants refer to the increase in uridine content (expressed in absolute value or as a percentage value) in a sequence optimized nucleic acid (e.g., a synthetic mRNA sequence) with respect to the uridine content of the corresponding candidate nucleic acid sequence. Uridine enrichment can be implemented by substituting codons in the candidate nucleic acid sequence with synonymous codons containing less uridine nucleobases. Uridine enrichment can be global (i.e., relative to the entire length of a candidate nucleic acid sequence) or local (i.e., relative to a subsequence or region of a candidate nucleic acid sequence).
As used herein, the terms "uridine rarefied" and grammatical variants refer to a decrease in uridine content (expressed in absolute value or as a percentage value) in a sequence optimized nucleic acid (e.g., a synthetic mRNA sequence) with respect to the uridine content of the corresponding candidate nucleic acid sequence. Uridine rarefication can be implemented by substituting codons in the candidate nucleic acid sequence with synonymous codons containing less uridine nucleobases. Uridine rarefication can be global (i.e., relative to the entire length of a candidate nucleic acid sequence) or local (i.e., relative to a subsequence or region of a candidate nucleic acid sequence).
As used herein, the term “initiation codon”, used interchangeably with the term “start codon”, refers to the first codon of an open reading frame that is translated by the ribosome and is comprised of a triplet of linked adenine-uracil-guanine nucleobases. The initiation codon is depicted by the first letter codes of adenine (A), uracil (U), and guanine (G) and is often written simply as “AUG”. Although natural mRNAs may use codons other than AUG as the initiation codon, which are referred to herein as “alternative initiation codons”, the initiation codons of polynucleotides described herein use the AUG codon. During the process of translation initiation, the sequence comprising the initiation codon is recognized via complementary base-pairing to the anticodon of an initiator tRNA (Met-tRNAiMet) bound by the ribosome. Open reading frames may contain more than one AUG initiation codon, which are referred to herein as “alternate initiation codons”.
The initiation codon plays an important role in translation initiation. The initiation codon is the first codon of an open reading frame that is translated by the ribosome. Typically, the initiation codon comprises the nucleotide triplet AUG, however, in some instances translation initiation can occur at other codons comprised of distinct nucleotides. The initiation of translation in eukaryotes is a multistep biochemical process that involves numerous protein-protein, protein-RNA, and RNA-RNA interactions between messenger RNA molecules (mRNAs), the 40S ribosomal subunit, other components of the translation machinery (e.g., eukaryotic initiation factors; elFs). The current model of mRNA translation initiation postulates that the pre-initiation complex (alternatively “43S pre-initiation complex”; abbreviated as “PIC”) translocates from the site of recruitment on the mRNA (typically the 5' cap) to the initiation codon by scanning nucleotides in a 5' to 3' direction until the first AUG codon that resides within a specific translation-promotive nucleotide context (the Kozak sequence) is encountered (Kozak (1989) J Cell Biol 108:229-241 ). Scanning by the PIC ends upon complementary base-pairing between nucleotides comprising the anticodon of the initiator Met-tRNAiMet transfer RNA and nucleotides comprising the initiation codon of the mRNA. Productive base-pairing between the AUG codon and the Met-tRNAiMet
anticodon elicits a series of structural and biochemical events that culminate in the joining of the large 60S ribosomal subunit to the PIC to form an active ribosome that is competent for translation elongation.
The term “Kozak sequence” (also referred to as “Kozak consensus sequence”) refers to a translation initiation enhancer element to enhance expression of a gene or open reading frame, and which in eukaryotes, is located in the 5' UTR. The Kozak consensus sequence was originally defined as the sequence GCCRCC (SEQ ID NO: 2), where R = a purine, following an analysis of the effects of single mutations surrounding the initiation codon (AUG) on translation of the preproinsulin gene (Kozak (1986) Cell 44:283-292). Polynucleotides disclosed herein comprise a Kozak consensus sequence, or a derivative or modification thereof. (Examples of translational enhancer compositions and methods of use thereof, see U.S. Pat. No. 5,807,707 to Andrews et al., incorporated herein by reference in its entirety; U.S. Pat. No. 5,723,332 to Chernajovsky, incorporated herein by reference in its entirety; U.S. Pat. No. 5,891 ,665 to Wilson, incorporated herein by reference in its entirety.)
As used herein, the term “nucleobase” (alternatively “nucleotide base” or “nitrogenous base”) refers to a purine or pyrimidine heterocyclic compound found in nucleic acids, including any derivatives or analogs of the naturally occurring purines and pyrimidines that confer improved properties (e.g., binding affinity, nuclease resistance, chemical stability) to a nucleic acid or a portion or segment thereof. Adenine, cytosine, guanine, thymine, and uracil are the nucleobases predominately found in natural nucleic acids. Other natural, non-natural, and/or synthetic nucleobases, as known in the art and/or described herein, can be incorporated into nucleic acids. Unless otherwise specified, the nucleobase sequence of a SEQ ID NO described herein encompasses both natural nucleobases and chemically modified nucleobases (e.g., a “U” designation in a SEQ ID NO encompasses both uracil and chemically modified uracil).
As used herein, the term “nucleoside” refers to a compound containing a sugar molecule (e.g., a ribose in RNA or a deoxyribose in DNA), or derivative or analog thereof, covalently linked to a nucleobase (e.g., a purine or pyrimidine), or a derivative or analog thereof (also referred to herein as “nucleobase”), but lacking an internucleoside linking group (e.g., a phosphate group). As used herein, the term “nucleotide” refers to a nucleoside covalently bonded to an internucleoside linking group (e.g., a phosphate group), or any derivative, analog, or modification thereof that confers improved chemical and/or functional properties (e.g., binding affinity, nuclease resistance, chemical stability) to a nucleic acid or a portion or segment thereof.
As used herein, the term “open reading frame”, abbreviated as “ORF”, refers to a segment or region of an mRNA molecule that encodes a polypeptide. The ORF comprises a continuous stretch of non-overlapping, in-frame codons, beginning with the initiation codon and ending with a stop codon, and is translated by the ribosome.
As used herein, the term “translational regulatory activity” (used interchangeably with “translational regulatory function”) refers to a biological function, mechanism, or process that modulates (e.g., regulates, influences, controls, varies) the activity of the translational apparatus, including the activity of the PIC and/or ribosome. In some aspects, the desired translation regulatory activity promotes and/or enhances the translational fidelity of mRNA translation. In some aspects, the desired translational regulatory activity reduces and/or inhibits leaky scanning.
As used herein, the terms "nucleic acid" and “polynucleotide” are used interchangeably. In their broadest sense, these terms include any compound and/or substance that comprises a polymer of nucleotides. Exemplary nucleic acids or polynucleotides of the present disclosure include, but are not limited to, ribonucleic acids (RNAs), deoxyribonucleic acids (DNAs), threose nucleic acids (TNAs), glycol nucleic acids (GNAs), peptide nucleic acids (PNAs), locked nucleic acids (LNAs, including LNA having a p- D-ribo configuration, a-LNA having an a-L-ribo configuration (a diastereomer of LNA), 2'-amino-LNA having a 2'-amino functionalization, and 2'-amino- a-LNA having a 2'-amino functionalization), ethylene nucleic acids (ENA), cyclohexenyl nucleic acids (CeNA) or hybrids or combinations thereof.
Nucleic acid molecules of the disclosure may be, for example, triple-, double-, or single-stranded deoxyribonucleic acid ("DNA"), as well as triple-, double- and single-stranded ribonucleic acid ("RNA"). This term also includes modified, for example, by alkylation, and/or by capping, and unmodified forms of the corresponding unmodified nucleic acid. In particular aspects, the nucleic acid comprises an mRNA. In other aspect, the mRNA is a synthetic mRNA. In some aspects, the synthetic mRNA comprises at least one unnatural nucleobase. In some aspects, all nucleobases of a certain class have been replaced with unnatural nucleobases (e.g., all uridines in a polynucleotide disclosed herein can be replaced with an unnatural nucleobase, e.g., 1 -methylpseudouridine). In some aspects, the polynucleotide (e.g., a synthetic RNA or a synthetic DNA) comprises only natural nucleobases, i.e., A (adenosine), G (guanosine), C (cytidine), and T (thymidine) in the case of a synthetic DNA, or A, C, G, and U (uridine) in the case of a synthetic RNA.
The skilled artisan will appreciate that the T bases in the codon maps disclosed herein are present in DNA, whereas the T bases would be replaced by U bases in corresponding RNAs. For example, a codon-nucleotide sequence disclosed herein in DNA form, e.g., a vector or an in-vitro translation (IVT) template, would have its T bases transcribed as U based in its corresponding transcribed mRNA. In this respect, both codon-optimized DNA sequences (comprising T) and their corresponding mRNA sequences (comprising U) are considered codon-optimized nucleotide sequence of the present disclosure. A skilled artisan would also understand that equivalent codon-maps can be generated by replaced one or more bases with non-natural bases. Thus, e.g., a TTC codon (DNA map) would correspond to a UUC codon (RNA map), which in turn would correspond to a ψψC codon (RNA map in which U has been replaced with pseudouridine).
Standard A-T and G-C base pairs form under conditions which allow the formation of hydrogen bonds between the N3-H and C4-oxy of thymidine and the N1 and C6-NH2 , respectively, of adenosine and between the C2-oxy, N3 and C4-NH2 , of cytidine and the C2-NH2 , N' — H and C6-oxy, respectively, of guanosine. Thus, for example, guanosine (2-amino-6-oxy-9-β-D-ribofuranosyl-purine) can be modified to form isoguanosine (2-oxy-6-amino-9-p-D-ribofuranosyl-purine). Such modification results in a nucleoside base which will no longer effectively form a standard base pair with cytosine. However, modification of cytosine (1 -β-D-ribofuranosyl-2-oxy-4-amino-pyrimidine) to form isocytosine (1 -β-D- ribofuranosyl-2-amino-4-oxy-pyrimidine-) results in a modified nucleotide which will not effectively base pair with guanosine but will form a base pair with isoguanosine (U.S. Pat. No. 5,681 ,702 to Collins et al.). Isocytosine is available from Sigma Chemical Co. (St. Louis, Mo.); isocytidine can be prepared by the method described by Switzer et al. (1993) Biochemistry 32:10489-10496 and references cited therein; 2'- deoxy-5-methyl-isocytidine can be prepared by the method of Tor et al., 1993, J. Am. Chem. Soc.
115:4461 -4467 and references cited therein; and isoguanine nucleotides can be prepared using the method described by Switzer et al., 1993, supra, and Mantsch et al., 1993, Biochem. 14:5593-5601 , or by the method described in U.S. Pat. No. 5,780,610 to Collins et al. Other nonnatural base pairs can be synthesized by the method described in Piccirilli et al., 1990, Nature 343:33-37, for the synthesis of 2,6- diaminopyrimidine and its complement (1 -methylpyrazolo-[4,3]pyrimidine-5,7-(4H,6H)-dione. Other such modified nucleotide units which form unique base pairs are known, such as those described in Leach et al. (1992) J. Am. Chem. Soc. 114:3675-3683 and Switzer et al., supra.
Nucleotides are referred to by their commonly accepted single-letter codes. Unless otherwise indicated, nucleic acids are written left to right in 5' to 3' orientation. Nucleobases are referred to herein by their commonly known one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Accordingly, A represents adenine, C represents cytosine, G represents guanine, T represents thymine, U represents uracil.
In accordance with the compositions and methods disclosed herein, nucleic acids or polynucleotides may be “enriched” in certain nucleosides. As used in this context, the term “enriched” refers to a polynucleotide in which at least 50% of the nucleosides within the polynucleotide are the same. For example, a polynucleotide is said to be “enriched” in uridine if at least 50% (e.g., 51%, 52%, 53%, 54%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%) of the nucleosides in the polynucleotide are uridine nucleosides. In another example, a polynucleotide is said to be “enriched” in a modified uridine nucleoside (e.g., in 1 -methylpseudouridine) if at least 50% (e.g., 51%, 52%, 53%, 54%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%) of the nucleosides in the polynucleotide are the modified uridine nucleoside (e.g., 1 -methylpseudouridine).
As used herein, polynuceotides that are “enriched” for certain nucleoside residues may be separated from one another by way of a spacer. In this context, a “spacer” refers to a polynucleotide that does not code for a polypeptide (i.e. , does not contain a start codon operably linked to a continuous segment of amino acid-encoding codons) and that is not enriched with the same nucleoside as the enriched polynucleotide(s) adjacent to the spacer. In some embodiments, a spacer may be enriched for a different nucleoside as the enriched polynucleotide(s) adjacent to the spacer. Spacers may be, for example, from 5 to 100 nucleosides in length, such as from 10 to 40 nucleosides in length (e.g., 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleosides in length).
The terms "polypeptide," "peptide," and "protein" are used interchangeably herein to refer to polymers of amino acids of any length. The polymer can comprise modified amino acids. The terms also encompass an amino acid polymer that has been modified naturally or by intervention; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling component. Also included within the definition are, for example, polypeptides containing one or more analogs of an amino acid (including, for example, unnatural amino acids such as homocysteine, ornithine, p-acetylphenylalanine, D-amino acids, and creatine), as well as other modifications known in the art.
The term, as used herein, refers to proteins, polypeptides, and peptides of any size, structure, or function. Polypeptides include encoded polynucleotide products, naturally occurring polypeptides, synthetic polypeptides, homologs, orthologs, paralogs, fragments and other equivalents, variants, and
analogs of the foregoing. A polypeptide can be a monomer or can be a multi-molecular complex such as a dimer, trimer or tetramer. They can also comprise single chain or multichain polypeptides. Most commonly disulfide linkages are found in multichain polypeptides. The term polypeptide can also apply to amino acid polymers in which one or more amino acid residues are an artificial chemical analogue of a corresponding naturally occurring amino acid. In some embodiments, a "peptide" can be less than or equal to 50 amino acids long, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids long.
Amino acids are referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Unless otherwise indicated, amino acid sequences are written left to right in amino to carboxy orientation.
“Percent (%) sequence complementarity” with respect to a reference polynucleotide sequence is defined as the percentage of nucleic acids in a candidate sequence that are complementary to the nucleic acids in the reference polynucleotide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence complementarity. A given nucleotide is considered to be “complementary” to a reference nucleotide as described herein if the two nucleotides form canonical Watson-Crick base pairs. For the avoidance of doubt, Watson-Crick base pairs in the context of the present disclosure include adenine-thymine, adenine-uracil, and cytosine-guanine base pairs. A proper Watson-Crick base pair is referred to in this context as a “match,” while each unpaired nucleotide, and each incorrectly paired nucleotide, is referred to as a “mismatch.” Alignment for purposes of determining percent nucleic acid sequence complementarity can be achieved in various ways that are within the capabilities of one of skill in the art, for example, using publicly available computer software such as BLAST, BLAST-2, or Megalign software. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms needed to achieve maximal complementarity over the full length of the sequences being compared. As an illustration, the percent sequence complementarity of a given nucleic acid sequence, A, to a given nucleic acid sequence, B, (which can alternatively be phrased as a given nucleic acid sequence, A that has a certain percent complementarity to a given nucleic acid sequence, B) is calculated as follows:
100 multiplied by (the fraction X/Y) where X is the number of complementary base pairs in an alignment (e.g., as executed by computer software, such as BLAST) in that program’s alignment of A and B, and where Y is the total number of nucleic acids in B. It will be appreciated that where the length of nucleic acid sequence A is not equal to the length of nucleic acid sequence B, the percent sequence complementarity of A to B will not equal the percent sequence complementarity of B to A. As used herein, a query nucleic acid sequence is considered to be “completely complementary” to a reference nucleic acid sequence if the query nucleic acid sequence has 100% sequence complementarity to the reference nucleic acid sequence.
As used herein, the terms “percent (%) sequence identity,” “percent (%) identity,” and the like, with respect to a reference polynucleotide or polypeptide sequence, is defined as the percentage of nucleic acids or amino acids in a candidate sequence that are identical to the nucleic acids or amino acids in the reference polynucleotide or polypeptide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity. Alignment for purposes of determining percent nucleic acid or amino acid sequence identity can be achieved in various ways that are within the capabilities of one of skill in the art, for example, using publicly available
computer software such as BLAST, BLAST-2, or Megalign software. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. For example, percent sequence identity values may be generated using the sequence comparison computer program BLAST. As an illustration, the percent sequence identity of a given nucleic acid or amino acid sequence, A, to, with, or against a given nucleic acid or amino acid sequence, B, (which can alternatively be phrased as a given nucleic acid or amino acid sequence, A that has a certain percent sequence identity to, with, or against a given nucleic acid or amino acid sequence, B) is calculated as follows:
100 multiplied by (the fraction X/Y) where X is the number of nucleotides or amino acids scored as identical matches by a sequence alignment program (e.g., BLAST) in that program’s alignment of A and B, and where Y is the total number of nucleic acids in B. It will be appreciated that where the length of nucleic acid or amino acid sequence A is not equal to the length of nucleic acid or amino acid sequence B, the percent sequence identity of A to B will not equal the percent sequence identity of B to A.
As used herein, the term “operatively linked” in the context of a polynucleotide fragment is intended to mean that the two polynucleotide fragments are joined such that the amino acid sequences encoded by the two polynucleotide fragments remain in-frame.
As used herein, the term "pharmacokinetic" refers to any one or more properties of a molecule or compound as it relates to the determination of the fate of substances administered to a living organism. Pharmacokinetics is divided into several areas including the extent and rate of absorption, distribution, metabolism and excretion. This is commonly referred to as ADME where: (A) Absorption is the process of a substance entering the blood circulation; (D) Distribution is the dispersion or dissemination of substances throughout the fluids and tissues of the body; (M) Metabolism (or Biotransformation) is the irreversible transformation of parent compounds into daughter metabolites; and (E) Excretion (or Elimination) refers to the elimination of the substances from the body. In rare cases, some drugs irreversibly accumulate in body tissue.
As used herein, the term “regulatory sequence” includes promoters, enhancers, and other expression control elements (e.g., polyadenylation signals) that control the transcription or translation, e.g., of open reading frames described herein. Such regulatory sequences are described, for example, in Goeddel, Gene Expression Technology: Methods in Enzymology 185 (Academic Press, San Diego, CA, 1990); incorporated herein by reference.
As used herein, the phrases "signal sequence," "signal peptide," and "transit peptide" are used interchangeably and refer to a sequence that can direct the transport or localization of a protein to a certain organelle, cell compartment, or extracellular export. The term encompasses both the signal sequence polypeptide and the nucleic acid sequence encoding the signal sequence. Thus, references to a signal sequence in the context of a nucleic acid refer in fact to the nucleic acid sequence encoding the signal sequence polypeptide.
As used herein, the term "similarity" refers to the overall relatedness between polymeric molecules, e.g. between polynucleotide molecules (e.g. DNA molecules and/or RNA molecules) and/or between polypeptide molecules. Calculation of percent similarity of polymeric molecules to one another
can be performed in the same manner as a calculation of percent identity, except that calculation of percent similarity takes into account conservative substitutions as is understood in the art.
As used herein, the phrase “specifically binds” refers to a binding reaction which is determinative of the presence of an antigen in a heterogeneous population of proteins and other biological molecules that is recognized, e.g., by a protein or nucleic acid with particularity. A protein or nucleic acid that specifically binds to an antigen will bind to the antigen with a KD of less than 100 nM. For example, a protein or nucleic acid that specifically binds to an antigen will bind to the antigen with a KD of up to 100 nM (e.g., between 1 pM and 100 nM). A protein or nucleic acid that does not exhibit specific binding to a particular antigen or epitope thereof will exhibit a KD of greater than 100 nM (e.g., greater than 500 nm, 1 pM, 100 pM, 500 pM, or 1 mM) for that particular antigen or epitope thereof. A variety of immunoassay formats may be used to select antibodies specifically immunoreactive with a particular protein or carbohydrate. For example, solid-phase ELISA immunoassays are routinely used to select antibodies specifically immunoreactive with a protein or carbohydrate. See, Harlow & Lane, Antibodies, A Laboratory Manual, Cold Spring Harbor Press, New York (1988) and Harlow & Lane, Using Antibodies, A Laboratory Manual, Cold Spring Harbor Press, New York (1999), for a description of immunoassay formats and conditions that can be used to determine specific immunoreactivity.
As used herein, the terms “subject” and “patient” refer to an organism that receives treatment for a particular disease or condition. Examples of subjects and patients include mammals, such as humans, primates, pigs, goats, rabbits, hamsters, cats, dogs, guinea pigs, members of the bovidae family (such as cattle, bison, buffalo, and yaks, among others), sheep, and horses, among others. A patient that may be treated using the compositions and methods described herein may have an established disease, in which case the patient has been diagnosed as having the disease and has shown symptoms of the disease for a prolonged period of time (e.g., over the course of days, weeks, months, or years). Alternatively, a patient may be symptomatic for a particular disease, but has yet to be diagnosed with the disease by a physician. Other patients that may be treated using the compositions and methods described herein include those that have been diagnosed as having a particular disease, and may or may not be showing symptoms of the disease as of yet. For example, a patient eligible for treatment with the compositions and methods described herein may be described as diagnosed but asymptomatic if the patient has received a diagnosis of a disease, even though the patient may not yet be showing symptoms thereof.
As used herein, "transfection" refers to the introduction of a polynucleotide (e.g., exogenous nucleic acids) into a cell wherein a polypeptide encoded by the polynucleotide is expressed (e.g., mRNA) or the polypeptide modulates a cellular function (e.g., siRNA, miRNA). As used herein, "expression" of a nucleic acid sequence refers to translation of a polynucleotide (e.g., an mRNA) into a polypeptide or protein and/or post-translational modification of a polypeptide or protein. Methods of transfection include, but are not limited to, chemical methods, physical treatments and cationic lipids or mixtures.
As used herein, the terms “treat” or “treatment” refer to therapeutic treatment, in which the object is to inhibit or slow down (lessen) an undesired physiological change or disorder. Beneficial or desired clinical results of treatment include, without limitation, alleviation of symptoms, diminishment of extent of disease, stabilized (i.e., not worsening) state of disease, delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable. Those in need of treatment include those already having the condition or disorder, as
well as those prone to have the condition or disorder or those in which the condition or disorder is to be inhibited.
As used herein, the term "effective amount" of an agent is that amount sufficient to effect beneficial or desired results, for example, clinical results, and, as such, an "effective amount" depends upon the context in which it is being applied. For example, in the context of administering an agent that treats a protein deficiency, an effective amount of an agent is, for example, an amount of mRNA expressing sufficient the desired protein to ameliorate, reduce, eliminate, or prevent the symptoms associated with the corresponding protein deficiency, as compared to the severity of the symptom observed without administration of the agent. The term "effective amount" can be used interchangeably with "effective dose," "therapeutically effective amount," or "therapeutically effective dose."
As used herein, “methods of administration” can include intravenous, intramuscular, intradermal, subcutaneous, or other methods of delivering a composition to a subject. A method of administration can be selected to target delivery (e.g., to specifically deliver) to a specific region or system of a body.
As used herein, the term “internal ribosome entry site” or “IRES” refers to a nucleic acid element that is capable of recruiting one or more components of the translation machinery, e.g., a component of the ribosome (e.g., 25S, 28S, 18S, 5.8S, or 5S rRNA), elF4G, or elF3 thereby fostering translation of an open reading frame that is operably linked thereto. IRES elements of the disclosure may be used in conjunction with either a 5’ cap-containing nucleic acid (e.g., a 5’-cap containing mRNA molecule) or a nucleic acid that lacks a 5’ cap (e.g., a circular RNA molecule). Exemplary IRES elements of the disclosure include polypyrimidine tracts, such as one or a plurality of polynucleotide tracts in which at least 70% of the nucleosides therein are pyrimidine-containing nucleosides, such as a uridine, a modified uridine, a cytidine, or a modified cytidine (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the nucleosides in each of the polynucleotide tracts may be a uridine, a modified uridine, a cytidine, or a modified cytidine).
The phrase "pharmaceutically acceptable" is employed herein to refer to those compounds, materials, compositions, and/or dosage forms that are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
The phrase "pharmaceutically acceptable excipient," as used herein, refers any ingredient other than the compounds described herein (for example, a vehicle capable of suspending or dissolving the active compound) and having the properties of being substantially nontoxic and non-inflammatory in a patient. Excipients can include, for example: antiadherents, antioxidants, binders, coatings, compression aids, disintegrants, dyes (colors), emollients, emulsifiers, fillers (diluents), film formers or coatings, flavors, fragrances, glidants (flow enhancers), lubricants, preservatives, printing inks, sorbents, suspension or dispersing agents, sweeteners, and waters of hydration. Exemplary excipients include, but are not limited to: butylated hydroxytoluene (BHT), calcium carbonate, calcium phosphate (dibasic), calcium stearate, croscarmellose, crosslinked polyvinyl pyrrolidone, citric acid, crospovidone, cysteine, ethylcellulose, gelatin, hydroxypropyl cellulose, hydroxypropyl methylcellulose, lactose, magnesium stearate, maltitol, mannitol, methionine, methylcellulose, methyl paraben, microcrystalline cellulose, polyethylene glycol,
polyvinyl pyrrolidone, povidone, pregelatinized starch, propyl paraben, retinyl palmitate, shellac, silicon dioxide, sodium carboxymethyl cellulose, sodium citrate, sodium starch glycolate, sorbitol, starch (corn), stearic acid, sucrose, talc, titanium dioxide, vitamin A, vitamin E, vitamin C, and xylitol.
The present disclosure also includes pharmaceutically acceptable salts of the compounds described herein. As used herein, "pharmaceutically acceptable salts" refers to derivatives of the disclosed compounds wherein the parent compound is modified by converting an existing acid or base moiety to its salt form (e.g., by reacting the free base group with a suitable organic acid). Examples of pharmaceutically acceptable salts include, but are not limited to, mineral or organic acid salts of basic residues such as amines; alkali or organic salts of acidic residues such as carboxylic acids; and the like. Representative acid addition salts include acetate, acetic acid, adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzene sulfonic acid, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, fumarate, glucoheptonate, glycerophosphate, hemisulfate, heptonate, hexanoate, hydrobromide, hydrochloride, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, toluenesulfonate, undecanoate, valerate salts, and the like. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like, as well as nontoxic ammonium, quaternary ammonium, and amine cations, including, but not limited to ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, ethylamine, and the like. The pharmaceutically acceptable salts of the present disclosure include the conventional non-toxic salts of the parent compound formed, for example, from non-toxic inorganic or organic acids. The pharmaceutically acceptable salts of the present disclosure can be synthesized from the parent compound that contains a basic or acidic moiety by conventional chemical methods. Generally, such salts can be prepared by reacting the free acid or base forms of these compounds with a stoichiometric amount of the appropriate base or acid in water or in an organic solvent, or in a mixture of the two; generally, nonaqueous media like ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are used. Lists of suitable salts are found in Flemington's Pharmaceutical Sciences, 17th ed., Mack Publishing Company, Easton, Pa., 1985, p. 1418, Pharmaceutical Salts: Properties, Selection, and Use, P.H. Stahl and C.G. Wermuth (eds.), Wiley-VCH, 2008, and Berge et al., Journal of Pharmaceutical Science, 66, 1 -19 (1977), each of which is incorporated herein by reference in its entirety.
The term "pharmaceutically acceptable solvate," as used herein, means a compound of the present disclosure wherein molecules of a suitable solvent are incorporated in the crystal lattice. A suitable solvent is physiologically tolerable at the dosage administered. For example, solvates can be prepared by crystallization, recrystallization, or precipitation from a solution that includes organic solvents, water, or a mixture thereof. Examples of suitable solvents are ethanol, water (for example, mono-, di-, and tri-hydrates), A/-methylpyrrolidinone (NMP), dimethyl sulfoxide (DMSO), A/,A/'-dimethylformamide (DMF), A/,A/'-dimethylacetamide (DMAC), 1 ,3-dimethyl-2-imidazolidinone (DMEU), 1 ,3-dimethyl-3, 4,5,6- tetrahydro-2-(1 H)-pyrimidinone (DMPU), acetonitrile (ACN), propylene glycol, ethyl acetate, benzyl
alcohol, 2-pyrrolidone, benzyl benzoate, and the like. When water is the solvent, the solvate is referred to as a "hydrate."
As used herein, the term "alkyl", "alkyl group", or "alkylene" means a linear or branched, saturated hydrocarbon including one or more carbon atoms (e.g., one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, or more carbon atoms), which is optionally substituted. The notation "C1-14 alkyl" means an optionally substituted linear or branched, saturated hydrocarbon including 1 -14 carbon atoms. Unless otherwise specified, an alkyl group described herein refers to both unsubstituted and substituted alkyl groups.
As used herein, the term "alkenyl", "alkenyl group", or "alkenylene" means a linear or branched hydrocarbon including two or more carbon atoms (e.g., two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, or more carbon atoms) and at least one double bond, which is optionally substituted. The notation "C2-14 alkenyl" means an optionally substituted linear or branched hydrocarbon including 2-14 carbon atoms and at least one carbon-carbon double bond. An alkenyl group may include one, two, three, four, or more carbon-carbon double bonds. For example, C18 alkenyl may include one or more double bonds. A C18 alkenyl group including two double bonds may be a linoleyl group. Unless otherwise specified, an alkenyl group described herein refers to both unsubstituted and substituted alkenyl groups.
As used herein, the term "alkynyl", "alkynyl group", or "alkynylene" means a linear or branched hydrocarbon including two or more carbon atoms (e.g., two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, or more carbon atoms) and at least one carbon-carbon triple bond, which is optionally substituted. The notation "C2-14 alkynyl" means an optionally substituted linear or branched hydrocarbon including 2-14 carbon atoms and at least one carbon-carbon triple bond. An alkynyl group may include one, two, three, four, or more carbon-carbon triple bonds. For example, C18 alkynyl may include one or more carbon-carbon triple bonds. Unless otherwise specified, an alkynyl group described herein refers to both unsubstituted and substituted alkynyl groups.
As used herein, the term "carbocycle" or "carbocyclic group" means an optionally substituted mono- or multi-cyclic system including one or more rings of carbon atoms. Rings may be three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, or twenty membered rings. The notation "C3-6 carbocycle" means a carbocycle including a single ring having 3-6 carbon atoms. Carbocycles may include one or more carbon-carbon double or triple bonds and may be non-aromatic or aromatic (e.g., cycloalkyl or aryl groups). Examples of carbocycles include cyclopropyl, cyclopentyl, cyclohexyl, phenyl, naphthyl, and 1 ,2 dihydronaphthyl groups. The term "cycloalkyl" as used herein means a non-aromatic carbocycle and may or may not include any double or triple bond. Unless otherwise specified, carbocycles described herein refers to both unsubstituted and substituted carbocycle groups, i.e., optionally substituted carbocycles.
As used herein, the term "heterocycle" or "heterocyclic group" means an optionally substituted mono- or multi-cyclic system including one or more rings, where at least one ring includes at least one heteroatom. Heteroatoms may be, for example, nitrogen, oxygen, or sulfur atoms. Rings may be three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, or fourteen membered rings. Heterocycles may include one or more double or triple bonds and may be non-aromatic or aromatic (e.g.,
heterocycloalkyl or heteroaryl groups). Examples of heterocycles include imidazolyl, imidazolidinyl, oxazolyl, oxazolidinyl, thiazolyl, thiazolidinyl, pyrazolidinyl, pyrazolyl, isoxazolidinyl, isoxazolyl, isothiazolidinyl, isothiazolyl, morpholinyl, pyrrolyl, pyrrolidinyl, furyl, tetrahydrofuryl, thiophenyl, pyridinyl, piperidinyl, quinolyl, and isoquinolyl groups. The term "heterocycloalkyl" as used herein means a nonaromatic heterocycle and may or may not include any double or triple bond. Unless otherwise specified, heterocycles described herein refers to both unsubstituted and substituted heterocycle groups, i.e., optionally substituted heterocycles.
As used herein, the term "heteroalkyl", "heteroalkenyl", or "heteroalkynyl", refers respectively to an alkyl, alkenyl, alkynyl group, as defined herein, which further comprises one or more (e.g., 1 , 2, 3, or 4) heteroatoms (e.g., oxygen, sulfur, nitrogen, boron, silicon, phosphorus) wherein the one or more heteroatoms is inserted between adjacent carbon atoms within the parent carbon chain and/or one or more heteroatoms is inserted between a carbon atom and the parent molecule, i.e., between the point of attachment. Unless otherwise specified, heteroalkyls, heteroalkenyls, or heteroalkynyls described herein refers to both unsubstituted and substituted heteroalkyls, heteroalkenyls, or heteroalkynyls, i.e., optionally substituted heteroalkyls, heteroalkenyls, or heteroalkynyls.
As used herein, a "biodegradable group" is a group that may facilitate faster metabolism of a lipid in a mammalian entity. A biodegradable group may be selected from the group consisting of, but is not limited to, -C(O)O-, -OC(O)-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, - P(O)(OR')O-, -S(O)2-, an aryl group, and a heteroaryl group. As used herein, an "aryl group" is an optionally substituted carbocyclic group including one or more aromatic rings. Examples of aryl groups include phenyl and naphthyl groups. As used herein, a "heteroaryl group" is an optionally substituted heterocyclic group including one or more aromatic rings. Examples of heteroaryl groups include pyrrolyl, furyl, thiophenyl, imidazolyl, oxazolyl, and thiazolyl. Both aryl and heteroaryl groups may be optionally substituted. For example, M and M' can be selected from the non-limiting group consisting of optionally substituted phenyl, oxazole, and thiazole. In the Formulas herein, M and M' can be independently selected from the list of biodegradable groups above. Unless otherwise specified, aryl or heteroaryl groups described herein refers to both unsubstituted and substituted groups, i.e., optionally substituted aryl or heteroaryl groups.
Alkyl, alkenyl, and cyclyl (e.g., carbocyclyl and heterocyclyl) groups may be optionally substituted unless otherwise specified. Optional substituents may be selected from the group consisting of, but are not limited to, a halogen atom (e.g., a chloride, bromide, fluoride, or iodide group), a carboxylic acid (e.g., C(O)OH), an alcohol (e.g., a hydroxyl, OH), an ester (e.g., C(O)OR OC(O)R), an aldehyde (e.g., C(O)H), a carbonyl (e.g., C(O)R, alternatively represented by C=0), an acyl halide (e.g., C(O)X, in which X is a halide selected from bromide, fluoride, chloride, and iodide), a carbonate (e.g., OC(O)OR), an alkoxy (e.g., OR), an acetal (e.g., C(0R)2R"", in which each OR are alkoxy groups that can be the same or different and R"" is an alkyl or alkenyl group), a phosphate (e.g., P(O)43-) , a thiol (e.g., SH), a sulfoxide (e.g., S(O)R), a sulfinic acid (e.g., S(O)OH), a sulfonic acid (e.g., S(O)20H), a thial (e.g., C(S)H), a sulfate (e.g., S(O)42-) , a sulfonyl (e.g., S(O)2 ), an amide (e.g., C(O)NR2, or N(R)C(O)R), an azido (e.g., N3), a nitro (e.g., NO2), a cyano (e.g., CN), an isocyano (e.g., NC), an acyloxy (e.g., OC(O)R), an amino (e.g., NR2, NRH, or NH2), a carbamoyl (e.g., 0C(O)NR2, 0C(O)NRH, or 0C(O)NH2), a sulfonamide (e.g., S(O)2NR2, S(O)2NRH, S(O)2NH2, N(R)S(O)2R, N(H)S(O)2R, N(R)S(O)2H, or N(H)S(O)2H),
an alkyl group, an alkenyl group, and a cyclyl (e.g., carbocyclyl or heterocyclyl) group. In any of the preceding, R is an alkyl or alkenyl group, as defined herein. In some embodiments, the substituent groups themselves may be further substituted with, for example, one, two, three, four, five, or six substituents as defined herein. For example, a C1-6 alkyl group may be further substituted with one, two, three, four, five, or six substituents as described herein.
Compounds of the disclosure that contain nitrogens can be converted to N-oxides by treatment with an oxidizing agent (e.g., 3-chloroperoxybenzoic acid (mCPBA) and/or hydrogen peroxides) to afford other compounds of the disclosure. Thus, all shown and claimed nitrogen-containing compounds are considered, when allowed by valency and structure, to include both the compound as shown and its N- oxide derivative (which can be designated as N->0 or N+-O-). Furthermore, in other instances, the nitrogens in the compounds of the disclosure can be converted to N-hydroxy or N-alkoxy compounds. For example, N-hydroxy compounds can be prepared by oxidation of the parent amine by an oxidizing agent such as m CPBA. All shown and claimed nitrogen-containing compounds are also considered, when allowed by valency and structure, to cover both the compound as shown and its N-hydroxy (i.e., N- OH) and N-alkoxy (i.e., N-OR, wherein R is substituted or unsubstituted C1-C6 alkyl, C1-C6 alkenyl, C1-C6 alkynyl, 3-14-membered carbocycle or 3-14-membered heterocycle) derivatives.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 A is a schematic illustrating that linear RNA molecules are prone to degradation at the 5’ and/or 3’ ends by way of exonucleases (top). These types of linear RNA molecules often contain a 5’ cap (bottom) in order to promote ribosome recruitment and, ultimately, translation of an open reading frame.
FIG. 1B is a schematic showing ways in which RNAs may mitigate or avoid exonuclease degradation. In one example (top), a linear RNA molecule may be bound to a chemical moiety at the 5’ and/or 3’ ends that blocks the access of exonucleases to the RNA molecule. In another example (middle), the RNA may be circularized, such that there are no 5’ or 3’ ends available for binding to (and cleavage by) an exonuclease). One aspect that has hindered the development of these types of molecules is the absence of a 5’ cap, which would typically be attached to the free 5’ end of a linear RNA molecule in order to promote ribosome binding and open reading frame translation. The present disclosure addresses this problem by providing internal ribosome entry (IRES) elements that recruit ribosomes in a cap-independent manner (bottom), allowing for RNAs to simultaneously recruit ribosomes and be modified in ways that remove/modify the cap so as to avoid nucleolytic degradation (e.g., by way of 5’ and/or 3’ blocking moieties or by way of RNA circularization).
FIG. 2 is a graph comparing the expression of green fluorescent protein (GFP) from three different, linear RNA constructs in HEK293 cells over the course of 60 hours. Each linear RNA contained an open reading frame encoding GFP, and each RNA lacked a 5’ cap structure. The RNA molecules differed in the type of IRES element tested within the 5’ untranslated region (UTR). One construct contained a known coxsackievirus B3 (CVB3) IRES sequence in its 5’ UTR (“GO lin, 5’ CVB3,” top of graph); another construct contained three polynucleotide tracts each containing 9 contiguous unmodified uridine residues, each tract separated from one another by two 13-nucleoside spacers (“GO lin, 5’ v1 .1 ,” lower line of graph); and another construct three polynucleotide tracts each containing 9 contiguous 1 - methylpseudouridine residues, each tract separated from one another by two 13-nucleoside spacers (“G5
lin , 5’ 3xU9,” middle of graph). A negative control, in which no RNA was provided to the HEK293 cells, was included as well (bottom flatline of graph). FIG. 2 also includes a table comparing the GFP expression level achieved by the “G5 lin, 5’3xU9” construct as compared to the “G0 lin, 5’ CVB3” construct and a construct having the same composition as “G5 lin, 5’3xU9,” but also containing the known 5’ Cap1 structure.
FIGS. 3A - 3D are graphs comparing the expression of GFP from three different, linear RNA constructs in various cell types (HeLa (FIG. 3A), HEK293 (FIG. 3B), THP1 (FIG. 3C), and Hep3B (FIG. 3D)). Each construct contained an open reading frame encoding GFP, but the constructs differed in the IRES element tested within the 5’ UTR and in the presence/absence of a 5’ cap. One construct contained the known 5’ Cap1 structure (“Cap1 -A100,” circles); another construct contained the CVB3 IRES sequence in its 5’ UTR, without a 5’ cap structure (“CVB3 (GO),” squares); and another construct contained three polynucleotide tracts each containing 9 contiguous 1 -methylpseudouridine residues, each tract separated from one another by two 13-nucleoside spacers without a 5’cap structure (“3xU9_1 (G5),” diamonds). A negative control, in which no RNA was provided to the HEK293 cells, was included as well (bottom flatline of graph). FIG. 3 also includes a table comparing the GFP expression level achieved by the “3xU9_1 (G5)” and “CVB3 (GO)” construct as compared to the “Cap1 -A100” construct.
FIG. 4A is a schematic showing an experimental design for the evaluation of erythropoietin (EPO) expression in BALB/c mice injected intravenously with SM86/DMG nanoparticles containing one of five different EPO-encoding RNA constructs: (i) a linear RNA construct containing an EPO-encoding open reading frame and a 5’ Cap1 structure (“Cap1 -A100,” also referred to as “GO Cap1 ”); (ii) a linear RNA construct containing an EPO-encoding open reading frame, a 5’ UTR containing the CVB3 IRES, and a 5’ triphosphate structure (“lin GO CVB3, 5’ PPP”); (iii) a linear RNA construct containing an EPO-encoding open reading frame, a 5’ UTR containing the CVB3 IRES, and a 5’ biotin-triazole structure (“lin GO CVB3, 5’ bA”); (iv) a linear RNA construct containing an EPO-encoding open reading frame, a 5’ UTR containing three polynucleotide tracts each containing 9 contiguous 1 -methylpseudouridine residues, each tract separated from one another by two 13-nucleoside spacers, and a 5’ triphosphate structure (“lin G5 3xU9, 5’ PPP”); and (v) a linear RNA construct containing an EPO-encoding open reading frame, a 5’ UTR containing three polynucleotide tracts each containing 9 contiguous 1 -methylpseudouridine residues, each tract separated from one another by two 13-nucleoside spacers, and a 5’ biotin-triazole structure (“lin G5 3xU9, 5’ bA”). Mice were injected with the SM86-DMG nanoparticles intravenously and were assessed for serum EPO concentrations after 3 hours, 6 hours, 1 day, and 2 days.
FIG. 4B is a graph comparing the serum EPO concentrations achieved by each construct.
FIG. 5 is a graph comparing the secretion of IFN-y-inducible protein 10 (IP10) - an immune response marker - in BALB/c mice injected intravenously with one of five different EPO-encoding RNA constructs in the same experiment as Fig. 4, 6 hours after injection. A vehicle-only arm (“buffer”) was included as a negative control. Mice were injected with the SM86-DMG nanoparticles intravenously and were subsequently assessed for serum IP10 concentrations.
FIG. 6A is a graph comparing the expression of luciferase in HeLa cells transfected in the presence of lipofectamine 2000 (L2K) with one of three different luciferase-encoding RNA constructs. The constructs tested were: (i) a linear RNA construct containing a luciferase-encoding open reading frame, a 5’ UTR containing an IRES having three polynucleotide tracts each containing 9 contiguous 1 -
methylpseudouridine residues, each tract separated from one another by two 13-nucleoside spacers, and a 5’ triphosphate structure (“G5 lin 5’ PPP_3xU9”); and (ii) a linear RNA construct containing a luciferaseencoding open reading frame, a 5’ UTR containing an IRES having six polynucleotide tracts each containing 9 contiguous 1 -methylpseudouridine residues, the tracts separated from one another by spacers of 18-28 nucleosides in length, and a 5’ triphosphate structure (“G5 lin 5’ PPP_6xU9”); and (iii) a linear RNA construct having the same structure as in (ii), except containing a 5’ Cap1 structure in lieu of a 5’ triphosphate structure (“G5 lin 5’ Cap1_v2.0”).
FIG. 6B is table comparing the luciferase expression of the constructs tested in FIG. 6A in two different cell types: HeLa cells and Hep3B cells.
FIG. 7A is a graph comparing the expression of luciferase in HeLa cells that were transfected, in accordance with the methodology described in FIG. 6A, with a circular RNA molecule containing a luciferase-encoding open reading frame. Within each RNA molecule, each instance of uridine was replaced with 1 -methylpseudouridine. In addition to encoding luciferase, the RNA molecule was tethered to one of three proteins by way of MS2 tethering sites within the RNA: (i) LACZ (“t-LACZ”), (ii) eukaryotic translation initiation factor 4 G (“t-elF4G”), or (iii) La protein (“t-La”). Tethering was facilitated by fusing MBP-encoding polypeptide to LACZ(t-Lacz), 4 G (“t-elF4G”), or (iii) La protein (“t-La”).
FIG. 7B is a graph comparing luciferase expression achieved by linearized versions of the constructs tested in FIG. 7A; in FIG. 7B, each construct contained a 5’ triphosphate structure and a 3’ poly(A) tail in lieu of circularization. Notably, the data shown in FIGS. 7A and 7B represent the first instance of successful translation of an RNA without a cap, particularly one in which all uridine nucleosides have been replaced with 1 -methylpseudouridine nucleosides. Taken together, these data demonstrate that IRES elements of the disclosure are capable of effectuating ribosomal recruitment - and successful protein translation - in a manner that is independent of the presence or absence of a 5’ cap. Moreover, these data show that IRES elements of the disclosure can effectuate ribosomal recruitment and successful protein translation in a manner that is not dependent upon the presence or absence of a chemical modification of one of the nucleosides of the nucleic acid molecule, particularly because the interaction that mediates the recruitment of the ribosome (i.e. , the interaction between the MS2 tethering site and the MS2-binding protein) is not affected by the presence or absence of a nucleoside modification (in this instance, 1 -methylpseudouridrine).
FIG. 8A is a graph comparing the expression of mGreenLantern protein in HeLa cells that were transfected with mGreenLantern-encoding RNA constructs in the presence of L2K. Three different RNA constructs were tested: (i) a linear RNA construct containing an mGreenLantern-encoding open reading frame, a 5’ UTR containing an IRES having six polynucleotide tracts each containing 9 contiguous 1 - methylpseudouridine residues, the tracts separated from one another by spacers of 18-28 nucleosides in length, and a 5’ triphosphate structure (“G5 lin 5’ Cap1_v2.0”); (ii) a linear RNA construct containing an mGreenLantern-encoding open reading frame, a 5’ UTR containing an IRES having the nucleic acid sequence of SEQ ID NO: 1 , and a 5’ triphosphate structure (“GO lin 5’ PPP_1xApt17”); and (iii) a linear RNA construct containing an mGreenLantern-encoding open reading frame, a 5’ UTR containing an IRES having the nucleic acid sequence of SEQ ID NO: 1 , with all U residues replaced with N- methylpseudouridine residues, and a 5’ triphosphate structure (“G5 lin 5’ PPP_1xApt17”).
FIG. 8B is a graph comparing the expression of luciferase in HeLa cells that were transfected with luciferase-encoding RNA constructs in the presence of L2K. Five different RNA constructs were tested: (i) a linear RNA construct containing a luciferase-encoding open reading frame, a 5’ UTR containing an IRES having three polynucleotide tracts each containing 9 contiguous 1 - methylpseudouridine residues, and a 5’ Cap1 structure (“G5 lin 5’ Cap1_v1.1 ”); (ii) a linear RNA construct containing a luciferase-encoding open reading frame, a 5’ UTR containing an IRES having three polynucleotide tracts each containing 9 contiguous 1 -methylpseudouridine residues, and a 5’ triphosphate structure (“G5 lin 5’ PPP_3xU9”); (iii) a linear RNA construct containing a luciferase-encoding open reading frame, a 5’ UTR containing an IRES having six polynucleotide tracts each containing 9 contiguous 1 -methylpseudouridine residues, and a 5’ triphosphate structure (“G5 lin 5’ PPP_6xU9”); (iv) a linear RNA construct containing a luciferase-encoding open reading frame, a 5’ UTR containing an IRES having the nucleic acid sequence of SEQ ID NO: 1 , with all U residues replaced with N- methylpseudouridine residues, and a 5’ triphosphate structure (“G5 lin 5’ PPP_1xApt17”); and (v) a linear RNA construct containing a luciferase-encoding open reading frame, a 5’ UTR containing an IRES having six repeats of the nucleic acid sequence of SEQ ID NO: 1 , with all U residues replaced with N- methylpseudouridine residues, and a 5’ triphosphate structure (“G5 lin 5’ PPP_6xApt17”).
FIG. 9A is a graph comparing the expression of luciferase in HeLa cells transfected with one of eight different luciferase-encoding RNA constructs: (i) a linear RNA construct containing a luciferaseencoding open reading frame and a 5’ Cap1 structure (“C1 ”); (ii) a linear RNA construct containing a luciferase-encoding open reading frame, a 5’ UTR containing an IRES having three polynucleotide tracts each containing 9 contiguous uridine residues, and a 5’-triphosphate structure (“v1 .1 ”); (iii) a linear RNA construct containing a luciferase-encoding open reading frame, a 5’ UTR containing an IRES having six polynucleotide tracts each containing 9 contiguous 1 -methylpseudouridine residues, and a 5’-triphosphate structure (“v2.0 (G5)”); (iv) a linear RNA construct containing a luciferase-encoding open reading frame, a 5’ UTR containing an IRES having six polynucleotide tracts each containing 9 contiguous uridine residues, and a 5’-triphosphate structure (“v2.0 (GO)”); (v) a linear RNA construct containing a luciferaseencoding open reading frame, a 5’ UTR containing an IRES having a polynucleotide tract that specifically binds La protein, with all uridine residues in the polynucleotide tract replaced by 1 -methylpseudouridine residues, and a 5’-triphosphate structure (“1xPDCD4 La (G5)”); (vi) a linear RNA construct containing a luciferase-encoding open reading frame, a 5’ UTR containing an IRES having a polynucleotide tract that specifically binds La protein, and a 5’-triphosphate structure (“1xPDCD4 La (GO)”); (vii) a linear RNA construct containing a luciferase-encoding open reading frame, a 5’ UTR containing an IRES having a polynucleotide tract that specifically binds elF4G protein, with all uridine residues in the polynucleotide tract replaced by 1 -methylpseudouridine residues, and a 5’-triphosphate structure (“1xAUAU4 (G5)”); and (viii) a linear RNA construct containing a luciferase-encoding open reading frame, a 5’ UTR containing an IRES having a polynucleotide tract that specifically binds elF4G protein, and a 5’-triphosphate structure (“1xAUAU4 (GO)”).
FIG. 9B provides a table reporting the luciferase expression achieved by certain of the constructs shown in FIG. 9A as a percentage of the luciferase expression achieved by the “Cap1 ” construct.
FIG. 10A is a graph comparing the expression of fluorescent protein in HeLa cells transfected with one of two different fluorescent-protein-encoding RNA constructs. The constructs tested were: (i) a
linear RNA construct containing a 5’ cap structure, a 5’ UTR containing an IRES having the nucleic acid sequence of GGGAAAUAAGAGAGAAAAGAAGAGuAAGAAGAAAUAUAAGACCCCGGCGCCGCCACC (SEQ ID NO: 3, “UTR1 ”), and a GFP-encoding open reading frame fused to a degron domain and; and (ii) an RNA construct containing a 5’ cap structure, a 5’ UTR containing an IRES having the nucleic acid sequence of GGGAAAUUUUUUUUUGAUAUUAUAAGAGUUUUUUUUUGAUAUUAAGAAAAUUUUUUUUUGAUAUU AGAAGAGUAAGAAGAAAUAUAAGACCCCGGCGCCGCCACC (SEQ ID NO: 4, “UTR2 ”), and a GFP- encoding open reading frame fused to a degron domain. A negative control (“no RNA”) was included for comparison purposes.
FIG. 10B is a graph demonstrating the results of an experiment conducted as outlined in FIG. 10A, but in HEK293 cells in lieu of HeLa cells.
FIG. 10C provides a set of graphs comparing the expression of luciferase in BALB/c mice transfected with one of two different luciferase-encoding RNA constructs: (i) a linear RNA construct containing a 5’ cap structure, a 5’ UTR containing an IRES having the nucleic acid sequence of “UTR1 ” (as in FIGS. 10A and 10B), and a luciferase-encoding open reading frame; and (ii) a linear RNA construct containing a 5’ cap structure, a 5’ UTR containing an IRES having the nucleic acid sequence of “UTR2 ” (as in FIGS. 10A and 10B), and a luciferase-encoding open reading frame. A negative control (“PBS”) was included for comparison purposes.
FIG. 10D provides a set of graphs comparing the expression of erythropoietin in BALB/c mice transfected with one of two different erythropoietin-encoding RNA constructs: (i) a linear RNA construct containing a 5’ cap structure, a 5’ UTR containing an IRES having the nucleic acid sequence of “UTR1 ” (as in FIGS. 10A and 10B), and an erythropoietin-encoding open reading frame; and (ii) a linear RNA construct containing a 5’ cap structure, a 5’ UTR containing an IRES having the nucleic acid sequence of “UTR2 ” (as in FIGS. 10A and 10B), and an erythropoietin-encoding open reading frame. A negative control (“PBS”) was included for comparison purposes.
FIG. 11 A is a graph comparing the expression of luciferase in Hep3b cells transfected in the presence of L2K with luciferase-encoding RNA constructs containing the indicated elements (e.g., see the x-axis). The sequence of these elements is provided in Table 14 (e.g., see Example 7). The three bars for each element represents, from left to right, luciferase expression measured at 2 hour, 5 hours, and 24 hours post-transfection. Luminescence expression data shows that 5’ hulRES9 (e.g., SEQ ID NO: 173) has the highest luciferase expression. This is an improvement over 5’ 3xU9 (SEQ ID NO: 202).
FIG. 11 B is a graph comparing the expression of luciferase in HeLa cells transfected in the presence of L2K with luciferase-encoding RNA constructs containing the indicated elements. The sequence of these elements is provided in Table 14 (e.g., see Example 7). The three bars for each element represents, from left to right, luciferase expression measured at 2 hour, 5 hours, and 24 hours post-transfection. Luminescence expression data shows that 5’ 6xU9 (SEQ ID NO: 203) has the highest luciferase expression and 5’ hulRES9 (e.g., SEQ ID NO: 173) has the next highest luciferase expression. This is an improvement over 5’ 3xU9 (SEQ ID NO: 202).
FIG. 12 is a graph comparing the expression of GFP in HeLa cells transfected in the presence of L2K with GFP-encoding RNA constructs containing the indicated elements; in this case, the GFP is fused to a degron domain. The sequence of these elements is provided in Table 15 (e.g., see Example 7). The
green integrated density of the inlet graph shows that 5’ Shape 1 (SEQ ID NO: 174) and 5’ Shape 3 (SEQ ID NO: 176) show the highest expression, well above 5’ 6xU9 (SEQ ID NO: 203). Further, 5’ Shape 2 (SEQ ID NO: 175) outperforms 5’ Shape 4 (SEQ ID NO: 177) and 5’ 6xU9.
FIG. 13 is a graph comparing the expression of GFP in HeLa cells transfected in the presence of L2K with GFP-encoding RNA constructs containing the indicated elements; in this case, the GFP is fused to a degron domain. The sequence of these elements is provided in Table 15 (e.g., see Example 7). The green integrated density of the inlet graph shows that 5’ Shape 2 (SEQ ID NO: 175) outperforms 5’ Shape 4 (SEQ ID NO: 177) and 5’ 6xU9 (SEQ ID NO: 203).
FIG. 14 is a graph comparing the expression of GFP in HeLa cells transfected in the presence of L2K with GFP-encoding RNA constructs containing the indicated elements; in this case, the GFP is fused to a degron domain. The sequence of these elements is provided in Table 15 (e.g., see Example 7). The green integrated density of the inlet graph shows that 5’ Shape 5 (SEQ ID NO: 178) and 5’ Shape 8 (SEQ ID NO: 180) perform similarly to 5’ 3xU9 (SEQ ID NO: 202).
FIG. 15 is a graph comparing the expression of GFP in HeLa cells transfected in the presence of L2K with GFP-encoding RNA constructs containing the indicated elements; in this case, the GFP is fused to a degron domain. The sequence of these elements is provided in Table 15 (e.g., see Example 7). The green integrated density reveals that 5’ Shape 1 (SEQ ID NO: 174), 5’ Shape 2 (SEQ ID NO: 175), 5’ Shape 3 (SEQ ID NO: 176), and 5’ Shape 4 (SEQ ID NO: 177) outperform 5’ 6xU9 (SEQ ID NO: 203) and 5’ 3xU9 (SEQ ID NO: 202), which outperform 5’ Shape 7 (SEQ ID NO: 179) and 5’ Shape 8 (SEQ ID NO: 180). 5’ Shape 9 (SEQ ID NO: 181 ) performs similar to baseline and uncapped control.
FIG. 16 is a graph comparing the expression of GFP in HeLa cells transfected in the presence of L2K with GFP-encoding RNA constructs containing the indicated elements; in this case, the GFP is fused to a degron domain. The sequence of these elements is provided in Table 15 (e.g., see Example 7). The green integrated density of the two inlet graphs shows that 5’ Shape 5 (SEQ ID NO: 178) and 5’ Shape 8 (SEQ ID NO: 180) have similar performance, while 5’ Shape 9 (SEQ ID NO: 181 ) and 5’ Shape 7 (SEQ ID NO: 179) are expressing closer to baseline.
FIG. 17 is a graph comparing the expression of GFP in HeLa cells transfected in the presence of L2K with GFP-encoding RNA constructs containing the indicated elements; in this case, the GFP is fused to a degron domain. The sequence of these elements is provided in Table 18 (e.g., see Example 7). The green integrated density of the two inlet graphs shows that 5’ Apt17+5xU9 (SEQ ID NO: 183 or SEQ ID NO: 184) constructs and 5’ 5xU9+CCND1 (SEQ ID NO: 182) constructs have an increased Cmax, suggesting that combining different IRES elements disclosed herein can increase gene expression.
FIG. 18 is a graph comparing the expression of GFP in HeLa cells transfected in the presence of L2K with GFP-encoding RNA constructs containing the indicated elements; in this case, the GFP is fused to a degron domain. The sequence of these elements is provided in Table 18 (e.g., see Example 7). The green integrated density data shows that 5’ 1XApt17 substantially outperforms 5’ 1xAUAU4 (SEQ ID NO: 194) and 5’ 1xPDCD4 (SEQ ID NO: 198), with the later having similar temporal expression and Cmax values.
FIG. 19 is a graph comparing the expression of GFP in HeLa cells transfected in the presence of L2K with GFP-encoding RNA constructs containing the indicated elements; in this case, the GFP is fused to a degron domain. The sequence of these elements is provided in Table 18 (e.g., see Example 7). The
green integrated density data shows that constructs with 5’ Apt17+5xU9 (SEQ ID NO: 183 or SEQ ID NO: 184) and constructs with 5’ 5xU9+CCND1 (SEQ ID NO: 182) have similar expression to constructs with 5’ 6xU9 (SEQ ID NO: 203). This data suggests that combining different IRES elements disclosed herein can increase gene expression.
FIG. 20 is a graph comparing the expression of GFP in HeLa cells transfected in the presence of L2K with GFP-encoding RNA constructs containing the indicated elements; in this case, the GFP is fused to a degron domain. The sequence of these elements is provided in Table 18 (e.g., see Example 7). The green integrated density data shows that constructs with elements 5’ 6xPDCD4 (SEQ ID NO: 198) have appreciable expression. Also, constructs with element 5’ 1xApt17 (SEQ ID NO: 193) show expression above background.
FIG. 21 A is a bar graph comparing the expression of luciferase in THP-1 cells transfected in the presence of L2K with luciferase-encoding RNA constructs containing the indicated elements. The sequence of these elements is provided in Table 18 (e.g., see Example 7). Luminescence expression data shows that 5’ 6xU9_v3 (SEQ ID NO: 189), 5’ 6xU9_v4 (SEQ ID NO: 205), and 5’ 6xU9_v5 (SEQ ID NO: 205) have the highest luciferase expression.
FIG. 21 B is the same bar graph as in FIG. 21 A, but without the capped control and the uncapped control (to better show the Y axis values).
FIG. 22A is a bar graph comparing the expression of luciferase in Hep3b cells transfected in the presence of L2K with luciferase-encoding RNA constructs containing the indicated elements. The sequence of these elements is provided in Table 18 (e.g., see Example 7). The two bars for each element represents, from left to right, luciferase expression measured at 4 and 24 hours post-transfection. Luminescence expression data shows that 5’ 6xU9_v3 (SEQ ID NO: 189), 5’ 6xU9_v4 (SEQ ID NO: 204), and 5’ 6xU9_v5 (SEQ ID NO: 205) have the highest luciferase expression.
FIG. 22B is the same bar graph as in FIG. 22A, but without the capped control and the uncapped control (to better show the Y axis values).
FIG. 23A is a bar graph comparing the expression of luciferase in HeLa cells transfected in the presence of L2K with luciferase-encoding RNA constructs containing the indicated elements. The sequence of these elements is provided in Table 18 (e.g., see Example 7). The two bars for each element represents, from left to right, luciferase expression measured at 4 and 24 hours post-transfection. Luminescence expression data shows that 5’ 6xU9_v3 (SEQ ID NO: 189), 5’ 6xU9_v4 (SEQ ID NO: 204), 5’ 6xU9_v5 (SEQ ID NO: 205), and 5’ 6xU9_v1 (SEQ ID NO: 187) have the highest luciferase expression.
FIG. 23B is the same bar graph as in FIG. 23A, but without the capped control and the uncapped control (to better show the Y axis values).
DETAILED DESCRIPTION
The present disclosure provides nucleic acid molecules (e.g., RNA molecules, such as linear or circular RNA molecules) that are capable of recruiting and binding to ribosomes without the need for a 5’ cap structure. Nucleic acid molecules often use 5’ cap structures as a means for promoting ribosomal binding and, ultimately, open reading frame translation. The presence of a 5’ cap that is susceptible to decapping and subsequent degradation of the RNA, may preclude the possibility of instead having chemical modifications that extend the molecule’s half-life. The present disclosure addresses this
problem by providing means for nucleic acid molecules to recruit and bind ribosome without the need for a 5’ cap structure, thus providing the advantage of simultaneously allowing the nucleic acid molecules to be translatable and to be modified in ways that mitigate nucleolytic degradation.
Examples of nucleic acid modifications that reduce or avoid nucleolytic degradation, but that also preclude the inclusion of a 5’ cap, include (i) the presence of 5’ chemical moieties that restrict the access of an exonuclease to the nucleic acid molecule, as well as (ii) circularization of a nucleic acid molecule, which removes 5’ and 3’ ends altogether. Both of these types of modifications provide the benefit of reducing or eliminating exonucleolytic cleavage by way of either chemically protecting, or removing, the 5’ and 3’ ends to which an exonuclease would bind. However, because these types of modifications alter or eliminate the 5’ end, they preclude the inclusion of a 5’ cap. The present disclosure features internal ribosome entry sites (IRESs) that can be incorporated into nucleic acids and that promote ribosome recruitment and protein translation in the absence of a 5’ cap.
Importantly, not only do the presently described IRES elements promote cap-independent translation, thereby permitting half-life-extending modifications such as 573’ blocking and circularization, the present IRES elements are also compatible with chemically modified uridine nucleosides, particularly 1 -methylpseudouridine nucleosides. This is a significant departure from known IRES elements, which are often structure-based and are expected to be incompatible with chemically modified nucleosides. The use of modified uridine residues, particularly 1 -methylpseudouridine, provides the benefit of engendering a nucleic acid molecule that is substantially less immunogenic than a corresponding nucleic acid molecule lacking this modification. Accordingly, IRES elements that are compatible with 1 - methylpseudoridine are particularly advantageous.
The IRES of the disclosure may recruit translation tractor and/or ribosomes to the nucleic acids described herein in order to promote translation. For example, IRES of the disclosure (e.g., SEQ ID NOs: 173-205) may bind to translation initiation factors, thereby recruiting the molecular machinery needed for initiating translation of the nucleic acid. In another example, IRES of the disclosure (e.g., SEQ ID NOs: 185, 190, and 199-201 ) may bind directly to ribosomal subunits (e.g., eukaryotic 60S or 40S subunits) by, e.g., hybridizing directly to ribosomal RNA (rRNA), such as 25S, 28S, 18S, 5.8S, and/or 5S rRNA.
Thus, the IRES elements described herein thus provide multiple benefits: not only do the present IRES elements allow the types of half-life-extending nucleic acid modifications that would preclude a 5’ cap group, but they also function with a uridine modification that significantly suppresses immunogenicity of the nucleic acid molecule. Furthermore, by binding to ribosomes or hybridizing directly with ribosomal RNA, IRES’ of the disclosure provide the advantage of fast and efficient protein expression while reducing energy expenditure on the cell.
The sections that follow describe exemplary IRES elements in further detail, as well as the various types of nucleic acid modifications that can be used in conjunction with the IRES elements of the disclosure.
1. Internal Ribosome Entry Sites
Exemplary nucleic acids of the disclosure are those that contain:
(i) an internal ribosome entry site (IRES) comprising one or more polynucleotide tracts enriched in uridine or a modified uridine; operably linked to
(ii) an open reading frame encoding a polypeptide.
In some embodiments, the IRES comprises from 1 to 20 of the polynucleotide tracts enriched in uridine or a modified uridine (e.g.. 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 of the polynucleotide tracts enriched in uridine or a modified uridine). The IRES may, for example, comprise from 2 to 10 of the polynucleotide tracts enriched in uridine or a modified uridine. In certain embodiments, the IRES comprises from 3 to 6 of the polynucleotide tracts enriched in uridine or a modified uridine.
In some embodiments, at least 70% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine (e.g.. 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the nucleosides in each of the polynucleotide tracts may be uridine or a modified uridine). In some embodiments, at least 75% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine. In some embodiments, at least 80% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine. In some embodiments, at least 85% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine. In some embodiments, at least 90% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine. In some embodiments, at least 95% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine. In some embodiments, all of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine.
In exemplary nucleic acids of the disclosure, each polynucleotide tract, independently, is from 5 to 20 nucleosides in length (e.g., 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleosides in length). In some embodiments, each polynucleotide tract, independently, is from 5 to 19 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 18 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 17 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 16 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 15 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 14 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 13 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 12 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 11 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 5 to 10 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 15 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 14 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 13 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 12 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 11 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 6 to 10 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 7 to 15 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 7 to 14 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 7 to 13 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 7 to 12 nucleosides in length. In some embodiments, each polynucleotide tract, independently, is from 7 to 11 nucleosides in
length. In some embodiments, each polynucleotide tract, independently, is from 7 to 10 nucleosides in length. In some embodiments, each polynucleotide tract is 9 nucleosides in length.
In exemplary nucleic acids of the disclosure, each polynucleotide tract, independently, comprises from 5 to 20 contiguous uridine or modified uridine nucleosides (e.g. 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 uridine or modified uridine nucleosides). In some embodiments, each polynucleotide tract, independently, comprises from 6 to 15 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract, independently, comprises from 6 to 14 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract, independently, comprises from 6 to 13 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract, independently, comprises from 6 to 12 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract, independently, comprises from 6 to 11 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract, independently, comprises from 6 to 10 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract, independently, comprises from 7 to 15 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract, independently, comprises from 7 to 14 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract, independently, comprises from 7 to 13 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract, independently, comprises from 7 to 12 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract, independently, comprises from 7 to 11 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract, independently, comprises from 7 to 10 contiguous uridine or modified uridine nucleosides.
In exemplary nucleic acids of the disclosure, each polynucleotide tract comprises at least 9 contiguous uridine or modified uridine nucleosides. In some embodiments, each polynucleotide tract comprises 9 contiguous uridine or modified uridine nucleosides.
In exemplary nucleic acids of the disclosure, one or more (or all) of the polynucleotide tracts are enriched in modified uridine. In some embodiments, the modified uridine is 1 -methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio- uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl-uridine, 5- methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl-uridine, 5- methylaminomethyl-2-thio-uridine, 5-methylaminomethyl-2-seleno-uridine, 5-carbamoylmethyl-uridine, 5- carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl-uridine, 1 - propynyl-pseudouridine, 5-taurinomethyl-uridine, 1 -taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio- uridine, 1 -taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine, 5-methyl-2-thio-uridine, 1 -methyl-4-thio- pseudouridine, 4-thio-1 -methyl-pseudouridine, 3-methylpseudouridine, 2-thio-1 -methyl-pseudouridine, 1 - methyl-1 -deaza-pseudouridine, 2-thio-1 -methyl-1 -deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio- dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-
methoxy-2-thio-pseudouridine, N1 -methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1 -methyl-3- (3-amino-3-carboxypropyl)pseudouridine, 5-(isopentenylaminomethyl)uridine, 5- (isopentenylaminomethyl)-2-thio-uridine, a-thio-uridine, 2'-O-methyl-uridine, 5,2'-O-dimethyl-uridine, 2'-O- methyl-pseudouridine, 2-thio-2'-O-methyl-uridine, 5-methoxycarbonylmethyl-2'-O-methyl-uridine, 5- carbamoylmethyl-2'-O-methyl-uridine, 5-carboxymethylaminomethyl-2'-O-methyl-uridine, 3,2'-O-dimethyl- uridine, 5-(isopentenylaminomethyl)-2'-O-methyl-uridine, 1 -thio-uridine, deoxythymidine, 2’-F-ara-uridine, 2’-F-uridine, 2’-OH-ara-uridine, 5-(2-carbomethoxyvinyl) uridine, or 5-[3-(1 -E-propenylamino)uridine. In some embodiments, the modified uridine is 1 -methylpseudouridine.
In exemplary nucleic acids of the disclosure, the IRES is located within a noncoding region of the nucleic acid, such as a 5’ untranslated region (UTR) that is operably linked to the open reading frame. In some embodiments, the open reading frame is further operably linked to a 3’ UTR.
In exemplary nucleic acids of the disclosure, the polynucleotide tracts are separated from one another by way of one or more spacers that each, independently, comprise from 5 to 100 nucleosides (e.g., 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 nucleosides). In some embodiments, each of the spacers, independently, comprises from 10 to 40 nucleosides (e.g., 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleosides). In some embodiments, each of the spacers, independently, comprises 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, or 38 nucleosides.
In exemplary nucleic acids of the disclosure, the IRES is represented by the formula: [(N)n - (U')m]p wherein: each N is, independently, any nucleoside residue; each U' is, independently, uridine or a modified uridine; each n is, independently, an integer from 1 to 100 e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14,
15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100); each m is, independently, an integer from 2 to 15 (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, or
15); and p is an integer from 2 to 20 (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, or 20).
In exemplary nucleic acids of the disclosure, N is, independently, selected from adenosine, a modified adenosine, uridine, a modified uridine, guanosine, a modified guanosine, cytidine, and a modified cytidine. In some embodiments, each N is, independently, selected from adenosine, uridine, a modified uridine, guanosine, and cytidine.
