EP4429462A2 - Pteridic acids and uses thereof - Google Patents
Pteridic acids and uses thereofInfo
- Publication number
- EP4429462A2 EP4429462A2 EP22818223.4A EP22818223A EP4429462A2 EP 4429462 A2 EP4429462 A2 EP 4429462A2 EP 22818223 A EP22818223 A EP 22818223A EP 4429462 A2 EP4429462 A2 EP 4429462A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- compound
- pteridic
- acid
- cell
- plant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D493/00—Heterocyclic compounds containing oxygen atoms as the only ring hetero atoms in the condensed system
- C07D493/02—Heterocyclic compounds containing oxygen atoms as the only ring hetero atoms in the condensed system in which the condensed system contains two hetero rings
- C07D493/10—Spiro-condensed systems
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H3/00—Processes for modifying phenotypes, e.g. symbiosis with bacteria
- A01H3/04—Processes for modifying phenotypes, e.g. symbiosis with bacteria by treatment with chemicals
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N43/00—Biocides, pest repellants or attractants, or plant growth regulators containing heterocyclic compounds
- A01N43/90—Biocides, pest repellants or attractants, or plant growth regulators containing heterocyclic compounds having two or more relevant hetero rings, condensed among themselves or with a common carbocyclic ring system
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01P—BIOCIDAL, PEST REPELLANT, PEST ATTRACTANT OR PLANT GROWTH REGULATORY ACTIVITY OF CHEMICAL COMPOUNDS OR PREPARATIONS
- A01P21/00—Plant growth regulators
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/52—Genes encoding for enzymes or proenzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
- C12R2001/465—Streptomyces
Definitions
- the present disclosure relates, generally, to pteridic acids and derivatives thereof, their production, and their use to promote plant growth or to reduce plant stress, such as abiotic stress.
- Plant functioning under stress is affected by plant hormones, which can help the plant tolerate environmental stresses.
- Plant hormones include auxin, abscisic acid, ethylene, gibberellins, cytokines, salicylic acid, strigolactones, brassinosteroids, and nitrous oxide.
- abscisic acid is well-known to enhance plant fitness and cope with abiotic stresses.
- Supplementing plant hormones to crops represents an attractive strategy to promote resistance to environmental stresses in a natural way.
- ABA abscisic acid
- the present disclosure identifies a series of compounds that can be used as ABA alternatives to promote plant growth and/or reduce plant stress, as well as methods of producing and using these compounds.
- a compound of formula (IX) is provided, or a salt or solvate thereof; wherein,
- Ri and R2 are independently selected from the group consisting of: -H, alkyl and halogen;
- Rs is selected from -H and [-OH, OCH3, or O];
- R4 is selected from -H, methyl or ethyl
- X is selected from O and N; n is selected from 1 and 2, preferably the compound is of formula (X):
- Ri and R2 are independently selected from the group consisting of: -H, alkyl and halogen;
- Rs is selected from -OH, OCH3, or O;
- X is selected from O and N; n is selected from 1 and 2, preferably the compound is of formula (II):
- an isolated nucleic acid comprising or consisting of a nucleic acid selected from the group consisting of: i) ptaA as set forth in SEQ ID NO: 1; ii) ptaB as set forth in SEQ ID NO: 3; iii) ptaC as set forth in SEQ ID NO: 5; iv) ptaD as set forth in SEQ ID NO: 7; v) ptaE as set forth in SEQ ID NO: 9, and respective variants thereof having at least 70% similarity or identity thereto, such as at least 80%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% similarity
- a vector or a system of vectors comprising an isolated nucleic acid selected from the group consisting of: i) ptaA as set forth in SEQ ID NO: 1; ii) ptaB as set forth in SEQ ID NO: 3; iii) ptaC as set forth in SEQ ID NO: 5; iv) ptaD as set forth in SEQ ID NO: 7; v) ptaE as set forth in SEQ ID NO: 9, and respective variants thereof having at least 70% similarity or identity thereto, such as at least 80%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% similarity or identity thereto.
- a compound as defined herein obtainable by a method comprising growing a cell as defined herein, in a cultivation broth, under conditions allowing the production of the compound.
- a method of producing the compound as herein defined comprising growing a cell as defined herein, in a cultivation broth, under conditions allowing the production of the compound.
- a method of promoting the growth of a plant, promoting seed germination, and/or reducing the stress on a plant comprising contacting the plant with the compound defined herein.
- a method of promoting the growth of a plant, and/or reducing the stress on a plant comprising contacting the plant with the compound defined herein.
- a method of promoting the growth of a plant, and/or promoting seed germination comprising contacting the plant with the compound defined herein.
- a method of promoting seed germination, and/or reducing the stress on a plant comprising contacting the plant with the compound defined herein.
- Figure 1 shows the structure of the pteridic acids that have been isolated from microorganisms.
- Pteridic acid A (1), pteridic acid B (2), pteridic acid C (3), pteridic acid D (4), pteridic acid E (5), pteridic acid F (6), pteridic acid G (7), pteridic acid H (8), pteridic acid I (9).
- Figure 2 shows the result of an Extracted Ion Chromatogram (ESI positive mode m/z 383.2428, 10 ppm) reporting the production of pteridic acids F and H by both S. rapamycinicus and S. iranensis.
- Figure 3 shows selected HMBC correlations for compounds pteridic acid F (6), pteridic acid H (8), pteridic acid I (9).
- Figure 4 shows an ORTEP diagram displaying the atom-numbering scheme and solid- state conformation of pteridic acid H (8).
- Figure 5 illustrates that the storage of pteridic acid H in solution (roughly 1 : 1 month; 2: 3 months; 3: 6 months) led to transformation to pteridic acid F and other related metabolites.
- Figure 6 shows the open reading frame (ORF) map of the pteridic acids (elaiophylin) biosynthetic locus from S. iranensis HM35.
- Figure 7 shows the LCMS profile reporting the abolishment of pteridic acids production following a mutation of ptaA.
- Extracted Ion Chromatography in positive mode of pteridic acid F [M+H] + , m/z 383.2428).
- Figure 8 shows a proposed biosynthetic pathway for pteridic acids F (6), H (8) and I (9).
- Figure 9 shows enhancement of hypocotyl growth of mung beans with pteridic acid H treatment. Left: pteridic acid H 1.0 ng/mL, right: water control. Hypocotyl length increased by 21%. No promotion of adventitious root growth was observed.
- Figure 10 illustrates that pteridic acid H or ABA help the growth of mung beans under a heavy metal condition (10 mM CuSC ).
- Figure 11 illustrates that pteridic acid H and ABA at 10 nM help barley against drought stress (mediated by 20% PEG-6000).
- Figure 12 illustrates that pteridic acid microbial producers S. rapamycinicus and S. violaceusniger help barley against drought stress (mediated by 20% PEG-6000).
- Figure 13 illustrates the effect of different concentrations of pteridic acid H (PAH, 0.25, 0.5, 1.0 ng/mL) on germination rate of wheat seeds.
- PAH pteridic acid H
- CK blank control. Values are mean ⁇ SD of three independent experiments, * P ⁇ 0.05, ** P ⁇ 0.01 , *** P ⁇ 0.001.
- Figure 14 illustrates the promoting effect of pteridic acids on kidney beans.
- 14B corresponding statistical analyses on shoot lengths of kidney beans seedlings with the same treatment as in Figure 2a. Values are mean ⁇ SD, ** P ⁇ 0.01.
- Figure 17 shows mung beans cultivated in glass tubes with MS (diluted 1:2) agar and more lateral roots showed when treated with PAH, compared to blank control.
- PAF pteridic acid F
- Figure 19 illustrates the effect of pteridic acids H and F on barley seedlings.
- Figure 20 illustrates the effect of different concentrations of pteridic acid H (PAH, 0.25, 0.5, 1.0, 5.0, 10.0 ng/mL) and distilled water (CK, blank control) on seedling growth of wheat.
- PAH pteridic acid H
- CK blank control
- Figure 21 illustrates the effect of different concentrations of pteridic acid H (PAH, 0.25, 0.5, 1.0, 5.0, 10.0 ng/mL) on seedling growth of Arabidopsis under excessive salinity stress.
- PAH pteridic acid H
- CK blank control treated by sterile Milli-Q water
- NaCI the excessive salinity stress conducted by 80 mM NaCI.
- Figure 22 shows pictures of Arabidopsis seedlings treated with different concentrations of pteridic acid H (PAH, 0.25, 0.5, 1.0, 5.0, 10.0 ng/mL) under excessive salt stress.
- PAH pteridic acid H
- CK blank control treated by sterile Milli-Q water
- Figure 23 illustrates the effect of different concentrations of pteridic acid H (PAH, 0.25, 0.5, 1.0 ng/mL) on seedling growth of Arabidopsis under drought stress.
- PAH pteridic acid H
- CK blank control treated by sterile Milli-Q water
- PEG 10% and PEG 20% drought stress induced by 10 % (v/v) PEG and 20% (v/v) PEG separately.
- Figure 24 illustrates the effect of pteridic acid H on Arabidopsis under drought stress
- 24A Effects of different concentrations of pteridic acid H (PAH, 0.25, 0.5, 1.0 ng/mL) on seedling growth.
- CK blank control treated by sterile Milli-Q water;
- PEG 10% and PEG 20% drought stress induced by 10 % (v/v) PEG and 20% (v/v) PEG, respectively.
- Figure 25 shows the time course analysis of the transformation of pteridic acid H to pteridic acid F in pH 3 water solution, at 4 °C, 0 d, 1 d, 3 d and 11 d. * Internal standard/impurity.
- Figure 26 shows the time course analysis of the transformation of pteridic acid H to pteridic acid F in pH 3 water solution, at 25 °C, 1 d, 3 d 5 d and 7 d. * Internal standard/impurity.
- Figure 27 shows the time course analysis of the transformation of pteridic acid H to pteridic acid F in pH 7 water solution, at 4 °C, 0 d, 1 d, 3 d and 11 d. * Internal standard/impurity.
- Figure 28 shows the time course analysis of the transformation of pteridic acid H to pteridic acid F in pH 7 water solution, at 25 °C, 1 d, 3 d 5 d and 7 d. * Internal standard/impurity.
- Figure 29 shows the effect of S. iranensis HM 35 on barley seedlings under the abiotic stress.
- the drought stress and salinity stress were mediated by 20% (w/v) PEG-6000 and 100 mM NaCI, respectively.
- Mock control, Si, treatment of S. iranensis HM 35 culture broth; M, treatment of blank medium (ISP2).
- Asterisks indicate the level of statistical significance: *P ⁇ 0.05, **P ⁇ 0.01, ***P ⁇ 0.001 and ****P ⁇ 0.0001.
- Asterisks indicate the level of statistical significance: *P ⁇ 0.05, **P ⁇ 0.01, ***P ⁇ 0.001 and ****P ⁇ 0.0001.
- thaliana seedlings growing in different conditions h
- h the phenotype differences of lateral root growth of A. thaliana seedlings growing in different conditions.
- Asterisks indicate the level of statistical significance: *P ⁇ 0.05, **P ⁇ 0.01, ***P ⁇ 0.001 and ****P ⁇ 0.0001.
- Figure 33 illustrates the effect of pteridic acid producers on barley, a, S. violaceusniger Tu 4113 and S. rapamycinicus NRRL 5491 showed abiotic stress (20% PEG and 100 mM NaCI) mitigating effects on barley seedlings, b, Different growth of barley seedlings in water, drought stress mediated by 20% (w/v) PEG-6000 and salinity stress mediated by 100 mM NaCI.
- Mock control
- Sv treatment of S. violaceusniger Tu 4113
- Sr treatment of S. rapamycinicus NRRL 5491.
- alkyl refers to a straight or branched hydrocarbon chain radical consisting of carbon and hydrogen atoms, containing no unsaturation, and may be straight or branched, substituted or unsubstituted.
- the alkyl group may consist of 1 to 12 carbon atoms, e.g., 1 carbon atom, 2 carbon atoms, 3 carbon atoms, 4 carbon atoms etc., up to and including 12 carbon atoms.
- Exemplary alkyl groups include, but are in no way limited to, methyl, ethyl, propyl, isopropyl, n- butyl, iso-butyl, sec-butyl isobutyl, tertiary butyl, pentyl, isopentyl, neopentyl, hexyl, septyl, octyl, nonyl and decyl.
- the alkyl moiety may be attached to the rest of the molecule by a single bond, such as for example, methyl (Me), ethyl (Et), n-propyl (Pr), 1-methylethyl (iso-propyl), n-butyl, n-pentyl, 1,1 -dimethylethyl (t-butyl) and 3- methylhexyl.
- an alkyl group is optionally substituted by one or more of any suitable substituents.
- An alkyl group can be mono-, di-, tri- or tetra-valent, as appropriate to satisfy valence requirements.
- the io term alkylene by itself or as part of another substituent means a divalent radical derived from an alkyl moiety, as exemplified, but not limited, by -CH2CH2CH2CH2-.
- suitable substituents for substituted groups disclosed herein independently include, but are not limited to, alkyl, heteroalkyl, alkenyl, alkynyl, cycloalkyl, heterocycloalkyl, aryl, arylalkyl, heteroaryl, heteroarylalkyl, hydroxy, halo, cyano, trifluoromethyl, trifluoromethoxy, nitro, trimethylsilanyl, chloride, bromide, — OR a , — SR a , — OC(O)— R a , — N(R a ) 2 , — C(O)R a , — C(O)OR a , -OC(O)N(R a ) 2 , -C(O)N(R a ) 2 , — N(R a )C(O)OR a , — N(R a )C(O)OR a , — N(R a
- R a is independently hydrogen, alkyl, haloalkyl, carbocyclyl, carbocyclylalkyl, aryl, aralkyl, heterocycloalkyl, heterocycloalkylalkyl, heteroaryl or heteroarylalkyl.
- nucleic acid refers to polynucleotides such as deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) or a combination of the two and any chemical or enzymatic modification thereof (e.g., methylated DNA, DNA of modified nucleotides).
- DNA deoxyribonucleic acid
- RNA ribonucleic acid
- the term should also be understood to include, as equivalents, derivatives, variants and analogues of either RNA or DNA made from nucleotide analogues, single (sense or antisense) and double-stranded polynucleotides.
- isolated nucleic acid refers to a nucleic acid that is separated from its native environment and present in sufficient quantity to permit its identification or use.
- An isolated nucleic acid may be one that is (i) amplified in vitro by, for example, polymerase chain reaction (PCR); (ii) recombinantly produced or cloned; (iii) purified, as by cleavage and gel separation; or (iv) synthesized by, for example, chemical synthesis.
- PCR polymerase chain reaction
- recombinantly produced or cloned purified, as by cleavage and gel separation
- synthesized by, for example, chemical synthesis synthesized by, for example, chemical synthesis.
- An isolated nucleic acid is one which is readily manipulable by recombinant DNA techniques well known in the art.
- nucleotide sequence contained in a vector in which 5' and 3' restriction sites are known or for which polymerase chain reaction (PCR) primer sequences have been disclosed is considered isolated but a nucleic acid sequence existing in its native state in its natural host is not.
- An isolated nucleic acid may be substantially purified, but need not be.
- a nucleic acid that is isolated within a cloning or expression vector is not pure in that it may comprise a small percentage of the material of the cell in which it resides.
- Such a nucleic acid is isolated, however, as the term is used herein because it is readily manipulable by standard techniques known to those of ordinary skill in the art. Any of the nucleic acids provided herein may be isolated.
- gene means a nucleic acid sequence that contains information necessary for expression of a polypeptide or protein. It includes the promoter and terminator and the structural gene as well as other sequences involved in expression of the protein.
- protein or “polypeptide” as defined herein are used interchangeably and refer to molecules consisting of a chain of amino acids, without reference to a specific mode of action, size, 3-dimensional structure or origin. A fragment or portion of a protein may thus still be referred to as a "protein".
- An "isolated protein” is used to refer to a protein which is no longer in its natural environment, for example in vitro.
- a “heterologous protein” refers to a protein which is not naturally present in the cell in which it is expressed, for example it is expressed in a recombinant bacterial or plant host cell.
- An enzyme is a protein having enzymatic activity.
- vector means a DNA molecule capable of replication in a host cell and/or to which another DNA segment can be operatively linked so as to bring about replication of the attached segment.
- a plasmid is an exemplary vector.
- a system of vectors comprising several nucleic acids comprises a plurality of vectors, which together comprise a plurality of nucleic acids.
- the nucleic acids are not necessarily all on the same vector; a vector of the system of vectors may comprise several nucleic acids.
- a system of vectors comprising five nucleic acids can be: a first vector comprising a first and a second nucleic acids, and a second vector comprising a third, a fourth and a fifth nucleic acids; or five vectors each comprising one of the first, second, third, fourth and fifth nucleic acids.
- host cell refers to a cell which includes an exogenous polynucleotide, wherein the methods used to insert the exogenous polynucleotide into a cell include direct uptake, transduction, f-mating, or other methods known in the art to create recombinant host cells.
- exogenous polynucleotide may be a non-integrated vector, including but not limited to a plasmid, or may be integrated into the host genome.
- microorganism as defined herein is meant to include a bacterium, yeast and/or fungi, a cell growth medium comprising the microorganism, e.g., a cell growth medium in which the microorganism was cultivated.
- non-natural microorganism refers to a microorganism that has been manipulated to include an exogenous polynucleotide.
- exogenous polynucleotide may be a non-integrated vector, including but not limited to a plasmid, or may be integrated into the host genome.
- a non-natural microorganism may thus express a heterologous protein, i.e., a protein which is not naturally found in the microorganism.
- stress condition refers to the exposure of a plant, plant cell, or the like, to a physical, environmental, biological or chemical agent or condition that has an adverse effect on metabolism, growth, development, propagation and/or survival of the plant (collectively “growth”).
- a stress can be imposed on a plant due, for example, to an environmental factor such as water (e.g., flooding, drought, dehydration), anaerobic conditions (e.g., a low level of oxygen), abnormal osmotic conditions, salinity or temperature (e.g., hot/heat, cold, freezing, frost), a deficiency of nutrients such as nitrogen, phosphate, potassium, sulfur, micronutrient, or exposure to pollutants (e.g., heavy metals), or by a hormone, second messenger or other molecule.
- Anaerobic stress for example, is due to a reduction in oxygen levels (hypoxia or anoxia) sufficient to produce a stress response.
- a flooding stress can be due to prolonged or transient immersion of a plant, plant part, tissue or isolated cell in a liquid medium such as occurs during monsoon, wet season, flash flooding or excessive irrigation of plants, or the like.
- a cold stress or heat stress can occur due to a decrease or increase, respectively, in the temperature from the optimum range of growth temperatures for a particular plant species. Such optimum growth temperature ranges are readily determined or known to those skilled in the art.
- Dehydration stress can be induced by the loss of water, reduced turgor, or reduced water content of a cell, tissue, organ or whole plant.
- Drought stress can be induced by or associated with the deprivation of water or reduced supply of water to a cell, tissue, organ or organism.
- Saline stress can be associated with or induced by a perturbation in the osmotic potential of the intracellular or extracellular environment of a cell.
- Osmotic stress also can be associated with or induced by a change, for example, in the concentration of molecules in the intracellular or extracellular environment of a plant cell, particularly where the molecules cannot be partitioned across the plant cell membrane.
- abiotic stress refers to the exposure of a plant, plant cell, or the like, to a non-living (“abiotic”) physical or chemical agent that has an adverse effect on metabolism, growth, development, propagation, or survival of the plant (collectively, “growth”).
- a stress can be imposed on a plant due, for example, to an environmental factor such as water (e.g., flooding, drought, or dehydration), anaerobic conditions (e.g., a lower level of oxygen or high level of CO2), abnormal osmotic conditions, salinity, or temperature (e.g., hot/heat, cold, freezing, or frost), a deficiency of nutrients or exposure to pollutants (e.g., heavy metals), or by a hormone, second messenger, or other molecule.
- an environmental factor such as water (e.g., flooding, drought, or dehydration), anaerobic conditions (e.g., a lower level of oxygen or high level of CO2), abnormal osmotic conditions, salinity, or temperature (e.g., hot/heat, cold, freezing, or frost), a deficiency of nutrients or exposure to pollutants (e.g., heavy metals), or by a hormone, second messenger, or other molecule.
- Drought conditions are used interchangeably and refer to a condition where plant growth or productivity is inhibited relative to a plant where water is not limiting.
- water-stress is used synonymously and interchangeably with the drought water stress. Drought conditions may be defined by a drought Palmer drought index less than -2, such as less than -3, less than -4, less than -5, less than -6, less than -7, less than -8, less than -9, or -10.
- high salinity refers to an environment around the plant, which leads to a setback of water absorption of the plant and at the same time deprivation of water from the plant body.
- the condition of high salinity in the soil can be defined as an electrical Conductivity (mmhos/cm) greater than 1.26 in the soil, for example greater than 1.3, greater than 1.4, greater than 1.5, greater than 1.75, greater than 2.00.
- high levels of heavy metal in the soil refers to a condition wherein the concentration of heavy metals around the plant leads to an inhibition of plant growth or productivity. Such concentrations are readily determined or known to those skilled in the art.
- the condition of high levels of heavy metals in the soil may be reached when at least one heavy metal, preferably selected from the group consisting of: Cd, Zn, Cu, Cr, Pb and Ni, exceeds the concentration of 10 mg/kg in the soil, such as exceeds the concentration of 12 mg/kg, of 15 mg/kg, of 17 mg/kg, of 20 mg/kg, or more.
- High levels of heavy metal in the soil can also be reached when the sum of the concentrations of heavy metals, preferably selected from the group consisting of: Cd, Zn, Cu, Cr, Pb and Ni, exceeds the concentration of 10 mg/kg in the soil, such as exceeds the concentration of 12 mg/kg, of 15 mg/kg, of 17 mg/kg, of 20 mg/kg, or more.
- lysate of a cell and “organic extract of a cell” " as defined herein are used interchangeably and refer to cell suspensions or fractions thereof, obtained after lysing the cells.
- the cell lysate typically contains proteins and other molecules which can be intracellular or extracellular, for example secreted proteins and molecules.
- the cell lysates comprise an extremely complex mixture of e.g., proteins, glycoproteins, polysaccharides, lipids, nucleic acids etc. All these components may interact with each other.
- the cell lysate in the solution or suspension of the present disclosure may still comprise some whole cells (e.g., living cells), parts of cells or any fractions or mixtures thereof obtained after a lysis step.
- the term includes any derivative of a lysate of a cell known to a person skilled in the art. For instance, the lysate may be further processed, e.g., subjected to a step of concentration by evaporation.
- identity and similarity with respect to a polynucleotide (or polypeptide), as defined herein are used interchangeably and refer to the percentage of nucleic acids (or amino acids) in the candidate sequence that are identical or similar, respectively, to the residues of a corresponding native nucleic acids (or amino acids), after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent identity I similarity, and considering any conservative substitutions according to the NCIIIB rules (http://www.chem. qmul.ac.uk/iubmb/misc/naseq.html; NC-llIB, Eur J Biochem (1985)) as part of the sequence identity.
- the percentage of similarity refers to the percentage of residues conserved with similar physiochemical properties. Neither 5' or 3' extensions nor insertions (for nucleic acids) or N’ or C’ extensions nor insertions (for polypeptides) result in a reduction of identity or similarity. Methods and computer programs for the alignments are well known in the art.
- a given similarity between two sequences implies that the identity between these sequences is at least equal to the similarity; for example, if two sequences are 70% similar to one another, they cannot be less than 70% identical to one another - but could be sharing 80% identity.
- at least 70% similarity or identity means at least 75%, at least 80%, at least 85%, at least 90%, at least 95% throughout the present disclosure.
- pteridic acids that share the structure of formula (II) encompasses pteridic acid F, pteridic acid H, pteridic acid I, throughout the present disclosure.
- a functional variant refers herein to functional variants of an enzyme, which retain at least some of the activity of the parent enzyme.
- a functional variant of a Type I PKS can catalyse the same conversion as the enzymes from which they are derived, although the efficiency of reaction may be different, e.g., the efficiency is decreased or increased compared to the parent enzyme, the substrate specificity is modified, the longevity or turnover of the enzyme is modified, the cellular localisation of the enzyme is modified.
- Pteridic acids are polyketides compounds that harbour spiro ketal structures, that share the structure described in formula (III):
- Ri and R2 are independently selected from the group consisting of: hydrogen, alkyl and halogen;
- Rs is selected from the group consisting of: hydrogen, hydroxy, methoxy, oxygen;
- R4 is selected from the group consisting of hydrogen, methyl and ethyl; X is selected from oxygen and nitrogen; n is selected from 1 and 2.
- Pteridic acids A-B ( Figure 1 - compounds 1 and 2) were originally disclosed with an R stereochemistry on the tenth carbon atom, however the structure was later corrected to an S stereochemistry. These compounds have been reported as plant growth promoters and induce the formation of adventitious roots in the hypocotyl of kidney beans in an auxin-like manner 3 .
- auxin promotes inter alia, root initiation, induces both growth of pre-existing roots and root branching (lateral root initiation), and promotes also adventitious root formation.
- auxin overproduction enhances the inhibitory effects of abscisic acid (ABA) in germination assays. While pteridic acids A and B were discovered more than 20 years ago, at present they are not available on the market, and the original strains reported to produce the compounds are also not available.
- ABA abscisic acid
- Pteridic acids C-G ( Figure 1 - compounds 3-7) were isolated from a marine Streptomyces sp. and they were not tested in planta 4 .
- R1 and R2 are independently selected from the group consisting of hydrogen, alkyl and halogen;
- R3 is selected from the group consisting of: oxygen, methoxy, and hydroxy
- R4 is selected from the group consisting of: hydrogen, methyl and ethyl
- X is selected from oxygen and nitrogen; n is selected from 1 and 2, preferably the compound is of formula (
- pteridic acid compounds characterised by a single or a double bond between the thirteenth carbon and an oxygen. Such compounds differ from other pteridic acid compounds, such as pteridic acids A and B, as detailed herein below.
- R1 and R2 are independently selected from the group consisting of hydrogen, alkyl and halogen;
- R3 is selected from the group consisting of: oxygen, methoxy, and hydroxy
- X is selected from oxygen and nitrogen; preferably the compound of formula (II):
- Ri is a Ci-e alkyl, such as methyl.
- R2 is a Ci-e alkyl, such as methyl.
- pteridic acids A and B have been described as auxin-like.
- compounds of formula (II), in particular pteridic acids H and I further described herein below are characterized a single or double bond between the thirteenth carbon and an oxygen atom, and their effect on plant growth is surprisingly ABA-like.
- Abscisic acid (ABA) functions in many plant developmental processes, including seed and bud dormancy, the control of organ size, and stomatai closure. ABA is especially important for plants in the response to environmental stresses, including drought, soil salinity, cold tolerance, freezing tolerance, heat stress and heavy metal ion tolerance.
- auxin has classically been considered a “growth hormone”
- ABA is frequently defined as a “stress hormone” with roles in the regulation of biotic and abiotic stress responses.
- pteridic acids H and I when supplemented to plants have an effect on the plant which is different from the effect observed when supplementing other pteridic acids.
- a sufficiently acidic compound may form alkali or earth alkali metal salts, for example sodium, potassium, lithium, calcium or magnesium salts; ammonium salts; or organic base salts, for example methylamine, dimethylamine, tnmethylamine, tnethylamine, ethylenediamine, ethanolamine, choline hydroxide, meglumin, piperidine, morpholine, tris-(2-hydroxyethyl)amine, lysine or arginine salts; all of which are also further examples of salts of the compounds described herein.
- the compounds described herein may be solvated, especially hydrated. The hydratization/hydration may occur during the process of production or as a consequence of the hygroscopic nature of the initially water free compounds.
- the solvates and/or hydrates may e.g., be present in solid or liquid form. Salts and/or solvates of the compounds described herein, in particular of pteridic acids H and I, may thus also be used in
- Ri is a Ci-e alkyl. In some embodiments, R2 is a Ci-e alkyl. In some embodiments, Ri is methyl. In some embodiments, R2 is methyl. In some embodiments, n is 2. In some embodiments, X is oxygen. In some embodiments, Ri is independently selected from the group consisting of: hydrogen, alkyl and halogen. In some embodiments, R2 is independently selected from the group consisting of: hydrogen, alkyl and halogen. In some embodiments, R2 is hydrogen. In some embodiments, Rs is hydrogen.
- Ri is hydrogen and Rs is hydroxy or Ri is methyl and R3 is oxygen. In some embodiments, Ri is hydrogen and Rs is hydroxyl. In some embodiments, Ri is methyl and R3 is oxygen.
- Ri and R2 are hydrogen, Rs is hydroxy, X is oxygen, n is 2, and the compound is pteridic acid H of formula (IV):
- Ri is methyl
- R2 is hydrogen
- R3 is oxygen
- X is oxygen
- n is 2
- the compound is pteridic acid I of formula (V):
- pteridic acid I may be generated from pteridic acid H through methylation and oxidation.
- Ri and R2 are hydrogen, Rs is hydroxy, X is oxygen, n is 2, and the compound is pteridic acid F of formula (VIII):
- the pteridic acid is selected from the group consisting of pteridic acid H, pteridic acid F and pteridic acid I.
- the pteridic acid is selected from the group consisting of pteridic acid H, and pteridic acid I.
- the pteridic acid is selected from the group consisting of pteridic acid F, and pteridic acid I.
- the pteridic acid is selected from the group consisting of pteridic acid H, and pteridic acid F.
- the present disclosure thus also provides a composition comprising any of the above compounds, in particular pteridic acid F, pteridic acid H or pteridic acid I.
- the composition further comprises an acceptable carrier.
- the composition further comprises one or more additional compounds selected from the group consisting of a liquid carrier, a solid carrier and a substrate.
- compositions comprising said compounds of formula (I), in particular compounds of formula (II) such as pteridic acid H, such as pteridic acid F, or such as pteridic acid I, are useful to promote plant growth and/or productivity.
- said compounds promote the growth of a plant.
- the plant growth effect is well known to a person skilled in the art and may comprise but is not limited to increased cell division and cell elongation compared to a plant of the same species that has not been contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
- said compounds promote plant productivity.
- the productivity of a plant is well known to a person skilled in the art and it can be quantified as the rate of generation of biomass.
- the skilled person would know how to quantify the increased productivity of a plant when contacted with compounds of formula (I), or compositions comprising said compounds of formula (I), in particular compounds of formula (II) such as pteridic acid H, such as pteridic acid F, or such as pteridic acid I, compared to a plant grown in similar conditions but not contacted with said compounds, or compositions comprising said compounds.
- pteridic acid H such as pteridic acid F
- pteridic acid I such as pteridic acid I
- compounds of formula (I), in particular compounds of formula (II) such as pteridic acid H, such as pteridic acid F, or such as pteridic acid I can be used as bio-stimulant.
- Said plant growth effect may comprise increased root elongation, shoot length, and/or hypocotyl growth promoting compared to a plant of the same species that has not been contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
- pteridic acids H, and/or I are useful to promote said plant growth and/or productivity.
- compounds of formula (II), or compositions comprising said compounds of formula (II), such as pteridic acid H, such as pteridic acid F, or such as pteridic acid I, are useful to promote said plant growth and/or productivity.
- a compound of structure (II) is capable of promoting plant growth for a given plant
- the skilled person can thus compare root elongation and hypocotyl growth of plants that have been contacted with said compounds, or composition comprising said compounds, with those that have not been contacted with the compounds, or composition comprising said compounds, and grown in otherwise similar conditions.
- Such test comprises measuring the length of the hypocotyl of said plants, as illustrated, for example, in Example 4.
- contacting a plant with the present compounds or compositions results in an increase of any one of the parameters selected from the group consisting of: the root length; the shoot length; the fresh weight; and the dry weight, where the parameter is increased by at least 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, or at least 50% compared to the same parameter, /.e., the root length; the shoot length; the fresh weight; or the dry weight, respectively, of another plant
- the shoot length of a plant contacted with the present compounds or compositions is increased of at least 1%, such as at least 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, or at least 50% compared to the shoot length of another plant of the same species which is not contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
- the root length of a plant contacted with the present compounds or compositions is increased of at least 1%, such as at least 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, or at least 50% compared to the root length of another plant of the same species which is not contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
- a compound of structure (II) is capable of promoting plant growth for a given plant
- the skilled person can also compare the fresh and/or dry weight of plants that have been contacted with said compounds, or composition comprising said compounds, with those that have not been contacted with the compounds, or compositions comprising said compounds, and grown in otherwise similar conditions.
- Such test may comprise measuring the fresh and/or dry weight of said plants, as illustrated, for example, in Example 7.
- contacting a plant with the present compounds or compositions results in an increase in fresh weight compared to the growth of fresh weight of another plant of the same species which is not contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
- the fresh weight of the plant is increased of at least 1%, such as at least 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%,
- the dry weight of a plant contacted with the present compounds or compositions is increased compared to the growth of fresh weight of another plant of the same species which is not contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
- the dry weight of the plant is increased of at least 1%, such as at least 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%,
- the compound is pteridic acid H.
- the compound is pteridic acid I.
- the compound is pteridic acid F.
- the plant is contacted with pteridic acid H and with pteridic acid I.
- the plant is contacted with any one of pteridic acids H, I, and/or F.
