EP4377475A1 - Device and method for multiplexed detection of nucleic acid sequences - Google Patents

Device and method for multiplexed detection of nucleic acid sequences

Info

Publication number
EP4377475A1
EP4377475A1 EP22764443.2A EP22764443A EP4377475A1 EP 4377475 A1 EP4377475 A1 EP 4377475A1 EP 22764443 A EP22764443 A EP 22764443A EP 4377475 A1 EP4377475 A1 EP 4377475A1
Authority
EP
European Patent Office
Prior art keywords
fluorescence
probes
probe
nucleic acid
quencher
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
EP22764443.2A
Other languages
German (de)
French (fr)
Inventor
Francesco Villa
Christophe Pannetier
Maël LE BERRE
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Bforcure
Original Assignee
Bforcure
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Bforcure filed Critical Bforcure
Publication of EP4377475A1 publication Critical patent/EP4377475A1/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2537/00—Reactions characterised by the reaction format or use of a specific feature
    • C12Q2537/10—Reactions characterised by the reaction format or use of a specific feature the purpose or use of
    • C12Q2537/143—Multiplexing, i.e. use of multiple primers or probes in a single reaction, usually for simultaneously analyse of multiple analysis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2561/00—Nucleic acid detection characterised by assay method
    • C12Q2561/113—Real time assay
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2565/00—Nucleic acid analysis characterised by mode or means of detection
    • C12Q2565/10—Detection mode being characterised by the assay principle
    • C12Q2565/101—Interaction between at least two labels

Definitions

  • the invention relates to the field of the detection of nucleic acid sequences by PCR reaction, or any other process for the amplification of nucleic acids in vitro, and in particular the multiplexed detection of nucleic acid sequences by chain reaction by polymerase (PCR).
  • PCR polymerase
  • PCR polymerase chain reaction
  • This method aims to obtain a sufficient quantity of the desired sequences using a mixture of pairs of oligonucleotide primers located in these sequences of interest.
  • Several variants of PCR have been developed (eg LATE-PCR, ASPCR).
  • Other in vitro nucleic acid amplification processes are also known, such as the NASBA (nucleic acid sequence-based amplification) process, the TMA (transcription-mediated amplification) process, LAMP (loop-mediated isothermal amplification), SDA (strand displacement amplification) and rolling circle amplification.
  • the probes can consist of a single oligonucleotide or the combination of two oligonucleotides, free in solution.
  • the probes are conventionally labeled using a fluorophore and a quencher.
  • a fluorophore and a quencher When a probe is mixed with a sample that does not contain its target sequence, and the temperature is within the temperature range compatible with its hybridization, the fluorescence of this probe is reduced or suppressed by the spatial proximity of the quencher and fluorophore.
  • the fluorophore and the quencher are kept at a distance and the probe becomes fluorescent.
  • the homogeneous phase format can be used in several variants, the most used of which are detailed below:
  • the probe in this variant, the probe consists of a single oligonucleotide, designed in such a way that the fluorophore and the quencher are close together immediate when the probe is not hybridized and is at low temperature. This proximity most often results from the presence of complementary sequences of a few bases at the ends of the sequence specific to the sequence of interest. In solution, these two complementary ends hybridize to form a double helix, which has the effect of bringing together and keeping the fluorophore and the quencher at a short distance.
  • the probes which hybridize to their target sequences become fluorescent, and
  • These formats can themselves be implemented according to variants such as methods using probes (which can also play the role of primer in some of these methods) of the Scorpion type (registered trademark), Amplifluor (registered trademark), MGB Eclipse (registered trademark), Light Upon extension (LUX, registered trademark), Quenching of Unincorporated Amplification Signal Reporters (QUASR) or QZyme (registered trademark) for example.
  • the homogeneous phase format has many advantages, including: excellent kinetics of interactions of the probes with their respective target sequences, low cost, and excellent performance in terms of sensitivity.
  • probes targeting distinct sequences have emission wavelengths that can be separated from each other in order to be able to use them during the same measurement.
  • a real-time thermal cycler capable of measuring 4 fluorescence channels can only detect and discriminate the fluorescence emitted by a maximum of 4 probes and the amplification reactions carried out with this device cannot detect more than 4 target sequences per reaction.
  • probes emitting in the same fluorescence channel can be mixed provided that they can be excited separately.
  • Some fluorophores can indeed be excited at wavelengths that are distant from each other, but emit in the same wavelength band. This is particularly the case for fluorophores which emit with a wide Stokes shift.
  • the Cepheid company recently improved its GeneXpert (registered trademark) device by extending the number of fluorophores detected from 6 to 10 (see the article by Chakravorty et al.
  • This method requires an optical module making it possible to analyze the spectral composition of the signal emitted: excitation in the green produces signals emitted by the fluorophores CF3, C8 and CF10 in the yellow, orange and infrared respectively. It also has the disadvantage of methods using several fluorescence bands, namely the optical contamination of a band, or channel, in an adjacent band. These optical contaminations (also called “crosstalks”) can disturb the analysis of the results in the adjacent bands and be a source of erroneous results, of the false positive type for example.
  • - discrimination by the melting curve method it is known to distinguish probes sharing the same fluorescence emission range by distinguishing the probes by their melting temperature. To do this, a melting curve is produced after having initiated the formation of the duplex between the sequence of interest and the oligonucleotide probe(s), by gradually and monotonously increasing the temperature T of the solution. , while recording the fluorescence signal F. The maximum of the -dF/dT curve indicates the melting temperature Tm of the duplex.
  • This melting temperature makes it possible to ensure that the duplex formed is a homoduplex, or even a heteroduplex if this temperature is lower than the known temperature of F homoduplex, or even to identify, in this case, the mutation(s) at the origin of the heteroduplex when the possible mutant sequences are indexed in a limiting list and when their respective melting temperatures with the probe are previously known in a one-to-one manner.
  • amplification in the general case of exponential amplifications dependent on primers such as PCR, the amplification is said to be symmetrical and these primers are in stoichiometric concentration, which has the consequence that the amplification generates as many sense DNA strands that anti-sense.
  • primers such as PCR
  • the amplification is said to be symmetrical and these primers are in stoichiometric concentration, which has the consequence that the amplification generates as many sense DNA strands that anti-sense.
  • one of these strands shares the same sequence, or a sequence very close, to that of the probe, so that this strand can compete with the probe to hybridize with the target sequence, and delete the signal emitted by this probe.
  • an asymmetric amplification can be carried out by modifying the ratio of the concentrations of the primers in order to favor the formation of the DNA strand complementary to the probe, but the amplification then quickly ceases to be exponential when the primer in small quantity has been consumed to become only linear, which lengthens the duration of the test and/or decreases its sensitivity,
  • primers containing a unique conserved region in their 5' region are used here. This makes it possible to advantageously and effectively reduce the occurrence of primer dimers (Brownie et al “The elimination of primer-dimer accumulation in PCR”, Nucleic acids Res. 1997 Nucleic Acids Res. 1997 Aug 15;25(16):3235 -41. doi: 10.1093/nar/25.16.3235, published at https://doi.org/10.1093/nar/25.16.3235.) and exponentially amplify a large number of sequences of interest with a single primer couple. On the other hand, it is obviously impossible to carry out an asymmetric amplification, since the primer used amplifies each of the sense and antisense strands of the sequence of interest.
  • the probe In the case where the probe is not hydrolysed, its hybridization can be suppressed or considerably reduced by the presence of the complementary strand formed during the symmetrical amplification reaction. This decrease in signal can result from at least two mechanisms: - competition during hybridization with this complementary strand, which, even at a concentration lower than that of the probe, can hybridize first and preferentially,
  • the above method according to the melting curve is carried out at the end point and therefore does not allow quantification of the relative concentrations of the sequences of interest if they are simultaneously present.
  • the Seegene company has described two methods to circumvent this limitation. The first, called TOCE (“Tagging Oligonucleotide Cleavage & Extension”, registered trademark) makes it possible to detect up to 5 probes per fluorescence emission channel using “catcher” fluorescent probes distinguishable by their melting temperature.
  • TOCE Tag Oligonucleotide Cleavage & Extension
  • the main drawback is the complexity of implementing this method, which requires adding several oligonucleotides in addition to those used to amplify the sequences of interest.
  • MuDT Multi Ct values in a single channel
  • the probes exhibit distinct melting temperatures, separated by several degrees.
  • PCR amplification is carried out with cycles whose temperature profile includes one or more stages when the temperature rises towards the melting temperature close to 95°C.
  • the temperature stages are chosen between the melting temperatures of the probes, and the fluorescence signal is recorded at each of these stages. By calculation, the contribution of each of the probes to the total fluorescence signal can be determined.
  • thermal cycler used must be able to manage this type of particular cycle profile, which is incompatible with rapid PCR in which one seeks to minimize the times of temperature change during the cycles.
  • This method is also incompatible with detection in TaqMan mode in which the probe is hydrolyzed.
  • the invention improves the situation. To this end, it proposes a device for the multiplexed detection of nucleic acid sequences comprising a thermocycler arranged to carry out a series of thermal cycles with an in vitro nucleic acid amplification reagent containing at least two fluorescence probes combining a quencher and a fluorophore, said fluorescence probes being arranged to each target a distinct nucleic acid sequence and said fluorophores emitting in overlapping fluorescence wavelength ranges, a light sensor arranged to measure radiation emitted by said fluorophores within said ranges of fluorescence wavelengths, the radiation emitted by each probe varying depending on whether the latter is in an unmodified state in which the quencher substantially attenuates or does not attenuate the fluorescence emission, or in a state modified wherein the quencher has an opposite effect on fluorescence emission, and an analyzer arranged to determine , for each respective fluorescence probe, a value representative of a concentration in a
  • This device is particularly advantageous because it makes it possible to detect the presence of a sequence of interest using a characterized fluorescent probe of which a temporal signature has previously been characterized.
  • the determination of this time signature makes it possible to simultaneously use probes emitting in the same fluorescence emission band, but whose time signatures are sufficiently different so that their respective contributions can nevertheless be separated.
  • this time signature also makes it possible to effectively eliminate potential optical contamination from one fluorescence band to an adjacent band. With this device, potential optical contaminations can even be exploited to detect the presence of a sequence of interest.
  • the invention may have one or more of the following characteristics:
  • the thermal cycler is a PCR thermal cycler
  • the at least two fluorescence probes are chosen from the group comprising TaqMan probes, molecular beacons, dual fluorescence transfer probes, Scorpion probes, Amplifluor probes, MGB Eclipse probes , LUX probes, QUASR probes and QZyme probes,
  • the in vitro nucleic acid amplification reagent comprises three fluorescence probes combining a quencher and a fluorophore, said fluorescence probes being arranged to each target a distinct nucleic acid sequence and said fluorophores having length ranges of overlapping fluorescence wave,
  • the in vitro nucleic acid amplification reagent comprises at least two groups of fluorescence probes combining a quencher and a fluorophore, said fluorescence probes being arranged to each target a distinct nucleic acid sequence and said fluorophores exhibiting plaques of overlapping fluorescence wavelengths within each group of fluorescence probes
  • the analyzer is arranged to determine the representative value of the concentration of each fluorescence probe in a modified state by solving a matrix system based on the fluorescence measurements, the time signatures and the constancy of the respective concentration of each fluorescence probe ,
  • the analyzer is arranged to solve a matrix system by group of fluorescence probes, - the analyzer is arranged to use a minimization algorithm, and
  • the analyzer is arranged to determine the representative value of the concentration of each fluorescence probe in a modified state by applying a descent of the gradient or by using a neural network.
  • the invention also relates to a method for the multiplexed detection of nucleic acid sequences comprising the following operations: a) carrying out a plurality of thermal cycles on a reaction mixture comprising a sample to be analyzed and an in vitro nucleic acid amplification reagent containing at least two fluorescence probes combining a quencher and a fluorophore, said fluorescence probes being arranged to each target a distinct nucleic acid sequence and said fluorophores emitting in overlapping fluorescence wavelength ranges, b) upon of each thermal cycle, performing at least two fluorescence measurements in said ranges of fluorescence wavelengths, the radiation emitted by each probe varying according to whether the latter is in an unmodified state in which the quencher attenuates or does not attenuate not noticeably emitting fluorescence, or in an altered state in which the quencher has an opposite effect on the fluorescence emission, c) determining a value representative of the concentration of each fluorescence probe in a modified
  • the method may have one or more of the following characteristics: - operation b) comprises performing PCR cycles, and the at least two fluorescence probes are chosen from the group comprising TaqMan probes, molecular beacons, dual fluorescence transfer probes, Scorpion probes, Amplifluor probes , MGB Eclipse probes, LUX probes, QUASR probes and QZyme probes,
  • step b) comprises the use of an in vitro nucleic acid amplification reagent comprising three fluorescence probes combining a quencher and a fluorophore, said fluorescence probes being arranged to each target a nucleic acid sequence distinct and said fluorophores exhibiting overlapping fluorescence wavelength ranges,
  • - operation b) comprises the use of an in vitro nucleic acid amplification reagent comprising at least two groups of fluorescence probes combining a quencher and a fluorophore, said fluorescence probes being arranged to each target a sequence nucleic acid and said fluorophores exhibiting overlapping fluorescence wavelength ranges within each group of fluorescence probes,
  • - operation c) includes the resolution of a matrix system based on the fluorescence measurements, the time signatures and the constancy of the respective concentration of each fluorescence probe,
  • - operation c) includes the application of a gradient descent or the use of a neural network.
  • FIG.l represents a generic diagram of a device according to the invention
  • - [Fig.2] shows the fluorescence intensity obtained as a function of time during two PCR reactions using a TaqMan probe labeled respectively with the ATTO 565 fluorophore and the Cy3 fluorophore
  • - [Fig.3] represents the time signature of a set of probes, with, for each of them, the profile of the temperature cycle used, the respective components of this signature when the probe has not interacted, and interacted with the target sequence of which it is specific
  • FIG.4 illustrates the implementation of the method with the device in the particular mode of a PCR reaction carried out with two TaqMan probes emitting in the same fluorescence band, comprising the decomposition into an optimal sum of the time signatures as described upper,
  • FIG.5 illustrates the implementation of the method with the device in the particular mode of a PCR reaction carried out with two TaqMan probes emitting in the same fluorescence band, comprising the decomposition into an optimal sum of the time signatures as described above, during a multiplex amplification of two sequences of interest,
  • FIG.6 illustrates the implementation of the method with the device for eliminating optical contamination signals from one channel to an adjacent channel, as well as in the particular mode of a PCR reaction carried out with beacon-type probes molecules and QUASR.
  • the invention proposes a device capable of carrying out multiplexed detection of nucleic acid sequences, that is to say using probes comprising one or more fluorophores allowing the identification of genetic sequences by modification of the signal emitted during detection. interaction of said probes with said sequences (for example TaqMan, Molecular Beacon, FRET probes, etc.), said fluorophores emitting in ranges of fluorescence wavelengths possibly overlapping.
  • the interaction of the probe with the target sequence of which it is specific can take several forms depending on the detection method used.
  • the chemical nature of the probe can also vary according to the processes. It can be made into deoxyribonucleic acid (DNA), ribonucleic acid (RNA), or synthetic nucleic acid analogues such as peptidonucleic acids (Peptide Nucleic Acids, PNAs), "locked” nucleic acids (Locked Nucleic Acids , LNA).
  • the probe may include chemical groups modifying its interaction with the genetic sequence for which it is specific, such as a group binding in the minor groove of the double helix (Minor Groove Binder, MGB).
  • the probe may consist of a single oligonucleotide molecule comprising one or more fluorophores and one or more chemical groups having the effect of modulating the intensity of their fluorescence according to the state of the probe, called "quenchers". in the following text.
  • the probe can also consist of two or more molecules, some comprising one or more fluorophores, the others comprising one or more chemical groups having the effect of modulating the intensity of their fluorescence according to the possible interactions define the state of the probe .
  • QUASR probe comprising two oligonucleotides
  • FRET type consisting of two oligonucleotides, one carrying at its 3' end a fluorophore capable of de-exciting by transferring its energy to a quencher carried 5' to a second oligonucleotide, this quencher itself being able to de-energize by emitting light radiation in a wavelength band different from that of the fluorophore.
  • the interaction of the probe may consist of a simple hybridization with the genetic sequence for which it is specific, or a hybridization followed by a hydrolysis mediated by an enzymatic activity, or a hybridization followed by incorporation into an existing DNA strand mediated by the action of a ligase, or into a synthesized DNA strand mediated by the action of a polymerase.
  • interaction will be used generically to describe the action of a probe which interacts with the genetic sequence of which it is specific according to one of the processes described above
  • interaction modified means the process by which the fluorescence characteristics of a probe are modified by its interaction with the genetic sequence of which it is specific according to one of the methods described above.
  • the multiplexed detection according to the invention is made possible thanks to the determination of fluorescence time signatures for each type of fluorescent probe used, to the acquisition of two or more fluorescence signals during at least two thermal cycles applied during the amplification reaction, and the implementation of an algorithm making it possible to separate the signals emitted by these probes by using these signatures.
  • the device applies to these probes one or more thermal cycles by exciting them optically and by recording continuously or in a sampled manner the fluorescence signals emitted in one or more bands of lengths d wave, which makes it possible to carry out the multiplex measurement.
  • the amplification method includes a series of thermal cycles as in the case of PCR, the fluorescence signals are recorded during at least two of these cycles, and preferably during each cycle.
  • the amplification method isothermal, at least two thermal cycles are applied to the sample, one at the start and the other at the end of the reaction, during which the emitted fluorescence signals are recorded.
  • the device 2 comprises a thermocycler 4 capable of applying two or more temperature cycles to an amplification reaction mixture containing at least two fluorescent probes, a light 6 having the capacity to carry out at least two intensity measurements of fluorescence per cycle in at least one wavelength band, and an analyzer 8 arranged to measure the relative concentration of the different states in which the different probes are found during the reaction, and to deduce the presence therefrom of one or more nucleotide sequences of interest targeted by said probes.
  • the light sensor 6 comprises both the source of excitation of the fluorescent probes and the corresponding photodetector.
  • the light sensor 6 could be separated into a source and a detector.
  • the analyzer 8 is an appropriate computer program or code executed on one or more processors.
  • processors it must be understood any processor adapted to the calculation of projection of textures on planes and of processing linked to voxels.
  • a processor can be produced in any known manner, in the form of a microprocessor for a personal computer, a dedicated chip of the FPGA or SoC (System on chip) type, a calculation resource on a grid or in a cloud, a microcontroller, or any other form capable of providing the computing power necessary for the implementation described below.
  • FPGA Field Programmable gate array
  • SoC System on chip
  • One or more of these elements can also be made in the form of specialized electronic circuits such as an ASIC.
  • a combination of processor and electronic circuits can also be envisaged.
  • the thermal cycler 4 is capable of applying variable temperatures situated in a given range to a sample mixed with an in vitro nucleic acid amplification reagent, this reagent containing at least two fluorescent probes having distinct temporal signatures.
  • the thermal cycler 4 can repeatedly apply a given temperature profile to this mixture.
  • the analyzer 8 receives or determines the temperature values applied to the sample. In the example described here, these values are sent to the analyzer 8. According to various embodiments, they can be measured in or in contact with the sample, or extrapolated as a function of time.
  • the thermocycler 4 is a fast thermocycler (that is to say with a temperature change of the order of more than 5° C. per second, and more preferably of more than 15°C per second).
  • the light sensor 6 is arranged to subject the reaction mixture to light excitation in one or more wavelength bands in the ultraviolet and/or in the visible and/or in the infrared, and to measure the intensity of the fluorescence emission resulting from this excitation, in one or more bands of wavelengths in the ultraviolet and/or in the visible and/or in the infrared, by performing one or more spot measurements for a determined period , or a series of punctual measurements at a given frequency (for example, for 100ms every 200ms).
  • the analyzer 8 can almost continuously follow the evolution of the fluorescence response throughout the thermal cycles.
  • the PCR reaction is used to detect and discriminate the presence or the absence of a genetic target in combination, the PCR reagent containing a set of probes combining a quencher and a fluorophore (such as TaqMan probes for example), which fluorescent probes use distinct fluorophores which can emit in a common band or range of wavelengths.
  • a fluorophore such as TaqMan probes for example
  • the analyzer 8 is capable of measuring in an unambiguous manner, for each probe present in the reagent, the modification of the fluorescence signal resulting from the interaction between the probe and the amplification products (or amplicons) derived from the genetic sequence for which it is specific, independently of each other, and thus to achieve a level of multiplexing of 2n, or even 3n or 4n, with a device according to the invention capable of measuring fluorescence signal in n wavelength bands simultaneously.
  • FIG. 2 shows two fluorescence curves recorded with device 2, in the same fluorescence channel, but during PCR reactions, in which the probes used are functionalized with two different fluorophores (ATTO 565 and Cy3). These curves show that the fluorescence profiles as a function of time during a cycle vary, depending on the nature of the probe, and depending on whether the cycle is at the start or at the end of the amplification.
  • the thermal cycle is a PCR cycle and comprises increasing the temperature from a low temperature to a high temperature, the low temperature being between 55 and 70° C., from preferably between 58 and 65° C. and the high temperature being between 80 and 100° C., preferably between 90 and 98° C., followed by the decrease in temperature from the high temperature to the low temperature.
  • thermal cycles are generically described as including increasing temperature from 60 to 95°C, followed by decreasing temperature to 60°C. These values are particularly suitable for the implementation of a rapid PCR reaction. It goes without saying that the values of these ranges (60°C, 95°C and 60°C) could be modified to adapt to particular thermal cycles used during PCR amplification with, for example, the use of 3 temperatures instead of 2, or even thermal cycles added during isothermal amplification according to a temperature profile compatible with the thermal stability of the reagents used.
  • the signal modification results from the hydrolysis of the probe or probes in the case of TaqMan probes cleaved by a polymerase possessing an exonuclease activity.
  • the device 2 can be used to determine the time signature of each of the probes present in the reaction mixture.
  • the general principle implemented by the invention is based on the detection of the modification of the fluorescence signal emitted by a probe depending on whether or not it has interacted with the nucleotide sequence of interest of which it is specific.