In exemplary nucleic acids of the disclosure, the modified uridine of N is 1 -methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio- uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl-uridine, 5- methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl-uridine, 5-
methylaminomethyl-2-thio-uridine, 5-methylaminomethyl-2-seleno-uridine, 5-carbamoylmethyl-uridine, 5- carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl-uridine, 1 - propynyl-pseudouridine, 5-taurinomethyl-uridine, 1 -taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio- uridine, 1 -taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine, 5-methyl-2-thio-uridine, 1 -methyl-4-thio- pseudouridine, 4-thio-1 -methyl-pseudouridine, 3-methylpseudouridine, 2-thio-1 -methyl-pseudouridine, 1 - methyl-1 -deaza-pseudouridine, 2-thio-1 -methyl-1 -deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio- dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4- methoxy-2-thio-pseudouridine, N1 -methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1 -methyl-3- (3-amino-3-carboxypropyl)pseudouridine, 5-(isopentenylaminomethyl)uridine, 5- (isopentenylaminomethyl)-2-thio-uridine, a-thio-uridine, 2'-O-methyl-uridine, 5,2'-O-dimethyl-uridine, 2'-O- methyl-pseudouridine, 2-thio-2'-O-methyl-uridine, 5-methoxycarbonylmethyl-2'-O-methyl-uridine, 5- carbamoylmethyl-2'-O-methyl-uridine, 5-carboxymethylaminomethyl-2'-O-methyl-uridine, 3,2'-O-dimethyl- uridine, 5-(isopentenylaminomethyl)-2'-O-methyl-uridine, 1 -thio-uridine, deoxythymidine, 2’-F-ara-uridine, 2’-F-uridine, 2’-OH-ara-uridine, 5-(2-carbomethoxyvinyl) uridine, or 5-[3-(1 -E-propenylamino)uridine.
In exemplary nucleic acids of the disclosure, the modified cytidine of N is 5-aza-cytidine, 6-aza- cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetyl-cytidine, 5-formyl-cytidine, N4-methyl-cytidine, 5- methyl-cytidine, 5-halo-cytidine, 5-hydroxymethyl-cytidine, 1 -methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1 - methyl-pseudoisocytidine, 4-thio- 1 -methyl-1 -deaza-pseudoisocytidine, 1 -methyl-1 -deaza- pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio- zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, 4-methoxy-1 - methyl-pseudoisocytidine, lysidine, a-thio-cytidine, 2'-O-methyl-cytidine, 5,2'-O-dimethyl-cytidine, N4- acetyl-2'-O-methyl-cytidine, N4,2'-O-dimethyl-cytidine, 5-formyl-2'-O-methyl-cytidine, N4,N4,2'-O- trimethyl-cytidine, 1 -thio-cytidine, 2’-F-ara-cytidine, 2’-F-cytidine, or 2’-OH-ara-cytidine.
In exemplary nucleic acids of the disclosure, the modified adenosine of N is 2-amino-purine, 2, 6- diaminopurine, 2-amino-6-halo-purine, 6-halo-purine, 2-amino-6-methyl-purine, 8-azido-adenosine, 7- deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7- deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1 -methyl-adenosine, 2-methyl-adenine, N6- methyl-adenosine, 2-methylthio-N6-methyl-adenosine, N6-isopentenyl-adenosine, 2-methylthio-N6- isopentenyl-adenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis- hydroxyisopentenyl)adenosine, N6-glycinylcarbamoyl-adenosine, N6-threonylcarbamoyl-adenosine, N6- methyl-N6-threonylcarbamoyl-adenosine, 2-methylthio-N6-threonylcarbamoyl-adenosine, N6,N6- dimethyl-adenosine, N6-hydroxynorvalylcarbamoyl-adenosine, 2-methylthio-N6- hydroxynorvalylcarbamoyl-adenosine, N6-acetyl-adenosine, 7-methyl-adenine, 2-methylthio-adenine, 2- methoxy-adenine, a-thio-adenosine, 2'-O-methyl-adenosine, N6,2'-O-dimethyl-adenosine, N6,N6,2'-O- trimethyl-adenosine, 1 ,2'-O-dimethyl-adenosine, 2'-O-ribosyladenosine, 2-amino-N6-methyl-purine, 1 -thioadenosine, 8-azido-adenosine, 2’-F-ara-adenosine, 2’-F-adenosine, 2’-OH-ara-adenosine, or N6-(19- amino-pentaoxanonadecyl)-adenosine.
In exemplary nucleic acids of the disclosure, the modified guanosine of N is inosine, 1 -methylinosine, wyosine, methylwyosine, 4-demethyl-wyosine, isowyosine, wybutosine, peroxywybutosine,
hydroxywybutosine, 7-deaza-guanosine, queuosine, epoxyqueuosine, galactosyl-queuosine, mannosyl- queuosine, 7-cyano-7-deaza-guanosine, 7-aminomethyl-7-deaza-guanosine, archaeosine, 7-deaza-8- aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl- guanosine, 6-thio-7-methyl-guanosine, 7-methyl-inosine, 6-methoxy-guanosine, 1 -methyl-guanosine, N2- methyl-guanosine, N2,N2-dimethyl-guanosine, N2,7-dimethyl-guanosine, N2, N2,7-dimethyl-guanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1 -methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, N2,N2-dimethyl-6-thio-guanosine, a-thio-guanosine, 2'-O-methyl-guanosine, N2-methyl-2'-O-methyl- guanosine, N2,N2-dimethyl-2'-O-methyl-guanosine, 1 -methyl-2'-O-methyl-guanosine, N2,7-dimethyl-2'-O- methyl-guanosine, 2'-O-methyl-inosine, 1 ,2'-O-dimethyl-inosine, 2'-O-ribosylguanosine, 1 -thio-guanosine, O6-methyl-guanosine, 2’-F-ara-guanosine, or 2’-F-guanosine.
In exemplary nucleic acids of the disclosure, the modified uridine of U’ is 1 -methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio- uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl-uridine, 5- methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl-uridine, 5- methylaminomethyl-2-thio-uridine, 5-methylaminomethyl-2-seleno-uridine, 5-carbamoylmethyl-uridine, 5- carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl-uridine, 1 - propynyl-pseudouridine, 5-taurinomethyl-uridine, 1 -taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio- uridine, 1 -taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine, 5-methyl-2-thio-uridine, 1 -methyl-4-thio- pseudouridine, 4-thio-1 -methyl-pseudouridine, 3-methylpseudouridine, 2-thio-1 -methyl-pseudouridine, 1 - methyl-1 -deaza-pseudouridine, 2-thio-1 -methyl-1 -deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio- dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4- methoxy-2-thio-pseudouridine, N1 -methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1 -methyl-3- (3-amino-3-carboxypropyl)pseudouridine, 5-(isopentenylaminomethyl)uridine, 5- (isopentenylaminomethyl)-2-thio-uridine, a-thio-uridine, 2'-O-methyl-uridine, 5,2'-O-dimethyl-uridine, 2'-O- methyl-pseudouridine, 2-thio-2'-O-methyl-uridine, 5-methoxycarbonylmethyl-2'-O-methyl-uridine, 5- carbamoylmethyl-2'-O-methyl-uridine, 5-carboxymethylaminomethyl-2'-O-methyl-uridine, 3,2'-O-dimethyl- uridine, 5-(isopentenylaminomethyl)-2'-O-methyl-uridine, 1 -thio-uridine, deoxythymidine, 2’-F-ara-uridine, 2’-F-uridine, 2’-OH-ara-uridine, 5-(2-carbomethoxyvinyl) uridine, or 5-[3-(1 -E-propenylamino)uridine.
In exemplary nucleic acids of the disclosure, each n is, independently, an integer from 10 to 40. In some embodiments, each n is, independently, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, or 38. In some embodiments, each m is, independently, an integer from 2 to 15. In some embodiments, each m is, independently, an integer from 7 to 1 1 . In some embodiments, each m is 9. In some embodiments, p is an integer from 2 to 10. In some embodiments, p is an integer from 3 to 6, optionally wherein p is 3 or 6.
In exemplary nucleic acids of the disclosure, the nucleic acid is RNA. In some embodiments, the nucleic acid is linear. In some embodiments, the nucleic acid is circular. In some embodiments, the open reading from consists of nucleosides selected from adenosine, a modified adenosine, uridine, a modified
uridine, guanosine, a modified guanosine, cytidine, and a modified cytidine. In some embodiments, the open reading from consists of nucleosides selected from adenosine, uridine, a modified uridine, guanosine, and cytidine.
In exemplary nucleic acids of the disclosure, the modified uridine of the open reading frame is 1 - methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5- aza-uridine, 2-thio-uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5- carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl- uridine, 5-methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl- uridine, 5-methylaminomethyl-2-thio-uridine, 5-methylaminomethyl-2-seleno-uridine, 5-carbamoylmethyl- uridine, 5-carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl- uridine, 1 -propynyl-pseudouridine, 5-taurinomethyl-uridine, 1 -taurinomethyl-pseudouridine, 5- taurinomethyl-2-thio-uridine, 1 -taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine, 5-methyl-2-thio- uridine, 1 -methyl-4-thio-pseudouridine, 4-thio-1 -methyl-pseudouridine, 3-methylpseudouridine, 2-thio-1 - methyl-pseudouridine, 1 -methyl-1 -deaza-pseudouridine, 2-thio-1 -methyl-1 -deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4- methoxy-2-thio-pseudouridine, N1 -methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1 -methyl-3- (3-amino-3-carboxypropyl)pseudouridine, 5-(isopentenylaminomethyl)uridine, 5- (isopentenylaminomethyl)-2-thio-uridine, a-thio-uridine, 2'-O-methyl-uridine, 5,2'-O-dimethyl-uridine, 2'-O- methyl-pseudouridine, 2-thio-2'-O-methyl-uridine, 5-methoxycarbonylmethyl-2'-O-methyl-uridine, 5- carbamoylmethyl-2'-O-methyl-uridine, 5-carboxymethylaminomethyl-2'-O-methyl-uridine, 3,2'-O-dimethyl- uridine, 5-(isopentenylaminomethyl)-2'-O-methyl-uridine, 1 -thio-uridine, deoxythymidine, 2’-F-ara-uridine, 2’-F-uridine, 2’-OH-ara-uridine, 5-(2-carbomethoxyvinyl) uridine, or 5-[3-(1 -E-propenylamino)uridine. In some embodiments, the modified uridine of the open reading frame is 1 -methylpseudouridine.
In exemplary nucleic acids of the disclosure, the modified cytidine of N is 5-aza-cytidine, 6-aza- cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetyl-cytidine, 5-formyl-cytidine, N4-methyl-cytidine, 5- methyl-cytidine, 5-halo-cytidine, 5-hydroxymethyl-cytidine, 1 -methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1 - methyl-pseudoisocytidine, 4-thio- 1 -methyl-1 -deaza-pseudoisocytidine, 1 -methyl-1 -deaza- pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio- zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, 4-methoxy-1 - methyl-pseudoisocytidine, lysidine, a-thio-cytidine, 2'-O-methyl-cytidine, 5,2'-O-dimethyl-cytidine, N4- acetyl-2'-O-methyl-cytidine, N4,2'-O-dimethyl-cytidine, 5-formyl-2'-O-methyl-cytidine, N4,N4,2'-O- trimethyl-cytidine, 1 -thio-cytidine, 2’-F-ara-cytidine, 2’-F-cytidine, or 2’-OH-ara-cytidine.
In exemplary nucleic acids of the disclosure, the modified adenosine of N is 2-amino-purine, 2, 6- diaminopurine, 2-amino-6-halo-purine, 6-halo-purine, 2-amino-6-methyl-purine, 8-azido-adenosine, 7- deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7- deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1 -methyl-adenosine, 2-methyl-adenine, N6- methyl-adenosine, 2-methylthio-N6-methyl-adenosine, N6-isopentenyl-adenosine, 2-methylthio-N6-
isopentenyl-adenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis- hydroxyisopentenyl)adenosine, N6-glycinylcarbamoyl-adenosine, N6-threonylcarbamoyl-adenosine, N6- methyl-N6-threonylcarbamoyl-adenosine, 2-methylthio-N6-threonylcarbamoyl-adenosine, N6,N6- dimethyl-adenosine, N6-hydroxynorvalylcarbamoyl-adenosine, 2-methylthio-N6- hydroxynorvalylcarbamoyl-adenosine, N6-acetyl-adenosine, 7-methyl-adenine, 2-methylthio-adenine, 2- methoxy-adenine, a-thio-adenosine, 2'-O-methyl-adenosine, N6,2'-O-dimethyl-adenosine, N6,N6,2'-O- trimethyl-adenosine, 1 ,2'-O-dimethyl-adenosine, 2'-O-ribosyladenosine, 2-amino-N6-methyl-purine, 1 -thioadenosine, 8-azido-adenosine, 2’-F-ara-adenosine, 2’-F-adenosine, 2’-OH-ara-adenosine, or N6-(19- amino-pentaoxanonadecyl)-adenosine.
In exemplary nucleic acids of the disclosure, the modified guanosine of N is inosine, 1 -methylinosine, wyosine, methylwyosine, 4-demethyl-wyosine, isowyosine, wybutosine, peroxywybutosine, hydroxywybutosine, 7-deaza-guanosine, queuosine, epoxyqueuosine, galactosyl-queuosine, mannosyl- queuosine, 7-cyano-7-deaza-guanosine, 7-aminomethyl-7-deaza-guanosine, archaeosine, 7-deaza-8- aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl- guanosine, 6-thio-7-methyl-guanosine, 7-methyl-inosine, 6-methoxy-guanosine, 1 -methyl-guanosine, N2- methyl-guanosine, N2,N2-dimethyl-guanosine, N2,7-dimethyl-guanosine, N2, N2,7-dimethyl-guanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1 -methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, N2,N2-dimethyl-6-thio-guanosine, a-thio-guanosine, 2'-O-methyl-guanosine, N2-methyl-2'-O-methyl- guanosine, N2,N2-dimethyl-2'-O-methyl-guanosine, 1 -methyl-2'-O-methyl-guanosine, N2,7-dimethyl-2'-O- methyl-guanosine, 2'-O-methyl-inosine, 1 ,2'-O-dimethyl-inosine, 2'-O-ribosylguanosine, 1 -thio-guanosine, O6-methyl-guanosine, 2’-F-ara-guanosine, or 2’-F-guanosine.
In exemplary nucleic acids of the disclosure, the polypeptide encoded by the open reading frame is a secreted protein, a cytokine, a growth factor, an enzyme, an immunomodulator, an antibody or antigen-binding fragment thereof, a cell-penetrating peptide, an extracellular membrane-bound protein, an intracellular membrane-bound protein, a cytoplasmic protein, a cytoskeletal protein, or a nuclear protein.
In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with about 70% to about 100% (e.g., about 70% to about 100%, about 75% to about 100%, about 80% to about 100%, about 85% to about 100%, about 90% to about 100%, about 91 % to about 100%, about 92% to about 100%, about 93% to about 100%, about 94% to about 100%, about 95% to about 100%, about 96% to about 100%, about 97% to about 100%, about 98% to about 100%, or about 99% to 100%) sequence identity to an IRES presented in Table 2 (e.g., any one of IRES 1 to IRES 22).
In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 70% sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 75% sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 80% sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 85% sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 90% sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 91 % sequence identity to any one of SEQ ID NOs: 173-190
and 202-205. In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 92% sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 93% sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 94% sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 95% sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 96% sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 97% sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 98% sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 99% sequence identity to any one of SEQ ID NOs: 173-190 and 202-205. In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with 100% sequence identity to any one of SEQ ID NOs: 173-190 and 202-205.
Table 2. Exemplary IRES sequences
In exemplary nucleic acids of the disclosure, the nucleic acid does not comprise a 5’ cap.
In another aspect, the disclosure provides a nucleic acid comprising:
(i) (a) an IRES comprising one or more polynucleotides that specifically bind a RNA binding protein, a translation initiation factor (for example, eukaryotic translation initiation factor 4 G (elF4G), eukaryotic translation initiation factor 4G2 (elF4G2, also referred to as Dap5), eukaryotic translation initiation factor 3 (elF3)), or IRES trans-acting factors (ITAfs), such as a polypyrimidine tract-binding protein (PTBP); or (b) a fusion protein comprising a translation initiation factor (e.g., elF4G, elF4G2, elF3, La protein, or an ITAf, such as La) fused to an RNA-binding protein; operably linked to
(ii) an open reading frame encoding a polypeptide.
In exemplary nucleic acids of the disclosure, the one or more polynucleotides specifically bind elF4G. In some embodiments, each of the one or more polynucleotides, independently, has a nucleic acid sequence that is at least 75% identical to ACUCACUAUUUGUUUUCGCGCCCAGUUGCAAAAA (SEQ ID NO: 1 ). In some embodiments, each of the one or more polynucleotides, independently, has a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO: 1 (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of SEQ ID NO: 1 ). In some embodiments, each of the one or more polynucleotides has the nucleic acid sequence of SEQ ID NO: 1 . In some embodiments, the nucleic acid does not comprise a 5’ cap.
In a further aspect, the disclosure provides a polypeptide expression system comprising:
(i) the nucleic acid of the foregoing aspect (or any of the above embodiments thereof); and
(ii) a nucleic acid comprising an open reading frame that encodes elF4G, La protein, or a functional variant thereof.
In some embodiments, the nucleic acid of (i) and the nucleic acid of (ii) are separate molecules.
In some embodiments, the nucleic acid of (ii) comprises, from 5’ to 3’:
(i) a 5’ UTR;
(ii) the open reading frame encoding the elF4G, La protein, or functional variant thereof; and
(iii) a 3’ UTR.
In some embodiments, the nucleic acid of (ii) further comprises a 5’ cap operably linked to the 5’ UTR.
In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with about 70% to about 100% (e.g., about 70% to about 100%, about 75% to about 100%, about 80% to about 100%, about 85% to about 100%, about 90% to about 100%, about 91 % to about 100%, about 92% to about 100%, about 93% to about 100%, about 94% to about 100%, about 95% to about 100%, about 96% to about 100%, about 97% to about 100%, about 98% to about 100%, or about 99% to 100%) sequence identity to an IRES presented in Table 3 (e.g., any one of IRES 23 to IRES 33).
In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 70% sequence identity to any one of SEQ ID NOs: 191 -201 . In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 75% sequence identity to any one of SEQ ID NOs: 191 -201 . In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 80% sequence identity to any one of SEQ ID NOs: 191 -201 . In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 85% sequence identity to any one of SEQ ID NOs: 191 -201 . In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 90% sequence identity to any one of SEQ ID NOs: 191 -201 . In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 91% sequence identity to any one of SEQ ID NOs: 191 -201 . In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 92% sequence identity to any one of SEQ ID NOs: 191 -201 . In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 93% sequence identity to any one of SEQ ID NOs: 191 -201 . In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 94% sequence identity to any one of SEQ ID NOs: 191 -201 . In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 95% sequence identity to any one of SEQ ID NOs: 191 -201 . In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 96% sequence identity to any one of SEQ ID NOs: 191 -201 . In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 97% sequence identity to any one of SEQ ID NOs: 191 -201 . In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 98% sequence identity to any one of SEQ ID NOs: 191 -201 . In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with at least 99% sequence identity to any one of SEQ ID NOs: 191 -201 . In exemplary nucleic acids of the disclosure, the IRES contains a nucleotide sequence with 100% sequence identity to any one of SEQ ID NOs: 191 -201 .
Table 3. Exemplary translation initiation elements
2. Chemically Modified Nucleic Acids
The IRES elements of the disclosure, as well as the open reading frame, UTR, and other elements of the nucleic acid constructs described herein, may have one or more chemical modifications. According to Aduri et al., (Aduri, R. et al., AMBER force field parameters for the naturally occurring modified nucleosides in RNA. Journal of Chemical Theory and Computation. 2006. 3(4):1464-75), there are 107 naturally occurring nucleosides, including 1 -methyladenosine, 2-methylthio-N6-hydroxynorvalyl carbamoyladenosine, 2-methyladenosine, 2-O-ribosylphosphate adenosine, N6-methyl-N6- threonylcarbamoyladenosine, N6-acetyladenosine, N6-glycinylcarbamoyladenosine, N6- isopentenyladenosine, N6-methyladenosine, N6-threonylcarbamoyladenosine, N6,N6-dimethyladenosine, N6-(cis-hydroxyisopentenyl)adenosine, N6-hydroxynorvalylcarbamoyladenosine, 1 ,2-0- dimethyladenosine, N6,2-O-dimethyladenosine, 2-O-methyladenosine, N6,N6,O-2-trimethyladenosine, 2- methylthio-N6-(cis-hydroxyisopentenyl) adenosine, 2-methylthio-N6-methyladenosine, 2-methylthio-N6- isopentenyladenosine, 2-methylthio-N6-threonyl carbamoyladenosine, 2-thiocytidine, 3-methylcytidine , N4-acetylcytidine, 5-formylcytidine, N4-methylcytidine, 5-methylcytidine, 5-hydroxymethylcytidine, lysidine, N4-acetyl-2-O-methylcytidine, 5-formyl-2-O-methylcytidine, 5,2-O-dimethylcytidine, 2-0- methylcytidine, N4,2-O-dimethylcytidine, N4,N4,2-O-trimethylcytidine, 1 -methylguanosine, N2,7- dimethylguanosine, N2-methylguanosine, 2-O-ribosylphosphate guanosine, 7-methylguanosine, under modified hydroxywybutosine, 7-aminomethyl-7-deazaguanosine, 7-cyano-7-deazaguanosine, N2,N2- dimethylguanosine, 4-demethylwyosine, epoxyqueuosine, hydroxywybutosine, isowyosine, N2, 7,2-0- trimethylguanosine, N2,2-O-dimethylguanosine, 1 ,2-O-dimethylguanosine, 2-O-methylguanosine, N2,N2,2-O-trimethylguanosine, N2,N2,7-trimethylguanosine, peroxywybutosine, galactosyl-queuosine, mannosyl-queuosine, queuosine, archaeosine, wybutosine, methylwyosine, wyosine, 2-thiouridine, 3-(3- amino-3-carboxypropyl)uridine, 3-methyluridine, 4-thiouridine, 5-methyl-2-thiouridine, 5- methylaminomethyluridine, 5-carboxymethyluridine, 5-carboxymethylaminomethyluridine, 5- hydroxyuridine, 5-methyluridine, 5-taurinomethyluridine, 5-carbamoylmethyluridine, 5- (carboxyhydroxymethyl)uridine methyl ester, dihydrouridine, 5-methyldihydrouridine, 5- methylaminomethyl-2-thiouridine, 5-(carboxyhydroxymethyl)uridine, 5-(isopentenylaminomethyl)uridine, 5-(isopentenylaminomethyl)-2-thiouridine, 3,2-O-dimethyluridine, 5-carboxymethylaminomethyl-2-O- methyluridine, 5-carbamoylmethyl-2-O-methyluridine, 5-methoxycarbonylmethyl-2-O-methyluridine, 5- (isopentenylaminomethyl)-2-O-methyluridine, 5,2-O-dimethyluridine, 2-0-methyluridine, 2-thio-2-O- methyluridine, uridine 5-oxyacetic acid, 5-methoxycarbonylmethyluridine, uridine 5-oxyacetic acid methyl ester, 5-methoxyuridine, 5-aminomethyl-2-thiouridine, 5-carboxymethylaminomethyl-2-thiouridine, 5- methylaminomethyl-2-selenouridine, 5-methoxycarbonylmethyl-2-thiouridine, 5-taurinomethyl-2- thiouridine, pseudouridine, 1 -methyl-3-(3-amino-3-carboxypropyl)pseudouridine, 1 -methylpseudouridine, 3-methylpseudouridine, 2-O-methylpseudouridine, inosine, 1 -methylinosine, 1 ,2-O-dimethylinosine, and 2-O-methylinosine. Each of these may be components of nucleic acids of the present invention. a. Nucleosides containing modified sugars
The alternative nucleosides and nucleotides (e.g., building block molecules), which may be incorporated into a polynucleotide (e.g., RNA or mRNA, as described herein), can be altered on the sugar of the ribonucleic acid. For example, the 2' hydroxyl group (OH) can be modified or replaced with a
number of different substituents. Exemplary substitutions at the 2'-position include, but are not limited to, H, halo, optionally substituted C1-6 alkyl; optionally substituted C1-6 alkoxy; optionally substituted C6-1 0 aryloxy; optionally substituted C3-8 cycloalkyl; optionally substituted C3-8 cycloalkoxy; optionally substituted C6-10 aryloxy; optionally substituted C6-1 0 aryl- C1-6 alkoxy, optionally substituted C1-12 (heterocyclyl)oxy; a sugar (e.g., ribose, pentose, or any described herein); a polyethyleneglycol (PEG), - O(CH2CH2O)nCH2CH2OR, where R is H or optionally substituted alkyl, and n is an integer from 0 to 20 (e.g., from 0 to 4, from 0 to 8, from 0 to 10, from 0 to 16, from 1 to 4, from 1 to 8, from 1 to 10, from 1 to 16, from 1 to 20, from 2 to 4, from 2 to 8, from 2 to 10, from 2 to 16, from 2 to 20, from 4 to 8, from 4 to 10, from 4 to 16, and from 4 to 20); “locked” nucleic acids (LNA) in which the 2'-hydroxyl is connected by a C1-6 alkylene or C1-6 heteroalkylene bridge to the 4’-carbon of the same ribose sugar, where exemplary bridges included methylene, propylene, ether, or amino bridges; aminoalkyl, as defined herein; aminoalkoxy, as defined herein; amino as defined herein; and amino acid, as defined herein
Generally, RNA includes the sugar group ribose, which is a 5-membered ring having an oxygen. Exemplary, non-limiting alternative nucleotides include replacement of the oxygen in ribose (e.g., with S, Se, or alkylene, such as methylene or ethylene); addition of a double bond (e.g., to replace ribose with cyclopentenyl or cyclohexenyl); ring contraction of ribose (e.g., to form a 4-membered ring of cyclobutane or oxetane); ring expansion of ribose (e.g., to form a 6- or 7-membered ring having an additional carbon or heteroatom, such as for anhydrohexitol, altritol, mannitol, cyclohexanyl, cyclohexenyl, and morpholino that also has a phosphoramidate backbone); multicyclic forms (e.g., tricyclo; and “unlocked” forms, such as glycol nucleic acid (GNA) (e.g., R-GNA or S-GNA, where ribose is replaced by glycol units attached to phosphodiester bonds), threose nucleic acid (TNA, where ribose is replace with a-L-threofuranosyl- (3'->2')), and peptide nucleic acid (PNA, where 2-amino-ethyl-glycine linkages replace the ribose and phosphodiester backbone). The sugar group can also contain one or more carbons that possess the opposite stereochemical configuration than that of the corresponding carbon in ribose. Thus, a polynucleotide molecule can include nucleotides containing, e.g., arabinose, as the sugar. b. Alterations on the nucleobase
The present disclosure provides for alternative nucleosides and nucleotides. As described herein “nucleoside” is defined as a compound containing a sugar molecule (e.g., a pentose or ribose) or derivative thereof in combination with an organic base (e.g., a purine or pyrimidine) or a derivative thereof (also referred to herein as “nucleobase”). As described herein, “nucleotide” is defined as a nucleoside including a phosphate group.
Exemplary non-limiting alterations include an amino group, a thiol group, an alkyl group, a halo group, or any described herein. The alternative nucleotides may by synthesized by any useful method, as described herein (e.g., chemically, enzymatically, or recombinantly to include one or more alternative or alternative nucleosides).
In some embodiments, a nucleic acid of the invention (e.g., an mRNA or an oligonucleotide) includes one or more 2’-OMe nucleotides, 2’-methoxyethyl nucleotides (2’-MOE nucleotides), 2’-F nucleotide, 2’-NH2 nucleotide, 2’fluoroarabino nucleotides (FANA nucleotides), locked nucleic acid nucleotides (LNA nucleotides), or 4’-S nucleotides.
The alternative nucleotide base pairing encompasses not only the standard adenosine-thymine, adenosine-uracil, and guanosine-cytosine base pairs, but also base pairs formed between nucleotides and/or alternative nucleotides including non-standard or alternative bases, wherein the arrangement of hydrogen bond donors and hydrogen bond acceptors permits hydrogen bonding between a non-standard base and a standard base or between two complementary non-standard base structures. One example of such non-standard base pairing is the base pairing between the alternative nucleotide inosine and adenine, cytosine, or uracil.
The alternative nucleosides and nucleotides can include an alternative nucleobase. Examples of nucleobases found in RNA include, but are not limited to, adenine, guanine, cytosine, and uracil. Examples of nucleobase found in DNA include, but are not limited to, adenine, guanine, cytosine, and thymine. These nucleobases can be altered or wholly replaced to provide polynucleotide molecules having enhanced properties (e.g., resistance to nucleases and stability), and these properties may manifest through disruption of the binding of a major groove binding partner.
In some embodiments, the alternative nucleobase is an alternative uracil. Exemplary nucleobases and nucleosides having an alternative uracil include pseudouridine (ip), pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine (s2U), 4-thio-uridine (s4U), 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine (ho5U), 5-aminoallyl-uridine, 5-halo-uridine (e.g., 5-iodo-uridineor 5-bromo-uridine), 3-methyl-uridine (m3U), 5-methoxy-uridine (mo5U), uridine 5- oxyacetic acid (cmo5U), uridine 5-oxyacetic acid methyl ester (mcmo5U), 5-carboxymethyl-uridine (cm5U), 1 -carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine (chm5U), 5-carboxyhydroxymethyl- uridine methyl ester (mchm5U), 5-methoxycarbonylmethyl-uridine (mcm5U), 5-methoxycarbonylmethyl-2- thio-uridine (mcm5s2U), 5-aminomethyl-2-thio-uridine (nm5s2U), 5-methylaminomethyl-uridine (mnm5U), 5- methylaminomethyl-2-thio-uridine (mnm5s2U), 5-methylaminomethyl-2-seleno-uridine (mnm5se2U), 5- carbamoylmethyl-uridine (ncm5U), 5-carboxymethylaminomethyl-uridine (cmnm5U), 5- carboxymethylaminomethyl-2-thio-uridine (cmnm5s2U), 5-propynyl-uridine, 1 -propynyl-pseudouridine, 5- taurinomethyl-uridine (Tm5U), 1 -taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uridine(Tm5s2U), 1 - taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine (m5U, i.e., having the nucleobase deoxythymine), 1 - methyl-pseudouridine (m1 ψ), 5-methyl-2-thio-uridine (m5s2U), 1 -methyl-4-thio-pseudouridine (m1s4ip), 4- thio-1 -methyl-pseudouridine, 3-methyl-pseudouridine (m3ip), 2-thio-1 -methyl-pseudouridine, 1 -methyl-1 - deaza-pseudouridine, 2-thio-1 -methyl-1 -deaza-pseudouridine, dihydrouridine (D), dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine (m5D), 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2- methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, N1 -methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine (acp3U), 1 -methyl-3-(3-amino-3- carboxypropyl)pseudouridine (acp3 ip), 5-(isopentenylaminomethyl)uridine (inm5U), 5- (isopentenylaminomethyl)-2-thio-uridine (inm5s2U), a-thio-uridine, 2'-O-methyl-uridine (Um), 5,2'-O- dimethyl-uridine (m5Um), 2'-O-methyl-pseudouridine (ipm), 2-thio-2'-O-methyl-uridine (s2Um), 5- methoxycarbonylmethyl-2'-O-methyl-uridine (mcm5Um), 5-carbamoylmethyl-2'-O-methyl-uridine (ncm5Um), 5-carboxymethylaminomethyl-2'-O-methyl-uridine (cmnm5Um), 3,2'-O-dimethyl-uridine (m3Um), and 5-(isopentenylaminomethyl)-2'-O-methyl-uridine (inm5Um), 1 -thio-uridine, deoxythymidine, 2’-F-ara-uridine, 2’-F-uridine, 2’-OH-ara-uridine, 5-(2-carbomethoxyvinyl) uridine, and 5-[3-(1 -E- propenylamino)uridine.
In preferred embodiments, the nucleic acid is modified to contain 1 -methylpseudouridine (m1ψ) in lieu of uridine at each instance.
In some embodiments, the alternative nucleobase is an alternative cytosine. Exemplary nucleobases and nucleosides having an alternative cytosine include 5-aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine (m3C), N4-acetyl-cytidine (ac4C), 5-formyl-cytidine (f5C), N4-methyl- cytidine (m4C), 5-methyl-cytidine (m5C), 5-halo-cytidine (e.g., 5-iodo-cytidine), 5-hydroxymethyl-cytidine (hm5C), 1 -methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine (s2C), 2- thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-th io- 1 -methyl-pseudoisocytidine, 4-th io- 1 -methyl-1 - deaza-pseudoisocytidine, 1 -methyl-1 -deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl- zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, 4-methoxy-1 -methyl-pseudoisocytidine, lysidine (k2C), a-thio-cytidine, 2'-O- methyl-cytidine (Cm), 5,2'-O-dimethyl-cytidine (m5Cm), N4-acetyl-2'-O-methyl-cytidine (ac4Cm), N4,2'-O- dimethyl-cytidine (m4Cm), 5-formyl-2'-O-methyl-cytidine (f5Cm), N4,N4,2'-O-trimethyl-cytidine (m42Cm), 1 - thio-cytidine, 2’-F-ara-cytidine, 2’-F-cytidine, and 2’-OH-ara-cytidine.
In some embodiments, the alternative nucleobase is an alternative adenine. Exemplary nucleobases and nucleosides having an alternative adenine include 2-amino-purine, 2, 6-diaminopurine, 2-amino-6-halo-purine (e.g., 2-amino-6-chloro-purine), 6-halo-purine (e.g., 6-chloro-purine), 2-amino-6- methyl-purine, 8-azido-adenosine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7- deaza-8-aza-2-amino-purine, 7-deaza-2, 6-diaminopurine, 7-deaza-8-aza-2, 6-diaminopurine, 1 -methyladenosine (m1A), 2-methyl-adenine (m2A), N6-methyl-adenosine (m6A), 2-methylthio-N6-methyl- adenosine (ms2m6A), N6-isopentenyl-adenosine (i6A), 2-methylthio-N6-isopentenyl-adenosine (ms2i6A), N6-(cis-hydroxyisopentenyl)adenosine (io6 A), 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine (ms2io6A), N6-glycinylcarbamoyl-adenosine (g6A), N6-threonylcarbamoyl-adenosine (t6A), N6-methyl-N6- threonylcarbamoyl-adenosine (m6t6A), 2-methylthio-N6-threonylcarbamoyl-adenosine (ms2g6A), N6,N6- dimethyl-adenosine (m62A), N6-hydroxynorvalylcarbamoyl-adenosine (hn6A), 2-methylthio-N6- hydroxynorvalylcarbamoyl-adenosine (ms2hn6A), N6-acetyl-adenosine (ac6A), 7-methyl-adenine, 2- methylthio-adenine, 2-methoxy-adenine, a-thio-adenosine, 2'-O-methyl-adenosine (Am), N6,2'-O- dimethyl-adenosine (m6Am), N6,N6,2'-O-trimethyl-adenosine (m62Am), 1 ,2'-O-dimethyl-adenosine (m1Am), 2'-O-ribosyladenosine (phosphate) (Ar(p)), 2-amino-N6-methyl-purine, 1 -thio-adenosine, 8-azido- adenosine, 2’-F-ara-adenosine, 2’-F-adenosine, 2’-OH-ara-adenosine, and N6-(19-amino- pentaoxanonadecyl)-adenosine.
In some embodiments, the alternative nucleobase is an alternative guanine. Exemplary nucleobases and nucleosides having an alternative guanine include inosine (I), 1 -methyl-inosine (m1 l), wyosine (imG), methylwyosine (mimG), 4-demethyl-wyosine (imG-14), isowyosine (imG2), wybutosine (yW), peroxywybutosine (02yW), hydroxywybutosine (OhyW), undermodified hydroxywybutosine (OhyW*), 7-deaza-guanosine, queuosine (Q), epoxyqueuosine (oQ), galactosyl-queuosine (galQ), mannosyl-queuosine (manQ), 7-cyano-7-deaza-guanosine (preQ0), 7-aminomethyl-7-deaza-guanosine (preQi), archaeosine (G+), 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio- 7-deaza-8-aza-guanosine, 7-methyl-guanosine (m7G), 6-thio-7-methyl-guanosine, 7-methyl-inosine, 6- methoxy-guanosine, 1 -methyl-guanosine (m1G), N2-methyl-guanosine (m2G), N2,N2-dimethyl-guanosine (m22G), N2,7-dimethyl-guanosine (m27G), N2, N2,7-dimethyl-guanosine (m2’2’7G), 8-oxo-guanosine, 7-
methyl-8-oxo-guanosine, 1 -methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, N2,N2-dimethyl-6-thio- guanosine, a-thio-guanosine, 2'-O-methyl-guanosine (Gm), N2-methyl-2'-O-methyl-guanosine (m2Gm), N2,N2-dimethyl-2'-O-methyl-guanosine (m22Gm), 1 -methyl-2'-O-methyl-guanosine (m1Gm), N2,7- dimethyl-2'-O-methyl-guanosine (m2’7Gm), 2'-O-methyl-inosine (Im), 1 ,2'-O-dimethyl-inosine (m1 lm), 2'-O- ribosylguanosine (phosphate) (Gr(p)) , 1 -thio-guanosine, O6-methyl-guanosine, 2’-F-ara-guanosine, and 2’-F-guanosine.
The nucleobase of the nucleotide can be independently selected from a purine, a pyrimidine, a purine, or pyrimidine analog. For example, the nucleobase can each be independently selected from adenine, cytosine, guanine, uracil, or hypoxanthine. In some embodiments, the nucleobase can also include, for example, naturally-occurring and synthetic derivatives of a base, including pyrazolo[3,4- d]pyrimidines, 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2- aminoadenine, 6-methyl, and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo (e.g., 8-bromo), 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7- methyladenine, 8-azaguanine and 8-azaadenine, deazaguanine, 7-deazaguanine, 3-deazaguanine, deazaadenine, 7-deazaadenine, 3-deazaadenine, pyrazolo[3,4-d]pyrimidine, imidazo[1 ,5-a]1 ,3,5 triazinones, 9-deazapurines, imidazo[4,5-d]pyrazines, thiazolo[4,5-d]pyrimidines, pyrazin-2-ones, 1 ,2,4- triazine, pyridazine; and 1 ,3,5 triazine. When the nucleotides are depicted using the shorthand A, G, C, T or U, each letter refers to the representative base and/or derivatives thereof (e.g., A includes adenine or adenine analogs (e.g., 7-deaza adenine)).
In some embodiments, the polynucleotides of the invention contain 5-methoxy-uracil, uracil, 5- methyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uracil, uracil, 5-trifluoromethyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5- methoxy-uracil, uracil, 5-hydroxymethyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uracil, uracil, 5-bromo-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uracil, uracil, 5-iodo-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uracil, uracil, 5-methoxy- cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uracil, uracil, 5-ethyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uracil, uracil, 5- phenyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uracil, uracil, 5-ethnyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5- methoxy-uracil, uracil, N4-methyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uracil, uracil, 5-fluoro-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uracil, uracil, N4-acetyl-cytosine, and cytosine as the only uracils and cytosines. In
some embodiments, the polynucleotides of the invention contain 5-methoxy-uracil, uracil, pseudoisocytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uracil, uracil, 5-formyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5- methoxy-uracil, uracil, 5-aminoallyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uracil, uracil, 5-carboxy-cytosine, and cytosine as the only uracils and cytosines.
In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouracil, uracil, 5-methyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouracil, uracil, 5-trifluoromethyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouracil, uracil, 5-hydroxymethyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouracil, uracil, 5-bromo-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouracil, uracil, 5-iodo-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1 - methyl-pseudouracil, uracil, 5-methoxy-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouracil, uracil, 5-ethyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouracil, uracil, 5-phenyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouracil, uracil, 5-ethnyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouracil, uracil, N4-methyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1 - methyl-pseudouracil, uracil, 5-fluoro-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouracil, uracil, N4-acetyl- cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouracil, uracil, pseudoisocytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1 -methyl- pseudouracil, uracil, 5-formyl-cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouracil, uracil, 5-aminoallyl- cytosine, and cytosine as the only uracils and cytosines. In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouracil, uracil, 5-carboxy-cytosine, and cytosine as the only uracils and cytosines.
In some embodiments, the polynucleotides of the invention contain 5-methoxy-uridine, uridine, 5- methyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uridine, uridine, 5-trifluoromethyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 5- methoxy-uridine, uridine, 5-hydroxymethyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uridine, uridine, 5-bromo- cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of
the invention contain 5-methoxy-uridine, uridine, 5-iodo-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uridine, uridine, 5-methoxy-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uridine, uridine, 5-ethyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 5- methoxy-uridine, uridine, 5-phenyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uridine, uridine, 5-ethnyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uridine, uridine, N4-methyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uridine, uridine, 5-fluoro-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uridine, uridine, N4-acetyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 5- methoxy-uridine, uridine, pseudoisocytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uridine, uridine, 5-formyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uridine, uridine, 5-aminoallyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 5-methoxy-uridine, uridine, 5-carboxy-cytidine, and cytidine as the only uridines and cytidines.
In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouridine, uridine, 5-methyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouridine, uridine, 5-trifluoromethyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouridine, uridine, 5-hydroxymethyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouridine, uridine, 5-bromo-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouridine, uridine, 5-iodo-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 1 - methyl-pseudouridine, uridine, 5-methoxy-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouridine, uridine, 5-ethyl- cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouridine, uridine, 5-phenyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 1 -methyl- pseudouridine, uridine, 5-ethnyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouridine, uridine, N4-methyl- cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouridine, uridine, 5-fluoro-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 1 -methyl- pseudouridine, uridine, N4-acetyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouridine, uridine, pseudoisocytidine, and cytidine as the only uridines and cytidines. In some embodiments, the
polynucleotides of the invention contain 1 -methyl-pseudouridine, uridine, 5-formyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 1 - methyl-pseudouridine, uridine, 5-aminoallyl-cytidine, and cytidine as the only uridines and cytidines. In some embodiments, the polynucleotides of the invention contain 1 -methyl-pseudouridine, uridine, 5- carboxy-cytidine, and cytidine as the only uridines and cytidines.
In some embodiments, the polynucleotides of the invention contain the uracil of one of the nucleosides of Table 4 and uracil as the only uracils. In other embodiments, the polynucleotides of the invention contain a uridine of Table 4 and uridine as the only uridines. Table 4. Exemplary modified uridine nucleosides
In some embodiments, the polynucleotides of the invention contain the cytosine of one of the nucleosides of Table 5 and cytosine as the only cytosines. In other embodiments, the polynucleotides of the invention contain a cytidine of Table 5 and cytidine as the only cytidines.
Table 5. Exemplary modified cytidine nucleosides
c. Alterations on the internucleoside linkage
The alternative nucleotides, which may be incorporated into a polynucleotide molecule, can be altered on the internucleoside linkage (e.g., phosphate backbone). Herein, in the context of the polynucleotide backbone, the phrases “phosphate” and “phosphodiester” are used interchangeably. Backbone phosphate groups can be altered by replacing one or more of the oxygen atoms with a different substituent.
The alternative nucleosides and nucleotides can include the wholesale replacement of an unaltered phosphate moiety with another internucleoside linkage as described herein. Examples of alternative phosphate groups include, but are not limited to, phosphorothioate, phosphoroselenates, boranophosphates, boranophosphate esters, hydrogen phosphonates, phosphoramidates, phosphorodiamidates, alkyl or aryl phosphonates, and phosphotriesters. Phosphorodithioates have both non-linking oxygens replaced by sulfur. The phosphate linker can also be altered by the replacement of a
linking oxygen with nitrogen (bridged phosphoramidates), sulfur (bridged phosphorothioates), and carbon (bridged methylene-phosphonates).
The alternative nucleosides and nucleotides can include the replacement of one or more of the non-bridging oxygens with a borane moiety (BH3), sulfur (thio), methyl, ethyl and/or methoxy. As a nonlimiting example, two non-bridging oxygens at the same position (e.g., the alpha (α), beta (β) or gamma (y) position) can be replaced with a sulfur (thio) and a methoxy.
The replacement of one or more of the oxygen atoms at the a position of the phosphate moiety (e.g., a-thio phosphate) is provided to confer stability (such as against exonucleases and endonucleases) to RNA and DNA through the unnatural phosphorothioate backbone linkages. Phosphorothioate DNA and RNA have increased nuclease resistance and subsequently a longer half-life in a cellular environment. While not wishing to be bound by theory, phosphorothioate linked polynucleotide molecules are expected to also reduce the innate immune response through weaker binding/activation of cellular innate immune molecules.
In specific embodiments, an alternative nucleoside includes an alpha-thio-nucleoside (e.g., 5'-O- (1 -thiophosphate)-adenosine, 5'-O-(1 -thiophosphate)-cytidine (a-thio-cytidine), 5'-O-(1 -thiophosphate)- guanosine, 5'-O-(1 -thiophosphate)-uridine, or 5'-O-(1 -thiophosphate)-pseudouridine).
Other internucleoside linkages that may be employed according to the present invention, including internucleoside linkages which do not contain a phosphorous atom, are described herein below. d. Combinations of alternative sugars, nucleobases, and internucleoside linkages
The polynucleotides of the invention can include a combination of alterations to the sugar, the nucleobase, and/or the internucleoside linkage. These combinations can include any one or more alterations described herein.
3. Lipid Nanoparticle (LNP) Compositions
The present disclosure provides LNP compositions that encapsulate a nucleic acid molecule (e.g., linear or circular RNA molecule) described herein. The LNPs of the disclosure may confer one or more advantageous properties. The lipid nanoparticle compositions described herein may be used for the delivery of therapeutic and/or prophylactic agents, e.g., mRNAs, to mammalian cells or organs. For example, the lipid nanoparticles described herein have little or no immunogenicity. For example, the lipid compounds disclosed herein have a lower immunogenicity as compared to a reference lipid (e.g., MC3, KC2, or DLinDMA). For example, a formulation comprising a lipid disclosed herein and a therapeutic or prophylactic agent, e.g., mRNA, has an increased therapeutic index as compared to a corresponding formulation which comprises a reference lipid (e.g., MC3, KC2, or DLinDMA) and the same therapeutic or prophylactic agent.
In some embodiments, the present application provides pharmaceutical compositions comprising:
(a) a delivery agent comprising a lipid nanoparticle; and
(b) a polynucleotide comprising an IRES of the disclosure. a. Lipid Nanoparticles
In some embodiments, polynucleotides of the present disclosure are included in a lipid nanoparticle (LNP). Lipid nanoparticles according to the present disclosure may comprise: (i) an
ionizable lipid (e.g., an ionizable amino lipid); (ii) a sterol or other structural lipid; (iii) a non-cationic helper lipid or phospholipid; and (iv) a PEG-modified lipid. In some embodiments, lipid nanoparticles according to the present disclosure further comprise one or more polynucleotides of the present disclosure (e.g., a linear or circular RNA encoding a therapeutic polypeptide, such as a therapeutic polypeptide disclosed herein).
The lipid nanoparticles according to the present disclosure can be generated using components, compositions, and methods as are generally known in the art, see for example PCT/US2016/052352; PCT/US2016/068300; PCT/US2017/037551 ; PCT/US2015/027400; PCT/US2016/047406; PCT/US2016000129; PCT/US2016/014280; PCT/US2016/014280; PCT/US2017/038426; PCT/US2014/027077; PCT/US2014/055394; PCT/US2016/52117; PCT/US2012/069610;
PCT/US2017/027492; PCT/US2016/059575 and PCT/US2016/069491 all of which are incorporated by reference herein in their entirety.
In some embodiments, the lipid nanoparticle comprises an ionizable cationic lipid (e.g., an ionizable amino lipid) at a content of 20-60 mol.%, 25-60 mol.%, 30-60 mol.%, 35-60 mol.%, 40-60 mol.%, 45-60 mol.%, 20-55 mol.%, 25-55 mol.%, 30-55 mol.%, 35-55 mol.%, 40-55 mol.%, 45-55 mol.%, 20-50 mol.%, 25-50 mol.%, 30-50 mol.%, 35-50 mol.%, or 40-50 mol.%. For example, the lipid nanoparticle may comprise an ionizable cationic lipid (e.g., an ionizable amino lipid) at a content of 40-50 mol.%, 45-50 mol.%, 45-46 mol.%, 46-47 mol.%, 47-48 mol.%, 48-49 mol.%, or 49-50 mol.%, for example about 45 mol.%, about 45.5 mol.%, about 46 mol.%, about 46.5 mol.%, about 47 mol.%, about 47.5 mol.%, about 48 mol.%, about 48.5 mol.%, about 49 mol.%, or about 49.5 mol.% ionizable cationic lipid (e.g., an ionizable amino lipid).
In some embodiments, the lipid nanoparticle comprises a non-cationic helper lipid or phospholipid at a content of 5-25 mol.%. For example, the lipid nanoparticle may comprise a non-cationic helper lipid or phospholipid at a content of molar ratio of 5-25 mol.%, 5-20 mol.%, 5-15 mol.%, 10-25 mol.%, 10-20 mol.%, 10-15 mol.%, 5-6 mol.%, 6-7 mol.%, 7-8 mol.%, 8-9 mol.%, 9-10 mol.%, 10-1 1 mol.%, 1 1 -12 mol.%, 12-13 mol.%, 13-14 mol.%, 14-15 mol.%, 10-14 mol.%, 10-13 mol.%, 10-12 mol.%, 10-1 1 mol.%, 9-15 mol.%, 9-14 mol.%, 9-13 mol.%, 9-12 mol.%, or 9-1 1 mol.% non-cationic lipid.
In some embodiments, the lipid nanoparticle comprises a sterol or other structural lipid at a content molar ratio of 25-55 mol.%, 25-50 mol.%, 25-45 mol.%, 25-40 mol.%, 25-35 mol.%, 30-55 mol.%, 30-50 mol.%, 30-45 mol.%, 30-40 mol.%, 30-35 mol.%, 35-55 mol.%, 35-50 mol.%, 35-45 mol.%, 35-40 mol.%, 25-30 mol.%, 30-35 mol.%, 25-28 mol.%, 28-30 mol.%, 30-33 mol.%, 35-38 mol.%, 38-40 mol.%, 36-40 mol.%, 37-40 mol.%, 38-40 mol.%, 38-39 mol.%, 36-40 mol.%, 37-40 mol.%, 36-39 mol.%, or 37- 39 mol.%. For example, the lipid nanoparticle may comprise a sterol or other structural lipid at a content of about 30 mol.%, about 30.5 mol.%, about 31 .0 mol.%, about 31 .5 mol.%, about 32.0 mol.%, about 32.5 mol.%, about 33.0 mol.%, about 33.5 mol.%, about 34.0 mol.%, about 34.5 mol.%, about 35.0 mol.%, about 35.5 mol.%, about 36.0 mol.%, about 36.5 mol.%, about 37.0 mol.%, about 37.5 mol.%, about 38.0 mol.%, about 38.5 mol.%, about 39.0 mol.%, about 39.5 mol.%, about 40.0 mol.%, about 40.5 mol.%, about 41 .0 mol.%, about 41 .5 mol.%, about 42.0 mol.%, about 42.5 mol.%, about 43.0 mol.%, about 43.5 mol.%, about 44.0 mol.%, about 44.5 mol.%, or about 45.0 mol.%.
In some embodiments, the lipid nanoparticle comprises a PEG-modified lipid at a content of 0.5- 15 mol.%, 1 .0-15 mol.%, 1 .5-15 mol.%, 2.0-15 mol.%, 2.5-15 mol.%, 3.0-15 mol.%, 3.5-15 mol.%, 4.0-15
mol.%, 4.5-15 mol.%, 5.0-15 mol.%, 10-15 mol.%, 0.5-10 mol.%, 0.5-5 mol.%, 0.5-4.5 mol.%, 0.5-4.0 mol.%, 0.5-3.5 mol.%, 0.5-3.0 mol.%, 0.5-2.5 mol.%, 0.5-2.0 mol.%, 0.5-1 .5 mol.%, 0.5-1 .0 mol.%, 1 .0-10 mol.%, 1 .0-5 mol.%, 1 .0-4.5 mol.%, 1 .0-4.0 mol.%, 1 .0-3.5 mol.%, 1 .0-3.0 mol.%, 1 .0-2.5 mol.%, 1 .0-2.0 mol.%, 1 .0-1 .5 mol.%, 1 .5-5.0 mol.%, 1 .5-4.5 mol.%, 1 .5-4.0 mol.%, 1 .5-3.5 mol.%, 1 .5-3.0 mol.%, 1 .5- 2.5 mol.%, 1 .5-2.0 mol.%, 2.0-5.0 mol.%, 2.0-4.5 mol.%, 2.0-4.0 mol.%, 2.0-3.5 mol.%, 2.0-3.0 mol.%, or 2.0-2.5 mol.%. For example, the lipid nanoparticle may comprise a PEG-modified lipid at a content of a about 0.5 mol.%, about 1 .0 mol.%, about 1 .5 mol.%, about 2.0 mol.%, about 2.5 mol.%, about 3.0 mol.%, about 3.5 mol.%, about 4.0 mol.%, about 4.5 mol.%, about 5.0 mol.%, about 6.0 mol.%, about 7.0 mol.%, about 8.0 mol.%, about 9.0 mol.%, about 10.0 mol.%, or about 15.0 mol.%.
In some embodiments, the lipid nanoparticle comprises: (i) 20 to 60 mol.% ionizable cationic lipid
(e.g. ionizable amino lipid), (ii) 25 to 55 mol.% sterol or other structural lipid, (Hi) 5 to 25 mol.% noncationic lipid (e.g., phospholipid), and (iv) 0.5 to 15 mol.% PEG-modified lipid.
In some embodiments, the lipid nanoparticle comprises: (i) 40 to 50 mol.% ionizable cationic lipid (e.g. ionizable amino lipid), (ii) 30 to 45 mol.% sterol or other structural lipid, (Hi) 5 to 15 mol.% noncationic lipid (e.g., phospholipid), and (iv) 1 to 5 mol.% PEG-modified lipid.
In some embodiments, the lipid nanoparticle comprises: (i) 45 to 50 mol.% ionizable cationic lipid (e.g. ionizable amino lipid), (ii) 35 to 45 mol.% sterol or other structural lipid, (Hi) 8 to 12 mol.% noncationic lipid (e.g., phospholipid), and (iv) 1 .5 to 3.5 mol.% PEG-modified lipid.
In the following sections, “Compounds” numbered with an “I-” prefix (e.g., “Compound 1-1 ,” “Compound I-2,” “Compound I-3,” “Compound l-VI,” etc., indicate specific ionizable lipid compounds. Likewise, compounds numbered with a “P-” prefix (e.g., “Compound P-l,” etc.) indicate a specific PEG- modified lipid compound. b. Ionizable Amino Lipids
In some embodiments, the lipid nanoparticle of the present disclosure comprises an ionizable cationic lipid (e.g., an ionizable amino lipid) that is a compound of Formula (I):
(I) or its N-oxide, or a salt or isomer thereof, wherein R’a is R' branched; wherein
denotes a point of attachment; wherein Raα, Raβ, Ray and Raδ are each independently selected from the group consisting of H, C2-12 alkyl, and C2-12 alkenyl;
R2 and R3 are each independently selected from the group consisting of C1-14 alkyl and C2-14 alkenyl;
R4 is selected from the group consisting of -(CH2)nOH, wherein n is selected from the group consisting of 1 , 2, 3, 4, and 5, and
wherein denotes a point of attachment; wherein
R10 is N(R)2; each R is independently selected from the group consisting of C1-6 alkyl, C2-3 alkenyl, and H; and n2 is selected from the group consisting of 1 , 2, 3, 4, 5, 6, 7, 8, 9, and 10; each R5 is independently selected from the group consisting of C1-3 alkyl,
C2-3 alkenyl, and H; each R6 is independently selected from the group consisting of C1-3 alkyl,
C2-3 alkenyl, and H;
M and M’ are each independently selected from the group consisting of -C(O)O- and
-OC(O)-;
R’ is a C1-12 alkyl or C2-12 alkenyl;
I is selected from the group consisting of 1 , 2, 3, 4, and 5; and m is selected from the group consisting of 5, 6, 7, 8, 9, 10, 1 1 , 12, and 13.
In some embodiments, in Formula (I), R’a is R’branched; R’branched is
denotes a point of attachment; Raα, Raβ, Ray and Raδ are each H; R2 and R3 are each C1-14 alkyl; R4 is - (CH2)nOH; n is 2; each R5 is H; each R6 is H; M and M’ are each -C(O)O-; R’ is a C1-12 alkyl; I is 5; and m is 7.
In some embodiments, in Formula (I), R’a is R’branched; R’branched is
denotes a point of attachment; Raα, Raβ, Ray and Raδ are each H; R2 and R3 are each C1-14 alkyl; R4 is -(CH2)nOH; n is 2; each R5 is H; each R6 is H; M and M’ are each -
C(O)O-; R’ is a C1-12 alkyl; I is 3; and m is 7.
In some embodiments of the compounds of Formula (I), R’a is R’branched; R’branched ;s
denotes a point of attachment; Raa is C2-12 alkyl; Raα, Raβ, Ray and a Rreaδ each H;
R2 and R3 are each C1-14 alkyl; R4 is
R10 is NH( C1-6 alkyl); n2 is 2; R5 is H; each R6 is H; M and M’ are each -C(O)O-; R’ is a C1-12 alkyl; I is 5; and m is 7.
In some embodiments of the compounds of Formula (I), R’a is R’branched;
R'branched is
denotes a point of attachment; Raα, Raβ, and Raδ are each H; Rav is C2-12 alkyl; R2 and R3 are each C1-14 alkyl; R4 is -(CH2)nOH; n is 2; each R5 is H; each R6 is H; M and M’ are each -C(O)O-; R’ is a C1-12 alkyl; I is 5; and m is 7.
In some embodiments, the compound of Formula (I) is selected from: (Compound 1-1 ),
(Compound I-2), and
some
In some
(Compound I-2).
In some embodiments, the compound of Formula (I) is:
(Compound I-3).
In some aspects, the disclosure relates to a compound of Formula (la):
(la) or its N-oxide, or a salt or isomer thereof, wherein R’a is R'branched ; wherein
R'branched is ; denotes a point of attachment;
wherein Raα, Raβ, Ray and a Rreaδ each independently selected from the group consisting of H, C2-12 alkyl, and C2-12 alkenyl;
R2 and R3 are each independently selected from the group consisting of C1-14 alkyl and C2-14 alkenyl;
R4 is selected from the group consisting of -(CH2)nOH wherein n is selected from the group consisting of 1 , 2, 3, 4, and 5, and
wherein
denotes a point of attachment; wherein
R10 is N(R)2; each R is independently selected from the group consisting of C1-6 alkyl, C2-3 alkenyl, and H; and n2 is selected from the group consisting of 1 , 2, 3, 4, 5, 6, 7, 8, 9, and 10; each R5 is independently selected from the group consisting of C1-3 alkyl,
C2-3 alkenyl, and H; each R6 is independently selected from the group consisting of C1-3 alkyl,
C2-3 alkenyl, and H;
M and M’ are each independently selected from the group consisting of -C(O)O- and -OC(O)-;
R’ is a C1-12 alkyl or C2-12 alkenyl;
I is selected from the group consisting of 1 , 2, 3, 4, and 5; and m is selected from the group consisting of 5, 6, 7, 8, 9, 10, 1 1 , 12, and 13.
In some aspects, the disclosure relates to a compound of Formula (lb):
(lb) or its N-oxide, or a salt or isomer thereof, wherein R’a is R'branched ; wherein
R'branched is ; wherein
denotes a point of attachment;
wherein Raa, Raα, Raβ, Ray and a Rreaδ each independently selected from the group consisting of H, C2-12 alkyl, and C2-12 alkenyl;
R2 and R3 are each independently selected from the group consisting of C1-14 alkyl and C2-14 alkenyl;
R4 is -(CH2)nOH, wherein n is selected from the group consisting of 1 , 2, 3, 4, and 5; each R5 is independently selected from the group consisting of C1-3 alkyl,
C2-3 alkenyl, and H; each R6 is independently selected from the group consisting of C1-3 alkyl,
C2-3 alkenyl, and H;
M and M’ are each independently selected from the group consisting of -C(O)O- and -OC(O)-;
R’ is a C1-12 alkyl or C2-12 alkenyl;
I is selected from the group consisting of 1 , 2, 3, 4, and 5; and m is selected from the group consisting of 5, 6, 7, 8, 9, 10, 1 1 , 12, and 13.
In some embodiments of Formula (I) or (lb), R’a is R'branched ; R'branched is
denotes a point of attachment; Raβ, Ray, and Raδ are each H; R2 and R3 are each C1-14 alkyl; R4 is - (CH2)nOH; n is 2; each R5 is H; each R6 is H; M and M’ are each -C(O)O-; R’ is a C1-12 alkyl; I is 5; and m is 7.
In some embodiments of Formula (I) or (lb), R’a is R'branched ; is ; R'branched is ;
denotes a point of attachment; Raβ and Raδ are each H; Ray is C2-12 alkyl; R2 and R3 are each C1-14 alkyl;
R4 is -(CH2)nOH; n is 2; each R5 is H; each R6 is H; M and M’ are each -C(O)O-; R’ is a C1-12 alkyl; I is 5; and m is 7.
In some embodiments, the disclosure relates to a compound of Formula (Ic):
(Ic) or its N-oxide, or a salt or isomer thereof, wherein R’a is R'branched w is ;herein
R'branched is ;
wherein
denotes a point of attachment; wherein Raα, Raβ, Ray and Raδ are each independently selected from the group consisting of H, C2-12 alkyl, and C2-12 alkenyl;
R2 and R3 are each independently selected from the group consisting of C1-14 alkyl and C2-14 alkenyl;
wherein denotes a point of attachment; wherein
R10 is N(R)2; each R is independently selected from the group consisting of C1-6 alkyl, C2-3 alkenyl, and H; n2 is selected from the group consisting of 1 , 2, 3, 4, 5, 6, 7, 8, 9, and 10; each R5 is independently selected from the group consisting of C1-3 alkyl,
C2-3 alkenyl, and H; each R6 is independently selected from the group consisting of C1-3 alkyl,
C2-3 alkenyl, and H;
M and M’ are each independently selected from the group consisting of -C(O)O- and -OC(O)-;
R’ is a C1-12 alkyl or C2-12 alkenyl;
I is selected from the group consisting of 1 , 2, 3, 4, and 5; and m is selected from the group consisting of 5, 6, 7, 8, 9, 10, 1 1 , 12, and 13.
attachment; RaP, Rav, and Raδ are each H; Raa is C2-12 alkyl; R2 and R3 are each C1-14 alkyl; R4 is
denotes a point of attachment; R10 is NH(C1-6 alkyl); n2 is 2; each R5 is H; each R6 is H; M and M’ are each -C(O)O-; R’ is a C1-12 alkyl; I is 5; and m is 7.
In some embodiments, the compound of Formula (Ic) is:
(Compound I-2).
In some aspects, the disclosure relates to a compound of Formula (II):
(II) or its N-oxide, or a salt or isomer thereof, wherein R’a is R’branched or R’cyclic; wherein
where
in denotes a point of attachment; Ray and Raδ are each independently selected from the group consisting of H, C1-12 alkyl, and C2-12 alkenyl, wherein at least one of Ray and Raδ is selected from the group consisting of C1-12 alkyl and C2-12 alkenyl;
Rby and Rbδ are each independently selected from the group consisting of H, C1-12 alkyl, and C2-12 alkenyl, wherein at least one of Rby and Rbδ is selected from the group consisting of C1-12 alkyl and C2-12 alkenyl;
R2 and R3 are each independently selected from the group consisting of C1-14 alkyl and C2-14 alkenyl;
R4 is selected from the group consisting of -(CH2)nOH wherein n is selected from the group consisting of 1 , 2, 3, 4, and 5, and
wherein
denotes a point of attachment; wherein
R10 is N(R)2; each R is independently selected from the group consisting of C1-6 alkyl, C2-3 alkenyl, and H; and n2 is selected from the group consisting of 1 , 2, 3, 4, 5, 6, 7, 8, 9, and 10; each R’ independently is a C1-12 alkyl or C2-12 alkenyl;
Ya is a C3-6 carbocycle;
R*”a is selected from the group consisting of C1-15 alkyl and C2-15 alkenyl; and s is 2 or 3; m is selected from 1 , 2, 3, 4, 5, 6, 7, 8, and 9;
I is selected from 1 , 2, 3, 4, 5, 6, 7, 8, and 9.
In some aspects, the disclosure relates to a compound of Formula (I l-a) :
(ll-a) or its N-oxide, or a salt or isomer thereof, wherein R’a is R’branched or R’cyclic; wherein
wherein
denotes a point of attachment; Ray and Raδ are each independently selected from the group consisting of H, C1-12 alkyl, and C2-12 alkenyl, wherein at least one of Ray and Raδ is selected from the group consisting of C1-12 alkyl and C2-12 alkenyl;
Rby and Rbδ are each independently selected from the group consisting of H, C1-12 alkyl, and C2-12 alkenyl, wherein at least one of Rby and Rbδ is selected from the group consisting of C1-12 alkyl and C2-12 alkenyl;
R2 and R3 are each independently selected from the group consisting of C1-14 alkyl and C2-14 alkenyl;
R4 is selected from the group consisting of -(CH2)nOH wherein n is selected from the group consisting of 1 , 2, 3, 4, and 5 and
wherein
denotes a point of attachment; wherein
R10 is N(R)2; each R is independently selected from the group consisting of C1-6 alkyl, C2-3 alkenyl, and H; and n2 is selected from the group consisting of 1 , 2, 3, 4, 5, 6, 7, 8, 9, and 10; each R’ independently is a C1-12 alkyl or C2-12 alkenyl; m is selected from 1 , 2, 3, 4, 5, 6, 7, 8, and 9;
I is selected from 1 , 2, 3, 4, 5, 6, 7, 8, and 9.
In some aspects, the disclosure relates to a compound of Formula (I l-b) :
(ll-b) or its N-oxide, or a salt or isomer thereof, wherein R’a is R’branched or R’cyclic; wherein wherein
denotes a point of attachment; Ray and Rby are each independently selected from the group consisting of C1-12 alkyl and C2-12 alkenyl;
R2 and R3 are each independently selected from the group consisting of C1-14 alkyl and C2-14 alkenyl;
R4 is selected from the group consisting of -(CH2)nOH wherein n is selected from the group consisting of 1 , 2, 3, 4, and 5, and
wherein
denotes a point of attachment; wherein
R10 is N(R)2; each R is independently selected from the group consisting of C1-6 alkyl, C2-3 alkenyl, and H; and n2 is selected from the group consisting of 1 , 2, 3, 4, 5, 6, 7, 8, 9, and 10; each R’ independently is a C1-12 alkyl or C2-12 alkenyl; m is selected from 1 , 2, 3, 4, 5, 6, 7, 8, and 9;
I is selected from 1 , 2, 3, 4, 5, 6, 7, 8, and 9.
In some aspects, the disclosure relates to a compound of Formula (I l-c) :
(ll-c) or its N-oxide, or a salt or isomer thereof, wherein R’a is R’branched or R’cyclic; wherein
R'branched jg - and R’b is:
wherein
denotes a point of attachment; wherein Rav is selected from the group consisting of C1-12 alkyl and C2-12 alkenyl;
R2 and R3 are each independently selected from the group consisting of C1-14 alkyl and C2-14 alkenyl;
R4 is selected from the group consisting of -(CH2)nOH wherein n is selected from the group consisting of 1 , 2, 3, 4, and 5, and
wherein
denotes a point of attachment; wherein
R10 is N(R)2; each R is independently selected from the group consisting of C1-6 alkyl, C2-3 alkenyl, and H; and n2 is selected from the group consisting of 1 , 2, 3, 4, 5, 6, 7, 8, 9, and 10; R’ is a C1-12 alkyl or C2-12 alkenyl; m is selected from 1 , 2, 3, 4, 5, 6, 7, 8, and 9;
I is selected from 1 , 2, 3, 4, 5, 6, 7, 8, and 9.
In some aspects, the disclosure relates to a compound of Formula (I l-d) :
(ll-d) or its N-oxide, or a salt or isomer thereof, wherein R’a is R’branched or R’cyclic; wherein
R’branched is:
and R’b is
wherein
denotes a point of attachment; wherein Ray and Rby are each independently selected from the group consisting of C1-12 alkyl and C2-12 alkenyl;
R4 is selected from the group consisting of -(CH2)nOH wherein n is selected from the group consisting of 1 , 2, 3, 4, and 5, and
wherein
denotes a point of attachment; wherein
R10 is N(R)2; each R is independently selected from the group consisting of C1-6 alkyl, C2-3 alkenyl, and H; and n2 is selected from the group consisting of 1 , 2, 3, 4, 5, 6, 7, 8, 9, and 10; each R’ independently is a C1-12 alkyl or C2-12 alkenyl; m is selected from 1 , 2, 3, 4, 5, 6, 7, 8, and 9;
I is selected from 1 , 2, 3, 4, 5, 6, 7, 8, and 9.
In some aspects, the disclosure relates to a compound of Formula (ll-e):
(ll-e) or its N-oxide, or a salt or isomer thereof, wherein R’a is R’branched or R’cyclic; wherein
R’branched is ; wherein
denotes a point of attachment; wherein Ra* is selected from the group consisting of C1-12 alkyl and C2-12 alkenyl;
R2 and R3 are each independently selected from the group consisting of C1-14 alkyl and C2-14 alkenyl;
R4 is -(CH2)nOH wherein n is selected from the group consisting of 1 , 2, 3, 4, and 5;
R’ is a C1-12 alkyl or C2-12 alkenyl;
m is selected from 1 , 2, 3, 4, 5, 6, 7, 8, and 9;
I is selected from 1 , 2, 3, 4, 5, 6, 7, 8, and 9.
In some embodiments of the compound of Formula (II), (ll-a) , (ll-b) , (ll-c) , (ll-d) , or (ll-e), m and I are each independently selected from 4, 5, and 6. In some embodiments of the compound of Formula (II), (ll-a), (ll-b), (ll-c), (ll-d), or (ll-e), m and I are each 5.
In some embodiments of the compound of Formula (II), (ll-a), (ll-b), (ll-c), (ll-d), or (ll-e), each R’ independently is a C1-12 alkyl. In some embodiments of the compound of Formula (II), (ll-a), (ll-b), (ll-c), (ll-d), or (ll-e), each R’ independently is a C2-5 alkyl.
