Classifications

• • A—HUMAN NECESSITIES
  • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
  • A01P—BIOCIDAL, PEST REPELLANT, PEST ATTRACTANT OR PLANT GROWTH REGULATORY ACTIVITY OF CHEMICAL COMPOUNDS OR PREPARATIONS
  • A01P7/00—Arthropodicides
  • A01P7/04—Insecticides
• • A—HUMAN NECESSITIES
  • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
  • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
  • A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
  • A01N63/30—Microbial fungi; Substances produced thereby or obtained therefrom

Definitions

• Insects can have negative impacts on many plants. When left unchecked, particular species of insects can have devastating effects on large populations of plants. As just one example, pine borer beetles have killed millions of trees in North America. In California alone, it is estimated that 147 million trees died between 2010 and 2018. Pine borer beetles kill more healthy adult pine trees in British Columbia than logging and wildfires combined.
• the present disclosure relates to compositions, method of making and using the same, for treating plants infested with harmful insects.
• the present disclosure provides a method for producing a mycoinsecticide composition.
• the method comprises: preparing a starter culture to grow a strain of B. bassiana fungus; freezing and storing the prepared starter culture to obtain a fungus mixture; treating the stored fungus mixture to obtain a fungus liquid containing the grown B. bassiana fungus; treating and/or formulating the fungus liquid to obtain the mycoinsecticide composition; and packaging the mycoinsecticide composition.
• preparing a starter culture further comprises: adding water to a cereal grain in a vessel and allowing the water to soak the cereal grain; adding the B. bassiana fungus and a glucose source to produce a fungus mixture having a glucose content of about 4 to about 6 %, based on total weight of the fungus mixture; and allowing the fungus mixture to grow in the vessel for about 10 to about 30 days at a temperature of about 70 to about 80 °F.
• the fungus mixture is frozen and stored at a temperature of about -22 to about 0 °F.
• treating the stored fungus mixture further comprises: thawing and washing the fungus mixture with a water-based liquid to obtain a fungus liquid; and straining the fungus liquid and storing the fungus liquid in a container.
• treating and/or formulating the fungus liquid further comprises: adding a glucose source to raise the total glucose content of the fungus liquid to about 6 to about 8% based on total weight of the fungus liquid; adding a fertilizer to the fungus liquid; and bubbling and stirring the fungus liquid in the container for about 10 to about 60 days.
• the glucose source is molasses.
• the B. bassiana fungus is of the strain JTDRL-
• the cereal grain comprises rice and barley.
• the present disclosure provides a mycoinsecticide composition.
• the mycoinsecticide composition comprises Beauveria bassiana fungus of the strain JTDRL-RC5A-HSSE deposited under NRRL Number 67768.
• the mycoinsecticide composition is product made by the methods described herein.
• the present disclosure provides a method of treating plants to prevent damage from insects.
• the method comprises: preparing the mycoinsecticide composition described herein; and applying the mycoinsecticide composition to the plants by spraying.
• the plants may be trees including pine trees, or bushes including coffee plants.
• the insects may be borer beetles including coffee borer beetles or pine borer beetles.
• FIG. 1 illustrates a flow diagram of one particular example method 100 for making a mycoinsecticide composition, in accordance with various embodiments of the present disclosure.
• FIG. 2 illustrates a flow diagram of one particular example method 200 for insect control, in accordance with various embodiments of the present disclosure.
• compositions and methods for treating plants infested with harmful insects include a particular strain of Beauveria bassiana.
• the live fungus is pathogenic to various species of insects, causing white muscardine disease.
• spores of this fungus come in contact with the cuticle (skin) of susceptible insects, they germinate and grow directly through the cuticle to the inner body of their host.
• the compositions are sprayed over affected areas and the fungus attaches to the insects.
