EP4114949A1

EP4114949A1 - Compositions and methods for inhibiting expression of transthyretin (ttr)

Info

Publication number: EP4114949A1
Application number: EP21714746.1A
Authority: EP
Inventors: Amy Chan; Maja JANAS; Robin D. MCDOUGALL; Diane RAMSDEN; Mark K. SCHLEGEL; Jessica E. SUTHERLAND
Original assignee: Alnylam Pharmaceuticals Inc
Current assignee: Alnylam Pharmaceuticals Inc
Priority date: 2020-03-06
Filing date: 2021-03-05
Publication date: 2023-01-11
Also published as: AU2021232029A1; WO2021178778A1; CA3174473A1; CN115461460A; IL296106A; KR20220152270A; JP2023516748A

Abstract

The present invention provides compositions and methods for treating TTR-associated diseases using RNAi agents, e.g., double stranded RNAi agents, that target the transthyretin (TTR) gene.

Description

COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF TRANSTHYRETIN (TTR)

Related Applications

The present application claims the benefit of priority to U.S. Provisional Application No. 62/985,950, filed on March 6, 2020, the entire contents of which are incorporated herein by reference.

Sequence Listing

The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on February 26, 2021, is named 121301_12320_SL.txt and is 44,455 bytes in size.

Background

Transthyretin (TTR) (also known as prealbumin) is found in serum and cerebrospinal fluid (CSF). TTR transports retinol-binding protein (RBP) and thyroxine (T4) and also acts as a carrier of retinol (vitamin A) through its association with RBP in the blood and the CSF. Transthyretin is named for its transport of thyroxine and retinol. TTR also functions as a protease and can cleave proteins including apoA-I (the major HDL apolipoprotein), amyloid b-peptide, and neuropeptide Y. See Liz, M.A. etal (2010) IUBMB Life, 62(6):429-435.

TTR is a tetramer of four identical 127-amino acid subunits (monomers) that are rich in beta sheet structure. Each monomer has two 4-stranded beta sheets and the shape of a prolate ellipsoid. Antiparallel beta-sheet interactions link monomers into dimers. A short loop from each monomer forms the main dimer-dimer interaction. These two pairs of loops separate the opposed, convex beta-sheets of the dimers to form an internal channel.

The liver is the major site of TTR expression. Other significant sites of expression include the choroid plexus, retina (particularly the retinal pigment epithelium) and pancreas.

Transthyretin is one of at least 27 distinct types of proteins that is a precursor protein in the formation of amyloid fibrils. See Guan, J. et al. (Nov. 4, 2011) Current perspectives on cardiac amyloidosis, Am J Physiol Heart Circ Physiol, doi: 10.1152/ajpheart.00815.2011. Extracellular deposition of amyloid fibrils in organs and tissues is the hallmark of amyloidosis. Amyloid fibrils are composed of misfolded protein aggregates, which may result from either excess production of or specific mutations in precursor proteins. The amyloidogenic potential of TTR may be related to its extensive beta sheet structure; X-ray crystallographic studies indicate that certain amyloidogenic mutations destabilize the tetrameric structure of the protein. See, e.g., Saraiva M.J.M. (2002) Expert Reviews in Molecular Medicine, 4(12): 1-11.

Amyloidosis is a general term for the group of amyloid diseases that are characterized by amyloid deposits. Amyloid diseases are classified based on their precursor protein; for example, the name starts with “A” for amyloid and is followed by an abbreviation of the precursor protein, e.g., ATTR for amloidogenic transthyretin. Ibid. There are numerous TTR-associated diseases, most of which are amyloid diseases. Normal- sequence TTR is associated with cardiac amyloidosis in people who are elderly and is termed senile systemic amyloidosis (SSA) (also called senile cardiac amyloidosis (SCA) or cardiac amyloidosis).

SSA often is accompanied by microscopic deposits in many other organs. TTR amyloidosis manifests in various forms. When the peripheral nervous system is affected more prominently, the disease is termed familial amyloidotic polyneuropathy (FAP). When the heart is primarily involved but the nervous system is not, the disease is called familial amyloidotic cardiomyopathy (FAC). A third major type of TTR amyloidosis is leptomeningeal amyloidosis, also known as leptomeningeal or meningocerebrovascular amyloidosis, central nervous system (CNS) amyloidosis, or amyloidosis VII form. Mutations in TTR may also cause amyloidotic vitreous opacities, carpal tunnel syndrome, and euthyroid hyperthyroxinemia, which is a non-amyloidotic disease thought to be secondary to an increased association of thyroxine with TTR due to a mutant TTR molecule with increased affinity for thyroxine. See, e.g., Moses et al. (1982) J. Clin. Invest., 86, 2025-2033.

Abnormal TTR alleles may be either inherited or acquired through somatic mutations. Guan, J. et al. (Nov. 4, 2011) Current perspectives on cardiac amyloidosis, Am J Physiol Heart Circ Physiol, doi:10.1152/ajpheart.00815.2011. Transthyretin associated ATTR is the most frequent form of hereditary systemic amyloidosis. Lobato, L. (2003) J. Nephrol., 16:438-442. TTR mutations accelerate the process of TTR amyloid formation and are the most important risk factor for the development of ATTR. More than 85 amyloidogenic TTR variants are known to cause systemic familial amyloidosis. TTR mutations usually give rise to systemic amyloid deposition, with particular involvement of the peripheral nervous system, although some mutations are associated with cardiomyopathy or vitreous opacities. Ibid.

The V30M mutation is the most prevalent TTR mutation. See, e.g., Lobato, L. (2003) J Nephrol, 16:438-442. The V 1221 mutation is carried by 3.9% of the African American population and is the most common cause of FAC. Jacobson, D.R. et al. (1997) N. Engl. J. Med. 336 (7): 466-73. It is estimated that SSA affects more than 25% of the population over age 80. Westermark, P. et al. (1990) Proc. Natl. Acad. Sci. U.S.A. 87 (7): 2843-5.

Accordingly, there is a need in the art for effective treatments for TTR-associated diseases.

Summary of the Invention

The present invention provides compositions and methods for inhibiting expression of TTR and methods of treating or preventing a transthyretin- (TTR-) associated disease in a human subject using double stranded RNAi agents, targeting the TTR gene.

The invention provides a double stranded RNAi agent comprising a sense strand and an antisense strand, wherein: each the sense strand and the antisense strand are independently up to 30 nucleotides in length; the sense strand comprises the modified nucleotide sequence 5’- usgsggauUfuCfAfUfguaaccaaga-3’ (SEQ ID NO: 6); and the antisense strand comprises the modified nucleotide sequence 5’- usCfsuugGf(Tgn)uAfcaugAfaAfucccasusc-3’ (SEQ ID NO: 7), wherein a, c, g, andu are 2'-0-methyIadenosine-3’ -phosphate, 2'-0-methyIcytidine-3’- phosphate, 2'-0-methyIguanosine-3’ -phosphate, and 2'-0-methyIuridine-3’ -phosphate, respectively;

Af, Cf, Gf, and Uf are 2 ’-fluoroadenosine-3’ -phosphate, 2 ’-fluorocytidine-3’ -phosphate, 2’- fluoroguanosine-3’ -phosphate, and 2’-fluorouridine-3’-phosphate, respectively;

(Tgn) is thymidine-glycol nucleic acid (GNA) S-Isomer; and s is a phosphorothioate linker.

In certain embodiments, the sense strand of the double stranded RNAi agent is conjugated to at least one ligand. In certain embodiments, the ligand is one or more GalNAc derivatives attached through a bivalent or tri valent branched linker. In certain embodiments, the ligand is

In certain embodiments, the ligand is attached to the 3 end of the sense strand.

In certain embodiments, the double stranded RNAi agent is conjugated to the ligand as shown in the following schematic:

3

In certain embodiments, the sense strand is 21 nucleotides in length and the antisense strand is 23 nucleotides in length.

The invention provides a use of a double stranded RNAi agent in a method of treating a human subject suffering from a TTR-associated disease, comprising administration of a fixed dose of about 25 mg to about 1000 mg of a double stranded RNAi agent, wherein: each the sense strand and the antisense strand are independently up to 30 nucleotides in length; the sense strand comprises the modified nucleotide sequence 5’- usgsggauUfuCfAfUfguaaccaaga-3’ (SEQ ID NO: 6); and the antisense strand comprises the modified nucleotide sequence 5’- usCfsuugGf(Tgn)uAfcaugAfaAfucccasusc-3’ (SEQ ID NO: 7), wherein a, c, g, andu are 2'-0-methyladenosine-3’ -phosphate, 2'-0-methylcytidine-3’- phosphate, 2'-0-methylguanosine-3’ -phosphate, and 2'-0-methyluridine-3’ -phosphate, respectively;

The invention also provides a use of a double stranded RNAi agent in a method of inhibiting expression of TTR in a human subject who does not meet diagnostic criteria of a TTR-associated disease, comprising administration of a fixed dose of about 25 mg to about 1000 mg of a double stranded RNAi agent, wherein: each the sense strand and the antisense strand are independently up to 30 nucleotides in length; the sense strand comprises the modified nucleotide sequence 5’- usgsggauUfuCfAfUfguaaccaaga-3’ (SEQ ID NO: 6); and the antisense strand comprises the modified nucleotide sequence 5’- usCfsuugGf(Tgn)uAfcaugAfaAfucccasusc-3’ (SEQ ID NO: 7), wherein a, c, g, andu are 2'-0-methyladenosine-3’ -phosphate, 2'-0-methylcytidine-3’- phosphate, 2'-0-methylguanosine-3’ -phosphate, and 2'-0-methyluridine-3’ -phosphate, respectively;

Af, Cf, Gf, and Uf are 2 ’-fluoroadenosine-3 ’-phosphate, 2 ’-fluorocytidine-3 ’-phosphate, 2’- fluoroguanosine-3’ -phosphate, and 2’-fluorouridine-3’-phosphate, respectively;

In certain embodiments, the sense strand of the double stranded RNAi agent is conjugated to at least one ligand. In certain embodiments, the ligand is one or more GalNAc derivatives attached through a bivalent or tri valent branched linker. In certain embodiments, the ligand is In certain embodiments, the ligand is attached to the 3 end of the sense strand. In certain embodiments, the double stranded RNAi agent is conjugated to the ligand as shown in the following schematic wherein X is O or S.

In certain embodiments, the uses of the invention comprise improving at least one indicia of neurological impairement, quality of life, nerve damage, cardiovascular health. In certain embodiments, the indicia assessed is a neurological impairment, for example, using a Neuropathy Impairment (NIS) score or a modified NIS (mNIS+7) score. In certain embodiments, the indicia is a quality of life indicia assessed, for example, using a SF-36® health survey score, a Norfolk Quality of Life -Diabetic Neuropathy (Norfolk QOL-DN) score, a NIS-W score, a Rasch-built Overall Disability Scale (R-ODS) score, a composite autonomic symptom score (COMPASS-31), a median body mass index (mBMI) score, a 6-minute walk test (6MWT) score, and a 10-meter walk test score. In certain embodiments, the indicia is nerve damage assessed, for example, a change in the level of one or more proteins selected from the group neurofilament light chain (NfL), RSP03, CCDC80, EDA2R, NT-proBNP, and N- CDase, such as a human blood sample, or serum or plasma derived therefrom. In certain embodiments, the indicia of nerve damage is a change from baseline in the level of neurofilament light chain (NfL) protein level. In certain embodiments, the indicia of cardiovascular impairment is cardiovascular hospitalization, using Kansas City Cardiomyopathy Questionnaire Overall Summary (KCCQ-OS) with an increased score indicative of better health status, change from baseline in mean left lventricular (LV) wall thickness by echocardiographic assessment, change from baseline in global longitudinal strain by echocardiographic assessment, and change from baseline in N-terminal prohormone B-type Natriuretic Peptide (NTproBNP).

In certain embodiments, the human subject carries a TTR gene mutation that is associated with the development of a TTR-associated disease, e.g., senile systemic amyloidosis (SSA), systemic familial amyloidosis, familial amyloidotic polyneuropathy (FAP), familial amyloidotic cardiomyopathy (FAC), leptomeningeal/Central Nervous System (CNS) amyloidosis, and hyperthyroxinemia.

In certain embodiments, the human subject has a transthyretin-mediated amyloidosis (ATTR amyloidosis) and the use of the double stranded RNAi agent reduces an amyloid TTR deposit in the human subject. In certain embodiments, the ATTR amyloidosis is hereditary ATTR (h-ATTR) amyloidosis. In certain embodiments, the ATTR amyloidosis is non-heriditary ATTR (wt ATTR) amyloidosis.

In certain embodiments, the double stranded RNAi agent is administered to the human subject by subcutaneously or intravenously. In certain embodiments, the subcutaneous administration is self administration. In certain embodiments, the self-administration is via a pre -filled syringe or auto- injector device.

In certain embodiments, the use further comprises assessing the level of TTR mRNA expression or TTR protein expression in a sample derived from the human subject, such as a human blood sample, or serum or plasma derived therefrom.

In certain embodiments, the double stranded RNAi agent is administered to the human subject once every month, once every other month, once every three months, once every four months, once every five months, or once every six months. In certain embodiments, the fixed dose of the double stranded RNAi agent is administered to the human subject once about every three months. In certain embodiments, the fixed dose of the double stranded RNAi agent is administered to the human subject once about every six months.

In certain embodiments, the double stranded RNAi agent is chronically administered to the human subject.

In certain embodiments, the double stranded RNAi agent is administered to the human subject about once per quarter to about once per year. In certain embodiments, the double stranded RNAi agent is administered to the human subject about once per quarter, about once every six months, or about once per year.

In certain embodiments, the double stranded RNAi agent is administered to the human subject at a fixed dose of about 25 mg to about 300 mg. In certain embodiments, the double stranded RNAi agent is administered to the human subject at a fixed dose of about 25 mg to about 200 mg. In certain embodiments, the double stranded RNAi agent is administered to the human subject at a fixed dose of about 75 mg to about 200 mg. In certain embodiments, the double stranded RNAi agent is administered to the human subject at a fixed dose of about 25 mg. In certain embodiments, the double stranded RNAi agent is administered to the human subject at a fixed dose of about 50 mg. In certain embodiments, the double stranded RNAi agent is administered to the human subject at a fixed dose of about 75 mg. In certain embodiments, the double stranded RNAi agent is administered to the human subject at a fixed dose of about 100 mg. In certain embodiments, the double stranded RNAi agent is administered to the human subject at a fixed dose of about 200 mg. In certain embodiments, the double stranded RNAi agent is administered to the human subject at a fixed dose of about 25 mg to about 300 mg; about 25 mg to about 200 mg; about 75 mg to about 200 mg; about 25 mg; about 50 mg; about 75 mg; about 100 mg; about 200mg; or about 300 mg once per quarter, i.e., about once every three months.

In certain embodiments, the double stranded RNAi agent is administered to the human subject at a fixed dose of about 400 mg to about 600 mg. In certain embodiments, the double stranded RNAi agent is administered to the human subject at a fixed dose of about 400 mg or about 600 mg about once every six months to about once per year. In certain embodiments, the double stranded RNAi agent is administered to the human subject at a fixed dose of about 400 mg or about 600 mg about once every six months or about once per year.

In certain embodiments, the double stranded RNAi agent is administered to the human subject at a fixed dose of about 700 mg to about 1000 mg or about 700 mg to about 900 mg. In certain embodiments, the double stranded RNAi agent is administered to the human subject at a fixed dose of about 700 mg, about 800 mg, about 900mg, or about 1000 mg about once per year.

In certain embodiments, the use further comprises administering to the human subject an additional therapeutic agent, e.g., a TTR tetramer stabilizer or a non-steroidal anti-inflammatory agent.

The present invention also provides kits for performing any of the methods of the invention. The kits may include the double stranded RNAi agent; and a label comprising instructions for use.

The present invention is further illustrated by the following detailed description and drawings.

Brief Description of the Drawings

Figure 1 is a graph depicting relative serum TTR protein levels in V30M transgenic mice (n=3 per group) after administration of a single 1 mg/kg dose of the indicated double stranded RNAi agents on Day 0.

Figure 2 is a graph depicting relative serum TTR protein levels in cynomolgus monkeys (n=3 per group) after administration of a single 1 mg/kg dose or 3 mg/kg dose of the indicated double stranded RNAi agents on Day 0. Results shown are from three independent studies.

Detailed Description of the Invention

The present invention provides methods of inhibiting expression of TTR, including inhibiting TTR expression in a human subject who does not meet diagnostic criteria of a TTR-associated disease and methods of treating a human subject with a Transthyretin- (TTR-) associated disease using double stranded RNAi agents, targeting the TTR gene wherein the sense strand comprises the modified nucleotide sequence 5’-usgsggauUfuCfAfUfguaaccaaga-3’ (SEQ ID NO: 6); and the antisense strand comprises the modified nucleotide sequence 5’-usCfsuugGf(Tgn)uAfcaugAfaAfucccasusc-3’ (SEQ ID NO: 7.

The following detailed description discloses how to make and use compositions containing iRNA agents to selectively inhibit the expression of a TTR gene, as well as compositions, uses, and methods for treating subjects having diseases and disorders that would benefit from inhibition or reduction of the expression of a TTR gene.

I. Definitions

In order that the present invention may be more readily understood, certain terms are first defined. In addition, it should be noted that whenever a value or range of values of a parameter are recited, it is intended that values and ranges intermediate to the recited values are also intended to be part of this invention.

The articles “a” and “an” are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element, e.g., a plurality of elements.

