EP3935167A2 - Compositions and methods for treating huntington's disease - Google Patents
Compositions and methods for treating huntington's diseaseInfo
- Publication number
- EP3935167A2 EP3935167A2 EP20770560.9A EP20770560A EP3935167A2 EP 3935167 A2 EP3935167 A2 EP 3935167A2 EP 20770560 A EP20770560 A EP 20770560A EP 3935167 A2 EP3935167 A2 EP 3935167A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- seq
- adaptor oligonucleotide
- adaptor
- u1ao
- oligonucleotide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/14—Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/31—Chemical structure of the backbone
- C12N2310/315—Phosphorothioates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/35—Nature of the modification
- C12N2310/351—Conjugate
- C12N2310/3519—Fusion with another nucleic acid
Definitions
- This invention relates generally to the field of gene silencing. Specifically, the invention provides compositions and methods for regulating the expression of the huntingtin gene.
- HD Huntington’s disease
- polyQ polyglutamine
- the size of the expansion is partially negatively correlated with age of onset (e.g., adult-onset vs. juvenile).
- HD is caused by CAG repeat expansion ( ⁇ >36 repeats) within the first exon of the huntingtin gene.
- the huntingtin gene ( htt ) and protein (HTT) are widely and ubiquitously expressed, but the disease has a pattern of selective neuronal vulnerability (e.g., within the brain) (Ambrose, et al. (1994) Somat. Cell Mol. Genet., 20:27-38; Landles, et al. (2004) EMBO Rep., 5:958-963). Neither the normal function for htt nor the pathological mechanism for mutant htt is completely understood. Multiple mechanisms including a toxic gain of function and loss of wild type function may exist. Notably, aggregates of the HTT protein can be found in different locations and different types of neurons.
- nucleic acid molecules for inhibiting the expression of the huntingtin gene ⁇ htt are provided.
- the nucleic acid molecules comprise an annealing domain operably linked to at least one effector domain, wherein the annealing domain hybridizes to the pre-mRNA of htt and wherein the effector domain hybridizes to the U1 snRNA of U1 snRNP.
- the U1 AO may be directed to full-length and/or truncated htt.
- the nucleic acid molecules may be conjugated to (e.g., directly or via a linker) a targeting moiety.
- the targeting moiety may be conjugated to the 5’ end and/or the 3’ end (e.g., the nucleic acid may comprise two targeting moieties, either the same or different).
- the nucleic acid molecules are conjugated to an aptamer.
- methods for inhibiting the expression of htt comprising delivering to a cell at least one of the nucleic acid molecules of the instant invention.
- compositions which comprise at least one of the nucleic acid molecules of the invention and at least one pharmaceutically acceptable carrier.
- vectors encoding the nucleic acid molecules of the instant invention are also provided.
- methods of treating, inhibiting, and/or preventing Huntington’s disease in a subject comprise administering a therapeutically effective amount of at least one nucleic acid molecule of the instant invention (e.g., U1 AO or vector encoding the U1AO) to a subject in need thereof.
- the method comprises administering more than one U1AO.
- the method comprises administering a U1AO directed to full-length htt , truncated htt, or both full-length and truncated htt (e.g., with separate U1AO).
- Figure 1 A is a schematic of a U1 adaptor oligonucleotide depicting its 2 domains: an annealing domain to base pair to the target gene’s pre-mRNA in the 3’ terminal exon and an effector domain that inhibits maturation of the pre-mRNA via binding of endogenous U1 snRNP.
- the provided sequence of the effector domain is SEQ ID NO: 1.
- Figure IB is a schematic of the U1 adaptor annealing to target pre- mRNA.
- the provided sequence of the effector domain is SEQ ID NO: 1.
- Figure 1C is a schematic of the U1 adaptor binding U1 snRNP, which leads to poly(A) site inhibition.
- Y pseudouridines of the U1 snRNA in the U1 snRNP.
- the provided sequence of the U1 snRNA in the U1 snRNP is SEQ ID NO: 2.
- the provided sequence of the effector domain is SEQ ID NO: 1.
- Figure 2 provides a graph showing the percent change of human huntingtin (HTT) mRNA normalized to hypoxanthine phosphoribosyltransf erase 1 (HPRT1) in HD9197 cells transfected for 44 hours with a panel of 20 nM Ul adaptor
- oligonucleotides UlAOs
- 20 nM siRNAs directed against full length human HTT.
- Figure 3 provides a Western blot of DU145 cells transfected 48 hours with 20 nM various hHTT-FL UlAOs and siRNAs, with the exception of 7 nM in lane 9 and 30 nM in lane 7.
- GAPDH is provided as a loading control.
- U1A U1 snRNP subunit
- 1,500,00 cell equivalents were loaded per lane.
- Lanes 4 and 6 are independent replicates.
- MW molecular weight markers.
- Figure 4A provides a graph of the percent change of hHTT-FL mRNA in YAC128 forebrain after intracerebroventricular (ICV) injection into the left ventricle of saline or hHTT-FL-2 U1AO.
- YAC128 are a well established mouse model of Huntington’s diseases containing the -300,000 basepair human huntingtin gene with 128 CAG repeats. Average of control mice was set to 100%.
- Figure 4B provides a graph of the percent change of hHTT-TR mRNA in YAC128 forebrain after ICV injection of saline or hHTT-FL-2 U1AO.
- Figure 5 provides an image of an 8% denaturing polyacrylamide gel electrophoresis (PAGE) Northern blot of total RNA from YAC128 forebrain after injection of saline or hHTT-FL-2 U1AO.
- the probe was a 33 nucleotide 32 P-anti- hHTT-FL-2 oligonucleotide. Standards are uninjected U1 AO.
- Figure 6 provides images of RNAScope® detection of hHTT-FL in the striatum of saline ICV-treated mice (left) or hTT-FL-2 U1AO ICV-treated mice (right). Mice were analyzed after a 4 day duration. 4 ' ,6-diamidino-2-phenylindole (DAPI) was used to stain the nuclei.
- DAPI diamidino-2-phenylindole
- Figure 7A provides a graph of the percent change of hHTT-FL mRNA in YAC128 forebrain after ICV-injection of saline or hHTT-FL-2 U1AO over the indicated times. Average of control mice was set to 100%.
- Figure 7B provides an image of a Northern blot of total RNA from YAC128 forebrain at the indicated times after injection of saline or hHTT-FL-2 U1AO. The probe was a 33 nucleotide 32 P- anti-hHTT-FL-2 oligonucleotide. Standards are uninjected U1AO. Control saline mice 1-7 and mice 11-12 and 16-17 are the same mice as shown in Figures 4 and 5.
- Figure 9A provides a graph of the percent change of mHTT-TR mRNA in 8-9 month old Q175 forebrain after injection of saline, mHTT-TR-A U1AO, or NC-A control U1 AO.
- Figure 10 provides images of RNAScope® detection of mHTT-TR in the striatum of saline treated mice (left) or mHTT-TR-A U1 AO treated mice (right) with a 4 day duration.
- Figure 11 A provides a graph of the percent change of mHTT-TR mRNA in 8- 9 month old Q175 mice forebrain twenty-one days after ICV-injection of saline or mHTT-TR-A U1 AO. Average of control mice was set to 100%.
- Figure 1 IB provides a graph of the percent change of mHTT-FL mRNA in 8-9 month old Q175 mice forebrain twenty-one days after injection of saline or mHTT-TR-A U1 AO. Average of control mice was set to 100%.
- Figure 13 provides images of RNAScope® detection of mHTT-FL in the striatum of saline treated mice (left) or mHTT-FL-A U1 AO treated mice (right).
- Figures 14A-14L provides target sites in human hit for U1 AO and examples of U1AO sequences in DNA format.
- the target sequences in rows 50, 272, 151, 3, 187, 4, 5, 10, and 2 are SEQ ID NOs: 26-34, respectively.
- the target sequences in rows 1, 6-9, 11-49, 51-150, 152-186, 188-271, and 273-325 are SEQ ID NOs: 40-355, respectively.
- the U1AO sequences provided in DNA format are SEQ ID Nos: 356- 680, from top to bottom.
- Figures 15A-15C provide graphs of the level of silencing of mHTT-Fl and mHTT-Tr at 1 month (Fig. 15 A), 2 months (Fig. 15B), and 4 months (Fig. 15C) after ICV injection of mHTT-FL-a U1AO at four different concentration into Q175 mice.
- Figure 15D provides graphs of the level of silencing of mHTT-Fl and mHTT-Tr at 1 month, 2 months, and 4 months after ICV injection of control NC-a U1AO at 80 pg into Q175 mice.