• spores germinate and mycelium filaments grow the fungus penetrates through layers of the cuticle of the target insect. In some instances, the insects ingest the fungus, allowing it to kill the host from within.
• Coffee berry borers also known as coffee borer beetles (Hypothenemus hampe ) are insects that infest and feed upon coffee plants. In particular, these small black beetles invade the coffee berry. These beetles originated in Africa, but have spread to all countries where coffee crops are grown, making them one of the top most harmful pests of coffee plants. Traditional pesticides are largely unsuccessful in controlling coffee berry borers because they are only effective before the insects bore into the coffee berries.
• Bark beetles are tiny insects with hard, cylindrical bodies that reproduce under the bark of trees. Roots, stems, seeds, and fruits of the trees can be damaged by the beetles.
• the mountain pine beetle (Dendroctonus ponderosae). southern pine beetle (Dendroctonus frontalis), and their near relatives are major pests of conifer forests in North America.
• a similarly aggressive species in Europe is the spruce bark beetle (Ips typographus). This has caused widespread damage to forests. This, in turn, has created major fire hazards.
• the sweetpotato bug (Physomerus grossipes) is a sucking insect. They pierce the plants they feed on with their mouths and suck out the sap. While small numbers of the bugs will not cause a lot of damage, large infestations can cause yellowing and wilting in plants, making them more susceptible to other pests and diseases.
• the sweetpotato bug is a relatively new arrival to the islands of Hawaii. These bugs are fairly resistant to chemical sprays, making them an ideal target for biological controls. Initial testing has shown that B. bassiana is effective at eradicating these bugs.
• Table 1 provides an exemplary list of additional insect species and associated target tree species.
• insects that are harmful to plants include borer beetles and weevils such as: Ash bark beetles (Hylesinus species), Ambrosia beetles (Xyleborinus saxesenii), Hemp Weevil (Rhinoncus pericarpius), Stalk borers (Papaipema nebr), Hemp borers (Grapholita delineana), European com borers (ECBs), (Ostrinia nubilalis), and Hemp Flea Beetles (Psylliodes attenuate).
• insect targets include, but are not limited to: Aphids, Barnacles / Scale Insects, Broad Mites & Russet Mites, Caterpillars & Inchworms, Crickets, Fungus Gnats, Grasshoppers, Leafhoppers, Leaf Miners, Mealybugs, Slugs / Snails, Spider Mites, Thrips, and Whiteflies. All of the insects described here may be targeted with the biological control agents described herein. In some embodiments, additional insects could be targeted by these mycoinsecticides.
• compositions of the present disclosure include Beauveria bassiana fungus selected from 31 possible strains. Some are more effective for use as biopesticides than others.
• the fungus is the strain JTDRL-RC5A-HSSE.
• the fungus included in the composition is both in the form of spores and mycelia. By including two forms of the fungus, chances are increased that the fungus will grow and spread once it is applied.
• mycelia instead of spores alone
• the fungus will visibly spread sooner, indicating that an effective amount has been applied.
• Diatomaceous earth and fertilizer can also be included for compositions that will be applied directly to plants. These ingredients boost efficacy of the biopesticide and also provide plants with other beneficial properties to enhance growth and vitality of the plants.
• the preferred strain of B. bassiana used for biocontrol is strain JTDRL- RC5A-HSSE. A deposit of this strain has been made to the Agricultural Research Culture Collection International Depository Authority with NRRL Number 67768.
• p-tubulin DNA sequence of JTDRL-RC5 A-HSSE GGTGCTGCTTTCTGGCAGACCATCTCTGGCGAGCACGGCCTCGACTCCAGC GGTGTTTACAATGGCACTTCTGAGCTTCAGCTCGAGCGCATGAATGTCTACT TCAACGAGGTTTGTTGTGCCCTCCCAACGCGTTGCTTGATTTCGTTGTGGAT ACTGACCGCGATTTTCCATAGGCCTCCGGCAACAAATATGTACCTCGCGCC GTCCTCGTCGATCTTGAGCCCGGTACCATGGATGCTGTCCGTGCCGGTCCCT TCGGTCAGCTCTTCCGTCCCGACAACTTCGTTTTCGGTCAGTCCGGTGCCGG CAACAACTGGGCCAAGGGTCACTACACTGAGGGT
• FIG. 1 shows a flow diagram of one particular example method 100.
• a method 100 includes at least one of operations 110, 120, 130, 140, 150, or any combination thereof.
• Operation 110 includes preparing a starter culture to grow a strain of B. bassiana fungus.