The term “including” is used herein to mean, and is used interchangeably with, the phrase “including, but not limited to”.

The term “or” is used herein to mean, and is used interchangeably with, the term “and/or,” unless context clearly indicates otherwise.

The term “about” is used herein to mean within the typical ranges of tolerances in the art, e.g., acceptable variation in time between doses, acceptable variation in dosage unit amount. For example, “about” can be understood as within about 2 standard deviations from the mean. In certain embodiments, about means +10%. In certain embodiments, about means +5%. When about is present before a series of numbers or a range, it is understood that “about” can modify each of the numbers in the series or range.

The term “at least” , “no less than”, or “or more” prior to a number or series of numbers is understood to include the number adjacent to the term “at least”, and all subsequent numbers or integers that could logically be included, as clear from context. For example, the number of nucleotides in a nucleic acid molecule must be an integer. For example, “at least 18 nucleotides of a 21 nucleotide nucleic acid molecule” means that 18, 19, 20, or 21 nucleotides have the indicated property. When at least is present before a series of numbers or a range, it is understood that “at least” can modify each of the numbers in the series or range.

As used herein, “no more than” or “less than” is understood as the value adjacent to the phrase and logical lower values or integers, as logical from context, to zero. For example, a duplex with an overhang of “no more than 2 nucleotides” has a 2, 1, or 0 nucleotide overhang. When “no more than” is present before a series of numbers or a range, it is understood that “no more than” can modify each of the numbers in the series or range.

As used herein, methods of detection can include determination that the amount of analyte present is below the level of detection of the method.

As used herein, a “transthyretin” (“TTR”) refers to the well-known gene and protein. TTR is also known as prealbumin, HsT2651, PALB, and TBPA. TTR functions as a transporter of retinol binding protein (RBP), thyroxine (T4) and retinol, and it also acts as a protease. The liver secretes TTR into the blood, and the choroid plexus secretes TTR into the cerebrospinal fluid. TTR is also expressed in the pancreas and the retinal pigment epithelium. The greatest clinical relevance of TTR is that both normal (wild type) and mutant TTR protein can form amyloid fibrils that aggregate into extracellular deposits, causing amyloidosis. See, e.g., Saraiva M.J.M. (2002) Expert Reviews in Molecular Medicine , 4(12): 1-11 for a review. The molecular cloning and nucleotide sequence of rat transthyretin, as well as the distribution of mRNA expression, was described by Dickson, P.W. et al. (1985) J. Biol. Chem. 260(13)8214-8219. The X-ray crystal structure of human TTR was described in Blake, C.C. et al. (1974) J Mol Biol 88, 1-12. The sequence of a human TTR mRNA transcript can be found at National Center for Biotechnology Information (NCBI) RefSeq accession number NM_000371 (e.g., SEQ ID NOs:l and 5). The sequence of mouse TTR mRNA can be found at RefSeq accession number NM_013697.2, and the sequence of rat TTR mRNA can be found at RefSeq accession number NM_012681.1. Additional examples of TTR mRNA sequences are readily available using publicly available databases, e.g., GenBank, UniProt, and OMIM.

A “TTR-associated disease,” as used herein, is intended to include any disease associated with the TTR gene or protein. Such a disease may be caused, for example, by excess production of the TTR protein, by TTR gene mutations, by abnormal cleavage of the TTR protein, instability of TTR tetramers, by abnormal interactions between TTR and other proteins or other endogenous or exogenous substances. A “TTR-associated disease” includes any type of transthyretin-mediated amyloidosis (ATTR amyloidosis) wherein TTR plays a role in the formation of abnormal extracellular aggregates or amyloid deposits, e.g., either herititary ATTR (h-ATTR) amyloidosis or non-heriditary ATTR (ATTR) amyloidosis. TTR-associated diseases include senile systemic amyloidosis (SSA), systemic familial amyloidosis, familial amyloidotic polyneuropathy (FAP), familial amyloidotic cardiomyopathy (FAC), leptomeningeal/Central Nervous System (CNS) amyloidosis, amyloidotic vitreous opacities, carpal tunnel syndrome, and hyperthyroxinemia. Symptoms of TTR amyloidosis include sensory neuropathy (e.g., paresthesia, hypesthesia in distal limbs), autonomic neuropathy (e.g., gastrointestinal dysfunction, such as gastric ulcer, or orthostatic hypotension), motor neuropathy, seizures, dementia, myelopathy, polyneuropathy, carpal tunnel syndrome, autonomic insufficiency, cardiomyopathy, vitreous opacities, renal insufficiency, nephropathy, substantially reduced mBMI (modified Body Mass Index), cranial nerve dysfunction, and corneal lattice dystrophy.

As used herein, the term “strand comprising a sequence” refers to an oligonucleotide comprising a chain of nucleotides that is described by the sequence referred to using the standard nucleotide nomenclature.

The terms “iRNA,” “RNAi agent,” “iRNA agent,”, “RNA interference agent” as used interchangeably herein, refer to an agent that contains RNA as that term is defined herein, and which mediates the targeted cleavage of an RNA transcript via an RNA-induced silencing complex (RISC) pathway. iRNA directs the sequence-specific degradation of mRNA through a process known as RNA interference (RNAi). The iRNA modulates, e.g., inhibits, the expression of a TTR gene in a cell, e.g., a cell within a subject, such as a mammalian subject.

As used herein, an “iRNA” for use in the compositions, uses, and methods of the invention is a double stranded RNA and is referred to herein as a “double stranded RNAi agent,” “double stranded RNA (dsRNA) molecule,” “dsRNA agent,” or “dsRNA”. The term “dsRNA” refers to a complex of ribonucleic acid molecules, having a duplex structure comprising two anti-parallel and substantially complementary nucleic acid strands, referred to as having “sense” and “antisense” orientations with respect to a target RNA, i.e., a TTR gene. A double stranded RNAi agent triggers the degradation of a target RNA, e.g., an mRNA, through a post-transcriptional gene-silencing mechanism referred to herein as RNA interference or RNAi. As used herein, the term “modified nucleotide” refers to a nucleotide having, independently, a modified sugar moiety, a modified internucleotide linkage, or a modified nucleobase. Thus, the term modified nucleotide encompasses substitutions, additions or removal of, e.g., a functional group or atom, to internucleoside linkages, sugar moieties, or nucleobases. The modifications suitable for use in the agents of the invention include all types of modifications disclosed herein or known in the art. Any such modifications, as used in a siRNA type molecule, are encompassed by “RNAi agent” for the purposes of this specification and claims.

The duplex region may be of any length that permits specific degradation of a desired target RNA through a RISC pathway, and may range from about 21 to 36 base pairs in length, e.g., about 21- 30 base pairs in length, for example, about 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base pairs in length. In one embodiment, an RNAi agent of the invention is a dsRNA agent, each strand of which comprises 21-23 nucleotides that interacts with a TTR mRNA sequence to direct the cleavage of the target mRNA. Without wishing to be bound by theory, long double stranded RNA introduced into cells is broken down into siRNA by a Type III endonuclease known as Dicer (Sharp et al. (2001) Genes Dev. 15:485). Dicer, a ribonuclease-III-like enzyme, processes the dsRNA into 19-23 base pair short interfering RNAs with characteristic two base 3’ overhangs (Bernstein, et al., (2001) Nature 409:363). The siRNAs are then incorporated into an RNA-induced silencing complex (RISC) where one or more helicases unwind the siRNA duplex, enabling the complementary antisense strand to guide target recognition (Nykanen, et al, (2001) Cell 107:309). Upon binding to the appropriate target mRNA, one or more endonucleases within the RISC cleave the target to induce silencing (Elbashir, et al, (2001) Genes Dev. 15:188). In one embodiment, an RNAi agent of the invention is a dsRNA of 24- 30 nucleotides that interacts with a TTR mRNA sequence to direct the cleavage of the target RNA.

As used herein, the term “nucleotide overhang” refers to at least one unpaired nucleotide that protrudes from the duplex structure of an iRNA, e.g., a dsRNA. For example, when a 3'-end of one strand of a dsRNA extends beyond the 5'-end of the other strand, or vice versa, there is a nucleotide overhang. A dsRNA can comprise an overhang of at least one nucleotide; alternatively, the overhang can comprise at least two nucleotides, at least three nucleotides, at least four nucleotides, at least five nucleotides or more. A nucleotide overhang can comprise or consist of a nucleotide/nucleoside analog, including a deoxynucleotide/nucleoside. The overhang(s) can be on the sense strand, the antisense strand or any combination thereof. Furthermore, the nucleotide(s) of an overhang can be present on the 5'-end, 3'-end or both ends of either an antisense or sense strand of a dsRNA. In one embodiment of the dsRNA, at least one strand comprises a 3’ overhang of at least 1 nucleotide. In another embodiment, at least one strand comprises a 3’ overhang of at least 2 nucleotides, e.g., 2, 3, 4, 5, 6, 7, 8, or 9 nucleotides. In other embodiments, at least one strand of the RNAi agent comprises a 5’ overhang of at least 1 nucleotide. In certain embodiments, at least one strand comprises a 5’ overhang of at least 2 nucleotides, e.g., 2, 3, 4, 5, 6, 7, 8, or 9 nucleotides. In still other embodiments, both the 3’ and the 5’ end of one strand of the RNAi agent comprise an overhang of at least 1 nucleotide.

In one embodiment, the antisense strand of a dsRNA has a 1-9 nucleotide, e.g., 0-3, 1-3, 2-4, 2- 5, 4-9, 5-9, e.g., a 1, 2, 3, 4, 5, 6, 7, 8, or 9 nucleotide, overhang at the 3’-end or the 5’-end. In one embodiment, the sense strand of a dsRNA has a 1-9 nucleotide, e.g., a 1, 2, 3, 4, 5, 6, 7, 8, or 9 nucleotide, overhang at the 3 ’-end or the 5 ’-end. In another embodiment, one or more of the nucleotides in the overhang is replaced with a nucleoside thiophosphate.

“Blunt” or “blunt end” means that there are no unpaired nucleotides at that end of the double stranded RNAi agent, i.e., no nucleotide overhang. A “blunt ended” RNAi agent is a dsRNA that is double stranded over its entire length, i.e., no nucleotide overhang at either end of the molecule. The RNAi agents of the invention include RNAi agents with nucleotide overhangs at one end (i.e., agents with one overhang and one blunt end) or with nucleotide overhangs at both ends.

The term “antisense strand” or "guide strand" refers to the strand of an iRNA, e.g., a dsRNA, which includes a region that is substantially complementary to a target sequence, e.g., a TTR mRNA.

As used herein, the term “region of complementarity” refers to the region on the antisense strand that is substantially complementary to a sequence, for example a target sequence, e.g., a TTR nucleotide sequence, as defined herein. Where the region of complementarity is not fully complementary to the target sequence, the mismatches can be in the internal or terminal regions of the molecule. Generally, the most tolerated mismatches are in the terminal regions, e.g., within 5, 4, 3, 2, or 1 nucleotides of the 5’ - or 3 ’-terminus of the iRNA. In one embodiment, a double stranded RNAi agent of the invention includea a nucleotide mismatch in the antisense strand. In another embodiment, a double stranded RNAi agent of the invention includes a nucleotide mismatch in the sense strand. In one embodiment, the nucleotide mismatch is, for example, within 5, 4, 3, 2, or 1 nucleotides from the 3’-terminus of the iRNA. In another embodiment, the nucleotide mismatch is, for example, in the 3 ’-terminal nucleotide of the iRNA.

The term “sense strand,” or "passenger strand" as used herein, refers to the strand of an iRNA that includes a region that is substantially complementary to a region of the antisense strand as that term is defined herein.

As used herein, the term “cleavage region” refers to a region that is located immediately adjacent to the cleavage site. The cleavage site is the site on the target at which cleavage occurs. In some embodiments, the cleavage region comprises three bases on either end of, and immediately adjacent to, the cleavage site. In some embodiments, the cleavage region comprises two bases on either end of, and immediately adjacent to, the cleavage site. In some embodiments, the cleavage site specifically occurs at the site bound by nucleotides 10 and 11 of the antisense strand, and the cleavage region comprises nucleotides 11, 12 and 13.

As used herein, and unless otherwise indicated, the term “complementary,” when used to describe a first nucleotide sequence in relation to a second nucleotide sequence, refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize and form a duplex structure under certain conditions with an oligonucleotide or polynucleotide comprising the second nucleotide sequence, as will be understood by the skilled person. Such conditions can be, for example, “stringent conditions”, where stringent conditions can include: 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50 oC or 70 oC for 12-16 hours followed by washing (see, e.g., “Molecular Cloning: A Laboratory Manual, Sambrook, et al. (1989) Cold Spring Harbor Laboratory Press). Other conditions, such as physiologically relevant conditions as can be encountered inside an organism, can apply. The skilled person will be able to determine the set of conditions most appropriate for a test of complementarity of two sequences in accordance with the ultimate application of the hybridized nucleotides.

Complementary sequences within an iRNA, e.g., within a dsRNA as described herein, include base-pairing of the oligonucleotide or polynucleotide comprising a first nucleotide sequence to an oligonucleotide or polynucleotide comprising a second nucleotide sequence over the entire length of one or both nucleotide sequences. Such sequences can be referred to as “fully complementary” with respect to each other herein. However, where a first sequence is referred to as “substantially complementary” with respect to a second sequence herein, the two sequences can be fully complementary, or they can form one or more, but generally not more than 5, 4, 3 or 2 mismatched base pairs upon hybridization for a duplex up to 30 base pairs, while retaining the ability to hybridize under the conditions most relevant to their ultimate application, e.g., inhibition of gene expression, in vitro or in vivo.. However, where two oligonucleotides are designed to form, upon hybridization, one or more single stranded overhangs, such overhangs shall not be regarded as mismatches with regard to the determination of complementarity. For example, a dsRNA comprising one oligonucleotide 21 nucleotides in length and another oligonucleotide 23 nucleotides in length, wherein the longer oligonucleotide comprises a sequence of 21 nucleotides that is fully complementary to the shorter oligonucleotide, can yet be referred to as “fully complementary” for the purposes described herein.

“Complementary” sequences, as used herein, can also include, or be formed entirely from, non- Watson-Crick base pairs or base pairs formed from non-natural and modified nucleotides, in so far as the above requirements with respect to their ability to hybridize are fulfilled. Such non-Watson-Crick base pairs include, but are not limited to, G:U Wobble or Hoogstein base pairing.

The terms “complementary,” “fully complementary” and “substantially complementary” herein can be used with respect to the base matching between the sense strand and the antisense strand of a dsRNA, or between two oligonucleotides or polynucleotides, such as the antisense strand of an iRNA agent and a target sequence, as will be understood from the context of their use.

As used herein, a polynucleotide that is “substantially complementary to at least part of’ a messenger RNA (mRNA) refers to a polynucleotide that is substantially complementary to a contiguous portion of the mRNA of interest (e.g., an mRNA encoding a TTR gene). For example, a polynucleotide is complementary to at least a part of a TTR mRNA if the sequence is substantially complementary to a non-interrupted portion of an mRNA encoding a TTR gene.

Accordingly, in some embodiments, the antisense polynucleotides disclosed herein are fully complementary to the target TTR sequence. In other embodiments, the antisense polynucleotides disclosed herein are fully complementary to SEQ ID NO: 8 (5’- UGGGAUUUCAUGUAACCAAGA - 3’). In one embodiment, the antisense polynucleotide sequence is 5’-

UCUUGGUUACAUGAAAUCCCAUC -3’ (SEQ ID NO:9), wherein the U at position 7 of the antisense strand can be a T. As used herein, a “reference level” is understood as a predetermined level to which a level obtained from an assay, e.g., a biomarker level, e.g., a protein biomarker level, is compared. In certain embodiments, a reference level can be a control level determined for a healthy population, e.g., a population that does not have a disease or condition associated with a changed level of the biomarker and does not have a predisposition, e.g., genetic predisposition, to a disease or condition associated with a changed level of the biomarker. In certain embodiments, the population should be matched for certain criteria, e.g., age, sex. In certain embodiments, the reference level of the biomarker is a level from the same subject at an earlier time, e.g., before the development of symptomatic disease or before the start of treatment. Typically, samples are obtained from the subject at clinically relevant intervals, e.g., at intervals sufficiently separated in time that a change in the biomarker could be observed, e.g., at least a three month interval, at least a six month interval, or at least a nine month interval. When more than two samples are obtained from a subject over time, it is understood that any of the prior samples can act as a reference level.

As used herein, a “change as compared to a reference level” and the like is understood as a statistically or clinically significant change in the biomarker level, e.g., the change in the protein biomarker level, as compared to the reference level, is greater than the typical standard deviation of the assay method. Moreover, the change should be clinically relevant. The change as compared to a reference level can be determined as a percent change. For example, if a reference level is 100 pg/ml for biomarker X, and the level of biomarker X in the subject is 150 pg/ml, the level is increased by 50% calculated by ((150 pg/ml -100 pg/ml)/100 pg/ml) X 100% = 50%. If the level of biomarker X in the subject is 300 pg/ml, the level is increased by 300%. If the level of biomarker X in the subject is 50 pg/ml, the level is decreased by 50%. In certain embodiments, the change as compared to a reference level is increased by at least 50%. In certain embodiments, the change as compared to a reference level is increased by at least 100%, at least 200%, or at least 300%. In certain embodiments, the change as compared to a reference sample is decreased by at least 25%. In certain embodiments, the change as compared to a reference sample is decreased by at least 50%.