- the plant is contacted with pteridic acid H and with pteridic acid F.
- the plant is contacted with pteridic acid I and with pteridic acid F. In some embodiments, the plant is contacted with a composition comprising said compound(s). How to contact the compound and the plant is described in further detail herein below.
- the plant is as described in the section “Plants” of the present disclosure.
- adventitious roots are plant roots that form from any non-root tissue and are produced both during normal conditions and in response to stress conditions, such as flooding, nutrient deprivation, and wounding.
- ABA has been reported to inhibit hypocotyl adventitious root formation, while auxin stimulates it. Without being bound by theory, reducing the formation of adventitious roots can be expected to increase growth of other plant parts, e.g., leaves or stems.
- pteridic acids A and B are known to stimulate adventitious root growth in an auxin like manner.
- compounds of formula (I), or compositions comprising said compounds of formula (I), in particular compounds of formula (II) such as pteridic acid H and/or pteridic acid I can promote plant growth and/or productivity without inducing an increased formation of adventitious roots in the hypocotyl compared to a plant of the same species that has not been contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
- said compounds of formula (I), or compositions comprising said compounds of formula (I), in particular compounds of formula (II) such as pteridic acid H and/or pteridic acid I mimic the effect of ABA.
- the plant growth effect achieved by exposing the plant to any one of said compounds of formula (I), or compositions comprising said compounds of formula (I), in particular compounds of formula (II), such as pteridic acid H, pteridic acid F, and/or pteridic acid I does not result in an increased formation of adventitious roots compared to a plant of the same species that has not been contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
- the plant growth effect achieved by exposing the plant to any one of said compounds of formula (I), or compositions comprising said compounds of formula (I), in particular compounds of formula (II), such as pteridic acid H, pteridic acid F, and/or pteridic acid I results in a decreased formation of adventitious roots compared to a plant of the same species that has not been contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
- the hypocotyl is the part of a plant embryo or seedling that lies between the radicle and the cotyledons. Upon germination, the hypocotyl pushes the cotyledons above the ground to develop. It eventually becomes part of the plant stem.
- the plant growth effect achieved by exposing the plant to any one of said compounds of formula (I), or compositions comprising said compounds of formula (I), in particular compounds of formula (II), such as pteridic acid H, pteridic acid F, and/or pteridic acid I results in increased growth of the hypocotyl compared to the growth of the hypocotyl to a plant of the same species that has not been contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
- any one of said compounds of formula (I), or compositions comprising said compounds of formula (I), in particular compounds of formula (II) such as pteridic acid H, and/or such as pteridic acid I, are useful to reduce the stress of a plant.
- the plant is as described in the section “Plants” of the present disclosure.
- the inventors found that when plant of mung beans were grown in Petri dish in conditions mimicking drought, such as those mediated by 15% PEG-6000 in the soil, plants that were contacted with pteridic acid H or pteridic acid I showed increased root length compared to plants otherwise grown in similar conditions.
- the effect of contacting the plants with these compounds was similar to the one elicited by ABA, while auxin showed only a limited effect.
- Abscisic acid is a plant hormone. ABA functions in many plant developmental processes, including seed and bud dormancy, the control of organ size, and stomatai closure. It is especially important for plants in response to environmental stresses, including drought, soil salinity, cold tolerance, freezing tolerance, heat stress and heavy metal ion tolerance.
- the present inventors have found that said compounds of formula (I), or compositions comprising said compounds of formula (I), in particular compounds of formula (II), are characterized by an ABA-like activity.
- said compounds of formula (I), or compositions comprising said compounds of formula (I), in particular compounds of formula (II) such as pteridic acid H, pteridic acid F, and/or pteridic acid I may be used to reduce the abiotic stress experienced by the plant, such as under drought conditions, or conditions of high soil salinity and/or high levels of heavy metals in the soil in which the plant is grown. Said stress conditions are readily determined by or known to those skilled in the art.
- any one of the parameters selected from the group consisting of: the root length; the shoot length; the fresh weight; and the dry weight, of a plant grown under stress conditions, preferably under abiotic stress conditions such as drought conditions, high soil salinity and/or high levels of heavy metals in the soil in which the plant is grown is increased of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 160%, 180%, 200%, 220%, 240%, 260%, 280%, 300%, 350%, 400%, 450%, or 500% when the plant is contacted with the present compounds or compositions compared to the same parameter, /.e., the root length; the shoot length; the fresh weight; or the dry weight, of another plant of the same species which is not contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
- abiotic stress conditions such as drought conditions
- high soil salinity and/or high levels of heavy metals in the soil in which the plant is grown
- the root length of a plant contacted with the present compounds or compositions and grown under stress conditions preferably under abiotic stress conditions such as drought conditions, high soil salinity and/or high levels of heavy metals in the soil in which the plant is grown is increased of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 160%, 180%, 200%, 220%, 240%, 260%, 280%, 300%, 350%, 400%, 450%, or 500% compared to the root length of another plant of the same species which is not contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
- abiotic stress conditions such as drought conditions
- high soil salinity and/or high levels of heavy metals in the soil in which the plant is grown is increased of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 160%, 180%, 200%, 220%, 240%, 260%, 280%, 300%
- the shoot length of a plant contacted with the present compounds or compositions and grown under stress conditions preferably under abiotic stress conditions such as drought conditions, high soil salinity and/or high levels of heavy metals in the soil in which the plant is grown is increased of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 160%, 180%, 200%, 220%, 240%, 260%, 280%, 300%, 350%, 400%, 450%, or 500% compared to the shoot length of another plant of the same species which is not contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
- abiotic stress conditions such as drought conditions
- high soil salinity and/or high levels of heavy metals in the soil in which the plant is grown is increased of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 160%, 180%, 200%, 220%, 240%, 260%, 280%, 300%
- the dry weight of a plant contacted with the present compounds or compositions and grown under stress conditions preferably under abiotic stress conditions such as drought conditions, high soil salinity and/or high levels of heavy metals in the soil in which the plant is grown is increased of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 160%, 180%, 200%, 220%, 240%, 260%, 280%, 300%, 350%, 400%, 450%, or 500% compared to the dry weight of another plant of the same species which is not contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
- abiotic stress conditions such as drought conditions
- high soil salinity and/or high levels of heavy metals in the soil in which the plant is grown is increased of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 160%, 180%, 200%, 220%, 240%, 260%, 280%, 300%
- the fresh weight of a plant contacted with the present compounds or compositions and grown under stress conditions preferably under abiotic stress conditions such as drought conditions, high soil salinity and/or high levels of heavy metals in the soil in which the plant is grown is increased of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 160%, 180%, 200%, 220%, 240%, 260%, 280%, 300%, 350%, 400%, 450%, or 500% compared to the fresh weight of another plant of the same species which is not contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
- abiotic stress conditions such as drought conditions
- high soil salinity and/or high levels of heavy metals in the soil in which the plant is grown is increased of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 160%, 180%, 200%, 220%, 240%, 260%, 280%, 300%
- the compound is pteridic acid H.
- the compound is pteridic acid I.
- the compound is ptendic acid F.
- the plant is contacted with pteridic acid H and with pteridic acid I.
- the plant is contacted with all of pteridic acids H, I, and F.
- the plant is contacted with pteridic acid H and with pteridic acid F.
- the plant is contacted with pteridic acid I and with pteridic acid F.
- the plant is contacted with a composition comprising said compounds. How to contact the compound and the plant is described in further detail herein below.
- said compounds of formula (I), or compositions comprising said compounds of formula (I), in particular compounds of formula (II) such as pteridic acid H, pteridic acid F, and/or pteridic acid I are useful to reduce the stress of a plant grown in drought condition. Such condition is readily determined by or known to those skilled in the art.
- Such test comprises comparing plants that have been contacted with the compounds, or a composition comprising said compounds, to plants that have not been contacted with the compounds, or a composition comprising said compounds, under drought conditions, for example by growing the plants in conditions mimicking drought.
- adding 15% PEG-6000 in the soil, under conditions that otherwise promote cellular growth is an example of how to mimic drought conditions.
- condition of drought is defined by a drought Palmer drought index less than -2, such as less than -3, less than -4, less than -5, less than -6, less than -7, less than -8, less than -9, or -10.
- the root length of a plant contacted with the present compounds or compositions and grown under drought conditions is increased of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 160%, 180%, 200%, 220%, 240%, 260%, 280%, 300%, 350%, 400%, 450%, or 500% compared to the root length of another plant of the same species which is not contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
- the shoot length of a plant contacted with the present compounds or compositions and grown under drought conditions is increased of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 160%, 180%, 200%, 220%, 240%, 260%, 280%, 300%, 350%, 400%, 450%, or 500% compared to the shoot length of another plant of the same species which is not contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
- the dry weight of a plant contacted with the present compounds or compositions and grown under drought conditions is increased of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 160%, 180%, 200%, 220%, 240%, 260%, 280%, 300%, 350%, 400%, 450%, or 500% compared to the dry weight of another plant of the same species which is not contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
- the fresh weight of a plant contacted with the present compounds or compositions and grown under drought conditions is increased of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 160%, 180%, 200%, 220%, 240%, 260%, 280%, 300%, 350%, 400%, 450%, or 500% compared to the fresh weight of another plant of the same species which is not contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
- the compounds described herein, or compositions comprising said compounds described herein, such as pteridic acid H, pteridic acid F, and/or pteridic acid I are useful to reduce the stress of a plant grown in conditions characterized by high soil salinity around the plant. Such conditions are readily determined or known to those skilled in the art. It is possible to test in a controlled environment whether the compounds promote plant growth and/or productivity, or to test whether the plant copes better with high soil salinity when contacted with said compound, or a composition comprising said compound.
- Such test can for example comprise comparing plants that have been contacted with the compounds, or a composition comprising said compounds, to plants that have not been contacted with the compounds, or a composition comprising said compounds, under conditions of high salinity, for example by growing the plants in conditions mimicking high soil salinity.
- adding 100 mM NaCI in the soil, under conditions that otherwise promote cellular growth is an example of how to mimic high salinity conditions.
- condition of high soil salinity is defined as an electrical Conductivity (mmhos/cm) greater than 1.26 in the soil, for example greater than 1.3, greater than 1.4, greater than 1.5, greater than 1.75, greater than 2.00.
- the root length of a plant contacted with the present compounds or compositions and grown in high salinity conditions is increased of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 160%, 180%, 200%, 220%, 240%, 260%, 280%, 300%, 350%, 400%, 450%, or 500% compared to the root length of another plant of the same species which is not contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
- the root length of a plant contacted with the present compounds or compositions and grown in high salinity conditions is increased of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 160%, 180%, 200%, 220%, 240%, 260%, 280%, 300%, 350%, 400%, 450%, or 500% compared to the shoot length of another plant of the same species which is not contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
- the root length of a plant contacted with the present compounds or compositions and grown in high salinity conditions is increased of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 160%, 180%, 200%, 220%, 240%, 260%, 280%, 300%, 350%, 400%, 450%, or 500% compared to the dry weight of another plant of the same species which is not contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
- the root length of a plant contacted with the present compounds or compositions and grown in high salinity conditions is increased of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 160%, 180%, 200%, 220%, 240%, 260%, 280%, 300%, 350%, 400%, 450%, or 500% compared to the fresh weight of another plant of the same species which is not contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
- said pteridic acids that share the structure of formula (I), or compositions comprising said compounds of formula (I), in particular compounds of formula (II), such as pteridic acid H, pteridic acid F, and/or pteridic acid I are useful to reduce the stress of a plant grown in an environment characterized by the presence of high metals in the soil around the plant. Such condition is readily determined or known to those skilled in the art.
- test in a controlled environment whether the pteridic acid of interest promotes plant growth and/or productivity, or to test whether the plant copes better with high levels of heavy metals in the soil when contacted with said compound, or a composition comprising said compound.
- Such test can for example comprise comparing plants that have been contacted with the compounds, or a composition comprising said compounds, to plants that have not been contacted with the compounds, or a composition comprising said compounds, under conditions mimicking high levels of heavy metals.
- adding 10 mM CuSC in the soil, under conditions that otherwise promote cellular growth is an example of how to mimic high levels of heavy metals.
- the condition of high levels of heavy metals is defined as when at least one heavy metal, preferably selected from the group consisting of: Cd, Zn, Cu, Cr, Pb and Ni, exceeds the concentration of 10 mg/kg in the soil, such as exceeds the concentration of 12 mg/kg, of 15 mg/kg, of 17 mg/kg, of 20 mg/kg, or more.
- High levels of heavy metal in the soil can also be reached when the sum of the concentrations of heavy metals, preferably selected from the group consisting of: Cd, Zn, Cu, Cr, Pb and Ni, exceeds the concentration of 10 mg/kg in the soil, such as exceeds the concentration of 12 mg/kg, of 15 mg/kg, of 17 mg/kg, of 20 mg/kg, or more.
- the root length of a plant contacted with the present compounds or compositions and grown in conditions of high levels of heavy metals in the soil is increased of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 160%, 180%, 200%, 220%, 240%, 260%, 280%, 300%, 350%, 400%, 450%, or 500% compared to the root length of another plant of the same species which is not contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
- the root length of a plant contacted with the present compounds or compositions and grown in conditions of high levels of heavy metals in the soil is increased of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 160%, 180%, 200%, 220%, 240%, 260%, 280%, 300%, 350%, 400%, 450%, or 500% compared to the shoot length of another plant of the same species which is not contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
- the root length of a plant contacted with the present compounds or compositions and grown in conditions of high levels of heavy metals in the soil is increased of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 160%, 180%, 200%, 220%, 240%, 260%, 280%, 300%, 350%, 400%, 450%, or 500% compared to the dry weight of another plant of the same species which is not contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
- the root length of a plant contacted with the present compounds or compositions and grown in conditions of high levels of heavy metals in the soil is increased of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 160%, 180%, 200%, 220%, 240%, 260%, 280%, 300%, 350%, 400%, 450%, or 500% compared to the fresh weight of another plant of the same species which is not contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
- Seed germination begins with imbibition of dry seed followed by emergence of the embryonic root, which is called the radicle.
- the molecular mechanisms underlying seed germination in plants are relatively well understood, and ABA is known to be integral in the regulation of seed dormancy and therefore timing of seed germination.
- Strong genetic evidence supports a model whereby ABA-mediated inhibition of seed germination requires intact auxin biosynthesis, transport and signalling.
- auxin enhances the inhibitory effects of ABA in germination assays, suggesting that auxin homeostasis is downstream of ABA in regulation of seed germination.
- pteridic acids described herein showed mostly an “ABA-like” mode of action
- the inventors of the present disclosure have found that said pteridic acids, such as pteridic acid H, pteridic acid F, and/or pteridic acid I, are capable of promoting, rather than inhibiting seed germination.
- said compounds of formula (I), or compositions comprising said compounds of formula (I), in particular compounds of formula (II) such as pteridic acid H, pteridic acid F, and/or pteridic acid I are used to promote seed germination of a plant.
- the seed germination rate of a plant is increased of at least 1%, such as at least 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7% compared to the seed germination rate of another plant of the same species which is not contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
- the plant is a plant as described in the section “Plants”.
- the plant is wheat. Plants
- the plant contacted by any one of said compounds of formula (I), or compositions comprising said compounds of formula (I), in particular compounds of formula (II) such as pteridic acid H, pteridic acid F, and/or such as pteridic acid I, can belong to any variety of plant.
- the present compounds and methods can be applied to any variety of plant.
- the plant is selected from the group consisting of: barley, wheat, potato, rice, maize, mung bean, soybeans/legume, rapeseed, sugar cane, cassava, groundnut, corn, cotton, tomato, grape, lettuce, sugar beet, palm, coffee, tobacco, tea, cannabis, coca, strawberry, carrot and/or cabbage.
- the plant contacted with the pteridic acid of formula (II), or compositions comprising said compounds of formula (II), such as pteridic acid H, such as pteridic acid F, and/or such as pteridic acid I, is barley, and/or mung beans.
- the compound is pteridic acid H and the plant is selected from the group consisting of: barley, wheat, potato, rice, maize, mung bean, soybeans/legume, rapeseed, sugar cane, cassava, groundnut, corn, cotton, tomato, grape, lettuce, sugar beet, palm, coffee, tobacco, tea, cannabis, coca, strawberry, carrot and/or cabbage.
- the compound is pteridic acid I and the plant is selected from the group consisting of: barley, wheat, potato, rice, maize, mung bean, soybeans/legume, rapeseed, sugar cane, cassava, groundnut, corn, cotton, tomato, grape, lettuce, sugar beet, palm, coffee, tobacco, tea, cannabis, coca, strawberry, carrot and/or cabbage.
- the compound is pteridic acid F and the plant is selected from the group consisting of: barley, wheat, potato, rice, maize, mung bean, soybeans/legume, rapeseed, sugar cane, cassava, groundnut, corn, cotton, tomato, grape, lettuce, sugar beet, palm, coffee, tobacco, tea, cannabis, coca, strawberry, carrot and/or cabbage.
- the compound is a mixture of ptendic acid H and ptendic acid I and the plant is selected from the group consisting of: barley, wheat, potato, rice, maize, mung bean, soybeans/legume, rapeseed, sugar cane, cassava, groundnut, corn, cotton, tomato, grape, lettuce, sugar beet, palm, coffee, tobacco, tea, cannabis, coca, strawberry, carrot and/or cabbage.
- the compound is a mixture of pteridic acid H, pteridic acid F, and pteridic acid I and the plant is selected from the group consisting of: barley, wheat, potato, rice, maize, mung bean, soybeans/legume, rapeseed, sugar cane, cassava, groundnut, corn, cotton, tomato, grape, lettuce, sugar beet, palm, coffee, tobacco, tea, cannabis, coca, strawberry, carrot and/or cabbage.
- the compound is a mixture of pteridic acid H, and pteridic acid F, and the plant is selected from the group consisting of: barley, wheat, potato, rice, maize, mung bean, soybeans/legume, rapeseed, sugar cane, cassava, groundnut, corn, cotton, tomato, grape, lettuce, sugar beet, palm, coffee, tobacco, tea, cannabis, coca, strawberry, carrot and/or cabbage.
- the compound is a mixture of pteridic acid F, and pteridic acid I and the plant is selected from the group consisting of: barley, wheat, potato, rice, maize, mung bean, soybeans/legume, rapeseed, sugar cane, cassava, groundnut, corn, cotton, tomato, grape, lettuce, sugar beet, palm, coffee, tobacco, tea, cannabis, coca, strawberry, carrot and/or cabbage.
- any one of said compounds of formula (I), or compositions comprising said compounds of formula (I), in particular compounds of formula (II) such as pteridic acid H, pteridic acid F, and/or pteridic acid I is obtainable by a method comprising growing a cell in a cultivation broth, under conditions allowing the production of the compound.
- Said cell may be any one of the cells disclosed throughout the disclosure.
- Said compounds may be obtained by including a further step of obtaining an organic extract of the cultivation broth.
- Said compounds may be obtained by including a further step of recovering and optionally purifying the compound from the organic extract.
- Said compound may be pteridic acid H, pteridic acid F, pteridic acid I, or a mixture of them.
- the present disclosure discloses a method to produce any one of said compounds of formula (I), or compositions comprising said compounds of formula (I), in particular compounds of formula (II) comprising growing a cell in a cultivation broth, under condition allowing the production of the compound.
- Said cell may be any one of the cells disclosed throughout the disclosure.
- Said compounds may be produced by including a further step of obtaining an organic extract of the cultivation broth.
- Said compounds may be produced by including a further step of recovering and optionally purifying the compound from the organic extract.
- Said compound may be pteridic acid H, pteridic acid F, pteridic acid I, or a mixture of them.
- Any one of said compounds may be obtained by growing in a cultivation broth a cell, such as a cell artificially modified to synthesise the compound, as detailed herein below.
- the fermentation of said cultivation broth may be carried out as is known in the art.
- the fermentation is carried out for 4-8 days with aeration, such as 5-7 days, preferably 6 days.
- Said fermentation procedure may be carried out at a pH range of 5- 7, preferably a pH range of 5.4-6.4.
- Said method of obtaining the compounds disclosed throughout the description may further include a step of obtaining an organic extract of the cultivation broth.
- Said organic extract might be obtained with any method known by a person skilled in the art.
- the method may further include a step of recovering and optionally purifying the compound from the organic extract or from the fermentation broth.
- Said purification step may comprise organic solvent extraction followed by chromatographic separation by Sephadex LH-20 and silica gel chromatography.
- the compounds of formula (I), or compositions comprising said compounds of formula (I), in particular compounds of formula (II) such as pteridic acid H, pteridic acid F, and/or such as pteridic acid I are useful as plant stimulant, as plant hormone surrogates, as compounds useful to promote the growth of a plant, to promote plant productivity, and/or to promote seed germination.
- the compounds of formula (I), or compositions comprising said compounds of formula (I), in particular compounds of formula (II) such as pteridic acid H, pteridic acid F, and/or such as pteridic acid I, described herein are useful to promote the growth of a plant, and/or promote plant productivity under stress conditions such as stress conditions.
- a compound of formula (I), in particular a compound of formula (II) such as pteridic acid H, and/or such as pteridic acid I, of the present disclosure is comprised within a composition.
- the composition comprises any one of the pteridic acids selected from the group consisting of: pteridic acid H, pteridic acid F, and pteridic acid I.
- the composition comprises pteridic acid H, pteridic acid F, and pteridic acid I.
- the composition comprises pteridic acid H, and pteridic acid F.
- the composition comprises pteridic acid H and pteridic acid I.
- the composition comprises pteridic acid F and pteridic acid I.
- the composition comprises pteridic acid H.
- the composition comprises pteridic acid F.
- the composition comprises pteridic acid I. In some embodiments of the present disclosure, the composition further comprises an acceptable carrier.
- the compound is stable when stored at pH7 between 0 and 40 °C, such as between 0 and 35 °C, between 0 and 30 °C, between 0 and 25 °C, between 4 and 40 °C, between 4 and 35 °C, between 4 and 30 °C, or such as between 4 and 25 °C.
- the compound is stable when stored at pH7 for at least 7 days, at least 11 days, at least 15 days, at least 30 days, at least 3 months, at least 6 months, at least a year, at least 2 years, at least 3 years, at least 5 years, at least 10 years.
- the compound is stable when stored at pH3 for at least 5 days, at least 7 days, at least 11 days, at least 15 days, at least 30 days, at least 3 months, at least 6 months, at least a year, at least 2 years, at least 3 years, at least 5 years, at least 10 years.
- said present compounds, or compositions comprising said compounds can be provided to or contacted with a plant as described herein using any method known by a person skilled in the art, such as irrigation, or such as seed-coating, or such as foliar spray.
- said compound of formula (II) is pteridic acid I, pteridic acid H, or both.
- said compound is any one of the pteridic acids selected from the group consisting of: pteridic acid H, pteridic acid I, and pteridic acid F.
- the compound is a mixture of ptendic acid H, ptendic acid I, and pteridic acid F.
- said compound of formula (II) is pteridic acid I, pteridic acid H, or both.
- said compound is any one of the pteridic acids selected from the group consisting of: pteridic acid H, pteridic acid I, and pteridic acid F.
- the compound is a mixture of pteridic acid H, pteridic acid I, and pteridic acid F.
- Said compounds disclosed above can be supplied to the soil in which the plant is grown as a pure compound, as a lysate of said cell producing the compound, by supplementation of said cells producing the compound, as part of said cultivation broth comprising the compound and/or cells producing the compound, as detailed herein.
- said compounds, or a composition comprising the compound, such as pteridic acid H is supplied to the soil in a concentration range of the compound between 0,1 nM to 500 nM, such as 0,1 nM to 10 nM, such as 0,1 nM to 20 nM, such as 0,1 nM to 30 nM, such as 0,1 nM to 40 nM, such as 0,1 nM to 50 nM, such as 0,1 nM to 60 nM, such as 0,1 nM to 70 nM, such as 0,1 nM to 80 nM, such as 0,1 nM to 90 nM, such as 0,1 nM to 100 nM, such as 0,1 nM to 200 nM, such as 0,1 nM to 300 nM, or such as 0,1 nM to 400 nM, such as 1 nM to 10 nM, such as 1 nM to 20 nM, such as 1 nM to 30 nM, such as
- Microorganisms producing compounds disclosed above may be supplemented with a microbial cfu of 10 5 -10 1o /plant, such as 1O 6 -1O 1o /plant, such as 1O 7 -1O 1o /plant, such as 1O 8 -1O 1o /plant, such as 10 9 -10 1 °/plant, such as 10 5 -10 6 /plant, such as 10 5 -10 7 /plant, such as 10 -10 7 /plant, such as 10 -10 8 /plant, such as 10 -10 9 /plant, such as 10 -10 9 /plant, such as 10 6 -10 8 /plant, such as 10 7 -10 9 /plant.
- a microbial cfu of 10 5 -10 1o /plant such as 1O 6 -1O 1o /plant, such as 1O 7 -1O 1o /plant, such as 1O 8 -1O 1o /plant, such as 10 9 -10 1 °/plant, such as 10 5 -10
- the present disclosure discloses a cell producing any one of the compounds of formula (I), or compositions comprising said compounds of formula (I), in particular compounds of formula (II) such as pteridic acid I, pteridic acid F, or such as pteridic acid H.
- said cell is a microorganism.
- said cell is a natural occurring cell or an artificially modified cell, such as a modified insect cell, or such as a modified microorganism.
- the cell is a cell which does not occur in nature, in particular the cell is engineered.
- said cell is a microorganism in its naturally occurring form.
- the cell is artificially modified to produce or to enhance the production of the compound.
- the microorganism may belong to the genus Streptomyces or Allokutzneria, for example S. iranensis, S.
- the cell is artificially modified to produce the compound.
- the cell is artificially modified to enhance the production of the compound.
- said cell producing any one of the compounds disclosed herein is S. iranensis or S. rapamycinicus.
- said cell producing any one of the compounds disclosed herein is S. iranensis, S. violaceusniger, S. albus, S. melanosporofaciens, S. yatensis, S. cangkringensis, or S. rapamycinicus.
- said cell producing any one of the compounds disclosed herein is S. iranensis, S. violaceusniger, S. melanosporofaciens, S. cangkringensis, or S. rapamycinicus.
- Said microorganisms may be in their natural occurring form, or artificially modified to enhance the production of the compound.
- said cell may be a naturally occurring cell, wherein the naturally occurring cell is not a S. iranensis or a S. rapamycinicus cell. In some embodiments, said cell may be a naturally occurring cell, wherein the naturally occurring cell is not a S. iranensis, S. violaceusniger, S. albus, S. melanosporofaciens, S. yatensis, S. cangkringensis, or S. rapamycinicus cell. In some preferred embodiments, said cell may be a naturally occurring cell, wherein the naturally occurring cell is not a S. iranensis, S. violaceusniger, S. melanosporofaciens, S. cangkringensis, or a S. rapamycinicus cell.
- said cell is a non-natural S. iranensis or a non-natural S. rapamycinicus cell.
- said cell is a non-natural S. iranensis, a non-natural S. violaceusniger, a non-natural S. albus, a non-natural S. melanosporofaciens, a non-natural S. yatensis, a non-natural S. cangkringensis, or a non-natural S. rapamycinicus cell.
- said cell is a non- natural S. iranensis, a non-natural S. violaceusniger, a non-natural S. melanosporofaciens, a non-natural S. cangkringensis, or a non-natural S. rapamycinicus cell.
- said cell is an artificially modified cell expressing one or more heterologous proteins selected from the group consisting of: i) PtaA as set forth in SEQ ID NO: 2, ii) PtaB as set forth in SEQ ID NO: 4, iii) PtaC as set forth in SEQ ID NO: 6, iv) PtaD as set forth in SEQ ID NO: 8, and v) PtaE as set forth in SEQ ID NO: 10, and functional variants thereof having at least 70% similarity or sequence identity thereto, such as at least 75%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 95% sequence identity thereto.
- heterologous proteins selected from the group consisting of: i) PtaA as set forth in SEQ ID NO: 2, ii) PtaB as set forth in SEQ ID NO: 4, iii) PtaC as set forth in SEQ ID NO: 6, iv) PtaD as set forth in SEQ ID NO
- said cell is an artificially modified cell expressing one or more of: i) PtaA as set forth in SEQ ID NO: 2 or a functional variant thereof having at least 70% sequence identity thereto; ii) PtaB as set forth in SEQ ID NO: 4 or a functional variant thereof having at least 70% sequence identity thereto; iii) PtaC as set forth in SEQ ID NO: 6 or a functional variant thereof having at least 70% sequence identity thereto; iv) PtaD as set forth in SEQ ID NO: 8 or a functional variant thereof having at least 70% sequence identity thereto; and v) PtaE as set forth in SEQ ID NO: 10 or a functional variant thereof having at least 70% sequence identity thereto.
- the artificially modified cell expresses more of at least one of said proteins compared to a naturally occurring cell of the same species.
- the skilled person might use any method known in the art to increase the expression of one or more of said proteins.
- the cell might express one of said proteins under a constitutive promoter; the cell might express an mRNA encoding at least one of said proteins that is more stable than the one naturally occurring; and/or the cell might express a codon optimized mRNA encoding at least one of said proteins.
- said cell is an artificially modified cell expressing PtaA as set forth in SEQ ID NO: 2 or a functional variant thereof having at least 70% sequence identity thereto, such as at least 75%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 95% sequence identity thereto.
- said cell is an artificially modified cell expressing PtaB as set forth in SEQ ID NO: 4 or a functional variant thereof having at least 70% sequence identity thereto, such as at least 75%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 95% sequence identity thereto.
- said cell is an artificially modified cell expressing PtaC as set forth in SEQ ID NO: 6 or a functional variant thereof having at least 70% sequence identity thereto, such as at least 75%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 95% sequence identity thereto.
- said cell is an artificially modified cell expressing PtaD as set forth in SEQ ID NO: 8 or a functional variant thereof having at least 70% sequence identity thereto, such as at least 75%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 95% sequence identity thereto.
- said cell is an artificially modified cell expressing PtaE as set forth in SEQ ID NO: 10 or a functional variant thereof having at least 70% sequence identity thereto, such as at least 75%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 95% sequence identity thereto.
- the cell may be modified to express two of the above listed proteins.
- the cell may express the proteins: i) PtaA and PtaB; ii) PtaA and PtaC; iii) PtaA and PtaD; iv) PtaA and PtaE; v) PtaB and PtaC; vi) PtaB and PtaD; vii) PtaB and PtaE; viii) PtaC and PtaD; ix) PtaC and PtaE; x) PtaD and PtaE, or functional variants thereof having at least 70% similarity or identity thereto, such as at least 80%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% similarity
- the cell may be modified to express three of the above listed proteins.
- the cell may express the proteins: i) PtaA, PtaB and PtaC; ii) PtaA, PtaB and PtaD; iii) PtaA, PtaB and PtaE; iv) PtaA, PtaC and PtaD; v) PtaA, PtaC and PtaE; vi) PtaA, PtaD and PtaE; vii) PtaB, PtaC and PtaD; viii) PtaB, PtaC and PtaE; ix) PtaB, PtaD and PtaE; x) PtaC, PtaD and PtaE, or functional variants thereof having at least 70% similarity or identity thereto, such as at least 80%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least
- the cell may be modified to express four of the above listed proteins.
- the cell may express: i) PtaA, PtaB, PtaC and PtaD; ii) PtaA, PtaB, PtaC and PtaE; iii) PtaA, PtaB, PtaD and PtaE; iv) PtaA, PtaC, PtaD and PtaE; v) PtaB, PtaC, PtaD and PtaE, or functional variants thereof having at least 70% similarity or identity thereto, such as at least 80%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% similarity or identity thereto.
- said cell is an artificially modified cell in which any one of the nucleic acid sequences selected from the group consisting of the following sequences has been introduced: i) ptaA as set forth in SEQ ID NO: 1; ii) ptaB as set forth in SEQ ID NO: 3; iii) ptaC as set forth in SEQ ID NO: 5; iv) ptaD as set forth in SEQ ID NO: 7; and v) ptaE as set forth in SEQ ID NO: 9, and respective variants thereof having at least 70% similarity or identity thereto, such as at least 80%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% similarity or identity thereto.
- said cell is an artificially modified cell in which all the nucleic acid sequences selected from the group consisting of the following sequences have been introduced: i) ptaA as set forth in SEQ ID NO: 1; ii) ptaB as set forth in SEQ ID NO: 3; iii) ptaC as set forth in SEQ ID NO: 5; iv) ptaD as set forth in SEQ ID NO: 7; and v) ptaE as set forth in SEQ ID NO: 9 and respective variants thereof having at least 70% similarity or identity thereto, such as at least 80%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% similarity or identity thereto.