• Operation 120 includes freezing and storing the prepared starter culture for a period of time to obtain a fungus mixture.
• Operation 130 includes treating the stored fungus mixture to obtain a fungus liquid containing the grown B. bassiana fungus.
• Operation 140 includes treating and/or formulating the fungus liquid to obtain the mycoinsecticide composition.
• Operation 150 includes packaging the mycoinsecticide composition.
• Operation 110 a starter culture is prepared and the B. bassiana fungus is first grown from the starter culture.
• Operation 110 may further include operations 111, 112, 113, and 114.
• Operation 111 includes mixing water and a cereal grain in a vessel.
• Operation 112 includes adding a strain of B. bassiana fungus and molasses in the vessel to produce a fungus mixture.
• Operation 113 includes sealing the vessel.
• Operation 114 includes allowing the fungus mixture to grow in the vessel at a first temperature for a first period of time.
• a vessel is filled with water and a cereal grain, and the cereal grain is soaked in the water for a period of time.
• the cereal grain is selected from one or more of rice, barley, corn, wheat, sorghum, millet, oats, rye, and fonio.
• the cereal grain includes rice.
• barley is added with rice.
• the cereal grain is soaked in water for at least about 0.5 hour, or at least about 1 hour, at least about 2 hours, at least about 3 hours, at least about 4 hours, at least about 5 hours, or at least about 10 hours.
• the cereal grain is soaked in water for about 1 to about 10 hours, or from about 2 to about 6 hours, or from about 2 to about 4 hours.
• the fungus is grown in a vessel that holds 5 lbs of dry weight substrate which is then soaked in water for approximately two hours prior to inoculating the substrate.
• the vessel is selected from one or more of a bucket, a tank, a bag and a tub.
• a mushroom bag is used and is laid flat during the growing process.
• the vessel can hold at least one gallon of liquid contents.
• the vessel can hold at least two gallons, at least three gallons, at least 5 gallons, or at least 10 gallons of contents.
• the size of the vessel is selected in proportion to the number of pounds of grain used.
• the water- saturated cereal grain is inoculated with the B. bassiana fungus that is added to the vessel.
• a preferred strain of B. bassiana fungus is strain JTDRL-RC5A-HSSE according to the present disclosure.
• a source of glucose is also added to the vessel at 112 along with the fungus to encourage growth of the fungus.
• the source of glucose is selected from one or more of molasses, brown sugar, and syrup.
• the glucose is included in an amount of at least 2% of the total volume of the vessel.
• the glucose is included in an amount of at least 3% or at least 4%.
• the glucose is included in an amount of less than 7% of the total volume of the vessel.
• the glucose content is from 2 to 7% of the total volume.
• the glucose content is from 4 to 6% of the total volume.
• the vessel is sealed.
• the vessel is a mushroom bag.
• the mushroom bag is inoculated with the fungus through a valve that is then sealed for the growing process.
• the B. bassiana fungus mixture is allowed to grow in the sealed vessel at a controlled temperature.
• the B. bassiana fungus is grown in the vessel at a temperature within the range of about 60 to about 90 °F.
• the temperature is within the range of about 70 to about 80 °F.
• the temperature for growth is about 78 °F.
• the fungus mixture is allowed to grow for at least about 10 days. In some embodiments, the fungus mixture is allowed to grow for at least about 14 days. In some embodiments, the fungus mixture is allowed to grow for at least about 20 days. In some embodiments, the fungus mixture is allowed to grow for about 30 days or less. In some embodiments, the fungus mixture is allowed to grow for about 14 to about 21 days. In some embodiments, the fungus mixture is allowed to grow for about 20 to about 30 days. In some embodiments, the fungus mixture is allowed to grow for about 18 to about 24 days.
• the sealed vessel containing the fungus mixture is frozen at a second temperature and stored for a second period time.
• the fungus mixture can be frozen and stored for up to five years.
• the bag can be rolled up and placed in a freezer for storage.
• the fungus mixture can also be transported in a frozen state.
• the fungus mixture is frozen to a temperature of less than about 0 °F.
• the fungus mixture is frozen to a temperature of less than about -5 °F.