A “biological sample from a subject” or a “sample from a subject” as used herein, includes one or more fluids, cells, or tissues isolated from a subject. Examples of biological fluids include blood, serum, serosal fluids, plasma, cerebrospinal fluid, ocular fluids, lymph, urine, saliva, and the like.

Tissue samples may include samples from tissues, organs, or localized regions. For example, samples may be derived from particular organs, parts of organs, or fluids or cells within those organs. In certain embodiments, samples may be liver tissue or be derived from the liver. In some embodiments, a “biological sample from a subject” can refer to blood or blood derived serum or plasma from the subject. In some embodiments, the fluid is substantially free of cells, e.g., is free of cells.

As used herein, a “clinically relevant difference” is understood as at least greater difference than typical interobserver variation for the assessment, wherein the observer may be a trained health care professional, a caregiver, or the patient, performing the same assessment on the same individual at around the same time, e.g., within a week, such as within consecutive days. It is understood that certain patient observations are subjective and should be nearly identical when performed by different observers within a short time frame, e.g., body weight, heart rate. Other qualitative measures, such as some aspects of mNTS+7 (e.g., response to touch-pressure, vibration, joint position and motion) and Norfolk-Quality of Life (e.g., pain level, hot or cold hands and feet, steadiness while standing) may vary more from day to day, and from one observer to another. Therefore, composite scores are used to aggregate observations and larger variations between observers are expected without any indication of clinically relevant change. Assays for biomarker levels have known levels of variations within and between samples. Determination of a clinically relevant difference is within the ability of one of skill in the art, e.g., a health care professional experienced in treating patients with TTR associated diseases, clinical laboratory professional.

As used herein, “chronically administered” is understood as administration for an indefinite interval, e.g., for the remainder of the life of the subject, until liver transplant.

As used herein, a “therapeutic agent that stabilizes TTR” or “that stabilizes a TTR tetramer” is an agent that reduces or prevents the dissociation of the subunits of a TTR tetramer, e.g., into monomers. In some embodiments, the agent reduces the formation of TTR amyloid plaques, e.g., by reducing the level of TTR monomers or proteolytic fragments of TTR monomers that form TTR amyloid plaques. Such agents include, but are not limited to, tafamidis, diflunisal, and AGIO.

As used herein, the term “administering a therapeutic agent” is understood as providing a therapeutic agent to a subject. In embodiments, the therapeutic agent is provided at an appropriate dosage and by a route of administration for the agent as provided, for example, by the label of the therapeutic agent.

II. Methods for Treating a TTR-Associated Disease

The present invention provides double stranded RNAi agents and their use in methods for treating a TTR-associated disease in a human subject, such as a transthyretin-mediated amyloidosis (ATTR amyloidosis), e.g., hereditary ATTR (h-ATTR) amyloidosis or non-heriditary ATTR (wt ATTR) amyloidosis; or for inhibiting expression of TTR in a subject that does not yet meet the diagnostic criteria of a TTR-associated disease, but who is at risk for developing a TTR-associated disease, e.g., a subject with a TTR mutation associated with TTR amyloidosis, a subject with some indicia of TTR amyloidosis who does not yet meet the diagnostic criteria of TTR amyloidosis, a subject with altered biomarker levels associated with TTR amyloidosis. The methods include administering to the subject a therapeutically effective amount of an RNAi agent of the invention.

In one aspect, the present invention provides methods of treating a human subject suffering from a TTR-associated disease or at risk for developing a TTR-associated disease. The methods include administering to the human subject a fixed dose of about 25 mg to about 1000 mg of a double stranded RNAi agent wherein the sense strand comprises the modified nucleotide sequence 5’- usgsggauUfuCfAfUfguaaccaaga-3’ (SEQ ID NO: 6); and the antisense strand comprises the modified nucleotide sequence 5’-usCfsuugGf(Tgn)uAfcaugAfaAfucccasusc-3’ (SEQ ID NO: 7), wherein a, c, g, andu are 2'-0-methyladenosine-3’ -phosphate, 2'-0-methylcytidine-3’- phosphate, 2'-0-methylguanosine-3’ -phosphate, and 2'-0-methyluridine-3’ -phosphate, respectively;

In another aspect, the present invention provides methods of improving at least one indicia of neurological impairement or quality of life in a human subject suffering from a TTR-associated disease or at risk for developing a TTR-associated disease. The methods include administering to the human subject a fixed dose of about 25 mg to about 1000 mg of a double stranded RNAi agent wherein the sense strand comprises the modified nucleotide sequence 5’-usgsggauUfuCfAfUfguaaccaaga-3’ (SEQ ID NO: 6); and the antisense strand comprises the modified nucleotide sequence 5’- usCfsuugGf(Tgn)uAfcaugAfaAfucccasusc-3’ (SEQ ID NO: 7).

In another aspect, the present invention provides methods of reducing, slowing, or arresting a Neuropathy Impairment Score (NIS) or a modified NIS (mNIS+7) in a human subject suffering from a TTR-associated disease or at risk for developing a TTR-associated disease. The methods include administering to the human subject a fixed dose of about 25 mg to about 1000 mg of a double stranded RNAi agent wherein the sense strand comprises the modified nucleotide sequence 5’- usgsggauUfuCfAfUfguaaccaaga-3’ (SEQ ID NO: 6); and the antisense strand comprises the modified nucleotide sequence 5’-usCfsuugGf(Tgn)uAfcaugAfaAfucccasusc-3’ (SEQ ID NO: 7).

In another aspect, the present invention provides methods of increasing a 6-minute walk test (6MWT) in a human subject suffering from a TTR-associated disease or at risk for developing a TTR- associated disease. The methods include administering to the human subject a fixed dose of about 25 mg to about 1000 mg of a double stranded RNAi agent wherein the sense strand comprises the modified nucleotide sequence 5’-usgsggauUfuCfAfUfguaaccaaga-3’ (SEQ ID NO: 6); and the antisense strand comprises the modified nucleotide sequence 5’-usCfsuugGf(Tgn)uAfcaugAfaAfucccasusc-3’ (SEQ ID NO: 7).

In certain embodiments, the double stranded RNAi agent is administered to the human subject at a fixed dose of about 25 mg to about 300 mg. In certain embodiments, the double stranded RNAi agent is administered to the human subject at a fixed dose of about 25 mg to about 200 mg. In certain embodiments, the double stranded RNAi agent is administered to the human subject at a fixed dose of about 75 mg to about 200 mg. In certain embodiments, the double stranded RNAi agent is administered to the human subject at a fixed dose of about 25 mg. In certain embodiments, the double stranded RNAi agent is administered to the human subject at a fixed dose of about 50 mg. In certain embodiments, the double stranded RNAi agent is administered to the human subject at a fixed dose of about 75 mg. In certain embodiments, the double stranded RNAi agent is administered to the human subject at a fixed dose of about 100 mg. In certain embodiments, the double stranded RNAi agent is administered to the human subject at a fixed dose of about 200 mg. In certain embodiments, the double stranded RNAi agent is administered to the human subject at a fixed dose of about 25 mg to about 300 mg; about 25 mg to about 200 mg; about 50 mg to about 300 mg; about 25 mg; about 50 mg; about 100 mg; about 200mg; or about 300 mg once per quarter, i.e., about once every three months.

In an embodiment, the subject is a human being treated or assessed for a disease, disorder or condition that would benefit from reduction in TTR gene expression; a human at risk for a disease, disorder or condition that would benefit from reduction in TTR gene expression, e.g., a human who does not meet the diagnostic criteria of a TTR-associated disease, but who demonstrates at least one sign or symptom of a TTR-associated disease or has at least one risk factor of developing a TTR associated disease; a human having a disease, disorder or condition that would benefit from reduction in TTR gene expression; or human being treated for a disease, disorder or condition that would benefit from reduction in TTR gene expression, as described herein.

In some embodiments, the human subject is suffering from a TTR-associated disease. In other embodiments, the subject is a subject at risk for developing a TTR-associated disease, e.g., a subject with a TTR gene mutation that is associated with the development of a TTR associated disease, a subject with a family history of TTR-associated disease, or a subject who has signs or symptoms suggesting the development of TTR associated disease without meeting the diagnostic criteria for a TTR-associated disease.

A “TTR-associated disease,” as used herein, includes any disease caused by or associated with the formation of amyloid deposits in which the fibril precurosors consist of variant or wild-type TTR protein. Mutant and wild-type TTR give rise to various forms of amyloid deposition (amyloidosis). Amyloidosis involves the formation and aggregation of misfolded proteins, resulting in extracellular deposits that impair organ function. Climical syndromes associated with TTR aggregation include, for example, senile systemic amyloidosis (SSA); systemic familial amyloidosis; familial amyloidotic polyneuropathy (FAP); familial amyloidotic cardiomyopathy (FAC); and leptomeningeal amyloidosis, also known as leptomeningeal or meningocerebrovascular amyloidosis, central nervous system (CNS) amyloidosis, or amyloidosis VII form. In one embodiment, the RNAi agents of the invention are administered to subjects suffering from familial amyloidotic cardiomyopathy (FAC). In another embodiment, the RNAi agents of the invention are administered to subjects suffering from FAC with a mixed phenotype, i.e., a subject having both cardiac and neurological impairements. In yet another embodiment, the RNAi agents of the invention are administered to subjects suffering from FAP with a mixed phenotype, i.e., a subject having both neurological and cardiac impairements. In one embodiment, the RNAi agents of the invention are administered to subjects suffering from FAP that has been treated with an orthotopic liver transplantation (OLT).

In another embodiment, the RNAi agents of the invention are administered to subjects suffering from senile systemic amyloidosis (SSA). In other embodiments of the methods of the invention, RNAi agents of the invention are administered to subjects suffering from familial amyloidotic cardiomyopathy (FAC) and senile systemic amyloidosis (SSA). Normal-sequence TTR causes cardiac amyloidosis in people who are elderly and is termed senile systemic amyloidosis (SSA) (also called senile cardiac amyloidosis (SCA) or cardiac amyloidosis). SSA often is accompanied by microscopic deposits in many other organs. TTR mutations accelerate the process of TTR amyloid formation and are the most important risk factor for the development of clinically significant TTR amyloidosis (also called ATTR (amyloidosis-transthyretin type)). More than 85 amyloidogenic TTR variants are known to cause systemic familial amyloidosis.

In some embodiments of the methods of the invention, RNAi agents of the invention are administered to subjects suffering from transthyretin (TTR) -related familial amyloidotic polyneuropathy (FAP). Such subjects may suffer from ocular manifestations, such as vitreous opacity and glaucoma. It is known to one of skill in the art that amyloidogenic transthyretin (ATTR) synthesized by retinal pigment epithelium (RPE) plays important roles in the progression of ocular amyloidosis. Previous studies have shown that panretinal laser photocoagulation, which reduced the RPE cells, prevented the progression of amyloid deposition in the vitreous, indicating that the effective suppression of ATTR expression in RPE may become a novel therapy for ocular amyloidosis (see, e.g., Kawaji, T., et al., Ophthalmology. (2010) 117: 552-555). Another TTR-associated disease is hyperthyroxinemia, also known as “dystransthyretinemic hyperthyroxinemia” or “dysprealbuminemic hyperthyroxinemia”. This type of hyperthyroxinemia may be secondary to an increased association of thyroxine with TTR due to a mutant TTR molecule with increased affinity for thyroxine. See, e.g., Moses et al. (1982) J. Clin.

Invest., 86, 2025-2033.

The RNAi agents of the invention may be administered to a subject using any mode of administration known in the art, including, but not limited to subcutaneous, intravenous, and intramuscular injection, and any combinations thereof.

In some embodiments, the agents are administered to the subject subcutaneously.

In some embodiments, a subject is administered a single dose of an RNAi agent via subcutaneous injection, e.g., abdominal, thigh, or upper arm injection. In other embodiments, a subject is administered a split dose of an RNAi agent via subcutaneous injection. In one embodiment, the split dose of the RNAi agent is administered to the subject via subcutaneous injection at two different anatomical locations on the subject. For example, the subject may be subcutaneously injected subcutaneously at a dose of 25 mg to 1000 mg. In some embodiments of the invention, the subcutaneous administration is self-administration via, e.g., a pre-filled syringe or auto-injector syringe. In some embodiments, a dose of the RNAi agent for subcutaneous administration is contained in a volume of less than or equal to one ml of, e.g., a pharmaceutically acceptable carrier. In some embodiments, the RNAi agent is in a non-pyrogenic formulation.

In some embodiments, the RNAi agent is administered to a subject in an amount effective to inhibit TTR expression in a cell within the subject. The amount effective to inhibit TTR expression in a cell within a subject may be assessed using methods discussed below, including methods that involve assessment of the inhibition of TTR mRNA, TTR protein, or related variables, such as amyloid deposits.

In some embodiments, the RNAi agent is administered to a subject in a therapeutically effective amount.

“Therapeutically effective amount,” as used herein, is intended to include the amount of an RNAi agent that, when administered to a patient for treating a TTR associated disease, is sufficient to effect treatment of the disease (e.g., by diminishing, maintaining, or slowing the progression of the existing disease as compared to an appropriate control; or diminishing, maintaining, or slowing one or more symptoms of disease as compared to an appropriate control). The “therapeutically effective amount” may vary depending on the RNAi agent, how the agent is administered, the disease and its severity and the history, age, weight, family history, genetic makeup, stage of pathological processes mediated by TTR expression, the types of preceding or concomitant treatments, if any, and other individual characteristics of the patient to be treated. Diagnostic criteria for TTR amyloidosis, polyneuropathies, and cardiomyopathies are discussed further below.

“Therapeutically effective amount,” as used herein, is intended to include the amount of an RNAi agent that, when administered to a subject who does not yet meet the diagnositic criteria of a TTR-associated disease, e.g., a subject who has not been diagnosed with hTTR amyloidosis polyneuropathy; a subject who does not meet the diagnostic criteria of Stage 1 FAP, but who may be predisposed to the disease, e.g., a subject with a TTR mutation associated with TTR amyloidosis, a subject suffering from one or more of orthostatic hypotension, heart failure, cardiac arrhythmia, left ventricular wall thickness, interventricular septal wall thickness, cardiac posterior wall thickness diarrhea, constipation, erectile dysfunction, glaucoma, intravitreal deposition, scalloped pupils; carpal tunnel syndrome, lumbar spinal stenosis, and bicep tendon rupture; a subject with an elevated neurofilament light chain (NfL) level as compared to a reference sample, e.g., a Nfl level of at least 37 pg/ml in serum, is sufficient to prevent or ameliorate the disease or one or more symptoms of the disease. Symptoms that may be ameliorated include sensory neuropathy (e.g., paresthesia, hypesthesia in distal limbs), autonomic neuropathy (e.g., gastrointestinal dysfunction, such as gastric ulcer, or orthostatic hypotension), motor neuropathy, seizures, dementia, myelopathy, polyneuropathy, carpal tunnel syndrome, autonomic insufficiency, cardiomyopathy, vitreous opacities, renal insufficiency, nephropathy, substantially reduced mBMI (modified Body Mass Index), cranial nerve dysfunction, corneal lattice dystrophy, left lventricular (LV) wall thickening by echocardiographic assessment, increased global longitudinal strain by echocardiographic assessment, increased N-terminal prohormone B-type Natriuretic Peptide (NTproBNP), and hospitalization due to cardiac event. Diminishing the disease includes slowing the course of the disease or reducing the severity of later-developing disease. The dose may vary depending on the RNAi agent, how the agent is administered, the degree of risk of disease, and the history, age, weight, family history, genetic makeup, the types of preceding or concomitant treatments, if any, and other individual characteristics of the patient to be treated.

A “therapeuticahy-effective amount” also includes an amount of an RNAi agent that produces some desired local or systemic effect at a reasonable benefit/risk ratio applicable to any treatment. RNAi agents employed in the methods of the present invention may be administered in a sufficient amount to produce a reasonable benefit/risk ratio applicable to such treatment.

As used herein, the phrase “therapeutically effective amount” also includes an amount that provides a benefit in the treatment, prevention, or management of pathological processes or symptom(s) of pathological processes mediated by TTR expression. Symptoms of TTR amyloidosis include sensory neuropathy (e.g. paresthesia, hypesthesia in distal limbs), autonomic neuropathy (e.g., gastrointestinal dysfunction, such as gastric ulcer, or orthostatic hypotension), motor neuropathy, seizures, dementia, myelopathy, polyneuropathy, carpal tunnel syndrome, autonomic insufficiency, cardiomyopathy, vitreous opacities, renal insufficiency, nephropathy, substantially reduced mBMI (modified Body Mass Index), cranial nerve dysfunction, corneal lattice dystrophy, left lventricular (LV) wall thickening by echocardiographic assessment, increased global longitudinal strain by echocardiographic assessment, increased N-terminal prohormone B-type Natriuretic Peptide (NTproBNP), and hospitalization due to cardiac event.

In one embodiment, for example, when the subject has FAP, FAP with mixed phenotype, FAC with mixed phenotype, or FAP and has had an OLT, treatment of the subject with a dsRNA agent of the invention slows the progression of neuropathy. In another embodiment, for example, when the subject has FAP, FAP with mixed phenotype, FAC with mixed phenotype, SSA, or FAP and has had an OLT, treatment of the subject with a dsRNA agent of the invention slows the progression of neuropathy and cardiomyopathy. In another embodiment, for example, when the subject has cardiac involvement, the method of the invention improve cardiac structure and function, including, for example, the methods reduce the mean left ventricular wall thickness and longitudinal strain, and reduce the expression level of the cardiac stress biomarker, N-terminal pro b-type natriuretic peptide (NT-proBNP).