In some embodiments of the compound of Formula (II), (ll-a), (ll-b), (ll-c), (ll-d), or (ll-e), R’b is:
and R2 and R3 are each independently a C1-14 alkyl. In some embodiments of the compound of Formula (II), (ll-a), (ll-b), (ll-c), (ll-d), or (ll-e), R’b is:
and R2 and R3 are each independently a C6-1 0 alkyl. In some embodiments of the compound of Formula (II), (ll-a), (ll-b), (ll-c), (ll-d), or (ll-e), R’b is: r3^r2 and R2 and R3 are each a C8 alkyl.
In some embodiments of the compound of Formula (II), (ll-a), (ll-b), (ll-c), (ll-d), or (ll-e), R’branched is
and R’b is: R
, Rav is a C1-12 alkyl and R2 and R3 are each independently a C6-1 0 alkyl. In some embodiments of the compound of Formula (II), (ll-a), (ll-b), (ll-c), (ll-d), or (ll-e),
R’branched is:
anc| R’b is: Ray is a C2-6 a|kyl and R2 and R3 are each
independently a C6-10 alkyl. In some embodiments of the compound of Formula (II), (ll-a), (ll-b), (ll-c), (II- d), or (ll-e), R’branched is: and R’b is: Ray is a C2-6 alkyl, and R2 and R3 are
each a C8 alkyl.
In some embodiments of the compound of Formula (II), (ll-a), (ll-b), (ll-c), (ll-d), or (ll-e), R’branched is: ancl Ray anc| Rby are each a c1 _12 alkyl. In some
embodiments of the compound of Formula (II), (ll-a), (ll-b), (ll-c), (ll-d), or (ll-e), R’branched is: and Ray and Rby are each a C2-6 alkyl.
In some embodiments of the compound of Formula (II), (ll-a), (ll-b), (ll-c), (ll-d), or (ll-e), m and I are each independently selected from 4, 5, and 6 and each R’ independently is a C1-12 alkyl. In some embodiments of the compound of Formula (II), (ll-a), (ll-b), (ll-c), (ll-d), or (ll-e), m and I are each 5 and each R’ independently is a C2-5 alkyl.
In some embodiments of the compound of Formula (II), (ll-a) , (ll-b) , (ll-c) , (ll-d) , or (ll-e), R’branched is:
m and I are each independently selected from 4, 5, and 6, each R’ independently is a C1-12 alkyl, and Ray and Rby are each a C1-12 alkyl. In some embodiments of the compound of Formula (II), (ll-a), (ll-b), (ll-c), (ll-d), or (ll-e), R’branched is:
m and I are each 5, each R’ independently is a C2-5 alkyl, and Ray and Rby are each a C2-6 alkyl.
In some embodiments of the compound of Formula (II), (ll-a), (ll-b), (ll-c), (ll-d), or (ll-e), Ranched is
m and I are each independently selected from 4, 5, and 6,
R’ is a C1-12 alkyl, Ra* is a C1-12 alkyl and R2 and R3 are each independently a C6-10 alkyl. In some embodiments of the compound of Formula (II), (ll-a), (ll-b), (ll-c), (ll-d), or (ll-e), R’branched is:
m and I are each 5, R’ is a C2-5 alkyl, Rav is a C2-6 alkyl, and R2 and R3 are each a C8 alkyl.
In some embodiments of the compound of Formula (II), (ll-a), (ll-b), (ll-c), (ll-d), or (ll-e), R4 is
wherein R10 is NH(C1-6 alkyl) and n2 is 2. In some embodiments of the compound of Formula (II), (ll-a), (ll-b), (ll-c), (ll-d), or (ll-e), R4 is
wherein R10 is NH(CHs) and n2 is 2.
In some embodiments of the compound of Formula (II), (ll-a), (ll-b), (ll-c), (ll-d), or (ll-e), R’branched is: m and I are each independently selected from 4, 5,
and 6, each R’ independently is a C1-12 alkyl, Ra* and Rby are each a C1-12 alkyl, and R4 is
, wherein R10 is NH(C1-6 alkyl), and n2 is 2. In some embodiments of the compound of Formula (II), (ll-a), (ll-b), (ll-c), (ll-d), or (ll-e), R’branched is: is:
m and I are each 5, each R’ independently is a C2-5 alkyl, Ray and Rby are each a C2-6
alkyl, and R4 is , wherein R10 is NH(CHs) and n2 is 2.
In some embodiments of the compound of Formula (II), (ll-a) , (ll-b) , (ll-c) , (ll-d) , or (ll-e), Ranched is: m and I are each independently selected from 4, 5, and 6,
R’ is a C1-12 alkyl, R2 and R3 are each independently a C6-10 alkyl, Rav is a C1-12 alkyl, and R4 is wherein R10 is NH(C1-6 alkyl) and n2 is 2. In some embodiments of the compound
of Formula (II), (ll-a), (ll-b), (ll-c), (ll-d), or (ll-e), R’branched is:
and I are each 5, R’ is a C2-5 alkyl, Ra* is a C2-6 alkyl, R2 and R3 are each a C8 alkyl, and R4 is
wherein R10 is NH(CHs) and n2 is 2.
In some embodiments of the compound of Formula (II), (ll-a), (ll-b), (ll-c), (ll-d), or (ll-e), R4 is - (CH2)nOH and n is 2, 3, or 4. In some embodiments of the compound of Formula (II), (ll-a), (ll-b), (ll-c), (ll-d), or (ll-e), R4 is -(CH2)nOH and n is 2.
In some embodiments of the compound of Formula (II), (ll-a), (ll-b), (ll-c), (ll-d), or (ll-e), R’branched is: m and I are each independently selected from 4, 5,
and 6, each R’ independently is a C1-12 alkyl, Ray and Rby are each a C1-12 alkyl, R4 is -(CH2)nOH, and n is 2, 3, or 4. In some embodiments of the compound of Formula (II), (ll-a), (ll-b), (ll-c), (ll-d), or (ll-e),
R’branched is: m and I are each 5, each R’ independently is
a C2-5 alkyl, Ray and Rby are each a C2-6 alkyl, R4 is -(CH2)nOH, and n is 2.
In some aspects, the disclosure relates to a compound of Formula (ll-f):
(ll-f) or its N-oxide, or a salt or isomer thereof, wherein R’a is R’branched or R’cyclic; wherein
R’branched is and
wherein
denotes a point of attachment;
Rav is a C1-12 alkyl;
R2 and R3 are each independently a C1-14 alkyl;
R4 is -(CH2)nOH wherein n is selected from the group consisting of 1 , 2, 3, 4, and 5;
R’ is a C1-12 alkyl; m is selected from 4, 5, and 6; and
I is selected from 4, 5, and 6.
In some embodiments of the compound of Formula (ll-f), m and I are each 5, and n is 2, 3, or 4.
In some embodiments of the compound of Formula (ll-f) R’ is a C2-5 alkyl, Rav is a C2-6 alkyl, and R2 and R3 are each a C6-10 alkyl.
In some embodiments of the compound of Formula (ll-f), m and I are each 5, n is 2, 3, or 4, R’ is a C2-5 alkyl, Ra* is a C2-6 alkyl, and R2 and R3 are each a C6-10 alkyl.
In some aspects, the disclosure relates to a compound of Formula (I l-g) :
R’ is a C2-5 alkyl; and
R4 is selected from the group consisting of -(CH2)nOH wherein n is selected from the group consisting of 3, 4, and 5, and
wherein
denotes a point of attachment, R10 is NH(C1-6 alkyl), and n2 is selected from the group consisting of 1 , 2, and 3.
In some aspects, the disclosure relates to a compound of Formula (I l-h) :
Ray and Rby are each independently a C2-6 alkyl; each R’ independently is a C2-5 alkyl; and
R4 is selected from the group consisting of -(CH2)nOH wherein n is selected from the group consisting of 3, 4, and 5, and
wherein
denotes a point of attachment, R10 is NH(C1-6 alkyl), and n2 is selected from the group consisting of 1 , 2, and 3.
In some embodiments of the compound of Formula (I l-g) or (ll-h), R4 is
wherein
R10 is NH(CH3) and n2 is 2.
In some embodiments of the compound of Formula (I l-g) or (ll-h) , R4 is -(CH2)2OH.
In some aspects, the disclosure relates to a compound having the Formula (III):
or a salt or isomer thereof, wherein
R1 , R2, R3, R4, and Rs are independently selected from the group consisting of C5-20 alkyl, C5-20 alkenyl, -R”MR’, -R*YR”, -YR”, and -R*OR”; each M is independently selected from the group consisting of -C(O)O-, -OC(O)-, -OC(O)O-, -C(O)N(R’)-, -N(R’)C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR’)O-, -S(O)2-, an aryl group, and a heteroaryl group;
X1 , X2, and X3 are independently selected from the group consisting of a bond, -CH2-, -(CH2)2-, -CHR-, -CHY-, -C(O)-, -C(O)O-, -OC(O)-, -C(O)-CH2-, -CH2-C(O)-, -C(O)O-CH2-, -OC(O)-CH2-, -CH2-C(O)O-, -CH2-OC(O)-, -CH(OH)-, -C(S)-, and -CH(SH)-; each Y is independently a C3-6 carbocycle; each R* is independently selected from the group consisting of C1-12 alkyl and C2-12 alkenyl; each R is independently selected from the group consisting of C1-3 alkyl and a C3-6 carbocycle; each R’ is independently selected from the group consisting of C1-12 alkyl, C2-12 alkenyl, and H; and each R” is independently selected from the group consisting of C3-12 alkyl and C3-12 alkenyl, and wherein: i) at least one of X1 , X2, and X3 is not -CH2-; and/or ii) at least one of R1 , R2, R3, R4, and Rs is -R”MR’.
In some embodiments, R1 , R2, R3, R4, and Rs are each C5-20 alkyl; X1 is -CH2-; and X2 and X3 are each -C(O)-.
In some embodiments, the compound of Formula (III) is:
(Compound l-VI), or a salt or isomer thereof. c. Phospholipids
The lipid composition of the lipid nanoparticle composition disclosed herein can comprise one or more phospholipids, for example, one or more saturated or (poly)unsaturated phospholipids or a combination thereof. In general, phospholipids comprise a phospholipid moiety and one or more fatty acid moieties.
A phospholipid moiety can be selected, for example, from the non-limiting group consisting of phosphatidyl choline, phosphatidyl ethanolamine, phosphatidyl glycerol, phosphatidyl serine, phosphatidic acid, 2-lysophosphatidyl choline, and a sphingomyelin.
A fatty acid moiety can be selected, for example, from the non-limiting group consisting of lauric acid, myristic acid, myristoleic acid, palmitic acid, palmitoleic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, erucic acid, phytanoic acid, arachidic acid, arachidonic acid, eicosapentaenoic acid, behenic acid, docosapentaenoic acid, and docosahexaenoic acid.
Particular phospholipids can facilitate fusion to a membrane. For example, a cationic phospholipid can interact with one or more negatively charged phospholipids of a membrane (e.g., a cellular or intracellular membrane). Fusion of a phospholipid to a membrane can allow one or more elements (e.g., a therapeutic agent) of a lipid-containing composition (e.g., LNPs) to pass through the membrane permitting, e.g., delivery of the one or more elements to a target tissue.
Non-natural phospholipid species including natural species with modifications and substitutions including branching, oxidation, cyclization, and alkynes are also contemplated. For example, a phospholipid can be functionalized with or cross-linked to one or more alkynes (e.g., an alkenyl group in which one or more double bonds is replaced with a triple bond). Under appropriate reaction conditions, an alkyne group can undergo a copper-catalyzed cycloaddition upon exposure to an azide. Such reactions can be useful in functionalizing a lipid bilayer of a nanoparticle composition to facilitate membrane permeation or cellular recognition or in conjugating a nanoparticle composition to a useful component such as a targeting or imaging moiety (e.g., a dye).
Phospholipids include, but are not limited to, glycerophospholipids such as phosphatidylcholines, phosphatidylethanolamines, phosphatidylserines, phosphatidylinositols, phosphatidy glycerols, and phosphatidic acids. Phospholipids also include phosphosphingolipid, such as sphingomyelin.
In some embodiments, a phospholipid of the present disclosure comprises 1 ,2-distearoyl-sn- glycero-3-phosphocholine (DSPC), 1 ,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1 ,2- dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1 ,2-dimyristoyl-sn-gly cero-phosphocholine (DMPC),
1 .2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), l,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC),
1 .2-diundecanoyl-sn-glycero-phosphocholine (DUPC), 1 -palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1 ,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 Diether PC), 1 -oleoyl-2
cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), 1 -hexadecyl-sn-glycero-3- phosphocholine (C16 Lyso PC), 1 ,2-dilinolenoyl-sn-glycero-3-phosphocholine,1 ,2-diarachidonoyl-sn- glycero-3-phosphocholine, 1 ,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1 ,2-diphytanoyl-sn- glycero-3-phosphoethanolamine (ME 16.0 PE), 1 ,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1 ,2- dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1 ,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1 ,2- diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1 ,2-didocosahexaenoyl-sn-glycero-3- phosphoethanolamine, 1 ,2-dioleoyl-sn-glycero-3-phospho-rac-(1 -glycerol) sodium salt (DOPG), sphingomyelin, and mixtures thereof.
In certain embodiments, a phospholipid useful or potentially useful in the present disclosure is an analog or variant of DSPC. In certain embodiments, a phospholipid useful or potentially useful in the present disclosure is a compound of Formula (IV):
(IV), or a salt thereof, wherein: each R1 is independently optionally substituted alkyl; or optionally two R1 are joined together with the intervening atoms to form optionally substituted monocyclic carbocyclyl or optionally substituted monocyclic heterocyclyl; or optionally three R1 are joined together with the intervening atoms to form optionally substituted bicyclic carbocyclyl or optionally substitute bicyclic heterocyclyl; n is 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10; m is 0, 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10;
A is of the Formula:
each instance of L2 is independently a bond or optionally substituted C1-6 alkylene, wherein one methylene unit of the optionally substituted C1-6 alkylene is optionally replaced with O, N(RN), S, C(O), - C(O)N(RN), NRNC(O), C(O)O, OC(O), OC(O)O, OC(O)N(RN), NRNC(O)O, or NRNC(O)N(RN); each instance of R2 is independently optionally substituted C1-30 alkyl, optionally substituted C1-30 alkenyl, or optionally substituted C1-30 alkynyl; optionally wherein one or more methylene units of R2 are independently replaced with optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(RN), O, S, C(O), C(O)N(RN), - NRNC(O), NRNC(O)N(RN), C(O)O, OC(O), OC(O)O, OC(O)N(RN), NRNC(O)O, C(O)S, SC(O), C(=NRN), C(=NRN)N(RN), NRNC(=NRN), NRNC(=NRN)N(RN), C(S), C(S)N(RN), NRNC(S), NRNC(S)N(RN), S(O), - OS(O), S(O)O, OS(O)O, OS(O)2, S(O)2O, OS(O)2O, N(RN)S(O), S(O)N(RN), N(RN)S(O)N(RN), - OS(O)N(RN), N(RN)S(O)O, S(O)2, N(RN)S(O)2, S(O)2N(RN), N(RN)S(O)2N(RN), OS(O)2N(RN), or - N(RN)S(O)2O; each instance of RN is independently hydrogen, optionally substituted alkyl, or a nitrogen protecting group;
Ring B is optionally substituted carbocyclyl, optionally substituted heterocyclyl, optionally substituted aryl, or optionally substituted heteroaryl; and
p is 1 or 2; provided that the compound is not of the Formula:
wherein each instance of R2 is independently unsubstituted alkyl, unsubstituted alkenyl, or unsubstituted alkynyl.
In some embodiments, the phospholipids may be one or more of the phospholipids described in U.S. Application No. 62/520,530. i. Phospholipid Head Modifications
In certain embodiments, a phospholipid useful or potentially useful in the present disclosure comprises a modified phospholipid head (e.g., a modified choline group). In certain embodiments, a phospholipid with a modified head is DSPC, or analog thereof, with a modified quaternary amine. For example, in embodiments of Formula (IV), at least one of R1 is not methyl. In certain embodiments, at least one of R1 is not hydrogen or methyl. In certain embodiments, the compound of Formula (IV) is of one of the following Formulae:
or a salt thereof, wherein: each t is independently 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10; each u is independently 0, 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10; and each v is independently 1 , 2, or 3.
In certain embodiments, a compound of Formula (IV) is of Formula (IV-a):
(IV-a), or a salt thereof.
In certain embodiments, a phospholipid useful or potentially useful in the present disclosure comprises a cyclic moiety in place of the glyceride moiety. In certain embodiments, a phospholipid useful in the present disclosure is DSPC, or analog thereof, with a cyclic moiety in place of the glyceride moiety. In certain embodiments, the compound of Formula (IV) is of Formula (IV-b):
or a salt thereof. ii. Phospholipid Tail Modifications
In certain embodiments, a phospholipid useful or potentially useful in the present disclosure comprises a modified tail. In certain embodiments, a phospholipid useful or potentially useful in the present disclosure is DSPC, or analog thereof, with a modified tail. As described herein, a “modified tail” may be a tail with shorter or longer aliphatic chains, aliphatic chains with branching introduced, aliphatic chains with substituents introduced, aliphatic chains wherein one or more methylenes are replaced by cyclic or heteroatom groups, or any combination thereof. For example, in certain embodiments, the compound of (IV) is of Formula (IV-a), or a salt thereof, wherein at least one instance of R2 is each instance of R2 is optionally substituted C1-30 alkyl, wherein one or more methylene units of R2 are independently replaced with optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(RN), O, S, C(O), C(O)N(RN), - NRNC(O), NRNC(O)N(RN), C(O)O, OC(O), OC(O)O, OC(O)N(RN), NRNC(O)O, C(O)S, SC(O), C(=NRN), C(=NRN)N(RN), NRNC(=NRN), NRNC(=NRN)N(RN), C(S), C(S)N(RN), NRNC(S), NRNC(S)N(RN), S(O), - OS(O), S(O)O, OS(O)O, OS(O)2, S(O)2O, OS(O)2O, N(RN)S(O), S(O)N(RN), N(RN)S(O)N(RN), - OS(O)N(RN), N(RN)S(O)O, S(O)2, N(RN)S(O)2, S(O)2N(RN), N(RN)S(O)2N(RN), OS(O)2N(RN), or - N(RN)S(O)2O.
In certain embodiments, the compound of Formula (IV) is of Formula (IV-c):
or a salt thereof, wherein: each x is independently an integer between 0-30, inclusive; and each instance is G is independently selected from the group consisting of optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(RN), O, S, C(O), C(O)N(RN), NRNC(O), NRNC(O)N(RN), C(O)O, 00(O), - 00(O)0, 0C(O)N(RN), NRNC(O)0, C(O)S, SC(O), C(=NRN), C(=NRN)N(RN), NRNC(=NRN), - NRNC(=NRN)N(RN), C(S), C(S)N(RN), NRNC(S), NRNC(S)N(RN), S(O), 0S(O), S(O)0, 0S(O)0, 0S(O)2, S(O)20, 0S(O)20, N(RN)S(O), S(O)N(RN), N(RN)S(O)N(RN), OS(O)N(RN), N(RN)S(O)O, S(O)2, - N(RN)S(O)2, S(O)2N(RN), N(RN)S(O)2N(RN), OS(O)2N(RN), or N(RN)S(O)2O. Each possibility represents a separate embodiment of the present disclosure.
In certain embodiments, a phospholipid useful or potentially useful in the present disclosure comprises a modified phosphocholine moiety, wherein the alkyl chain linking the quaternary amine to the phosphoryl group is not ethylene (e.g., n is not 2). Therefore, in certain embodiments, a phospholipid
useful or potentially useful in the present disclosure is a compound of Formula (IV), wherein n is 1 , 3, 4, 5, 6, 7, 8, 9, or 10. For example, in certain embodiments, a compound of Formula (IV) is of one of the following Formulae: or a salt thereof. iii. Alternative Lipids
In certain embodiments, a phospholipid useful or potentially useful in the present disclosure comprises a modified phosphocholine moiety, wherein the alkyl chain linking the quaternary amine to the phosphoryl group is not ethylene (e.g., n is not 2). Therefore, in certain embodiments, a phospholipid useful.
In certain embodiments, an alternative lipid is used in place of a phospholipid of the present disclosure.
In certain embodiments, an alternative lipid of the present disclosure is oleic acid. In certain embodiments, the alternative lipid is one of the following:
d. Structural Lipids
The lipid composition of a pharmaceutical composition disclosed herein can comprise one or more structural lipids. As used herein, the term "structural lipid" refers to sterols and also to lipids containing sterol moieties.
Incorporation of structural lipids in the lipid nanoparticle may help mitigate aggregation of other lipids in the particle. Structural lipids can be selected from the group including but not limited to, cholesterol, fecosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, tomatine, ursolic acid, alpha-tocopherol, hopanoids, phytosterols, steroids, and mixtures thereof. In some embodiments, the structural lipid is a sterol. As defined herein, "sterols" are a subgroup of steroids consisting of steroid alcohols. In certain embodiments, the structural lipid is a steroid. In certain embodiments, the structural lipid is cholesterol. In certain embodiments, the structural lipid is an analog of cholesterol. In certain embodiments, the structural lipid is alpha-tocopherol.
In some embodiments, the structural lipids may be one or more of the structural lipids described in U.S. Application No. 62/520,530. e. Polyetylene Glycol-Lipids
The lipid composition of a pharmaceutical composition disclosed herein can comprise one or more a polyethylene glycol (PEG) lipid.
As used herein, the term “PEG-lipid” refers to polyethylene glycol (PEG)-modified lipids. Nonlimiting examples of PEG-lipids include PEG-modified phosphatidylethanolamine and phosphatidic acid, PEG-ceramide conjugates (e.g., PEG-CerC14 or PEG-CerC20), PEG-modified dialkylamines and PEG- modified 1 ,2-diacyloxypropan-3-amines. Such lipids are also referred to as PEGylated lipids. For example, a PEG lipid can be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, or a PEG-DSPE lipid.
In some embodiments, the PEG-lipid includes, but not limited to 1 ,2-dimyristoyl-sn-glycerol methoxypolyethylene glycol (PEG-DMG), 1 ,2-distearoyl-sn-glycero-3-phosphoethanolamine-N- [amino(polyethylene glycol)] (PEG-DSPE), PEG-disteryl glycerol (PEG-DSG), PEG-dipalmetoleyl, PEG- dioleyl, PEG-distearyl, PEG-diacylglycamide (PEG-DAG), PEG-dipalmitoyl phosphatidylethanolamine (PEG-DPPE), or PEG-l,2-dimyristyloxlpropyl-3-amine (PEG-c-DMA).
In some embodiments, the PEG-lipid is selected from the group consisting of a PEG-modified phosphatidylethanolamine, a PEG-modified phosphatidic acid, a PEG-modified ceramide, a PEG- modified dialkylamine, a PEG-modified diacylglycerol, a PEG-modified dialkylglycerol, and mixtures thereof.
In some embodiments, the lipid moiety of the PEG-lipids includes those having lengths of from about Cuto about C22, preferably from about Cuto about C . In some embodiments, a PEG moiety, for example an mPEG-NH2, has a size of about 1000, 2000, 5000, 10,000, 15,000 or 20,000 daltons. In some embodiments, the PEG-lipid is PEG2k-DMG.
In some embodiments, the lipid nanoparticles described herein can comprise a PEG lipid which is a non-diffusible PEG. Non-limiting examples of non-diffusible PEGs include PEG-DSG and PEG-DSPE.
PEG-lipids are known in the art, such as those described in U.S. Patent No. 8,158,601 and International Publ. No. WO 2015/130584 A2, which are incorporated herein by reference in their entirety.
In general, some of the other lipid components (e.g., PEG lipids) of various Formulae, described herein may be synthesized as described International Patent Application No. PCT/US2016/000129, filed December 10, 2016, entitled “Compositions and Methods for Delivery of Therapeutic Agents,” which is incorporated by reference in its entirety.
The lipid component of a lipid nanoparticle composition may include one or more molecules comprising polyethylene glycol, such as PEG or PEG-modified lipids. Such species may be alternately referred to as PEGylated lipids. A PEG lipid is a lipid modified with polyethylene glycol. A PEG lipid may be selected from the non-limiting group including PEG-modified phosphatidylethanolamines, PEG- modified phosphatidic acids, PEG-modified ceramides, PEG-modified dialkylamines, PEG-modified diacylglycerols, PEG-modified dialkylglycerols, and mixtures thereof. For example, a PEG lipid may be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, or a PEG-DSPE lipid.
In some embodiments the PEG-modified lipids are a modified form of PEG DMG. PEG-DMG has the following structure:
In some embodiments, PEG lipids useful in the present disclosure can be PEGylated lipids described in International Publication No. WO2012099755, the contents of which is herein incorporated by reference in its entirety. Any of these exemplary PEG lipids described herein may be modified to comprise a hydroxyl group on the PEG chain. In certain embodiments, the PEG lipid is a PEG-OH lipid. As generally defined herein, a “PEG-OH lipid” (also referred to herein as “hydroxy-PEGylated lipid”) is a PEGylated lipid having one or more hydroxyl (-OH) groups on the lipid. In certain embodiments, the PEG-OH lipid includes one or more hydroxyl groups on the PEG chain. In certain embodiments, a PEG-
OH or hydroxy-PEGylated lipid comprises an -OH group at the terminus of the PEG chain. Each possibility represents a separate embodiment of the present disclosure.
In certain embodiments, a PEG lipid useful in the present disclosure is a compound of Formula (V). Provided herein are compounds of Formula (V):
(V), or salts thereof, wherein:
R3 is -OR0;
R° is hydrogen, optionally substituted alkyl, or an oxygen protecting group; r is an integer between 1 and 100, inclusive;
L1 is optionally substituted C1-10 alkylene, wherein at least one methylene of the optionally substituted C1-10 alkylene is independently replaced with optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, O, N(RN), S, C(O), C(O)N(RN), NRNC(O), C(O)O, OC(O), 00(O)0, 0C(O)N(RN), NRNC(O)0, or NRNC(O)N(RN);
D is a moiety obtained by click chemistry or a moiety cleavable under physiological conditions; m is 0, 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10;
A is of the Formula:
each instance of L2 is independently a bond or optionally substituted C1-6 alkylene, wherein one methylene unit of the optionally substituted C1-6 alkylene is optionally replaced with O, N(RN), S, C(O), - C(O)N(RN), NRNC(O), 0(O)0, 00(O), 00(O)0, 0C(O)N(RN), NRNC(O)0, or NRNC(O)N(RN); each instance of R2 is independently optionally substituted C1-30 alkyl, optionally substituted C1-30 alkenyl, or optionally substituted C1-30 alkynyl; optionally wherein one or more methylene units of R2 are independently replaced with optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(RN), O, S, C(O), C(O)N(RN), - NRNC(O), NRNC(O)N(RN), C(O)0, 0C(O), 0C(O)0, 0C(O)N(RN), NRNC(O)0, C(O)S, SC(O), C(=NRN), C(=NRN)N(RN), NRNC(=NRN), NRNC(=NRN)N(RN), C(S), C(S)N(RN), NRNC(S), NRNC(S)N(RN), S(O) , - 0S(O), S(O)0, 0S(O)0, 0S(O)2, S(O)20, 0S(O)20, N(RN)S(O), S(O)N(RN), N(RN)S(O)N(RN), - OS(O)N(RN), N(RN)S(O)O, S(O)2, N(RN)S(O)2, S(O)2N(RN), N(RN)S(O)2N(RN), OS(O)2N(RN), or - N(RN)S(O)2O; each instance of RN is independently hydrogen, optionally substituted alkyl, or a nitrogen protecting group;
Ring B is optionally substituted carbocyclyl, optionally substituted heterocyclyl, optionally substituted aryl, or optionally substituted heteroaryl; and p is 1 or 2.
In certain embodiments, the compound of Fomula (V) is a PEG-OH lipid (i.e., R3 is -OR0, and R° is hydrogen). In certain embodiments, the compound of Formula (V) is of Formula (V-OH):
(V-OH), or a salt thereof.
In certain embodiments, a PEG lipid useful in the present disclosure is a PEGylated fatty acid. In certain embodiments, a PEG lipid useful in the present disclosure is a compound of Formula (VI). Provided herein are compounds of Formula (VI):
or a salts thereof, wherein:
R3 is-OR°;
R° is hydrogen, optionally substituted alkyl or an oxygen protecting group; r is an integer between 1 and 100, inclusive;
R5 is optionally substituted C10-40 alkyl, optionally substituted C10-40 alkenyl, or optionally substituted C10-40 alkynyl; and optionally one or more methylene groups of R5 are replaced with optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(RN), O, S, C(O), C(O)N(RN), NRNC(O), NRNC(O)N(RN), C(O)O, OC(O), OC(O)O, OC(O)N(RN), NRNC(O)O, C(O)S, SC(O), C(=NRN), C(=NRN)N(RN), NRNC(=NRN), - NRNC(=NRN)N(RN), C(S), C(S)N(RN), NRNC(S), NRNC(S)N(RN), S(O), OS(O), S(O)O, OS(O)O, OS(O)2, S(O)2O, OS(O)2O, N(RN)S(O), S(O)N(RN), N(RN)S(O)N(RN), OS(O)N(RN), N(RN)S(O)O, S(O)2, - N(RN)S(O)2, S(O)2N(RN), N(RN)S(O)2N(RN), OS(O)2N(RN), or N(RN)S(O)2O; and each instance of RN is independently hydrogen, optionally substituted alkyl, or a nitrogen protecting group.
In certain embodiments, the compound of Formula (VI) is of Formula (VI-OH):
or a salt thereof. In some embodiments, r is 45.
In yet other embodiments the compound of Formula (VI) is:
or a salt thereof. In one embodiment, r is 40-50.
In some embodiments, the compound of Formula (VI) is
(Compound P-l).
In some aspects, the lipid composition of the pharmaceutical compositions disclosed herein does not comprise a PEG-lipid.
In some embodiments, the PEG-lipids may be one or more of the PEG lipids described in U.S. Application No. 62/520,530.
In some embodiments, a PEG lipid of the present disclosure comprises a PEG-modified phosphatidylethanolamine, a PEG-modified phosphatidic acid, a PEG-modified ceramide, a PEG- modified dialkylamine, a PEG-modified diacylglycerol, a PEG-modified dialkylglycerol, and mixtures
thereof. In some embodiments, the PEG-modified lipid is PEG-DMG, PEG-c-DOMG (also referred to as PEG-DOMG), PEG-DSG and/or PEG-DPG.
In some embodiments, a LNP of the present disclosure comprises an ionizable cationic lipid of any of Formula I, II or III, a phospholipid comprising DSPC, a structural lipid, and a PEG lipid comprising PEG-DMG.
In some embodiments, a LNP of the present disclosure comprises an ionizable cationic lipid of any of Formula I, II or III, a phospholipid comprising DSPC, a structural lipid, and a PEG lipid comprising a compound having Formula VI.
In some embodiments, a LNP of the present disclosure comprises an ionizable cationic lipid of Formula I, II or III, a phospholipid comprising a compound having Formula IV, a structural lipid, and the PEG lipid comprising a compound having Formula V or VI.
In some embodiments, a LNP of the present disclosure comprises an ionizable cationic lipid of Formula I, II or III, a phospholipid comprising a compound having Formula IV, a structural lipid, and the PEG lipid comprising a compound having Formula V or VI.
In some embodiments, a LNP of the present disclosure comprises an ionizable cationic lipid of Formula I, II or III, a phospholipid having Formula IV, a structural lipid, and a PEG lipid comprising a compound having Formula VI.
In some embodiments, a LNP of the present disclosure comprises an ionizable cationic lipid of
and a PEG lipid comprising Formula VI.
In some embodiments, a LNP of the present disclosure comprises an ionizable cationic lipid of
and an alternative lipid comprising oleic acid.
In some embodiments, a LNP of the present disclosure comprises an ionizable cationic lipid of
an alternative lipid comprising oleic acid, a structural lipid comprising cholesterol, and a PEG lipid comprising a compound having Formula VI.
In some embodiments, a LNP of the present disclosure comprises an ionizable cationic lipid of
a phospholipid comprising DOPE, a structural lipid comprising cholesterol, and a PEG lipid comprising a compound having Formula VI.
In some embodiments, a LNP of the present disclosure comprises an ionizable cationic lipid of
a phospholipid comprising DOPE, a structural lipid comprising cholesterol, and a PEG lipid comprising a compound having Formula VI.
In some embodiments, a LNP of the present disclosure comprises an N:P ratio of from about 2:1 to about 30:1 .
In some embodiments, a LNP of the present disclosure comprises an N:P ratio of about 6:1 .
In some embodiments, a LNP of the present disclosure comprises an N:P ratio of about 3:1 .
In some embodiments, a LNP of the present disclosure comprises a wt/wt ratio of the ionizable cationic lipid component to the RNA of from about 10:1 to about 100:1 .
In some embodiments, a LNP of the present disclosure comprises a wt/wt ratio of the ionizable cationic lipid component to the RNA of about 20:1 .
In some embodiments, a LNP of the present disclosure comprises a wt/wt ratio of the ionizable cationic lipid component to the RNA of about 10:1 .
In some embodiments, a LNP of the present disclosure has a mean diameter from about 50nm to about 150nm.
In some embodiments, a LNP of the present disclosure has a mean diameter from about 70nm to about 120nm.
As used herein, the term "alkyl", "alkyl group", or "alkylene" means a linear or branched, saturated hydrocarbon including one or more carbon atoms (e.g., one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, or more carbon atoms), which is optionally substituted. The notation "Ci i4 alkyl" means an optionally substituted linear or branched, saturated hydrocarbon including 1 -14 carbon atoms. Unless otherwise specified, an alkyl group described herein refers to both unsubstituted and substituted alkyl groups.
As used herein, the term "alkenyl", "alkenyl group", or "alkenylene" means a linear or branched hydrocarbon including two or more carbon atoms (e.g., two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, or more carbon atoms) and at least one double bond, which is optionally substituted. The notation "C2-14 alkenyl" means an optionally substituted linear or branched hydrocarbon including 2-14 carbon atoms and at least one carbon-carbon double bond. An alkenyl group may include one, two, three, four, or more carbon-carbon
double bonds. For example, C18 alkenyl may include one or more double bonds. A C18 alkenyl group including two double bonds may be a linoleyl group. Unless otherwise specified, an alkenyl group described herein refers to both unsubstituted and substituted alkenyl groups.
As used herein, the term "alkynyl", "alkynyl group", or "alkynylene" means a linear or branched hydrocarbon including two or more carbon atoms (e.g., two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, or more carbon atoms) and at least one carbon-carbon triple bond, which is optionally substituted. The notation "C2-14 alkynyl" means an optionally substituted linear or branched hydrocarbon including 2-14 carbon atoms and at least one carbon-carbon triple bond. An alkynyl group may include one, two, three, four, or more carbon-carbon triple bonds. For example, C18 alkynyl may include one or more carbon-carbon triple bonds. Unless otherwise specified, an alkynyl group described herein refers to both unsubstituted and substituted alkynyl groups.
As used herein, the term "carbocycle" or "carbocyclic group" means an optionally substituted mono- or multi-cyclic system including one or more rings of carbon atoms. Rings may be three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, or twenty membered rings. The notation "C3-6 carbocycle" means a carbocycle including a single ring having 3-6 carbon atoms. Carbocycles may include one or more carbon-carbon double or triple bonds and may be non-aromatic or aromatic (e.g., cycloalkyl or aryl groups). Examples of carbocycles include cyclopropyl, cyclopentyl, cyclohexyl, phenyl, naphthyl, and 1 ,2 dihydronaphthyl groups. The term "cycloalkyl" as used herein means a non-aromatic carbocycle and may or may not include any double or triple bond. Unless otherwise specified, carbocycles described herein refers to both unsubstituted and substituted carbocycle groups, i.e., optionally substituted carbocycles.
As used herein, the term "heterocycle" or "heterocyclic group" means an optionally substituted mono- or multi-cyclic system including one or more rings, where at least one ring includes at least one heteroatom. Heteroatoms may be, for example, nitrogen, oxygen, or sulfur atoms. Rings may be three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, or fourteen membered rings. Heterocycles may include one or more double or triple bonds and may be non-aromatic or aromatic (e.g., heterocycloalkyl or heteroaryl groups). Examples of heterocycles include imidazolyl, imidazolidinyl, oxazolyl, oxazolidinyl, thiazolyl, thiazolidinyl, pyrazolidinyl, pyrazolyl, isoxazolidinyl, isoxazolyl, isothiazolidinyl, isothiazolyl, morpholinyl, pyrrolyl, pyrrolidinyl, furyl, tetrahydrofuryl, thiophenyl, pyridinyl, piperidinyl, quinolyl, and isoquinolyl groups. The term "heterocycloalkyl" as used herein means a non- aromatic heterocycle and may or may not include any double or triple bond. Unless otherwise specified, heterocycles described herein refers to both unsubstituted and substituted heterocycle groups, i.e., optionally substituted heterocycles.
As used herein, the term "heteroalkyl", "heteroalkenyl", or "heteroalkynyl", refers respectively to an alkyl, alkenyl, alkynyl group, as defined herein, which further comprises one or more (e.g., 1 , 2, 3, or 4) heteroatoms (e.g., oxygen, sulfur, nitrogen, boron, silicon, phosphorus) wherein the one or more heteroatoms is inserted between adjacent carbon atoms within the parent carbon chain and/or one or more heteroatoms is inserted between a carbon atom and the parent molecule, i.e., between the point of attachment. Unless otherwise specified, heteroalkyls, heteroalkenyls, or heteroalkynyls described herein
refers to both unsubstituted and substituted heteroalkyls, heteroalkenyls, or heteroalkynyls, i.e., optionally substituted heteroalkyls, heteroalkenyls, or heteroalkynyls.
As used herein, a "biodegradable group" is a group that may facilitate faster metabolism of a lipid in a mammalian entity. A biodegradable group may be selected from the group consisting of, but is not limited to, -C(O)O-, -OC(O)-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, - P(O)(OR')O-, -S(O)2-, an aryl group, and a heteroaryl group. As used herein, an "aryl group" is an optionally substituted carbocyclic group including one or more aromatic rings. Examples of aryl groups include phenyl and naphthyl groups. As used herein, a "heteroaryl group" is an optionally substituted heterocyclic group including one or more aromatic rings. Examples of heteroaryl groups include pyrrolyl, furyl, thiophenyl, imidazolyl, oxazolyl, and thiazolyl. Both aryl and heteroaryl groups may be optionally substituted. For example, M and M' can be selected from the non-limiting group consisting of optionally substituted phenyl, oxazole, and thiazole. In the Formulas herein, M and M' can be independently selected from the list of biodegradable groups above. Unless otherwise specified, aryl or heteroaryl groups described herein refers to both unsubstituted and substituted groups, i.e., optionally substituted aryl or heteroaryl groups.
Alkyl, alkenyl, and cyclyl (e.g., carbocyclyl and heterocyclyl) groups may be optionally substituted unless otherwise specified. Optional substituents may be selected from the group consisting of, but are not limited to, a halogen atom (e.g., a chloride, bromide, fluoride, or iodide group), a carboxylic acid (e.g., C(O)OH), an alcohol (e.g., a hydroxyl, OH), an ester (e.g., C(O)OR OC(O)R), an aldehyde (e.g., C(O)H), a carbonyl (e.g., C(O)R, alternatively represented by 0=0), an acyl halide (e.g., C(O)X, in which X is a halide selected from bromide, fluoride, chloride, and iodide), a carbonate (e.g., OC(O)OR), an alkoxy (e.g., OR), an acetal (e.g., C(0R)2R"", in which each OR are alkoxy groups that can be the same or different and R"" is an alkyl or alkenyl group), a phosphate (e.g., P(O)43-) , a thiol (e.g., SH), a sulfoxide (e.g., S(O)R), a sulfinic acid (e.g., S(O)OH), a sulfonic acid (e.g., S(O)20H), a thial (e.g., C(S)H), a sulfate (e.g., S(O)42-) , a sulfonyl (e.g., S(O)2 ), an amide (e.g., C(O)NR2, or N(R)C(O)R), an azido (e.g., N3), a nitro (e.g., NO2), a cyano (e.g., CN), an isocyano (e.g., NC), an acyloxy (e.g., OC(O)R), an amino (e.g., NR2, NRH, or NH2), a carbamoyl (e.g., 0C(O)NR2, 0C(O)NRH, or 0C(O)NH2), a sulfonamide (e.g., S(O)2NR2, S(O)2NRH, S(O)2NH2, N(R)S(O)2R, N(H)S(O)2R, N(R)S(O)2H, or N(H)S(O)2H), an alkyl group, an alkenyl group, and a cyclyl (e.g., carbocyclyl or heterocyclyl) group. In any of the preceding, R is an alkyl or alkenyl group, as defined herein. In some embodiments, the substituent groups themselves may be further substituted with, for example, one, two, three, four, five, or six substituents as defined herein. For example, a C1-6 alkyl group may be further substituted with one, two, three, four, five, or six substituents as described herein.
Compounds of the disclosure that contain nitrogens can be converted to N-oxides by treatment with an oxidizing agent (e.g., 3-chloroperoxybenzoic acid (mCPBA) and/or hydrogen peroxides) to afford other compounds of the disclosure. Thus, all shown and claimed nitrogen-containing compounds are considered, when allowed by valency and structure, to include both the compound as shown and its N- oxide derivative (which can be designated as N->0 or N+-0-). Furthermore, in other instances, the nitrogens in the compounds of the disclosure can be converted to N-hydroxy or N-alkoxy compounds. For example, N-hydroxy compounds can be prepared by oxidation of the parent amine by an oxidizing agent such as m CPBA. All shown and claimed nitrogen-containing compounds are also considered,
when allowed by valency and structure, to cover both the compound as shown and its N-hydroxy (i.e., N- OH) and N-alkoxy (i.e., N-OR, wherein R is substituted or unsubstituted C1-C6 alkyl, C1-C6 alkenyl, C1-C6 alkynyl, 3-14-membered carbocycle or 3-14-membered heterocycle) derivatives. f. Other Lipid Composition Components
The lipid composition of a pharmaceutical composition disclosed herein can include one or more components in addition to those described above. For example, the lipid composition can include one or more permeability enhancer molecules, carbohydrates, polymers, surface altering agents (e.g., surfactants), or other components. For example, a permeability enhancer molecule can be a molecule described by U.S. Patent Application Publication No. 2005/0222064. Carbohydrates can include simple sugars (e.g., glucose) and polysaccharides (e.g., glycogen and derivatives and analogs thereof).
A polymer can be included in and/or used to encapsulate or partially encapsulate a pharmaceutical composition disclosed herein (e.g., a pharmaceutical composition in lipid nanoparticle form). A polymer can be biodegradable and/or biocompatible. A polymer can be selected from, but is not limited to, polyamines, polyethers, polyamides, polyesters, polycarbamates, polyureas, polycarbonates, polystyrenes, polyimides, polysulfones, polyurethanes, polyacetylenes, polyethylenes, polyethyleneimines, polyisocyanates, polyacrylates, polymethacrylates, polyacrylonitriles, and polyarylates.
The ratio between the lipid composition and the polynucleotide range can be from about 10:1 to about 60:1 (wt/wt).
In some embodiments, the ratio between the lipid composition and the polynucleotide can be about 10:1 , 11 :1 , 12:1 , 13:1 , 14:1 , 15:1 , 16:1 , 17:1 , 18:1 , 19:1 , 20:1 , 21 :1 , 22:1 , 23:1 , 24:1 , 25:1 , 26:1 , 27:1 , 28:1 , 29:1 , 30:1 , 31 :1 , 32:1 , 33:1 , 34:1 , 35:1 , 36:1 , 37:1 , 38:1 , 39:1 , 40:1 , 41 :1 , 42:1 , 43:1 , 44:1 , 45:1 , 46:1 , 47:1 , 48:1 , 49:1 , 50:1 , 51 :1 , 52:1 , 53:1 , 54:1 , 55:1 , 56:1 , 57:1 , 58:1 , 59:1 or 60:1 (wt/wt). In some embodiments, the wt/wt ratio of the lipid composition to the polynucleotide encoding a therapeutic agent is about 20:1 or about 15:1 .
In some embodiments, the pharmaceutical composition disclosed herein can contain more than one polypeptide. For example, a pharmaceutical composition disclosed herein can contain two or more polynucleotides (e.g., RNA, e.g., mRNA).
In some embodiments, the lipid nanoparticles described herein can comprise polynucleotides (e.g., mRNA) in a lipid polynucleotide weight ratio of 5:1 , 10:1 , 15:1 , 20:1 , 25:1 , 30:1 , 35:1 , 40:1 , 45:1 , 50:1 , 55:1 , 60:1 or 70:1 , or a range or any of these ratios such as, but not limited to, 5:1 to about 10:1 , from about 5:1 to about 15:1 , from about 5:1 to about 20:1 , from about 5:1 to about 25:1 , from about 5:1 to about 30:1 , from about 5:1 to about 35:1 , from about 5:1 to about 40:1 , from about 5:1 to about 45:1 , from about 5:1 to about 50:1 , from about 5:1 to about 55:1 , from about 5:1 to about 60:1 , from about 5:1 to about 70:1 , from about 10:1 to about 15:1 , from about 10:1 to about 20:1 , from about 10:1 to about 25:1 , from about 10:1 to about 30:1 , from about 10:1 to about 35:1 , from about 10:1 to about 40:1 , from about 10:1 to about 45:1 , from about 10:1 to about 50:1 , from about 10:1 to about 55:1 , from about 10:1 to about 60:1 , from about 10:1 to about 70:1 , from about 15:1 to about 20:1 , from about 15:1 to about 25:1 ,from about 15:1 to about 30:1 , from about 15:1 to about 35:1 , from about 15:1 to about 40:1 , from
about 15:1 to about 45:1 , from about 15:1 to about 50:1 , from about 15:1 to about 55:1 , from about 15:1 to about 60:1 or from about 15:1 to about 70:1 .
In some embodiments, the lipid nanoparticles described herein can comprise the polynucleotide in a concentration from approximately 0.1 mg/ml to 2 mg/ml such as, but not limited to, 0.1 mg/ml, 0.2 mg/ml, 0.3 mg/ml, 0.4 mg/ml, 0.5 mg/ml, 0.6 mg/ml, 0.7 mg/ml, 0.8 mg/ml, 0.9 mg/ml, 1 .0 mg/ml, 1 .1 mg/ml, 1 .2 mg/ml, 1 .3 mg/ml, 1 .4 mg/ml, 1 .5 mg/ml, 1 .6 mg/ml, 1 .7 mg/ml, 1 .8 mg/ml, 1 .9 mg/ml, 2.0 mg/ml or greater than 2.0 mg/ml. g. Nanoparticle Compositions
In some embodiments, the pharmaceutical compositions disclosed herein are Formulated as lipid nanoparticles (LNP). Accordingly, the present disclosure also provides nanoparticle compositions comprising (i) a lipid composition comprising a delivery agent such as compound as described herein, and (ii) a polynucleotide containing an IRES described herein and encoding a polypeptide of interest. In such nanoparticle composition, the lipid composition disclosed herein can encapsulate the polynucleotide containing the IRES and encoding the polypeptide.
Nanoparticle compositions are typically sized on the order of micrometers or smaller and can include a lipid bilayer. Nanoparticle compositions encompass lipid nanoparticles (LNPs), liposomes (e.g., lipid vesicles), and lipoplexes. For example, a nanoparticle composition can be a liposome having a lipid bilayer with a diameter of 500 nm or less.
Nanoparticle compositions include, for example, lipid nanoparticles (LNPs), liposomes, and lipoplexes. In some embodiments, nanoparticle compositions are vesicles including one or more lipid bilayers. In certain embodiments, a nanoparticle composition includes two or more concentric bilayers separated by aqueous compartments. Lipid bilayers can be functionalized and/or crosslinked to one another. Lipid bilayers can include one or more ligands, proteins, or channels.
In some embodiments, a lipid nanoparticle comprises an ionizable amino lipid, a structural lipid, a phospholipid, and mRNA. In some embodiments, the LNP comprises an ionizable amino lipid, a PEG- modified lipid, a sterol and a structural lipid. In some embodiments, the LNP has a molar ratio of about 40-50% ionizable amino lipid; about 5-15% structural lipid; about 30-45% sterol; and about 1 -5% PEG- modified lipid.
In some embodiments, the lipid nanoparticle comprises 47-49 mol.% ionizable cationic lipid (e.g. ionizable amino lipid, e.g., Compound 1-1 , Compound I-2, or Compound I-3), 10-12 mol.% non-cationic lipid (e.g., phospholipid, e.g., DSPC), 38-40 mol.% sterol (e.g., cholesterol) or other structural lipid, and 1 - 3 mol.% PEG-modified lipid (e.g., PEG-DMG or Compound P-l).
For instance, in some embodiments, the lipid nanoparticle (“LNP-1 ”) may comprise the following components at the following molar ratios:
(i) 45-50 mol.% Compound 1-1
(ii) 35-45 mol.% sterol (e.g., cholesterol);
(iii) 8-12 mol.% phospholipid (e.g., DSPC or DOPE); and
(iv) 1 .5-3.5 mol.% PEG-lipid (e.g., Compound P-l or PEG-DMG).
For instance, in some embodiments, the lipid nanoparticle (“LNP-1 A”) may comprise the following components at the following molar ratios:
(i) 45-50 mol.% Compound 1-1
(ii) 35-45 mol.% Cholesterol;
(Hi) 8-12 mol.% DSPC; and
(iv) 1 .5-3.5 mol.% PEG-DMG.
For instance, in some embodiments, the lipid nanoparticle (“LNP-1 B”) may comprise the following components at the following molar ratios:
(i) 45-50 mol.% Compound 1-1
(ii) 35-45 mol.% Cholesterol;
(Hi) 8-12 mol.% DSPC; and
(iv) 1 .5-3.5 mol.% Compound P-l.
In some embodiments, the lipid nanoparticle (“LNP-2”) may comprise the following:
(i) 45-50 mol.% Compound I-2;
(ii) 35-45 mol.% sterol (e.g., Cholesterol);
(Hi) 8-12 mol.% phospholipid (e.g., DSPC or DOPE); and
(iv) 1 .5-3.5 mol.% PEG-lipid (e.g., Compound P-l or PEG-DMG).
In some embodiments, the lipid nanoparticle (“LNP-2A”) may comprise the following:
(i) 45-50 mol.% Compound I-2;
(ii) 35-45 mol.% Cholesterol;
(Hi) 8-12 mol.% DSPC; and
(iv) 1 .5-3.5 mol.% PEG-DMG.
For instance, in some embodiments, the lipid nanoparticle (“LNP-2B”) may comprise the following components at the following molar ratios:
(i) 45-50 mol.% Compound I-2;
(ii) 35-45 mol.% Cholesterol;
(Hi) 8-12 mol.% DSPC; and
(iv) 1 .5-3.5 mol.% Compound P-l.
In some embodiments, the lipid nanoparticle (“LNP-3”) may comprise the following:
(i) 45-50 mol.% Compound I-3;
(ii) 35-45 mol.% sterol (e.g., Cholesterol);
(Hi) 8-12 mol.% phospholipid (e.g., DSPC or DOPE); and
(iv) 1 .5-3.5 mol.% PEG-lipid (e.g., Compound P-l or PEG-DMG).
In some embodiments, the lipid nanoparticle (“LNP-3A”) may comprise the following:
(i) 45-50 mol.% Compound I-3;
(ii) 35-45 mol.% Cholesterol;
(Hi) 8-12 mol.% DSPC; and
(iv) 1 .5-3.5 mol.% PEG-DMG.
In some embodiments, the lipid nanoparticle (“LNP-3B”) may comprise the following:
(i) 45-50 mol.% Compound I-3;
(ii) 35-45 mol.% Cholesterol;
(Hi) 8-12 mol.% DSPC; and
(iv) 1 .5-3.5 mol.% Compound P-l.
In some embodiments, the LNP has a polydispersity value of less than 0.4. In some embodiments, the LNP has a net neutral charge at a neutral pH. In some embodiments, the LNP has a mean diameter of 50-150 nm. In some embodiments, the LNP has a mean diameter of 80-100 nm.
As generally defined herein, the term “lipid” refers to a small molecule that has hydrophobic or amphiphilic properties. Lipids may be naturally occurring or synthetic. Examples of classes of lipids include, but are not limited to, fats, waxes, sterol-containing metabolites, vitamins, fatty acids, glycerolipids, glycerophospholipids, sphingolipids, saccharolipids, and polyketides, and prenol lipids. In some instances, the amphiphilic properties of some lipids leads them to form liposomes, vesicles, or membranes in aqueous media.
In some embodiments, a lipid nanoparticle (LNP) may comprise an ionizable amino lipid. As used herein, the term “ionizable amino lipid” has its ordinary meaning in the art and may refer to a lipid comprising one or more charged moieties. In some embodiments, an ionizable amino lipid may be positively charged or negatively charged. An ionizable amino lipid may be positively charged, in which case it can be referred to as “cationic lipid”. In certain embodiments, an ionizable amino lipid molecule may comprise an amine group, and can be referred to as an ionizable amino lipid. As used herein, a “charged moiety” is a chemical moiety that carries a formal electronic charge, e.g., monovalent (+1 , or -1 ), divalent (+2, or -2), trivalent (+3, or -3), etc. The charged moiety may be anionic (i.e., negatively charged) or cationic (i.e., positively charged). Examples of positively-charged moieties include amine groups (e.g., primary, secondary, and/or tertiary amines), ammonium groups, pyridinium groups, guanidine groups, and imidizolium groups. In a particular embodiment, the charged moieties comprise amine groups. Examples of negatively- charged groups or precursors thereof, include carboxylate groups, sulfonate groups, sulfate groups, phosphonate groups, phosphate groups, hydroxyl groups, and the like. The charge of the charged moiety may vary, in some cases, with the environmental conditions, for example, changes in pH may alter the charge of the moiety, and/or cause the moiety to become charged or uncharged. In general, the charge density of the molecule may be selected as desired.
It should be understood that the terms “charged” or “charged moiety” does not refer to a “partial negative charge" or “partial positive charge" on a molecule. The terms “partial negative charge" and “partial positive charge" are given their ordinary meaning in the art. A “partial negative charge" may result when a functional group comprises a bond that becomes polarized such that electron density is pulled toward one atom of the bond, creating a partial negative charge on the atom. Those of ordinary skill in the art will, in general, recognize bonds that can become polarized in this way.
The ionizable amino lipid is sometimes referred to in the art as an “ionizable cationic lipid”. In some embodiments, the ionizable amino lipid may have a positively charged hydrophilic head and a hydrophobic tail that are connected via a linker structure.
In addition to these, an ionizable amino lipid may also be a lipid including a cyclic amine group.
In some embodiments, the ionizable amino lipid may be selected from, but not limited to, an ionizable amino lipid described in International Publication Nos. WO2013086354 and WO2013116126; the contents of each of which are herein incorporated by reference in their entirety.
In yet another embodiment, the ionizable amino lipid may be selected from, but not limited to, Formula CLI-CLXXXXII of US Patent No. 7,404,969; each of which is herein incorporated by reference in their entirety.
In some embodiments, the lipid may be a cleavable lipid such as those described in International Publication No. WO2012170889, herein incorporated by reference in its entirety. In some embodiments, the lipid may be synthesized by methods known in the art and/or as described in International Publication Nos. WO2013086354; the contents of each of which are herein incorporated by reference in their entirety.
Nanoparticle compositions can be characterized by a variety of methods. For example, microscopy (e.g., transmission electron microscopy or scanning electron microscopy) can be used to examine the morphology and size distribution of a nanoparticle composition. Dynamic light scattering or potentiometry (e.g., potentiometric titrations) can be used to measure zeta potentials. Dynamic light scattering can also be utilized to determine particle sizes. Instruments such as the Zetasizer Nano ZS (Malvern Instruments Ltd, Malvern, Worcestershire, UK) can also be used to measure multiple characteristics of a nanoparticle composition, such as particle size, polydispersity index, and zeta potential.
The size of the nanoparticles can help counter biological reactions such as, but not limited to, inflammation, or can increase the biological effect of the polynucleotide.
As used herein, “size” or “mean size” in the context of nanoparticle compositions refers to the mean diameter of a nanoparticle composition.
In some embodiments, a polynucleotide of the disclosure is formulated in lipid nanoparticles having a diameter from about 10 to about 100 nm such as, but not limited to, about 10 to about 20 nm, about 10 to about 30 nm, about 10 to about 40 nm, about 10 to about 50 nm, about 10 to about 60 nm, about 10 to about 70 nm, about 10 to about 80 nm, about 10 to about 90 nm, about 20 to about 30 nm, about 20 to about 40 nm, about 20 to about 50 nm, about 20 to about 60 nm, about 20 to about 70 nm, about 20 to about 80 nm, about 20 to about 90 nm, about 20 to about 100 nm, about 30 to about 40 nm, about 30 to about 50 nm, about 30 to about 60 nm, about 30 to about 70 nm, about 30 to about 80 nm, about 30 to about 90 nm, about 30 to about 100 nm, about 40 to about 50 nm, about 40 to about 60 nm, about 40 to about 70 nm, about 40 to about 80 nm, about 40 to about 90 nm, about 40 to about 100 nm, about 50 to about 60 nm, about 50 to about 70 nm, about 50 to about 80 nm, about 50 to about 90 nm, about 50 to about 100 nm, about 60 to about 70 nm, about 60 to about 80 nm, about 60 to about 90 nm, about 60 to about 100 nm, about 70 to about 80 nm, about 70 to about 90 nm, about 70 to about 100 nm, about 80 to about 90 nm, about 80 to about 100 nm and/or about 90 to about 100 nm.
In some embodiments, the nanoparticles have a diameter from about 10 to 500 nm. In some embodiments, the nanoparticle has a diameter greater than 100 nm, greater than 150 nm, greater than 200 nm, greater than 250 nm, greater than 300 nm, greater than 350 nm, greater than 400 nm, greater than 450 nm, greater than 500 nm, greater than 550 nm, greater than 600 nm, greater than 650 nm, greater than 700 nm, greater than 750 nm, greater than 800 nm, greater than 850 nm, greater than 900 nm, greater than 950 nm or greater than 1000 nm.
In some embodiments, the largest dimension of a nanoparticle composition is 1 pm or shorter (e.g., 1 pm, 900 nm, 800 nm, 700 nm, 600 nm, 500 nm, 400 nm, 300 nm, 200 nm, 175 nm, 150 nm, 125 nm, 100 nm, 75 nm, 50 nm, or shorter).
A nanoparticle composition can be relatively homogenous. A polydispersity index can be used to indicate the homogeneity of a nanoparticle composition, e.g., the particle size distribution of the nanoparticle composition. A small (e.g., less than 0.3) polydispersity index generally indicates a narrow
particle size distribution. A nanoparticle composition can have a polydispersity index from about 0 to about 0.25, such as 0.01 , 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11 , 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21 , 0.22, 0.23, 0.24, or 0.25. In some embodiments, the polydispersity index of a nanoparticle composition disclosed herein can be from about 0.10 to about 0.20.
The zeta potential of a nanoparticle composition can be used to indicate the electrokinetic potential of the composition. For example, the zeta potential can describe the surface charge of a nanoparticle composition. Nanoparticle compositions with relatively low charges, positive or negative, are generally desirable, as more highly charged species can interact undesirably with cells, tissues, and other elements in the body. In some embodiments, the zeta potential of a nanoparticle composition disclosed herein can be from about -10 mV to about +20 mV, from about -10 mV to about +15 mV, from about 10 mV to about +10 mV, from about -10 mV to about +5 mV, from about -10 mV to about 0 mV, from about - 10 mV to about -5 mV, from about -5 mV to about +20 mV, from about -5 mV to about +15 mV, from about -5 mV to about +10 mV, from about -5 mV to about +5 mV, from about -5 mV to about 0 mV, from about 0 mV to about +20 mV, from about 0 mV to about +15 mV, from about 0 mV to about +10 mV, from about 0 mV to about +5 mV, from about +5 mV to about +20 mV, from about +5 mV to about +15 mV, or from about +5 mV to about +10 mV.
In some embodiments, the zeta potential of the lipid nanoparticles can be from about 0 mV to about 100 mV, from about 0 mV to about 90 mV, from about 0 mV to about 80 mV, from about 0 mV to about 70 mV, from about 0 mV to about 60 mV, from about 0 mV to about 50 mV, from about 0 mV to about 40 mV, from about 0 mV to about 30 mV, from about 0 mV to about 20 mV, from about 0 mV to about 10 mV, from about 10 mV to about 100 mV, from about 10 mV to about 90 mV, from about 10 mV to about 80 mV, from about 10 mV to about 70 mV, from about 10 mV to about 60 mV, from about 10 mV to about 50 mV, from about 10 mV to about 40 mV, from about 10 mV to about 30 mV, from about 10 mV to about 20 mV, from about 20 mV to about 100 mV, from about 20 mV to about 90 mV, from about 20 mV to about 80 mV, from about 20 mV to about 70 mV, from about 20 mV to about 60 mV, from about 20 mV to about 50 mV, from about 20 mV to about 40 mV, from about 20 mV to about 30 mV, from about 30 mV to about 100 mV, from about 30 mV to about 90 mV, from about 30 mV to about 80 mV, from about 30 mV to about 70 mV, from about 30 mV to about 60 mV, from about 30 mV to about 50 mV, from about 30 mV to about 40 mV, from about 40 mV to about 100 mV, from about 40 mV to about 90 mV, from about 40 mV to about 80 mV, from about 40 mV to about 70 mV, from about 40 mV to about 60 mV, and from about 40 mV to about 50 mV. In some embodiments, the zeta potential of the lipid nanoparticles can be from about 10 mV to about 50 mV, from about 15 mV to about 45 mV, from about 20 mV to about 40 mV, and from about 25 mV to about 35 mV. In some embodiments, the zeta potential of the lipid nanoparticles can be about 10 mV, about 20 mV, about 30 mV, about 40 mV, about 50 mV, about 60 mV, about 70 mV, about 80 mV, about 90 mV, and about 100 mV.
The term “encapsulation efficiency” of a polynucleotide describes the amount of the polynucleotide that is encapsulated by or otherwise associated with a nanoparticle composition after preparation, relative to the initial amount provided. As used herein, “encapsulation” can refer to complete, substantial, or partial enclosure, confinement, surrounding, or encasement.
Encapsulation efficiency is desirably high (e.g., close to 100%). The encapsulation efficiency can be measured, for example, by comparing the amount of the polynucleotide in a solution containing the
nanoparticle composition before and after breaking up the nanoparticle composition with one or more organic solvents or detergents.
Fluorescence can be used to measure the amount of free polynucleotide in a solution. For the nanoparticle compositions described herein, the encapsulation efficiency of a polynucleotide can be at least 50%, for example 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the encapsulation efficiency can be at least 80%. In certain embodiments, the encapsulation efficiency can be at least 90%.
The amount of a polynucleotide present in a pharmaceutical composition disclosed herein can depend on multiple factors such as the size of the polynucleotide, desired target and/or application, or other properties of the nanoparticle composition as well as on the properties of the polynucleotide.
For example, the amount of an mRNA useful in a nanoparticle composition can depend on the size (expressed as length, or molecular mass), sequence, and other characteristics of the mRNA. The relative amounts of a polynucleotide in a nanoparticle composition can also vary.
The relative amounts of the lipid composition and the polynucleotide present in a lipid nanoparticle composition of the present disclosure can be optimized according to considerations of efficacy and tolerability. For compositions including an mRNA as a polynucleotide, the N:P ratio can serve as a useful metric.
As the N:P ratio of a nanoparticle composition controls both expression and tolerability, nanoparticle compositions with low N:P ratios and strong expression are desirable. N:P ratios vary according to the ratio of lipids to RNA in a nanoparticle composition.
In general, a lower N:P ratio is preferred. The one or more RNA, lipids, and amounts thereof can be selected to provide an N:P ratio from about 2:1 to about 30:1 , such as 2:1 , 3:1 , 4:1 , 5:1 , 6:1 , 7:1 , 8:1 , 9:1 , 10:1 , 12:1 , 14:1 , 16:1 , 18:1 , 20:1 , 22:1 , 24:1 , 26:1 , 28:1 , or 30:1 . In certain embodiments, the N:P ratio can be from about 2:1 to about 8:1 . In other embodiments, the N:P ratio is from about 5:1 to about 8:1 . In certain embodiments, the N:P ratio is between 5:1 and 6:1 . In one specific aspect, the N:P ratio is about is about 5.67:1 .
In addition to providing nanoparticle compositions, the present disclosure also provides methods of producing lipid nanoparticles comprising encapsulating a polynucleotide. Such method comprises using any of the pharmaceutical compositions disclosed herein and producing lipid nanoparticles in accordance with methods of production of lipid nanoparticles known in the art. See, e.g., Wang et al. (2015) “Delivery of oligonucleotides with lipid nanoparticles” Adv. Drug Deliv. Rev. 87:68-80; Silva et al. (2015) “Delivery Systems for Biopharmaceuticals. Part I: Nanoparticles and Microparticles” Curr. Pharm. Technol. 16: 940-954; Naseri et al. (2015) “Solid Lipid Nanoparticles and Nanostructured Lipid Carriers: Structure, Preparation and Application” Adv. Pharm. Bull. 5:305-13; Silva et al. (2015) “Lipid nanoparticles for the delivery of biopharmaceuticals” Curr. Pharm. Biotechnol. 16:291 -302, and references cited therein.
In some embodiments, the LNP formulations described herein can additionally comprise a permeability enhancer molecule. Non-limiting permeability enhancer molecules are described in U.S. Pub. No. US20050222064, herein incorporated by reference in its entirety.
The LNP formulations can further contain a phosphate conjugate. The phosphate conjugate can increase in vivo circulation times and/or increase the targeted delivery of the nanoparticle. Phosphate conjugates can be made by the methods described in, e.g., Inti. Pub. No. WO2013033438 or U.S. Pub.
No. US20130196948. The LNP formulation can also contain a polymer conjugate (e.g., a water soluble conjugate) as described in, e.g., U.S. Pub. Nos. US20130059360, US20130196948, and US20130072709. Each of the references is herein incorporated by reference in its entirety.
The LNP formulations can comprise a conjugate to enhance the delivery of nanoparticles of the present disclosure in a subject. Further, the conjugate can inhibit phagocytic clearance of the nanoparticles in a subject. In some embodiments, the conjugate can be a "self" peptide designed from the human membrane protein CD47 (e.g., the "self" particles described by Rodriguez et al, Science 2013 339, 971 -975, herein incorporated by reference in its entirety). As shown by Rodriguez et al., the self peptides delayed macrophage-mediated clearance of nanoparticles which enhanced delivery of the nanoparticles.
The LNP formulations can comprise a carbohydrate carrier. As a non-limiting example, the carbohydrate carrier can include, but is not limited to, an anhydride-modified phytoglycogen or glycogentype material, phytoglycogen octenyl succinate, phytoglycogen beta-dextrin, anhydride-modified phytoglycogen beta-dextrin (e.g., Inti. Pub. No. W02012109121 , herein incorporated by reference in its entirety).
The LNP formulations can be coated with a surfactant or polymer to improve the delivery of the particle. In some embodiments, the LNP can be coated with a hydrophilic coating such as, but not limited to, PEG coatings and/or coatings that have a neutral surface charge as described in U.S. Pub. No. US20130183244, herein incorporated by reference in its entirety.
The LNP formulations can be engineered to alter the surface properties of particles so that the lipid nanoparticles can penetrate the mucosal barrier as described in U.S. Pat. No. 8,241 ,670 or Inti. Pub. No. WO2013110028, each of which is herein incorporated by reference in its entirety.
The LNP engineered to penetrate mucus can comprise a polymeric material (i.e., a polymeric core) and/or a polymer-vitamin conjugate and/or a tri-block co-polymer. The polymeric material can include, but is not limited to, polyamines, polyethers, polyamides, polyesters, polycarbamates, polyureas, polycarbonates, poly(styrenes), polyimides, polysulfones, polyurethanes, polyacetylenes, polyethylenes, polyethyeneimines, polyisocyanates, polyacrylates, polymethacrylates, polyacrylonitriles, and polyarylates.
LNP engineered to penetrate mucus can also include surface altering agents such as, but not limited to, polynucleotides, anionic proteins (e.g., bovine serum albumin), surfactants (e.g., cationic surfactants such as for example dimethyldioctadecyl-ammonium bromide), sugars or sugar derivatives (e.g., cyclodextrin), nucleic acids, polymers (e.g., heparin, polyethylene glycol and poloxamer), mucolytic agents (e.g., N-acetylcysteine, mugwort, bromelain, papain, clerodendrum, acetylcysteine, bromhexine, carbocisteine, eprazinone, mesna, ambroxol, sobrerol, domiodol, letosteine, stepronin, tiopronin, gelsolin, thymosin p4 dornase alfa, neltenexine, erdosteine) and various DNases including rhDNase.
In some embodiments, the mucus penetrating LNP can be a hypotonic formulation comprising a mucosal penetration enhancing coating. The formulation can be hypotonic for the epithelium to which it is being delivered. Non-limiting examples of hypotonic formulations can be found in, e.g., Inti. Pub. No. WO2013110028, herein incorporated by reference in its entirety.
In some embodiments, the polynucleotide described herein is Formulated as a lipoplex, such as, without limitation, the ATUPLEXTM system, the DACC system, the DBTC system and other siRNA-
lipoplex technology from Silence Therapeutics (London, United Kingdom), STEMFECTTM from STEMGENT® (Cambridge, MA), and polyethylenimine (PEI) or protamine-based targeted and nontargeted delivery of nucleic acids (Aleku et al. Cancer Res. 2008 68:9788-9798; Strumberg et al. Int J Clin Pharmacol Ther 2012 50:76-78; Santel et al., Gene Ther 2006 13:1222-1234; Santel et al., Gene Ther 2006 13:1360-1370; Gutbier et al., Pulm Pharmacol. Ther. 2010 23:334-344; Kaufmann et al. Microvasc Res 2010 80:286-293Weide et al. J Immunother. 2009 32:498-507; Weide et al. J Immunother. 2008 31 :180-188; Pascolo Expert Opin. Biol. Ther. 4:1285-1294; Fotin-Mleczek et al., 201 1 J. Immunother. 34:1 -15; Song et al., Nature Biotechnol. 2005, 23:709-717; Peer et al., Proc Natl Acad Sci U S A. 2007 6;104:4095-4100; deFougerolles Hum Gene Ther. 2008 19:125-132; all of which are incorporated herein by reference in its entirety).