  • the Applicant's work has made it possible to identify 1) that this fluorescence signal generally depends on the temperature through several more or less well-known physical phenomena which occur concomitantly, the main ones of which will be cited below; 2) that the variation of the fluorescence signal of this probe with temperature can be measured by applying a temperature cycle to the sample containing the probe(s): 3) that the fluorescence curve obtained itself varies depending on whether the probe has interacted or not with the nucleotide sequence for which it is specific; 3) that this variation of the variation of the signal during a cycle is specific to the probe and constitutes a signature which can be exploited to detect, at the time of the application of a thermal cycle, the fraction of this probe which happens to have interacted with the target sequence of which it is specific; 4) that the determination
  • the change in the conformation of the probe which comes to modify the distance between the fluorophore and the quencher, or the location of the fluorophore or the quencher (for example, the fluorophore of a probe can be close to the quencher of another probe or to the quenchers of several probes) has an effect on the fluorescence signal emitted by the fluorophore.
  • the mixture of the amplification reaction containing the fluorescent probes and the other reagents is regulated by intramolecular and intermolecular interactions between the different chemical species.
  • the oligonucleotides in solution can adopt different conformations depending on the temperature and the stage of the amplification reaction (the presence in increasing concentration of sequences complementary to the probes generated during the amplification reaction).
  • the temperature and the stage of the amplification reaction the presence in increasing concentration of sequences complementary to the probes generated during the amplification reaction.
  • the probe interacts with a complementary sequence generated during the amplification reaction
  • the probe is linked to complex structures, with one or more oligonucleotides in solution linked together.
  • the probe can therefore adopt different states, for example different conformations, depending on whether it is in one or the other of these situations.
  • the efficiency of the quencher in quenching the fluorescence emitted by the fluorophore is a third factor influencing the variation of the fluorescence intensity of the probe with temperature.
  • the state of the probe can also be an important factor:
  • the fluorophore is cleaved irreversibly from the probe and its fluorescence is no longer impacted by the proximity of the quencher.
  • the interaction of the probe with the nucleotide sequence of which it is specific thus results in a change of state in which the fluorophore of the probe is no longer molecularly bound to the quencher.
  • the law of variation of the fluorescence intensity as a function of temperature of this probe can be modified, either because the probe adopts another conformation due to its state of hybridization (as is the case for Molecular Beacon probes), because a component of the probe is close to a other component of the probe having a disruptive effect (as is the case for dual probes of the FRET type or Scorpion primers) or that a polymerase possessing a 5' to 3' exonuclease activity is present in the sample, and that the fluorophore of the probes which have hybridized with their complementary sequence is cleaved by this exonuclease (as is the case for the TaqMan probes), the law of variation of the fluorescence as a function of the temperature of this probe is modified .
  • the molecules of the probe for which it is specific are not significantly modified by the presence of an amplification product from this sequence of interest (except in the particular case of a high initial concentration of this sequence of interest), and the recorded fluorescence signal comes only from the component of the time signature of the probe unmodified by interaction with the sequence for which it is specific.
  • an increasing fraction of the probe is modified as a result of the interaction with the amplification product from the sequence of interest, and the recorded signal is a linear combination of the contributions of the components of the signature respective time of the unmodified probe and modified by the interaction with the amplification products from the sequence of interest.
  • the characterization of the fluorescent probes by the determination of their respective time signatures, in their unmodified form and their modified form therefore makes it possible to calculate, at the instant when a thermal cycle is applied to the reaction mixture, the fraction of a modified probe after interaction with the sequence for which it is specific.
  • the first component of the time signature of this probe consists of the variation in the intensity of its fluorescence during the thermal cycle in the absence of hybridization of this probe with its complementary sequence.
  • the second component of its signature is the variation in the intensity of its fluorescence during the thermal cycle after its hydrolysis, i.e. after cleavage of the fluorophore (or quencher) from the rest of the probe.
  • the first component of the time signature of this probe consists of the variation of the intensity of its fluorescence during the thermal cycle in the absence of hybridization of this probe with its complementary sequence.
  • the second component of its signature is the variation in the intensity of its fluorescence during the thermal cycle in the presence of its complementary sequence.
  • Molecular Beacon probes have the advantage of providing better fluorescence contrast between their different folding states.
  • the first component of the time signature of this probe consists of the variation in the intensity of the fluorescence of the oligonucleotide carrying the acceptor fluorophore during the thermal cycle in the absence of hybridization of this oligonucleotide with its complementary sequence.
  • the second component of its signature is the variation in fluorescence intensity during the thermal cycle in the presence of its complementary sequence, including the FRET signal when the two oligonucleotides of the probe are hybridized adjacently to their common target sequence.
  • the FRET probes can be more flexible for characterizing mutations or for limiting the number of oligonucleotide sequences in the PCR amplification reagent by using several FRET probes on the same amplicon, their use makes it possible to limit the number of oligonucleotides present, therefore their interaction, thus facilitating the increase in multiplexing.
  • a fluorescent oligonucleotide probe for each sequence of interest, a fluorescent oligonucleotide probe is designed comprising an oligonucleotide sequence complementary to and characteristic of a portion of said sequence of interest, and which is known, or failing that, which is determined, for a given fluorescence channel, the time signature (Snm(t), Sm(t)) comprising two components consisting of the curve of the fluorescence intensity as a function of time for a fixed thermal cycle, when no probe is modified by the interaction with its sequence of interest, and when all of the molecules of the probe are modified by the interaction with its sequence of interest respectively.
  • This probe can be of the Taqman, Molecular Beacon, dual fluorescence transfer probe, Scorpion, Amplifluor, MGB Eclipse, LUX, QUASR or QZyme type without this list being limiting.
  • the time signature includes a component for the unmodified form of the probe, hereinafter Snm(t), and a component for the modified form of the probe at following the interaction with its sequence of interest, hereinafter Sm(t).
  • the components of the time signature can be determined respectively by directly applying the thermal cycle to the probe in the buffer used for the reaction, respectively in its unmodified form and in its modified form by the interaction with its sequence of interest.
  • the time signature can also be obtained by determining the fluorescence profile of the probe in its two forms as a function of temperature (SnmT(T), SmT(T)), and by applying the function obtained to the function describing the temperature profile PT(t) (mathematically, Snm is the composite of the functions SnmT and PT, or SnmToPT; likewise Sm is the composite of the functions SmT and PT, or SmToPT).
  • the components of the time signature of the probe in its unmodified form or in its modified form can be determined indirectly by subtraction between the fluorescence intensity profile of a combination of the probe and other probes or fluorescent sources and the fluorescence intensity profile of this same combination in the absence of the probe whose signature is to be determined.
  • a combination of time signatures can be used rather than the time signature of a single probe to determine the presence of a probe directly or indirectly.
  • the use of combination of signatures avoids having to characterize each probe individually and makes it possible to overcome any effects of interaction between the probes in the fluorescence signal.
  • the signal of any combination of probes can be used according to the invention as a direct or indirect marker (by combining several signals) of the state of the composition of the reagent.
  • Figure 3 shows examples of time signature for TaqMan or QUASR type probes using various fluorophores and quenchers: the component of the unmodified time signature and the component of the time signature modified as a result of the interaction with the sequence whose it is specific.
  • probes emitting in the same range of fluorescence wavelengths are chosen so that their temporal signatures (in their unmodified state and in their modified state) are sufficiently distinct to be able to be discriminated.
  • reaction mix comprising the sample containing the sequences of interest in unknown number and concentration is made with them.
  • this reaction mix comprises, for each sequence of interest sought, the fluorescent probe chosen and whose time signature has been characterized directly or indirectly as indicated above, a set of primers compatible with this probe and capable of amplifying the sequence of interest, reagents and enzymes necessary for carrying out the amplification reaction.
  • these are in particular dNTPs and at least one heat-resistant polymerase (in the variant in which the probes are of the TaqMan type, the polymerase has a 5' to 3' exonuclease activity) .
  • the reaction mix can also comprise a reverse transcriptase if at least one of the sequences of interest is in RNA.
  • the amplification method is PCR and the probes are of the TaqMan or Molecular Beacon type
  • the primers are non-fluorescent and located on the sequence of interest on either side of the probe.
  • the polymerase additionally possesses 5' to 3' exonuclease activity.
  • this probe also plays the role of one of the two primers.
  • thermocycler 4 subjects the reaction mix to one or more cycles of the temperature profile, this number being able to vary from 1 to 40 typically, if necessary after having carried out a cycle allowing the reverse transcription of sequences of interest into RNA and/or or a cycle allowing the activation of the polymerase at high temperature (“hotstart”).
  • hotstart the fluorescent probe(s) are excited and the light sensor 6 records the resulting fluorescence continuously on the fluorescence channel(s) corresponding to the fluorescence wavelength ranges of each probe.
  • the sampling frequency of the light sensor 6 is chosen such that at least two fluorescence measurements are carried out per cycle, preferably at least one in the denaturation step and at least one in the hybridization step (which can also be the elongation step in the case of a PCR reaction) preferably at a higher frequency making it possible to cover intermediate temperatures, which allows a better power of discrimination.
  • the analyzer 8 is then called upon to process the fluorescence signals measured in each fluorescence channel by the light sensor 6, by breaking them down, for each channel and at each cycle at which the signals were acquired, in the form of a linear combination of the components of the time signatures of the probes in this channel or of a combination thereof. This makes it possible to determine, at each cycle or before and after the appearance of the amplification signal, the fraction of each probe which is in the unmodified form, and that which is in the modified form. This determination can be carried out qualitatively by visual interpretation of the temporal signatures or quantitatively by a numerical calculation with a suitable algorithm.
  • Several algorithms can be used to extract the time signature provided that they allow the decomposition of the measured signatures into a sum of signatures characteristic of the presence of a probe in its modified or unmodified form or of any combination of presence or absence of several probes in their form modified or unmodified.
  • the algorithm used can for example be an algorithm seeking for each cycle, the weights of the linear combination of the characteristic signatures approaching in an optimal manner the signatures measured for each cycle. These weights can be directly or indirectly representative of the modification of a probe following its interaction with the sequence for which it is specific, a consequence of the amplification of this sequence by the amplification reaction. The following paragraph details an implementation of this algorithm.
  • the fluorescence signal F k (t) measured by the light sensor 6 can be defined as follows:
  • equation 3 defines a matrix system which associates the fluorescence signal measured with the concentrations of each probe of index i for cycle k.
  • the thermal cycle comprises the step of heating from the lower temperature to the upper temperature and the step of cooling from the upper temperature to the lower temperature.
  • a similar calculation can be carried out using more direct signatures (for example the signatures of the probes mixed with or without the modification of a probe) by carrying out a change of space by a linear transformation U:
  • the time signature can be used, to increase the precision of the breakdown. Indeed, certain phenomena such as the variation in the quantity of modified probe during the elongation phase of the PCR cycle which results from the activity of the polymerase or even the non-reproducibility of the temperature change profile at short times may alter the shape of the signature at certain times and it may be preferable not to take these parts of the signature into account for the determination of the amounts of modified probe.
  • the importance of each time of the time signature can be weighted for the calculation in order to optimize the impact on the result of the calculation.
  • the analyzer 8 could operate in a purely numerical and non-matrix manner, using for example a gradient descent algorithm to optimize the residual error of the approximation of the signature measured by the linear combination of characteristic signatures, or also contain tables of the lookup table type, or even use a trained neural network to return the concentrations of each probe according to the input measurement signal.
  • the algorithm can use a more complex model than the linear combination of the signatures, taking into account for example the influence of the variation of the quantity of probe modified within a cycle or the evolution during the cycles of the amount of modified probes that may be constrained by assumptions such as the shape of the amplification curve.
  • the algorithm can then take the form of an optimization calculation under constraints by minimizing an energy function or even take the form of a neural network trained to learn specific parameters of an amplification on the basis of the sequence of signatures.
  • FIG. 5 illustrates the implementation in the particular mode of a PCR reaction with two TaqMan probes. It shows the extraction of the respective concentrations of each probe hydrolyzed by decomposition into an optimal sum of time signatures as described above.
  • the upper curves show the raw fluorescence signal during the PCR with the same mix containing 2 TaqMan probes emitting in the same band, specific respectively for two bacterial genomes which are used pure (the first on the left and the second in the center) , or mixed in different amounts (right).
  • the bottom curves show the respective concentrations of the 2 hydrolyzed probes calculated at each cycle according to an extraction with the same parameters when only the first probe is hydrolyzed during the extraction (left graphs), only the second probe is cleaved (graphs on the center) and when the 2 probes are cleaved according to different kinetics during the PCR (right graphs).
  • the graph at the bottom right shows the ability of the device of the invention to extract the amplification signals from these two distinct targets (here sequences belonging to the genome of B. subtilis and E. coli) at different initial concentrations using probes sharing the same fluorescence signal.
  • Example 1 Identification of the presence of a nucleotide sequence of interest in a multiplex PCR analysis using two TaqMan probes functionalized with fluorophores both emitting mainly in the band above 650nm.
  • the example below shows how the method and the device of the invention make it possible to identify the presence of a target sequence of interest among two target sequences using a multiplex PCR analysis using two TaqMan probes functionalized with fluorophores both emitting mainly in the band above 650 nm. These probes, each specific for one of the sequences of interest, emit a fluorescence signal measured in the same channel of the device, but have a different time signature.
  • the use of the demultiplexing algorithm combined with the knowledge of these signatures makes it possible to identify the amplification of one target or the other.
  • the primers are specific to amplify two sequences of the [D-alaline-D-alanine ligase] gene.
  • the sense and antisense primer sequences are GCTTT AGC A AC AGCCT ATC AG and TCGTCCGAACRTCTTCATTT, for E. faecalis the sense and antisense primer sequences are GTTCTAGTGTCGGAATTAGCA and GCTTCRATCCCTTGTTCAAC.
  • Two fluorescent probes of the TaqMan type are functionalized at the 5' end with the fluorophore ATT0647N for E.
  • faecalis (sequence TGCTCGGGCATCATAACGGAAAGC, see line with identifier ID 7 of table 1) and CY5 for E. faecium (sequence GAAGCGCGCGAAATCGAAGTTGCT, see line d identifier ID 6 from table 1). Both probes are functionalized at the 3' end with the BHQ2 quencher. We identify the two probes as "Probe a" and "Probe b" respectively.
  • PCR reactions are carried out with each pair of primers combined with the probe and the DNA of the corresponding bacterial sequence, in order to characterize the signature of each of the two probes separately:
  • the reaction mixture consists of a buffer (Tris-HCL, KC1 25mM, (NPLOiSCE 16mM, MgCl 4.5mM) and the amplification is carried out using 3U of Taq DNA Polymerase and 0.2 mM of dNTPs
  • the PCR protocol used consists of: denaturation/activation of the polymerase carried out for one minute at 95°C and 45 PCR cycles (composed of two phases: denaturation for 3 seconds at 95°C and hybridization/extension for 15 seconds at 60° C. Fluorescence intensity measurements are performed every 100 ms.
  • Figure 4 shows the signal measured on channel 4 during the two experiments ( Figure 4 a: signal “1” for probe “a” and Figure 4 b: signal “2” for probe “b”).
  • two multiplex amplification reactions are carried out with a mixture of reagents using the method of the invention.
  • the two probes are added to the PCR mixture respectively at the concentration of 0.ImM (probe a, E. faecalis) and 0.2 mM (probe b, E. faecium).
  • the two pairs of primers are added to the PCR mixture at the concentration of 0.5mM for each primer:
  • the signals “3” and “4” are then demultiplexed using the algorithm of the invention and the time signatures of each probe, by calculating, for each cycle of each multiplex PCR reaction, the value representative of the concentration of each modified probes.
  • the result of this demultiplexing is shown in FIG. 4 for each of the multiplex amplification reactions (FIG. 4 e: signal 3 analysis, FIG. 4 b: signal 4 analysis).
  • FIG. 4 e signal 3 analysis
  • FIG. 4 b signal 4 analysis
  • Observation of the curves of the values representative of the concentration of each modified probe, as a function of the cycle of the PCR reaction makes it possible to identify without ambiguity the nature of the sequence of interest which was actually present in each of the two reactions.
  • Example 2 Identification of the presence of a mixture of two nucleotide sequences of interest in an analysis by multiplex PCR using two TaqMan probes functionalized with fluorophores both emitting mainly in the 575-615 nm band.
  • a series of 3 PCR amplifications is carried out using a reaction mixture comprising the two pairs of primers and the two probes necessary for amplify the two nucleotide sequences of interest.
  • Algorithm 8 is then used to demultiplex these curves and, for each amplification reaction and for each probe, a curve is obtained showing the representative value of the modified probe as a function of the cycle number. It is observed that it is possible to find from these demultiplexed curves the nature of the nucleotide sequence(s) of interest present in the reaction mixtures.
  • a threshold cycle (“Threshold Cycle”, Ct) can be measured, which can be plotted in a standard curve which connects the cycle Ct and the logarithm of the initial quantity of molecules of each of the sequences d of interest in order to quantify the quantity of each of the nucleotide sequences of interest present in the mixture.
  • Example 3 Correction of the optical contamination generated by the fluorescence signal produced during a PCR during the hydrolysis of a TaqMan "a" probe for the detection of the presence of human and viral sequences of interest
  • the PCR experiment is performed using primers and probes specific for the SARS-CoV-2 viral genome and an endogenous control gene present in human nasopharyngeal epithelial cells.
  • the kit contains probes for the detection of 3 target sequences in 3 optical channels of device 2: channels 1 and 3 for two targets of the SARS-CoV-2 coronavirus, channel 4 for the endogenous control target.
  • the human DNA contained in a sample is detected by PCR amplification of the control sequence of interest with a pair of primers.
  • the fluorescence signal is generated by a functionalized probe with a fluorophore at the 5' end and a quencher at the 3' end, this fluorophore emits a fluorescence signal in a wavelength band detectable in the optical channel number 4 of Device 2.
  • This probe is referenced as Probe “a” and its signal as “Signal 1”, shown in Figure 6a.
  • the signal generated by the probe is also detected in optical channel number 3 of device 2.
  • This signal is referred to as “Signal 2”.
  • This contamination generates an apparent increase in the signal generated by the probe used for the detection of a target sequence of Sars-CoV-2 present in channel number 3, which could be wrongly interpreted as the presence of this target sequence in the 'sample.
  • This probe is referred to as the “b” probe.
  • Signal 2 is shown in Figure 6b.
  • the PCR protocol used in this experiment consists of: reverse transcription performed for 30 seconds at 50°C, nucleic acid denaturation and polymerase activation performed for one minute at 95°C, followed by 45 PCR cycles (composed of two phases: denaturation for 3 seconds at 95°C and annealing/extension for 15 seconds at 60°C).
  • the sampling period of the fluorescence measurement is 100ms throughout the duration of the PCR.
  • Example 4 Detection of a sequence of interest by exploiting the time signature of a “molecular beacon” type fluorescent probe used in a multiplex PCR amplification reaction.
  • the method and device of the invention are used to detect the presence of a nucleotide sequence of interest in a sample by means of PCR amplification using “Molecular Beacon” type probes (MB, Molecular Beacon ).
  • MB Molecular Beacon
  • these probes are not cleaved during the reaction, unlike probes of the TaqMan type.
  • the chosen polymerase lacks 5' to 3' exonuclease activity, and is replaced by a strand displacement (SD) activity.
  • a PCR is carried out with the following protocol: initial denaturation / activation of the polymerase for 30 seconds at 92°C and 40 cycles of PCR (composed of two phases: denaturation for 5 seconds at 92°C and hybridization / extension for 30 seconds at 62°C).
  • the reaction mixture is composed of a buffer (SD polymerase reaction buffer) by adding MgC12 to the final concentration of 3 mM and the amplification is carried out using 5U of SD Polymerase HotStart and 0.2 mM of dNTPs.
  • a buffer SD polymerase reaction buffer
  • From primers to concentration of 0.2 mM sense primer, sequence CCGCCAATGGTACCGCAATCCCT
  • 2 mM reverse primer, sequence GCTACTGCCATTATATTTTACGGTC
  • the molecular beacon type fluorescent probe is at a concentration of 0.03 mM.
  • This signature is then used to demultiplex the signals recorded during multiplex PCR reactions which use this probe to search for the presence of the corresponding nucleotide sequence among other sequences.
  • Example 5 Determination of the time signature of a probe according to the QUASR method implemented in a PCR reaction.
  • the invention can be used to analyze fluorescence curves during PCR amplification using the QUASR (Quenching of Unincorporated Amplification Signal Reporters) system.
  • a PCR is carried out with the following protocol: initial denaturation / activation of the polymerase for one minute at 95°C and 45 cycles of PCR (composed of two phases: denaturation for 3 seconds at 95°C and hybridization / extension for 15 seconds at 60°C).
  • the sampling period of the fluorescence measurement is 200 ms throughout the duration of the PCR.
  • the reaction mixture is composed of a buffer (Tris-HCL, KCl 25mM, (NPDiSCL 16mM, MgCl 4.5mM) and the amplification is carried out using 3U of SuperHotTaq DNA polymerase and 0.2mM dNTPs.
  • ACATTTCACAACACGAGCTGACGA at a concentration of 0.5 mM are used to amplify 10 5 genomes of E. coli (extracted and diluted after bacterial culture in LB medium).
  • An oligonucleotide complementary to the “sense” primer GGCGCAAGGTTTACATAAACATTGGCGT-BHQ1 is added to the reaction mixture at a concentration of 0.3 mM.
  • This signature is then used to demultiplex the signals recorded during multiplex PCR reactions which use this probe to search for the presence of the corresponding nucleotide sequence among other sequences.
  • Example 6 Detection of 5 nucleotide sequences in a syndromic kit of respiratory viruses Influenza A, B, syncitial respiratory viruses A and B, and SARS-CoV-2 using a pentaplex PCR.
  • the method and the device described in the present invention allow the search for the presence of 5 viruses using a pentaplex PCR carried out by mixing five pairs of primers and five probes for the detection of 5 targets using only two channels device optics (channels 3 and 4).
  • the primers and probes used are specific for the following targets:
  • the primers are added to the mixture at a concentration of between 0.1 and 0.6 mM; the probes are added to the reaction at a concentration between 0.1 and 0.5 mM.
  • the RT-PCR mix consists of buffer (Tris-HCL, 25mM KC1, (NH4)2SO4 16mM, MgC124.5mM) and amplification is performed using between 3 and 10U of TAQ polymerase (with exonuclease activity in 5') and 3U of WarmStart reverse transcriptase.
  • the PCR protocol used consists of: reverse transcription carried out for one minute at 60°C, denaturation / activation of the polymerase carried out for one minute at 95°C and 45 PCR cycles (composed of two phases: denaturation for 3 seconds at 95°C C and hybridization/extension for 15 seconds at 60°C). Fluorescence intensity measurements are performed every 100 ms. 5 PCR reactions are carried out comprising all the probes except one to determine the time signatures of the probes.
  • time signatures are then used to demultiplex the signals recorded during pentaplex PCR reactions to search, in a single reaction, for the presence of any sequence among the 5 nucleotide sequences of interest.
  • This capacity for multiplexed detection of nucleic acid sequences opens up significant possibilities, such as the possibility of carrying out the simultaneous search for numerous point genetic mutations of the SARS-CoV-2 coronavirus genome in a clinical sample, which makes it possible to quickly identify the variant present in this sample, a faster and less expensive alternative to sequencing the viral genome present in this sample.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