- Figures 16A-16C provide graphs of the level of silencing of mHTT-Fl and mHTT-Tr at 1 month (Fig. 16A), 2 months (Fig. 16B), and 4 months (Fig. 16C) after ICV injection of mHTT-Tr-a U1 AO at four different concentration into Q175 mice.
- Figure 17 provide graphs of the pharmacokinetics of mHTT-FL-a U1AO (top), mHTT-Tr-a U1 AO (middle), and NC-a U1 AO (bottom). The amount of RNA is shown at 1 month, 2 months, and 4 months. Each of the four different
- U1 Adaptors are an oligonucleotide- mediated gene silencing technology which are mechanistically distinct from antisense or siRNA.
- U1 Adaptors act by selectively interfering with a key step in mRNA maturation: the addition of a 3’ polyadenosine (poly A) tail. Nearly all protein-coding mRNAs require a polyA tail and the failure to add one results in rapid degradation of the nascent mRNA inside the nucleus, thereby preventing expression of a protein product.
- U1 Adaptors have been described in U.S. Patent No. 9,441,221; U.S. Patent No. 9,078,823; U.S. Patent No. 8,907,075; and U.S. Patent No. 8,343,941 (each of which is incorporated by reference herein).
- U1 Adaptor oligonucleotides are well suited to in vivo applications because they can accept extensive chemical modifications to improve nuclease resistance and the attachment of bulky groups, such as tags for imaging or ligands for receptor- mediated uptake by target cells, without loss of silencing activity.
- Huntington’s disease has several characteristics that make it a particularly well suited for treatment using U1 AO. First, reducing expression of the mutant hit gene will be beneficial in slowing and/or halting neurodegeneration. Second, the disease can be diagnosed with certainty via genetic testing. Third, the disease usually has an adult onset. Fourth, the disease is slowly progressive and well documented, with a predictable course.
- the caudate nucleus is a region prominently affected, can be monitored with imaging, and lies close to the cerebral ventricle for diffusion from interventions administered in the ventricular system.
- the highly vulnerable medium spiny neurons in the caudate nucleus have been well studied and express markers that can be useful for cell directed targeting by modified carriers.
- the methods comprise the use of a U1 adaptor oligonucleotide/ molecule (see, generally, Figure 1).
- the U1AO is an oligonucleotide with two domains: (1) an annealing domain designed to base pair to the htt gene’s pre-mRNA (e.g., in the terminal exon) and (2) an effector domain (also referred to as the U1 domain) that inhibits 3’-end formation of the target pre-mRNA via binding endogenous U1 snRNP.
- the U1 adaptor tethers endogenous U1 snRNP to a gene-specific pre-mRNA and the resulting complex blocks proper 3’ end formation.
- U1 snRNP is highly abundant ( ⁇ 1 million/mammalian cell nucleus) and in stoichiometric excess compared to other spliceosome components. Therefore, there are no deleterious effects of titrating out endogenous U1 snRNP.
- the U1AO is able to enter cells either alone or in complex with delivery reagents (e.g., lipid-based transfection reagents).
- the U1AO should also be capable of entering the nucleus to bind to pre-mRNA. Indeed, this property has already been established for small nucleic acid molecules such as in those antisense approaches that utilize the RNase H pathway where the oligo enters the nucleus and binds to pre- mRNA. Additionally, it has been showed that antisense oligos can bind to nuclear pre-mRNA and sterically block access of splicing factors leading to altered splicing patterns (Ittig et al. (2004) Nuc. Acids Res., 32:346-53).
- the annealing domain of the U1 adaptor molecule is designed to have high affinity and specificity to the target site on the target pre- mRNA (e.g., to the exclusion of other pre-mRNAs).
- a balance should be achieved between having the annealing domain too short, as this will jeopardize affinity, or too long, as this will promote“off-target” effects or alter other cellular pathways.
- the annealing domain should not interfere with the function of the effector domain (for example, by base pairing and hairpin formation).
- the U1 AO annealing domain does not have an absolute requirement on length.
- the annealing domain will typically be from about 10 to about 50 nucleotides in length, more typically from about 10 to about 30 nucleotides or about 10 to about 20 nucleotides. In a particular embodiment, the annealing domain is at least about 13 or 15 nucleotides in length.
- the annealing domain may be at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or, more particularly, 100% complementary to the gene of interest ⁇ htt).
- the annealing domain hybridizes with a target site within the 3’ terminal exon, which includes the terminal coding region and the 3’UTR and polyadenylation signal sequences (e.g., through the polyadenylation site).
- the target sequence is within about 500 basepair, about 250 basepair, about 100 basepair, or about 50 bp of the poly(A) signal sequence.
- the CAG (encoding glutamine) disease expansion (typically greater than 36 repeats) in HTT is located within the 1st exon of the HTT gene (The Huntington's Disease Collaborative Research Group (1993) Cell 72:971-983).
- a short exon 1 HTT polyadenylated mRNA resulting from aberrant splicing of the mutant allele is translated into a pathogenic exon 1 HTT protein that contributes to disease progression (Sathasivam et al. (2013) Proc. Natl. Acad. Sci., 110:2366-2370; Gipson et al. (2013) RNA Biol., 10: 1647-1652).
- Exemplary amino acid and nucleotide sequences of human HTT and htt can be found, for example, in Gene ID: 3064 and GenBank Accession Nos. NM_002111.8 and NP_002102.4.
- Target sites within htt for the U1 AO have been identified herein using selection criteria for gene silencing.
- Figures 14A-14L list target sites within htt for the U1AO with the best scoring target sites listed first.
- the annealing domain hybridizes with a target site provided in Figures 14A-14L.
- the annealing domain hybridizes with a target site provided in rows 1-278 of Figures 14A-14L.
- the annealing domain hybridizes with a target site provided in rows 1-192 of Figures 14A-14L.
- the annealing domain hybridizes with a target site provided in rows 1-58 of Figures 14A-14L.
- the annealing domain hybridizes with a target site provided in rows 1-26 of Figures 14A-14L. In a particular embodiment, the annealing domain hybridizes with a target site provided in rows 1-10 of Figures 14A-14L. In a particular embodiment, the annealing domain hybridizes with a target site selected from:
- CAGCAGGATGGGCAAGCTGG SEQ ID NO: 27
- GGT GGGAGAGACTGT GAGGC SEQ ID NO: 33
- TCCTTTCTCCTGATAGTCAC SEQ ID NO: 34
- the annealing domain hybridizes with
- the annealing domain may be at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or, more particularly, 100% complementary to any target sequence within Figures 14A- 14L or any one of SEQ ID NO: 26-36.
- the annealing domain may comprise additional or fewer nucleotides at the 5’ and/or 3’ end of any target sequence within Figures 14A-14L or any one of SEQ ID NO: 26-36.
- the annealing domain may comprise at least 1, 2, 3, 4, 5, or up to 10 or 20 nucleotides added to the 5’ and/or 3’ end of any target sequence within Figures 14A-14L or any one of SEQ ID NO: 26-36 (e.g., from the sequence of the hit gene) or may have a deletion of at least 1, 2, 3, 4, or 5 nucleotides from the 5’ and/or 3’ end of any target sequence within Figures 14A-14L or any one of SEQ ID NO: 26-36.
- the U1 domain of the U1AO binds with high affinity to U1 snRNP.
- the U1 domain is complementary to nucleotides 2-11 of endogenous U1 snRNA.
- the U1 domain comprises 5’-CAGGUAAGUA-3’ (SEQ ID NO: 1); 5’-CAGGUAAGUAU- 3’ (SEQ ID NO: 4); 5’-GCCAGGUAAGUAU-3’ (SEQ ID NO: 5).
- the U1 domain comprises the sequence 5’-CAGGUAAGUA-3’ (SEQ ID NO: 1).
- the U1 domain comprises the sequence 5’- GCCAGGUAAGUAU-3’ (SEQ ID NO: 5).
- the U1 domain has at least 70%, at least 75%, at least 80%, at least 85%, and more particularly at least 90%, at least 95%, or at least 97% identity to SEQ ID NO: 1, SEQ ID NO: 4, or SEQ ID NO: 5.
- the U1 domain may comprise additional nucleotides 5’ or 3’ to SEQ ID NO: 1, SEQ ID NO: 4, or SEQ ID NO: 5.
- the U1 domain may comprise at least 1, 2, 3, 4, 5, or up to 10 or 20 nucleotides 5’ or 3’ to SEQ ID NO: 1, SEQ ID NO: 4, or SEQ ID NO: 5.