In some embodiments, the polynucleotides described herein are Formulated as a solid lipid nanoparticle (SLN), which can be spherical with an average diameter between 10 to 1000 nm. SLN possess a solid lipid core matrix that can solubilize lipophilic molecules and can be stabilized with surfactants and/or emulsifiers. Exemplary SLN can be those as described in Inti. Pub. No. W02013105101 , herein incorporated by reference in its entirety.
In some embodiments, the polynucleotides described herein can be Formulated for controlled release and/or targeted delivery. As used herein, "controlled release" refers to a pharmaceutical composition or compound release profile that conforms to a particular pattern of release to effect a therapeutic outcome. In some embodiments, the polynucleotides can be encapsulated into a delivery agent described herein and/or known in the art for controlled release and/or targeted delivery. As used herein, the term "encapsulate" means to enclose, surround or encase. As it relates to the formulation of the compounds of the present disclosure, encapsulation can be substantial, complete or partial. The term "substantially encapsulated" means that at least greater than 50, 60, 70, 80, 85, 90, 95, 96, 97, 98, 99, or greater than 99% of the pharmaceutical composition or compound of the present disclosure can be enclosed, surrounded or encased within the delivery agent. "Partial encapsulation" or “partially encapsulate” means that less than 10, 10, 20, 30, 40 50 or less of the pharmaceutical composition or compound of the present disclosure can be enclosed, surrounded or encased within the delivery agent.
Advantageously, encapsulation can be determined by measuring the escape or the activity of the pharmaceutical composition or compound of the present disclosure using fluorescence and/or electron micrograph. For example, at least 1 , 5, 10, 20, 30, 40, 50, 60, 70, 80, 85, 90, 95, 96, 97, 98, 99, 99.9, or greater than 99% of the pharmaceutical composition or compound of the present disclosure are encapsulated in the delivery agent.
In some embodiments, the polynucleotides described herein can be encapsulated in a therapeutic nanoparticle, referred to herein as "therapeutic nanoparticle polynucleotides." Therapeutic nanoparticles can be Formulated by methods described in, e.g., Inti. Pub. Nos. WO2010005740, WO2010030763, WO2010005721 , WO2010005723, and WO2012054923; and U.S. Pub. Nos. US201 10262491 , US20100104645, US20100087337, US20100068285, US201 10274759, US20100068286, US20120288541 , US20120140790, US20130123351 and US20130230567; and U.S. Pat. Nos. 8,206,747, 8,293,276, 8,318,208 and 8,318,21 1 , each of which is herein incorporated by reference in its entirety.
In some embodiments, the therapeutic nanoparticle polynucleotide can be Formulated for sustained release. As used herein, "sustained release" refers to a pharmaceutical composition or compound that conforms to a release rate over a specific period of time. The period of time can include, but is not limited to, hours, days, weeks, months and years. As a non-limiting example, the sustained release nanoparticle of the polynucleotides described herein can be Formulated as disclosed in Inti. Pub. No. WO2010075072 and U.S. Pub. Nos. US20100216804, US20110217377, US20120201859 and US20130150295, each of which is herein incorporated by reference in their entirety.
In some embodiments, the therapeutic nanoparticle polynucleotide can be Formulated to be target specific, such as those described in Inti. Pub. Nos. WO2008121949, WO2010005726, WO2010005725, WO2011084521 and WO2011084518; and U.S. Pub. Nos. US20100069426, US20120004293 and US20100104655, each of which is herein incorporated by reference in its entirety.
The LNPs can be prepared using microfluidic mixers or micromixers. Exemplary microfluidic mixers can include, but are not limited to, a slit interdigital micromixer including, but not limited to those manufactured by Microinnova (Allerheiligen bei Wildon, Austria) and/or a staggered herringbone micromixer (SHM) (see Zhigaltsevet al., "Bottom-up design and synthesis of limit size lipid nanoparticle systems with aqueous and triglyceride cores using millisecond microfluidic mixing," Langmuir 28:3633-40 (2012); Belliveau et al., "Microfluidic synthesis of highly potent limit-size lipid nanoparticles for in vivo delivery of siRNA," Molecular Therapy-Nucleic Acids. 1 :e37 (2012); Chen et al., "Rapid discovery of potent siRNA-containing lipid nanoparticles enabled by controlled microfluidic formulation," J. Am. Chem. Soc. 134(16):6948-51 (2012); each of which is herein incorporated by reference in its entirety). Exemplary micromixers include Slit Interdigital Microstructured Mixer (SIMM-V2) or a Standard Slit Interdigital Micro Mixer (SSIMM) or Caterpillar (CPMM) or Impinging-jet (IJMM,) from the Institut fur Mikrotechnik Mainz GmbH, Mainz Germany. In some embodiments, methods of making LNP using SHM further comprise mixing at least two input streams wherein mixing occurs by microstructure-induced chaotic advection (MICA). According to this method, fluid streams flow through channels present in a herringbone pattern causing rotational flow and folding the fluids around each other. This method can also comprise a surface for fluid mixing wherein the surface changes orientations during fluid cycling. Methods of generating LNPs using SHM include those disclosed in U.S. Pub. Nos. US20040262223 and US20120276209, each of which is incorporated herein by reference in their entirety.
In some embodiments, the polynucleotides described herein can be Formulated in lipid nanoparticles using microfluidic technology (see Whitesides, George M., "The Origins and the Future of Microfluidics," Nature 442: 368-373 (2006); and Abraham et al., "Chaotic Mixer for Microchannels," Science 295: 647-651 (2002); each of which is herein incorporated by reference in its entirety). In some embodiments, the polynucleotides can be Formulated in lipid nanoparticles using a micromixer chip such as, but not limited to, those from Harvard Apparatus (Holliston, MA) or Dolomite Microfluidics (Royston, UK). A micromixer chip can be used for rapid mixing of two or more fluid streams with a split and recombine mechanism.
In some embodiments, the polynucleotides described herein can be Formulated in lipid nanoparticles having a diameter from about 1 nm to about 100 nm such as, but not limited to, about 1 nm to about 20 nm, from about 1 nm to about 30 nm, from about 1 nm to about 40 nm, from about 1 nm to about 50 nm, from about 1 nm to about 60 nm, from about 1 nm to about 70 nm, from about 1 nm to
about 80 nm, from about 1 nm to about 90 nm, from about 5 nm to about from 100 nm, from about 5 nm to about 10 nm, about 5 nm to about 20 nm, from about 5 nm to about 30 nm, from about 5 nm to about 40 nm, from about 5 nm to about 50 nm, from about 5 nm to about 60 nm, from about 5 nm to about 70 nm, from about 5 nm to about 80 nm, from about 5 nm to about 90 nm, about 10 to about 20 nm, about 10 to about 30 nm, about 10 to about 40 nm, about 10 to about 50 nm, about 10 to about 60 nm, about 10 to about 70 nm, about 10 to about 80 nm, about 10 to about 90 nm, about 20 to about 30 nm, about 20 to about 40 nm, about 20 to about 50 nm, about 20 to about 60 nm, about 20 to about 70 nm, about 20 to about 80 nm, about 20 to about 90 nm, about 20 to about 100 nm, about 30 to about 40 nm, about 30 to about 50 nm, about 30 to about 60 nm, about 30 to about 70 nm, about 30 to about 80 nm, about 30 to about 90 nm, about 30 to about 100 nm, about 40 to about 50 nm, about 40 to about 60 nm, about 40 to about 70 nm, about 40 to about 80 nm, about 40 to about 90 nm, about 40 to about 100 nm, about 50 to about 60 nm, about 50 to about 70 nm about 50 to about 80 nm, about 50 to about 90 nm, about 50 to about 100 nm, about 60 to about 70 nm, about 60 to about 80 nm, about 60 to about 90 nm, about 60 to about 100 nm, about 70 to about 80 nm, about 70 to about 90 nm, about 70 to about 100 nm, about 80 to about 90 nm, about 80 to about 100 nm and/or about 90 to about 100 nm.
In some embodiments, the lipid nanoparticles can have a diameter from about 10 to 500 nm. In some embodiments, the lipid nanoparticle can have a diameter greater than 100 nm, greater than 150 nm, greater than 200 nm, greater than 250 nm, greater than 300 nm, greater than 350 nm, greater than 400 nm, greater than 450 nm, greater than 500 nm, greater than 550 nm, greater than 600 nm, greater than 650 nm, greater than 700 nm, greater than 750 nm, greater than 800 nm, greater than 850 nm, greater than 900 nm, greater than 950 nm or greater than 1000 nm.
In some embodiments, the polynucleotides can be delivered using smaller LNPs. Such particles can comprise a diameter from below 0.1 pm up to 100 nm such as, but not limited to, less than 0.1 pm, less than 1 .0 pm, less than 5pm, less than 10 pm, less than 15 urn, less than 20 urn, less than 25 urn, less than 30 urn, less than 35 urn, less than 40 urn, less than 50 urn, less than 55 urn, less than 60 urn, less than 65 urn, less than 70 urn, less than 75 urn, less than 80 urn, less than 85 urn, less than 90 urn, less than 95 urn, less than 100 urn, less than 125 urn, less than 150 urn, less than 175 urn, less than 200 urn, less than 225 urn, less than 250 urn, less than 275 urn, less than 300 urn, less than 325 urn, less than 350 urn, less than 375 urn, less than 400 urn, less than 425 urn, less than 450 urn, less than 475 urn, less than 500 urn, less than 525 urn, less than 550 urn, less than 575 urn, less than 600 urn, less than 625 urn, less than 650 urn, less than 675 urn, less than 700 urn, less than 725 urn, less than 750 urn, less than 775 urn, less than 800 urn, less than 825 urn, less than 850 urn, less than 875 urn, less than 900 urn, less than 925 urn, less than 950 urn, or less than 975 urn.
The nanoparticles and microparticles described herein can be geometrically engineered to modulate macrophage and/or the immune response. The geometrically engineered particles can have varied shapes, sizes and/or surface charges to incorporate the polynucleotides described herein for targeted delivery such as, but not limited to, pulmonary delivery (see, e.g., Inti. Pub. No. WO20130821 1 1 , herein incorporated by reference in its entirety). Other physical features the geometrically engineering particles can include, but are not limited to, fenestrations, angled arms, asymmetry and surface roughness, charge that can alter the interactions with cells and tissues.
In some embodiment, the nanoparticles described herein are stealth nanoparticles or targetspecific stealth nanoparticles such as, but not limited to, those described in U.S. Pub. No.
US20130172406, herein incorporated by reference in its entirety. The stealth or target-specific stealth nanoparticles can comprise a polymeric matrix, which can comprise two or more polymers such as, but not limited to, polyethylenes, polycarbonates, polyanhydrides, polyhydroxyacids, polypropylfumerates, polycaprolactones, polyamides, polyacetals, polyethers, polyesters, poly(orthoesters), polycyanoacrylates, polyvinyl alcohols, polyurethanes, polyphosphazenes, polyacrylates, polymethacrylates, polycyanoacrylates, polyureas, polystyrenes, polyamines, polyesters, polyanhydrides, polyethers, polyurethanes, polymethacrylates, polyacrylates, polycyanoacrylates, or combinations thereof.
4. Therapeutic Polypeptides
The polynucleotides described herein may encode a therapeutic polypeptide, such as a polypeptide that, when provided to a subject (e.g., a mammalian subject, such as a human), exerts a beneficial effect, such as the alleviation of one or more symptoms of a disease, diminishment of extent of a disease, stabilized (i.e. , not worsening) state of a disease, delay or slowing of progression of a disease, or amelioration or palliation of a state of a disease. The disease may be one that is associated with a deficiency in an endogenous version of the polypeptide.
In some embodiments, the polypeptide encoded by the open reading frame is a secreted protein, (e.g., a cytokine, a growth factor, an enzyme, an immunomodulator, an antibody or antigen-binding fragment thereof, or a cell-penetrating peptide), an extracellular membrane-bound protein, an intracellular membrane-bound protein, a cytoplasmic protein, a cytoskeletal protein, or a nuclear protein.
In some embodiments, the polypeptide is a protein of the human proteome. For example, the polypeptide may have the amino acid sequence of any one of SEQ ID NOs: 769 to 1392 of PCT/US2013/030062; SEQ ID NOs: 884 to 1611 of PCT/US2013/030068; SEQ ID NOs: 1827 to 3497 of PCT/US2013/030064; SEQ ID NOs: 3858 to 7559 of PCT/US2013/030067; SEQ ID NOs: 4672 to 9187 of PCT/US2013/030066; SEQ ID NOs: 4704 to 9203 of PCT/US2013/030070; SEQ ID NOs: 8144 to 16131 of PCT/US2013/030059; SEQ ID NOs: 8922 to 17687 of PCT/US2013/030060; and SEQ ID NOs: 35608 to 45601 of PCT/US2013/030061 , the disclosures of each of such applications are incorporated herein by reference in their entirety.
In some embodiments, the polypeptide has an amino acid sequence that is at least 70% identical to the amino acid sequence of any one of SEQ ID NOs: 769 to 1392 of PCT/US2013/030062; SEQ ID NOs: 884 to 1611 of PCT/US2013/030068; SEQ ID NOs: 1827 to 3497 of PCT/US2013/030064; SEQ ID NOs: 3858 to 7559 of PCT/US2013/030067; SEQ ID NOs: 4672 to 9187 of PCT/US2013/030066; SEQ ID NOs: 4704 to 9203 of PCT/US2013/030070; SEQ ID NOs: 8144 to 16131 of PCT/US2013/030059; SEQ ID NOs: 8922 to 17687 of PCT/US2013/030060; and SEQ ID NOs: 35608 to 45601 of PCT/US2013/030061.
In some embodiments, the polypeptide has an amino acid sequence that is at least 75% identical to the amino acid sequence of any one of SEQ ID NOs: 769 to 1392 of PCT/US2013/030062; SEQ ID NOs: 884 to 1611 of PCT/US2013/030068; SEQ ID NOs: 1827 to 3497 of PCT/US2013/030064; SEQ ID NOs: 3858 to 7559 of PCT/US2013/030067; SEQ ID NOs: 4672 to 9187 of PCT/US2013/030066; SEQ ID
NOs: 4704 to 9203 of PCT/US2013/030070; SEQ ID NOs: 8144 to 16131 of PCT/US2013/030059; SEQ ID NOs: 8922 to 17687 of PCT/US2013/030060; and SEQ ID NOs: 35608 to 45601 of PCT/US2013/030061 .
In some embodiments, the polypeptide has an amino acid sequence that is at least 80% identical to the amino acid sequence of any one of SEQ ID NOs: 769 to 1392 of PCT/US2013/030062; SEQ ID NOs: 884 to 161 1 of PCT/US2013/030068; SEQ ID NOs: 1827 to 3497 of PCT/US2013/030064; SEQ ID NOs: 3858 to 7559 of PCT/US2013/030067; SEQ ID NOs: 4672 to 9187 of PCT/US2013/030066; SEQ ID NOs: 4704 to 9203 of PCT/US2013/030070; SEQ ID NOs: 8144 to 16131 of PCT/US2013/030059; SEQ ID NOs: 8922 to 17687 of PCT/US2013/030060; and SEQ ID NOs: 35608 to 45601 of PCT/US2013/030061 .
In some embodiments, the polypeptide has an amino acid sequence that is at least 85% identical to the amino acid sequence of any one of SEQ ID NOs: 769 to 1392 of PCT/US2013/030062; SEQ ID NOs: 884 to 161 1 of PCT/US2013/030068; SEQ ID NOs: 1827 to 3497 of PCT/US2013/030064; SEQ ID NOs: 3858 to 7559 of PCT/US2013/030067; SEQ ID NOs: 4672 to 9187 of PCT/US2013/030066; SEQ ID NOs: 4704 to 9203 of PCT/US2013/030070; SEQ ID NOs: 8144 to 16131 of PCT/US2013/030059; SEQ ID NOs: 8922 to 17687 of PCT/US2013/030060; and SEQ ID NOs: 35608 to 45601 of PCT/US2013/030061 .
In some embodiments, the polypeptide has an amino acid sequence that is at least 90% identical to the amino acid sequence of any one of SEQ ID NOs: 769 to 1392 of PCT/US2013/030062; SEQ ID NOs: 884 to 161 1 of PCT/US2013/030068; SEQ ID NOs: 1827 to 3497 of PCT/US2013/030064; SEQ ID NOs: 3858 to 7559 of PCT/US2013/030067; SEQ ID NOs: 4672 to 9187 of PCT/US2013/030066; SEQ ID NOs: 4704 to 9203 of PCT/US2013/030070; SEQ ID NOs: 8144 to 16131 of PCT/US2013/030059; SEQ ID NOs: 8922 to 17687 of PCT/US2013/030060; and SEQ ID NOs: 35608 to 45601 of PCT/US2013/030061 .
In some embodiments, the polypeptide has an amino acid sequence that is at least 95% identical (e.g., 95%, 96%, 97%, 98%, 99%, or 100% identical) to the amino acid sequence of any one of SEQ ID NOs: 769 to 1392 of PCT/US2013/030062; SEQ ID NOs: 884 to 161 1 of PCT/US2013/030068; SEQ ID NOs: 1827 to 3497 of PCT/US2013/030064; SEQ ID NOs: 3858 to 7559 of PCT/US2013/030067; SEQ ID NOs: 4672 to 9187 of PCT/US2013/030066; SEQ ID NOs: 4704 to 9203 of PCT/US2013/030070; SEQ ID NOs: 8144 to 16131 of PCT/US2013/030059; SEQ ID NOs: 8922 to 17687 of PCT/US2013/030060; and SEQ ID NOs: 35608 to 45601 of PCT/US2013/030061 .
In some embodiments, the polypeptide has an amino acid sequence that is at least 96% identical (e.g., 96%, 97%, 98%, 99%, or 100% identical) to the amino acid sequence of any one of SEQ ID NOs: 769 to 1392 of PCT/US2013/030062; SEQ ID NOs: 884 to 161 1 of PCT/US2013/030068; SEQ ID NOs: 1827 to 3497 of PCT/US2013/030064; SEQ ID NOs: 3858 to 7559 of PCT/US2013/030067; SEQ ID NOs: 4672 to 9187 of PCT/US2013/030066; SEQ ID NOs: 4704 to 9203 of PCT/US2013/030070; SEQ ID NOs: 8144 to 16131 of PCT/US2013/030059; SEQ ID NOs: 8922 to 17687 of PCT/US2013/030060; and SEQ ID NOs: 35608 to 45601 of PCT/US2013/030061 .
In some embodiments, the polypeptide has an amino acid sequence that is at least 97% identical (e.g., 97%, 98%, 99%, or 100% identical) to the amino acid sequence of any one of SEQ ID NOs: 769 to 1392 of PCT/US2013/030062; SEQ ID NOs: 884 to 161 1 of PCT/US2013/030068; SEQ ID NOs: 1827 to
3497 of PCT/US2013/030064; SEQ ID NOs: 3858 to 7559 of PCT/US2013/030067; SEQ ID NOs: 4672 to 9187 of PCT/US2013/030066; SEQ ID NOs: 4704 to 9203 of PCT/US2013/030070; SEQ ID NOs: 8144 to 16131 of PCT/US2013/030059; SEQ ID NOs: 8922 to 17687 of PCT/US2013/030060; and SEQ ID NOs: 35608 to 45601 of PCT/US2013/030061 .
In some embodiments, the polypeptide has an amino acid sequence that is at least 98% identical (e.g., 98%, 99%, or 100% identical) to the amino acid sequence of any one of SEQ ID NOs: 769 to 1392 of PCT/US2013/030062; SEQ ID NOs: 884 to 1611 of PCT/US2013/030068; SEQ ID NOs: 1827 to 3497 of PCT/US2013/030064; SEQ ID NOs: 3858 to 7559 of PCT/US2013/030067; SEQ ID NOs: 4672 to 9187 of PCT/US2013/030066; SEQ ID NOs: 4704 to 9203 of PCT/US2013/030070; SEQ ID NOs: 8144 to 16131 of PCT/US2013/030059; SEQ ID NOs: 8922 to 17687 of PCT/US2013/030060; and SEQ ID NOs: 35608 to 45601 of PCT/US2013/030061 .
In some embodiments, the polypeptide has an amino acid sequence that is at least 99% identical (e.g., 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, or 100% identical) to the amino acid sequence of any one of SEQ ID NOs: 769 to 1392 of PCT/US2013/030062; SEQ ID NOs: 884 to 1611 of PCT/US2013/030068; SEQ ID NOs: 1827 to 3497 of PCT/US2013/030064; SEQ ID NOs: 3858 to 7559 of PCT/US2013/030067; SEQ ID NOs: 4672 to 9187 of PCT/US2013/030066; SEQ ID NOs: 4704 to 9203 of PCT/US2013/030070; SEQ ID NOs: 8144 to 16131 of PCT/US2013/030059; SEQ ID NOs: 8922 to 17687 of PCT/US2013/030060; and SEQ ID NOs: 35608 to 45601 of PCT/US2013/030061 .
5. Signal Sequences
The polynucleotides (e.g., a RNA, e.g., an mRNA) of the present disclosure can also comprise nucleotide sequences that encode additional features that facilitate trafficking of the encoded polypeptides to therapeutically relevant sites. One such feature that aids in protein trafficking is the signal sequence, or targeting sequence. The peptides encoded by these signal sequences are known by a variety of names, including targeting peptides, transit peptides, and signal peptides. In some embodiments, the polynucleotide (e.g., a RNA, e.g., an mRNA) comprises a nucleotide sequence (e.g., an ORF) that encodes a signal peptide operably linked to a nucleotide sequence that encodes a polypeptide of interest.
In some embodiments, the "signal sequence" or "signal peptide" is a polynucleotide or polypeptide, respectively, which is from about 30-210, e.g., about 45-80 or 15-60 nucleotides (e.g., about 20, 30, 40, 50, 60, or 70 amino acids) in length that, optionally, is incorporated at the 5' (or N-terminus) of the coding region or the polypeptide, respectively. Addition of these sequences results in trafficking the encoded polypeptide to a desired site, such as the endoplasmic reticulum or the mitochondria through one or more targeting pathways. Some signal peptides are cleaved from the protein, for example by a signal peptidase after the proteins are transported to the desired site.
6. Sequence Optimization of Nucleotide Sequences Encoding a Target Polypeptide
In some embodiments, a polynucleotide (e.g., a RNA, e.g., an mRNA) of the present disclosure is sequence optimized. In some embodiments, the polynucleotide (e.g., a RNA, e.g., an mRNA) of the present disclosure comprises a nucleotide sequence (e.g., an ORF) encoding a therapeutic polypeptide (e.g., a therapeutic polypeptide described above), optionally, a nucleotide sequence (e.g, an ORF)
encoding another polypeptide of interest, a 5'-UTR, a 3'-UTR, the 5' UTR or 3' UTR optionally comprising at least one microRNA binding site, optionally a nucleotide sequence encoding a linker, a polyA tail, or any combination thereof), in which the ORF(s) are sequence optimized.
A sequence-optimized nucleotide sequence, e.g., a codon-optimized RNA sequence encoding a therapeutic polypeptide, is a sequence comprising at least one synonymous nucleobase substitution with respect to a reference sequence (e.g., a wild type nucleotide sequence encoding the therapeutic polypeptide of interest).
A sequence-optimized nucleotide sequence can be partially or completely different in sequence from the reference sequence. For example, a reference sequence encoding polyserine uniformly encoded by UCU codons can be sequence-optimized by having 100% of its nucleobases substituted (for each codon, U in position 1 replaced by A, C in position 2 replaced by G, and U in position 3 replaced by C) to yield a sequence encoding polyserine which would be uniformly encoded by AGO codons. The percentage of sequence identity obtained from a global pairwise alignment between the reference polyserine nucleic acid sequence and the sequence-optimized polyserine nucleic acid sequence would be 0%. However, the protein products from both sequences would be 100% identical.
Some sequence optimization (also sometimes referred to codon optimization) methods are known in the art (and discussed in more detail below) and can be useful to achieve one or more desired results. These results can include, e.g., matching codon frequencies in certain tissue targets and/or host organisms to ensure proper folding; biasing G/C content to increase mRNA stability or reduce secondary structures; minimizing tandem repeat codons or base runs that can impair gene construction or expression; customizing transcriptional and translational control regions; inserting or removing protein trafficking sequences; removing/adding post translation modification sites in an encoded protein (e.g., glycosylation sites); adding, removing or shuffling protein domains; inserting or deleting restriction sites; modifying ribosome binding sites and mRNA degradation sites; adjusting translational rates to allow the various domains of the protein to fold properly; and/or reducing or eliminating problem secondary structures within the polynucleotide. Sequence optimization tools, algorithms and services are known in the art, non-limiting examples include services from GeneArt (Life Technologies), DNA2.0 (Menlo Park CA) and/or proprietary methods.
Codon options for each amino acid are given in Table 6.
Table 6. Codon Options
In some embodiments, a polynucleotide (e.g., a RNA, e.g., an mRNA) of the present disclosure comprises a sequence-optimized nucleotide sequence (e.g., an ORF) encoding a therapeutic polypeptide, a functional fragment, or a variant thereof, wherein the therapeutic polypeptide, functional fragment, or a variant thereof encoded by the sequence-optimized nucleotide sequence has improved properties (e.g., compared to a therapeutic polypeptide, functional fragment, or a variant thereof encoded by a reference nucleotide sequence that is not sequence optimized), e.g., improved properties related to expression efficacy after administration in vivo. Such properties include, but are not limited to, improving nucleic acid stability (e.g., mRNA stability), increasing translation efficacy in the target tissue, reducing the number of truncated proteins expressed, improving the folding or prevent misfolding of the expressed proteins, reducing toxicity of the expressed products, reducing cell death caused by the expressed products, increasing and/or decreasing protein aggregation.
In some embodiments, the sequence-optimized nucleotide sequence (e.g., an ORF) is codon optimized for expression in human subjects, having structural and/or chemical features that avoid one or more of the problems in the art, for example, features which are useful for optimizing formulation and delivery of nucleic acid-based therapeutics while retaining structural and functional integrity; overcoming a threshold of expression; improving expression rates; half-life and/or protein concentrations; optimizing protein localization; and avoiding deleterious bio-responses such as the immune response and/or degradation pathways.
In some embodiments, the polynucleotides of the present disclosure comprise a nucleotide sequence (e.g., a nucleotide sequence (e.g., an ORF) encoding a therapeutic polypeptide, a nucleotide sequence (e.g., an ORF) encoding another polypeptide of interest, a 5'-UTR, a 3'-UTR, a microRNA
binding site, a nucleic acid sequence encoding a linker, or any combination thereof) that is sequence- optimized according to a method comprising:
(i) substituting at least one codon in a reference nucleotide sequence (e.g., an ORF encoding a therapeutic polypeptide) with an alternative codon to increase or decrease uridine content to generate a uridine-modified sequence;
(ii) substituting at least one codon in a reference nucleotide sequence (e.g., an ORF encoding a therapeutic polypeptide) with an alternative codon having a higher codon frequency in the synonymous codon set;
(iii) substituting at least one codon in a reference nucleotide sequence (e.g., an ORF encoding a therapeutic polypeptide) with an alternative codon to increase G/C content; or
(iv) a combination thereof.
In some embodiments, the sequence-optimized nucleotide sequence (e.g., an ORF encoding a therapeutic polypeptide) has at least one improved property with respect to the reference nucleotide sequence.
In some embodiments, the sequence optimization method is multiparametric and comprises one, two, three, four, or more methods disclosed herein and/or other optimization methods known in the art.
Features, which can be considered beneficial in some embodiments of the present disclosure, can be encoded by or within regions of the polynucleotide and such regions can be upstream (5') to, downstream (3') to, or within the region that encodes the therapeutic polypeptide. These regions can be incorporated into the polynucleotide before and/or after sequence-optimization of the protein encoding region or open reading frame (ORF). Examples of such features include, but are not limited to, untranslated regions (UTRs), microRNA sequences, Kozak sequences, oligo(dT) sequences, poly-A tail, and detectable tags and can include multiple cloning sites that can have Xbal recognition.
In some embodiments, the polynucleotide of the present disclosure comprises a 5' UTR, a 3' UTR and/or a microRNA binding site. In some embodiments, the polynucleotide comprises two or more 5' UTRs and/or 3' UTRs, which can be the same or different sequences. In some embodiments, the polynucleotide comprises two or more microRNA binding sites, which can be the same or different sequences. Any portion of the 5' UTR, 3' UTR, and/or microRNA binding site, including none, can be sequence-optimized and can independently contain one or more different structural or chemical modifications, before and/or after sequence optimization.
In some embodiments, after optimization, the polynucleotide is reconstituted and transformed into a vector such as, but not limited to, plasmids, viruses, cosmids, and artificial chromosomes. For example, the optimized polynucleotide can be reconstituted and transformed into chemically competent E. coli, yeast, neurospora, maize, drosophila, etc. where high copy plasmid-like or chromosome structures occur by methods described herein.
7. Sequence-Optimized Nucleotide Sequences Encoding Target Polypeptides
In some embodiments, the polynucleotide of the present disclosure comprises a sequence- optimized nucleotide sequence encoding a therapeutic polypeptide disclosed herein. In some embodiments, the polynucleotide of the present disclosure comprises an open reading frame (ORF) encoding a therapeutic polypeptide, wherein the ORF has been sequence optimized.
The sequence-optimized nucleotide sequences disclosed herein may be distinct from the corresponding wild type nucleotide acid sequences and from other known sequence-optimized nucleotide sequences, e.g., these sequence-optimized nucleic acids have unique compositional characteristics.
In some embodiments, the percentage of uracil or thymine nucleobases in a sequence-optimized nucleotide sequence (e.g., encoding a therapeutic polypeptide, a functional fragment, or a variant thereof) is modified (e.g., reduced) with respect to the percentage of uracil or thymine nucleobases in the reference wild-type nucleotide sequence. Such a sequence is referred to as a uracil-modified or thymine- modified sequence. The percentage of uracil or thymine content in a nucleotide sequence can be determined by dividing the number of uracils or thymines in a sequence by the total number of nucleotides and multiplying by 100. In some embodiments, the sequence-optimized nucleotide sequence has a lower uracil or thymine content than the uracil or thymine content in the reference wild-type sequence. In some embodiments, the uracil or thymine content in a sequence-optimized nucleotide sequence of the present disclosure is greater than the uracil or thymine content in the reference wild-type sequence and still maintain beneficial effects, e.g., increased expression and/or reduced Toll-Like Receptor (TLR) response when compared to the reference wild-type sequence.
Methods for optimizing codon usage are known in the art. For example, an ORF of any one or more of the sequences provided herein may be codon optimized. Codon optimization, in some embodiments, may be used to match codon frequencies in target and host organisms to ensure proper folding; bias GC content to increase mRNA stability or reduce secondary structures; minimize tandem repeat codons or base runs that may impair gene construction or expression; customize transcriptional and translational control regions; insert or remove protein trafficking sequences; remove/add post translation modification sites in encoded protein (e.g., glycosylation sites); add, remove or shuffle protein domains; insert or delete restriction sites; modify ribosome binding sites and mRNA degradation sites; adjust translational rates to allow the various domains of the protein to fold properly; or reduce or eliminate problem secondary structures within the polynucleotide. Codon optimization tools, algorithms and services are known in the art - non-limiting examples include services from GeneArt (Life Technologies), DNA2.0 (Menlo Park CA) and/or proprietary methods. In some embodiments, the open reading frame (ORF) sequence is optimized using optimization algorithms.
8. Characterization of Sequence-Optimized Nucleic Acids
In some embodiments of the present disclosure, the polynucleotide (e.g., a RNA, e.g., an mRNA) comprising a sequence optimized nucleic acid disclosed herein encoding a therapeutic polypeptide can be tested to determine whether at least one nucleic acid sequence property (e.g., stability when exposed to nucleases) or expression property has been improved with respect to the non-sequence optimized nucleic acid.
As used herein, "expression property" refers to a property of a nucleic acid sequence either in vivo (e.g., translation efficacy of a synthetic mRNA after administration to a subject in need thereof) or in vitro (e.g., translation efficacy of a synthetic mRNA tested in an in vitro model system). Expression properties include but are not limited to the amount of protein produced by an mRNA encoding a therapeutic polypeptide after administration, and the amount of soluble or otherwise functional protein produced. In some embodiments, sequence optimized nucleic acids disclosed herein can be evaluated
according to the viability of the cells expressing a protein encoded by a sequence optimized nucleic acid sequence (e.g., a RNA, e.g., an mRNA) encoding a therapeutic polypeptide disclosed herein.
In a given embodiment, a plurality of sequence optimized nucleic acids disclosed herein (e.g., a RNA, e.g., an mRNA) containing codon substitutions with respect to the non-optimized reference nucleic acid sequence can be characterized functionally to measure a property of interest, for example an expression property in an in vitro model system, or in vivo in a target tissue or cell. a. Optimization of Nucleic Acid Sequence Intrinsic Properties
In some embodiments of the present disclosure, the desired property of the polynucleotide is an intrinsic property of the nucleic acid sequence. For example, the nucleotide sequence (e.g., a RNA, e.g., an mRNA) can be sequence optimized for in vivo or in vitro stability. In some embodiments, the nucleotide sequence can be sequence optimized for expression in a given target tissue or cell. In some embodiments, the nucleic acid sequence is sequence optimized to increase its plasma half-life by preventing its degradation by endo and exonucleases.
In other embodiments, the nucleic acid sequence is sequence optimized to increase its resistance to hydrolysis in solution, for example, to lengthen the time that the sequence optimized nucleic acid or a pharmaceutical composition comprising the sequence optimized nucleic acid can be stored under aqueous conditions with minimal degradation.
In other embodiments, the sequence optimized nucleic acid can be optimized to increase its resistance to hydrolysis in dry storage conditions, for example, to lengthen the time that the sequence optimized nucleic acid can be stored after lyophilization with minimal degradation. b. Nucleic Acids Sequence Optimized for Protein Expression
In some embodiments of the present disclosure, the desired property of the polynucleotide is the level of expression of a therapeutic polypeptide encoded by a sequence optimized sequence disclosed herein. Protein expression levels can be measured using one or more expression systems. In some embodiments, expression can be measured in cell culture systems, e.g., CHO cells or HEK293 cells. In some embodiments, expression can be measured using in vitro expression systems prepared from extracts of living cells, e.g., rabbit reticulocyte lysates, or in vitro expression systems prepared by assembly of purified individual components. In other embodiments, the protein expression is measured in an in vivo system, e.g., mouse, rabbit, monkey, etc.
In some embodiments, protein expression in solution form can be desirable. Accordingly, in some embodiments, a reference sequence can be sequence optimized to yield a sequence optimized nucleic acid sequence having optimized levels of expressed proteins in soluble form. Levels of protein expression and other properties such as solubility, levels of aggregation, and the presence of truncation products (i.e., fragments due to proteolysis, hydrolysis, or defective translation) can be measured according to methods known in the art, for example, using electrophoresis (e.g., native or SDS-PAGE) or chromatographic methods (e.g., HPLC, size exclusion chromatography, etc.).
c. Optimization of Target Tissue or Target Cell Viability
In some embodiments, the expression of heterologous therapeutic proteins encoded by a nucleic acid sequence can have deleterious effects in the target tissue or cell, reducing protein yield, or reducing the quality of the expressed product (e.g., due to the presence of protein fragments or precipitation of the expressed protein in inclusion bodies), or causing toxicity.
Accordingly, in some embodiments of the present disclosure, the sequence optimization of a nucleic acid sequence disclosed herein, e.g., a nucleic acid sequence encoding a therapeutic polypeptide, can be used to increase the viability of target cells expressing the protein encoded by the sequence optimized nucleic acid.
Heterologous protein expression can also be deleterious to cells transfected with a nucleic acid sequence for autologous or heterologous transplantation. Accordingly, in some embodiments of the present disclosure the sequence optimization of a nucleic acid sequence disclosed herein can be used to increase the viability of target cells expressing the protein encoded by the sequence optimized nucleic acid sequence. Changes in cell or tissue viability, toxicity, and other physiological reactions can be measured according to methods known in the art. d. Reduction of Immune and/or Inflammatory Response
In some cases, the administration of a sequence optimized nucleic acid encoding a therapeutic polypeptide or a functional fragment thereof can trigger an immune response, which could be caused by (i) the therapeutic agent (e.g., an mRNA encoding a therapeutic polypeptide), or (ii) the expression product of such therapeutic agent (e.g., the therapeutic polypeptide encoded by the mRNA), or (iv) a combination thereof. Accordingly, in some embodiments of the present disclosure the sequence optimization of nucleic acid sequence (e.g., an mRNA) disclosed herein can be used to decrease an immune or inflammatory response triggered by the administration of a nucleic acid encoding a therapeutic polypeptide or by the expression product of a therapeutic polypeptide encoded by such nucleic acid.
In some cases, an inflammatory response can be measured by detecting increased levels of one or more inflammatory cytokines using methods known in the art, e.g., ELISA. The term "inflammatory cytokine" refers to cytokines that are elevated in an inflammatory response. Examples of inflammatory cytokines include interleukin-6 (IL-6), CXCL1 (chemokine (C-X-C motif) ligand 1 ; interferon-y (IFNy), tumor necrosis factor a (TNFa), interferon y-induced protein 10 (IP-10), or granulocyte-colony stimulating factor (G-CSF). The term inflammatory cytokines includes also other cytokines associated with inflammatory responses known in the art, e.g., interleukin-1 (IL-1 ), interleukin-8 (IL-8), interleukin-12 (IL- 12), interleukin-13 (11-13), interferon a (IFN-a), etc.
9. Modified Nucleotide Sequences Encoding Target Polypeptides
In some embodiments, the polynucleotide (e.g., a RNA, e.g., an mRNA) of the present disclosure comprises a chemically modified nucleobase, for example, a chemically modified uracil, e.g., pseudouracil, N1 -methylpseudouracil, 5-methoxyuracil, or the like. In some embodiments, the mRNA is a uracil-modified sequence comprising an ORF encoding a therapeutic polypeptide, wherein the mRNA comprises a chemically modified nucleobase, for example, a chemically modified uracil, e.g., pseudouracil, N1 -methylpseudouracil, or 5-methoxyuracil.
In certain aspects of the present disclosure, when the modified uracil base is connected to a ribose sugar, as it is in polynucleotides, the resulting modified nucleoside or nucleotide is referred to as modified uridine. In some embodiments, uracil in the polynucleotide is at least about 25%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least 90%, at least 95%, at least 99%, or about 100% modified uracil. In some embodiments, uracil in the polynucleotide is at least 95% modified uracil. In some embodiments, uracil in the polynucleotide is 100% modified uracil.
In embodiments where uracil in the polynucleotide is at least 95% modified uracil overall uracil content can be adjusted such that an mRNA provides suitable protein expression levels while inducing little to no immune response. In some embodiments, the uracil content of the ORF is between about 100% and about 150%, between about 100% and about 110%, between about 105% and about 115%, between about 110% and about 120%, between about 115% and about 125%, between about 120% and about 130%, between about 125% and about 135%, between about 130% and about 140%, between about 135% and about 145%, between about 140% and about 150% of the theoretical minimum uracil content in the corresponding wild-type ORF (%UTM). In other embodiments, the uracil content of the ORF is between about 121% and about 136% or between 123% and 134% of the %UTM. In some embodiments, the uracil content of the ORF encoding a therapeutic polypeptide is about 115%, about 120%, about 125%, about 130%, about 135%, about 140%, about 145%, or about 150% of the %UTM. In this context, the term "uracil" can refer to modified uracil and/or naturally occurring uracil.
In some embodiments, the uracil content in the ORF of the mRNA encoding a therapeutic polypeptide of the present disclosure is less than about 30%, about 25%, about 20%, about 15%, or about 10% of the total nucleobase content in the ORF. In some embodiments, the uracil content in the ORF is between about 10% and about 20% of the total nucleobase content in the ORF. In other embodiments, the uracil content in the ORF is between about 10% and about 25% of the total nucleobase content in the ORF. In some embodiments, the uracil content in the ORF of the mRNA encoding a therapeutic polypeptide is less than about 20% of the total nucleobase content in the open reading frame. In this context, the term "uracil" can refer to modified uracil and/or naturally occurring uracil.
In further embodiments, the ORF of the mRNA encoding a therapeutic polypeptide having modified uracil and adjusted uracil content has increased Cytosine (C), Guanine (G), or Guanine/Cytosine (G/C) content (absolute or relative). In some embodiments, the overall increase in C, G, or G/C content (absolute or relative) of the ORF is at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 6%, at least about 7%, at least about 10%, at least about 15%, at least about 20%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, or at least about 100% relative to the G/C content (absolute or relative) of the wild-type ORF. In some embodiments, the G, the C, or the G/C content in the ORF is less than about 100%, less than about 90%, less than about 85%, or less than about 80% of the theoretical maximum G, C, or G/C content of the corresponding wild type nucleotide sequence encoding the therapeutic polypeptide (%GTMX; %CTMX, or %G/CTMX). In some embodiments, the increases in G and/or C content (absolute or relative) described herein can be conducted by replacing synonymous codons with low G, C, or G/C content with synonymous codons having higher G, C, or G/C content. In other embodiments, the
increase in G and/or C content (absolute or relative) is conducted by replacing a codon ending with U with a synonymous codon ending with G or C.
In further embodiments, the ORF of the mRNA encoding a therapeutic polypeptide of the present disclosure comprises modified uracil and has an adjusted uracil content containing less uracil pairs (UU) and/or uracil triplets (UUU) and/or uracil quadruplets (UUUU) than the corresponding wild-type nucleotide sequence encoding the therapeutic polypeptide. In some embodiments, the ORF of the mRNA encoding a therapeutic polypeptide of the present disclosure contains no uracil pairs and/or uracil triplets and/or uracil quadruplets. In some embodiments, uracil pairs and/or uracil triplets and/or uracil quadruplets are reduced below a certain threshold, e.g., no more than 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 occurrences in the ORF of the mRNA encoding the therapeutic polypeptide. In a particular embodiment, the ORF of the mRNA encoding the therapeutic polypeptide of the present disclosure contains less than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11 , 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nonphenylalanine uracil pairs and/or triplets. In some embodiments, the ORF of the mRNA encoding the therapeutic polypeptide contains no non-phenylalanine uracil pairs and/or triplets.
In further embodiments, the ORF of the mRNA encoding a therapeutic polypeptide of the present disclosure comprises modified uracil and has an adjusted uracil content containing less uracil-rich clusters than the corresponding wild-type nucleotide sequence encoding the therapeutic polypeptide. In some embodiments, the ORF of the mRNA encoding the therapeutic polypeptide of the present disclosure contains uracil-rich clusters that are shorter in length than corresponding uracil-rich clusters in the corresponding wild-type nucleotide sequence encoding the therapeutic polypeptide.
In further embodiments, alternative lower frequency codons are employed. At least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 99%, or 100% of the codons in the therapeutic polypeptide-encoding ORF of the modified uracil-comprising mRNA are substituted with alternative codons, each alternative codon having a codon frequency lower than the codon frequency of the substituted codon in the synonymous codon set. The ORF also has adjusted uracil content, as described above. In some embodiments, at least one codon in the ORF of the mRNA encoding the therapeutic polypeptide is substituted with an alternative codon having a codon frequency lower than the codon frequency of the substituted codon in the synonymous codon set.
In some embodiments, the adjusted uracil content, therapeutic polypeptide-encoding ORF of the modified uracil-comprising mRNA exhibits expression levels of therapeutic polypeptide when administered to a mammalian cell that are higher than expression levels of therapeutic polypeptide from the corresponding wild-type mRNA. In some embodiments, the mammalian cell is a mouse cell, a rat cell, or a rabbit cell. In other embodiments, the mammalian cell is a monkey cell or a human cell. In some embodiments, the human cell is a HeLa cell, a BJ fibroblast cell, or a peripheral blood mononuclear cell (PBMC). In some embodiments, a therapeutic polypeptide of the disclosure is expressed at a level higher than expression levels of the same polypeptide from the corresponding wild-type mRNA when the mRNA is administered to a mammalian cell in vivo. In some embodiments, the mRNA is administered to mice, rabbits, rats, monkeys, or humans. In some embodiments, mice are null mice. In some
embodiments, the mRNA is administered to mice in an amount of about 0.01 mg/kg, about 0.05 mg/kg, about 0.1 mg/kg, or 0.2 mg/kg or about 0.5 mg/kg. In some embodiments, the mRNA is administered intravenously or intramuscularly. In other embodiments, the therapeutic polypeptide is expressed when the mRNA is administered to a mammalian cell in vitro. In some embodiments, the expression is increased by at least about 2-fold, at least about 5-fold, at least about 10-fold, at least about 50-fold, at least about 500-fold, at least about 1500-fold, or at least about 3000-fold. In other embodiments, the expression is increased by at least about 10%, about 20%, about 30%, about 40%, about 50%, 60%, about 70%, about 80%, about 90%, or about 100%.
In some embodiments, adjusted uracil content, therapeutic polypeptide-encoding ORF of the modified uracil-comprising mRNA exhibits increased stability. In some embodiments, the mRNA exhibits increased stability in a cell relative to the stability of a corresponding wild-type mRNA under the same conditions. In some embodiments, the mRNA exhibits increased stability including resistance to nucleases, thermal stability, and/or increased stabilization of secondary structure. In some embodiments, increased stability exhibited by the mRNA is measured by determining the half-life of the mRNA (e.g., in a plasma, serum, cell, or tissue sample) and/or determining the area under the curve (AUC) of the protein expression by the mRNA over time (e.g., in vitro or in vivo). An mRNA is identified as having increased stability if the half-life and/or the AUC is greater than the half-life and/or the AUC of a corresponding wildtype mRNA under the same conditions.
In some embodiments, the mRNA of the present disclosure induces a detectably lower immune response (e.g., innate or acquired) relative to the immune response induced by a corresponding wild-type mRNA under the same conditions. In other embodiments, the mRNA of the present disclosure induces a detectably lower immune response (e.g., innate or acquired) relative to the immune response induced by an mRNA that encodes for a therapeutic polypeptide but does not comprise modified uracil under the same conditions, or relative to the immune response induced by an mRNA that encodes for a therapeutic polypeptide and that comprises modified uracil but that does not have adjusted uracil content under the same conditions. The innate immune response can be manifested by increased expression of pro- inflammatory cytokines, activation of intracellular PRRs (RIG-I, MDA5, etc.), cell death, and/or termination or reduction in protein translation. In some embodiments, a reduction in the innate immune response can be measured by expression or activity level of Type 1 interferons (e.g., IFN-a, IFN-p, IFN-K, IFN-b, IFN-E, IFN-T, IFN-W, and IFN-ζ) or the expression of interferon-regulated genes such as the toll-like receptors (e.g., TLR7 and TLR8), and/or by decreased cell death following one or more administrations of the mRNA of the present disclosure into a cell.
In some embodiments, the expression of Type-1 interferons by a mammalian cell in response to the mRNA of the present disclosure is reduced by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 99.9%, or greater than 99.9% relative to a corresponding wild-type mRNA, to an mRNA that encodes a therapeutic polypeptide but does not comprise modified uracil, or to an mRNA that encodes a therapeutic polypeptide and that comprises modified uracil but that does not have adjusted uracil content. In some embodiments, the interferon is IFN-p. In some embodiments, cell death frequency caused by administration of mRNA of the present disclosure to a mammalian cell is 10%, 25%, 50%, 75%, 85%, 90%, 95%, or over 95% less than the cell death frequency observed with a corresponding wild-type mRNA, an mRNA that encodes for a therapeutic polypeptide but does not
comprise modified uracil, or an mRNA that encodes for a therapeutic polypeptide and that comprises modified uracil but that does not have adjusted uracil content. In some embodiments, the mammalian cell is a BJ fibroblast cell. In other embodiments, the mammalian cell is a splenocyte. In some embodiments, the mammalian cell is that of a mouse or a rat. In other embodiments, the mammalian cell is that of a human. In some embodiments, the mRNA of the present disclosure does not substantially induce an innate immune response of a mammalian cell into which the mRNA is introduced.
10. Methods for Modifying Polynucleotides
The disclosure includes modified polynucleotides comprising a polynucleotide described herein (e.g., a polynucleotide, e.g. mRNA, comprising a nucleotide sequence encoding a therapeutic polypeptide). The modified polynucleotides can be chemically modified and/or structurally modified. When the polynucleotides of the present disclosure are chemically and/or structurally modified the polynucleotides can be referred to as "modified polynucleotides."
The present disclosure provides for modified nucleosides and nucleotides of a polynucleotide (e.g., RNA polynucleotides, such as mRNA polynucleotides) encoding a therapeutic polypeptide. A "nucleoside" refers to a compound containing a sugar molecule (e.g., a pentose or ribose) or a derivative thereof in combination with an organic base (e.g., a purine or pyrimidine) or a derivative thereof (also referred to herein as "nucleobase"). A “nucleotide" refers to a nucleoside including a phosphate group. Modified nucleotides can be synthesized by any useful method, such as, for example, chemically, enzymatically, or recombinantly, to include one or more modified or non-natural nucleosides. Polynucleotides can comprise a region or regions of linked nucleosides. Such regions can have variable backbone linkages. The linkages can be standard phosphodiester linkages, in which case the polynucleotides would comprise regions of nucleotides.
The modified polynucleotides disclosed herein can comprise various distinct modifications. In some embodiments, the modified polynucleotides contain one, two, or more (optionally different) nucleoside or nucleotide modifications. In some embodiments, a modified polynucleotide, introduced to a cell can exhibit one or more desirable properties, e.g., improved protein expression, reduced immunogenicity, or reduced degradation in the cell, as compared to an unmodified polynucleotide.
In some embodiments, a polynucleotide of the present disclosure (e.g., a polynucleotide comprising a nucleotide sequence encoding a therapeutic polypeptide) is structurally modified. As used herein, a "structural" modification is one in which two or more linked nucleosides are inserted, deleted, duplicated, inverted or randomized in a polynucleotide without significant chemical modification to the nucleotides themselves. Because chemical bonds will necessarily be broken and reformed to effect a structural modification, structural modifications are of a chemical nature and hence are chemical modifications. However, structural modifications will result in a different sequence of nucleotides. For example, the polynucleotide "ATCG" can be chemically modified to "AT-5meC-G". The same polynucleotide can be structurally modified from "ATCG" to "ATCCCG". Here, the dinucleotide "CC" has been inserted, resulting in a structural modification to the polynucleotide.
Therapeutic compositions of the present disclosure comprise, in some embodiments, at least one nucleic acid (e.g., RNA) having an open reading frame encoding a therapeutic polypeptide, a fragment thereof, or a variant thereof, wherein the nucleic acid comprises nucleotides and/or nucleosides that can
be standard (unmodified) or modified as is known in the art. In some embodiments, nucleotides and nucleosides of the present disclosure comprise modified nucleotides or nucleosides. Such modified nucleotides and nucleosides can be naturally-occurring modified nucleotides and nucleosides or non- naturally occurring modified nucleotides and nucleosides. Such modifications can include those at the sugar, backbone, or nucleobase portion of the nucleotide and/or nucleoside as are recognized in the art.
In some embodiments, a naturally-occurring modified nucleotide or nucleotide of the disclosure is one as is generally known or recognized in the art. Non-limiting examples of such naturally occurring modified nucleotides and nucleotides can be found, inter alia, in the widely recognized MODOMICS database.
In some embodiments, a non-naturally occurring modified nucleotide or nucleoside of the disclosure is one as is generally known or recognized in the art. Non-limiting examples of such non- naturally occurring modified nucleotides and nucleosides can be found, inter alia, in published US Application Nos. PCT/US2012/058519; PCT/US2013/075177; PCT/US2014/058897;
PCT/US2014/058891 ; PCT/US2014/070413; PCT/US2015/36773; PCT/US2015/36759;
PCT/US2015/36771 ; or PCT/IB2017/051367 all of which are incorporated by reference herein.
In some embodiments, at least one RNA (e.g., mRNA) of the present disclosure is not chemically modified and comprises the standard ribonucleotides consisting of adenosine, guanosine, cytosine and uridine. In some embodiments, nucleotides and nucleosides of the present disclosure comprise standard nucleoside residues such as those present in transcribed RNA (e.g. A, G, C, or U). In some embodiments, nucleotides and nucleosides of the present disclosure comprise standard deoxyribonucleosides such as those present in DNA (e.g. dA, dG, dC, or dT).
Hence, nucleic acids of the disclosure (e.g., DNA nucleic acids and RNA nucleic acids, such as mRNA nucleic acids) can comprise standard nucleotides and nucleosides, naturally-occurring nucleotides and nucleosides, non-naturally-occurring nucleotides and nucleosides, or any combination thereof.
Nucleic acids of the disclosure (e.g., DNA nucleic acids and RNA nucleic acids, such as mRNA nucleic acids), in some embodiments, comprise various (more than one) different types of standard and/or modified nucleotides and nucleosides. In some embodiments, a particular region of a nucleic acid contains one, two or more (optionally different) types of standard and/or modified nucleotides and nucleosides.
In some embodiments, a modified RNA nucleic acid (e.g., a modified mRNA nucleic acid), introduced to a cell or organism, exhibits reduced degradation in the cell or organism, respectively, relative to an unmodified nucleic acid comprising standard nucleotides and nucleosides.
In some embodiments, a modified RNA nucleic acid (e.g., a modified mRNA nucleic acid), introduced into a cell or organism, may exhibit reduced immunogenicity in the cell or organism, respectively (e.g., a reduced innate response) relative to an unmodified nucleic acid comprising standard nucleotides and nucleosides.
Nucleic acids (e.g., RNA nucleic acids, such as mRNA nucleic acids), in some embodiments, comprise non-natural modified nucleotides that are introduced during synthesis or post-synthesis of the nucleic acids to achieve desired functions or properties. The modifications may be present on internucleoside linkages, purine or pyrimidine bases, or sugars. The modification may be introduced with
chemical synthesis or with a polymerase enzyme at the terminal of a chain or anywhere else in the chain. Any of the regions of a nucleic acid may be chemically modified.
The present disclosure provides for modified nucleosides and nucleotides of a nucleic acid (e.g., RNA nucleic acids, such as mRNA nucleic acids). A “nucleoside” refers to a compound containing a sugar molecule (e.g., a pentose or ribose) or a derivative thereof in combination with an organic base (e.g., a purine or pyrimidine) or a derivative thereof (also referred to herein as “nucleobase”). A “nucleotide” refers to a nucleoside, including a phosphate group. Modified nucleotides may by synthesized by any useful method, such as, for example, chemically, enzymatically, or recombinantly, to include one or more modified or non-natural nucleosides. Nucleic acids can comprise a region or regions of linked nucleosides. Such regions may have variable backbone linkages. The linkages can be standard phosphodiester linkages, in which case the nucleic acids would comprise regions of nucleotides.
Modified nucleotide base pairing encompasses not only the standard adenosine-thymine, adenosine-uracil, or guanosine-cytosine base pairs, but also base pairs formed between nucleotides and/or modified nucleotides comprising non-standard or modified bases, wherein the arrangement of hydrogen bond donors and hydrogen bond acceptors permits hydrogen bonding between a non-standard base and a standard base or between two complementary non-standard base structures, such as, for example, in those nucleic acids having at least one chemical modification. One example of such nonstandard base pairing is the base pairing between the modified nucleotide inosine and adenine, cytosine or uracil. Any combination of base/sugar or linker may be incorporated into nucleic acids of the present disclosure.
In some embodiments, modified nucleobases in nucleic acids (e.g., RNA nucleic acids, such as mRNA nucleic acids) comprise N1 -methyl-pseudouridine (m1 ip), 1 -ethyl-pseudouridine (e1 ip), 5-methoxy- uridine (mo5U), 5-methyl-cytidine (m5C), and/or pseudouridine (ip). In some embodiments, modified nucleobases in nucleic acids (e.g., RNA nucleic acids, such as mRNA nucleic acids) comprise 5- methoxymethyl uridine, 5-methylthio uridine, 1 -methoxymethyl pseudouridine, 5-methyl cytidine, and/or 5- methoxy cytidine. In some embodiments, the polyribonucleotide includes a combination of at least two (e.g., 2, 3, 4 or more) of any of the aforementioned modified nucleobases, including but not limited to chemical modifications.
In some embodiments, a RNA nucleic acid of the disclosure comprises N1 -methyl-pseudouridine (ml ip) substitutions at one or more or all uridine positions of the nucleic acid.
In some embodiments, a RNA nucleic acid of the disclosure comprises N1 -methyl-pseudouridine (ml ip) substitutions at one or more or all uridine positions of the nucleic acid and 5-methyl cytidine substitutions at one or more or all cytidine positions of the nucleic acid.
In some embodiments, a RNA nucleic acid of the disclosure comprises pseudouridine (ip) substitutions at one or more or all uridine positions of the nucleic acid.
In some embodiments, a RNA nucleic acid of the disclosure comprises pseudouridine (ip) substitutions at one or more or all uridine positions of the nucleic acid and 5-methyl cytidine substitutions at one or more or all cytidine positions of the nucleic acid.
In some embodiments, a RNA nucleic acid of the disclosure comprises uridine at one or more or all uridine positions of the nucleic acid.
In some embodiments, nucleic acids (e.g., RNA nucleic acids, such as mRNA nucleic acids) are uniformly modified (e.g., fully modified, modified throughout the entire sequence) for a particular modification. For example, a nucleic acid can be uniformly modified with N1 -methyl-pseudouridine, meaning that all uridine residues in the mRNA sequence are replaced with N1 -methyl-pseudouridine. Similarly, a nucleic acid can be uniformly modified for any type of nucleoside residue present in the sequence by replacement with a modified residue such as those set forth above.
The nucleic acids of the present disclosure may be partially or fully modified along the entire length of the molecule. For example, one or more or all or a given type of nucleotide (e.g., purine or pyrimidine, or any one or more or all of A, G, U, C) may be uniformly modified in a nucleic acid of the disclosure, or in a predetermined sequence region thereof (e.g., in the mRNA including or excluding the polyA tail). In some embodiments, all nucleotides X in a nucleic acid of the present disclosure (or in a sequence region thereof) are modified nucleotides, wherein X may be any one of nucleotides A, G, U, C, or any one of the combinations A+G, A+U, A+C, G+U, G+C, U+C, A+G+U, A+G+C, G+U+C or A+G+C.
The nucleic acid may contain from about 1 % to about 100% modified nucleotides (either in relation to overall nucleotide content, or in relation to one or more types of nucleotide, i.e., any one or more of A, G, U or C) or any intervening percentage (e.g., from 1 % to 20%, from 1 % to 25%, from 1 % to 50%, from 1 % to 60%, from 1 % to 70%, from 1 % to 80%, from 1 % to 90%, from 1 % to 95%, from 10% to 20%, from 10% to 25%, from 10% to 50%, from 10% to 60%, from 10% to 70%, from 10% to 80%, from 10% to 90%, from 10% to 95%, from 10% to 100%, from 20% to 25%, from 20% to 50%, from 20% to 60%, from 20% to 70%, from 20% to 80%, from 20% to 90%, from 20% to 95%, from 20% to 100%, from 50% to 60%, from 50% to 70%, from 50% to 80%, from 50% to 90%, from 50% to 95%, from 50% to 100%, from 70% to 80%, from 70% to 90%, from 70% to 95%, from 70% to 100%, from 80% to 90%, from 80% to 95%, from 80% to 100%, from 90% to 95%, from 90% to 100%, and from 95% to 100%). It will be understood that any remaining percentage is accounted for by the presence of unmodified A, G, U, or C.
The nucleic acids may contain at a minimum 1 % and at maximum 100% modified nucleotides, or any intervening percentage, such as at least 5% modified nucleotides, at least 10% modified nucleotides, at least 25% modified nucleotides, at least 50% modified nucleotides, at least 80% modified nucleotides, or at least 90% modified nucleotides. For example, the nucleic acids may contain a modified pyrimidine such as a modified uracil or cytosine. In some embodiments, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90% or 100% of the uracil in the nucleic acid is replaced with a modified uracil (e.g., a 5-substituted uracil). The modified uracil can be replaced by a compound having a single unique structure, or can be replaced by a plurality of compounds having different structures (e.g., 2, 3, 4 or more unique structures). In some embodiments, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90% or 100% of the cytosine in the nucleic acid is replaced with a modified cytosine (e.g., a 5-substituted cytosine). The modified cytosine can be replaced by a compound having a single unique structure, or can be replaced by a plurality of compounds having different structures (e.g., 2, 3, 4 or more unique structures).
11. Untranslated Regions
Untranslated regions (UTRs) are nucleic acid sections of a polynucleotide before a start codon (5' UTR) and after a stop codon (3' UTR) that are not translated. In some embodiments, a polynucleotide (e.g., a ribonucleic acid (RNA), e.g., a messenger RNA (mRNA)) of the present disclosure comprising an open reading frame (ORF) encoding a therapeutic polypeptide further comprises a UTR (e.g., a 5' UTR or functional fragment thereof, a 3' UTR or functional fragment thereof, or a combination thereof).
A UTR (e.g., 5' UTR or 3' UTR) can be homologous or heterologous to the coding region in a polynucleotide. In some embodiments, the UTR is homologous to the ORF encoding the therapeutic polypeptide. In some embodiments, the UTR is heterologous to the ORF encoding the therapeutic polypeptide.
In some embodiments, the polynucleotide comprises two or more 5' UTRs or functional fragments thereof, each of which has the same or different nucleotide sequences. In some embodiments, the polynucleotide comprises two or more 3' UTRs or functional fragments thereof, each of which has the same or different nucleotide sequences.
In some embodiments, the 5' UTR or functional fragment thereof, 3' UTR or functional fragment thereof, or any combination thereof is sequence optimized.
In some embodiments, the 5'UTR or functional fragment thereof, 3' UTR or functional fragment thereof, or any combination thereof comprises at least one chemically modified nucleobase, e.g., N1 -methylpseudouracil or 5-methoxyuracil.
UTRs can have features that provide a regulatory role, e.g., increased or decreased stability, localization and/or translation efficiency. A polynucleotide comprising a UTR can be administered to a cell, tissue, or organism, and one or more regulatory features can be measured using routine methods. In some embodiments, a functional fragment of a 5' UTR or 3' UTR comprises one or more regulatory features of a full length 5' or 3' UTR, respectively.
Natural 5' UTRs bear features that play roles in translation initiation. They harbor signatures like Kozak sequences that are commonly known to be involved in the process by which the ribosome initiates translation of many genes. Kozak sequences have the consensus CCR(A/G)CCAUGG (SEQ ID NO: 5), where R is a purine (adenine or guanine) three bases upstream of the start codon (AUG), which is followed by another ‘G’. 5' UTRs also have been known to form secondary structures that are involved in elongation factor binding.
By engineering the features typically found in abundantly expressed genes of specific target organs, one can enhance the stability and protein production of a polynucleotide. For example, introduction of 5' UTR of liver-expressed mRNA, such as albumin, serum amyloid A, Apolipoprotein A/B/E, transferrin, alpha fetoprotein, erythropoietin, or Factor VIII, can enhance expression of polynucleotides in hepatic cell lines or liver. Likewise, use of 5'UTR from other tissue-specific mRNA to improve expression in that tissue is possible for muscle (e.g., MyoD, Myosin, Myoglobin, Myogenin, Herculin), for endothelial cells (e.g., Tie-1 , CD36), for myeloid cells (e.g., C/EBP, AML1 , G-CSF, GM- CSF, CD11 b, MSR, Fr-1 , i-NOS), for leukocytes (e.g., CD45, CD18), for adipose tissue (e.g., CD36, GLUT4, ACRP30, adiponectin) and for lung epithelial cells (e.g., SP-A/B/C/D).
In some embodiments, UTRs are selected from a family of transcripts whose proteins share a common function, structure, feature, or property. For example, an encoded polypeptide can belong to a
family of proteins (i.e., that share at least one function, structure, feature, localization, origin, or expression pattern), which are expressed in a particular cell, tissue or at some time during development. The UTRs from any of the genes or mRNA can be swapped for any other UTR of the same or different family of proteins to create a new polynucleotide.
In some embodiments, the 5' UTR and the 3' UTR can be heterologous. In some embodiments, the 5' UTR can be derived from a different species than the 3' UTR. In some embodiments, the 3' UTR can be derived from a different species than the 5' UTR.
Co-owned International Patent Application No. PCT/US2014/021522 (Publ. No.
WO/2014/164253, incorporated herein by reference in its entirety) provides a listing of exemplary UTRs that can be utilized in the polynucleotide of the present disclosure as flanking regions to an ORF.
Additional exemplary UTRs of the application include, but are not limited to, one or more 5'UTR and/or 3'UTR derived from the nucleic acid sequence of: a globin, such as an a- or p-globin (e.g., a Xenopus, mouse, rabbit, or human globin); a strong Kozak translational initiation signal; a CYBA (e.g., human cytochrome b-245 a polypeptide); an albumin (e.g., human albumin?); a HSD17B4 (hydroxysteroid (17-p) dehydrogenase); a virus (e.g., a tobacco etch virus (TEV), a Venezuelan equine encephalitis virus (VEEV), a Dengue virus, a cytomegalovirus (CMV) (e.g., CMV immediate early 1 (IE1 )), a hepatitis virus (e.g., hepatitis B virus), a sindbis virus, or a PAV barley yellow dwarf virus); a heat shock protein (e.g., hsp70); a translation initiation factor (e.g., elF4G); a glucose transporter (e.g., hGLUTI (human glucose transporter 1 )); an actin (e.g., human a or p actin); a GAPDH; a tubulin; a histone; a citric acid cycle enzyme; a topoisomerase (e.g., a 5'UTR of a TOP gene lacking the 5' TOP motif (the oligopyrimidine tract)); a ribosomal protein Large 32 (L32); a ribosomal protein (e.g., human or mouse ribosomal protein, such as, for example, rps9); an ATP synthase (e.g., ATP5A1 or the p subunit of mitochondrial H+-ATP synthase); a growth hormone (e.g., bovine (bGH) or human (hGH)); an elongation factor (e.g., elongation factor 1 a1 (EEF1 A1 )); a manganese superoxide dismutase (MnSOD); a myocyte enhancer factor 2A (MEF2A); a p-F1 -ATPase, a creatine kinase, a myoglobin, a granulocyte-colony stimulating factor (G-CSF); a collagen (e.g., collagen type I, alpha 2 (Coll A2), collagen type I, alpha 1 (Coll A1 ), collagen type VI, alpha 2 (Col6A2), collagen type VI, alpha 1 (Col6A1 )); a ribophorin (e.g., ribophorin I (RPNI)); a low density lipoprotein receptor-related protein (e.g., LRP1 ); a cardiotrophin-like cytokine factor (e.g., Nnt1 ); calreticulin (Calr); a procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1 (Plodl ); and a nucleobindin (e.g., Nucbl ).
In some embodiments, the 5' UTR is selected from the group consisting of a p-globin 5' UTR; a 5'UTR containing a strong Kozak translational initiation signal; a cytochrome b-245 a polypeptide (CYBA) 5' UTR; a hydroxysteroid (17-p) dehydrogenase (HSD17B4) 5' UTR; a Tobacco etch virus (TEV) 5' UTR; a Venezuelen equine encephalitis virus (TEEV) 5' UTR; a 5' proximal open reading frame of rubella virus (RV) RNA encoding nonstructural proteins; a Dengue virus (DEN) 5' UTR; a heat shock protein 70 (Hsp70) 5' UTR; a elF4G 5' UTR; a GLUT1 5' UTR; functional fragments thereof and any combination thereof.
In some embodiments, the 3' UTR is selected from the group consisting of a p-globin 3' UTR; a CYBA 3' UTR; an albumin 3' UTR; a growth hormone (GH) 3' UTR; a VEEV 3' UTR; a hepatitis B virus (HBV) 3' UTR; a-globin 3'UTR; a DEN 3' UTR; a PAV barley yellow dwarf virus (BYDV-PAV) 3' UTR; an elongation factor 1 a1 (EEF1A1 ) 3' UTR; a manganese superoxide dismutase (MnSOD) 3' UTR; a p
subunit of mitochondrial H(+)-ATP synthase (p-mRNA) 3' UTR; a GLUT1 3' UTR; a MEF2A 3' UTR; a p- F1-ATPase 3' UTR; functional fragments thereof, and combinations thereof.
Wild-type UTRs derived from any gene or mRNA can be incorporated into the polynucleotides of the present disclosure. In some embodiments, a UTR can be altered relative to a wild type or native UTR to produce a variant UTR, e.g., by changing the orientation or location of the UTR relative to the ORF; or by inclusion of additional nucleotides, deletion of nucleotides, swapping or transposition of nucleotides. In some embodiments, variants of 5' or 3' UTRs can be utilized, for example, mutants of wild type UTRs, or variants wherein one or more nucleotides are added to or removed from a terminus of the UTR.
Additionally, one or more synthetic UTRs can be used in combination with one or more nonsynthetic UTRs. See, e.g., Mandal and Rossi, Nat. Protoc. 2013 8(3):568-82, the contents of which are incorporated herein by reference in their entirety.
UTRs or portions thereof can be placed in the same orientation as in the transcript from which they were selected or can be altered in orientation or location. Hence, a 5' and/or 3' UTR can be inverted, shortened, lengthened, or combined with one or more other 5' UTRs or 3' UTRs.
In some embodiments, the polynucleotide comprises multiple UTRs, e.g., a double, a triple or a quadruple 5' UTR or 3' UTR. For example, a double UTR comprises two copies of the same UTR either in series or substantially in series. For example, a double beta-globin 3'UTR can be used (see US2010/0129877, the contents of which are incorporated herein by reference in its entirety).
The polynucleotides of the present disclosure can comprise combinations of features. For example, the ORF can be flanked by a 5'UTR that comprises a strong Kozak translational initiation signal and/or a 3'UTR comprising an oligo(dT) sequence for templated addition of a poly-A tail. A 5'UTR can comprise a first polynucleotide fragment and a second polynucleotide fragment from the same and/or different UTRs (see, e.g., US2010/0293625, herein incorporated by reference in its entirety).
Other non-UTR sequences can be used as regions or subregions within the polynucleotides of the present disclosure. For example, introns or portions of intron sequences can be incorporated into the polynucleotides of the present disclosure. Incorporation of intronic sequences can increase protein production as well as polynucleotide expression levels. In some embodiments, the polynucleotide of the present disclosure comprises an internal ribosome entry site (IRES) instead of or in addition to a UTR (see, e.g., Yakubov et al., Biochem. Biophys. Res. Commun. 2010 394(1 ):189-193, the contents of which are incorporated herein by reference in their entirety). In some embodiments, the polynucleotide comprises an IRES instead of a 5' UTR sequence. In some embodiments, the polynucleotide comprises an ORF and a viral capsid sequence. In some embodiments, the polynucleotide comprises a synthetic 5' UTR in combination with a non-synthetic 3' UTR.