- the cell may express the genes: i) ptaA and ptaB, ii) ptaA and ptaC', iii) ptaA and ptaD, iv) ptaA and ptaE, v) ptaB and ptaC', vi) ptaB and ptaD, vii) ptaB and ptaE, viii) ptaC and ptaD, ix) ptaC and ptaE, x) ptaD and ptaE, or respective variants thereof having at least 70% similarity or identity thereto, such as at least 80%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%,
- the cell may express the genes: i) ptaA, ptaB and ptaC; ii) ptaA, ptaB and ptaD; iii) ptaA, ptaB and ptaE; iv) ptaA, ptaC and ptaD; v) ptaA, ptaC and ptaE; vi) ptaA, ptaD and ptaE; vii) ptaB, ptaC and ptaD; viii) ptaB, ptaC and ptaE; ix) ptaB, ptaD and ptaE; x) ptaC, ptaD and ptaE, or respective variants thereof having at least 70% similarity or identity
- the cell may express the genes: i) ptaA, ptaB, ptaC and ptaD; ii) ptaA, ptaB, ptaC and ptaE; iii) ptaA, ptaB, ptaD and ptaE; iv) ptaA, ptaC, ptaD and ptaE; v) ptaB, ptaCI, ptaD and ptaE, or respective variants thereof having at least 70% similarity or identity thereto, such as at least 80%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 70% similarity or identity thereto, such as at least 80%, such as at least
- nucleic acids in the cell having at least 70% similarity or identity thereto, such as at least 80%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% similarity or identity thereto.
- ptaA-E mutants will be created by CRISPR-cas9.
- the activity of the variant can be measured by detecting the amount of compound of formula (I) synthesised, for example as described in the examples.
- said cell is an artificially modified cell that comprises anyone of the disclosed nucleic acids.
- said cell is an artificially modified cell that comprises anyone of the disclosed vectors or system of vectors.
- said cell is employed to obtain anyone of the compounds of formula (I), in particular compounds of formula (II) such as pteridic acid H, pteridic acid F, and/or pteridic acid I.
- said cell can be provided directly to the plant, or the compound can be purified to some extent as described herein above.
- said cell or derivatives thereof is supplied to plants to reduce plant stress, such as abiotic stress, such as drought conditions, such as high salinity in the soil, such as high levels of metals in the soil.
- plant stress such as abiotic stress, such as drought conditions, such as high salinity in the soil, such as high levels of metals in the soil.
- the shoot length of a plant contacted with the present compounds or compositions is increased of at least 1%, such as at least 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, or at least 50% compared to the shoot length of another plant of the same species which is not contacted with a cell producing the compound and otherwise grown under similar conditions.
- the root length of a plant contacted with the present compounds or compositions is increased of at least 1%, such as at least 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, or at least 50% compared to the root length of another plant of the same species which is not contacted with a cell producing the compound and otherwise grown under similar conditions.
- the fresh weight of a plant contacted with the present compounds or compositions is increased of at least 1%, such as at least 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, or at least 50% compared to the root length of another plant of the same species which is not contacted with a cell producing the compound and otherwise grown under similar conditions.
- the dry weight of a plant contacted with the present compounds or compositions is increased of at least 1%, such as at least 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, or at least 50% compared to the root length of another plant of the same species which is not contacted with a cell producing the compound and otherwise grown under similar conditions.
- the root length of a plant contacted with the present compounds or compositions and grown in drought conditions is increased of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 160%, 180%, 200%, 220%, 240%, 260%, 280%, 300%, 350%, 400%, 450%, or 500% compared to the root length of another plant of the same species which is not contacted with a cell producing the compound and otherwise grown under similar conditions.
- the root length of a plant contacted with the present compounds or compositions and grown in high salinity conditions is increased of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 160%, 180%, 200%, 220%, 240%, 260%, 280%, 300%, 350%, 400%, 450%, or 500% compared to the root length of another plant of the same species which is not contacted with a cell producing the compound and otherwise grown under similar conditions.
- the root length of a plant contacted with the present compounds or compositions and grown in conditions of high levels of heavy metals in the soils is increased of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 160%, 180%, 200%, 220%, 240%, 260%, 280%, 300%, 350%, 400%, 450%, or 500% compared to the root length of another plant of the same species which is not contacted with a cell producing the compound and otherwise grown under similar conditions.
- genes involved in synthesis of compounds of formula (I), in particular compounds of formula (II) such as pteridic acid H and pteridic acid I are: i) ptaA as set forth in SEQ ID NO: 1; ii) ptaB as set forth in SEQ ID NO: 3; iii) ptaC as set forth in SEQ ID NO: 5; iv) ptaD as set forth in SEQ ID NO: 7 v) ptaE as set forth in SEQ ID NO: 9.
- any of the above nucleic acids, or respective variants thereof having at least 70% similarity or identity thereto such as at least 80%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% similarity or identity thereto, can be introduced in a cell, whereby the cell can generate pteridic acid H and/or pteridic acid I.
- said ptendic acids may be ptendic acid I and/or ptendic acid H.
- said pteridic acids may be pteridic acid I, pteridic acid F and/or pteridic acid H. In some embodiments of the disclosures said pteridic acids may be pteridic acid I, and/or pteridic acid F. In some embodiments of the disclosures said pteridic acids may be pteridic acid F and/or pteridic acid H.
- Pteridic acids are assembled by multi-modular type I polyketide synthases following the PKS pattern collinearity, including eight modules, corresponding to one starting unit (acetyl-CoA) followed by seven extensions (methylmalonyl-CoA or ethylmalonyl-CoA), to form a linear polyketide precursor.
- the 6,6-spiroketal core structure is formed because spontaneous spiroketalization of the carbonyl group on C11 and the two hydroxyl groups on C17 and C25.
- Biosynthetic genes that are required to synthesize compounds of formula (I), such as pteridic acid H, or such as pteridic acid I, may comprise anyone of the genes in table 1.
- the present disclosure discloses a vector or a system of vectors comprising one or more of the isolated nucleic acids selected from the group consisting of: i) ptaA as set forth in SEQ ID NO: 1; ii) ptaB as set forth in SEQ ID NO: 3; iii) ptaC as set forth in SEQ ID NO: 5; iv) ptaD as set forth in SEQ ID NO: 7; and v) ptaE as set forth in SEQ ID NO: 9, and respective variants thereof having at least 70% similarity or identity thereto, such as at least 80%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% similarity or identity thereto.
- said vector vector or system of vectors comprises any combination of two or more isolated nucleic acids selected from the group consisting of: i) ptaA as set forth in SEQ ID NO: 1; ii) ptaB as set forth in SEQ ID NO: 3; iii) ptaC as set forth in SEQ ID NO: 5; iv) ptaD as set forth in SEQ ID NO: 7; and v) ptaE as set forth in SEQ ID NO: 9, and respective variants thereof having at least 70% similarity or identity thereto, wherein the isolated nucleic acids are sufficient to result in biosynthesis of the disclosed pteridic acids in a cell of interest.
- said vector vector or system of vectors comprises two or more isolated nucleic acids selected from the group consisting of: i) ptaA as set forth in SEQ ID NO: 1; ii) ptaB as set forth in SEQ ID NO: 3; iii) ptaC as set forth in SEQ ID NO: 5; iv) ptaD as set forth in SEQ ID NO: 7; and v) ptaE as set forth in SEQ ID NO: 9, and respective variants thereof having at least 70% similarity or identity thereto, wherein the isolated nucleic acids are sufficient to synthesize the genes necessary for a method of producing any one of the disclosed pteridic acid that share the structure of formula (I).
- said vector vector or system of vectors comprises all the isolated nucleic acids: i) ptaA as set forth in SEQ ID NO: 1; ii) ptaB as set forth in SEQ ID NO: 3; iii) ptaC as set forth in SEQ ID NO: 5; iv) ptaD as set forth in SEQ ID NO: 7; and v) ptaE as set forth in SEQ ID NO: 9, and respective variants thereof having at least 70% similarity or identity thereto, such as at least 80%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% similarity or identity thereto.
- said vector vector or system of vectors comprises ptaA as set forth in SEQ ID NO: 1. and respective variants thereof having at least 70% similarity or identity thereto. In some embodiments, said vector vector or system of vectors comprises ptaB as set forth in SEQ ID NO: 3. and respective variants thereof having at least 70% similarity or identity thereto.
- said vector vector or system of vectors comprises ptaC as set forth in SEQ ID NO: 5. and respective variants thereof having at least 70% similarity or identity thereto.
- said vector vector or system of vectors comprises ptaD as set forth in SEQ ID NO: 7. and respective variants thereof having at least 70% similarity or identity thereto.
- said vector vector or system of vectors comprises ptaE as set forth in SEQ ID NO: 9. and respective variants thereof having at least 70% similarity or identity thereto.
- said vector vector or system of vectors comprises two of the above listed the isolated nucleic acids.
- the vector vector or system of vectors may comprise: i) ptaA and ptaB, ii) ptaA and ptaC', iii) ptaA and ptaD, iv) ptaA and ptaE, v) ptaB and ptaC', vi) ptaB and ptaD, vii) ptaB and ptaE, viii) ptaC and ptaD, ix) ptaC and ptaE, x) ptaD and ptaE, or variants thereof having at least 70% similarity or identity thereto, such as at least 80%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 70% similarity or
- said vector vector or system of vectors comprises three of the above listed the isolated nucleic acids.
- the vector vector or system of vectors may comprise: i) ptaA, ptaB and ptaC; ii) ptaA, ptaB and ptaD; iii) ptaA, ptaB and ptaE; iv) ptaA, ptaC and ptaD; v) ptaA, ptaC and ptaE; vi) ptaA, ptaD and ptaE; vii) ptaB, ptaC and ptaD; viii) ptaB, ptaC and ptaE; ix) ptaB, ptaD and ptaE; x) ptaC, ptaD and ptaE, or
- said vector vector or system of vectors comprises four of the above listed the isolated nucleic acids.
- the vector vector or system of vectors may comprise: i) ptaA, ptaB, ptaC and ptaD; ii) ptaA, ptaB, ptaC and ptaE; iii) ptaA, ptaB, ptaD and ptaE; iv) ptaA, ptaC, ptaD and ptaE; v) ptaB, ptaCI, ptaD and ptaE, or respective variants thereof having at least 70% similarity or identity thereto, such as at least 80%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 9
- said vector vector or system of vectors comprises any one of the biosynthetic genes that are sufficient to be introduced in a cell as described herein to synthesize compounds of formula (I), and respective variants thereof having at least 70% similarity or identity thereto.
- NMR spectra were recorded on 800 MHz Bruker Avance III spectrometer equipped with a TCI CryoProbe using standard pulse sequences. NMR data were processed using MestReNova 11.0. UHPLC-HRMS was performed on an Agilent Infinity 1290 LIHPLC system equipped with a diode array detector. UV-Vis spectra were recorded from 190 to 640 nm. Specific rotations were acquired using Perkin-Elmer 241 polarimeter. IR data were acquired on Bruker Alpha FTIR spectrometer using OPUS version 7.2. TLC analysis was performed on silica gel plates (Sil G/UV254, 0.20 mm, Macherey-Nagel).
- Biotage Isolera One Flash Chromatography system was used for flash chromatography and performed on silica gel 60 (Merck, 0.04-0.063 mm, 230-400 mesh ASTM). Sephadex LH-20 was from Pharmacia. All solvents and chemicals used for HRMS and chromatography were VWR Chemicals LC-MS grade, while for metabolites extraction, the solvents were of HPLC grade (VWR Chemicals).
- Streptomyces iranensis DSM 41954 was cultivated in medium 2 (CaCl2'2H2O, 3.0 g; citric acid/Fe III, 1.0 g; MnSC ⁇ O, 0.2 g; ZnCh, 0.1 g; CUSO4 5H2O, 0.025 g;
- Fraction G was firstly fractionated by silica gel chromatography with a CH2CI2/CH3OH gradient to yield 16 fractions, F01-F16.
- F06 was further separated by a Sephadex LH-20 (MeOH) column, and eight sub-fractions were obtained. The first two sub-fractions were combined and separated by HPLC RP-C (MeOH/FW as gradient) to afford 9 (0.9 mg).
- F07 was first separated by a Sephadex LH-20 (MeOH) column, and twelve sub-fractions F07a-l were obtained. From F07e, 8 (15.0 mg) and 6 (4.0 mg) were obtained by repeated HPLC RP-C (CH3CN/H2O as gradient).
- Streptomyces rapamycinicus was cultivated in ISP2 medium (yeast extract (Difco) 4.0 g, malt extract (Difco) 10.0 g, dextrose (Difco) 4.0 g, agar, 20.0 g) for two weeks. Ethyl acetate extraction of the agar was concentrated in methanol, which was analyzed by LCMS.
- Pteridic acid F (6) white solid; [a] ° 81 (0.32 mg/mL, CH3OH), UV (CH3CN/H2O) 4 max (%) 262 (100%) nm; IR (ATR) v m ax 2967, 2934, 2879, 1712, 1642, 1600, 1458, 1410, 1383, 1300, 1266, 1223, 1187, 1142, 1109, 1058, 1002, 973 cm’ 1 ; (+)-HRESIMS m/z 383.2418 [M + H] + (calcd for C21H35O6, 383.2428).
- 1 H NMR see Table 2; 13 C NMR see Table 3;
- Pteridic acid H (8) white solid; [a] ° -18 (10 mg/mL, CH3OH), UV (CH3CN/H2O) 4 max (%) 264 (100%) nm; IR (ATR) v m ax 2968, 2931 , 2877, 1692, 1643, 1618, 1458, 1410, 1380, 1299, 1270, 1188, 1138, 1106, 1059, 1002, 973, 850 cm’ 1 ; (+)-H RESIMS m/z 383.2418 [M + H] + (calcd for C21H35O6, 383.2428).
- 1 H NMR see Table 2; 13 C NMR see Table 3;
- Pteridic acid I (9) white solid; [a] ° -4 (0.44 mg/mL, CH3OH), UV (CH3CN/H2O) 4 max 264 (100%) nm; IR (ATR) v m ax 2968, 2934, 2874, 1717, 1598, 1454, 1408, 1302, 1265, 1222, 1142, 1056, 1002 cm’ 1 ; (+)-HRESIMS m/z 395.2426 [M+H] + (calcd fo ⁇ HssOe, 395.2428).
- 1 H NMR see Table 2; 13 C NMR see Table 3. Table 2.
- X-ray data collection of 8 was performed on an Agilent Supernova Diffractometer using CuKa radiation. Data were processed and scaled using the CrysAlisPro software (Agilent Technologies). The structure was solved using SHELXS and refined using SHELXL. Hydrogen atoms were included on ideal positions using riding coordinates. The absolute configuration was determined based on the Flack parameter.
- Pteridic acids F, H and I were tested for their activity in helping mung beans cope with salinity, heavy metal and drought stress using a Petri dish assay.
- ABA and IAA were used as controls.
- an assay of growing mung beans on petri dish were carried out. mung beans were pre-germinated and placed on top of the Murashige and Skoog medium agar, supplemented with 100 mM NaCI or 10 mM CuSC , with 1.0 ng/mL pure substance.
- For drought assay a solution of 15% PEG-6000 was absorbed into a cotton cloth. Mung beans were placed on the top of the cloth. All mung beans were grown under darkness, 21 °C for two days, three days and four days for drought, salinity and heavy metal, respectively. Student t-test was used for the statistical analysis.
- All strains and plasmids used are listed in Table 4. All Escherichia coli strains were grown in liguid/solid LB medium (5 g/L yeast extract, 10 g/L peptone, 10 g/L NaCI) at 37 °C. Wild type S. iranensis HM35 and mutants were grown on MS (Mannitol Soya Flour) medium (20 g/L, D-mannitol, 20 g/L fat-reduced soy flour, and 20 g/L agar).
- MS Merannitol Soya Flour
- apramycin 50 pg/mL
- chloramphenicol 25 pg/mL
- kanamycin 50 pg/mL
- PCR polymerase chain reaction
- cloning were conducted according to standard procedures using manufacturer protocols. PCR was performed using Q5® High-Fidelity 2* Master Mix or OneTaq® Quick-Load® 2X Master Mix with Standard Buffer (New England Biolabs, USA). DNA assembly was done by using NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs, USA). DNA digestion was performed with FastDigest restriction enzymes (Thermo Fisher Scientific, USA).
- NucleoSpin® Gel and PCR Clean-up kit (Macherey-Nagel, Germany) was used for DNA clean-up both from PCR products and agarose gel extracts.
- One ShotTM Maehl TM T1 Phage-Resistant Chemically Competent E. coli (Thermo Fisher Scientific, USA) was used for cloning.
- NucleoSpin® Plasmid EasyPure Kit (Macherey-Nagel, Germany) was used for plasmid preparation. Sanger sequencing was carried out using Mix2Seq kit (Eurofins Scientific, Germany). All DNA manipulations experiments were conducted according to standard procedures using manufacturer protocols. We diligently followed all waste disposal regulations of our institute, university, and local government when disposing of waste materials. Table 5. Summary of primers used in this study.
- the gene annotation for the pteridic acids biosynthetic gene cluster is shown in Table 1.
- the oligo was designed as Del-ptaA and the pCRISPR-BEST plasmid was linearized by Ncol.
- the linearized pCRISPR-BEST plasmid then will be bridged by Del-ptaA, ending up with the desired pCRISPR- cBEST/AptaA
- the recombinant plasmid is transformed into chemically competent E.
- NOESY spectrum confirmed its relative configurations, where correlations between H-21 and H-13 and H- 15, H-7 and H-12a, and H6, H-10 and Me-18 were observed.
- the key NOESY correlations between H-7 and H-12a revealed a different spirolketal structure compared to 6. This can be also reflected by the relative up-field NMR data for C-12 (633.8 vs 6 37.4 in 6).
- Literature survey revealed that a same chemical was claimed to be isolated from Streptomyces pseudoverticillus YN 17707. 5 Pteridic acid F was also isolated from a marine Streptomyces sp. 4
- Compound 9 was a white solid, isolated as a third pteridic acid derivative. Its formula C22H34O6 was deduced by the ESIMS [M + H] + 395.2426 (calculated for 395.2428, 0.55 ppm).
- the 1 H NMR spectrum exhibited signals for four olefinic protons (67.23, 6.16, 6.02, 5.86) corresponding to two conjugated double bonds, three oxygen-bearing methines (64.14, 3.76, 3.75), six methyls and other aliphatic protons.
- the 13 C NMR spectrum indicated the presence of two carbonyl groups (6211.3, 169.3) and one oxygen-bearing quaternary carbon (6 102.2, C-11).
- pteridic acid H is the primary metabolite from the BGC and the other pteridic acids are transformed metabolites.
- KS ketosynthase domain
- AT acyltransferase domain
- AGP acyl carrier protein domain
- modification modules such as a p-ketoreductase domain (KR), a dehydratase domain (DH), and an enoyl reductase domain (ER).
- KR p-ketoreductase domain
- DH dehydratase domain
- ER enoyl reductase domain
- the growing polyketide chain transfers from the AGP of the first extender module to the KS of the next module, and when the carbon chain reaches the final extension, the linear polyketide is released by a thioesterase (TE).
- TE thioesterase
- Pteridic acids are assembled by multi- modular type I polyketide synthases following the PKS pattern collinearity, including eight modules, corresponding to one starting unit (acetyl-CoA) followed by seven extensions (methylmalonyl-CoA or ethylmalonyl-CoA), to form a linear polyketide precursor.
- the 6,6-spiroketal core structure is formed because spontaneous spiroketalization of the carbonyl group on C11 and the two hydroxyl groups on C17 and C25. Following a loss of H2O, two different oriented spiro rings were formed to yield compound pteridic acid F and H.
- the KR in module 3 is inactive and the DH in module 1 may be selectively in trans acting on the malonyl unit in module 2. 7
- Actinobacteria harboring pteridic acid biosynthetic gene cluster e.g., Streptomyces zinciresistens, Streptomyces buecherae, Streptomyces malaysiensis, Streptomyces samsunensis, Streptomyces hygroscopicus, Streptomyces antioxidans, Streptomyces javensis, Streptomyces rhizosphaericus, Streptomyces al bus, Streptomyces physcomitrii, Streptomyces yatensis, Streptomyces solisilvae, Streptomyces melanosporofaciens, Streptomyces lasiicapitis, Streptomyces autolyticus, Streptomyces zinciresistens K42, Streptomyces cangkringensis, Streptomyces
- Example 4 Effects of pteridic acids and pteridic acids producers in planta Pteridic acids F, H and I and pteridic acids producers have been tested of their biostimulant effects in two different plants (mung beans and barley) under three abiotic stresses (drought, heavy metal and salinity). The results clearly distinguished the effects from the prior art pteridic acids A-B.
- Pteridic acid H was tested for its stress hormone function in comparison with ABA in a Petri Dish assay. Unlike pteridic acids A-B, pteridic acid H could not promote the formation of adventitious roots in the hypocotyl of beans, no auxin-like activities were observed for pteridic acid H (Figure 9). Instead, it promotes the growth of hypocotyl in mung beans. Pteridic acid H could enhance hypocotyl growth (Table 8).
- both pteridic acids H and I could significantly (vs. control, t-test, p ⁇ 0.01%) reduce the salinity effects and performed better than ABA, with an average hypocotyl length of 24.7 mm (pteridic acid F), 25.3 mm (pteridic acid I) and 22.7 mm (ABA). Meanwhile, compared to the control (39.3 mm) and NaCI (12.0 mm) using, neither IAA and pteridic acid F showed effect and there was a similar growth as the control (Table 10).
- Pteridic acid H and ABA could help barley cope with drought stress under 10 nM (Figure 11). Inoculation of pteridic acids producers S. rapamycinicus and S. violeceuniger could help barley cope with drought stress (Figure 12).
- Table 8 Hypocotyl growth of mung beans under treatment of pteridic acids F, H and I, IAA and ABA (1 ng/mL).
- Table 9 Hypocotyl growth of mung beans under drought condition (mediated by 15% PEG-6000), with treatment of pteridic acids F, H and I, IAA and ABA (1 ng/mL).
- Wheat seeds (35-40 seeds per petri dish, 3 parallels for each treatment) were put on the sterilized filter paper after disinfection with 70 % ethanol for 30s and 2 % sodium hypochlorite for 12 min. Wheat seeds where treated with 7 mL of different concentrations of pteridic acid H (0.25, 0.5, 1.0 ng/mL) or distilled Milli-Q water (blank control). Then, after 5 days (incubation parameters: day/night cycle of 16/8h; 50%, 60%, 70%, 100% of circulation wind velocity for 12 h, 2 h, 2h, 8h, respectively), the amount of germinated and ungerminated seeds were counted and the average germination rate was calculated for each group. Statistical significance was assessed by one-way ANOVA with post hoc Dunnett’s multiple comparisons test. Asterisks indicate the level of statistical significance: *P ⁇ 0.05, **P ⁇ 0.01 and ***P ⁇ 0.001.
- Pteridic acid H showed a promoting effect on germination rate of wheat seeds (Figure 13), and significant differences were detected between blank control and the group treated with 0.5 and 1 ng/mL pteridic acid H. In particular, 0.5 ng/ml was the concentration of pteridic acid H that had the strongest observed effect.
- Kidney beans seeds (approximately 2 cm in length, from organic farming) were firstly sterilized successively with ethanol (70 % v/v) and sodium hypochlorite (5 % v/v), each for 2 min, and then rinsed with sterile Milli-Q water (three times). The sterilized seeds were cultivated in plates with MS (Murashige and Skoog Basal Medium, Sigma-Aldrich) diluted 1 :2 and 0.2 % Phytagel (Phytagel, Sigma-Aldrich) for 3-4 days.
- the seedlings After germination, the seedlings (with 1.5-2 cm long roots) were soaked in 10 mL aliquot of testing compounds (pteridic acid H or pteridic acid F, 1.0 ng/mL, dissolved in sterile Milli-Q water) in ultra clear polypropylene containers (0 34 mm, vol. 20 mL) with polyethylene cap. Control group was treated with 10 mL sterile Milli-Q water. For each treatment, three replicate (containers) were used, and each replicate included four seedlings.
- the seeds were transferred into a cut square petri dish (10 cm*10 cm) with on the top layer of a 200 g mixture of 80 % sandy soil (from field) and 20% Light Mix soil (from Biobizz organics). The seeds where then incubated vertically in a growth chamber (24/22 °C, day/night cycle of 16/8 h; 50%, 60%, 70%, 100% of circulation wind velocity for 12 h, 2 h, 2h, 8h, respectively) for 7 days.
- Pteridic acids A and B have been reported to stimulate adventitious root growth in kidney beans.
- the growth promoting effect of pteridic acids H and pteridic acid F is clearly different from the effect of pteridic acids A and B.
- Mung beans seeds were firstly disinfected with 70 % ethanol (30 s) and 2 % sodium hypochlorite (12 min) and rinsed with sterile Milli-Q water for three times. Then they were moved into autoclaved glass tubes (15 mL) and put on the top layer of 5 mL of MS (Murashige and Skoog Basal Medium, Sigma-Aldrich) diluted 1 :2 and 0.2 % Phytagel (Phytagel, Sigma-Aldrich), which had been pre-mixed with different concentrations of pteridic acid H or F (PAH or PAF, 0.25, 0.5, 1.0, 5.0, 10.0 ng/mL), or sterile Milli-Q water (blank control), and each treatment included ten seeds.
- MS Merashige and Skoog Basal Medium, Sigma-Aldrich
- Seeds of barley or wheat were firstly sterilized with 70 % (v/v) ethanol (30 s) and 2 % (v/v) sodium hypochlorite (12 min) and rinsed with sterile Milli-Q water for three times. The sterilized seeds were incubated for 3 days on filter paper filled with sterile Milli-Q water in a petri dish. After germination, the seedlings (with 1-1.5 cm long shoots) were soaked in 10 mL aliquot of pteridic acid H or pteridic acid F (0.25, 0.5, 1.0, 5.0,10.0 ng/mL) in ultra-clear polypropylene containers (0 34 mm, vol. 20 mL) with polyethylene cap.
- pteridic acid H or pteridic acid F (0.25, 0.5, 1.0, 5.0,10.0 ng/mL
- Control group was treated with 10 mL sterile Milli-Q water. For each treatment 10 seedlings were included. After incubation for 24 h, the seeds were transferred into plastic pots (0.28 L for wheat and 0.41 L for barley seedlings) with Light Mix soil mixture (from Biobizz organics), then incubated in a growth chamber (24/22 °C, day/night cycle; 16/8h, 50%, 60%, 70%, 100% circulation wind velocity for 12h, 2h, 2h, 8h, respectively) for 5 days. Square plates filled with water were put under the pots to help the soil keep adequate moisture.
- Petri dishes with seeds were placed vertically in growth chambers (24/22 °C; day/night cycle of 16/8 h; 50%, 60%, 70%, 100% of circulation wind velocity for 12 h, 2 h, 2h, 8h, respectively) for 3 days, and seedlings with 1-2 cm long roots were selected and transferred to new agar plates with different concentrations of pteridic acid H (PAH, 0.25, 0.5, 1.0, 5.0, 10.0 ng/mL) and continued to grow in the chamber for another 5 days. Data of 10 Arabidopsis seedlings were collected for each treatment.
- PAH pteridic acid H
- the excessive salinity stress was conducted at a concentration of 80 mM NaCI, and the drought stress was induced by 10 % (v/v) PEG or 20% (v/v) PEG.
- Statistical significance was assessed by one-way ANOVA with post hoc Dunnett’s multiple comparisons test. Asterisks indicate the level of statistical significance: *P ⁇ 0.05, **P ⁇ 0.01 and ***P ⁇ 0.001.
- Drought stress resistance of Arabidopsis was significantly improved by pteridic acid H (0.25, 0.5 and 1 ng/mL) under both 10% and 20% PEG treatments.
- Treatment with 0.25, 0.5 or 1 ng/mL completely rescued root length growth, as there was no significant difference between 10% PEG and control.
- root length was even increased in the group treated with pteridic acid H in drought conditions caused by 20% PEG compared to control ( Figure 23), and more more lateral roots were induced ( Figure 24).
- pteridic acid H or F The effect of 1.3 nM pteridic acid H or F was compared to treatments with a similar concentration auxin or ABA on Arabidopsis grown under conditions of drought (15% PEG) or high salinity (80 mM NaCI). Under stress conditions, both pteridic acids showed an effect on plant growth that resembled ABA ( Figure 32). In particular, pteridic acid H was capable of promoting primary root length and fresh weight consistently more than a similar concentrations of ABA.
- Pteridic acid H was dissolved with different water solutions to reach the concentration of 0.067 mg/mL for LC-ESI-HRMS/MS analyses. Water solutions of different pH were adjusted by 1M NaOH and 1M HCI.
- Ultra-high-performance liquid chromatographydiode array detection-quadrupole time-of-flight mass spectrometry (UHPLC-DAD- QTOFMS) was performed on an Agilent Infinity 1290 UHPLC system equipped with a diode array detector. Separation was achieved on a 250 x 2.1 mm i.d. , 2.7 pm, Poroshell 120 phenyl-hexyl column (Agilent Technologies) held at 60 °C and following previously described conditions 8 .
- Mass spectrometry (MS) detection was performed on an Agilent 6545 QTOF MS equipped with an Agilent dual jet stream electrospray ion source (ESI) with a drying gas temperature of 160 °C, a gas flow of 13 L min -1 , a sheath gas temperature of 300 °C, and a flow rate of 16 L min -1 .
- Capillary voltage was set to 4000 V and nozzle voltage to 500 V in positive mode.
- MS spectra were recorded as centroid data, at an m/z of 100-1700, and auto MS/HRMS fragmentation was performed at three collision energies (10, 20, and 40 eV), on the three most intense precursor peaks per cycle.
- the acquisition rate was 10 spectra s -1 .
- Pteridic acid H tested stable the first 3 days in pH 3 water solution, 4 °C, part of it was transferred to 25 °C for further test after 3 days, and the left was kept in 4 °C. After 11 days, nearly 20% of the pteridic acid H was transformed to pteridic acid F ( Figure 25).
- Pteridic acid H was unstable in pH 3 water solution, 25 °C. Pteridic acid H was transformed to pteridic acid F fast, and after 3 days 50% of pteridic acid H had already transformed into pteridic acid F. The transformation rate is approximately 12.5%, 25%, 37.5%, 50% in 1 d, 3 d, 5 d and 7 d in pH 3 water solution, 25 °C ( Figure 26).
- Pteridic acid H was stable in pH 7 water solution in 4 °C with low ability to transform to pteridic acid F even after 11 days (Figure 27).
- Pteridic acid H was stable in pH 7 water solution in 25 °C with low ability to transform to pteridic acid F even after 11 days (Figure 28).
- Streptomyces strains were grown on agar plates of ISP medium 3 (oatmeal 20.0 g, agar 18.0 g, trace salts solution 1 mL, distilled deionized water 1 L) at 28 °C in the chamber.
- the trace salts solution consisted of FeSO ⁇ FW 0.1 g, MnCh'4 H2O 0.1 g, ZnSC>4-7 H2O 0.1 g and distilled deionized water 100 mL.
- an agar plug (6 mm diameter) of the bacterial culture was taken out of the agar plates and transferred to a vial (Eppendorf) and extracted with 1 mL of methanol under ultrasonication for 60 min.
- the extracts were then transferred to new vials (Eppendorf), evaporated to dryness under N2, and re-dissolved in 200 pL of methanol for further sonication over 15 min (or vortex). After centrifugation at 13400 rpm for 3 min, the supernatants were transferred to HPLC vials and subjected to ultrahigh-performance liquid chromatography-high resolution electrospray ionization mass spectrometry (UHPLC-HRESIMS) analysis.
- UHPLC-HRESIMS ultrahigh-performance liquid chromatography-high resolution electrospray ionization mass spectrometry
- Ultra-high-performance liquid chromatography-diode array detection-quadrupole time- of-flight mass spectrometry (UHPLC-DAD-QTOFMS) was performed on an Agilent Infinity 1290 UHPLC system equipped with a diode array detector. Separation was achieved on a 250 * 2.1 mm i.d. , 2.7 pm, Poroshell 120 phenyl-hexyl column (Agilent Technologies) held at 60 °C and following previously described conditions.
- Mass spectrometry (MS) detection was performed on an Agilent 6545 QTOF MS equipped with an Agilent dual jet stream electrospray ion source (ESI) with a drying gas temperature of 160 °C, a gas flow of 13 L min -1 , a sheath gas temperature of 300 °C, and a flow rate of 16 L min -1 .
- Capillary voltage was set to 4000 V and nozzle voltage to 500 V in positive mode.
- MS spectra were recorded as centroid data, at an m/z of 100- 1700, and auto MS/HRMS fragmentation was performed at three collision energies (10, 20, and 40 eV), on the three most intense precursor peaks per cycle.
- the acquisition rate was 10 spectra s -1 .
- Ri and R2 are independently selected from the group consisting of: hydrogen, alkyl and halogen;
- Rs is selected from the group consisting of: hydrogen, oxygen, methoxy, and hydroxy
- R4 is selected from the group consisting of: hydrogen, methyl and ethyl
- X is selected from oxygen and nitrogen; n is selected from 1 and 2, preferably the compound is of formula (VII): or a salt or solvate thereof; wherein,
- Ri and R2 are independently selected from the group consisting of: hydrogen, alkyl and halogen;
- Rs is selected from the group consisting of: oxygen, methoxy, and hydroxy
- X is selected from oxygen and nitrogen; preferably the compound is of formula (II):
- composition according to item 12 wherein the composition comprises any one of the pteridic acids selected from the group consisting of: pteridic acid H, pteridic acid F, and pteridic acid I.
- the composition according to any one of items 12 to 13 wherein the composition further comprises an acceptable carrier.
- the composition according to any one of items 12 to 14 wherein the composition further comprises one or more additional compounds selected from the group consisting of a liquid carrier, a solid carrier and a substrate.
