EP4158057A1 - Microfluidic method for the detection of nucleic acids - Google Patents

Microfluidic method for the detection of nucleic acids

Info

Publication number
EP4158057A1
EP4158057A1 EP21728123.7A EP21728123A EP4158057A1 EP 4158057 A1 EP4158057 A1 EP 4158057A1 EP 21728123 A EP21728123 A EP 21728123A EP 4158057 A1 EP4158057 A1 EP 4158057A1
Authority
EP
European Patent Office
Prior art keywords
atto
reservoir
alexa
interest
bodipy
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP21728123.7A
Other languages
German (de)
French (fr)
Inventor
Vincenzo RICCO
Raino CECCARELLI
Alberto BOFFI
Giancarlo RUOCCO
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Disruptive Technological Advances In Life Science Srl
Fondazione Istituto Italiano di Tecnologia
Original Assignee
Disruptive Technological Advances In Life Science Srl
Fondazione Istituto Italiano di Tecnologia
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Disruptive Technological Advances In Life Science Srl, Fondazione Istituto Italiano di Tecnologia filed Critical Disruptive Technological Advances In Life Science Srl
Publication of EP4158057A1 publication Critical patent/EP4158057A1/en
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6816—Hybridisation assays characterised by the detection means
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention relates to a method for the detection of nucleic acids of interest in a biological fluid.
  • the medical and scientific community has been constantly searching for effective and rapid methods for detecting nucleic acids of interest in biological samples such as biological fluids, such as serum, saliva, urine and the like, in order to allow non-invasive, fast and effective diagnoses.
  • biological samples such as biological fluids, such as serum, saliva, urine and the like.
  • Such d methods find application in each sanitary infrastructure and particularly in disadvantaged area or in case of epidemic diseases.
  • pandemic caused by SARS-Cov-2 infection highlighted the need of faster, yet extremely sensitive, methods for promptly detecting the infection in the largest amount of individuals as possible.
  • the devices and methods known in the art generally require several steps to arrive at the final detection, which steps are often performed by separate technical means or sub-devices, if not even at different locations.
  • These know-art testing modes entail relevant costs and times for providing results and tend to be prone to risks of mistakes, e.g. as associated with sample misplacement and/or contamination.
  • nucleic acid detection such as PCR
  • PCR the known art methods for nucleic acid detection, such as PCR, require the collection of the biological sample upon a swab and subsequent multiple working cycles, with an important impact in terms of time and in complexity of the overall testing process.
  • testing set-up requires specialized (para-)medical personnel and technicians for the test to be administered properly.
  • the present invention provides a microfluidic method that allows a fast and reliable detection of nucleic acids of interest in a sample.
  • microfluidic method as disclosed in the present description allows to detect a very small amount of nucleic acids of interest in a sample, wherein no amplification steps are required, thereby providing an extremely rapid and sensitive tool for detecting, by way of example, infectious agents, in the sample tested.
  • microfluidic method herein disclosed allows to concentrate the nucleic acid of interest, if present in the tested sample, in a millimetric volume, thereby enabling the detection of very small amounts of the target molecules.
  • the method disclosed and claimed herein allows an effective and accurate detection of the virus in biological fluids, including saliva, in a time period of minutes, i.e from about 5 to 30 minutes from the collection of the sample, in particular from about 5 to 20 minutes from the collection of the sample when the sample used is saliva.
  • the method can be carried out in a simple and small microfluidic system, and can be carried out by operators that require a simple training for the use of the system without the need of specialised laboratories and operators.
  • Such a method is of particular interest for rapid screenings of individuals, such as screenings that could be of need in ariports, train stations, offices, factories and the like.
  • Objects of the present invention are, therefore, a microfluidic method for the detection of nucleic acids of interest in a biological fluid comprising the following steps: mixing said biological fluid with one or more reactant specifically binding said nucleic acids of interest, said reactant being chemically bound to a fluorescent moiety and a denaturing buffer, submitting the mixture thus obtained at temperature conditions suitable for obtaining a selective binding between said nucleic acid of interest, if present in said biological fluid, and said one or more reactant; loading said mixture in a single reservoir (A+B) of a microfluidic system wherein said reservoir is separated from a discard reservoir by a filter apt to capture said nucleic acids of interest, said filter being positioned so to allow the passage of a fluid from said reservoir to said discard reservoir when said fluid is submitted to centrifugal force; submitting said mixture to centrifugal force thereby obtaining a filter wherein said nucleic acids of interest linked to said reactants are captured, if present in said biological fluid; submitting said filter to irradi
  • Figures 1A and IB refer to a testing device 1 comprising the microfluidic system suitable for carrying out the methods according to the invention and show each a schematic plan view of a respective side, or face, of a support disk of such device; the testing device 1 comprises a main body, or support frame, 100.
  • the main body 100 is in the form of a disk, i.e. with a substantially circular profile in plan view and a flat shape, with two planar dimensions prevailing with respect to its thickness.
  • two main sides, or faces, of the main body 100 are shown in Figures 1A and IB, respectively, and therein denoted by 101 for a first side and 102 for a second side.
  • Figure 2A shows a schematic plan view of an enlarged part of a first side of the support disk represented in Figure 1 A;
  • Figure 2B shows a schematic plan view of an enlarged part of a second side of the support disk represented in Figure IB;
  • Figure 3 shows a block diagram of a testing system according to a preferred embodiment of the invention that includes the support disk of the previous figures.
  • the system 200 includes a testing unit 201 that receives the testing device 1, and in particular its main body 100.
  • the testing unit 201 has a structure similar to that of a DVD player, in particular including a movable, e.g. extractable, drawer 202 configured to receive the disk 100.
  • test equipment implemented by the apparatus 200 may be roughly the size of a table DVD player, e.g. (42 x 26 x10) cm.
  • An optical encoder device 202 associated with system 200, and in particular with unit 201, allows the disk 100 to stop in different positions/stations of measurement, treatment and/or detection.
  • the device 1, and in particular its main body 100 can bear optical markers.
  • Figure 4 represents a brief scheme of the core part of the system and method of the invention, the content of the first reservoir is indicated as A, the content of the second reservoir is indicated as B. The rinsing and discard reservoirs are not represented.
  • the system 200 comprises optical detecting means 203 configured to detect fluorescence in the detection chamber 160. This same means can be used to heat the photoabsorbent material 152, 153 associated with the paraffin valves 142, 143.
  • a control unit 204 programmed with a testing or analysis software can be incorporated into unit 201 or provided separately.
  • the control unit 204 controls and commands operation of the other system components, preferably according to the loading and analysis steps of a testing method disclosed below. Bilateral, possibly wireless, communication between unit 204 and the other system components is provided.
  • Figure 4 shows the target sequence in SARS-Cov-2 genome accession number MN908947 version (MN908947.3) of probes having SEQ IDs 1-28.
  • RNA sequences corresponds to commonly used primers for viral RNA recognition, currently used in RT-PCR methods. Such sequences have been validated for their recognition properties and annealing temperatures [Udugama et al “Diagnosing COVID-19: The Disease and Tools for Detection” ACS Nano 2020, 14, 4, 3822-3835 Publication Date:March 30, 2020] .
  • R is a purine (A or G) and Y is a pyrimidine (C or T) S is G or C
  • each sequence listed can also be intended as RNA sequence, in this case, each T is substituted by U.
  • RNA aptamers capable of recognizing a specific fluorophore moiety and enhancing the emissivity of such fluorophore can be used in order to generate a fluorescence detection system alternative to the directly fluorophore conjugated primer described above.
  • RNA sequences capable of non-covalent recognition of a specific fluorophore RNA sequences capable of non-covalent recognition of a specific fluorophore.
  • Microfluidic system has the meaning commonly used in the art and refer to a system that transports, mix, separates, analyses or otherwise processes fluids usually in the range of microliters to picoliters, in networks of channels with dimensions from tens to hundreds of micrometers.
  • Fluorophore small organic molecule endowed with fluorescent properties
  • Oligonucleotides RNA sequences capable of pairing with complementary RNA sequences on the target RNA molecule.
  • Oligonucleotide probes RNA or DNA sequences of approximately 10-100 nucleotides, capable of pairing with complementary sequences on the target nucleic acid molecule.
  • the present invention provides a method that allows a fast detection of nucleic acids of interest from a biological fluid in a microfluidic system.
  • the method enables to minimize the detection time of the molecules of interest reducing said time from hours to minutes.
  • the utilization of a suitable device where all reactants are preloaded and only the sample has to be loaded by an operator, enables also general operators to carry out the detection.
  • An object of the invention is therefore a microfluidic method for the detection of nucleic acids of interest in a biological fluid comprising the following steps: mixing said biological fluid with one or more reactant specifically binding said nucleic acids of interest, said reactant being chemically bound to a fluorescent moiety and a denaturing buffer, submitting the mixture thus obtained at temperature conditions suitable for obtaining a selective binding between said nucleic acid of interest, if present in said biological fluid, and said one or more reactant; loading said mixture in a single reservoir (A+B) of a microfluidic system wherein said reservoir is separated from a discard reservoir by a filter apt to capture said nucleic acids of interest, said filter being positioned so to allow the passage of a fluid from said reservoir to said discard reservoir when said fluid is submitted to centrifugal force; submitting said mixture to centrifugal force thereby obtaining a filter wherein said nucleic acids of interest linked to said reactants are captured, if present in said biological fluid; submitting said filter to irradiation at the ex