Adminsitration of a therapeutically or prophylacticahy effective amount of the RNAi agent of the invention is also useful in methodsfor improving at least one indicia of neurological impairment or quality of life in a subject suffering from or at risk of developing a TTR-associated disease.

For example, in one embodiment, the methods of the invention improve at least indicia of neurological impairment in the subject. “Improving at least one indicia of neurological impairment” in the subject refers to the ability of the methods of the invention to slow, reduce, or arrest neurological impairment, or improve any symptom associated with neurological impairment. Any suitable measure of neurological impairment can be used to determine whether a subject has reduced, slowed, or arrested, neurological impairment, or an improvement of a symptom associated with neurological impairment. One suitable measure is a Neuropathy Impairment Score (NIS). NIS refers to a scoring system that measures weakness, sensation, and reflexes, especially with respect to peripheral neuropathy. The NIS score evaluates a standard group of muscles for weakness (1 is 25% weak, 2 is 50% weak, 3 is 75% weak, 3.25 is movement against gravity, 3.5 is movement with gravity eliminated, 3.75 is muscle flicker without movement, and 4 is paralyzed), a standard group of muscle stretch reflexes (0 is normal, 1 is decreased, 2 is absent) , and touch-pressure, vibration, joint position and motion, and pinprick (all graded on index finger and big toe: 0 is normal, 1 is decreased, 2 is absent). Evaluations are corrected for age, gender, and physical fitness.

In one embodiment, the methods of the invention reduce a NIS by at least 5 points at 18 months from the start of dosing. In other embodiments, the methods of the invention result in a stabilization of NIS at 18 months from the start of treatment with an RNAi agent provided herein. In other embodiments, the methods slow an increasing NIS score as compared to an appropriate control group showing the natural history of the disease, e.g., a placebo control group as provided, for example in Adams et al., N Engl J Med 2018;379:11-21. It is understood that the rate of disease progression is dependent upon a number of factors including, but not limited to, the severity of disease in the subject at the initiation of treatment, the duration of treatment, prior treatments, and the specific TTR mutation present, if any.

Methods for determining a NIS in a human subject are well known to one of skill in the art and can be found in, for example, Dyck, PJ et al, (1997) Neurology 1997. 49(1): pgs. 229-239); Dyck PJ. (1988) Muscle Nerve. Jan; 1 l(l):21-32.

Another suitable measurement of neurological impairment is a Modified Neuropathy Impairment Score (mNIS+7). As known to one of ordinary skill in the art, mNTS+7 refers to a clinical exam-based assessment of neurologic impairment (NIS) combined with electrophysiologic measures of small and large nerve fiber function (NCS and QST), and measurement of autonomic function (postural blood pressure). The mNTS+7 score is a modification of the NIS+7 score (which represents NIS plus seven tests). NIS+7 analyzes weakness and muscle stretch reflexes. Five of the seven tests include attributes of nerve conduction. These attributes are the peroneal nerve compound muscle action potential amplitude, motor nerve conduction velocity and motor nerve distal latency (MNDL), tibial MNDL, and sural sensory nerve action potential amplitudes. These values are corrected for variables of age, gender, height, and weight. The remaining two of the seven tests include vibratory detection threshold and heart rate decrease with deep breathing.

The mNTS+7 score modifies NIS+7 to take into account the use of Smart Somatotopic Quantitative Sensation Testing, new autonomic assessments, and the use of compound muscle action potential of amplitudes of the ulnar, peroneal, and tibial nerves, and sensory nerve action potentials of the ulnar and sural nerves (Suanprasert, N. et al, (2014) J. Neurol. Sci., 344(1-2): pgs. 121-128).

In one embodiment, the methods of the invention reduce a mNTS+7 by at least 5 points at 18 months from the start of dosing. In other embodiments, the methods of the invention result in a stabilization of mNTS+7 at 18 months from the start of treatment with an RNAi agent provided herein.

In other embodiments, the methods slow an increasing mNTS+7 score as compared to an appropriate control group showing the natural history of the disease, e.g., a placebo control group as provided, for example in Adams et al., N Engl J Med 2018;379:11-21. It is understood that the rate of disease progression is dependent upon a number of factors including, but not limited to, the severity of disease in the subject at the initiation of treatment, the duration of treatment, prior treatments, and the specific TTR mutation present, if any.

In another embodiment, the methods of the invention improve at least one indicia of quality of life in the subject. “Improving at least one indicia of quality of life” in the subject refers to the ability of the methods of the invention to slow or arrest quality of life worsening or improve quality of life. Any suitable measure of quality of life can be used to determine whether a subject has slowed or arrested quality of life worsening, or improved quality of life.

For example, the SF-36® health survey provides a self-reporting, multi-item scale measuring eight health parameters: physical functioning, role limitations due to physical health problems, bodily pain, general health, vitality (energy and fatigue), social functioning, role limitations due to emotional problems, and mental health (psychological distress and psychological well-being). Each scale is directly transformed into a 0-100 scale on the assumption that each question carries equal weight. The lower the score the more disability. The higher the score the less disability i.e., a score of zero is equivalent to maximum disability and a score of 100 is equivalent to no disability. The survey also provides a physical component summary and a mental component summary.

In one embodiment, the methods of the invention provide to the subject an improvement versus baseline in at least one of the SF- 36 physical health related parameters (physical health, role -physical, bodily pain or general health) or in at least one of the SF-36 mental health related parameters (vitality, social functioning, role-emotional or mental health). Such an improvement can take the form of an increase of, for example at least 2 or at least 3 points, on the scale for any one or more parameters at 9 months from the start of the dosing.

In other embodiments, the methods of the invention arrest a decreasing SF-36 parameter score at 9 months from the start of dosing for any one or more parameters, e.g., the methods result in no clinically significant change of the SF-36 e.g., within the variation observed for individuals performing an SF-36 assessment. In yet other embodiments, the methods of the invention slow the rate at which a SF-36 score decreases at 9 months from the start of dosing, e.g., the rate of decrease of an SF-36 score in a subject treated with an RNAi agent of the invention as compared to the rate of decrease of an SF-36 score as compared to an appropriate control group showing the natural history of the disease, e.g., a placebo control group as provided, for example in Adams et al., N Engl J Med 2018;379:11-21. It is understood that the rate of disease progression is dependent upon a number of factors including, but not limited to, the severity of disease in the subject at the initiation of treatment, the duration of treatment, prior treatments, and the specific TTR mutation present, if any.

Another suitable measurement of quality of life is the Norfolk Quality of Fife-Diabetic Neuropathy (Norfolk QOF-DN) questionnaire. The Norfolk QOF-DN is a validated comprehensive questionnaire designed to capture the entire spectrum of DN related to large fiber, small fiber, and autonomic neuropathy not captured in existing instruments. In one embodiment, the methods of the invention improve a subject’s Norfolk QOL-DN score from baseline, e.g., a change of about -2.5, -3.0, -3.5, -4.0, -4.5, or -5.0 at 9 months from the start of treatment with an RNAi agent provided herein. In other embodiments, the methods arrest an increasing Norfolk QOL-DN score, e.g., the methods result in no clinically significant change of theNorfolk QOL- DN score, e.g., within the variation observed between individuals performing a QOL-DN assessment.

In yet other embodiments, the methods of the invention slow the rate at which an QOL-DN score increases, e.g., the rate of increase of a QOL-DN score in a subject treated with an RNAi agent of the invention as compared to the rate of increase of a QOL-DN score as compared to an appropriate control group showing the natural history of the disease, e.g., a placebo control group as provided, for example in Adams et al., N Engl J Med 2018;379:11-21. It is understood that the rate of disease progression is dependent upon a number of factors including, but not limited to, the severity of disease in the subject at the initiation of treatment, the duration of treatment, prior treatments, and the specific TTR mutation present, if any.

Another suitable measurement of quality of life is motor strength as assessed by, for example, a NIS-W score. A NIS-W score is a composite score that summates the weakness of head, trunk, and limb muscles. Using the NIS (W) (referring to the portion of the scale measuring weakness), muscle power is assessed as normal (0) or complete paralysis (4) with intermediate grades; 1 representing a muscle that is deemed 25% weak by clinical strength testing, 2 as 50% weak, 3 as 75% weak, 3.25 as movement against gravity, 3.50 as movement with gravity eliminated, and 3.75 as muscle flicker.

In one embodiment, the methods of the invention provide to the subject an improvement versus baseline in an NIS-W score Such an improvement can take the form of a decrease of at least 5, 6, 7, 8,

9, or 10 points of the subject’s NIS-W score at 18 months from the start of treatment with an RNAi agent provided herein. In other embodiments, the methods arrest a decrease NIS-W score, e.g., the methods result in no clinically significant increase of the NIS-W score, or a slowing in the rate of increase of NIS-W score as compared to an appropriate control group showing the natural history of the disease, e.g., a placebo control group as provided, for example in Adams et al., N Engl J Med 2018;379:11-21. It is understood that the rate of disease progression is dependent upon a number of factors including, but not limited to, the severity of disease in the subject at the initiation of treatment, the duration of treatment, prior treatments, and the specific TTR mutation present, if any.

Yet another suitable indicia of quality of life is the Rasch-built Overall Disability Scale (R- ODS), which is a a patient questionnaire designed to capture activity and social participation limitations in patients. In one embodiment, the methods of the invention provide to the subject an improvement versus baseline in an R-ODS score. Such an improvement can take the form of an increase of at least 2, for example at least 2, 3, 4, or 5 points of the subject’s R-ODS score at 18 months from the start of treatment with an RNAi agent provided herein. In other embodiments, the methods arrest a decreasing R-ODS score, e.g., the methods result in no clinically significant decrease of the R-ODS score at 18 months from the start of treatment with an RNAi agent provided herein. In yet other embodiments, the methods of the invention slow the rate at which a R-ODS score decreases at 18 months from the start of treatment with an RNAi agent provided herein, e.g., the rate of decrease of a R-ODS score in a subject treated with an RNAi agent of the invention as compared to the rate of decrease of a R-ODS score as compared to an appropriate control group showing the natural history of the disease, e.g., a placebo control group as provided, for example in Adams et al., N Engl J Med 2018;379:11-21. It is understood that the rate of disease progression is dependent upon a number of factors including, but not limited to, the severity of disease in the subject at the initiation of treatment, the duration of treatment, prior treatments, and the specific TTR mutation present, if any.

The composite autonomic symptom score (COMPASS-31), a patient questionnaire that assesses symptoms of dysautonomia autonomic which provides a symptom score from 0 to 100, is another suitable indicia of quality of life. In one embodiment, the methods of the invention provide to the subject an improvement versus baseline in a COMPASS-31 score. Such an improvement can take the form of an increase of at least 5, for example at least 5, 6, 7, 8, 9, or 10, points of the subject’s COMPASS-31 score at 18 months from the start of treatment with an RNAi agent provided herein. In other embodiments, the methods arrest a decreasing COMPASS-31 score, e.g., the methods result in no clinically relevant change of the COMPASS-31 score at 18 months from the start of treatment with an RNAi agent provided herein. In yet other embodiments, the methods of the invention slow the rate at which a COMPASS-31 score decreases, e.g., the rate of decrease of a COMPASS-31 score at 18 months from the start of treatment with an RNAi agent provided herein in a subject treated with an RNAi agent of the invention as compared to the rate of decrease of a COMPASS-31 score as compared to an appropriate control group showing the natural history of the disease, e.g., a placebo control group as provided, for example in Adams et al., N Engl J Med 2018;379:11-21. It is understood that the rate of disease progression is dependent upon a number of factors including, but not limited to, the severity of disease in the subject at the initiation of treatment, the duration of treatment, prior treatments, and the specific TTR mutation present, if any.

Other quality of life indicia may include nutritional status (e.g., as assessed by change in median body mass index (mBMI). In one embodiment, the methods of the invention provide to the subject an improvement versus baseline in mBMI. Such an improvement can take the form of a mBMI score increase of at least 2, 3, 4, 5, or more at 18 months from the start of treatment with an RNAi agent provided herein. In other embodiments, the methods arrest a decreasing mBMI index score, e.g., the methods result in no clinically significant change of the mBMI score at 18 months from the start of treatment with an RNAi agent provided herein. In yet other embodiments, the methods of the invention slow the rate at which mBMI score decreases, e.g., the rate of decrease of a mBMI score at 18 months from the start of treatment with an RNAi agent provided herein in a subject treated with an RNAi agent of the invention as compared to the rate of decrease of a mBMI score in a subject as compared to an appropriate control group showing the natural history of the disease, e.g., a placebo control group as provided, for example in Adams et al., N Engl J Med 2018;379:11-21. It is understood that the rate of disease progression is dependent upon a number of factors including, but not limited to, the severity of disease in the subject at the initiation of treatment, the duration of treatment, prior treatments, and the specific TTR mutation present, if any. Another quality of life indicia includes assessment of exercise capacity. One suitable measure of exercise capacity is a 6-minute walk test (6MWT), which measures how far the subject can walk in 6 minutes, i.e., the 6-minute walk distance (6MWD). In one embodiment, the methods of the invention provide to the subject an increase from baseline in the 6MWD by at least 10 meters, e.g., at least 10, 15, 20, or about 30 meters at 18 months from the start of treatment with an RNAi agent provided herein.

Another suitable measure is the 10-meter walk test which measures gait speed. In one embodiment, the methods of the invention provide to the subject an increase from baseline in the 10- meter walk test by at least 0.025 meters/second, e.g., at least 0.025, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0. 4.5, or about 5.0 meters/second at 18 months from the start of treatment with an RNAi agent provided herein.

In some embodiments, a change in a plasma biomarker level is an indicia of a decrease in ongoing nerve damage or progression of polyneuropathy in ATTR amyloidosis. For example, a decrease in the level of neurofilament light chain (NfL) at 9 months as compared to an NfL level at the start of treatment can be an indicia of a decrease in ongoing nerve damage or progression of polyneuropathy in ATTR amyloidosis. In certain embodiments, a decrease in the level of other proteins, especially RSP03, CCDC80, EDA2R, and NT-proBNP, either alone or in combination with a decrease in NfL level at 9 months from the start of treatment as compared to its corresponding level at the start of treatment can be an indicia of a decrease in ongoing nerve damage or progression of polyneuropathy in ATTR amyloidosis. In certain embodiments, an increase in the level of N-CDase, either alone or in combination with the other markers listed above, at 9 months from the start of treatment as compared to an its corresponding level at the start of treatment can be an indicia of a decrease in ongoing nerve damage or progression of polyneuropathy in ATTR amyloidosis. Further biomarkers that can act as indicia of a decrease in nerve damage or polyneuropathy in ATTR amyloidosis, such as at 9 months from the initiation of treatment with an RNAi agent provided herein, are provided in Table 1. A decrease in ongoing nerve damage or progression of polyneuropathy in ATTR amyloidosis is correlated with a decrease in the proteins having a positive beta coefficient. A decrease in ongoing nerve damage or progression of polyneuropathy in ATTR amyloidosis is correlated with an increase in proteins having a negative beta coefficient. It is understood that the change in the biomarker level is a statistically significant change, i.e., a change larger than the inherent variability of the assay.

In certain embodiments, the methods of the invention provide an improvement in cardiovascular indicia, e.g., increase in Kansas City Cardiomyopathy Questionnaire Overall Summary (KCCQ-OS), decreased left lventricular (LV) wall thickening by echocardiographic assessment as compared to baseline, decreased global longitudinal strain by echocardiographic assessment as compared to baseline, decreased N-terminal prohormone B-type Natriuretic Peptide (NTproBNP) as compared to baseline, and decrease in hospitalization due to cardiac event.

The methods of the present invention may also improve the prognosis of the subject being treated. For example, the methods of the invention may provide to the subject a reduction in probability of a clinical worsening event during the treatment period, or an increased longevity, or decreased hospitalization as compared to an appropriate control group showing the natural history of the disease, e.g., a placebo control group as provided, for example in Adams et al., N Engl J Med 2018;379:11-21.

In certain embodiments, a reduction in the probability of a clinical worsening event during the treatment can include a decrease in all-cause mortality or rates of cardiovascular-related hospitalization as assessed, e.g., according to the Finkelstein-Schoenfeld method, as compared to an appropriate control group, as provided, for example, in Maurer et al., N Engl J Med 2018:379:11-21. It is understood that the rate of disease progression is dependent upon a number of factors including, but not limited to, the severity of disease in the subject at the initiation of treatment, the duration of treatment, prior treatments, and the specific TTR mutation present, if any.

The dose of an RNAi agent that is administered to a subject may be tailored to balance the risks and benefits of a particular dose, for example, to achieve a desired level of inhibition of TTR gene expression (as assessed, e.g., based on TTR mRNA expression, TTR protein expression, or a reduction in an amyloid deposit, as defined above) or a desired therapeutic effect, while at the same time avoiding undesirable side effects.

In one embodiment, an iRNA agent of the invention is administered to a subject as a “fixed dose” (e.g., a dose in mg) means that one dose of an iRNA agent is used for all subjects regardless of any specific subject-related factors, such as weight.

In some embodiments, the RNAi agent is administered as a fixed dose of about 25 mg to about 1000 mg, e.g., about 25 mg, about 50 mg, about 100 mg, about 200 mg, about 300 mg, about 400 mg, about 500 mg, about 600 mg, about 700 mg, about 800 mg, about 900 mg, or about 1000 mg.