- the effector domain may be from about 8 nucleotides to about 30 nucleotides, from about 10 nucleotides to about 20 nucleotides, or from about 10 to about 15 nucleotides in length.
- the effector domain may be 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length.
- the insertion of point mutations into the U1 domain can moderate silencing. Indeed, altering the consensus sequence will produce U1 domains of different strength and affinity for the U1 snRNA, thereby leading to different levels of silencing. Therefore, once an annealing domain has been determined for a gene of interest, different U1 domains of different strength can be attached to the annealing domain to effect different levels of silencing of the gene of interest.
- nucleotide analogues can be included in the U1 domain to increase the affinity to endogenous U1 snRNP.
- the addition of nucleotide analogs may not be considered a point mutation if the nucleotide analog binds the same nucleotide as the replaced nucleotide.
- the U1 AO may be modified to be resistant to nucleases.
- the U1AO may comprise at least one non-natural nucleotide and/or nucleotide analog.
- the nucleotide analogs may be used to increase annealing affinity, specificity, bioavailability in the cell and organism, cellular and/or nuclear transport, stability, and/or resistance to degradation. For example, it has been well-established that inclusion of Locked Nucleic Acid (LNA) bases within an oligonucleotide increases the affinity and specificity of annealing of the oligonucleotide to its target site (Kauppinen et al. (2005) Drug Discov.
- LNA Locked Nucleic Acid
- U1AO inhibition does not involve enzymatic activity. As such, there is significantly greater flexibility in the permissible nucleotide analogs that can be employed in the U1 AO when compared with oligos for RNAi and RNase H-based silencing technologies.
- Nucleotide analogs include, without limitation, nucleotides with phosphate modifications comprising one or more phosphorothioate, phosphorodithioate, phosphodiester, methyl phosphonate, phosphoramidate, methylphosphonate, phosphotriester, phosphoroaridate, morpholino, amidate carbamate, carboxymethyl, acetamidate, polyamide, sulfonate, sulfonamide, sulfamate, formacetal,
- nucleotide mimetics such as, without limitation, peptide nucleic acids (PNA), morpholino nucleic acids, cyclohexenyl nucleic acids, anhydrohexitol nucleic acids, glycol nucleic acid, threose nucleic acid, and locked nucleic acids (LNA) (see, e.g., U.S. Patent Application Publication No. 2005/0118605).
- PNA peptide nucleic acids
- morpholino nucleic acids such as, without limitation, peptide nucleic acids (PNA), morpholino nucleic acids, cyclohexenyl nucleic acids, anhydrohexitol nucleic acids, glycol nucleic acid, threose nucleic acid, and locked nucleic acids (LNA)
- PNA peptide nucleic acids
- LNA locked nucleic acids
- Other nucleotide modifications are also provided in U.S. Patent Nos
- the U1AO comprises at least one locked nucleic acid.
- the annealing domain comprises at least one locked nucleic acid (optionally where the effector domain does not contain a locked nucleic acid).
- the U1AO, particularly the annealing domain has locked nucleic acids spaced apart by 2-4 nucleotides, particularly three nucleotides.
- the target site should be selected so as to minimize the base pairing potential of the effector domain with the target pre- mRNA, especially the portion flanking upstream of the annealing site.
- the U1AO should also be designed to have low self annealing so as to prevent the formation of hairpins within a single U1 adaptor and/or the formation of homodimers or homopolymers between two or more U1 adaptors.
- the annealing and effector domains of the U1 AO may be linked such that the effector domain is at the 5’ end and/or 3’ end of the annealing domain. Further, the annealing and effector domains may be operably linked via a linker domain.
- the linker domain may comprise, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, up to 15, up to 20, or up to 25 nucleotides.
- the U1AO may comprise ribonucleotides and/or deoxynucleotides. With regard to the sequences provided herein, uracil bases and thymidine bases may be exchanged.
- the U1AO comprises 2'-0-methyl nucleotides, 2'-0-methyloxyethoxy nucleotides, 2’-halo (e.g., 2’-fluoro), and/or locked nucleic acids.
- the U1AO comprises 2'-0-methyl nucleotides, 2'-0-methyloxyethoxy nucleotides, 2’-halo (e.g., 2’-fluoro), and/or locked nucleic acids.
- the U1AO comprises
- the U1 AO comprises a U1 AO provided in Figures 14A-14L (particularly in RNA).
- the U1AO comprises a U1AO sequence provided in rows 1-278 of Figures 14A-14L.
- the U1 AO comprises a U1 AO sequence provided in rows 1-192 of Figures 14A-14L.
- the U1 AO comprises a U1 AO sequence provided in rows 1-58 of Figures 14A-14L.
- the U1AO comprises a U1AO sequence provided in rows 1-26 of Figures 14A-14L.
- the U1AO comprises a U1AO sequence provided in rows 1- 10 of Figures 14A-14L.
- the U1AO comprises:
- the U1AO comprises
- the U1AO has at least 70%, at least 75%, at least 80%, at least 85%, and more particularly at least 90%, at least 95%, at least 97% or more identity with one of the above sequences or in Figures 14A-14L. With regard to the sequences provided herein, uracil bases and thymidine bases may be exchanged. In a particular embodiment, the U1AO comprises at least one or all nucleotide analogs.
- the U1AO comprises 2'-0-methyl nucleotides, 2'-0- methyloxyethoxy nucleotides, 2’-halo (e.g., 2’-fluoro), and/or locked nucleic acids.
- the U1AO comprises phosphorothioates. In a particular embodiment, the U1AO are modified as set forth in the Example.
- U1AO directed to a gene of interest may be used to modulate expression.
- Multiple U1 AO targeting (annealing) to different sequences in the same pre-mRNA can provide enhanced inhibition.
- Compositions of the instant invention may comprise more than one U1 AO directed to the htt gene (e.g., different targets within the hit gene).
- the U1AO can be combined with other methods of modulating the expression of a gene of interest.
- a U1 AO can be used in coordination with other inhibitory nucleic acid molecules such as antisense oligonucleotides or RNase H-based methods, RNAi, miRNA, and morpholino-based methods to give enhanced inhibition.
- other inhibitory nucleic acid molecules such as antisense oligonucleotides or RNase H-based methods, RNAi, miRNA, and morpholino-based methods to give enhanced inhibition.
- U1AO utilize a different mechanism than these other approaches, the combined use will result in an increased inhibition of gene expression compared to the use of a single inhibitory agent alone.
- U1 AO may target the biosynthetic step in the nucleus whereas RNAi and certain antisense approaches generally target cytoplasmic stability or translatability of a pre-existing pool of mRNA.
- the effector domain of the U1 adaptor can be replaced with the binding site for any one of a number of nuclear factors that regulate gene expression.
- polypyrimidine tract binding protein PTB is short and PTB is known to inhibit poly(A) sites.
- PTB polypyrimidine tract binding protein
- U1 snRNA genes that vary in sequence from the canonical U1 snRNA described hereinabove. Collectively, these U1 snRNA genes can be called the U1 variant genes. Some U1 variant genes are described in GenBank Accession Nos. L78810, AC025268, AC025264 and AL592207 and in Kyriakopoulou et al. (RNA (2006) 12: 1603-11), which identified close to 200 potential U1 snRNA-like genes in the human genome. Since some of these U1 variants have a 5’ end sequence different than canonical U1 snRNA, one plausible function is to recognize alternative splice signals during pre-mRNA splicing.
- the U1 domain of the U1AO of the instant invention may be designed to hybridize with the 5' end of the U1 variant snRNA in the same way as the U1 domain was designed to hybridize with the canonical U1 snRNA as described herein.
- the U1AO which hybridize to the U1 variants may then be used to modulate the expression of a gene of interest.
- the U1AO separates into two independent domains: (1) the annealing (i.e., targeting) activity and (2) the inhibitory activity, thereby allowing one to optimize annealing without affecting the inhibitory activity or vice versa.
- the annealing i.e., targeting
- the inhibitory activity thereby allowing one to optimize annealing without affecting the inhibitory activity or vice versa.
- usage of two U1AO to target the same gene gives additive even synergistic inhibition.
- the U1AO has a novel inhibitory mechanism.
- the U1 AO inhibits the biosynthesis of mRNA by inhibiting the critical, nearly-universal, pre-mRNA maturation step of poly(A) tail addition (also called 3' end processing).
- compositions of the instant invention comprise at least one U1AO of the instant invention and at least one pharmaceutically acceptable carrier.
- the compositions may further comprise at least one other agent which inhibits the expression of the gene of interest ( hit ).