  • said step of mixing said biological fluid with one or more reactant is carried out by loading said biological fluid, optionally suspended in a suitable lysis buffer in a first reservoir (A) of said microfluidic system, loading in a second reservoir (B) of said microfluidic system, a fluid comprising said one or more reactant specifically binding said nucleic acids of interest, said second reservoir being separated from said first reservoir by one or more microvalve; wherein said first and/or second reservoir are separated from a discard reservoir by a filter apt to capture said nucleic acids of interest, said filter being positioned so to allow the passage of a fluid from said first and/or second reservoir to said discard reservoir when said fluid is submitted to centrifugal force; and opening said microvalve separating said first reservoir from said second reservoir thereby obtaining a single reservoir (A+B) comprising said mixture of said biological fluid and said fluid comprising reactants.
  • the nucleic acids of interest can be pathogen genomes, such as bacterial genomes, protozoan genomes, viroids RNA, viral DNA or RNA genomes.
  • the nucleic acids of interest are viral genomes, such as DNA or RNA viral genomes.
  • a non-limiting example of viral genomes is represented by SARS-Cov-2 RNA, Ebolavirus RNA, Dengue Virus RNA, West Nile Virus RNA, Yellow fever virus RNA, Zika Virus RNA, Chikunguya Virus RNA, Herpes Virus DNA, HPV Virus DNA, HBV Virus DNA, HBC Virus RNA.
  • nucleic acid of interest is SARS-Cov-2 RNA.
  • nucleic acid of interest nucleic acid of interest.
  • the method of the invention can be carried out on biological fluids such as saliva, blood serum, urines.
  • biological fluid analysed for the detection of the molecules of interest is saliva.
  • the body fluid is suspended in a suitable lysis buffer which causes the disruption of said shell or membrane.
  • the lysis buffer can be also a denaturing buffer and can therefore be loaded directly in reservoir B.
  • said buffer can be pre-loaded in the vial for the sample collection, thereby avoiding a possible contamination of the buffer with other agents and simplifying the operational steps of the method.
  • Lysis buffers for viral particle lysis are well known in the art and several buffers of the kind are commercially available. The state of the art also provides various protocols for the preparation of viral lysis buffers. Lysis buffers suitable for the disruption of the viral shells may contain detergents, denaturing agents, chelating agents as well as proteinases. Said agents provide for the disruption of the viral shell and, at the same time, are effective in deactivating nucleases such as RNAses or DNAses that may be present in the biological fluid.
  • a lysis buffer according to the invention is a buffer containing one or more of guanidine salts such as guanidine thiocyanate, guanidine isothiocyanate, guanidine chloride, 2 mercaptoethanol, SDS, Tween 20, Triton X- 100, EDTA, phenol, NP40.
  • the buffer may further contain optionally proteinase K.
  • Viral lysis buffer containing SDS and EDTA are well known in the art as well as buffers containing guanidine thiocyanate and phenol, guanidine salts and proteinase K and the like. Said buffers are suitable for the method according to the present invention.
  • Possible lysis/denaturing buffer are buffers comprising a guanidine salt, such as guanidine thiocyanate 2-6 M, such as 2M, 4M or 6M.
  • a guanidine salt such as guanidine thiocyanate 2-6 M, such as 2M, 4M or 6M.
  • the presence of guanidine thiocyanate lowers the denaturing and annealing temperatures of the method of the invention.
  • the fluids in the first reservoir and in the second reservoir have a similar viscosity thereby allowing an efficient mixing of said fluids once they come in contact one with the other.
  • the fluid comprising one or more reactant specifically binding to the nucleic acid of interest can be common hybridisation buffers.
  • the reactant is selected depending on the nucleic acid of interest.
  • each reactant selectively binds a different and non-overlapping portion of said nucleic acid of interest.
  • nucleic acid of interest is a viral nucleic acid
  • a viral nucleic acid such as a Viral DNA or a Viral RNA (single stranded or double stranded)
  • suitable reactants are DNA or RNA oligonucleotides that are complementary to the nucleic acid of interest and that are specific for the same, i.e. they selectively bind the nucleic viral nucleic acid of interest, said oligomers being conjugated with a fluorophore group.
  • the oligonucleotide probes selected are 100% complementary to the target region of the viral nucleic acid.
  • oligonucleotides that can be used in order to carry out the method of the invention are well known in the art for various viral genomes and are commercially available.
  • the design of nucleotides selectively binding a known sequence of interest is well known to the skilled person and various commercial softwares that enable the skilled user to design suitable oligonucleotides specifically binding a precise target sequence (i.e. that do not show crossreactions or binding aspecificity) are also available.
  • said oligonucleotides can be in the form of DNA oligonucleotides or RNA oligonucleotides.
  • the oligonucleotide probe optionally comprises one or more chemically modified nucleotide, and wherein said oligonucleotide is chemically bound at its 5' and/or 5' end to a fluorescent moiety.
  • the oligonucleotide probes of the invention may comprise 1, 2, 3 or even 4 of said modified oligonucleotides.
  • the probe oligonucleotides are of a length from 14 to 60 nucleotides.
  • the fluorescent moiety is a fluorophore and it is covalently bound directly to said probe covalently.
  • the oligonucleotide probe can be comprised in a molecular beacon and is chemically bound at one end to fluorescent moiety comprising a fluorophore and to the other end to a moiety comprising a quencher of said fluorophore.
  • Molecular beacons probes are well known in the art.
  • the oligonucleotide probe or probes according to the invention can be incorporated in a molecular beacon by addition at each end, e.g. of a pair of short, complementary to each other, nucleotide strands, each, respectively bound to a fluorofore and to it’s quencher.
  • the fluorophore and the quencher upon hybridisation with the target sequence, the fluorophore and the quencher will be spaced one from the other and the fluorophore will be no longer quenched and will emit light upon irradiation at a suitable wavelength.
  • the fluorescent moiety can be an aptamer-fluorophore complex and, each oligonucleotide can be synthesized with an aptamer tail either at 5' or 5', or eventually an array of aptamers.
  • Aptamers are in vitro selected DNA or RNA molecules that are capable of forming complexes with suitable fluorophores, a suitable example of Aptamers-fluorophore complexes as fluorescent moieties according to the invention is provided by Mango Aptamer-fluorophores, such as like Mango I-IV.
  • RNA Aptamer sequences according to the invention is provided with SEQ IDs 29-32 as described in Alexis Autour et al., “Fluorogenic RNA Mango aptamers for imaging small non-coding RNAs in mammalian cells” Nature Communications 9, 656 (2016).
  • Suitable fluorophores complexing with Mango aptamers are represented, e.g. by TO1 -Biotin.
  • said probes are selected in order to hybridise at a sufficient distance on the nucleic acid of interest, in order to avoid steric hindrance during hybridisation, thereby allowing an effective annealing of each probe on the target sequence.
  • the position of the fluorescent moiety can be designed so to be at the opposite ends of the adjacent primers on the target nucleic acid of interest.
  • suitable fluorophores can be selected from: Alexa 350; Atto 390; Pacific blue; Atto 436; Marina blue; Acridine; Edans; Coumarin; Atto 465; BODIPY 493/503; Cy2; Atto 488; BODIPY FL-X; DANSYL; Alexa 488; Atto 495; FAM; Oregon Green; Atto 514; Rhodamine Green-X; NBD-X; TET; Atto 520; Alexa 430; BODIPY R6G-X; JOE; Yakima Yellow; Atto 532; Alexa 532; VIC; HEX; R6G; Atto Rho6G; Alexa 555; BODIPY 564/570; BODIPY TMR- X; Cy3; Alexa 546; TAMRA; Atto 550; Rhodamine Red-X; BODIPY 561/591; Atto 565; Atto Rho3B; Atto Rho 11; Redmond Red;
  • fluorophore When the fluorophore is selected from Alexa 488; Atto 495; FAM; Oregon Green; Atto 514; Rhodamine Green-X; NBD-X; TET; Atto 520; Alexa 430; BODIPY R6G-X; JOE; Yakima Yellow; Atto 532; Alexa 532; VIC; HEX a suitable quencher can be BHQ-1.
  • fluorophores and quenchers can be used based on their absorbtion wavelengths, emission wavelengths and quenching ranges.
  • BHQ-3 is a suitable quencher for Cy 5 and Cy 5.5.
  • fluorophores with the same adsorption wavelength and a different emission wavelength are selected.
  • a probe bound to DANSYL and a probe bound to Edans can be used, in this case both fluorophores can be excited with an UV laser beam and DANSYL will emit blue light whereas Edans will emit green light, another suitable couple of fluorophores is Coumarin and Alexa 434, both fluorophores will be excited with a blue/violet laser beam and Coumarin will emit blue light whereas Alexa 434 will emit yellow light.
  • Other suitable pairs can be easily selected by the skilled person based on the maximum Absorbtion wavelength and Maximun emission wavelength of each fluorophore.
  • the target nucleic acid is SARS-Cov-2 RNA.
  • oligonucleotides specifically binding SARS-Cov-2 RNA have been published in scientific literature and have been rendered available to the public.
  • U.S. CDC, China CDC, Charite Germany, Hong Kong University, National Institutes of Infectious Diseases (Japan), National Institutes of Health (Thailand) and many others have published a number of PCR primers and probes that can be used as oligonucleotides according to the invention.
  • Reverse primers can be used according to the published sequence, as well as the complementary sequence of the published forward primers and probes. Further probes can be readily designed as the sequence of the SARS-Cov-2 is also published.
  • a mixture of different oligonucleotides selectively binding to different regions of the viral RNA are used.
  • the oligonucleotides can be selected in order to bind to different genes of the viral RNA or to different regions of the same gene.
  • Suitable oligonucleotides can be of 14- 60 nucleotides in length, preferably 14-40 nucleotides.
  • oligonucleotides targeting one or more sequence of one or more of SARS-Cov-2 Orf1 gene can be used in order to avoid false negatives due to the presence of a mutation in a target binding site.
  • Suitable probes for the detection of the Sars-Cov-2 comprise one or more oligonucleotide of SEQ ID NO 1-28. When more than one probe is used, said oligonucleotides can be selected in order to bind different complementary target reasons in order to avoid steric hindrance and possible cross annealing among probes.
  • each probe can be easily positioned on the nucleic acid sequence and the sufficiently distant probes, e.g. probes hybridising to target sequences having a distance from each other of at least 300 nucleotides, preferably at least 500 nucleotides and even more preferably of at least 750 nucleotides can be selected.
  • probes with similar annealing temperatures can be selected.
  • the nucleic acid of interest is a viral nucleic acid
  • the mixture of biological fluid and the fluid comprising the reactants is obtained, the mixture is submitted to temperature conditions that allow the specific binding of the reactants with the nucleic acid of interest.
  • the nucleic acid of interest can be a double strand or a single strand nucleic acid.
  • the mixture is submitted to denaturation by increasing the temperature thereof to a suitable denaturation temperature that can be readily calculated based on the sequence of the oligonucleotide probe selected and on the composition of the lysis and/or denaturing buffer used.
  • a suitable denaturation temperature that can be readily calculated based on the sequence of the oligonucleotide probe selected and on the composition of the lysis and/or denaturing buffer used.
  • single stranded nucleic acids such as RNA genomes may present some double stranded portion, the mixture can also be submitted to denaturation as explained above if needed.
  • the denaturation step can be carried out for a period of time of about 20 to 90 seconds.