A device for multiplexed detection of nucleic acid sequences comprises a thermal cycler (4) arranged to perform a series of thermal cycles with an in vitro nucleic acid extraction reagent containing at least two fluorescence probes combining a quencher and a fluorophore, the fluorescence probes each being arranged to target a distinct nucleic acid sequence and the fluorophores having overlapping fluorescence wavelength ranges, a light sensor (6) arranged to measure radiation emitted by the fluorophores in the fluorescence wavelength ranges, the radiation emitted by each probe varying depending on whether the latter is in a non-modified state in which the quencher mitigates, or does not substantially mitigate, the fluorescence emission, or in a modified state in which the quencher has an opposite effect on the fluorescence emission, and an analyser (8) arranged to determine, for each respective fluorescence probe, a value representative of a concentration in a modified state from time signatures derived from the measured fluorescence as a function of time for a given thermal cycle of a reaction mixture comprising one or more probes, which may each be substantially entirely in a non-modified or modified state, and at least two measurements carried out during at least some of the thermal cycles, which values representative of a concentration in a modified state make it possible to qualify the presence of one or more nucleic acid sequences each associated with a distinct fluorescence probe so as to cause the fluorescence probe to change from the non-modified state to the modified state during interaction.

Description

Description Description
Titre : Dispositif et procédé de détection multiplexée de séquences d’acides nucléiques Title: Device and method for multiplexed detection of nucleic acid sequences
L’invention concerne le domaine de la détection de séquences d’acides nucléiques par réaction PCR, ou tout autre procédé d’amplification d’acides nucléiques in vitro, et en particulier la détection multiplexée de séquences d’acides nucléiques par réaction en chaîne par polymérase (PCR). The invention relates to the field of the detection of nucleic acid sequences by PCR reaction, or any other process for the amplification of nucleic acids in vitro, and in particular the multiplexed detection of nucleic acid sequences by chain reaction by polymerase (PCR).
Dans de nombreuses situations du domaine de la biologie moléculaire, il est nécessaire d’identifier avec un grand niveau de confiance la présence d’une ou de plusieurs séquences d’ADN ou d’ARN d’intérêt dans un échantillon, et de mesurer leur concentration relative respective, ces séquences figurant dans un ensemble de séquences d’intérêt. In many situations in the field of molecular biology, it is necessary to identify with a high level of confidence the presence of one or more DNA or RNA sequences of interest in a sample, and to measure their respective relative concentration, these sequences appearing in a set of sequences of interest.
Dans ces situations, il est souvent intéressant de pouvoir tester la présence de plusieurs séquences simultanément dans le même échantillon en un seul test. Les causes de ce besoin peuvent être l’urgence, la petite taille de l’échantillon, la faible concentration des séquences d’intérêt dans cet échantillon, ou encore le coût du test (réactifs, consommables, taux d’occupation de l’automate, etc.). In these situations, it is often interesting to be able to test the presence of several sequences simultaneously in the same sample in a single test. The causes of this need can be the urgency, the small size of the sample, the low concentration of the sequences of interest in this sample, or the cost of the test (reagents, consumables, occupation rate of the automaton , etc.).
Lorsque cette ou ces séquences sont en quantités trop faibles pour être caractérisées, il est classique de mettre en œuvre une amplification exponentielle in vitro de ces séquences, par exemple par une réaction en chaîne par polymérase (PCR). Ce procédé vise à obtenir une quantité suffisante des séquences recherchées à l’aide d’un mélange de paires d’amorces oligonucléotidiques localisées dans ces séquences d’intérêt. Plusieurs variantes de la PCR ont été développées (par exemple LATE-PCR, ASPCR). D’autres procédés d’amplification d’acides nucléiques in vitro sont également connus, tels que le procédé NASBA (nucleic acid sequence-based amplification), le procédé TMA (transcription mediated amplification), la LAMP (loop-mediated isothermal amplification), la SDA (strand displacement amplification) et l’amplification en cercle roulant (Rolling Circle Amplification). Différents procédés sont déjà connus pour identifier la présence d’une ou de plusieurs séquences nucléiques d’intérêt, après les avoir amplifiées le cas échéant. Il est possible de réaliser un séquençage sans a priori, ou ciblé, des acides nucléiques présents dans l’échantillon. De tels procédés sont en général longs et coûteux et restent limités à certaines applications. Les procédés les plus utilisés consistent à utiliser des sondes oligonucléotidiques qui peuvent s’hybrider sur une portion caractéristique de leur séquence d’intérêt. Ces sondes peuvent être mises en œuvre selon plusieurs familles de procédés : When this or these sequences are in quantities too small to be characterized, it is conventional to implement exponential amplification in vitro of these sequences, for example by a polymerase chain reaction (PCR). This method aims to obtain a sufficient quantity of the desired sequences using a mixture of pairs of oligonucleotide primers located in these sequences of interest. Several variants of PCR have been developed (eg LATE-PCR, ASPCR). Other in vitro nucleic acid amplification processes are also known, such as the NASBA (nucleic acid sequence-based amplification) process, the TMA (transcription-mediated amplification) process, LAMP (loop-mediated isothermal amplification), SDA (strand displacement amplification) and rolling circle amplification. Various methods are already known for identifying the presence of one or more nucleic acid sequences of interest, after having amplified them where appropriate. It is possible to carry out sequencing without a priori, or targeted, of the nucleic acids present in the sample. Such methods are generally long and expensive and remain limited to certain applications. The most used methods consist in using oligonucleotide probes which can hybridize on a characteristic portion of their sequence of interest. These probes can be implemented according to several families of processes:
- puce à ADN : il s’agit de fixer les diverses sondes sur un support solide, par exemple une matrice à 2 dimensions, et les repérer par leurs coordonnées dans cette matrice (principe également appelé « DNA microarray » en anglais). Cette détection en phase inhomogène présente un coût important de fabrication et une cinétique d’hybridation lente qui nuit aux performances en termes de sensibilité, - DNA chip: this involves fixing the various probes on a solid support, for example a 2-dimensional matrix, and identifying them by their coordinates in this matrix (principle also called “DNA microarray” in English). This detection in inhomogeneous phase has a high manufacturing cost and slow hybridization kinetics which affects performance in terms of sensitivity,
- puce liquide : il s’agit d’ordonner les sondes sur une puce liquide, voir par exemple le procédé xMap de Luminex publié à l’adresse https://www.luminexcorp.com/xmap- technology/. Ce procédé est complexe à utiliser car il nécessite un cytofluori mètre en flux, et l’analyse qu’il met en œuvre n’est pas instantanée car les billes sont analysées séquentiellement, - liquid chip: this involves ordering the probes on a liquid chip, see for example the Luminex xMap process published at the address https://www.luminexcorp.com/xmap-technology/. This process is complex to use because it requires a flow cytofluorimeter, and the analysis it implements is not instantaneous because the beads are analyzed sequentially,
- format en phase homogène : les sondes peuvent être constituées d’un oligonucléotide unique ou de l’association de deux oligonucléotides, libres en solution. Les sondes sont classiquement marquées au moyen d’un fluorophore et d’un quencher. Lorsqu’une sonde se trouve mélangée à un échantillon qui ne contient pas sa séquence cible, et que la température est dans l’intervalle de température compatible avec son hybridation, la fluorescence de cette sonde est diminuée ou supprimée par la proximité spatiale du quencher et du fluorophore. En revanche, lorsqu’elle interagit avec sa séquence cible, le fluorophore et le quencher se retrouvent maintenus à distance et la sonde devient fluorescente. - homogeneous phase format: the probes can consist of a single oligonucleotide or the combination of two oligonucleotides, free in solution. The probes are conventionally labeled using a fluorophore and a quencher. When a probe is mixed with a sample that does not contain its target sequence, and the temperature is within the temperature range compatible with its hybridization, the fluorescence of this probe is reduced or suppressed by the spatial proximity of the quencher and fluorophore. On the other hand, when it interacts with its target sequence, the fluorophore and the quencher are kept at a distance and the probe becomes fluorescent.
Le format en phase homogène peut être utilisé selon plusieurs variantes, dont les plus utilisées sont détaillées ci-dessous : The homogeneous phase format can be used in several variants, the most used of which are detailed below:
- la balise moléculaire : dans cette variante, la sonde est constituée d’un seul oligonucléotide, conçu de telle façon que le fluorophore et le quencher sont à proximité immédiate lorsque la sonde n’est pas hybridée et se trouve à basse température. Cette proximité résulte le plus souvent de la présence de séquences complémentaires de quelques bases aux extrémités de la séquence spécifique de la séquence d’intérêt. En solution, ces deux extrémités complémentaires s’hybrident en formant une double hélice, ce qui a pour effet de rapprocher et de maintenir à courte distance le fluorophore et le quencher. Lorsque les séquences cibles sont présentes dans la solution et que la température est en-dessous ou au voisinage de la température de fusion du duplex formé entre la sonde et sa cible, les sondes qui s’hybrident à leurs séquences cibles deviennent fluorescentes, et - the molecular beacon: in this variant, the probe consists of a single oligonucleotide, designed in such a way that the fluorophore and the quencher are close together immediate when the probe is not hybridized and is at low temperature. This proximity most often results from the presence of complementary sequences of a few bases at the ends of the sequence specific to the sequence of interest. In solution, these two complementary ends hybridize to form a double helix, which has the effect of bringing together and keeping the fluorophore and the quencher at a short distance. When the target sequences are present in the solution and the temperature is below or near the melting temperature of the duplex formed between the probe and its target, the probes which hybridize to their target sequences become fluorescent, and
- l’essai par l’activité nucléase 5’ : dans cette variante, lorsque la sonde est hybridée à sa séquence cible, l’hybridation d’une amorce en 5’ de cette sonde déclenche la polymérisation d’un nouveau brin d’ADN. Lorsque la polymérase rencontre l’extrémité 5 ’ de la sonde, elle la clive grâce à son activité exonucléasique de 5 ’ vers 3 ’ , ce qui a pour effet de séparer de façon irréversible le fluorophore du quencher. Le fluorophore peut alors exprimer sa fluorescence de manière plus efficace puisque le rayonnement n’est plus absorbé par le quencher. Le principe du procédé exploitant l’activité exonucléase de 5’ vers 3’ a été décrit dans le brevet US 5 210 015 et dans une publication de Holland PM et al. « Détection of spécifie polymerase chain reaction product by utilizing the 5' — 3' exonuclease activity of Thermus aquaticus DNA polymerase », Proceedings of the National Academy of Sciences Aug 1991, 88 (16) 7276-7280; DOI: 10.1073/pnas.88.16.7276 PNAS 1991en 1991. Dans ce procédé, la sonde était marquée par en 5’ à l’aide d’un marqueur radioactif. Le procédé a ensuite été amélioré en remplaçant ce marqueur par un fluorophore avec l’ajout d’un quencher en 3’ qui permet à la sonde de subir un changement de fluorescence selon qu’elle est libre en solution, ou hybridée, ou digérée (brevet US 5723591, sondes utilisables avec le procédé Taq-Man™). - the 5' nuclease activity test: in this variant, when the probe is hybridized to its target sequence, the hybridization of a primer in 5' of this probe triggers the polymerization of a new DNA strand . When the polymerase meets the 5' end of the probe, it cleaves it thanks to its exonuclease activity from 5' to 3', which has the effect of irreversibly separating the fluorophore from the quencher. The fluorophore can then express its fluorescence more efficiently since the radiation is no longer absorbed by the quencher. The principle of the process exploiting the 5' to 3' exonuclease activity has been described in US patent 5,210,015 and in a publication by Holland PM et al. "Detection of specific polymerase chain reaction product by utilizing the 5'-3' exonuclease activity of Thermus aquaticus DNA polymerase", Proceedings of the National Academy of Sciences Aug 1991, 88 (16) 7276-7280; DOI: 10.1073/pnas.88.16.7276 PNAS 1991 in 1991. In this process, the probe was 5' labeled with a radioactive label. The method was then improved by replacing this label with a fluorophore with the addition of a 3' quencher which allows the probe to undergo a change in fluorescence depending on whether it is free in solution, or hybridized, or digested ( US patent 5723591, probes usable with the Taq-Man™ method).
Ces formats peuvent eux-mêmes être mis en œuvre selon des variantes telles que les procédés utilisant des sondes (qui peuvent jouer également le rôle d’amorce dans certains de ces procédés) de type Scorpion (marque déposée), Amplifluor (marque déposée), MGB Eclipse (marque déposée), Light Upon extension (LUX, marque déposée), Quenching of Unincorporated Amplification Signal Reporters (QUASR) ou QZyme (marque déposée) par exemple. Le format en phase homogène présente de nombreux avantages parmi lesquels : une excellente cinétique d’interactions des sondes avec leur séquences cibles respectives, un faible coût, et d’excellentes performances en termes de sensibilité. These formats can themselves be implemented according to variants such as methods using probes (which can also play the role of primer in some of these methods) of the Scorpion type (registered trademark), Amplifluor (registered trademark), MGB Eclipse (registered trademark), Light Upon extension (LUX, registered trademark), Quenching of Unincorporated Amplification Signal Reporters (QUASR) or QZyme (registered trademark) for example. The homogeneous phase format has many advantages, including: excellent kinetics of interactions of the probes with their respective target sequences, low cost, and excellent performance in terms of sensitivity.
Cependant, la réalisation de plusieurs mesures simultanément est limitée par la capacité de séparer les signaux issus des différentes sondes mélangées dans le même test, ce qui constitue un inconvénient majeur. En effet, il faut que des sondes ciblant des séquences distinctes présentent des longueurs d’onde d’émission pouvant être séparées les unes des autres pour pouvoir les utiliser lors d’une même mesure. However, carrying out several measurements simultaneously is limited by the ability to separate the signals from the different mixed probes in the same test, which constitutes a major drawback. Indeed, it is necessary that probes targeting distinct sequences have emission wavelengths that can be separated from each other in order to be able to use them during the same measurement.
En effet, quelle que soit la variante retenue (balise moléculaire ou essai d’activité nucléase 5’ ou autre), il n’est pas possible d’utiliser plus d’une sonde par canal de fluorescence. Les thermocycleurs en temps réel disponibles sur le marché mesurent un niveau de fluorescence pour chaque canal à un moment unique de chaque cycle de la réaction d’amplification. Par conséquent, si deux sondes émettant dans le même canal de fluorescence sont mélangées, il n’est pas possible de distinguer leur contribution respective à la production du signal de fluorescence. Indeed, whatever variant is chosen (molecular beacon or 5' nuclease activity assay or other), it is not possible to use more than one probe per fluorescence channel. Commercially available real-time thermal cyclers measure a fluorescence level for each channel at a unique time in each cycle of the amplification reaction. Therefore, if two probes emitting in the same fluorescence channel are mixed, it is not possible to distinguish their respective contribution to the production of the fluorescence signal.
Ainsi, un thermocycleur en temps réel capable de mesurer 4 canaux de fluorescence ne peut détecter et discriminer la fluorescence émise que par 4 sondes maximum et les réactions d’amplification réalisées avec cet appareil ne peuvent pas détecter plus de 4 séquences cibles par réaction. Thus, a real-time thermal cycler capable of measuring 4 fluorescence channels can only detect and discriminate the fluorescence emitted by a maximum of 4 probes and the amplification reactions carried out with this device cannot detect more than 4 target sequences per reaction.
Plusieurs procédés ont été proposés pour contourner cette limitation : Several methods have been proposed to circumvent this limitation:
- discrimination par le découplage de l’excitation et de l’émission : dans ce procédé, des sondes émettant dans le même canal de fluorescence peuvent être mélangées à condition qu’elles puissent être excitées de manière distincte. Certains fluorophores peuvent en effet être excités à des longueurs d’onde éloignées les unes des autres, mais émetre dans la même bande de longueur d’onde. C’est notamment le cas des fluorophores qui émettent avec un large décalage Stokes. Ainsi, la société Cepheid a récemment amélioré son appareil GeneXpert (marque déposée) en étendant le nombre de fluorophores détectés de 6 à 10 (voir l’article de Chakravorty et al. « Détection of Isoniazid-, Fluoroquinolone-, Amikacin-, and Kanamycin-Resistant Tuberculosis in an Automated, Multiplexed 10- Color Assay Suitable for Point-of-Care Use », 2017, Journal of Clinical Microbiology, 55, 183, publié à l’adresse https://doi.org/10.1128/JCM.01771-16). Dans la bande d’émission orange par exemple, 3 fluorophores peuvent ainsi être discriminés (CF9, excitable dans le bleu, CF8, excitable dans le vert, CF4, excitable dans le jaune). Ce procédé nécessite un module optique permettant d’analyser la composition spectrale du signal émis : l’excitation dans le vert produit des signaux émis par les fluorophores CF3, C8 et CF10 dans le jaune, l’orange et l’infrarouge respectivement. Il présente de plus l’inconvénient des procédés utilisant plusieurs bandes de fluorescence, à savoir la contamination optique d’une bande, ou canal, dans une bande adjacente. Ces contaminations optiques (également appelées “crosstalks”) peuvent perturber l’analyse des résultats dans les bandes adjacentes et être source de résultats erronés, du type faux positifs par exemple. - Discrimination by decoupling excitation and emission: in this method, probes emitting in the same fluorescence channel can be mixed provided that they can be excited separately. Some fluorophores can indeed be excited at wavelengths that are distant from each other, but emit in the same wavelength band. This is particularly the case for fluorophores which emit with a wide Stokes shift. Thus, the Cepheid company recently improved its GeneXpert (registered trademark) device by extending the number of fluorophores detected from 6 to 10 (see the article by Chakravorty et al. "Detection of Isoniazid-, Fluoroquinolone-, Amikacin-, and Kanamycin-Resistant Tuberculosis in an Automated, Multiplexed 10- Color Assay Suitable for Point-of-Care Use”, 2017, Journal of Clinical Microbiology, 55, 183, published at https://doi.org /10.1128/JCM.01771-16). In the orange emission band, for example, 3 fluorophores can thus be distinguished (CF9, excitable in blue, CF8, excitable in green, CF4, excitable in yellow). This method requires an optical module making it possible to analyze the spectral composition of the signal emitted: excitation in the green produces signals emitted by the fluorophores CF3, C8 and CF10 in the yellow, orange and infrared respectively. It also has the disadvantage of methods using several fluorescence bands, namely the optical contamination of a band, or channel, in an adjacent band. These optical contaminations (also called “crosstalks”) can disturb the analysis of the results in the adjacent bands and be a source of erroneous results, of the false positive type for example.
- discrimination par la méthode de la courbe de fusion : il est connu de distinguer des sondes partageant la même plage d’émission de fluorescence en distinguant les sondes par leur température de fusion. Pour cela, on réalise une courbe de fusion après avoir initié la formation du duplex entre la séquence d’intérêt et la (ou les) sonde(s) oligonucléotidique(s), en augmentant progressivement et de façon monotone la température T de la solution, tout en enregistrant le signal de fluorescence F. Le maximum de la courbe -dF/dT indique la température de fusion Tf du duplex. Cette température de fusion permet de s’assurer que le duplex formé est un homoduplex, voire un hétéroduplex si cette température est inférieure à la température connue de F homoduplex, voire même d’identifier, dans ce cas, la ou les mutations à l’origine de l’hétéroduplex lorsque les séquences mutantes possibles sont répertoriées dans une liste limitative et que leurs températures de fusion respectives avec la sonde sont préalablement connues de façon biunivoque. - discrimination by the melting curve method: it is known to distinguish probes sharing the same fluorescence emission range by distinguishing the probes by their melting temperature. To do this, a melting curve is produced after having initiated the formation of the duplex between the sequence of interest and the oligonucleotide probe(s), by gradually and monotonously increasing the temperature T of the solution. , while recording the fluorescence signal F. The maximum of the -dF/dT curve indicates the melting temperature Tm of the duplex. This melting temperature makes it possible to ensure that the duplex formed is a homoduplex, or even a heteroduplex if this temperature is lower than the known temperature of F homoduplex, or even to identify, in this case, the mutation(s) at the origin of the heteroduplex when the possible mutant sequences are indexed in a limiting list and when their respective melting temperatures with the probe are previously known in a one-to-one manner.
En ce qui concerne la méthode de la courbe de fusion, certains des procédés de détection de séquences d’intérêt décrits plus haut sont incompatibles avec les conditions nécessaires pour mesurer la température de fusion. With respect to the melting curve method, some of the methods for detecting sequences of interest described above are incompatible with the conditions needed to measure melting temperature.
C’est en particulier le cas des procédés suivants : - amplification avec une polymérase ayant une activité exonucléase 5’->3’ : c’est le cas le plus fréquent, comme avec le procédé de l’essai par l’activité nucléase 5’, les polymérases non mutées ayant en général une telle activité. Il en résulte une hydrolyse de l’extrémité 5’ des sondes lorsque celle-ci n’est pas bloquée, et les molécules de sonde hydrolysée ne sont plus utilisables pour réaliser la courbe de fusion. This is particularly the case for the following processes: - amplification with a polymerase having a 5'->3' exonuclease activity: this is the most frequent case, as with the method of the test by 5' nuclease activity, non-mutated polymerases generally having such a activity. This results in hydrolysis of the 5' end of the probes when the latter is not blocked, and the molecules of hydrolyzed probe can no longer be used to produce the melting curve.
- amplification asymétrique : dans le cas général des amplifications exponentielles dépendantes d’amorces comme la PCR, l’amplification est dite symétrique et ces amorces sont en concentration stoechiométrique, ce qui a pour conséquence que l’amplification engendre autant de brins d’ADN sens qu’anti-sens. Par construction, l’un de ces brins partage la même séquence, ou une séquence très proche, de celle de la sonde, de sorte que ce brin peut rentrer en compétition avec la sonde pour s’hybrider à la séquence cible, et supprimer le signal émis par cette sonde. Pour contourner cette difficulté, on peut réaliser une amplification asymétrique en modifiant le rapport des concentrations des amorces afin de favoriser la formation du brin d’ADN complémentaire de la sonde, mais l’amplification cesse alors rapidement d’être exponentielle lorsque l’amorce en faible quantité a été consommée pour devenir seulement linéaire, ce qui rallonge la durée du test et/ou diminue sa sensibilité, - asymmetric amplification: in the general case of exponential amplifications dependent on primers such as PCR, the amplification is said to be symmetrical and these primers are in stoichiometric concentration, which has the consequence that the amplification generates as many sense DNA strands that anti-sense. By construction, one of these strands shares the same sequence, or a sequence very close, to that of the probe, so that this strand can compete with the probe to hybridize with the target sequence, and delete the signal emitted by this probe. To circumvent this difficulty, an asymmetric amplification can be carried out by modifying the ratio of the concentrations of the primers in order to favor the formation of the DNA strand complementary to the probe, but the amplification then quickly ceases to be exponential when the primer in small quantity has been consumed to become only linear, which lengthens the duration of the test and/or decreases its sensitivity,
- amplification multiplexe avec une amorce universelle : on utilise ici des amorces contenant une région conservée unique dans leur région 5’. Cela permet de diminuer avantageusement et efficacement l’occurrence des dimères d’amorces (Brownie et al « The élimination of primer-dimer accumulation in PCR », Nucleic acids Res. 1997 Nucleic Acids Res. 1997 Aug 15;25(16):3235-41. doi: 10.1093/nar/25.16.3235, publié à l’adresse https://doi.org/10.1093/nar/25.16.3235.) et d’amplifier exponentiellement un grand nombre de séquences d’intérêt avec un seul couple d’amorce. En revanche, il est évidemment impossible de réaliser une amplification asymétrique, puisque l’amorce utilisée amplifie chacun des brins sens et anti-sens de la séquence d’intérêt. - multiplex amplification with a universal primer: primers containing a unique conserved region in their 5' region are used here. This makes it possible to advantageously and effectively reduce the occurrence of primer dimers (Brownie et al “The elimination of primer-dimer accumulation in PCR”, Nucleic acids Res. 1997 Nucleic Acids Res. 1997 Aug 15;25(16):3235 -41. doi: 10.1093/nar/25.16.3235, published at https://doi.org/10.1093/nar/25.16.3235.) and exponentially amplify a large number of sequences of interest with a single primer couple. On the other hand, it is obviously impossible to carry out an asymmetric amplification, since the primer used amplifies each of the sense and antisense strands of the sequence of interest.
Dans le cas où la sonde n’est pas hydrolysée, son hybridation peut être supprimée ou considérablement diminuée par la présence du brin complémentaire formé pendant la réaction d’amplification symétrique. Cette diminution du signal peut résulter d’au moins deux mécanismes : - la compétition lors de l’hybridation avec ce brin complémentaire, qui, même en concentration inférieure à celle de la sonde, peut s’hybrider en premier et de façon préférentielle, In the case where the probe is not hydrolysed, its hybridization can be suppressed or considerably reduced by the presence of the complementary strand formed during the symmetrical amplification reaction. This decrease in signal can result from at least two mechanisms: - competition during hybridization with this complementary strand, which, even at a concentration lower than that of the probe, can hybridize first and preferentially,
- le déplacement de la sonde par le brin complémentaire, qui peut s’hybrider dans des régions homologues en 5’ ou 3’ de la séquence d’intérêt, même après l’hybridation de celle-ci. Ce brin complémentaire peut alors déplacer la sonde par migration de branche (« toehold-mediated strand displacement » en anglais) selon une cinétique qui dépend notamment de la longueur de de ces régions homologues (voir l’article de Srinivas et al. « On the biophysics and kinetics of toehold-mediated DNA strand displacement », Nucleic acids research 2013, publié à l’adresse https://doi.org/10.1093/nar/gkt801),- displacement of the probe by the complementary strand, which can hybridize in homologous regions 5' or 3' of the sequence of interest, even after hybridization of the latter. This complementary strand can then move the probe by branch migration (“toehold-mediated strand displacement” in English) according to kinetics which depend in particular on the length of these homologous regions (see the article by Srinivas et al. “On the biophysics and kinetics of toehold-mediated DNA strand displacement”, Nucleic acids research 2013, published at https://doi.org/10.1093/nar/gkt801),
- la discrimination par les méthodes TOCE et MuDT de la société Seegene : la méthode ci-dessus selon la courbe de fusion est réalisée en point final et ne permet donc pas de réaliser une quantification des concentrations relatives des séquences d’intérêt si elles sont simultanément présentes. La société Seegene a décrit deux procédés pour contourner cette limitation. Le premier, dénommé TOCE (« Tagging Oligonucleotide Cleavage & Extension », marque déposée) permet de détecter jusqu’à 5 sondes par canal d’émission de fluorescence en utilisant des sondes fluorescentes “catcher” distinguables par leur température de fusion. L’inconvénient principal est la complexité de mise en œuvre de ce procédé, qui nécessite d’ajouter plusieurs oligonucléotides en plus de ceux utilisés pour amplifier les séquences d’intérêt. Ces oligonucléotides sont susceptibles de générer des produits artéfactuels qui consomment des réactifs au détriment de la production des produits de PCR désirés. Le deuxième, dénommé MuDT (« Multi Ct values in a single channel », marqué déposée), permet de combiner jusqu’à 3 sondes dans les mêmes canaux d’excitation et d’émission. Les sondes présentent des températures de fusion distinctes, séparées de plusieurs degrés. L’amplification par PCR est réalisée avec des cycles dont le profil de température comprend un ou plusieurs paliers lors de la remontée de la température vers la température de fusion voisine de 95 °C. Les paliers de température sont choisis entre les températures de fusion des sondes, et le signal de fluorescence est enregistré à chacun de ces paliers. Par calcul, on peut déterminer la contribution de chacune des sondes au signal de fluorescence total. Un inconvénient important est que le thermocycleur utilisé doit pouvoir gérer ce type de profil particulier de cycle, qui est incompatible avec une PCR rapide dans laquelle on cherche à minimiser les temps de changement de température au cours des cycles. Ce procédé est en outre incompatible avec la détection en mode TaqMan dans lequel la sonde est hydrolysée. - discrimination by the TOCE and MuDT methods of the Seegene company: the above method according to the melting curve is carried out at the end point and therefore does not allow quantification of the relative concentrations of the sequences of interest if they are simultaneously present. The Seegene company has described two methods to circumvent this limitation. The first, called TOCE (“Tagging Oligonucleotide Cleavage & Extension”, registered trademark) makes it possible to detect up to 5 probes per fluorescence emission channel using “catcher” fluorescent probes distinguishable by their melting temperature. The main drawback is the complexity of implementing this method, which requires adding several oligonucleotides in addition to those used to amplify the sequences of interest. These oligonucleotides are likely to generate artifactual products that consume reagents to the detriment of producing the desired PCR products. The second, called MuDT (“Multi Ct values in a single channel”, registered trademark), makes it possible to combine up to 3 probes in the same excitation and emission channels. The probes exhibit distinct melting temperatures, separated by several degrees. PCR amplification is carried out with cycles whose temperature profile includes one or more stages when the temperature rises towards the melting temperature close to 95°C. The temperature stages are chosen between the melting temperatures of the probes, and the fluorescence signal is recorded at each of these stages. By calculation, the contribution of each of the probes to the total fluorescence signal can be determined. A significant drawback is that the thermal cycler used must be able to manage this type of particular cycle profile, which is incompatible with rapid PCR in which one seeks to minimize the times of temperature change during the cycles. This method is also incompatible with detection in TaqMan mode in which the probe is hydrolyzed.
