EP4430210A1 - Depression biomarkers, uses and method thereof - Google Patents

Depression biomarkers, uses and method thereof

Info

Publication number
EP4430210A1
EP4430210A1 EP22826405.7A EP22826405A EP4430210A1 EP 4430210 A1 EP4430210 A1 EP 4430210A1 EP 22826405 A EP22826405 A EP 22826405A EP 4430210 A1 EP4430210 A1 EP 4430210A1
Authority
EP
European Patent Office
Prior art keywords
mir
depression
biomarker
previous
reference value
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
EP22826405.7A
Other languages
German (de)
French (fr)
Inventor
João BRÁS
Maria Inês ALMEIDA
Susana SANTOS
Mário BARBOSA
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ineb-Instituto Nacional De Engenharia Biomedica
Universidade do Porto
Original Assignee
Ineb-Instituto Nacional De Engenharia Biomedica
Universidade do Porto
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ineb-Instituto Nacional De Engenharia Biomedica, Universidade do Porto filed Critical Ineb-Instituto Nacional De Engenharia Biomedica
Publication of EP4430210A1 publication Critical patent/EP4430210A1/en
Pending legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/178Oligonucleotides characterized by their use miRNA, siRNA or ncRNA

Definitions

  • the present disclosure relates to an in vitro or ex vivo use of biomarkers to detect depression, in particular microRNAs (miRNAs).
  • miRNAs microRNAs
  • Depression ranks as the most prevalent psychiatric disorder, with estimated over 260 million sufferers worldwide (WH02020), and a lifetime prevalence of 10-20% (1). It also figures among the top three causes of disability worldwide and can affect individuals of all ages throughout their entire lifespan, with a higher prevalence in women (1).
  • Conventional pharmacological treatments for depression are mainly based on the monoamines theory of depression, targeting neurotransmission regulation (2). However, it is estimated that between 30 to 50% of patients with major depression do not respond to the prescribed schemes of antidepressant medication (3, 4), reinforcing the need to stratify patients, and understand the multifactorial aetiology of this disorder.
  • miRNAs are small non-coding RNAs that regulate multiple target transcripts, influencing entire gene networks in processes such as neurogenesis and neuronal plasticity (8, 9).
  • peripheral blood cells share more than 80% of the transcriptome with brain tissue, therefore offering a potential diagnostic tool that can dynamically reflect changes in brain macro- and microenvironments (10).
  • the present disclosure relates to an in vitro or ex vivo use of miR-342-3p miRNA as a biomarker of depression, alone or in combination with other miRNA's (miR-146a- 5p and/or miR-155-5p) in an isolated biological sample, preferably blood or peripheral blood mononuclear cells. Furthermore, the present disclosure relates to an in vitro or ex vivo method diagnosis or prognosis of depression in a subject.
  • the present invention stems from the study of how peripubertal stress (PPS) combined with differential corticosterone (CORT)-stress responsiveness (CSR) influences depressive-like behaviours in male rats in adulthood, and how these alterations relate to expression of miRNAs.
  • PPS peripubertal stress
  • CORT differential corticosterone
  • CSR stress responsiveness
  • the present invention thus refers to the use of primer and probe sequence compositions and to a method developed in vitro for diagnosis and monitoring of depression, the said method comprising the steps of extracting RNA from PBMCs and quantifying levels of miR-342-3p, alone or in combination with other miRNAs.
  • Depression or major depressive disorder is a common and serious medical illness that negatively affects how you feel, the way you think and how you act. Fortunately, it is also treatable. Depression causes feelings of sadness and/or a loss of interest in activities you once enjoyed. It can lead to a variety of emotional and physical problems and can decrease your ability to function at work and at home.
  • miR-342 when miR-342 is mentioned, it refers to miR-342- 3p; when miR-155 is mentioned, it refers to miR-155-5p; when miR-146a is mentioned, it refers to miR-146a-5p; when miR-145 is mentioned, it refers to miR-145-5p.
  • PBMC peripheral blood mononuclear cells
  • CSR corticosterone
  • N-CSR refers to Normative- CORT stress-responsive.
  • H-CSR refers to High-CORT stress-responsive.
  • CTR refers to control
  • PPS refers to peripubertal stress
  • accession number of each miRNA herein disclosed can be accessed in the 3iRbase database, available in the following link:
  • microRNA miR-145-5p is also referred as hsa-miR-145-5p (Homo Sapiens (Hsa) miR-145-5p) and is identified by the miRbase accession number MIMAT0000437.
  • microRNA miR-146a-5p is also referred as hsa-miR-146a-5p and is identified by the miRbase accession number MIMAT0000449.
  • microRNA miR-155-5p 5p is also referred as hsa-miR-155-5p and is identified by the miRbase accession number MIMAT0000646
  • microRNA miR-342-3p is also referred as hsa-miR-342-3p and is identified by the miRbase accession number MIMAT0000753.
  • Biological sample generally refers to a sample obtained from a biological subject/patient, including sample of biological tissue or fluid origin, obtained, reached, or collected in situ or in vivo. Such samples can be, but are not limited to, organs, tissues, fractions and cells isolated from a mammal. Exemplary biological samples include but are not limited to cell lysate, a cell culture, a cell line, a tissue, oral tissue, gastrointestinal tissue, an organ, an organelle, a biological fluid, a blood sample, a serum sample, a urine sample, a skin sample, and the like.
  • Preferred biological samples include but are not limited to a blood, a plasma, a serum, a PBMC, a tissue biopsy, an oral mucosa, a saliva, an interstitial fluid, or a urine sample, and the like. More preferably, the biological sample blood. Even more preferably, the biological sample is PBMC.