- An isolated nucleic acid comprising or consisting of a nucleic acid selected from the group consisting of: i) ptaA as set forth in SEQ ID NO: 1; ii) ptaB as set forth in SEQ ID NO: 3; iii) ptaC as set forth in SEQ ID NO: 5; iv) ptaD as set forth in SEQ ID NO: 7; and v) ptaE as set forth in SEQ ID NO: 9, and respective variants thereof having at least 70% similarity or identity thereto, such as at least 80%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% similarity or identity thereto.
- a vector or a system of vectors comprising any one of the isolated nucleic acids selected from the group consisting of: i) ptaA as set forth in SEQ ID NO: 1; ii) ptaB as set forth in SEQ ID NO: 3; iii) ptaC as set forth in SEQ ID NO: 5; iv) ptaD as set forth in SEQ ID NO: 7; and v) ptaE as set forth in SEQ ID NO: 9, and respective variants thereof having at least 70% similarity or identity thereto, such as at least 80%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% similarity or identity thereto.
- vector or system of vectors comprising all the isolated nucleic acids: i) ptaA as set forth in SEQ ID NO: 1; ii) ptaB as set forth in SEQ ID NO: 3; iii) ptaC as set forth in SEQ ID NO: 5; iv) ptaD as set forth in SEQ ID NO: 7; and v) ptaE as set forth in SEQ ID NO: 9, and respective variants thereof having at least 70% similarity or identity thereto, such as at least 80%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% similarity or identity thereto.
- the cell according to item 19 wherein the cell is a non-natural cell, expressing one or more heterologous proteins selected from the group consisting of: i) PtaA as set forth in SEQ ID NO: 2, ii) PtaB as set forth in SEQ ID NO: 4, iii) PtaC as set forth in SEQ ID NO: 6, iv) PtaD as set forth in SEQ ID NO: 8, and v) PtaE as set forth in SEQ ID NO: 10, or functional variants thereof having at least 70% similarity or sequence identity thereto, such as at least 75%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 95% sequence identity thereto.
- heterologous proteins selected from the group consisting of: i) PtaA as set forth in SEQ ID NO: 2, ii) PtaB as set forth in SEQ ID NO: 4, iii) PtaC as set forth in SEQ ID NO: 6, iv) Pt
- cell according to any one of items 19 to 21 wherein the cell is a nonnatural cell, preferably a non-natural cell comprising any one of the isolated nucleic acids according to item 16, such as in the genome or on a vector, preferably the vector or system of vectors according to any one of items 17 or 18.
- the compound, or the composition, or the method according to item 31 wherein the purification is conducted by organic solvent extraction followed by chromatographic separation by Sephadex LH-20 and silica gel chromatography. 33.
- a method of promoting the growth of a plant, promoting seed germination, and/or reducing the stress on a plant comprising contacting a compound as defined in any one of items 1 to 11 , or the composition as defined in any one of items 12 to 15, with the plant.
- any one of the parameters selected from the group consisting of: the root length; the shoot length; the fresh weight; and the dry weight, of the plant is increased of at least 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%,
- any one of items 33 to 36 wherein the plant is grown under stress conditions, preferably under abiotic stress conditions such as drought conditions, high soil salinity and/or high levels of heavy metals in the soil in which the plant is grown.
- the method according to any one of items 33 to 37 wherein the root length of the plant grown under stress conditions, preferably under abiotic stress conditions such as drought conditions, high soil salinity and/or high levels of heavy metals in the soil in which the plant is grown is increased of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 160%, 180%, 200%, 220%, 240%, 260%, 280%, 300%, 350%, 400%, 450%, or 500% compared to the root length of another plant of the same species which is not contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
- the drought condition is defined by a drought Palmer drought index less than -2, such as less than -3, less than -4, less than -5, less than -6, less than -7, less than -8, less than -9, or -10.
- the condition of high salinity is defined as an electrical Conductivity (mmhos/cm) greater than 1.26 in the soil, for example greater than 1.3, greater than 1.4, greater than 1.5, greater than 1.75, greater than 2.00.
- any one of items 33 to 40 wherein the condition of high levels of heavy metals is reached when at least one heavy metal, preferably selected from the group consisting of: Cd, Zn, Cu, Cr, Pb and Ni, exceeds the concentration of 10 mg/kg in the soil, such as exceeds the concentration of 12 mg/kg, of 15 mg/kg, of 17 mg/kg, of 20 mg/kg, or more; or the condition of high levels of heavy metals is reached when the sum of the concentrations of individual heavy metals, preferably selected from the group consisting of: Cd, Zn, Cu, Cr, Pb and Ni, exceeds the concentration of 10 mg/kg in the soil, such as exceeds the concentration of 12 mg/kg, of 15 mg/kg, of 17 mg/kg, of 20 mg/kg, or more.
- at least one heavy metal preferably selected from the group consisting of: Cd, Zn, Cu, Cr, Pb and Ni
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biomedical Technology (AREA)
- Environmental Sciences (AREA)
- Plant Pathology (AREA)
- Botany (AREA)
- General Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Pest Control & Pesticides (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Developmental Biology & Embryology (AREA)
- Biophysics (AREA)
- Agronomy & Crop Science (AREA)
- Microbiology (AREA)
- Dentistry (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
- Organic Low-Molecular-Weight Compounds And Preparation Thereof (AREA)
Abstract
The present disclosure relates, generally, to pteridic acids and derivatives thereof, in particular pteridic acids H, F, and I, their production, and their use to promote plant growth and/or to reduce plant stress, such as abiotic stress.
Description
Ptendic acids and uses thereof
Technical field
The present disclosure relates, generally, to pteridic acids and derivatives thereof, their production, and their use to promote plant growth or to reduce plant stress, such as abiotic stress.
Background of the Invention
In modern agriculture, environmental stress that limits yields, owing to shifts in precipitation, heat waves, and other weather extremes represents a major challenge to achieve greater and more efficient crop production.
In natural ecosystems, plants engage with beneficial microorganisms that facilitate the uptake of limiting nutrients. Those microbial communities have been demonstrated to help plants cope with biotic and abiotic stresses. However, in modern agriculture, these beneficial associations are often dampened by supplied fertilizers. As a result, crops are particularly sensitive to environmental changes such as flooding, drought, soil salinity, and extreme temperatures.
Plant functioning under stress is affected by plant hormones, which can help the plant tolerate environmental stresses. Plant hormones include auxin, abscisic acid, ethylene, gibberellins, cytokines, salicylic acid, strigolactones, brassinosteroids, and nitrous oxide. Among those hormones, abscisic acid is well-known to enhance plant fitness and cope with abiotic stresses. Supplementing plant hormones to crops represents an attractive strategy to promote resistance to environmental stresses in a natural way.
Abiotic stress, such as drought, salinity and cold can stimulate the production of the hormone abscisic acid (ABA) in plants. ABA helps to regulate root growth in response to water availability, including inhibition of lateral root growth and enhancement of primary and secondary root growth. This developmental reprogramming allows roots to seek water under water-limited conditions.
Recent progress has revealed mechanisms of ABA receptor and signal transduction for the enhancement of dehydration tolerance. ABA closes the stomatai pores on the leaf surface to reduce the water loss during drought, but this response can be weak in crop
varieties. Application of exogenously sprayed ABA could enhance the resilience of plants with stresses1 2.
Based on this knowledge, the application of abscisic acid could serve as a promising strategy for future agriculture. However, its relatively high price limits currently its wide application in agriculture.
Environmental-friendly and more economic alternatives to abscisic acid are thus needed.
Summary of the Invention
The present disclosure identifies a series of compounds that can be used as ABA alternatives to promote plant growth and/or reduce plant stress, as well as methods of producing and using these compounds.
In a first aspect, a compound of formula (IX) is provided,
or a salt or solvate thereof; wherein,
Ri and R2are independently selected from the group consisting of: -H, alkyl and halogen;
Rs is selected from -H and [-OH, OCH3, or O];
R4 is selected from -H, methyl or ethyl;
X is selected from O and N; n is selected from 1 and 2, preferably the compound is of formula (X):
Thus, in an aspect, a compound of formula (I) is provided,
or a salt or solvate thereof; wherein,
Ri and R2are independently selected from the group consisting of: -H, alkyl and halogen;
Rs is selected from -OH, OCH3, or O;
X is selected from O and N; n is selected from 1 and 2, preferably the compound is of formula (II):
In another aspect is provided an isolated nucleic acid comprising or consisting of a nucleic acid selected from the group consisting of: i) ptaA as set forth in SEQ ID NO: 1; ii) ptaB as set forth in SEQ ID NO: 3;
iii) ptaC as set forth in SEQ ID NO: 5; iv) ptaD as set forth in SEQ ID NO: 7; v) ptaE as set forth in SEQ ID NO: 9, and respective variants thereof having at least 70% similarity or identity thereto, such as at least 80%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% similarity or identity thereto.
In another aspect is provided a vector or a system of vectors comprising an isolated nucleic acid selected from the group consisting of: i) ptaA as set forth in SEQ ID NO: 1; ii) ptaB as set forth in SEQ ID NO: 3; iii) ptaC as set forth in SEQ ID NO: 5; iv) ptaD as set forth in SEQ ID NO: 7; v) ptaE as set forth in SEQ ID NO: 9, and respective variants thereof having at least 70% similarity or identity thereto, such as at least 80%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% similarity or identity thereto.
In another aspect is provided a cell producing the compound as defined herein.
In another aspect is provided a compound as defined herein, obtainable by a method comprising growing a cell as defined herein, in a cultivation broth, under conditions allowing the production of the compound.
In another aspect is provided a method of producing the compound as herein defined, comprising growing a cell as defined herein, in a cultivation broth, under conditions allowing the production of the compound.
In another aspect is provided a method of promoting the growth of a plant, promoting seed germination, and/or reducing the stress on a plant, said method comprising contacting the plant with the compound defined herein.
Thus, in another aspect is provided a method of promoting the growth of a plant, and/or reducing the stress on a plant, said method comprising contacting the plant with the compound defined herein.
In another aspect is provided a method of promoting the growth of a plant, and/or promoting seed germination, said method comprising contacting the plant with the compound defined herein.
In another aspect is provided a method of promoting seed germination, and/or reducing the stress on a plant, said method comprising contacting the plant with the compound defined herein.
In another aspect is provided a use of the compound according as defined herein, to promote growth of a plant and/or to reduce the stress of a plant.
The invention is further defined in the claims attached hereto.
Description of Drawings
Figure 1 shows the structure of the pteridic acids that have been isolated from microorganisms. Pteridic acid A (1), pteridic acid B (2), pteridic acid C (3), pteridic acid D (4), pteridic acid E (5), pteridic acid F (6), pteridic acid G (7), pteridic acid H (8), pteridic acid I (9).
Figure 2 shows the result of an Extracted Ion Chromatogram (ESI positive mode m/z 383.2428, 10 ppm) reporting the production of pteridic acids F and H by both S. rapamycinicus and S. iranensis.
Figure 3 shows selected HMBC correlations for compounds pteridic acid F (6), pteridic acid H (8), pteridic acid I (9).
Figure 4 shows an ORTEP diagram displaying the atom-numbering scheme and solid- state conformation of pteridic acid H (8).
Figure 5 illustrates that the storage of pteridic acid H in solution (roughly 1 : 1 month; 2: 3 months; 3: 6 months) led to transformation to pteridic acid F and other related metabolites.
Figure 6 shows the open reading frame (ORF) map of the pteridic acids (elaiophylin) biosynthetic locus from S. iranensis HM35.
Figure 7 shows the LCMS profile reporting the abolishment of pteridic acids production following a mutation of ptaA. Extracted Ion Chromatography in positive mode of pteridic acid F ([M+H]+, m/z 383.2428). (I) The mutant strain S. iranensis HM35/AptaA; (II) The wild-type S. iranensis HM35. (1) pteridic acid H; (2) pteridic acid F. AU = arbitrary units, Min = minutes.
Figure 8 shows a proposed biosynthetic pathway for pteridic acids F (6), H (8) and I (9).
Figure 9 shows enhancement of hypocotyl growth of mung beans with pteridic acid H treatment. Left: pteridic acid H 1.0 ng/mL, right: water control. Hypocotyl length increased by 21%. No promotion of adventitious root growth was observed.
Figure 10 illustrates that pteridic acid H or ABA help the growth of mung beans under a heavy metal condition (10 mM CuSC ).
Figure 11 illustrates that pteridic acid H and ABA at 10 nM help barley against drought stress (mediated by 20% PEG-6000).
Figure 12 illustrates that pteridic acid microbial producers S. rapamycinicus and S. violaceusniger help barley against drought stress (mediated by 20% PEG-6000).
Figure 13 illustrates the effect of different concentrations of pteridic acid H (PAH, 0.25, 0.5, 1.0 ng/mL) on germination rate of wheat seeds. CK: blank control. Values are mean ± SD of three independent experiments, * P< 0.05, ** P < 0.01 , *** P < 0.001.
Figure 14 illustrates the promoting effect of pteridic acids on kidney beans. 14A: kidney beans seedlings growing in cut square Petri dish. Different groups were treated
with ptendic acid H (PAH, 1.0 ng/mL), ptendic acid F (PAF, 1 ng/mL) or distilled water (CK, blank control). Bars = 2 cm. 14B: corresponding statistical analyses on shoot lengths of kidney beans seedlings with the same treatment as in Figure 2a. Values are mean ± SD, ** P < 0.01.
Figure 15 shows no formation of adventitious root in kidney beans seedlings treated with pteridic acid H (PAH, 1.0 ng/mL) or pteridic acid F (PAF, 1.0 ng/mL). Distilled water was used for the control group (CK, blank control). Bars = 1 cm.
Figure 16 illustrates the effect of different concentrations of pteridic acid H (PAH, 0, 0.25, 0.5, 1.0, 5.0, 10.0 ng/mL) on seedling growth of mung beans. Values are mean ± SD (n = 10), * P< 0.05, ** P < 0.01 , *** P < 0.001.
Figure 17 shows mung beans cultivated in glass tubes with MS (diluted 1:2) agar and more lateral roots showed when treated with PAH, compared to blank control.
Figure 18 illustrates the effect of different concentrations of pteridic acid F (PAF, 0, 0.25, 0.5, 1.0, 5.0, 10.0 ng/mL) on seedling growth of mung beans. Values are mean ± SD (n = 10), * P< 0.05.
Figure 19 illustrates the effect of pteridic acids H and F on barley seedlings. 19A and 19B: effect of different concentrations of pteridic acid H or F (PAH or PAF, 0.25, 0.5, 1.0, 5.0, 10.0 ng/mL) and distilled water (CK, blank control) on seedling growth of barley. Values are mean ± SD (n=10), * P< 0.05, ** P < 0.01, *** P < 0.001.19C: images of barley treated with different concentrations of PAH (0.25, 0.5, 1.0, 5.0, 10.0 ng/mL) with distilled water as blank control (CK). Bar = 4 cm.
Figure 20 illustrates the effect of different concentrations of pteridic acid H (PAH, 0.25, 0.5, 1.0, 5.0, 10.0 ng/mL) and distilled water (CK, blank control) on seedling growth of wheat. 20A: Quantification. 20B: representative pictures. Values are mean ± SD (n=10), *** P < 0.001. Bar = 2 cm.
Figure 21 illustrates the effect of different concentrations of pteridic acid H (PAH, 0.25, 0.5, 1.0, 5.0, 10.0 ng/mL) on seedling growth of Arabidopsis under excessive salinity stress. CK: blank control treated by sterile Milli-Q water; NaCI: the excessive salinity
stress conducted by 80 mM NaCI. Data are mean ± SD (n=10), * P< 0.05, ** P < 0.01, *** P < 0.001.
Figure 22 shows pictures of Arabidopsis seedlings treated with different concentrations of pteridic acid H (PAH, 0.25, 0.5, 1.0, 5.0, 10.0 ng/mL) under excessive salt stress. CK: blank control treated by sterile Milli-Q water; NaCI: the excessive salinity stress conducted by 80 mM NaCI. Bar = 1 cm.
Figure 23 illustrates the effect of different concentrations of pteridic acid H (PAH, 0.25, 0.5, 1.0 ng/mL) on seedling growth of Arabidopsis under drought stress. CK: blank control treated by sterile Milli-Q water; PEG 10% and PEG 20%: drought stress induced by 10 % (v/v) PEG and 20% (v/v) PEG separately. Data are mean ± SD (n=10), * P< 0.05, ** P < 0.01 , *** P < 0.001.
Figure 24 illustrates the effect of pteridic acid H on Arabidopsis under drought stress 24A: Effects of different concentrations of pteridic acid H (PAH, 0.25, 0.5, 1.0 ng/mL) on seedling growth. CK: blank control treated by sterile Milli-Q water; PEG 10% and PEG 20%: drought stress induced by 10 % (v/v) PEG and 20% (v/v) PEG, respectively. 24B: Images of Arabidopsis growing on agar plates treated with different concentrations of PEG. More lateral roots were induced by higher concentration of PEG (20%) than lower treatment. Bar = 2 cm.
Figure 25 shows the time course analysis of the transformation of pteridic acid H to pteridic acid F in pH 3 water solution, at 4 °C, 0 d, 1 d, 3 d and 11 d. * Internal standard/impurity.
Figure 26 shows the time course analysis of the transformation of pteridic acid H to pteridic acid F in pH 3 water solution, at 25 °C, 1 d, 3 d 5 d and 7 d. * Internal standard/impurity.
Figure 27 shows the time course analysis of the transformation of pteridic acid H to pteridic acid F in pH 7 water solution, at 4 °C, 0 d, 1 d, 3 d and 11 d. * Internal standard/impurity.
Figure 28 shows the time course analysis of the transformation of pteridic acid H to pteridic acid F in pH 7 water solution, at 25 °C, 1 d, 3 d 5 d and 7 d. * Internal standard/impurity.
Figure 29 shows the effect of S. iranensis HM 35 on barley seedlings under the abiotic stress. The drought stress and salinity stress were mediated by 20% (w/v) PEG-6000 and 100 mM NaCI, respectively. Mock: control, Si, treatment of S. iranensis HM 35 culture broth; M, treatment of blank medium (ISP2).
Figure 30 shows the box-plot (middle bar = median, box limit = upper and lower quartile, extremes = Min and Max values), which depicts the plant height, fresh weight and dry weight of A. thaliana seedlings growing on drought condition (n =18) mediated by 20% (w/v) PEG-6000; Mock, control; Si, treatment of S. iranensis HM 35 culture broth; D, treatment of S. iranensis HM 35/DptaA culture broth; M, treatment of blank medium (ISP2). Asterisks indicate the level of statistical significance: *P < 0.05, **P < 0.01, ***P < 0.001 and ****P < 0.0001.
Figure 31 shows the box-plot (middle bar = median, box limit = upper and lower quartile, extremes = Min and Max values), which depicts the plant height, fresh weight and dry weight of A. thaliana seedlings growing on salinity stress condition (n =18) mediated by 100 mM NaCI; Mock, control; Si, treatment of S. iranensis HM 35 culture broth; D, treatment of S. iranensis HM 35/DptaA culture broth; M, treatment of blank medium (ISP2). Asterisks indicate the level of statistical significance: *P < 0.05, **P < 0.01, ***P < 0.001 and ****P < 0.0001.
Figure 32. illustrates the effect of pteridic acid H and F on A. thaliana seedlings under the abiotic stress, a, phenotype of A. thaliana growing on modified Murashige & Skoog medium without abiotic stress using different treatments (bars = 1 cm); b, phenotype of A. thaliana growing under drought stress mediated by 15 % (w/v) PEG-6000 using different treatments (bars = 1 cm); c, phenotype of A. thaliana growing under salinity stress mediated by 80 mM NaCI using different treatments (bars = 1 cm); d, the boxplot (middle bar = median, box limit = upper and lower quartile, extremes = Min and Max values) depicts the primary root length and fresh weight of A. thaliana seedlings growing on non-stress condition (n =16); e, the box-plot depicting the primary root length and fresh weight of A. thaliana seedlings growing on drought stress condition (n
=16); f, the box-plot depicting the primary root length and fresh weight of A thahana seedlings growing on salinity stress condition (n =16); g, the heat map of lateral root number of A. thaliana seedlings growing in different conditions; h, the phenotype differences of lateral root growth of A. thaliana seedlings growing in different conditions. Abbreviation: Mock, control; PH, treatment of 1.3 nM pteridic acid H; PF, treatment of 1.3 nM pteridic acid F; IAA, treatment of 1.3 nM indole-3-acetic acid; ABA, treatment of 1.3 nM abscisic acid. Asterisks indicate the level of statistical significance: *P < 0.05, **P < 0.01, ***P < 0.001 and ****P < 0.0001.
Figure 33 illustrates the effect of pteridic acid producers on barley, a, S. violaceusniger Tu 4113 and S. rapamycinicus NRRL 5491 showed abiotic stress (20% PEG and 100 mM NaCI) mitigating effects on barley seedlings, b, Different growth of barley seedlings in water, drought stress mediated by 20% (w/v) PEG-6000 and salinity stress mediated by 100 mM NaCI. Abbreviation: Mock, control; Sv, treatment of S. violaceusniger Tu 4113; Sr, treatment of S. rapamycinicus NRRL 5491. Values are mean ± SE (n = 6) and asterisks indicate the level of statistical significance:
0.0001.
Definitions
With reference to substituents, the term "independently" refers to the situation where when more than one substituent is possible, the substituents may be the same or different from each other.
The term “alkyl” refers to a straight or branched hydrocarbon chain radical consisting of carbon and hydrogen atoms, containing no unsaturation, and may be straight or branched, substituted or unsubstituted. In some preferred embodiments, the alkyl group may consist of 1 to 12 carbon atoms, e.g., 1 carbon atom, 2 carbon atoms, 3 carbon atoms, 4 carbon atoms etc., up to and including 12 carbon atoms. Exemplary alkyl groups include, but are in no way limited to, methyl, ethyl, propyl, isopropyl, n- butyl, iso-butyl, sec-butyl isobutyl, tertiary butyl, pentyl, isopentyl, neopentyl, hexyl, septyl, octyl, nonyl and decyl. The alkyl moiety may be attached to the rest of the molecule by a single bond, such as for example, methyl (Me), ethyl (Et), n-propyl (Pr), 1-methylethyl (iso-propyl), n-butyl, n-pentyl, 1,1 -dimethylethyl (t-butyl) and 3- methylhexyl. Unless stated otherwise specifically in the specification, an alkyl group is optionally substituted by one or more of any suitable substituents. An alkyl group can be mono-, di-, tri- or tetra-valent, as appropriate to satisfy valence requirements. The io
term alkylene by itself or as part of another substituent, means a divalent radical derived from an alkyl moiety, as exemplified, but not limited, by -CH2CH2CH2CH2-.
Generally, suitable substituents for substituted groups disclosed herein independently include, but are not limited to, alkyl, heteroalkyl, alkenyl, alkynyl, cycloalkyl, heterocycloalkyl, aryl, arylalkyl, heteroaryl, heteroarylalkyl, hydroxy, halo, cyano, trifluoromethyl, trifluoromethoxy, nitro, trimethylsilanyl, chloride, bromide, — ORa, — SRa, — OC(O)— Ra, — N(Ra)2, — C(O)Ra, — C(O)ORa, -OC(O)N(Ra)2, -C(O)N(Ra)2, — N(Ra)C(O)ORa, — N(Ra)C(O)Ra, -N(Ra)C(O)N(Ra)2, N(Ra)C(NRa)N(Ra)2,
— N(Ra)S(O)tRa, — N(Ra)S(O)2Ra, -S(O)ORa, -S(O)2ORa, -S(O)N(Ra)2, -S(O)2N(Ra)2, or PO3(Ra)2 where each Ra is independently hydrogen, alkyl, haloalkyl, carbocyclyl, carbocyclylalkyl, aryl, aralkyl, heterocycloalkyl, heterocycloalkylalkyl, heteroaryl or heteroarylalkyl.
The term “nucleic acid” as used herein refers to polynucleotides such as deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) or a combination of the two and any chemical or enzymatic modification thereof (e.g., methylated DNA, DNA of modified nucleotides). The term should also be understood to include, as equivalents, derivatives, variants and analogues of either RNA or DNA made from nucleotide analogues, single (sense or antisense) and double-stranded polynucleotides.
The term “isolated nucleic acid” as used herein refers to a nucleic acid that is separated from its native environment and present in sufficient quantity to permit its identification or use. An isolated nucleic acid may be one that is (i) amplified in vitro by, for example, polymerase chain reaction (PCR); (ii) recombinantly produced or cloned; (iii) purified, as by cleavage and gel separation; or (iv) synthesized by, for example, chemical synthesis. An isolated nucleic acid is one which is readily manipulable by recombinant DNA techniques well known in the art. Thus, a nucleotide sequence contained in a vector in which 5' and 3' restriction sites are known or for which polymerase chain reaction (PCR) primer sequences have been disclosed is considered isolated but a nucleic acid sequence existing in its native state in its natural host is not. An isolated nucleic acid may be substantially purified, but need not be. For example, a nucleic acid that is isolated within a cloning or expression vector is not pure in that it may comprise a small percentage of the material of the cell in which it resides. Such a nucleic acid is isolated, however, as the term is used herein because it is readily
manipulable by standard techniques known to those of ordinary skill in the art. Any of the nucleic acids provided herein may be isolated.
The term “gene” as used herein means a nucleic acid sequence that contains information necessary for expression of a polypeptide or protein. It includes the promoter and terminator and the structural gene as well as other sequences involved in expression of the protein.
The terms “protein” or “polypeptide” as defined herein are used interchangeably and refer to molecules consisting of a chain of amino acids, without reference to a specific mode of action, size, 3-dimensional structure or origin. A fragment or portion of a protein may thus still be referred to as a "protein". An "isolated protein" is used to refer to a protein which is no longer in its natural environment, for example in vitro. A “heterologous protein” refers to a protein which is not naturally present in the cell in which it is expressed, for example it is expressed in a recombinant bacterial or plant host cell. An enzyme is a protein having enzymatic activity.
The term “vector” as defined herein means a DNA molecule capable of replication in a host cell and/or to which another DNA segment can be operatively linked so as to bring about replication of the attached segment. A plasmid is an exemplary vector. A system of vectors comprising several nucleic acids comprises a plurality of vectors, which together comprise a plurality of nucleic acids. The nucleic acids are not necessarily all on the same vector; a vector of the system of vectors may comprise several nucleic acids. For example, a system of vectors comprising five nucleic acids can be: a first vector comprising a first and a second nucleic acids, and a second vector comprising a third, a fourth and a fifth nucleic acids; or five vectors each comprising one of the first, second, third, fourth and fifth nucleic acids.
The term “host cell” as defined herein refers to a cell which includes an exogenous polynucleotide, wherein the methods used to insert the exogenous polynucleotide into a cell include direct uptake, transduction, f-mating, or other methods known in the art to create recombinant host cells. By way of example only, such exogenous polynucleotide may be a non-integrated vector, including but not limited to a plasmid, or may be integrated into the host genome.
The term microorganism as defined herein is meant to include a bacterium, yeast and/or fungi, a cell growth medium comprising the microorganism, e.g., a cell growth medium in which the microorganism was cultivated.
The term “non-natural microorganism” as defined herein refers to a microorganism that has been manipulated to include an exogenous polynucleotide. By way of example only, such exogenous polynucleotide may be a non-integrated vector, including but not limited to a plasmid, or may be integrated into the host genome. A non-natural microorganism may thus express a heterologous protein, i.e., a protein which is not naturally found in the microorganism.
The term "stress condition" as defined herein refers to the exposure of a plant, plant cell, or the like, to a physical, environmental, biological or chemical agent or condition that has an adverse effect on metabolism, growth, development, propagation and/or survival of the plant (collectively “growth”). A stress can be imposed on a plant due, for example, to an environmental factor such as water (e.g., flooding, drought, dehydration), anaerobic conditions (e.g., a low level of oxygen), abnormal osmotic conditions, salinity or temperature (e.g., hot/heat, cold, freezing, frost), a deficiency of nutrients such as nitrogen, phosphate, potassium, sulfur, micronutrient, or exposure to pollutants (e.g., heavy metals), or by a hormone, second messenger or other molecule. Anaerobic stress, for example, is due to a reduction in oxygen levels (hypoxia or anoxia) sufficient to produce a stress response. A flooding stress can be due to prolonged or transient immersion of a plant, plant part, tissue or isolated cell in a liquid medium such as occurs during monsoon, wet season, flash flooding or excessive irrigation of plants, or the like. A cold stress or heat stress can occur due to a decrease or increase, respectively, in the temperature from the optimum range of growth temperatures for a particular plant species. Such optimum growth temperature ranges are readily determined or known to those skilled in the art. Dehydration stress can be induced by the loss of water, reduced turgor, or reduced water content of a cell, tissue, organ or whole plant. Drought stress can be induced by or associated with the deprivation of water or reduced supply of water to a cell, tissue, organ or organism. Saline stress (salt stress) can be associated with or induced by a perturbation in the osmotic potential of the intracellular or extracellular environment of a cell. Osmotic stress also can be associated with or induced by a change, for example, in the concentration of molecules in the intracellular or extracellular environment of a plant
cell, particularly where the molecules cannot be partitioned across the plant cell membrane.
The term “abiotic stress” as defined herein refers to the exposure of a plant, plant cell, or the like, to a non-living (“abiotic”) physical or chemical agent that has an adverse effect on metabolism, growth, development, propagation, or survival of the plant (collectively, “growth”). A stress can be imposed on a plant due, for example, to an environmental factor such as water (e.g., flooding, drought, or dehydration), anaerobic conditions (e.g., a lower level of oxygen or high level of CO2), abnormal osmotic conditions, salinity, or temperature (e.g., hot/heat, cold, freezing, or frost), a deficiency of nutrients or exposure to pollutants (e.g., heavy metals), or by a hormone, second messenger, or other molecule.
The terms “drought” and “drought conditions” as defined herein are used interchangeably and refer to a condition where plant growth or productivity is inhibited relative to a plant where water is not limiting. The term “water-stress” is used synonymously and interchangeably with the drought water stress. Drought conditions may be defined by a drought Palmer drought index less than -2, such as less than -3, less than -4, less than -5, less than -6, less than -7, less than -8, less than -9, or -10.
The term “high salinity” as defined herein refers to an environment around the plant, which leads to a setback of water absorption of the plant and at the same time deprivation of water from the plant body. The condition of high salinity in the soil can be defined as an electrical Conductivity (mmhos/cm) greater than 1.26 in the soil, for example greater than 1.3, greater than 1.4, greater than 1.5, greater than 1.75, greater than 2.00.
The term “high levels of heavy metal in the soil” as defined herein refers to a condition wherein the concentration of heavy metals around the plant leads to an inhibition of plant growth or productivity. Such concentrations are readily determined or known to those skilled in the art. The condition of high levels of heavy metals in the soil may be reached when at least one heavy metal, preferably selected from the group consisting of: Cd, Zn, Cu, Cr, Pb and Ni, exceeds the concentration of 10 mg/kg in the soil, such as exceeds the concentration of 12 mg/kg, of 15 mg/kg, of 17 mg/kg, of 20 mg/kg, or more. High levels of heavy metal in the soil can also be reached when the sum of the
concentrations of heavy metals, preferably selected from the group consisting of: Cd, Zn, Cu, Cr, Pb and Ni, exceeds the concentration of 10 mg/kg in the soil, such as exceeds the concentration of 12 mg/kg, of 15 mg/kg, of 17 mg/kg, of 20 mg/kg, or more.
The terms "lysate of a cell” and “organic extract of a cell” " as defined herein are used interchangeably and refer to cell suspensions or fractions thereof, obtained after lysing the cells. The cell lysate typically contains proteins and other molecules which can be intracellular or extracellular, for example secreted proteins and molecules. The cell lysates comprise an extremely complex mixture of e.g., proteins, glycoproteins, polysaccharides, lipids, nucleic acids etc. All these components may interact with each other. The cell lysate in the solution or suspension of the present disclosure may still comprise some whole cells (e.g., living cells), parts of cells or any fractions or mixtures thereof obtained after a lysis step. The term includes any derivative of a lysate of a cell known to a person skilled in the art. For instance, the lysate may be further processed, e.g., subjected to a step of concentration by evaporation.
The terms identity and similarity, with respect to a polynucleotide (or polypeptide), as defined herein are used interchangeably and refer to the percentage of nucleic acids (or amino acids) in the candidate sequence that are identical or similar, respectively, to the residues of a corresponding native nucleic acids (or amino acids), after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent identity I similarity, and considering any conservative substitutions according to the NCIIIB rules (http://www.chem. qmul.ac.uk/iubmb/misc/naseq.html; NC-llIB, Eur J Biochem (1985)) as part of the sequence identity. In particular, the percentage of similarity refers to the percentage of residues conserved with similar physiochemical properties. Neither 5' or 3' extensions nor insertions (for nucleic acids) or N’ or C’ extensions nor insertions (for polypeptides) result in a reduction of identity or similarity. Methods and computer programs for the alignments are well known in the art.
Generally, a given similarity between two sequences implies that the identity between these sequences is at least equal to the similarity; for example, if two sequences are 70% similar to one another, they cannot be less than 70% identical to one another - but could be sharing 80% identity.