À ce jour, les procédés qui prétendent être multiplex sont donc extrêmement insatisfaisants, soit par leur complexité, soit par leur performance, soit par leur incompatibilité avec des formats en phase homogène répandus comme les sondes TaqMan. Pour la plupart, on pourrait même les qualifier de multi-fluorescence plutôt que multiplex, puisqu’il s’agit surtout de faire des mesures « parallèles » ou simultanées, mais pas multiplexées, c’est-à-dire dont les signaux sont combinés entre eux. To date, methods that claim to be multiplex are therefore extremely unsatisfactory, either in their complexity, or in their performance, or in their incompatibility with widespread homogeneous phase formats such as TaqMan probes. For the most part, we could even qualify them as multi-fluorescence rather than multiplex, since it is above all a question of making "parallel" or simultaneous measurements, but not multiplexed, that is to say whose signals are combined between them.
L’invention vient améliorer la situation. À cet effet, elle propose un dispositif de détection multiplexée de séquences d’acides nucléiques comprenant un thermocycleur agencé pour réaliser une série de cycles thermiques avec un réactif d’amplification d’acides nucléiques in vitro contenant au moins deux sondes de fluorescence combinant un quencher et un fluorophore, lesdites sondes de fluorescence étant agencées pour chacune cibler une séquence d’acide nucléique distincte et lesdits fluorophores émettant dans des plages de longueurs d’onde de fluorescence se chevauchant, un capteur de lumière agencé pour mesurer un rayonnement émis par lesdits fluorophores dans lesdites plages de longueurs d’onde de fluorescence, le rayonnement émis par chaque sonde variant selon que celle-ci est dans un état non modifié dans lequel le quencher atténue ou n’atténue pas sensiblement l’émission de fluorescence, ou dans un état modifié dans lequel le quencher a un effet opposé sur l’émission de fluorescence, et un analyseur agencé pour déterminer, pour chaque sonde de fluorescence respective, une valeur représentative d’une concentration dans un état modifié, à partir de signatures temporelles tirées de la fluorescence mesurée en fonction du temps pour un cycle thermique donné d’un mélange réactionnel comprenant une ou plusieurs sondes, lesquelles peuvent être chacune sensiblement entièrement dans un état non modifié ou modifié, et d’au moins deux mesures réalisées au cours de certains au moins des cycles thermiques, lesquelles valeurs représentatives d’une concentration dans un état modifié permettent de qualifier la présence d’une ou plusieurs séquences d’acide nucléique chacune associée à une sonde de fluorescence distincte de manière à provoquer un changement d’état de la sonde de fluorescence de l’état non modifié vers l’état modifié lorsqu’elles interagissent. Ce dispositif est particulièrement avantageux car il permet de détecter la présence d’une séquence d’intérêt à l’aide d’une sonde fluorescente caractérisée dont on a au préalable caractérisé une signature temporelle. Ainsi, la détermination de cette signature temporelle permet d’utiliser simultanément des sondes émettant dans une même bande d’émission de fluorescence, mais dont les signatures temporelles sont suffisamment différentes pour que leurs contributions respectives puissent néanmoins être séparées. Avantageusement, cette signature temporelle permet également d’éliminer efficacement les contaminations optiques potentielles d’une bande de fluorescence à une bande adjacente. Avec ce dispositif, les contaminations optiques potentielles peuvent même être exploitées pour détecter la présence d’une séquence d’intérêt. The invention improves the situation. To this end, it proposes a device for the multiplexed detection of nucleic acid sequences comprising a thermocycler arranged to carry out a series of thermal cycles with an in vitro nucleic acid amplification reagent containing at least two fluorescence probes combining a quencher and a fluorophore, said fluorescence probes being arranged to each target a distinct nucleic acid sequence and said fluorophores emitting in overlapping fluorescence wavelength ranges, a light sensor arranged to measure radiation emitted by said fluorophores within said ranges of fluorescence wavelengths, the radiation emitted by each probe varying depending on whether the latter is in an unmodified state in which the quencher substantially attenuates or does not attenuate the fluorescence emission, or in a state modified wherein the quencher has an opposite effect on fluorescence emission, and an analyzer arranged to determine , for each respective fluorescence probe, a value representative of a concentration in a modified state, from temporal signatures drawn from the fluorescence measured as a function of time for a given thermal cycle of a reaction mixture comprising one or more probes, which can each be substantially entirely in an unmodified or modified state, and of at least two measurements carried out during at least some of the thermal cycles, which values representative of a concentration in a modified state make it possible to qualify the presence of one or more nucleic acid sequences each associated with a distinct fluorescence probe so as to cause a state change of the fluorescence probe from the unmodified state to the modified state when they interact. This device is particularly advantageous because it makes it possible to detect the presence of a sequence of interest using a characterized fluorescent probe of which a temporal signature has previously been characterized. Thus, the determination of this time signature makes it possible to simultaneously use probes emitting in the same fluorescence emission band, but whose time signatures are sufficiently different so that their respective contributions can nevertheless be separated. Advantageously, this time signature also makes it possible to effectively eliminate potential optical contamination from one fluorescence band to an adjacent band. With this device, potential optical contaminations can even be exploited to detect the presence of a sequence of interest.
Selon divers modes de réalisation, l’invention peut présenter une ou plusieurs des caractéristiques suivantes : According to various embodiments, the invention may have one or more of the following characteristics:
- le thermocycleur est un thermocycleur PCR, et les au moins deux sondes de fluorescence sont choisies parmi le groupe comprenant les sondes TaqMan, les balises moléculaires, les sondes duales à transfert de fluorescence, les sondes Scorpion, les sondes Amplifluor, les sondes MGB Eclipse, les sondes LUX, les sondes QUASR et les sondes QZyme,- the thermal cycler is a PCR thermal cycler, and the at least two fluorescence probes are chosen from the group comprising TaqMan probes, molecular beacons, dual fluorescence transfer probes, Scorpion probes, Amplifluor probes, MGB Eclipse probes , LUX probes, QUASR probes and QZyme probes,
- le réactif d’amplification d’acides nucléiques in vitro comprend trois sondes de fluorescence combinant un quencher et un fluorophore, lesdites sondes de fluorescence étant agencées pour chacune cibler une séquence d’acide nucléique distincte et lesdits fluorophores présentant des plages de longueurs d’onde de fluorescence se chevauchant,- the in vitro nucleic acid amplification reagent comprises three fluorescence probes combining a quencher and a fluorophore, said fluorescence probes being arranged to each target a distinct nucleic acid sequence and said fluorophores having length ranges of overlapping fluorescence wave,
- le réactif d’amplification d’acides nucléiques in vitro comprend au moins deux groupes de sondes de fluorescence combinant un quencher et un fluorophore, lesdites sondes de fluorescence étant agencées pour chacune cibler une séquence d’acide nucléique distincte et lesdits fluorophores présentant des plages de longueurs d’onde de fluorescence se chevauchant au sein de chaque groupe de sondes de fluorescence - the in vitro nucleic acid amplification reagent comprises at least two groups of fluorescence probes combining a quencher and a fluorophore, said fluorescence probes being arranged to each target a distinct nucleic acid sequence and said fluorophores exhibiting plaques of overlapping fluorescence wavelengths within each group of fluorescence probes
- l’analyseur est agencé pour déterminer la valeur représentative de la concentration de chaque sonde de fluorescence dans un état modifié en résolvant un système matriciel basé sur les mesures de fluorescence, les signatures temporelles et la constance de la concentration respective de chaque sonde de fluorescence, - the analyzer is arranged to determine the representative value of the concentration of each fluorescence probe in a modified state by solving a matrix system based on the fluorescence measurements, the time signatures and the constancy of the respective concentration of each fluorescence probe ,
- l’analyseur est agencé pour résoudre un système matriciel par groupe de sondes de fluorescence, - l’analyseur est agencé pour utiliser un algorithme de minimisation, et - the analyzer is arranged to solve a matrix system by group of fluorescence probes, - the analyzer is arranged to use a minimization algorithm, and
- l’analyseur est agencé pour déterminer la valeur représentative de la concentration de chaque sonde de fluorescence dans un état modifié en appliquant une descente du gradient ou en utilisant un réseau de neurones. - the analyzer is arranged to determine the representative value of the concentration of each fluorescence probe in a modified state by applying a descent of the gradient or by using a neural network.
L’invention concerne également un procédé de détection multiplexée de séquences d’acides nucléiques comprenant les opérations suivantes : a) réaliser une pluralité de cycles thermiques sur un mélange réactionnel comprenant un échantillon à analyser et un réactif d’amplification d’acides nucléiques in vitro contenant au moins deux sondes de fluorescence combinant un quencher et un fluorophore, lesdites sondes de fluorescence étant agencées pour chacune cibler une séquence d’acide nucléique distincte et lesdits fluorophores émettant dans des plages de longueurs d’onde de fluorescence se chevauchant, b) lors de chaque cycle thermique, réaliser au moins deux mesures de fluorescence dans lesdites plages de longueurs d’onde de fluorescence, le rayonnement émis par chaque sonde variant selon que celle-ci est dans un état non modifié dans lequel le quencher atténue ou n’atténue pas sensiblement l’émission de fluorescence, ou dans un état modifié dans lequel le quencher a un effet opposé sur l’émission de fluorescence, c) déterminer une valeur représentative de la concentration de chaque sonde de fluorescence dans un état modifié à partir des mesures de l’opération b) et de signatures temporelles tirées de la fluorescence mesurée en fonction du temps pour un cycle thermique donné d’un mélange réactionnel comprenant une ou plusieurs sondes, lesquelles peuvent être chacune sensiblement entièrement dans un état non modifié ou modifié, lesquelles valeurs représentatives d’une concentration dans un état modifié permettent de qualifier la présence d’une ou plusieurs séquences d’acide nucléique chacune associée à une sonde de fluorescence distincte de manière à provoquer un changement d’état de la sonde de fluorescence de l’état non modifié vers l’état modifié lorsqu’elles interagissent. The invention also relates to a method for the multiplexed detection of nucleic acid sequences comprising the following operations: a) carrying out a plurality of thermal cycles on a reaction mixture comprising a sample to be analyzed and an in vitro nucleic acid amplification reagent containing at least two fluorescence probes combining a quencher and a fluorophore, said fluorescence probes being arranged to each target a distinct nucleic acid sequence and said fluorophores emitting in overlapping fluorescence wavelength ranges, b) upon of each thermal cycle, performing at least two fluorescence measurements in said ranges of fluorescence wavelengths, the radiation emitted by each probe varying according to whether the latter is in an unmodified state in which the quencher attenuates or does not attenuate not noticeably emitting fluorescence, or in an altered state in which the quencher has an opposite effect on the fluorescence emission, c) determining a value representative of the concentration of each fluorescence probe in a modified state from the measurements of step b) and time signatures drawn from the fluorescence measured as a function of time for a given thermal cycle of a reaction mixture comprising one or more probes, which can each be substantially entirely in an unmodified or modified state, which values representative of a concentration in a modified state make it possible to qualify the presence of one or more acid sequences nucleic each associated with a separate fluorescence probe so as to cause a change of state of the fluorescence probe from the unmodified state to the modified state when they interact.
Selon divers modes de réalisation, le procédé peut présenter une ou plusieurs des caractéristiques suivantes : - l’opération b) comprend la réalisation de cycles PCR, et les au moins deux sondes de fluorescence sont choisies parmi le groupe comprenant les sondes TaqMan, les balises moléculaires, les sondes duales à transfert de fluorescence, les sondes Scorpion, les sondes Amplifluor, les sondes MGB Eclipse, les sondes LUX, les sondes QUASR et les sondes QZyme, According to various embodiments, the method may have one or more of the following characteristics: - operation b) comprises performing PCR cycles, and the at least two fluorescence probes are chosen from the group comprising TaqMan probes, molecular beacons, dual fluorescence transfer probes, Scorpion probes, Amplifluor probes , MGB Eclipse probes, LUX probes, QUASR probes and QZyme probes,
- l’opération b) comprend l’utilisation d’un réactif d’amplification d’acides nucléiques in vitro comprenant trois sondes de fluorescence combinant un quencher et un fluorophore, lesdites sondes de fluorescence étant agencées pour chacune cibler une séquence d’acide nucléique distincte et lesdits fluorophores présentant des plages de longueurs d’onde de fluorescence se chevauchant, - step b) comprises the use of an in vitro nucleic acid amplification reagent comprising three fluorescence probes combining a quencher and a fluorophore, said fluorescence probes being arranged to each target a nucleic acid sequence distinct and said fluorophores exhibiting overlapping fluorescence wavelength ranges,
- l’opération b) comprend l’utilisation d’un réactif d’amplification d’acides nucléiques in vitro comprenant au moins deux groupes de sondes de fluorescence combinant un quencher et un fluorophore, lesdites sondes de fluorescence étant agencées pour chacune cibler une séquence d’acide nucléique distincte et lesdits fluorophores présentant des plages de longueurs d’onde de fluorescence se chevauchant au sein de chaque groupe de sondes de fluorescence, - operation b) comprises the use of an in vitro nucleic acid amplification reagent comprising at least two groups of fluorescence probes combining a quencher and a fluorophore, said fluorescence probes being arranged to each target a sequence nucleic acid and said fluorophores exhibiting overlapping fluorescence wavelength ranges within each group of fluorescence probes,
- l’opération c) comprend la résolution d’un système matriciel basé sur les mesures de fluorescence, les signatures temporelles et la constance de la concentration respective de chaque sonde de fluorescence, - operation c) includes the resolution of a matrix system based on the fluorescence measurements, the time signatures and the constancy of the respective concentration of each fluorescence probe,
- l’opération c) comprend la résolution d’un système matriciel par groupe de sondes de fluorescence, et - operation c) includes the resolution of a matrix system by group of fluorescence probes, and
- l’opération c) comprend l’application d’une descente de gradient ou l’utilisation d’un réseau de neurones. - operation c) includes the application of a gradient descent or the use of a neural network.
D’autres caractéristiques et avantages de l’invention apparaîtront mieux à la lecture de la description qui suit, tirée d’exemples donnés à titre illustratif et non limitatif, tirés des dessins sur lesquels : Other characteristics and advantages of the invention will appear better on reading the following description, taken from examples given by way of illustration and not limitation, taken from the drawings in which:
- [Fig.l] représente un diagramme générique d’un dispositif selon l’invention, - [Fig.l] represents a generic diagram of a device according to the invention,
- [Fig.2] montre l’intensité de fluorescence obtenue en fonction du temps au cours de deux réactions de PCR à l’aide d’une sonde TaqMan marquée respectivement avec le fluorophore ATTO 565 et le fluorophore Cy3, - [Fig.3] représente la signature temporelle d’un ensemble de sondes, avec, pour chacune d’elles, le profil du cycle de température utilisé, les composantes respectives de cette signature lorsque la sonde n’a pas interagi, et a interagi, avec la séquence cible dont elle est spécifique, - [Fig.2] shows the fluorescence intensity obtained as a function of time during two PCR reactions using a TaqMan probe labeled respectively with the ATTO 565 fluorophore and the Cy3 fluorophore, - [Fig.3] represents the time signature of a set of probes, with, for each of them, the profile of the temperature cycle used, the respective components of this signature when the probe has not interacted, and interacted with the target sequence of which it is specific,
- [Fig.4] illustre la mise en œuvre du procédé avec le dispositif dans le mode particulier d’une réaction PCR réalisée avec deux sondes TaqMan émettant dans la même bande de fluorescence, comprenant la décomposition en une somme optimale des signatures temporelles comme décrit plus haut, - [Fig.4] illustrates the implementation of the method with the device in the particular mode of a PCR reaction carried out with two TaqMan probes emitting in the same fluorescence band, comprising the decomposition into an optimal sum of the time signatures as described upper,
- [Fig.5] illustre la mise en œuvre du procédé avec le dispositif dans le mode particulier d’une réaction PCR réalisée avec deux sondes TaqMan émettant dans une même bande de fluorescence, comprenant la décomposition en une somme optimale des signatures temporelles comme décrit plus haut, lors d’une amplification multiplexe de deux séquences d’intérêt, - [Fig.5] illustrates the implementation of the method with the device in the particular mode of a PCR reaction carried out with two TaqMan probes emitting in the same fluorescence band, comprising the decomposition into an optimal sum of the time signatures as described above, during a multiplex amplification of two sequences of interest,
- [Fig.6] illustre la mise en œuvre du procédé avec le dispositif pour éliminer les signaux de contamination optique d’un canal à un canal adjacent, ainsi que dans le mode particulier d’une réaction PCR réalisée avec des sondes de type balises moléculaires et QUASR. - [Fig.6] illustrates the implementation of the method with the device for eliminating optical contamination signals from one channel to an adjacent channel, as well as in the particular mode of a PCR reaction carried out with beacon-type probes molecules and QUASR.
Les dessins et la description ci-après contiennent, pour l'essentiel, des éléments de caractère certain. Ils pourront donc non seulement servir à mieux faire comprendre la présente invention, mais aussi contribuer à sa définition, le cas échéant. The drawings and the description below contain, for the most part, certain elements. They may therefore not only be used to better understand the present invention, but also contribute to its definition, if necessary.
L’invention propose un dispositif capable de réaliser une détection multiplexée de séquences d’acides nucléiques, c’est-à-dire en utilisant des sondes comprenant un ou plusieurs fluorophores permettant l’identification de séquences génétiques par modification du signal émis lors de l’interaction desdites sondes avec lesdites séquences (par exemple sondes TaqMan, Molecular Beacon, FRET, etc.), lesdits fluorophores émettant dans des plages de longueurs d’onde de fluorescence pouvant éventuellement se chevaucher. The invention proposes a device capable of carrying out multiplexed detection of nucleic acid sequences, that is to say using probes comprising one or more fluorophores allowing the identification of genetic sequences by modification of the signal emitted during detection. interaction of said probes with said sequences (for example TaqMan, Molecular Beacon, FRET probes, etc.), said fluorophores emitting in ranges of fluorescence wavelengths possibly overlapping.
L’interaction de la sonde avec la séquence cible dont elle est spécifique peut prendre plusieurs formes selon le procédé de détection utilisé. Il existe en effet plusieurs procédés connus, tels que, sans que cette liste soit limitative, la détection par PCR en temps réel utilisant des sondes de type TaqMan, des balises moléculaires (molecular beacon), des sondes MGB Eclipse, des sondes duales utilisant un transfert de fluorescence (FRET), ou la détection par PCR en temps réel utilisant des amorces fluorescentes servant également de sondes de type Scorpion, Amplifluor, LUX , QUASR ou QZyme. The interaction of the probe with the target sequence of which it is specific can take several forms depending on the detection method used. In fact, there are several methods known, such as, without this list being exhaustive, detection by real-time PCR using TaqMan type probes, molecular beacons, MGB Eclipse probes, dual probes using fluorescence transfer (FRET) , or detection by real-time PCR using fluorescent primers also serving as probes of the Scorpion, Amplifluor, LUX , QUASR or QZyme type.
La nature chimique de la sonde peut également variée selon les procédés. Elle peut être rendue en acide désoxyribonucléique (ADN), en acide ribonucléique (ARN), ou en analogues d’acide nucléique de synthèse tels que les acides peptidonucléique (Peptide Nucleic Acids, PNA), les acides nucléiques « cadenassés » (Locked Nucleic Acids, LNA). La sonde peut inclure des groupements chimiques modifiant son interaction avec la séquence génétique dont elle est spécifique, tels qu’un groupement se fixant dans le petit sillon de la double hélice (Minor Groove Binder, MGB). The chemical nature of the probe can also vary according to the processes. It can be made into deoxyribonucleic acid (DNA), ribonucleic acid (RNA), or synthetic nucleic acid analogues such as peptidonucleic acids (Peptide Nucleic Acids, PNAs), "locked" nucleic acids (Locked Nucleic Acids , LNA). The probe may include chemical groups modifying its interaction with the genetic sequence for which it is specific, such as a group binding in the minor groove of the double helix (Minor Groove Binder, MGB).
Selon le procédé mis en œuvre, la sonde peut consister en une molécule oligonucléotidique unique comprenant un ou plusieurs fluorophores et un ou plusieurs groupements chimiques ayant pour effet de moduler l’intensité de leur fluorescence selon l’état de la sonde, appelés « quenchers » dans la suite du texte. La sonde peut également consister en deux ou plus molécules, les unes comprenant un ou plusieurs fluorophores, les autres comprenant un ou plusieurs groupements chimiques ayant pour effet de moduler l’intensité de leur fluorescence en fonction des interactions possibles définissent l’état de la sonde. C’est par exemple le cas avec une sonde QUASR comprenant deux oligonucléotides, ou avec une sonde duale à transfert de fluorescence de type FRET constituée de deux oligonucléotides, l’un portant à son extrémité 3’ un fluorophore capable de se désexciter en transférant son énergie à un quencher porté en 5’ d’un deuxième oligonucléotide, ce quencher pouvant lui-même se désexciter en émettant un rayonnement lumineux dans une bande de longueur d’onde différente de celle du fluorophore. Depending on the method implemented, the probe may consist of a single oligonucleotide molecule comprising one or more fluorophores and one or more chemical groups having the effect of modulating the intensity of their fluorescence according to the state of the probe, called "quenchers". in the following text. The probe can also consist of two or more molecules, some comprising one or more fluorophores, the others comprising one or more chemical groups having the effect of modulating the intensity of their fluorescence according to the possible interactions define the state of the probe . This is for example the case with a QUASR probe comprising two oligonucleotides, or with a dual fluorescence transfer probe of the FRET type consisting of two oligonucleotides, one carrying at its 3' end a fluorophore capable of de-exciting by transferring its energy to a quencher carried 5' to a second oligonucleotide, this quencher itself being able to de-energize by emitting light radiation in a wavelength band different from that of the fluorophore.
Selon le procédé de détection mis en œuvre, l’interaction de la sonde peut consister en une simple hybridation avec la séquence génétique dont elle est spécifique, ou une hybridation suivie d’une hydrolyse médiée par une activité enzymatique, ou une hybridation suivie d’une incorporation dans un brin d’ADN existant médiée par l’action d’une ligase, ou dans un brin d’ADN synthétisé médiée par l’action d’une polymérase. Depending on the detection method implemented, the interaction of the probe may consist of a simple hybridization with the genetic sequence for which it is specific, or a hybridization followed by a hydrolysis mediated by an enzymatic activity, or a hybridization followed by incorporation into an existing DNA strand mediated by the action of a ligase, or into a synthesized DNA strand mediated by the action of a polymerase.
Dans la suite du texte, on utilisera de manière générique le terme « interagir » pour décrire l’action d’une sonde qui interagit avec la séquence génétique dont elle est spécifique selon l’un des procédés décrits ci-dessus, et le terme « modifiée par l’interaction » le processus selon lequel les caractéristiques de fluorescence d’une sonde sont modifiées par son interaction avec la séquence génétique dont elle est spécifique selon un des procédés décrits ci-dessus. In the remainder of the text, the term “interact” will be used generically to describe the action of a probe which interacts with the genetic sequence of which it is specific according to one of the processes described above, and the term “ interaction modified” means the process by which the fluorescence characteristics of a probe are modified by its interaction with the genetic sequence of which it is specific according to one of the methods described above.
La détection multiplexée selon l’invention est rendue possible grâce à la détermination de signatures temporelles de fluorescence pour chaque type de sonde fluorescente utilisée, à l’acquisition de deux signaux de fluorescence ou plus au cours d’au moins deux cycles thermiques appliqués pendant la réaction d’amplification, et à la mise en œuvre d’un algorithme permettant de séparer les signaux émis par ces sondes en utilisant ces signatures. The multiplexed detection according to the invention is made possible thanks to the determination of fluorescence time signatures for each type of fluorescent probe used, to the acquisition of two or more fluorescence signals during at least two thermal cycles applied during the amplification reaction, and the implementation of an algorithm making it possible to separate the signals emitted by these probes by using these signatures.
Ainsi, dans un mode de réalisation particulier de l’invention, le dispositif applique à ces sondes un ou plusieurs cycles thermiques en les excitant optiquement et en enregistrant en continu ou de manière échantillonnée les signaux de fluorescence émis dans une ou plusieurs bandes de longueurs d’onde, ce qui permet de réaliser la mesure multiplex. Lorsque la méthode d’amplification comprend une suite de cycles thermiques comme dans le cas de la PCR, les signaux de fluorescence sont enregistrés au cours d’au moins deux de ces cycles, et de manière préférentielle, au cours de chaque cycle. Lorsque la méthode d’amplification est isotherme, au moins deux cycles thermiques sont appliqués à l’échantillon, l’un au début, l’autre à la fin de la réaction, pendant lesquels les signaux de fluorescence émis sont enregistrés. Thus, in a particular embodiment of the invention, the device applies to these probes one or more thermal cycles by exciting them optically and by recording continuously or in a sampled manner the fluorescence signals emitted in one or more bands of lengths d wave, which makes it possible to carry out the multiplex measurement. When the amplification method includes a series of thermal cycles as in the case of PCR, the fluorescence signals are recorded during at least two of these cycles, and preferably during each cycle. When the amplification method is isothermal, at least two thermal cycles are applied to the sample, one at the start and the other at the end of the reaction, during which the emitted fluorescence signals are recorded.
Plus précisément, et comme représenté sur la figure 1, le dispositif 2 selon l’invention comprend un thermocycleur 4 capable d’appliquer deux cycles de température ou plus à un mélange réactionnel de l’amplification contenant au moins deux sondes fluorescentes, un capteur de lumière 6 ayant la capacité de réaliser au moins deux mesures d’intensité de fluorescence par cycle dans au moins une bande de longueur d’onde, et un analyseur 8 agencé pour réaliser la mesure de la concentration relative des différents états dans lesquels se trouvent les différentes sondes au cours de la réaction, et pour en déduire la présence d’une ou de plusieurs séquences nucléotidiques d’intérêt ciblées par lesdites sondes. Dans l’exemple décrit ici, le capteur de lumière 6 comprend à la fois la source d’excitation des sondes fluorescentes et le photodétecteur correspondant. En variante, le capteur de lumière 6 pourrait être séparé en source et détecteur. Dans l’exemple décrit ici, l’analyseur 8 est un programme ou code informatique approprié exécuté sur un ou plusieurs processeurs. Par processeurs, il doit être compris tout processeur adapté au calcul de projection de textures sur des plans et de traitements liés aux voxels. Un tel processeur peut être réalisé de toute manière connue, sous la forme d’un microprocesseur pour ordinateur personnel, d’une puce dédiée de type FPGA ou SoC (« System on chip » en anglais), d’une ressource de calcul sur une grille ou dans un cloud, d’un microcontrôleur, ou de toute autre forme propre à fournir la puissance de calcul nécessaire à la réalisation décrite plus bas. Un ou plusieurs de ces éléments peuvent également être réalisés sous la forme de circuits électroniques spécialisés tel un ASIC. Une combinaison de processeur et de circuits électroniques peut également être envisagée. More specifically, and as shown in Figure 1, the device 2 according to the invention comprises a thermocycler 4 capable of applying two or more temperature cycles to an amplification reaction mixture containing at least two fluorescent probes, a light 6 having the capacity to carry out at least two intensity measurements of fluorescence per cycle in at least one wavelength band, and an analyzer 8 arranged to measure the relative concentration of the different states in which the different probes are found during the reaction, and to deduce the presence therefrom of one or more nucleotide sequences of interest targeted by said probes. In the example described here, the light sensor 6 comprises both the source of excitation of the fluorescent probes and the corresponding photodetector. As a variant, the light sensor 6 could be separated into a source and a detector. In the example described here, the analyzer 8 is an appropriate computer program or code executed on one or more processors. By processors, it must be understood any processor adapted to the calculation of projection of textures on planes and of processing linked to voxels. Such a processor can be produced in any known manner, in the form of a microprocessor for a personal computer, a dedicated chip of the FPGA or SoC (System on chip) type, a calculation resource on a grid or in a cloud, a microcontroller, or any other form capable of providing the computing power necessary for the implementation described below. One or more of these elements can also be made in the form of specialized electronic circuits such as an ASIC. A combination of processor and electronic circuits can also be envisaged.