  • the mixture will be then submitted to a suitable annealing temperature, that can be calculated based on the probes sequence and on the lysis/denaturation buffer used, allowing the selective, specific, binding of the probes to the target sequence and not allowing aspecific binding (commonly defined as high stringency temperature).
  • a suitable annealing temperature that can be calculated based on the probes sequence and on the lysis/denaturation buffer used, allowing the selective, specific, binding of the probes to the target sequence and not allowing aspecific binding (commonly defined as high stringency temperature).
  • the temperature can be easily calculated depending on the length and composition in ATGC of the oligonucleotide probes used and on the chemical composition of the lysis/denaturation buffer.
  • the temperature conditions may comprise a denaturing step at a temperature from 50°C to 96°C and/or an annealing step at a temperature from 30°C to 70°C.
  • the denaturing step can be avoided and the temperature conditions will only comprise an annealing step as described in the present specification.
  • said denaturing step if present, is carried out from 30’ to 90’ and wherein said annealing step is carried out from 30’ to 90’.
  • the annealing temperature can be from about 20 to 70°C, such as about 30, about 40, about 45, about 48, about 50, about 54, about 56, about 58, about 60, about 62, about 64, about 68 °C depending on the guanidine salt and on the overall salt concentration of the buffer and on the sequence of the selected probes.
  • the annealing temperature will be held, before applying the centrifugal force for a time period from 30 to 70 seconds.
  • the centrifugal force is then applied to the microfluidic system by spinning said system at between 400 and 1200x g.
  • microfluidic system is built in the device depicted in the drawings and defined above.
  • the centrifugal force applied forces the mixture as defined above through the filter into the discard reservoir, thereby providing a filter with a retentate and an eluate.
  • the filter according to the invention is selected so to retain the nucleic acid of interest, if present, in the mixture and to let the unbound reactant flow through in the eluate.
  • said filter is positioned so to allow the passage of a fluid from said first and/or second reservoir to said discard reservoir when said fluid is submitted to centrifugal force in a microcolumn thereby forming a reading chamber where the emission wavelengths of the fluorophores can be read.
  • the microcolum can be, by way of example, a microcolumn of about 0.2mm of diameter and about 4mm length, wherein the filter, consisting of an agarose gel, silica, methacrylate, polyacrylamide, or any other chromatographic support capable of separating by exclusion or by chemical interaction the nucleic acids of interest is loaded before using the system for the method herein described.
  • Gel filtration chromatography is an analytical process commonly used in order to separate substances having high molecular weights such as proteins or nucleic acids from low molecular weight components.
  • the flow through the chromatographic column is commonly obtained through gravity or peristaltic pumps.
  • the flow of the mixture comprising the nucleic acid of interest, if present, specifically bound to the reactants as defined in the present description and in the claims is ensured by the centrifugal strength applied to the microfluidic system.
  • the macromolecules in the mixture comprising the biological fluid and the reactants flow through the filter according to their molecular weight, the smaller molecules, including unbound reactants, eluting from the column while the larger molecules such nucleic acids genomes being retained in the filter.
  • the filter according to the invention can be selected in order to retain the molecules of interest and may be selected according to two different methodologies: i) size exclusion chromatographic mode or ii) porous ulirafiltration membrane.
  • size exclusion chromatography a homogeneous gel substance is used, most often agarose.
  • agarose gel the percent of agarose is selected according to the specific nucleic acid of interest.
  • An aqueous solution comprising the desired percentage of agarose is warmed up for some minute in order to dissolve the agarose and poured in the microfluidic system microcolumn described above before use.
  • the percent weight/volume of agarose of the gel can be calculated in order to obtain
  • the filter may consists of a solid thin layer with with pore size range of 1-100 nm, and a molecular weight cut-off range of 1k-500k Da. These membranes possess high overall retention rate, which allows for retention of macromolecules, both nucleic acids and proteins. Regarding the overall stability, the ultrafiltration membranes have the advantage of higher mechanical stability with respect to the gel based filters and also greater chemical stability.
  • Typical porous membranes can be made either of cellulose, polycarbonate or polyether sulfone. Preferably, membranes with a cut-off of 30 kDa or less are used.
  • the nucleic acid of interest is SARS-Cov-2 RNA.
  • the reported length of the single stranded RNA of the virus is of about 29811 nucleotides.
  • RNA bound to the reactant as defined above has, therefore, a dimension of about 30 kb, therefore, an agarose gel of 0.4-0.6% w/v, preferably of about 0.5% w/v retains the viral genome while the unbound reactants, of a size below 70 nucleotides flow through the gel when the centrifugal force is applied.
  • a rinsing step can be carried out with a suitable rinsing buffer, that could be, e.g. the commonly used Tris- EDTA buffer, can be flown through the filter by opening the microvalve of the third reservoir comprising the rinsing buffer and submitting the system once more to centrifugal force.
  • a suitable rinsing buffer that could be, e.g. the commonly used Tris- EDTA buffer
  • the filter is then submitted to irradiation at the excitation wavelength of the fluorophore/s used, at the emission wavelength is measured.
  • Fluorescent detection indicates the presence of the nucleic acid of interest in the biological fluid assayed. Fluorescent detection can be achieved using single-photon avalanche diode (SPAD) or similar solid-state photodetector within the same family as photodiodes and avalanche photodiodes (APDs). Under appropriate laser diode excitation, assuming a quantum yield of 1 and absence of internal filter effect, a few hundreds of molecules could be eventually detected within the 1 microliter volume of the observation channel.
  • SPAD single-photon avalanche diode
  • APDs avalanche photodiodes
  • microfluidic system wherein the complex nucleic acid of interest-fluorescent specific reactant is trapped in a filter positioned in a microfluidic column as described in the present specification, allows the concentration of said complex in a very small volume (less than 1 microliter) thereby allowing the detection of the nucleic acid of interest even if present in sub femtomolar concentration.
  • microvalves also defined in the device as reactant valve 142 and reactant valve 143, can be made in the form of a one-way valve and configured for a single use.
  • each of said valve is made of paraffin, or a similar substance, which dissolves with heat.
  • the melted paraffin adheres to the microfluidic path walls, i.e. the conduit walls, and does not affect the testing process.
  • valves can be carried out by heating said valve thereby melting the same.
  • the valve can be coated with, or in proximity of a photoabsorbent material, that can be selectively heated, e.g. by a laser beam so to melt the proximal paraffine valve.
  • the detection method of the invention in any of the embodiments disclosed above and claimed can be carried out on a microfluidic system consisting of a testing device (1) comprising:
  • ⁇ a disk-shaped main body (100), configured to be rotatable about a spinning axis (110) thereof;
  • microfluidic path obtained on said main body (100), which microfluidic fluidic path (10) defines at least one testing region (11), said testing region (11) including:
  • ⁇ a first reservoir (A), configured to receive said biological fluid
  • a second reservoir configured to receive said fluid comprising one or more reactant specifically binding said nucleic acids of interest;
  • ⁇ a detection chamber or portion comprising said filter (160), arranged at a greater radial distance from the spinning axis (110) with respect to said first reservoir (A) and/or second reservoir (B);
  • conduits (131, 132) connecting said first reservoir (A) and/or said second reservoir (B) to said detection chamber or portion (160) for adducting thereto said mixture, wherein the arrangement is such that rotation of said main body (100) determines the adduction of said mixture from its respective reservoir (A, B) towards said detection chamber or portion (160) by effect of centrifugal force.
  • Another object of the invention is a method for diagnosing an infection or the ongoing of an infectious disease in a subject said method comprising the steps of the microfluidic method for the detection of nucleic acids of interest in a biological fluid in any of the embodiments described herein and in the claims, wherein the detection of said nucleic acid of interest indicates the presence of said infection or the ongoing of said infectious disease in said subject.
  • infection diagnosed is an infection by SARS-Cov-2 and the disease diagnosed disease is COVID-19.
  • 1 ml of a saliva sample, collected in a syringe is added to compartment A.
  • 1 mL of the lysis buffer comprising i) from 354 to 708 mg guanidine isothiocyanate (or 1 mg Triton X-100, or 5 mg Tween 20); ii) 0.1 - 1 microM fluorescently labelled oligonucleotides (comprising single or double fluorescent nucleotides or Mango extended oligonucleotides) is added to compartment B.
  • Atto 633 dye conjugated to the oligonucleotide is used in the present example.
  • the paraffin valves (142) are melt in order to allow flows from compartments A and B to the main conduit (161).
  • the mixed solution is directly heated within the main conduit above the annealing Tm (65°C) and subsequently cooled down before entering the gel phase by appropriate synchronization of the rotation speed with the volume flow through the gel section of the conduit.
  • Optimal speed in the present setup was fixed to 3800 rpm.
  • the reaction mixture is therefore separated during the flow through the gel cylinder such that oligonucleotides that are not bound to the target nucleic acid are eluted first and complexes between viral RNA and oligonucleotides are retained by the gel phase.
  • the valve 143 Upon exhaustion of the liquid phase in compartment A and B, the valve 143 is melted and a washing flow of PBS buffer is allowed in order to remove non complexed oligonucleotides from the gel moiety.
  • the high molecular weight (> 30 kb) viral DNA in complex with fluorophoric oligonucleotides can be thus probed by a dedicated laser diode source focalized on the top of the gel.
  • the wavelength of the source, 632 nm corresponds to the absorption peak of the ATTO 633 dye.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention describes a novel method for the fast detection of an analyte, typically a viral nucleic acid. The method relies on the denaturation of the viral particle and immediate mixing with pairing primers (complementary oligonucleotides) linked to a fluorophore. The RNA containing solution and the fluorescent primers containing solution are then mixed in a v-shaped conduit under centrifugal force provided by a spinning disk. Once mixed, the reactants are heated and forced through a molecular sieve that separates larger viral nucleic acid complexed with fluorescent primers from unreacted oligonucleotides. Labelled viral molecules are then probed by a focalized laser light at the absorption wavelength of the fluorophore while physically trapped into the molecular sieve.