In some embodiments, the UTR can also include at least one translation enhancer polynucleotide, translation enhancer element, or translational enhancer elements (collectively, "TEE," which refers to nucleic acid sequences that increase the amount of polypeptide or protein produced from a polynucleotide. As a non-limiting example, the TEE can be located between the transcription promoter and the start codon. In some embodiments, the 5' UTR comprises a TEE.
In one aspect, a TEE is a conserved element in a UTR that can promote translational activity of a nucleic acid such as, but not limited to, cap-dependent or cap-independent translation.
a. 5' UTR sequences
5' UTR sequences are important for ribosome recruitment to the mRNA and have been reported to play a role in translation (Hinnebusch A, et al., (2016) Science, 352:6292: 1413-6).
Disclosed herein, inter alia, is a polynucleotide, e.g., mRNA, comprising an open reading frame encoding a therapeutic polypeptide, which polynucleotide has a 5' UTR that confers an increased half-life, increased expression and/or increased activity of the polypeptide encoded by said polynucleotide, or of the polynucleotide itself. In some embodiments, a polynucleotide disclosed herein comprises: (a) a 5'- UTR (e.g., as provided in Table 7 or a variant or fragment thereof); (b) a coding region comprising a stop element (e.g., as described herein); and (c) a 3'-UTR (e.g., as described herein), and LNP compositions comprising the same. In some embodiments, the polynucleotide comprises a 5'-UTR comprising a sequence provided in Table 7 or a variant or fragment thereof (e.g., a functional variant or fragment thereof).
In some embodiments, the polynucleotide having a 5' UTR sequence provided in Table 7 or a variant or fragment thereof, has an increase in the half-life of the polynucleotide, e.g., about 1 .5-20-fold increase in half-life of the polynucleotide. In some embodiments, the increase in half-life is about 1 .5-, 2-, 3-, 4-, 5-, 6-, 7-, 8-, 9-, 10-, 11 -, 12-, 13-, 14-, 15-, 16-, 17-, 18-, 19- or 20-fold, or more. In some embodiments, the increase in half life is about 1 .5-fold or more. In some embodiments, the increase in half life is about 2-fold or more. In some embodiments, the increase in half life is about 3-fold or more. In some embodiments, the increase in half life is about 4-fold or more. In some embodiments, the increase in half life is about 5-fold or more.
In some embodiments, the polynucleotide having a 5' UTR sequence provided in Table 7 or a variant or fragment thereof, results in an increased level and/or activity, e.g., output, of the polypeptide encoded by the polynucleotide. In some embodiments, the 5'UTR results in about 1 .5-20-fold increase in level and/or activity, e.g., output, of the polypeptide encoded by the polynucleotide. In some embodiments, the increase in level and/or activity is about 1.5-, 2-, 3-, 4-, 5-, 6-, 7-, 8-, 9-, 10-, 11 -, 12-, 13-, 14-, 15-, 16-, 17-, 18-, 19- or 20-fold, or more. In some embodiments, the increase in level and/or activity is about 1 .5-fold or more. In some embodiments, the increase in level and/or activity is about 2- fold or more. In some embodiments, the increase in level and/or activity is about 3-fold or more. In some embodiments, the increase in level and/or activity is about 4-fold or more. In some embodiments, the increase in level and/or activity is about 5-fold or more.
In some embodiments, the increase is compared to an otherwise similar polynucleotide which does not have a 5' UTR, has a different 5' UTR, or does not have a 5' UTR described in Table 7 or a variant or fragment thereof.
In some embodiments, the increase in half-life of the polynucleotide is measured according to an assay that measures the half-life of a polynucleotide.
In some embodiments, the increase in level and/or activity, e.g., output, of the polypeptide encoded by the polynucleotide is measured according to an assay that measures the level and/or activity of a polypeptide.
In some embodiments, the 5' UTR comprises a sequence provided in Table 7 or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to a 5' UTR sequence provided in Table 7, or a variant or a fragment thereof. In some embodiments, the 5' UTR comprises a sequence
with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 , SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, or SEQ ID NO: 34.
In some embodiments, the 5' UTR comprises a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 6. In some embodiments, the 5' UTR comprises a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 7. In some embodiments, the 5' UTR comprises a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 8. In some embodiments, the 5' UTR comprises a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 9. In some embodiments, the 5' UTR comprises a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 10. In some embodiments, the 5' UTR comprises a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 11. In some embodiments, the 5' UTR comprises a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 12. In some embodiments, the 5' UTR comprises a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 13. In some embodiments, the 5' UTR comprises a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 14. In some embodiments, the 5' UTR comprises a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 34.
In some embodiments, the 5' UTR comprises the sequence of SEQ ID NO: 6. In some embodiments, the 5' UTR consists of the sequence of SEQ ID NO: 6. In some embodiments, the 5' UTR comprises the sequence of SEQ ID NO: 11 . In some embodiments, the 5' UTR consists of the sequence of SEQ ID NO: 11. In some embodiments, the 5' UTR comprises the sequence of SEQ ID NO: 12. In some embodiments, the 5' UTR consists of the sequence of SEQ ID NO: 12. In some embodiments, the 5' UTR comprises the sequence of SEQ ID NO: 34. In some embodiments, the 5' UTR consists of the sequence of SEQ ID NO: 34.
In some embodiments, a 5' UTR sequence provided in Table 7 has a first nucleotide (not shown) which is an A. In some embodiments, a 5' UTR sequence provided in Table 7 has a first nucleotide (not shown) which is a G.
Table 7. Exemplary 5' UTR sequences
In some embodiments, the 5' UTR comprises a variant of SEQ ID NO: 6. In some embodiments, the variant of SEQ ID NO: 6 comprises a nucleic acid sequence of Formula A: GGAAAUCGCAAAA (N2)x (N3)x C U (N4)x (N5)x CGCG U UAGAU U UCU U U UAG U U U U C U N6N7C A AC U AG C A AG C U U U U U G U U C U C G CC (NsC C)x (SEQ ID NO: 15), wherein:
(N2)X is a uracil and x is an integer from 0 to 5, e.g., wherein x =3 or 4;
(N3)X is a guanine and x is an integer from 0 to 1 ;
(N4)X is a cytosine and x is an integer from 0 to 1 ; (Ns)x is a uracil and x is an integer from 0 to 5, e.g., wherein x =2 or 3;
Ne is a uracil or cytosine;
N? is a uracil or guanine;
Ns is adenine or guanine and x is an integer from 0 to 1 .
In some embodiments (N2)x is a uracil and x is 0. In some embodiments (N2)x is a uracil and x is 1 . In some embodiments (N2)x is a uracil and x is 2. In some embodiments (N2)x is a uracil and x is 3. In some embodiments, (N2)x is a uracil and x is 4. In some embodiments (N2)x is a uracil and x is 5.
In some embodiments, (Ns)x is a guanine and x is 0. In some embodiments, (Ns)x is a guanine and x is 1 .
In some embodiments, (N4)x is a cytosine and x is 0. In some embodiments, (N4)x is a cytosine and x is 1 .
In some embodiments, (Ns)x is a uracil and x is 0. In some embodiments, (Ns)x is a uracil and x is 1 . In some embodiments, (Ns)x is a uracil and x is 2. In some embodiments, (Ns)x is a uracil and x is 3. In some embodiments, (Ns)x is a uracil and x is 4. In some embodiments (Ns)x is a uracil and x is 5.
In some embodiments, N6 is a uracil. In some embodiments, N6 is a cytosine.
In some embodiments, N7 is a uracil. In some embodiments, N7 is a guanine.
In some embodiments, N8 is an adenine and x is 0. In some embodiments, N8 is an adenine and x is 1 .
In some embodiments, N8 is a guanine and x is 0. In some embodiments, N8 is a guanine and x is 1 .
In some embodiments, the 5' UTR comprises a variant of SEQ ID NO: 6, SEQ ID NO: 1 1 , SEQ ID NO: 12, or SEQ ID NO: 34. In some embodiments, the variant of SEQ ID NO: 6, SEQ ID NO: 1 1 , SEQ ID NO: 12, or SEQ ID NO: 34 comprises a sequence with at least 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 6, SEQ ID NO: 1 1 , SEQ ID NO: 12, or SEQ ID NO: 34. In some embodiments, the variant of SEQ ID NO: 6, SEQ ID NO: 1 1 , SEQ ID NO: 12, or SEQ ID NO: 34 comprises a sequence with at least 50% identity to SEQ ID NO: 6, SEQ ID NO: 1 1 , SEQ ID NO: 12, or SEQ ID NO: 34. In some embodiments, the variant of SEQ ID NO: 6, SEQ ID NO: 1 1 , SEQ ID NO: 12, or SEQ ID NO: 34 comprises a sequence with at least 60% identity to SEQ ID NO: 6, SEQ ID NO: 1 1 , SEQ ID NO: 12, or SEQ ID NO: 34. In some embodiments, the variant of SEQ ID NO: 6, SEQ ID NO: 1 1 , SEQ ID NO: 12, or SEQ ID NO: 34 comprises a sequence with at least 70% identity to SEQ ID NO: 6, SEQ ID NO: 1 1 , SEQ ID NO: 12, or SEQ ID NO: 34. In some embodiments, the variant of SEQ ID NO: 6, SEQ ID NO: 1 1 , SEQ ID NO: 12, or SEQ ID NO: 34 comprises a sequence with at least 80% identity to SEQ ID NO: 6, SEQ ID NO: 1 1 , SEQ ID NO: 12, or SEQ ID NO: 34. In some embodiments, the variant of SEQ ID NO: 6, SEQ ID NO: 1 1 , SEQ ID NO: 12, or SEQ ID NO: 34 comprises a sequence with at least 90% identity to SEQ ID NO: 6, SEQ ID NO: 1 1 , SEQ ID NO: 12, or SEQ ID NO: 34 . In some embodiments, the variant of SEQ ID NO: 6, SEQ ID NO: 1 1 , SEQ ID NO: 12, or SEQ ID NO: 34 comprises a sequence with at least 95% identity to SEQ ID NO: 6, SEQ ID NO: 1 1 , SEQ ID NO: 12, or SEQ ID NO: 34 . In some embodiments, the variant of SEQ ID NO: 6, SEQ ID NO: 1 1 , SEQ ID NO: 12, or SEQ ID NO: 34 comprises a sequence with at least 96% identity to SEQ ID NO: 6, SEQ ID NO: 1 1 , SEQ ID NO: 12, or SEQ ID NO: 34 . In some embodiments, the variant of SEQ ID NO: 6, SEQ ID NO: 1 1 , SEQ ID NO: 12, or SEQ ID NO: 34 comprises a sequence with at least 97% identity to SEQ ID NO: 6, SEQ ID NO: 1 1 , SEQ ID NO: 12, or SEQ ID NO: 34. In some embodiments, the variant of SEQ ID NO: 6, SEQ ID NO: 1 1 , SEQ ID NO: 12, or SEQ ID NO: 34 comprises a sequence with at least 98% identity to SEQ ID NO: 6,
SEQ ID NO: 11 , SEQ ID NO: 12, or SEQ ID NO: 34. In some embodiments, the variant of SEQ ID NO: 6, SEQ ID NO: 11 , SEQ ID NO: 12, or SEQ ID NO: 34 comprises a sequence with at least 99% identity to SEQ ID NO: 6, SEQ ID NO: 11 , SEQ ID NO: 12, or SEQ ID NO: 34.
In some embodiments, the variant of SEQ ID NO: 6, SEQ ID NO: 11 , SEQ ID NO: 12, or SEQ ID NO: 34 comprises a uridine content of at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, or 80%. In some embodiments, the variant of SEQ ID NO: 6, SEQ ID NO: 11 , SEQ ID NO: 12, or SEQ ID NO: 34 comprises a uridine content of at least 5%. In some embodiments, the variant of SEQ ID NO: 6, SEQ ID NO: 11 , SEQ ID NO: 12, or SEQ ID NO: 34 comprises a uridine content of at least 10%. In some embodiments, the variant of SEQ ID NO: 6, SEQ ID NO: 11 , SEQ ID NO: 12, or SEQ ID NO: 34 comprises a uridine content of at least 20%. In some embodiments, the variant of SEQ ID NO: 6, SEQ ID NO: 11 , SEQ ID NO: 12, or SEQ ID NO: 34 comprises a uridine content of at least 30%. In some embodiments, the variant of SEQ ID NO: 6, SEQ ID NO: 11 , SEQ ID NO: 12, or SEQ ID NO: 34 comprises a uridine content of at least 40%. In some embodiments, the variant of SEQ ID NO: 6, SEQ ID NO: 11 , SEQ ID NO: 12, or SEQ ID NO: 34 comprises a uridine content of at least 50%. In some embodiments, the variant of SEQ ID NO: 6, SEQ ID NO: 11 , SEQ ID NO: 12, or SEQ ID NO: 34 comprises a uridine content of at least 60%. In some embodiments, the variant of SEQ ID NO: 6, SEQ ID NO: 11 , SEQ ID NO: 12, or SEQ ID NO: 34 comprises a uridine content of at least 70%. In some embodiments, the variant of SEQ ID NO: 6, SEQ ID NO: 11 , SEQ ID NO: 12, or SEQ ID NO: 34 comprises a uridine content of at least 80%.
In some embodiments, the variant of SEQ ID NO: 6, SEQ ID NO: 11 , SEQ ID NO: 12, or SEQ ID NO: 34 comprises at least 2, 3, 4, 5, 6 or 7 consecutive uridines (e.g., a polyuridine tract). In some embodiments, the polyuridine tract in the variant of SEQ ID NO: 6, SEQ ID NO: 11 , SEQ ID NO: 12, or SEQ ID NO: 34 comprises at least 1 -7, 2-7, 3-7, 4-7, 5-7, 6-7, 1 -6, 1 -5, 1 -4, 1 -3, 1 -2, 2-6, or 3-5 consecutive uridines. In some embodiments, the polyuridine tract in the variant of SEQ ID NO: 6, SEQ ID NO: 11 , SEQ ID NO: 12, or SEQ ID NO: 34 comprises 4 consecutive uridines. In some embodiments, the polyuridine tract in the variant of SEQ ID NO: 6, SEQ ID NO: 11 , SEQ ID NO: 12, or SEQ ID NO: 34 comprises 5 consecutive uridines.
In some embodiments, the variant of SEQ ID NO: 6, SEQ ID NO: 11 , SEQ ID NO: 12, or SEQ ID NO: 34 comprises 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, or 15 polyuridine tracts. In some embodiments, the variant of SEQ ID NO: 6, SEQ ID NO: 11 , SEQ ID NO: 12, or SEQ ID NO: 34 comprises 3 polyuridine tracts. In some embodiments, the variant of SEQ ID NO: 6, SEQ ID NO: 11 , SEQ ID NO: 12, or SEQ ID NO: 34 comprises 4 polyuridine tracts. In some embodiments, the variant of SEQ ID NO: 6, SEQ ID NO: 11 , SEQ ID NO: 12, or SEQ ID NO: 34 comprises 5 polyuridine tracts.
In some embodiments, one or more of the polyuridine tracts are adjacent to a different polyuridine tract. In some embodiments, each of, e.g., all, the polyuridine tracts are adjacent to each other, e.g., all of the polyuridine tracts are contiguous.
In some embodiments, one or more of the polyuridine tracts are separated by 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 2, 13, 14, 15, 16, 17, 18. 19, 20, 30, 40, 50 or 60 nucleotides. In some embodiments, each of, e.g., all of, the polyuridine tracts are separated by 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 2, 13, 14, 15, 16, 17, 18. 19, 20, 30, 40, 50 or 60 nucleotides.
In some embodiments, a first polyuridine tract and a second polyuridine tract are adjacent to each other.
In some embodiments, a subsequent, e.g., third, fourth, fifth, sixth or seventh, eighth, ninth, or tenth, polyuridine tract is separated by 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 2, 13, 14, 15, 16, 17, 18. 19, 20, 30, 40, 50 or 60 nucleotides from the first polyuridine tract, the second polyuridine tract, or any one of the subsequent polyuridine tracts.
In some embodiments, a first polyuridine tract is separated by 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 2, 13, 14, 15, 16, 17, 18. 19, 20, 30, 40, 50 or 60 nucleotides from a subsequent polyuridine tract, e.g., a second, third, fourth, fifth, sixth or seventh, eighth, ninth, or tenth polyuridine tract. In some embodiments, one or more of the subsequent polyuridine tracts are adjacent to a different polyuridine tract.
In some embodiments, the 5' UTR comprises a Kozak sequence, e.g., a GCCRCC nucleotide sequence (SEQ ID NO: 35) wherein R is an adenine or guanine. In some embodiments, the Kozak sequence is disposed at the 3' end of the 5'UTR sequence.
In an aspect, the polynucleotide (e.g., mRNA) comprising an open reading frame encoding a therapeutic polypeptide and comprising a 5' UTR sequence disclosed herein is formulated as an LNP. In some embodiments, the LNP composition comprises: (i) an ionizable lipid, e.g., an amino lipid; (ii) a sterol or other structural lipid; (iii) a non-cationic helper lipid or phospholipid; and (iv) a PEG-lipid.
In another aspect, an LNP composition comprising a polynucleotide disclosed herein encoding a therapeutic polypeptide, e.g., as described herein, can be administered with an additional agent, e.g., as described herein. b. 3' UTR sequences
3'UTR sequences have been shown to influence translation, half-life, and subcellular localization of mRNAs (Mayr C., Cold Spring Harb. Persp. Biol. 2019 Oct 1 ;11 (10):a034728).
Disclosed herein, inter alia, is a polynucleotide, e.g., mRNA, comprising an open reading frame encoding a therapeutic polypeptide, which polynucleotide has a 3' UTR that confers an increased half-life, increased expression and/or increased activity of the polypeptide encoded by said polynucleotide, or of the polynucleotide itself. A polynucleotide disclosed herein may comprise: (a) a 5'-UTR (e.g., as described herein); (b) a coding region comprising a stop element (e.g., as described herein); and (c) a 3'- UTR (e.g., as provided in Table 8 or a variant or fragment thereof), and LNP compositions comprising the same. In some embodiments, the polynucleotide comprises a 3'-UTR comprising a sequence provided in Table 8 or a variant or fragment thereof.
In some embodiments, the polynucleotide having a 3' UTR sequence provided in Table 8 or a variant or fragment thereof, results in an increased half-life of the polynucleotide, e.g., about 1 .5-10-fold increase in half-life of the polynucleotide. In some embodiments, the increase in half-life is about 1 .5-, 2-, 3-, 4-, 5-, 6-, 7-, 8-, 9-, or 10-fold, or more. In some embodiments, the increase in half-life is about 1 .5- fold or more. In some embodiments, the increase in half-life is about 2-fold or more. In some embodiments, the increase in half-life is about 3-fold or more. In some embodiments, the increase in half-life is about 4-fold or more. In some embodiments, the increase in half-life is about 5-fold or more. In some embodiments, the increase in half-life is about 6-fold or more. In some embodiments, the increase
in half-life is about 7-fold or more. In some embodiments, the increase in half-life is about 8-fold. In some embodiments, the increase in half-life is about 9-fold or more. In some embodiments, the increase in half-life is about 10-fold or more.
In some embodiments, the polynucleotide having a 3' UTR sequence provided in Table 8 or a variant or fragment thereof, results in a polynucleotide with a mean half-life score of greater than 10.
In some embodiments, the polynucleotide having a 3' UTR sequence provided in Table 8 or a variant or fragment thereof, results in an increased level and/or activity, e.g., output, of the polypeptide encoded by the polynucleotide.
In some embodiments, the increase is compared to an otherwise similar polynucleotide which does not have a 3' UTR, has a different 3' UTR, or does not have a 3' UTR of Table 8 or a variant or fragment thereof.
In some embodiments, the polynucleotide comprises a 3' UTR sequence provided in Table 8 or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to a 3' UTR sequence provided in Table 8, or a fragment thereof. In some embodiments, the 3' UTR comprises a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41 , SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51 , SEQ ID NO: 61 , SEQ ID NO: 62, and SEQ ID NO: 63.
In some embodiments, the 3' UTR comprises the sequence of SEQ ID NO: 36, or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 36. In some embodiments, the 3' UTR comprises the sequence of SEQ ID NO: 37, or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 37. In some embodiments, the 3' UTR comprises the sequence of SEQ ID NO: 38, or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 38. In some embodiments, the 3' UTR comprises the sequence of SEQ ID NO: 39, or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 39. In some embodiments, the 3' UTR comprises the sequence of SEQ ID NO: 40, or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 40. In some embodiments, the 3' UTR comprises the sequence of SEQ ID NO: 41 , or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 41 . In some embodiments, the 3' UTR comprises the sequence of SEQ ID NO: 42, or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 42. In some embodiments, the 3' UTR comprises the sequence of SEQ ID NO: 43, or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 43. In some embodiments, the 3' UTR comprises the sequence of SEQ ID NO: 44, or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 44. In some embodiments, the 3' UTR comprises the sequence of SEQ ID NO: 45, or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 45. In some embodiments, the 3' UTR comprises the sequence of SEQ ID NO: 46, or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 46. In some embodiments, the 3' UTR comprises the sequence of SEQ ID NO: 47, or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 47. In some embodiments, the 3' UTR comprises the sequence of SEQ ID NO: 48, or a sequence with at least 80%,
85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 48. In some embodiments, the 3' UTR comprises the sequence of SEQ ID NO: 49, or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 49. In some embodiments, the 3' UTR comprises the sequence of SEQ ID NO: 50, or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 50. In some embodiments, the 3' UTR comprises the sequence of
SEQ ID NO: 51 , or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 51 . In some embodiments, the 3' UTR comprises the sequence of SEQ ID NO: 61 , or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 61 . In some embodiments, the 3' UTR comprises the sequence of SEQ ID NO: 62, or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 62. In some embodiments, the 3' UTR comprises the sequence of SEQ ID NO: 63, or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to SEQ ID NO: 63.
Table 8. Exemplary 3' UTR sequences
In some embodiments, the 3' UTR comprises a micro RNA (miRNA) binding site, e.g., as described herein, which binds to a miR present in a human cell. In some embodiments, the 3' UTR comprises a miRNA binding site of SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, or a combination thereof. In some embodiments, the 3' UTR comprises a plurality of miRNA binding sites (e.g., 2, 3, 4, 5, 6, 7 or 8 miRNA binding sites). In some embodiments, the plurality of miRNA binding sites comprises the same or different miRNA binding sites. miR122 bs = CAAACACCAUUGUCACACUCCA (SEQ ID NO: 64) miR-142-3p bs = UCCAUAAAGUAGGAAACACUACA (SEQ ID NO: 65) miR-126 bs = CGCAUUAUUACUCACGGUACGA (SEQ ID NO: 66)
In an aspect, disclosed herein is a polynucleotide encoding a polypeptide, wherein the polynucleotide comprises: (a) a 5'-UTR, e.g., as described herein; (b) a coding region comprising a stop element (e.g., as described herein); and (c) a 3'-UTR (e.g., as described herein).
In an aspect, an LNP composition comprising a polynucleotide comprising an open reading frame encoding a therapeutic polypeptide and comprising a 3' UTR disclosed herein comprises: (i) an ionizable lipid, e.g., an amino lipid; (ii) a sterol or other structural lipid; (iii) a non-cationic helper lipid or phospholipid; and (iv) a PEG-lipid.
12. MicroRNA Binding Sites
Polynucleotides of the present disclosure can include regulatory elements, for example, microRNA (miRNA) binding sites, transcription factor binding sites, structured mRNA sequences and/or motifs, artificial binding sites engineered to act as pseudo-receptors for endogenous nucleic acid binding molecules, and combinations thereof. In some embodiments, polynucleotides including such regulatory elements are referred to as including “sensor sequences”.
In some embodiments, a polynucleotide (e.g., a ribonucleic acid (RNA), e.g., a messenger RNA (mRNA)) of the present disclosure comprises an open reading frame (ORF) encoding a polypeptide of interest and further comprises one or more miRNA binding site(s). Inclusion or incorporation of miRNA binding site(s) provides for regulation of polynucleotides of the present disclosure, and in turn, of the
polypeptides encoded therefrom, based on tissue-specific and/or cell-type specific expression of naturally-occurring miRNAs.
The present disclosure also provides pharmaceutical compositions and formulations that comprise any of the polynucleotides described above. In some embodiments, the composition or formulation further comprises a delivery agent.
In some embodiments, the composition or formulation can contain a polynucleotide comprising a sequence optimized nucleic acid sequence disclosed herein which encodes a polypeptide. In some embodiments, the composition or formulation can contain a polynucleotide (e.g., a RNA, e.g., an mRNA) comprising a polynucleotide (e.g., an ORF) having significant sequence identity to a sequence optimized nucleic acid sequence disclosed herein which encodes a polypeptide. In some embodiments, the polynucleotide further comprises a miRNA binding site, e.g., a miRNA binding site that binds to miR-126, miR-142, miR-144, miR-146, miR-150, miR-155, miR-16, miR-21 , miR-223, miR-24, miR-27 and miR- 26a.
A miRNA, e.g., a natural-occurring miRNA, is a 19-25 nucleotide long noncoding RNA that binds to a polynucleotide and down-regulates gene expression either by reducing stability or by inhibiting translation of the polynucleotide. A miRNA sequence comprises a “seed” region, i.e., a sequence in the region of positions 2-8 of the mature miRNA. A miRNA seed can comprise positions 2-8 or 2-7 of the mature miRNA.
MicroRNAs derive enzymatically from regions of RNA transcripts that fold back on themselves to form short hairpin structures often termed a pre-miRNA (precursor-miRNA). A pre-miRNA typically has a two-nucleotide overhang at its 3' end, and has 3' hydroxyl and 5' phosphate groups. This precursor- mRNA is processed in the nucleus and subsequently transported to the cytoplasm where it is further processed by DICER (a RNase III enzyme), to form a mature microRNA of approximately 22 nucleotides. The mature microRNA is then incorporated into a ribonuclear particle to form the RNA-induced silencing complex, RISC, which mediates gene silencing. Art-recognized nomenclature for mature miRNAs typically designates the arm of the pre-miRNA from which the mature miRNA derives; "5p" means the microRNA is from the 5 prime arm of the pre-miRNA hairpin and "3p" means the microRNA is from the 3 prime end of the pre-miRNA hairpin. A miR referred to by number herein can refer to either of the two mature microRNAs originating from opposite arms of the same pre-miRNA (e.g., either the 3p or 5p microRNA). All miRs referred to herein are intended to include both the 3p and 5p arms/sequences, unless particularly specified by the 3p or 5p designation.
As used herein, the term “microRNA (miRNA or miR) binding site” refers to a sequence within a polynucleotide, e.g., within a DNA or within an RNA transcript, including in the 5'UTR and/or 3'UTR, that has sufficient complementarity to all or a region of a miRNA to interact with, associate with or bind to the miRNA. In some embodiments, a polynucleotide of the present disclosure comprising an ORF encoding a polypeptide of interest and further comprises one or more miRNA binding site(s). In exemplary embodiments, a 5' UTR and/or 3' UTR of the polynucleotide (e.g., a ribonucleic acid (RNA), e.g., a messenger RNA (mRNA)) comprises the one or more miRNA binding site(s).
A miRNA binding site having sufficient complementarity to a miRNA refers to a degree of complementarity sufficient to facilitate miRNA-mediated regulation of a polynucleotide, e.g., miRNA- mediated translational repression or degradation of the polynucleotide. In exemplary aspects of the
present disclosure, a miRNA binding site having sufficient complementarity to the miRNA refers to a degree of complementarity sufficient to facilitate miRNA-mediated degradation of the polynucleotide, e.g., miRNA-guided RNA-induced silencing complex (RlSC)-mediated cleavage of mRNA. The miRNA binding site can have complementarity to, for example, a 19-25 nucleotide long miRNA sequence, to a 19-23 nucleotide long miRNA sequence, or to a 22 nucleotide long miRNA sequence. A miRNA binding site can be complementary to only a portion of a miRNA, e.g., to a portion less than 1 , 2, 3, or 4 nucleotides of the full length of a naturally-occurring miRNA sequence, or to a portion less than 1 , 2, 3, or 4 nucleotides shorter than a naturally-occurring miRNA sequence. Full or complete complementarity (e.g., full complementarity or complete complementarity over all or a significant portion of the length of a naturally-occurring miRNA) is preferred when the desired regulation is mRNA degradation.
In some embodiments, a miRNA binding site includes a sequence that has complementarity (e.g., partial or complete complementarity) with a miRNA seed sequence. In some embodiments, the miRNA binding site includes a sequence that has complete complementarity with a miRNA seed sequence. In some embodiments, a miRNA binding site includes a sequence that has complementarity (e.g., partial or complete complementarity) with a miRNA sequence. In some embodiments, the miRNA binding site includes a sequence that has complete complementarity with a miRNA sequence. In other embodiments, the sequence is not completely complementary. In some embodiments, a miRNA binding site has complete complementarity with a miRNA sequence but for 1 , 2, or 3 nucleotide substitutions, terminal additions, and/or truncations.
In some embodiments, the miRNA binding site is the same length as the corresponding miRNA. In other embodiments, the miRNA binding site is one, two, three, four, five, six, seven, eight, nine, ten, eleven or twelve nucleotide(s) shorter than the corresponding miRNA at the 5' terminus, the 3' terminus, or both. In still other embodiments, the microRNA binding site is two nucleotides shorter than the corresponding microRNA at the 5' terminus, the 3' terminus, or both. The miRNA binding sites that are shorter than the corresponding miRNAs are still capable of degrading the mRNA incorporating one or more of the miRNA binding sites or preventing the mRNA from translation.
In some embodiments, the miRNA binding site binds the corresponding mature miRNA that is part of an active RISC containing Dicer. In some embodiments, binding of the miRNA binding site to the corresponding miRNA in RISC degrades the mRNA containing the miRNA binding site or prevents the mRNA from being translated. In some embodiments, the miRNA binding site has sufficient complementarity to miRNA so that a RISC complex comprising the miRNA cleaves the polynucleotide comprising the miRNA binding site. In other embodiments, the miRNA binding site has imperfect complementarity so that a RISC complex comprising the miRNA induces instability in the polynucleotide comprising the miRNA binding site. In some embodiments, the miRNA binding site has imperfect complementarity so that a RISC complex comprising the miRNA represses transcription of the polynucleotide comprising the miRNA binding site.
In some embodiments, the miRNA binding site has one, two, three, four, five, six, seven, eight, nine, ten, eleven or twelve mismatch(es) from the corresponding miRNA.
In some embodiments, the miRNA binding site has at least about ten, at least about eleven, at least about twelve, at least about thirteen, at least about fourteen, at least about fifteen, at least about sixteen, at least about seventeen, at least about eighteen, at least about nineteen, at least about twenty,
or at least about twenty-one contiguous nucleotides complementary to at least about ten, at least about eleven, at least about twelve, at least about thirteen, at least about fourteen, at least about fifteen, at least about sixteen, at least about seventeen, at least about eighteen, at least about nineteen, at least about twenty, or at least about twenty-one, respectively, contiguous nucleotides of the corresponding miRNA.
By engineering one or more miRNA binding sites into a polynucleotide of the present disclosure, the polynucleotide can be targeted for degradation or reduced translation, provided the miRNA in question is available. This can reduce off-target effects upon delivery of the polynucleotide. For example, if a polynucleotide of the present disclosure is not intended to be delivered to a tissue or cell but ends up is said tissue or cell, then a miRNA abundant in the tissue or cell can inhibit the expression of the gene of interest if one or multiple binding sites of the miRNA are engineered into the 5' UTR and/or 3' UTR of the polynucleotide. Thus, in some embodiments, incorporation of one or more miRNA binding sites into an mRNA of the disclosure may reduce the hazard of off-target effects upon nucleic acid molecule delivery and/or enable tissue-specific regulation of expression of a polypeptide encoded by the mRNA. In yet other embodiments, incorporation of one or more miRNA binding sites into an mRNA of the disclosure can modulate immune responses upon nucleic acid delivery in vivo. In further embodiments, incorporation of one or more miRNA binding sites into an mRNA of the disclosure can modulate accelerated blood clearance (ABC) of lipid-comprising compounds and compositions described herein.
Conversely, miRNA binding sites can be removed from polynucleotide sequences in which they naturally occur to increase protein expression in specific tissues. For example, a binding site for a specific miRNA can be removed from a polynucleotide to improve protein expression in tissues or cells containing the miRNA.
Regulation of expression in multiple tissues can be accomplished through introduction or removal of one or more miRNA binding sites, e.g., one or more distinct miRNA binding sites. The decision whether to remove or insert a miRNA binding site can be made based on miRNA expression patterns and/or their profilings in tissues and/or cells in development and/or disease. Identification of miRNAs, miRNA binding sites, and their expression patterns and role in biology have been reported (e.g., Bonauer et al., Curr. Drug Targets 2010 1 1 :943-949; Anand and Cheresh Curr. Op. Hematol. 201 1 18:171 -176; Contreras and Rao Leukemia 2012 26:404-413 (201 1 Dec 20. doi: 10.1038/leu.201 1 .356); Bartel, Cell, 2009 136:215-233; Landgraf et al, Cell, 2007 129:1401 -1414; Gentner and Naldini, Tissue Antigens, 2012 80:393-403 and all references therein; each of which is incorporated herein by reference in its entirety).
Examples of tissues where miRNA are known to regulate mRNA, and thereby protein expression, include, but are not limited to, liver (miR-122), muscle (miR-133, miR-206, miR-208), endothelial cells (miR-17-92, miR-126), myeloid cells (miR-142-3p, miR-142-5p, miR-16, miR-21 , miR-223, miR-24, miR- 27), adipose tissue (let-7, miR-30c), heart (miR-1 d, miR-149), kidney (miR-192, miR-194, miR-204), and lung epithelial cells (let-7, miR-133, miR-126).
Specifically, miRNAs are known to be differentially expressed in immune cells (also called hematopoietic cells), such as antigen presenting cells (APCs) (e.g., dendritic cells and macrophages), macrophages, monocytes, B lymphocytes, T lymphocytes, granulocytes, natural killer cells, etc. Immune cell specific miRNAs are involved in immunogenicity, autoimmunity, the immune-response to infection, inflammation, as well as unwanted immune response after gene therapy and tissue/organ transplantation. Immune cells specific miRNAs also regulate many aspects of development, proliferation, differentiation
and apoptosis of hematopoietic cells (immune cells). For example, miR-142 and miR-146 are exclusively expressed in immune cells, particularly abundant in myeloid dendritic cells. It has been demonstrated that the immune response to a polynucleotide can be shut-off by adding miR-142 binding sites to the 3'- UTR of the polynucleotide, enabling more stable gene transfer in tissues and cells. miR-142 efficiently degrades exogenous polynucleotides in antigen presenting cells and suppresses cytotoxic elimination of transduced cells (e.g., Annoni A et al., Blood, 2009, 114, 5152-5161 ; Brown BD, et al., Nat. Med. 2006, 12(5), 585-591 ; Brown BD, et al., Blood, 2007, 110(13): 4144-4152, each of which is incorporated herein by reference in its entirety).
An antigen-mediated immune response can refer to an immune response triggered by foreign antigens, which, when entering an organism, are processed by the antigen presenting cells and displayed on the surface of the antigen presenting cells. T cells can recognize the presented antigen and induce a cytotoxic elimination of cells that express the antigen.
Introducing one or more (e.g., one, two, or three) miR-142 binding sites into the 5' UTR and/or 3'UTR of a polynucleotide of the present disclosure can selectively repress gene expression in antigen presenting cells through miR-142 mediated degradation, limiting antigen presentation in antigen presenting cells (e.g., dendritic cells) and thereby preventing antigen-mediated immune response after the delivery of the polynucleotide. The polynucleotide is then stably expressed in target tissues or cells without triggering cytotoxic elimination.
In some embodiments, it may be beneficial to target the same cell type with multiple miRs and to incorporate binding sites to each of the 3p and 5p arm if both are abundant (e.g., both miR-142-3p and miR142-5p are abundant in hematopoietic stem cells). Thus, in certain embodiments, polynucleotides of the present disclosure contain two or more (e.g., two, three, four or more) miR bindings sites from: (i) the group consisting of miR-142, miR-144, miR-150, miR-155 and miR-223 (which are expressed in many hematopoietic cells); or (ii) the group consisting of miR-142, miR150, miR-16 and miR-223 (which are expressed in B cells); or the group consisting of miR-223, miR-451 , miR-26a, miR-16 (which are expressed in progenitor hematopoietic cells).
In some embodiments, it may also be beneficial to combine various miRs such that multiple cell types of interest are targeted at the same time (e.g., miR-142 and miR-126 to target many cells of the hematopoietic lineage and endothelial cells). Thus, for example, in certain embodiments, polynucleotides of the present disclosure comprise two or more (e.g., two, three, four or more) miRNA bindings sites, wherein: (i) at least one of the miRs targets cells of the hematopoietic lineage (e.g., miR-142, miR-144, miR-150, miR-155 or miR-223) and at least one of the miRs targets plasmacytoid dendritic cells, platelets or endothelial cells (e.g., miR-126); or (ii) at least one of the miRs targets B cells (e.g., miR-142, miR150, miR-16 or miR-223) and at least one of the miRs targets plasmacytoid dendritic cells, platelets or endothelial cells (e.g., miR-126); or (iii) at least one of the miRs targets progenitor hematopoietic cells (e.g., miR-223, miR-451 , miR-26a or miR-16) and at least one of the miRs targets plasmacytoid dendritic cells, platelets or endothelial cells (e.g., miR-126); or (iv) at least one of the miRs targets cells of the hematopoietic lineage (e.g., miR-142, miR-144, miR-150, miR-155 or miR-223), at least one of the miRs targets B cells (e.g., miR-142, miR150, miR-16 or miR-223) and at least one of the miRs targets plasmacytoid dendritic cells, platelets or endothelial cells (e.g., miR-126); or any other possible combination of the foregoing four classes of miR binding sites (i.e., those targeting the hematopoietic
lineage, those targeting B cells, those targeting progenitor hematopoietic cells and/or those targeting plasmacytoid dendritic cells/platelets/endothelial cells).
In some embodiments, to modulate immune responses, polynucleotides of the present disclosure can comprise one or more miRNA binding sequences that bind to one or more miRs that are expressed in conventional immune cells or any cell that expresses TLR7 and/or TLR8 and secrete pro-inflammatory cytokines and/or chemokines (e.g., in immune cells of peripheral lymphoid organs and/or splenocytes and/or endothelial cells). It has now been discovered that incorporation into an mRNA of one or more miRs that are expressed in conventional immune cells or any cell that expresses TLR7 and/or TLR8 and secrete pro-inflammatory cytokines and/or chemokines (e.g., in immune cells of peripheral lymphoid organs and/or splenocytes and/or endothelial cells) reduces or inhibits immune cell activation (e.g., B cell activation, as measured by frequency of activated B cells) and/or cytokine production (e.g., production of IL-6, IFN-y and/or TNFa). Furthermore, it has now been discovered that incorporation into an mRNA of one or more miRs that are expressed in conventional immune cells or any cell that expresses TLR7 and/or TLR8 and secrete pro-inflammatory cytokines and/or chemokines (e.g., in immune cells of peripheral lymphoid organs and/or splenocytes and/or endothelial cells) can reduce or inhibit an anti-drug antibody (ADA) response against a protein of interest encoded by the mRNA.
In some embodiments, to modulate accelerated blood clearance of a polynucleotide delivered in a lipid-comprising compound or composition, polynucleotides of the present disclosure can comprise one or more miR binding sequences that bind to one or more miRNAs expressed in conventional immune cells or any cell that expresses TLR7 and/or TLR8 and secrete pro-inflammatory cytokines and/or chemokines (e.g., in immune cells of peripheral lymphoid organs and/or splenocytes and/or endothelial cells). It has now been discovered that incorporation into an mRNA of one or more miR binding sites reduces or inhibits accelerated blood clearance (ABC) of the lipid-comprising compound or composition for use in delivering the mRNA. Furthermore, it has now been discovered that incorporation of one or more miR binding sites into an mRNA reduces serum levels of anti-PEG anti-IgM (e.g., reduces or inhibits the acute production of IgMs that recognize polyethylene glycol (PEG) by B cells) and/or reduces or inhibits proliferation and/or activation of plasmacytoid dendritic cells following administration of a lipid- comprising compound or composition comprising the mRNA.
In some embodiments, miR sequences may correspond to any known microRNA expressed in immune cells, including but not limited to those taught in US Publication US2005/0261218 and US Publication US2005/0059005, the contents of which are incorporated herein by reference in their entirety. Non-limiting examples of miRs expressed in immune cells include those expressed in spleen cells, myeloid cells, dendritic cells, plasmacytoid dendritic cells, B cells, T cells and/or macrophages. For example, miR-142-3p, miR-142-5p, miR-16, miR-21 , miR-223, miR-24 and miR-27 are expressed in myeloid cells, miR-155 is expressed in dendritic cells, B cells and T cells, miR-146 is upregulated in macrophages upon TLR stimulation and miR-126 is expressed in plasmacytoid dendritic cells. In certain embodiments, the miR(s) is expressed abundantly or preferentially in immune cells. For example, miR- 142 (miR-142-3p and/or miR-142-5p), miR-126 (miR-126-3p and/or miR-126-5p), miR-146 (miR-146-3p and/or miR-146-5p) and miR-155 (miR-155-3p and/or miR155-5p) are expressed abundantly in immune cells. These microRNA sequences are known in the art and, thus, one of ordinary skill in the art can
readily design binding sequences or target sequences to which these microRNAs will bind based upon Watson-Crick complementarity.
In some embodiments, the polynucleotide of the present disclosure comprises three copies of the same miRNA binding site. In certain embodiments, use of three copies of the same miR binding site can exhibit beneficial properties as compared to use of a single miRNA binding site.
In some embodiments, the polynucleotide of the present disclosure comprises two or more (e.g., two, three, four) copies of at least two different miR binding sites expressed in immune cells.
In some embodiments, the polynucleotide of the present disclosure comprises at least two miR binding sites for microRNAs expressed in immune cells, wherein one of the miR binding sites is for miR- 142-3p. In various embodiments, the polynucleotide of the present disclosure comprises binding sites for miR-142-3p and miR-155 (miR-155-3p or miR-155-5p), miR-142-3p and miR-146 (miR-146-3 or miR-146- 5p), or miR-142-3p and miR-126 (miR-126-3p or miR-126-5p).
In some embodiments, the polynucleotide of the present disclosure comprises at least two miR binding sites for microRNAs expressed in immune cells, wherein one of the miR binding sites is for miR- 126-3p. In various embodiments, the polynucleotide of the present disclosure comprises binding sites for miR-126-3p and miR-155 (miR-155-3p or miR-155-5p), miR-126-3p and miR-146 (miR-146-3p or miR- 146-5p), or miR-126-3p and miR-142 (miR-142-3p or miR-142-5p).
In some embodiments, the polynucleotide of the present disclosure comprises at least two miR binding sites for microRNAs expressed in immune cells, wherein one of the miR binding sites is for miR- 142-5p. In various embodiments, the polynucleotide of the present disclosure comprises binding sites for miR-142-5p and miR-155 (miR-155-3p or miR-155-5p), miR-142-5p and miR-146 (miR-146-3 or miR-146- 5p), or miR-142-5p and miR-126 (miR-126-3p or miR-126-5p).
In some embodiments, the polynucleotide of the present disclosure comprises at least two miR binding sites for microRNAs expressed in immune cells, wherein one of the miR binding sites is for miR- 155-5p. In various embodiments, the polynucleotide of the present disclosure comprises binding sites for miR-155-5p and miR-142 (miR-142-3p or miR-142-5p), miR-155-5p and miR-146 (miR-146-3 or miR-146- 5p), or miR-155-5p and miR-126 (miR-126-3p or miR-126-5p).
In some embodiments, a polynucleotide of the present disclosure comprises a miRNA binding site, wherein the miRNA binding site comprises one or more nucleotide sequences selected from Table 9, including one or more copies of any one or more of the miRNA binding site sequences. In some embodiments, a polynucleotide of the present disclosure further comprises at least one, two, three, four, five, six, seven, eight, nine, ten, or more of the same or different miRNA binding sites selected from Table 9, including any combination thereof.
In some embodiments, the miRNA binding site binds to miR-142 or is complementary to miR-142. In some embodiments, the miR-142 comprises SEQ ID NO: 67. In some embodiments, the miRNA binding site binds to miR-142-3p or miR-142-5p. In some embodiments, the miR-142-3p binding site comprises SEQ ID NO: 69. In some embodiments, the miR-142-5p binding site comprises SEQ ID NO: 71 . In some embodiments, the miRNA binding site comprises a nucleotide sequence at least 80%, at least 85%, at least 90%, at least 95%, or 100% identical to SEQ ID NO: 69 or SEQ ID NO: 71 .
In some embodiments, the miRNA binding site binds to miR-126 or is complementary to miR-126. In some embodiments, the miR-126 comprises SEQ ID NO: 72. In some embodiments, the miRNA
binding site binds to miR-126-3p or miR-126-5p. In some embodiments, the miR-126-3p binding site comprises SEQ ID NO: 74. In some embodiments, the miR-126-5p binding site comprises SEQ ID NO: 76. In some embodiments, the miRNA binding site comprises a nucleotide sequence at least 80%, at least 85%, at least 90%, at least 95%, or 100% identical to SEQ ID NO: 74 or SEQ ID NO: 76.
In some embodiments, the 3' UTR comprises two miRNA binding sites, wherein a first miRNA binding site binds to miR-142 and a second miRNA binding site binds to miR-126.
Table 9. Exemplary miR-142, miR-126, and miR-142 and miR-126 binding sites
In some embodiments, a miRNA binding site is inserted in the polynucleotide of the present disclosure in any position of the polynucleotide (e.g., the 5' UTR and/or 3' UTR). In some embodiments, the 5' UTR comprises a miRNA binding site. In some embodiments, the 3' UTR comprises a miRNA binding site. In some embodiments, the 5' UTR and the 3' UTR comprise a miRNA binding site. The insertion site in the polynucleotide can be anywhere in the polynucleotide as long as the insertion of the miRNA binding site in the polynucleotide does not interfere with the translation of a functional polypeptide in the absence of the corresponding miRNA; and in the presence of the miRNA, the insertion of the miRNA binding site in the polynucleotide and the binding of the miRNA binding site to the corresponding miRNA are capable of degrading the polynucleotide or preventing the translation of the polynucleotide.
In some embodiments, a miRNA binding site is inserted in at least about 30 nucleotides downstream from the stop codon of an ORF in a polynucleotide of the present disclosure comprising the ORF. In some embodiments, a miRNA binding site is inserted in at least about 10 nucleotides, at least about 15 nucleotides, at least about 20 nucleotides, at least about 25 nucleotides, at least about 30 nucleotides, at least about 35 nucleotides, at least about 40 nucleotides, at least about 45 nucleotides, at least about 50 nucleotides, at least about 55 nucleotides, at least about 60 nucleotides, at least about 65 nucleotides, at least about 70 nucleotides, at least about 75 nucleotides, at least about 80 nucleotides, at least about 85 nucleotides, at least about 90 nucleotides, at least about 95 nucleotides, or at least about
100 nucleotides downstream from the stop codon of an ORF in a polynucleotide of the present disclosure. In some embodiments, a miRNA binding site is inserted in about 10 nucleotides to about 100 nucleotides, about 20 nucleotides to about 90 nucleotides, about 30 nucleotides to about 80 nucleotides, about 40 nucleotides to about 70 nucleotides, about 50 nucleotides to about 60 nucleotides, about 45 nucleotides to about 65 nucleotides downstream from the stop codon of an ORF in a polynucleotide of the present disclosure.
In some embodiments, a miRNA binding site is inserted within the 3' UTR immediately following the stop codon of the coding region within the polynucleotide of the present disclosure, e.g., mRNA. In some embodiments, if there are multiple copies of a stop codon in the construct, a miRNA binding site is inserted immediately following the final stop codon. In some embodiments, a miRNA binding site is inserted further downstream of the stop codon, in which case there are 3' UTR bases between the stop codon and the miR binding site(s).
In some embodiments, one or more miRNA binding sites can be positioned within the 5' UTR at one or more possible insertion sites.
In some embodiments, a codon optimized open reading frame encoding a polypeptide of interest comprises a stop codon and the at least one microRNA binding site is located within the 3' UTR 1 -100 nucleotides after the stop codon. In some embodiments, the codon optimized open reading frame encoding the polypeptide of interest comprises a stop codon and the at least one microRNA binding site for a miR expressed in immune cells is located within the 3' UTR 30-50 nucleotides after the stop codon. In some embodiments, the codon optimized open reading frame encoding the polypeptide of interest comprises a stop codon and the at least one microRNA binding site for a miR expressed in immune cells is located within the 3' UTR at least 50 nucleotides after the stop codon. In other embodiments, the codon optimized open reading frame encoding the polypeptide of interest comprises a stop codon and the at least one microRNA binding site for a miR expressed in immune cells is located within the 3' UTR immediately after the stop codon, or within the 3' UTR 15-20 nucleotides after the stop codon or within the 3' UTR 70-80 nucleotides after the stop codon. In other embodiments, the 3' UTR comprises more than one miRNA binding site (e.g., 2-4 miRNA binding sites), wherein there can be a spacer region (e.g., of 10-100, 20-70 or 30-50 nucleotides in length) between each miRNA binding site. In some embodiments, the 3' UTR comprises a spacer region between the end of the miRNA binding site(s) and the poly A tail nucleotides. For example, a spacer region of 10-100, 20-70 or 30-50 nucleotides in length can be situated between the end of the miRNA binding site(s) and the beginning of the poly A tail.
In some embodiments, a codon optimized open reading frame encoding a polypeptide of interest comprises a start codon and the at least one microRNA binding site is located within the 5' UTR 1 -100 nucleotides before (upstream of) the start codon. In some embodiments, the codon optimized open reading frame encoding the polypeptide of interest comprises a start codon and the at least one microRNA binding site for a miR expressed in immune cells is located within the 5' UTR 10-50 nucleotides before (upstream of) the start codon. In some embodiments, the codon optimized open reading frame encoding the polypeptide of interest comprises a start codon and the at least one microRNA binding site for a miR expressed in immune cells is located within the 5' UTR at least 25 nucleotides before (upstream of) the start codon. In other embodiments, the codon optimized open reading frame encoding the polypeptide of interest comprises a start codon and the at least one
microRNA binding site for a miR expressed in immune cells is located within the 5' UTR immediately before the start codon, or within the 5' UTR 15-20 nucleotides before the start codon or within the 5' UTR 70-80 nucleotides before the start codon. In other embodiments, the 5' UTR comprises more than one miRNA binding site (e.g., 2-4 miRNA binding sites), wherein there can be a spacer region (e.g., of 10- 100, 20-70 or 30-50 nucleotides in length) between each miRNA binding site.
In some embodiments, the 3' UTR comprises more than one stop codon, wherein at least one miRNA binding site is positioned downstream of the stop codons. For example, a 3' UTR can comprise 1 , 2 or 3 stop codons. Non-limiting examples of triple stop codons that can be used include: UGAUAAUAG, UGAUAGUAA, UAAUGAUAG, UGAUAAUAA, UGAUAGUAG, UAAUGAUGA, UAAUAGUAG, UGAUGAUGA, UAAUAAUAA, and UAGUAGUAG. Within a 3' UTR, for example, 1 , 2, 3 or 4 miRNA binding sites, e.g., miR-142-3p binding sites, can be positioned immediately adjacent to the stop codon(s) or at any number of nucleotides downstream of the final stop codon. When the 3' UTR comprises multiple miRNA binding sites, these binding sites can be positioned directly next to each other in the construct (i.e., one after the other) or, alternatively, spacer nucleotides can be positioned between each binding site.
In some embodiments, the 3' UTR comprises three stop codons with a single miR-142-3p binding site located downstream of the 3rd stop codon.
In some embodiments, the polynucleotide of the present disclosure comprises a 5' UTR, a codon optimized open reading frame encoding a polypeptide of interest, a 3' UTR comprising the at least one miRNA binding site for a miR expressed in immune cells, and a 3' tailing region of linked nucleosides. In various embodiments, the 3' UTR comprises 1 -4, at least two, one, two, three or four miRNA binding sites for miRs expressed in immune cells, preferably abundantly or preferentially expressed in immune cells.
In some embodiments, the at least one miRNA expressed in immune cells is a miR-142-3p microRNA binding site. In some embodiments, the miR-142-3p microRNA binding site comprises the sequence shown in SEQ ID NO: 69.
In some embodiments, the at least one miRNA expressed in immune cells is a miR-126 microRNA binding site. In some embodiments, the miR-126 binding site is a miR-126-3p binding site. In some embodiments, the miR-126-3p microRNA binding site comprises the sequence shown in SEQ ID NO: 74.
Non-limiting exemplary sequences for miRs to which a microRNA binding site(s) of the disclosure can bind include the following: miR-142-3p, miR-142-5p, miR-146-3p, miR-146-5p, miR-155-3p, miR-155- 5p, miR-126-3p, miR-126-5p, miR-16-3p, miR-16-5p, miR-21 -3p, miR-21 -5p, miR-223-3p, miR-223-5p, miR-24-3p, miR-24-5p, miR-27-3p, and miR-27-5p. Other suitable miR sequences expressed in immune cells (e.g., abundantly or preferentially expressed in immune cells) are known and available in the art, for example at the University of Manchester’s microRNA database, miRBase. Sites that bind any of the aforementioned miRs can be designed based on Watson-Crick complementarity to the miR, typically 100% complementarity to the miR, and inserted into an mRNA construct of the disclosure as described herein.
In some embodiments, a polynucleotide of the present disclosure (e.g., and mRNA, e.g., the 3' UTR thereof) can comprise at least one miRNA binding site to thereby reduce or inhibit accelerated blood clearance, for example by reducing or inhibiting production of IgMs, e.g., against PEG, by B cells and/or
reducing or inhibiting proliferation and/or activation of pDCs, and can comprise at least one miRNA binding site for modulating tissue expression of an encoded protein of interest. miRNA gene regulation can be influenced by the sequence surrounding the miRNA such as, but not limited to, the species of the surrounding sequence, the type of sequence (e.g., heterologous, homologous, exogenous, endogenous, or artificial), regulatory elements in the surrounding sequence and/or structural elements in the surrounding sequence. The miRNA can be influenced by the 5'UTR and/or 3'UTR. As a non-limiting example, a non-human 3'UTR can increase the regulatory effect of the miRNA sequence on the expression of a polypeptide of interest compared to a human 3' UTR of the same sequence type.
In some embodiments, other regulatory elements and/or structural elements of the 5' UTR can influence miRNA mediated gene regulation. One example of a regulatory element and/or structural element is a structured IRES (Internal Ribosome Entry Site) in the 5' UTR, which is necessary for the binding of translational elongation factors to initiate protein translation. EIF4A2 binding to this secondarily structured element in the 5'-UTR is necessary for miRNA mediated gene expression (Meijer HA et al., Science, 2013, 340, 82-85, herein incorporated by reference in its entirety). The polynucleotides of the present disclosure can further include this structured 5' UTR in order to enhance microRNA mediated gene regulation.
At least one miRNA binding site can be engineered into the 3' UTR of a polynucleotide of the present disclosure. In this context, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, or more miRNA binding sites can be engineered into a 3' UTR of a polynucleotide of the present disclosure. For example, 1 to 10, 1 to 9, 1 to 8, 1 to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3, 2, or 1 miRNA binding sites can be engineered into the 3' UTR of a polynucleotide of the present disclosure. In some embodiments, miRNA binding sites incorporated into a polynucleotide of the present disclosure can be the same or can be different miRNA sites. A combination of different miRNA binding sites incorporated into a polynucleotide of the present disclosure can include combinations in which more than one copy of any of the different miRNA sites are incorporated. In some embodiments, miRNA binding sites incorporated into a polynucleotide of the present disclosure can target the same or different tissues in the body. As a non-limiting example, through the introduction of tissue-, cell-type-, or disease-specific miRNA binding sites in the 3'-UTR of a polynucleotide of the present disclosure, the degree of expression in specific cell types (e.g., myeloid cells, endothelial cells, etc.) can be reduced.
In some embodiments, a miRNA binding site can be engineered near the 5' terminus of the 3' UTR, about halfway between the 5' terminus and 3' terminus of the 3'UTR and/or near the 3' terminus of the 3' UTR in a polynucleotide of the present disclosure. As a non-limiting example, a miRNA binding site can be engineered near the 5' terminus of the 3'UTR and about halfway between the 5' terminus and 3' terminus of the 3'UTR. As another non-limiting example, a miRNA binding site can be engineered near the 3' terminus of the 3'UTR and about halfway between the 5' terminus and 3' terminus of the 3' UTR. As yet another non-limiting example, a miRNA binding site can be engineered near the 5' terminus of the 3' UTR and near the 3' terminus of the 3' UTR.
In some embodiments, a 3'UTR can comprise 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 miRNA binding sites. The miRNA binding sites can be complementary to a miRNA, miRNA seed sequence, and/or miRNA sequences flanking the seed sequence.
In some embodiments, the expression of a polynucleotide of the present disclosure can be controlled by incorporating at least one sensor sequence in the polynucleotide and formulating the polynucleotide for administration. As a non-limiting example, a polynucleotide of the present disclosure can be targeted to a tissue or cell by incorporating a miRNA binding site and formulating the polynucleotide in a lipid nanoparticle comprising an ionizable amino lipid, including any of the lipids described herein.
A polynucleotide of the present disclosure can be engineered for more targeted expression in specific tissues, cell types, or biological conditions based on the expression patterns of miRNAs in the different tissues, cell types, or biological conditions. Through introduction of tissue-specific miRNA binding sites, a polynucleotide of the present disclosure can be designed for optimal protein expression in a tissue or cell, or in the context of a biological condition.
In some embodiments, a polynucleotide of the present disclosure can be designed to incorporate miRNA binding sites that either have 100% identity to known miRNA seed sequences or have less than 100% identity to miRNA seed sequences. In some embodiments, a polynucleotide of the present disclosure can be designed to incorporate miRNA binding sites that have at least: 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity to known miRNA seed sequences. The miRNA seed sequence can be partially mutated to decrease miRNA binding affinity and as such result in reduced downmodulation of the polynucleotide. In essence, the degree of match or mis-match between the miRNA binding site and the miRNA seed can act as a rheostat to more finely tune the ability of the miRNA to modulate protein expression. In addition, mutation in the non-seed region of a miRNA binding site can also impact the ability of a miRNA to modulate protein expression.
In some embodiments, a miRNA sequence can be incorporated into the loop of a stem loop.
In some embodiments, a miRNA seed sequence can be incorporated in the loop of a stem loop and a miRNA binding site can be incorporated into the 5' or 3' stem of the stem loop.
In some embodiments, the miRNA sequence in the 5' UTR can be used to stabilize a polynucleotide of the present disclosure described herein.
In some embodiments, a miRNA sequence in the 5' UTR of a polynucleotide of the present disclosure can be used to decrease the accessibility of the site of translation initiation such as, but not limited to a start codon. See, e.g., Matsuda et al., PLoS One. 2010 11 (5):e15057; incorporated herein by reference in its entirety, which used antisense locked nucleic acid (LNA) oligonucleotides and exonjunction complexes (EJCs) around a start codon (-4 to +37 where the A of the AUG codons is +1 ) in order to decrease the accessibility to the first start codon (AUG). Matsuda showed that altering the sequence around the start codon with an LNA or EJC affected the efficiency, length and structural stability of a polynucleotide. A polynucleotide of the present disclosure can comprise a miRNA sequence, instead of the LNA or EJC sequence described by Matsuda et al, near the site of translation initiation in order to decrease the accessibility to the site of translation initiation. The site of translation initiation can be prior to, after or within the miRNA sequence. As a non-limiting example, the site of translation initiation can be located within a miRNA sequence such as a seed sequence or binding site.
In some embodiments, a polynucleotide of the present disclosure can include at least one miRNA in order to dampen the antigen presentation by antigen presenting cells. The miRNA can be the complete miRNA sequence, the miRNA seed sequence, the miRNA sequence without the seed, or a combination thereof. As a non-limiting example, a miRNA incorporated into a polynucleotide of the present disclosure can be specific to the hematopoietic system. As another non-limiting example, a miRNA incorporated into a polynucleotide of the present disclosure to dampen antigen presentation is miR-142-3p.
In some embodiments, a polynucleotide of the present disclosure can include at least one miRNA in order to dampen expression of the encoded polypeptide in a tissue or cell of interest. As a non-limiting example a polynucleotide of the present disclosure can include at least one miR-142-3p binding site, miR- 142-3p seed sequence, miR-142-3p binding site without the seed, miR-142-5p binding site, miR-142-5p seed sequence, miR-142-5p binding site without the seed, miR-146 binding site, miR-146 seed sequence and/or miR-146 binding site without the seed sequence.
In some embodiments, a polynucleotide of the present disclosure can comprise at least one miRNA binding site in the 3'UTR in order to selectively degrade mRNA therapeutics in the immune cells to subdue unwanted immunogenic reactions caused by therapeutic delivery. As a non-limiting example, the miRNA binding site can make a polynucleotide of the present disclosure more unstable in antigen presenting cells. Non-limiting examples of these miRNAs include miR-142-5p, miR-142-3p, miR-146a-5p, and miR-146-3p.
In some embodiments, a polynucleotide of the present disclosure comprises at least one miRNA sequence in a region of the polynucleotide that can interact with an RNA binding protein.
In some embodiments, the polynucleotide of the present disclosure (e.g., a RNA, e.g., an mRNA) comprising (i) a sequence-optimized nucleotide sequence (e.g., an ORF) encoding a therapeutic polypeptide (e.g., the wild-type sequence, functional fragment, or variant thereof) and (ii) a miRNA binding site (e.g., a miRNA binding site that binds to miR-142) and/or a miRNA binding site that binds to miR-126.
13. 5' Caps
Although not required, the polynucleotides of the disclosure may contain a 5’ cap structure, if desired. It will be understood that in one embodiment, the nucleic acid molecules of the invention lack a 5’ Cap.
The 5' cap structure of a natural mRNA is involved in nuclear export, increasing mRNA stability and binds the mRNA Cap Binding Protein (CBP), which is responsible for mRNA stability in the cell and translation competency through the association of CBP with poly(A) binding protein to form the mature cyclic mRNA species. The cap further assists the removal of 5' proximal introns during mRNA splicing.
Endogenous mRNA molecules can be 5'-end capped generating a 5'-ppp-5'-triphosphate linkage between a terminal guanosine cap residue and the 5'-terminal transcribed sense nucleotide of the mRNA molecule. This 5'-guanylate cap can then be methylated to generate an N7-methyl-guanylate residue. The ribose sugars of the terminal and/or anteterminal transcribed nucleotides of the 5' end of the mRNA can optionally also be 2'-O-methylated. 5'-decapping through hydrolysis and cleavage of the guanylate cap structure can target a nucleic acid molecule, such as an mRNA molecule, for degradation.
In some embodiments, the polynucleotides of the present disclosure (e.g., a polynucleotide comprising a nucleotide sequence encoding a therapeutic polypeptide) incorporate a cap moiety. In any of the embodiments disclosed herein, a 5’ terminal cap may terminate at the 3’ end with an A or G, even if not shown in the disclosure below.
In some embodiments, polynucleotides of the present disclosure comprise a non-hydrolyzable cap structure preventing decapping and thus increasing mRNA half-life. Because cap structure hydrolysis requires cleavage of 5'-ppp-5' phosphorodiester linkages, modified nucleotides can be used during the capping reaction. For example, a Vaccinia Capping Enzyme from New England Biolabs (Ipswich, MA) can be used with a-thio-guanosine nucleotides according to the manufacturer's instructions to create a phosphorothioate linkage in the 5'-ppp-5' cap. Additional modified guanosine nucleotides can be used such as a-methyl-phosphonate and seleno-phosphate nucleotides.
Additional modifications include, but are not limited to, 2'-O-methylation of the ribose sugars of 5'- terminal and/or 5'-anteterminal nucleotides of the polynucleotide (as mentioned above) on the 2'-hydroxyl group of the sugar ring. Multiple distinct 5'-cap structures can be used to generate the 5'-cap of a nucleic acid molecule, such as a polynucleotide that functions as an mRNA molecule. Cap analogs, which herein are also referred to as synthetic cap analogs, chemical caps, chemical cap analogs, or structural or functional cap analogs, differ from natural (i.e., endogenous, wild-type or physiological) 5'-caps in their chemical structure, while retaining cap function. Cap analogs can be chemically (i.e., non-enzymatically) or enzymatically synthesized and/or linked to the polynucleotides of the present disclosure.
For example, the Anti-Reverse Cap Analog (ARCA) cap contains two guanines linked by a 5'-5'- triphosphate group, wherein one guanine contains an N7 methyl group as well as a 3'-O-methyl group (i.e., N7,3'-O-dimethyl-guanosine-5'-triphosphate-5'-guanosine (m7G-3'mppp-G; which can equivalently be designated 3' O-Me-m7G(5')ppp(5')G). The 3'-0 atom of the other, unmodified, guanine becomes linked to the 5'-terminal nucleotide of the capped polynucleotide. The N7- and 3'-O-methlyated guanine provides the terminal moiety of the capped polynucleotide.
Another exemplary cap is mCAP, which is similar to ARCA but has a 2'-O-methyl group on guanosine (i.e., N7,2'-O-dimethyl-guanosine-5'-triphosphate-5'-guanosine, m7Gm-ppp-G).
Another exemplary cap is m7G-ppp-Gm-A (i.e., N7,guanosine-5'-triphosphate-2'-O-dimethyl- guanosine-adenosine).
In some embodiments, the cap is a dinucleotide cap analog. As a non-limiting example, the dinucleotide cap analog can be modified at different phosphate positions with a boranophosphate group or a phosphoroselenoate group such as the dinucleotide cap analogs described in U.S. Patent No. US 8,519,110, the contents of which are herein incorporated by reference in its entirety.
In some embodiments, the cap is a cap analog is a N7-(4-chlorophenoxyethyl) substituted dinucleotide form of a cap analog known in the art and/or described herein. Non-limiting examples of a N7-(4-chlorophenoxyethyl) substituted dinucleotide form of a cap analog include a N7-(4- chlorophenoxyethyl)-G(5')ppp(5')G and a N7-(4-chlorophenoxyethyl)-m3' °G(5')ppp(5')G cap analog (See, e.g., the various cap analogs and the methods of synthesizing cap analogs described in Kore et al. Bioorganic & Medicinal Chemistry 2013 21 :4570-4574; the contents of which are herein incorporated by reference in its entirety). In some embodiments, a cap analog of the present disclosure is a 4- chloro/bromophenoxyethyl analog.
Polynucleotides of the present disclosure can also be capped post-manufacture (whether IVT or chemical synthesis), using enzymes, in order to generate more authentic 5'-cap structures. As used herein, the phrase "more authentic" refers to a feature that closely mirrors or mimics, either structurally or functionally, an endogenous or wild type feature. That is, a "more authentic" feature is better representative of an endogenous, wild-type, natural or physiological cellular function and/or structure as compared to synthetic features or analogs, etc., of the prior art, or which outperforms the corresponding endogenous, wild-type, natural or physiological feature in one or more respects. Non-limiting examples of more authentic 5'cap structures of the present disclosure are those that, among other things, have enhanced binding of cap binding proteins, increased half-life, reduced susceptibility to 5' endonucleases and/or reduced 5'decapping, as compared to synthetic 5'cap structures known in the art (or to a wild-type, natural or physiological 5'cap structure). For example, recombinant Vaccinia Virus Capping Enzyme and recombinant 2'-O-methyltransferase enzyme can create a canonical 5'-5'-triphosphate linkage between the 5'-terminal nucleotide of a polynucleotide and a guanine cap nucleotide wherein the cap guanine contains an N7 methylation and the 5'-terminal nucleotide of the mRNA contains a 2'-O-methyl. Such a structure is termed the Cap1 structure. This cap results in a higher translational-competency and cellular stability and a reduced activation of cellular pro-inflammatory cytokines, as compared, e.g., to other 5'cap analog structures known in the art. Cap structures include, but are not limited to, 7mG(5')ppp(5')N1 pN2p (cap 0), 7mG(5')ppp(5')N1 mpNp (cap 1 ), and 7mG(5')-ppp(5')N1 mpN2mp (cap 2).
As a non-limiting example, capping chimeric polynucleotides post-manufacture can be more efficient as nearly 100% of the chimeric polynucleotides can be capped. This is in contrast to -80% when a cap analog is linked to a chimeric polynucleotide in the course of an in vitro transcription reaction.
According to the present disclosure, 5' terminal caps can include endogenous caps or cap analogs. According to the present disclosure, a 5' terminal cap can comprise a guanine analog. Useful guanine analogs include, but are not limited to, inosine, N1 -methyl-guanosine, 2'fluoro-guanosine, 7- deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine.
Also provided herein are exemplary caps including those that can be used in co-transcriptional capping methods for ribonucleic acid (RNA) synthesis, using RNA polymerase, e.g., wild type RNA polymerase or variants thereof, e.g., such as those variants described herein. In some embodiments, caps can be added when RNA is produced in a “one-pot” reaction, without the need for a separate capping reaction. Thus, the methods, in some embodiments, comprise reacting a polynucleotide template with an RNA polymerase variant, nucleoside triphosphates, and a cap analog under in vitro transcription reaction conditions to produce RNA transcript.
As used here the term “cap” includes the inverted G nucleotide and can comprise one or more additional nucleotides 3’ of the inverted G nucleotide, e.g., 1 , 2, 3, or more nucleotides 3’ of the inverted G nucleotide and 5’ to the 5’ UTR, e.g., a 5’ UTR described herein.
Exemplary caps comprise a sequence of GG, GA, or GGA, wherein the underlined, italicized G is an in inverted G nucleotide followed by a 5’-5’-triphosphate group.