Le thermocycleur 4 est capable d’appliquer des températures variables situées dans une plage donnée à un échantillon mélangé avec un réactif d’amplification d’acides nucléiques in vitro, ce réactif contenant au moins deux sondes fluorescentes ayant des signatures temporelles distinctes. Le thermocycleur 4 peut appliquer de façon répétée un profil de température donné à ce mélange. L’analyseur 8 reçoit ou détermine les valeurs de température appliquées à l’échantillon. Dans l’exemple décrit ici, ces valeurs sont envoyées à l’analyseur 8. Selon divers modes de réalisation, elles peuvent être mesurées dans ou au contact de l’échantillon, ou extrapolées en fonction du temps. Dans un mode de réalisation préféré de l’invention, le thermocycleur 4 est un thermocycleur rapide (c’est-à-dire avec un changement de température de l’ordre de plus de 5°C par seconde, et de manière plus préférée de plus de 15°C par seconde). Cela est rendu possible grâce à l’analyseur 8 selon l’invention. Conventionnellement, les thermocycleurs rapides ne sont pas utilisés pour essayer de réaliser des mesures multiplex car les informations qu’ils fournissent ne sont pas suffisamment précises. Le capteur de lumière 6 est agencé pour soumettre le mélange réactionnel à une excitation lumineuse dans une ou plusieurs bandes de longueur d’onde dans l’ultraviolet et/ou dans le visible et/ou dans l’infrarouge, et de mesurer l’intensité de l’émission de fluorescence résultant de cette excitation, dans une ou plusieurs bandes de longueurs d’onde dans l’ultraviolet et/ou dans le visible et/ou dans l’infrarouge, en réalisant une ou plusieurs mesures ponctuelles pendant une durée déterminée, ou une série de mesures ponctuelles à une fréquence donnée (par exemple, pendant 100ms toutes les 200ms). Ces mesures de fluorescence en fonction du temps dans la ou les bandes de longueurs d’onde accessibles sont envoyées à l’analyseur 8. Dans un mode de réalisation préféré, la périodicité d’acquisition est comprise entre 10ms et 10s, et de manière encore plus préférée entre 100ms et ls. Ainsi, contrairement à tout l’état de l’art connu, l’analyseur 8 peut suivre de manière quasi-continue l’évolution de réponse en fluorescence au long des cycles thermiques. The thermal cycler 4 is capable of applying variable temperatures situated in a given range to a sample mixed with an in vitro nucleic acid amplification reagent, this reagent containing at least two fluorescent probes having distinct temporal signatures. The thermal cycler 4 can repeatedly apply a given temperature profile to this mixture. The analyzer 8 receives or determines the temperature values applied to the sample. In the example described here, these values are sent to the analyzer 8. According to various embodiments, they can be measured in or in contact with the sample, or extrapolated as a function of time. In a preferred embodiment of the invention, the thermocycler 4 is a fast thermocycler (that is to say with a temperature change of the order of more than 5° C. per second, and more preferably of more than 15°C per second). This is made possible thanks to the analyzer 8 according to the invention. Conventionally, fast thermal cyclers are not used to try to perform multiplex measurements because the information they provide is not sufficiently precise. The light sensor 6 is arranged to subject the reaction mixture to light excitation in one or more wavelength bands in the ultraviolet and/or in the visible and/or in the infrared, and to measure the intensity of the fluorescence emission resulting from this excitation, in one or more bands of wavelengths in the ultraviolet and/or in the visible and/or in the infrared, by performing one or more spot measurements for a determined period , or a series of punctual measurements at a given frequency (for example, for 100ms every 200ms). These fluorescence measurements as a function of time in the accessible wavelength band or bands are sent to the analyzer 8. In a preferred embodiment, the acquisition periodicity is between 10 ms and 10 s, and even more most preferred between 100ms and ls. Thus, contrary to all the known state of the art, the analyzer 8 can almost continuously follow the evolution of the fluorescence response throughout the thermal cycles.
Dans un mode particulier et préféré du procédé selon l’invention, on utilise la réaction de PCR pour détecter et discriminer la présence ou l’absence d’une cible génétique en combinaison, le réactif de PCR contenant un jeu de sondes combinant un quencher et un fluorophore (telles que des sondes TaqMan par exemple), lesquelles sondes fluorescentes utilisent des fluorophores distincts qui peuvent émettre dans une bande ou plage commune de longueurs d’onde. In a particular and preferred mode of the method according to the invention, the PCR reaction is used to detect and discriminate the presence or the absence of a genetic target in combination, the PCR reagent containing a set of probes combining a quencher and a fluorophore (such as TaqMan probes for example), which fluorescent probes use distinct fluorophores which can emit in a common band or range of wavelengths.
Grâce à la connaissance préalable de la signature temporelle de chacune des sondes, l’analyseur 8 est capable de mesurer de manière non-ambiguë, pour chaque sonde présente dans le réactif, la modification de signal de fluorescence résultant de l’interaction entre la sonde et les produits d’amplification (ou amplicons) issus de la séquence génétique dont elle est spécifique, indépendamment les unes des autres, et d’atteindre ainsi un niveau de multiplexage de 2n, voire 3n ou 4n, avec un dispositif selon l’invention capable de mesurer le signal de fluorescence dans n bandes de longueurs d’onde simultanément. Thanks to the prior knowledge of the time signature of each of the probes, the analyzer 8 is capable of measuring in an unambiguous manner, for each probe present in the reagent, the modification of the fluorescence signal resulting from the interaction between the probe and the amplification products (or amplicons) derived from the genetic sequence for which it is specific, independently of each other, and thus to achieve a level of multiplexing of 2n, or even 3n or 4n, with a device according to the invention capable of measuring fluorescence signal in n wavelength bands simultaneously.
Ce procédé permet de reconnaître qu'une séquence d’intérêt est présente dans un échantillon, non pas par la simple observation d’une augmentation de la fluorescence à basse température (60°C par exemple) avec le temps comme cela est fait classiquement au cours d’une analyse par amplification d’acides nucléiques in vitro en temps réel, mais par l’observation du changement du profil de fluorescence mesuré par le capteur de lumière 6 lors d'un cycle thermique. La figure 2 montre deux courbes de fluorescence enregistrées avec le dispositif 2, dans un même canal de fluorescence, mais au cours de réactions de PCR, dans lesquelles les sondes utilisées sont fonctionnalisées avec deux fluorophores différents (ATTO 565 et Cy3). Ces courbes montrent que les profils de fluorescence en fonction du temps au cours d’un cycle varient, en fonction de la nature de la sonde, et selon que le cycle se situe au début ou à la fin de l’amplification. This method makes it possible to recognize that a sequence of interest is present in a sample, not by the simple observation of an increase in fluorescence at low temperature (60°C for example) with time as is conventionally done during an analysis by amplification of nucleic acids in vitro in real time, but by observing the change in the fluorescence profile measured by the sensor of light 6 during a thermal cycle. FIG. 2 shows two fluorescence curves recorded with device 2, in the same fluorescence channel, but during PCR reactions, in which the probes used are functionalized with two different fluorophores (ATTO 565 and Cy3). These curves show that the fluorescence profiles as a function of time during a cycle vary, depending on the nature of the probe, and depending on whether the cycle is at the start or at the end of the amplification.
Dans un mode particulier du procédé selon l’invention, le cycle thermique est un cycle de PCR et comprend l’augmentation de la température d’une température basse à une température haute, la température basse étant comprise entre 55 et 70°C, de préférence entre 58 et 65°C et la température haute étant comprise entre 80 à 100°C, de préférence entre 90 et 98 °C, suivi de la décroissance de la température de la température haute à la température basse. In a particular mode of the method according to the invention, the thermal cycle is a PCR cycle and comprises increasing the temperature from a low temperature to a high temperature, the low temperature being between 55 and 70° C., from preferably between 58 and 65° C. and the high temperature being between 80 and 100° C., preferably between 90 and 98° C., followed by the decrease in temperature from the high temperature to the low temperature.
Dans la présente description, les cycles thermiques sont décrits de manière générique comme comprenant l’augmentation de la température de 60 à 95°C, suivi de la décroissance de la température à 60°C. Ces valeurs sont particulièrement adaptées à la mise en œuvre d’une réaction PCR rapide. Il va de soi que les valeurs de ces plages (60°C, 95°C et 60°C) pourraient être modifiées pour s’adapter à des cycles thermiques particuliers utilisés lors d’une amplification par PCR avec par exemple l’utilisation de 3 températures au lieu de 2, ou même de cycles thermiques ajoutés au cours d’une amplification isotherme selon un profil de température compatible avec la stabilité thermique des réactifs utilisés. In this specification, thermal cycles are generically described as including increasing temperature from 60 to 95°C, followed by decreasing temperature to 60°C. These values are particularly suitable for the implementation of a rapid PCR reaction. It goes without saying that the values of these ranges (60°C, 95°C and 60°C) could be modified to adapt to particular thermal cycles used during PCR amplification with, for example, the use of 3 temperatures instead of 2, or even thermal cycles added during isothermal amplification according to a temperature profile compatible with the thermal stability of the reagents used.
Dans un mode particulier du procédé selon l’invention, la modification de signal résulte de l’hydrolyse de la ou des sondes dans le cas de sondes TaqMan clivées par une polymérase possédant une activité exonucléase. De plus, le dispositif 2 peut être utilisé pour déterminer la signature temporelle de chacune des sondes présentes dans le mélange réactionnel. In a particular mode of the method according to the invention, the signal modification results from the hydrolysis of the probe or probes in the case of TaqMan probes cleaved by a polymerase possessing an exonuclease activity. Furthermore, the device 2 can be used to determine the time signature of each of the probes present in the reaction mixture.
Principe général de l’invention General principle of the invention
Le principe général mis en œuvre par l’invention repose sur la détection de la modification du signal de la fluorescence émise par une sonde selon qu’elle a interagi ou non avec la séquence nucléotidique d’intérêt dont elle est spécifique. Les travaux de la Demanderesse ont permis d’identifier 1) que ce signal de fluorescence dépend d’une manière générale de la température au travers de plusieurs phénomènes physiques plus ou moins bien connus qui se produisent de façon concomitante, dont les principaux vont être cités ci-après ; 2) que la variation du signal de la fluorescence de cette sonde avec la température peut être mesurée en appliquant un cycle de température à l’échantillon contenant la ou les sondes : 3) que la courbe de fluorescence obtenue varie elle-même selon que la sonde a interagi ou non avec la séquence nucléotidique dont elle est spécifique ; 3) que cette variation de la variation du signal au cours d’un cycle est propre à la sonde et constitue une signature qui peut être exploitée pour détecter, au moment de l’application d’un cycle thermique, la fraction de cette sonde qui se trouve avoir interagi avec la séquence cible dont elle est spécifique ; 4) que la détermination de cette fraction à au moins deux instants choisis de la réaction d’amplification peut permettre d’en déduire la présence ou l’absence, ou la concentration initiale à travers la détermination d’un cycle seuil, dans le mélange réactionnel d’amplification, de la séquence nucléotidique d’intérêt dont la sonde est spécifique. The general principle implemented by the invention is based on the detection of the modification of the fluorescence signal emitted by a probe depending on whether or not it has interacted with the nucleotide sequence of interest of which it is specific. The Applicant's work has made it possible to identify 1) that this fluorescence signal generally depends on the temperature through several more or less well-known physical phenomena which occur concomitantly, the main ones of which will be cited below; 2) that the variation of the fluorescence signal of this probe with temperature can be measured by applying a temperature cycle to the sample containing the probe(s): 3) that the fluorescence curve obtained itself varies depending on whether the probe has interacted or not with the nucleotide sequence for which it is specific; 3) that this variation of the variation of the signal during a cycle is specific to the probe and constitutes a signature which can be exploited to detect, at the time of the application of a thermal cycle, the fraction of this probe which happens to have interacted with the target sequence of which it is specific; 4) that the determination of this fraction at at least two chosen instants of the amplification reaction can make it possible to deduce its presence or absence, or the initial concentration through the determination of a threshold cycle, in the mixture amplification reaction, of the nucleotide sequence of interest for which the probe is specific.
Rappelant que dans la plupart des cas, le niveau de fluorescence d’une sonde interagissant avec une séquence nucléotidique spécifique varie grâce à la modification de la distance entre un fluorophore et un quencher (cas des sondes TaqMan, Molecular Beacon, FRET, MGB Eclipse, et des amorces faisant fonction de sondes Scorpion, Amplifluor, LUX, QUASR, etc), cette variation de fluorescence peut dépendre de la température de plusieurs manières. Tout d’abord, la variation du rendement quantique de la fluorescence du fluorophore utilisé, qui diminue au fur et à mesure que la température augmente. Par exemple, le rendement de la rhodamine B décroît de façon monotone avec la température en passant de 0,8 à 10°C à 0,3 à 60°C (voir l’article de Kubin et al. « Fluorescence quantum yields of some rhodamine dyes », Journal of Luminescence 1983, doi.org/10.1016/0022- 2313(82)90045-X). Dans ce cas précis, cette décroissance est due pour l’essentiel à l’augmentation du quenching dynamique avec la température (voir la note technique de Amaoutakis 2016, « Quenching of fluoresence with température », Technical note from EDINBURGH INSTRUMENTS publié à l’adresse https://www.edinst.com/wp- content/uploads/2018/10/TN_27 -Quenching-of-Fluorescence-with-Temperature.pdf) . Cette variation du rendement quantique avec la température varie elle-même avec la nature du fluorophore. Ainsi, la variation du rendement quantique de fluorescence avec la température de deux fluorophores émettant dans une même plage de longueurs d’onde peut différer d’un fluorophore à l’autre, Recalling that in most cases, the level of fluorescence of a probe interacting with a specific nucleotide sequence varies by modifying the distance between a fluorophore and a quencher (case of TaqMan, Molecular Beacon, FRET, MGB Eclipse, and primers serving as Scorpion, Amplifluor, LUX, QUASR, etc. probes), this variation in fluorescence can be temperature dependent in several ways. First of all, the variation of the quantum efficiency of the fluorescence of the fluorophore used, which decreases as the temperature increases. For example, the yield of rhodamine B decreases monotonically with temperature, going from 0.8 at 10°C to 0.3 at 60°C (see the article by Kubin et al. “Fluorescence quantum yields of some rhodamine dyes”, Journal of Luminescence 1983, doi.org/10.1016/0022-2313(82)90045-X). In this specific case, this decrease is mainly due to the increase in dynamic quenching with temperature (see the technical note by Amaoutakis 2016, "Quenching of fluoresence with temperature", Technical note from EDINBURGH INSTRUMENTS published at https://www.edinst.com/wp-content/uploads/2018/10/TN_27-Quenching-of-Fluorescence-with-Temperature.pdf). This variation in quantum yield with temperature itself varies with the nature of the fluorophore. Thus, the variation of the fluorescence quantum yield with the temperature of two fluorophores emitting in the same wavelength range can differ from one fluorophore to another,
Ensuite, le changement de la conformation de la sonde, qui vient modifier la distance entre le fluorophore et le quencher, ou l’emplacement du fluorophore ou du quencher (par exemple, le fluorophore d'une sonde peut être à proximité du quencher d'une autre sonde ou aux quenchers de plusieurs sondes) a une conséquence sur le signal de fluorescence émis par le fluorophore. Plus généralement, le mélange de la réaction d’amplification contenant les sondes fluorescentes et les autres réactifs est régulé par des interactions intramoléculaires et intermoléculaires entre les différentes espèces chimiques. Les oligonucléotides en solution peuvent adopter différentes conformations en fonction de la température et du stade de la réaction d’amplification (la présence en concentration croissante de séquences complémentaires aux sondes générées lors de la réaction d’amplification). En première approximation, pour une sonde intacte, différentes situations sont possibles à chaque instant de la réaction d’amplification :Then, the change in the conformation of the probe, which comes to modify the distance between the fluorophore and the quencher, or the location of the fluorophore or the quencher (for example, the fluorophore of a probe can be close to the quencher of another probe or to the quenchers of several probes) has an effect on the fluorescence signal emitted by the fluorophore. More generally, the mixture of the amplification reaction containing the fluorescent probes and the other reagents is regulated by intramolecular and intermolecular interactions between the different chemical species. The oligonucleotides in solution can adopt different conformations depending on the temperature and the stage of the amplification reaction (the presence in increasing concentration of sequences complementary to the probes generated during the amplification reaction). As a first approximation, for an intact probe, different situations are possible at each instant of the amplification reaction:
1) la sonde interagit avec une séquence complémentaire générée pendant la réaction d’amplification, 1) the probe interacts with a complementary sequence generated during the amplification reaction,
2) la sonde n’interagit avec aucune séquence complémentaire, ou2) the probe does not interact with any complementary sequence, or
3) la sonde est liée à des structures complexes, avec un ou plusieurs oligonucléotides en solution liés entre eux. La sonde peut donc adopter différents états, par exemple différentes conformations, selon qu’elle se trouve dans l’une ou l’autre de ces situations. 3) the probe is linked to complex structures, with one or more oligonucleotides in solution linked together. The probe can therefore adopt different states, for example different conformations, depending on whether it is in one or the other of these situations.
L’efficacité du quencher à quencher la fluorescence émise par le fluorophore est un troisième facteur influençant la variation de l’intensité de la fluorescence de la sonde avec la température. The efficiency of the quencher in quenching the fluorescence emitted by the fluorophore is a third factor influencing the variation of the fluorescence intensity of the probe with temperature.
Enfin, l’état de la sonde peut être également un facteur important : Dans le procédé TaqMan, lorsque la sonde s’est hybridée sur sa séquence cible et a été hydro lysée dans le mode de révélation par l’activité exonucléase 5’ vers 3’ de la polymérase, le fluorophore est clivé de façon irréversible de la sonde et sa fluorescence n’est plus impactée par la proximité du quencher. L’interaction de la sonde avec la séquence nucléotidique dont elle est spécifique se traduit ainsi par un changement d’état dans lequel le fluorophore de la sonde n’est plus lié moléculairement au quencher. Finally, the state of the probe can also be an important factor: In the TaqMan method, when the probe has hybridized to its target sequence and has been hydrolyzed in the mode of revelation by the 5' exonuclease activity towards 3 'of the polymerase, the fluorophore is cleaved irreversibly from the probe and its fluorescence is no longer impacted by the proximity of the quencher. The interaction of the probe with the nucleotide sequence of which it is specific thus results in a change of state in which the fluorophore of the probe is no longer molecularly bound to the quencher.
La Demanderesse a découvert expérimentalement que les lois de variations de chacun de ces phénomènes avec la température peuvent varier elles-mêmes de façon importante en fonction de la structure de la sonde et en particulier de la nature du fluorophore, de la séquence de la sonde et de la nature du quencher, ainsi que de la proximité avec une autre sonde. En fonction des paramètres, la combinaison de ces différentes lois peut produire une loi globale très variable d’une sonde à l’autre. En particulier, l’effet de la température sur le rendement quantique du fluorophore et celui de la température sur la conformation de la sonde ont des contributions de signes opposés et de constantes de temps différentes. The Applicant has discovered experimentally that the variation laws of each of these phenomena with temperature can themselves vary significantly depending on the structure of the probe and in particular the nature of the fluorophore, the sequence of the probe and the nature of the quencher, as well as the proximity to another probe. Depending on the parameters, the combination of these different laws can produce an overall law that varies greatly from one probe to another. In particular, the effect of temperature on the quantum yield of the fluorophore and that of temperature on the conformation of the probe have contributions of opposite signs and different time constants.
Les travaux de la Demanderesse lui ont permis d’identifier que, pour un profil de température donné, cette courbe constitue la première composante d’une signature temporelle. The Applicant's work has enabled it to identify that, for a given temperature profile, this curve constitutes the first component of a time signature.
Lorsqu’une séquence nucléotidique complémentaire à l’une des sondes est présente dans un échantillon à une certaine concentration et que l’une des molécules portant cette séquence interagit avec une molécule de cette sonde spécifique de cette séquence, la loi de variation de l’intensité de la fluorescence en fonction de la température de cette sonde peut être modifiée, que ce soit parce que la sonde adopte une autre conformation due à son état d’hybridation (comme c’est le cas pour les sondes Molecular Beacon), parce qu’un composant de la sonde est à proximité d’un autre composant de la sonde ayant un effet perturbateur (comme c’est le cas pour les sondes duales de type FRET ou les amorces Scorpion) ou encore qu’une polymérase possédant une activité exonucléase 5’ vers 3’ est présente dans l’échantillon, et que le fluorophore des sondes qui se sont hybridées avec leur séquence complémentaire est clivé par cette exonucléase (comme c’est le cas pour les sondes TaqMan), la loi de variation de la fluorescence en fonction de la température de cette sonde se trouve modifiée. When a nucleotide sequence complementary to one of the probes is present in a sample at a certain concentration and one of the molecules carrying this sequence interacts with a molecule of this specific probe of this sequence, the law of variation of the fluorescence intensity as a function of temperature of this probe can be modified, either because the probe adopts another conformation due to its state of hybridization (as is the case for Molecular Beacon probes), because a component of the probe is close to a other component of the probe having a disruptive effect (as is the case for dual probes of the FRET type or Scorpion primers) or that a polymerase possessing a 5' to 3' exonuclease activity is present in the sample, and that the fluorophore of the probes which have hybridized with their complementary sequence is cleaved by this exonuclease (as is the case for the TaqMan probes), the law of variation of the fluorescence as a function of the temperature of this probe is modified .
Les travaux de la Demanderesse lui ont permis d’identifier que, pour un profil de température donné, cette variation constitue une deuxième composante de la signature temporelle qui vient se substituer à la première composante de la signature. The Applicant's work has enabled it to identify that, for a given temperature profile, this variation constitutes a second component of the time signature which replaces the first component of the signature.
En analysant et comparant les signaux de fluorescence enregistrés pendant un cycle de température donné avant et après les interactions résultant de la présence du produit d’amplification, il devient donc possible de calculer, pour chaque sonde et à l’instant où est appliqué le cycle thermique, sa fraction qui a été modifiée par cette interaction, et d’en déduire ainsi la quantité du produit d’amplification issu de cette séquence spécifique présent dans l’échantillon grâce à ces deux composantes de signature temporelle. By analyzing and comparing the fluorescence signals recorded during a given temperature cycle before and after the interactions resulting from the presence of the amplification product, it therefore becomes possible to calculate, for each probe and at the instant when the cycle is applied temperature, its fraction which has been modified by this interaction, and thus to deduce therefrom the quantity of the amplification product resulting from this specific sequence present in the sample thanks to these two time signature components.
Au cours des premiers cycles ou des premiers instants d’une réaction d’amplification dans laquelle se trouve une certaine quantité d’une séquence d’intérêt, les molécules de la sonde dont elle est spécifique ne sont pas modifiées significativement par la présence d’un produit d’amplification issu de cette séquence d’intérêt (sauf dans le cas particulier d’une concentration initiale élevée de cette séquence d’intérêt), et le signal de fluorescence enregistré provient uniquement de la composante de la signature temporelle de la sonde non-modifiée par l’interaction avec la séquence dont elle est spécifique. Après un certain nombre de cycles, une fraction croissante de la sonde est modifiée à la suite de l’interaction avec le produit d’amplification issu de la séquence d’intérêt, et le signal enregistré est une combinaison linéaire des contributions des composantes de la signature temporelle respectives de la sonde non-modifiée et modifiée par l’interaction avec les produits d’amplification issus de la séquence d’intérêt. During the first cycles or the first instants of an amplification reaction in which there is a certain quantity of a sequence of interest, the molecules of the probe for which it is specific are not significantly modified by the presence of an amplification product from this sequence of interest (except in the particular case of a high initial concentration of this sequence of interest), and the recorded fluorescence signal comes only from the component of the time signature of the probe unmodified by interaction with the sequence for which it is specific. After a certain number of cycles, an increasing fraction of the probe is modified as a result of the interaction with the amplification product from the sequence of interest, and the recorded signal is a linear combination of the contributions of the components of the signature respective time of the unmodified probe and modified by the interaction with the amplification products from the sequence of interest.
Si on mélange plusieurs sondes fluorescentes émettant dans une même bande de fluorescence et qu’on enregistre en continu, avec une fréquence d’échantillonnage suffisante, l’intensité de fluorescence émise par ce mélange de sondes au cours d’un ou plusieurs cycles (avant et après modification de ces sondes par la présence de la ou des séquences ciblées amplifiées), on peut, grâce à leurs signatures temporelles respectives, séparer à chaque cycle les contributions au signal de chacune des sondes en déterminant pour chaque sonde la fraction qui se trouve sous forme non-modifiée et la fraction qui se trouve sous forme modifiée par l’interaction avec la séquence nucléotidique dont elle est spécifique. If several fluorescent probes emitting in the same fluorescence band are mixed and continuous recording is made, with a sufficient sampling frequency, of the fluorescence intensity emitted by this mixture of probes during one or more cycles (before and after modification of these probes by the presence of the amplified targeted sequence(s), it is possible, thanks to their respective time signatures, to separate at each cycle the contributions to the signal of each of the probes by determining for each probe the fraction which is in unmodified form and the fraction which is in modified form by interaction with the nucleotide sequence for which it is specific.
Lorsque des sondes émettent majoritairement dans des bandes de fluorescence non pas communes mais adjacentes comme c’est le cas avec de nombreux fluorophores organiques, le procédé permet notamment d’éliminer les contaminations optiques d’une bande à l’autre (“crosstalks” en anglais) ou toute autre variation de fluorescence ne provenant pas de la modification de la sonde par l’interaction avec la séquence dont elle est spécifique. Dans l’état de l’art, l’élimination de ces contaminations optiques est réalisée classiquement par l’application d’une correction linéaire à l’aide d’une matrice carrée dont les termes non-diagonaux dépendent de l’identité des fluorophores utilisés dans un kit multiplex. Par exemple, avec un thermocycleur disposant de 4 canaux de détection de la fluorescence, l’utilisateur renseigne l’identité des fluorophores utilisés dans son kit. Cette indication permet de sélectionner une matrice de correction des contaminations optiques adaptée à cette combinaison de fluorophores. When probes emit mainly in fluorescence bands that are not common but adjacent, as is the case with many organic fluorophores, the process makes it possible in particular to eliminate optical contamination from one band to another (“crosstalks” in English) or any other fluorescence variation not resulting from the modification of the probe by the interaction with the sequence for which it is specific. In the state of the art, the elimination of these optical contaminations is conventionally carried out by the application of a linear correction using a square matrix whose non-diagonal terms depend on the identity of the fluorophores used in a multiplex kit. For example, with a thermal cycler with 4 fluorescence detection channels, the user enters the identity of the fluorophores used in his kit. This indication makes it possible to select an optical contamination correction matrix adapted to this combination of fluorophores.
Dans le procédé selon l’invention, une telle correction avec une matrice n’est plus possible puisque plusieurs fluorophores émettant de façon prépondérante dans un canal A peuvent contaminer, à des taux distincts, le signal dans un canal adjacent B. Ainsi, le taux de contamination engendré par l’ensemble de ces fluorophores dans le canal B dépendra de l’amplification ou non de chacune des séquences d’intérêt détectée dans le canal A. Dans le procédé selon l’invention, on détermine ou on connaît, pour une sonde émettant de façon prépondérante dans un canal A, les signatures temporelles de cette sonde dans le ou les canaux adjacents. Et on utilise ces signatures pour déterminer précisément leur contribution au signal dans ce ou ces canaux adjacents. On peut ainsi retrancher cette contribution au signal pour éliminer de façon efficace les contaminations optiques. In the method according to the invention, such a correction with a matrix is no longer possible since several fluorophores emitting predominantly in a channel A can contaminate, at different rates, the signal in an adjacent channel B. Thus, the rate of contamination generated by all of these fluorophores in channel B will depend on the amplification or not of each of the sequences of interest detected in channel A. In the method according to the invention, one determines or one knows, for a probe emitting predominantly in channel A, the time signatures of this probe in the adjacent channel(s). And these signatures are used to precisely determine their contribution to the signal in this or these adjacent channels. It is thus possible to subtract this contribution to the signal in order to effectively eliminate the optical contaminations.
La caractérisation des sondes fluorescentes par la détermination de leurs signatures temporelles respectives, dans leur forme non-modifiée et leur forme modifiée permet donc de calculer, à l’instant où un cycle thermique est appliqué au mélange réactionnel, la fraction d’une sonde modifiée après interaction avec la séquence dont elle est spécifique. Si on applique ce cycle thermique de façon répétée au cours d’une réaction d’amplification d’acides nucléiques in vitro, et qu’on en déduit par calcul la fraction de la sonde qui se trouve sous la forme modifiée à chaque cycle, cette fraction étant indicative de la quantité des produits d’amplification issus de la séquence nucléotidique dont la sonde est spécifique, on peut établir la courbe de la variation de cette fraction en fonction du temps, ou du nombre de cycles dans le cas d’une réaction de type PCR, et en déduire un cycle seuil (Ct, « threshold cycle » en anglais) qui permet ensuite d’en déduire la quantité de la séquence d’intérêt dont la sonde est spécifique (par exemple en reportant la valeur de ce cycle seuil sur une courbe d’étalonnage). The characterization of the fluorescent probes by the determination of their respective time signatures, in their unmodified form and their modified form therefore makes it possible to calculate, at the instant when a thermal cycle is applied to the reaction mixture, the fraction of a modified probe after interaction with the sequence for which it is specific. If this thermal cycle is applied repeatedly during an in vitro nucleic acid amplification reaction, and if we deduce by calculation the fraction of the probe which is in the modified form at each cycle, this fraction being indicative of the quantity of amplification products resulting from the nucleotide sequence for which the probe is specific, it is possible to establish the curve of the variation of this fraction as a function of time, or of the number of cycles in the case of a reaction of the PCR type, and deduce therefrom a threshold cycle (Ct, "threshold cycle" in English) which then makes it possible to deduce therefrom the quantity of the sequence of interest for which the probe is specific (for example by reporting the value of this cycle threshold on a calibration curve).