In certain embodiments, the double stranded RNAi agent is administered to the human subject at a fixed dose of about 25 mg to about 300 mg. In certain embodiments, the double stranded RNAi agent is administered to the human subject at a fixed dose of about 25 mg to about 200 mg. In certain embodiments, the double stranded RNAi agent is administered to the human subject at a fixed dose of about 75 mg to about 200 mg. In certain embodiments, the double stranded RNAi agent is administered to the human subject at a fixed dose of about 25 mg. In certain embodiments, the double stranded RNAi agent is administered to the human subject at a fixed dose of about 50 mg. In certain embodiments, the double stranded RNAi agent is administered to the human subject at a fixed dose of about 75 mg. In certain embodiments, the double stranded RNAi agent is administered to the human subject at a fixed dose of about 100 mg. In certain embodiments, the double stranded RNAi agent is administered to the human subject at a fixed dose of about 200 mg. In certain embodiments, the double stranded RNAi agent is administered to the human subject at a fixed dose of about 25 mg to about 300 mg; about 25 mg to about 200 mg; about 75 mg to about 200 mg; about 25 mg; about 50 mg; about 100 mg; about 200mg; or about 300 mg once per quarter, i.e., about once every three months.

In certain embodiments, the administration is subcutaneous administration, e.g., self administration via, e.g., a pre -filled syringe or auto-injector syringe. In some embodiments, a dose of the RNAi agent for subcutaneous administration is contained in a volume of less than or equal to one ml of, e.g., a pharmaceutically acceptable carrier.

Any of these schedules may optionally be repeated for one or more iterations. The number of iterations may depend on the achievement of a desired effect, e.g., the suppression of a TTR gene, retinol binding protein level, vitamin A level, or the achievement of a therapeutic effect, e.g., reducing an amyloid deposit or reducing a symptom of a TTR-associated disease. In certain embodiments, the iRNA agent is administered chronically, for an indefinite period of time, e.g., throughout the life of the patient.

In some embodiments, the RNAi agent is administered with other therapeutic agents or other therapeutic regimens. For example, other agents or other therapeutic regimens suitable for treating a TTR-associated disease may include a liver transplant, a heart transplant, implantation of a pacemaker, an agent which can reduce monomer TTR levels in the body; Tafamidis (Vyndaqel® or Vyndamax®) or AGIO, which kinetically stabilizes the TTR tetramer preventing tetramer dissociation required for TTR amyloidogenesis; nonsteroidal anti-inflammatory drugs (NSAIDS), e.g., diflunisal, and diuretics, which may be employed, for example, to reduce edema in TTR amyloidosis with cardiac involvement.

In one embodiment, a subject is administered an initial dose and one or more maintenance doses of an RNAi agent. The maintenance dose or doses can be the same or lower than the initial dose, e.g., one-half of the initial dose. Following treatment, the patient can be monitored for changes in his/her condition.

In some embodiments of the methods of the invention, expression of a TTR gene as assessed by serum or plasma TTR levels is inhibited by at least 85%, in some embodiments at least 90%. It is understood that inhibition of TTR expression using the iRNA agents provided herein would inhibit expression of TTR in the liver and not substantially in other tissues, e.g., TTR expression in the eye.

The term “inhibiting,” as used herein, is used interchangeably with “reducing,” “silencing,” “downregulating”, “suppressing”, and other similar terms, and includes any level of inhibition. In some embodiments, inhibiting includes a statistically significant or clinically significant inhibition.

The phrase “inhibiting expression of a TTR” is intended to refer to inhibition of expression of any TTR gene including variants or mutants of a TTR gene. Thus, the TTR gene may be a wild-type TTR gene, a mutant TTR gene (such as a mutant TTR gene giving rise to amyloid deposition). Inhibition may be assessed by a decrease in an absolute or relative level of one or more variables that are associated with TTR expression compared with a control level. The control level may be any type of control level that is utilized in the art, e.g., a pre-dose baseline level, or a level determined from a similar subject, cell, or sample that is untreated or treated with a control (such as, e.g., buffer only control or inactive agent control). As used herein, inhibition of TTR expression is typically assessed by determining a TTR level in an appropriate sample (e.g., historical control sample, level determined in a normal sample or clinical trial) or before treatment of the subject with an iRNA agent, such as those provided herein or in PCT publications W02010048228, W02013075035, and W02017023660, or other agent, e.g., antisense oligonucleotide agent, dicer substrate agent, that inhibits the expression of TTR, see, e.g., WO2011139917 and WO2015085158; and after treatment with an iRNA agent provided herein. It is understood that the iRNA agents provided herein are durable but slow acting. Therefore, the level of knockdown is determined after sufficient time to reach nadir, e.g., at least 3 weeks after first dose of the iRNA agent in a human subject, or when steady state of TTR knockdown has been achieved, e.g., after multiple doses with an iRNA agent provided herein.

Inhibition of the expression of a TTR gene may be manifested by a reduction of the amount of mRNA expressed by a first cell or group of cells (such cells may be present, for example, in a sample derived from a subject) in which a TTR gene is transcribed and which has or have been treated (e.g., by contacting the cell or cells with an RNAi agent of the invention, or by administering an RNAi agent of the invention to a subject in which the cells are or were present) such that the expression of a TTR gene is inhibited, as compared to a second cell or group of cells substantially identical to the first cell or group of cells but which has not or have not been so treated (control cell(s)). In some embodiments, the percent inhibition is assessed by expressing the level of mRNA in treated cells as a percentage of the level of mRNA in control cells, using the following formula:

A similar calculation may be performed on serum TTR protein concentrations, e.g., in a blood sample obtained froma subject, to determine percent inhibition of expression. If no TTR is detected in the serum or plasma sample after treatment, the amount of TTR present is considered to be the at the lower limit of detection of the assay used.

In some embodiments, the percent inhibition is determined using a validated and clinically acceptable method.

Alternatively, inhibition of the expression of a TTR gene may be assessed in terms of a reduction of a parameter that is functionally linked to TTR gene expression, e.g., TTR protein expression, retinol binding protein level, vitamin A level, or presence of amyloid deposits comprising TTR. TTR gene silencing may be determined in any cell expressing TTR, either constitutively or by genomic engineering, and by any assay known in the art. The liver is the major site of TTR gene expression. Other significant sites of expression include the retina and choroid plexus. III. iRNAs of the Invention

Suitable iRNAs for use in the methods of the present invention include double stranded ribonucleic acid (dsRNA) molecules for inhibiting the expression of a TTR gene in a cell, such as a cell within a subject, e.g., a mammal, such as a human having a TTR-associated disease. The dsRNA includes an antisense strand having a region of complementarity which is complementary to at least a part of an mRNA formed in the expression of a TTR gene. The region of complementarity is about 21- 30 nucleotides or less in length (e.g., about 30, 29, 28, 27, 26, 25, 24, 23, 22, or 21 nucleotides in length). Upon contact with a cell expressing the TTR gene, the iRNA selectively inhibits the expression of the TTR gene (e.g., a human, a non-human primate, or a non-primate mammal TTR gene) by at least about 70% as assayed by, for example, real time PCR using the method provided in Example 4 of W02013075035 when Hep3B cells are transfected with 10 nM of the iRNA agent using the method provided therein.

A dsRNA includes two RNA strands that are complementary and hybridize to form a duplex structure under conditions in which the dsRNA will be used. One strand of a dsRNA (the antisense strand) includes a region of complementarity that is substantially complementary, and generally fully complementary, to a target sequence. The target sequence can be derived from the sequence of an mRNA formed during the expression of a TTR gene. The other strand (the sense strand) includes a region that is complementary to the antisense strand, such that the two strands hybridize and form a duplex structure when combined under suitable conditions. As described elsewhere herein and as known in the art, the complementary sequences of a dsRNA can also be contained as self complementary regions of a single nucleic acid molecule, as opposed to being on separate oligonucleotides .

Generally, the duplex structure is 21 to 30 base pairs in length. Similarly, the region of complementarity to the target sequence is 22 and 30 nucleotides in length.

A dsRNA can be synthesized by standard methods known in the art as further discussed below. iRNA compounds of the invention may be prepared using a two-step procedure. First, the individual strands of the double stranded RNA molecule are prepared separately. Then, the component strands are annealed. The individual strands of the siRNA compound can be prepared using solution- phase or solid-phase organic synthesis or both. Organic synthesis offers the advantage that the oligonucleotide strands comprising unnatural or modified nucleotides can be easily prepared. Single- stranded oligonucleotides of the invention can be prepared using solution-phase or solid-phase organic synthesis or both.

IV. Modified iRNAs of the Invention

The iRNA agents for use in the methods of the invention include defined chemical modifications in the sense and antisense strand. When the length of either strand is extended to provide an antisense strand longer than 23 nucleotides and a sense strand longer than 21 nucleotides, the nucleotides can include modifications including, but not limited to, sugar modifications, backbone modifications, and base modifications.Modifications include, for example, end modifications, e.g., 5’- end modifications (phosphorylation, conjugation, inverted linkages) or 3 ’-end modifications (conjugation, DNA nucleotides, inverted linkages, etc.)·, base modifications, e.g., replacement with stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners, removal of bases (abasic nucleotides), or conjugated bases; sugar modifications (e.g., at the 2’ -position or 4’ -position) or replacement of the sugar; or backbone modifications, including modification or replacement of the phosphodiester linkages. Specific examples of iRNA compounds useful in the embodiments described herein include, but are not limited to, RNAs containing modified backbones or no natural internucleoside linkages. RNAs having modified backbones include, among others, those that do not have a phosphorus atom in the backbone. For the purposes of this specification, and as sometimes referenced in the art, modified RNAs that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides. In some embodiments, a modified iRNA has a phosphorus atom in its internucleoside backbone.

Modified RNA backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3'-5' linkages, 2'-5'-linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. Various salts, mixed salts and free acid forms are also included.

Modified RNA backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatoms and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH₂ component parts.

In other embodiments, suitable RNA mimetics are contemplated for use in iRNAs, in which both the sugar and the internucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with novel groups. The base units are maintained for hybridization with an appropriate nucleic acid target compound. One such oligomeric compound, an RNA mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar backbone of an RNA is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone.

Some embodiments featured in the disclosure include RNAs with phosphorothioate backbones and oligonucleosides with heteroatom backbones, and in particular — CH₂-NH— CH₂-, — CH₂- N(CH₃) - O--CH2-- [known as a methylene (methylimino) or MMI backbone], — CH₂-O— N(CH₃)~ CH₂— , --CH₂- N(CH₃)- N(CK₃)- CH₂— and — N(CH₃)— CH₂— CH₂— of the above -referenced U.S. Patent No.

5,489,677, and the amide backbones of the above-referenced U.S. Patent No. 5,602,240. In some embodiments, the RNAs featured herein have morpholino backbone structures of the above -referenced U.S. Patent No. 5,034,506. The native phosphodiester backbone can be represented as 0-P(0)(0H)- OCH2-.

Modified RNAs can also contain one or more substituted sugar moieties. The iRNAs, e.g., dsRNAs, featured herein can include one of the following at the 2'-position: OH; F; 0-, S-, or N-alkyl; 0-, S-, or N-alkenyl; 0-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl can be substituted or unsubstituted C₁ to C₁₀ alkyl or C2 to C₁₀ alkenyl and alkynyl. Exemplary suitable modifications include 0[(CH₂)_nO] _mCH₃, 0(CH₂)._n0CH₃, 0(CH₂)_nNH₂, 0(CH₂) _nCH₃, 0(CH₂)_n0NH₂, and 0(CH₂)_n0N[(CH₂)_nCH₃)]₂, where n and m are from 1 to about 10. In other embodiments, dsRNAs include one of the following at the 2' position: Ci to C₁₀ lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH₃, OCN, Cl, Br, CN, CF₃, OCF₃, SOCH₃, S0₂CH₃, ON0₂, N0₂, N₃, NH₂, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an iRNA, or a group for improving the pharmacodynamic properties of an iRNA, and other substituents having similar properties. In some embodiments, the modification includes a 2'-methoxyethoxy (2'-0— CH₂CH₂OCH₃, also known as 2'-0-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78:486-504) i.e., an alkoxy-alkoxy group. Another exemplary modification is 2'-dimethylaminooxyethoxy, i.e., a 0(CH₂)₂0N(CH₃)₂ group, also known as 2'-DMAOE, as described in examples herein below, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-0- dimethylaminoethoxyethyl or 2'-DMAEOE), i.e., 2'-0— CH₂— O— CH₂— N(CH₃)₂. Further exemplary modifications include: 5’-Me-2’-F nucleotides, 5’-Me-2’-OMe nucleotides, 5’-Me-2’-deoxynucleotides, (both R and S isomers in these three families); 2’-alkoxyalkyl; and 2’-NMA (N-methylacetamide).

Other modifications include 2'-methoxy (2'-OCH₃), 2'-aminopropoxy (2'-OCH₂CH₂CH₂NH₂) and 2'-fluoro (2'-F). Similar modifications can also be made at other positions on the RNA of an iRNA, particularly the 3' position of the sugar on the 3' terminal nucleotide or in 2'-5' linked dsRNAs and the 5' position of 5' terminal nucleotide. iRNAs can also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar.

The RNA of an iRNA of the invention can also include nucleobase (often referred to in the art simply as “base”) modifications or substitutions. As used herein, “unmodified” or “natural” nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleobases include other synthetic and natural nucleobases such as deoxythymidine (dT), 5-methylcytosine (5-me-C), 5 -hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4- thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl anal other 8-substituted adenines and guanines, 5-halo, particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7- daazaadenine and 3-deazaguanine and 3-deazaadenine. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds featured in the invention. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2°C (Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., Eds., dsRNA Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are exemplary base substitutions, even more particularly when combined with 2'-0-methoxyethyl sugar modifications.

An RNAi agent of the disclosure can also be modified to include one or more bicyclic sugar moities. A “bicyclic sugar” is a furanosyl ring modified by a ring formed by the bridging of two carbons, whether adjacent or non-adjacent atoms. A “bicyclic nucleoside” (“BNA”) is a nucleoside having a sugar moiety comprising a ring formed by bridging comprising a bridge connecting two carbons, whether adjacent or non-adjacent, two carbon atoms of the sugar ring, thereby forming a bicyclic ring system. In certain embodiments, the bridge connects the 4’-carbon and the 2’-carbon of the sugar ring, optionally, via the 2’ -acyclic oxygen atom. Thus, in some embodiments an agent of the disclosure may include one or more locked nucleic acids (LNA). A locked nucleic acid is a nucleotide having a modified ribose moiety in which the ribose moiety comprises an extra bridge connecting the 2' and 4' carbons. In other words, an LNA is a nucleotide comprising a bicyclic sugar moiety comprising a 4'-CH2-0-2' bridge. This structure effectively "locks" the ribose in the 3'-endo structural conformation. The addition of locked nucleic acids to siRNAs has been shown to increase siRNA stability in serum, and to reduce off-target effects (Elmen, J. et al, (2005) Nucleic Acids Research 33(l):439-447; Mook, OR. et al, (2007) Mol Cane Ther 6(3): 833-843; Grunweller, A. et al, (2003) Nucleic Acids Research 31(12):3185-3193). Examples of bicyclic nucleosides for use in the polynucleotides of the disclosure include without limitation nucleosides comprising a bridge between the 4' and the 2' ribosyl ring atoms. In certain embodiments, the antisense polynucleotide agents of the disclosure include one or more bicyclic nucleosides comprising a 4' to 2' bridge.

A locked nucleoside can be represented by the structure (omitting stereochemistry), wherein B is a nucleobase or modified nucleobase and L is the linking group that joins the 2’- carbon to the 4’ -carbon of the ribose ring. Examples of such 4' to 2' bridged bicyclic nucleosides, include but are not limited to 4'- (CH2)— 0-2' (LNA); 4'-(CH2)— S-2'; 4'-(CH2)2— 0-2' (ENA); 4'-CH(CH3)— 0-2' (also referred to as “constrained ethyl” or “cEt”) and 4'-CH(CH20CH3) — 0-2' (and analogs thereof; see, e.g., U.S. Pat.

No. 7,399,845); 4'-C(CH3)(CH3) — 0-2' (and analogs thereof; see e.g., US Patent No. 8,278,283); 4'- CH2 — N(OCH3)-2' (and analogs thereof; see e.g., US Patent No. 8,278,425); 4'-CH2 — O — N(CH3)-2' (see, e.g., U.S. Patent Publication No. 2004/0171570); 4'-CH2 — N(R) — 0-2', wherein R is H, C1-C12 alkyl, or a nitrogen protecting group (see, e.g., U.S. Pat. No. 7,427,672); 4'-CH2 — C(H)(CH3)-2' (see, e.g., Chattopadhyaya et al, J. Org. Chem., 2009, 74, 118-134); and 4'-CH2 — C(=CH2)-2' (and analogs thereof; see, e.g., US Patent No. 8,278,426). The entire contents of each of the foregoing are hereby incorporated herein by reference.

Additional representative US Patents and US Patent Publications that teach the preparation of locked nucleic acid nucleotides include, but are not limited to, the following: US Patent Nos. 6,268,490; 6,525,191; 6,670,461; 6,770,748; 6,794,499; 6,998,484; 7,053,207; 7,034,133;7,084,125; 7,399,845; 7,427,672; 7,569,686; 7,741,457; 8,022,193; 8,030,467; 8,278,425; 8,278,426; 8,278,283; US 2008/0039618; and US 2009/0012281, the entire contents of each of which are hereby incorporated herein by reference.

Any of the foregoing bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example α-L-ribofuranose and b-D-ribofuranose (see WO 99/14226).