• the fungus mixture is frozen to a temperature of less than about -10 °F.
• the fungus mixture is frozen to a temperature of about -20 to about 0 °F. In some embodiments, the fungus mixture is frozen to a temperature of about -15 to about -10 °F. In some embodiments, the fungus mixture is frozen to a temperature of about -12 °F.
• Operation 130 may further include operations 131 and 132. At 131, the frozen and stored fungus mixture is thawed and washed with a water-based liquid and the fungus is washed off of the fungus mixture and to obtain a fungus liquid.
• the resulting fungus liquid containing the fungus is transferred to a new container at 132 and stored therein.
• some of the mixture is returned to the original vessel to inoculate a new batch of funguscontaining mixture.
• the container holds at least about 5 gallons. In some embodiments, the new container holds at least about 20 gallons. In some embodiments, the new container holds at least about 50 gallons. In some embodiments, the new container holds a volume of from about 5 to about 55 gallons.
• the water-based liquid used to wash the cereal grain contains a minimum amount of chlorine.
• the chlorine content may be beneficial for minimizing contaminants in the mixture.
• the mixture is strained as it is transferred to the new container.
• the fungus liquid may be further treated and/or formulated at 140 to obtain the mycoinsecticide composition.
• Operation 140 may further include at least one of operations 141, 142, 143, or combinations thereof.
• the fungus liquid in the container is bubbled with a gas such as ambient air and stirred in a process referred to a hydration. Bubbling provides oxygen to the fungus liquid.
• a fertilizer mixture is added to the liquid fungus composition.
• the fertilizer mixture includes diatomaceous earth.
• the composition is free or substantially free from surfactants.
• the glucose content of the fugus liquid is raised by adding more of a glucose source such as molasses to the fugus liquid.
• a glucose source such as molasses
• the glucose content of the fugus liquid is raised to about 6 to about 8 %.
• the glucose content of the fugus liquid is raised to about 7 %.
• Other additives and functional ingredients common to the insecticide industry may be added to the fungus liquid at 140.
• the mycoinsecticide composition is free or substantially free from a synthetic biocide.
• the hydration process at 141 takes at least about two weeks. In some embodiments, the hydration process takes at least about three weeks. In some embodiments, the hydration process takes from about 15 to about 30 days. [0049]
• the obtained mycoinsecticide composition may be packaged at operation 150. In one embodiment, the mycoinsecticide composition is transferred to an applicator device.
• the resulting mycoinsecticide composition can be applied to the area to be treated.
• a portion of the mycoinsecticide composition can remain in the container and continues to grow in a “regrowth process.”
• this regrowth process can be repeated up to five times.
• the regrowth process is repeated three to four times.
• the present disclosure relates to a method of insect control, the method comprising applying a mycoinsecticide composition described herein to the area to be treated.
• the liquid mycoinsecticide compositions according to the present disclosure can be applied in multiple ways with different types of applicator devices. These may include, among others: 1) small applications with backpack sprayers, 2) larger mechanical spray equipment, 3) large tank spraying equipment, 4) large capacity tractor application, 5) drone application, 6) helicopter application, and 7) aircraft tanker application.
• the applicator device is selected from a backpacker sprayer, a spot sprayer, an ATV sprayer, a UTV sprayer, a tow behind sprayer, a truck bed sprayer, a 3 point hitch sprayer, a boom sprayer, and a mist sprayer.
• the applicator device is attached to at least one of an airplane, a jet aircraft, a helicopter, and an unmanned aerial vehicle.
• the process of preparing the present mycoinsecticide composition and applying the mycoinsecticide composition is performed by a trained individual.
• each batch of the liquid composition can treat at least one acre of land.
• the liquid composition can be applied to thousands of acres at a time to combat widespread infestations.