In some embodiments, a cap comprises a compound of Formula (C-l)
ring Bi is a modified or unmodified Guanine; ring B2 and ring B3 each independently is a nucleobase or a modified nucleobase;
X2 is O, S(O)P, NR24 or CR25R26 in which p is 0, 1 , or 2;
Y0 is O or CR6R7;
Y1 is O, S(O)n, CR6R7, or NRs, in which n is 0, 1 , or 2; each — is a single bond or absent, wherein when each — is a single bond, Yi is O, S(O)n, CR6R7, or NRs; and when each — is absent, Y1 is void;
Y2 is (OP(O)R4)m in which m is 0, 1 , or 2, or -0-(CR40R41)u-Q0-(CR42R4s)v-, in which Q0 is a bond, O, S(O)r, NR44, or CR45R46, r is 0, 1 , or 2, and each of u and v independently is 1 , 2, 3 or 4; each R2 and R2' independently is halo, LNA, or OR3; each R3 independently is H, C1-C6 alkyl, C2-C6 alkenyl, or C2-C6 alkynyl and R3, when being C1-C6 alkyl, C2-C6 alkenyl, or C2-C6 alkynyl, is optionally substituted with one or more of halo, OH and C1-C6 alkoxyl that is optionally substituted with one or more OH or OC(O)- C1-C6 alkyl; each R4 and R4' independently is H, halo, C1-C6 alkyl, OH, SH, SeH, or BHs-; each of Re, R7, and Rs, independently, is -Q1-T1 , in which Qi is a bond or C1-C3 alkyl linker optionally substituted with one or more of halo, cyano, OH and C1-C6 alkoxy, and T1 is H, halo, OH, COOH, cyano, or Rs1 , in which Rs1 is C1-C3 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, Ci- Ce alkoxyl, C(O)O-Ci- Ce alkyl, C3-C8 cycloalkyl, C6-C10 aryl, NR31 R32, (NRs1 R32R33)+, 4 to 12- membered heterocycloalkyl, or 5- or 6-membered heteroaryl, and Rs1 is optionally substituted with one or more substituents selected from the group consisting of halo, OH, oxo, C1-C6 alkyl, COOH, C(O)O- C1-C6 alkyl, cyano, C1-C6 alkoxyl, NR31 R32, (NR31 R32R33)+, C3-C8 cycloalkyl, C6-C10 aryl, 4 to 12-membered heterocycloalkyl, and 5- or 6- membered heteroaryl;
each of R10, R11 , R12, R13 R14, and R15, independently, is - Q2-T2, in which Q2 is a bond or C1- C3 alkyl linker optionally substituted with one or more of halo, cyano, OH and C1-C6 alkoxy, and T2 is H, halo, OH, NH2, cyano, NO2, N3, RS2, or O RS2, in which RS2 is C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3- C8 cycloalkyl, C6-C10 aryl, NHC(O)- C1-C6 alkyl, NR31 R32, (NRs1 R32R33)+, 4 to 12-membered heterocycloalkyl, or 5- or 6-membered heteroaryl, and RS2 is optionally substituted with one or more substituents selected from the group consisting of halo, OH, oxo, C1-C6 alkyl, COOH, C(O)O-C1-C6 alkyl, cyano, C1-C6 alkoxyl, NR31 R32, (NRs1 R32R33)+, C3-C8 cycloalkyl, C6-C10 aryl, 4 to 12-membered heterocycloalkyl, and 5- or 6- membered heteroaryl; or alternatively R12 together with R14 is oxo, or R13 together with R15 is oxo, each of R20, R21 , R22, and R23 independently is -Q3-T3, in which Q3 is a bond or C1-C3 alkyl linker optionally substituted with one or more of halo, cyano, OH and C1-C6 alkoxy, and T3 is H, halo, OH, NH2, cyano, NO2, N3, Rs3, or O Rs3, in which Rs3 is C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C8 cycloalkyl, C6-C10 aryl, NHC(O)-C1-C6 alkyl, mono-C1-C6 alkylamino, di-C1-C6 alkylamino, 4 to 12-membered heterocycloalkyl, or 5- or 6-membered heteroaryl, and Rs3 is optionally substituted with one or more substituents selected from the group consisting of halo, OH, oxo, C1-C6 alkyl, COOH, C(O)O-C1-C6 alkyl, cyano, C1-C6 alkoxyl, amino, mono-C1-C6 alkylamino, di-C1-C6 alkylamino, C3-C8 cycloalkyl, C6-C10 aryl, 4 to 12-membered heterocycloalkyl, and 5- or 6-membered heteroaryl; each of R24, R25, and R26 independently is H or C1-C6 alkyl; each of R27 and R28 independently is H or O R29; or R27 and R28 together form O-R30-O; each R29 independently is H, C1-C6 alkyl, C2-C6 alkenyl, or C2-C6 alkynyl and R29, when being C1-C6 alkyl, C2-C6 alkenyl, or C2-C6 alkynyl, is optionally substituted with one or more of halo, OH and C1-C6 alkoxyl that is optionally substituted with one or more OH or OC(O)-C1-C6 alkyl; R30 is C1-C6 alkylene optionally substituted with one or more of halo, OH and C1-C6 alkoxyl; each of R31, R32, and R33, independently is H, C1-C6 alkyl, C3-C8 cycloalkyl, C6-C10 aryl, 4 to 12- membered heterocycloalkyl, or 5- or 6-membered heteroaryl; each of R40, R41 , R42, and R43 independently is H, halo, OH, cyano, N3, OP(O)R47R4s, or C1-C6 alkyl optionally substituted with one or more OP(O)R47R48, or one R41 and one R43, together with the carbon atoms to which they are attached and Q0, form C4-C10 cycloalkyl, 4- to 14-membered heterocycloalkyl, C6-C10 aryl, or 5- to 14-membered heteroaryl, and each of the cycloalkyl, heterocycloalkyl, phenyl, or 5- to 6-membered heteroaryl is optionally substituted with one or more of OH, halo, cyano, N3, oxo, OP(O)R47R48, C1-C6 alkyl, C1-C6 haloalkyl, COOH, C(O)O-C1-C6 alkyl, C1-C6 alkoxyl, C1-C6 haloalkoxyl, amino, mono-C1-C6 alkylamino, and di-C1-C6 alkylamino; R44 is H, C1-C6 alkyl, or an amine protecting group; each of R45 and R46 independently is H, OP(O)R47R4s, or C1-C6 alkyl optionally substituted with one or more OP(O)R47R48, and each of R47 and R48, independently is H, halo, C1-C6 alkyl, OH, SH, SeH, or BHs-.
It should be understood that a cap analog, as provided herein, may include any of the cap analogs described in international publication WO 2017/066797, published on 20 April 2017, incorporated by reference herein in its entirety.
In some embodiments, the B2 middle position can be a non-ribose molecule, such as arabinose.
In some embodiments R2 is ethyl-based.
Thus, in some embodiments, a cap comprises the following structure:
(C-ll)
In other embodiments, a cap comprises the following structure:
(C-lll)
In yet other embodiments, a cap comprises the following structure:
(C-IV)
In still other embodiments, a cap comprises the following structure:
(C-V)
In some embodiments, R is an alkyl (e.g., C1-C6 alkyl). In some embodiments, R is a methyl group (e.g., Ci alkyl). In some embodiments, R is an ethyl group (e.g., C2 alkyl).
In some embodiments, a cap comprises a sequence selected from the following sequences: GAA, GAC, GAG, GAU, GCA, GCC, GCG, GCU, GGA , GGC, GGG, GGU, GUA, GUC, GUG, and GUU.
In some embodiments, a cap comprises GAA. In some embodiments, a cap comprises GAC. In some embodiments, a cap comprises GAG. In some embodiments, a cap comprises GAU. In some embodiments, a cap comprises GCA. In some embodiments, a cap comprises GCC. In some embodiments, a cap comprises GCG. In some embodiments, a cap comprises GCU. In some embodiments, a cap comprises GGA. In some embodiments, a cap comprises GGC. In some embodiments, a cap comprises GGG. In some embodiments, a cap comprises GGU. In some
embodiments, a cap comprises GUA. In some embodiments, a cap comprises GUC. In some embodiments, a cap comprises GUG. In some embodiments, a cap comprises GUU.
In some embodiments, a cap comprises a sequence selected from the following sequences: m7GpppApA, m7GpppApC, m7GpppApG, m7GpppApU, m7GpppCpA, m7GpppCpC, m7GpppCpG, m7GpppCpU, m7GpppGpA, m7GpppGpC, m7GpppGpG, m7GpppGpU, m7GpppUpA, m7GpppUpC, m7GpppUpG, and m7GpppUpU.
In some embodiments, a cap comprises m7GpppApA. In some embodiments, a cap comprises m7GpppApC. In some embodiments, a cap comprises m7GpppApG. In some embodiments, a cap comprises m7GpppApU. In some embodiments, a cap comprises m7GpppCpA. In some embodiments, a cap comprises m7GpppCpC. In some embodiments, a cap comprises m7GpppCpG. In some embodiments, a cap comprises m7GpppCpU. In some embodiments, a cap comprises m7GpppGpA. In some embodiments, a cap comprises m7GpppGpC. In some embodiments, a cap comprises m7GpppGpG. In some embodiments, a cap comprises m7GpppGpU. In some embodiments, a cap comprises m7GpppUpA. In some embodiments, a cap comprises m7GpppUpC. In some embodiments, a cap comprises m7GpppUpG. In some embodiments, a cap comprises m7GpppUpU.
A cap, in some embodiments, comprises a sequence selected from the following sequences: m7G3'OMepppApA, m7G3'OMepppApC, m7G3'OMepppApG, m7G3'OMepppApU, m7G3'OMepppCpA, m7G3'OMePPpCpC, m7G3'OMePPpCpG, m7G3'OMePPpCpU, m7G3'OMePPpGpA, m7G3'OMePPpGpC, m7G3'OMepppGpG, m7G3'OMepppGpU, m7G3'OMepppUpA, m7G3'OMepppUpC, m7G3'OMepppUpG, and m7G3'OMePPpUpU.
In some embodiments, a cap comprises m7G3'OMepppApA. In some embodiments, a cap comprises m7G3'OMepppApC. In some embodiments, a cap comprises m7G3'OMepppApG. In some embodiments, a cap comprises m7G3'OMepppApU. In some embodiments, a cap comprises m7G3'OMepppCpA. In some embodiments, a cap comprises m7G3'OMepppCpC. In some embodiments, a cap comprises m7G3'OMepppCpG. In some embodiments, a cap comprises m7G3'OMepppCpU. In some embodiments, a cap comprises m7G3'OMepppGpA. In some embodiments, a cap comprises m7G3'OMepppGpC. In some embodiments, a cap comprises m7G3'OMepppGpG. In some embodiments, a cap comprises m7G3'OMepppGpU. In some embodiments, a cap comprises m7G3'OMepppUpA. In some embodiments, a cap comprises m7G3'OMepppUpC. In some embodiments, a cap comprises m7G3'OMepppUpG. In some embodiments, a cap comprises m7G3'OMepppUpU.
In some embodiments, a cap comprises a sequence selected from the following sequences: m7G3'OMePPpA2'OMepA, m7G3'OMePPpA2'OMepC, m7G3'OMePPpA2'OMepG , m7G3'OMePPpA2'OMepU, m7G3'OMePPpC2'OMepA, m7G3'OMepppC2'OMepC, m7G3'OMepppC2'OMepG, m7G3'OMePPpC2'OMepU, m7G3'OMePPpG2'OMepA, m7G3'OMepppC2'OMepC, m7G3'OMePPpC2'OMepG , m7G3'OMepppC2'OMepU, m7G3'OMePPpU2'OMepA, m7G3'OMePPpU2'OMepC, m7G3'OMePPpU2'OMepG, and m7G3'OMepppU2'OMepU.
In some embodiments, a cap comprises m7G3'OMepppA2'OMepA. In some embodiments, a cap comprises m7G3'OMepppA2'OMepC. In some embodiments, a cap comprises m7G3'OMepppA2'OMepG. In some embodiments, a cap comprises m7G3'OMepppA2'OMepU. In some embodiments, a cap comprises m7G3'OMepppC2'OMepA. In some embodiments, a cap comprises m7G3'OMepppC2'OMepC. In some embodiments, a cap comprises m7G3'OMepppC2'OMepG. In some embodiments, a cap comprises
m7G3'OMepppC2'OMepU. In some embodiments, a cap comprises m7G3'OMepppG2'OMepA. In some embodiments, a cap comprises m7G3'OMepppG2'OMepC. In some embodiments, a cap comprises m7G3'OMepppC2'OMepG . In some embodiments, a cap comprises m7G3'OMepppG2'OMepU. In some embodiments, a cap comprises m7G3'OMepppU2'OMe pA. In some embodiments, a cap comprises m7G3'OMepppU2'OMepC. In some embodiments, a cap comprises m7G3'OMepppU2'OMepG. In some embodiments, a cap comprises m7G3 OMepppU2'OMepU.
A cap, in still other embodiments, comprises a sequence selected from the following sequences: m7GpppA2'OMepA, m7GpppA2'OMepC, m7GpppA2'OMepG, m7GpppA2'OMepU, m7GpppC2'OMepA, m7GpppC2'OMepC, m7GpppC2'OMepG, m7GpppC2'OMepU, m7GpppC2'OMepA, m7GpppC2'OMepC, m7GpppG2-0MepG, m7GpppC2'OMepU, m7GpppU2'OMepA, m7GpppU2'OMepC, m7GpppU2'OMepG, and m7GpppU2'OMepU.
In some embodiments, a cap comprises m7GpppA2'OMepA. In some embodiments, a cap comprises m7GpppA2'OMepC. In some embodiments, a cap comprises m7GpppA2'OMepG. In some embodiments, a cap comprises m7GpppA2'OMepU. In some embodiments, a cap comprises m7GpppC2'OMepA. In some embodiments, a cap comprises m7GpppC2'OMepC. In some embodiments, a cap comprises m7GpppC2'OMepG. In some embodiments, a trinucleotide cap comprises m7GpppC2'OMepU. In some embodiments, a cap comprises m7GpppG2'OMepA. In some embodiments, a cap comprises m7GpppG2'OMepC. In some embodiments, a cap comprises m7GpppG2'OMepG. In some embodiments, a cap comprises m7GpppG2'OMepU. In some embodiments, a cap comprises m7GpppU2'OMepA. In some embodiments, a cap comprises m7GpppU2'OMepC. In some embodiments, a cap comprises m7GpppU2'OMepG. In some embodiments, a cap comprises m7GpppU2'OMepU.
In some embodiments, a cap comprises m7Gpppm6A2'OMepG. In some embodiments, a cap comprises m7Gpppe6A2'OMepG.
In some embodiments, a cap comprises GAG. In some embodiments, a cap comprises GCG. In some embodiments, a cap comprises GUG. In some embodiments, a cap comprises GGG.
In some embodiments, a cap comprises any one of the following structures:
In some embodiments, the cap comprises m7GpppN1N2N3, where N1, N2, and N3 are optional (i.e., can be absent or one or more can be present) and are independently a natural, a modified, or an unnatural nucleoside base. In some embodiments, m7G is further methylated, e.g., at the 3’ position. In some embodiments, the m7G comprises an O-methyl at the 3’ position. In some embodiments N1, N2, and N3 if present, optionally, are independently an adenine, a uracil, a guanidine, a thymine, or a cytosine. In some embodiments, one or more (or all) of N1, N2, and N3, if present, are methylated, e.g., at the 2’ position. In some embodiments, one or more (or all) of N1, N2, and N3, if present have an O-methyl at the 2’ position. In some embodiments, the cap comprises the following structure:
(C-IX) wherein Bi, B2, and B3 are independently a natural, a modified, or an unnatural nucleoside based; and R1, R2, R3, and R4 are independently OH or O-methyl. In some embodiments, R3 is O-methyl and R4 is OH. In some embodiments, R3 and R4 are O-methyl. In some embodiments, R4 is O-methyl. In some embodiments, R1 is OH, R2 is OH, R3 is O-methyl, and R4 is OH. In some embodiments, R1 is OH, R2 is
OH, R3 is O-methyl, and R4 is O-methyl. In some embodiments, at least one of R1 and R2 is O-methyl, R3 is O-methyl, and R4 is OH. In some embodiments, at least one of R1 and R2 is O-methyl, R3 is O-methyl, and R4 is O-methyl.
In some embodiments, Bi, B3, and B3 are natural nucleoside bases. In some embodiments, at least one of B1 , B2, and B3 is a modified or unnatural base. In some embodiments, at least one of Bi , B2, and B3 is N6-methyladenine. In some embodiments, Bi is adenine, cytosine, thymine, or uracil. In some embodiments, Bi is adenine, B2 is uracil, and B3 is adenine. In some embodiments, R1 and R2 are OH, R3 and R4 are O-methyl, Bi is adenine, B2 is uracil, and B3 is adenine.
In some embodiments the cap comprises a sequence selected from the following sequences: GAAA, GACA, GAGA, GAUA, GCAA, GCCA, GCGA, GCUA, GGAA, GGCA, GGGA, GGUA, GUCA, and GUUA. In some embodiments the cap comprises a sequence selected from the following sequences: GAAG, GACG, GAGG, GAUG, GCAG, GCCG, GCGG, GCUG, GGAG, GGCG, GGGG, GGUG, GUCG, GUGG, and GUUG. In some embodiments the cap comprises a sequence selected from the following sequences: GAAU, GACU, GAGU, GAUU, GCAU, GCCU, GCGU, GCUU, GGAU, GGCU, GGGU, GGUU, GUAU, GUCU, GUGU, and GUUU. In some embodiments the cap comprises a sequence selected from the following sequences: GAAC, GACC, GAGC, GAUC, GCAC, GCCC, GCGC, GCUC, GGAC, GGCC, GGGC, GGUC, GUAC, GUCC, GUGC, and GUUC.
A cap, in some embodiments, comprises a sequence selected from the following sequences: m7G3'OMePPpApApN, m7G3 OMePPpApCpN, m7G3'OMePPpApGpN, m7G3'OMePPpApUpN, m7G3'OMePPpCpApN, m7G3'OMepppCpCpN, m7G3'OMepppCpGpN, m7G3'OMepppCpUpN, m7G3'OMepppGpApN, m7G3'OMepppGpCpN, m7G3'OMepppGpGpN, m7G3'OMepppGpUpN, m7G3'OMepppUpApN, m7G3'OMepppUpCpN, m7G3'OMepppUpGpN, and m7G3'OMepppUpUpN, where N is a natural, a modified, or an unnatural nucleoside base.
A cap, in some embodiments, comprises a sequence selected from the following sequences: m7G3'OMePPpA2'OMepApN, m7G3'OMePPpA2'OMepCpN, m7G3'OMePPpA2'OMepGpN, m7G3'OMePPpA2'OMepUpN, m7G3'OMepppC2'OMepApN, m7G3'OMepppC2'OMepCpN, m7G3'OMepppC2'OMepGpN, m7G3'OMepppC2'OMepUpN, m7G3'OMePPpC2'OMepApN, m7G3'OMepppC2'OMepCpN, m7G3'OMePPpC2'OMepGpN, m7G3'OMepppC2'OMepUpN, m7G3'OMepppU2'OMepApN, m7G3'OMepppl2'OMe pCpN, m7G3'OMepppU2'OMepGpN, and m7G3'OMepppU2'OMepUpN, where N is a natural, a modified, or an unnatural nucleoside base.
A cap, in some embodiments, comprises a sequence selected from the following sequences: m7GpppA2'OMepApN, m7GpppA2'OMepCpN, m7GpppA2'OMepGpN, m7GpppA2'OMepUpN, m7GpppC2'OMepApN, m7GpppC2'OMepCpN, m7GpppC2'OMepGpN, m7GpppC2'OMepUpN, m7GpppG2'OMepApN, m7GpppG2'OMepCpN, m7GpppG2'OMepGpN, m7GpppG2'OMepUpN, m7GpppU2'OMepApN, m7GpppU2'OMepCpN, m7GpppU2'OMepGpN, and m7GpppU2'OMepUpN, where N is a natural, a modified, or an unnatural nucleoside base.
A cap, in some embodiments, comprises a sequence selected from the following sequences: m7G3'OMepppA2'OMepA2'OMepN, m7G3'OMepppA2'OMepC2'OMepN, m7G3'OMepppA2'OMepC2'OMepN , m7G3'OMepppA2'OMepU2'OMepN , m7G3'OMepppC2'OMepA2'OMepN , m7G3'OMepppC2'OMepC2'OMepN , m7G3'OMepppC2'OMepC2'OMepN , m7G3'OMepppC2'OMepU2'OMepN , m7G3'OMepppC2'OMepA2'OMepN , m7G3'OMepppC2'OMepC2'OMepN , m7G3'OMepppC2'OMepC2'OMepN , m7G3'OMepppC2'OMepU2'OMepN ,
m7G3'OMePPpU2'OMepA2'OMepN, m7G3'OMepppU2'OMepC2'OMepN, m7G3'OMepppU2'OMepC2'OMepN, and m7G3'OMepppU2'OMepU2'OMepN, where N is a natural, a modified, or an unnatural nucleoside base.
A cap, in some embodiments, comprises a sequence selected from the following sequences: m7GpppA2'OMepA2'OMepN, m7GpppA2'OMepC2'OMepN, m7GpppA2'OMepC2'OMepN, m7GpppA2'OMepU2'OMepN, m7GpppC2'OMepA2'OMepN, m7GpppC2'OMepC2'OMepN, m7GpppC2'OMepC2'OMepN, m7GpppC2'OMepU2'OMepN, m7GpppC2'OMepA2'OMepN, m7GpppC2'OMepC2'OMepN, m7GpppC2'OMepC2'OMepN, m7GpppC2'OMepU2'OMepN, m7GpppU2'OMepA2'OMepN, m7GpppU2'OMepC2'OMepN, m7GpppU2'OMepC2'OMepN, and m7GpppU2'OMepU2'OMepN, where N is a natural, a modified, or an unnatural nucleoside base.
In some embodiments, a cap comprises GGAG. In some embodiments, a cap comprises the following structure:
14. Modified 5’ and 3’ Stabilizing Regions
The IRES elements of the disclosure may, e.g., be incorporated into a nucleic acid containing a 5’ stabilizing region and/or a 3’ stabilizing region. In some embodiments, the nucleic acids of the invention include a 5’ and/or 3'-stabi lizing region including one or more nucleosides (e.g., 1 to 500 nucleosides such as 1 to 200, 1 to 400, 1 to 10, 5 to 15, 10 to 20, 15 to 25, 20 to 30, 25 to 35, 30 to 40, 35 to 45, 40 to 50, 45 to 65, 50 to 70, 65 to 85, 70 to 90, 85 to 1 05, 90 to 1 10, 1 05 to 135, 120 to 150, 130 to 170, 150 to 200 or 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 1 1 0, 120, 130, 140, 150, 1 60, 170, 180, 190, or 200 nucleosides). In some embodiments, the 5’ and/or 3'-stabil izing region contains one or more chemically modified nucleosides, such as a nucleoside having an alternative nucleobase, sugar, or backbone (e.g., a 2'-deoxynucleoside, a 3'-deoxynucleoside, a 2',3'-dideoxynucleoside, a 2'-O- methylnucleoside, a 3'-O-methylnucleoside, a 3'-O-ethyl-nucleoside, 3'-arabinoside, an L-nucleoside, alpha-thio-2'-O-methyl-adenosine, 2'-fluoro-adenosine, arabino-adenosine, hexitol-adenosine, LNA- adenosine, PNA-adenosine, inverted thymidine, or 3'-azido-2',3'-dideoxyadenosine). In some embodiments, the 5’ and/or 3'-stabilizing region includes a plurality of alternative nucleosides. In some embodiments, the 5’ and/or 3’-stabilizing region includes at least one non-nucleoside (e.g., an abasic ribose) at the 5’-terminus, the 3’-terminus, or at an internal position of the 5’ and/or 3’-stabilizing region.
In some embodiments, the 5’ and/or 3'-stabl izing region consists of one nucleoside (e.g., a 2'- deoxynucleoside, a 3'-deoxynucleoside, a 2',3'-dideoxynucleoside, a 2'-O-methylnucleoside, a 3'-O- methylnucleoside, a 3'-O-ethyl-nucleoside, 3'-arabinoside, an L-nucleoside, alpha-thio-2'-O-methyl- adenosine, 2'-fluoro-adenosine, arabino-adenosine, hexitol-adenosine, LNA-adenosine, PNA-adenosine, inverted thymidine, or 3'-azido-2',3'-dideoxyadenosine).
In some embodiments, one or more nucleosides in the 5’ and/or 3'-stabilizing region include the structure:
wherein B1 is a nucleobase; each U and U’ is, independently, O, S, N(Ru)nu, or C(Ru)nu, wherein nu is 1 or 2 (e.g., 1 for N(Ru)nu and 2 for C(Ru)nu) and each Ru is, independently, H, halo, or optionally substituted C1-C6 alkyl; each of R1 , R1’, R1", R2, R2’, R2", R3, R4, and R5 is, independently, H, halo, hydroxy, thiol, optionally substituted C1-C6 alkyl, optionally substituted C2-C6 alkynyl, optionally substituted C1-C6 heteroalkyl, optionally substituted C2-C6 heteroalkenyl, optionally substituted C2-C6 heteroalkynyl, optionally substituted amino, azido, optionally substituted C6-C10 aryl; or R3 and/or R5 can join together with one of R1 , R1’, R1", R2, R2’, or R2"to form together with the carbons to which they are attached an optionally substituted C3-C10 carbocycle or an optionally substituted C3-C9 heterocyclyl; each of m and n is independently, 0, 1 , 2, 3, 4, or 5; each of Y1 , Y2, and Y3, is, independently, O, S, Se, -NRN1-, optionally substituted C1-C6 alkylene, or optionally substituted C1-C6 heteroalkylene, wherein RN1 is H, optionally substituted C1-C6 alkyl, optionally substituted C2-C6 alkenyl, optionally substituted C2-C6 alkynyl, or optionally substituted Ce-Cw aryl; and each Y4 is, independently, H, hydroxy, protected hydroxy, halo, thiol, boranyl, optionally substituted C1-C6 alkyl, optionally substituted C2-C6 alkenyl, optionally substituted C2-C6 alkynyl, optionally substituted C1-C6 heteroalkyl, optionally substituted C2-C6 heteroalkenyl, optionally substituted C2-C6 heteroalkynyl, or optionally substituted amino; and
Y5 is O, S, Se, optionally substituted C1-C6 alkylene, or optionally substituted C1-C6 heteroalkylene; or is a salt thereof.
In some embodiments, the 5’ and/or 3'-stabi lizing region includes a plurality of adenosines. In some embodiments, all of the nucleosides of the 5’ and/or 3'-stabilizing region are adenosines. In some embodiments, the 5’ and/or 3'-stabilizing region includes at least one (e.g., at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, or at least ten) alternative nucleosides (e.g., an L-nucleoside such as L-adenosine, 2'-O-methyl-adenosine, alpha-thio-2'-O-methyl-
adenosine, 2'-fluoro-adenosine, arabino-adenosine, hexitol-adenosine, LNA-adenosine, PNA-adenosine, or inverted thymidine). In some embodiments, the alternative nucleoside is an L-adenosine, a 2'-O- methyl-adenosine, or an inverted thymidine. In some embodiments, the 5’ and/or 3'-stabi lizing region includes a plurality of alternative nucleosides. In some embodiments, all of the nucleotides in the 3'- stabilizing region are alternative nucleosides. In some embodiments, the 5’ and/or 3'-stabilizing region includes at least two different alternative nucleosides. In some embodiments, at least one alternative nucleoside is 2'-O-methyl-adenosine. In some embodiments, at least one alternative nucleoside is inverted thymidine. In some embodiments, at least one alternative nucleoside is 2'-O-methyl-adenosine, and at least one alternative nucleoside is inverted thymidine.
In some embodiments, the stabilizing region includes the structure:
Formula XI or a salt thereof; wherein each X is, independently O or S; and
A represents adenine and T represents thymine.
In some embodiments, each X is O. In some embodiments, each X is S.
In some embodiments, all of the plurality of alternative nucleosides are the same (e.g., all of the alternative nucleosides are L-adenosine). In some embodiments, the 5’ and/or 3’-stabi lizing region includes ten nucleosides. In some embodiments, the 5’ and/or 3’-stabilizi ng region includes eleven nucleosides. In some embodiments, the 5’ and/or 3’-stabi lizing region comprises at least five L- adenosines (e.g., at least ten L-adenosines, or at least twenty L-adenosines). In some embodiments, the 5’ and/or 3’-stabi lizing region consists of five L-adenosines. In some embodiments, the 5’ and/or 3’- stabilizing region consists of ten L-adenosines. In some embodiments, the 5’ and/or 3’-stabilizing region consists of twenty L-adenosines.
Further examples of 5’ and/or 3’-stabilized regions are known in the art, e.g., as described in International Patent Publication Nos. WO2013/103659, WO2017/049275, and WO2017/049286, the 5’ and/or 3’-stabilized regions of which are herein incorporated by references.
In some embodiments, the 5'-terminus of the 3'-stabilizing region is conjugated to the 3'-terminus of the 3'-UTR. In some embodiments, the 5'-terminus of the 3'-stabil izing region is conjugated to the 3'- terminus of the poly-A region. In some embodiments, the 5'-terminus of the 3'-stabil izing region is conjugated to the 3'-terminus of the poly-C region. In some embodiments of any of the foregoing polynucleotides, the 3'-stabil izing region includes the 3'-terminus of the polynucleotide.
In some embodiments, the 3'-terminus of the 5'-stabilizing region is conjugated to the 5'-terminus of the 5'-UTR. In some embodiments, the 5'-stabilizing region includes the 5'-terminus of the polynucleotide.
In some embodiments, the 5’ and/or 3’-stabilizi ng tail is conjugated to the remainder of the polynucleotide, e.g., via a phosphate linkage. In some embodiments, the phosphate linkage is a natural
phosphate linkage. In some embodiments, the conjugation of the 5’ and/or 3’-stabilizing region and the remainder of the polynucleotide is produced via enzymatic or splint ligation.
In some embodiments, the 5’ and/or 3’-stabilizi ng tail is conjugated to the remainder of the polynucleotide, e.g., via a chemical linkage. In some embodiments, the chemical linkage includes the structure of Formula XII:
Formula XII wherein a, b, c, e, f, and g are each, independently, 0 or 1 ; d is 0, 1 , 2, or 3; each of R6, R8, R10, and R12, is, independently, optionally substituted C1-C6 alkylene, optionally substituted C1-C6 heteroalkylene, optionally substituted C2-C6 alkenylene, optionally substituted C2-C6 alkynylene, or optionally substituted C6-C10 arylene, O, S, Se, and NR13;
R7 and R11 are each, independently, carbonyl, thiocarbonyl, sulfonyl, or phosphoryl, wherein, if R7 is phosphoryl, -(R9)d- is a bond, and e, f, and g are 0, then at least one of R6 or R8 is not O; and if R11 is phosphoryl, -(R9)d- is a bond, and a, b, and c are 0, then at least one of R10 or R12 is not O; each R9 is optionally substituted C1-C10 alkylene, optionally substituted C2-C10 alkenylene, optionally substituted C2-C10 alkynylene, optionally substituted C2-C10 heterocyclylene, optionally substituted C6-C12 arylene, optionally substituted C2-C100 polyethylene glycolene, or optionally substituted C1-C10 heteroalkylene, or a bond linking (R6)a-(R7)b-(R8)c to (R10)e-(R11 )f-(R12)g, wherein if -(R9)d- is a bond, then at least one of a, b, c, e, f, or g is 1 ; and
R13 is hydrogen, optionally substituted C1-C4 alkyl, optionally substituted C2-C4 alkenyl, optionally substituted C2-C4 alkynyl, optionally substituted C2-C6 heterocyclyl, optionally substituted C6-C12 aryl, or optionally substituted C1- C7 heteroalkyl.
In some embodiments, the chemical linkage comprises the structure of Formula XIII:
Formula XIII wherein B1 is a nucleobase, hydrogen, halo, hydroxy, thiol, optionally substituted C1-C6 alkyl, optionally substituted C2-C6 alkenyl, optionally substituted C2-C6 alkynyl, optionally substituted C1-C6 heteroalkyl, optionally substituted C2-C6 heteroalkenyl, optionally substituted C2-C6 heteroalkynyl, optionally substituted amino, azido, optionally substituted C3-C10 cycloalkyl, optionally substituted Ce-Cw aryl, optionally substituted C2-C9 heterocycle; and
R14 and R15 are each, independently, hydrogen or hydroxy.
In some embodiments, the chemical linkage includes the structure:
Further examples of chemical linkages to conjugate 5’ and/or 3’-stabilized regions to the remainder of the polynucleotide are known in the art, e.g., as described in International Patent Publication Nos. WO2017/049275 and WO2017/049286, the chemical linkers of which are herein incorporated by reference.
15. Poly-A Tails
In some embodiments, the polynucleotides of the present disclosure (e.g., a polynucleotide comprising a nucleotide sequence encoding a therapeutic polypeptide) further comprise a poly-A tail. In some embodiments, terminal groups on the poly-A tail can be incorporated for stabilization. In some embodiments, a poly-A tail comprises des-3' hydroxyl tails.
During RNA processing, a long chain of adenine nucleotides (poly-A tail) can be added to a polynucleotide (e.g., an mRNA molecule) in order to increase stability. Immediately after transcription, the 3' end of the transcript can be cleaved to free a 3' hydroxyl. Then poly-A polymerase adds a chain of adenine nucleotides to the RNA. The process, called polyadenylation, adds a poly-A tail that can be between, for example, approximately 80 to approximately 250 residues long, including approximately 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240 or 250 residues long. In some embodiments, the poly-A tail is 100 nucleotides in length.
PolyA tails can also be added after the construct is exported from the nucleus.
According to the present disclosure, terminal groups on the poly A tail can be incorporated for stabilization. Polynucleotides of the present disclosure can include des-3' hydroxyl tails. They can also include structural moieties or 2'-O-methyl modifications as taught by Junjie Li, et al. (Current Biology, vol. 15, 1501-1507, August 23, 2005), the contents of which are incorporated herein by reference in its entirety).
The polynucleotides of the present disclosure can be designed to encode transcripts with alternative polyA tail structures including histone mRNA. According to Norbury, "Terminal uridylation has also been detected on human replication-dependent histone mRNAs. The turnover of these mRNAs is thought to be important for the prevention of potentially toxic histone accumulation following the completion or inhibition of chromosomal DNA replication. These mRNAs are distinguished by their lack of a 3' poly(A) tail, the function of which is instead assumed by a stable stem-loop structure and its cognate stem-loop binding protein (SLBP); the latter carries out the same functions as those of PABP on polyadenylated mRNAs" (Norbury, "Cytoplasmic RNA: a case of the tail wagging the dog," Nature Reviews Molecular Cell Biology; AOP, published online 29 August 2013; doi :10.1038/nrm3645), the contents of which are incorporated herein by reference in its entirety.
Unique poly-A tail lengths provide certain advantages to the polynucleotides of the present disclosure. Generally, the length of a poly-A tail, when present, is greater than 30 nucleotides in length. In some embodiments, the poly-A tail is greater than 35 nucleotides in length (e.g., at least or greater than about 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1 ,000, 1 ,100, 1 ,200, 1 ,300, 1 ,400, 1 ,500, 1 ,600, 1 ,700, 1 ,800, 1 ,900, 2,000, 2,500, and 3,000 nucleotides).
In some embodiments, the polynucleotide or region thereof includes from about 30 to about 3,000 nucleotides (e.g., from 30 to 50, from 30 to 100, from 30 to 250, from 30 to 500, from 30 to 750, from 30 to 1 ,000, from 30 to 1 ,500, from 30 to 2,000, from 30 to 2,500, from 50 to 100, from 50 to 250, from 50 to 500, from 50 to 750, from 50 to 1 ,000, from 50 to 1 ,500, from 50 to 2,000, from 50 to 2,500, from 50 to 3,000, from 100 to 500, from 100 to 750, from 100 to 1 ,000, from 100 to 1 ,500, from 100 to 2,000, from 100 to 2,500, from 100 to 3,000, from 500 to 750, from 500 to 1 ,000, from 500 to 1 ,500, from 500 to 2,000, from 500 to 2,500, from 500 to 3,000, from 1 ,000 to 1 ,500, from 1 ,000 to 2,000, from 1 ,000 to 2,500, from 1 ,000 to 3,000, from 1 ,500 to 2,000, from 1 ,500 to 2,500, from 1 ,500 to 3,000, from 2,000 to 3,000, from 2,000 to 2,500, and from 2,500 to 3,000).
In some embodiments, the poly-A tail is designed relative to the length of the overall polynucleotide or the length of a particular region of the polynucleotide. This design can be based on the length of a coding region, the length of a particular feature or region or based on the length of the ultimate product expressed from the polynucleotides.
In this context, the poly-A tail can be 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100% greater in length than the polynucleotide or feature thereof. The poly-A tail can also be designed as a fraction of the polynucleotides to which it belongs. In this context, the poly-A tail can be 10, 20, 30, 40, 50, 60, 70, 80, or 90% or more of the total length of the construct, a construct region or the total length of the construct minus the poly-A tail. Further, engineered binding sites and conjugation of polynucleotides for Poly-A binding protein can enhance expression.
Additionally, multiple distinct polynucleotides can be linked together via the PABP (Poly-A binding protein) through the 3'-end using modified nucleotides at the 3'-terminus of the poly-A tail. Transfection experiments can be conducted in relevant cell lines and protein production can be assayed by ELISA at 12hr, 24hr, 48hr, 72hr and day 7 post-transfection.
In some embodiments, the polynucleotides of the present disclosure are designed to include a polyA-G Quartet region. The G-quartet is a cyclic hydrogen bonded array of four guanine nucleotides that
can be formed by G-rich sequences in both DNA and RNA. In some embodiments, the G-quartet is incorporated at the end of the poly-A tail. The resultant polynucleotide is assayed for stability, protein production and other parameters including half-life at various time points. It has been discovered that the polyA-G quartet results in protein production from an mRNA equivalent to at least 75% of that seen using a poly-A tail of 120 nucleotides alone.
In some embodiments, the polyA tail comprises an alternative nucleoside, e.g., inverted thymidine. PolyA tails comprising an alternative nucleoside, e.g., inverted thymidine, may be generated as described herein. For instance, mRNA constructs may be modified by ligation to stabilize the poly(A) tail. Ligation may be performed using 0.5-1 .5 mg/mL mRNA (5' Cap1 , 3' A100), 50 mM Tris-HCI pH 7.5, 10 mM MgCl2, 1 mM TCEP, 1000 units/mL T4 RNA Ligase 1 , 1 mM ATP, 20% w/v polyethylene glycol 8000, and 5:1 molar ratio of modifying oligo to mRNA. Modifying oligo has a sequence of 5’-phosphate- AAAAAAAAAAAAAAAAAAAA-(inverted deoxythymidine (idT) (SEQ ID NO: 77)) (see below). Ligation reactions are mixed and incubated at room temperature (~22°C) for, e.g., 4 hours. Stable tail mRNA are purified by, e.g., dT purification, reverse phase purification, hydroxyapatite purification, ultrafiltration into water, and sterile filtration. The resulting stable tail-containing mRNAs contain the following structure at the 3’end, starting with the polyA region: Aioo-UCUAGAAAAAAAAAAAAAAAAAAAA-inverted deoxythymidine (SEQ ID NO: 78).
Modifying oligo to stabilize tail (5’-phosphate-AAAAAAAAAAAAAAAAAAAA-(inverted deoxythymidine) (SEQ ID NO: 77)):
In some instances, the polyA tail comprises A100-UCUAG-A20-inverted deoxy-thymidine (SEQ ID NO: 78). In some instances, the polyA tail consists of A100-UCUAG-A20-inverted deoxy-thymidine (SEQ ID NO: 78).
16. Molecular Tethers
The disclosure features systems containing a first polynucleotide that binds a second polynucleotide by way of an intermolecular tether. For example, the first polynucleotide may contain a binding element that includes a sequence, e.g., a DNA or RNA sequence, which is bound, e.g., recognized by, an RNA binding protein or a fragment thereof, e.g., a tether molecule, e.g., as disclosed herein. In some embodiments, the tether molecule binds to a sequence comprising the binding element,
or a fragment thereof. In some embodiments, the tether molecule binds to a structure comprising the binding element, or a fragment thereof.
In some embodiments, the binding element of the first polynucleotide is bound by the tether molecule of the second polynucleotide, e.g., an effector molecule further comprising a tether molecule.
In some embodiments, a tether molecule is chosen from a tether molecule provided in Table 10, e.g., MBP, PCP, Lambda N, U1 A or PUF, 15.5kd, or LARP7 or a variant or fragment thereof. In some embodiments, the binding element comprises a sequence which is bound, e.g., recognized, by the tether molecule. In some embodiments, the binding element comprises a sequence comprising a structure that is bound, e.g., recognized, by the tether molecule.
In some embodiments, the binding element is chosen from a binding element provided in Table 10, e.g., MS2, PP7, BoxB, U1 A hairpin, PRE, a kink-turn forming sequence, 7sk, or a variant or fragment thereof. In some embodiments, the binding element is MS2. In some embodiments, the binding element is PP7. In some embodiments, the binding element is BoxB. In some embodiments, the binding element is U1 A hairpin. In some embodiments, the binding element is PRE. In some embodiments, the binding element is a kink-turn forming sequence. In some embodiments, the binding element is 7SK.
In some embodiments, when the binding element is MS2 (e.g., wildtype MS2, or a variant or fragment thereof) the tether molecule is MBP (e.g., wildtype MBP, a variant or fragment thereof).
In some embodiments, when the binding element is PP7 (e.g., wildtype PP7, or a variant or fragment thereof) the tether molecule is PCP (e.g., wildtype PCP, or a variant or fragment thereof).
In some embodiments, when the binding element is BoxB (e.g., wildtype BoxB, or a variant or fragment thereof) the tether molecule is Lambda N (e.g., wildtype Lambda N, or a variant or fragment thereof).
In some embodiments, when the binding element is U1 A hairpin (e.g., wildtype U1 A hairpin, or a variant or fragment thereof) the tether molecule is U1 A (e.g., wildtype U1 A, or a variant or fragment thereof).
In some embodiments, when the binding element is PRE (e.g., wildtype PRE, or a variant or fragment thereof) the tether molecule is PUF (e.g., wildtype PUF, or a variant or fragment thereof).
In some embodiments, when the binding element is a kink-turn forming sequence the tether molecule is 15.5kd (e.g., wildtype 15.5kd, or a variant or fragment thereof).
In some embodiments, when the binding element is a 7sk sequence the tether molecule is LARP7 (e.g., wildtype LARP7, or a variant or fragment thereof).
Table 10. Exemplary binding elements and tether molecules
In some embodiments, the binding element comprises a sequence comprising 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 30, 40, 50, 60, 70, 80, 90 or 100 nucleotides. In some embodiments, the binding element comprises a sequence comprising about 5-100, about 5-90, about 5-80, about 5-70, about 5-60, about 5-50, about 5-40, about 5-30, about 5-25, about 5-20, about 5- 19, about 5-18, about 5-17, about 5-16, about 5-15, about 5-14, about 5-13, about 5-12, about 5-1 1 , about 5-10, about 5-9, about 5-8, about 5-7 or about 5-6 nucleotides. In some embodiments, the binding element comprises a sequence comprising about 5-100, about 6-100, about 7-100, about 8-100, about 9- 100, about 10-100, about 1 1 -100, about 12-100, about 13-100, about 14-100, about 15-100, about 16-
100, about 17-100, about 18-100, about 19-100, about 20-100, about 21 -100, about 22-100, about 23-
100, about 24-100, about 25-100, about 30-100, about 40-100, about 50-100, about 60-100, about 70-
100, about 80-100, or about 90-100 nucleotides. In some embodiments, the binding element comprises a sequence comprising about 5-100, about 6-90, about 7-80, about 8-70, about 9-60, about 10-50, about 1 1 -40, about 12-30, about 13-25, about 14-24, about 15-23, about 16-22, about 17-21 , or about 18-20 nucleotides. In some embodiments, the binding element comprises a sequence comprising 19 nucleotides.
In some embodiments, the binding element comprises a binding element nucleotide sequence provided in Table 11 or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity thereof. In some embodiments, the binding element comprises a binding element sequence provided in SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81 , SEQ ID NO: 82, or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity thereof.
In some embodiments of any of the systems, LNP compositions, methods or uses disclosed herein, the binding element comprises at least 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 20 or 30 repeats of the sequence bound by the tether molecule of the second polynucleotide. In some embodiments, the binding element comprises no more than 80, 70, 60, 50, 40 or 30 repeats of the sequence bound by the tether molecule of the second polynucleotide. In some embodiments, the binding element comprises about 1 -30, about 1 -20, about 1 -10, about 1 -9, about 1 -8, about 1 -7, about 1 -6, about
I -5, about 1 -4, about 1 -3, or about 1 -2 repeats of the sequence bound by the tether molecule of the second polynucleotide. In some embodiments, the binding element comprises about 1 -30, about 2-30, about 3-30, about 4-30 about, 5-30 about, 6-30, about 7-30, about 8-30, about 9-30, about 10-30, about
I I -30, about 12-30, about 13-30, about 14-30, about 15-30, or about 20-30 repeats of the sequence bound by the tether molecule of the second polynucleotide. In some embodiments, the binding element comprises about 1 -30, about 2-20, about 3-15, about 4-14, about 5-13, about 6-12, about 7-1 1 , or about 8-10 repeats of the sequence bound by the tether molecule of the second polynucleotide. In some embodiments, the binding element comprises 6 repeats of the sequence bound by the tether molecule of the second polynucleotide.
In some embodiments of any of the systems, LNP compositions, methods or uses disclosed herein, each repeat is separated by a spacer sequence comprising 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 30, 40, 50, 60, 70, 80, 90 or 100 nucleotides. In some embodiments, the spacer sequence comprises about 1 -100, about 1 -90, about 1 -80, about 1 -70, about 1 - 60, about 1 -50, about 1 -40, about 1 -30, about 1 -25, about 1 -20, about 1 -19, about 1 -18, about 1 -17, about 1 -16, about 1 -15, about 1 -14, about 1 -13, about 1 -12, about 1 -1 1 , about 1 -10, about 1 -9, about 1 -8,
about 1 -7, about 1 -6, about 1 -5, about 1 -4, about 1 -3, or about 1 -2 nucleotides. In some embodiments, the spacer sequence comprises about 1 -100, about 2-100, about 3-100, about 4-100, about 5-100, about 6-100, about 7-100, about 8-100, about 9-100, about 10-100, about 1 1 -100, about 12-100, about 13-100, about 14-100, about 15-100, about 16-100, about 17-100, about 18-100, about 19-100, about 20-100, about 21 -100, about 22-100, about 23-100, about 24-100, about 25-100, about 30-100, about 40-100, about 50-100, about 60-100, about 70-100, about 80-100, or about 90-100 nucleotides. In some embodiments, the spacer sequence comprises about 1 -100, about 2-90, about 3-80, about 4-70, about 5- 60, about 6-50, about 7-40, about 8-40, about 9-30, about 10-25, about 1 1 -24, about 12-23, about 13-22, about 14-21 , about 15-20, about 16-19, about 17-18 nucleotides. In some embodiment, the spacer sequence comprises 20 nucleotides.
In some embodiment, the spacer sequence comprises a spacer sequence provided in Table 11 or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity thereof.
Table 11. Exemplary sequences of a binding element, a tether molecule, and/or an effector molecule
In some embodiments, the tether molecule comprises a tether molecule provided in Table 10, e.g., MBP, PCP, Lambda N, U1 A or PUF, 15.5kd, LARP7 or a variant or fragment thereof. In some embodiments, the tether molecule is MBP. In some embodiments, the tether molecule is PCP. In some embodiments, the tether molecule is Lambda N. In some embodiments, the tether molecule is U1 A. In some embodiments, the tether molecule is PUF. In some embodiments, the tether molecule is 15.5 kd. In some embodiments, the tether molecule is LARP7.
In some embodiments, when the tether molecule is MBP (e.g., wildtype MBP, a variant or fragment thereof) the binding element is MS2 (e.g., wildtype MS2, or a variant or fragment thereof).
In some embodiments, when the tether molecule is PCP (e.g., wildtype PCP, or a variant or fragment thereof) the binding element is PP7 (e.g., wildtype PP7, or a variant or fragment thereof).
In some embodiments, when the tether molecule is Lambda N (e.g., wildtype Lambda N, or a variant or fragment thereof) the binding element is BoxB (e.g., wildtype BoxB, or a variant or fragment thereof).
In some embodiments, when the tether molecule is U1 A (e.g., wildtype U1 A, or a variant or fragment thereof) the binding element is U1 A hairpin (e.g., wildtype U1 A hairpin, or a variant or fragment thereof).
In some embodiments, when the tether molecule is 15.5kd (e.g., wildtype 15.5kd, or a variant or fragment thereof) the binding element is a kink-turn forming sequence e.g., wildtype U1 A hairpin, or a variant or fragment thereof).
In some embodiments, when the tether molecule is PUF (e.g., wildtype PUF, or a variant or fragment thereof) the binding element is PRE (e.g., wildtype PRE, or a variant or fragment thereof).
In some embodiments, when the tether molecule is LARP7 (e.g., wildtype LARP7, or a variant or fragment thereof) the binding element is 7SK (e.g., wildtype 7SK, or a variant or fragment thereof).
Additional exemplary RNA-binding proteins or RNA-binding domains which can be used as tether molecules are disclosed in Corley et al, Molecular Cell 78:1 pp. 9-29, the entire contents of which are hereby incorporated by reference. For example, Table 12 provides additional exemplary RNA-binding proteins or domains which can be used as tether molecules. In an embodiment, a tether molecule disclosed herein comprises a domain (or a variant, or a fragment thereof) or a protein (or a variant or a fragment thereof) listed in Table 12.
Table 12. Exemplary RNA-binding proteins and domains
In some embodiments, the tether molecule comprises MBP. In some embodiments, the tether molecule comprises an amino acid sequence provided in Table 11 or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity thereof. In some embodiments, the tether molecule comprises the amino acid sequence of SEQ ID NO: 84, or an amino acid sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity thereof.
In some embodiments, the tether molecule comprises is encoded by a nucleotide sequence provided in Table 11 or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity thereof. In some embodiments, the tether molecule comprises is encoded by the nucleotide sequence of SEQ ID NO: 85, or a sequence with at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity thereof.
In some embodiments, the effector molecule is a translation factor, e.g., elF4G; Poly A binding protein (PABP); elF3d or a component thereof; Dazl, or a fragment, or variant or combination thereof. Additional exemplary translation factors are provided in Pelletier and Soneneberg. Annu. Rev. Biochem. 2019. 88:307-35, the entire contents of which are hereby incorporated by reference
In some embodiments, the effector molecule binds directly to the binding element. The effector molecule may have a specific target sequence to which it can bind.
In some embodiments, the effector molecule further comprises a polypeptide that binds to, e.g., recognizes, the binding element (a tether molecule).
In an embodiment the effector molecule comprising the tether molecule comprises a polypeptide comprising the first domain and the second domain. In an embodiment, the first and second domains are operatively linked.
In an embodiment, in the second polynucleotide encoding the effector molecule which further comprises a tether molecule, the nucleotide sequence encoding the effector molecule is upstream of the nucleotide sequence encoding the tether molecule. In an embodiment, the nucleotide sequence encoding the effector molecule is downstream of the nucleotide sequence encoding the tether molecule. In an embodiment, the nucleotide sequence encoding the effector molecule is separated from the nucleotide sequence encoding the tether molecule by a protease cleavage site or an internal ribosomal entry site.
In an embodiment, in the second polynucleotide encoding the effector molecule which further comprises a tether molecule, the nucleotide sequence encoding the effector molecule is adjacent to the nucleotide sequence encoding the tether molecule.
In some embodiments, the effector molecule is a translation factor which modulates, e.g., facilitates, ribosome binding, e.g., recruitment, pre-initiation complex formation, or RNA unwinding. In some embodiments, the effector molecule comprises elF4G, e.g., wildtype elF4G, a variant of elF4G, or a fragment thereof.
In some embodiments, the effector molecule comprises wildtype elF4G. In some embodiments, wildtype elF4G comprises a sequence of about 1600 amino acids.
In some embodiments, the effector molecule comprises a fragment of elF4G, e.g., as disclosed herein. In some embodiments, the elF4G fragment retains ribosome binding, e.g., recruitment.
In some embodiments, the elF4G fragment is about 1 ,500-200 amino acids, about 1 ,400-300 amino acids, about 1 ,300-350 amino acids, about 1 ,200-400 amino acids, about 1 ,100-450 amino acids, about 1 ,000-500 amino acids, about 900-550 amino acids, about 800-600 amino acids, about 1 ,500-300 amino acids, 1 ,500-400 amino acids, 1 ,500-500 amino acids, about 1 ,500-600 amino acids, amino acids, about 1 ,500-700 amino acids, about 1 ,500-800 amino acids, about 1 ,500-900 amino acids, about 1 ,500- 1000 amino acids, about 1 ,500-1 ,100 amino acids, about 1 ,500-1 ,200 amino acids, about 1 ,500-1 ,300 amino acids, about 1 ,500-1 ,400 amino acids, about 1 ,400-200 amino acids, about 1 ,300-200 amino acids, about 1 ,200-200 amino acids, about 1 ,100-200 amino acids, about 1 ,000-200 amino acids, about 900-200 amino acids, about 800-200 amino acids, about 700-200 amino acids, about 600-200 amino acids, or about 500-200 amino acids in length.
In some embodiments, the elF4G fragment is about 500 amino acids in length. In some embodiments, the elF4G fragment is about 600 amino acids in length. In some embodiments, the elF4G fragment is about 700 amino acids in length. In some embodiments, the elF4G fragment is about 800 amino acids in length. In some embodiments, the elF4G fragment is about 900 amino acids in length. In some embodiments, the elF4G fragment is about 1000 amino acids in length. In some embodiments, the elF4G fragment is about 1100 amino acids in length. In some embodiments, the elF4G fragment is about 1200 amino acids in length. In some embodiments, the elF4G fragment is about 1300 amino acids in length. In some embodiments, the elF4G fragment is about 1400 amino acids in length. In some embodiments, the elF4G fragment is about 1500 amino acids in length.
In some embodiments, the effector molecule comprises a variant of elF4G, e.g., as disclosed herein. In some embodiments, the elF4G variant retains ribosome binding, e.g., recruitment. In some embodiments, the elF4G variant comprises a mutation (e.g., substitution) in the elF4G polypeptide sequence at any one, two, all or a combination of the following positions: amino acid 768, amino acid 771 , or amino acid 776. In some embodiments, the elF4G variant comprises a mutation, e.g., substitution, at position 768 of the elF4G polypeptide sequence, e.g., a Leucine to Alanine substitution at position 768. In some embodiments, the elF4G variant comprises a mutation, e.g., substitution, at position 771 of the elF4G polypeptide sequence, e.g., a Leucine to Alanine substitution at position 771 . In some embodiments, the elF4G variant comprises a mutation, e.g., substitution, at position 776 of the elF4G polypeptide sequence, e.g., a Phenylalanine to Alanine at position 776. In some embodiments, the elF4G variant comprises a mutation, e.g., substitution, at position 768 of the elF4G polypeptide sequence, e.g., an Alanine at position 768; and a mutation, e.g., substitution, at position 771 of the elF4G polypeptide sequence, e.g., an Alanine at position 771 . In some embodiments, the elF4G variant comprises a mutation, e.g., substitution, at position 768 of the elF4G polypeptide sequence, e.g., an Alanine at position 768; and a mutation, e.g., substitution, at position 776 of the elF4G polypeptide sequence, e.g., an Alanine at position 776. In some embodiments, the elF4G variant comprises a mutation, e.g., substitution, at position 771 of the elF4G polypeptide sequence, e.g., an Alanine at position 771 ; and a mutation, e.g., substitution, at position 776 of the elF4G polypeptide sequence, e.g., an Alanine at position 776. In some embodiments, the elF4G variant comprises a mutation, e.g., substitution, at position 771 of the elF4G polypeptide sequence, e.g., an Alanine at position 771 ; a mutation, e.g., substitution, at position 771 of the elF4G polypeptide sequence, e.g., an Alanine at position 771 ; and a
mutation, e.g., substitution, at position 776 of the elF4G polypeptide sequence, e.g., an Alanine at position 776.
In some embodiments, the effector molecule is a part of the elF3 complex, e.g., which can recruit the ribosome. In some embodiments, the elF3 complex comprises elF3d, elF3c, elF3e, or elF3i, or a fragment thereof, or any combination thereof.
17. Synthesis of Circular Nucleic Acids
The circular nucleic acids of the disclosure may be prepared according to any available technique including, but not limited to chemical synthesis and enzymatic synthesis. In some embodiments, a linear primary construct or linear mRNA may be cyclized to create a circular RNA of the disclosure. The mechanism of cyclization may occur through methods such as, but not limited to, chemical, enzymatic, or ribozyme catalyzed methods. The newly formed 5'-/3'-linkage may be an intramolecular linkage or an intermolecular linkage.
In one embodiment, a linear primary construct or linear mRNA may be cyclized using the chemical method to form a circular RNA construct. In the chemical method, the 5'-end and the 3'-end of the nucleic acid (e.g., linear primary construct or linear mRNA) contain chemically reactive groups that, when close together, form a new covalent linkage between the 5'-end and the 3'-end of the molecule. The 5'-end may contain an NHS-ester reactive group and the 3'-end may contain a 3'-amino-terminated nucleotide such that in an organic solvent the 3'-amino-terminated nucleotide on the 3'-end of a linear RNA molecule will undergo a nucleophilic attack on the 5'-NHS-ester moiety forming a new 5'73'-amide bond.
In one embodiment, a DNA or RNA ligase may be used to enzymatically link a 5'-phosphorylated nucleic acid molecule (e.g., a linear primary construct or linear mRNA) to the 3'-hydroxyl group of a nucleic acid forming a new phosphorodiester linkage. In an example reaction, 1 pg of a nucleic acid molecule is incubated at 37eC for 1 hour with 1 -10 units of T4 RNA ligase (New England Biolabs, Ipswich, MA) according to the manufacturer’s protocol. The ligation reaction may occur in the presence of a split oligonucleotide capable of base-pairing with both the 5'- and 3'- region in juxtaposition to assist the enzymatic ligation reaction.
In one embodiment, a DNA or RNA ligase may be used in the synthesis of the circular polynucleotides. As a non-limiting example, the ligase may be a circ ligase or circular ligase. In another embodiment, protein ligation may be used to enzymatically link a first protein associated with the 5’end of the linear primary construct or linear mRNA with a second protein associated with the 3’ end of the linear primary construct or linear mRNA. In one aspect, the first and second protein may be the same protein. In another embodiment, the first and second proteins are different. As a non-limiting example, one or both proteins may be a RNA binding fusion enzyme. In another non-limiting example, one or both proteins may be PUF1 protein which may be derived from Plasmodium falciparum. As yet another non-limiting example, one or both proteins may be fused with other enzymes in order to cyclize the linear primary constructs or linear mRNA.
In one embodiment, protein ligation may be used to enzymatically link a first fusion enzyme associated with the 5’end of the linear primary construct or linear mRNA with a second fusion enzyme associated with the 3’ end of the linear primary construct or linear mRNA.
In one embodiment, either the 5'-or 3'-end of the cDNA template can encode a ligase ribozyme sequence such that during in vitro transcription, the resultant nucleic acid molecule can contain an active ribozyme sequence capable of ligating the 5'-end of a nucleic acid molecule to the 3'-end of a nucleic acid molecule. The ligase ribozyme may be derived from the Group I Intron, Hepatitis Delta Virus, Hairpin ribozyme or may be selected by SELEX (systematic evolution of ligands by exponential enrichment). The ribozyme ligase reaction may take 1 to 24 hours at temperatures between 0 and 37eC.
In one embodiment, a linear primary construct or linear mRNA may be cyclized by using at least one non-nucleic acid moiety. In one aspect, the at least one non-nucleic acid moiety may react with regions or features near the 5’ terminus and/or near the 3’ terminus of the linear primary construct or linear mRNA in order to cyclize the linear primary construct or linear mRNA. In another aspect, the at least one non-nucleic acid moiety may be located in or linked to or near the 5’ terminus and/or the 3’ terminus of the linear primary construct or linear mRNA. The non-nucleic acid moieties contemplated in the present invention may be homologous or heterologous. As a non-limiting example, the non-nucleic acid moiety may be a linkage such as a hydrophobic linkage, ionic linkage, a biodegradable linkage and/or a cleavable linkage. As another non-limiting example, the non-nucleic acid moiety is a ligation moiety. As yet another non-limiting example, the non-nucleic acid moiety may be an oligonucleotide or a peptide moiety such as an apatamer.
In one embodiment, a linear primary construct or linear mRNA may be cyclized due to a non- nucleic acid moiety that causes an attraction between atoms, molecules surfaces at, near or linked to the 5’ and 3’ ends of the linear primary construct or linear mRNA. As a non-limiting example, a linear primary construct or linear mRNA may be cyclized by intermolecular forces or intramolecular forces. Non-limiting examples of intermolecular forces include dipole-dipole forces, dipole-induced dipole forces, induced dipole-induced dipole forces, Van der Waals forces, and London dispersion forces. Non-limiting examples of intramolecular forces include covalent bonds, metallic bonds, ionic bonds, resonant bonds, agnostic bonds, dipolar bonds, conjugation, hyperconjugation and antibonding.
In one embodiment, the linear primary construct or linear mRNA may comprise a ribozyme RNA sequence near the 5’ terminus and near the 3’ terminus. The ribozyme RNA sequence may covalently link to a peptide when the sequence is exposed to the remainder of the ribozyme. In one aspect, the peptides covalently linked to the ribozyme RNA sequence near the 5’ terminus and the 3’terminus may associate with each other causing the linear primary construct or linear mRNA to cyclize. In another aspect, the peptides covalently linked to the ribozyme RNA near the 5’ terminus and the 3’terminus may cause the linear primary construct or linear mRNA to cyclize after being subjected to ligation using various methods known in the art such as, but not limited to, protein ligation. Non-limiting examples of ribozymes for use in the linear primary constructs or linear RNA of the present invention or a non- exhaustive listing of methods to incorporate and/or covalently link peptides are described in US patent application No. US20030082768, the contents of which is here in incorporated by reference in its entirety.
Various methods of synthesizing circular nucleic acid molecules are also described in the art (see, e.g., US Patent No. US6210931 , US Patent No. US5773244, US Patent No. US5766903, US Patent No. US5712128, US Patent No. US5426180, US Publication No. US20100137407, International Publication No. WO1992001813 and International Publication No. WO2010084371 ; the contents of each of which are herein incorporated by reference in their entirety).
In some embodiments, the process of design and synthesis of the circular nucleic acids of the disclosure generally includes the steps of gene construction, linear mRNA production (either with or without modifications) and purification, and cyclization of the linear mRNA. In the enzymatic synthesis method, a target polynucleotide sequence encoding the polypeptide of interest is first selected for incorporation into a vector which will be amplified to produce a cDNA template. Optionally, the target polynucleotide sequence and/or any flanking sequences may be codon optimized. The cDNA template is then used to produce mRNA through in vitro transcription (IVT). After production, the mRNA may undergo purification and the cyclization processes. The steps of producing a linear polynucleotide encoding a polypeptide of interest, which then may undergo a cyclization process, are provided in more detail below.
For example, polynucleotides of the invention having a sequence comprising Formula XIV: [An]-L1-[Bo],
Formula XIV may be synthesized by reacting a compound having the structure of Formula XV: [An]-(R1)a-(R2)b-(R3)c-N3
Formula XV with a compound having the structure of Formula XVI:
R27-(R5)d-(R6)e-(R7)f-[B0]
Formula XVI wherein each A and B is independently any nucleoside (e.g., a nucleotide); n and o are, independently 10 to 10,000, e.g., 10 to 1000 or 10 to 2000; and L1 has the structure of Formula XVII:
Formula XVII wherein a, b, c, d, e, and f are each, independently, 0 or 1 ;
R1 , R3, R5, and R7 each, independently, is selected from optionally substituted C1-C6 alkylene, optionally substituted C1-C6 heteroalkylene, O, S, and NR8;
R2 and R6 are each, independently, selected from carbonyl, thiocarbonyl, sulfonyl, or phosphoryl;
R4 is an optionally substituted triazolene; and
R8 is hydrogen, optionally substituted C1- C4 alkyl, optionally substituted C3-C4 alkenyl, optionally substituted C2-C4 alkynyl, optionally substituted C2-C6 heterocyclyl, optionally substituted C6-C12 aryl, or optionally substituted C1- C7 heteroalkyl; and
R27 is an optionally substituted C2-C3 alkynyl or an optionally substituted C8-C12 cycloalkynyl, wherein L1 is attached to [An] and [Bo] at the sugar of one of the nucleosides.
Circular polynucleotides of the invention including the structure of Formula XVIII, XIX, XX, or XXI:
Formula XX Formula XXL may be synthesized by reacting (e.g., under [3+2] cycloaddition conditions in the presence or absence of a copper source) a compound having the structure of Formula XXII, XXIII, XXIV, or XXV:
Formula XXII Formula XXIII
with a compound having the structure of Formula XXVI or XXVII:
Formula XXVI Formula XXVII wherein each of N1 and N2 is independently a nucleobase; each of R9, R10, R11 , R12, R13, R14, R15, and R16 is, independently, H, halo, hydroxy, thiol, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 heteroalkyl, optionally substituted C2-C6 heteroalkenyl, optionally substituted C2-C6 heteroalkynyl, optionally substituted amino, azido, or optionally substituted C6-C10 aryl; each of g and h is, independently, 0 or 1 ; each X1 and X4 is, independently, O, NH, or S; and each of R24 and R27 is, independently, a region of linked nucleosides; and each of R25, R25’, R26 and R26’ is, independently, optionally substituted C1-C6 alkylene or optionally substituted C1-C6 heteroalkylene or R25’ or R26’ and the alkynyl group together form optionally substituted cycloalkynyl.
For example, the circular polynucleotides of the invention may be synthesized as shown below:
In some embodiments, the 5' cap structure or poly-A tail may be attached to a linear polynucleotide with this method and the linear polynucleotide may be circularized by the methods described herein.
A 5' cap structure may be attached to a polynucleotide of the invention as shown below:
The polynucleotide may be circularized after the 5’ cap structure is attached.
A poly-A tail may be attached to a polynucleotide of the invention as shown below:
The polynucleotide may be circularized after the poly-A tail is attached.
Polynucleotides which may be circularized may be made using various methods.
For example, polynucleotides of the invention may comprise the structure of Formula XXVIII or XXIX:
Formula XXVIII Formula XXIX
The circular polynucleotides may comprise a structure made by a method which includes reacting (e.g., under alkylating conditions) a compound having the structure of Formula XXX or XXXI:
Formula XXX Formula XXXI with a compound having the structure of Formula XXXII:
Formula XXXII wherein each of N1 and N2 is, independently, a nucleobase; each of R9, R10, R11 , R12, R13, R14, R15, and R16 is, independently, H, halo, hydroxy, thiol, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 heteroalkyl, optionally substituted C2-C6 heteroalkenyl, optionally substituted C2-C6 heteroalkynyl, optionally substituted amino, azido, or optionally substituted C6-C10 aryl; each of g and h is, independently, 0 or 1 ; each X1 and X4 is, independently, O, NH, or S; each X2 is independently O or S; and each X3 is independently OH or SH, or a salt thereof;
each of R17 and R19 is, independently, a region of linked nucleosides; and R18 is a halogen.
Circular polynucleotides of the invention may include the structure of Formula XXXIII or XXXIV:
Formula XXXIII Formula XXXIV
This method includes reacting (e.g., under Staudinger reaction conditions) a compound having the structure of Formula XXXV or XXXVI:
Formula XXXV Formula XXXVI with a compound having the structure of Formula XXXVII or XXXVIII:
Formula XXXVII Formula XXXVIII wherein each of N1 and N2 is, independently, a nucleobase; each of R9, R10, R11 , R12, R13, R14, R15, and R16 is, independently, H, halo, hydroxy, thiol, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 heteroalkyl, optionally substituted C2-C6 heteroalkenyl, optionally substituted C2-C6 heteroalkynyl, optionally substituted amino, azido, or optionally substituted C6-C10 aryl; each of g and h is, independently, 0 or 1 ; each X4 is, independently, O, NH, or S; and each X1 and X2 is independently O or S; each X3 is independently OH, SH, or a salt thereof; each of R20 and R23 is, independently, a region of linked nucleosides; and
each of R21 and R22 is, independently, optionally substituted C1-C6 alkoxy.
Circular polynucleotides of the invention including the structure of Formula XXXIX, XL, XLI, or
XLII:
Formula XLI Formula XLII.
This method includes reacting (e.g., under [3+2] cycloaddition conditions in the presence or absence of a copper source) a compound having the structure of Formula XLIII, XLIV, XLV, or XLVI:
Formula XLIII Formula XLIV
with a compound having the structure of Formula XLVII or XLVIII:
Formula XL VII Formula XLVIII wherein each of N1 and N2 is, independently, a nucleobase; each of R9, R10, R11 , R12, R13, R14, R15, and R16 is, independently, H, halo, hydroxy, thiol, optionally substituted C1-C6 alkyl, optionally substituted C1-C6 heteroalkyl, optionally substituted C2-C6 heteroalkenyl, optionally substituted C2-C6 heteroalkynyl, optionally substituted amino, azido, or optionally substituted C6-C10 aryl; each of g and h is, independently, 0 or 1 ; each X1 and X4 is, independently, absent, O, NH, or S or a salt thereof; each of R24 and R27 is, independently, a region of linked nucleosides; and each of R25, R25’, R26 and R26’ is independently absent or optionally substituted C1-C6 alkylene or optionally substituted C1-C6 heteroalkylene or R25 and the alkynyl group together form optionally substituted cycloalkynylene.
Circular polynucleotides of the invention may be synthesized as shown below:
Other methods for the synthesis of the circular polynucleotides of the invention are shown below:
where CEO
is 2-cyanoethoxy, and X is O or S. Other methods for the synthesis of the circular polynucleotides of the invention are shown below:
It will be understood that the reactive group shown at the 3' (or 4' position, when g or h is 1 ) and at the 5' (or 6' position, when g or h is 1 ) can be reversed. For example, the halogen, azido, or alkynyl group may be attached to the 5' position (or 6' position, when g or h is 1 ), and the thiophosphate, (thio)phosphoryl, or azido group may be attached to the 3' position (or 4' position, when g or h is 1 ).