  • An aspect of the present disclosure relates to an in vitro or ex vivo use of miR- 342-3p miRNA as a biomarker of depression or major depressive disorder.
  • the use further comprises the use of miR-155-5p and miR- 146a-5p as biomarkers of depression or major depressive disorder.
  • a measured level of expression of miR-342-3p into an isolated biological sample is compared to a control reference value, and wherein an increase of said measured level relative to said control reference value is indicative of depression.
  • the use comprises the measured levels of expression of a biomarker combination, wherein said biomarker combination miR-342-3p and miR- 146a-5p into the isolated biological sample are compared to a control reference value, and wherein an increase of miR-342-3p measured level and decrease of miR-146a-5p measured level relative to said control reference value is indicative of depression.
  • the use comprises the measured levels of expression of a biomarker combination, wherein said biomarker combination miR-342-3p and miR-155- 5p into the isolated biological sample are compared to a control reference value, and wherein an increase of miR-342-3p measured level and decrease of miR-155-5p measured level relative to said control reference value is indicative of depression.
  • the use comprises the measured levels of expression of a biomarker combination, wherein said biomarker combination miR-342-3p, miR-146a-5p and miR-155-5p into the isolated biological sample are compared to a control reference value, and wherein an increase of miR-342-3p measured level and decrease of miR- 146a-5p and miR-155-5p measured levels relative to said control reference value is indicative of depression.
  • the biological sample is blood.
  • the biological sample is peripheral blood mononuclear cells.
  • Another aspect of the present disclosure relates to an in vitro or ex vivo method for diagnosis or prognosis of depression or major depressive disorder in a subject, comprising the following the steps: measuring a presence or an expression level of miR-342-3p miRNA, in a biological sample previously obtained from said subject; and comparing said presence or expression level to a control reference value, wherein an increased presence or level of expression of said miRNA relative to said control reference value is indicative of depression.
  • the biological sample is blood.
  • the biological sample is peripheral blood mononuclear cells.
  • biomarker for use in vitro or ex vivo diagnostic of depression or major depressive disorder, wherein said biomarker is miR-342-3p, preferably combined with miR-146a-5p and/or miR-155-5p.
  • the biomarker is the combination of miR-342-3p and miR- 155-5p; or miR-342-3p and miR-146a-5p.
  • the biomarker further comprises miR-342-3p, miR-155-5p and miR-146a-5p.
  • Another aspect of the present disclosure relates to a kit for use in vitro or ex vivo diagnostic of depression comprising the biomarker herein described.
  • miR-342-3p levels of miR-342-3p are upregulated, while miR-146a-5p and miR-155-5p are downregulated in the PBMCs of depression patients.
  • the expression levels of the newly identified miRNA in the context of depression (miR-342-3p) and other additional miRNAs previously reported to be dysregulated in depression (miR-145-5p, miR-146a-5p and miR-155-5p) were evaluated in the PBMCs by RT-qPCR using U6 snRNA as internal control. Results revealed that miR-342-3p is significantly upregulated, while miR-146a-5p and miR-155-5p levels are significantly downregulated in the PBMCs of depression patients compared with healthy controls.
  • the present disclosure relates to an in vitro or ex vivo use of miR-342-3p miRNA as a biomarker of depression, alone or in combination with other miRNA's (miR-146a- 5p and/or miR-155-5p) in an isolated biological sample, preferably blood or peripheral blood mononuclear cells. Furthermore, the present disclosure relates to an in vitro or ex vivo method diagnosis or prognosis of depression in a subject.
  • the present invention comprises the study of how peripubertal stress (PPS) combined with differential corticosterone (CORT)-stress responsiveness (CSR) influences depressive-like behaviours in rats in adulthood, and how these alterations relate to the brain expression of microRNAs (miRNAs).
  • PPS peripubertal stress
  • CORT differential corticosterone
  • CSR stress responsiveness
  • the present invention further refers to a method developed in vitro, employing specific primer and probe compositions for diagnostic and monitoring of depression, the said method comprising the steps of extracting RNA from PBMCs and quantifying levels of miR-342-3p, alone or in combination with other miRNAs.
  • the said compositions and methods of the present invention may be advantageously used to improve accuracy in diagnosis and monitoring of depression, which remains inaccurate as it is mostly narrative and observation based.
  • the present disclosure relates to the use of biomarkers to detect
  • An aspect of the present disclosure refers to the use of miR-342-3p specific primer and probe RT-PCR compositions for diagnostic and monitoring of depression.
  • the present invention further refers to a method developed in vitro, employing the said compositions, for diagnostic and monitoring of depression, the said method comprising the steps of extracting RNA from PBMCs and quantifying levels of miR-342-3p, alone or in combination with other miRNAs.
  • an in vivo study is performed to explore how, two key risk factors for depression, i.e. peripubertal stress (PPS) combined with differential corticosterone (CORT)-stress responsiveness (CSR), influence protracted depressive-like behaviors and the expression of brain molecular markers in male rats.