As defined herein the term at least 70% similarity or identity means at least 75%, at least 80%, at least 85%, at least 90%, at least 95% throughout the present disclosure.
As defined herein the term “pteridic acids that share the structure of formula (II)” encompasses pteridic acid F, pteridic acid H, pteridic acid I, throughout the present disclosure.
The term “functional variant” refers herein to functional variants of an enzyme, which retain at least some of the activity of the parent enzyme. Thus, a functional variant of a Type I PKS can catalyse the same conversion as the enzymes from which they are derived, although the efficiency of reaction may be different, e.g., the efficiency is decreased or increased compared to the parent enzyme, the substrate specificity is modified, the longevity or turnover of the enzyme is modified, the cellular localisation of the enzyme is modified.
Detailed description
Pteridic acids
Pteridic acids are polyketides compounds that harbour spiro ketal structures, that share the structure described in formula (III):
(HI)
wherein:
Ri and R2are independently selected from the group consisting of: hydrogen, alkyl and halogen;
Rs is selected from the group consisting of: hydrogen, hydroxy, methoxy, oxygen;
R4 is selected from the group consisting of hydrogen, methyl and ethyl;
X is selected from oxygen and nitrogen; n is selected from 1 and 2.
The skilled person will understand that no compound described herein has a carbon with more than four bonds.
Pteridic acids A-B (Figure 1 - compounds 1 and 2) were originally disclosed with an R stereochemistry on the tenth carbon atom, however the structure was later corrected to an S stereochemistry. These compounds have been reported as plant growth promoters and induce the formation of adventitious roots in the hypocotyl of kidney beans in an auxin-like manner3. Auxin promotes, inter alia, root initiation, induces both growth of pre-existing roots and root branching (lateral root initiation), and promotes also adventitious root formation. Furthermore auxin overproduction enhances the inhibitory effects of abscisic acid (ABA) in germination assays. While pteridic acids A and B were discovered more than 20 years ago, at present they are not available on the market, and the original strains reported to produce the compounds are also not available.
Pteridic acids C-G (Figure 1 - compounds 3-7) were isolated from a marine Streptomyces sp. and they were not tested in planta4.
Herein is disclosed a group of compounds, which classify as pteridic acids, that share the structure described in formula (VI), (VI)
or a salt or solvate thereof; wherein,
R1 and R2are independently selected from the group consisting of hydrogen, alkyl and halogen;
R3 is selected from the group consisting of: oxygen, methoxy, and hydroxy;
R4 is selected from the group consisting of: hydrogen, methyl and ethyl;
X is selected from oxygen and nitrogen; n is selected from 1 and 2, preferably the compound is of formula (
Herein are thus disclosed pteridic acid compounds characterised by a single or a double bond between the thirteenth carbon and an oxygen. Such compounds differ from other pteridic acid compounds, such as pteridic acids A and B, as detailed herein below.
In particular, herein is disclosed a group of compounds, which classify as pteridic acids, that share the structure described in formula (I),
or a salt or solvate thereof; wherein,
R1 and R2 are independently selected from the group consisting of hydrogen, alkyl and halogen;
R3 is selected from the group consisting of: oxygen, methoxy, and hydroxy;
X is selected from oxygen and nitrogen; preferably the compound of formula (II):
In some embodiments, Ri is a Ci-e alkyl, such as methyl.
In some embodiments, R2 is a Ci-e alkyl, such as methyl.
The present inventors have found that while all pteridic acids harbor spiroketal structures, the plant growing effect may be greatly affected by their structure. For example the effect of pteridic acids A and B has been described as auxin-like. The present disclosure reports that compounds of formula (II), in particular pteridic acids H and I further described herein below, are characterized a single or double bond between the thirteenth carbon and an oxygen atom, and their effect on plant growth is surprisingly ABA-like. Abscisic acid (ABA) functions in many plant developmental processes, including seed and bud dormancy, the control of organ size, and stomatai closure. ABA is especially important for plants in the response to environmental stresses, including drought, soil salinity, cold tolerance, freezing tolerance, heat stress and heavy metal ion tolerance.
Thus, whereas auxin has classically been considered a “growth hormone”, ABA is frequently defined as a “stress hormone” with roles in the regulation of biotic and abiotic stress responses.
As can be seen in the examples, in particular example 3, pteridic acids H and I when supplemented to plants have an effect on the plant which is different from the effect observed when supplementing other pteridic acids.
A sufficiently acidic compound may form alkali or earth alkali metal salts, for example sodium, potassium, lithium, calcium or magnesium salts; ammonium salts; or organic
base salts, for example methylamine, dimethylamine, tnmethylamine, tnethylamine, ethylenediamine, ethanolamine, choline hydroxide, meglumin, piperidine, morpholine, tris-(2-hydroxyethyl)amine, lysine or arginine salts; all of which are also further examples of salts of the compounds described herein. The compounds described herein may be solvated, especially hydrated. The hydratization/hydration may occur during the process of production or as a consequence of the hygroscopic nature of the initially water free compounds. The solvates and/or hydrates may e.g., be present in solid or liquid form. Salts and/or solvates of the compounds described herein, in particular of pteridic acids H and I, may thus also be used in the present methods.
In some embodiments, Ri is a Ci-e alkyl. In some embodiments, R2 is a Ci-e alkyl. In some embodiments, Ri is methyl. In some embodiments, R2 is methyl. In some embodiments, n is 2. In some embodiments, X is oxygen. In some embodiments, Ri is independently selected from the group consisting of: hydrogen, alkyl and halogen. In some embodiments, R2 is independently selected from the group consisting of: hydrogen, alkyl and halogen. In some embodiments, R2 is hydrogen. In some embodiments, Rs is hydrogen.
In some embodiments, Ri is hydrogen and Rs is hydroxy or Ri is methyl and R3 is oxygen. In some embodiments, Ri is hydrogen and Rs is hydroxyl. In some embodiments, Ri is methyl and R3 is oxygen.
Pteridic acid H
In some embodiments, Ri and R2are hydrogen, Rs is hydroxy, X is oxygen, n is 2, and the compound is pteridic acid H of formula (IV):
(IV)
Pteridic acid I
In some embodiments, Ri is methyl, R2 is hydrogen, R3 is oxygen, X is oxygen, n is 2, and the compound is pteridic acid I of formula (V):
Without being bound by theory, pteridic acid I may be generated from pteridic acid H through methylation and oxidation.
Pteridic acid F
In some embodiments, Ri and R2are hydrogen, Rs is hydroxy, X is oxygen, n is 2, and the compound is pteridic acid F of formula (VIII):
(VIII)
Thus, in some embodiments, the pteridic acid is selected from the group consisting of pteridic acid H, pteridic acid F and pteridic acid I.
In some embodiments, the pteridic acid is selected from the group consisting of pteridic acid H, and pteridic acid I.
In some embodiments, the pteridic acid is selected from the group consisting of pteridic acid F, and pteridic acid I.
In some embodiments, the pteridic acid is selected from the group consisting of pteridic acid H, and pteridic acid F.
The present disclosure thus also provides a composition comprising any of the above compounds, in particular pteridic acid F, pteridic acid H or pteridic acid I. In some embodiments, the composition further comprises an acceptable carrier.
In some embodiments, the composition further comprises one or more additional compounds selected from the group consisting of a liquid carrier, a solid carrier and a substrate.
Plant growth
The present disclosure discloses that said compounds of formula (I) or compositions comprising said compounds of formula (I), in particular compounds of formula (II) such as pteridic acid H, such as pteridic acid F, or such as pteridic acid I, are useful to promote plant growth and/or productivity.
Thus, in some embodiments, said compounds promote the growth of a plant. The plant growth effect is well known to a person skilled in the art and may comprise but is not limited to increased cell division and cell elongation compared to a plant of the same species that has not been contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
In some embodiments, said compounds promote plant productivity. The productivity of a plant is well known to a person skilled in the art and it can be quantified as the rate of generation of biomass. Thus, the skilled person would know how to quantify the increased productivity of a plant when contacted with compounds of formula (I), or compositions comprising said compounds of formula (I), in particular compounds of formula (II) such as pteridic acid H, such as pteridic acid F, or such as pteridic acid I, compared to a plant grown in similar conditions but not contacted with said compounds, or compositions comprising said compounds. For instance, such a method is used in Example 7 which illustrates, for example, that mung beans contacted with pteridic acid H show increased root length, increased shoot length, increased fresh and dry weight.
The present inventors have discovered that compounds of formula (I), in particular compounds of formula (II) such as pteridic acid H, such as pteridic acid F, or such as pteridic acid I, can be used as bio-stimulant.
Said plant growth effect may comprise increased root elongation, shoot length, and/or hypocotyl growth promoting compared to a plant of the same species that has not been contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions. In some embodiments, pteridic acids H, and/or I are useful to promote said plant growth and/or productivity. In some embodiments, compounds of formula (II), or compositions comprising said compounds of formula (II), such as pteridic acid H, such as pteridic acid F, or such as pteridic acid I, are useful to promote said plant growth and/or productivity.
In order to determine whether a compound of structure (II) is capable of promoting plant growth for a given plant, the skilled person can thus compare root elongation and hypocotyl growth of plants that have been contacted with said compounds, or composition comprising said compounds, with those that have not been contacted with the compounds, or composition comprising said compounds, and grown in otherwise similar conditions. Such test comprises measuring the length of the hypocotyl of said plants, as illustrated, for example, in Example 4.
In some embodiments, contacting a plant with the present compounds or compositions results in an increase of any one of the parameters selected from the group consisting of: the root length; the shoot length; the fresh weight; and the dry weight, where the parameter is increased by at least 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, or at least 50% compared to the same parameter, /.e., the root length; the shoot length; the fresh weight; or the dry weight, respectively, of another plant of the same species which is not contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
In some embodiments, the shoot length of a plant contacted with the present compounds or compositions is increased of at least 1%, such as at least 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%,
44%, 45%, 46%, 47%, 48%, 49%, or at least 50% compared to the shoot length of another plant of the same species which is not contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
In some embodiments, the root length of a plant contacted with the present compounds or compositions is increased of at least 1%, such as at least 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, or at least 50% compared to the root length of another plant of the same species which is not contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
In order to determine whether a compound of structure (II) is capable of promoting plant growth for a given plant, the skilled person can also compare the fresh and/or dry weight of plants that have been contacted with said compounds, or composition comprising said compounds, with those that have not been contacted with the compounds, or compositions comprising said compounds, and grown in otherwise similar conditions. Such test may comprise measuring the fresh and/or dry weight of said plants, as illustrated, for example, in Example 7.
Thus, in some embodiments, contacting a plant with the present compounds or compositions results in an increase in fresh weight compared to the growth of fresh weight of another plant of the same species which is not contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
In some embodiments, upon contacting a plant with the present compounds or compositions, the fresh weight of the plant is increased of at least 1%, such as at least 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%,
27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%,
42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, or at least 50% compared to the root length of another plant of the same species which is not contacted with the compound,
or a composition comprising said compound, and otherwise grown under similar conditions.
Thus, in some embodiments, the dry weight of a plant contacted with the present compounds or compositions is increased compared to the growth of fresh weight of another plant of the same species which is not contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
In some embodiments, upon contacting a plant with the present compounds or compositions, the dry weight of the plant is increased of at least 1%, such as at least 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%,
27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%,
42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, or at least 50% compared to the root length of another plant of the same species which is not contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
Herein is thus disclosed a method for promoting the growth of a plant, comprising contacting a compound as disclosed herein with the plant. In some embodiments, the compound is pteridic acid H. In other embodiments the compound is pteridic acid I. In other embodiments, the compound is pteridic acid F. In some embodiments, the plant is contacted with pteridic acid H and with pteridic acid I. In some embodiments, the plant is contacted with any one of pteridic acids H, I, and/or F. In some embodiments, the plant is contacted with pteridic acid H and with pteridic acid F. In some embodiments, the plant is contacted with pteridic acid I and with pteridic acid F. In some embodiments, the plant is contacted with a composition comprising said compound(s). How to contact the compound and the plant is described in further detail herein below.
In some embodiments, the plant is as described in the section “Plants” of the present disclosure.
Adventitious root
Adventitious roots are plant roots that form from any non-root tissue and are produced both during normal conditions and in response to stress conditions, such as flooding, nutrient deprivation, and wounding. ABA has been reported to inhibit hypocotyl adventitious root formation, while auxin stimulates it. Without being bound by theory, reducing the formation of adventitious roots can be expected to increase growth of other plant parts, e.g., leaves or stems.
Previously described pteridic acids A and B are known to stimulate adventitious root growth in an auxin like manner. The present inventors have discovered that compounds of formula (I), or compositions comprising said compounds of formula (I), in particular compounds of formula (II) such as pteridic acid H and/or pteridic acid I, can promote plant growth and/or productivity without inducing an increased formation of adventitious roots in the hypocotyl compared to a plant of the same species that has not been contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions. Thus, in this context and in contrast to pteridic acids A and B, said compounds of formula (I), or compositions comprising said compounds of formula (I), in particular compounds of formula (II) such as pteridic acid H and/or pteridic acid I, mimic the effect of ABA.
In some embodiments, the plant growth effect achieved by exposing the plant to any one of said compounds of formula (I), or compositions comprising said compounds of formula (I), in particular compounds of formula (II), such as pteridic acid H, pteridic acid F, and/or pteridic acid I, does not result in an increased formation of adventitious roots compared to a plant of the same species that has not been contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions. In other embodiments, the plant growth effect achieved by exposing the plant to any one of said compounds of formula (I), or compositions comprising said compounds of formula (I), in particular compounds of formula (II), such as pteridic acid H, pteridic acid F, and/or pteridic acid I, results in a decreased formation of adventitious roots compared to a plant of the same species that has not been contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
Hypocotyl growth
The hypocotyl is the part of a plant embryo or seedling that lies between the radicle and the cotyledons. Upon germination, the hypocotyl pushes the cotyledons above the ground to develop. It eventually becomes part of the plant stem.
In some embodiments, the plant growth effect achieved by exposing the plant to any one of said compounds of formula (I), or compositions comprising said compounds of formula (I), in particular compounds of formula (II), such as pteridic acid H, pteridic acid F, and/or pteridic acid I, results in increased growth of the hypocotyl compared to the growth of the hypocotyl to a plant of the same species that has not been contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
Plant stress
The present disclosure discloses that any one of said compounds of formula (I), or compositions comprising said compounds of formula (I), in particular compounds of formula (II) such as pteridic acid H, and/or such as pteridic acid I, are useful to reduce the stress of a plant.
In some embodiments, the plant is as described in the section “Plants” of the present disclosure.
For example, the inventors found that when plant of mung beans were grown in Petri dish in conditions mimicking drought, such as those mediated by 15% PEG-6000 in the soil, plants that were contacted with pteridic acid H or pteridic acid I showed increased root length compared to plants otherwise grown in similar conditions. The effect of contacting the plants with these compounds was similar to the one elicited by ABA, while auxin showed only a limited effect.
Abiotic stress
Abscisic acid (ABA) is a plant hormone. ABA functions in many plant developmental processes, including seed and bud dormancy, the control of organ size, and stomatai closure. It is especially important for plants in response to environmental stresses, including drought, soil salinity, cold tolerance, freezing tolerance, heat stress and heavy metal ion tolerance. The present inventors have found that said compounds of formula
(I), or compositions comprising said compounds of formula (I), in particular compounds of formula (II), are characterized by an ABA-like activity.
In some embodiments, said compounds of formula (I), or compositions comprising said compounds of formula (I), in particular compounds of formula (II) such as pteridic acid H, pteridic acid F, and/or pteridic acid I, may be used to reduce the abiotic stress experienced by the plant, such as under drought conditions, or conditions of high soil salinity and/or high levels of heavy metals in the soil in which the plant is grown. Said stress conditions are readily determined by or known to those skilled in the art. In order to determine whether the plant is more resistant to abiotic stress, for example, it is possible to compare whether plants contacted with the compounds and grown in conditions mimicking drought stress (e.g., by adding PEG to the soil, see Example 7) or high soil salinity (e.g., by adding NaCI to the soil, see Example 7) have increased root length compared to plants not contacted with the compound but otherwise grown in similar conditions.
In some embodiments, any one of the parameters selected from the group consisting of: the root length; the shoot length; the fresh weight; and the dry weight, of a plant grown under stress conditions, preferably under abiotic stress conditions such as drought conditions, high soil salinity and/or high levels of heavy metals in the soil in which the plant is grown is increased of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 160%, 180%, 200%, 220%, 240%, 260%, 280%, 300%, 350%, 400%, 450%, or 500% when the plant is contacted with the present compounds or compositions compared to the same parameter, /.e., the root length; the shoot length; the fresh weight; or the dry weight, of another plant of the same species which is not contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
In some embodiments, the root length of a plant contacted with the present compounds or compositions and grown under stress conditions, preferably under abiotic stress conditions such as drought conditions, high soil salinity and/or high levels of heavy metals in the soil in which the plant is grown is increased of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 160%, 180%, 200%, 220%, 240%, 260%, 280%, 300%, 350%, 400%, 450%, or 500% compared to the root length
of another plant of the same species which is not contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
In some embodiments, the shoot length of a plant contacted with the present compounds or compositions and grown under stress conditions, preferably under abiotic stress conditions such as drought conditions, high soil salinity and/or high levels of heavy metals in the soil in which the plant is grown is increased of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 160%, 180%, 200%, 220%, 240%, 260%, 280%, 300%, 350%, 400%, 450%, or 500% compared to the shoot length of another plant of the same species which is not contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
In some embodiments, the dry weight of a plant contacted with the present compounds or compositions and grown under stress conditions, preferably under abiotic stress conditions such as drought conditions, high soil salinity and/or high levels of heavy metals in the soil in which the plant is grown is increased of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 160%, 180%, 200%, 220%, 240%, 260%, 280%, 300%, 350%, 400%, 450%, or 500% compared to the dry weight of another plant of the same species which is not contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
In some embodiments, the fresh weight of a plant contacted with the present compounds or compositions and grown under stress conditions, preferably under abiotic stress conditions such as drought conditions, high soil salinity and/or high levels of heavy metals in the soil in which the plant is grown is increased of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 160%, 180%, 200%, 220%, 240%, 260%, 280%, 300%, 350%, 400%, 450%, or 500% compared to the fresh weight of another plant of the same species which is not contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
Herein is thus disclosed a method for reducing the stress on a plant, comprising contacting a compound as disclosed herein with the plant. In some embodiments, the compound is pteridic acid H. In other embodiments, the compound is pteridic acid I. In
other embodiments, the compound is ptendic acid F. In some embodiments, the plant is contacted with pteridic acid H and with pteridic acid I. In some embodiments, the plant is contacted with all of pteridic acids H, I, and F. In some embodiments, the plant is contacted with pteridic acid H and with pteridic acid F. In some embodiments, the plant is contacted with pteridic acid I and with pteridic acid F. In some embodiments, the plant is contacted with a composition comprising said compounds. How to contact the compound and the plant is described in further detail herein below.
Drought condition
In some embodiments, said compounds of formula (I), or compositions comprising said compounds of formula (I), in particular compounds of formula (II) such as pteridic acid H, pteridic acid F, and/or pteridic acid I, are useful to reduce the stress of a plant grown in drought condition. Such condition is readily determined by or known to those skilled in the art.
It is possible to test in a controlled environment whether the compounds described herein promote plant growth and/or productivity, or to test whether the plant copes better with drought when contacted with said compounds, or a composition comprising said compounds. Such test comprises comparing plants that have been contacted with the compounds, or a composition comprising said compounds, to plants that have not been contacted with the compounds, or a composition comprising said compounds, under drought conditions, for example by growing the plants in conditions mimicking drought. As the skilled person knows, adding 15% PEG-6000 in the soil, under conditions that otherwise promote cellular growth, is an example of how to mimic drought conditions.
In some embodiments, the condition of drought is defined by a drought Palmer drought index less than -2, such as less than -3, less than -4, less than -5, less than -6, less than -7, less than -8, less than -9, or -10.
In some embodiments, the root length of a plant contacted with the present compounds or compositions and grown under drought conditions is increased of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 160%, 180%, 200%, 220%, 240%, 260%, 280%, 300%, 350%, 400%, 450%, or 500% compared to the root length of another plant of the same species which is not contacted with the compound,
or a composition comprising said compound, and otherwise grown under similar conditions.
In some embodiments, the shoot length of a plant contacted with the present compounds or compositions and grown under drought conditions is increased of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 160%, 180%, 200%, 220%, 240%, 260%, 280%, 300%, 350%, 400%, 450%, or 500% compared to the shoot length of another plant of the same species which is not contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
In some embodiments, the dry weight of a plant contacted with the present compounds or compositions and grown under drought conditions is increased of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 160%, 180%, 200%, 220%, 240%, 260%, 280%, 300%, 350%, 400%, 450%, or 500% compared to the dry weight of another plant of the same species which is not contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
In some embodiments, the fresh weight of a plant contacted with the present compounds or compositions and grown under drought conditions is increased of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 160%, 180%, 200%, 220%, 240%, 260%, 280%, 300%, 350%, 400%, 450%, or 500% compared to the fresh weight of another plant of the same species which is not contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
High soil salinity
In some embodiments, the compounds described herein, or compositions comprising said compounds described herein, such as pteridic acid H, pteridic acid F, and/or pteridic acid I, are useful to reduce the stress of a plant grown in conditions characterized by high soil salinity around the plant. Such conditions are readily determined or known to those skilled in the art.
It is possible to test in a controlled environment whether the compounds promote plant growth and/or productivity, or to test whether the plant copes better with high soil salinity when contacted with said compound, or a composition comprising said compound. Such test can for example comprise comparing plants that have been contacted with the compounds, or a composition comprising said compounds, to plants that have not been contacted with the compounds, or a composition comprising said compounds, under conditions of high salinity, for example by growing the plants in conditions mimicking high soil salinity. As the skilled person knows, adding 100 mM NaCI in the soil, under conditions that otherwise promote cellular growth, is an example of how to mimic high salinity conditions.
In some embodiments, the condition of high soil salinity is defined as an electrical Conductivity (mmhos/cm) greater than 1.26 in the soil, for example greater than 1.3, greater than 1.4, greater than 1.5, greater than 1.75, greater than 2.00.
In some embodiments, the root length of a plant contacted with the present compounds or compositions and grown in high salinity conditions is increased of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 160%, 180%, 200%, 220%, 240%, 260%, 280%, 300%, 350%, 400%, 450%, or 500% compared to the root length of another plant of the same species which is not contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
In some embodiments, the root length of a plant contacted with the present compounds or compositions and grown in high salinity conditions is increased of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 160%, 180%, 200%, 220%, 240%, 260%, 280%, 300%, 350%, 400%, 450%, or 500% compared to the shoot length of another plant of the same species which is not contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
In some embodiments, the root length of a plant contacted with the present compounds or compositions and grown in high salinity conditions is increased of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 160%, 180%, 200%, 220%, 240%, 260%, 280%, 300%, 350%, 400%, 450%, or 500% compared to the dry
weight of another plant of the same species which is not contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
In some embodiments, the root length of a plant contacted with the present compounds or compositions and grown in high salinity conditions is increased of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 160%, 180%, 200%, 220%, 240%, 260%, 280%, 300%, 350%, 400%, 450%, or 500% compared to the fresh weight of another plant of the same species which is not contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
High levels of heavy metals in the soil
In some embodiments of the disclosure, said pteridic acids that share the structure of formula (I), or compositions comprising said compounds of formula (I), in particular compounds of formula (II), such as pteridic acid H, pteridic acid F, and/or pteridic acid I, are useful to reduce the stress of a plant grown in an environment characterized by the presence of high metals in the soil around the plant. Such condition is readily determined or known to those skilled in the art.
It is possible to test in a controlled environment whether the pteridic acid of interest promotes plant growth and/or productivity, or to test whether the plant copes better with high levels of heavy metals in the soil when contacted with said compound, or a composition comprising said compound. Such test can for example comprise comparing plants that have been contacted with the compounds, or a composition comprising said compounds, to plants that have not been contacted with the compounds, or a composition comprising said compounds, under conditions mimicking high levels of heavy metals. As the skilled person knows, adding 10 mM CuSC in the soil, under conditions that otherwise promote cellular growth, is an example of how to mimic high levels of heavy metals.
In some embodiments, the condition of high levels of heavy metals is defined as when at least one heavy metal, preferably selected from the group consisting of: Cd, Zn, Cu, Cr, Pb and Ni, exceeds the concentration of 10 mg/kg in the soil, such as exceeds the concentration of 12 mg/kg, of 15 mg/kg, of 17 mg/kg, of 20 mg/kg, or more. High levels
of heavy metal in the soil can also be reached when the sum of the concentrations of heavy metals, preferably selected from the group consisting of: Cd, Zn, Cu, Cr, Pb and Ni, exceeds the concentration of 10 mg/kg in the soil, such as exceeds the concentration of 12 mg/kg, of 15 mg/kg, of 17 mg/kg, of 20 mg/kg, or more.
In some embodiments, the root length of a plant contacted with the present compounds or compositions and grown in conditions of high levels of heavy metals in the soil is increased of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 160%, 180%, 200%, 220%, 240%, 260%, 280%, 300%, 350%, 400%, 450%, or 500% compared to the root length of another plant of the same species which is not contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
In some embodiments, the root length of a plant contacted with the present compounds or compositions and grown in conditions of high levels of heavy metals in the soil is increased of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 160%, 180%, 200%, 220%, 240%, 260%, 280%, 300%, 350%, 400%, 450%, or 500% compared to the shoot length of another plant of the same species which is not contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
In some embodiments, the root length of a plant contacted with the present compounds or compositions and grown in conditions of high levels of heavy metals in the soil is increased of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 160%, 180%, 200%, 220%, 240%, 260%, 280%, 300%, 350%, 400%, 450%, or 500% compared to the dry weight of another plant of the same species which is not contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
In some embodiments, the root length of a plant contacted with the present compounds or compositions and grown in conditions of high levels of heavy metals in the soil is increased of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 160%, 180%, 200%, 220%, 240%, 260%, 280%, 300%, 350%, 400%, 450%, or 500% compared to the fresh weight of another plant of the same species which is not
contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
Seed germination
Seed germination begins with imbibition of dry seed followed by emergence of the embryonic root, which is called the radicle. The molecular mechanisms underlying seed germination in plants are relatively well understood, and ABA is known to be integral in the regulation of seed dormancy and therefore timing of seed germination. Strong genetic evidence supports a model whereby ABA-mediated inhibition of seed germination requires intact auxin biosynthesis, transport and signalling. Furthermore, auxin enhances the inhibitory effects of ABA in germination assays, suggesting that auxin homeostasis is downstream of ABA in regulation of seed germination.
Whereas the pteridic acids described herein showed mostly an “ABA-like” mode of action, surprisingly, the inventors of the present disclosure have found that said pteridic acids, such as pteridic acid H, pteridic acid F, and/or pteridic acid I, are capable of promoting, rather than inhibiting seed germination.
Thus, in some embodiments, said compounds of formula (I), or compositions comprising said compounds of formula (I), in particular compounds of formula (II) such as pteridic acid H, pteridic acid F, and/or pteridic acid I, are used to promote seed germination of a plant.
In some embodiments, the seed germination rate of a plant is increased of at least 1%, such as at least 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7% compared to the seed germination rate of another plant of the same species which is not contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
In some embodiments, the plant is a plant as described in the section “Plants”.
In some embodiments, the plant is wheat.
Plants
The plant contacted by any one of said compounds of formula (I), or compositions comprising said compounds of formula (I), in particular compounds of formula (II) such as pteridic acid H, pteridic acid F, and/or such as pteridic acid I, can belong to any variety of plant. The present compounds and methods can be applied to any variety of plant.
In some embodiments, the plant is selected from the group consisting of: barley, wheat, potato, rice, maize, mung bean, soybeans/legume, rapeseed, sugar cane, cassava, groundnut, corn, cotton, tomato, grape, lettuce, sugar beet, palm, coffee, tobacco, tea, cannabis, coca, strawberry, carrot and/or cabbage.
In some embodiments, the plant contacted with the pteridic acid of formula (II), or compositions comprising said compounds of formula (II), such as pteridic acid H, such as pteridic acid F, and/or such as pteridic acid I, is barley, and/or mung beans.
In some embodiments, the compound is pteridic acid H and the plant is selected from the group consisting of: barley, wheat, potato, rice, maize, mung bean, soybeans/legume, rapeseed, sugar cane, cassava, groundnut, corn, cotton, tomato, grape, lettuce, sugar beet, palm, coffee, tobacco, tea, cannabis, coca, strawberry, carrot and/or cabbage.
In some embodiments, the compound is pteridic acid I and the plant is selected from the group consisting of: barley, wheat, potato, rice, maize, mung bean, soybeans/legume, rapeseed, sugar cane, cassava, groundnut, corn, cotton, tomato, grape, lettuce, sugar beet, palm, coffee, tobacco, tea, cannabis, coca, strawberry, carrot and/or cabbage.
In some embodiments, the compound is pteridic acid F and the plant is selected from the group consisting of: barley, wheat, potato, rice, maize, mung bean, soybeans/legume, rapeseed, sugar cane, cassava, groundnut, corn, cotton, tomato, grape, lettuce, sugar beet, palm, coffee, tobacco, tea, cannabis, coca, strawberry, carrot and/or cabbage.
In some embodiments, the compound is a mixture of ptendic acid H and ptendic acid I and the plant is selected from the group consisting of: barley, wheat, potato, rice, maize, mung bean, soybeans/legume, rapeseed, sugar cane, cassava, groundnut, corn, cotton, tomato, grape, lettuce, sugar beet, palm, coffee, tobacco, tea, cannabis, coca, strawberry, carrot and/or cabbage.
In some embodiments, the compound is a mixture of pteridic acid H, pteridic acid F, and pteridic acid I and the plant is selected from the group consisting of: barley, wheat, potato, rice, maize, mung bean, soybeans/legume, rapeseed, sugar cane, cassava, groundnut, corn, cotton, tomato, grape, lettuce, sugar beet, palm, coffee, tobacco, tea, cannabis, coca, strawberry, carrot and/or cabbage.
In some embodiments, the compound is a mixture of pteridic acid H, and pteridic acid F, and the plant is selected from the group consisting of: barley, wheat, potato, rice, maize, mung bean, soybeans/legume, rapeseed, sugar cane, cassava, groundnut, corn, cotton, tomato, grape, lettuce, sugar beet, palm, coffee, tobacco, tea, cannabis, coca, strawberry, carrot and/or cabbage.
In some embodiments, the compound is a mixture of pteridic acid F, and pteridic acid I and the plant is selected from the group consisting of: barley, wheat, potato, rice, maize, mung bean, soybeans/legume, rapeseed, sugar cane, cassava, groundnut, corn, cotton, tomato, grape, lettuce, sugar beet, palm, coffee, tobacco, tea, cannabis, coca, strawberry, carrot and/or cabbage.
Production of the compound
The present disclosure discloses that any one of said compounds of formula (I), or compositions comprising said compounds of formula (I), in particular compounds of formula (II) such as pteridic acid H, pteridic acid F, and/or pteridic acid I, is obtainable by a method comprising growing a cell in a cultivation broth, under conditions allowing the production of the compound. Said cell may be any one of the cells disclosed throughout the disclosure. Said compounds may be obtained by including a further step of obtaining an organic extract of the cultivation broth. Said compounds may be obtained by including a further step of recovering and optionally purifying the compound from the organic extract. Said compound may be pteridic acid H, pteridic acid F, pteridic acid I, or a mixture of them.
The present disclosure discloses a method to produce any one of said compounds of formula (I), or compositions comprising said compounds of formula (I), in particular compounds of formula (II) comprising growing a cell in a cultivation broth, under condition allowing the production of the compound. Said cell may be any one of the cells disclosed throughout the disclosure. Said compounds may be produced by including a further step of obtaining an organic extract of the cultivation broth. Said compounds may be produced by including a further step of recovering and optionally purifying the compound from the organic extract. Said compound may be pteridic acid H, pteridic acid F, pteridic acid I, or a mixture of them.
Cultivation broth
Any one of said compounds may be obtained by growing in a cultivation broth a cell, such as a cell artificially modified to synthesise the compound, as detailed herein below.
The fermentation of said cultivation broth may be carried out as is known in the art. For example, the fermentation is carried out for 4-8 days with aeration, such as 5-7 days, preferably 6 days. Said fermentation procedure may be carried out at a pH range of 5- 7, preferably a pH range of 5.4-6.4.
Organic extract
Said method of obtaining the compounds disclosed throughout the description, may further include a step of obtaining an organic extract of the cultivation broth. Said organic extract might be obtained with any method known by a person skilled in the art.
Purification of the compound
To produce anyone of the compounds disclosed throughout the description, the method may further include a step of recovering and optionally purifying the compound from the organic extract or from the fermentation broth. Said purification step may comprise organic solvent extraction followed by chromatographic separation by Sephadex LH-20 and silica gel chromatography.