In some embodiments, linear polynucleotides and/or linear primary constructs maybe cyclized to generate the circular nucleic acid of the present invention including but not limited to, 3 different routes such as 1 ) chemical, 2) enzymatic, and 3) ribozyme catalyzed. Non-limiting examples of these routes are outlined below. The newly formed 5'-/3'-linkage may be intramolecular or intermolecular. As a non-limiting example, the linear polynucleotides and linear primary constructs which may be circularized may be selected from those described in; International Publication Nos. WO2013151666, WO2013151667, WO2013151668, WO2013151663, WO2013151669, WO2013151670, WO2013151664,
WO2013151665, WO2013151671 , WO2013151672, WO2013151736, the contents of each of which are herein incorporated by reference in their entireties.
In the first route, the 5'-end and the 3'-end of the nucleic acid contain the chemically reactive group or groups that, when close together, form a new covalent linkage between the 5'-end and the 3'- end of the molecule. The 5'-end may contain, but is not limited to, an NHS-ester reactive group and the 3'-end may contain, but is not limited to, a 3'-amino-terminated nucleotide such that in an organic solvent the 3'-amino-terminated nucleotide on the 3'-end of a synthetic mRNA molecule will undergo a nucleophilic attack on the 5'-NHS-ester moiety forming a new 5'73'-amide bond resulting in a circRNA.
In the second route, T4 RNA ligase may be used to enzymatically link a 5'-phosphorylated nucleic acid molecule to the 3'-hydroxyl group of a nucleic acid forming a new phosphorodiester linkage. In a non-limiting example reaction, 1 pg of a nucleic acid molecule is incubated at 37eC for 1 hour with 1 -10 units of T4 RNA ligase (New England Biolabs, Ipswich, MA) according to the manufacturer’s protocol. The ligation reaction may occur in the presence of a split oligonucleotide capable of base-pairing with both the 5'- and 3'- region in juxtaposition to assist the enzymatic ligation reaction. The reaction would create a circular nucleic acid.
In the third route, either the 5'-or 3'-end of the cDNA template encodes a ligase ribozyme sequence such that during in vitro transcription, the resultant nucleic acid molecule can contain an active ribozyme sequence capable of ligating the 5'-end of a nucleic acid molecule to the 3'-end of a nucleic acid molecule. The ligase ribozyme may be derived from the Group I Intron, Group I Intron, Hepatitis Delta Virus, Hairpin ribozyme or may be selected by SELEX (systematic evolution of ligands by exponential enrichment). The ribozyme ligase reaction may take 1 to 24 hours at temperatures between 0 eC and 37eC.
The circular polynucleotides of the invention may be synthesized as shown below:
Alternatively, the alkynyl and azido groups may be replaced with other reactive groups as described herein, e.g., halogen and thiophosphate or azido and (thio) phosphoryl.
18. Start Codon Region
The invention also includes a polynucleotide that comprises both a start codon region and the polynucleotide described herein (e.g., a polynucleotide comprising a nucleotide sequence encoding a therapeutic polypeptide). In some embodiments, the polynucleotides of the present disclosure can have regions that are analogous to or function like a start codon region.
In some embodiments, the translation of a polynucleotide can initiate on a codon that is not the start codon AUG. Translation of the polynucleotide can initiate on an alternative start codon such as, but not limited to, ACG, AGG, AAG, CTG/CUG, GTG/GUG, ATA/AUA, ATT/AUU, TTG/UUG (see Touriol et al. Biology of the Cell 95 (2003) 169-178 and Matsuda and Mauro PLoS ONE, 2010 5:11 ; the contents of each of which are herein incorporated by reference in its entirety).
As a non-limiting example, the translation of a polynucleotide begins on the alternative start codon ACG. As another non-limiting example, polynucleotide translation begins on the alternative start codon CTG or CUG. As yet another non-limiting example, the translation of a polynucleotide begins on the alternative start codon GTG or GUG.
Nucleotides flanking a codon that initiates translation such as, but not limited to, a start codon or an alternative start codon, are known to affect the translation efficiency, the length and/or the structure of the polynucleotide. (See, e.g., Matsuda and Mauro PLoS ONE, 2010 5:11 ; the contents of which are herein incorporated by reference in its entirety). Masking any of the nucleotides flanking a codon that
initiates translation can be used to alter the position of translation initiation, translation efficiency, length and/or structure of a polynucleotide.
In some embodiments, a masking agent can be used near the start codon or alternative start codon in order to mask or hide the codon to reduce the probability of translation initiation at the masked start codon or alternative start codon. Non-limiting examples of masking agents include antisense locked nucleic acids (LNA) polynucleotides and exon-junction complexes (EJCs) (See, e.g., Matsuda and Mauro describing masking agents LNA polynucleotides and EJCs (PLoS ONE, 2010 5:11 ); the contents of which are herein incorporated by reference in its entirety).
In some embodiments, a masking agent can be used to mask a start codon of a polynucleotide in order to increase the likelihood that translation will initiate on an alternative start codon. In some embodiments, a masking agent can be used to mask a first start codon or alternative start codon in order to increase the chance that translation will initiate on a start codon or alternative start codon downstream to the masked start codon or alternative start codon.
In some embodiments, a start codon or alternative start codon can be located within a perfect complement for a miRNA binding site. The perfect complement of a miRNA binding site can help control the translation, length and/or structure of the polynucleotide similar to a masking agent. As a non-limiting example, the start codon or alternative start codon can be located in the middle of a perfect complement for a miRNA binding site. The start codon or alternative start codon can be located after the first nucleotide, second nucleotide, third nucleotide, fourth nucleotide, fifth nucleotide, sixth nucleotide, seventh nucleotide, eighth nucleotide, ninth nucleotide, tenth nucleotide, eleventh nucleotide, twelfth nucleotide, thirteenth nucleotide, fourteenth nucleotide, fifteenth nucleotide, sixteenth nucleotide, seventeenth nucleotide, eighteenth nucleotide, nineteenth nucleotide, twentieth nucleotide or twenty-first nucleotide.
In some embodiments, the start codon of a polynucleotide can be removed from the polynucleotide sequence in order to have the translation of the polynucleotide begin on a codon that is not the start codon. Translation of the polynucleotide can begin on the codon following the removed start codon or on a downstream start codon or an alternative start codon. In a non-limiting example, the start codon ATG or AUG is removed as the first 3 nucleotides of the polynucleotide sequence in order to have translation initiate on a downstream start codon or alternative start codon. The polynucleotide sequence where the start codon was removed can further comprise at least one masking agent for the downstream start codon and/or alternative start codons in order to control or attempt to control the initiation of translation, the length of the polynucleotide and/or the structure of the polynucleotide.
19. Stop Codon Region
The present disclosure also includes a polynucleotide that comprises both a stop codon region and the polynucleotide described herein (e.g., a polynucleotide comprising a nucleotide sequence encoding a therapeutic polypeptide). In some embodiments, the polynucleotides of the present disclosure can include at least two stop codons before the 3' untranslated region (UTR). The stop codon can be selected from TGA, TAA and TAG in the case of DNA, or from UGA, UAA and UAG in the case of RNA. In some embodiments, the polynucleotides of the present disclosure include the stop codon TGA in the case of DNA, or the stop codon UGA in the case of RNA, and one additional stop codon. In a further
embodiment the additional stop codon can be TAA or UAA. In some embodiments, the polynucleotides of the present disclosure include three consecutive stop codons, four stop codons, or more.
20. Combination of mRNA elements
Any of the polynucleotides disclosed herein can comprise one, two, three, or all of the following elements: (a) a 5’-UTR, e.g., as described herein; (b) a coding region comprising a stop element (e.g., as described herein); (c) a 3’-UTR (e.g., as described herein) and; optionally (d) a 3’ stabilizing region, e.g., as described herein. Also disclosed herein are LNP compositions comprising the same.
In some embodiments, a polynucleotide of the disclosure comprises (a) a 5’ UTR described in Table 7 or a variant or fragment thereof and (b) a coding region comprising a stop element provided herein. In some embodiments, the polynucleotide further comprises a cap structure, e.g., as described herein, or a poly A tail, e.g., as described herein. In some embodiments, the polynucleotide further comprises a 3’ stabilizing region, e.g., as described herein.
In some embodiments, a polynucleotide of the disclosure comprises (a) a 5’ UTR described in Table 7 or a variant or fragment thereof and (c) a 3’ UTR described in Table 8 or a variant or fragment thereof. In some embodiments, the polynucleotide further comprises a cap structure, e.g., as described herein, or a poly A tail, e.g., as described herein. In some embodiments, the polynucleotide further comprises a 3’ stabilizing region, e.g., as described herein.
In some embodiments, a polynucleotide of the disclosure comprises (c) a 3’ UTR described in Table 8 or a variant or fragment thereof and (b) a coding region comprising a stop element provided herein. In some embodiments, the polynucleotide comprises a sequence provided in Table 13. In some embodiments, the polynucleotide further comprises a cap structure, e.g., as described herein, or a poly A tail, e.g., as described herein. In some embodiments, the polynucleotide further comprises a 3’ stabilizing region, e.g., as described herein.
In some embodiments, a polynucleotide of the disclosure comprises (a) a 5’ UTR described in Table 7 or a variant or fragment thereof; (b) a coding region comprising a stop element provided herein; and (c) a 3’ UTR described in Table 8 or a variant or fragment thereof. In some embodiments, the polynucleotide further comprises a cap structure, e.g., as described herein, or a poly A tail, e.g., as described herein. In some embodiments, the polynucleotide further comprises a 3’ stabilizing region, e.g., as described herein.
Table 13. Exemplary 3’ UTR and stop element sequences
21. Methods of Making Polynucleotides
The present disclosure also provides methods for making a polynucleotide of the present disclosure (e.g., a polynucleotide comprising a nucleotide sequence encoding a therapeutic polypeptide) or a complement thereof.
In some aspects, a polynucleotide (e.g., a RNA, e.g., an mRNA) disclosed herein, and encoding a therapeutic polypeptide, can be constructed using in vitro transcription (IVT). In other aspects, a polynucleotide (e.g., a RNA, e.g., an mRNA) disclosed herein, and encoding a therapeutic polypeptide, can be constructed by chemical synthesis using an oligonucleotide synthesizer.
In other aspects, a polynucleotide (e.g., a RNA, e.g., an mRNA) disclosed herein, and encoding a therapeutic polypeptide is made by using a host cell. In certain aspects, a polynucleotide (e.g., a RNA, e.g., an mRNA) disclosed herein, and encoding a therapeutic polypeptide is made by one or more combination of the IVT, chemical synthesis, host cell expression, or any other methods known in the art.
Naturally occurring nucleosides, non-naturally occurring nucleosides, or combinations thereof, can totally or partially naturally replace occurring nucleosides present in the candidate nucleotide sequence and can be incorporated into a sequence-optimized nucleotide sequence (e.g., a RNA, e.g., an mRNA) encoding a therapeutic polypeptide. The resultant polynucleotides, e.g., mRNAs, can then be examined for their ability to produce protein and/or produce a therapeutic outcome. a. In Vitro Transcription / Enzymatic Synthesis
The present disclosure also provides methods for making a polynucleotide disclosed herein or a complement thereof. In some aspects, a polynucleotide (e.g., an mRNA) disclosed herein can be constructed using in vitro transcription.
In other aspects, a polynucleotide (e.g., an mRNA) disclosed herein can be constructed by chemical synthesis using an oligonucleotide synthesizer. In other aspects, a polynucleotide (e.g., an mRNA) disclosed herein is made by using a host cell. In certain aspects, a polynucleotide (e.g., an mRNA) disclosed herein is made by one or more combination of the IVT, chemical synthesis, host cell expression, or any other methods known in the art.
Naturally occurring nucleosides, non-naturally occurring nucleosides, or combinations thereof, can totally or partially naturally replace occurring nucleosides present in the candidate nucleotide sequence and can be incorporated into a sequence-optimized nucleotide sequence (e.g., an mRNA)
encoding a therapeutic polypeptide. The resultant mRNAs can then be examined for their ability to produce a therapeutic polypeptide and/or produce a therapeutic outcome.
While RNA can be made synthetically using methods well known in the art, in some embodiments an RNA transcript (e.g., mRNA transcript) is synthesized by contacting a DNA template with an RNA polymerase (e.g., a T7 RNA polymerase or a T7 RNA polymerase variant) under conditions that result in the production of RNA transcript.
In some aspects, the present disclosure provides methods of performing an IVT (in vitro transcription) reaction, comprising contacting a DNA template with the RNA polymerase (e.g., a T7 RNA polymerase, such as a T7 RNA polymerase variant) in the presence of nucleoside triphosphates and buffer under conditions that result in the production of RNA transcripts.
Other aspects of the present disclosure provide capping methods, e.g., co-transcriptional capping methods or other methods known in the art. In some embodiments, a capping method comprises reacting a polynucleotide template with a T7 RNA polymerase variant, nucleoside triphosphates, and a cap analog under in vitro transcription reaction conditions to produce RNA transcript.
IVT conditions typically require a purified linear DNA template containing a promoter, nucleoside triphosphates, a buffer system that includes dithiothreitol (DTT) and magnesium ions, and an RNA polymerase. The exact conditions used in the transcription reaction depend on the amount of RNA needed for a specific application. Typical IVT reactions are performed by incubating a DNA template with a RNA polymerase and nucleoside triphosphates, including GTP, ATP, CTP, and UTP (or nucleotide analogs) in a transcription buffer. An RNA transcript having a 5' terminal guanosine triphosphate is produced from this reaction.
A deoxyribonucleic acid (DNA) is simply a nucleic acid template for RNA polymerase. A DNA template may include a polynucleotide encoding a therapeutic polypeptide. A DNA template, in some embodiments, includes an RNA polymerase promoter (e.g., a T7 RNA polymerase promoter) located 5' from and operably linked to polynucleotide encoding a therapeutic polypeptide. A DNA template may also include a nucleotide sequence encoding a polyadenylation (polyA) tail located at the 3' end of the gene of interest.
Polypeptides of interest include, but are not limited to, biologies, antibodies, antigens (vaccines), and therapeutic proteins. The term “protein” encompasses peptides.
An RNA transcript, in some embodiments, is the product of an IVT reaction and, as will be understood by one of ordinary skill in the art, the DNA template for making an RNA molecule is known based on base complementarity. An RNA transcript, in some embodiments, is a messenger RNA (mRNA) that includes a nucleotide sequence encoding a polypeptide of interest linked to a polyA tail. In some embodiments, the mRNA is modified mRNA (mmRNA), which includes at least one modified nucleotide.
A nucleotide includes a nitrogenous base, a five-carbon sugar (ribose or deoxyribose), and at least one phosphate group. Nucleotides include nucleoside monophosphates, nucleoside diphosphates, and nucleoside triphosphates. A nucleoside monophosphate (NMP) includes a nucleobase linked to a ribose and a single phosphate; a nucleoside diphosphate (NDP) includes a nucleobase linked to a ribose and two phosphates; and a nucleoside triphosphate (NTP) includes a nucleobase linked to a ribose and three phosphates. Nucleotide analogs are compounds that have the general structure of a nucleotide or
are structurally similar to a nucleotide. Nucleotide analogs, for example, include an analog of the nucleobase, an analog of the sugar and/or an analog of the phosphate group(s) of a nucleotide.
A nucleoside includes a nitrogenous base and a 5-carbon sugar. Thus, a nucleoside plus a phosphate group yields a nucleotide. Nucleoside analogs are compounds that have the general structure of a nucleoside or are structurally similar to a nucleoside. Nucleoside analogs, for example, include an analog of the nucleobase and/or an analog of the sugar of a nucleoside.
It should be understood that the term “nucleotide” includes naturally-occurring nucleotides, synthetic nucleotides and modified nucleotides, unless indicated otherwise. Examples of naturally- occurring nucleotides used for the production of RNA, e.g., in an IVT reaction, as provided herein include adenosine triphosphate (ATP), guanosine triphosphate (GTP), cytidine triphosphate (CTP), uridine triphosphate (UTP), and 5-methyluridine triphosphate (m5UTP). In some embodiments, adenosine diphosphate (ADP), guanosine diphosphate (GDP), cytidine diphosphate (CDP), and/or uridine diphosphate (UDP) are used.
Examples of nucleotide analogs include, but are not limited to, antiviral nucleotide analogs, phosphate analogs (soluble or immobilized, hydrolyzable or non-hydrolyzable), dinucleotide, trinucleotide, tetranucleotide, e.g., a cap analog, or a precursor/substrate for enzymatic capping (vaccinia or ligase), a nucleotide labeled with a functional group to facilitate ligation/conjugation of cap or 5' moiety (IRES), a nucleotide labeled with a 5' PO4 to facilitate ligation of cap or 5' moiety, or a nucleotide labeled with a functional group/protecting group that can be chemically or enzymatically cleaved. Examples of antiviral nucleotide/nucleoside analogs include, but are not limited to, Ganciclovir, Entecavir, Telbivudine, Vidarabine and Cidofovir.
Modified nucleotides may include modified nucleobases. For example, a RNA transcript (e.g., mRNA transcript) of the present disclosure may include a modified nucleobase selected from pseudouridine (ip), 1 -methylpseudouridine (m1 ψ), 1 -ethylpseudouridine, 2-thiouridine, 4’-thiouridine, 2- thio-1 -methyl-1 -deaza-pseudouridine, 2-thio-1 -methyl-pseudouridine, 2-thio-5-aza-uridine , 2-thio- dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4- methoxy-pseudouridine, 4-thio-1 -methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methyluridine, 5-methoxyuridine (mo5U) and 2’-O-methyl uridine. In some embodiments, an RNA transcript (e.g., mRNA transcript) includes a combination of at least two (e.g., 2, 3, 4 or more) of the foregoing modified nucleobases.
The nucleoside triphosphates (NTPs) as provided herein may comprise unmodified or modified ATP, modified or unmodified UTP, modified or unmodified GTP, and/or modified or unmodified CTP. In some embodiments, NTPs of an IVT reaction comprise unmodified ATP. In some embodiments, NTPs of an IVT reaction comprise modified ATP. In some embodiments, NTPs of an IVT reaction comprise unmodified UTP. In some embodiments, NTPs of an IVT reaction comprise modified UTP. In some embodiments, NTPs of an IVT reaction comprise unmodified GTP. In some embodiments, NTPs of an IVT reaction comprise modified GTP. In some embodiments, NTPs of an IVT reaction comprise unmodified CTP. In some embodiments, NTPs of an IVT reaction comprise modified CTP.
The concentration of nucleoside triphosphates and cap analog present in an IVT reaction may vary. In some embodiments, NTPs and cap analog are present in the reaction at equimolar concentrations. In some embodiments, the molar ratio of cap analog (e.g., trinucleotide cap) to
nucleoside triphosphates in the reaction is greater than 1 :1 . For example, the molar ratio of cap analog to nucleoside triphosphates in the reaction may be 2:1 , 3:1 , 4:1 , 5:1 , 6:1 , 7:1 , 8:1 , 9:1 , 10:1 , 15:1 , 20:1 , 25:1 , 50:1 , or 100:1 . In some embodiments, the molar ratio of cap analog (e.g., trinucleotide cap) to nucleoside triphosphates in the reaction is less than 1 :1 . For example, the molar ratio of cap analog (e.g., trinucleotide cap) to nucleoside triphosphates in the reaction may be 1 :2, 1 :3, 1 :4, 1 :5, 1 :6, 1 :7, 1 :8, 1 :9, 1 :10, 1 :15, 1 :20, 1 :25, 1 :50, or 1 :100.
The composition of NTPs in an IVT reaction may also vary. For example, ATP may be used in excess of GTP, CTP and UTP. As a non-limiting example, an IVT reaction may include 7.5 millimolar GTP, 7.5 millimolar CTP, 7.5 millimolar UTP, and 3.75 millimolar ATP. The same IVT reaction may include 3.75 millimolar cap analog (e.g., trinucleotide cap). In some embodiments, the molar ratio of G:C:U:A:cap is 1 :1 :1 :0.5:0.5. In some embodiments, the molar ratio of G:C:U:A:cap is 1 :1 :0.5:1 :0.5. In some embodiments, the molar ratio of G:C:U:A:cap is 1 :0.5:1 :1 :0.5. In some embodiments, the molar ratio of G:C:U:A:cap is 0.5:1 :1 :1 :0.5.
In some embodiments, an RNA transcript (e.g., mRNA transcript) includes a modified nucleobase selected from pseudouridine (ip), 1 -methylpseudouridine (m1ψ) , 5-methoxyuridine (mo5U), 5- methylcytidine (m5C), a-thio-guanosine and a-thio-adenosine. In some embodiments, an RNA transcript (e.g., mRNA transcript) includes a combination of at least two (e.g., 2, 3, 4 or more) of the foregoing modified nucleobases.
In some embodiments, an RNA transcript (e.g., mRNA transcript) includes pseudouridine (ip). In some embodiments, an RNA transcript (e.g., mRNA transcript) includes 1 -methylpseudouridine (m1ψ) . In some embodiments, an RNA transcript (e.g., mRNA transcript) includes 5-methoxyuridine (mo5U). In some embodiments, an RNA transcript (e.g., mRNA transcript) includes 5-methylcytidine (m5C). In some embodiments, an RNA transcript (e.g., mRNA transcript) includes a-thio-guanosine. In some embodiments, an RNA transcript (e.g., mRNA transcript) includes a-thio-adenosine.
In some embodiments, the polynucleotide (e.g., RNA polynucleotide, such as mRNA polynucleotide) is uniformly modified (e.g., fully modified, modified throughout the entire sequence) for a particular modification. For example, a polynucleotide can be uniformly modified with 1 - methylpseudouridine (m1ψ), meaning that all uridine residues in the mRNA sequence are replaced with 1 - methylpseudouridine (m1ψ) . Similarly, a polynucleotide can be uniformly modified for any type of nucleoside residue present in the sequence by replacement with a modified residue such as any of those set forth above. Alternatively, the polynucleotide (e.g., RNA polynucleotide, such as mRNA polynucleotide) may not be uniformly modified (e.g., partially modified, part of the sequence is modified). Each possibility represents a separate embodiment of the present disclosure.
In some embodiments, the buffer system contains tris. The concentration of tris used in an IVT reaction, for example, may be at least 10 mM, at least 20 mM, at least 30 mM, at least 40 mM, at least 50 mM, at least 60 mM, at least 70 mM, at least 80 mM, at least 90 mM, at least 100 mM or at least 1 10 mM phosphate. In some embodiments, the concentration of phosphate is 20-60 mM or 10-100 mM.
In some embodiments, the buffer system contains dithiothreitol (DTT). The concentration of DTT used in an IVT reaction, for example, may be at least 1 mM, at least 5 mM, or at least 50 mM. In some embodiments, the concentration of DTT used in an IVT reaction is 1 -50 mM or 5-50 mM. In some embodiments, the concentration of DTT used in an IVT reaction is 5 mM.
In some embodiments, the buffer system contains magnesium. In some embodiments, the molar ratio of NTP to magnesium ions (Mg2+; e.g., MgCl2) present in an IVT reaction is 1 :1 to 1 :5. For example, the molar ratio of NTP to magnesium ions may be 1 :1 , 1 :2, 1 :3, 1 :4 or 1 :5.
In some embodiments, the molar ratio of NTP plus cap analog (e.g., trinucleotide cap, such as GAG) to magnesium ions (Mg2+; e.g., MgCl2) present in an IVT reaction is 1 :1 to 1 :5. For example, the molar ratio of NTP+trinucleotide cap (e.g., GAG) to magnesium ions may be 1 :1 , 1 :2, 1 :3, 1 :4 or 1 :5.
In some embodiments, the buffer system contains Tris-HCI, spermidine (e.g., at a concentration of 1 -30 mM), TRITON® X-100 (polyethylene glycol p-(1 ,1 ,3,3-tetramethylbutyl)-phenyl ether) and/or polyethylene glycol (PEG).
The addition of nucleoside triphosphates (NTPs) to the 3' end of a growing RNA strand is catalyzed by a polymerase, such as T7 RNA polymerase, for example, any one or more of the T7 RNA polymerase variants (e.g., G47A) of the present disclosure. In some embodiments, the RNA polymerase (e.g., T7 RNA polymerase variant) is present in a reaction (e.g., an IVT reaction) at a concentration of 0.01 mg/ml to 1 mg/ml. For example, the RNA polymerase may be present in a reaction at a concentration of 0.01 mg/mL, 0.05 mg/ml, 0.1 mg/ml, 0.5 mg/ml or 1 .0 mg/ml.
In some embodiments, the polynucleotide of the present disclosure is an IVT polynucleotide. Traditionally, the basic components of an mRNA molecule include at least a coding region, a 5'UTR, a 3'UTR, a 5' cap and a poly-A tail. The IVT polynucleotides of the present disclosure can function as mRNA but are distinguished from wild-type mRNA in their functional and/or structural design features which serve, e.g., to overcome existing problems of effective polypeptide production using nucleic-acid based therapeutics.
The primary construct of an IVT polynucleotide comprises a first region of linked nucleotides that is flanked by a first flanking region and a second flaking region. This first region can include, but is not limited to, the encoded polypeptide. The first flanking region can include a sequence of linked nucleosides which function as a 5’ untranslated region (UTR) such as the 5’ UTR of any of the nucleic acids encoding the native 5’ UTR of the polypeptide or a non-native 5’UTR such as, but not limited to, a heterologous 5’ UTR or a synthetic 5’ UTR. The IVT encoding a therapeutic polypeptide can comprise at its 5 terminus a signal sequence region encoding one or more signal sequences. The flanking region can comprise a region of linked nucleotides comprising one or more complete or incomplete 5' UTRs sequences. The flanking region can also comprise a 5' terminal cap. The second flanking region can comprise a region of linked nucleotides comprising one or more complete or incomplete 3' UTRs which can encode the native 3’ UTR of a therapeutic polypeptide, or a non-native 3’ UTR such as, but not limited to, a heterologous 3’ UTR or a synthetic 3’ UTR. The flanking region can also comprise a 3' tailing sequence. The 3’ tailing sequence can be, but is not limited to, a polyA tail, a polyA-G quartet and/or a stem loop sequence.
Additional and exemplary features of IVT polynucleotide architecture and methods of making a polynucleotide are disclosed in PCT International application WO 2017/201325, filed on 18 May 2017, the entire contents of which are hereby incorporated by reference. b. Chemical Synthesis
Standard methods can be applied to synthesize an isolated polynucleotide sequence encoding an isolated polypeptide of interest, such as a polynucleotide of the present disclosure (e.g., a
polynucleotide comprising a nucleotide sequence encoding a therapeutic polypeptide). For example, a single DNA or RNA oligomer containing a codon-optimized nucleotide sequence coding for the particular isolated polypeptide can be synthesized. In other aspects, several small oligonucleotides coding for portions of the desired polypeptide can be synthesized and then ligated. In some aspects, the individual oligonucleotides typically contain 5' or 3' overhangs for complementary assembly.
A polynucleotide disclosed herein (e.g., a RNA, e.g., an mRNA) can be chemically synthesized using chemical synthesis methods and potential nucleobase substitutions known in the art. See, for example, International Publication Nos. WO2014093924, WO2013052523; WO2013039857, WO2012135805, WO2013151671 ; U.S. Publ. No. US20130115272; or U.S. Pat. Nos. US8999380 or US8710200, all of which are herein incorporated by reference in their entireties. c. Quantification of Expressed Polynucleotides Encoding Target Polypeptides
In some embodiments, the polynucleotides of the present disclosure (e.g., a polynucleotide comprising a nucleotide sequence encoding a therapeutic polypeptide), their expression products, as well as degradation products and metabolites can be quantified according to methods known in the art.
In some embodiments, the polynucleotides of the present disclosure can be quantified in exosomes or when derived from one or more bodily fluid. As used herein "bodily fluids" include peripheral blood, serum, plasma, ascites, urine, cerebrospinal fluid (CSF), sputum, saliva, bone marrow, synovial fluid, aqueous humor, amniotic fluid, cerumen, breast milk, broncheoalveolar lavage fluid, semen, prostatic fluid, cowper's fluid or pre-ejaculatory fluid, sweat, fecal matter, hair, tears, cyst fluid, pleural and peritoneal fluid, pericardial fluid, lymph, chyme, chyle, bile, interstitial fluid, menses, pus, sebum, vomit, vaginal secretions, mucosal secretion, stool water, pancreatic juice, lavage fluids from sinus cavities, bronchopulmonary aspirates, blastocyl cavity fluid, and umbilical cord blood. Alternatively, exosomes can be retrieved from an organ selected from the group consisting of lung, heart, pancreas, stomach, intestine, bladder, kidney, ovary, testis, skin, colon, breast, prostate, brain, esophagus, liver, and placenta.
In the exosome quantification method, a sample of not more than 2 mL is obtained from the subject and the exosomes isolated by size exclusion chromatography, density gradient centrifugation, differential centrifugation, nanomembrane ultrafiltration, immunoabsorbent capture, affinity purification, microfluidic separation, or combinations thereof. In the analysis, the level or concentration of a polynucleotide can be an expression level, presence, absence, truncation or alteration of the administered construct. It is advantageous to correlate the level with one or more clinical phenotypes or with an assay for a human disease biomarker.
The assay can be performed using construct specific probes, cytometry, qRT-PCR, real-time PCR, PCR, flow cytometry, electrophoresis, mass spectrometry, or combinations thereof while the exosomes can be isolated using immunohistochemical methods such as enzyme linked immunosorbent assay (ELISA) methods. Exosomes can also be isolated by size exclusion chromatography, density gradient centrifugation, differential centrifugation, nanomembrane ultrafiltration, immunoabsorbent capture, affinity purification, microfluidic separation, or combinations thereof.
These methods afford the investigator the ability to monitor, in real time, the level of polynucleotides remaining or delivered. This is possible because the polynucleotides of the present disclosure differ from the endogenous forms due to the structural or chemical modifications.
In some embodiments, the polynucleotide can be quantified using methods such as, but not limited to, ultraviolet visible spectroscopy (UV/Vis). A non-limiting example of a UV/Vis spectrometer is a NANODROP® spectrometer (ThermoFisher, Waltham, MA). The quantified polynucleotide can be analyzed in order to determine if the polynucleotide can be of proper size, check that no degradation of the polynucleotide has occurred. Degradation of the polynucleotide can be checked by methods such as, but not limited to, agarose gel electrophoresis, HPLC based purification methods such as, but not limited to, strong anion exchange HPLC, weak anion exchange HPLC, reverse phase HPLC (RP-HPLC), and hydrophobic interaction HPLC (HIC-HPLC), liquid chromatography-mass spectrometry (LCMS), capillary electrophoresis (CE) and capillary gel electrophoresis (CGE).
22. Pharmaceutical Compositions and Formulations
The present disclosure provides pharmaceutical compositions and formulations that comprise any of the polynucleotides described above. In some embodiments, the composition or formulation further comprises a delivery agent.
In some embodiments, the composition or formulation can contain a polynucleotide comprising a sequence optimized nucleic acid sequence disclosed herein which encodes a therapeutic polypeptide. In some embodiments, the composition or formulation can contain a polynucleotide (e.g., a RNA, e.g., an mRNA) comprising a polynucleotide (e.g., an ORF) having significant sequence identity to a sequence optimized nucleic acid sequence disclosed herein which encodes a therapeutic polypeptide. In some embodiments, the polynucleotide further comprises a miRNA binding site, e.g., a miRNA binding site that binds miR-126, miR-142, miR-144, miR-146, miR-150, miR-155, miR-16, miR-21 , miR-223, miR-24, miR- 27 and miR-26a.
Pharmaceutical compositions or formulation can optionally comprise one or more additional active substances, e.g., therapeutically and/or prophylactically active substances. Pharmaceutical compositions or formulation of the present disclosure can be sterile and/or pyrogen-free. General considerations in the formulation and/or manufacture of pharmaceutical agents can be found, for example, in Flemington: The Science and Practice of Pharmacy 21st ed., Lippincott Williams & Wilkins, 2005 (incorporated herein by reference in its entirety). In some embodiments, compositions are administered to humans, human patients or subjects. For the purposes of the present disclosure, the phrase "active ingredient" generally refers to polynucleotides to be delivered as described herein.
Formulations and pharmaceutical compositions described herein can be prepared by any method known or hereafter developed in the art of pharmacology. In general, such preparatory methods include the step of associating the active ingredient with an excipient and/or one or more other accessory ingredients, and then, if necessary and/or desirable, dividing, shaping and/or packaging the product into a desired single- or multi-dose unit.
A pharmaceutical composition or formulation in accordance with the present disclosure can be prepared, packaged, and/or sold in bulk, as a single unit dose, and/or as a plurality of single unit doses. As used herein, a "unit dose" refers to a discrete amount of the pharmaceutical composition comprising a
predetermined amount of the active ingredient. The amount of the active ingredient is generally equal to the dosage of the active ingredient that would be administered to a subject and/or a convenient fraction of such a dosage such as, for example, one-half or one-third of such a dosage.
Relative amounts of the active ingredient, the pharmaceutically acceptable excipient, and/or any additional ingredients in a pharmaceutical composition in accordance with the present disclosure can vary, depending upon the identity, size, and/or condition of the subject being treated and further depending upon the route by which the composition is to be administered.
In some embodiments, the compositions and formulations described herein can contain at least one polynucleotide of the present disclosure. As a non-limiting example, the composition or formulation can contain 1 , 2, 3, 4 or 5 polynucleotides of the present disclosure. In some embodiments, the compositions or formulations described herein can comprise more than one type of polynucleotide. In some embodiments, the composition or formulation can comprise a polynucleotide in linear and circular form. In some embodiments, the composition or formulation can comprise a circular polynucleotide and an in vitro transcribed (IVT) polynucleotide. In yet another embodiment, the composition or formulation can comprise an IVT polynucleotide, a chimeric polynucleotide and a circular polynucleotide.
Although the descriptions of pharmaceutical compositions and formulations provided herein are principally directed to pharmaceutical compositions and formulations that are suitable for administration to humans, it will be understood by the skilled artisan that such compositions are generally suitable for administration to any other animal, e.g., to non-human animals, e.g. non-human mammals.
The present disclosure provides pharmaceutical formulations that comprise a polynucleotide described herein (e.g., a polynucleotide comprising a nucleotide sequence encoding a therapeutic polypeptide). The polynucleotides described herein can be Formulated using one or more excipients to: (1 ) increase stability; (2) increase cell transfection; (3) permit the sustained or delayed release (e.g., from a depot formulation of the polynucleotide); (4) alter the biodistribution (e.g., target the polynucleotide to specific tissues or cell types); (5) increase the translation of encoded protein in vivo; and/or (6) alter the release profile of encoded protein in vivo.
In some embodiments of the pharmaceutical formulations disclosed herein, the polynucleotide (e.g., a RNA, e.g., a mRNA) disclosed herein is Formulated with a delivery agent comprising LNP-1 A, LNP 1 -B, LNP-2A, LNP-2B, LNP-3A, or LNP-3B. In some embodiments, the polynucleotide (e.g., a RNA, e.g., a mRNA) of the present disclosure is Formulated with LNP-1 A. In some embodiments, the polynucleotide (e.g., a RNA, e.g., a mRNA) of the present disclosure is Formulated with LNP-1 B. In some embodiments, the polynucleotide (e.g., a RNA, e.g., a mRNA) of the present disclosure is Formulated with LNP-2A. In some embodiments, the polynucleotide (e.g., a RNA, e.g., a mRNA) of the present disclosure is Formulated with LNP-2B. In some embodiments, the polynucleotide (e.g., a RNA, e.g., a mRNA) of the present disclosure is Formulated with LNP-3A. In some embodiments, the polynucleotide (e.g., a RNA, e.g., a mRNA) of the present disclosure is Formulated with LNP-3B.
A pharmaceutically acceptable excipient, as used herein, includes, but are not limited to, any and all solvents, dispersion media, or other liquid vehicles, dispersion or suspension aids, diluents, granulating and/or dispersing agents, surface active agents, isotonic agents, thickening or emulsifying agents, preservatives, binders, lubricants or oil, coloring, sweetening or flavoring agents, stabilizers, antioxidants, antimicrobial or antifungal agents, osmolality adjusting agents, pH adjusting agents, buffers,
chelants, cyoprotectants, and/or bulking agents, as suited to the particular dosage form desired. Various excipients for Formulating pharmaceutical compositions and techniques for preparing the composition are known in the art (see Remington: The Science and Practice of Pharmacy, 21st Edition, A. R. Gennaro (Lippincott, Williams & Wilkins, Baltimore, MD, 2006; incorporated herein by reference in its entirety).
Exemplary diluents include, but are not limited to, calcium or sodium carbonate, calcium phosphate, calcium hydrogen phosphate, sodium phosphate, lactose, sucrose, cellulose, microcrystalline cellulose, kaolin, mannitol, sorbitol, etc., and/or combinations thereof.
Exemplary surface active agents and/or emulsifiers include, but are not limited to, natural emulsifiers (e.g., acacia, agar, alginic acid, sodium alginate, tragacanth, chondrux, cholesterol, xanthan, pectin, gelatin, egg yolk, casein, wool fat, cholesterol, wax, and lecithin), sorbitan fatty acid esters (e.g., polyoxyethylene sorbitan monooleate [TWEEN®80], sorbitan monopalmitate [SPAN®40], glyceryl monooleate, polyoxyethylene esters, polyethylene glycol fatty acid esters (e.g., CREMOPHOR®), polyoxyethylene ethers (e.g., polyoxyethylene lauryl ether [BRIJ®30]), PLUORINC®F 68, POLOXAMER®188, etc. and/or combinations thereof.
Exemplary binding agents include, but are not limited to, starch, gelatin, sugars (e.g., sucrose, glucose, dextrose, dextrin, molasses, lactose, lactitol, mannitol), amino acids (e.g., glycine), natural and synthetic gums (e.g., acacia, sodium alginate), ethylcellulose, hydroxyethylcellulose, hydroxypropyl methylcellulose, etc., and combinations thereof.
Oxidation is a potential degradation pathway for mRNA, especially for liquid mRNA formulations. In order to prevent oxidation, antioxidants can be added to the formulations. Exemplary antioxidants include, but are not limited to, alpha tocopherol, ascorbic acid, ascorbyl palmitate, benzyl alcohol, butylated hydroxyanisole, m-cresol, methionine, butylated hydroxytoluene, monothioglycerol, sodium or potassium metabisulfite, propionic acid, propyl gallate, sodium ascorbate, etc., and combinations thereof.
Exemplary chelating agents include, but are not limited to, ethylenediaminetetraacetic acid (EDTA), citric acid monohydrate, disodium edetate, fumaric acid, malic acid, phosphoric acid, sodium edetate, tartaric acid, trisodium edetate, etc., and combinations thereof.
Exemplary antimicrobial or antifungal agents include, but are not limited to, benzalkonium chloride, benzethonium chloride, methyl paraben, ethyl paraben, propyl paraben, butyl paraben, benzoic acid, hydroxybenzoic acid, potassium or sodium benzoate, potassium or sodium sorbate, sodium propionate, sorbic acid, etc., and combinations thereof.
Exemplary preservatives include, but are not limited to, vitamin A, vitamin C, vitamin E, betacarotene, citric acid, ascorbic acid, butylated hydroxyanisol, ethylenediamine, sodium lauryl sulfate (SLS), sodium lauryl ether sulfate (SLES), etc., and combinations thereof.
In some embodiments, the pH of polynucleotide solutions is maintained between pH 5 and pH 8 to improve stability. Exemplary buffers to control pH can include, but are not limited to sodium phosphate, sodium citrate, sodium succinate, histidine (or histidine-HCI), sodium malate, sodium carbonate, etc., and/or combinations thereof.
Exemplary lubricating agents include, but are not limited to, magnesium stearate, calcium stearate, stearic acid, silica, talc, malt, hydrogenated vegetable oils, polyethylene glycol, sodium benzoate, sodium or magnesium lauryl sulfate, etc., and combinations thereof.
The pharmaceutical composition or formulation described here can contain a cryoprotectant to stabilize a polynucleotide described herein during freezing. Exemplary cryoprotectants include, but are not limited to mannitol, sucrose, trehalose, lactose, glycerol, dextrose, etc., and combinations thereof.
The pharmaceutical composition or formulation described here can contain a bulking agent in lyophilized polynucleotide formulations to yield a "pharmaceutically elegant" cake, stabilize the lyophilized polynucleotides during long term (e.g., 36 month) storage. Exemplary bulking agents of the present disclosure can include, but are not limited to sucrose, trehalose, mannitol, glycine, lactose, raffinose, and combinations thereof.
In some embodiments, the pharmaceutical composition or formulation further comprises a delivery agent. The delivery agent of the present disclosure can include, without limitation, liposomes, lipid nanoparticles, lipidoids, polymers, lipoplexes, microvesicles, exosomes, peptides, proteins, cells transfected with polynucleotides, hyaluronidase, nanoparticle mimics, nanotubes, conjugates, and combinations thereof.
23. Methods of Use
The polynucleotides, pharmaceutical compositions and formulations described above are used in the preparation, manufacture, and therapeutic use of to treat and/or prevent diseases, disorders, or conditions (e.g., diseases, disorders, or conditions associated with a deficiency in an endogenous protein).
In some embodiments, the polynucleotides, polypeptides, pharmaceutical compositions, and formulations of the present disclosure are used in a method of treating or delaying the onset and/or progression of a disease in a subject (e.g., a human subject), comprising: administering to the subject an effective amount of any of the polynucleotides, polypeptides, pharmaceutical compositions, and formulations described above.
In some embodiments, the polynucleotides, polypeptides, pharmaceutical compositions, and formulations of the present disclosure are used in a method of increasing therapeutic polypeptide levels in a subject (e.g., a human subject), comprising: administering to the subject an effective amount of any of the polynucleotides, polypeptides, pharmaceutical compositions, and formulations described above.
In some embodiments, the polynucleotides, polypeptides, pharmaceutical compositions, and formulations of the present disclosure are used in a method of increasing therapeutic polypeptide activity in a subject (e.g., a human subject), comprising: administering to the subject an effective amount of any of the polynucleotides, polypeptides, pharmaceutical compositions, and formulations described above.
Other aspects of the present disclosure relate to transplantation of cells containing polynucleotides to a mammalian subject. Administration of cells to mammalian subjects is known to those of ordinary skill in the art, and includes, but is not limited to, local implantation (e.g., topical or subcutaneous administration), organ delivery or systemic injection (e.g., intravenous injection or inhalation), and the formulation of cells in pharmaceutically acceptable carriers. a. Target Polypeptide Expression Levels
Certain aspects of the present disclosure feature measurement, determination and/or monitoring of the expression level or levels of therapeutic protein in a subject, for example, in an animal (e.g.,
rodents, primates, and the like) or in a human subject. Animals include normal, healthy or wild type animals.
Therapeutic protein expression levels can be measured or determined by any art- recognized method for determining protein levels in biological samples, e.g., from blood samples or a needle biopsy. The term "level" or "level of a protein" as used herein, preferably means the weight, mass or concentration of the protein within a sample or a subject. It will be understood by the skilled artisan that in certain embodiments the sample may be subjected, e.g., to any of the following: purification, precipitation, separation, e.g. centrifugation and/or HPLC, and subsequently subjected to determining the level of the protein, e.g., using mass and/or spectrometric analysis. In exemplary embodiments, enzyme- linked immunosorbent assay (ELISA) can be used to determine protein expression levels. In other exemplary embodiments, protein purification, separation and LC-MS can be used as a means for determining the level of a protein according to the invention. In some embodiments, an mRNA therapy of the present disclosure (e.g., a single intravenous dose) results in increased therapeutic protein expression levels in the tissue (e.g., heart, liver, brain, or skeletal muscle) of the subject (e.g., 2-fold, 3- fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 20-fold, 30-fold, 40-fold, 50-fold increase and/or increased to at least 50%, at least 60%, at least 70%, at least 75%, 80%, at least 85%, at least 90%, at least 95%, or at least 100% of normal levels) for at least 6 hours, at least 12 hours, at least 24 hours, at least 36 hours, at least 48 hours, at least 60 hours, at least 72 hours, at least 84 hours, at least 96 hours, at least 108 hours, at least 122 hours after administration of a single dose or multiple doses of the mRNA therapy. b. Target Polypeptide Activity
In subjects that are treated in conjunction with the methods and medical uses of the disclosure, therapeutic enzymatic activity may be reduced compared to a normal physiological activity level. Further aspects of the present disclosure feature measurement, determination and/or monitoring of the activity level(s) (i.e., enzymatic activity level(s)) of therapeutic protein in a subject, for example, in an animal (e.g., rodent, primate, and the like) or in a human subject. Activity levels can be measured or determined by any art-recognized method for determining enzymatic activity levels in biological samples. The term "activity level" or "enzymatic activity level" as used herein, preferably means the activity of the enzyme per volume, mass or weight of sample or total protein within a sample. In exemplary embodiments, the "activity level" or "enzymatic activity level" is described in terms of units per milliliter of fluid (e.g., bodily fluid, e.g., serum, plasma, urine and the like) or is described in terms of units per weight of tissue or per weight of protein (e.g., total protein) within a sample. Units (“U”) of enzyme activity can be described in terms of weight or mass of substrate hydrolyzed per unit time. In certain embodiments of the present disclosure feature, therapeutic enzyme activity is described in terms of U/ml plasma or U/mg protein (tissue), where units (“U”) are described in terms of nmol substrate hydrolyzed per hour (or nmol/hr).
In certain embodiments, an mRNA therapy of the present disclosure features a pharmaceutical composition comprising a dose of mRNA effective to result in at least 5 U/mg, at least 10 U/mg, at least 20 U/mg, at least 30 U/mg, at least 40 U/mg, at least 50 U/mg, at least 60 U/mg, at least 70 U/mg, at least 80 U/mg, at least 90 U/mg, at least 100 U/mg, or at least 150 U/mg of polypeptide activity in tissue (e.g.,
liver) between 6 and 12 hours, or between 12 and 24, between 24 and 48, or between 48 and 72 hours post administration (e.g., at 48 or at 72 hours post administration).
In some embodiments, an mRNA therapy of the present disclosure (e.g., a single intravenous dose) results in increased polypeptide activity levels in the liver tissue of the subject (e.g., 2-fold, 3-fold, 4- fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 20-fold, 30-fold, 40-fold, 50-fold increase and/or increased to at least 50%, at least 60%, at least 70%, at least 75%, 80%, at least 85%, at least 90%, at least 95%, or at least 100% of normal levels) for at least 6 hours, at least 12 hours, at least 24 hours, or at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30 or more days after administration of a single dose or multiple doses of the mRNA therapy.
In exemplary embodiments, an mRNA therapy of the present disclosure features a pharmaceutical composition comprising a single intravenous dose of mRNA that results in the abovedescribed levels of activity. In some embodiments, an mRNA therapy of the present disclosure features a pharmaceutical composition which can be administered in multiple single unit intravenous doses of mRNA that maintain the above-described levels of activity.
24. Forms of Administration
The polynucleotides, pharmaceutical compositions and formulations of the present disclosure described above can be administered by any route that results in a therapeutically effective outcome, such as intravenous (into a vein) administration. These also include, but are not limited to enteral (into the intestine), gastroenteral, epidural (into the dura matter), oral (by way of the mouth), transdermal, peridural, intracerebral (into the cerebrum), intracerebroventricular (into the cerebral ventricles), epicutaneous (application onto the skin), intradermal, (into the skin itself), subcutaneous (under the skin), nasal administration (through the nose), intravenous bolus, intravenous drip, intraarterial (into an artery), intramuscular (into a muscle), intracardiac (into the heart), intraosseous infusion (into the bone marrow), intrathecal (into the spinal canal), intraperitoneal, (infusion or injection into the peritoneum), intravesical infusion, intravitreal, (through the eye), intracavernous injection (into a pathologic cavity) intracavitary (into the base of the penis), intravaginal administration, intrauterine, extra-amniotic administration, transdermal (diffusion through the intact skin for systemic distribution), transmucosal (diffusion through a mucous membrane), transvaginal, insufflation (snorting), sublingual, sublabial, enema, eye drops (onto the conjunctiva), in ear drops, auricular (in or by way of the ear), buccal (directed toward the cheek), conjunctival, cutaneous, dental (to a tooth or teeth), electro-osmosis, endocervical, endosinusial, endotracheal, extracorporeal, hemodialysis, infiltration, interstitial, intra-abdominal, intra-amniotic, intraarticular, intrabiliary, intrabronchial, intrabursal, intracartilaginous (within a cartilage), intracaudal (within the cauda equine), intracisternal (within the cisterna magna cerebellomedularis), intracorneal (within the cornea), dental intracornal, intracoronary (within the coronary arteries), intracorporus cavernosum (within the dilatable spaces of the corporus cavernosa of the penis), intradiscal (within a disc), intraductal (within a duct of a gland), intraduodenal (within the duodenum), intradural (within or beneath the dura), intraepidermal (to the epidermis), intraesophageal (to the esophagus), intragastric (within the stomach), intragingival (within the gingivae), intraileal (within the distal portion of the small intestine), intralesional (within or introduced directly to a localized lesion), intraluminal (within a lumen of a tube), intralymphatic (within the lymph), intramedullary (within the marrow cavity of a bone), intrameningeal (within the
meninges), intraocular (within the eye), intraovarian (within the ovary), intrapericardial (within the pericardium), intrapleural (within the pleura), intraprostatic (within the prostate gland), intrapulmonary (within the lungs or its bronchi), intrasinal (within the nasal or periorbital sinuses), intraspinal (within the vertebral column), intrasynovial (within the synovial cavity of a joint), intratendinous (within a tendon), intratesticular (within the testicle), intrathecal (within the cerebrospinal fluid at any level of the cerebrospinal axis), intrathoracic (within the thorax), intratubular (within the tubules of an organ), intratympanic (within the aurus media), intravascular (within a vessel or vessels), intraventricular (within a ventricle), iontophoresis (by means of electric current where ions of soluble salts migrate into the tissues of the body), irrigation (to bathe or flush open wounds or body cavities), laryngeal (directly upon the larynx), nasogastric (through the nose and into the stomach), occlusive dressing technique (topical route administration that is then covered by a dressing that occludes the area), ophthalmic (to the external eye), oropharyngeal (directly to the mouth and pharynx), parenteral, percutaneous, periarticular, peridural, perineural, periodontal, rectal, respiratory (within the respiratory tract by inhaling orally or nasally for local or systemic effect), retrobulbar (behind the pons or behind the eyeball), intramyocardial (entering the myocardium), soft tissue, subarachnoid, subconjunctival, submucosal, topical, transplacental (through or across the placenta), transtracheal (through the wall of the trachea), transtympanic (across or through the tympanic cavity), ureteral (to the ureter), urethral (to the urethra), vaginal, caudal block, diagnostic, nerve block, biliary perfusion, cardiac perfusion, photopheresis or spinal. In specific embodiments, compositions can be administered in a way that allows them to cross the blood-brain barrier, vascular barrier, or other epithelial barrier. In some embodiments, a formulation for a route of administration can include at least one inactive ingredient.
25. Equivalents and Scope
Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments in accordance with the invention described herein. The scope of the present disclosure is not intended to be limited to the above Description, but rather is as set forth in the appended claims.
In the claims, articles such as "a," "an," and "the" can mean one or more than one unless indicated to the contrary or otherwise evident from the context. Claims or descriptions that include "or" between one or more members of a group are considered satisfied if one, more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process unless indicated to the contrary or otherwise evident from the context. The invention includes embodiments in which exactly one member of the group is present in, employed in, or otherwise relevant to a given product or process. The invention includes embodiments in which more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process.
It is also noted that the term "comprising" is intended to be open and permits but does not require the inclusion of additional elements or steps. When the term "comprising" is used herein, the term "consisting of" is thus also encompassed and disclosed.
Where ranges are given, endpoints are included. Furthermore, it is to be understood that unless otherwise indicated or otherwise evident from the context and understanding of one of ordinary skill in the art, values that are expressed as ranges can assume any specific value or subrange within the stated
ranges in different embodiments of the present disclosure, to the tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise.
In addition, it is to be understood that any particular embodiment of the present disclosure that falls within the prior art can be explicitly excluded from any one or more of the claims. Since such embodiments are deemed to be known to one of ordinary skill in the art, they can be excluded even if the exclusion is not set forth explicitly herein. Any particular embodiment of the compositions of the present disclosure (e.g., any nucleic acid or protein encoded thereby; any method of production; any method of use; etc.) can be excluded from any one or more claims, for any reason, whether or not related to the existence of prior art.
All cited sources, for example, references, publications, databases, database entries, and art cited herein, are incorporated into this application by reference, even if not expressly stated in the citation. In case of conflicting statements of a cited source and the instant application, the statement in the instant application shall control.
Section and table headings are not intended to be limiting.
EXAMPLES
The following examples are put forth so as to provide those of ordinary skill in the art with a description of how the compositions and methods claimed herein are performed, made, and evaluated, and are intended to be purely exemplary described herein and are not intended to limit the scope of what the inventors regards as their invention.
Example 1. IRES elements of the disclosure are capable of effectuating translation of linear mRNA molecules even in the absence of a 5’ cap structure.
This example demonstrates the utility of IRES elements described herein in promoting translation of linear mRNA molecules that lack a 5’ cap. Additionally, the data described in this example illustrate that the IRES elements described herein are compatible with chemically modified nucleosides, such as 1 - methylpseudouridine.
As is shown in FIG. 1 A, linear RNA molecules are prone to degradation at the 5’ and/or 3’ ends by way of exonucleases (top). These types of linear RNA molecules often contain a 5’ cap (bottom) in order to promote ribosome recruitment and, ultimately, translation of an open reading frame. FIG. 1 B shows exemplary ways in which RNAs may mitigate or avoid exonuclease degradation. In one example (top), a linear RNA molecule may be bound to a chemical moiety at the 5’ and/or 3’ ends that blocks the access of exonucleases to the RNA molecule. In another example (middle), the RNA may be circularized, such that there are no 5’ or 3’ ends available for binding to (and cleavage by) an exonuclease). One aspect that has hindered the development of these types of molecules is the absence of a 5’ cap, which would typically be attached to the free 5’ end of a linear RNA molecule in order to promote ribosome binding and open reading frame translation. The present disclosure addresses this problem by providing internal ribosome entry (IRES) elements that recruit the translation machinery (translation factors, e.g., elf4g or ribosome itself) in a cap-independent manner (bottom), allowing for RNAs to simultaneously recruit ribosomes and be modified in ways that remove/modify the cap so as to
avoid nucleolytic degradation (e.g.. by way of 5’ and/or 3’ blocking moieties or by way of RNA circularization).
As is shown in FIG. 2, linear mRNA molecules lacking a 5’ cap but containing an IRES element of the disclosure are capable of expressing functional protein product. FIG. 2 compares the expression of green fluorescent protein (GFP) fused to a degron domain, from three different, linear RNA constructs in HEK293 cells over the course of 60 hours. Each linear RNA contained an open reading frame encoding GFP fused to a degron domain, and each RNA lacked a 5’ cap structure. The RNA molecules differed in the type of IRES element tested within the 5’ untranslated region (UTR). One construct contained a known coxsackievirus B3 (CVB3) IRES sequence in its 5’ UTR (“GO lin, 5’ CVB3,” top of graph); another construct contained three polynucleotide tracts each containing 9 contiguous unmodified uridine residues, each tract separated from one another by two 13-nucleoside spacers (“GO lin, 5’ v1 .1 ,” lower line of graph); and another construct contained three polynucleotide tracts each containing 9 contiguous 1 - methylpseudouridine residues, each tract separated from one another by two 13-nucleoside spacers (“G5 lin, 5’ 3xU9,” middle of graph). A negative control, in which no RNA was provided to the HEK293 cells, was included as well (bottom flatline of graph). FIG. 2 also includes a table comparing the GFP expression level achieved by the “G5 lin, 5’3xU9” construct as compared to the “GO lin, 5’ CVB3” construct and a construct having the same composition as “G5 lin, 5’3xU9,” but also containing the known 5’ Cap1 structure.
The inventors have also demonstrated the ability of IRES elements of the disclosure to promote translation of mRNA molecules that lack a 5’ cap in FIGS. 3A - 3D. These figures provide graphs comparing the expression of GFP fused to a degron domain from three different, linear RNA constructs in various cell types (HeLa (FIG. 3A), HEK293 (FIG. 3B), THP1 (FIG. 3C), and Hep3B (FIG. 3D)). Each construct contained an open reading frame encoding GFP, but the constructs differed in the IRES element tested within the 5’ UTR and in the presence/absence of a 5’ cap. One construct contained the known 5’ Cap1 structure (“Cap1 -A100,” circles); another construct contained the CVB3 IRES sequence in its 5’ UTR, without a 5’ cap structure (“CVB3 (GO),” squares); and another construct contained three polynucleotide tracts each containing 9 contiguous 1 -methylpseudouridine residues, each tract separated from one another by two 13-nucleoside spacers without a 5’cap structure (“3xU9_1 (G5),” diamonds). A negative control, in which no RNA was provided to the HEK293 cells, was included as well (bottom flatline of graph). FIG. 3 also includes a table comparing the GFP expression level achieved by the “3xU9_1 (G5)” and “CVB3 (GO)” construct as compared to the “Cap1 -A100” construct.
Notably, FIGS. 4A and 4B demonstrate that IRES elements of the disclosure outperform certain IRES elements known in the art. FIG. 4A is a schematic showing an experimental design for the evaluation of erythropoietin (EPO) expression in BALB/c mice injected intravenously with SM86/DMG nanoparticles containing one of five different EPO-encoding RNA constructs: (i) a linear RNA construct containing an EPO-encoding open reading frame and a 5’ Cap1 structure (“Cap1 -A100,” also referred to as “GO Cap1 ”); (ii) a linear RNA construct containing an EPO-encoding open reading frame, a 5’ UTR containing the CVB3 IRES, and a 5’ triphosphate structure (“lin GO CVB3, 5’ PPP”); (iii) a linear RNA construct containing an EPO-encoding open reading frame, a 5’ UTR containing the CVB3 IRES, and a 5’ biotin-triazole structure (“lin GO CVB3, 5’ bA”); (iv) a linear RNA construct containing an EPO-encoding open reading frame, a 5’ UTR containing three polynucleotide tracts each containing 9 contiguous 1 -
methylpseudouridine residues, each tract separated from one another by two 13-nucleoside spacers, and a 5’ triphosphate structure (“lin G5 3xU9, 5’ PPP”); and (v) a linear RNA construct containing an EPO- encoding open reading frame, a 5’ UTR containing three polynucleotide tracts each containing 9 contiguous 1 -methylpseudouridine residues, each tract separated from one another by two 13-nucleoside spacers, and a 5’ biotin-triazole structure (“lin G53xU9, 5’ bA”). Mice were injected with the SM86-DMG nanoparticles intravenously and were assessed for serum EPO concentrations after 3 hours, 6 hours, 1 day, and 2 days. FIG. 4B is a graph comparing the serum EPO concentrations achieved by each construct.
Taken together, the above data demonstrate that IRES elements of the disclosure are capable of promoting protein translation from linear mRNA molecules in a manner that does not rely on the presence or absence of a 5’ cap structure and in a manner that is compatible with chemically modified nucleosides.
Example 2. IRES elements of the disclosure exhibit reduced immunogenicity relative to IRES elements known in the art.
This example describes the results of an experiment in which IRES elements of the disclosure were assessed for their propensity to induce an immune response upon administration to a subject.
As is shown in FIG. 5, a series of experiments were conducted in order to compare the secretion of I FN-y-inducible protein 10 (IP10) - an immune response marker - in BALB/c mice injected intravenously with one of five different EPO-encoding RNA constructs. These constructs were: (i) a linear RNA construct containing an EPO-encoding open reading frame and a 5’ Cap1 structure (“GO Cap1 ”); (ii) a linear RNA construct containing an EPO-encoding open reading frame, a 5’ UTR containing the CVB3 IRES, and a 5’ triphosphate structure (“lin GO CVB3, 5’ PPP”); (iii) a linear RNA construct containing an EPO-encoding open reading frame, a 5’ UTR containing the CVB3 IRES, and a 5’ biotin- triazole structure (“lin GO CVB3, 5’ bA”); (iv) a linear RNA construct containing an EPO-encoding open reading frame, a 5’ UTR containing three polynucleotide tracts each containing 9 contiguous 1 - methylpseudouridine residues, each tract separated from one another by two 13-nucleoside spacers, and a 5’ triphosphate structure (“lin G5 3xU9, 5’ PPP”); and (v) a linear RNA construct containing an EPO- encoding open reading frame, a 5’ UTR containing three polynucleotide tracts each containing 9 contiguous 1 -methylpseudouridine residues, each tract separated from one another by two 13-nucleoside spacers, and a 5’ biotin-triazole structure (“lin G53xU9, 5’ bA”). Mice were injected with the SM86-DMG nanoparticles intravenously and were subsequently assessed for serum IP10 concentrations.
Overall, the “U9” IRES elements effectuated little to no significant immunogenicity. Notably, in at least one instance, the “U9”-containing IRES elements resulted in reduced immunogenicity relative to those constructs containing the CVB3 IRES. Taken together, these data demonstrate that the IRES elements of the disclosure are not only compatible with chemically modified nucleosides and promote ribosomal recruitment even in the absence of a 5’ cap, but that the IRES elements disclosed herein exhibit improved safety relative to known IRES elements by avoiding an immunogenic response.
Example 3. IRES elements of the disclosure may include various quantities of polypyrimidine (e.g., polyuridine or poly-1-methylpseudouridine) tracts.
This example demonstrates that IRES elements described herein may contain a plurality of polypyrimidine tracts, such as from three to six polypyrimidine tracts.
As is shown in FIG. 6A, the experiments described in this example compare the expression of luciferase in HeLa cells transfected in the presence of lipofectamine 2000 (L2K) with one of three different luciferase-encoding RNA constructs. The constructs tested were: (i) a linear RNA construct containing a luciferase-encoding open reading frame, a 5’ UTR containing an IRES having three polynucleotide tracts each containing 9 contiguous 1 -methylpseudouridine residues, each tract separated from one another by two 13-nucleoside spacers, and a 5’ triphosphate structure (“G5 lin 5’ PPP_3xU9”); and (ii) a linear RNA construct containing a luciferase-encoding open reading frame, a 5’ UTR containing an IRES having six polynucleotide tracts each containing 9 contiguous 1 -methylpseudouridine residues, the tracts separated from one another by spacers of 18-28 nucleosides in length, and a 5’ triphosphate structure (“G5 lin 5’ PPP_6xU9”); and (iii) a linear RNA construct having the same structure as in (ii), except containing a 5’ Cap1 structure in lieu of a 5’ triphosphate structure (“G5 lin 5’ Cap1_v2.0”). FIG. 6B is table comparing the luciferase expression of the constructs tested in FIG. 6A in two different cell types: HeLa cells and Hep3B cells.
Taken together, the above data demonstrate that IRES elements containing, e.g., from three to six polypyrimidine (e.g., polyuridine or poly-1 -methylpseudouridine) tracts are capable of promoting ribosomal recruitment and translation of protein products.
Example 4. IRES elements of the disclosure are capable of promoting translation of circular RNA molecules.
This example demonstrates that IRES elements described herein are capable of promoting translation of circular RNA molecules (without the need for a 5’ cap structure) having chemically modified uridine nucleosides (1 -methylpseudouridine) in lieu of uridine. Notably, this example represents the first reported instance of translation from a circular RNA molecule containing 1 -methylpseudouridine nucleosides.
As is shown in FIG. 7A, the experiments conducted in this example were conducted with the aim of comparing the expression of luciferase in HeLa cells that were transfected, in accordance with the methodology described in FIG. 6A, with a circular RNA molecule containing a luciferase-encoding open reading frame. In addition to encoding luciferase, the RNA molecule was tethered to one of three proteins by way of MS2 tethering sites within the RNA: (i) LACZ (“t-LACZ”), (ii) eukaryotic translation initiation factor 4 G (“t-elF4G”), or (iii) La protein (“t-La”). Tethering was facilitated by fusing MBP- encoding polypeptide to LACZ(t-Lacz), 4 G (“t-elF4G”), or (iii) La protein (“t-La”).
Similarly, FIG. 7B is a graph comparing luciferase expression achieved by linearized versions of the constructs tested in FIG. 7A; in FIG. 7B, each construct contained a 5’ triphosphate structure and a 3’ poly(A) tail in lieu of circularization. Notably, the data shown in FIGS. 7A and 7B represent the first instance of successful translation of a RNA, particularly one in which all uridine nucleosides have been replaced with 1 -methylpseudouridine nucleosides.
Taken together, the data shown in FIGS. 7A and 7B show that IRES elements described herein engender ribosomal recruitment and translation in a manner that is independent of the presence or absence of a 5’ cap and in a manner that is compatible with chemically modified nucleosides. The latter observation stems from the fact that the interaction that mediates the recruitment of the ribosome (i.e., the interaction between the MS2 tethering site and the MS2-binding protein) is not affected by the presence or absence of a nucleoside modification (in this instance, 1 -methylspeduorudiein). Accordingly, the IRES elements of the disclosure can be used in conjunction with chemically modified nucleosides, including 1 - methylpseudouridine.
Example 5. IRES elements of the disclosure may include RNA sequences that bind translation initiation factors by way of intermolecular tethering.
The results reported in this example demonstrate the IRES elements described herein are compatible with intermolecular tethers that bring a translation initiation factor into proximity of a desired open reading frame.
As is shown in FIG. 8A, a series of experiments was undertaken in order to compare the expression of mGreenLantern protein in HeLa cells that were transfected with mGreenLantern-encoding RNA constructs in the presence of L2K. Three different RNA constructs were tested: (i) a linear RNA construct containing an mGreenLantern-encoding open reading frame, a 5’ UTR containing an IRES having six polynucleotide tracts each containing 9 contiguous 1 -methylpseudouridine residues, the tracts separated from one another by spacers of 18-28 nucleosides in length, and a 5’ triphosphate structure (“G5 lin 5’ Cap1_v2.0”); (ii) a linear RNA construct containing an mGreenLantern-encoding open reading frame, a 5’ UTR containing an IRES having the nucleic acid sequence of SEQ ID NO: 1 , and a 5’ triphosphate structure (“GO lin 5’ PPP_1 xApt17”); and (iii) a linear RNA construct containing an mGreenLantern-encoding open reading frame, a 5’ UTR containing an IRES having the nucleic acid sequence of SEQ ID NO: 1 , with all U residues replaced with N-methylpseudouridine residues, and a 5’ triphosphate structure (“G5 lin 5’ PPP_1 xAptl 7”). Similarly, FIG. 8B is a graph comparing the expression of luciferase in HeLa cells that were transfected with luciferase-encoding RNA constructs in the presence of L2K. Five different RNA constructs were tested: (i) a linear RNA construct containing a luciferaseencoding open reading frame, a 5’ UTR containing an IRES having three polynucleotide tracts each containing 9 contiguous 1 -methylpseudouridine residues, and a 5’ Cap1 structure (“G5 lin 5’ Cap1_v1 .1 ”); (ii) a linear RNA construct containing a luciferase-encoding open reading frame, a 5’ UTR containing an IRES having three polynucleotide tracts each containing 9 contiguous 1 -methylpseudouridine residues, and a 5’ triphosphate structure (“G5 lin 5’ PPP_3xU9”); (iii) a linear RNA construct containing a luciferaseencoding open reading frame, a 5’ UTR containing an IRES having six polynucleotide tracts each containing 9 contiguous 1 -methylpseudouridine residues, and a 5’ triphosphate structure (“G5 lin 5’ PPP_6xU9”); (iv) a linear RNA construct containing a luciferase-encoding open reading frame, a 5’ UTR containing an IRES having the nucleic acid sequence of SEQ ID NO: 1 , with all U residues replaced with N-methylpseudouridine residues, and a 5’ triphosphate structure (“G5 lin 5’ PPP_1 xApt17”); and (v) a linear RNA construct containing a luciferase-encoding open reading frame, a 5’ UTR containing an IRES having six repeats of the nucleic acid sequence of SEQ ID NO: 1 , with all U residues replaced with N- methylpseudouridine residues, and a 5’ triphosphate structure (“G5 lin 5’ PPP_6xApt17”).
The experiments summarized in FIGS. 9A and 9B similarly demonstrate the ability of IRES elements that bind translation initiation factors to promote protein synthesis. FIG. 9A is a graph comparing the expression of luciferase in HeLa cells transfected with one of eight different luciferaseencoding RNA constructs: (i) a linear RNA construct containing a luciferase-encoding open reading frame and a 5’ Cap1 structure (“C1 ”); (ii) a linear RNA construct containing a luciferase-encoding open reading frame, a 5’ UTR containing an IRES having three polynucleotide tracts each containing 9 contiguous uridine residues, and a 5’-triphosphate structure (“v1 .1 ”); (iii) a linear RNA construct containing a luciferase-encoding open reading frame, a 5’ UTR containing an IRES having six polynucleotide tracts each containing 9 contiguous 1 -methylpseudouridine residues, and a 5’-triphosphate structure (“v2.0 (G5)”); (iv) a linear RNA construct containing a luciferase-encoding open reading frame, a 5’ UTR containing an IRES having six polynucleotide tracts each containing 9 contiguous uridine residues, and a 5’-triphosphate structure (“v2.0 (G0)”); (v) a linear RNA construct containing a luciferaseencoding open reading frame, a 5’ UTR containing an IRES having a polynucleotide tract that specifically binds La protein, with all uridine residues in the polynucleotide tract replaced by 1 -methylpseudouridine residues, and a 5’-triphosphate structure (“1xPDCD4 La (G5)”); (vi) a linear RNA construct containing a luciferase-encoding open reading frame, a 5’ UTR containing an IRES having a polynucleotide tract that specifically binds La protein, and a 5’-triphosphate structure (“1xPDCD4 La (GO)”); (vii) a linear RNA construct containing a luciferase-encoding open reading frame, a 5’ UTR containing an IRES having a polynucleotide tract that specifically binds elF4G protein, with all uridine residues in the polynucleotide tract replaced by 1 -methylpseudouridine residues, and a 5’-triphosphate structure (“1xAUAU4 (G5)”); and (viii) a linear RNA construct containing a luciferase-encoding open reading frame, a 5’ UTR containing an IRES having a polynucleotide tract that specifically binds elF4G protein, and a 5’-triphosphate structure (“1xAUAU4 (GO)”). FIG. 9B provides a table reporting the luciferase expression achieved by certain of the constructs shown in FIG. 9A as a percentage of the luciferase expression achieved by the “Cap1 ” construct.
Taken together, the above data demonstrate the ability of IRES elements that bind a translation initiation factor (for example, by way of an intermolecular tether described herein) to promote protein synthesis. Additional translation initiation factor-recruiting sequences, as well as alternative molecular tethers, that may be used in conjunction with the compositions and methods of the disclosure are described herein.