- the composition may further comprise at least one siRNA or antisense oligonucleotide directed against the gene of interest (hit).
- the U1AO of the present invention may be administered alone, as naked polynucleotides, to cells or an organism, including animals and humans.
- the U1AO may be administered with an agent which enhances its uptake by cells.
- the U1AO may be contained within a liposome, nanoparticle, or polymeric composition.
- the U1AO may be delivered to a cell or animal, including humans, in an expression vector such as a plasmid or viral vector.
- a U1 AO can be expressed from a vector such as a plasmid or a virus.
- RNA molecules may employ a strong promoter which may be constitutive or regulated.
- promoters are well known in the art and include, but are not limited to, RNA polymerase II promoters, the T7 RNA polymerase promoter, and the RNA polymerase III promoters U6 and HI.
- Viral-mediated delivery includes the use of vectors based on, without limitation, retroviruses, adenoviruses, adeno-associated viruses, vaccinia virus, lentiviruses, polioviruses, and herpesviruses.
- compositions of the present invention can be administered by any suitable route, for example, by injection (e.g., intravenously,
- compositions can be administered for the treatment of Huntington’s disease which can be treated through the downregulation of htt.
- the compositions may be used in vitro , in vivo , and/or ex vivo.
- the U1AO of the instant invention (or compositions comprising the same) may be delivered to autologous cells (optionally comprising the step of obtaining the cells from the subject) and then re-introduced into the subject.
- U1 AO, and/or vectors of the instant invention may also be comprised in a kit.
- the instant invention also encompasses methods of treating, inhibiting
- the methods comprise the administration of a therapeutically effective amount of at least one composition of the instant invention to a subject (e.g., an animal or human) in need thereof.
- the composition comprises at least one U1AO of the instant invention and at least one
- the U1AO is directed to htt , particularly hit (e.g., mutant htt) that is full-length and/or truncated.
- the instant methods may further comprise the administration of at least one other agent which inhibits the expression of the target htt gene.
- the method may further comprise the administration of at least one siRNA or antisense oligonucleotide directed against the htt gene.
- the methods may also comprise the administration at least one other therapeutic agent (e.g., a symptom-alleviating therapeutic agent for Huntington’s disease (e.g., tetrabenazine (Xenazine®) or deutetrabenazine (Austedo®)).
- the therapeutic agent is conjugated to the U1AO (e.g., directly or via a linker; e.g., at the 3’ end and/or 5’end).
- the therapeutic agent may be administered in separate compositions (e.g., with at least one pharmaceutically acceptable carrier) or in the same composition.
- the therapeutic agent may be administered simultaneously and/or consecutively with the U1AO.
- the U1AO of the present invention may be
- the U1AO may be contained within a delivery vehicle such as a micelle, liposome, nanoparticle, or polymeric composition.
- the U1AO is complexed with (e.g., contained within or encapsulated by) a dendrimer, particularly cationic dendrimers such as poly(amido amine) (PAMAM) dendrimers and
- polypropyleneimine (PPI) dendrimers e.g., generation 2, 3, 4, or 5
- PPI polypropyleneimine
- the U1AO are targeted to a particular cell type (e.g., neurons).
- the U1AO is covalently linked (e.g., directly or via a linker) to at least one targeting moiety.
- the targeting moiety may be operably linked to the 5’ end, the 3’ end, or both ends or to internal nucleotides.
- one or more targeting moieties are conjugated to one end of the U1AO (e.g., through a single linker).
- a complex comprising the U1AO e.g., a dendrimer, micelle, liposome, nanoparticle, or polymeric composition
- U1AO e.g., a dendrimer, micelle, liposome, nanoparticle, or polymeric composition
- a linker e.g., directly or via a linker
- the linker is a chemical moiety comprising a covalent bond or a chain of atoms that covalently attaches two compounds such as a targeting moiety to the U1AO or complex.
- the linker can be linked to any synthetically feasible position of the targeting moiety and the U1AO or complex (vehicle).
- the linker connects the targeting moiety and the U1AO or complex via an amine group and/or sulfhydryl/thiol group, particularly a sulfhydryl/thiol group.
- the U1AO may be derivatized (e.g., at the 5’ end) with one or more amino or thio groups.
- the linker is attached at a position which avoids blocking the targeting moiety or the activity of the U1 AO.
- exemplary linkers may comprise at least one optionally substituted; saturated or unsaturated; linear, branched or cyclic alkyl group or an optionally substituted aryl group.
- the linker may also be a polypeptide (e.g., from about 1 to about 20 amino acids or more, or 1 to about 5).
- the linker may be biodegradable (cleavable (e.g., comprises a disulfide bond)) under physiological environments or conditions.
- the linker comprises polyethylene glycol (PEG) (alone or in
- the linker is a SPDP (N-Succinimidyl 3-(2-pyridyldithio)-propionate) linker such as LC-SPDP
- linker such as LC- SMCC(succinimidyl 4-(N-maleimidomethyl)cyclohexane-l-carboxy-(6- amidocaproate)).
- the linker may also be non-degradable (non-cleavable) and may be a covalent bond or any other chemical structure which cannot be substantially cleaved or cleaved at all under physiological environments or conditions.
- Targeting moieties of the instant invention preferentially bind to the relevant tissue (e.g., nerves) or organ (e.g., brain).
- the targeting moiety specifically binds to a marker specifically (e.g., only) expressed on the target cells or a marker up-regulated on the target cells compared to other cells.
- the targeting moiety is an antibody or antibody fragment immunologically specific for a surface protein on the target cells or a surface protein expressed at higher levels (or greater density) on the target cells than other cells, tissues, or organs.
- the antibody or antibody fragment may be a therapeutic antibody (e.g., possessing a therapeutic effect itself).
- the targeting moiety is a ligand or binding fragment thereof for a cell surface receptor on the target cells.
- the targeting moiety is an aptamer.
- the U1 AO of the instant invention may further be conjugated to other desirable compounds.
- the U1AO may be further conjugated (directly or via a linker as described above) to detectable agents, therapeutics (e.g., monoclonal antibodies, peptides, proteins, inhibitory nucleic acid molecules, small molecules, chemotherapeutic agents, etc.), carrier protein, and agents which improve
- the additional compounds may be attached to any synthetically feasible position of the U1AO (or conjugate (e.g., to the U1 Adaptor (e.g., either end) or the targeting moiety).
- the targeting moiety and the U1AO are each individually attached to additional compound (e.g., carrier protein) (as such the additional compound can be considered to serve as the linker between the U1 AO and the targeting moiety).
- the U1 AO is conjugated to a targeting moiety (e.g., neuron targeting moiety) at one end and, optionally, a therapeutic agent on the other.
- Detectable agents may be any compound or protein which may be assayed for directly or indirectly, particularly directly. Detectable agents include, for example, chemiluminescent, bioluminescent, and/or fluorescent compounds or proteins, imaging agent, contrast agent, radionuclides, paramagnetic or superparamagnetic ions, isotopes (e.g., radioisotopes (e.g., 3 ⁇ 4
- tritium and 14 C or stable isotopes (e.g., 2 H (deuterium), U C, 13 C, 17 0 and 18 0), optical agents, and fluorescence agents.
- stable isotopes e.g., 2 H (deuterium), U C, 13 C, 17 0 and 18 0
- optical agents e.g., fluorescence agents.
- Carrier proteins include, without limitation, serum albumin (e.g., bovine, human), ovalbumin, and keyhole limpet hemocyanin (KLH).
- the carrier protein is human serum albumin.
- Carrier proteins (as well as other proteins or peptides) may be conjugated to the U1AO (or conjugate) at any synthetically feasible position.
- linkers e.g., LC-SPDP
- Any unreacted linkers may be inactivated by blocking with cysteine.
- the U1 AO of the instant invention may be conjugated (e.g., directly or via a linker) to a compound (e.g., antibodies, peptides, proteins, nucleic acid molecules, small molecules, etc.) which targets the U1AO to a desired cell type and/or promotes cellular uptake of the U1 AO (e.g., a cell penetrating moiety).
- a compound e.g., antibodies, peptides, proteins, nucleic acid molecules, small molecules, etc.
- the targeting moiety may be operably linked to the 5’ end, the 3’ end, or both ends or to internal nucleotides.
- the targeting moiety and/or cell penetrating moiety are conjugated to the 5’ end and/or 3’ end.
- the targeting moiety and/or cell penetrating moiety is conjugated to the 5’ end.
- the U1AO is conjugated to both a targeting moiety and a cell penetrating moiety.