Compositions
The compounds of formula (I), or compositions comprising said compounds of formula (I), in particular compounds of formula (II) such as pteridic acid H, pteridic acid F, and/or such as pteridic acid I, are useful as plant stimulant, as plant hormone surrogates, as compounds useful to promote the growth of a plant, to promote plant productivity, and/or to promote seed germination. Furthermore the compounds of formula (I), or compositions comprising said compounds of formula (I), in particular compounds of formula (II) such as pteridic acid H, pteridic acid F, and/or such as pteridic acid I, described herein are useful to promote the growth of a plant, and/or promote plant productivity under stress conditions such as stress conditions.
Thus, in some embodiments, a compound of formula (I), in particular a compound of formula (II) such as pteridic acid H, and/or such as pteridic acid I, of the present disclosure is comprised within a composition.
In some embodiments, the composition comprises any one of the pteridic acids selected from the group consisting of: pteridic acid H, pteridic acid F, and pteridic acid I.
In some embodiments, the composition comprises pteridic acid H, pteridic acid F, and pteridic acid I.
In some embodiments, the composition comprises pteridic acid H, and pteridic acid F.
In some embodiments, the composition comprises pteridic acid H and pteridic acid I.
In some embodiments, the composition comprises pteridic acid F and pteridic acid I.
In some embodiments, the composition comprises pteridic acid H.
In some embodiments, the composition comprises pteridic acid F.
In some embodiments, the composition comprises pteridic acid I.
In some embodiments of the present disclosure, the composition further comprises an acceptable carrier.
Stability of the compound
The present disclosure discloses that any one of said compounds of formula (I), or compositions comprising said compounds of formula (I), in particular compounds of formula (II) such as pteridic acid H and/or pteridic acid I, remain stable in a water solution at pH7.
Thus, in some embodiments, the compound is stable when stored at pH7 between 0 and 40 °C, such as between 0 and 35 °C, between 0 and 30 °C, between 0 and 25 °C, between 4 and 40 °C, between 4 and 35 °C, between 4 and 30 °C, or such as between 4 and 25 °C. In some embodiments, the compound is stable when stored at pH7 for at least 7 days, at least 11 days, at least 15 days, at least 30 days, at least 3 months, at least 6 months, at least a year, at least 2 years, at least 3 years, at least 5 years, at least 10 years.
The present disclosure further discloses that any one of said compounds of formula (I), or compositions comprising said compounds of formula (I), in particular compounds of formula (II) such as pteridic acid H and/or pteridic acid I, remain stable in a water solution at pH3, wherein the water solution has a temperature between 0 and 20 °C, such as between 0 and 15 °C, between 0 and 10 °C, between 0 and 5 °C, between 0 and 4 °C, between 4 and 20 °C, between 4 and 15 °C, between 4 and 10 °C, or such as 4 °C. . In some embodiments, the compound is stable when stored at pH3 for at least 5 days, at least 7 days, at least 11 days, at least 15 days, at least 30 days, at least 3 months, at least 6 months, at least a year, at least 2 years, at least 3 years, at least 5 years, at least 10 years.
Supplementing the compound
The present compounds, or compositions comprising said compounds, can be provided to or contacted with a plant as described herein using any method known by a person skilled in the art, such as irrigation, or such as seed-coating, or such as foliar spray. In some embodiments, said compound of formula (II), is pteridic acid I, pteridic acid H, or both. In some embodiments, said compound is any one of the pteridic acids selected from the group consisting of: pteridic acid H, pteridic acid I, and pteridic acid
F. In some embodiments the compound is a mixture of ptendic acid H, ptendic acid I, and pteridic acid F.
Said compounds, or compositions comprising said compounds, might be supplemented to the soil as one compounds or as any combination of multiple compounds. In some embodiments, said compound of formula (II), is pteridic acid I, pteridic acid H, or both. In some embodiments, said compound is any one of the pteridic acids selected from the group consisting of: pteridic acid H, pteridic acid I, and pteridic acid F. In some embodiments the compound is a mixture of pteridic acid H, pteridic acid I, and pteridic acid F.
Said compounds disclosed above can be supplied to the soil in which the plant is grown as a pure compound, as a lysate of said cell producing the compound, by supplementation of said cells producing the compound, as part of said cultivation broth comprising the compound and/or cells producing the compound, as detailed herein.
In some embodiments, said compounds, or a composition comprising the compound, such as pteridic acid H, is supplied to the soil in a concentration range of the compound between 0,1 nM to 500 nM, such as 0,1 nM to 10 nM, such as 0,1 nM to 20 nM, such as 0,1 nM to 30 nM, such as 0,1 nM to 40 nM, such as 0,1 nM to 50 nM, such as 0,1 nM to 60 nM, such as 0,1 nM to 70 nM, such as 0,1 nM to 80 nM, such as 0,1 nM to 90 nM, such as 0,1 nM to 100 nM, such as 0,1 nM to 200 nM, such as 0,1 nM to 300 nM, or such as 0,1 nM to 400 nM, such as 1 nM to 10 nM, such as 1 nM to 20 nM, such as 1 nM to 30 nM, such as 1 nM to 40 nM, such as 1 nM to 50 nM, such as 1 nM to 60 nM, such as 1 nM to 70 nM, such as 1 nM to 80 nM, such as 1 nM to 90 nM, such as 1 nM to 100 nM, such as 1 nM to 200 nM, such as 1 nM to 300 nM, such as 1 nM to 400 nM, such as 10 nM to 20 nM, such as 10 nM to 30 nM, such as 10 nM to 40 nM, such as 10 nM to 50 nM, such as 10 nM to 60 nM, such as 1 nM to 70 nM, such as 10 nM to 80 nM, such as 10 nM to 90 nM, such as 10 nM to 100 nM, such as 10 nM to 200 nM, such as 10 nM to 300 nM, such as 10 nM to 400 nM, such as 10 nM to 500 nM, preferably 10 nM.
Microorganisms producing compounds disclosed above may be supplemented with a microbial cfu of 105-101o/plant, such as 1O6-1O1o/plant, such as 1O7-1O1o/plant, such as 1O8-1O1o/plant, such as 109-101°/plant, such as 105-106/plant, such as 105-107/plant, such
as 10 -107/plant, such as 10 -108/plant, such as 10 -109/plant, such as 10 -109/plant, such as 106-108/plant, such as 107-109/plant.
Cell producing the compound
The present disclosure discloses a cell producing any one of the compounds of formula (I), or compositions comprising said compounds of formula (I), in particular compounds of formula (II) such as pteridic acid I, pteridic acid F, or such as pteridic acid H.
In some embodiments, said cell is a microorganism.
In some embodiments, said cell is a natural occurring cell or an artificially modified cell, such as a modified insect cell, or such as a modified microorganism. In particular embodiments, the cell is a cell which does not occur in nature, in particular the cell is engineered.
In some embodiments, said cell is a microorganism in its naturally occurring form. In some embodiments, the cell is artificially modified to produce or to enhance the production of the compound. The microorganism may belong to the genus Streptomyces or Allokutzneria, for example S. iranensis, S. rapamycinicus, Streptomyces zinciresistens, Streptomyces buecherae, Streptomyces malaysiensis, Streptomyces samsunensis, Streptomyces hygroscopicus, Streptomyces antioxidans, Streptomyces javensis, Streptomyces rhizosphaericus, Streptomyces al bus, Streptomyces physcomitrii, Streptomyces yatensis, Streptomyces solisilvae, Streptomyces melanosporofaciens, Streptomyces lasiicapitis, Streptomyces autolyticus, Streptomyces zinciresistens K42, Streptomyces cangkringensis, Streptomyces indonesiensis, Streptomyces asiaticus, Streptomyces aureoverticillatus, Streptomyces buecherae, Streptomyces antimycoticus, Streptomyces lasiicapitis, Streptomyces lasiicapitis, Streptomyces violaceusniger, and/or Allokutzneria albata, preferably S. iranensis and/or S. rapamycinicus.
In some embodiments, the cell is artificially modified to produce the compound.
In some embodiments, the cell is artificially modified to enhance the production of the compound.
In some embodiments, said cell producing any one of the compounds disclosed herein is S. iranensis or S. rapamycinicus. In some embodiments, said cell producing any one of the compounds disclosed herein is S. iranensis, S. violaceusniger, S. albus, S. melanosporofaciens, S. yatensis, S. cangkringensis, or S. rapamycinicus. In some preferred embodiments, said cell producing any one of the compounds disclosed herein is S. iranensis, S. violaceusniger, S. melanosporofaciens, S. cangkringensis, or S. rapamycinicus. Said microorganisms may be in their natural occurring form, or artificially modified to enhance the production of the compound.
In some embodiments, said cell may be a naturally occurring cell, wherein the naturally occurring cell is not a S. iranensis or a S. rapamycinicus cell. In some embodiments, said cell may be a naturally occurring cell, wherein the naturally occurring cell is not a S. iranensis, S. violaceusniger, S. albus, S. melanosporofaciens, S. yatensis, S. cangkringensis, or S. rapamycinicus cell. In some preferred embodiments, said cell may be a naturally occurring cell, wherein the naturally occurring cell is not a S. iranensis, S. violaceusniger, S. melanosporofaciens, S. cangkringensis, or a S. rapamycinicus cell.
In some embodiments, said cell is a non-natural S. iranensis or a non-natural S. rapamycinicus cell. In some embodiments, said cell is a non-natural S. iranensis, a non-natural S. violaceusniger, a non-natural S. albus, a non-natural S. melanosporofaciens, a non-natural S. yatensis, a non-natural S. cangkringensis, or a non-natural S. rapamycinicus cell. In some preffered embodiments, said cell is a non- natural S. iranensis, a non-natural S. violaceusniger, a non-natural S. melanosporofaciens, a non-natural S. cangkringensis, or a non-natural S. rapamycinicus cell.
In some embodiments, said cell is an artificially modified cell expressing one or more heterologous proteins selected from the group consisting of: i) PtaA as set forth in SEQ ID NO: 2, ii) PtaB as set forth in SEQ ID NO: 4, iii) PtaC as set forth in SEQ ID NO: 6, iv) PtaD as set forth in SEQ ID NO: 8, and v) PtaE as set forth in SEQ ID NO: 10,
and functional variants thereof having at least 70% similarity or sequence identity thereto, such as at least 75%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 95% sequence identity thereto.
In some embodiments, said cell is an artificially modified cell expressing one or more of: i) PtaA as set forth in SEQ ID NO: 2 or a functional variant thereof having at least 70% sequence identity thereto; ii) PtaB as set forth in SEQ ID NO: 4 or a functional variant thereof having at least 70% sequence identity thereto; iii) PtaC as set forth in SEQ ID NO: 6 or a functional variant thereof having at least 70% sequence identity thereto; iv) PtaD as set forth in SEQ ID NO: 8 or a functional variant thereof having at least 70% sequence identity thereto; and v) PtaE as set forth in SEQ ID NO: 10 or a functional variant thereof having at least 70% sequence identity thereto.
In some embodiments, the artificially modified cell expresses more of at least one of said proteins compared to a naturally occurring cell of the same species. The skilled person might use any method known in the art to increase the expression of one or more of said proteins. For example the cell might express one of said proteins under a constitutive promoter; the cell might express an mRNA encoding at least one of said proteins that is more stable than the one naturally occurring; and/or the cell might express a codon optimized mRNA encoding at least one of said proteins.
In some embodiments, said cell is an artificially modified cell expressing PtaA as set forth in SEQ ID NO: 2 or a functional variant thereof having at least 70% sequence identity thereto, such as at least 75%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 95% sequence identity thereto.
In some embodiments, said cell is an artificially modified cell expressing PtaB as set forth in SEQ ID NO: 4 or a functional variant thereof having at least 70% sequence identity thereto, such as at least 75%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 95% sequence identity thereto.
In some embodiments, said cell is an artificially modified cell expressing PtaC as set forth in SEQ ID NO: 6 or a functional variant thereof having at least 70% sequence identity thereto, such as at least 75%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 95% sequence identity thereto.
In some embodiments, said cell is an artificially modified cell expressing PtaD as set forth in SEQ ID NO: 8 or a functional variant thereof having at least 70% sequence identity thereto, such as at least 75%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 95% sequence identity thereto.
In some embodiments, said cell is an artificially modified cell expressing PtaE as set forth in SEQ ID NO: 10 or a functional variant thereof having at least 70% sequence identity thereto, such as at least 75%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 95% sequence identity thereto.
The cell may be modified to express two of the above listed proteins. For example, the cell may express the proteins: i) PtaA and PtaB; ii) PtaA and PtaC; iii) PtaA and PtaD; iv) PtaA and PtaE; v) PtaB and PtaC; vi) PtaB and PtaD; vii) PtaB and PtaE; viii) PtaC and PtaD; ix) PtaC and PtaE; x) PtaD and PtaE, or functional variants thereof having at least 70% similarity or identity thereto, such as at least 80%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% similarity or identity thereto.
The cell may be modified to express three of the above listed proteins. For example, the cell may express the proteins:
i) PtaA, PtaB and PtaC; ii) PtaA, PtaB and PtaD; iii) PtaA, PtaB and PtaE; iv) PtaA, PtaC and PtaD; v) PtaA, PtaC and PtaE; vi) PtaA, PtaD and PtaE; vii) PtaB, PtaC and PtaD; viii) PtaB, PtaC and PtaE; ix) PtaB, PtaD and PtaE; x) PtaC, PtaD and PtaE, or functional variants thereof having at least 70% similarity or identity thereto, such as at least 80%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% similarity or identity thereto.
The cell may be modified to express four of the above listed proteins. For example, the cell may express: i) PtaA, PtaB, PtaC and PtaD; ii) PtaA, PtaB, PtaC and PtaE; iii) PtaA, PtaB, PtaD and PtaE; iv) PtaA, PtaC, PtaD and PtaE; v) PtaB, PtaC, PtaD and PtaE, or functional variants thereof having at least 70% similarity or identity thereto, such as at least 80%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% similarity or identity thereto.
In some embodiments, said cell is an artificially modified cell in which any one of the nucleic acid sequences selected from the group consisting of the following sequences has been introduced: i) ptaA as set forth in SEQ ID NO: 1; ii) ptaB as set forth in SEQ ID NO: 3; iii) ptaC as set forth in SEQ ID NO: 5;
iv) ptaD as set forth in SEQ ID NO: 7; and v) ptaE as set forth in SEQ ID NO: 9, and respective variants thereof having at least 70% similarity or identity thereto, such as at least 80%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% similarity or identity thereto.
In some embodiments, said cell is an artificially modified cell in which all the nucleic acid sequences selected from the group consisting of the following sequences have been introduced: i) ptaA as set forth in SEQ ID NO: 1; ii) ptaB as set forth in SEQ ID NO: 3; iii) ptaC as set forth in SEQ ID NO: 5; iv) ptaD as set forth in SEQ ID NO: 7; and v) ptaE as set forth in SEQ ID NO: 9 and respective variants thereof having at least 70% similarity or identity thereto, such as at least 80%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% similarity or identity thereto.
In some embodiments, two of the above listed genes have been introduced in the cell. For example, the cell may express the genes: i) ptaA and ptaB, ii) ptaA and ptaC', iii) ptaA and ptaD, iv) ptaA and ptaE, v) ptaB and ptaC', vi) ptaB and ptaD, vii) ptaB and ptaE, viii) ptaC and ptaD, ix) ptaC and ptaE, x) ptaD and ptaE,
or respective variants thereof having at least 70% similarity or identity thereto, such as at least 80%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% similarity or identity thereto.
In some embodiments, three of the above listed genes have been introduced in the cell. For example, the cell may express the genes: i) ptaA, ptaB and ptaC; ii) ptaA, ptaB and ptaD; iii) ptaA, ptaB and ptaE; iv) ptaA, ptaC and ptaD; v) ptaA, ptaC and ptaE; vi) ptaA, ptaD and ptaE; vii) ptaB, ptaC and ptaD; viii) ptaB, ptaC and ptaE; ix) ptaB, ptaD and ptaE; x) ptaC, ptaD and ptaE, or respective variants thereof having at least 70% similarity or identity thereto, such as at least 80%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% similarity or identity thereto.
In some embodiments, four of the above listed genes have been introduced in the cell. For example, the cell may express the genes: i) ptaA, ptaB, ptaC and ptaD; ii) ptaA, ptaB, ptaC and ptaE; iii) ptaA, ptaB, ptaD and ptaE; iv) ptaA, ptaC, ptaD and ptaE; v) ptaB, ptaCI, ptaD and ptaE, or respective variants thereof having at least 70% similarity or identity thereto, such as at least 80%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%,
such as at least 97%, such as at least 98%, such as at least 99%, such as 100% similarity or identity thereto.
This can be done by introducing the corresponding nucleic acids in the cell, or variants thereof having at least 70% similarity or identity thereto, such as at least 80%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% similarity or identity thereto.
In order to test whether a variant of ptaA-E is a functional variant, ptaA-E mutants will be created by CRISPR-cas9. The activity of the variant can be measured by detecting the amount of compound of formula (I) synthesised, for example as described in the examples.
In some embodiments, said cell is an artificially modified cell that comprises anyone of the disclosed nucleic acids.
In some embodiments, said cell is an artificially modified cell that comprises anyone of the disclosed vectors or system of vectors.
In some embodiments, said cell is employed to obtain anyone of the compounds of formula (I), in particular compounds of formula (II) such as pteridic acid H, pteridic acid F, and/or pteridic acid I.
In some embodiments, said cell can be provided directly to the plant, or the compound can be purified to some extent as described herein above.
In some embodiments of the disclosure, said cell or derivatives thereof is supplied to plants to reduce plant stress, such as abiotic stress, such as drought conditions, such as high salinity in the soil, such as high levels of metals in the soil.
In some embodiments, the shoot length of a plant contacted with the present compounds or compositions is increased of at least 1%, such as at least 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%,
29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, or at least 50% compared to the shoot length of another plant of the same species which is not contacted with a cell producing the compound and otherwise grown under similar conditions.
In some embodiments, the root length of a plant contacted with the present compounds or compositions is increased of at least 1%, such as at least 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, or at least 50% compared to the root length of another plant of the same species which is not contacted with a cell producing the compound and otherwise grown under similar conditions.
In some embodiments, the fresh weight of a plant contacted with the present compounds or compositions is increased of at least 1%, such as at least 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, or at least 50% compared to the root length of another plant of the same species which is not contacted with a cell producing the compound and otherwise grown under similar conditions.
In some embodiments, the dry weight of a plant contacted with the present compounds or compositions is increased of at least 1%, such as at least 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, or at least 50% compared to the root length of another plant of the same species which is not contacted with a cell producing the compound and otherwise grown under similar conditions.
In some embodiments, the root length of a plant contacted with the present compounds or compositions and grown in drought conditions is increased of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 160%, 180%, 200%,
220%, 240%, 260%, 280%, 300%, 350%, 400%, 450%, or 500% compared to the root length of another plant of the same species which is not contacted with a cell producing the compound and otherwise grown under similar conditions.
In some embodiments, the root length of a plant contacted with the present compounds or compositions and grown in high salinity conditions is increased of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 160%, 180%, 200%, 220%, 240%, 260%, 280%, 300%, 350%, 400%, 450%, or 500% compared to the root length of another plant of the same species which is not contacted with a cell producing the compound and otherwise grown under similar conditions.
In some embodiments, the root length of a plant contacted with the present compounds or compositions and grown in conditions of high levels of heavy metals in the soils is increased of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 160%, 180%, 200%, 220%, 240%, 260%, 280%, 300%, 350%, 400%, 450%, or 500% compared to the root length of another plant of the same species which is not contacted with a cell producing the compound and otherwise grown under similar conditions.
Isolated nucleic acid
The present disclosure discloses that the genes involved in synthesis of compounds of formula (I), in particular compounds of formula (II) such as pteridic acid H and pteridic acid I, are: i) ptaA as set forth in SEQ ID NO: 1; ii) ptaB as set forth in SEQ ID NO: 3; iii) ptaC as set forth in SEQ ID NO: 5; iv) ptaD as set forth in SEQ ID NO: 7 v) ptaE as set forth in SEQ ID NO: 9.
Thus, any of the above nucleic acids, or respective variants thereof having at least 70% similarity or identity thereto, such as at least 80%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% similarity or identity thereto, can be introduced in a cell, whereby the cell can generate pteridic acid H and/or pteridic acid I. In some
embodiments of the disclosures said ptendic acids may be ptendic acid I and/or ptendic acid H. In some embodiments of the disclosures said pteridic acids may be pteridic acid I, pteridic acid F and/or pteridic acid H. In some embodiments of the disclosures said pteridic acids may be pteridic acid I, and/or pteridic acid F. In some embodiments of the disclosures said pteridic acids may be pteridic acid F and/or pteridic acid H.
Whole genome sequencing and bioinformatics analysis revealed that there are 44 biosynthetic gene clusters in Streptomyces iranensis HM 35 (NCBI taxonomy ID, 576784; sample ID, DSM41954).
Pteridic acids are assembled by multi-modular type I polyketide synthases following the PKS pattern collinearity, including eight modules, corresponding to one starting unit (acetyl-CoA) followed by seven extensions (methylmalonyl-CoA or ethylmalonyl-CoA), to form a linear polyketide precursor. The 6,6-spiroketal core structure is formed because spontaneous spiroketalization of the carbonyl group on C11 and the two hydroxyl groups on C17 and C25.
Biosynthetic genes that are required to synthesize compounds of formula (I), such as pteridic acid H, or such as pteridic acid I, may comprise anyone of the genes in table 1.
Table 1. Annotation of pteridic acids core biosynthetic genes and tailoring genes in S. iranensis HM35.
ORF Sizea SI/IDb Protein homologue and origin pta6 494 96/97 RLV74939.1 , Streptomyces rapamycinicus NRRL 5491 pta5 346 98/97 WP_210951575.1 , Streptomyces sp. MK37H pta4 572 98/97 WP_020866330.1 , Streptomyces rapamycinicus pta3 958 99/99 WP_020866329.1 , Streptomyces rapamycinicus pta2 316 99/99 RLV74943.1 , Streptomyces rapamycinicus NRRL 5491 pta1 324 98/98 WP_2 14665150.1 , Streptomyces javensis ptaA 4535 90/88 WP_2 14609358.1 , Streptomyces malaysiensis ptaB 1746 91/89 WP_037957959.1 , Streptomyces sp. PRh5 ptaC 1655 95/94 WP_138910801.1 , Streptomyces sp. DASNCL29 ptaD 3395 96/95 WP_020866322.1 , Streptomyces rapamycinicus ptaE 2112 95/95 WP_201848053.1 , Streptomyces sp. 110
pta1* 261 97/95 GDY58888.1, Streptomyces violaceusniger pta2* 417 99/98 MBP8534388.1, Streptomyces sp. MK37H pta3* 196 97/97 WP_2 10946413.1, Streptomyces sp. MK37H pta4* 304 100/99 WP_138910796.1, Streptomyces sp. DASNCL29 pta5* 245 99/99 WP_020866316.1, Streptomyces rapamycinicus pta6* 420 97/97 WP_199334865.1 , Streptomyces sp. GMR22 pta7* 223 98/98 WP_138910795.1, Streptomyces sp. DASNCL29 pta8* 321 96/96 WP_ 164428021.1 , Streptomyces rhizosphaericus pta9* 328 98/98 WP_191066610.1, Streptomyces sp. 5-10 pta10* 469 97/95 GDY58900.1, Streptomyces violaceusniger pta11* 446 99/99 WP_020866310.1, Streptomyces rapamycinicus
Vector or system of vectors
The present disclosure discloses a vector or a system of vectors comprising one or more of the isolated nucleic acids selected from the group consisting of: i) ptaA as set forth in SEQ ID NO: 1; ii) ptaB as set forth in SEQ ID NO: 3; iii) ptaC as set forth in SEQ ID NO: 5; iv) ptaD as set forth in SEQ ID NO: 7; and v) ptaE as set forth in SEQ ID NO: 9, and respective variants thereof having at least 70% similarity or identity thereto, such as at least 80%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% similarity or identity thereto.
In some embodiments, said vector vector or system of vectors comprises any combination of two or more isolated nucleic acids selected from the group consisting of: i) ptaA as set forth in SEQ ID NO: 1; ii) ptaB as set forth in SEQ ID NO: 3; iii) ptaC as set forth in SEQ ID NO: 5; iv) ptaD as set forth in SEQ ID NO: 7; and
v) ptaE as set forth in SEQ ID NO: 9, and respective variants thereof having at least 70% similarity or identity thereto, wherein the isolated nucleic acids are sufficient to result in biosynthesis of the disclosed pteridic acids in a cell of interest.
In some embodiments, said vector vector or system of vectors comprises two or more isolated nucleic acids selected from the group consisting of: i) ptaA as set forth in SEQ ID NO: 1; ii) ptaB as set forth in SEQ ID NO: 3; iii) ptaC as set forth in SEQ ID NO: 5; iv) ptaD as set forth in SEQ ID NO: 7; and v) ptaE as set forth in SEQ ID NO: 9, and respective variants thereof having at least 70% similarity or identity thereto, wherein the isolated nucleic acids are sufficient to synthesize the genes necessary for a method of producing any one of the disclosed pteridic acid that share the structure of formula (I).
In some embodiments, said vector vector or system of vectors comprises all the isolated nucleic acids: i) ptaA as set forth in SEQ ID NO: 1; ii) ptaB as set forth in SEQ ID NO: 3; iii) ptaC as set forth in SEQ ID NO: 5; iv) ptaD as set forth in SEQ ID NO: 7; and v) ptaE as set forth in SEQ ID NO: 9, and respective variants thereof having at least 70% similarity or identity thereto, such as at least 80%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% similarity or identity thereto.
In some embodiments, said vector vector or system of vectors comprises ptaA as set forth in SEQ ID NO: 1. and respective variants thereof having at least 70% similarity or identity thereto.
In some embodiments, said vector vector or system of vectors comprises ptaB as set forth in SEQ ID NO: 3. and respective variants thereof having at least 70% similarity or identity thereto.
In some embodiments, said vector vector or system of vectors comprises ptaC as set forth in SEQ ID NO: 5. and respective variants thereof having at least 70% similarity or identity thereto.
In some embodiments, said vector vector or system of vectors comprises ptaD as set forth in SEQ ID NO: 7. and respective variants thereof having at least 70% similarity or identity thereto.
In some embodiments, said vector vector or system of vectors comprises ptaE as set forth in SEQ ID NO: 9. and respective variants thereof having at least 70% similarity or identity thereto.
In some embodiments, said vector vector or system of vectors comprises two of the above listed the isolated nucleic acids. For example, the vector vector or system of vectors may comprise: i) ptaA and ptaB, ii) ptaA and ptaC', iii) ptaA and ptaD, iv) ptaA and ptaE, v) ptaB and ptaC', vi) ptaB and ptaD, vii) ptaB and ptaE, viii) ptaC and ptaD, ix) ptaC and ptaE, x) ptaD and ptaE, or variants thereof having at least 70% similarity or identity thereto, such as at least 80%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% similarity or identity thereto.
In some embodiments, said vector vector or system of vectors comprises three of the above listed the isolated nucleic acids. For example, the vector vector or system of vectors may comprise: i) ptaA, ptaB and ptaC; ii) ptaA, ptaB and ptaD; iii) ptaA, ptaB and ptaE; iv) ptaA, ptaC and ptaD; v) ptaA, ptaC and ptaE; vi) ptaA, ptaD and ptaE; vii) ptaB, ptaC and ptaD; viii) ptaB, ptaC and ptaE; ix) ptaB, ptaD and ptaE; x) ptaC, ptaD and ptaE, or respective variants thereof having at least 70% similarity or identity thereto, such as at least 80%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% similarity or identity thereto.
In some embodiments, said vector vector or system of vectors comprises four of the above listed the isolated nucleic acids. For example, the vector vector or system of vectors may comprise: i) ptaA, ptaB, ptaC and ptaD; ii) ptaA, ptaB, ptaC and ptaE; iii) ptaA, ptaB, ptaD and ptaE; iv) ptaA, ptaC, ptaD and ptaE; v) ptaB, ptaCI, ptaD and ptaE, or respective variants thereof having at least 70% similarity or identity thereto, such as at least 80%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% similarity or identity thereto.
In some embodiments, said vector vector or system of vectors comprises any one of the biosynthetic genes that are required to synthesize compounds of formula (I), and respective variants thereof having at least 70% similarity or identity thereto.
In some embodiments, said vector vector or system of vectors comprises any one of the biosynthetic genes that are sufficient to be introduced in a cell as described herein to synthesize compounds of formula (I), and respective variants thereof having at least 70% similarity or identity thereto.
Examples
The disclosure is further supported by the following examples.
Example 1. Material and Methods
NMR spectra
NMR spectra were recorded on 800 MHz Bruker Avance III spectrometer equipped with a TCI CryoProbe using standard pulse sequences. NMR data were processed using MestReNova 11.0. UHPLC-HRMS was performed on an Agilent Infinity 1290 LIHPLC system equipped with a diode array detector. UV-Vis spectra were recorded from 190 to 640 nm. Specific rotations were acquired using Perkin-Elmer 241 polarimeter. IR data were acquired on Bruker Alpha FTIR spectrometer using OPUS version 7.2. TLC analysis was performed on silica gel plates (Sil G/UV254, 0.20 mm, Macherey-Nagel). Biotage Isolera One Flash Chromatography system was used for flash chromatography and performed on silica gel 60 (Merck, 0.04-0.063 mm, 230-400 mesh ASTM). Sephadex LH-20 was from Pharmacia. All solvents and chemicals used for HRMS and chromatography were VWR Chemicals LC-MS grade, while for metabolites extraction, the solvents were of HPLC grade (VWR Chemicals).
Strain fermentation and isolation
Streptomyces iranensis DSM 41954 was cultivated in medium 2 (CaCl2'2H2O, 3.0 g; citric acid/Fe III, 1.0 g; MnSC ^O, 0.2 g; ZnCh, 0.1 g; CUSO4 5H2O, 0.025 g;
Na2B4O2'10H2O, 0.02 g; NaMoO4'2H2O, 0.01 g; and oatmeal, 20.0 g, in 1.0 L distilled water), at 175 L scale in a 300 L fermentor vessel. The fermentation was carried out for 6 days with aeration of 25-50 L min-1, stirring at 200 rpm with a temperature of 28 °C, and a pH range of 5.4-6.4. The fermentation broth was filtered and loaded onto an Amberchrom 161c resin LC column (200 x 20 cm, 6 L). Elution with a linear gradient of
H2O-MeOH (from 30% to 100% v/v, flow rate 0.5 L min-1 , in 58 min) afforded seven fractions (A-G). Fraction G was firstly fractionated by silica gel chromatography with a CH2CI2/CH3OH gradient to yield 16 fractions, F01-F16. F06 was further separated by a Sephadex LH-20 (MeOH) column, and eight sub-fractions were obtained. The first two sub-fractions were combined and separated by HPLC RP-C (MeOH/FW as gradient) to afford 9 (0.9 mg). F07 was first separated by a Sephadex LH-20 (MeOH) column, and twelve sub-fractions F07a-l were obtained. From F07e, 8 (15.0 mg) and 6 (4.0 mg) were obtained by repeated HPLC RP-C (CH3CN/H2O as gradient).
Streptomyces rapamycinicus was cultivated in ISP2 medium (yeast extract (Difco) 4.0 g, malt extract (Difco) 10.0 g, dextrose (Difco) 4.0 g, agar, 20.0 g) for two weeks. Ethyl acetate extraction of the agar was concentrated in methanol, which was analyzed by LCMS.
From both Streptomyces iranensis and Streptomyces rapamycinicus, pteridic acids A-B could not be detected and isolated.
Pteridic acid F (6): white solid; [a] ° 81 (0.32 mg/mL, CH3OH), UV (CH3CN/H2O) 4max (%) 262 (100%) nm; IR (ATR) vmax 2967, 2934, 2879, 1712, 1642, 1600, 1458, 1410, 1383, 1300, 1266, 1223, 1187, 1142, 1109, 1058, 1002, 973 cm’1; (+)-HRESIMS m/z 383.2418 [M + H]+ (calcd for C21H35O6, 383.2428). 1H NMR see Table 2; 13C NMR see Table 3;
Pteridic acid H (8): white solid; [a] ° -18 (10 mg/mL, CH3OH), UV (CH3CN/H2O) 4max (%) 264 (100%) nm; IR (ATR) vmax 2968, 2931 , 2877, 1692, 1643, 1618, 1458, 1410, 1380, 1299, 1270, 1188, 1138, 1106, 1059, 1002, 973, 850 cm’1; (+)-H RESIMS m/z 383.2418 [M + H]+ (calcd for C21H35O6, 383.2428). 1H NMR see Table 2; 13C NMR see Table 3;
Pteridic acid I (9): white solid; [a] ° -4 (0.44 mg/mL, CH3OH), UV (CH3CN/H2O) 4max 264 (100%) nm; IR (ATR) vmax 2968, 2934, 2874, 1717, 1598, 1454, 1408, 1302, 1265, 1222, 1142, 1056, 1002 cm’1; (+)-HRESIMS m/z 395.2426 [M+H]+ (calcd fo^HssOe, 395.2428). 1H NMR see Table 2; 13C NMR see Table 3.