Example 6. IRES elements of the disclosure are useful in linear mRNA molecules containing a 5’ cap.
The results reported in this example demonstrate another important feature of IRES elements of the disclosure: In addition to being useful in conjunction with RNA molecules that lack a 5’ cap, the IRES elements described herein are also advantages in RNA molecules (e.g., linear mRNA molecules) that contain a 5’ cap. In this setting, the IRES elements of the disclosure may provide the benefit of a means by which the RNA may be translated even after the 5’ cap is removed by way of endogenous decapping processes. Without being limited by mechanism, the foregoing scenario represents one way in which the inclusion of an IRES element of the disclosure can effectively extend the ability of decapped nucleic acids (e.g., decapped linear RNAs) to effectuate protein expression.
As is shown in FIG. 10A, the experiments conducted in this example were undertaken with the aim of comparing the expression of fluorescent protein in HeLa cells transfected with one of two different fluorescent-protein-encoding RNA constructs. The constructs tested were: (i) a linear RNA construct containing a 5’ cap structure, a 5’ UTR containing an IRES having the nucleic acid sequence of GGGAAAUAAGAGAGAAAAGAAGAGuAAGAAGAAAUAUAAGACCCCGGCGCCGCCACC (SEQ ID NO: 3, “UTR1 ”), and a GFP-encoding open reading frame and; and (ii) an RNA construct containing a 5’ cap structure, a 5’ UTR containing an IRES having the nucleic acid sequence of GGGAAAUUUUUUUUUGAUAUUAUAAGAGUUUUUUUUUGAUAUUAAGAAAAUUUUUUUUUGAUAUU AGAAGAGUAAGAAGAAAUAUAAGACCCCGGCGCCGCCACC (SEQ ID NO: 4, “UTR2”), and a GFP- encoding open reading frame. A negative control (“no RNA”) was included for comparison purposes. Similarly, FIG. 10B is a graph demonstrating the results of an experiment conducted as outlined in FIG. 10A, but in HEK293 cells in lieu of HeLa cells.
FIG. 10C provides a set of graphs comparing the expression of luciferase in BALB/c mice transfected with one of two different luciferase-encoding RNA constructs: (i) a linear RNA construct containing a 5’ cap structure, a 5’ UTR containing an IRES having the nucleic acid sequence of “UTR1 ” (as in FIGS. 10A and 10B), and a luciferase-encoding open reading frame; and (ii) a linear RNA construct containing a 5’ cap structure, a 5’ UTR containing an IRES having the nucleic acid sequence of “UTR2” (as in FIGS. 10A and 10B), and a luciferase-encoding open reading frame. A negative control (“PBS”) was included for comparison purposes. Similarly, FIG. 10D provides a set of graphs comparing the expression of erythropoietin in BALB/c mice transfected with one of two different erythropoietin-encoding RNA constructs: (i) a linear RNA construct containing a 5’ cap structure, a 5’ UTR containing an IRES having the nucleic acid sequence of “UTR1 ” (as in FIGS. 10A and 10B), and an erythropoietin-encoding open reading frame; and (ii) a linear RNA construct containing a 5’ cap structure, a 5’ UTR containing an IRES having the nucleic acid sequence of “UTR2” (as in FIGS. 10A and 10B), and an erythropoietinencoding open reading frame. A negative control (“PBS”) was included for comparison purposes.
Taken together, the data reported in FIGS. 10A - 10D demonstrate that IRES elements of the disclosure are useful not only in RNA molecules that lack a 5’ cap (see, e.g., Examples 1 and 4), but also in RNA molecules that contain a 5’ cap, as the IRES elements, in this context, may provide a means of extending the ability of RNA molecules to result in protein product even after endogenous decapping.
Example 7. IRES elements of the disclosure provide robust protein expression without the need for a 5’ cap
This example demonstrates the utility of IRES elements described herein for promoting translation of a gene products in an expression construct.
As described in FIG. 11 , the expression of a luciferase reporter in constructs containing the IRES elements in Table 14 was investigated. In brief, Hep3b cells or HeLa cells were transfected in the presence of L2K with luciferase-encoding RNA constructs containing the elements shown in Table 14. Luciferase expression was measured at 2 hour, 5 hours, and 24 hours post-transfection (FIG. 11 ). Luminescence revealed that 5’ hulRES9 (e.g., SEQ ID NO: 173) had the highest luciferase expression, which is an improvement over 5’ 3xU9 (SEQ ID NO: 202).
Table 14. IRES elements tested in FIG. 11
As described in FIGs. 12-16, the expression of a GFP reporter in constructs containing the IRES elements in Table 15 was investigated. In brief, HeLa cells were transfected in the presence of L2K with GFP-encoding RNA constructs containing the elements shown in Table 15. The GFP was fused to a degron domain. The results, as measured by green integrated density, revealed that 5’ Shape 1 (SEQ ID NO: 174) and 5’ Shape 3 (SEQ ID NO: 176) have the highest expression, well above 5’ 6xU9 (SEQ ID NO: 203). Further, 5’ Shape 2 (SEQ ID NO: 175) outperformed 5’ Shape 4 (SEQ ID NO: 177) and 5’ 6xU9 (SEQ ID NO: 203).
Table 15. IRES elements tested in FIGs. 12-16
The area under the curve (AUC) of FIGs. 12-16 was measured in order to quantify temporal GFP expression (e.g., see Table 16).
Table 16. AUC of constructs tested in FIGs. 12-16
As described in FIGs. 17-20, the expression of a GFP reporter in constructs containing the IRES elements in Table 17 was investigated. In brief, HeLa cells were transfected in the presence of L2K with GFP-encoding RNA constructs containing the elements shown in Table 17. The GFP was fused to a
degron domain. In some instances, the results of this experiment revealed that combining different IRES elements disclosed herein can provide robust gene expression. For example, the two inlet graphs of FIG. 17 reveal that 5’ Apt17+5xU9 (SEQ ID NO: 183 or SEQ ID NO: 184) constructs and the 5’ 5xU9+CCND1 (SEQ ID NO: 182) construct had increased Cmax values. In another example, constructs with 5’ Apt17+5xU9 (SEQ ID NO: 183 or SEQ ID NO: 184) and constructs with 5’ 5xU9+CCND1 (SEQ ID NO: 182) had comparable expression to constructs with 5’ 6xU9 (SEQ ID NO: 203) (FIG. 19). On the contrary, a single IRES, 5’ 1XApt17 (SEQ ID NO: 193) had much lower GFP expression; however it substantially outperformed 5’ 1xAUAU4 (SEQ ID NO: 194) and 5’ 1xPDCD4 (SEQ ID NO: 198), with the later having similar temporal expression and Cmax values (FIG. 18). In FIG. 20, green integrated density data showed that constructs with elements 5’ 6xPDCD4 (SEQ ID NO: 198) have appreciable expression. Also, constructs with element 5’ 1xApt17 (SEQ ID NO: 193) showed expression above background.
Table 17. IRES elements tested in FIGs. 17-20
As described in FIGs. 21 -23, the expression of a luciferase reporter in constructs containing the IRES elements in Table 18 was investigated. In brief, THP-1 cells (FIG 21 ), Hep3b cells (FIG 22), or HeLa cells (FIG 23) were transfected in the presence of L2K with luciferase-encoding RNA constructs containing the elements shown in Table 18. Luciferase expression was measured at 4 and 24 hours post-transfection. In THP-1 cells, constructs containing 5’ 6xU9_v3 (SEQ ID NO: 189), 5’ 6xU9_v4 (SEQ ID NO: 204), or 5’ 6xU9_v5 (SEQ ID NO: 205) had the highest luciferase expression. In Hep3b cells, constructs containing 5’ 6xU9_v3 (SEQ ID NO: 189), 5’ 6xU9_v4 (SEQ ID NO: 204), and 5’ 6xU9_v5 (SEQ ID NO: 205) had the highest luciferase expression. And in HeLa cells, constructs containing 5’ 6xU9_v3 (SEQ ID NO: 189), 5’ 6xU9_v4 (SEQ ID NO: 204), 5’ 6xU9_v5 (SEQ ID NO: 205), and 5’ 6xU9_v1 (SEQ ID NO: 187) had the highest luciferase expression.
Table 18. IRES elements tested in FIGs 21-23
OTHER EMBODIMENTS All publications, patents, and patent applications mentioned in this specification are incorporated herein by reference to the same extent as if each independent publication or patent application was specifically and individually indicated to be incorporated by reference.
While the invention has been described in connection with specific embodiments thereof, it will be understood that it is capable of further modifications and this application is intended to cover any variations, uses, or adaptations described herein following, in general, the principles described herein and including such departures from the invention that come within known or customary practice within the art to which the invention pertains and may be applied to the essential features hereinbefore set forth, and follows in the scope of the claims.
Other embodiments are within the claims.
Claims
1 . A nucleic acid comprising:
(i) an internal ribosome entry site (IRES) comprising one or more polynucleotide tracts enriched in uridine or a modified uridine; operably linked to
(ii) an open reading frame encoding a polypeptide.
2. The nucleic acid of claim 1 , wherein the IRES comprises from 1 to 20 of the polynucleotide tracts enriched in uridine or a modified uridine.
3. The nucleic acid of claim 2, wherein the IRES comprises from 2 to 10 of the polynucleotide tracts enriched in uridine or a modified uridine.
4. The nucleic acid of claim 3, wherein the IRES comprises from 3 to 6 of the polynucleotide tracts enriched in uridine or a modified uridine.
5. The nucleic acid of claim 4, wherein the IRES comprises 3 of the polynucleotide tracts enriched in uridine or a modified uridine.
6. The nucleic acid of claim 4, wherein the IRES comprises 4 of the polynucleotide tracts enriched in uridine or a modified uridine.
7. The nucleic acid of claim 4, wherein the IRES comprises 5 of the polynucleotide tracts enriched in uridine or a modified uridine.
8. The nucleic acid of claim 4, wherein the IRES comprises 6 of the polynucleotide tracts enriched in uridine or a modified uridine.
9. The nucleic acid of any one of claims 1 -8, wherein at least 70% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine.
10. The nucleic acid of claim 9, wherein at least 75% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine.
11 . The nucleic acid of claim 10, wherein at least 80% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine.
12. The nucleic acid of claim 11 , wherein at least 85% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine.
13. The nucleic acid of claim 12, wherein at least 90% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine.
14. The nucleic acid of claim 13, wherein at least 95% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine.
15. The nucleic acid of claim 14, wherein all of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine, preferably wherein all of the nucleosides in each of the polynucleotide tracts is a modified uridine.
16. The nucleic acid of any one of claims 1 -15, wherein each polynucleotide tract, independently, is from 5 to 20 nucleosides in length.
17. The nucleic acid of claim 16, wherein each polynucleotide tract, independently, is from 6 to 15 nucleosides in length.
18. The nucleic acid of claim 17, wherein each polynucleotide tract, independently, is from 7 to 11 nucleosides in length.
19. The nucleic acid of claim 18, wherein each polynucleotide tract is 9 nucleosides in length.
20. The nucleic acid of any one of claims 1 -19, wherein each polynucleotide tract, independently, comprises from 5 to 20 contiguous uridine or modified uridine nucleosides.
21 . The nucleic acid of claim 20, wherein each polynucleotide tract, independently, comprises from 6 to 15 contiguous uridine or modified uridine nucleosides.
22. The nucleic acid of claim 21 , wherein each polynucleotide tract, independently, comprises from 7 to 11 contiguous uridine or modified uridine nucleosides.
23. The nucleic acid of any one of claims 1 -22, wherein each polynucleotide tract comprises at least 9 contiguous uridine or modified uridine nucleosides.
24. The nucleic acid of claim 23, wherein each polynucleotide tract comprises 9 contiguous uridine or modified uridine nucleosides.
25. The nucleic acid of any one of claims 1 -24, wherein each polynucleotide tract is enriched in the modified uridine.
26. The nucleic acid of any one of claims 1 -25, wherein the modified uridine is 1 - methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5- aza-uridine, 2-thio-uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5-
carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl- uridine, 5-methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl- uridine, 5-methylaminomethyl-2-thio-uridine, 5-methylaminomethyl-2-seleno-uridine, 5-carbamoylmethyl- uridine, 5-carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl- uridine, 1 -propynyl-pseudouridine, 5-taurinomethyl-uridine, 1 -taurinomethyl-pseudouridine, 5- taurinomethyl-2-thio-uridine, 1 -taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine, 5-methyl-2-thio- uridine, 1 -methyl-4-thio-pseudouridine, 4-thio-1 -methyl-pseudouridine, 3-methylpseudouridine, 2-thio-1 - methyl-pseudouridine, 1 -methyl-1 -deaza-pseudouridine, 2-thio-1 -methyl-1 -deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4- methoxy-2-thio-pseudouridine, N1 -methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1 -methyl-3- (3-amino-3-carboxypropyl)pseudouridine, 5-(isopentenylaminomethyl)uridine, 5- (isopentenylaminomethyl)-2-thio-uridine, a-thio-uridine, 2'-O-methyl-uridine, 5,2'-O-dimethyl-uridine, 2'-O- methyl-pseudouridine, 2-thio-2'-O-methyl-uridine, 5-methoxycarbonylmethyl-2'-O-methyl-uridine, 5- carbamoylmethyl-2'-O-methyl-uridine, 5-carboxymethylaminomethyl-2'-O-methyl-uridine, 3,2'-O-dimethyl- uridine, 5-(isopentenylaminomethyl)-2'-O-methyl-uridine, 1 -thio-uridine, deoxythymidine, 2’-F-ara-uridine, 2’-F-uridine, 2’-OH-ara-uridine, 5-(2-carbomethoxyvinyl) uridine, or 5-[3-(1 -E-propenylamino)uridine.
27. The nucleic acid of claim 26, wherein the modified uridine is 1 -methylpseudouridine.
28. The nucleic acid of any one of claims 1 -27, wherein the IRES is located within a noncoding region of the nucleic acid (e.g., a 5’ untranslated region (UTR)) that is operably linked to the open reading frame.
29. The nucleic acid of claim 28, wherein the open reading frame is further operably linked to a 3’ UTR.
30. The nucleic acid of any one of claims 1 -29, wherein the polynucleotide tracts are separated from one another by way of one or more spacers that each, independently, comprise from 5 to 100 nucleosides.
31 . The nucleic acid of claim 30, wherein each of the spacers, independently, comprises from 10 to 40 nucleosides.
32. The nucleic acid of claim 31 , wherein each of the spacers, independently, comprises 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, or 38 nucleosides.
33. The nucleic acid of any one of claims 1 -32, wherein the IRES is represented by the formula:
[(N)n - ( U')m]p wherein:
each A/ is, independently, any nucleoside residue; each U' is, independently, uridine or a modified uridine; each n is, independently, an integer from 1 to 100; each m is, independently, an integer from 2 to 15; and p is an integer from 2 to 20.
34. The nucleic acid of claim 33, wherein each N is, independently, selected from adenosine, a modified adenosine, uridine, a modified uridine, guanosine, a modified guanosine, cytidine, and a modified cytidine.
35. The nucleic acid of claim 34, wherein each N is, independently, selected from adenosine, uridine, a modified uridine, guanosine, and cytidine.
36. The nucleic acid of claim 34 or 35, wherein the modified uridine of N is 1 - methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5- aza-uridine, 2-thio-uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5- carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl- uridine, 5-methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl- uridine, 5-methylaminomethyl-2-thio-uridine, 5-methylaminomethyl-2-seleno-uridine, 5-carbamoylmethyl- uridine, 5-carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl- uridine, 1 -propynyl-pseudouridine, 5-taurinomethyl-uridine, 1 -taurinomethyl-pseudouridine, 5- taurinomethyl-2-thio-uridine, 1 -taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine, 5-methyl-2-thio- uridine, 1 -methyl-4-thio-pseudouridine, 4-thio-1 -methyl-pseudouridine, 3-methylpseudouridine, 2-thio-1 - methyl-pseudouridine, 1 -methyl-1 -deaza-pseudouridine, 2-thio-1 -methyl-1 -deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4- methoxy-2-thio-pseudouridine, N1 -methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1 -methyl-3- (3-amino-3-carboxypropyl)pseudouridine, 5-(isopentenylaminomethyl)uridine, 5- (isopentenylaminomethyl)-2-thio-uridine, a-thio-uridine, 2'-O-methyl-uridine, 5,2'-O-dimethyl-uridine, 2'-O- methyl-pseudouridine, 2-thio-2'-O-methyl-uridine, 5-methoxycarbonylmethyl-2'-O-methyl-uridine, 5- carbamoylmethyl-2'-O-methyl-uridine, 5-carboxymethylaminomethyl-2'-O-methyl-uridine, 3,2'-O-dimethyl- uridine, 5-(isopentenylaminomethyl)-2'-O-methyl-uridine, 1 -thio-uridine, deoxythymidine, 2’-F-ara-uridine, 2’-F-uridine, 2’-OH-ara-uridine, 5-(2-carbomethoxyvinyl) uridine, or 5-[3-(1 -E-propenylamino)uridine.
37. The nucleic acid of claim 36, wherein the modified uridine of N is 1 -methylpseudouridine.
38. The nucleic acid of any one of claims 34, 36, and 37, wherein the modified cytidine of N is 5- aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetyl-cytidine, 5-formyl-cytidine, N4-methyl-cytidine, 5-methyl-cytidine, 5-halo-cytidine, 5-hydroxymethyl-cytidine, 1 -methyl-
pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4- thio-pseudoisocytidine, 4-thio-1 -methyl-pseudoisocytidine, 4-thio-1 -methyl-1 -deaza-pseudoisocytidine, 1 - methyl-1 -deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio- zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy- pseudoisocytidine, 4-methoxy-1 -methyl-pseudoisocytidine, lysidine, a-thio-cytidine, 2'-O-methyl-cytidine, 5,2'-O-dimethyl-cytidine, N4-acetyl-2'-O-methyl-cytidine, N4,2'-O-dimethyl-cytidine, 5-formyl-2'-O-methyl- cytidine, N4,N4,2'-O-trimethyl-cytidine, 1 -thio-cytidine, 2’-F-ara-cytidine, 2’-F-cytidine, or 2’-OH-ara- cytidine.
39. The nucleic acid of any one of claims 34 and 36-38, wherein the modified adenosine of N is 2-amino-purine, 2, 6-diaminopurine, 2-amino-6-halo-purine, 6-halo-purine, 2-amino-6-methyl-purine, 8- azido-adenosine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2- amino-purine, 7-deaza-2, 6-diaminopurine, 7-deaza-8-aza-2, 6-diaminopurine, 1 -methyl-adenosine, 2- methyl-adenine, N6-methyl-adenosine, 2-methylthio-N6-methyl-adenosine, N6-isopentenyl-adenosine, 2- methylthio-N6-isopentenyl-adenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis- hydroxyisopentenyl)adenosine, N6-glycinylcarbamoyl-adenosine, N6-threonylcarbamoyl-adenosine, N6- methyl-N6-threonylcarbamoyl-adenosine, 2-methylthio-N6-threonylcarbamoyl-adenosine, N6,N6- dimethyl-adenosine, N6-hydroxynorvalylcarbamoyl-adenosine, 2-methylthio-N6- hydroxynorvalylcarbamoyl-adenosine, N6-acetyl-adenosine, 7-methyl-adenine, 2-methylthio-adenine, 2- methoxy-adenine, a-thio-adenosine, 2'-O-methyl-adenosine, N6,2'-O-dimethyl-adenosine, N6,N6,2'-O- trimethyl-adenosine, 1 ,2'-O-dimethyl-adenosine, 2'-O-ribosyladenosine, 2-amino-N6-methyl-purine, 1 -thioadenosine, 8-azido-adenosine, 2’-F-ara-adenosine, 2’-F-adenosine, 2’-OH-ara-adenosine, or N6-(19- amino-pentaoxanonadecyl)-adenosine.
40. The nucleic acid of any one of claims 34 and 36-39, wherein the modified guanosine of N is inosine, 1 -methyl-inosine, wyosine, methylwyosine, 4-demethyl-wyosine, isowyosine, wybutosine, peroxywybutosine, hydroxywybutosine, 7-deaza-guanosine, queuosine, epoxyqueuosine, galactosyl- queuosine, mannosyl-queuosine, 7-cyano-7-deaza-guanosine, 7-aminomethyl-7-deaza-guanosine, archaeosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8- aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methyl-inosine, 6-methoxy-guanosine, 1 -methyl-guanosine, N2-methyl-guanosine, N2,N2-dimethyl-guanosine, N2,7-dimethyl-guanosine, N2, N2,7-dimethyl-guanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1 -methyl-6-thio-guanosine, N2- methyl-6-thio-guanosine, N2,N2-dimethyl-6-thio-guanosine, a-thio-guanosine, 2'-O-methyl-guanosine, N2-methyl-2'-O-methyl-guanosine, N2,N2-dimethyl-2'-O-methyl-guanosine, 1 -methyl-2'-O-methyl- guanosine, N2,7-dimethyl-2'-O-methyl-guanosine, 2'-O-methyl-inosine, 1 ,2'-O-dimethyl-inosine, 2'-O- ribosylguanosine, 1 -thio-guanosine, O6-methyl-guanosine, 2’-F-ara-guanosine, or 2’-F-guanosine.
41 . The nucleic acid of any one of claims 33-40, wherein the modified uridine of U’ is 1 - methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5- aza-uridine, 2-thio-uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine
5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5- carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl- uridine, 5-methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl- uridine, 5-methylaminomethyl-2-thio-uridine, 5-methylaminomethyl-2-seleno-uridine, 5-carbamoylmethyl- uridine, 5-carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl- uridine, 1 -propynyl-pseudouridine, 5-taurinomethyl-uridine, 1 -taurinomethyl-pseudouridine, 5- taurinomethyl-2-thio-uridine, 1 -taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine, 5-methyl-2-thio- uridine, 1 -methyl-4-thio-pseudouridine, 4-thio-1 -methyl-pseudouridine, 3-methylpseudouridine, 2-thio-1 - methyl-pseudouridine, 1 -methyl-1 -deaza-pseudouridine, 2-thio-1 -methyl-1 -deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4- methoxy-2-thio-pseudouridine, N1 -methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1 -methyl-3- (3-amino-3-carboxypropyl)pseudouridine, 5-(isopentenylaminomethyl)uridine, 5- (isopentenylaminomethyl)-2-thio-uridine, a-thio-uridine, 2'-O-methyl-uridine, 5,2'-O-dimethyl-uridine, 2'-O- methyl-pseudouridine, 2-thio-2'-O-methyl-uridine, 5-methoxycarbonylmethyl-2'-O-methyl-uridine, 5- carbamoylmethyl-2'-O-methyl-uridine, 5-carboxymethylaminomethyl-2'-O-methyl-uridine, 3,2'-O-dimethyl- uridine, 5-(isopentenylaminomethyl)-2'-O-methyl-uridine, 1 -thio-uridine, deoxythymidine, 2’-F-ara-uridine, 2’-F-uridine, 2’-OH-ara-uridine, 5-(2-carbomethoxyvinyl) uridine, or 5-[3-(1 -E-propenylamino)uridine.
42. The nucleic acid of claim 41 , wherein the modified uridine of U’ is 1 -methylpseudouridine.
43. The nucleic acid of any one of claims 33-42, wherein each n is, independently, an integer from 10 to 40.
44. The nucleic acid of claim 43, wherein each n is, independently, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, or 38.
45. The nucleic acid of any one of claims 33-43, wherein each m is, independently, an integer from 2 to 15.
46. The nucleic acid of claim 45, wherein each m is, independently, an integer from 7 to 1 1 .
47. The nucleic acid of claim 46, wherein each m is 9.
48. The nucleic acid of any one of claims 33-47, wherein p is an integer from 2 to 10.
49. The nucleic acid of claim 48, wherein p is an integer from 3 to 6, optionally wherein p is 3 or
6.
50. The nucleic acid of any one of claims 1 -49, wherein the nucleic acid is RNA.
51 . The nucleic acid of any one of claims 1 -50, wherein the nucleic acid is linear.
52. The nucleic acid of any one of claims 1 -50, wherein the nucleic acid is circular.
53. The nucleic acid of any one of claims 1 -52, wherein the open reading from consists of nucleosides selected from adenosine, a modified adenosine, uridine, a modified uridine, guanosine, a modified guanosine, cytidine, and a modified cytidine.
54. The nucleic acid of claim 53, wherein the open reading from consists of nucleosides selected from adenosine, uridine, a modified uridine, guanosine, and cytidine.
55. The nucleic acid of claim 53 or 54, wherein the modified uridine of the open reading frame is
1 -methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio- 5-aza-uridine, 2-thio-uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5- carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl- uridine, 5-methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl- uridine, 5-methylaminomethyl-2-thio-uridine, 5-methylaminomethyl-2-seleno-uridine, 5-carbamoylmethyl- uridine, 5-carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl- uridine, 1 -propynyl-pseudouridine, 5-taurinomethyl-uridine, 1 -taurinomethyl-pseudouridine, 5- taurinomethyl-2-thio-uridine, 1 -taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine, 5-methyl-2-thio- uridine, 1 -methyl-4-thio-pseudouridine, 4-thio-1 -methyl-pseudouridine, 3-methylpseudouridine, 2-thio-1 - methyl-pseudouridine, 1 -methyl-1 -deaza-pseudouridine, 2-thio-1 -methyl-1 -deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine,
2-thio-dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4- methoxy-2-thio-pseudouridine, N1 -methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1 -methyl-3- (3-amino-3-carboxypropyl)pseudouridine, 5-(isopentenylaminomethyl)uridine, 5- (isopentenylaminomethyl)-2-thio-uridine, a-thio-uridine, 2'-O-methyl-uridine, 5,2'-O-dimethyl-uridine, 2'-O- methyl-pseudouridine, 2-thio-2'-O-methyl-uridine, 5-methoxycarbonylmethyl-2'-O-methyl-uridine, 5- carbamoylmethyl-2'-O-methyl-uridine, 5-carboxymethylaminomethyl-2'-O-methyl-uridine, 3,2'-O-dimethyl- uridine, 5-(isopentenylaminomethyl)-2'-O-methyl-uridine, 1 -thio-uridine, deoxythymidine, 2’-F-ara-uridine, 2’-F-uridine, 2’-OH-ara-uridine, 5-(2-carbomethoxyvinyl) uridine, or 5-[3-(1 -E-propenylamino)uridine.
56. The nucleic acid of claim 55, wherein the modified uridine of the open reading frame is 1 - methylpseudouridine.
57. The nucleic acid of any one of claims 53, 55, and 56, wherein the modified cytidine of N is 5- aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetyl-cytidine, 5-formyl-cytidine, N4-methyl-cytidine, 5-methyl-cytidine, 5-halo-cytidine, 5-hydroxymethyl-cytidine, 1 -methyl- pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-
thio-pseudoisocytidine, 4-thio-1 -methyl-pseudoisocytidine, 4-thio-1 -methyl-1 -deaza-pseudoisocytidine, 1 - methyl-1 -deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio- zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy- pseudoisocytidine, 4-methoxy-1 -methyl-pseudoisocytidine, lysidine, a-thio-cytidine, 2'-O-methyl-cytidine, 5,2'-O-dimethyl-cytidine, N4-acetyl-2'-O-methyl-cytidine, N4,2'-O-dimethyl-cytidine, 5-formyl-2'-O-methyl- cytidine, N4,N4,2'-O-trimethyl-cytidine, 1 -thio-cytidine, 2’-F-ara-cytidine, 2’-F-cytidine, or 2’-OH-ara- cytidine.
58. The nucleic acid of any one of claims 53 and 55-57, wherein the modified adenosine of N is 2-amino-purine, 2, 6-diaminopurine, 2-amino-6-halo-purine, 6-halo-purine, 2-amino-6-methyl-purine, 8- azido-adenosine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2- amino-purine, 7-deaza-2, 6-diaminopurine, 7-deaza-8-aza-2, 6-diaminopurine, 1 -methyl-adenosine, 2- methyl-adenine, N6-methyl-adenosine, 2-methylthio-N6-methyl-adenosine, N6-isopentenyl-adenosine, 2- methylthio-N6-isopentenyl-adenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis- hydroxyisopentenyl)adenosine, N6-glycinylcarbamoyl-adenosine, N6-threonylcarbamoyl-adenosine, N6- methyl-N6-threonylcarbamoyl-adenosine, 2-methylthio-N6-threonylcarbamoyl-adenosine, N6,N6- dimethyl-adenosine, N6-hydroxynorvalylcarbamoyl-adenosine, 2-methylthio-N6- hydroxynorvalylcarbamoyl-adenosine, N6-acetyl-adenosine, 7-methyl-adenine, 2-methylthio-adenine, 2- methoxy-adenine, a-thio-adenosine, 2'-O-methyl-adenosine, N6,2'-O-dimethyl-adenosine, N6,N6,2'-O- trimethyl-adenosine, 1 ,2'-O-dimethyl-adenosine, 2'-O-ribosyladenosine, 2-amino-N6-methyl-purine, 1 -thioadenosine, 8-azido-adenosine, 2’-F-ara-adenosine, 2’-F-adenosine, 2’-OH-ara-adenosine, or N6-(19- amino-pentaoxanonadecyl)-adenosine.
59. The nucleic acid of any one of claims 53 and 55-58, wherein the modified guanosine of N is inosine, 1 -methyl-inosine, wyosine, methylwyosine, 4-demethyl-wyosine, isowyosine, wybutosine, peroxywybutosine, hydroxywybutosine, 7-deaza-guanosine, queuosine, epoxyqueuosine, galactosyl- queuosine, mannosyl-queuosine, 7-cyano-7-deaza-guanosine, 7-aminomethyl-7-deaza-guanosine, archaeosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8- aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methyl-inosine, 6-methoxy-guanosine, 1 -methyl-guanosine, N2-methyl-guanosine, N2,N2-dimethyl-guanosine, N2,7-dimethyl-guanosine, N2, N2,7-dimethyl-guanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1 -methyl-6-thio-guanosine, N2- methyl-6-thio-guanosine, N2,N2-dimethyl-6-thio-guanosine, a-thio-guanosine, 2'-O-methyl-guanosine, N2-methyl-2'-O-methyl-guanosine, N2,N2-dimethyl-2'-O-methyl-guanosine, 1 -methyl-2'-O-methyl- guanosine, N2,7-dimethyl-2'-O-methyl-guanosine, 2'-O-methyl-inosine, 1 ,2'-O-dimethyl-inosine, 2'-O- ribosylguanosine, 1 -thio-guanosine, O6-methyl-guanosine, 2’-F-ara-guanosine, or 2’-F-guanosine.
60. The nucleic acid of any one of claims 1 -59, wherein the polypeptide encoded by the open reading frame is a secreted protein, a cytokine, a growth factor, an enzyme, an immunomodulator, an antibody or antigen-binding fragment thereof, a cell-penetrating peptide, an extracellular membranebound protein, an intracellular membrane-bound protein, a cytoplasmic protein, a cytoskeletal protein, or a nuclear protein.
61 . The nucleic acid of any one of claims 1 -60, wherein the nucleic acid does not comprise a 5’ cap.
62. The nucleic acid of any one of claims 1 -51 and 53-60, wherein the nucleic acid comprises a 5’ cap.
63. The nucleic acid of any one of claims 1 -62, wherein the nucleic acid comprises a nucleotide sequence with at least 75% percent sequence identity to any one of SEQ ID NOs: 173-190 and 202-205.
64. The nucleic acid of claim 63, wherein the nucleic acid comprises a nucleotide sequence with at least 80% percent sequence identity to any one of SEQ ID NOs: 173-190 and 202-205.
65. The nucleic acid of claim 64, wherein the nucleic acid comprises a nucleotide sequence with at least 85% percent sequence identity to any one of SEQ ID NOs: 173-190 and 202-205.
66. The nucleic acid of claim 65, wherein the nucleic acid comprises a nucleotide sequence with at least 90% percent sequence identity to any one of SEQ ID NOs: 173-190 and 202-205.
67. The nucleic acid of claim 66, wherein the nucleic acid comprises a nucleotide sequence with at least 95% percent sequence identity to any one of SEQ ID NOs: 173-190 and 202-205.
68. The nucleic acid of claim 67, wherein the nucleic acid comprises the nucleotide sequence of any one of SEQ ID NOs: 173-190 and 202-205.
69. A nucleic acid comprising:
(i) an IRES comprising one or more polynucleotides that specifically bind a translation initiation factor (e.g., eukaryotic translation initiation factor 4 G (elF4G), eukaryotic translation initiation factor 4G2 (elF4G2), eukaryotic translation initiation factor 3 (elF3), La protein, or an IRES trans-acting factors (ITAf)), or a fusion protein comprising a translation initiation factor (e.g., elF4G, elF4G2, elF3, La protein, or an ITAf) fused to an RNA-binding protein; operably linked to
(ii) an open reading frame encoding a polypeptide.
70. The nucleic acid of claim 69, wherein the one or more polynucleotides specifically bind elF4G.
71 . The nucleic acid of claim 70, wherein each of the one or more polynucleotides, independently, has a nucleic acid sequence that is at least 75% identical to ACUCACUAUUUGUUUUCGCGCCCAGUUGCAAAAA (SEQ ID NO: 1 ), optionally wherein each U residue in SEQ ID NO: 1 is replaced with 1 -methylpseudouridine.
72. The nucleic acid of claim 71 , wherein each of the one or more polynucleotides, independently, has a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO: 1 (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 1 ), optionally wherein each U residue in SEQ ID NO: 1 is replaced with 1 -methylpseudouridine.
73. The nucleic acid of claim 69, wherein the IRES comprises one or more polynucleotides that specifically bind to a fusion protein comprising a translation initiation factor (e.g., elF4G, elF4G2, elF3, La protein, or an ITAf) fused to an RNA-binding protein, optionally wherein the RNA-binding protein is MS2-binding protein and the one or more polynucleotides comprise one or more MS2 RNA hairpins.
74. The nucleic acid of any one of claims 69-73, wherein the nucleic acid does not comprise a 5’ cap.
75. The nucleic acid of any one of claims 69-73, wherein the nucleic acid comprises a 5’ cap.
76. The nucleic acid of any one of claims 69-75, wherein the nucleic acid comprises a nucleotide sequence with at least 75% percent sequence identity to any one of SEQ ID NO: 191 -201 .
77. The nucleic acid of claim 76, wherein the nucleic acid comprises a nucleotide sequence with at least 80% percent sequence identity to any one of SEQ ID NOs: 191 -201 .
78. The nucleic acid of claim 77, wherein the nucleic acid comprises a nucleotide sequence with at least 85% percent sequence identity to any one of SEQ ID NOs: 191 -201 .
79. The nucleic acid of claim 78, wherein the nucleic acid comprises a nucleotide sequence with at least 90% percent sequence identity to any one of SEQ ID NOs: 191 -201 .
80. The nucleic acid of claim 79, wherein the nucleic acid comprises a nucleotide sequence with at least 95% percent sequence identity to any one of SEQ ID NOs: 191 -201 .
81 . The nucleic acid of claim 80, wherein the nucleic acid comprises the nucleotide sequence of any one of SEQ ID NOs: 191 -201 .
82. A nucleic acid comprising:
(i) an IRES comprising a nucleotide sequence having complementarity sufficient to hybridize to a region within a ribosomal RNA (rRNA), operably linked to
(ii) an open reading frame encoding a polypeptide.
83. The nucleic acid of claim 82, wherein the IRES does not specifically bind to ribosomal protein.
84. The nucleic acid of claim 82 or 83, wherein the nucleotide sequence of the IRES has at least 70% complementarity to the region within the rRNA, optionally wherein the IRES has at least 71 %, 72%, 73%, 74%, 85%, 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementarity to the region within the rRNA.
85. The nucleic acid of claim 84, wherein the nucleotide sequence of the IRES has at least 70% complementarity to at least 10, at least 1 1 , at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21 , at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or 30 or more contiguous nucleobases within the region of the rRNA.
86. The nucleic acid of claim 82 or 83, wherein the nucleotide sequence of the IRES has at least 75% complementarity to at least 10, at least 1 1 , at least 12, at least 13, at least 14, at least 15, at least
16, at least 17, at least 18, at least 19, at least 20, at least 21 , at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or 30 or more contiguous nucleobases within the region of the rRNA, optionally wherein the nucleic acid sequences has at least 76%, 77%, 78%, 79%, 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementarity to the at least 10, at least 1 1 , at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21 , at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or 30 or more contiguous nucleobases within the region of the rRNA.
87. The nucleic acid of any one of claims 82-86, wherein the nucleotide sequence of the IRES comprises at least 10, at least 1 1 , at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21 , at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the rRNA.
88. The nucleic acid of claim 87, wherein the nucleotide sequence of the IRES comprises from 10 to 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the rRNA.
89. The nucleic acid of any claim 88, wherein the nucleotide sequence of the IRES comprises from 12 to 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the rRNA.
90. The nucleic acid of claim 89, wherein the nucleotide sequence of the IRES comprises from 15 to 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the rRNA.
91 . The nucleic acid of claim 90, wherein the nucleotide sequence of the IRES comprises from 18 to 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the rRNA.
92. The nucleic acid of claim 91 , wherein the nucleotide sequence of the IRES comprises from 20 to 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the rRNA.
93. The nucleic acid of claim 92, wherein the nucleotide sequence of the IRES comprises from 25 to 30 contiguous nucleotides that are fully complementary to a contiguous polynucleotide segment of equal length within the region of the rRNA.
94. The nucleic acid of any one of claims 82-93, wherein the nucleotide sequence of the IRES comprises 9 or fewer nucleotide mismatches relative to the region of the rRNA, optionally wherein the antisense strand comprises 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer, or only 1 mismatch relative to the region of the rRNA.
95. The nucleic acid of any one of claims 82-94, wherein the IRES comprises one or more polynucleotide tracts enriched in uridine or a modified uridine
96. The nucleic acid of claim 95, wherein the IRES comprises from 1 to 20 of the polynucleotide tracts enriched in uridine or a modified uridine.
97. The nucleic acid of claim 96, wherein the IRES comprises from 2 to 10 of the polynucleotide tracts enriched in uridine or a modified uridine.
98. The nucleic acid of claim 97, wherein the IRES comprises from 3 to 6 of the polynucleotide tracts enriched in uridine or a modified uridine.
99. The nucleic acid of claim 98, wherein the IRES comprises 3 of the polynucleotide tracts enriched in uridine or a modified uridine.
100. The nucleic acid of claim 98, wherein the IRES comprises 4 of the polynucleotide tracts enriched in uridine or a modified uridine.
101 . The nucleic acid of claim 98, wherein the IRES comprises 5 of the polynucleotide tracts enriched in uridine or a modified uridine.
102. The nucleic acid of claim 98, wherein the IRES comprises 6 of the polynucleotide tracts enriched in uridine or a modified uridine.
103. The nucleic acid of any one of claims 95-102, wherein at least 70% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine.
104. The nucleic acid of claim 103, wherein at least 75% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine.
105. The nucleic acid of claim 104, wherein at least 80% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine.
106. The nucleic acid of claim 105, wherein at least 85% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine.
107. The nucleic acid of claim 106, wherein at least 90% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine.
108. The nucleic acid of claim 107, wherein at least 95% of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine.
109. The nucleic acid of claim 108, wherein all of the nucleosides in each of the polynucleotide tracts is uridine or a modified uridine, preferably wherein all of the nucleosides in each of the polynucleotide tracts is a modified uridine.
110. The nucleic acid of any one of claims 95-109, wherein each polynucleotide tract, independently, is from 5 to 20 nucleosides in length.
111. The nucleic acid of claim 110, wherein each polynucleotide tract, independently, is from 6 to 15 nucleosides in length.
112. The nucleic acid of claim 111 , wherein each polynucleotide tract, independently, is from 7 to 11 nucleosides in length.
113. The nucleic acid of claim 112, wherein each polynucleotide tract is 9 nucleosides in length.
114. The nucleic acid of any one of claims 95-113, wherein each polynucleotide tract, independently, comprises from 5 to 20 contiguous uridine or modified uridine nucleosides.
1 15. The nucleic acid of claim 1 14, wherein each polynucleotide tract, independently, comprises from 6 to 15 contiguous uridine or modified uridine nucleosides.
1 16. The nucleic acid of claim 1 15, wherein each polynucleotide tract, independently, comprises from 7 to 1 1 contiguous uridine or modified uridine nucleosides.
1 17. The nucleic acid of any one of claims 95-1 16, wherein each polynucleotide tract comprises at least 9 contiguous uridine or modified uridine nucleosides.
1 18. The nucleic acid of claim 1 17, wherein each polynucleotide tract comprises 9 contiguous uridine or modified uridine nucleosides.
1 19. The nucleic acid of any one of claims 95-1 18, wherein each polynucleotide tract is enriched in the modified uridine.
120. The nucleic acid of any one of claims 95-1 19, wherein the modified uridine is 1 - methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5- aza-uridine, 2-thio-uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5- carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl- uridine, 5-methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl- uridine, 5-methylaminomethyl-2-thio-uridine, 5-methylaminomethyl-2-seleno-uridine, 5-carbamoylmethyl- uridine, 5-carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl- uridine, 1 -propynyl-pseudouridine, 5-taurinomethyl-uridine, 1 -taurinomethyl-pseudouridine, 5- taurinomethyl-2-thio-uridine, 1 -taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine, 5-methyl-2-thio- uridine, 1 -methyl-4-thio-pseudouridine, 4-thio-1 -methyl-pseudouridine, 3-methylpseudouridine, 2-thio-1 - methyl-pseudouridine, 1 -methyl-1 -deaza-pseudouridine, 2-thio-1 -methyl-1 -deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4- methoxy-2-thio-pseudouridine, N1 -methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1 -methyl-3- (3-amino-3-carboxypropyl)pseudouridine, 5-(isopentenylaminomethyl)uridine, 5- (isopentenylaminomethyl)-2-thio-uridine, a-thio-uridine, 2'-O-methyl-uridine, 5,2'-O-dimethyl-uridine, 2'-O- methyl-pseudouridine, 2-thio-2'-O-methyl-uridine, 5-methoxycarbonylmethyl-2'-O-methyl-uridine, 5- carbamoylmethyl-2'-O-methyl-uridine, 5-carboxymethylaminomethyl-2'-O-methyl-uridine, 3,2'-O-dimethyl- uridine, 5-(isopentenylaminomethyl)-2'-O-methyl-uridine, 1 -thio-uridine, deoxythymidine, 2’-F-ara-uridine, 2’-F-uridine, 2’-OH-ara-uridine, 5-(2-carbomethoxyvinyl) uridine, or 5-[3-(1 -E-propenylamino)uridine.
121 . The nucleic acid of claim 120, wherein the modified uridine is 1 -methylpseudouridine.
122. The nucleic acid of any one of claims 95-121 , wherein the IRES is located within a noncoding region of the nucleic acid (e.g., a 5’ UTR) that is operably linked to the open reading frame.
123. The nucleic acid of claim 122, wherein the open reading frame is further operably linked to a 3’ UTR.
124. The nucleic acid of any one of claims 95-123, wherein the polynucleotide tracts are separated from one another by way of one or more spacers that each, independently, comprise from 5 to 100 nucleosides.
125. The nucleic acid of claim 124, wherein each of the spacers, independently, comprises from 10 to 40 nucleosides.
126. The nucleic acid of claim 125, wherein each of the spacers, independently, comprises 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, or 38 nucleosides.
127. The nucleic acid of any one of claims 95-126, wherein the IRES comprises a segment having the formula:
[(N)n - ( U')m]p wherein: each N is, independently, any nucleoside residue; each U' is, independently, uridine or a modified uridine; each n is, independently, an integer from 1 to 100; each m is, independently, an integer from 2 to 15; and p is an integer from 2 to 20.
128. The nucleic acid of claim 127, wherein each N is, independently, selected from adenosine, a modified adenosine, uridine, a modified uridine, guanosine, a modified guanosine, cytidine, and a modified cytidine.
129. The nucleic acid of claim 128, wherein each N is, independently, selected from adenosine, uridine, a modified uridine, guanosine, and cytidine.
130. The nucleic acid of claim 128 or 129, wherein the modified uridine of N is 1 - methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5- aza-uridine, 2-thio-uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5- carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl- uridine, 5-methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl-
uridine, 5-methylaminomethyl-2-thio-uridine, 5-methylaminomethyl-2-seleno-uridine, 5-carbamoylmethyl- uridine, 5-carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl- uridine, 1 -propynyl-pseudouridine, 5-taurinomethyl-uridine, 1 -taurinomethyl-pseudouridine, 5- taurinomethyl-2-thio-uridine, 1 -taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine, 5-methyl-2-thio- uridine, 1 -methyl-4-thio-pseudouridine, 4-thio-1 -methyl-pseudouridine, 3-methylpseudouridine, 2-thio-1 - methyl-pseudouridine, 1 -methyl-1 -deaza-pseudouridine, 2-thio-1 -methyl-1 -deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4- methoxy-2-thio-pseudouridine, N1 -methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1 -methyl-3- (3-amino-3-carboxypropyl)pseudouridine, 5-(isopentenylaminornethyl)uridine, 5- (isopentenylaminornethyl)-2-thio-uridine, a-thio-uridine, 2'-O-methyl-uridine, 5,2'-O-dimethyl-uridine, 2'-O- methyl-pseudouridine, 2-thio-2'-O-methyl-uridine, 5-rnethoxycarbonylmethyl-2'-O-rnethyl-uridine, 5- carbarnoylmethyl-2'-O-rnethyl-uridine, 5-carboxymethylaminomethyl-2'-O-methyl-uridine, 3,2'-O-dimethyl- uridine, 5-(isopentenylarninomethyl)-2'-O-rnethyl-uridine, 1 -thio-uridine, deoxythymidine, 2’-F-ara-uridine, 2’-F-uridine, 2’-OH-ara-uridine, 5-(2-carbomethoxyvinyl) uridine, or 5-[3-(1 -E-propenylamino)uridine.
131 . The nucleic acid of claim 130, wherein the modified uridine of N is 1 -methylpseudouridine.
132. The nucleic acid of any one of claims 128, 130, and 131 , wherein the modified cytidine of N is 5-aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetyl-cytidine, 5-formyl-cytidine, N4-methyl-cytidine, 5-methyl-cytidine, 5-halo-cytidine, 5-hydroxymethyl-cytidine, 1 -methyl- pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4- thio-pseudoisocytidine, 4-thio-1 -methyl-pseudoisocytidine, 4-thio-1 -methyl-1 -deaza-pseudoisocytidine, 1 - methyl-1 -deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio- zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy- pseudoisocytidine, 4-methoxy-1 -methyl-pseudoisocytidine, lysidine, a-thio-cytidine, 2'-O-methyl-cytidine, 5,2'-O-dimethyl-cytidine, N4-acetyl-2'-O-methyl-cytidine, N4,2'-O-dimethyl-cytidine, 5-formyl-2'-O-methyl- cytidine, N4,N4,2'-O-trimethyl-cytidine, 1 -thio-cytidine, 2’-F-ara-cytidine, 2’-F-cytidine, or 2’-OH-ara- cytidine.
133. The nucleic acid of any one of claims 128 and 130-132, wherein the modified adenosine of N is 2-amino-purine, 2, 6-diaminopurine, 2-amino-6-halo-purine, 6-halo-purine, 2-amino-6-methyl-purine, 8- azido-adenosine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2- amino-purine, 7-deaza-2, 6-diaminopurine, 7-deaza-8-aza-2, 6-diaminopurine, 1 -methyl-adenosine, 2- methyl-adenine, N6-methyl-adenosine, 2-methylthio-N6-methyl-adenosine, N6-isopentenyl-adenosine, 2- methylthio-N6-isopentenyl-adenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis- hydroxyisopentenyl)adenosine, N6-glycinylcarbamoyl-adenosine, N6-threonylcarbamoyl-adenosine, N6- methyl-N6-threonylcarbamoyl-adenosine, 2-methylthio-N6-threonylcarbamoyl-adenosine, N6,N6- dimethyl-adenosine, N6-hydroxynorvalylcarbamoyl-adenosine, 2-methylthio-N6- hydroxynorvalylcarbamoyl-adenosine, N6-acetyl-adenosine, 7-methyl-adenine, 2-methylthio-adenine, 2- methoxy-adenine, a-thio-adenosine, 2'-O-methyl-adenosine, N6,2'-O-dimethyl-adenosine, N6,N6,2'-O-
trimethyl-adenosine, 1 ,2'-O-dimethyl-adenosine, 2'-O-ribosyladenosine, 2-amino-N6-methyl-purine, 1 -thioadenosine, 8-azido-adenosine, 2’-F-ara-adenosine, 2’-F-adenosine, 2’-OH-ara-adenosine, or N6-(19- amino-pentaoxanonadecyl)-adenosine.
134. The nucleic acid of any one of claims 128 and 130-133, wherein the modified guanosine of N is inosine, 1 -methyl-inosine, wyosine, methylwyosine, 4-demethyl-wyosine, isowyosine, wybutosine, peroxywybutosine, hydroxywybutosine, 7-deaza-guanosine, queuosine, epoxyqueuosine, galactosyl- queuosine, mannosyl-queuosine, 7-cyano-7-deaza-guanosine, 7-aminomethyl-7-deaza-guanosine, archaeosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8- aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methyl-inosine, 6-methoxy-guanosine,
1 -methyl-guanosine, N2-methyl-guanosine, N2,N2-dimethyl-guanosine, N2,7-dimethyl-guanosine, N2, N2,7-dimethyl-guanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1 -methyl-6-thio-guanosine, N2- methyl-6-thio-guanosine, N2,N2-dimethyl-6-thio-guanosine, a-thio-guanosine, 2'-O-methyl-guanosine, N2-methyl-2'-O-methyl-guanosine, N2,N2-dimethyl-2'-O-methyl-guanosine, 1 -methyl-2'-O-methyl- guanosine, N2,7-dimethyl-2'-O-methyl-guanosine, 2'-O-methyl-inosine, 1 ,2'-O-dimethyl-inosine, 2'-O- ribosylguanosine, 1 -thio-guanosine, O6-methyl-guanosine, 2’-F-ara-guanosine, or 2’-F-guanosine.
135. The nucleic acid of any one of claims 127-134, wherein the modified uridine of U’ is 1 - methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5- aza-uridine, 2-thio-uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5- carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl- uridine, 5-methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl- uridine, 5-methylaminomethyl-2-thio-uridine, 5-methylaminomethyl-2-seleno-uridine, 5-carbamoylmethyl- uridine, 5-carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl- uridine, 1 -propynyl-pseudouridine, 5-taurinomethyl-uridine, 1 -taurinomethyl-pseudouridine, 5- taurinomethyl-2-thio-uridine, 1 -taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine, 5-methyl-2-thio- uridine, 1 -methyl-4-thio-pseudouridine, 4-thio-1 -methyl-pseudouridine, 3-methylpseudouridine, 2-thio-1 - methyl-pseudouridine, 1 -methyl-1 -deaza-pseudouridine, 2-thio-1 -methyl-1 -deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine,
2-thio-dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4- methoxy-2-thio-pseudouridine, N1 -methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1 -methyl-3- (3-amino-3-carboxypropyl)pseudouridine, 5-(isopentenylaminomethyl)uridine, 5- (isopentenylaminomethyl)-2-thio-uridine, a-thio-uridine, 2'-O-methyl-uridine, 5,2'-O-dimethyl-uridine, 2'-O- methyl-pseudouridine, 2-thio-2'-O-methyl-uridine, 5-methoxycarbonylmethyl-2'-O-methyl-uridine, 5- carbamoylmethyl-2'-O-methyl-uridine, 5-carboxymethylaminomethyl-2'-O-methyl-uridine, 3,2'-O-dimethyl- uridine, 5-(isopentenylaminomethyl)-2'-O-methyl-uridine, 1 -thio-uridine, deoxythymidine, 2’-F-ara-uridine, 2’-F-uridine, 2’-OH-ara-uridine, 5-(2-carbomethoxyvinyl) uridine, or 5-[3-(1 -E-propenylamino)uridine.
136. The nucleic acid of claim 135, wherein the modified uridine of U’ is 1 -methylpseudouridine.
137. The nucleic acid of any one of claims 127-136, wherein each n is, independently, an integer from 10 to 40.
138. The nucleic acid of claim 137, wherein each n is, independently, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, or 38.
139. The nucleic acid of any one of claims 127-137, wherein each m is, independently, an integer from 2 to 15.
140. The nucleic acid of claim 139, wherein each m is, independently, an integer from 7 to 1 1 .
141 . The nucleic acid of claim 140, wherein each m is 9.
142. The nucleic acid of any one of claims 127-141 , wherein p is an integer from 2 to 10.
143. The nucleic acid of claim 142, wherein p is an integer from 3 to 6, optionally wherein p is 3 or
6.
144. The nucleic acid of any one of claims 95-143, wherein the nucleic acid is RNA.
145. The nucleic acid of any one of claims 95-144, wherein the nucleic acid is linear.
146. The nucleic acid of any one of claims 95-144, wherein the nucleic acid is circular.
147. The nucleic acid of any one of claims 95-146, wherein the open reading from consists of nucleosides selected from adenosine, a modified adenosine, uridine, a modified uridine, guanosine, a modified guanosine, cytidine, and a modified cytidine.
148. The nucleic acid of claim 147, wherein the open reading from consists of nucleosides selected from adenosine, uridine, a modified uridine, guanosine, and cytidine.
149. The nucleic acid of claim 147 or 148, wherein the modified uridine of the open reading frame is 1 -methylpseudouridine, pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2- thio-5-aza-uridine, 2-thio-uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy- uridine, 5-aminoallyl-uridine, 5-halo-uridine, 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1 -carboxymethyl-pseudouridine, 5- carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl- uridine, 5-methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl- uridine, 5-methylaminomethyl-2-thio-uridine, 5-methylaminomethyl-2-seleno-uridine, 5-carbamoylmethyl- uridine, 5-carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl-
uridine, 1 -propynyl-pseudouridine, 5-taurinomethyl-uridine, 1 -taurinomethyl-pseudouridine, 5- taurinomethyl-2-thio-uridine, 1 -taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine, 5-methyl-2-thio- uridine, 1 -methyl-4-thio-pseudouridine, 4-thio-1 -methyl-pseudouridine, 3-methylpseudouridine, 2-thio-1 - methyl-pseudouridine, 1 -methyl-1 -deaza-pseudouridine, 2-thio-1 -methyl-1 -deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4- methoxy-2-thio-pseudouridine, N1 -methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1 -methyl-3- (3-amino-3-carboxypropyl)pseudouridine, 5-(isopentenylaminornethyl)uridine, 5- (isopentenylaminornethyl)-2-thio-uridine, a-thio-uridine, 2'-O-methyl-uridine, 5,2'-O-dimethyl-uridine, 2'-O- methyl-pseudouridine, 2-thio-2'-O-methyl-uridine, 5-rnethoxycarbonylmethyl-2'-O-rnethyl-uridine, 5- carbarnoylmethyl-2'-O-rnethyl-uridine, 5-carboxymethylaminomethyl-2'-O-methyl-uridine, 3,2'-O-dimethyl- uridine, 5-(isopentenylarninomethyl)-2'-O-rnethyl-uridine, 1 -thio-uridine, deoxythymidine, 2’-F-ara-uridine, 2’-F-uridine, 2’-OH-ara-uridine, 5-(2-carbomethoxyvinyl) uridine, or 5-[3-(1 -E-propenylamino)uridine.
150. The nucleic acid of claim 149, wherein the modified uridine of the open reading frame is 1 - methylpseudouridine.
151 . The nucleic acid of any one of claims 147, 149, and 150, wherein the modified cytidine of N is 5-aza-cytidine, 6-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetyl-cytidine, 5-formyl-cytidine, N4-methyl-cytidine, 5-methyl-cytidine, 5-halo-cytidine, 5-hydroxymethyl-cytidine, 1 -methyl- pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4- thio-pseudoisocytidine, 4-thio-1 -methyl-pseudoisocytidine, 4-thio-1 -methyl-1 -deaza-pseudoisocytidine, 1 - methyl-1 -deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio- zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy- pseudoisocytidine, 4-methoxy-1 -methyl-pseudoisocytidine, lysidine, a-thio-cytidine, 2'-O-methyl-cytidine, 5,2'-O-dimethyl-cytidine, N4-acetyl-2'-O-methyl-cytidine, N4,2'-O-dimethyl-cytidine, 5-formyl-2'-O-methyl- cytidine, N4,N4,2'-O-trimethyl-cytidine, 1 -thio-cytidine, 2’-F-ara-cytidine, 2’-F-cytidine, or 2’-OH-ara- cytidine.
152. The nucleic acid of any one of claims 147 and 149-151 , wherein the modified adenosine of N is 2-amino-purine, 2, 6-diaminopurine, 2-amino-6-halo-purine, 6-halo-purine, 2-amino-6-methyl-purine, 8- azido-adenosine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2- amino-purine, 7-deaza-2, 6-diaminopurine, 7-deaza-8-aza-2, 6-diaminopurine, 1 -methyl-adenosine, 2- methyl-adenine, N6-methyl-adenosine, 2-methylthio-N6-methyl-adenosine, N6-isopentenyl-adenosine, 2- methylthio-N6-isopentenyl-adenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis- hydroxyisopentenyl)adenosine, N6-glycinylcarbamoyl-adenosine, N6-threonylcarbamoyl-adenosine, N6- methyl-N6-threonylcarbamoyl-adenosine, 2-methylthio-N6-threonylcarbamoyl-adenosine, N6,N6- dimethyl-adenosine, N6-hydroxynorvalylcarbamoyl-adenosine, 2-methylthio-N6- hydroxynorvalylcarbamoyl-adenosine, N6-acetyl-adenosine, 7-methyl-adenine, 2-methylthio-adenine, 2- methoxy-adenine, a-thio-adenosine, 2'-O-methyl-adenosine, N6,2'-O-dimethyl-adenosine, N6,N6,2'-O- trimethyl-adenosine, 1 ,2'-O-dimethyl-adenosine, 2'-O-ribosyladenosine, 2-amino-N6-methyl-purine, 1 -thio-
adenosine, 8-azido-adenosine, 2’-F-ara-adenosine, 2’-F-adenosine, 2’-OH-ara-adenosine, or N6-(19- amino-pentaoxanonadecyl)-adenosine.
153. The nucleic acid of any one of claims 147 and 149-152, wherein the modified guanosine of A/ is inosine, 1 -methyl-inosine, wyosine, methylwyosine, 4-demethyl-wyosine, isowyosine, wybutosine, peroxywybutosine, hydroxywybutosine, 7-deaza-guanosine, queuosine, epoxyqueuosine, galactosyl- queuosine, mannosyl-queuosine, 7-cyano-7-deaza-guanosine, 7-aminomethyl-7-deaza-guanosine, archaeosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8- aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methyl-inosine, 6-methoxy-guanosine, 1 -methyl-guanosine, N2-methyl-guanosine, N2,N2-dimethyl-guanosine, N2,7-dimethyl-guanosine, N2, N2,7-dimethyl-guanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1 -methyl-6-thio-guanosine, N2- methyl-6-thio-guanosine, N2,N2-dimethyl-6-thio-guanosine, a-thio-guanosine, 2'-O-methyl-guanosine, N2-methyl-2'-O-methyl-guanosine, N2,N2-dimethyl-2'-O-methyl-guanosine, 1 -methyl-2'-O-methyl- guanosine, N2,7-dimethyl-2'-O-methyl-guanosine, 2'-O-methyl-inosine, 1 ,2'-O-dimethyl-inosine, 2'-O- ribosylguanosine, 1 -thio-guanosine, O6-methyl-guanosine, 2’-F-ara-guanosine, or 2’-F-guanosine.
154. The nucleic acid of any one of claims 95-153, wherein the polypeptide encoded by the open reading frame is a secreted protein, a cytokine, a growth factor, an enzyme, an immunomodulator, an antibody or antigen-binding fragment thereof, a cell-penetrating peptide, an extracellular membranebound protein, an intracellular membrane-bound protein, a cytoplasmic protein, a cytoskeletal protein, or a nuclear protein.
155. The nucleic acid of any one of claims 95-154, wherein the nucleic acid does not comprise a 5’ cap.
156. The nucleic acid of any one of claims 95-145 and 147-154, wherein the nucleic acid comprises a 5’ cap.
157. The nucleic acid of any one of claims 82-156, wherein the nucleotide sequence of the IRES comprises at least 75% sequence identity to SEQ ID NO: 185 or SEQ ID NO: 190.
158. The nucleic acid of claim 157, wherein the nucleotide sequence of the IRES comprises at least 80% sequence identity to SEQ ID NO: 185 or SEQ ID NO: 190.
159. The nucleic acid of claim 158, wherein the nucleotide sequence of the IRES comprises at least 85% sequence identity to SEQ ID NO: 185 or SEQ ID NO: 190.
160. The nucleic acid of claim 159, wherein the nucleotide sequence of the IRES has at least 90% sequence identity to SEQ ID NO: 185 or SEQ ID NO: 190.
161 . The nucleic acid of claim 160, wherein the nucleotide sequence of the IRES has a at least 95% sequence identity to SEQ ID NO: 185 or SEQ ID NO: 190, optionally wherein the nucleotide sequence of the IRES has at least 96%, 97%, 98%, or 99% sequence identity SEQ ID NO: 185 or SEQ ID NO: 190.
162. The nucleic acid of claim 161 , wherein the nucleotide sequence of the IRES is SEQ ID NO: 185 or SEQ ID NO: 190.
163. The nucleic acid of any one of claims 82-162, wherein the IRES comprises one or more polynucleotides that specifically bind a translation initiation factor (e.g., elF4G, elF4G2, elF3, La protein, or an TAf), or a fusion protein comprising a translation initiation factor (e.g., elF4G, elF4G2, elF3, La protein, or an ITAf) fused to an RNA-binding protein.
164. The nucleic acid of claim 163, wherein the one or more polynucleotides specifically bind elF4G.
165. The nucleic acid of claim 164, wherein each of the one or more polynucleotides, independently, has a nucleic acid sequence that is at least 75% identical to ACUCACUAUUUGUUUUCGCGCCCAGUUGCAAAAA (SEQ ID NO: 1 ), optionally wherein each U residue in SEQ ID NO: 1 is replaced with 1 -methylpseudouridine.
166. The nucleic acid of claim 165, wherein each of the one or more polynucleotides, independently, has a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence of SEQ ID NO: 1 (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the nucleic acid sequence of SEQ ID NO: 1 ), optionally wherein each U residue in SEQ ID NO: 1 is replaced with 1 -methylpseudouridine.
167. The nucleic acid of claim 163, wherein the IRES comprises one or more polynucleotides that specifically bind to a fusion protein comprising a translation initiation factor (e.g., elF4G, elF4G2, elF3, La protein, or an ITAf) fused to an RNA-binding protein, optionally wherein the RNA-binding protein is MS2-binding protein and the one or more polynucleotides comprise one or more MS2 RNA hairpins.
168. The nucleic acid of any one of claims 163-167, wherein the nucleic acid does not comprise a 5’ cap.
169. The nucleic acid of any one of claims 163-167, wherein the nucleic acid comprises a 5’ cap.
170. The nucleic acid of any one of claims 163-169, wherein the nucleic acid comprises a nucleotide sequence with at least 75% sequence identity to any one of SEQ ID NO: 191 -201 .
171 . The nucleic acid of claim 170, wherein the nucleic acid comprises a nucleotide sequence with at least 80% sequence identity to any one of SEQ ID NO: 191 -201 .
172. The nucleic acid of claim 171 , wherein the nucleic acid comprises a nucleotide sequence with at least 85% sequence identity to any one of SEQ ID NO: 191 -201 .
173. The nucleic acid of claim 172, wherein the nucleic acid comprises a nucleotide sequence with at least 90% sequence identity to any one of SEQ ID NO: 191 -201 .
174. The nucleic acid of claim 173, wherein the nucleic acid comprises a nucleotide sequence with at least 95% sequence identity to any one of SEQ ID NO: 191 -201 .
175. The nucleic acid of claim 174, wherein the nucleic acid comprises the nucleotide sequence of any one of SEQ ID NO: 191 -201 .
176. The nucleic acid of any one of claims 82-175, wherein the rRNA is from a 60S or 40S ribosomal subunit, optionally wherein the rRNA is selected from the group consisting of a 25S, 28S, 18S, 5.8S, and 5S rRNA.
177. A polypeptide expression system comprising :
(i) the nucleic acid of any one of claims 1 -176; and
(ii) a nucleic acid comprising an open reading frame that encodes a translation initiation factor (e.g., elF4G, elF4G2, elF3, La protein, or an ITAf).
178. The polypeptide expression system of claim 177, wherein the nucleic acid of (i) and the nucleic acid of (ii) are separate molecules.
179. The polypeptide expression system of claim 177 or 178, wherein the nucleic acid of (ii) comprises, from 5’ to 3’:
(i) a 5’ UTR;
(ii) the open reading frame encoding the elF4G, La protein, or functional variant thereof; and
(iii) a 3’ UTR.
180. The polypeptide expression system of claim 179, wherein the nucleic acid of (ii) further comprises a 5’ cap operably linked to the 5’ UTR.
181 . A host cell comprising the nucleic acid of any one of claims 1 -176 or the polypeptide expression system of any one of claims 70-73.
182. The host cell of claim 181 , wherein the host cell is a eukaryotic cell.
183. The host cell of claim 182, wherein the eukaryotic cell is a mammalian cell.
184. The host cell of claim 183, wherein the mammalian cell is a human cell.
185. A method of expressing a polypeptide in a subject, the method comprising administering to the subject the nucleic acid of any one of claims 1 -176 or the polypeptide expression system of any one of claims 177-180.
186. A method of expressing a polypeptide in a cell or population of cells, the method comprising providing to the cell or population of cells the nucleic acid of any one of claims 1 -176 or the polypeptide expression system of any one of claims 177-180.
187. A method of treating a disease or condition associated with a deficiency in an endogenous polypeptide, the method comprising administering to the subject the nucleic acid of any one of claims 1 - 176 or the polypeptide expression system of any one of claims 177-180, wherein the polypeptide encoded by the nucleic acid or polypeptide expression system corresponds to the polypeptide whose deficiency is associated with the disease or condition.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202263395614P | 2022-08-05 | 2022-08-05 | |
| PCT/US2023/071742 WO2024031087A2 (en) | 2022-08-05 | 2023-08-04 | Internal ribosome entry sites for improved polynucleotide translation |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP4565692A2 true EP4565692A2 (en) | 2025-06-11 |
Family
ID=89849952
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP23851018.4A Pending EP4565692A2 (en) | 2022-08-05 | 2023-08-04 | Internal ribosome entry sites for improved polynucleotide translation |
Country Status (3)
| Country | Link |
|---|---|
| EP (1) | EP4565692A2 (en) |
| TW (1) | TW202417629A (en) |
| WO (1) | WO2024031087A2 (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2025249560A1 (en) * | 2024-05-31 | 2025-12-04 | 国立大学法人京都大学 | Nucleic acid aptamer, rna molecule, pharmaceutical composition, and template dna molecule |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2763701B1 (en) * | 2011-10-03 | 2018-12-19 | Moderna Therapeutics, Inc. | Modified nucleosides, nucleotides, and nucleic acids, and uses thereof |
-
2023
- 2023-08-04 WO PCT/US2023/071742 patent/WO2024031087A2/en not_active Ceased
- 2023-08-04 EP EP23851018.4A patent/EP4565692A2/en active Pending
- 2023-08-07 TW TW112129616A patent/TW202417629A/en unknown
Also Published As
| Publication number | Publication date |
|---|---|
| TW202417629A (en) | 2024-05-01 |
| WO2024031087A2 (en) | 2024-02-08 |
| WO2024031087A3 (en) | 2024-04-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20230398074A1 (en) | Nucleic Acid-Based Therapy of Muscular Dystrophies | |
| US12239742B2 (en) | Polynucleotides encoding Citrin for the treatment of Citrullinemia type 2 | |
| US12252704B2 (en) | Polynucleotides encoding galactose-1-phosphate uridylyltransferase for the treatment of galactosemia type 1 | |
| EP3458107B1 (en) | Polynucleotides encoding jagged1 for the treatment of alagille syndrome | |
| US20240318187A1 (en) | Polyribonucleotides containing reduced uracil content and uses thereof | |
| US20200085916A1 (en) | Polynucleotides encoding porphobilinogen deaminase for the treatment of acute intermittent porphyria | |
| US20190298657A1 (en) | Polynucleotides Encoding Acyl-CoA Dehydrogenase, Very Long-Chain for the Treatment of Very Long-Chain Acyl-CoA Dehydrogenase Deficiency | |
| US20250170070A1 (en) | Polynucleotides encoding glucose-6-phosphatase for the treatment of glycogen storage disease | |
| EP3458106A1 (en) | Polynucleotides encoding lipoprotein lipase for the treatment of hyperlipidemia | |
| AU2017266948A1 (en) | Polynucleotides encoding porphobilinogen deaminase for the treatment of acute intermittent porphyria | |
| AU2017268394A1 (en) | Polynucleotides encoding relaxin | |
| JP2023527875A (en) | Phenylalanine hydroxylase variants and uses thereof | |
| US20250262320A1 (en) | Polynucleotides encoding uridine diphosphate glycosyltransferase 1 family, polypeptide a1 for the treatment of crigler-najjar syndrome | |
| WO2024031087A2 (en) | Internal ribosome entry sites for improved polynucleotide translation | |
| WO2024129779A1 (en) | Internal ribosome entry sites for improved polynucleotide translation | |
| WO2026102302A1 (en) | Polynucleotides containing a modified 3'-region | |
| WO2025175176A1 (en) | Synthetic nucleic acids and methods of using the same for improved polypeptide production | |
| WO2025137275A1 (en) | Novel cas nucleases and polynucleotides encoding the same | |
| WO2025231360A1 (en) | Novel cas nucleases and polynucleotides encoding the same | |
| WO2022271776A1 (en) | Polynucleotides encoding uridine diphosphate glycosyltransferase 1 family, polypeptide a1 for the treatment of crigler-najjar syndrome | |
| WO2024182301A2 (en) | Lipid nanoparticles and polynucleotides encoding galactose-1-phosphate uridylyltransferase (galt) for the treatment of galactosemia |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE |
|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE |
|
| 17P | Request for examination filed |
Effective date: 20250219 |
|
| AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR |
|
| DAV | Request for validation of the european patent (deleted) | ||
| DAX | Request for extension of the european patent (deleted) |