Description

MICROFLUIDIC METHOD FOR THE DETECTION OF NUCLEIC ACIDS
The present invention relates to a method for the detection of nucleic acids of interest in a biological fluid.
STATE OF THE ART
The medical and scientific community has been constantly searching for effective and rapid methods for detecting nucleic acids of interest in biological samples such as biological fluids, such as serum, saliva, urine and the like, in order to allow non-invasive, fast and effective diagnoses. Such d methods find application in each sanitary infrastructure and particularly in disadvantaged area or in case of epidemic diseases.
In recent times, such a need for rapid and reliable tests capable of detecting a target molecule or substance in a biological sample has been brought to worldwide attention to a greater extent, with the COVID-19 pandemic diffusion.
Due to the particular infectious rate of SARS-Cov-2, to the high mortality of the disease deriving from said infection and to the presence of an extremely high percentage of asymptomatic patients, the need of providing a rapid and effective method for diagnosing the infection or to assess the previous occurrence thereof, i.e. to identify individuals that have been infected by the disease and have recovered therefrom, is strongly felt worldwide.
The development of rapid tests allowing an early detection of infections from agents causing epidemic or pandemic diseases thus allowing the enforcement of prompt medical and social measures.
The pandemic caused by SARS-Cov-2 infection highlighted the need of faster, yet extremely sensitive, methods for promptly detecting the infection in the largest amount of individuals as possible.
The devices and methods known in the art generally require several steps to arrive at the final detection, which steps are often performed by separate technical means or sub-devices, if not even at different locations. These know-art testing modes entail relevant costs and times for providing results and tend to be prone to risks of mistakes, e.g. as associated with sample misplacement and/or contamination.
For example, the known art methods for nucleic acid detection, such as PCR, require the collection of the biological sample upon a swab and subsequent multiple working cycles, with an important impact in terms of time and in complexity of the overall testing process.
Moreover, the testing set-up requires specialized (para-)medical personnel and technicians for the test to be administered properly.
At present, in particular with the COVID-19 pandemic, the need of an extremely rapid and simple detection method, that can be carried out with small dimension and moderately expensive devices, by way of examples in airports, factories, firms and public or populated sites, is strongly felt.
DESCRIPTION
SUMMARY OF THE INVENTION
The present invention provides a microfluidic method that allows a fast and reliable detection of nucleic acids of interest in a sample.
The realization of a microfluidic method as disclosed in the present description allows to detect a very small amount of nucleic acids of interest in a sample, wherein no amplification steps are required, thereby providing an extremely rapid and sensitive tool for detecting, by way of example, infectious agents, in the sample tested.
The inventors have in fact found that the microfluidic method herein disclosed allows to concentrate the nucleic acid of interest, if present in the tested sample, in a millimetric volume, thereby enabling the detection of very small amounts of the target molecules.
Studies on the recent pandemics of SARS-Cov-2 report that the median viral load in posterior oropharyngeal saliva or other respiratory specimens at presentation was 5.2 log10 copies per mL (IQR 4.1-7.0). Salivary viral load was highest during the first week after symptom onset and subsequently declined with time (slope -0.15, 95% Cl -0.19 to -0.11; R2=0.71). Furthermore, most publications report that SARS- Cov-2 is present even at very early stages of the infection in most patients tested.
Due to the fact that transmission of the virus is known to happen mainly through breath droplets, it is clear that saliva is loaded with copies of the virus that are sufficient for a very effective spread of the infection.
The method disclosed and claimed herein allows an effective and accurate detection of the virus in biological fluids, including saliva, in a time period of minutes, i.e from about 5 to 30 minutes from the collection of the sample, in particular from about 5 to 20 minutes from the collection of the sample when the sample used is saliva.
The method can be carried out in a simple and small microfluidic system, and can be carried out by operators that require a simple training for the use of the system without the need of specialised laboratories and operators. Such a method is of particular interest for rapid screenings of individuals, such as screenings that could be of need in ariports, train stations, offices, factories and the like.
Objects of the present invention are, therefore, a microfluidic method for the detection of nucleic acids of interest in a biological fluid comprising the following steps: mixing said biological fluid with one or more reactant specifically binding said nucleic acids of interest, said reactant being chemically bound to a fluorescent moiety and a denaturing buffer, submitting the mixture thus obtained at temperature conditions suitable for obtaining a selective binding between said nucleic acid of interest, if present in said biological fluid, and said one or more reactant; loading said mixture in a single reservoir (A+B) of a microfluidic system wherein said reservoir is separated from a discard reservoir by a filter apt to capture said nucleic acids of interest, said filter being positioned so to allow the passage of a fluid from said reservoir to said discard reservoir when said fluid is submitted to centrifugal force; submitting said mixture to centrifugal force thereby obtaining a filter wherein said nucleic acids of interest linked to said reactants are captured, if present in said biological fluid; submitting said filter to irradiation at the excitation wavelength(s) of said fluorescent moiety and assessing the presence or absence of said molecules of interest by registering the “amount of fluorescence” at the emission wavelength(s) of said fluorescent moiety, wherein an emission of fluorescence at the emission wavelength(s) of said fluorescent moiety indicates the presence of said molecules of interest in said biological fluid and to a method for diagnosing an infectious disease in a subject said method comprising the steps of said detection method, wherein the detection of said nucleic acid of interest indicates the presence of said infectious disease in said subject.
DETAILED DESCRIPTION OF THE FIGURES
Figures 1A and IB refer to a testing device 1 comprising the microfluidic system suitable for carrying out the methods according to the invention and show each a schematic plan view of a respective side, or face, of a support disk of such device; the testing device 1 comprises a main body, or support frame, 100.
The main body 100 is in the form of a disk, i.e. with a substantially circular profile in plan view and a flat shape, with two planar dimensions prevailing with respect to its thickness. In particular, two main sides, or faces, of the main body 100 are shown in Figures 1A and IB, respectively, and therein denoted by 101 for a first side and 102 for a second side.
Figure 2A shows a schematic plan view of an enlarged part of a first side of the support disk represented in Figure 1 A;
Figure 2B shows a schematic plan view of an enlarged part of a second side of the support disk represented in Figure IB; and
Figure 3 shows a block diagram of a testing system according to a preferred embodiment of the invention that includes the support disk of the previous figures.
The system 200 includes a testing unit 201 that receives the testing device 1, and in particular its main body 100. Advantageously, the testing unit 201 has a structure similar to that of a DVD player, in particular including a movable, e.g. extractable, drawer 202 configured to receive the disk 100.
Globally, the test equipment implemented by the apparatus 200 may be roughly the size of a table DVD player, e.g. (42 x 26 x10) cm.
An optical encoder device 202 associated with system 200, and in particular with unit 201, allows the disk 100 to stop in different positions/stations of measurement, treatment and/or detection. To this aim, the device 1, and in particular its main body 100, can bear optical markers.
Figure 4 represents a brief scheme of the core part of the system and method of the invention, the content of the first reservoir is indicated as A, the content of the second reservoir is indicated as B. The rinsing and discard reservoirs are not represented.
The system 200 comprises optical detecting means 203 configured to detect fluorescence in the detection chamber 160. This same means can be used to heat the photoabsorbent material 152, 153 associated with the paraffin valves 142, 143.
A control unit 204 programmed with a testing or analysis software can be incorporated into unit 201 or provided separately.
The control unit 204 controls and commands operation of the other system components, preferably according to the loading and analysis steps of a testing method disclosed below. Bilateral, possibly wireless, communication between unit 204 and the other system components is provided.
Figure 4 shows the target sequence in SARS-Cov-2 genome accession number MN908947 version (MN908947.3) of probes having SEQ IDs 1-28.
DETAILED DESCRIPTION OF THE SEQUENCES PRIMERS
Specific RNA sequences are disclosed that corresponds to commonly used primers for viral RNA recognition, currently used in RT-PCR methods. Such sequences have been validated for their recognition properties and annealing temperatures [Udugama et al “Diagnosing COVID-19: The Disease and Tools for Detection” ACS Nano 2020, 14, 4, 3822-3835 Publication Date:March 30, 2020] .
SEQUENCE LISTING
SEQ ID NO 1
5'- TCTGGTTACTGCCAGTTGAATC -5'
SEQ ID NO 2
5'- GGTCCACCAAACGTAATGCGGGGT -5'
SEQ ID NO 3
5'- TTTGCGGCCAATGTTTGTAA -5'
SEQ ID NO 4
5'- GCGCGACATTCCGAAGAA -5'
SEQ ID NO 5
5'- CTGAAGCGCTGGGGGCAAATTGT -5'
SEQ ID NO 6
5'- TTTTGGTGTATTCAAGGCTCCC -5'
SEQ ID NO 7
5'- TGTAGCACGATTGCAGCATTG -5'
SEQ ID NO 8
5'- CAGGATTGCGGGTGCCAATGTGRT -5'
SEQ ID NO 9
5'- TTAAGTGTAAAACCCACAGGG -5'
SEQ ID NO 10
5'- CCATAACCTTTCCACATACCGCAGACGG -5'
SEQ ID NO 11 5'- ATTCTAGCAGGAGAAGTTCCCC -5'
SEQ ID NO 12
5'- CAGACATTTTGCTCTCAAGCTG -5'
SEQ ID NO 13
5'- AATCTGTCAAGCAGCAGCAA -5'
SEQ ID NO 14
5'- CCGCCACACATGACCATYTCAC -5'
SEQ ID NO 15
5'- CARATGTTAAASACACTATTAGCATA -5'
SEQ ID NO 16
5'- GCATCTCCTGATGAGGTTCCACCTG -5'
SEQ ID NO 17