An RNAi agent of the disclosure can also be modified to include one or more constrained ethyl nucleotides. As used herein, a "constrained ethyl nucleotide" or "cEt" is a locked nucleic acid comprising a bicyclic sugar moiety comprising a 4’-CH(CH3)-0-2’ bridge (i.e., L in the preceding structure). In one embodiment, a constrained ethyl nucleotide is in the S conformation referred to herein as “S-cEt.”

An iRNA of the invention may also include one or more “conformationally restricted nucleotides” (“CRN”). CRN are nucleotide analogs with a linker connecting the C2’and C4’ carbons of ribose or the C3 and -C5' carbons of ribose . CRN lock the ribose ring into a stable conformation and increase the hybridization affinity to rnRNA. The linker is of sufficient length to place the oxygen in an optimal position for stability and affinity resulting in less ribose ring puckering.

One or more of the nucleotides of an iRNA of the invention may also include a hydroxymethyl substituted nucleotide. A “hydroxymethyl substituted nucleotide” is an acyclic 2’-3’-seco-nucleotide, also referred to as an “unlocked nucleic acid” (“UNA”) modification.

Potentially stabilizing modifications to the ends of RNA molecules can include N- (acetylaminocaproyl)-4-hydroxyprolinol (Hyp-C6-NHAc), N-(caproyl-4-hydroxyprolinol (Hyp-C6), N- (acetyl-4-hydroxyprolinol (Hyp-NHAc), thymidine-2’-0-deoxythymidine (ether), N-(aminocaproyl)-4- hydroxyprolinol (Hyp-C6-amino), 2-docosanoyl-uridine-3’- phosphate, inverted base dT(idT) and others. Disclosure of this modification can be found in WO 2011/005861.

Other modifications of the nucleotides of an iRNA of the invention include a 5’ phosphate or 5’ phosphate mimic, e.g., a 5’-terminal phosphate or phosphate mimic on the antisense strand of an RNAi agent. Suitable phosphate mimics are disclosed in, for example US Patent Publication No. 2012/0157511, the entire contents of which are incorporated herein by reference.

V. iRNAs Conjugated to Ligands

Another modification of the RNA of an iRNA of the invention involves chemically linking to the RNA one or more ligands, moieties or conjugates that enhance the activity, cellular distribution or cellular uptake of the iRNA. Such moieties include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acid. Sci. USA, 1989, 86: 6553-6556), cholic acid (Manoharan et al., Biorg. Med. Chem. Let., 1994, 4:1053-1060), a thioether, e.g., beryl-S-tritylthiol (Manoharan et aI., Ahh. N.Y. Acad. Sci., 1992, 660:306-309; Manoharan et al., Biorg. Med. Chem. Let., 1993, 3:2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20:533-538), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., EMBO J, 1991, 10:1111-1118; Kabanov et al., FEBS Lett., 1990, 259:327-330; Svinarchuk et al., Biochimie, 1993, 75:49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1 ,2-di-O-hexadecyl- rac-glycero-3-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654; Shea et al., Nucl. Acids Res., 1990, 18:3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651-3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229-237), or an octadecylamine or hexylamino-carbonyloxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923-937).

In one embodiment, a ligand alters the distribution, targeting or lifetime of an iRNA agent into which it is incorporated. In some embodiments, a ligand provides an enhanced affinity for a selected target, e.g., molecule, cell or cell type, compartment, e.g., a cellular or organ compartment, tissue, organ or region of the body, as, e.g., compared to a species absent such a ligand. Exemplary ligands will not take part in duplex pairing in a duplexed nucleic acid.

Ligands can also include targeting groups, e.g., a cell or tissue targeting agent, e.g., a lectin, glycoprotein, lipid or protein, e.g., an antibody, that binds to a specified cell type such as a kidney cell.

A targeting group can be a thyrotropin, melanotropin, lectin, glycoprotein, surfactant protein A, Mucin carbohydrate, multivalent lactose, monovalent galactose, N-acetyl-galactosamine, N-acetyl- gulucoseamine multivalent mannose, multivalent fucose, glycosylated polyaminoacids, multivalent galactose, transferrin, bisphosphonate, poly glutamate, polyaspartate, a lipid, cholesterol, a steroid, bile acid, folate, vitamin B12, vitamin A, biotin, or an RGD peptide or RGD peptide mimetic. In certain embodiments, ligands include monovalent or multivalent galactose. In certain embodiments, ligands include cholesterol.

Ligand-conjugated oligonucleotides of the invention may be synthesized by the use of an oligonucleotide that bears a pendant reactive functionality, such as that derived from the attachment of a linking molecule onto the oligonucleotide (described below). This reactive oligonucleotide may be reacted directly with commercially available ligands, ligands that are synthesized bearing any of a variety of protecting groups, or ligands that have a linking moiety attached thereto. The oligonucleotides used in the conjugates of the present invention may be conveniently and routinely made through the well-known technique of solid-phase synthesis. Any other means for such synthesis known in the art may additionally or alternatively be employed. It is also known to use similar techniques to prepare other oligonucleotides, such as the phosphorothioates and alkylated derivatives.

A. Carbohydrate Conjugates

In some embodiments of the compositions and methods of the invention, an iRNA oligonucleotide further comprises a carbohydrate. The carbohydrate conjugated iRNA are advantageous for the in vivo delivery of nucleic acids, as well as compositions suitable for in vivo therapeutic use, as described herein. As used herein, “carbohydrate” refers to a compound which is either a carbohydrate per se made up of one or more monosaccharide units having at least 6 carbon atoms (which can be linear, branched or cyclic) with an oxygen, nitrogen or sulfur atom bonded to each carbon atom; or a compound having as a part thereof a carbohydrate moiety made up of one or more monosaccharide units each having at least six carbon atoms (which can be linear, branched or cyclic), with an oxygen, nitrogen or sulfur atom bonded to each carbon atom. Representative carbohydrates include the sugars (mono-, di-, tri- and oligosaccharides containing from about 4, 5, 6, 7, 8, or 9 monosaccharide units), and polysaccharides such as starches, glycogen, cellulose and polysaccharide gums. Specific monosaccharides include C5 and above (e.g., C5, C6, C7, or C8) sugars; di- and trisaccharides include sugars having two or three monosaccharide units (e.g., C5, C6, C7, or C8).

In one embodiment, a carbohydrate conjugate for use in the compositions and methods of the invention is a monosaccharide. In another embodiment, a carbohydrate conjugate for use in the compositions and methods of the invention is selected from the group consisting of:

In one embodiment, the monosaccharide is an N-acetylgalactosamine, such as Formula II.

Another representative carbohydrate conjugate for use in the embodiments described herein includes, but is not limited to,

In certain embodiments of the invention, the GalNAc or GalNAc derivative is attached to an iRNA agent of the invention via a monovalent linker. In some embodiments, the GalNAc or GalNAc derivative is attached to an iRNA agent of the invention via a bivalent linker. In yet other embodiments of the invention, the GalNAc or GalNAc derivative is attached to an iRNA agent of the invention via a trivalent linker.

In one embodiment, the double stranded RNAi agents of the invention comprise one GalNAc or GalNAc derivative attached to the iRNA agent. In another embodiment, the double stranded RNAi agents of the invention comprise a plurality ( e.g ., 2, 3, 4, 5, or 6) GalNAc or GalNAc derivatives, each independently attached to a plurality of nucleotides of the double stranded RNAi agent through a plurality of monovalent linkers.

In some embodiments, for example, when the two strands of an iRNA agent of the invention are part of one larger molecule connected by an uninterrupted chain of nucleotides between the 3 ’-end of one strand and the 5 ’-end of the respective other strand forming a hairpin loop comprising, a plurality of unpaired nucleotides, each unpaired nucleotide within the hairpin loop may independently comprise a GalNAc or GalNAc derivative attached via a monovalent linker. The hairpin loop may also be formed by an extended overhang in one strand of the duplex.

In some embodiments, the carbohydrate conjugate further comprises one or more additional ligands as described above, such as, but not limited to, a PK modulator or a cell permeation peptide.

Additional carbohydrate conjugates suitable for use in the present invention include those described in PCT Publication Nos. WO 2014/179620 and WO 2014/179627, the entire contents of each of which are incorporated herein by reference.

B. Linkers

In some embodiments, the conjugate or ligand described herein can be attached to an iRNA oligonucleotide with various linkers that can be cleavable or non-cleavable.

The term "linker" or “linking group” means an organic moiety that connects two parts of a compound, e.g., covalently attaches two parts of a compound. Linkers typically comprise a direct bond or an atom such as oxygen or sulfur, a unit such as NR8, C(O), C(0)NH, SO, SO2, SO2NH or a chain of atoms, such as, but not limited to, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, arylalkyl, arylalkenyl, arylalkynyl, heteroarylalkyl, heteroarylalkenyl, heteroarylalkynyl, heterocyclylalkyl, heterocyclylalkenyl, heterocyclylalkynyl, aryl, heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl, alkylarylalkyl, alkylarylalkenyl, alkylarylalkynyl, alkenylarylalkyl, alkenylarylalkenyl, alkenylarylalkynyl, alkynylarylalkyl, alkynylarylalkenyl, alkynylarylalkynyl, alkylheteroarylalkyl, alkylheteroarylalkenyl, alkylheteroarylalkynyl, alkenylheteroarylalkyl, alkenylheteroarylalkenyl, alkenylheteroarylalkynyl, alkynylheteroarylalkyl, alkynylheteroarylalkenyl, alkynylheteroarylalkynyl, alkylheterocyclylalkyl, alkylheterocyclylalkenyl, alkylhererocyclylalkynyl, alkenylheterocyclylalkyl, alkenylheterocyclylalkenyl, alkenylheterocyclylalkynyl, alkynylheterocyclylalkyl, alkynylheterocyclylalkenyl, alkynylheterocyclylalkynyl, alkylaryl, alkenylaryl, alkynylaryl, alkylheteroaryl, alkenylheteroaryl, alkynylhereroaryl, which one or more methylenes can be interrupted or terminated by O, S, S(O), SO2, N(R8), C(O), substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted heterocyclic; where R8 is hydrogen, acyl, aliphatic or substituted aliphatic. In one embodiment, the linker is between about 1-24 atoms, 2-24, 3-24, 4-24, 5-24, 6-24, 6-18, 7-18, 8-18 atoms, 7-17, 8-17, 6-16, 7-16, or 8-16 atoms.

A cleavable linking group is one which is sufficiently stable outside the cell, but which upon entry into a target cell is cleaved to release the two parts the linker is holding together. In one embodiment, the cleavable linking group is cleaved at least about 10 times, 20, times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times or more, or at least about 100 times faster in a target cell or under a first reference condition (which can, e.g., be selected to mimic or represent intracellular conditions) than in the blood of a subject, or under a second reference condition (which can, e.g., be selected to mimic or represent conditions found in the blood or serum).

Cleavable linking groups are susceptible to cleavage agents, e.g., pH, redox potential or the presence of degradative molecules. Generally, cleavage agents are more prevalent or found at higher levels or activities inside cells than in serum or blood. Examples of such degradative agents include: redox agents which are selected for particular substrates or which have no substrate specificity, including, e.g., oxidative or reductive enzymes or reductive agents such as mercaptans, present in cells, that can degrade a redox cleavable linking group by reduction; esterases; endosomes or agents that can create an acidic environment, e.g., those that result in a pH of five or lower; enzymes that can hydrolyze or degrade an acid cleavable linking group by acting as a general acid, peptidases (which can be substrate specific), and phosphatases.

A cleavable linkage group, such as a disulfide bond can be susceptible to pH. The pH of human serum is 7.4, while the average intracellular pH is slightly lower, ranging from about 7.1-7.3.

Endosomes have a more acidic pH, in the range of 5.5-6.0, and lysosomes have an even more acidic pH at around 5.0. Some linkers will have a cleavable linking group that is cleaved at a selected pH, thereby releasing a cationic lipid from the ligand inside the cell, or into the desired compartment of the cell.

A linker can include a cleavable linking group that is cleavable by a particular enzyme. The type of cleavable linking group incorporated into a linker can depend on the cell to be targeted. For example, a liver-targeting ligand can be linked to a cationic lipid through a linker that includes an ester group. Liver cells are rich in esterases, and therefore the linker will be cleaved more efficiently in liver cells than in cell types that are not esterase-rich. Other cell-types rich in esterases include cells of the lung, renal cortex, and testis.

Linkers that contain peptide bonds can be used when targeting cell types rich in peptidases, such as liver cells and synoviocytes.

In general, the suitability of a candidate cleavable linking group can be evaluated by testing the ability of a degradative agent (or condition) to cleave the candidate linking group. It will also be desirable to also test the candidate cleavable linking group for the ability to resist cleavage in the blood or when in contact with other non-target tissue. Thus, one can determine the relative susceptibility to cleavage between a first and a second condition, where the first is selected to be indicative of cleavage in a target cell and the second is selected to be indicative of cleavage in other tissues or biological fluids, e.g., blood or serum. The evaluations can be carried out in cell free systems, in cells, in cell culture, in organ or tissue culture, or in whole animals. It can be useful to make initial evaluations in cell-free or culture conditions and to confirm by further evaluations in whole animals. In some embodiments, useful candidate compounds are cleaved at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster in the cell (or under in vitro conditions selected to mimic intracellular conditions) as compared to blood or serum (or under in vitro conditions selected to mimic extracellular conditions).

/^'. Redox cleavable Unking groups

In one embodiment, a cleavable linking group is a redox cleavable linking group that is cleaved upon reduction or oxidation. An example of reductively cleavable linking group is a disulphide linking group (-S-S-). To determine if a candidate cleavable linking group is a suitable “reductively cleavable linking group,” or for example is suitable for use with a particular iRNA moiety and particular targeting agent one can look to methods described herein. For example, a candidate can be evaluated by incubation with dithiothreitol (DTT), or other reducing agent using reagents know in the art, which mimic the rate of cleavage which would be observed in a cell, e.g., a target cell. The candidates can also be evaluated under conditions which are selected to mimic blood or serum conditions. In one, candidate compounds are cleaved by at most about 10% in the blood. In other embodiments, useful candidate compounds are degraded at least about 2, 4, 10, 20, 30, 40, 50, 60, 70, 80, 90, or about 100 times faster in the cell (or under in vitro conditions selected to mimic intracellular conditions) as compared to blood (or under in vitro conditions selected to mimic extracellular conditions). The rate of cleavage of candidate compounds can be determined using standard enzyme kinetics assays under conditions chosen to mimic intracellular media and compared to conditions chosen to mimic extracellular media.

Phosphate-based cleavable Unking groups In certain embodiments, a cleavable linker comprises a phosphate -based cleavable linking group. A phosphate -based cleavable linking group is cleaved by agents that degrade or hydrolyze the phosphate group. An example of an agent that cleaves phosphate groups in cells are enzymes such as phosphatases in cells. Examples of phosphate -based linking groups are -O- P(0)(0Rk)-0-, -0-P(S)(0Rk)-0-, -0-P(S)(SRk)-0-, -S-P(0)(0Rk)-0-, -0-P(0)(0Rk)-S-, -S- P(0)(0Rk)-S-, -0-P(S)(0Rk)-S-, -S-P(S)(0Rk)-0-, -0-P(0)(Rk)-0-, -0-P(S)(Rk)-0-, -S-P(0)(Rk)-0-, -S-P(S)(Rk)-0-, -S-P(0)(Rk)-S-, -0-P(S)( Rk)-S, wherein Rk at each occurrence can be, independently, C1-C20 alkyl, C1-C20 haloalkyl, C6-C10 aryl, or C7-C12 aralkyl. Exemplary embodiments include - 0-P(0)(0H)-0-, -0-P(S)(0H)-0-, -0-P(S)(SH)-0-, -S-P(0)(0H)-0-, -0-P(0)(0H)-S-, -S-P(0)(0H)- S-, -0-P(S)(0H)-S-, -S-P(S)(0H)-0-, -0-P(0)(H)-0-, -0-P(S)(H)-0-, -S-P(0)(H)-0, -S-P(S)(H)-0-, - S-P(0)(H)-S-, and -0-P(S)(H)-S-. In one embodiment, a phosphate-based linking group is -O- P(0)(0H)-0-. These candidates can be evaluated using methods analogous to those described above.

///^'. Acid cleavable Unking groups

In certain embodiments, a cleavable linker comprises an acid cleavable linking group. An acid cleavable linking group is a linking group that is cleaved under acidic conditions. In some embodiments acid cleavable linking groups are cleaved in an acidic environment with a pH of about 6.5 or lower ( e.g ., about 6.0, 5.75, 5.5, 5.25, 5.0, or lower), or by agents such as enzymes that can act as a general acid. In a cell, specific low pH organelles, such as endosomes and lysosomes can provide a cleaving environment for acid cleavable linking groups. Examples of acid cleavable linking groups include but are not limited to hydrazones, esters, and esters of amino acids. Acid cleavable groups can have the general formula -C=NN-, C(0)0, or -OC(O). An exemplary embodiment is when the carbon attached to the oxygen of the ester (the alkoxy group) is an aryl group, substituted alkyl group, or tertiary alkyl group such as dimethyl pentyl or t-butyl. These candidates can be evaluated using methods analogous to those described above. iv. Ester-based linking groups

In another embodiment, a cleavable linker comprises an ester-based cleavable linking group.