  • PPS peripubertal stress
  • CORT differential corticosterone
  • CSR stress responsiveness
  • PPS protocol is based on exposure to fear-induction procedures, according to Marquez et al. (12), and include the exposure to an open-field, a synthetic fox odor and an elevated platform.
  • CTR and PPS rats undergo sequential behavioral tests to evaluate depressive-like behaviors (saccharin preference and forced- swim test).
  • 42 animals are used, namely 18 N-CSR (9 CTR and 9 PPS) and 24 H- CSR (12 CTR and 12 PPS).
  • Rats are sacrificed by decapitation and brains freshly dissected for isolation of the medial prefrontal cortex (mPFC), nucleus accumbens (NAc), amygdala (Amg) and hippocampus (HPC). Each brain region is placed in an RNAse-free cryotube, fresh frozen in liquid nitrogen, and stored at -80°C prior to RNA extraction. Trunk blood is also collected and immediately processed for PBMCs isolation. Total RNA from brain regions and PBMCs is extracted using TRIzol reagent (Invitrogen). miR-342- 3p expression is evaluated using a TaqMan microRNA assay (Applied Biosystems).
  • mPFC medial prefrontal cortex
  • NAc nucleus accumbens
  • Amg amygdala
  • HPC hippocampus
  • cDNA is synthesized using 30 ng of RNA as a template, gene-specific stem-loop Reverse Transcription primer, and the TaqMan microRNA reverse transcription kit (Applied Biosystems). Oligonucleotide primers and Taqman probes are used to amplify and detect the synthetic DNA fragment obtained from cDNA synthesis.
  • Compositions comprising the above-mentioned assay are prepared by adding reactant solutions to the RT-PCR, available from the market, in specific concentrations and qPCR is carried out in Real-Time PCR Detection System (Bio-Rad) using cDNA and SsoAdvancedTM Universal Probes Supermix (Bio-Rad). Small nuclear RNA U6 is used as reference gene.
  • Relative expression levels is calculated using the quantification cycle (Cq) method.
  • Cq quantification cycle
  • clinical depression diagnostics may further include a structured clinical interview to assess the presence of major psychiatric syndromes according to the Diagnostic and Statistical Manual of Mental Disorders, Fifth Edition (DSM-5), an assessment of current psychiatric symptoms, and a determination of previous antidepressant treatment.
  • DSM-5 Diagnostic and Statistical Manual of Mental Disorders
  • blood samples are obtained from depression patients at baseline, as well as before undergoing treatment.
  • Patients may be excluded from the analysis if presenting any of the following: i) psychotic symptoms; ii) presence of an infectious or inflammatory illness or the regular use of anti-inflammatory medication; iii) Inability to completely understand and fill in the self-assessment instruments; iv) Being part of a trial or with other psychological/psychopharmacological treatment.
  • peripheral blood is collected using VACUETTE® Tubes EDTA K3 (Greiner Bio-One, France). Blood components are separated by centrifuging at 1200g, for 20 min, at room temperature (RT), without break. Plasma is collected and centrifuged twice at 2500g, for 10 min at 4 °C before being aliquoted and stored at -80 °C. Medial layer containing PBMCs are slowly collected and transferred into a new 15mL centrifuge tube. PBMCs are diluted in an equal volume of PBS lx, slowly layered over Lymphoprep (Ratio 1:1) and centrifuged at 800g, for 20min, at RT, without break. Medial layer containing enriched PBMCs is collected, and cells washed twice with PBS lx (300g, lOmin, at 4°C) before being lysed with TRIzol®.
  • room temperature should be regarded as a temperature between 15-30 °C, preferably between 18-25 °C, more preferably between 20-22 °C.
  • RNA is extracted using TRIzol® reagent (Invitrogen) according to the manufacturer's instructions. RNA concentration and purity is evaluated in a NanoDrop 1000 (Thermo Scientific). RNA integrity is evaluated by agarose gel electrophoresis or by ExperionTM automated electrophoresis system (Bio-Rad, USA).
  • miR-342-3p and miR-145-5p, miR-146a-5p, miR-155-5p expression was evaluated using TaqMan miRNA assays (Applied Biosystems). Briefly, cDNA is synthesized using 30 ng of RNA as a template, gene-specific stem-loop Reverse Transcription primer, and the TaqMan microRNA reverse transcription kit (Applied Biosystems). Oligonucleotide primers and Taqman probes are used to amplify and detect the synthetic DNA fragment obtained from cDNA synthesis.
  • Table 1 Oligonucleotides sequences and ID's of the Taqman® assays used for RT-qPCR for miR-145-5p, miR-146a-5p, miR-155-5p, miR-342-3p and U6 SnRNA. miRBase Taqman® miRNA name Accession Mature sequence miRNA assay ID
  • the above-mentioned assays can be obtained in the market, for example from ThermoFisher.
  • compositions comprising the above-mentioned assays are prepared by adding reactant solutions to the RT-PCR, available from the market, in specific concentrations and qPCR is carried out in Real-Time PCR Detection System (Bio-Rad) using cDNA and SsoAdvancedTM Universal Probes Supermix (Bio-Rad). Small nuclear RNA U6 is used as reference gene. Relative expression levels were calculated using the quantification cycle (Cq) method.
  • the diagnostic value of the tested miRNAs was calculated using Receiver Operating Characteristics (ROC) curve in GraphPad.
  • ROC analysis is performed to evaluate the ability of the differently expressed miRNAs to distinguish between depression patients and healthy controls, individually or in combination.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present disclosure relates to an in vitro or ex vivo use of miR-342-3p as a biomarker of depression in an isolated biological sample, preferably blood or peripheral blood mononuclear cells. Furthermore, the present disclosure relates to an in vitro or ex vivo method diagnosis or prognosis of depression in a subject.