5'- ACGCTATTAACTATTAACGTACCTGT -5'
SEQ ID NO 18
5'- ATATTGCAGCAGTACGCACACA -5'
SEQ ID NO 19
5'- CGAAGCGCAGTAAGGATGGCTAGTGT -5'
SEQ ID NO 20
5'- AGGTTACCYGTAAARCCCCA -5'
SEQ ID NO 21
5'- AACRCGCTTAACAAAGCACTC -5'
SEQ ID NO 22
5'- CCGCAAATTGCACAATTTGC -5'
SEQ ID NO 23
5'- CCGCAAATTGCACAATTTGC -5'
SEQ ID NO 24
5'- TGGCAGCTGTGTAGGTCAAC -5'
SEQ ID NO 25
5'- TCCATGCCAATGCGCGACAT -5'
SEQ ID NO 26
5'- ATCTGAGGGTCCACCAAACG -5' SEQ ID NO 27
5'- CCCCACTGCGTTCTCCATT - 5'
SEQ ID NO 28
5'- TGGTTACTGCCAGTT -5'
Wherein R is a purine (A or G) and Y is a pyrimidine (C or T) S is G or C
Each sequence listed can also be intended as RNA sequence, in this case, each T is substituted by U.
Further sequences herein disclosed coding for RNA aptamers capable of recognizing a specific fluorophore moiety and enhancing the emissivity of such fluorophore can be used in order to generate a fluorescence detection system alternative to the directly fluorophore conjugated primer described above.
SEQ ID NO 29 Mango I aptamer
5' CGCACGUACGAAGGGACGGUGCGGAGAGGAGAGUACGUGC 5'
SEQ ID NO 30 Mango Π aptamer
5' GGCACGUACGAAGGAGAGGAGAGGAAGAGGAGAGUACGUGC 5'
SEQ ID NO 31 Mango III aptamer
5' GGC ACGU ACG AAGG AAGG AUU GGU AU GU GGU AU AUU GCU ACGUGCC 5'
SEQ ID NO 32 Mango IV aptamer
5' GGCACGUACCGAGGGAGUGGUGAGGAUGAGGCGAGUACGUGC 5'.
GLOSSARY
Aptamers: RNA sequences capable of non-covalent recognition of a specific fluorophore.
Microfluidic system has the meaning commonly used in the art and refer to a system that transports, mix, separates, analyses or otherwise processes fluids usually in the range of microliters to picoliters, in networks of channels with dimensions from tens to hundreds of micrometers. Fluorophore: small organic molecule endowed with fluorescent properties
Oligonucleotides: RNA sequences capable of pairing with complementary RNA sequences on the target RNA molecule.
Oligonucleotide probes: RNA or DNA sequences of approximately 10-100 nucleotides, capable of pairing with complementary sequences on the target nucleic acid molecule.
DETAILED DESCRIPTION OF THE INVENTION The present invention provides a method that allows a fast detection of nucleic acids of interest from a biological fluid in a microfluidic system.
The method enables to minimize the detection time of the molecules of interest reducing said time from hours to minutes. The utilization of a suitable device where all reactants are preloaded and only the sample has to be loaded by an operator, enables also general operators to carry out the detection.
An object of the invention is therefore a microfluidic method for the detection of nucleic acids of interest in a biological fluid comprising the following steps: mixing said biological fluid with one or more reactant specifically binding said nucleic acids of interest, said reactant being chemically bound to a fluorescent moiety and a denaturing buffer, submitting the mixture thus obtained at temperature conditions suitable for obtaining a selective binding between said nucleic acid of interest, if present in said biological fluid, and said one or more reactant; loading said mixture in a single reservoir (A+B) of a microfluidic system wherein said reservoir is separated from a discard reservoir by a filter apt to capture said nucleic acids of interest, said filter being positioned so to allow the passage of a fluid from said reservoir to said discard reservoir when said fluid is submitted to centrifugal force; submitting said mixture to centrifugal force thereby obtaining a filter wherein said nucleic acids of interest linked to said reactants are captured, if present in said biological fluid; submitting said filter to irradiation at the excitation wavelength(s) of said fluorescent moiety and assessing the presence or absence of said molecules of interest by registering the “amount of fluorescence” at the emission wavelength(s) of said fluorescent moiety, wherein an emission of fluorescence at the emission wavelength(s) of said fluorescent moiety indicates the presence of said molecules of interest in said biological fluid.
In a particular embodiment of the invention, said step of mixing said biological fluid with one or more reactant is carried out by loading said biological fluid, optionally suspended in a suitable lysis buffer in a first reservoir (A) of said microfluidic system, loading in a second reservoir (B) of said microfluidic system, a fluid comprising said one or more reactant specifically binding said nucleic acids of interest, said second reservoir being separated from said first reservoir by one or more microvalve; wherein said first and/or second reservoir are separated from a discard reservoir by a filter apt to capture said nucleic acids of interest, said filter being positioned so to allow the passage of a fluid from said first and/or second reservoir to said discard reservoir when said fluid is submitted to centrifugal force; and opening said microvalve separating said first reservoir from said second reservoir thereby obtaining a single reservoir (A+B) comprising said mixture of said biological fluid and said fluid comprising reactants.
According to the invention, the nucleic acids of interest can be pathogen genomes, such as bacterial genomes, protozoan genomes, viroids RNA, viral DNA or RNA genomes.
In an embodiment of the invention, the nucleic acids of interest are viral genomes, such as DNA or RNA viral genomes.
A non-limiting example of viral genomes is represented by SARS-Cov-2 RNA, Ebolavirus RNA, Dengue Virus RNA, West Nile Virus RNA, Yellow fever virus RNA, Zika Virus RNA, Chikunguya Virus RNA, Herpes Virus DNA, HPV Virus DNA, HBV Virus DNA, HBC Virus RNA.
In a preferred embodiment the nucleic acid of interest is SARS-Cov-2 RNA. nucleic acid of interestnucleic acid of interest.
The method of the invention can be carried out on biological fluids such as saliva, blood serum, urines. In a preferred embodiment, the biological fluid analysed for the detection of the molecules of interest is saliva.
When the nucleic acid of interest is a molecule normally surrounded by a shell, or by a membrane, such as a viral genome, the body fluid is suspended in a suitable lysis buffer which causes the disruption of said shell or membrane. In an alternative embodiment of the method of the invention, the lysis buffer can be also a denaturing buffer and can therefore be loaded directly in reservoir B.
In one embodiment, said buffer can be pre-loaded in the vial for the sample collection, thereby avoiding a possible contamination of the buffer with other agents and simplifying the operational steps of the method.
Lysis buffers for viral particle lysis are well known in the art and several buffers of the kind are commercially available. The state of the art also provides various protocols for the preparation of viral lysis buffers. Lysis buffers suitable for the disruption of the viral shells may contain detergents, denaturing agents, chelating agents as well as proteinases. Said agents provide for the disruption of the viral shell and, at the same time, are effective in deactivating nucleases such as RNAses or DNAses that may be present in the biological fluid.
By way of example, a lysis buffer according to the invention is a buffer containing one or more of guanidine salts such as guanidine thiocyanate, guanidine isothiocyanate, guanidine chloride, 2 mercaptoethanol, SDS, Tween 20, Triton X- 100, EDTA, phenol, NP40. The buffer may further contain optionally proteinase K. Viral lysis buffer containing SDS and EDTA are well known in the art as well as buffers containing guanidine thiocyanate and phenol, guanidine salts and proteinase K and the like. Said buffers are suitable for the method according to the present invention.
Possible lysis/denaturing buffer are buffers comprising a guanidine salt, such as guanidine thiocyanate 2-6 M, such as 2M, 4M or 6M. The presence of guanidine thiocyanate, lowers the denaturing and annealing temperatures of the method of the invention.
In a preferred embodiment, the fluids in the first reservoir and in the second reservoir have a similar viscosity thereby allowing an efficient mixing of said fluids once they come in contact one with the other.
According to the method of the invention the fluid comprising one or more reactant specifically binding to the nucleic acid of interest can be common hybridisation buffers. The reactant is selected depending on the nucleic acid of interest.
When more than one reactant is used, each reactant selectively binds a different and non-overlapping portion of said nucleic acid of interest.
When the nucleic acid of interest is a viral nucleic acid, such a Viral DNA or a Viral RNA (single stranded or double stranded) suitable reactants are DNA or RNA oligonucleotides that are complementary to the nucleic acid of interest and that are specific for the same, i.e. they selectively bind the nucleic viral nucleic acid of interest, said oligomers being conjugated with a fluorophore group.
Preferably, unless mutations in the selected complementary region of the viral nucleic acid are known, the oligonucleotide probes selected are 100% complementary to the target region of the viral nucleic acid.
A large number of oligonucleotides that can be used in order to carry out the method of the invention are well known in the art for various viral genomes and are commercially available. In addition, the design of nucleotides selectively binding a known sequence of interest is well known to the skilled person and various commercial softwares that enable the skilled user to design suitable oligonucleotides specifically binding a precise target sequence (i.e. that do not show crossreactions or binding aspecificity) are also available.
According to any embodiment of the invention, said oligonucleotides can be in the form of DNA oligonucleotides or RNA oligonucleotides.
In an embodiment of the invention, the oligonucleotide probe optionally comprises one or more chemically modified nucleotide, and wherein said oligonucleotide is chemically bound at its 5' and/or 5' end to a fluorescent moiety.
The skilled person knows how to easily select chemically modified nucleotides in order to, e.g. improve binding affinity and specificity, to resist nuclease degradation and the like.
Said nucleotides are commonly known in the art and the oligonucleotide probes of the invention may comprise 1, 2, 3 or even 4 of said modified oligonucleotides. Preferably, according to any embodiment of the invention the probe oligonucleotides are of a length from 14 to 60 nucleotides.
According to a preferred embodiment, the fluorescent moiety is a fluorophore and it is covalently bound directly to said probe covalently.
Suitable fluorophores according to the invention will be discussed below.