An ester-based cleavable linking group is cleaved by enzymes such as esterases and amidases in cells. Examples of ester-based cleavable linking groups include but are not limited to esters of alkylene, alkenylene and alkynylene groups. Ester cleavable linking groups have the general formula -C(0)0-, or -OC(O)-. These candidates can be evaluated using methods analogous to those described above. v. Peptide-based cleaving groups

In yet another embodiment, a cleavable linker comprises a peptide-based cleavable linking group. A peptide-based cleavable linking group is cleaved by enzymes such as peptidases and proteases in cells. Peptide-based cleavable linking groups are peptide bonds formed between amino acids to yield oligopeptides (e.g., dipeptides, tripeptides etc.) and polypeptides. Peptide -based cleavable groups do not include the amide group (-C(O)NH-). The amide group can be formed between any alkylene, alkenylene or alkynelene. A peptide bond is a special type of amide bond formed between amino acids to yield peptides and proteins. The peptide based cleavage group is generally limited to the peptide bond (i.e., the amide bond) formed between amino acids yielding peptides and proteins and does not include the entire amide functional group. Peptide -based cleavable linking groups have the general formula - NHCHRAC(0)NHCHRBC(0)-, where RA and RB are the R groups of the two adjacent amino acids. These candidates can be evaluated using methods analogous to those described above. In one embodiment, an iRNA of the invention is conjugated to a carbohydrate through a linker. Non-limiting examples of iRNA carbohydrate conjugates with linkers of the compositions and methods of the invention include, but are not limited to,

when one of X or Y is an oligonucleotide, the other is a hydrogen.

In certain embodiments of the compositions and methods of the invention, a ligand is one or more “GalNAc” (N-acetylgalactosamine) derivatives attached through a bivalent or trivalent branched linker.

In one embodiment, a dsRNA of the invention is conjugated to a bivalent or trivalent branched linker selected from the group of structures shown in any of formula (XXXII) - (XXXV):

wherein: q2A, q2B, q3A, q3B, q4A, q4B, q5A, q5B and q5C represent independently for each occurrence q2A, q2B, q3A, q3B, q4A, q4B, q5A, q5B and q5C represent independently for each occurrence 0-20 and wherein the repeating unit can be the same or different;

P^2A, P^2B, P^3A, P^3B, P⁴⁴, P⁴¹³, P^5A, P^5B, P^5C, T^2A, T^2B, T^3A, T^3B, T^4A, T^4B, T^4A, T^5B, T^5C are each independently for each occurrence absent, CO, NH, O, S, OC(O), NHC(O), C¾, CFbNH or CH2O;

Q^2A, Q^2B, Q^3A, Q^3B, Q^4A, Q^4B, Q^5a, Q^5b, Q^5C are independently for each occurrence absent, alkylene, substituted alkylene wherin one or more methylenes can be interrupted or terminated by one or more of O, S, S(O), S0₂, N(R^N), C(R’)=C(R”), CºC or C(O);

R^2A, R^2B, R^3A, R^3B, R^4A, R^4B, R^5a, R^5b, R^5C are each independently for each occurrence absent, NH, O, S, and L^5C represent the ligand; i.e. each independently for each occurrence a monosaccharide (such as GalNAc), disaccharide, trisaccharide, tetrasaccharide, oligosaccharide, or polysaccharide; andR^a is H or amino acid side chain.Trivalent conjugating GalNAc derivatives are particularly useful for use with RNAi agents for inhibiting the expression of a target gene, such as those of formula (XXXVI): wherein L^5A, L^5B and L^5c represent a monosaccharide, such as GalNAc derivative. Examples of suitable bivalent and trivalent branched linker groups conjugating GalNAc derivatives include, but are not limited to, the structures recited above as formulas II, VII, XI, X, and XIII.

Representative U.S. patents that teach the preparation of RNA conjugates include, but are not limited to, U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941; 6,294,664; 6,320,017;

6,576,752; 6,783,931; 6,900,297; 7,037,646; 8,106,022, the entire contents of each of which are hereby incorporated herein by reference.

It is not necessary for all positions in a given compound to be uniformly modified, and in fact more than one of the aforementioned modifications can be incorporated in a single compound or even at a single nucleoside within an iRNA. The present invention also includes iRNA compounds that are chimeric compounds.

VI. Delivery of an iRNA of the Invention

The delivery of an iRNA of the invention to a cell e.g., a cell within a human subject (e.g., a subject in need thereof, such as a subject having a disease, disorder or condition associated with contact activation pathway gene expression) can be achieved in a number of different ways. For example, delivery may be performed by contacting a cell with an iRNA of the invention either in vitro or in vivo. In vivo delivery may also be performed directly by administering a composition comprising an iRNA, e.g., a dsRNA, to a subject. Delivery may be performed, for example, by intravenous administration or subcutaneous administration. In certain embodiments, the iRNA agent is delivered by subcutaneous administration. In certain embodiments, the iRNA agent is administered by self-administration using a pre-filled syringe or auto-injector device.

In general, any method of delivering a nucleic acid molecule (in vitro or in vivo ) can be adapted for use with an iRNA of the invention (see e.g., Akhtar S. and Julian RL. (1992) Trends Cell. Biol. 2(5): 139-144 and WO9402595, which are incorporated herein by reference in their entireties). For in vivo delivery, factors to consider in order to deliver an iRNA molecule include, for example, biological stability of the delivered molecule, prevention of non-specific effects, and accumulation of the delivered molecule in the target tissue.

VII. Pharmaceutical Compositions of the Invention

The present invention also includes pharmaceutical compositions and formulations which include the iRNAs described herein for use in the methods of the invention. In one embodiment, provided herein are pharmaceutical compositions containing an iRNA, as described herein, and a pharmaceutically acceptable carrier. The pharmaceutical compositions containing the iRNA are useful for treating a disease or disorder associated with the expression or activity of a TTR gene. Such pharmaceutical compositions are formulated based on the mode of delivery. One example is compositions that are formulated for systemic administration via parenteral delivery, e.g., by subcutaneous (SC) or intravenous (IV) delivery. The pharmaceutical compositions of the invention may be administered in dosages sufficient to inhibit expression of a TTR gene. In one embodiment, the iRNA agents of the invention, e.g., a dsRNA agent, is formualted for subcutaneous administration in a pharmaceutically acceptable carrier

In other embodiments, a single dose of the pharmaceutical compositions can be long lasting, such that subsequent doses are administered at 1 month intervals, at not more than 1, 2, 3, or 4 month intervals, or at quarterly (about every three months) intervals. In some embodiments of the invention, a single dose of the pharmaceutical compositions of the invention is administered once per month. In other embodiments of the invention, a single dose of the pharmaceutical compositions of the invention is administered once every other month. In other embodiments, a single dose of the pharmaceutical compositions of the invention is administered quarterly, i.e., about once every three months. In other embodiments, a single dose of the pharmaceutical compositions of the invention is administered once every four months. In another embodiment, a single dose of the pharmaceutical compositions of the invention is administered once every five months. In other embodiments, a single dose of the pharmaceutical compositions of the invention is administered once every six months. In other embodiments, a single dose of the pharmaceutical compositions of the invention is administered once every twelve months.

VIII. Kits

The present invention also provides kits for performing any of the methods of the invention. Such kits include one or more double stranded RNAi agent(s) and a label providing instructions for use of the double-stranded agent(s) for use in any of the methods if the invention. The kits may optionally further comprise means for contacting the cell with the RNAi agent (e.g., an injection device or an infusion pump), or means for measuring the inhibition of TTR (e.g., means for measuring the inhibition of TTR mRNA or TTR protein). Such means for measuring the inhibition of TTR may comprise a means for obtaining a sample from a subject, such as, e.g., a plasma sample. The kits of the invention may optionally further comprise means for administering the RNAi agent(s) to a subject or means for determining the therapeutically effective or prophylactically effective amount.

The RNAi agent may be provided in any convenient form, such as a solution in sterile water or other appropriate solution, e.g., PBS, normal saline, 5 mM phosphate buffer, for resuspension and injection. For example, the RNAi agent may be provided as a 300 mg, 200 mg, 100 mg, or 50 mg vial with water or other appropriate solution in sterile water for injection. In certain embodiments, the RNAi agent is provided in a kit for self administration comprising a pre -filled syringe or autoinjector containing 300mg, 200 mg, 100 mg, or 50 mg of the RNAi agent in an appropriate volume of excipient for administration, optionally further including instructions for use. In certain embodiments, the RNAi agent may be provided in multiple vials or devices for administration of the dose by multiple injections to be given at about the same time, e.g, within one week, within one day, within one hour.

IX. Diagnosis of TTR amyloidosis polyneuropathy and assessment of disease burden

TTR amyloidosis is a complex, multifactorial disease. An expanding list of criteria have been used to monitor the progression of TTR-FAP: neuropathy impairment score (NIS), NIS + 7, and modified NIS (mNIS) + 7 and mNIS + 7_Ionis These diagnostic criteria are well known in the art and highlights of the criteria are provided below. As used herein, meeting the diagnostic criteria of TTR- FAP is understood as meeting FAP stage 1 criteria, with or without the presence of a mutation associated with hereditary TTR-FAP. Progression of indicators of neuropathy is considered an increase of at least two points in modified neuropathy impairment score (mNIS) + 7.

Familial Amyloid Polyneuropathy (FAP) Stage

Coutinho et al. developed a clinical staging system for the neuropathy symptoms of hATTR (formerly termed familial amyloid neuropathy). The scale ranges from 1 to 3, as follows (Ando et al. Orphanet J Rare Dis. 2013;8:31):

FAP Stage 1: Walking without assistance, mild neuropathy (sensory, autonomic, and motor) in lower limbs.

FAP Stage 2: Walking with assistance, moderate impairment in lower limbs, trunk, and upper limbs.

FAP Stage 3: wheelchair or bed-ridden, severe neuropathy.

A subject with no neuropathy is considered to be FAP Stage 0.

Neuropathy Impairment Scoring Methods

Methods to assess neuropathies are known in the art. For example, in the Mayo Clinic Neurologic Examination Sheet and also in the weakness subscores of Neuropathy Impairment Score (NIS), weakness (NIS-W) are scored in 25% decrements from 1 to 4 points and separately for major muscle groups of each side of the body (Dyck et al., Quantitating overall neuropathic symptoms, impairments, and outcomes. In: Dyck PJ, Thomas PK, editors. Peripheral neuropathy. 4th ed. Philadelphia: Elsevier; 2005. p. 1031-52). A broad group, especially of cranial, proximal, and distal limb muscles, is evaluated in NIS-W with a maximum score of 192 points. A decrease of the major 5 muscle stretch reflexes is usually assessed by neurologists and touch pressure, vibration, joint motion, and pin-prick sensations of feet and hands are scored in 25% decrements and from 1 to 4 in the Mayo Clinic Neurology Examination Sheet. To complete NIS of reflexes (NIS-R) and of sensation (NIS-S) Mayo Clinic record scores are transformed to NIS point scores (i.e., Mayo Clinic scores of 1 or 2 are given an NIS point score of 1 and Mayo Clinic scores of 3 or 4 are given an NIS score of 2). Therefore, the maximal NIS scores of the usual reflexes evaluated by neurologists (NIS-R) are 5 x 2 x 2 = 20 points and of the 4 modalities of sensation often evaluated by neurologists (NIS-S) are 8 x 2 x 2 = 32 points. Therefore, the maximum NIS score is: 192 + 20 + 32 =244 points. The NIS has been described in previous publications (Dyck et al. 2005 and Dyck et al., Neurol. 1997;49:229-39).

NIS + 7 has been used as the primary or co-primary outcome measure in the trials of diabetic sensorimotor polyneuropathy, TTR FAP, and other generalized sensorimotor polyneuropathies (N. Suanprasert et al. J Neurol Sci 344 (2014) 121-128). NIS + 7 adequately assesses graded severities of muscle weakness and muscle stretch reflex abnormality with only minimal ceiling effects for reflexes.

In NIS + 7, 5 of the 7 tests are attributes of nerve conduction — expressed either as normal deviates (Z scores) or points. The attributes included in NIS + 7 were chosen because their abnormality sensitively detects diabetic sensorimotor polyneuropathy (Dyck et al. Muscle Nerve 2003;27(2):202-10). The attributes included are the peroneal nerve compound muscle action potential (CMAP) amplitude, motor nerve conduction velocity (MNCV), and motor nerve distal latency (MNDL), tibial MNDL and sural sensory nerve action potential (SNAP) amplitudes. Their measured values can be transformed to normal deviates from percentile values correcting for applicable variables of age, gender, height, or weight as based on earlier studies of a large healthy subject reference cohort. Additionally, these percentile values can be expressed as NIS points from obtained percentile values (i.e., N5th = 0 points; <5th- N 1st = 1 point and <lst = 2 points (and similarly when abnormality is in the upper tail of the normal distribution).

Assessment of weakness and reflex abnormality, assessment of sensation loss, autonomic dysfunction, and neurophysiologic test abnormalities are not adequately assessed by NIS + 7 for use in trials of TTR FAP. In NIS + 7 sensation loss is not optimally assessed: 1) body distribution of sensation loss is not adequately taken into account, 2) large as compared to small fiber sensory loss is over emphasized and 3) improved methods of testing and comparison to reference values are preferred over clinical assessments. Also, autonomic dysfunction is not adequately assessed by the use of only heart rate deep breathing (HRdb). The attributes of nerve conduction used to assess NIS + 7 are not ideal for the study of TTR FAP.

Modified neuropathy impairment score +7 (mNIS+7), and updated version of NIS + 7, is a composite score measuring motor strength, reflexes, sensation, nerve conduction, and autonomic function. Two versions of this composite measure were adapted from the NIS+7 to better reflect hATTR amyloidosis with polyneuropathy and have been used as primary outcomes in inotersen and patisiran clinical trials. Key differences between these two versions, and the other neuropathy scoring systems, are summarized in the table below (from Adams et al., BMC Neurology, volume 17, Article number:

181 (2017)). In both scales, a lower score represents better neurologic function (e.g. an increase in score reflects worsening of neurologic impairment). Neuropathy Impairment Score Criteria

Diagnosis of TTR amyloidosis cardiomyopathy (ATTR-CM) and assessment of disease burden

Patients with hATTR amyloidosis and cardiomyopathy typically experience progressive symptoms of heart failure (HF) and cardiac arrhythmias, with death typically occurring 2.5 to 5 years after diagnosis. Cardiac infiltration of the extracellular matrix by TTR amyloid fibrils leads to a progressive increase of ventricular wall thickness and a marked increase in chamber stiffness, resulting in impaired diastolic function. Systolic function is also impaired, typically reflected by abnormal longitudinal strain despite a normal ejection fraction, which is preserved until late stages of the disease. In patients with ATTR amyloidosis and light-chain (AL) cardiac amyloidosis, both longitudinal strain and N-terminal prohormone of brain natriuretic peptide (NT-proBNP) have been shown to be independent predictors of survival.

Echocardiography is routinely used to assess cardiac structure and function; parameters pre specified in the statistical analysis plan include mean left ventricular (LV) wall thickness, LV mass, longitudinal strain, and ejection fraction. Cardiac output, left atrial size, LV end-diastolic volume (LVEDV), and LV end-systolic volume (LVESV). Echocardiograms are routinely used for cardiac imaging. Myocardial strain can be assessed with speckle tracking using vendor-independent software (TOMTEC, Munich, Germany). Analysis of NT-proBNP and troponin I levels is routinely performed in clinical laboratories using commercially available diagnostic tests, e.g., using chemiluminescence assays (Roche Diagnostic Cobas, Indianapolis, IN, USA for NT-proBNP; Siemens Centaur XP, Camberley, Surrey, UK for troponin I). Similarly, clinical practice routinely includes measurement of creatinine levels and estimated glomerular filtration rate (eGFR) based on creatinine levels, e.g., using the Modification of Diet in Renal Disease study formula.

A review providing screening and diagnostic methods for ATTR-CM was recently published by Witteles et al., 2019 (JACC: Heart Failure, 2019. 7:709-716) which provides information on methods of diagnosis including a list of “red flags” suggesting the presence of ATTR-CM and screening methods including echocardiography, electrocardiography, cardiac magnetic resonance, the presence of systemic symptoms involving the peripheral or autonomic nervous system along with cardiac dysfunction including bilateral sensory motor polyneuropathy that begins in the lower limbs and follows an ascending pattern, dysautonomia in the form of orthostatic hypotension, diarrhea/ constipation, and erectile dysfunction, and eye involvement such as glaucoma, intravitreal deposition, and scalloped pupils; carpal tunnel syndrome, especially bilateral carpal tunnel syndrome, lumbar spinal stenosis, and bicep tendon rupture. Other diagnostic methods include bone scintography with technetium (Tc)- labelled bisphosphonates localizes to TTR cardiac amyloid deposits for reasons that are not known. Biopsy is also used to confirm the presence of TTR amyloidosis in heart.

Methods for assessment and classification of cardiac function of the parameters provided above are known in the art. As used herein, the specific method of assessment or classification of cardiac function may be any clinically acceptable standard to demonstrate sufficiently decreased cardiac function such that the standard of care includes a medical intervention, e.g., administration of a pharmacological agent, surgery.