Description

DEPRESSION BIOMARKERS, USES AN D METHOD TH EREOF
TECH NICAL FIELD
[0001] The present disclosure relates to an in vitro or ex vivo use of biomarkers to detect depression, in particular microRNAs (miRNAs).
BACKGROUND
[0002] Depression ranks as the most prevalent psychiatric disorder, with estimated over 260 million sufferers worldwide (WH02020), and a lifetime prevalence of 10-20% (1). It also figures among the top three causes of disability worldwide and can affect individuals of all ages throughout their entire lifespan, with a higher prevalence in women (1). Conventional pharmacological treatments for depression are mainly based on the monoamines theory of depression, targeting neurotransmission regulation (2). However, it is estimated that between 30 to 50% of patients with major depression do not respond to the prescribed schemes of antidepressant medication (3, 4), reinforcing the need to stratify patients, and understand the multifactorial aetiology of this disorder. It is now clear that the major reason, still preventing a most accurate diagnosis as well as the development of better pharmacotherapies, is the poor understanding of the molecular pathology underlying depression. This leads to narrative and observationbased diagnosis, disregarding the biological particularities of each patient (5). Thus, there is an urgent need to establish complementary diagnostics tests, by defining diagnosis follow-up and prognosis biomarkers based on the underlying disease mechanisms. In this sense, microRNAs (miRNAs) have recently emerged as important mediators in the pathophysiology of depression, with potential to be used as therapeutical targets and/or biomarkers (6, 7). miRNAs are small non-coding RNAs that regulate multiple target transcripts, influencing entire gene networks in processes such as neurogenesis and neuronal plasticity (8, 9). Since brain tissue is rarely available for study, the analysis of other peripheral information sources, such as saliva, plasma, serum and particularly Peripheral Blood Mononuclear Cells (PBMCs), has received increasing attention. In fact, previous studies have shown that peripheral blood cells share more than 80% of the transcriptome with brain tissue, therefore offering a potential diagnostic tool that can dynamically reflect changes in brain macro- and microenvironments (10).
[0003] These facts are disclosed in order to illustrate the technical problem addressed by the present disclosure, which relates to a blood-based biomarker panel associated to the pathogenesis of depression.
GENERAL DESCRIPTION
[0004] The present disclosure relates to an in vitro or ex vivo use of miR-342-3p miRNA as a biomarker of depression, alone or in combination with other miRNA's (miR-146a- 5p and/or miR-155-5p) in an isolated biological sample, preferably blood or peripheral blood mononuclear cells. Furthermore, the present disclosure relates to an in vitro or ex vivo method diagnosis or prognosis of depression in a subject.
[0005] Unexpectedly, the inventors have observed that miR-342-3p is upregulated in the PBMCs of depression patients and is positively correlated with depressive-like behaviours. Additionally, considering the expression of additional miRNA's ( miR-146a- 5p and miR-155-5p) and tested as a miRNA panel, sensitivity increased significantly and the use of the three miRNAs in combination was the best classifier (AUC=0.842, sensitivity of 80.6% and specificity of 72.5%).
[0006] The present invention stems from the study of how peripubertal stress (PPS) combined with differential corticosterone (CORT)-stress responsiveness (CSR) influences depressive-like behaviours in male rats in adulthood, and how these alterations relate to expression of miRNAs. Surprisingly, High-CORT stress-responsive (H- CSR) male rats that underwent PPS, which exhibit depressive-like behaviour, show hippocampal upregulation of specific miRNAs, in particular of miR-342-3p. These findings in a rat model allow to assess that miR-342-3p expression is positively correlated with passive coping responses, which are characteristic of depression, and highlight miR-342-3p as a potential biomarker for the diagnosis of depression in humans. Analysis of the expression of the homologous human miR-342-3p, along with other miRNAs, in the PBMCs originally reveals diagnostic potential for depression, as assessed in a case-control study. The present invention thus refers to the use of primer and probe sequence compositions and to a method developed in vitro for diagnosis and monitoring of depression, the said method comprising the steps of extracting RNA from PBMCs and quantifying levels of miR-342-3p, alone or in combination with other miRNAs.
[0007] Depression or major depressive disorder is a common and serious medical illness that negatively affects how you feel, the way you think and how you act. Fortunately, it is also treatable. Depression causes feelings of sadness and/or a loss of interest in activities you once enjoyed. It can lead to a variety of emotional and physical problems and can decrease your ability to function at work and at home.
[0008] Within the present disclosure, when miR-342 is mentioned, it refers to miR-342- 3p; when miR-155 is mentioned, it refers to miR-155-5p; when miR-146a is mentioned, it refers to miR-146a-5p; when miR-145 is mentioned, it refers to miR-145-5p.
[0009] In the present disclosure, PBMC refers to peripheral blood mononuclear cells.
[0010] In the present disclosure, CSR refers to corticosterone (CORT)-stress responsiveness.
[0011] In the present disclosure, N-CSR refers to Normative- CORT stress-responsive.
[0012] In the present disclosure, H-CSR refers to High-CORT stress-responsive.
[0013] In the present disclosure, CTR refers to control
[0014] In the present disclosure, PPS refers to peripubertal stress.
[0015] The accession number of each miRNA herein disclosed can be accessed in the 3iRbase database, available in the following link:
[0016] The microRNA miR-145-5p is also referred as hsa-miR-145-5p (Homo Sapiens (Hsa) miR-145-5p) and is identified by the miRbase accession number MIMAT0000437.
[0017] The microRNA miR-146a-5p is also referred as hsa-miR-146a-5p and is identified by the miRbase accession number MIMAT0000449.
[0018] The microRNA miR-155-5p 5p is also referred as hsa-miR-155-5p and is identified by the miRbase accession number MIMAT0000646 [0019] The microRNA miR-342-3p is also referred as hsa-miR-342-3p and is identified by the miRbase accession number MIMAT0000753.
[0020] "Biological sample," as used herein, generally refers to a sample obtained from a biological subject/patient, including sample of biological tissue or fluid origin, obtained, reached, or collected in situ or in vivo. Such samples can be, but are not limited to, organs, tissues, fractions and cells isolated from a mammal. Exemplary biological samples include but are not limited to cell lysate, a cell culture, a cell line, a tissue, oral tissue, gastrointestinal tissue, an organ, an organelle, a biological fluid, a blood sample, a serum sample, a urine sample, a skin sample, and the like. Preferred biological samples include but are not limited to a blood, a plasma, a serum, a PBMC, a tissue biopsy, an oral mucosa, a saliva, an interstitial fluid, or a urine sample, and the like. More preferably, the biological sample blood. Even more preferably, the biological sample is PBMC.