In another embodiment of the invention, the oligonucleotide probe can be comprised in a molecular beacon and is chemically bound at one end to fluorescent moiety comprising a fluorophore and to the other end to a moiety comprising a quencher of said fluorophore.
Molecular beacons probes are well known in the art. The oligonucleotide probe or probes according to the invention can be incorporated in a molecular beacon by addition at each end, e.g. of a pair of short, complementary to each other, nucleotide strands, each, respectively bound to a fluorofore and to it’s quencher. As well known in the art, upon hybridisation with the target sequence, the fluorophore and the quencher will be spaced one from the other and the fluorophore will be no longer quenched and will emit light upon irradiation at a suitable wavelength.
In a yet further embodiment of the invention the fluorescent moiety can be an aptamer-fluorophore complex and, each oligonucleotide can be synthesized with an aptamer tail either at 5' or 5', or eventually an array of aptamers.
Aptamers are in vitro selected DNA or RNA molecules that are capable of forming complexes with suitable fluorophores, a suitable example of Aptamers-fluorophore complexes as fluorescent moieties according to the invention is provided by Mango Aptamer-fluorophores, such as like Mango I-IV.
A non-limiting example of suitable RNA Aptamer sequences according to the invention is provided with SEQ IDs 29-32 as described in Alexis Autour et al., “Fluorogenic RNA Mango aptamers for imaging small non-coding RNAs in mammalian cells” Nature Communications 9, 656 (2018). Suitable fluorophores complexing with Mango aptamers are represented, e.g. by TO1 -Biotin.
Preferably, when more than one probe is used, said probes are selected in order to hybridise at a sufficient distance on the nucleic acid of interest, in order to avoid steric hindrance during hybridisation, thereby allowing an effective annealing of each probe on the target sequence. Additionally, the position of the fluorescent moiety can be designed so to be at the opposite ends of the adjacent primers on the target nucleic acid of interest.
A list of suitable fluorophores, indicating the excitation maximum wavelength, the maximum excitation wavelength and their suitable quencher is provided in table 1 below.
Table 1.
Therefore, according to the invention, suitable fluorophores can be selected from: Alexa 350; Atto 390; Pacific blue; Atto 436; Marina blue; Acridine; Edans; Coumarin; Atto 465; BODIPY 493/503; Cy2; Atto 488; BODIPY FL-X; DANSYL; Alexa 488; Atto 495; FAM; Oregon Green; Atto 514; Rhodamine Green-X; NBD-X; TET; Atto 520; Alexa 430; BODIPY R6G-X; JOE; Yakima Yellow; Atto 532; Alexa 532; VIC; HEX; R6G; Atto Rho6G; Alexa 555; BODIPY 564/570; BODIPY TMR- X; Cy3; Alexa 546; TAMRA; Atto 550; Rhodamine Red-X; BODIPY 561/591; Atto 565; Atto Rho3B; Atto Rho 11; Redmond Red; Cy3-5; Atto Rho 12; ROX; Alexa 568; Cal Red; Atto Thio 12; Atto Rho 101; BODIPY TR-X; Alexa 594; Atto 590; Atto Rho 13; Atto 594; Atto 610; LC Red 640; BODIPY 630/650-X; Atto 620: Atto Rho 14; Alexa 633; Atto 663; BODIPY 650/665-X; Alexa 647; Atto 647; Atto 647N; Cy5; Atto 655; Atto Oxa 12; Atto 655; Alexa 660; Cy5.5; Atto 680; Alexa 680; LC Red 705; Atto 700; Alexa 700; Atto 725; Atto 740; Alexa 750 When a molecular beacon is used, if the fluorophore is selected from Alexa 350; Atto 390; Pacific blue; Atto 436; Marina blue; Acridine; Edans; Coumarin; Atto 465; BODIPY 493/503; Cy2; Atto 488; BODIPY FL-X; DANSYL a suitable quencher can be Dabcyl. When the fluorophore is selected from Alexa 488; Atto 495; FAM; Oregon Green; Atto 514; Rhodamine Green-X; NBD-X; TET; Atto 520; Alexa 430; BODIPY R6G-X; JOE; Yakima Yellow; Atto 532; Alexa 532; VIC; HEX a suitable quencher can be BHQ-1. When the fluorophore is selected from R6G; Atto Rho6G; Alexa 555; BODIPY 564/570; BODIPY TMR-X; Cy3; Alexa 546; TAMRA; Atto 550; Rhodamine Red-X; BODIPY 561/591; Atto 565; Atto Rho3B; Atto Rho 11; Redmond Red; Cy3-5; Atto Rho 12; ROX; Alexa 568; Cal Red; Atto Thio 12; Atto Rho 101; BODIPY TR-X; Alexa 594; Atto 590; Atto Rho 13; Atto 594; Atto 610; LC Red 640 a suitable quencher is BHQ-2; and when the fluorophore is selected from BODIPY 650/665-X; Alexa 647; Atto 647; Atto 647N; Cy5; Atto 655; Atto Oxa 12; Atto 655; Alexa 660; Cy5.5; Atto 680; Alexa 680; LC Red 705; Atto 700; Alexa 700; Atto 725; Atto 740; Alexa 750 a suitable quencher can be BBQ-650.
Other known fluorophores and quenchers can be used based on their absorbtion wavelengths, emission wavelengths and quenching ranges. By way of example, BHQ-3 is a suitable quencher for Cy 5 and Cy 5.5.
When probes with different fluorophores are used, in a preferred embodiment, fluorophores with the same adsorption wavelength and a different emission wavelength are selected.
The skilled person can easily select couples of fluorophores with the above mentioned characteristics, in a non-limiting example a probe bound to DANSYL and a probe bound to Edans can be used, in this case both fluorophores can be excited with an UV laser beam and DANSYL will emit blue light whereas Edans will emit green light, another suitable couple of fluorophores is Coumarin and Alexa 434, both fluorophores will be excited with a blue/violet laser beam and Coumarin will emit blue light whereas Alexa 434 will emit yellow light. Other suitable pairs can be easily selected by the skilled person based on the maximum Absorbtion wavelength and Maximun emission wavelength of each fluorophore.
According to a preferred embodiment of the invention, the target nucleic acid is SARS-Cov-2 RNA.
A number of suitable oligonucleotides specifically binding SARS-Cov-2 RNA have been published in scientific literature and have been rendered available to the public. By way of example, U.S. CDC, China CDC, Charite Germany, Hong Kong University, National Institutes of Infectious Diseases (Japan), National Institutes of Health (Thailand) and many others have published a number of PCR primers and probes that can be used as oligonucleotides according to the invention. Reverse primers can be used according to the published sequence, as well as the complementary sequence of the published forward primers and probes. Further probes can be readily designed as the sequence of the SARS-Cov-2 is also published. In order to detect all SARS-Cov-2 variants, in a preferred embodiment of the invention a mixture of different oligonucleotides selectively binding to different regions of the viral RNA are used.
The oligonucleotides can be selected in order to bind to different genes of the viral RNA or to different regions of the same gene. Suitable oligonucleotides can be of 14- 60 nucleotides in length, preferably 14-40 nucleotides.
Advantageously, oligonucleotides targeting one or more sequence of one or more of SARS-Cov-2 Orf1 gene (human RNA polymerase protein), N-gene (nucleocapsid protein), E-gene (envelope protein) and S-gene (spike protein) can be used in order to avoid false negatives due to the presence of a mutation in a target binding site. Suitable probes for the detection of the Sars-Cov-2 comprise one or more oligonucleotide of SEQ ID NO 1-28. When more than one probe is used, said oligonucleotides can be selected in order to bind different complementary target reasons in order to avoid steric hindrance and possible cross annealing among probes. Given the known sequence of Sars-Cov-2 an the target sequence of each probe can be easily positioned on the nucleic acid sequence and the sufficiently distant probes, e.g. probes hybridising to target sequences having a distance from each other of at least 300 nucleotides, preferably at least 500 nucleotides and even more preferably of at least 750 nucleotides can be selected.
Additionally, as the high stringency annealing temperature in the buffer used can be easily calculated for each probe from the its nucleotide sequence, probes with similar annealing temperatures can be selected.
According to the method of the invention, when the nucleic acid of interest is a viral nucleic acid, once the mixture of biological fluid and the fluid comprising the reactants is obtained, the mixture is submitted to temperature conditions that allow the specific binding of the reactants with the nucleic acid of interest.
As the nucleic acid of interest can be a double strand or a single strand nucleic acid. In the case the nucleic acid of interest is double stranded, the mixture is submitted to denaturation by increasing the temperature thereof to a suitable denaturation temperature that can be readily calculated based on the sequence of the oligonucleotide probe selected and on the composition of the lysis and/or denaturing buffer used. As single stranded nucleic acids, such as RNA genomes may present some double stranded portion, the mixture can also be submitted to denaturation as explained above if needed. The denaturation step can be carried out for a period of time of about 20 to 90 seconds. The mixture will be then submitted to a suitable annealing temperature, that can be calculated based on the probes sequence and on the lysis/denaturation buffer used, allowing the selective, specific, binding of the probes to the target sequence and not allowing aspecific binding (commonly defined as high stringency temperature). As well known by the skilled person, the temperature can be easily calculated depending on the length and composition in ATGC of the oligonucleotide probes used and on the chemical composition of the lysis/denaturation buffer.
The mixture can be submitted to shaking before denaturation and/or annealing. According to the invention, the temperature conditions may comprise a denaturing step at a temperature from 50°C to 96°C and/or an annealing step at a temperature from 30°C to 70°C.
Depending on the nucleic acid of interest, on the probe/s selected and on the denaturing buffer used, the denaturing step can be avoided and the temperature conditions will only comprise an annealing step as described in the present specification.
In an embodinment, said denaturing step, if present, is carried out from 30’ to 90’ and wherein said annealing step is carried out from 30’ to 90’.
When a lysis and/or denaturing buffer comprising a guanidine salt such as guanidine thiocyanate, or guanidine isothiocyanate 2-6 M, the annealing temperature can be from about 20 to 70°C, such as about 30, about 40, about 45, about 48, about 50, about 54, about 56, about 58, about 60, about 62, about 64, about 68 °C depending on the guanidine salt and on the overall salt concentration of the buffer and on the sequence of the selected probes. The annealing temperature will be held, before applying the centrifugal force for a time period from 30 to 70 seconds.
The centrifugal force is then applied to the microfluidic system by spinning said system at between 400 and 1200x g.