• FIG. 2 illustrates a flow diagram of one particular example method 200 for insect control.
• the method 200 includes operations 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, and 212.
• 201 about 2.5 lbs of a cereal grain comprising rice and barley are mixed with water in a mushroom bag to allow the water to soak the cereal grain for about 2 to about 4 hours.
• B. bassiana fungus of the strain JTDRL-RC5A-HSSE deposited under NRRL Number 67768 and molasses are added to the vessel to produce a fungus mixture.
• the amount of molasses is adjusted such that the fungus mixture has a glucose content of about 5%.
• the mushroom bag is sealed.
• the sealed mushroom bag was stored at a temperature of about 78 °F for about 14 to about 21 days to allow the fungus to grow.
• the mushroom bag is rolled and stored at a temperature of about -12 °F for a period of time up to about 5 years.
• the fungus mixture is thawed and washed with a waterbased liquid containing chlorine to obtain a fungus liquid.
• the fungus liquid is strained and stored in a container.
• molasses is added to the fungus liquid to adjust the glucose content of the fungus liquid to about 7%.
• a fertilizer is added to the fungus liquid.
• the fungus liquid is bubbled and stirred for about 20 to about 30 days at a temperature of about 78 °F to obtain a mycoinsecticide composition.
• the mycoinsecticide composition is transferred from the container to an applicator device.
• the mycoinsecticide composition is sprayed over an area to be treated, wherein the area to be treated includes plants damaged by insects or susceptible to damage from insects.
• weight percent As used herein, “weight percent,” “wt%, “percent by weight,” “% by weight,” and variations thereof refer to the concentration of a substance as the weight of that substance divided by the total weight of the composition and multiplied by 100. It is understood that, as used here, “percent,” “%,” and the like are intended to be synonymous with “weight percent,” “wt%,” etc.
• any ranges of values set forth in this specification contemplate all values within the range and are to be construed as support for claims reciting any sub-ranges having endpoints which are real number values within the specified range in question.
• a disclosure in this specification of a range of from 1 to 5 shall be considered to support claims to any of the following ranges: 1-5; 1-4; 1-3; 1-2; 2-5; 2-4; 2-3; 3-5; 3-4; and 4- 5.
• substantially free may refer to any component that the composition of the disclosure lacks or mostly lacks. When referring to “substantially free” it is intended that the component is not intentionally added to compositions of the disclosure. Use of the term “substantially free” of a component allows for trace amounts of that component to be included in compositions of the disclosure because they are present in another component. However, it is recognized that only trace or de minimus amounts of a component will be allowed when the composition is said to be “substantially free” of that component. Moreover, if a composition is said to be “substantially free” of a component, if the component is present in trace or de minimus amounts it is understood that it will not affect the effectiveness of the composition.
• composition may be substantially free of that ingredient.
• express inclusion of an ingredient allows for its express exclusion thereby allowing a composition to be substantially free of that expressly stated ingredient.

Landscapes

• Life Sciences & Earth Sciences (AREA)
• Engineering & Computer Science (AREA)
• Zoology (AREA)
• Environmental Sciences (AREA)
• General Health & Medical Sciences (AREA)
• Health & Medical Sciences (AREA)
• Microbiology (AREA)
• Pest Control & Pesticides (AREA)
• Plant Pathology (AREA)
• Wood Science & Technology (AREA)
• General Chemical & Material Sciences (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Mycology (AREA)
• Chemical & Material Sciences (AREA)
• Agronomy & Crop Science (AREA)
• Biotechnology (AREA)
• Insects & Arthropods (AREA)
• Virology (AREA)
• Dentistry (AREA)
• Agricultural Chemicals And Associated Chemicals (AREA)

Applications Claiming Priority (3)

Publications (1)

Family

ID=81125605

Family Applications (1)

Country Status (2)

Family Cites Families (6)

• 2021
  • 2021-10-06 WO PCT/US2021/053795 patent/WO2022076577A1/en unknown
  • 2021-10-06 EP EP21878470.0A patent/EP4225029A1/de active Pending

Also Published As

Similar Documents

Legal Events