[0021] An aspect of the present disclosure relates to an in vitro or ex vivo use of miR- 342-3p miRNA as a biomarker of depression or major depressive disorder.
[0022] In an embodiment, the use further comprises the use of miR-155-5p and miR- 146a-5p as biomarkers of depression or major depressive disorder.
[0023] In an embodiment, a measured level of expression of miR-342-3p into an isolated biological sample is compared to a control reference value, and wherein an increase of said measured level relative to said control reference value is indicative of depression.
[0024] In an embodiment, the use comprises the measured levels of expression of a biomarker combination, wherein said biomarker combination miR-342-3p and miR- 146a-5p into the isolated biological sample are compared to a control reference value, and wherein an increase of miR-342-3p measured level and decrease of miR-146a-5p measured level relative to said control reference value is indicative of depression.
[0025] In an embodiment, the use comprises the measured levels of expression of a biomarker combination, wherein said biomarker combination miR-342-3p and miR-155- 5p into the isolated biological sample are compared to a control reference value, and wherein an increase of miR-342-3p measured level and decrease of miR-155-5p measured level relative to said control reference value is indicative of depression. [0026] In an embodiment, the use comprises the measured levels of expression of a biomarker combination, wherein said biomarker combination miR-342-3p, miR-146a-5p and miR-155-5p into the isolated biological sample are compared to a control reference value, and wherein an increase of miR-342-3p measured level and decrease of miR- 146a-5p and miR-155-5p measured levels relative to said control reference value is indicative of depression.
[0027] In an embodiment, the biological sample is blood.
[0028] In an embodiment, the biological sample is peripheral blood mononuclear cells.
[0029] Another aspect of the present disclosure relates to an in vitro or ex vivo method for diagnosis or prognosis of depression or major depressive disorder in a subject, comprising the following the steps: measuring a presence or an expression level of miR-342-3p miRNA, in a biological sample previously obtained from said subject; and comparing said presence or expression level to a control reference value, wherein an increased presence or level of expression of said miRNA relative to said control reference value is indicative of depression.
[0030] In an embodiment, the biological sample is blood.
[0031] In an embodiment, the biological sample is peripheral blood mononuclear cells.
[0032] Another aspect of the present disclosure relates to a biomarker for use in vitro or ex vivo diagnostic of depression or major depressive disorder, wherein said biomarker is miR-342-3p, preferably combined with miR-146a-5p and/or miR-155-5p.
[0033] In an embodiment, the biomarker is the combination of miR-342-3p and miR- 155-5p; or miR-342-3p and miR-146a-5p.
[0034] In an embodiment, the biomarker further comprises miR-342-3p, miR-155-5p and miR-146a-5p.
[0035] Another aspect of the present disclosure relates to a kit for use in vitro or ex vivo diagnostic of depression comprising the biomarker herein described. BRI EF DESCRI PTION OF THE DRAWI NGS
[0036] The following figures provide preferred embodiments for illustrating the disclosure and should not be seen as limiting the scope of invention.
[0037] Figure 1. miR-342-3p is overexpressed in the hippocampus of rats exhibiting depressive-like behaviors (H-CSR PPS rats). miR-342-3p expression levels were significantly impacted by stress exposure. Post hoc analysis revealed that miR-342-3p expression levels were significantly increased in high-CORT responsiveness (H-CSR) rats undergoing peripubertal stress (PPS) compared with the respective non-PPS control rats. miR-342-3p expression levels in the hippocampus were evaluated by RT-qPCR using U6 snRNA as an internal control. Relative expression levels were calculated using the quantification cycle (Cq) method, according to the MIQE guidelines, and results are presented as the mean ± SEM. N: N-CSR = 18 (9 CTR and 9 PPS); H-CSR = 24 (12 CTR and 12 PPS). Two-way ANOVA followed by Sidak's multiple comparisons test, *p < 0.05.
[0038] Figure 2A-2B. miR-342-3p hippocampal expression positively correlates with depressive-like behaviors. Correlations between hippocampal miR-342-3p expression and depressive-like behaviors revealed a significant positive correlation between miR- 342-3p levels and the percentage of time spent floating on the second day of the forced- swim test (FST) (Fig. 2B) and a tendency towards a negative correlation with saccharin preference (Fig. 2A). These results suggest that hippocampal miR-342-3p expression may be a factor in depression susceptibility. Pearson correlations were performed considering all animals (N=42). The coefficient r and p-value for each correlation are presented in a box. Statistically significant correlations are highlighted in green (p<0.05).
[0039] Figure 3. miR-342-3p tends to be upregulated in the PBMCs of rats exhibiting depressive-like behaviors. miR-342-3p expression levels in the PBMCs of rats undergoing PPS, particularly those exhibiting increased depressive-like behaviors (H-CSR PPS), suggesting that dysregulated levels may be also detected systemically. miR-342-3p expression levels were evaluated by RT-qPCR using U6 snRNA as an internal control. Relative expression levels were calculated using the quantification cycle (Cq) method, according to the MIQE guidelines, and results are presented as the mean ± SEM. N: N- CSR = 18 (9 CTR and 9 PPS); H-CSR = 24 (12 CTR and 12 PPS). [0040] Figure 4A-4D. Levels of miR-342-3p are upregulated, while miR-146a-5p and miR-155-5p are downregulated in the PBMCs of depression patients. The expression levels of the newly identified miRNA in the context of depression (miR-342-3p) and other additional miRNAs previously reported to be dysregulated in depression (miR-145-5p, miR-146a-5p and miR-155-5p) were evaluated in the PBMCs by RT-qPCR using U6 snRNA as internal control. Results revealed that miR-342-3p is significantly upregulated, while miR-146a-5p and miR-155-5p levels are significantly downregulated in the PBMCs of depression patients compared with healthy controls. Relative expression levels were calculated using the quantification cycle (Cq) method, according to MIQE guidelines, and results are presented as mean ± SEM. Each dot represents an individual (Control or Depression patient). Statistical differences between groups were evaluated using Mann- Whitney non-parametric unpaired test or unpaired T-test (** p<0.01, * p<0.05 and + p<0.1). N: Healthy controls = 40; Depression patients = 32.