In a preferred embodiment of the invention the microfluidic system is built in the device depicted in the drawings and defined above.
The centrifugal force applied forces the mixture as defined above through the filter into the discard reservoir, thereby providing a filter with a retentate and an eluate.
The filter according to the invention is selected so to retain the nucleic acid of interest, if present, in the mixture and to let the unbound reactant flow through in the eluate.
According to the invention, said filter is positioned so to allow the passage of a fluid from said first and/or second reservoir to said discard reservoir when said fluid is submitted to centrifugal force in a microcolumn thereby forming a reading chamber where the emission wavelengths of the fluorophores can be read. The microcolum can be, by way of example, a microcolumn of about 0.2mm of diameter and about 4mm length, wherein the filter, consisting of an agarose gel, silica, methacrylate, polyacrylamide, or any other chromatographic support capable of separating by exclusion or by chemical interaction the nucleic acids of interest is loaded before using the system for the method herein described.
Gel filtration chromatography is an analytical process commonly used in order to separate substances having high molecular weights such as proteins or nucleic acids from low molecular weight components. The flow through the chromatographic column is commonly obtained through gravity or peristaltic pumps. In the method according to the invention, the flow of the mixture comprising the nucleic acid of interest, if present, specifically bound to the reactants as defined in the present description and in the claims, is ensured by the centrifugal strength applied to the microfluidic system.
Under the centrifugal force applied, the macromolecules in the mixture comprising the biological fluid and the reactants flow through the filter according to their molecular weight, the smaller molecules, including unbound reactants, eluting from the column while the larger molecules such nucleic acids genomes being retained in the filter.
The filter according to the invention can be selected in order to retain the molecules of interest and may be selected according to two different methodologies: i) size exclusion chromatographic mode or ii) porous ulirafiltration membrane. In the case of size exclusion chromatography, a homogeneous gel substance is used, most often agarose. When an agarose gel is used, the percent of agarose is selected according to the specific nucleic acid of interest. An aqueous solution comprising the desired percentage of agarose is warmed up for some minute in order to dissolve the agarose and poured in the microfluidic system microcolumn described above before use.
The percent weight/volume of agarose of the gel can be calculated in order to obtain
When a porous ultrafiltration membrane is used, the filter may consists of a solid thin layer with with pore size range of 1-100 nm, and a molecular weight cut-off range of 1k-500k Da. These membranes possess high overall retention rate, which allows for retention of macromolecules, both nucleic acids and proteins. Regarding the overall stability, the ultrafiltration membranes have the advantage of higher mechanical stability with respect to the gel based filters and also greater chemical stability. Typical porous membranes can be made either of cellulose, polycarbonate or polyether sulfone. Preferably, membranes with a cut-off of 30 kDa or less are used.
In an embodiment of the invention, the nucleic acid of interest is SARS-Cov-2 RNA. The reported length of the single stranded RNA of the virus is of about 29811 nucleotides.
The RNA bound to the reactant as defined above, has, therefore, a dimension of about 30 kb, therefore, an agarose gel of 0.4-0.6% w/v, preferably of about 0.5% w/v retains the viral genome while the unbound reactants, of a size below 70 nucleotides flow through the gel when the centrifugal force is applied.
In an embodiment of the invention, once the mixture of biological fluid and fluid comprising the reactants as defined above, wherein said reactants are bound to the nucleic acid of interest, if present, is flown through the filter, a rinsing step can be carried out with a suitable rinsing buffer, that could be, e.g. the commonly used Tris- EDTA buffer, can be flown through the filter by opening the microvalve of the third reservoir comprising the rinsing buffer and submitting the system once more to centrifugal force.
The filter is then submitted to irradiation at the excitation wavelength of the fluorophore/s used, at the emission wavelength is measured.
Detection of fluorescence in the filter indicates the presence of the nucleic acid of interest in the biological fluid assayed. Fluorescent detection can be achieved using single-photon avalanche diode (SPAD) or similar solid-state photodetector within the same family as photodiodes and avalanche photodiodes (APDs). Under appropriate laser diode excitation, assuming a quantum yield of 1 and absence of internal filter effect, a few hundreds of molecules could be eventually detected within the 1 microliter volume of the observation channel.
The use of a microfluidic system according to the invention, wherein the complex nucleic acid of interest-fluorescent specific reactant is trapped in a filter positioned in a microfluidic column as described in the present specification, allows the concentration of said complex in a very small volume (less than 1 microliter) thereby allowing the detection of the nucleic acid of interest even if present in sub femtomolar concentration.
The use of a microfluidic system, allows to concentrate all the nucleic acid of interest, if present, selectively bound to fluorescent probes, in an extremely small filter as defined above, thereby allowing the detection of very small amounts of said nucleic acid. According to the invention the microvalves, also defined in the device as reactant valve 142 and reactant valve 143, can be made in the form of a one-way valve and configured for a single use. In particular, in a preferred embodiment each of said valve is made of paraffin, or a similar substance, which dissolves with heat. Advantageously, after heating the melted paraffin adheres to the microfluidic path walls, i.e. the conduit walls, and does not affect the testing process. The opening of the valves according to this embodiment can be carried out by heating said valve thereby melting the same. According to a preferred embodiment, the valve can be coated with, or in proximity of a photoabsorbent material, that can be selectively heated, e.g. by a laser beam so to melt the proximal paraffine valve.
In a preferred embodiment, the detection method of the invention in any of the embodiments disclosed above and claimed can be carried out on a microfluidic system consisting of a testing device (1) comprising:
□ a disk-shaped main body (100), configured to be rotatable about a spinning axis (110) thereof; and
□ a microfluidic path, obtained on said main body (100), which microfluidic fluidic path (10) defines at least one testing region (11), said testing region (11) including:
□ a first reservoir (A), configured to receive said biological fluid;
□ a second reservoir (B), configured to receive said fluid comprising one or more reactant specifically binding said nucleic acids of interest;
□ a detection chamber or portion comprising said filter (160), arranged at a greater radial distance from the spinning axis (110) with respect to said first reservoir (A) and/or second reservoir (B); and
□ one or more conduits (131, 132) connecting said first reservoir (A) and/or said second reservoir (B) to said detection chamber or portion (160) for adducting thereto said mixture, wherein the arrangement is such that rotation of said main body (100) determines the adduction of said mixture from its respective reservoir (A, B) towards said detection chamber or portion (160) by effect of centrifugal force.
Said device and a detection system comprising it is depicted in figures 1, 2 and 3 and each component is defined in the description of the figures.
Another object of the invention is a method for diagnosing an infection or the ongoing of an infectious disease in a subject said method comprising the steps of the microfluidic method for the detection of nucleic acids of interest in a biological fluid in any of the embodiments described herein and in the claims, wherein the detection of said nucleic acid of interest indicates the presence of said infection or the ongoing of said infectious disease in said subject.
In a preferred embodiment of the invention, infection diagnosed is an infection by SARS-Cov-2 and the disease diagnosed disease is COVID-19.
EXAMPLES
1 ml of a saliva sample, collected in a syringe is added to compartment A. 1 mL of the lysis buffer comprising i) from 354 to 708 mg guanidine isothiocyanate (or 1 mg Triton X-100, or 5 mg Tween 20); ii) 0.1 - 1 microM fluorescently labelled oligonucleotides (comprising single or double fluorescent nucleotides or Mango extended oligonucleotides) is added to compartment B. Atto 633 dye conjugated to the oligonucleotide is used in the present example. Using long-wavelength activated Atto dyes in conjunction with the appropriate excitation wavelength reduces autofluorescence due to sample, gel, glass, or polymer support, thus improving overall sensitivity in the system. The background fluorescence due to Rayleigh and Raman scattering are also dramatically reduced by use of 632 nm wavelength excitation, currently employed in the present set-up. The system is then allowed to spin up to 2500 rpm.
The paraffin valves (142) are melt in order to allow flows from compartments A and B to the main conduit (161). The mixed solution is directly heated within the main conduit above the annealing Tm (65°C) and subsequently cooled down before entering the gel phase by appropriate synchronization of the rotation speed with the volume flow through the gel section of the conduit. Optimal speed in the present setup was fixed to 3800 rpm. The reaction mixture is therefore separated during the flow through the gel cylinder such that oligonucleotides that are not bound to the target nucleic acid are eluted first and complexes between viral RNA and oligonucleotides are retained by the gel phase. Upon exhaustion of the liquid phase in compartment A and B, the valve 143 is melted and a washing flow of PBS buffer is allowed in order to remove non complexed oligonucleotides from the gel moiety. The high molecular weight (> 30 kb) viral DNA in complex with fluorophoric oligonucleotides can be thus probed by a dedicated laser diode source focalized on the top of the gel. The wavelength of the source, 632 nm, corresponds to the absorption peak of the ATTO 633 dye.