Table 2. 1H (800 MHz) N MR data for 6, 8 and 9 (in MeOD)
Table 3. 13C (200 MHz) NMR data for 6, 8 and 9 (in MeOD)
Crystal Structure Determination
X-ray data collection of 8 was performed on an Agilent Supernova Diffractometer using CuKa radiation. Data were processed and scaled using the CrysAlisPro software (Agilent Technologies). The structure was solved using SHELXS and refined using SHELXL. Hydrogen atoms were included on ideal positions using riding coordinates. The absolute configuration was determined based on the Flack parameter.
Crystal Data for 8: C21H34O6, Mr = 382.50, monoclinic, a = 8.4619(1) A, b = 15.6161(2) A, c = 8.4994(1) A, a = 90.00°, = 107.768(1)°, y = 90.00°, V= 1069.55(2) A3, T = 120(2) K, space group P2i, Z = 2, p(Cu Ka) = 0.698 mm-1, 17514 reflections collected, 4275 independent reflections (/?int = 0.0226, F?Sigma = 0.0155). The final F?i values were 0.0249 (/ > 2o(/)). The final WR2 values were 0.0648 (/ > 2o(/)). The final F?i values were 0.0252 (all data). The final w/?2 values were 0.0651 (all data). The goodness of fit on F^ was 1.057. The Flack parameter is 0.13(10) (CCDC Deposition Number 1984025).
Plant growth experiment
Pteridic acids F, H and I were tested for their activity in helping mung beans cope with salinity, heavy metal and drought stress using a Petri dish assay. ABA and IAA were used as controls. To investigate the effects of different pteridic acids in salinity and heavy metal conditions, an assay of growing mung beans on petri dish were carried out. mung beans were pre-germinated and placed on top of the Murashige and Skoog medium agar, supplemented with 100 mM NaCI or 10 mM CuSC , with 1.0 ng/mL pure substance. For drought assay, a solution of 15% PEG-6000 was absorbed into a cotton cloth. Mung beans were placed on the top of the cloth. All mung beans were grown under darkness, 21 °C for two days, three days and four days for drought, salinity and heavy metal, respectively. Student t-test was used for the statistical analysis.
Both pteridic acid H and microbial producers were tested of their effects in barley grown in soil. S. rapamycinicus and S. violaceunigerwere cultivated in ISP2 medium, 4 days, 28°C. 100 pL culture broth was added to a 50 mL Falcon tube containing 40 mL garden soil. For pure substances, 10 nM pteridic acid H and ABA were added. Barley seeds were planted in each tube and grown for 21°C, 12h dark/12 light, 7 days.
Strains, plasmids, media, and growth condition
All strains and plasmids used are listed in Table 4. All Escherichia coli strains were grown in liguid/solid LB medium (5 g/L yeast extract, 10 g/L peptone, 10 g/L NaCI) at 37 °C. Wild type S. iranensis HM35 and mutants were grown on MS (Mannitol Soya Flour) medium (20 g/L, D-mannitol, 20 g/L fat-reduced soy flour, and 20 g/L agar). Appropriate antibiotics were supplemented with the following working concentrations: apramycin (50 pg/mL), chloramphenicol (25 pg/mL), and kanamycin (50 pg/mL). All chemicals involved in this study were from Sigma, USA.
Table 4. Summary of strains and plasmids used in this study.
Strains Description Source/[Ref]
One Shot™ Maehl ™ T1 Thermo
For routine plasmids maintenance Phage-Resistant Chemically Fisher and cloning
Competent E. coli Scientific
For conjugating plasmids into
E. coli ET12567/pUZ8002 [2]
Streptomyces
Streptomyces iranensis HM35 Wild-type strain [1]
Streptomyces iranensis
AptaA mutant strain In this work
HM35/AptaA
Plasmids pCRISPR-cBEST For C to T base editing [2]
Modified plasmid for inactivation of pCRISPR-cBEST/AptaA In this work ptaA
General protocol of DNA manipulation
All primers used were synthesized by IDT (Integrated DNA Technologies, USA) and listed in Table 5. Plasmids and genomic DNA purification, polymerase chain reaction (PCR), and cloning were conducted according to standard procedures using manufacturer protocols. PCR was performed using Q5® High-Fidelity 2* Master Mix or OneTaq® Quick-Load® 2X Master Mix with Standard Buffer (New England Biolabs, USA). DNA assembly was done by using NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs, USA). DNA digestion was performed with FastDigest restriction enzymes (Thermo Fisher Scientific, USA). NucleoSpin® Gel and PCR Clean-up kit (Macherey-Nagel, Germany) was used for DNA clean-up both from PCR products and agarose gel extracts. One Shot™ Maehl ™ T1 Phage-Resistant Chemically Competent E. coli (Thermo Fisher Scientific, USA) was used for cloning. NucleoSpin® Plasmid EasyPure Kit (Macherey-Nagel, Germany) was used for plasmid preparation. Sanger sequencing was carried out using Mix2Seq kit (Eurofins Scientific, Luxembourg). All DNA manipulations experiments were conducted according to standard procedures using manufacturer protocols. We diligently followed all waste disposal regulations of our institute, university, and local government when disposing of waste materials.
Table 5. Summary of primers used in this study.
Primer Sequence (5’ 3’) Description name
CGGTTGGTAGGATCGACGGCGCACCCAGGCGGTAT Inactivation of Del-ptaA
GCGTAGTTTTAGAGCTAGAAATAGC ptaA
Forward primer
ID-sgRNA-
TGTGTGGAATTGTGAGCGGATA for screening
F plasmid
Reverse primer
ID-sgRNA-
CCCATTCAAGAACAGCAAGCA for screening
R plasmid
Forward primer
ID-ptaA-F TTGCACAGCTCGACGGACAT for screening mutants
Reverse primer
ID-ptaA-R GTGTCACCCGCTTTGTCGA for screening mutants
Genetic manipulation The gene annotation for the pteridic acids biosynthetic gene cluster is shown in Table 1. To use the pCRISPR-BEST for base editing applications, the oligo was designed as Del-ptaA and the pCRISPR-BEST plasmid was linearized by Ncol. By mixing the linearized pCRISPR-BEST plasmid and Del-ptaA with the NEBuilder® HiFi DNA Assembly Master Mix (New England Biolabs, USA). The linearized pCRISPR-BEST plasmid then will be bridged by Del-ptaA, ending up with the desired pCRISPR- cBEST/AptaA The recombinant plasmid is transformed into chemically competent E. coli and confirmed via PCR amplification and Sanger sequencing. The E.coli- Streptomyces conjugation experiment was conducted according to the modified protocol. The MS media with addition of 120 mM calcium chloride solution was used for plating of conjugation mixes.
Example 2. Bioactive pteridic acids isolation and characterization
LC/MS analysis (Figure 2) of both Streptomyces iranensis and Streptomyces rapamycinicus revealed that they produce polyketides which were proposed to belong to the pteridic acids family.
To elucidate the structures of those polyketides, the organic extract of an up-scaled fermentation broth (200 L) of Streptomyces iranensis was subjected to open-column chromatography on Amberchrom 161c resin, silica gel, and Sephadex LH-20, yielding compounds 6 (4.0 mg), 8 (15.0 mg), and 9 (0.9 mg), which were studied by NMR, MS and CD spectroscopy. The NMR data are shown in Tables 6-7.
Compound 6, a white solid, was isolated as pteridic acid F since ESIMS deduced the same molecular formula of C21H34O6. The 1H NMR spectrum exhibited signals for four olefinic protons (67.16, 6.25, 6.07, 5.97) corresponding to two conjugated double bonds, four oxygen-bearing methines (6 3.88, 3.66, 3.56, 3.32), five methyls, and other aliphatic protons. The 13C NMR spectrum indicated the presence of one carbonyl group (6 170.2) and one oxygen-bearing quaternary carbon (6 103.2, C-11). HSQC and HMBC correlations confirmed a spiroketal skeleton (Figure 3). NOESY spectrum confirmed its relative configurations, where correlations between H-21 and H-13 and H- 15, H-7 and H-12a, and H6, H-10 and Me-18 were observed. The key NOESY correlations between H-7 and H-12a revealed a different spirolketal structure compared to 6. This can be also reflected by the relative up-field NMR data for C-12 (633.8 vs 6 37.4 in 6). Literature survey revealed that a same chemical was claimed to be isolated from Streptomyces pseudoverticillus YN 17707.5 Pteridic acid F was also isolated from a marine Streptomyces sp.4
Compound 8 was isolated as a white solid. Its formula of C21H34O6 was deduced by ESIMS [M + H]+ 383.2418 (calculated for 383.2428, 2.6 ppm). The 1H NMR spectrum exhibited signals for four olefinic protons (6 7.33, 6.26, 6.13, 5.90) corresponding to two conjugated double bonds, four oxygen-bearing methines (6 3.85, 3.69, 3.59, 3.43), five methyls, and other aliphatic protons. The 13C NMR spectrum indicated the presence of one carbonyl group (6 168.7) and one oxygen-bearing quaternary carbon (6 103.2, C- 11). The H, H COSY spectrum established two partial substructures, which could be connected via a spiro function through the analysis of HSQC and HMBC correlations (Figure 3). Compound 8 was crystallized in methanol solution. The X-ray structure
determination confirmed the structure as an isomer of pteridic acid F and was named as pteridic acid H (Figure 4).
Compound 9 was a white solid, isolated as a third pteridic acid derivative. Its formula C22H34O6 was deduced by the ESIMS [M + H]+ 395.2426 (calculated for 395.2428, 0.55 ppm). The 1H NMR spectrum exhibited signals for four olefinic protons (67.23, 6.16, 6.02, 5.86) corresponding to two conjugated double bonds, three oxygen-bearing methines (64.14, 3.76, 3.75), six methyls and other aliphatic protons. The 13C NMR spectrum indicated the presence of two carbonyl groups (6211.3, 169.3) and one oxygen-bearing quaternary carbon (6 102.2, C-11). The presence of C-11 (6 102.2) indicated the existence of a spiro ring as the other pteridic acids. The location of the carbonyl group at C-13 was confirmed by correlations between H-14, H-15, and H-20 to C-13, in the HMBC spectrum. The location of the O-methyl group was determined by the HMBC correlation between OMe and C-1 (6 169.3). Its relative configuration was established by NOESY experiment where correlations between H-15 and Me-21 , H-6, H-10 and Me-18, H-12a and Me-19, H7 and Me-17, and H9 and Me-19 were observed. Thus, compound 9 shares the same skeleton as pteridic acid H and we name it pteridic acid I.
However, after storage of the main metabolite pteridic acid H in methanol solution, it gets transformed into pteridic acid F and other metabolites (Figure 5). We propose that pteridic acid H is the primary metabolite from the BGC and the other pteridic acids are transformed metabolites.
Table 6 - 1H (800 MHz) NMR data for 6, 8 and 9 (in MeOD)
Table 7. 13C (200 MHz) NMR data for 6, 8 and 9 (in MeOD)
Example 3. Biosynthesis of pteridic acid
Whole genome sequencing and bioinformatics analysis revealed that there are 44 biosynthetic gene clusters in Streptomyces iranensis HM 35 (NCBI taxonomy ID, 576784; sample ID, DSM41954).6 Based on cluster BLAST, structural similarity analysis and polyketides biosynthesis mechanisms, we hypothesized that the elaiophylin biosynthetic gene cluster is also responsible for pteridic acids biosynthesis (Figure 6). To confirm the hypothesis, the core gene of potential pteridic acids biosynthesis, ptaA, was inactivated in S. iranensis HM35 by introducing a stop codon at position 916 instead of tryptophan. By comparing the metabolite discrepancy of the wild-type strain and the mutant strain, we can determine that the inactivation of the ptaA gene caused the mutant strain to lose the ability to produce pteridic acids (Figure 7).
Generally, the individual domains in type I polyketide synthases are grouped into functional modules containing basic modules, including ketosynthase domain (KS), acyltransferase domain (AT), and acyl carrier protein domain (AGP). There are some modification modules in the assembly line, such as a p-ketoreductase domain (KR), a dehydratase domain (DH), and an enoyl reductase domain (ER). The growing polyketide chain transfers from the AGP of the first extender module to the KS of the next module, and when the carbon chain reaches the final extension, the linear polyketide is released by a thioesterase (TE). Pteridic acids are assembled by multi- modular type I polyketide synthases following the PKS pattern collinearity, including
eight modules, corresponding to one starting unit (acetyl-CoA) followed by seven extensions (methylmalonyl-CoA or ethylmalonyl-CoA), to form a linear polyketide precursor. The 6,6-spiroketal core structure is formed because spontaneous spiroketalization of the carbonyl group on C11 and the two hydroxyl groups on C17 and C25. Following a loss of H2O, two different oriented spiro rings were formed to yield compound pteridic acid F and H. According to the structural characteristics of pteridic acids, the KR in module 3 is inactive and the DH in module 1 may be selectively in trans acting on the malonyl unit in module 2.7
Herein, based on the evidence from the biosynthetic information and genome editing result, we propose that both pteridic acids and elaiophylins were derived from a common biosynthetic gene cluster. The organization of the gene cluster and biosynthesis pathway can be seen in Figure 8.
Through NCBI search using pteridic acid BGC in S. iranensis, there are various Actinobacteria harboring pteridic acid biosynthetic gene cluster, e.g., Streptomyces zinciresistens, Streptomyces buecherae, Streptomyces malaysiensis, Streptomyces samsunensis, Streptomyces hygroscopicus, Streptomyces antioxidans, Streptomyces javensis, Streptomyces rhizosphaericus, Streptomyces al bus, Streptomyces physcomitrii, Streptomyces yatensis, Streptomyces solisilvae, Streptomyces melanosporofaciens, Streptomyces lasiicapitis, Streptomyces autolyticus, Streptomyces zinciresistens K42, Streptomyces cangkringensis, Streptomyces indonesiensis, Streptomyces asiaticus, Streptomyces aureoverticillatus, Streptomyces buecherae, Streptomyces antimycoticus, Streptomyces lasiicapitis, Streptomyces lasiicapitis, Allokutzneria albata and Streptomyces violaceusniger.
Example 4. Effects of pteridic acids and pteridic acids producers in planta Pteridic acids F, H and I and pteridic acids producers have been tested of their biostimulant effects in two different plants (mung beans and barley) under three abiotic stresses (drought, heavy metal and salinity). The results clearly distinguished the effects from the prior art pteridic acids A-B.
Pteridic acid H was tested for its stress hormone function in comparison with ABA in a Petri Dish assay. Unlike pteridic acids A-B, pteridic acid H could not promote the formation of adventitious roots in the hypocotyl of beans, no auxin-like activities were
observed for pteridic acid H (Figure 9). Instead, it promotes the growth of hypocotyl in mung beans. Pteridic acid H could enhance hypocotyl growth (Table 8).
To evaluate pteridic acids F, H and I in helping plants cope with different abiotic stresses, a bioassay using mung beans grown in Petri dish was carried out. Three different types of stress were tested, drought mediated by 15% PEG-6000, salinity by 100 mM NaCI and heavy metal by 10 mM CuSC .
1 ng/mL of pteridic acids, IAA and ABA were supplemented into the mung bean culture, respectively. Under drought conditions, pteridic acids H and I exhibited significant effects in helping mung beans cope with drought. Compared to the PEG control, the average root length was increased by 60% vs. control for both pteridic acids H and I (t- test, p<0.01%) and is comparable to ABA (64% vs. control, t-test, p<0.01%). Neither pteridic acid F and IAA exhibited promoting effects (Table 9).
Under 100 mM NaCI condition, both pteridic acids H and I could significantly (vs. control, t-test, p<0.01%) reduce the salinity effects and performed better than ABA, with an average hypocotyl length of 24.7 mm (pteridic acid F), 25.3 mm (pteridic acid I) and 22.7 mm (ABA). Meanwhile, compared to the control (39.3 mm) and NaCI (12.0 mm) using, neither IAA and pteridic acid F showed effect and there was a similar growth as the control (Table 10).
Under 10 mM CuSO4 condition, pteridic acid H and ABA were used. Pteridic acid H exhibited a slightly better effect than ABA (Table 11 , Figure 10).
Pteridic acid H and ABA could help barley cope with drought stress under 10 nM (Figure 11). Inoculation of pteridic acids producers S. rapamycinicus and S. violeceuniger could help barley cope with drought stress (Figure 12).
Table 8 - Hypocotyl growth of mung beans under treatment of pteridic acids F, H and I, IAA and ABA (1 ng/mL).
Table 9 - Hypocotyl growth of mung beans under drought condition (mediated by 15% PEG-6000), with treatment of pteridic acids F, H and I, IAA and ABA (1 ng/mL).
Table 10 - Hypocotyl growth of mung beans under salinity condition (mediated by 100 mM NaCI), with the treatment of pteridic acids F, H and I, IAA and ABA (1 ng/mL)
Table 11. Hypocotyl growth of mung beans under heavy metal condition (mediated by
10 mM CuSO4), with the treatment of pteridic acid H and ABA (1 ng/mL)
Example 5. Promoting effect of ptenchc acid H on germination rate of wheat seeds
Wheat seeds (35-40 seeds per petri dish, 3 parallels for each treatment) were put on the sterilized filter paper after disinfection with 70 % ethanol for 30s and 2 % sodium hypochlorite for 12 min. Wheat seeds where treated with 7 mL of different concentrations of pteridic acid H (0.25, 0.5, 1.0 ng/mL) or distilled Milli-Q water (blank control). Then, after 5 days (incubation parameters: day/night cycle of 16/8h; 50%, 60%, 70%, 100% of circulation wind velocity for 12 h, 2 h, 2h, 8h, respectively), the amount of germinated and ungerminated seeds were counted and the average germination rate was calculated for each group. Statistical significance was assessed by one-way ANOVA with post hoc Dunnett’s multiple comparisons test. Asterisks indicate the level of statistical significance: *P < 0.05, **P < 0.01 and ***P < 0.001.
Pteridic acid H showed a promoting effect on germination rate of wheat seeds (Figure 13), and significant differences were detected between blank control and the group treated with 0.5 and 1 ng/mL pteridic acid H. In particular, 0.5 ng/ml was the concentration of pteridic acid H that had the strongest observed effect.
Example 6. Effect of pteridic acid H and F on kidney beans.
Kidney beans seeds (approximately 2 cm in length, from organic farming) were firstly sterilized successively with ethanol (70 % v/v) and sodium hypochlorite (5 % v/v), each for 2 min, and then rinsed with sterile Milli-Q water (three times). The sterilized seeds were cultivated in plates with MS (Murashige and Skoog Basal Medium, Sigma-Aldrich) diluted 1 :2 and 0.2 % Phytagel (Phytagel, Sigma-Aldrich) for 3-4 days. After germination, the seedlings (with 1.5-2 cm long roots) were soaked in 10 mL aliquot of testing compounds (pteridic acid H or pteridic acid F, 1.0 ng/mL, dissolved in sterile Milli-Q water) in ultra clear polypropylene containers (0 34 mm, vol. 20 mL) with polyethylene cap. Control group was treated with 10 mL sterile Milli-Q water. For each treatment, three replicate (containers) were used, and each replicate included four seedlings. After incubation for 24 h, the seeds were transferred into a cut square petri dish (10 cm*10 cm) with on the top layer of a 200 g mixture of 80 % sandy soil (from field) and 20% Light Mix soil (from Biobizz organics). The seeds where then incubated vertically in a growth chamber (24/22 °C, day/night cycle of 16/8 h; 50%, 60%, 70%, 100% of circulation wind velocity for 12 h, 2 h, 2h, 8h, respectively) for 7 days.
Solutions of pteridic acid H and pteridic acid (2 mL, 1.0 ng/mL for both) were added
separately into corresponding containers, sterile Milli-Q water was used as blank control.
Increased shoot length was observed in groups exposed to pteridic acid H (1 ng/mL) and pteridic acid F (1 ng/mL) compared to the control group (Figure 14).
No adventitious roots were observed in the groups exposed to pteridic acid H (1 ng/mL) and pteridic acid F (1 ng/mL), while one adventitious root was observed in the control group (Figure 15).
Pteridic acids A and B have been reported to stimulate adventitious root growth in kidney beans. Thus, the growth promoting effect of pteridic acids H and pteridic acid F is clearly different from the effect of pteridic acids A and B.
Example 7. Effect of pteridic acid H and F on mung beans
Mung beans seeds were firstly disinfected with 70 % ethanol (30 s) and 2 % sodium hypochlorite (12 min) and rinsed with sterile Milli-Q water for three times. Then they were moved into autoclaved glass tubes (15 mL) and put on the top layer of 5 mL of MS (Murashige and Skoog Basal Medium, Sigma-Aldrich) diluted 1 :2 and 0.2 % Phytagel (Phytagel, Sigma-Aldrich), which had been pre-mixed with different concentrations of pteridic acid H or F (PAH or PAF, 0.25, 0.5, 1.0, 5.0, 10.0 ng/mL), or sterile Milli-Q water (blank control), and each treatment included ten seeds. Then after 5 days (incubation parameters: day/night cycle of 16/8 h; 50%, 60%, 70%, 100% of circulation wind velocity for 12 h, 2 h, 2h, 8h, respectively), the shoot length (cm), root length (cm), fresh weight (g) and dry weight (g) of each seedling were measured separately. The dry weight were obtained by putting seedlings in the hot-air oven at 65°C for 12 hours. Statistical significance was assessed by one-way ANOVA with post hoc Dunnett’s multiple comparisons test. Asterisks indicate the level of statistical significance: *P < 0.05, **P < 0.01 and ***P < 0.001.
Increased root length was promoted by pteridic acid H at concentrations of 0.5 and 1 ng/mL, while at concentrations of 5 and 10 ng/mL, root length was slightly inhibited (Figure 16). Increased shoot length was significantly promoted by pteridic acid H at 0.5 ng/mL, and promotion was detected at all concentrations tested, i.e. , from 0.25 to 10 ng/mL (Figure 16). Increased fresh weight and dry weight were significantly promoted
by pteridic acid H at all concentration tested, i.e., 0.25-10 ng/mL; the effect was more prominent below 1 ng/mL (Figure 16).
Furthermore, when treated with pteridic acid H, mung beans cultivated in glass tubes with MS diluted 1:2 and Phytagel showed more lateral roots compared to blank control (Figure 17).
Increased root length and shoot length were promoted by pteridic acid F at concentration of 0.25, 0.5 and 1 ng/mL, while at 5 and 10 ng/mL root length was decreased. Increased fresh weight and dry weight were slightly promoted at 0.5 and 1 ng/mL, with no significance (Figure 18).
Example 8. Effect of pteridic acid H and F on barley
Seeds of barley or wheat were firstly sterilized with 70 % (v/v) ethanol (30 s) and 2 % (v/v) sodium hypochlorite (12 min) and rinsed with sterile Milli-Q water for three times. The sterilized seeds were incubated for 3 days on filter paper filled with sterile Milli-Q water in a petri dish. After germination, the seedlings (with 1-1.5 cm long shoots) were soaked in 10 mL aliquot of pteridic acid H or pteridic acid F (0.25, 0.5, 1.0, 5.0,10.0 ng/mL) in ultra-clear polypropylene containers (0 34 mm, vol. 20 mL) with polyethylene cap. Control group was treated with 10 mL sterile Milli-Q water. For each treatment 10 seedlings were included. After incubation for 24 h, the seeds were transferred into plastic pots (0.28 L for wheat and 0.41 L for barley seedlings) with Light Mix soil mixture (from Biobizz organics), then incubated in a growth chamber (24/22 °C, day/night cycle; 16/8h, 50%, 60%, 70%, 100% circulation wind velocity for 12h, 2h, 2h, 8h, respectively) for 5 days. Square plates filled with water were put under the pots to help the soil keep adequate moisture.
Increased root length was promoted by pteridic acid H at concentrations of 0.25, 0.5 and 1 ng/mL, while at 5 and 10 ng/mL root length was slightly inhibited (Figure 19A, and 19C). A similar trend, albeit not significant, was observed following treatment with pteridic acid F (Figure 19B).
Increased shoot length was promoted by pteridic acid H at all concentrations tested, namely 0.25 , 0.5, 1, 5 and 10 ng/mL (Figure 20).
Similarly, the culture broth of pteridic acid producers S iranensis HM 35 (Figure 29), as well as inoculation with S. violaceusniger and S. rapamycinicus (Figure 33) could help barley seedling cope with drought stress and salinity stress.
Example 9. Effect of pteridic acid H and F on Arabidopsis under stress
Columbia (Col) ecotype Arabidopsis thaliana seeds were firstly sterilized with 70 % (v/v) ethanol (30 s) and 2 % (v/v) sodium hypochlorite (12 min) and rinsed with sterile Milli-Q water for three times. Sterilized Arabidopsis seeds were then cold stratified for 2 days at 4 °C, and subsequently sown in Petri dishes that contained MS (Murashige and Skoog Basal Medium, Sigma-Aldrich) diluted 1:2 and 0.2 % Phytagel (Phytagel, Sigma- Aldrich). Petri dishes with seeds were placed vertically in growth chambers (24/22 °C; day/night cycle of 16/8 h; 50%, 60%, 70%, 100% of circulation wind velocity for 12 h, 2 h, 2h, 8h, respectively) for 3 days, and seedlings with 1-2 cm long roots were selected and transferred to new agar plates with different concentrations of pteridic acid H (PAH, 0.25, 0.5, 1.0, 5.0, 10.0 ng/mL) and continued to grow in the chamber for another 5 days. Data of 10 Arabidopsis seedlings were collected for each treatment. The excessive salinity stress was conducted at a concentration of 80 mM NaCI, and the drought stress was induced by 10 % (v/v) PEG or 20% (v/v) PEG. Statistical significance was assessed by one-way ANOVA with post hoc Dunnett’s multiple comparisons test. Asterisks indicate the level of statistical significance: *P < 0.05, **P < 0.01 and ***P < 0.001.
Increased root length was promoted by pteridic acid H at 0.25, 0.5 and 1 ng/mL, and inhibited at 5 and10 ng/mL (Figure 21 and 22).
Stress resistance of Arabidopsis to excessive salinity was significantly improved when incubated with 0.25, 0.5 and 1 ng/mL of pteridic acid H. Treatment with 0.25 ng/mL completely rescued root length growth under salt conditions, as there was no significant difference between blank control and the group treated with pteridic acid H (Figure 21 and 22).
Drought stress resistance of Arabidopsis was significantly improved by pteridic acid H (0.25, 0.5 and 1 ng/mL) under both 10% and 20% PEG treatments. Treatment with
0.25, 0.5 or 1 ng/mL completely rescued root length growth, as there was no significant difference between 10% PEG and control. Surprisingly, root length was even increased in the group treated with pteridic acid H in drought conditions caused by 20% PEG compared to control (Figure 23), and more more lateral roots were induced (Figure 24).
Similarly, treatment with the culture broth of pteridic acids producer S.iranensis HM 35 resulted in a significant increase of plant height, fresh weight and dry weight of Arabidopsis grown under drought conditions (Figure 30), or salinity stress (Figure 31).
The effect of 1.3 nM pteridic acid H or F was compared to treatments with a similar concentration auxin or ABA on Arabidopsis grown under conditions of drought (15% PEG) or high salinity (80 mM NaCI). Under stress conditions, both pteridic acids showed an effect on plant growth that resembled ABA (Figure 32). In particular, pteridic acid H was capable of promoting primary root length and fresh weight consistently more than a similar concentrations of ABA.
Example 10. Stability test of pteridic acid H
Pteridic acid H was dissolved with different water solutions to reach the concentration of 0.067 mg/mL for LC-ESI-HRMS/MS analyses. Water solutions of different pH were adjusted by 1M NaOH and 1M HCI. Ultra-high-performance liquid chromatographydiode array detection-quadrupole time-of-flight mass spectrometry (UHPLC-DAD- QTOFMS) was performed on an Agilent Infinity 1290 UHPLC system equipped with a diode array detector. Separation was achieved on a 250 x 2.1 mm i.d. , 2.7 pm, Poroshell 120 phenyl-hexyl column (Agilent Technologies) held at 60 °C and following previously described conditions8. Mass spectrometry (MS) detection was performed on an Agilent 6545 QTOF MS equipped with an Agilent dual jet stream electrospray ion source (ESI) with a drying gas temperature of 160 °C, a gas flow of 13 L min-1, a sheath gas temperature of 300 °C, and a flow rate of 16 L min-1. Capillary voltage was set to 4000 V and nozzle voltage to 500 V in positive mode. MS spectra were recorded as centroid data, at an m/z of 100-1700, and auto MS/HRMS fragmentation was performed at three collision energies (10, 20, and 40 eV), on the three most intense precursor peaks per cycle. The acquisition rate was 10 spectra s-1. Data were handled using Agilent MassHunter Qualitative Analysis software (Agilent Technologies). Lock mass solution in 70% MeOH in water was infused in the second sprayer using an extra LC pump at a flow rate of 15 pL/min using a 1:100 splitter. The solution contained 1 pM
tributylamine (Sigma-Aldrich) and 10 pM hexakis (2,2,3,3-tetrafluoropropoxy)- phosphazene (Apollo Scientific Ltd., Cheshire, UK) as lock masses. The [M + H]+ ions (m/z 186.2216 and 922.0098, respectively) of both compounds were used.
Pteridic acid H tested stable the first 3 days in pH 3 water solution, 4 °C, part of it was transferred to 25 °C for further test after 3 days, and the left was kept in 4 °C. After 11 days, nearly 20% of the pteridic acid H was transformed to pteridic acid F (Figure 25).
Pteridic acid H was unstable in pH 3 water solution, 25 °C. Pteridic acid H was transformed to pteridic acid F fast, and after 3 days 50% of pteridic acid H had already transformed into pteridic acid F. The transformation rate is approximately 12.5%, 25%, 37.5%, 50% in 1 d, 3 d, 5 d and 7 d in pH 3 water solution, 25 °C (Figure 26).
Pteridic acid H was stable in pH 7 water solution in 4 °C with low ability to transform to pteridic acid F even after 11 days (Figure 27).
Pteridic acid H was stable in pH 7 water solution in 25 °C with low ability to transform to pteridic acid F even after 11 days (Figure 28).
Example 11. Pteridic acid biosynthesis in the other Streptomyces
The pteridic acid biosynthetic genes of different Streptomyces origin were predicted by the antiSMASH 6.0 software, and nucleotide sequence alignment was performed by Blastn function in the software Geneious 9.0.2. The results are illustrated in Table 12.
Table 12. Comparison of pteridic acid biosynthetic genes in the other three Streptomyces with S. iranensis.
Example 12. Isolation of Pteridic acids in Streptomyces
Cultivation and plug extraction of Streptomyces
Streptomyces strains were grown on agar plates of ISP medium 3 (oatmeal 20.0 g, agar 18.0 g, trace salts solution 1 mL, distilled deionized water 1 L) at 28 °C in the chamber. The trace salts solution consisted of FeSO^FW 0.1 g, MnCh'4 H2O 0.1 g, ZnSC>4-7 H2O 0.1 g and distilled deionized water 100 mL. After the incubation for 14 days, an agar plug (6 mm diameter) of the bacterial culture was taken out of the agar plates and transferred to a vial (Eppendorf) and extracted with 1 mL of methanol under ultrasonication for 60 min. The extracts were then transferred to new vials (Eppendorf), evaporated to dryness under N2, and re-dissolved in 200 pL of methanol for further sonication over 15 min (or vortex). After centrifugation at 13400 rpm for 3 min, the supernatants were transferred to HPLC vials and subjected to ultrahigh-performance liquid chromatography-high resolution electrospray ionization mass spectrometry (UHPLC-HRESIMS) analysis.
LC-MS analysis’.
Ultra-high-performance liquid chromatography-diode array detection-quadrupole time- of-flight mass spectrometry (UHPLC-DAD-QTOFMS) was performed on an Agilent Infinity 1290 UHPLC system equipped with a diode array detector. Separation was achieved on a 250 * 2.1 mm i.d. , 2.7 pm, Poroshell 120 phenyl-hexyl column (Agilent Technologies) held at 60 °C and following previously described conditions. Mass spectrometry (MS) detection was performed on an Agilent 6545 QTOF MS equipped with an Agilent dual jet stream electrospray ion source (ESI) with a drying gas temperature of 160 °C, a gas flow of 13 L min-1, a sheath gas temperature of 300 °C, and a flow rate of 16 L min-1. Capillary voltage was set to 4000 V and nozzle voltage to 500 V in positive mode. MS spectra were recorded as centroid data, at an m/z of 100- 1700, and auto MS/HRMS fragmentation was performed at three collision energies (10, 20, and 40 eV), on the three most intense precursor peaks per cycle. The acquisition rate was 10 spectra s-1. Data were handled using Agilent MassHunter Qualitative Analysis software (Agilent Technologies). Lock mass solution in 70% MeOH in water
was infused in the second sprayer using an extra LC pump at a flow rate of 15 pL/min using a 1:100 splitter. The solution contained 1 pM tributylamine (Sigma-Aldrich) and 10 pM hexakis (2,2,3,3-tetrafluoropropoxy)phosphazene (Apollo Scientific Ltd., Cheshire, UK) as lock masses. The [M + H]+ ions (m/z 186.2216 and 922.0098, respectively) of both compounds were used.
Table 13. Pteridic acid production in the other three Streptomyces using pteridic acid F, H and I as standards from S. iranensis
Sequence overview
References
1) Mega, R.; Abe, F.; Kim, J. S.; Tsuboi, Y.; Tanaka, K.; Kobayashi, H.; Sakata, Y.; Hanada, K.; Tsujimoto, H.; Kikuchi, J.; Cutler, S. R.; Okamoto, M. Tuning Water-Use Efficiency and Drought Tolerance in Wheat Using Abscisic Acid Receptors. Nature Plants. 2019. https://doi.org/10.1038/s41477-019-0361-8.
2) Waterland, N. L.; Campbell, C. A.; Finer, J. J.; Jones, M. L. Abscisic Acid Application Enhances Drought Stress Tolerance in Bedding Plants. HortScience 2010. https://doi.Org/10.21273/hortsci.45.3.409.
3) Igarashi, Y.; lida, T.; Yoshida, R.; Furumai, T. Pteridic Acids A and B, Novel Plant Growth Promoters with Auxin-like Activity from Streptomyces Hygroscopicus TP-A0451. Journal of Antibiotics. 2002. https://doi.org/10.7164/antibiotics.55.764.
4) Nong, X. H.; Wei, X. Y.; Qi, S. H. Pteridic Acids C-G Spirocyclic Polyketides from the Marine-Derived Streptomyces Sp. SCSGAA 0027. Journal of Antibiotics 2017. https://doi.org/10.1038/ja.2017.105.
5) Han, B.; Li, W. X.; Cui, C. bin. Pteridic Acid Hydrate and Pteridic Acid C Produced by StreStreptomyces Pseudoverticillus YN17707 Induce Cell Cycle Arrest. Chinese Journal of Natural Medicines 2015, 13 (6), 467-470. https://doi.Org/10.1016/S1875-5364(15)30041 -8.
6) Horn, F.; Schroeckh, V.; Netzker, T.; Guthke, R.; Linde, J. Draft Genome Sequence of Streptomyces Iranensis. Genome Announcements 2014. https://doi.Org/10.1128/genomeA.00616-14.
7) Klassen, J. L.; Lee, S. R.; Poulsen, M.; Beemelmanns, C.; Kim, K. H. Efomycins K and L from a Termite-Associated Streptomyces Sp. M56 and Their Putative Biosynthetic Origin. Frontiers in Microbiology 2019, 10 (JULY), 1-8. https://doi.Org/10.3389/fmicb.2019.01739. 8) Wang, X.; Subko, K.; Kildgaard, S.; Frisvad, J. C.; Larsen, T. O. Front. Fungal
Biol. 2021, 2, DOI: 10.3389/ffunb.2021.719420.
Items
1. A compound of formula (VI),
or a salt or solvate thereof; wherein,
Ri and R2are independently selected from the group consisting of: hydrogen, alkyl and halogen;
Rs is selected from the group consisting of: hydrogen, oxygen, methoxy, and hydroxy;
R4 is selected from the group consisting of: hydrogen, methyl and ethyl;
X is selected from oxygen and nitrogen; n is selected from 1 and 2, preferably the compound is of formula (VII):
or a salt or solvate thereof; wherein,
Ri and R2are independently selected from the group consisting of: hydrogen, alkyl and halogen;
Rs is selected from the group consisting of: oxygen, methoxy, and hydroxy;
X is selected from oxygen and nitrogen; preferably the compound is of formula (II):
3. The compound according to any one of items 1 or 2, wherein R1 is a Ci-e alkyl.
4. The compound according to any one of the previous items , wherein R2 is a Ci-e alkyl.
5. The compound according to any one of the previous items, wherein R1 is methyl.
6. The compound according to any one of the previous items, wherein R2 is methyl.
7. The compound according to any one of items 1 or 2 , wherein R1 is hydrogen and R3 is hydroxy.
8. The compound according to any one of items 1 or 2, wherein R1 is methyl and Rs is oxygen.
9. The compound according to any one of items 1 or 2, wherein: i. R1 is hydrogen and Rs is hydroxy; or ii. R1 is methyl and R3 is oxygen.
The compound according to any one of the previous items, wherein Ri and R2 are hydrogen, Rs is hydroxy, X is oxygen, n is 2, and the compound is pteridic acid H of formula (IV)
The compound according to any one of the previous items, wherein R1 is methyl, R2 is hydrogen, R3 is oxygen, X is oxygen, n is 2, and the compound is pteridic acid I of formula (V):
A composition comprising the compound according to any one of the preceding items. The composition according to item 12, wherein the composition comprises any one of the pteridic acids selected from the group consisting of: pteridic acid H, pteridic acid F, and pteridic acid I. The composition according to any one of items 12 to 13, wherein the composition further comprises an acceptable carrier.
15. The composition according to any one of items 12 to 14, wherein the composition further comprises one or more additional compounds selected from the group consisting of a liquid carrier, a solid carrier and a substrate.
16. An isolated nucleic acid comprising or consisting of a nucleic acid selected from the group consisting of: i) ptaA as set forth in SEQ ID NO: 1; ii) ptaB as set forth in SEQ ID NO: 3; iii) ptaC as set forth in SEQ ID NO: 5; iv) ptaD as set forth in SEQ ID NO: 7; and v) ptaE as set forth in SEQ ID NO: 9, and respective variants thereof having at least 70% similarity or identity thereto, such as at least 80%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% similarity or identity thereto.
17. A vector or a system of vectors comprising any one of the isolated nucleic acids selected from the group consisting of: i) ptaA as set forth in SEQ ID NO: 1; ii) ptaB as set forth in SEQ ID NO: 3; iii) ptaC as set forth in SEQ ID NO: 5; iv) ptaD as set forth in SEQ ID NO: 7; and v) ptaE as set forth in SEQ ID NO: 9, and respective variants thereof having at least 70% similarity or identity thereto, such as at least 80%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% similarity or identity thereto.
18. The vector or system of vectors according to item 17, wherein the vector or system of vectors comprise all the isolated nucleic acids: i) ptaA as set forth in SEQ ID NO: 1; ii) ptaB as set forth in SEQ ID NO: 3; iii) ptaC as set forth in SEQ ID NO: 5;
iv) ptaD as set forth in SEQ ID NO: 7; and v) ptaE as set forth in SEQ ID NO: 9, and respective variants thereof having at least 70% similarity or identity thereto, such as at least 80%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% similarity or identity thereto.
19. A cell producing the compound according to any one of items 1 to 11.
20. The cell according to item 19, wherein the cell is a non-natural cell, expressing one or more heterologous proteins selected from the group consisting of: i) PtaA as set forth in SEQ ID NO: 2, ii) PtaB as set forth in SEQ ID NO: 4, iii) PtaC as set forth in SEQ ID NO: 6, iv) PtaD as set forth in SEQ ID NO: 8, and v) PtaE as set forth in SEQ ID NO: 10, or functional variants thereof having at least 70% similarity or sequence identity thereto, such as at least 75%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 95% sequence identity thereto.
21. The cell according to any one of items 19 to 20, wherein the cell is a nonnatural cell, expressing i) PtaA as set forth in SEQ ID NO: 2 or a functional variant thereof having at least 70% sequence identity thereto; ii) PtaB as set forth in SEQ ID NO: 4 or a functional variant thereof having at least 70% sequence identity thereto; iii) PtaC as set forth in SEQ ID NO: 6 or a functional variant thereof having at least 70% sequence identity thereto; iv) PtaD as set forth in SEQ ID NO: 8 or a functional variant thereof having at least 70% sequence identity thereto; and v) PtaE as set forth in SEQ ID NO: 10 or a functional variant thereof having at least 70% sequence identity thereto.
22. The cell according to any one of items 19 to 21 , wherein the cell is a nonnatural cell, preferably a non-natural cell comprising any one of the isolated nucleic acids according to item 16, such as in the genome or on a vector, preferably the vector or system of vectors according to any one of items 17 or 18.
23. The cell according to any one of items 19 to 22, wherein the cell is a microorganism.
24. The cell according to any one of items 19 to 23, wherein the cell comprises any one of the nucleic acid sequences selected from the group consisting of: i) ptaA as set forth in SEQ ID NO: 1; ii) ptaB as set forth in SEQ ID NO: 3; iii) ptaC as set forth in SEQ ID NO: 5; iv) ptaD as set forth in SEQ ID NO: 7; or v) ptaE as set forth in SEQ ID NO: 9, and respective variants thereof having at least 70% similarity or identity thereto, such as at least 80%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% similarity or identity thereto.
25. The cell according to any one of items 19 to 24, wherein the cell is a nonnatural S. iranensis, S. violaceusniger, S. melanosporofaciens, S. cangkringensis, and/or S. rapamycinicus cell or wherein the cell is a natural cell which is not a S. iranensis, S. violaceusniger, S. melanosporofaciens, S. cangkringensis, or a S. rapamycinicus cell.
26. The cell according to any one of items 19 to 25, wherein the cell is a nonnatural S. iranensis and/or S. rapamycinicus cell or wherein the cell is a natural cell which is not a S. iranensis or a S. rapamycinicus cell.
27. The cell according to any one of items 19 to 25, wherein the microorganism belongs to the genus Streptomyces or Allokutzneria, for example S. iranensis, S. rapamycinicus, Streptomyces zinciresistens, Streptomyces buecherae,
Streptomyces malaysiensis, Streptomyces samsunensis, Streptomyces hygroscopicus, Streptomyces antioxidans, Streptomyces javensis, Streptomyces rhizosphaericus, Streptomyces albus, Streptomyces physcomitrii, Streptomyces yatensis, Streptomyces solisilvae, Streptomyces melanosporofaciens, Streptomyces lasiicapitis, Streptomyces autolyticus, Streptomyces zinciresistens K42, Streptomyces cangkringensis, Streptomyces indonesiensis, Streptomyces asiaticus, Streptomyces aureoverticillatus, Streptomyces buecherae, Streptomyces antimycoticus, Streptomyces lasiicapitis, Streptomyces lasiicapitis, Streptomyces violaceusniger, and/or Allokutzneria albata, preferably S. iranensis, and/or S. rapamycinicus. A compound as defined in any one of items 1 to 11 , or a composition as defined in any one of items 12 to 15, obtainable by a method comprising growing a cell in a cultivation broth, wherein the cell is as defined in any one of items 19 to 27, under conditions allowing the production of the compound. A method of producing a compound as defined in any one of items 1 to 11 , or a composition as defined in any one of items 12 to 15, comprising growing a cell in a cultivation broth, wherein the cell is a cell as defined in any one of items 19 to 27, under conditions allowing the production of the compound. The compound, or the composition, according to item 28, or the method according to item 29, wherein the method further includes a step of obtaining an organic extract of the cultivation broth. The compound, or the composition, according to any one of items 28, the method according to item 29, and/or the compound, or the composition, or the method according to item 30, wherein the method further includes a step of recovering and optionally purifying the compound from the organic extract. The compound, or the composition, or the method according to item 31 , wherein the purification is conducted by organic solvent extraction followed by chromatographic separation by Sephadex LH-20 and silica gel chromatography.
33. A method of promoting the growth of a plant, promoting seed germination, and/or reducing the stress on a plant, said method comprising contacting a compound as defined in any one of items 1 to 11 , or the composition as defined in any one of items 12 to 15, with the plant.
34. The compound, or the composition, according to any one of items 28 or 30 to 32, the composition according to any one of items 28 to 32, or the method according to any one of items 29 to 33, wherein the compound is pteridic acid H and/or pteridic acid I.
35. The method according to any one of items 33 to 34, wherein the seed germination rate of the plant is increased of at least 1%, such as at least 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7% compared to the seed germination rate of another plant of the same species which is not contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
36. The method according to any one of items 33 to 35, wherein any one of the parameters selected from the group consisting of: the root length; the shoot length; the fresh weight; and the dry weight, of the plant is increased of at least 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%,
24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%,
37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, or at least 50% compared to the same parameter, /.e., the root length; the shoot length; the fresh weight; or the dry weight, of another plant of the same species which is not contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
37. The method according to any one of items 33 to 36, wherein the plant is grown under stress conditions, preferably under abiotic stress conditions such as drought conditions, high soil salinity and/or high levels of heavy metals in the soil in which the plant is grown.
The method according to any one of items 33 to 37, wherein the root length of the plant grown under stress conditions, preferably under abiotic stress conditions such as drought conditions, high soil salinity and/or high levels of heavy metals in the soil in which the plant is grown is increased of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 160%, 180%, 200%, 220%, 240%, 260%, 280%, 300%, 350%, 400%, 450%, or 500% compared to the root length of another plant of the same species which is not contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions. The method according to any one of items 33 to 38, wherein the drought condition is defined by a drought Palmer drought index less than -2, such as less than -3, less than -4, less than -5, less than -6, less than -7, less than -8, less than -9, or -10. The method according to any one of items 33 to 39, wherein the condition of high salinity is defined as an electrical Conductivity (mmhos/cm) greater than 1.26 in the soil, for example greater than 1.3, greater than 1.4, greater than 1.5, greater than 1.75, greater than 2.00. The method according to any one of items 33 to 40, wherein the condition of high levels of heavy metals is reached when at least one heavy metal, preferably selected from the group consisting of: Cd, Zn, Cu, Cr, Pb and Ni, exceeds the concentration of 10 mg/kg in the soil, such as exceeds the concentration of 12 mg/kg, of 15 mg/kg, of 17 mg/kg, of 20 mg/kg, or more; or the condition of high levels of heavy metals is reached when the sum of the concentrations of individual heavy metals, preferably selected from the group consisting of: Cd, Zn, Cu, Cr, Pb and Ni, exceeds the concentration of 10 mg/kg in the soil, such as exceeds the concentration of 12 mg/kg, of 15 mg/kg, of 17 mg/kg, of 20 mg/kg, or more. The method according to any one of items 33 to 41 , wherein the formation of adventitious roots in the hypocotyl of the plant is not increased compared to the formation of adventitious roots of another plant of the same species which is not
contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
43. The method according to any one of items 33 to 42, wherein the growth of hypocotyl is increased compared to the growth of hypocotyl of another plant of the same species which is not contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
44. The method according to any one of items 33 to 43, wherein the plant is barley, wheat, potato, rice, maize, mung bean, soybeans/legume, rapeseed, sugar cane, cassava, groundnut, corn, cotton, tomato, grape, lettuce, sugar beet, palm, coffee, tobacco, tea, cannabis, coca, strawberry, carrot, cabbage.
45. The method according to any one of items 33 to 44, wherein the compound is supplied to the soil in which the plant is grown as a pure compound, a composition comprising the compound, as a lysate of a cell producing the compound, by supplementation of cells producing the compound, as part of a cultivation broth comprising the compound and/or cells producing the compound, preferably the cell according to any one of items 19 to 27.
46. The method according to any one of items 33 to 45, wherein the compound, or a composition comprising the compound, such as pteridic acid H, is supplied to the soil at a concentration of the compound between 0,1 nM and 500 nM, preferably 10 nM.
47. The method according to any one of items 33 to 46, wherein the compound, or a composition comprising the compound, is supplied to the soil by irrigation, seed-coating or foliar spray at the time of planting or before drought starts.
48. The method according to any one of items 33 to 47, wherein the compound is supplied to the soil as a cultivation broth of a cell producing the compound 50 pL-1 mL/plant, with a microbial cfu 105-101o/plant, preferably the cell according to any one of items 19 to 27.
Use of the compound according to any one of the items 1 to 11 , 28, or 30 to 32, or a composition according to any one of items 12 to 15, 28 or 30 to 32 to promote growth of a plant, promote seed germination, and/or to reduce the stress of a plant. The use according to item 49, wherein the plant is as defined in item 44.
Claims
Claims
1. A compound of formula (VI),
or a salt or solvate thereof; wherein,
Ri and R2are independently selected from the group consisting of: hydrogen, alkyl and halogen;
Rs is selected from the group consisting of: hydrogen, oxygen, methoxy, and hydroxy; R4 is selected from the group consisting of: hydrogen, methyl and ethyl;
X is selected from oxygen and nitrogen; n is selected from 1 and 2, preferably the compound is of formula (VII):
2. A compound of formula (I),
or a salt or solvate thereof; wherein,
Ri and F<2 are independently selected from the group consisting of: hydrogen, alkyl and halogen;
Rs is selected from the group consisting of: oxygen, methoxy, and hydroxy;
X is selected from oxygen and nitrogen; preferably the compound is of formula (II):
3. The compound according to any one of the previous claims, wherein R1 is a Ci-e alkyl.
4. The compound according to any one of the previous claims, wherein R2 is a Ci-e alkyl.
5. The compound according to any one of the previous claims, wherein R1 is methyl.
6. The compound according to any one of the previous claims, wherein R2 is methyl.
7. The compound according to any one of claims 1 or 2, wherein R1 is hydrogen and R3 is hydroxy.
8. The compound according to any one of claims 1 or 2, wherein R1 is methyl and Rs is oxygen.
9. The compound according to any one of claims 1 or 2, wherein: i. R1 is hydrogen and Rs is hydroxy; or ii. R1 is methyl and R3 is oxygen.
The compound according to any one of the previous claims, wherein Ri and R2 are hydrogen, Rs is hydroxy, X is oxygen, n is 2, and the compound is pteridic acid H of formula (IV):
The compound according to any one of the previous claims, wherein R1 is methyl, R2 is hydrogen, R3 is oxygen, X is oxygen, n is 2, and the compound is pteridic acid I of formula (V):
A composition comprising the compound according to any one of the preceding claims. The composition according to claim 12, wherein the composition comprises any one of the pteridic acid selected from the group consisting of: pteridic acid H, pteridic acid F, and pteridic acid I. The composition according to any one of claims 12 to 13, wherein the composition further comprises an acceptable carrier.
94
15. The composition according to any one of claims 12 to 14, wherein the composition further comprises one or more additional compounds selected from the group consisting of a liquid carrier, a solid carrier and a substrate.
16. An isolated nucleic acid comprising or consisting of a nucleic acid selected from the group consisting of: i) ptaA as set forth in SEQ ID NO: 1; ii) ptaB as set forth in SEQ ID NO: 3; iii) ptaC as set forth in SEQ ID NO: 5; iv) ptaD as set forth in SEQ ID NO: 7; and v) ptaE as set forth in SEQ ID NO: 9, and respective variants thereof having at least 70% similarity or identity thereto, such as at least 80%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% similarity or identity thereto.
17. A vector or a system of vectors comprising any one of the isolated nucleic acids selected from the group consisting of: i) ptaA as set forth in SEQ ID NO: 1; ii) ptaB as set forth in SEQ ID NO: 3; iii) ptaC as set forth in SEQ ID NO: 5; iv) ptaD as set forth in SEQ ID NO: 7; and v) ptaE as set forth in SEQ ID NO: 9, and respective variants thereof having at least 70% similarity or identity thereto, such as at least 80%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% similarity or identity thereto.
18. The vector or system of vectors according to claim 17, wherein the vector or system of vectors comprise all the isolated nucleic acids: i) ptaA as set forth in SEQ ID NO: 1; ii) ptaB as set forth in SEQ ID NO: 3; iii) ptaC as set forth in SEQ ID NO: 5;
95
iv) ptaD as set forth in SEQ ID NO: 7; and v) ptaE as set forth in SEQ ID NO: 9, and respective variants thereof having at least 70% similarity or identity thereto, such as at least 80%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% similarity or identity thereto.
19. A cell producing the compound according to any one of claims 1 to 11.
20. The cell according to claim 19, wherein the cell is a non-natural cell, expressing one or more heterologous proteins selected from the group consisting of: i) PtaA as set forth in SEQ ID NO: 2, ii) PtaB as set forth in SEQ ID NO: 4, iii) PtaC as set forth in SEQ ID NO: 6, iv) PtaD as set forth in SEQ ID NO: 8, and v) PtaE as set forth in SEQ ID NO: 10, or functional variants thereof having at least 70% similarity or sequence identity thereto, such as at least 75%, such as at least 80%, such as at least 85%, such as at least 90%, such as at least 95% sequence identity thereto.
21. The cell according to any one of claims 19 to 20, wherein the cell is a nonnatural cell, expressing i) PtaA as set forth in SEQ ID NO: 2 or a functional variant thereof having at least 70% sequence identity thereto; ii) PtaB as set forth in SEQ ID NO: 4 or a functional variant thereof having at least 70% sequence identity thereto; iii) PtaC as set forth in SEQ ID NO: 6 or a functional variant thereof having at least 70% sequence identity thereto; iv) PtaD as set forth in SEQ ID NO: 8 or a functional variant thereof having at least 70% sequence identity thereto; and v) PtaE as set forth in SEQ ID NO: 10 or a functional variant thereof having at least 70% sequence identity thereto.
22. The cell according to any one of claims 19 to 21, wherein the cell is a nonnatural cell, preferably a non-natural cell comprising any one of the isolated nucleic acids according to claim 16, such as in the genome or on a vector, preferably the vector or system of vectors according to any one of claims 17 or 18.
23. The cell according to any one of claims 19 to 22, wherein the cell is a microorganism.
24. The cell according to any one of claims 19 to 23, wherein the cell comprises any one of the nucleic acid sequences selected from the group consisting of: i) ptaA as set forth in SEQ ID NO: 1; ii) ptaB as set forth in SEQ ID NO: 3; iii) ptaC as set forth in SEQ ID NO: 5; iv) ptaD as set forth in SEQ ID NO: 7; or v) ptaE as set forth in SEQ ID NO: 9, and respective variants thereof having at least 70% similarity or identity thereto, such as at least 80%, such as at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% similarity or identity thereto.
25. The cell according to any one of claims 19 to 24, wherein the cell is a nonnatural S. iranensis, S. violaceusniger, S. melanosporofaciens, S. cangkringensis, and/or S. rapamycinicus cell or wherein the cell is a natural cell which is not a S. iranensis, S. violaceusniger, S. melanosporofaciens, S. cangkringensis, or a S. rapamycinicus cell.
26. The cell according to any one of claims 19 to 25, wherein the cell is a nonnatural S. iranensis and/or S. rapamycinicus cell or wherein the cell is a natural cell which is not a S. iranensis or a S. rapamycinicus cell.
27. The cell according to any one of claims 19 to 26, wherein the microorganism belongs to the genus Streptomyces or Allokutzneria, for example S. iranensis, S. rapamycinicus, Streptomyces zinciresistens, Streptomyces buecherae,
97
Streptomyces malaysiensis, Streptomyces samsunensis, Streptomyces hygroscopicus, Streptomyces antioxidans, Streptomyces javensis, Streptomyces rhizosphaericus, Streptomyces albus, Streptomyces physcomitrii, Streptomyces yatensis, Streptomyces solisilvae, Streptomyces melanosporofaciens, Streptomyces lasiicapitis, Streptomyces autolyticus, Streptomyces zinciresistens K42, Streptomyces cangkringensis, Streptomyces indonesiensis, Streptomyces asiaticus, Streptomyces aureoverticillatus, Streptomyces buecherae, Streptomyces antimycoticus, Streptomyces lasiicapitis, Streptomyces lasiicapitis, Streptomyces violaceusniger, and/or Allokutzneria albata, preferably S. iranensis, and/or S. rapamycinicus. A compound as defined in any one of claims 1 to 11 , or a composition as defined in any one of claims 12 to 15, obtainable by a method comprising growing a cell in a cultivation broth, wherein the cell is as defined in any one of claims 19 to 27, under conditions allowing the production of the compound. A method of producing a compound as defined in any one of claims 1 to 11 , or a composition as defined in any one of claims 12 to 15, comprising growing a cell in a cultivation broth, wherein the cell is a cell as defined in any one of claims 19 to 27, under conditions allowing the production of the compound. The compound, or the composition, according to claim 28, or the method according to claim 29, wherein the method further includes a step of obtaining an organic extract of the cultivation broth. The compound, or the composition, according to claim 28, or the method according to claim 29, and/or the compound, or the composition, or the method according to claim 30, wherein the method further includes a step of recovering and optionally purifying the compound from the organic extract. The compound, or the composition, or the method according to claim 31, wherein the purification is conducted by organic solvent extraction followed by chromatographic separation by Sephadex LH-20 and silica gel chromatography.
33. A method of promoting the growth of a plant, promoting seed germination, and/or reducing the stress on a plant, said method comprising contacting a compound as defined in any one of claims 1 to 11 , or the composition as defined in any one of claims 12 to 15, with the plant.
34. The compound, or the composition, according to any one of claims 28 or 30 to 32, the composition according to any one of claims 28 to 32, or the method according to any one of claims 29 to 33, wherein the compound is pteridic acid H and/or pteridic acid I.
35. The method according to any one of claims 33 to 34, wherein the seed germination rate of the plant is increased of at least 1%, such as at least 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7% compared to the seed germination rate of another plant of the same species which is not contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
36. The method according to any one of claims 33 to 35, wherein any one of the parameters selected from the group consisting of: the root length; the shoot length; the fresh weight; and the dry weight, of the plant is increased of at least 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%,
24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%,
37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, or at least 50% compared to the same parameter, /.e., the root length; the shoot length; the fresh weight; or the dry weight, of another plant of the same species which is not contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
37. The method according to any one of claims 33 to 36, wherein the plant is grown under stress conditions, preferably under abiotic stress conditions such as drought conditions, high soil salinity and/or high levels of heavy metals in the soil in which the plant is grown.
The method according to any one of claims 33 to 37, wherein the root length of the plant grown under stress conditions, preferably under abiotic stress conditions such as drought conditions, high soil salinity and/or high levels of heavy metals in the soil in which the plant is grown is increased of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 160%, 180%, 200%, 220%, 240%, 260%, 280%, 300%, 350%, 400%, 450%, or 500% compared to the root length of another plant of the same species which is not contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions. The method according to any one of claims 33 to 38, wherein the drought condition is defined by a drought Palmer drought index less than -2, such as less than -3, less than -4, less than -5, less than -6, less than -7, less than -8, less than -9, or -10. The method according to any one of claims 33 to 39, wherein the condition of high salinity is defined as an electrical Conductivity (mmhos/cm) greater than
1.26 in the soil, for example greater than 1.3, greater than 1.4, greater than 1.5, greater than 1.75, greater than 2.00. The method according to any one of claims 33 to 40, wherein the condition of high levels of heavy metals is reached when at least one heavy metal, preferably selected from the group consisting of: Cd, Zn, Cu, Cr, Pb and Ni, exceeds the concentration of 10 mg/kg in the soil, such as exceeds the concentration of 12 mg/kg, of 15 mg/kg, of 17 mg/kg, of 20 mg/kg, or more; or the condition of high levels of heavy metals is reached when the sum of the concentrations of individual heavy metals, preferably selected from the group consisting of: Cd, Zn, Cu, Cr, Pb and Ni, exceeds the concentration of 10 mg/kg in the soil, such as exceeds the concentration of 12 mg/kg, of 15 mg/kg, of 17 mg/kg, of 20 mg/kg, or more. The method according to any one of claims 33 to 41 , wherein the formation of adventitious roots in the hypocotyl of the plant is not increased compared to the formation of adventitious roots of another plant of the same species which is not
100
contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
43. The method according to any one of claims 33 to 42, wherein the growth of hypocotyl of the plant is increased compared to the growth of hypocotyl of another plant of the same species which is not contacted with the compound, or a composition comprising said compound, and otherwise grown under similar conditions.
44. The method according to any one of claims 33 to 43, wherein the plant is barley, wheat, potato, rice, maize, mung bean, soybeans/legume, rapeseed, sugar cane, cassava, groundnut, corn, cotton, tomato, grape, lettuce, sugar beet, palm, coffee, tobacco, tea, cannabis, coca, strawberry, carrot, cabbage.
45. The method according to any one of claims 33 to 44, wherein the compound is supplied to the soil in which the plant is grown as a pure compound, a composition comprising the compound, as a lysate of a cell producing the compound, by supplementation of cells producing the compound, as part of a cultivation broth comprising the compound and/or cells producing the compound, preferably the cell according to any one of claims 19 to 27.
46. The method according to any one of claims 33 to 45, wherein the compound, or composition comprising the compound, such as pteridic acid H, is supplied to the soil at a concentration of the compound between 0,1 nM and 500 nM, preferably 10 nM.
47. The method according to any one of claims 33 to 46, wherein the compound, or composition comprising the compound, is supplied to the soil by irrigation, seed-coating or foliar spray at the time of planting or before drought starts.
48. The method according to any one of claims 33 to 47, wherein the compound is supplied to the soil as a cultivation broth of a cell producing the compound 50 pL-1 mL/plant, with a microbial cfu 105-101o/plant, preferably the cell according to any one of claims 19 to 27.
Use of the compound according to any one of the claims 1 to 11 , 28, or 30 to 32, or a composition according to any one of claims 12 to 15, 28 or 30 to 32 to promote growth of a plant, promote seed germination, and/or to reduce the stress of a plant. The use according to claim 49, wherein the plant is as defined in claim 44.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP21207931 | 2021-11-12 | ||
| PCT/EP2022/081635 WO2023084032A2 (en) | 2021-11-12 | 2022-11-11 | Pteridic acids and uses thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP4429462A2 true EP4429462A2 (en) | 2024-09-18 |
Family
ID=78617270
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP22818223.4A Pending EP4429462A2 (en) | 2021-11-12 | 2022-11-11 | Pteridic acids and uses thereof |
Country Status (4)
| Country | Link |
|---|---|
| EP (1) | EP4429462A2 (en) |
| CN (1) | CN118215398A (en) |
| CA (1) | CA3233137A1 (en) |
| WO (1) | WO2023084032A2 (en) |
-
2022
- 2022-11-11 EP EP22818223.4A patent/EP4429462A2/en active Pending
- 2022-11-11 WO PCT/EP2022/081635 patent/WO2023084032A2/en not_active Ceased
- 2022-11-11 CA CA3233137A patent/CA3233137A1/en active Pending
- 2022-11-11 CN CN202280074477.7A patent/CN118215398A/en active Pending
Also Published As
| Publication number | Publication date |
|---|---|
| CA3233137A1 (en) | 2025-02-25 |
| CN118215398A (en) | 2024-06-18 |
| WO2023084032A3 (en) | 2023-08-17 |
| WO2023084032A9 (en) | 2023-06-29 |
| WO2023084032A2 (en) | 2023-05-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Saito et al. | Feasible production of camptothecin by hairy root culture of Ophiorrhiza pumila | |
| US10750711B2 (en) | Streptomyces endophyte compositions and methods for improved agronomic traits in plants | |
| US20170211079A1 (en) | Transgenic plants for enhancing anthocyanin biosynthesis | |
| Li et al. | PnF3H, a flavanone 3-hydroxylase from the Antarctic moss Pohlia nutans, confers tolerance to salt stress and ABA treatment in transgenic Arabidopsis | |
| Van Uden et al. | Production of 5-methoxypodophyllotoxin in cell suspension cultures of Linum flavum L. | |
| AU2013329026A1 (en) | Process for producing gougerotin employing Streptomyces microflavus strains | |
| Cheng et al. | Cloning of PEPC-1 from a C4 halophyte Suaeda aralocaspica without Kranz anatomy and its recombinant enzymatic activity in responses to abiotic stresses | |
| Gebre et al. | Transformation of tef (Eragrostis tef) by Agrobacterium through immature embryo regeneration system for inducing semi-dwarfism | |
| Ablazov et al. | Zaxinone Synthase overexpression modulates rice physiology and metabolism, enhancing nutrient uptake, growth and productivity | |
| DE602004010682T2 (en) | METHOD FOR DETOXIFYING MYCOTOXINES | |
| US8809328B2 (en) | Imidazole derivative | |
| CN101182545A (en) | The method of co-transformation of hmgr and fps to increase the content of artemisinin in Artemisia annua | |
| EP4429462A2 (en) | Pteridic acids and uses thereof | |
| EP4119507A1 (en) | Use of flavonoid glycoside substance and glycosyltransferase gene therefor in regulating resistance of plant to weeds | |
| Hariri et al. | Aeromonas hydrophila by quorum sensing Auto-Inducers on growth amelioration, enhance salt tolerance and mechanism of encoding genes in rapeseed | |
| Bunsupa et al. | Molecular biology and biotechnology of quinolizidine alkaloid biosynthesis in Leguminosae plants | |
| JP2007504836A (en) | Bioreactor containing cells expressing a glycosyltransferase nucleic acid | |
| KR101166715B1 (en) | Recombinant vector comprising polynucleotide related with tocotrienol biosynthesis and transformants transformed thereby | |
| CN113755508B (en) | Paraquat resistance gene EiKCS and application thereof | |
| KR102942979B1 (en) | Method for producing tomato plant with improved growth and productivity under nitrogen-deficient condition by SlDREB3 gene editing, and tomato plant produced by the same method | |
| KR101929637B1 (en) | Method for improving tolerance of plant to hypoxia | |
| Neelwarne | Red beet hairy root cultures | |
| KR100973997B1 (en) | Recombinant expression vector comprising polynucleotide encoding isoflavone synthase and transformant using same | |
| KR20020086687A (en) | Ketol fatty acid derivatives and plant growth regulating agents | |
| Rose et al. | Function of the HYDROXYCINNAMOYL-CoA: SHIKIMATE HYDROXYCINNAMOYL TRANSFERASE is evolutionarily conserved in embryophytes |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: UNKNOWN |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE |
|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE |
|
| 17P | Request for examination filed |
Effective date: 20240604 |
|
| AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC ME MK MT NL NO PL PT RO RS SE SI SK SM TR |
|
| DAV | Request for validation of the european patent (deleted) | ||
| DAX | Request for extension of the european patent (deleted) |