- the term“cell penetrating agent” or“cell penetrating moiety” refers to compounds or functional groups which mediate transfer of a compound from an extracellular space to within a cell.
- the U1AO is conjugated to an aptamer.
- the aptamer may be targeted to a surface compound or protein (e.g., receptor) of a desired cell type (e.g., the surface compound or protein may be preferentially or exclusively expressed on the surface of the cell type to be targeted).
- the aptamer is a cell penetrating aptamer (e.g., Cl or Otter (see, e.g., Burke, D.H. (2012) Mol. Then, 20: 251-253)).
- the U1AO is conjugated to a cell penetrating peptide (e.g., Tat peptides (e.g., YGRKKKRRQRRRPPQ; SEQ ID NO: 6 (optionally acetylated on N-terminus)), Penetratin (e.g., RQIKIWFQNRRMKWKKGG; SEQ ID NO: 7), short amphipathic peptides (e.g., from the Pep- and MPG-families), oligoarginine (e.g., 4-12 consecutive arginine), oligolysine (e.g., 4-12 consecutive lysine)).
- a cell penetrating peptide e.g., Tat peptides (e.g.,
- the U1AO is conjugated to a small molecule such as biotin (as part of targeting antibodies) or a non-polar fluorescent group (e.g., a cyanine such as Cy3 or Cy5) or to other cell penetrating agents.
- a small molecule such as biotin (as part of targeting antibodies) or a non-polar fluorescent group (e.g., a cyanine such as Cy3 or Cy5) or to other cell penetrating agents.
- At least one of the 3’ end and 5’ end of the U1AO comprises a free-SH group.
- the U1AO (including the vehicles comprising the same) described herein will generally be administered to a patient as a pharmaceutical preparation.
- patient and“subject”, as used herein, include humans and animals.
- These U1 adaptors may be employed therapeutically, under the guidance of a physician.
- compositions comprising the U1AO of the instant invention may be conveniently formulated for administration with any pharmaceutically acceptable carrier(s).
- the U1AO may be formulated with an acceptable medium such as water, buffered saline, ethanol, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol and the like), dimethyl sulfoxide (DMSO), oils, detergents, suspending agents or suitable mixtures thereof.
- concentration of the U1AO in the chosen medium may be varied and the medium may be chosen based on the desired route of administration of the pharmaceutical preparation. Except insofar as any conventional media or agent is incompatible with the U1AO to be
- the dose and dosage regimen of U1AO according to the invention that are suitable for administration to a particular patient may be determined by a physician considering the patient’s age, sex, weight, general medical condition, and the specific condition for which the U1 AO is being administered and the severity thereof.
- the physician may also take into account the route of administration, the pharmaceutical carrier, and the UlAO’s biological activity.
- the U1AO of the invention may be administered by direct injection to a desired site (e.g., brain).
- a pharmaceutical preparation comprises the U1AO dispersed in a medium that is compatible with the site of injection.
- U1 AO of the instant invention may be administered by any method.
- the U1AO of the instant invention can be administered, without limitation parenterally, subcutaneously, orally, topically, pulmonarily, rectally, vaginally, intravenously, intracerebroventricularly, intracranially, intraperitoneally, intrathecally, intracerebrally, epidurally,
- the method of administration is by direct injection (e.g., into the brain) or
- compositions containing a U1 AO of the present invention as the active ingredient in intimate admixture with a pharmaceutically acceptable carrier can be prepared according to conventional pharmaceutical compounding techniques.
- the carrier may take a wide variety of forms depending on the form of preparation desired for administration, e.g., intravenous, oral, direct injection, intracranial, intracerebroventricular, and intravitreal.
- a pharmaceutical preparation of the invention may be formulated in dosage unit form for ease of administration and uniformity of dosage.
- Dosage unit form refers to a physically discrete unit of the pharmaceutical preparation appropriate for the patient undergoing treatment. Each dosage should contain a quantity of active ingredient calculated to produce the desired effect in association with the selected pharmaceutical carrier. Procedures for determining the appropriate dosage unit are well known to those skilled in the art.
- Dosage units may be proportionately increased or decreased based on the weight of the patient. Appropriate concentrations for alleviation of a particular pathological condition may be determined by dosage concentration curve calculations, as known in the art.
- the appropriate dosage unit for the administration of U1AO may be determined by evaluating the toxicity of the molecules or cells in animal models.
- compositions may be administered to mice, and the minimal and maximal dosages may be determined based on the beneficial results and side effects observed as a result of the treatment.
- Appropriate dosage unit may also be
- the dosage units of U1AO may be determined individually or in combination with each treatment according to the effect detected.
- the pharmaceutical preparation comprising the U1AO may be administered at appropriate intervals, for example, at least twice a day or more until the pathological symptoms are reduced or alleviated, after which the dosage may be reduced to a maintenance level.
- the appropriate interval in a particular case would normally depend on the condition of the patient.
- Nucleic acid or a“nucleic acid molecule” as used herein refers to any DNA or RNA molecule, either single or double stranded and, if single stranded, the molecule of its complementary sequence in either linear or circular form.
- a sequence or structure of a particular nucleic acid molecule may be described herein according to the normal convention of providing the sequence in the 5' to 3' direction.
- the term“isolated nucleic acid” is sometimes used. This term, when applied to DNA, refers to a DNA molecule that is separated from sequences with which it is immediately contiguous in the naturally occurring genome of the organism in which it originated.
- an“isolated nucleic acid” may comprise a DNA molecule inserted into a vector, such as a plasmid or virus vector, or integrated into the genomic DNA of a prokaryotic or eukaryotic cell or host organism.
- isolated nucleic acid may refer to an RNA molecule encoded by an isolated DNA molecule as defined above.
- the term may refer to an RNA molecule that has been sufficiently separated from other nucleic acids with which it would be associated in its natural state (i.e., in cells or tissues).
- An isolated nucleic acid (either DNA or RNA) may further represent a molecule produced directly by biological or synthetic means and separated from other components present during its production.
- A“vector” is a genetic element, such as a plasmid, cosmid, bacmid, phage or virus, to which another genetic sequence or element (either DNA or RNA) may be attached.
- the vector may be a replicon so as to bring about the replication of the attached sequence or element.
- An“expression operon” refers to a nucleic acid segment that may possess transcriptional and translational control sequences, such as promoters, enhancers, translational start signals (e.g., ATG or AUG codons), polyadenylation signals, terminators, and the like, and which facilitate the expression of a nucleic acid or a polypeptide coding sequence in a host cell or organism.
- An“expression vector” is a vector which facilitates the expression of a nucleic acid or a polypeptide coding sequence in a host cell or organism.
- oligonucleotide refers to nucleic acid sequences, primers, and probes of the present invention, and is defined as a nucleic acid molecule comprised of two or more ribo or deoxyribonucleotides, preferably more than three. The exact size of the oligonucleotide will depend on various factors and on the particular application and use of the oligonucleotide.
- siRNA small, interfering RNA
- siRNA refers to a short (typically less than 30 nucleotides long, more typically between about 21 to about 25 nucleotides in length) double stranded RNA molecule.
- the siRNA modulates the expression of a gene to which the siRNA is targeted.
- short hairpin RNA or“shRNA” refers to an siRNA precursor that is a single RNA molecule folded into a hairpin structure comprising an siRNA and a single stranded loop portion of at least one, typically 1-10, nucleotide.
- RNA interference refers generally to a sequence- specific or selective process by which a target molecule (e.g., a target gene, protein or RNA) is downregulated via a double-stranded RNA.
- a target molecule e.g., a target gene, protein or RNA
- the double-stranded RNA structures that typically drive RNAi activity are siRNAs, shRNAs, microRNAs, and other double-stranded structures that can be processed to yield a small RNA species that inhibits expression of a target transcript by RNA interference.
- antisense refers to an oligonucleotide having a sequence that hybridizes to a target sequence in an RNA by Watson-Crick base pairing, to form an RNA: oligonucleotide heteroduplex with the target sequence, typically with an mRNA.
- the antisense oligonucleotide may have exact sequence complementarity to the target sequence or near complementarity. These antisense oligonucleotides may block or inhibit translation of the mRNA, and/or modify the processing of an mRNA to produce a splice variant of the mRNA.
- Antisense oligonucleotides are typically between about 5 to about 100 nucleotides in length, more typically, between about 7 and about 50 nucleotides in length, and even more typically between about 10 nucleotides and about 30 nucleotides in length.
- the term“substantially pure” refers to a preparation comprising at least 50- 60% by weight of a given material (e.g., nucleic acid, oligonucleotide, protein, etc.). More preferably, the preparation comprises at least 75% by weight, and most preferably 90- 95% by weight of the given compound. Purity is measured by methods appropriate for the given compound (e.g. chromatographic methods, agarose or polyacrylamide gel electrophoresis, HPLC analysis, and the like).
- isolated may refer to a compound or complex that has been sufficiently separated from other compounds with which it would naturally be associated. “Isolated” is not meant to exclude artificial or synthetic mixtures with other compounds or materials, or the presence of impurities that do not interfere with fundamental activity or ensuing assays, and that may be present, for example, due to incomplete purification, or the addition of stabilizers.
- the term“gene” refers to a nucleic acid comprising an open reading frame encoding a polypeptide, including both exon and (optionally) intron sequences.
- the nucleic acid may also optionally include non coding sequences such as promoter or enhancer sequences.
- the term“intron” refers to a DNA sequence present in a given gene that is not translated into protein and is generally found between exons.
- the term“aptamer” refers to a nucleic acid that specifically binds to a target, such as a protein, through interactions other than Watson-Crick base pairing.
- the aptamer specifically binds to one or more targets (e.g., a protein or protein complex) to the general exclusion of other molecules in a sample.
- the aptamer may be a nucleic acid such as an RNA, a DNA, a modified nucleic acid, or a mixture thereof.
- the aptamer may also be a nucleic acid in a linear or circular form and may be single stranded or double stranded.
- the aptamer may comprise oligonucleotides that are at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40 or more nucleotides in length.
- Aptamers may comprise sequences that are up to 40, up to 60, up to 80, up to 100, up to 150, up to 200 or more nucleotides in length.
- Aptamers may be from about 5 to about 150 nucleotides, from about 10 to about 100 nucleotides, or from about 20 to about 75 nucleotides in length.
- aptamers are discussed herein as nucleic acid molecules (e.g., oligonucleotides) aptamers, aptamer equivalents may also be used in place of the nucleic acid aptamers, such as peptide aptamers.
- operably linked may refer to a nucleic acid sequence placed into a functional relationship with another nucleic acid sequence.
- nucleic acid sequences that may be operably linked include, without limitation, promoters, transcription terminators, enhancers or activators and heterologous genes which when transcribed and, if appropriate to, translated will produce a functional product such as a protein, ribozyme or RNA molecule.
- “Pharmaceutically acceptable” indicates approval by a regulatory agency of the Federal government or a state government. “Pharmaceutically acceptable” agents may be listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans.
- A“carrier” refers to, for example, a diluent, preservative, solubilizer, emulsifier, adjuvant, excipient, auxilliary agent or vehicle with which an active agent of the present invention is administered.
- Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water or aqueous saline solutions and aqueous dextrose and glycerol solutions may be employed as carriers. Suitable pharmaceutical carriers are described, for example, in “Remington's Pharmaceutical Sciences” by E.W. Martin.
- an“antibody” or“antibody molecule” is any immunoglobulin, including antibodies and fragments thereof (e.g., immunologically specific fragments), that binds to a specific antigen.
- antibody or antibody molecule contemplates intact immunoglobulin molecules, immunologically active portions of an immunoglobulin molecule, and fusions of immunologically active portions of an immunoglobulin molecule.
- the term includes polyclonal, monoclonal, chimeric, single domain (Dab) and bispecific antibodies.
- antibody or antibody molecule contemplates recombinantly generated intact immunoglobulin molecules and immunologically active portions of an immunoglobulin molecule such as, without limitation: Fab, Fab', F(ab') 2 , F(v), scFv, scFv 2 , and scFv-Fc.
- the term“immunologically specific” refers to antibodies that bind to one or more epitopes of a protein or compound of interest, but which do not substantially recognize and bind other molecules in a sample containing a mixed population of antigenic biological molecules.
- the term“treat” refers to the ability of the compound to relieve, alleviate, and/or slow the progression of the patient’s disease.
- the term“treat” refers to inhibiting and/or reversing the progression of a disease.
- the following example describes illustrative methods of practicing the instant invention and is not intended to limit the scope of the invention in any way.
- HD9197 cells (Coriel Institute GM09197; 21/181 CAG repeats, fibroblast 6 year old male) were transfected with a panel of U1 adaptor oligonucleotides (UlAOs) and siRNAs (see below) directed against full length human huntingtin (HTT) using LipofectamineTM RNAiMAX transfection reagent (Invitrogen, Carlsbad, CA). The percent change of human HTT mRNA normalized to hypoxanthine
- phosphoribosyltransferase 1 HPRT1
- human HTT-full length mRNA-2 hHTT-FL-2
- U1AO had the highest silencing activity which was significantly greater than the silencing observed with any siRNA.
- hHTT-FL-1 U1AO can silence to ⁇ 30%. Similar results were obtained with DU145 (human prostate cancer cell line) and Mia PaCa2 cells (human pancreatic cancer cell line). With regard to the truncated version of HTT (also referred to as the alternatively spliced or intron 1 truncated form), hHTT-TR-1 U1AO was determined to have the greatest silencing activity.
- hHTT-fl-h UC CU GCU G AU G AC AU GU GGGGC C AGGU A AGU AU (SEQ ID NO:
- each nucleotide is T -O-methyl
- hHTT-fl-2i CAGAAAAGGUUCACGUCCACGCCAGGUAAGUAU (SEQ ID NO:
- each nucleotide is T -O-methyl
- hHTT-fl-3i CAACCACCUCAAGCACAGACGCCAGGUAAGUAU (SEQ IDNO:
- each nucleotide is T -O-methyl
- hHTT-fl-4i UUCGUAAACAAGUCAGCAGCGCCAGGUAAGUAU (SEQ ID NO:
- each nucleotide is 2’-0-methyl
- hHTT-fl-5i GCCUCACAGUCUCUCCCACCGCCAGGUAAGUAU (SEQ ID NO:
- each nucleotide is 2’-0-methyl
- hHTT-fl-6i GUGACUAUCAGGAGAAAGGAGCCAGGUAAGUAU (SEQ ID NO:
- each nucleotide is T -O-methyl
- NC-a (ctrl): mAAmCmGmGmUmUmAmGmGmCmAmCmCmTmCmUmUmGmA mGmCmCmAmGmGmUmAmAmGmUmAmU (SEQ ID NO: 17), wherein m 2’ -O-methyl;
- Figure 3 provides a Western blot of Human DU145 cells transfected 48 hours (LipofectamineTM 2000) with various anti-hHTT-FL UlAOs and siRNAs (see below). Cells were lysed directly into laemmli buffer and then analyzed by Western blot after electrophoresis on a 6-20% gradient gel. The best anti-hHTT-FL UlAOs (hHTT-FL- 1 and hHTT-FL-2) were used here and show silencing activity at the protein level.
- the anti-HTT-FL siRNA also showed silencing activity. Notably, using less U1AO gave less silencing (compare lane 9 with lane 7).
- YAC128 are mice containing the entire human HTT gene (300,000 bp) having 128 CAG repeats.
- 1 pg or 20 pg of hHTT-FL-2 U1AO or saline was unilaterally intracerebroventricular (ICV) injected into YAC128 mice. After 48 hours, mice were sacrificed with perfusion. Total RNA from left forebrains was extracted by a Trizol-based method and was analyzed by RT- qPCR and normalized to eukaryotic translation initiation factor 4A3 (Eif4a3).
- a 20 pg unilaterally-ICV-injected dose of the hHTT-FL-2 U1AO silences with a 62% reduction of the hHTT-Fl mRNA in YAC128 brain as compared to saline treated mice.
- the specificity of silencing is confirmed by the fact that neither the hHTT-Tr mRNA isoform (Fig. 4B) nor the Eif4a3 housekeeping gene underwent an observable change in expression.
- RNA (4 pg / lane) from forebrains of YAC128 mice were analyzed by 32 P Northern blot (8% PAGE) ( Figure 5). Specifically, the blot was probed with a 33nt 32 P-anti-hHTT-FL-2 oligonucleotide complementary to hHTT-FL-2 U1AO in order to measure U1 AO levels.
- the lanes marked“Standards” are the uninjected U1AO and their inclusion allows for a rigorous quantitation. As seen in Figure 5, the U1AO in the brain tissue is neither degraded nor shortened. Shortening of the injected U1 AO, even by just a few nucleotides, would result in a noticeable change in migration relative to the standards.
- RNAScope® method involves fixing the hemibrain in 4% paraformaldehyde for 48 hours, transferring to PBS, and processing through tissue processor for paraffin embedding.
- the formalin-fixed paraffin-embedded (FFPE) brains were cut at 5 microns thick through the sagittal plane and striatal sections followed by in situ hybridization using an RNAScope® probe specific to hHTT-FL mRNA.
- FFPE formalin-fixed paraffin-embedded
- hHTT-FL-2 U1AO 20 pg of hHTT- FL-2 U1AO or saline was unilaterally intracerebroventricular (ICV) injected into YAC128 mice. After 2, 4, or 7 days, mice were sacrificed with perfusion. Total RNA from left forebrains was extracted by a Trizol-based method and was analyzed by RT-qPCR and normalized to eukaryotic translation initiation factor 4A3 (Eif4a3). As seen in Figure 7A, a 20 pg unilaterally-ICV-injected dose of the hHTT-FL-2 U1 AO reduces hHTT-Fl mRNA in YAC128 brain constantly over time.
- Figure 7B provides a Northern blot analysis probed with a 33nt 32 P-anti-hHTT-FL-2
- hHTT-TR-1 U1AO 20 pg of hHTT- TR-1 U1AO, hHTT-TR-2 U1AO, or saline was unilaterally ICV injected into YAC128 mice. After 48 hours, mice were sacrificed with perfusion. Total RNA from forebrains was extracted by a Trizol-based method and was analyzed by RT- qPCR and normalized to eukaryotic translation initiation factor 4A3 (Eif4a3). As seen in Figure 8A, hHTT-TR-1 U1 AO did not effectively silence hHTT-TR whereas the hHTT-TR-2 U1 AO significantly silences hHTT-TR by about 79%. The effect was specific as no silencing was observed for the hHTT-FL mRNA in either the saline-treated or hHTT-TR-treated mice (Fig. 8B).
- Anti-mouse HTT UlAOs were also synthesized and shown to silence mHTT in cultured cells.
- the best anti-mouse HTT UlAOs were mHTT-TR-a (targeting mHTT-TR mRNA transcript) and mHTT-FL-a (targeting mHTT-FL mRNA transcript). These UlAOs were then tested in the Q 175 mouse model.
- Q175 mice are a knock-in mice where, for heterozygotes, one of the HTT alleles has 175 CAG repeat.
- saline 20 pg of mHTT-TR-A U1AO, or 40 pg of non-specific control adaptor (NC-A) U1AO was unilaterally ICV injected into Q175 mice.
- the NC-A U1 AO is a non-specific control U1 AO designed to not silence any mouse gene.
- mice were sacrificed with perfusion.
- Total RNA from left forebrains was extracted by a Trizol-based method and was analyzed by RT-qPCR and normalized to eukaryotic translation initiation factor 4A3 (Eif4a3).
- a 20 pg unilaterally-ICV-injected dose of the mHTT- TR-A U1 AO silences with a 75% reduction of the mHTT-TR mRNA in Q175 brain as compared to control treated mice.
- the specificity of silencing is confirmed by the fact that neither the mHTT-FL mRNA isoform (Fig. 9B) nor the Eif4a3 housekeeping gene underwent a significant change in expression.
- RNAScope® analysis was also performed to detect mHTT-TR transcripts at single cell resolution. Briefly, the RNAScope® method involves fixing the hemibrain in 4% paraformaldehyde for 48 hours, transferring to PBS, and processing through tissue processor for paraffin embedding. The formalin-fixed paraffin- embedded (FFPE) brains were cut at 5 microns thick through the sagittal plane and striatal sections followed by in situ hybridization using an RNAScope® probe specific to mHTT-TR mRNA. As seen in Figure 10, the mHTT-TR-A Ell AO-treated mice (right) have fewer dots and a reduced intensity as compared to saline treated mice (left), thereby demonstrating silencing of mHTT-TR.
- FFPE formalin-fixed paraffin- embedded
- mHTT-TR-A Ell AO 20 pg of mHTT- TR-A Ell AO or saline was unilaterally intracerebroventricular (ICV) injected into Q175 mice. After 21 days, mice were sacrificed with perfusion. Total RNA from left forebrains was extracted by a Trizol-based method and was analyzed by RT-qPCR and normalized to eukaryotic translation initiation factor 4A3 (Eif4a3). As seen in Figure 11 A, a 20 pg unilaterally-ICV-injected dose of the mHTT-TR-A Ell AO reduces mHTT-TR mRNA in Q175 mouse brain even after 21 days. The specificity of silencing is confirmed by the fact that neither the mHTT-FL mRNA isoform (Fig.
- saline, 40 pg of mHTT-FL- A U1 AO, or 40 pg of non-specific control adaptor (NC-A) U1 AO was unilaterally ICV injected into Q175 mice.
- the NC-A U1 AO is a non-specific control U1AO designed to not silence any mouse gene.
- mice were sacrificed with perfusion.
- Total RNA from left forebrains was extracted by a Trizol-based method and was analyzed by RT-qPCR and normalized to eukaryotic translation initiation factor 4A3 (Eif4a3).
- a 40 pg unilaterally-ICV- injected dose of the mHTT-FL- A U1 AO silences with a 69% reduction of the mHTT- FL mRNA in Q 175 brain as compared to control treated mice.
- the specificity of silencing is confirmed by the fact that neither the mHTT-TR mRNA isoform (Fig. 12B) nor the Eif4a3 housekeeping gene underwent a significant change in expression.
- An RNAScope® analysis was also performed to detect mHTT-FL transcripts at single cell resolution.
- the RNAScope® method involves fixing the hemibrain in 4% paraformaldehyde for 48 hours, transferring to PBS, and processing through tissue processor for paraffin embedding.
- the formalin-fixed paraffin- embedded (FFPE) brains were cut at 5 microns thick through the sagittal plane and striatal sections followed by in situ hybridization using an RNAScope® probe specific to mHTT-FL mRNA.
- FFPE formalin-fixed paraffin- embedded
- Biodistribution studies for hHTT-FL-2 U1AO were also performed. Briefly, to assess biodistribution in brain regions at the single cell level, a series of
- Cy 3 -hHTT-FL-2 U1AO Cy 3 -fluorescently labelled hHTT-FL-2 U1AO
- 5 pg of Cy 3 -hHTT-FL-2 U1AO was unilaterally ICV- injected into 6-8 month old YAC128 mice.
- mice were sacrificed with perfusion (with saline) to remove blood and extracellular U1 AO.
- Brain samples were subsequently studied by confocal microscopy.
- higher doses of Cy3-hHTT-FL-2 U1 AO were not used because the Cy3 fluorescent group itself proved toxic.
- Cy3-hHTT-FL-2 U1AO also had widespread uptake by most neurons (e.g., cortical neurons) and cell types. Additionally, Cy3-hHTT-FL-2 U1AO was clearly visible in the nucleus and perinucleus. Lastly, fluorescent intensity was only slightly diminished at the 28 day time point as compared to the 1 and 7 day time points, thereby demonstrating the stability of Cy3-hHTT-FL-2 U1 AO over time. Further experiments were performed to demonstrate 50% to 80% sustained reduction of the mHTT-Fl transcript from one to four months. In parallel
- a cohort of three mice from each concentration was euthanized after 1, 2, and 4 months where mice underwent perfusion with lx PBS and then sacrificed. Hemibrains were collected and processed for analysis by RT-qPCR and Northern blot. All U 1 Adaptor treated mice were compared to untreated Q175 mice. Silencing of the mHTT-Fl transcript was assessed by RT-qPCR which were then compared to untreated mice set to 100%.
- RT-qPCR to detect mHTT-Tr transcript included Dnase treatment necessary to remove intron #1 DNA that would have interfered with mHTT-Tr transcript Ct values.
- a cohort of three mice from each concentration was euthanized after 1, 2, and 4 months where mice underwent perfusion with lx PBS and then sacrificed. Hemibrains were collected and processed for analysis by RT-qPCR and Northern blot. All U 1 Adaptor treated mice were compared to untreated Q175 mice. Silencing of the mHTT-Tr transcript was assessed by RT-qPCR which were then compared to untreated mice set to 100%.
- RT-qPCR to detect mHTT-Tr transcript included Dnase treatment necessary to remove intron #1 DNA that would have interfered with mHTT-Tr transcript Ct values.
- the mHTT-Tr transcript was specifically reduced at 1, 2, and 4 months, respectively, after treatment.
- silencing of the mHTT-Tr transcript by mHTT-Tr-a U1 AO was deemed specific because: 1) no significant changes in the mHTT-Fl transcript were observed and 2) the NC-a non-specific control U1 AO showed no silencing at the highest dose (80 pg) at the 1, 2 and 4 month durations.
- silencing of the mHTT-Fl transcript by mHTT-Fl-a U1 AO was deemed specific because: 1) no significant changes in the mHTT-Tr transcript were observed and 2) the NC-a non-specific control U1 AO showed no silencing at the highest dose (80 pg) at the 1, 2 and 4 month durations.
- PK Pharmacokinetics studies were also performed.
- a PK profile was achieved by 32 P -Northern blot analysis over a four point dose response combined with a 3-point time-course duration of the same mice listed above.
- An aliquot of the same RNA used to perform RT-qPCR was used for Northern blotting.
- RNA samples from U1 Adaptor-treated mice along with standards and a 32 P tracer were separated on an 8% denaturing urea-PAGE gel followed by transfer to a Northern blot membrane. The membrane was then probed with the cognate 32 P-probe, washed and exposed to X-ray film.
- the cognate probes were a 32 P -labelled oligonucleotide called 32 P-anti-mHTT-FL-a that is antisense to the mHTT-Fl-a U1AO or a 32 P-labelled oligonucleotide called 32 P-anti-mHTT-Tr-a that is antisense to the mHTT-Tr-a U1 AO or a 32 P -labelled oligonucleotide called 32 P-anti-NC-a that is antisense to the NC-a U1 AO.
- the Northern blots were quantified by phosphoimager analysis on a TyphoonTM system. Results are provided in Figure 17.
- H&E hematoxylin and eosin
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Biochemistry (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Epidemiology (AREA)
- Psychology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Neurosurgery (AREA)
- Neurology (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Description
Claims
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201962815647P | 2019-03-08 | 2019-03-08 | |
| PCT/US2020/021652 WO2020185651A2 (en) | 2019-03-08 | 2020-03-09 | Compositions and methods for treating huntington's disease |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP3935167A2 true EP3935167A2 (en) | 2022-01-12 |
Family
ID=72428020
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP20770560.9A Withdrawn EP3935167A2 (en) | 2019-03-08 | 2020-03-09 | Compositions and methods for treating huntington's disease |
Country Status (10)
| Country | Link |
|---|---|
| EP (1) | EP3935167A2 (en) |
| JP (1) | JP2022524383A (en) |
| KR (1) | KR20220002882A (en) |
| CN (1) | CN113924364A (en) |
| AU (1) | AU2020238872A1 (en) |
| BR (1) | BR112021017635A2 (en) |
| CA (1) | CA3132388A1 (en) |
| IL (1) | IL286083A (en) |
| SG (1) | SG11202109180RA (en) |
| WO (1) | WO2020185651A2 (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN119137273A (en) | 2022-03-04 | 2024-12-13 | 洛卡纳生物股份有限公司 | Compositions and methods comprising engineered small nuclear RNA (snRNA) |
| WO2024035952A1 (en) * | 2022-08-12 | 2024-02-15 | Remix Therapeutics Inc. | Methods and compositions for modulating splicing at alternative splice sites |
Family Cites Families (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6900016B1 (en) * | 2000-09-08 | 2005-05-31 | Applera Corporation | Polymorphisms in known genes associated with inflammatory autoimmune disease, methods of detection and uses thereof |
| US7214786B2 (en) * | 2000-12-14 | 2007-05-08 | Kovalic David K | Nucleic acid molecules and other molecules associated with plants and uses thereof for plant improvement |
| US20080274989A1 (en) * | 2002-08-05 | 2008-11-06 | University Of Iowa Research Foundation | Rna Interference Suppression of Neurodegenerative Diseases and Methods of Use Thereof |
| US9441221B2 (en) * | 2007-03-30 | 2016-09-13 | Rutgers, The State University Of New Jersey | Compositions and methods for gene silencing |
| EP2246432A2 (en) * | 2008-01-29 | 2010-11-03 | Proyecto de Biomedicina Cima, S.L. | Methods and compositions capable of causing post-transcriptional silencing of gene expression in a synergic manner |
| AU2015252117A1 (en) * | 2008-04-11 | 2015-11-26 | Tekmira Pharmaceuticals Corporation | Site-specific delivery of nucleic acids by combining targeting ligands with endosomolytic components |
| JP7009356B2 (en) * | 2015-04-03 | 2022-01-25 | ユニバーシティ・オブ・マサチューセッツ | Oligonucleotide compounds targeting huntingtin mRNA |
-
2020
- 2020-03-09 WO PCT/US2020/021652 patent/WO2020185651A2/en not_active Ceased
- 2020-03-09 SG SG11202109180RA patent/SG11202109180RA/en unknown
- 2020-03-09 BR BR112021017635A patent/BR112021017635A2/en not_active Application Discontinuation
- 2020-03-09 CA CA3132388A patent/CA3132388A1/en active Pending
- 2020-03-09 KR KR1020217032259A patent/KR20220002882A/en not_active Withdrawn
- 2020-03-09 CN CN202080019190.5A patent/CN113924364A/en active Pending
- 2020-03-09 EP EP20770560.9A patent/EP3935167A2/en not_active Withdrawn
- 2020-03-09 JP JP2021553317A patent/JP2022524383A/en active Pending
- 2020-03-09 AU AU2020238872A patent/AU2020238872A1/en not_active Abandoned
-
2021
- 2021-09-02 IL IL286083A patent/IL286083A/en unknown
Also Published As
| Publication number | Publication date |
|---|---|
| BR112021017635A2 (en) | 2021-11-09 |
| CA3132388A1 (en) | 2020-09-17 |
| AU2020238872A1 (en) | 2021-09-16 |
| IL286083A (en) | 2021-10-31 |
| WO2020185651A3 (en) | 2020-10-29 |
| WO2020185651A2 (en) | 2020-09-17 |
| KR20220002882A (en) | 2022-01-07 |
| JP2022524383A (en) | 2022-05-02 |
| SG11202109180RA (en) | 2021-09-29 |
| CN113924364A (en) | 2022-01-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP7423015B2 (en) | Chimeric double-stranded nucleic acid | |
| JP2024045199A (en) | Antisense oligomers for the treatment of conditions and diseases | |
| CN102171342B (en) | Effective exon (44) skipping method and related means in Duchenne muscular dystrophy | |
| CN105517556B (en) | Regulation of Prekallikrein (PKK) Expression | |
| KR20220104677A (en) | Compositions and methods for modulating splicing and protein expression | |
| CN105637090A (en) | Compositions for modulating expression of C9ORF72 | |
| JP6637961B2 (en) | MYH7B inhibitors and uses thereof | |
| US9441221B2 (en) | Compositions and methods for gene silencing | |
| JP2018531046A6 (en) | Nucleic acid based TIA-1 inhibitors | |
| JP2018531046A (en) | Nucleic acid based TIA-1 inhibitors | |
| WO2020185651A2 (en) | Compositions and methods for treating huntington's disease | |
| US20220372488A1 (en) | Compositions and methods for treating neurodegenerative disorders | |
| JP2021534799A (en) | How to Target Kits Using Splice Switching Oligonucleotides to Induce Mast Cell Apoptosis | |
| US20240294907A1 (en) | Selective delivery of oligonucleotides to glial cells | |
| US20260035694A1 (en) | Antisense oligomers for treatment of non-sense mediated rna decay based conditions and diseases | |
| US20230272393A1 (en) | Compositions and methods for modulating apoc3 expression | |
| US9840705B2 (en) | Materials and methods for treatment of pulmonary arterial hypertension | |
| JP2025518507A (en) | Compositions and methods for inhibiting snca expression | |
| US20240409938A1 (en) | Lipophilic sirna conjugates for the treatment of central nervous system diseases | |
| US20260055414A1 (en) | Compositions and methods for inhibiting xdh expression | |
| JP2013039036A (en) | NUCLEIC ACID INHIBITING EXPRESSION OF HIF-2α | |
| WO2026106795A1 (en) | Antisense oligonucleotides targeting bmper for treatment of glomerular diseases | |
| WO2026017176A1 (en) | Oligonucleotide targeting microtubule-associated protein tau gene and use thereof | |
| CN121866333A (en) | Antisense oligomer therapy for bone loss | |
| WO2014095916A1 (en) | Ninjurin-1 as therapeutic target for brain tumor |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE |
|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE |
|
| 17P | Request for examination filed |
Effective date: 20211004 |
|
| AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR |
|
| REG | Reference to a national code |
Ref country code: HK Ref legal event code: DE Ref document number: 40058923 Country of ref document: HK |
|
| DAV | Request for validation of the european patent (deleted) | ||
| DAX | Request for extension of the european patent (deleted) | ||
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
| 18D | Application deemed to be withdrawn |
Effective date: 20231003 |