[0041] Figure 5A-5D. ROC analysis of the differently expressed miRNAs. ROC analysis was performed to evaluate the sensitivity of miR-342-3p, miR-146a-5p and miR-155-5p to distinguish between depression patients and controls when used individually or in combination as a miRNA panel. When tested as a miRNA panel, sensitivity increased significantly and the use of the three miRNAs in combination was the best classifier (AUC=0.842, sensitivity of 80.6% and specificity of 72.5%). The area under the curve (AUC) represents the measure of the ability of each miRNA or the miRNA panel to distinguish between both groups, and the p-value tests the null hypothesis AUC equals 0.5. N: Healthy controls = 40; Depression patients = 32.
DETAILED DESCRI PTION
[0042] The present disclosure relates to an in vitro or ex vivo use of miR-342-3p miRNA as a biomarker of depression, alone or in combination with other miRNA's (miR-146a- 5p and/or miR-155-5p) in an isolated biological sample, preferably blood or peripheral blood mononuclear cells. Furthermore, the present disclosure relates to an in vitro or ex vivo method diagnosis or prognosis of depression in a subject.
[0043] The present invention comprises the study of how peripubertal stress (PPS) combined with differential corticosterone (CORT)-stress responsiveness (CSR) influences depressive-like behaviours in rats in adulthood, and how these alterations relate to the brain expression of microRNAs (miRNAs). These findings in an animal model, highlight miR-342-3p as a potential biomarker for diagnostics of depression in humans. The present invention further refers to a method developed in vitro, employing specific primer and probe compositions for diagnostic and monitoring of depression, the said method comprising the steps of extracting RNA from PBMCs and quantifying levels of miR-342-3p, alone or in combination with other miRNAs. The said compositions and methods of the present invention may be advantageously used to improve accuracy in diagnosis and monitoring of depression, which remains inaccurate as it is mostly narrative and observation based. The present disclosure relates to the use of biomarkers to detect depression, in particular miRNAs.
[0044] An aspect of the present disclosure refers to the use of miR-342-3p specific primer and probe RT-PCR compositions for diagnostic and monitoring of depression. The present invention further refers to a method developed in vitro, employing the said compositions, for diagnostic and monitoring of depression, the said method comprising the steps of extracting RNA from PBMCs and quantifying levels of miR-342-3p, alone or in combination with other miRNAs.
[0045] In an embodiment, an in vivo study is performed to explore how, two key risk factors for depression, i.e. peripubertal stress (PPS) combined with differential corticosterone (CORT)-stress responsiveness (CSR), influence protracted depressive-like behaviors and the expression of brain molecular markers in male rats. Briefly, selective breeding of rats according to their individual differences in CSR is performed as previously described by Walker et al. (11). This results in litters of Normative (N)-CSR and High (H)-CSR. At postnatal day 21 (P 21) rats from both groups are randomly assigned to control (CTR) and PPS conditions. Between P 28 and P 42, rats are maintained in control conditions (CTR group) or subjected to the PPS protocol (PPS group). PPS protocol is based on exposure to fear-induction procedures, according to Marquez et al. (12), and include the exposure to an open-field, a synthetic fox odor and an elevated platform. In adulthood (P 90), CTR and PPS rats undergo sequential behavioral tests to evaluate depressive-like behaviors (saccharin preference and forced- swim test). In total, 42 animals are used, namely 18 N-CSR (9 CTR and 9 PPS) and 24 H- CSR (12 CTR and 12 PPS). Rats are sacrificed by decapitation and brains freshly dissected for isolation of the medial prefrontal cortex (mPFC), nucleus accumbens (NAc), amygdala (Amg) and hippocampus (HPC). Each brain region is placed in an RNAse-free cryotube, fresh frozen in liquid nitrogen, and stored at -80°C prior to RNA extraction. Trunk blood is also collected and immediately processed for PBMCs isolation. Total RNA from brain regions and PBMCs is extracted using TRIzol reagent (Invitrogen). miR-342- 3p expression is evaluated using a TaqMan microRNA assay (Applied Biosystems). Briefly, cDNA is synthesized using 30 ng of RNA as a template, gene-specific stem-loop Reverse Transcription primer, and the TaqMan microRNA reverse transcription kit (Applied Biosystems). Oligonucleotide primers and Taqman probes are used to amplify and detect the synthetic DNA fragment obtained from cDNA synthesis. Compositions comprising the above-mentioned assay are prepared by adding reactant solutions to the RT-PCR, available from the market, in specific concentrations and qPCR is carried out in Real-Time PCR Detection System (Bio-Rad) using cDNA and SsoAdvancedTM Universal Probes Supermix (Bio-Rad). Small nuclear RNA U6 is used as reference gene. Relative expression levels is calculated using the quantification cycle (Cq) method. Statistical analysis is performed using GraphPad Prism version 7. When analyzing the difference between the means of more than two groups, 2-way ANOVA is performed to estimate how the mean of the quantitative variables changed according to the levels of the independent variables (CSR and stress exposure). To test which levels were actually different between the CTR and PPS groups, Sidak's post hoc multiple comparisons test is performed. Pearson correlation analysis is performed to compare behavioural performance with brain miR-342-3p expression levels, and accounts all animals (N=42). p<0.05 is considered statistically significant.
[0046] In an embodiment, patients ranging in age from 18-65 years are studied after screening and diagnosis of major depressive disorder by psychiatrists. Briefly, clinical depression diagnostics may further include a structured clinical interview to assess the presence of major psychiatric syndromes according to the Diagnostic and Statistical Manual of Mental Disorders, Fifth Edition (DSM-5), an assessment of current psychiatric symptoms, and a determination of previous antidepressant treatment. [0047] In an embodiment, blood samples are obtained from depression patients at baseline, as well as before undergoing treatment. Patients may be excluded from the analysis if presenting any of the following: i) psychotic symptoms; ii) presence of an infectious or inflammatory illness or the regular use of anti-inflammatory medication; iii) Inability to completely understand and fill in the self-assessment instruments; iv) Being part of a trial or with other psychological/psychopharmacological treatment.
[0048] In an embodiment, peripheral blood is collected using VACUETTE® Tubes EDTA K3 (Greiner Bio-One, France). Blood components are separated by centrifuging at 1200g, for 20 min, at room temperature (RT), without break. Plasma is collected and centrifuged twice at 2500g, for 10 min at 4 °C before being aliquoted and stored at -80 °C. Medial layer containing PBMCs are slowly collected and transferred into a new 15mL centrifuge tube. PBMCs are diluted in an equal volume of PBS lx, slowly layered over Lymphoprep (Ratio 1:1) and centrifuged at 800g, for 20min, at RT, without break. Medial layer containing enriched PBMCs is collected, and cells washed twice with PBS lx (300g, lOmin, at 4°C) before being lysed with TRIzol®.
[0049] For the scope and interpretation of the present disclosure it is defined that "room temperature" should be regarded as a temperature between 15-30 °C, preferably between 18-25 °C, more preferably between 20-22 °C.
[0050] In an embodiment, total RNA is extracted using TRIzol® reagent (Invitrogen) according to the manufacturer's instructions. RNA concentration and purity is evaluated in a NanoDrop 1000 (Thermo Scientific). RNA integrity is evaluated by agarose gel electrophoresis or by Experion™ automated electrophoresis system (Bio-Rad, USA).
[0051] In an embodiment, miR-342-3p and miR-145-5p, miR-146a-5p, miR-155-5p expression was evaluated using TaqMan miRNA assays (Applied Biosystems). Briefly, cDNA is synthesized using 30 ng of RNA as a template, gene-specific stem-loop Reverse Transcription primer, and the TaqMan microRNA reverse transcription kit (Applied Biosystems). Oligonucleotide primers and Taqman probes are used to amplify and detect the synthetic DNA fragment obtained from cDNA synthesis. Table 1: Oligonucleotides sequences and ID's of the Taqman® assays used for RT-qPCR for miR-145-5p, miR-146a-5p, miR-155-5p, miR-342-3p and U6 SnRNA. miRBase Taqman® miRNA name Accession Mature sequence miRNA assay ID
Number hsa-miR-145-5p MIMAT0000437 GUCCAGUUUUCCCAGGAAUCCCU 002278 hsa-miR-146a-5p MIMAT0000449 UGAGAACUGAAUUCCAUGGGUU 000468 hsa-miR-155-5p MIMAT0000646 UUAAUGCUAAUCGUGAUAGGGGUU 002623 hsa-miR-342-3p MIMAT0000753 UCUCACACAGAAAUCGCACCCGU 002260
Taqman® Negative control NCBI Accession Control sequence miRNA control name Number assay ID
GTG CTCG CTTCG G CAG CACATATACTAAAAT
TGGAACGATACAGAGAAGATTAGCATGGCC U6 SnRNA NR 004394 001973
CCTGCGCAAGGATGACACGCAAATTCGTGA
AGCGTTCCATATTTT
[0052] The above-mentioned assays can be obtained in the market, for example from ThermoFisher.
[0053] Compositions comprising the above-mentioned assays are prepared by adding reactant solutions to the RT-PCR, available from the market, in specific concentrations and qPCR is carried out in Real-Time PCR Detection System (Bio-Rad) using cDNA and SsoAdvancedTM Universal Probes Supermix (Bio-Rad). Small nuclear RNA U6 is used as reference gene. Relative expression levels were calculated using the quantification cycle (Cq) method.
[0054] The diagnostic value of the tested miRNAs (individually or combined) was calculated using Receiver Operating Characteristics (ROC) curve in GraphPad.
[0055] For that, miRNAs relative expression values were previously combined using the binary logistic toll on SPSS considering the experimental group as the dependent variable and the different tested miRNAs as covariates. The area under the curve (AUC) measures of the ability of each miRNA or the miRNA panel to distinguish between both groups, and the p-value tests the null hypothesis that the AUC equals 0.5. [0056] In an embodiment, ROC analysis is performed to evaluate the ability of the differently expressed miRNAs to distinguish between depression patients and healthy controls, individually or in combination. The area under the curve (AUC) for miR-342, miR-146a and miR-155 when tested individually is 0.667 (CI=0.53-0.80, p=0.0164), 0.736 (0=0.62-0.85, p=0.0007) and 0.691 (CI=0.57-0.81, p=0.006) respectively. When tested as a miRNA panel, sensitivity increases significantly and the use of the three miRNAs in combination is the best classifier (AUC=0.842, 0=0.75-0.93, p<0.0001; Figure 4 and Table 2).
Table 2. ROC analysis of the differently expressed miRNAs, individually or combined. AUC - area under the curve; Cl - confidence interval. miR-146a 0.7363 0.06018 0.62-0.85 0.0007 miR-155 0.6911 0.06257 0.57-0.81 0.006
A miR-342 + miR-146a 0.8065 0.05234 0.70-090 <0.0001
B miR-342 + miR-155 0.7629 0.05876 0.65-0.88 0.0002
C miR-146a + iR-155 0.7411 0.05797 0.63-0.85 0.0005
D miR-342 + miR-146a + miR-155 0.8419 0.04679 0.75-0.93 <0.0001
[0057] The term "comprising" whenever used in this document is intended to indicate the presence of stated features, integers, steps, components, but not to preclude the presence or addition of one or more other features, integers, steps, components or groups thereof.
[0058] The disclosure should not be seen in any way restricted to the embodiments described and a person with ordinary skill in the art will foresee many possibilities to modifications thereof. The above-described embodiments are combinable.
[0059] The following claims further set out particular embodiments of the disclosure.
References:
1. VosT, Lim SS, Abbafati C, Abbas KM, Abbasi M, Abbasifard M, et al. Global burden of 369 diseases and injuries in 204 countries and territories, 1990-2019: a systematic analysis for the Global Burden of Disease Study 2019. The Lancet. 2020;396(10258):1204-22. 2. Cipriani A, Furukawa TA, Salanti G, Chaimani A, Atkinson LZ, Ogawa Y, et al. Comparative efficacy and acceptability of 21 antidepressant drugs for the acute treatment of adults with major depressive disorder: a systematic review and network meta-analysis. The Lancet. 2018;391(10128):1357-66.
3. Blackburn TP. Depressive disorders: Treatment failures and poor prognosis over the last 50 years. Pharmacology research & perspectives. 2019;7(3):e00472.
4. Rush AJ, Trivedi MH, Wisniewski SR, Nierenberg AA, Stewart JW, Warden D, et al. Acute and longer-term outcomes in depressed outpatients requiring one or several treatment steps: a STAR*D report. The American journal of psychiatry. 2006;163(ll):1905-17.
5. Fried El, Nesse RM. Depression sum-scores don't add up: why analyzing specific depression symptoms is essential. BMC medicine. 2015; 13(1) :72.
6. Brites D, Fernandes A. Neuroinflammation and Depression: Microglia Activation, Extracellular Microvesicles and microRNA Dysregulation. Front Cell Neurosci. 2015;9:476.
7. Geaghan M, Cairns MJ. MicroRNA and Posttranscriptional Dysregulation in Psychiatry. Biological psychiatry. 2015;78(4):231-9.
8. Contreras J, Rao DS. MicroRNAs in inflammation and immune responses. Leukemia. 2012;26(3):404-13.
9. Almeida Ml, Reis RM, Calin GA. MicroRNA history: discovery, recent applications, and next frontiers. Mutation research. 2011;717(l-2):l-8.
10. Liew C-C, Ma J, Tang H-C, Zheng R, Dempsey AA. The peripheral blood transcriptome dynamically reflects system wide biology: a potential diagnostic tool. Journal of Laboratory and Clinical Medicine. 2006;147(3):126-32.