Claims

1. A microfluidic method for the detection of nucleic acids of interest in a biological fluid comprising the following steps: mixing said biological fluid with one or more reactant specifically binding said nucleic acids of interest, said reactant being chemically bound to a fluorescent moiety and a denaturing buffer, submitting the mixture thus obtained at temperature conditions suitable for obtaining a selective binding between said nucleic acid of interest, if present in said biological fluid, and said one or more reactant; loading said mixture in a single reservoir (A+B) of a microfluidic system wherein said reservoir is separated from a discard reservoir by a filter apt to capture said nucleic acids of interest, said filter being positioned so to allow the passage of a fluid from said reservoir to said discard reservoir when said fluid is submitted to centrifugal force; submitting said mixture to centrifugal force thereby obtaining a filter wherein said nucleic acids of interest linked to said reactants are captured, if present in said biological fluid; submitting said filter to irradiation at the excitation wavelength(s) of said fluorescent moiety and assessing the presence or absence of said molecules of interest by registering the “amount of fluorescence” at the emission wavelength(s) of said fluorescent moiety, wherein an emission of fluorescence at the emission wavelength(s) of said fluorescent moiety indicates the presence of said molecules of interest in said biological fluid.
2. The microfluidic method of claim 1 wherein said step of mixing said biological fluid with one or more reactant is carried out by loading said biological fluid, optionally suspended in a suitable lysis buffer in a first reservoir (A) of said microfluidic system, loading in a second reservoir (B) of said microfluidic system, a fluid comprising said one or more reactant specifically binding said nucleic acids of interest, said second reservoir being separated from said first reservoir by one or more microvalve; wherein said first and/or second reservoir are separated from a discard reservoir by a filter apt to capture said nucleic acids of interest, said filter being positioned so to allow the passage of a fluid from said first and/or second reservoir to said discard reservoir when said fluid is submitted to centrifugal force; and opening said microvalve separating said first reservoir from said second reservoir thereby obtaining a single reservoir (A+B) comprising said mixture of said biological fluid and said fluid comprising reactants.
3. The method of claim 1 or 2 further comprising the steps of: loading a rinsing buffer in a third reservoir separated from said filter by further one or more microvalves said third reservoir being positioned so to allow the passage of a fluid through said filter from said third reservoir to said discard reservoir when said fluid is submitted to centrifugal force; submitting said rinsing buffer to centrifugal force before submitting said filter to said irradiation.
4. The method of anyone of claims 1 to 3 wherein said one or more reactant selectively bind said nucleic acid of interest and wherein, when more than one reactant is present, each reactant selectively binds a different and non-overlapping portion of said nucleic acid of interest.
5. The method of claim 4 wherein said reactant is a DNA oligonucleotide probe or a RNA oligonucleotide probe optionally comprising one or more chemically modified nucleotide, and wherein said oligonucleotide is chemically bound at its 5' and/or 5' end to a fluorescent moiety.
6. The method of claim 5 wherein said probe is of 14 to 60 nucleotides in length.
7. The method of claim 8 wherein said probe is a probe consisting of or comprising SEQ ID 1-28.
8. The method of anyone of claims 5 to 7 wherein said fluorescent moiety is a fluorophore.
9. The method of anyone of claims 5 to 7 wherein said oligonucleotide is comprised a molecular beacon, and is chemically bound at one end to fluorescent moiety comprising a fluorophore and to the other end to a moiety comprising a quencher of said fluorophore.
10. The method of anyone of claims 5 to 7 fluorescent moiety is an aptamer oligonucleotide comprising a fluorophore.
11. The method of claim 10 wherein said aptamers are Mango aptamers.
12. The method of claim 11 wherein said Mango aptamers are selected from aptamers having SEQ ID 29-32.
13. The method of anyone of claims from 1 to 7 wherein said fluid comprising reactants comprise two different reactants, nucleic acid of interest and each reactant is bound, respectively, to a first fluorophore and to a second different fluorophore, said fluorophores having the same excitation wavelength and a different emission wavelength.
14. The method of anyone of claims 5 to 13 wherein said fluorophores are selected from:
Alexa 350; Atto 390; Pacific blue; Atto 436; Marina blue; Acridine; Edans; Coumarin; Atto 465; BODIPY 493/503; Cy2; Atto 488; BODIPY FL-X; DANSYL; Alexa 488; Atto 495; FAM; Oregon Green; Atto 514; Rhodamine Green-X; NBD-X; TET; Atto 520; Alexa 430; BODIPY R6G-X; JOE; Yakima Yellow; Atto 532; Alexa 532; VIC; HEX; R6G; Atto Rho6G; Alexa 555; BODIPY 564/570; BODIPY TMR- X; Cy3; Alexa 546; TAMRA; Atto 550; Rhodamine Red-X; BODIPY 561/591; Atto 565; Atto Rho3B; Atto Rho 11; Redmond Red; Cy3-5; Atto Rho 12; ROX; Alexa 568; Cal Red; Atto Thio 12; Atto Rho 101; BODIPY TR-X; Alexa 594; Atto 590; Atto Rho 13; Atto 594; Atto 610; LC Red 640; BODIPY 630/650-X; Atto 620: Atto Rho 14; Alexa 633; Atto 663; BODIPY 650/665-X; Alexa 647; Atto 647; Atto 647N; Cy5; Atto 655; Atto Oxa 12; Atto 655; Alexa 660; Cy5.5; Atto 680; Alexa 680; LC Red 705; Atto 700; Alexa 700; Atto 725; Atto 740; Alexa 750.
15. The method of claim 9 wherein said fluorophore is selected from Alexa 350; Atto 390; Pacific blue; Atto 436; Marina blue; Acridine; Edans; Coumarin; Atto 465; BODIPY 493/503; Cy2; Atto 488; BODIPY FL-X; DANSYL and said quencher is Dabcyl and/or wherein said fluorophore is selected from Alexa 488; Atto 495; FAM; Oregon Green; Atto 514; Rhodamine Green-X; NBD-X; TET; Atto 520; Alexa 430; BODIPY R6G-X; JOE; Yakima Yellow; Atto 532; Alexa 532; VIC; HEX and said quencher is BHQ-1 and/or said fluorophore is selected from R6G; Atto Rho6G; Alexa 555; BODIPY 564/570; BODIPY TMR-X; Cy3; Alexa 546; TAMRA; Atto 550; Rhodamine Red-X; BODIPY 561/591; Atto 565; Atto Rho3B; Atto Rho 11; Redmond Red; Cy3-5; Atto Rho 12; ROX; Alexa 568; Cal Red; Atto Thio 12; Atto Rho 101; BODIPY TR-X; Alexa 594; Atto 590; Atto Rho 13; Atto 594; Atto 610; LC Red 640 and said quencher is BHQ-2; and/or wherein said fluorophore is selected from BODIPY 650/665-X; Alexa 647; Atto 647; Atto 647N; Cy5; Atto 655; Atto Oxa 12; Atto 655; Alexa 660; Cy5.5; Atto 680; Alexa 680; LC Red 705; Atto 700; Alexa 700; Atto 725; Atto 740; Alexa 750 and said quencher is BBQ-650.
16. The method of anyone of claims 1 to 10 wherein said nucleic acid of interest is a viral DNA or a viral RNA.
17. The method of claim 16 wherein said viral RNA is the SARS-Cov-2 viral RNA, Ebolavirus RNA, Dengue Virus RNA, West Nile Virus RNA, Yellow fever virus RNA, Zika Virus RNA, Chikunguya Virus RNA, Herpes Virus DNA, HPV Virus DNA, HBV Virus DNA, HBC Virus RNA.
18. The method according to anyone of claims 1 to 15 wherein said lysis and or said denaturing buffer comprises a guanidine salt 2 to 6 M.
19. The method according to anyone of claims 1 to 18 wherein said temperature conditions comprise a denaturing step at a temperature from 50°C to 96°C and/or an annealing step at a temperature from 30°C to 70°C.
20. The method according to claim 19 wherein said denaturing step, if present, is carried out from 30' to 90' and wherein said annealing step is carried out from 30' to
90'.
21. The method of anyone of claims 1 to 20 wherein said filter is an agarose gel of 0.4-0.6% w/v or, a cellulose, polyether sulphone or polycarbonate porous membrane.
22. The method of anyone of claims 1 to 21 wherein said microfluidic system is a testing device (1) comprising:
□ a disk-shaped main body (100), configured to be rotatable about a spinning axis (110) thereof; and □ a microfluidic path, obtained on said main body (100), which microfluidic fluidic path (10) defines at least one testing region (11), said testing region (11) including:
□ a first reservoir (A), configured to receive said biological fluid;
□ a second reservoir (B), configured to receive said fluid comprising one or more reactant specifically binding said nucleic acids of interest;
□ a detection chamber or portion comprising said filter (160), arranged at a greater radial distance from the spinning axis (110) with respect to said first reservoir (A) and/or second reservoir (B); and
□ one or more conduits (131, 132) connecting said first reservoir (A) and/or said second reservoir (B) to said detection chamber or portion (160) for adducting thereto said mixture, wherein the arrangement is such that rotation of said main body (100) determines the abduction of said mixture from its respective reservoir (A, B) towards said detection chamber or portion (160) by effect of centrifugal force.
23. The method of anyone of claims 1 to 22 wherein said biological fluid is saliva or blood serum.
24. A method for diagnosing an infectious disease in a subject said method comprising the steps of the method defined in anyone of claims 1-23, wherein the detection of said nucleic acid of interest indicates the presence of said infectious disease in said subject.
25. The method of claim 24 wherein said disease is COVID-19.
EP21728123.7A 2020-05-26 2021-05-21 Microfluidic method for the detection of nucleic acids Withdrawn EP4158057A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
PCT/IB2020/054965 WO2021240208A1 (en) 2020-05-26 2020-05-26 Microfluidic method for the detection of nucleic acids
PCT/IB2021/054419 WO2021240319A1 (en) 2020-05-26 2021-05-21 Microfluidic method for the detection of nucleic acids

Publications (1)

Publication Number Publication Date
EP4158057A1 true EP4158057A1 (en) 2023-04-05

Family

ID=70918765

Family Applications (1)

Application Number Title Priority Date Filing Date
EP21728123.7A Withdrawn EP4158057A1 (en) 2020-05-26 2021-05-21 Microfluidic method for the detection of nucleic acids

Country Status (2)

Country Link
EP (1) EP4158057A1 (en)
WO (2) WO2021240208A1 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12492398B2 (en) * 2020-11-23 2025-12-09 Zunyi Yang Compositions for the multiplexed detection of viruses

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018137513A1 (en) * 2017-01-24 2018-08-02 北京万泰生物药业股份有限公司 System for detecting convective pcr amplification and method for detecting convective pcr amplification

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6821730B2 (en) * 2001-11-09 2004-11-23 Intel Corporation Carbon nanotube molecular labels
EP2198003A4 (en) * 2007-10-09 2018-02-28 University of Notre Dame du Lac Microfluidic platforms for multi-target detection

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018137513A1 (en) * 2017-01-24 2018-08-02 北京万泰生物药业股份有限公司 System for detecting convective pcr amplification and method for detecting convective pcr amplification

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
ALEXIS AUTOUR ET AL: "Fluorogenic RNA Mango aptamers for imaging small non-coding RNAs in mammalian cells", NATURE COMMUNICATIONS, vol. 9, no. 1, 13 February 2018 (2018-02-13), XP055488187, DOI: 10.1038/s41467-018-02993-8 *
See also references of WO2021240319A1 *
SU-XIA HAN ET AL: "Molecular Beacons: A Novel Optical Diagnostic Tool", ARCHIVUM IMMUNOLOGIAE ET THERAPIAE EXPERIMENTALIS, vol. 61, no. 2, 5 January 2013 (2013-01-05), CH, pages 139 - 148, XP055455379, ISSN: 0004-069X, DOI: 10.1007/s00005-012-0209-7 *

Also Published As

Publication number Publication date
WO2021240319A1 (en) 2021-12-02
WO2021240208A1 (en) 2021-12-02

Similar Documents

Publication Publication Date Title
US11273442B1 (en) Programmable nuclease compositions and methods of use thereof
KR101817155B1 (en) Kit and Method for detecting nucleic acids using nanoparticles
KR102392564B1 (en) Paper chips that use a wax barrier to control fluid flow
JP4268944B2 (en) Nucleic acid detection or quantification method
WO2021240319A1 (en) Microfluidic method for the detection of nucleic acids
US20230235312A1 (en) Detection method using lateral-flow paper chip capable of multi-nucleic acid colorimetric detection with one-step
WO2012151289A2 (en) Method and system to detect aggregate formation on a substrate
CN112575065B (en) Detection method based on hybrid chain reaction amplified output signal and detection kit thereof
CA2960859A1 (en) Hybrid multi-step nucleic acid amplification
KR102437064B1 (en) Lab-on-paper platform for nucleic acid detection with simultaneous purification and detection based on an integrated system with lateral fluidity
KR102370561B1 (en) Detection method using paper chip capable of multi-nucleic acid colorimetric detection with one-step
KR102370572B1 (en) Colorimetric diagnostic method using strutcture with opener-based paper chip for controlling lateral flow that can diagnose multiple nucleic acids in one step
KR102719549B1 (en) Household lab-on-paper diagnostic chip comprising a composition for diagnosing multiple sexually transmitted diseases
CN111471588A (en) Real-time fluorescence quantitative PCR instrument module
KR101731400B1 (en) Non-Amplification Method for DNA Detection Using Gold Nanoparticle and Magnetic Bead Particle
KR102370566B1 (en) Diagnostic method for detecting multiple nucleic acid with one-step
KR20190041314A (en) Oligonucleotide set for detection of chikungunya virus and uses thereof
KR102370580B1 (en) Strutcture with opener-based paper chip for controlling lateral flow that can diagnose multiple nucleic acids in one step
KR102392567B1 (en) A composition for chlamydia diagnosis and a multi-isothermal amplification primer set, and a kit with improved speed, accuracy and portability using the same and a visual diagnosis method using the diagnostic kit
KR102840054B1 (en) High-sensitivity and specific target nucleic acid detection method using loop-mediated isothermal amplification and nucleic acid lateral flow assay system
KR102719538B1 (en) Household lab-on-paper diagnostic chip comprising a composition for diagnosing gonorrhea
KR102143795B1 (en) Loop Mediated Isothermal Amplification Primer Set for Detection of Dengue Virus Serotype 2 or 4 and Uses Thereof
KR102393392B1 (en) A composition for syphilis diagnosis and a multi-isothermal amplification primer set, and a kit with improved speed, accuracy and portability using the same and a visual diagnosis method using the diagnostic kit
KR102750775B1 (en) Method of salt mediated immobilization of nucleic acids, the solid support including nucleic acids immobilized thereby the method, lateral flow assay strips including the solid support and method of detection of target nucleic acid
US11369945B2 (en) Simple single-step porous polymer monolith for DNA extraction

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: UNKNOWN

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20221214

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

DAV Request for validation of the european patent (deleted)
DAX Request for extension of the european patent (deleted)
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: EXAMINATION IS IN PROGRESS

17Q First examination report despatched

Effective date: 20240320

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20240723