Serum Biomarkers as an Indicia of Nerve Damage and TTR Amyloidosis Progression

The diagnostic and monitoring methods set forth above are complex and often subjective. Moreover, as TTR amyloidosis is rare, and the signs and symptoms above can be present in a number of other diseases, clinically validated, non-invasive plasma biomarkers may facilitate earlier diagnosis and aid monitoring of disease progression. In a study by Ticau et al., 2019 (see www.medrxiv.org/content/10.1101/19011155v2.full.pdf) plasma levels of >1000 proteins were measured in patients with hATTR amyloidosis with polyneuropathy who received either placebo or patisiran in the phase 3 APOLLO study (NCT01960348) and in a cohort of healthy individuals. The impact of treatment with patisiran, a lipid formulated RNAi agent that inhibits the hepatic expression of TTR, on the time profile of each protein was determined by a linear mixed model at 0, 9, and 18 months. Neurofilament light chain (NfL) protein was further assessed using an orthogonal quantitative approach. A significant change in the levels of 66 proteins was observed with patisiran vs placebo, with change in NfL, a marker of neuronal damage, most significant. Analysis of the changes in protein levels demonstrated that the proteome of patients treated with patisiran trended towards healthy individuals at 18 months. Plasma NfL levels in healthy controls were four-fold lower than in patients with TTR amyloidosis with polyneuropathy (16.3 [SD 12.0] pg/mL vs 69.4 [SD 42.1] pg/mL, p<10¹⁶). Levels of NfL at 18 months increased with placebo (99.5 [SD 60.1] pg/mL) and decreased with patisiran treatment (48.8 [SD 29.9] pg/mL). At 18 months, improvement in modified Neuropathy Impairment Score+7 (mNIS+7) in patisiran-treated patients significantly correlated with a reduction in NfL levels (R=0.43, p<10⁷). NfL reduction with patisiran treatment correlated with improvement in mNIS+7 suggests it may serve as a biomarker of nerve damage and polyneuropathy in TTR amyloidosis. This biomarker may enable earlier diagnosis of polyneuropathy in patients with hATTR amyloidosis and facilitate monitoring of disease progression.

A decrease in the level of other proteins, especially RSP03, CCDC80, EDA2R, and NT- proBNP, were found to correlate with an improvement in mNIS+7, suggesting that, either alone or in combination with each other or Nfl, they may serve as a biomarker of nerve damage and polyneuropathy in ATTR amyloidosis. An increase in the level of N-CDase was found to correlate with an improvement in mNIS+7, suggesting that, either alone or in combination with the other markers listed above, it may serve as a biomarker of nerve damage and polyneuropathy in ATTR amyloidosis.

Further potential biomarkers are listed in the table below which were observed to change in response to treatment with patisiran. When a subject has an increase in the level of a protein having a positive beta coefficient relative to a reference level indicative of progression of ATTR amyloidosis, and when a subject has a decrease in the level of a protein having a negative beta coefficient relative to a reference level indicative of progression of ATTR amyloidosis. Changes in the level of one or more of these markers can be indicia of improvement, stabilization, or decrease in ongoing nerve damage and progression of polyneuropathy in ATTR amyloidosis.

Table 1. Biomarkers with changed levels in response to patisiran treatment

Sequences for these biomarkers are provided herein as SEQ ID NOs: 17-34.

This invention is further illustrated by the following examples which should not be construed as limiting. The contents of all references and published patents and patent applications cited throughout the application, as well the Sequence Listing are hereby incorporated herein by reference. EXAMPLES

Exemplary double straded RNAi agents for use in the methods of the invention are provided in Table 3 below. Table 2, below, provides the abbreviations of the nucleotide monomers and ligands used in nucleic acid sequence representation. It will be understood that these monomers, when present in an oligonucleotide, are mutually linked by 5'-3'-phosphodiester bonds unless otherwise indicated.

Table 2. Abbreviations of nucleotide monomers and ligands

Table 3. Modified nucleotide sequences of sense and antisense strands of RNAi agents targeted to

TTR Example 1: TTR Protein Knockdown by RNAi agents in the V30M Transgenic Mouse

The V30M mutation is a common amyloidogenic mutation in human TTR. Transgenic mice lacking mouse TTR and expressing human TTR with a V30M mutation were used in the study. Mice (n = 3 per group) were administered a single subcutaneous 1 mg/kg dose of RNAi agent AD-65492, previously disclosed in WO2018112320, or other RNAi agents based on the sequence and chemistry of AD-65492 in which a chemical modification at a single position of the antisense strand was changed to a GNA modification as shown in Table 2 above. Blood samples were obtained on days 0 (pre-dose), 3, 7, 10, 14, 21, 35, and 49. Serum was prepared and human TTR levels were determined using ELISA assay (see, e.g., Coelho, et al. (2013) N Engl J Med 369:819). Relative TTR levels as compared to Day 0 are shown in Figure 1.

Incorporation of a GNA at position 7 or 8 in the antisense strand was well tolerated (AD-87404 and AD-87405). Similar kinetics and maximum protein knockdown were similar to the parent RNAi agent AD-65492. Durability of knockdown by AD-87404 was similar to AD-65492. Incorporation of a GNA at positions 3-6 in the antisense strand was less well tolerated.

Example 2: TTR Protein Knockdown by RNAi agents in Non-Human Primate

The sequence of the iRNA agents in Table 2 is fully cross-reactive with cynomolgus monkey TTR. A single subcutaneous dose of AD-65492 (1 mg/kg) or AD-87404 (1 mg/kg or 3 mg/k) was administered to cynomolgus monkey (n = 3 per group) on day 0 in three separate studies. Blood samples were collected variously on Days -7 (7 days predose) through Day 119 as shown in Figure 2. Serum was prepared and cynomolgus monkey TTR levels were determined using ELISA assay (see, e.g., Coelho, et al. (2013) N Engl J Med 369:819). Relative TTR levels as compared to Day 0 are shown in Figure 2. TTR knockdown was similar in in monkeys administered 1 mg/kg of AD-65492 and 3 mg/kg of AD- 87404.

Example 3: Administration of a Single Dose of AD-87404 to Healthy Human Subjects

In a Phase I, randomized, single -blind, placebo-controlled study, AD-87404 (Sense: 5’- usgsggauUfuCfAfUfguaaccaaga - 3’ (SEQ ID NO: 6), wherein an L96 ligand is conjugated to the 3’ end of the sense strand); Antisense: 5’- usCfsuugGf(Tgn)uAfcaugAfaAfucccasusc - 3’ (SEQ ID NO:

7)) are administered to healthy human volunteers as a single dose of 25mg, 75 mg, 100 mg, 200 mg, or 400 mg, with possible dose groups of 600 mg, 700 mg, 900 mg, and 1000 mg. Groups are balanced for relevant demographic characteristics, e.g., age, sex, body weight.

Demographically matched control subjects are also administered a single dose of a placebo.

Plasma samples are collected and the level of TTR protein in the samples from the subjects in the placebo group and the subjects in all of the treatment groups is determined using an ELISA assay (see, e.g., Coelho, et al. (2013) N Engl J Med 369:819) at pre-determined intervals, e.g., days 1, 2, 3, 8, 15, 22, 29, 43, 57, 90, and then, for active treatment group subjects, every twenty-eighth day until the level of TTR recovers to 80% of the pre -treatment level (up through, approximately one year post-dose). Level and duration of knockdown are determined. Subjects in both AD-87404 groups and the control group are also monitored for adverse events. Exemplary adverse events monitored in the study include, but are not limited to, injection site erythema, injection site pain, pruritus, cough, nausea, fatigue, and abdominal painand clinically significant changes in physical exams, ECG, vital signs, or clinical laboratory parameters, e.g., renal function, hematologic parameters, and liver function (e.g., alanine aminotransferase (ALT), aspartate aminotransferase (AST)).

The results of this study demonstrate that a single subcutaneous dose of AD-87404 potently and durably knocks down TTR protein levels in a dose dependent manner.

Multiple dose studies and multiple ascending dose studies are also contemplated with monitoring of TTR protein knockdown in serum and adverse events.

Equivalents:

Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments and methods described herein. Such equivalents are intended to be encompassed by the scope of the following claims.

Claims

We claim:

1. An RNAi agent comprising a sense strand and an antisense strand, wherein: each of the sense strand and the antisense strand are independently up to 30 nucleotides in length; the sense strand comprises the modified nucleotide sequence 5’- usgsggauUfuCfAfUfguaaccaaga-3’ (SEQ ID NO: 6); and the antisense strand comprises the modified nucleotide sequence 5’- usCfsuugGf(Tgn)uAfcaugAfaAfucccasusc-3’ (SEQ ID NO: 7), wherein a, c, g, andu are 2'-0-methyladenosine-3’ -phosphate, 2'-0-methylcytidine-3’- phosphate, 2'-0-methylguanosine-3’ -phosphate, and 2'-0-methyluridine-3’ -phosphate, respectively;

2. The RNAi agent of claim 1, wherein the sense strand of the double stranded RNAi agent is conjugated to at least one ligand.

3. The RNAi agent of claim 2, wherein the ligand is one or more GalNAc derivatives attached through a bivalent or trivalent branched linker.

4. The RNAi agent of claim 3, wherein the ligand is

5. The RNAi ligand of any one of claims 2-4, wherein the ligand is attached to the 3 end of the sense strand.

6. The RNAi agent of claim 5, wherein the double stranded RNAi agent is conjugated to the ligand as shown in the following schematic wherein X is O or S.

7. The RNAi agent of any one of claims 1-6, wherein the sense strand is 21 nucleotides in length and the antisense strand is 23 nucleotides in length.

8. A use of an RNAi agent in a method of treating a human subject suffering from a TTR- associated disease, comprising administering to the subject a fixed dose of 25 mg to 1000 mg of a double stranded RNAi agent, comprising a sense strand and an antisense strand, wherein: each of the sense strand and the antisense strand are independently up to 30 nucleotides in length; the sense strand comprises the modified nucleotide sequence 5’- usgsggauUfuCfAfUfguaaccaaga-3’ (SEQ ID NO: 6); and the antisense strand comprises the modified nucleotide sequence 5’- usCfsuugGf(Tgn)uAfcaugAfaAfucccasusc-3’ (SEQ ID NO: 7), wherein a, c, g, andu are 2'-0-methyladenosine-3’ -phosphate, 2'-0-methylcytidine-3’- phosphate, 2'-0-methylguanosine-3’ -phosphate, and 2'-0-methyluridine-3’ -phosphate, respectively;

9. A use of an RNAi agent in a method of inhibiting expression of TTR in a human subject who does not meet diagnostic criteria of a TTR-associated disease, comprising administering to the subject a fixed dose of 25 mg to 1000 mg of a double stranded RNAi agent, comprising a sense strand and an antisense strand, wherein: each the sense strand and the antisense strand are independently up to 30 nucleotides in length; the sense strand comprises the modified nucleotide sequence 5’- usgsggauUfuCfAfUfguaaccaaga-3’ (SEQ ID NO: 6); and the antisense strand comprises the modified nucleotide sequence 5’- usCfsuugGf(Tgn)uAfcaugAfaAfucccasusc-3’ (SEQ ID NO: 7), wherein a, c, g, andu are 2'-0-methyladenosine-3’ -phosphate, 2'-0-methylcytidine-3’- phosphate, 2'-0-methylguanosine-3’ -phosphate, and 2'-0-methyluridine-3’ -phosphate, respectively;

10. The use of claim 8 or 9, wherein the sense strand of the double stranded RNAi agent is conjugated to at least one ligand.

11. The use of claim 10, wherein the ligand is one or more GalNAc derivatives attached through a bivalent or trivalent branched linker.

12. The use of claim 11, wherein the ligand is

13. The use of any one of claims 9-12, wherein the ligand is attached to the 3 end of the sense strand.

14. The use of claim 13, wherein the double stranded RNAi agent is conjugated to the ligand as shown in the following schematic

wherein X is O or S.

15. The use of any one of claims 8-14, wherein the sense strand is 21 nucleotides in length and the antisense strand is 23 nucleotides in length.

16. A use of any one of claims 8-15, wherein the method comprises improving at least one indicia of neurological impairement, quality of life, ongoing nerve damage, or cardiovascular impairment.

17. The use of claim 16, wherein the indicia is a neurological impairment indicia.

18. The use of claim 17, wherein the neurological impairment indicia is a change from baseline in an indicia selected from the group of Neuropathy Impairment (NIS) score, a modified NIS (mNIS+7) score, a NIS-W score, a composite autonomic symptom score (COMPASS-31), a median body mass index (mBMI) score, a 6-minute walk test (6MWT) score, and a 10-meter walk test score.

19. The use of claim 16, wherein the indicia is a quality of life indicia.

20. The use of claim 19, wherein the quality of life indicia is a change from baseline in an indicia selected from the group of a SF-36® health survey score, a Norfolk Quality of Life-Diabetic Neuropathy (Norfolk QOL-DN) score, and a Rasch-built Overall Disability Scale (R-ODS) score

21. The use of claim 16, wherein the indicia is ongoing nerve damage.

22. The use of claim 21, wherein the indicia of ongoing nerve damage is a change from baseline in a plasma protein level of one or more proteins selected from the group neurofilament light chain (NfL), RSP03, CCDC80, EDA2R, NT-proBNP, and N-CDase.

23. The use of claim 21, wherein the indicia of ongoing nerve damage is a change in plasma level of neurofilament light chain (NfL) protein level.

24. The use of claim 16, wherein the indicia is a cardiovascular impairment indicia.

25. The use of claim 24, wherein the indicia of cardiovascular impairment is cardiovascular hospitalization, a change from baseline using Kansas City Cardiomyopathy Questionnaire Overall Summary (KCCQ-OS) with an increased score indicative of better health status, change from baseline in mean left lventricular (LV) wall thickness by echocardiographic assessment, change from baseline in global longitudinal strain by echocardiographic assessment, and change from baseline in N-terminal prohormone B-type Natriuretic Peptide (NTproBNP)

26. The use of any one of claims 8-25, wherein the human subject carries a TTR gene mutation that is associated with the development of a TTR-associated disease.

27. The use of any one of claims 8-26, wherein the TTR-associated disease is selected from the group consisting of senile systemic amyloidosis (SSA), systemic familial amyloidosis, familial amyloidotic polyneuropathy (FAP), familial amyloidotic cardiomyopathy (FAC), leptomeningeal/Central Nervous System (CNS) amyloidosis, hyperthyroxinemia, and cardiac amyloidosis.

28. The use of any one of claims 8-25, wherein the human subject has a transthyretin- mediated amyloidosis (ATTR amyloidosis) and the use of the RNAi agent method reduces an amyloid TTR deposit in the human subject.

29. The use of claim 28, wherein the ATTR is hereditary ATTR (h-ATTR).

30. The use of claim 28, wherein the ATTR is non-heriditary ATTR (wt ATTR).

31. The use of any one of claims 8-30, wherein the double stranded RNAi agent is administered to the human subject by subcutaneous administration or intravenous administration.

32. The use of claim 31, wherein the subcutaneous administration is self administration.

33. The use of claim 32, wherein the self administration is via a pre -filled syringe or auto injector syringe.

34. The use of any one of claims 8-33, further comprising assessing the level of TTR mRNA expression or TTR protein expression in a sample derived from the human subject.

35. The use of any one of claims 8-34, wherein the double stranded RNAi agent is administered to the human subject once every three months to once a year.

36. The use of any one of claims 8-35, wherein the fixed dose of the double stranded RNAi agent is administered to the human subject once about every three months, once every six months, or once a year.

37. The use of any one of claims 8-35, wherein the fixed dose of the double stranded RNAi agent is administered to the human subject at a fixed dose of 25 mg to 300 mg once every three months.

38. The use of any one of claims 8-35, wherein the fixed dose of the double stranded RNAi agent is administered to the human subject at a fixed dose of 25 mg to 200 mg once every three months.

39. The use of any one of claims 8-35, wherein the fixed dose of the double stranded RNAi agent is administered to the human subject at a fixed dose of 75 mg to 200 mg once every three months.

40. The use of any one of claims 8-35, wherein the fixed dose of the double stranded RNAi agent is administered to the human subject at a fixed dose of 25 mg once every three months.

41. The use of any one of claims 8-35, wherein the fixed dose of the double stranded RNAi agent is administered to the human subject at a fixed dose of 75 mg once every three months.

42. The use of any one of claims 8-35, wherein the fixed dose of the double stranded RNAi agent is administered to the human subject at a fixed dose of 100 mg once every three months.

43. The use of any one of claims 8-35, wherein the fixed dose of the double stranded RNAi agent is administered to the human subject at a fixed dose of 200 mg once every three months.

44. The use of any one of claims 8-35, wherein the fixed dose of the double stranded RNAi agent is administered to the human subject at a fixed dose of 300 mg once every three months.

45. The use of any one of claims 8-35, wherein the fixed dose of the double stranded RNAi agent is administered to the human subject at a fixed dose of 400 mg to 600 mg once every six months to once every 12 months.

46. The use of any one of claims 8-35, wherein the fixed dose of the double stranded RNAi agent is administered to the human subject at a fixed dose of 400 mg to 600 mg once every six months or once every 12 months.

47. The use of any one of claims 8-35, wherein the fixed dose of the double stranded RNAi agent is administered to the human subject at a fixed dose of 400 mg or 600 mg once every six months or once every 12 months.

48. The use of any one of claims 8-35, wherein the fixed dose of the double stranded RNAi agent is administered to the human subject at a fixed dose of 700 mg to 1000 mg once every 12 months.

49. The use of any one of claims 8-35, wherein the fixed dose of the double stranded RNAi agent is administered to the human subject at a fixed dose of 700 mg, 800 mg, 900 mg, or 1000 mg once every 12 months.

50. The use of any one of claims 8-49, further comprising administering to the human subject an additional therapeutic agent.

51. The use of claim 50, wherein the additional therapeutic agent is a TTR tetramer stabilizer or a non-steroidal anti-inflammatory agent.