Dans le mode particulier où la réaction d’amplification est la réaction de PCR et l’une au moins des sondes est une sonde TaqMan, la première composante de la signature temporelle de cette sonde est constituée de la variation de l’intensité de sa fluorescence au cours du cycle thermique en absence d’hybridation de cette sonde avec sa séquence complémentaire. La seconde composante de sa signature est la variation de l’intensité de sa fluorescence au cours du cycle thermique après son hydrolyse, c’est-à-dire après clivage du fluorophore (ou du quencher) du reste de la sonde. In the particular mode where the amplification reaction is the PCR reaction and at least one of the probes is a TaqMan probe, the first component of the time signature of this probe consists of the variation in the intensity of its fluorescence during the thermal cycle in the absence of hybridization of this probe with its complementary sequence. The second component of its signature is the variation in the intensity of its fluorescence during the thermal cycle after its hydrolysis, i.e. after cleavage of the fluorophore (or quencher) from the rest of the probe.
Dans le mode particulier où la réaction d’amplification est la PCR et l’une au moins des sondes utilisées est une balise moléculaire (Molecular Beacon), la première composante de la signature temporelle de cette sonde est constituée de la variation de l’intensité de sa fluorescence au cours du cycle thermique en absence d’hybridation de cette sonde avec sa séquence complémentaire. La seconde composante de sa signature est la variation de l’intensité de sa fluorescence au cours du cycle thermique en présence de sa séquence complémentaire. Avantageusement, les sondes Molecular Beacon ont l’avantage de fournir un meilleur contraste de fluorescence entre leurs différents états de repliement. In the particular mode where the amplification reaction is PCR and at least one of the probes used is a molecular beacon, the first component of the time signature of this probe consists of the variation of the intensity of its fluorescence during the thermal cycle in the absence of hybridization of this probe with its complementary sequence. The second component of its signature is the variation in the intensity of its fluorescence during the thermal cycle in the presence of its complementary sequence. Advantageously, Molecular Beacon probes have the advantage of providing better fluorescence contrast between their different folding states.
Dans le mode particulier où la réaction d’amplification est la PCR et l’une au moins des sondes est de type FRET, la première composante de la signature temporelle de cette sonde est constituée de la variation de l’intensité de la fluorescence de l’oligonucléotide portant le fluorophore accepteur au cours du cycle thermique en absence d’hybridation de cet oligonucléotide avec sa séquence complémentaire. La seconde composante de sa signature est la variation de l’intensité de la fluorescence au cours du cycle thermique en présence de sa séquence complémentaire, dont le signal FRET lorsque les deux oligonucléotides de la sonde sont hybridés de façon adjacente sur leur séquence cible commune. Avantageusement, les sondes FRET pouvant être plus souples pour caractériser des mutations ou pour limiter le nombre de séquences d’oligonucléotides dans le réactif d’amplification par PCR par l’utilisation de plusieurs sondes FRET sur un même amplicon, leur utilisation permet de limiter le nombre d’oligonucléotide en présence, donc leur interaction, donc de faciliter l’augmentation du multiplexage. In the particular mode where the amplification reaction is PCR and at least one of the probes is of the FRET type, the first component of the time signature of this probe consists of the variation in the intensity of the fluorescence of the oligonucleotide carrying the acceptor fluorophore during the thermal cycle in the absence of hybridization of this oligonucleotide with its complementary sequence. The second component of its signature is the variation in fluorescence intensity during the thermal cycle in the presence of its complementary sequence, including the FRET signal when the two oligonucleotides of the probe are hybridized adjacently to their common target sequence. Advantageously, since the FRET probes can be more flexible for characterizing mutations or for limiting the number of oligonucleotide sequences in the PCR amplification reagent by using several FRET probes on the same amplicon, their use makes it possible to limit the number of oligonucleotides present, therefore their interaction, thus facilitating the increase in multiplexing.
Détermination de la signature temporelle d’une sonde donnée Determination of the time signature of a given probe
Pour chaque séquence d’intérêt, on conçoit une sonde oligonucléotidique fluorescente comprenant une séquence oligonucléotidique complémentaire et caractéristique d’une portion de ladite séquence d’intérêt, et dont on connaît, ou à défaut dont on détermine, pour un canal de fluorescence donné, la signature temporelle (Snm(t), Sm(t)) comprenant deux composantes constituées de la courbe de l’intensité de fluorescence en fonction du temps pour un cycle thermique fixé, lorsque qu’aucune sonde n’est modifiée par l’interaction avec sa séquence d’intérêt, et lorsque la totalité des molécules de la sonde sont modifiées par l’interaction avec sa séquence d’intérêt respectivement. Cette sonde peut être de type Taqman, Molecular Beacon, sonde duale à transfert de fluorescence, Scorpion, Amplifluor, MGB Eclipse, LUX, QUASR ou QZyme sans que cette liste soit limitative. For each sequence of interest, a fluorescent oligonucleotide probe is designed comprising an oligonucleotide sequence complementary to and characteristic of a portion of said sequence of interest, and which is known, or failing that, which is determined, for a given fluorescence channel, the time signature (Snm(t), Sm(t)) comprising two components consisting of the curve of the fluorescence intensity as a function of time for a fixed thermal cycle, when no probe is modified by the interaction with its sequence of interest, and when all of the molecules of the probe are modified by the interaction with its sequence of interest respectively. This probe can be of the Taqman, Molecular Beacon, dual fluorescence transfer probe, Scorpion, Amplifluor, MGB Eclipse, LUX, QUASR or QZyme type without this list being limiting.
Comme on l’a vu plus haut, pour un canal de fluorescence donné, la signature temporelle comprend une composante pour la forme non modifiée de la sonde, ci-après Snm(t), et une composante pour la forme modifiée de la sonde à la suite de l’interaction avec sa séquence d’intérêt, ci-après Sm(t). As seen above, for a given fluorescence channel, the time signature includes a component for the unmodified form of the probe, hereinafter Snm(t), and a component for the modified form of the probe at following the interaction with its sequence of interest, hereinafter Sm(t).
Les composantes de la signature temporelle (Snm(t), Sm(t)) peuvent être déterminées respectivement en appliquant directement le cycle thermique à la sonde dans le tampon utilisé pour la réaction, respectivement sous sa forme non modifiée et sous sa forme modifiée par l’interaction avec sa séquence d’intérêt. En variante, la signature temporelle peut également être obtenue en déterminant le profil de fluorescence de la sonde sous ses deux formes en fonction de la température (SnmT(T), SmT(T)), et en appliquant la fonction obtenue à la fonction décrivant le profil de température PT(t) (mathématiquement, Snm est la composée des fonctions SnmT et PT, soit SnmToPT ; de même Sm est la composée des fonctions SmT et PT, soit SmToPT). De manière alternative, les composantes de la signature temporelle de la sonde sous sa forme non modifiée ou sous sa forme modifiée peuvent être déterminées indirectement par soustraction entre le profil de l’intensité de fluorescence d’une combinaison de la sonde et d’autres sondes ou sources fluorescentes et le profil de l’intensité de fluorescence de cette même combinaison en l’absence de la sonde dont la signature est à déterminer. Avantageusement, une combinaison de signatures temporelles peut être utilisée plutôt que la signature temporelle d’une sonde seule pour déterminer la présence d’une sonde directement ou indirectement. Par exemple, on peut utiliser la signature de la combinaison de plusieurs sondes et la signature de la combinaison de ces mêmes sondes en l’absence de l’une des sondes pour déterminer l’absence de cete même sonde, ou encore la signature de la combinaison de plusieurs sondes et la signature de la combinaison de ces mêmes sondes en l’absence de l’une des sondes et en présence du produit de la disparition de la sonde absente pour déterminer la transformation de cette même sonde (par exemple l’absence de la signature d’une sonde TaqMan et la présence de la signature de la sonde hydrolysée). L’utilisation de combinaison de signatures évite d’avoir à caractériser chaque sonde individuellement et permet de s’affranchir d’éventuelles effets d’interaction entre les sondes dans le signal de fluorescence. De manière générale, le signal de toute combinaison de sondes peut être utilisé selon l’invention comme marqueur direct ou indirect (par combinaison de plusieurs signaux) de l’état de la composition du réactif. The components of the time signature (Snm(t), Sm(t)) can be determined respectively by directly applying the thermal cycle to the probe in the buffer used for the reaction, respectively in its unmodified form and in its modified form by the interaction with its sequence of interest. As a variant, the time signature can also be obtained by determining the fluorescence profile of the probe in its two forms as a function of temperature (SnmT(T), SmT(T)), and by applying the function obtained to the function describing the temperature profile PT(t) (mathematically, Snm is the composite of the functions SnmT and PT, or SnmToPT; likewise Sm is the composite of the functions SmT and PT, or SmToPT). Alternatively, the components of the time signature of the probe in its unmodified form or in its modified form can be determined indirectly by subtraction between the fluorescence intensity profile of a combination of the probe and other probes or fluorescent sources and the fluorescence intensity profile of this same combination in the absence of the probe whose signature is to be determined. Advantageously, a combination of time signatures can be used rather than the time signature of a single probe to determine the presence of a probe directly or indirectly. For example, one can use the signature of the combination of several probes and the signature of the combination of these same probes in the absence of one of the probes to determine the absence of this same probe, or even the signature of the combination of several probes and the signature of the combination of these same probes in the absence of one of the probes and in the presence of the product of the disappearance of the absent probe to determine the transformation of this same probe (for example the absence of the signature of a TaqMan probe and the presence of the signature of the probe hydrolyzed). The use of combination of signatures avoids having to characterize each probe individually and makes it possible to overcome any effects of interaction between the probes in the fluorescence signal. In general, the signal of any combination of probes can be used according to the invention as a direct or indirect marker (by combining several signals) of the state of the composition of the reagent.
La figure 3 montre des exemples de signature temporelle pour des sondes de type TaqMan ou QUASR utilisant divers fluorophores et quenchers : la composante de la signature temporelle non modifiée et la composante de la signature temporelle modifiée à la suite de l’interaction avec la séquence dont elle est spécifique. Figure 3 shows examples of time signature for TaqMan or QUASR type probes using various fluorophores and quenchers: the component of the unmodified time signature and the component of the time signature modified as a result of the interaction with the sequence whose it is specific.
[Tableau 1] I î j j I | i i La figure 3 référence les « ID » du tableau 1 ci-dessus et représente pour chaque sonde la composante de la signature temporelle non modifiée (« Av. Int. ») et la composante de la signature temporelle modifiée (« Ap.Int ») à la suite de l’interaction avec la séquence dont elle est spécifique. [Table 1] I î jj I | ii Figure 3 references the “IDs” from Table 1 above and represents for each probe the component of the unmodified time signature (“Av. Int.”) and the component of the modified time signature (“Ap.Int”) as a result of interaction with the sequence for which it is specific.
Selon un mode préféré de réalisation, des sondes émettant dans la même plage de longueurs d’onde de fluorescence sont choisies de sorte que leurs signatures temporelles (dans leur état non modifié et dans leur état modifié) soient suffisamment distinctes pour pouvoir être discriminées. According to a preferred embodiment, probes emitting in the same range of fluorescence wavelengths are chosen so that their temporal signatures (in their unmodified state and in their modified state) are sufficiently distinct to be able to be discriminated.
Réaction et détermination de la concentration des sondes Reaction and determination of probe concentration
Une fois un jeu de sondes choisi, un mix réactionnel comprenant l’échantillon contenant les séquences d’intérêt en nombre et concentration inconnus est fait avec celles-ci. Outre les séquences d’intérêt, ce mix réactionnel comprend, pour chaque séquence d’intérêt recherchée, la sonde fluorescente choisie et dont la signature temporelle a été caractérisée directement ou indirectement comme indiqué ci-dessus, un jeu d’amorces compatible avec cette sonde et capable d’amplifier la séquence d’intérêt, des réactifs et enzymes nécessaires à la réalisation de la réaction d’amplification. Dans le cas d’une détection par PCR, il s’agit notamment des dNTPs et d’au moins une polymérase thermorésistante (dans la variante dans laquelle les sondes sont de type TaqMan, la polymérase possède une activité exonucléase 5’ vers 3’). Le mix réactionnel peut également comprendre une transcriptase inverse si au moins l’une des séquences d’intérêt est en ARN. Dans la variante dans laquelle le procédé d’amplification est la PCR et les sondes sont de type TaqMan ou Molecular Beacon, les amorces sont non fluorescentes et situées sur la séquence d’intérêt de part et d’autre de la sonde. Dans la sous-variante dans laquelle les sondes sont de type TaqMan, la polymérase possède en outre une activité exonucléase 5’ vers 3 ’ . Dans la variante dans laquelle le procédé d’amplification est la PCR et une sonde est de type Scorpion, Amplifluor, LUX ou QZyme, cette sonde joue également le rôle de l’une des deux amorces. Once a set of probes has been chosen, a reaction mix comprising the sample containing the sequences of interest in unknown number and concentration is made with them. In addition to the sequences of interest, this reaction mix comprises, for each sequence of interest sought, the fluorescent probe chosen and whose time signature has been characterized directly or indirectly as indicated above, a set of primers compatible with this probe and capable of amplifying the sequence of interest, reagents and enzymes necessary for carrying out the amplification reaction. In the case of detection by PCR, these are in particular dNTPs and at least one heat-resistant polymerase (in the variant in which the probes are of the TaqMan type, the polymerase has a 5' to 3' exonuclease activity) . The reaction mix can also comprise a reverse transcriptase if at least one of the sequences of interest is in RNA. In the variant in which the amplification method is PCR and the probes are of the TaqMan or Molecular Beacon type, the primers are non-fluorescent and located on the sequence of interest on either side of the probe. In the subvariant in which the probes are of the TaqMan type, the polymerase additionally possesses 5' to 3' exonuclease activity. In the variant in which the amplification method is PCR and a probe is of the Scorpion, Amplifluor, LUX or QZyme type, this probe also plays the role of one of the two primers.
Ensuite, le thermocycleur 4 soumet le mix réactionnel à un ou plusieurs cycles du profil de température, ce nombre pouvant varier de 1 à 40 typiquement, le cas échéant après avoir effectué un cycle permettant la transcription inverse de séquences d’intérêt en ARN et/ou un cycle permettant l’activation de la polymérase à haute température (démarrage “hotstart”). Au cours de ces cycles la ou les sondes fluorescentes sont excitées et le capteur de lumière 6 enregistre la fluorescence résultante en continu sur le ou les canaux de fluorescence correspondant aux plages de longueurs d’onde de fluorescence de chaque sonde. La fréquence d’échantillonnage du capteur de lumière 6 est choisie de telle sorte qu’au moins deux mesures de fluorescence soient réalisées par cycle, de préférence au moins une dans l’étape de dénaturation et au moins une dans l’étape d’hybridation (qui peut également être l’étape d’élongation dans le cas d’une réaction de PCR) de préférence à une fréquence plus élevée permettant de couvrir des températures intermédiaires ce qui permet un meilleur pouvoir de discrimination. Then, the thermocycler 4 subjects the reaction mix to one or more cycles of the temperature profile, this number being able to vary from 1 to 40 typically, if necessary after having carried out a cycle allowing the reverse transcription of sequences of interest into RNA and/or or a cycle allowing the activation of the polymerase at high temperature (“hotstart”). During these cycles the fluorescent probe(s) are excited and the light sensor 6 records the resulting fluorescence continuously on the fluorescence channel(s) corresponding to the fluorescence wavelength ranges of each probe. The sampling frequency of the light sensor 6 is chosen such that at least two fluorescence measurements are carried out per cycle, preferably at least one in the denaturation step and at least one in the hybridization step (which can also be the elongation step in the case of a PCR reaction) preferably at a higher frequency making it possible to cover intermediate temperatures, which allows a better power of discrimination.
L’analyseur 8 est alors appelé pour traiter les signaux de fluorescence mesurés dans chaque canal de fluorescence par le capteur de lumière 6, en les décomposant, pour chaque canal et à chaque cycle auquel les signaux ont été acquis, sous la forme d’une combinaison linéaire des composantes des signatures temporelles des sondes dans ce canal ou d’une de leur combinaison. Cela permet de déterminer, à chaque cycle ou avant et après l’apparition du signal d’amplification, la fraction de chaque sonde qui se trouve sous forme non modifiée, et celle qui se trouve sous forme modifiée. Cette détermination peut être réalisée de manière qualitative par interprétation visuelle des signatures temporelle ou de manière quantitative par un calcul numérique avec un algorithme adapté. The analyzer 8 is then called upon to process the fluorescence signals measured in each fluorescence channel by the light sensor 6, by breaking them down, for each channel and at each cycle at which the signals were acquired, in the form of a linear combination of the components of the time signatures of the probes in this channel or of a combination thereof. This makes it possible to determine, at each cycle or before and after the appearance of the amplification signal, the fraction of each probe which is in the unmodified form, and that which is in the modified form. This determination can be carried out qualitatively by visual interpretation of the temporal signatures or quantitatively by a numerical calculation with a suitable algorithm.
Plusieurs algorithmes peuvent être utilisés pour extraire la signature temporelle pourvu qu’ils permettent la décomposition des signatures mesurées en une somme de signatures caractéristiques de la présence d’une sonde sous sa forme modifiée ou non modifiée ou de toutes combinaisons de présence ou d’absence de plusieurs sondes sous leur forme modifiée ou non modifiée. L’algorithme utilisé peut par exemple être un algorithme cherchant pour chaque cycle, les poids de la combinaison linéaire des signatures caractéristiques s’approchant de manière optimale des signatures mesurées pour chaque cycle. Ces poids pouvant être représentatif directement ou indirectement de la modification d’une sonde à la suite de son interaction avec la séquence dont elle est spécifique, conséquence de l’amplification de cette séquence par la réaction d’amplification. Le paragraphe suivant détaille une implémentation de cet algorithme. Several algorithms can be used to extract the time signature provided that they allow the decomposition of the measured signatures into a sum of signatures characteristic of the presence of a probe in its modified or unmodified form or of any combination of presence or absence of several probes in their form modified or unmodified. The algorithm used can for example be an algorithm seeking for each cycle, the weights of the linear combination of the characteristic signatures approaching in an optimal manner the signatures measured for each cycle. These weights can be directly or indirectly representative of the modification of a probe following its interaction with the sequence for which it is specific, a consequence of the amplification of this sequence by the amplification reaction. The following paragraph details an implementation of this algorithm.
Au k-ième cycle thermique appliqué pendant la réaction d’amplification, et dans un canal de fluorescence donné, le signal de fluorescence Fk(t) mesuré par le capteur de lumière 6 peut être défini comme suit : At the k-th thermal cycle applied during the amplification reaction, and in a given fluorescence channel, the fluorescence signal F k (t) measured by the light sensor 6 can be defined as follows:
[Equation Où : [Equation Or :
- 1 est le temps au cours du cycle de température, - 1 is the time during the temperature cycle,
- n est le nombre total de sondes dans le mélange réactionnel, - n is the total number of probes in the reaction mixture,
- Ci est la quantité (ou concentration) de sondes d’indice i (cette quantité est connue),- Ci is the quantity (or concentration) of probes of index i (this quantity is known),
- <¾ est la quantité (ou concentration) de sonde d’indice i présente sous forme modifiée au début du k-ième cycle de la réaction d’amplification, - <¾ is the quantity (or concentration) of probe of index i present in modified form at the start of the k-th cycle of the amplification reaction,
- /£ m(t) représente la signature temporelle de la sonde d’indice i lorsqu’elle est modifiée, et - / £ m (t) represents the time signature of the probe of index i when it is modified, and
- représente la signature temporelle de la sonde d’indice i lorsqu’elle est non- modifiée. - represents the time signature of the probe of index i when it is unmodified.
En réalisant le changement de variable [Equation By performing the change of variable [Equation
On obtient l’équation [Equation We obtain the equation [Equation
Comme la quantité å =1 ci/i nm(t) est la somme des composantes des signatures des sondes non modifiées pour le cycle k, et est connue puisque c; est connu et indépendant du cycle k, l’équation 3 définit un système matriciel qui associe le signal de fluorescence mesuré aux concentrations de chaque sonde d’indice i pour le cycle k. As the quantity å =1 c i / i nm (t) is the sum of the components of the signatures of the unmodified probes for the cycle k, and is known since c; is known and independent of cycle k, equation 3 defines a matrix system which associates the fluorescence signal measured with the concentrations of each probe of index i for cycle k.
Ces coefficients sont ceux qui annulent l’équation matricielle These coefficients are those which cancel the matrix equation
[Equation [Equation
Où les ti correspondent aux instants d’échantillonnage par le capteur de lumière 6 pendant l’application du cycle thermique par le thermocycleur 4. On rappelle que le cycle thermique comprend l’étape de chauffage de la température inférieure à la température supérieure et l’étape de refroidissement de la température supérieure à la température inférieure. Where the ti correspond to the instants of sampling by the light sensor 6 during the application of the thermal cycle by the thermal cycler 4. It is recalled that the thermal cycle comprises the step of heating from the lower temperature to the upper temperature and the step of cooling from the upper temperature to the lower temperature.
Comme les mesures ne sont pas parfaites, les pourront être choisis pour minimiser la différence. De nombreux algorithmes permettent de réaliser cette optimisation, par exemple les moindres carrés. Since the measurements are not perfect, the can be chosen to minimize the difference. Many algorithms make it possible to carry out this optimization, for example the least squares.
Ainsi, il apparaît que, grâce aux signatures temporelles, il est possible de réaliser un multiplexage / démultiplexage de degré 2, 3, 4, 5 ou plus, dès lors que l’on est capable de bien définir les signatures temporelles de chacune des sondes. Ce multiplexage / démultiplexage est réalisé dans tous les canaux de fluorescence du capteur de lumière 6, ce qui permet d’identifier les contributions optiques d’une sonde dans le canal dans lequel elle émet de façon prépondérante, mais aussi dans les canaux adjacents le cas échéant. Thus, it appears that, thanks to the time signatures, it is possible to carry out a multiplexing / demultiplexing of degree 2, 3, 4, 5 or more, since one is able to clearly define the time signatures of each of the probes . This multiplexing / demultiplexing is carried out in all the fluorescence channels of the light sensor 6, which makes it possible to identify the optical contributions of a probe in the channel in which it emits in a predominant way, but also in the adjacent channels if necessary. applicable.
L’implémentation généralisée de l’algorithme présenté ci-dessus nécessite de caractériser individuellement les sondes, ce qui nécessite l’utilisation de mesures indirectes (la signature des sondes lorsqu’elles ne sont pas mélangées) pouvant introduire des artefacts dans la détermination du vecteur c. The generalized implementation of the algorithm presented above requires the individual characterization of the probes, which requires the use of indirect measurements (the signature of the probes when they are not mixed) which can introduce artifacts in the determination of the vector vs.
Avantageusement, on pourra réaliser un calcul similaire en utilisant des signatures plus directes (par exemple les signatures des sondes mélangées avec ou sans la modification d’une sonde) en réalisant un changement d’espace par une transformation linéaire U : Advantageously, a similar calculation can be carried out using more direct signatures (for example the signatures of the probes mixed with or without the modification of a probe) by carrying out a change of space by a linear transformation U:
[Equation 5] tel que [Equation 5] such that
U = u U=u
-Vk ( -rn)- y k(Pm)- y k (Pm) -Vk (jm) tel que U permette de résoudre ce même problème de détermination du vecteur c en utilisant des signatures temporelles mesurables plus directement. -Vk(-rn)-yk(Pm)-yk(Pm)-Vk(jm) such that U solves this same problem of determining the vector c using more directly measurable time signatures.
Avantageusement, seules certaines parties de la signature temporelle peuvent être utilisées, pour augmenter la précision de la décomposition. En effet, certains phénomènes comme la variation de la quantité de sonde modifiée au cours de la phase d’élongation du cycle de PCR qui résulte de l’activité de la polymérase ou encore la non-reproductibilité du profil de changement de température aux temps courts peuvent altérer la forme de la signature à certains temps et il peut être préférable de ne pas prendre en compte ces parties de la signature pour la détermination des quantités de sonde modifiée. Dans certains modes de mise en œuvre, l’importance de chaque temps de la signature temporelle peut être pondérée pour le calcul afin d’en optimiser l’impact sur le résultat du calcul. Advantageously, only certain parts of the time signature can be used, to increase the precision of the breakdown. Indeed, certain phenomena such as the variation in the quantity of modified probe during the elongation phase of the PCR cycle which results from the activity of the polymerase or even the non-reproducibility of the temperature change profile at short times may alter the shape of the signature at certain times and it may be preferable not to take these parts of the signature into account for the determination of the amounts of modified probe. In certain modes of implementation, the importance of each time of the time signature can be weighted for the calculation in order to optimize the impact on the result of the calculation.
En variante, l’analyseur 8 pourrait fonctionner de manière purement numérique et non matricielle, en utilisant par exemple un algorithme de descente de gradient pour optimiser l’erreur résiduelle de l’approximation de la signature mesurée par la combinaison linéaire de signatures caractéristiques, ou encore contenir des tables de type lookup table, ou encore utiliser un réseau de neurones entraîné pour retourner les concentrations de chaque sonde en fonction du signal de mesure en entrée. As a variant, the analyzer 8 could operate in a purely numerical and non-matrix manner, using for example a gradient descent algorithm to optimize the residual error of the approximation of the signature measured by the linear combination of characteristic signatures, or also contain tables of the lookup table type, or even use a trained neural network to return the concentrations of each probe according to the input measurement signal.
Avantageusement, l’algorithme peut utiliser un modèle plus complexe que la combinaison linéaire des signatures, prenant en compte par exemple l’influence de la variation de la quantité de sonde modifiée au sein d’un cycle ou l’évolution au cours des cycles de la quantité de sondes modifiées qui peut être contrainte par des hypothèses telles que la forme de la courbe d’amplification. L’algorithme peut alors prendre la forme d’un calcul d’optimisation sous contraintes par la minimisation d’une fonction d’énergie ou encore prendre la forme d’un réseau de neurones entraîné à apprendre des paramètres spécifiques d’une amplification sur la base de la suite des signatures. La figure 5 illustre la mise en œuvre dans le mode particulier d’une réaction PCR avec deux sondes TaqMan. Elle montre l’extraction des concentrations respectives de chaque sonde hydrolysée par décomposition en une somme optimale des signatures temporelles comme décrit plus haut. Les courbes du haut montrent le signal de fluorescence brut au cours de la PCR avec le même mix contenant 2 sondes TaqMan émettant dans la même bande, spécifiques respectivement de deux génomes bactériens qui sont utilisés purs (le premier à gauche et le second au centre), ou mélangés dans des quantités différentes (à droite). Les courbes du bas montrent les concentrations respectives des 2 sondes hydrolysées calculées à chaque cycle selon une extraction avec les mêmes paramètres lorsque seule la première sonde est hydrolysée lors de l’extraction (graphes de gauche), seule la seconde sonde est clivée (graphes du centre) et lorsque les 2 sondes sont clivées selon des cinétiques différentes au cours de la PCR (graphes de droite). Le graphe en bas à droite montre la capacité du dispositif de l’invention à extraire les signaux d’amplification de ces deux cibles distinctes (ici des séquences appartenant au génome de B. subtilis et E. coli) à des concentrations initiales différentes en utilisant des sondes partageant le même signal de fluorescence. Advantageously, the algorithm can use a more complex model than the linear combination of the signatures, taking into account for example the influence of the variation of the quantity of probe modified within a cycle or the evolution during the cycles of the amount of modified probes that may be constrained by assumptions such as the shape of the amplification curve. The algorithm can then take the form of an optimization calculation under constraints by minimizing an energy function or even take the form of a neural network trained to learn specific parameters of an amplification on the basis of the sequence of signatures. FIG. 5 illustrates the implementation in the particular mode of a PCR reaction with two TaqMan probes. It shows the extraction of the respective concentrations of each probe hydrolyzed by decomposition into an optimal sum of time signatures as described above. The upper curves show the raw fluorescence signal during the PCR with the same mix containing 2 TaqMan probes emitting in the same band, specific respectively for two bacterial genomes which are used pure (the first on the left and the second in the center) , or mixed in different amounts (right). The bottom curves show the respective concentrations of the 2 hydrolyzed probes calculated at each cycle according to an extraction with the same parameters when only the first probe is hydrolyzed during the extraction (left graphs), only the second probe is cleaved (graphs on the center) and when the 2 probes are cleaved according to different kinetics during the PCR (right graphs). The graph at the bottom right shows the ability of the device of the invention to extract the amplification signals from these two distinct targets (here sequences belonging to the genome of B. subtilis and E. coli) at different initial concentrations using probes sharing the same fluorescence signal.
Exemples de réalisation : Examples of realization:
Exemple 1 : Identification de la présence d’une séquence nucléotidique d’intérêt dans une analyse par PCR multiplex utilisant deux sondes TaqMan fonctionnalisées avec des fluorophores émettant tous deux majoritairement dans la bande supérieure à 650nm. Example 1: Identification of the presence of a nucleotide sequence of interest in a multiplex PCR analysis using two TaqMan probes functionalized with fluorophores both emitting mainly in the band above 650nm.
L'exemple ci-dessous montre comment le procédé et le dispositif de l’invention permettent d'identifier la présence d'une séquence cible d'intérêt parmi deux séquences cibles à l’aide d’une analyse par PCR multiplex utilisant deux sondes TaqMan fonctionnalisées avec des fluorophores émettant tous deux majoritairement dans la bande supérieure à 650nm. Ces sondes, chacune spécifique de l’une des séquences d’intérêt, émettent un signal de fluorescence mesuré dans le même canal du dispositif, mais possèdent une signature temporelle différente. L'utilisation de l’algorithme de démultiplexage combiné avec la connaissance de ces signatures permet d'identifier l'amplification d'une cible ou l'autre. The example below shows how the method and the device of the invention make it possible to identify the presence of a target sequence of interest among two target sequences using a multiplex PCR analysis using two TaqMan probes functionalized with fluorophores both emitting mainly in the band above 650 nm. These probes, each specific for one of the sequences of interest, emit a fluorescence signal measured in the same channel of the device, but have a different time signature. The use of the demultiplexing algorithm combined with the knowledge of these signatures makes it possible to identify the amplification of one target or the other.
Les amorces sont spécifiques pour amplifier deux séquences du gène [D-alaline— D- alanine ligase]. Pour E. faecium les séquences de l’amorce sense et antisense sont GCTTT AGC A AC AGCCT ATC AG et TCGTCCGAACRTCTTCATTT, pour E. faecalis les séquences de l’amorce sense et antisense sont GTTCTAGTGTCGGAATTAGCA et GCTTCRATCCCTTGTTCAAC. Deux sondes fluorescentes de type TaqMan sont fonctionnalisées à l'extrémité 5' avec le fluorophore ATT0647N pour E. faecalis (séquence TGCTCGGGCATCATAACGGAAAGC, voir ligne d’identifiant ID 7 du tableau 1) et CY5 pour E. faecium (séquence GAAGCGCGCGAAATCGAAGTTGCT, voir ligne d’identifiant ID 6 du tableau 1). Les deux sondes sont fonctionnalisées à l'extrémité 3' avec le quencher BHQ2. Nous identifions les deux sondes comme "Sonde a" et "Sonde b" respectivement. The primers are specific to amplify two sequences of the [D-alaline-D-alanine ligase] gene. For E. faecium the sense and antisense primer sequences are GCTTT AGC A AC AGCCT ATC AG and TCGTCCGAACRTCTTCATTT, for E. faecalis the sense and antisense primer sequences are GTTCTAGTGTCGGAATTAGCA and GCTTCRATCCCTTGTTCAAC. Two fluorescent probes of the TaqMan type are functionalized at the 5' end with the fluorophore ATT0647N for E. faecalis (sequence TGCTCGGGCATCATAACGGAAAGC, see line with identifier ID 7 of table 1) and CY5 for E. faecium (sequence GAAGCGCGCGAAATCGAAGTTGCT, see line d identifier ID 6 from table 1). Both probes are functionalized at the 3' end with the BHQ2 quencher. We identify the two probes as "Probe a" and "Probe b" respectively.
Dans une première étape, on réalise deux réactions de PCR avec chaque paire d’amorce combiné avec la sonde et l’ADN de la séquence de la bactérie correspondants, afin de caractériser la signature de chacune des deux sondes séparément : In a first step, two PCR reactions are carried out with each pair of primers combined with the probe and the DNA of the corresponding bacterial sequence, in order to characterize the signature of each of the two probes separately:
- dans une première PCR, on amplifie 105 génomes de E. faecalis (ADN extrait et quantifié) et seule la sonde spécifique de E. faecalis est ajoutée au mélange PCR à la concentration de 0,1 mM. Les deux paires d'amorces sont ajoutées au mélange PCR à la concentration de 0,5mM pour chaque amorce. Le signal mesuré dans le canal 4 de Chronos DX est référencé comme “Signal 1”. - in a first PCR, 10 5 genomes of E. faecalis are amplified (DNA extracted and quantified) and only the probe specific for E. faecalis is added to the PCR mixture at a concentration of 0.1 mM. The two pairs of primers are added to the PCR mixture at the concentration of 0.5 mM for each primer. The signal measured in channel 4 of Chronos DX is referred to as “Signal 1”.
- dans une deuxième PCR, on amplifie 106 génomes de E. faecium (ADN extrait et quantifié) et seule la sonde de E. faecium est ajoutée au mélange PCR à la concentration de 0,2mM. Les deux paires d'amorces sont ajoutées au mélange PCR à la concentration de 0,5mM pour chaque amorce. Le signal mesuré dans le canal 4 de Chronos DX est référencé comme “Signal 2”. - in a second PCR, 10 6 genomes of E. faecium are amplified (DNA extracted and quantified) and only the E. faecium probe is added to the PCR mixture at a concentration of 0.2 mM. The two pairs of primers are added to the PCR mixture at the concentration of 0.5 mM for each primer. The signal measured in channel 4 of Chronos DX is referred to as “Signal 2”.
Dans ces deux réactions de PCR, le mélange réactionnel se compose d'un tampon (Tris- HCL, KC1 25mM, (NPLOiSCE 16mM, MgCb 4,5mM) et l’amplification est réalisée en utilisant 3U de Taq DNA Polymerase et 0,2 mM de dNTPs. Le protocole de PCR utilisé se compose de : dénaturation / activation de la polymérase réalisée pendant une minute à 95°C et 45 cycles PCR (composés de deux phases : dénaturation pendant 3 secondes à 95°C et hybridation/extension pendant 15 secondes à 60°C). Les mesures de l’intensité de fluorescence sont effectuées toutes les 100ms. La figure 4 montre le signal mesuré sur le canal 4 pendant les deux expériences (figure 4 a : signal “1” pour la sonde “a” et figure 4 b : signal “2” pour la sonde “b”). In these two PCR reactions, the reaction mixture consists of a buffer (Tris-HCL, KC1 25mM, (NPLOiSCE 16mM, MgCl 4.5mM) and the amplification is carried out using 3U of Taq DNA Polymerase and 0.2 mM of dNTPs The PCR protocol used consists of: denaturation/activation of the polymerase carried out for one minute at 95°C and 45 PCR cycles (composed of two phases: denaturation for 3 seconds at 95°C and hybridization/extension for 15 seconds at 60° C. Fluorescence intensity measurements are performed every 100 ms. Figure 4 shows the signal measured on channel 4 during the two experiments (Figure 4 a: signal “1” for probe “a” and Figure 4 b: signal “2” for probe “b”).
Les deux composantes de la signature temporelle de chacune des sondes est extraite à partir de ces signaux (signatures montrées dans les lignes 6 et 7 de la figure 3). The two components of the time signature of each of the probes is extracted from these signals (signatures shown in lines 6 and 7 of Figure 3).
Après avoir défini les signatures de chacune de ces deux sondes, on réalise deux réactions d’amplification multiplex avec un mélange des réactifs en utilisant le procédé de l’invention. Les deux sondes sont ajoutées au mélange PCR respectivement à la concentration de O,ImM (sonde a, E. faecalis) et 0,2mM (sonde b, E. faecium). Les deux paires d'amorces sont ajoutées au mélange PCR à la concentration de 0,5mM pour chaque amorce : After having defined the signatures of each of these two probes, two multiplex amplification reactions are carried out with a mixture of reagents using the method of the invention. The two probes are added to the PCR mixture respectively at the concentration of 0.ImM (probe a, E. faecalis) and 0.2 mM (probe b, E. faecium). The two pairs of primers are added to the PCR mixture at the concentration of 0.5mM for each primer:
- dans une première PCR, on amplifie 103 génomes de E. faecalis (ADN extrait et quantifié). Le signal mesuré dans le canal 4 de Chronos DX est référencé comme “Signal 3”. - in a first PCR, 10 3 genomes of E. faecalis are amplified (DNA extracted and quantified). The signal measured in channel 4 of Chronos DX is referred to as “Signal 3”.
- dans une deuxième PCR, on amplifie 105 génomes de E. faecium (ADN extrait et quantifié). Le signal mesuré dans le canal 4 de Chronos DX est référencé comme “Signal 4”. Dans la figure 4, on montre le signal mesuré sur le canal 4 pendant ces deux réactions de PCR multiplex (figure 4 c : signal “3” et figure 4 d : signal “4”). - in a second PCR, 10 5 genomes of E. faecium are amplified (DNA extracted and quantified). The signal measured in channel 4 of Chronos DX is referred to as “Signal 4”. In figure 4, we show the signal measured on channel 4 during these two multiplex PCR reactions (figure 4 c: signal “3” and figure 4 d: signal “4”).
On démultiplexe ensuite les signaux “3” et “4” en utilisant l’algorithme de l’invention et les signatures temporelles de chaque sonde, en calculant, pour chaque cycle de chaque réaction de PCR multiplex, la valeur représentative de la concentration de chacune des sondes modifiées. Le résultat de ce démultiplexage est montré dans la figure 4 pour chacune des réactions d’amplification multiplex (figure 4 e : analyse signal 3, figure 4 b : analyse signal 4). L’observation des courbes des valeurs représentatives de la concentration de chaque sonde modifiée, en fonction du cycle de la réaction de PCR, permet d’identifier sans ambiguïté la nature de la séquence d’intérêt qui était effectivement présente dans chacune des deux réactions. Exemple 2 : Identification de la présence d’un mélange de deux séquences nucléotidiques d’intérêt dans une analyse par PCR multiplex utilisant deux sondes TaqMan fonctionnalisées avec des fluorophores émettant tous deux majoritairement dans la bande 575-615nm. The signals “3” and “4” are then demultiplexed using the algorithm of the invention and the time signatures of each probe, by calculating, for each cycle of each multiplex PCR reaction, the value representative of the concentration of each modified probes. The result of this demultiplexing is shown in FIG. 4 for each of the multiplex amplification reactions (FIG. 4 e: signal 3 analysis, FIG. 4 b: signal 4 analysis). Observation of the curves of the values representative of the concentration of each modified probe, as a function of the cycle of the PCR reaction, makes it possible to identify without ambiguity the nature of the sequence of interest which was actually present in each of the two reactions. Example 2: Identification of the presence of a mixture of two nucleotide sequences of interest in an analysis by multiplex PCR using two TaqMan probes functionalized with fluorophores both emitting mainly in the 575-615 nm band.
Dans cet exemple, on cherche à connaître les quantités respectives de deux séquences d’ADN génomique de deux bactéries B. subtilis et E. coli en utilisant des sondes de type TaqMan émettant majoritairement dans la même bande de fluorescence 575-615nm. La sonde spécifique de E. coli est marquée avec le fluorophore ATTO 565 et la sonde spécifique de B. subtilis est marquée avec Cy3. In this example, we seek to know the respective quantities of two genomic DNA sequences of two bacteria B. subtilis and E. coli using TaqMan type probes emitting mainly in the same fluorescence band 575-615nm. The E. coli-specific probe is labeled with the ATTO 565 fluorophore and the B. subtilis-specific probe is labeled with Cy3.
Après avoir déterminé les signatures temporelles de ces deux sondes comme dans l’exemple ci-dessus, on réalise une série de 3 amplifications par PCR à l’aide d’un mélange réactionnel comprenant les deux paires d’amorces et les deux sondes nécessaires pour amplifier les deux séquences nucléotidiques d’intérêt. After having determined the time signatures of these two probes as in the example above, a series of 3 PCR amplifications is carried out using a reaction mixture comprising the two pairs of primers and the two probes necessary for amplify the two nucleotide sequences of interest.
Dans la première réaction, on ajoute 104 génomes de B. subtilis ; dans la deuxième réaction, on ajoute 102 génomes de E. coli ; dans la troisième réaction, on ajoute 104 génomes de B. subtilis et 102 génomes de E. coli. On réalise les réactions à l’aide du dispositif 2. Les signaux de fluorescence enregistrés dans le canal 3 au cours de chaque cycle de chacune des réactions de PCR sont montrés dans la ligne supérieure de la figure 5. In the first reaction, 10 4 genomes of B. subtilis are added; in the second reaction, 10 2 E. coli genomes are added; in the third reaction, 10 4 genomes of B. subtilis and 10 2 genomes of E. coli are added. The reactions are carried out using device 2. The fluorescence signals recorded in channel 3 during each cycle of each of the PCR reactions are shown in the upper row of Figure 5.
On utilise ensuite l’algorithme 8 pour démultiplexer ces courbes et on obtient, pour chaque réaction d’amplification et pour chaque sonde, une courbe montrant la valeur représentative de la sonde modifiée en fonction du numéro du cycle. On observe qu’on peut retrouver à partir de ces courbes démultiplexées la nature de la ou des séquences nucléotidiques d’intérêt présentes dans les mélanges réactionnels. Pour chacune de ces 6 courbes, on peut mesurer un cycle seuil (« Threshold Cycle », Ct), qu’on peut reporter dans une courbe étalon qui relie le cycle Ct et le logarithme de la quantité initiale de molécules de chacune des séquences d’intérêt afin de quantifier la quantité de chacune des séquences nucléotidiques d’intérêt présente dans le mélange. Exemple 3 : Correction de la contamination optique engendrée par le signal de fluorescence produit au cours d’une PCR pendant l’hydrolyse d'une sonde TaqMan "a" pour la détection de la présence de séquences d’intérêt humaines et virales Algorithm 8 is then used to demultiplex these curves and, for each amplification reaction and for each probe, a curve is obtained showing the representative value of the modified probe as a function of the cycle number. It is observed that it is possible to find from these demultiplexed curves the nature of the nucleotide sequence(s) of interest present in the reaction mixtures. For each of these 6 curves, a threshold cycle (“Threshold Cycle”, Ct) can be measured, which can be plotted in a standard curve which connects the cycle Ct and the logarithm of the initial quantity of molecules of each of the sequences d of interest in order to quantify the quantity of each of the nucleotide sequences of interest present in the mixture. Example 3: Correction of the optical contamination generated by the fluorescence signal produced during a PCR during the hydrolysis of a TaqMan "a" probe for the detection of the presence of human and viral sequences of interest
L'expérience PCR est réalisée en utilisant des amorces et sondes spécifiques du génome viral du SARS-CoV-2 et d’un gène contrôle endogène présent dans les cellules épithéliales du nasopharynx chez l’Homme. Le kit contient des sondes pour la détection de 3 séquences cibles dans 3 canaux optiques du dispositif 2 : canaux 1 et 3 pour deux cibles du coronavirus SARS-CoV-2, canal 4 pour la cible contrôle endogène. Dans cette expérience, l'ADN humain contenu dans un échantillon est détecté par l’amplification PCR de la séquence d’intérêt contrôle avec une paire d'amorces. Le signal de fluorescence est généré par une sonde fonctionnalisée avec un fluorophore à l'extrémité 5' et un quencher à l'extrémité 3', ce fluorophore émet un signal de fluorescence dans une bande de longueurs d'onde détectable dans le canal optique numéro 4 du dispositif 2. Cette sonde est référencée comme la Sonde “a” et son signal comme le “Signal 1”, montré dans la figure 6 a. The PCR experiment is performed using primers and probes specific for the SARS-CoV-2 viral genome and an endogenous control gene present in human nasopharyngeal epithelial cells. The kit contains probes for the detection of 3 target sequences in 3 optical channels of device 2: channels 1 and 3 for two targets of the SARS-CoV-2 coronavirus, channel 4 for the endogenous control target. In this experiment, the human DNA contained in a sample is detected by PCR amplification of the control sequence of interest with a pair of primers. The fluorescence signal is generated by a functionalized probe with a fluorophore at the 5' end and a quencher at the 3' end, this fluorophore emits a fluorescence signal in a wavelength band detectable in the optical channel number 4 of Device 2. This probe is referenced as Probe “a” and its signal as “Signal 1”, shown in Figure 6a.
En raison de l’étalement du spectre d’émission de la sonde a, le signal généré par la sonde est également détecté dans le canal optique numéro 3 du dispositif 2. Ce signal est référencé comme le “Signal 2”. Cette contamination génère une augmentation apparente du signal généré par la sonde utilisée pour la détection d’une séquence cible du Sars-CoV- 2 présente dans le canal numéro 3, ce qui pourrait être interprété à tort comme la présence de cette séquence cible dans l’échantillon. Cette sonde est référencée comme la sonde “b”. Le signal 2 est représenté dans la figure 6 b. Due to the emission spread spectrum of probe a, the signal generated by the probe is also detected in optical channel number 3 of device 2. This signal is referred to as “Signal 2”. This contamination generates an apparent increase in the signal generated by the probe used for the detection of a target sequence of Sars-CoV-2 present in channel number 3, which could be wrongly interpreted as the presence of this target sequence in the 'sample. This probe is referred to as the “b” probe. Signal 2 is shown in Figure 6b.
Le protocole de PCR utilisé dans cette expérience se compose de : transcription inverse réalisée pendant 30 secondes à 50°C, dénaturation des acides nucléiques et activation de la polymérase réalisées pendant une minute à 95°C, suivie de 45 cycles PCR (composés de deux phases : dénaturation pendant 3 secondes à 95 °C et hybridation/extension pendant 15 secondes à 60°C). La période d’échantillonnage de la mesure de la fluorescence est de 100ms pendant toute la durée de la PCR. Pour éliminer le signal de contamination optique, on applique le procédé selon l’invention, comprenant les étapes suivantes : The PCR protocol used in this experiment consists of: reverse transcription performed for 30 seconds at 50°C, nucleic acid denaturation and polymerase activation performed for one minute at 95°C, followed by 45 PCR cycles (composed of two phases: denaturation for 3 seconds at 95°C and annealing/extension for 15 seconds at 60°C). The sampling period of the fluorescence measurement is 100ms throughout the duration of the PCR. To eliminate the optical contamination signal, the method according to the invention is applied, comprising the following steps:
- Détermination de la signature temporelle des 2 sondes présentes dans le kit détectées dans les canaux optiques 3 et 4 du dispositif 2. Ces signatures sont obtenues à partir d'une PCR avec détection de l,2pl du contrôle d'amplification positif fourni avec le kit. Ces signatures sont identifiées en tant que signaux 3 et 4. - Determination of the time signature of the 2 probes present in the kit detected in optical channels 3 and 4 of device 2. These signatures are obtained from a PCR with detection of 1.2 pl of the positive amplification control supplied with the kit. These signatures are identified as signals 3 and 4.
- Utilisation de l’algorithme de l’analyseur 8 selon l’invention pour démultiplexer les signaux présents dans le signal 2. Le résultat du démultiplexage est montré dans la figure 6 c. On observe que la courbe correspondant au signal de la sonde b est parfaitement plate, ce qui indique que la séquence d’intérêt du génome viral du SARS-CoV-2 est absente de l’échantillon. - Use of the algorithm of the analyzer 8 according to the invention to demultiplex the signals present in the signal 2. The result of the demultiplexing is shown in figure 6 c. It is observed that the curve corresponding to the signal of probe b is perfectly flat, which indicates that the sequence of interest of the viral genome of SARS-CoV-2 is absent from the sample.
Exemple 4 : Détection d’une séquence d’intérêt par l’exploitation de la signature temporelle d’une sonde fluorescente de type “balise moléculaire” utilisée dans une réaction d’amplification par PCR multiplex. Example 4: Detection of a sequence of interest by exploiting the time signature of a “molecular beacon” type fluorescent probe used in a multiplex PCR amplification reaction.
Dans cet exemple, le procédé et le dispositif de l’invention sont utilisés pour détecter la présence d’une séquence nucléotidique d’intérêt dans un échantillon grâce à une amplification par PCR utilisant des sondes de type “Balise Moléculaire” (MB, Molecular Beacon). Dans le procédé utilisant une ou des balises moléculaires, ces sondes ne sont pas clivées pendant la réaction contrairement aux sondes de type TaqMan. Dans ce but, la polymérase choisie est dépourvue d’activité exonuclease 5’ vers 3’, et est remplacée par une activité de déplacement de brin (SD pour « Strand Displacement » en anglais). In this example, the method and device of the invention are used to detect the presence of a nucleotide sequence of interest in a sample by means of PCR amplification using “Molecular Beacon” type probes (MB, Molecular Beacon ). In the method using one or more molecular beacons, these probes are not cleaved during the reaction, unlike probes of the TaqMan type. For this purpose, the chosen polymerase lacks 5' to 3' exonuclease activity, and is replaced by a strand displacement (SD) activity.
Dans cet exemple, une PCR est réalisée avec le protocole suivant : dénaturation initiale / activation de la polymérase pendant 30 secondes à 92°C et 40 cycles de PCR (composés de deux phases : dénaturation pendant 5 secondes à 92°C et hybridation/extension pendant 30 secondes à 62°C). In this example, a PCR is carried out with the following protocol: initial denaturation / activation of the polymerase for 30 seconds at 92°C and 40 cycles of PCR (composed of two phases: denaturation for 5 seconds at 92°C and hybridization / extension for 30 seconds at 62°C).
Le mélange réactionnel est composé d’un tampon (SD polymerase reaction buffer) en ajoutant du MgC12 à la concentration finale de 3mM et l’amplification est réalisée en utilisant 5U de SD Polymerase HotStart et 0,2mM de dNTPs. Des amorces à la concentration de 0,2mM (amorce sens, séquence CCGCCAATGGTACCGCAATCCCT) et 2mM (amorce antisens, séquence GCTACTGCCATTATATTTTACGGTC) sont utilisées pour amplifier une séquence cible du gène f mH d’E. coli (104 bactéries ajoutées directement dans la PCR après culture bactérienne en milieu LB et quantification). La sonde fluorescente de type balise moléculaire (séquence FAM- CGGGCACGCCAATGTTTATGTAAACCTTGGCCCG-BHQ 1 ) est à la concentration de 0,03mM. The reaction mixture is composed of a buffer (SD polymerase reaction buffer) by adding MgC12 to the final concentration of 3 mM and the amplification is carried out using 5U of SD Polymerase HotStart and 0.2 mM of dNTPs. From primers to concentration of 0.2 mM (sense primer, sequence CCGCCAATGGTACCGCAATCCCT) and 2 mM (reverse primer, sequence GCTACTGCCATTATATTTTACGGTC) are used to amplify a target sequence of the f mH gene of E. coli (10 4 bacteria added directly in the PCR after bacterial culture in LB medium and quantification). The molecular beacon type fluorescent probe (sequence FAM-CGGGCACGCCAATGTTTATGTAAACCTTGGCCCG-BHQ 1 ) is at a concentration of 0.03 mM.
Le signal mesuré dans le canal 1 du dispositif 2 au cours de la réaction de PCR de 45 cycles est présenté dans la figure 6 d. À partir de cette courbe, on extrait les deux composantes de la signature temporelle de cette sonde de type balise moléculaire. Ces composantes sont montrées sur la figure 3 en référence à l’ID 10. The signal measured in channel 1 of device 2 during the 45-cycle PCR reaction is shown in Figure 6d. From this curve, the two components of the time signature of this molecular beacon type probe are extracted. These components are shown in Figure 3 with reference to ID 10.
On utilise ensuite cette signature pour démultiplexer les signaux enregistrés au cours de réactions de PCR multiplex qui utilise cette sonde pour rechercher la présence de la séquence nucléotidique correspondante parmi d’autres séquences. This signature is then used to demultiplex the signals recorded during multiplex PCR reactions which use this probe to search for the presence of the corresponding nucleotide sequence among other sequences.
Exemple 5 : Détermination de la signature temporelle d’une sonde selon le procédé QUASR mis en œuvre dans une réaction de PCR. Example 5: Determination of the time signature of a probe according to the QUASR method implemented in a PCR reaction.
L’invention peut être utilisée pour analyser les courbes de fluorescence pendant l'amplification par PCR utilisant le système QUASR (Quenching of Unincorporated Amplification Signal Reporters. The invention can be used to analyze fluorescence curves during PCR amplification using the QUASR (Quenching of Unincorporated Amplification Signal Reporters) system.
Dans cet exemple, une PCR est réalisée avec le protocole suivant : dénaturation initiale / activation de la polymérase pendant une minute à 95 °C et 45 cycles de PCR (composés de deux phases : dénaturation pendant 3 secondes à 95 °C et hybridation/extension pendant 15 secondes à 60°C). La période d’échantillonnage de la mesure de la fluorescence est de 200 ms pendant toute la durée de la PCR. In this example, a PCR is carried out with the following protocol: initial denaturation / activation of the polymerase for one minute at 95°C and 45 cycles of PCR (composed of two phases: denaturation for 3 seconds at 95°C and hybridization / extension for 15 seconds at 60°C). The sampling period of the fluorescence measurement is 200 ms throughout the duration of the PCR.
Le mélange réactionnel est composé d’un tampon (Tris-HCL, KC1 25mM, (NPDiSCL 16mM, MgCb 4,5mM) et l’amplification est réalisée en utilisant 3U de SuperHotTaq DNA polymerase et 0,2mM de dNTPs. Des amorces “sens” et “antisens” de séquence respective FAM-ACGCCAATGTTTATGTAAACCTTGCGCC etThe reaction mixture is composed of a buffer (Tris-HCL, KCl 25mM, (NPDiSCL 16mM, MgCl 4.5mM) and the amplification is carried out using 3U of SuperHotTaq DNA polymerase and 0.2mM dNTPs. “Forward” and “antisense” primers of respective sequence FAM-ACGCCAATGTTTATGTAAACCTTGCGCC and
ACATTTCACAACACGAGCTGACGA à la concentration de 0,5mM sont utilisées pour amplifier 105 génomes d'E. coli (extraits et dilués après culture bactérienne en milieu LB). Un oligonucléotide complémentaire de l'amorce “sens” GGCGCAAGGTTTACATAAACATTGGCGT-BHQ1 est ajouté au mélange réactionnel à la concentration de 0,3mM. ACATTTCACAACACGAGCTGACGA at a concentration of 0.5 mM are used to amplify 10 5 genomes of E. coli (extracted and diluted after bacterial culture in LB medium). An oligonucleotide complementary to the “sense” primer GGCGCAAGGTTTACATAAACATTGGCGT-BHQ1 is added to the reaction mixture at a concentration of 0.3 mM.
La courbe de l’intensité de la fluorescence en fonction du temps est mesurée lors des 45 cycles PCR et illustrée dans la figure 6 e. Cette courbe permet d’extraire les deux composantes de la signature temporelle de la sonde de type QUASR utilisée. Cette signature est montrée à la figure 3 avec l’ID 9. The plot of fluorescence intensity versus time is measured over the 45 PCR cycles and shown in Figure 6e. This curve makes it possible to extract the two components of the time signature of the QUASR type probe used. This signature is shown in Figure 3 with ID 9.
On utilise ensuite cette signature pour démultiplexer les signaux enregistrés au cours de réactions de PCR multiplex qui utilise cette sonde pour rechercher la présence de la séquence nucléotidique correspondante parmi d’autres séquences. This signature is then used to demultiplex the signals recorded during multiplex PCR reactions which use this probe to search for the presence of the corresponding nucleotide sequence among other sequences.
Exemple 6 : Détection de 5 séquences nucléotidiques dans un kit syndromique des virus respiratoire Influenza A, B, virus respiratoires syncitiaux A et B, et SARS-CoV-2 à l’aide d’une PCR pentaplex. Example 6: Detection of 5 nucleotide sequences in a syndromic kit of respiratory viruses Influenza A, B, syncitial respiratory viruses A and B, and SARS-CoV-2 using a pentaplex PCR.
Le procédé et le dispositif décrits dans la présente invention permettent la recherche de la présence de 5 virus à l’aide d’une PCR pentaplex réalisée en mélangeant cinq paires d'amorces et cinq sondes pour la détection de 5 cibles en utilisant seulement deux canaux optiques du dispositif (canaux 3 et 4). The method and the device described in the present invention allow the search for the presence of 5 viruses using a pentaplex PCR carried out by mixing five pairs of primers and five probes for the detection of 5 targets using only two channels device optics (channels 3 and 4).
Les amorces et les sondes utilisées sont spécifiques des cibles suivantes : The primers and probes used are specific for the following targets:
Canal 3 : Channel 3:
Cible 1 - Influenza A : Target 1 - Influenza A:
- amorce sens GG A ATGGCT A A AG AC A AG ACC A AT - direction primer GG A ATGGCT A A AG AC A AG ACC A AT
- amorce antisens CTGCAGTCCTCGCTCACT - antisense primer CTGCAGTCCTCGCTCACT
- sonde ATT0565-TTCACGCTCACCGTGCCCAGTGA-BHQ2 Cible 2 - Influenza B : - probe ATT0565-TTCACGCTCACCGTGCCCAGTGA-BHQ2 Target 2 - Influenza B:
- amorce sens CTCAACTCACTCTTCGAGCGT - forward primer CTCAACTCACTCTTCGAGCGT
- amorce antisens TCTGGTGATAATCGGTGCTCTT - antisense primer TCTGGTGATAATCGGTGCTCTT
- sonde CY3-TCTGGTGATAATCGGTGCTCTT-BHQ2 - probe CY3-TCTGGTGATAATCGGTGCTCTT-BHQ2
Cible 3 - SARS-CoV-2 : Target 3 - SARS-CoV-2:
- amorce sens GCTTCAGCGTTCTTCGGAAT - forward primer GCTTCAGCGTTCTTCGGAAT
- amorce antisens CAATTTGATGGCACCTGTGTAG - antisense primer CAATTTGATGGCACCTGTGTAG
- sonde Alexa Fluor 568-ATTGGCATGGAAGTCACACCTTCGG-BHQ2 - Alexa Fluor probe 568-ATTGGCATGGAAGTCACACCTTCGG-BHQ2
Canal 4 : Channel 4:
Cible 4 - RSVB : Target 4 - RSVB:
- amorce sens TCCTAACTTCTCAAGTGTGGTC - sense primer TCCTAACTTCTCAAGTGTGGTC
- amorce antisens CTTGGTTTCTTGGTGTACCTCT - reverse primer CTTGGTTTCTTGGTGTACCTCT
- sonde ATT0647N-AGGCAATGCAGCAGGTCTAGGCAT-BHQ2 - probe ATT0647N-AGGCAATGCAGCAGGTCTAGGCAT-BHQ2
Cible 5 - RSV type A : Target 5 - RSV type A:
- amorce sens GCAGGATTGTTTATGAATGCCT - sense primer GCAGGATTGTTTATGAATGCCT
- amorce antisens CACAACTTGTTCCATTTCTGCT - antisense primer CACAACTTGTTCCATTTCTGCT
- sonde Cy5-GGTGCAGGGCAAGTGATGTTACGG-BHQ2 - probe Cy5-GGTGCAGGGCAAGTGATGTTACGG-BHQ2
Les amorces sont ajoutées au mélange à une concentration comprise entre 0,1 et 0,6mM ; les sondes sont ajoutées à la réaction à une concentration comprise entre 0,1 et 0,5mM. Le mélange de RT-PCR se compose d’un tampon (Tris-HCL, KC1 25mM, (NH4)2S04 16mM, MgC124,5mM) et l’amplification est réalisée en utilisant entre 3 et 10U de TAQ polymerase (avec activité exonucléase en 5') et 3U de WarmStart reverse transcriptase. Le protocole PCR utilisé se compose de : transcription inverse réalisée pendant une minute à 60°C, dénaturation / activation de la polymérase réalisée pendant une minute à 95°C et 45 cycles PCR (composés de deux phases : dénaturation pendant 3 secondes à 95°C et hybridation/extension pendant 15 secondes à 60°C). Les mesures de l’intensité de fluorescence sont effectuées toutes les 100ms. On réalise 5 réactions de PCR comprenant l’ensemble des sondes sauf une pour déterminer les signatures temporelles des sondes. The primers are added to the mixture at a concentration of between 0.1 and 0.6 mM; the probes are added to the reaction at a concentration between 0.1 and 0.5 mM. The RT-PCR mix consists of buffer (Tris-HCL, 25mM KC1, (NH4)2SO4 16mM, MgC124.5mM) and amplification is performed using between 3 and 10U of TAQ polymerase (with exonuclease activity in 5') and 3U of WarmStart reverse transcriptase. The PCR protocol used consists of: reverse transcription carried out for one minute at 60°C, denaturation / activation of the polymerase carried out for one minute at 95°C and 45 PCR cycles (composed of two phases: denaturation for 3 seconds at 95°C C and hybridization/extension for 15 seconds at 60°C). Fluorescence intensity measurements are performed every 100 ms. 5 PCR reactions are carried out comprising all the probes except one to determine the time signatures of the probes.
On utilise ensuite ces signatures temporelles pour démultiplexer les signaux enregistrés au cours de réactions de PCR pentaplex pour rechercher, en une seule réaction, la présence de n’importe quelle séquence parmi les 5 séquences nucléotidiques d’intérêt. These time signatures are then used to demultiplex the signals recorded during pentaplex PCR reactions to search, in a single reaction, for the presence of any sequence among the 5 nucleotide sequences of interest.
Ainsi, il apparaît que, grâce aux signatures temporelles, il est possible de réaliser un multiplexage / démultiplexage de degré 2, 3, 4, 5 ou plus, dès lors que l’on est capable de bien définir les signatures temporelles de chacune des sondes. Thus, it appears that, thanks to the time signatures, it is possible to carry out a multiplexing / demultiplexing of degree 2, 3, 4, 5 or more, since one is able to clearly define the time signatures of each of the probes .
Cette capacité de détection multiplexée de séquences d’acides nucléiques ouvre des possibilités conséquentes, comme par exemple la possibilité de réaliser la recherche simultanée de nombreuses mutations génétiques ponctuelles du génome du coronavirus SARS-CoV-2 dans un échantillon clinique, ce qui permet d’identifier rapidement le variant présent dans cet échantillon, alternative plus rapide et moins coûteuse que le séquençage du génome viral présent dans cet échantillon. This capacity for multiplexed detection of nucleic acid sequences opens up significant possibilities, such as the possibility of carrying out the simultaneous search for numerous point genetic mutations of the SARS-CoV-2 coronavirus genome in a clinical sample, which makes it possible to quickly identify the variant present in this sample, a faster and less expensive alternative to sequencing the viral genome present in this sample.