Claims

C L A I M S An in vitro or ex vivo use of miR-342-3p miRNA as a biomarker of depression or major depressive disorder. The use according to any of the previous claims further comprising the use of miR- 155-5p as biomarkers of depression or major depressive disorder. The use according to the previous claim 1 further comprising the use of miR-155-5p and miR-146a-5p as biomarkers of depression or major depressive disorder. The use according to any of the previous claims wherein a measured level of expression of miR-342-3p into an isolated biological sample is compared to a control reference value, and wherein an increase of said measured level relative to said control reference value is indicative of depression. The use according to any of the previous claims comprising the measured levels of expression of a biomarker combination, wherein said biomarker combination miR- 342-3p and miR-146a-5p into the isolated biological sample are compared to a control reference value, and wherein an increase of miR-342-3p measured level and decrease of miR-146a-5p measured level relative to said control reference value is indicative of depression. The use according to any of the previous claims comprising the measured levels of expression of a biomarker combination, wherein said biomarker combination miR- 342-3p and miR-155-5p into the isolated biological sample are compared to a control reference value, and wherein an increase of miR-342-3p measured level and decrease of miR-155-5p measured level relative to said control reference value is indicative of depression. The use according to any of the previous claims comprising the measured levels of expression of a biomarker combination, wherein said biomarker combination miR- 342-3p, miR-146a-5p and miR-155-5p into the isolated biological sample are compared to a control reference value, and wherein an increase of miR-342-3p measured level and decrease of miR-146a-5p and miR-155-5p measured levels relative to said control reference value is indicative of depression. The use according to any of the previous claims wherein the biological sample is blood. The use according to the previous claim wherein the biological sample is peripheral blood mononuclear cells. An in vitro or ex vivo method for diagnosis or prognosis of depression or major depressive disorder in a subject, comprising the following the steps: measuring a presence oran expression level of miR-342-3p miRNA, in a biological sample previously obtained from said subject; and comparing said presence or expression level to a control reference value, wherein an increased presence or level of expression of said miRNA relative to said control reference value is indicative of depression. The method according to the previous claim further comprising the following steps: measuring a presence or an expression level of miR-146a-5p and/or miR-155-5p in a biological sample previously obtained from said subject; and comparing said presence or expression level to a control reference value, wherein a decreased presence or level of expression of said miRNA relative to said control reference value is indicative of depression. The method according to any of previous claims 10 - 11 wherein the biological sample is blood. The method according to any of previous claims 10 - 12 wherein the biological sample is peripheral blood mononuclear cells. A biomarker for use in vitro or ex vivo diagnostic of depression or major depressive disorder, wherein said biomarker is miR-342-3p, preferably combined with miR- 146a-5p and/or miR-155-5p. The biomarker for use according to the previous claim 14, wherein said biomarker is the combination of miR-342-3p and miR-155-5p; or miR-342-3p and miR-146a-5p. The biomarker for use according to the previous claim 14 further comprising miR- 342-3p, miR-155-5p and miR-146a-5p. A kit for use in vitro or ex vivo diagnostic of depression comprising the biomarker described in any of the claims 14-16.
16
EP22826405.7A 2021-11-12 2022-11-14 Depression biomarkers, uses and method thereof Pending EP4430210A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
PT11757021 2021-11-12
PCT/IB2022/060927 WO2023084478A1 (en) 2021-11-12 2022-11-14 Depression biomarkers, uses and method thereof

Publications (1)

Publication Number Publication Date
EP4430210A1 true EP4430210A1 (en) 2024-09-18

Family

ID=84537565

Family Applications (1)

Application Number Title Priority Date Filing Date
EP22826405.7A Pending EP4430210A1 (en) 2021-11-12 2022-11-14 Depression biomarkers, uses and method thereof

Country Status (2)

Country Link
EP (1) EP4430210A1 (en)
WO (1) WO2023084478A1 (en)

Also Published As

Publication number Publication date
WO2023084478A1 (en) 2023-05-19

Similar Documents

Publication Publication Date Title
Cao et al. MicroRNA biomarkers of Parkinson’s disease in serum exosome-like microvesicles
Gui et al. Altered microRNA profiles in cerebrospinal fluid exosome in Parkinson disease and Alzheimer disease
Yu et al. Alterations of miR-132 are novel diagnostic biomarkers in peripheral blood of schizophrenia patients
EP4257705B1 (en) Biomarkers of traumatic brain injury
KR102626614B1 (en) Diagnostic markers for MCI due to AD and their applications
Belzeaux et al. Potential use of MicroRNA for monitoring therapeutic response to antidepressants
JP2014520529A (en) MicroRNA biomarkers indicating Alzheimer&#39;s disease
EP3134552A2 (en) Methods, processes, devices and kits for the measurement of post traumatic stress disorder microrna markers
EP2326729A1 (en) Stimulus-elicited genomic profile markers of alzheimer&#39;s disease
EP3985130A1 (en) Circulating serum microrna biomarkers and methods for determining parkinson&#39;s disease
Yashooa et al. The miR-146a-5p and miR-125b-5p levels as biomarkers for early prediction of Alzheimer's disease
JP2021180654A (en) Method for detecting parkinson disease
Piscopo et al. Identification of miRNAs regulating MAPT expression and their analysis in plasma of patients with dementia
CN108841949B (en) Parkinson&#39;s disease early detection and diagnosis kits and devices
CN107937516A (en) A kind of circular rna marker and its application
CN110184338B (en) Application of cerebrospinal fluid exosome miRNA in MMD diagnosis and treatment
EP4077730B1 (en) Methods and kits for classification of psychotic disorder subjects and compounds for use in therapy of such disorders
WO2020127499A2 (en) Mirnas as biomarkers for parkinson&#39;s syndrome
WO2023084478A1 (en) Depression biomarkers, uses and method thereof
US20200199680A1 (en) MIRNA in Gulf War Illness
Yan et al. Expression Levels of miR-146b and Anti-Cardiac Troponin I in Serum of Children with Viral Myocarditis and Their Clinical Sig-nificance
IT201800004359A1 (en) IDENTIFICATION OF MUSCLE miRNAs AS BIOMARCATORS AND CO-ADJUVANT TREATMENT FOR SPINAL MUSCULAR ATROPHY
Rajkumar et al. Transcriptomic analysis of plasma small extracellular vesicles identifies potential diagnostic biomarkers for Parkinson’s disease dementia
KR20180078783A (en) A novel miRNA for diagnosing Alzheimer’s disease
CN115141883A (en) tsRNA biomarker for depression diagnosis, kit and application thereof

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: UNKNOWN

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20240612

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR

DAV Request for validation of the european patent (deleted)
DAX Request for extension of the european patent (deleted)