Claims

Revendications Claims
[Revendication 1] Dispositif de détection multiplexée de séquences d’acides nucléiques comprenant un thermocycleur (4) agencé pour réaliser une série de cycles thermiques avec un réactif d’amplification d’acides nucléiques in vitro contenant au moins deux sondes de fluorescence combinant un quencher et un fluorophore, lesdites sondes de fluorescence étant agencées pour chacune cibler une séquence d’acide nucléique distincte et lesdits fluorophores émettant dans des plages de longueurs d’onde de fluorescence se chevauchant, un capteur de lumière (6) agencé pour mesurer un rayonnement émis par lesdits fluorophores dans lesdites plages de longueurs d’onde de fluorescence, le rayonnement émis par chaque sonde variant selon que celle-ci est dans un état non modifié dans lequel le quencher atténue ou n’atténue pas sensiblement l’émission de fluorescence, ou dans un état modifié dans lequel le quencher a un effet opposé sur l’émission de fluorescence, et un analyseur (8) agencé pour déterminer, pour chaque sonde de fluorescence respective, une valeur représentative d’une concentration dans un état modifié, à partir de signatures temporelles tirées de la fluorescence mesurée en fonction du temps pour un cycle thermique donné d’un mélange réactionnel comprenant une ou plusieurs sondes, lesquelles peuvent être chacune sensiblement entièrement dans un état non modifié ou modifié, et d’au moins deux mesures réalisées au cours de certains au moins des cycles thermiques, lesquelles valeurs représentatives d’une concentration dans un état modifié permettent de qualifier la présence d’une ou plusieurs séquences d’acide nucléique chacune associée à une sonde de fluorescence distincte de manière à provoquer un changement d’état de la sonde de fluorescence de l’état non modifié vers l’état modifié lorsqu’elles interagissent. [Claim 1] Device for the multiplexed detection of nucleic acid sequences comprising a thermal cycler (4) arranged to carry out a series of thermal cycles with an in vitro nucleic acid amplification reagent containing at least two fluorescence probes combining a quencher and a fluorophore, said fluorescence probes being arranged to each target a distinct nucleic acid sequence and said fluorophores emitting in overlapping fluorescence wavelength ranges, a light sensor (6) arranged to measure emitted radiation by said fluorophores in said ranges of fluorescence wavelengths, the radiation emitted by each probe varying depending on whether the latter is in an unmodified state in which the quencher substantially attenuates or does not attenuate the fluorescence emission, or in a modified state in which the quencher has an opposite effect on the fluorescence emission, and an analyzer (8) arranged to determine r, for each respective fluorescence probe, a value representative of a concentration in a modified state, from temporal signatures drawn from the fluorescence measured as a function of time for a given thermal cycle of a reaction mixture comprising one or more probes , which can each be substantially entirely in an unmodified or modified state, and at least two measurements carried out during at least some of the thermal cycles, which values representative of a concentration in a modified state make it possible to qualify the presence of one or more nucleic acid sequences each associated with a distinct fluorescence probe so as to cause a change of state of the fluorescence probe from the unmodified state to the modified state when they interact.
[Revendication 2] Dispositif selon la revendication 1, dans lequel le thermocycleur (4) est un thermocycleur PCR, et les au moins deux sondes de fluorescence sont choisies parmi le groupe comprenant les sondes TaqMan, les balises moléculaires, les sondes duales à transfert de fluorescence, les sondes Scorpion, les sondes Amplifluor, les sondes MGB Eclipse, les sondes LUX, les sondes QUASR et les sondes QZyme. [Claim 2] Device according to claim 1, in which the thermal cycler (4) is a PCR thermal cycler, and the at least two fluorescence probes are chosen from the group consisting of TaqMan probes, molecular beacons, dual transfer probes, fluorescence, Scorpion probes, Amplifluor probes, MGB Eclipse probes, LUX probes, QUASR probes and QZyme probes.
[Revendication 3] Dispositif selon la revendication 1 ou 2, dans lequel le réactif d’amplification d’acides nucléiques in vitro comprend trois sondes de fluorescence combinant un quencher et un fluorophore, lesdites sondes de fluorescence étant agencées pour chacune cibler une séquence d’acide nucléique distincte et lesdits fluorophores présentant des plages de longueurs d’onde de fluorescence se chevauchant. [Claim 3] Device according to claim 1 or 2, in which the in vitro nucleic acid amplification reagent comprises three fluorescence probes combining a quencher and a fluorophore, said fluorescence probes being arranged to each target a sequence of distinct nucleic acid and said fluorophores exhibiting overlapping fluorescence wavelength ranges.
[Revendication 4] Dispositif selon l’une des revendications précédentes, dans lequel le réactif d’amplification d’acides nucléiques in vitro comprend au moins deux groupes de sondes de fluorescence combinant un quencher et un fluorophore, lesdites sondes de fluorescence étant agencées pour chacune cibler une séquence d’acide nucléique distincte et lesdits fluorophores présentant des plages de longueurs d’onde de fluorescence se chevauchant au sein de chaque groupe de sondes de fluorescence. [Claim 4] Device according to one of the preceding claims, in which the in vitro nucleic acid amplification reagent comprises at least two groups of fluorescence probes combining a quencher and a fluorophore, the said fluorescence probes being arranged for each targeting a distinct nucleic acid sequence and said fluorophores exhibiting overlapping fluorescence wavelength ranges within each group of fluorescence probes.
[Revendication 5] Dispositif selon l’une des revendications précédentes, dans lequel l’analyseur (8) est agencé pour déterminer la valeur représentative de la concentration de chaque sonde de fluorescence dans un état modifié en résolvant un système matriciel basé sur les mesures de fluorescence, les signatures temporelles et la constance de la concentration respective de chaque sonde de fluorescence. [Claim 5] Device according to one of the preceding claims, in which the analyzer (8) is arranged to determine the value representative of the concentration of each fluorescence probe in a modified state by solving a matrix system based on the measurements of fluorescence, the temporal signatures and the constancy of the respective concentration of each fluorescence probe.
[Revendication 6] Dispositif selon les revendications 4 et 5, dans lequel l’analyseur (8) est agencé pour résoudre un système matriciel par groupe de sondes de fluorescence. [Claim 6] Device according to claims 4 and 5, in which the analyzer (8) is arranged to solve a matrix system by group of fluorescence probes.
[Revendication 7] Dispositif selon la revendication 5 ou 6, dans lequel l’analyseur (8) est agencé pour utiliser un algorithme de minimisation. [Claim 7] Apparatus according to claim 5 or 6, wherein the analyzer (8) is arranged to use a minimization algorithm.
[Revendication 8] Dispositif selon l’une des revendications 1 à 4, dans lequel l’analyseur (8) est agencé pour déterminer la valeur représentative de la concentration de chaque sonde de fluorescence dans un état modifié en appliquant une descente du gradient ou en utilisant un réseau de neurones. [Claim 8] Device according to one of Claims 1 to 4, in which the analyzer (8) is arranged to determine the value representative of the concentration of each fluorescence probe in a modified state by applying a descent of the gradient or by using a neural network.
[Revendication 9] Procédé de détection multiplexée de séquences d’acides nucléiques comprenant les opérations suivantes : a) réaliser une pluralité de cycles thermiques sur un mélange réactionnel comprenant un échantillon à analyser et un réactif d’amplification d’acides nucléiques in vitro contenant au moins deux sondes de fluorescence combinant un quencher et un fluorophore, lesdites sondes de fluorescence étant agencées pour chacune cibler une séquence d’acide nucléique distincte et lesdits fluorophores émettant dans des plages de longueurs d’onde de fluorescence se chevauchant, b) lors de chaque cycle thermique, réaliser au moins deux mesures de fluorescence dans lesdites plages de longueurs d’onde de fluorescence, le rayonnement émis par chaque sonde variant selon que celle-ci est dans un état non modifié dans lequel le quencher atténue ou n’atténue pas sensiblement l’émission de fluorescence, ou dans un état modifié dans lequel le quencher a un effet opposé sur l’émission de fluorescence, c) déterminer une valeur représentative de la concentration de chaque sonde de fluorescence dans un état modifié à partir des mesures de l’opération b) et de signatures temporelles tirées de la fluorescence mesurée en fonction du temps pour un cycle thermique donné d’un mélange réactionnel comprenant une ou plusieurs sondes, lesquelles peuvent être chacune sensiblement entièrement dans un état non modifié ou modifié, lesquelles valeurs représentatives d’une concentration dans un état modifié permettent de qualifier la présence d’une ou plusieurs séquences d’acide nucléique chacune associée à une sonde de fluorescence distincte de manière à provoquer un changement d’état de la sonde de fluorescence de l’état non modifié vers l’état modifié lorsqu’elles interagissent. [Claim 9] Method for the multiplexed detection of nucleic acid sequences comprising the following operations: a) carrying out a plurality of thermal cycles on a reaction mixture comprising a sample to be analyzed and an in vitro nucleic acid amplification reagent containing at at least two fluorescence probes combining a quencher and a fluorophore, said fluorescence probes being arranged to each target a distinct nucleic acid sequence and said fluorophores emitting in overlapping fluorescence wavelength ranges, b) during each thermal cycle, performing at least two fluorescence measurements in said fluorescence wavelength ranges, the radiation emitted by each probe varying depending on whether it is in an unmodified state in which the quencher substantially attenuates or does not attenuate the fluorescence emission, or in a modified state in which the quencher has an opposite effect on the fluorescence emission, c) determining a value representative of the concentration of each fluorescence probe in a modified state from the measurements of step b) and time signatures drawn from the fluorescence measured as a function of time for a given thermal cycle of a reaction mixture comprising one or more probes, each of which may be substantially entirely in an unmodified or modified state, which r values representative of a concentration in a modified state make it possible to qualify the presence of one or more nucleic acid sequences each associated with a distinct fluorescence probe so as to cause a change of state of the fluorescence probe of the state unmodified to the modified state when they interact.
[Revendication 10] Procédé selon la revendication 9, dans lequel l’opération b) comprend la réalisation de cycles PCR, et les au moins deux sondes de fluorescence sont choisies parmi le groupe comprenant les sondes TaqMan, les balises moléculaires, les sondes duales à transfert de fluorescence, les sondes Scorpion, les sondes Amplifluor, les sondes MGB Eclipse, les sondes LUX, les sondes QUASR et les sondes QZyme. [Claim 10] Method according to claim 9, in which step b) comprises carrying out PCR cycles, and the at least two fluorescence probes are chosen from the group comprising TaqMan probes, molecular beacons, dual probes at fluorescence transfer, Scorpion probes, Amplifluor probes, MGB Eclipse probes, LUX probes, QUASR probes and QZyme probes.
[Revendication 11] Procédé selon la revendication 9 ou 10, dans lequel l’opération b) comprend l’utilisation d’un réactif d’amplification d’acides nucléiques in vitro comprenant trois sondes de fluorescence combinant un quencher et un fluorophore, lesdites sondes de fluorescence étant agencées pour chacune cibler une séquence d’acide nucléique distincte et lesdits fluorophores présentant des plages de longueurs d’onde de fluorescence se chevauchant. [Claim 11] A method according to claim 9 or 10, wherein step b) comprises the use of an in vitro nucleic acid amplification reagent comprising three fluorescence probes combining a quencher and a fluorophore, said probes each being arranged to target a distinct nucleic acid sequence and said fluorophores exhibiting overlapping fluorescence wavelength ranges.
[Revendication 12] Procédé selon l’une des revendications 9 à 11, dans lequel l’opération b) comprend l’utilisation d’un réactif d’amplification d’acides nucléiques in vitro comprenant au moins deux groupes de sondes de fluorescence combinant un quencher et un fluorophore, lesdites sondes de fluorescence étant agencées pour chacune cibler une séquence d’acide nucléique distincte et lesdits fluorophores présentant des plages de longueurs d’onde de fluorescence se chevauchant au sein de chaque groupe de sondes de fluorescence. [Claim 12] Method according to one of Claims 9 to 11, in which step b) comprises the use of a nucleic acid amplification reagent in vitro comprising at least two groups of fluorescence probes combining a quencher and a fluorophore, said fluorescence probes being arranged to each target a distinct nucleic acid sequence and said fluorophores having overlapping fluorescence wavelength ranges at the within each group of fluorescence probes.
[Revendication 13] Procédé selon l’une des revendications 9 à 12, dans lequel l’opération c) comprend la résolution d’un système matriciel basé sur les mesures de fluorescence, les signatures temporelles et la constance de la concentration respective de chaque sonde de fluorescence. [Claim 13] Method according to one of Claims 9 to 12, in which step c) comprises the resolution of a matrix system based on the fluorescence measurements, the time signatures and the constancy of the respective concentration of each probe fluorescence.
[Revendication 14] Procédé selon les revendications 12 et 13, dans lequel l’opération c) comprend la résolution d’un système matriciel par groupe de sondes de fluorescence. [Claim 14] A method according to claims 12 and 13, wherein step c) comprises solving one matrix system per group of fluorescence probes.
[Revendication 15] Procédé selon l’une des revendications 9 à 13, dans lequel l’opération c) comprend l’application d’une descente de gradient ou l’utilisation d’un réseau de neurones. [Claim 15] Method according to one of Claims 9 to 13, in which step c) comprises the application of a gradient descent or the use of a neural network.
EP22764443.2A 2021-07-30 2022-07-28 Device and method for multiplexed detection of nucleic acid sequences Pending EP4377475A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
FR2108385A FR3125824A1 (en) 2021-07-30 2021-07-30 Device and method for multiplexed detection of nucleic acid sequences
PCT/FR2022/051520 WO2023007097A1 (en) 2021-07-30 2022-07-28 Device and method for multiplexed detection of nucleic acid sequences

Publications (1)

Publication Number Publication Date
EP4377475A1 true EP4377475A1 (en) 2024-06-05

Family

ID=78649379

Family Applications (1)

Application Number Title Priority Date Filing Date
EP22764443.2A Pending EP4377475A1 (en) 2021-07-30 2022-07-28 Device and method for multiplexed detection of nucleic acid sequences

Country Status (5)

Country Link
EP (1) EP4377475A1 (en)
KR (1) KR20240049288A (en)
CN (1) CN118451198A (en)
FR (1) FR3125824A1 (en)
WO (1) WO2023007097A1 (en)

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5210015A (en) 1990-08-06 1993-05-11 Hoffman-La Roche Inc. Homogeneous assay system using the nuclease activity of a nucleic acid polymerase
US5538848A (en) 1994-11-16 1996-07-23 Applied Biosystems Division, Perkin-Elmer Corp. Method for detecting nucleic acid amplification using self-quenching fluorescence probe
EP2336358A1 (en) * 2008-05-06 2011-06-22 QIAGEN GmbH Simultaneous detection of multiple nucleic acid sequences in a reaction
US20120058481A1 (en) * 2010-08-20 2012-03-08 Life Technologies Corporation Quantitative Real Time PCR Assay Using FRET Dual-Labeled Primers

Also Published As

Publication number Publication date
WO2023007097A1 (en) 2023-02-02
FR3125824A1 (en) 2023-02-03
KR20240049288A (en) 2024-04-16
CN118451198A (en) 2024-08-06

Similar Documents

Publication Publication Date Title
Mori et al. Real-time turbidimetry of LAMP reaction for quantifying template DNA
US8182995B2 (en) Real time gene expression profiling
JP2021118697A (en) Digital specimen analysis
JP4689004B2 (en) Automatic analysis of real-time nucleic acid amplification
KR102145677B1 (en) Signal encoding and decoding in multiplexed biochemical assays
JP4458133B2 (en) Nucleic acid amplification equipment
JP6688318B2 (en) Multiple entry cleavage assay
US20050112647A1 (en) Detection system
JP7097859B2 (en) Detection of target nucleic acid sequences using different detection temperatures and reference values
JP2015042182A (en) Nucleic acid detection method
KR20200039851A (en) Method and apparatus for analyzing a target analyte in a sample
JP2010017127A5 (en)
Marme et al. Identification of single-point mutations in mycobacterial 16S rRNA sequences by confocal single-molecule fluorescence spectroscopy
EP4377475A1 (en) Device and method for multiplexed detection of nucleic acid sequences
US20210292817A1 (en) Methods for quantitation of analytes in multiplexed biochemical reactions
US20140080726A1 (en) Enhanced method for probe based detection of nucleic acids
JP6059453B2 (en) A method for detecting a plurality of gene polymorphisms at a single wavelength using a plurality of oligonucleotides modified with a fluorescent dye having the same or near detection wavelength
JP6577660B2 (en) Method for detecting multiple types of short-chain nucleic acids in a sample, combination analysis kit, and analysis kit supply management method
Mackay et al. Real-time fluorescent PCR techniques to study microbial–host interactions
WO2023067077A1 (en) High stokes shift fluorescence dyes for multiplex detection
Lee et al. Development of a temperature sensor array chip and a chip-based real-time PCR machine for DNA amplification efficiency-based quantification
Maity et al. PCR Technology and Its Importance In Covid-19 Pandemic
Singh et al. Chapter-6 Recent Developments in PCR Technology
EP4381097A1 (en) Methods, systems and compositions for detection of multiple analytes
WO2024015999A1 (en) Methods, systems and compositions for detection of multiple analytes

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: UNKNOWN

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20240227

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR