CA3132388A1 - Compositions and methods for treating huntington's disease - Google Patents

Abstract

Compositions and methods are provided for the inhibition, treatment and/or prevention of Huntington's disease.

Description

COMPOSITIONS AND METHODS FOR TREATING HUNTINGTON'S
DISEASE
This application claims priority under 35 U.S.C. 119(e) to U.S. Provisional Patent Application No. 62/815,647, filed March 8, 2019. The foregoing application is incorporated by reference herein.
FIELD OF THE INVENTION
This invention relates generally to the field of gene silencing. Specifically, the invention provides compositions and methods for regulating the expression of the huntingtin gene.
BACKGROUND OF THE INVENTION
Huntington's disease (HD) is an autosomal dominant neurodegenerative disease. HD is part of the family of polyglutamine (polyQ) disorders comprising at least nine different neurodegenerative diseases that result from the variably expanded trinucleotide CAG repeat in specific genes (e.g., huntingtin) (Walker, F.O.
(2007) Lancet, 369:218-228; Walker, F.O. (2007) Semin. Neurol., 27:143-150). The size of

2 0 the expansion is partially negatively correlated with age of onset (e.g., adult-onset vs.
juvenile). HD is caused by CAG repeat expansion (¨>36 repeats) within the first exon of the huntingtin gene.
The huntingtin gene (htt) and protein (HTT) are widely and ubiquitously expressed, but the disease has a pattern of selective neuronal vulnerability (e.g., within the brain) (Ambrose, et al. (1994) Somat. Cell Mol. Genet., 20:27-38;
Landles, et al. (2004) EMBO Rep., 5:958-963). Neither the normal function for htt nor the pathological mechanism for mutant htt is completely understood. Multiple mechanisms including a toxic gain of function and loss of wild type function may exist. Notably, aggregates of the HTT protein can be found in different locations and different types of neurons.
There is no cure for HD and treatments are focused on managing its symptoms (Johnson, et al. (2010) Hum. Mol. Genet., 19:R98-R102). Recent data indicate that full length and truncated mRNA transcripts and their associated protein products exist in HD patients and contribute to the mechanism of neuron dysfunction and death (Sathasivam, et al. (2013) Proc. Natl. Acad. Sci., 110:2366-2370). Notably, the use of genetically modified mouse models showed that HD-like disease phenotypes can be resolved if mutant huntingtin expression is eliminated, even at advanced disease stages (Yamamoto, etal. (2000) Cell, 101:57-66; Diaz-Hernandez, etal. (2005) J.
Neurosci., 25:9773-9781). Thus, reducing mutant htt mRNA (full-length and/or terminated) can lead to therapeutic intervention (Sah, et al. (2011) J. Clin.
Invest., 121:500-507). However, improved methods of regulating htt gene expression are required.
SUMMARY OF THE INVENTION
In accordance with the instant invention, nucleic acid molecules for inhibiting the expression of the huntingtin gene (htt) are provided. In a particular embodiment, the nucleic acid molecules comprise an annealing domain operably linked to at least one effector domain, wherein the annealing domain hybridizes to the pre-mRNA
of htt and wherein the effector domain hybridizes to the Ul snRNA of Ul snRNP. In a particular embodiment, the U1 AO may be directed to full-length and/or truncated htt.
In accordance with another aspect of the instant invention, the nucleic acid molecules may be conjugated to (e.g., directly or via a linker) a targeting moiety. The targeting moiety may be conjugated to the 5' end and/or the 3' end (e.g., the nucleic 2 0 acid may comprise two targeting moieties, either the same or different). In a particular embodiment, the nucleic acid molecules are conjugated to an aptamer.
In accordance with another aspect of the invention, methods are provided for inhibiting the expression of htt comprising delivering to a cell at least one of the nucleic acid molecules of the instant invention.
In accordance with another aspect of the invention, compositions are provided which comprise at least one of the nucleic acid molecules of the invention and at least one pharmaceutically acceptable carrier.
In still another aspect, vectors encoding the nucleic acid molecules of the instant invention are also provided.
In accordance with another aspect of the instant invention, methods of treating, inhibiting, and/or preventing Huntington's disease in a subject are provided.
The methods comprise administering a therapeutically effective amount of at least one nucleic acid molecule of the instant invention (e.g., U1A0 or vector encoding the U1 AO) to a subject in need thereof. In a particular embodiment, the method comprises administering more than one U1 AO. In a particular embodiment, the method comprises administering a U1 AO directed to full-length htt, truncated htt, or both full-length and truncated htt (e.g., with separate U1A0).
BRIEF DESCRIPTIONS OF THE DRAWING
Figure 1A is a schematic of a Ul adaptor oligonucleotide depicting its 2 domains: an annealing domain to base pair to the target gene's pre-mRNA in the

3' terminal exon and an effector domain that inhibits maturation of the pre-mRNA
via binding of endogenous Ul snRNP. The provided sequence of the effector domain is SEQ ID NO: 1. Figure 1B is a schematic of the Ul adaptor annealing to target pre-mRNA. The provided sequence of the effector domain is SEQ ID NO: 1. Figure 1C
is a schematic of the Ul adaptor binding Ul snRNP, which leads to poly(A) site inhibition. 1P = pseudouridines of the Ul snRNA in the Ul snRNP. The provided sequence of the Ul snRNA in the Ul snRNP is SEQ ID NO: 2. The provided sequence of the effector domain is SEQ ID NO: 1.
Figure 2 provides a graph showing the percent change of human huntingtin (HTT) mRNA normalized to hypoxanthine phosphoribosyltransferase 1 (HPRT1) in HD9197 cells transfected for 44 hours with a panel of 20 nM Ul adaptor oligonucleotides (U1A0s) and 20 nM siRNAs directed against full length human HTT.
Figure 3 provides a Western blot of DU145 cells transfected 48 hours with 20 nM various hHTT-FL U1A0s and siRNAs, with the exception of 7 nM in lane 9 and nM in lane 7. GAPDH is provided as a loading control. Ul A (U1 snRNP subunit) is provided as a second loading control. 1,500,00 cell equivalents were loaded per 25 lane. Lanes 4 and 6 are independent replicates. MW: molecular weight markers.
Figure 4A provides a graph of the percent change of hHTT-FL mRNA in YAC128 forebrain after intracerebroventricular (ICV) injection into the left ventricle of saline or hHTT-FL-2 U1A0. YAC128 are a well established mouse model of Huntington's diseases containing the ¨300,000 basepair human huntingtin gene with 30 128 CAG repeats. Average of control mice was set to 100%. N = 7 are from two different experiments (n = 3 and n = 4). Figure 4B provides a graph of the percent change of hHTT-TR mRNA in YAC128 forebrain after ICV injection of saline or hHTT-FL-2 U1 AO. Average of control mice was set to 100%.

Figure 5 provides an image of an 8% denaturing polyacrylamide gel electrophoresis (PAGE) Northern blot of total RNA from YAC128 forebrain after injection of saline or hHTT-FL-2 U1 AO. The probe was a 33 nucleotide 32P-anti-hHTT-FL-2 oligonucleotide. Standards are uninjected U1A0.
Figure 6 provides images of RNAScopeg detection of hHTT-FL in the striatum of saline ICV-treated mice (left) or hTT-FL-2 U1A0 ICV-treated mice (right). Mice were analyzed after a 4 day duration. 4' ,6-diamidino-2-phenylindole (DAPI) was used to stain the nuclei.
Figure 7A provides a graph of the percent change of hHTT-FL mRNA in YAC128 forebrain after ICV-injection of saline or hHTT-FL-2 U1 AO over the indicated times. Average of control mice was set to 100%. Figure 7B provides an image of a Northern blot of total RNA from YAC128 forebrain at the indicated times after injection of saline or hHTT-FL-2 U1A0. The probe was a 33 nucleotide 32P-anti-hHTT-FL-2 oligonucleotide. Standards are uninjected U1A0. Control saline mice 1-7 and mice 11-12 and 16-17 are the same mice as shown in Figures 4 and 5.
Figure 8A provides a graph of the percent change of hHTT-TR mRNA in YAC128 forebrain after ICV-injection of saline, hHTT-TR-1 U1A0, or hHTT-TR-2 U1 AO. Mice tissues were analyzed after a 5 day duration. Average of control mice was set to 100%. N = 7 are from two different experiments (n = 3 and n = 4).
Figure 8B provides a graph of the percent change of hHTT-FL mRNA in YAC128 forebrain after injection of saline, hHTT-TR-1 U1A0, or hHTT-TR-2 U1A0. Average of control mice was set to 100%. N = 7 are from two different experiments (n = 3 and n = 4).
Figure 9A provides a graph of the percent change of mHTT-TR mRNA in 8-9 month old Q175 forebrain after injection of saline, mHTT-TR-A U1A0, or NC-A
control U1A0. Q175 are a well-established knock-in mouse with ¨175 CAG repeats in the mouse htt gene. Average of control mice was set to 100%. N = 7 are from two different experiments (n = 3 and n = 4). Figure 9B provides a graph of the percent change of mHTT-FL mRNA using the same samples as in Fig. 9A. Average of control mice was set to 100%. N = 7 are from two different experiments (n = 3 and n = 4).

4 Figure 10 provides images of RNAScopeg detection of mHTT-TR in the striatum of saline treated mice (left) or mHTT-TR-A U1 AO treated mice (right) with a 4 day duration.
Figure 11A provides a graph of the percent change of mHTT-TR mRNA in 8-9 month old Q175 mice forebrain twenty-one days after ICV-injection of saline or mHTT-TR-A U1A0. Average of control mice was set to 100%. Figure 11B provides a graph of the percent change of mHTT-FL mRNA in 8-9 month old Q175 mice forebrain twenty-one days after injection of saline or mHTT-TR-A U1 AO.
Average of control mice was set to 100%.
Figure 12A provides a graph of the percent change of mHTT-FL mRNA in 8-9 month old Q175 forebrain after injection of saline, mHTT-FL-A U1A0, or NC-A
control U1A0. Average of control mice was set to 100%. N = 7 are from two different experiments (n = 3 and n = 4). Figure 12B provides a graph of the percent change of mHTT-TR mRNA in Q175 forebrain after injection of saline, mHTT-FL-A
U1 AO, or NC-A control U1 AO. Average of control mice was set to 100%. N = 7 are from two different experiments (n = 3 and n = 4).
Figure 13 provides images of RNAScopeg detection of mHTT-FL in the striatum of saline treated mice (left) or mHTT-FL-A U1 AO treated mice (right).
Figures 14A-14L provides target sites in human htt for U1A0 and examples of U1A0 sequences in DNA format. The target sequences in rows 50, 272, 151, 3, 187, 4, 5, 10, and 2 are SEQ ID NOs: 26-34, respectively. The target sequences in rows 1, 6-9, 11-49, 51-150, 152-186, 188-271, and 273-325 are SEQ ID NOs: 40-355, respectively. The U1 AO sequences provided in DNA format are SEQ ID Nos: 356-680, from top to bottom.
Figures 15A-15C provide graphs of the level of silencing of mHTT-F1 and mHTT-Tr at 1 month (Fig. 15A), 2 months (Fig. 15B), and 4 months (Fig. 15C) after ICV injection of mHTT-FL-a U1A0 at four different concentration into Q175 mice.
Figure 15D provides graphs of the level of silencing of mHTT-F1 and mHTT-Tr at month, 2 months, and 4 months after ICV injection of control NC-a U1 AO at 80 tg into Q175 mice.
Figures 16A-16C provide graphs of the level of silencing of mHTT-F1 and mHTT-Tr at 1 month (Fig. 16A), 2 months (Fig. 16B), and 4 months (Fig. 16C) after ICV injection of mHTT-Tr-a U1 AO at four different concentration into Q175 mice.

5 Figure 17 provide graphs of the pharmacokinetics of mHTT-FL-a U1A0 (top), mHTT-Tr-a U1A0 (middle), and NC-a U1A0 (bottom). The amount of RNA
is shown at 1 month, 2 months, and 4 months. Each of the four different concentration of mHTT-FL-a U1 AO and mHTT-Tr-a U1 AO are shown while only the 80 i.tg concentration for NC-a U1A0 is shown.
DETAILED DESCRIPTION OF THE INVENTION
Ul Adaptors (or Ul adaptor oligonucleotides (U1A0)) are an oligonucleotide-mediated gene silencing technology which are mechanistically distinct from antisense or siRNA. Ul Adaptors act by selectively interfering with a key step in mRNA
maturation: the addition of a 3' polyadenosine (polyA) tail. Nearly all protein-coding mRNAs require a polyA tail and the failure to add one results in rapid degradation of the nascent mRNA inside the nucleus, thereby preventing expression of a protein product. Ul Adaptors have been described in U.S. Patent No. 9,441,221; U.S.
Patent No. 9,078,823; U.S. Patent No. 8,907,075; and U.S. Patent No. 8,343,941 (each of which is incorporated by reference herein).
Ul Adaptor oligonucleotides are well suited to in vivo applications because they can accept extensive chemical modifications to improve nuclease resistance and the attachment of bulky groups, such as tags for imaging or ligands for receptor-2 0 mediated uptake by target cells, without loss of silencing activity.
Huntington's disease has several characteristics that make it a particularly well suited for treatment using U1 AO. First, reducing expression of the mutant htt gene will be beneficial in slowing and/or halting neurodegeneration. Second, the disease can be diagnosed with certainty via genetic testing. Third, the disease usually has an adult onset.
Fourth, the disease is slowly progressive and well documented, with a predictable course.
Fifth, both the clinical exam and non-invasive methods are available to follow the progression of disease and determine if interventions are beneficial. Sixth, the caudate nucleus is a region prominently affected, can be monitored with imaging, and lies close to the cerebral ventricle for diffusion from interventions administered in the ventricular system. Lastly, the highly vulnerable medium spiny neurons in the caudate nucleus have been well studied and express markers that can be useful for cell directed targeting by modified carriers.
Provided herein are methods and compositions for the modulation of the expression of htt, particularly mutant htt (htt comprising expanded trinucleotide CAG

6 repeats, including full-length and/or truncated). The methods comprise the use of a Ul adaptor oligonucleotide/ molecule (see, generally, Figure 1). In its simplest form, the U1A0 is an oligonucleotide with two domains: (1) an annealing domain designed to base pair to the htt gene's pre-mRNA (e.g., in the terminal exon) and (2) an effector domain (also referred to as the Ul domain) that inhibits 3'-end formation of the target pre-mRNA via binding endogenous Ul snRNP. Without being bound by theory, the Ul adaptor tethers endogenous Ul snRNP to a gene-specific pre-mRNA and the resulting complex blocks proper 3' end formation. Notably, Ul snRNP is highly abundant (-1 million/mammalian cell nucleus) and in stoichiometric excess compared to other spliceosome components. Therefore, there are no deleterious effects of titrating out endogenous Ul snRNP.
The U1A0 is able to enter cells either alone or in complex with delivery reagents (e.g., lipid-based transfection reagents). The U1A0 should also be capable of entering the nucleus to bind to pre-mRNA. Indeed, this property has already been established for small nucleic acid molecules such as in those antisense approaches that utilize the RNase H pathway where the oligo enters the nucleus and binds to pre-mRNA. Additionally, it has been showed that antisense oligos can bind to nuclear pre-mRNA and sterically block access of splicing factors leading to altered splicing patterns (Ittig et al. (2004) Nuc. Acids Res., 32:346-53).
In a particular embodiment, the annealing domain of the Ul adaptor molecule is designed to have high affinity and specificity to the target site on the target pre-mRNA (e.g., to the exclusion of other pre-mRNAs). In a particular embodiment, a balance should be achieved between having the annealing domain too short, as this will jeopardize affinity, or too long, as this will promote "off-target"
effects or alter other cellular pathways. Furthermore, the annealing domain should not interfere with the function of the effector domain (for example, by base pairing and hairpin formation). The U1 AO annealing domain does not have an absolute requirement on length. However, the annealing domain will typically be from about 10 to about nucleotides in length, more typically from about 10 to about 30 nucleotides or about 10 to about 20 nucleotides. In a particular embodiment, the annealing domain is at least about 13 or 15 nucleotides in length. The annealing domain may be at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or, more particularly, 100% complementary to the gene of interest (htt). In one embodiment, the annealing domain hybridizes with a target site within the 3' terminal exon, which

7 includes the terminal coding region and the 3'UTR and polyadenylation signal sequences (e.g., through the polyadenylation site). In another embodiment, the target sequence is within about 500 basepair, about 250 basepair, about 100 basepair, or about 50 bp of the poly(A) signal sequence.
The CAG (encoding glutamine) disease expansion (typically greater than 36 repeats) in HTT is located within the 1st exon of the HTT gene (The Huntington's Disease Collaborative Research Group (1993) Cell 72:971-983). A short exon 1 HTT
polyadenylated mRNA resulting from aberrant splicing of the mutant allele is translated into a pathogenic exon 1 HTT protein that contributes to disease progression (Sathasivam et al. (2013) Proc. Natl. Acad. Sci., 110:2366-2370;
Gipson et al. (2013) RNA Biol., 10:1647-1652). Exemplary amino acid and nucleotide sequences of human HTT and htt can be found, for example, in Gene ID: 3064 and GenBank Accession Nos. NM 002111.8 and NP 002102.4.
Target sites within htt for the U1 AO have been identified herein using selection criteria for gene silencing. Figures 14A-14L list target sites within htt for the U1 AO with the best scoring target sites listed first. In a particular embodiment, the annealing domain hybridizes with a target site provided in Figures 14A-14L. In a particular embodiment, the annealing domain hybridizes with a target site provided in rows 1-278 of Figures 14A-14L. In a particular embodiment, the annealing domain hybridizes with a target site provided in rows 1-192 of Figures 14A-14L. In a particular embodiment, the annealing domain hybridizes with a target site provided in rows 1-58 of Figures 14A-14L. In a particular embodiment, the annealing domain hybridizes with a target site provided in rows 1-26 of Figures 14A-14L. In a particular embodiment, the annealing domain hybridizes with a target site provided in rows 1-10 of Figures 14A-14L. In a particular embodiment, the annealing domain hybridizes with a target site selected from:
CCCACATGTCATCAGCAGGA (SEQ ID NO: 26);
CAGCAGGATGGGCAAGCTGG (SEQ ID NO: 27);
GAGCAGGTGGACGTGAACCT (SEQ ID NO: 28);
GTGGACGTGAACCTTTTCTG (SEQ ID NO: 29);
TCTGCCTGGTCGCCACAGAC (SEQ ID NO: 30);
GTCTGTGCTTGAGGTGGTTG (SEQ ID NO: 31):
GCTGCTGACTTGTTTACGAA (SEQ ID NO: 32);
GGTGGGAGAGACTGTGAGGC (SEQ ID NO: 33);

8 TCCTTTCTCCTGATAGTCAC (SEQ ID NO: 34);
GCGGGGATGGCGGTAACCCT (SEQ ID NO: 35); or GTCTTCCCTTGTCCTCTCGC (SEQ ID NO: 36).
In a particular embodiment, the annealing domain hybridizes with GTGGACGTGAACCTTTTCTG (SEQ ID NO: 29). The annealing domain may be at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, or, more particularly, 100% complementary to any target sequence within Figures 14L or any one of SEQ ID NO: 26-36. The annealing domain may comprise additional or fewer nucleotides at the 5' and/or 3' end of any target sequence within Figures 14A-14L or any one of SEQ ID NO: 26-36. For example, the annealing domain may comprise at least 1, 2, 3, 4, 5, or up to 10 or 20 nucleotides added to the 5' and/or 3' end of any target sequence within Figures 14A-14L or any one of SEQ ID
NO: 26-36 (e.g., from the sequence of the htt gene) or may have a deletion of at least 1, 2, 3, 4, or 5 nucleotides from the 5' and/or 3' end of any target sequence within Figures 14A-14L or any one of SEQ ID NO: 26-36.
In a particular embodiment, the Ul domain of the U1A0 binds with high affinity to Ul snRNP. In a particular embodiment, the Ul domain is complementary to nucleotides 2-11 of endogenous Ul snRNA. In a particular embodiment, the Ul domain comprises 5'-CAGGUAAGUA-3' (SEQ ID NO: 1); 5'-CAGGUAAGUAU-2 0 3' (SEQ ID NO: 4); 5'-GCCAGGUAAGUAU-3' (SEQ ID NO: 5). In a particular embodiment, the Ul domain comprises the sequence 5'-CAGGUAAGUA-3' (SEQ
ID NO: 1). In a particular embodiment, the Ul domain comprises the sequence 5'-GCCAGGUAAGUAU-3' (SEQ ID NO: 5). In another embodiment, the Ul domain has at least 70%, at least 75%, at least 80%, at least 85%, and more particularly at least 90%, at least 95%, or at least 97% identity to SEQ ID NO: 1, SEQ ID NO:
4, or SEQ ID NO: 5. The Ul domain may comprise additional nucleotides 5' or 3' to SEQ
ID NO: 1, SEQ ID NO: 4, or SEQ ID NO: 5. For example, the Ul domain may comprise at least 1, 2, 3, 4, 5, or up to 10 or 20 nucleotides 5' or 3' to SEQ
ID NO: 1, SEQ ID NO: 4, or SEQ ID NO: 5. Indeed, increasing the length of the Ul domain to include basepairing into stem 1 and/or basepairing to position 1 of Ul snRNA
improves the Ul adaptor's affinity to Ul snRNP. The effector domain may be from about 8 nucleotides to about 30 nucleotides, from about 10 nucleotides to about 20 nucleotides, or from about 10 to about 15 nucleotides in length. For example, the

9 effector domain may be 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length.
The insertion of point mutations into the Ul domain, i.e., diverging from the consensus sequence SEQ ID NO: 1, SEQ ID NO: 4, or SEQ ID NO: 5, can moderate silencing. Indeed, altering the consensus sequence will produce Ul domains of different strength and affinity for the Ul snRNA, thereby leading to different levels of silencing. Therefore, once an annealing domain has been determined for a gene of interest, different Ul domains of different strength can be attached to the annealing domain to effect different levels of silencing of the gene of interest. For example, gAGGUAAGUA (SEQ ID NO: 3) would bind more weakly to Ul snRNP than SEQ
ID NO: 1 and, therefore, would produce a lower level of silencing. As discussed above, nucleotide analogues can be included in the Ul domain to increase the affinity to endogenous Ul snRNP. The addition of nucleotide analogs may not be considered a point mutation if the nucleotide analog binds the same nucleotide as the replaced nucleotide.
The U1 AO may be modified to be resistant to nucleases. In a particular embodiment, the U1 AO may comprise at least one non-natural nucleotide and/or nucleotide analog. The nucleotide analogs may be used to increase annealing affinity, specificity, bioavailability in the cell and organism, cellular and/or nuclear transport, 2 0 stability, and/or resistance to degradation. For example, it has been well-established that inclusion of Locked Nucleic Acid (LNA) bases within an oligonucleotide increases the affinity and specificity of annealing of the oligonucleotide to its target site (Kauppinen et al. (2005) Drug Discov. Today Tech., 2:287-290; Orum et al.

(2004) Letters Peptide Sci., 10:325-334). Unlike RNAi and RNase H-based silencing technologies, U1A0 inhibition does not involve enzymatic activity. As such, there is significantly greater flexibility in the permissible nucleotide analogs that can be employed in the U1A0 when compared with oligos for RNAi and RNase H-based silencing technologies.
Nucleotide analogs include, without limitation, nucleotides with phosphate modifications comprising one or more phosphorothioate, phosphorodithioate, phosphodiester, methyl phosphonate, phosphoramidate, methylphosphonate, phosphotriester, phosphoroaridate, morpholino, amidate carbamate, carboxymethyl, acetamidate, polyamide, sulfonate, sulfonamide, sulfamate, formacetal, thioformacetal, and/or alkylsilyl substitutions (see, e.g., Hunziker and Leumann (1995) Nucleic Acid Analogues: Synthesis and Properties, in Modern Synthetic Methods, VCH, 331-417; Mesmaeker et al. (1994) Novel Backbone Replacements for Oligonucleotides, in Carbohydrate Modifications in Antisense Research, ACS, 24-39); nucleotides with modified sugars (see, e.g., U.S. Patent Application Publication No. 2005/0118605) and sugar modifications such as 2'-0-methyl (2'-0-methylnucleotides), 2'-0-methyloxyethoxy, and 2'-halo (e.g., 2'-fluoro); and nucleotide mimetics such as, without limitation, peptide nucleic acids (PNA), morpholino nucleic acids, cyclohexenyl nucleic acids, anhydrohexitol nucleic acids, glycol nucleic acid, threose nucleic acid, and locked nucleic acids (LNA) (see, e.g., U.S. Patent Application Publication No. 2005/0118605). Other nucleotide modifications are also provided in U.S. Patent Nos. 5,886,165; 6,140,482;
5,693,773;
5,856,462; 5,973,136; 5,929,226; 6,194,598; 6,172,209; 6,175,004; 6,166,197;
6,166,188; 6,160,152; 6,160,109; 6,153,737; 6,147,200; 6,146,829; 6,127,533;
and 6,124,445. In a particular embodiment, the U1 AO comprises at least one locked nucleic acid. In a particular embodiment, the annealing domain comprises at least one locked nucleic acid (optionally where the effector domain does not contain a locked nucleic acid). In a particular embodiment, the U1 AO, particularly the annealing domain, has locked nucleic acids spaced apart by 2-4 nucleotides, particularly three nucleotides.
2 0 Notably, care should be taken so as to not design a Ul adaptor wherein the effector domain has significant affinity for the target site of the mRNA or the sites immediately flanking the target site. In other words, the target site should be selected so as to minimize the base pairing potential of the effector domain with the target pre-mRNA, especially the portion flanking upstream of the annealing site.
To increase the silencing ability of the U1A0, the U1A0 should also be designed to have low self annealing so as to prevent the formation of hairpins within a single Ul adaptor and/or the formation of homodimers or homopolymers between two or more Ul adaptors.
The annealing and effector domains of the U1A0 may be linked such that the effector domain is at the 5' end and/or 3' end of the annealing domain.
Further, the annealing and effector domains may be operably linked via a linker domain. The linker domain may comprise, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, up to 15, up to 20, or up to 25 nucleotides.

The U1A0 may comprise ribonucleotides and/or deoxynucleotides. With regard to the sequences provided herein, uracil bases and thymidine bases may be exchanged. In a particular embodiment, the U1A0 comprises 2'-0-methyl nucleotides, 2'-0-methyloxyethoxy nucleotides, 2'-halo (e.g., 2'-fluoro), and/or locked nucleic acids. In a particular embodiment, the U1A0 comprises phosphorothioates.
In a particular embodiment, the U1A0 comprises a U1A0 provided in Figures 14A-14L (particularly in RNA). In a particular embodiment, the U1A0 comprises a U1A0 sequence provided in rows 1-278 of Figures 14A-14L. In a particular embodiment, the U1A0 comprises a U1A0 sequence provided in rows 1-192 of Figures 14A-14L. In a particular embodiment, the U1A0 comprises a U1 AO
sequence provided in rows 1-58 of Figures 14A-14L. In a particular embodiment, the U1A0 comprises a U1A0 sequence provided in rows 1-26 of Figures 14A-14L. In a particular embodiment, the U1A0 comprises a U1A0 sequence provided in rows 1-

10 of Figures 14A-14L. In a particular embodiment, the U1A0 comprises:
UCCUGCUGAUGACAUGUGGGGCCAGGUAAGUAU (SEQ ID NO: 8);
CCAGCUUGCCCAUCCUGCUGGCCAGGUAAGUAU (SEQ ID NO: 37);
AGGUUCACGUCCACCUGCUCGCCAGGUAAGUAU (SEQ ID NO: 38);
CAGAAAAGGUUCACGUCCACGCCAGGUAAGUAU (SEQ ID NO: 9);
GUCUGUGGCGACCAGGCAGAGCCAGGUAAGUAU (SEQ ID NO: 39);
CAACCACCUCAAGCACAGACGCCAGGUAAGUAU (SEQ ID NO: 10):
UUCGUAAACAAGUCAGCAGCGCCAGGUAAGUAU (SEQ ID NO: 11);
GCCUCACAGUCUCUCCCACCGCCAGGUAAGUAU (SEQ ID NO: 12);
GUGACUAUCAGGAGAAAGGAGCCAGGUAAGUAU (SEQ ID NO: 13);
CAGAAAAGGTUCACGUCCACGCCAGGUAAGUAU (SEQ ID NO: 14);
AGGGUTACCGCCATCCCCGCGCCAGGUAAGUAU (SEQ ID NO: 15);
or GCGAGAGGACAAGGGAAGACGCCAGGUAAGUAU (SEQ ID NO: 16).
In a particular embodiment, the U1A0 comprises CAGAAAAGGUUCACGUCCACGCCAGGUAAGUAU (SEQ ID NO: 9). In another embodiment, the U1A0 has at least 70%, at least 75%, at least 80%, at least 85%, and more particularly at least 90%, at least 95%, at least 97% or more identity with one of the above sequences or in Figures 14A-14L. With regard to the sequences provided herein, uracil bases and thymidine bases may be exchanged. In a particular embodiment, the U1A0 comprises at least one or all nucleotide analogs. In a particular embodiment, the U1A0 comprises 2'-0-methyl nucleotides, 2'-0-methyloxyethoxy nucleotides, 2'-halo (e.g., 2'-fluoro), and/or locked nucleic acids.
In a particular embodiment, the U1A0 comprises phosphorothioates. In a particular embodiment, the U1A0 are modified as set forth in the Example.
In another embodiment of the instant invention, more than one U1A0 directed to a gene of interest (htt) may be used to modulate expression. Multiple U1A0 targeting (annealing) to different sequences in the same pre-mRNA can provide enhanced inhibition. Compositions of the instant invention may comprise more than one U1A0 directed to the htt gene (e.g., different targets within the htt gene).
In still another embodiment, the U1A0 can be combined with other methods of modulating the expression of a gene of interest. For example, a U1A0 can be used in coordination with other inhibitory nucleic acid molecules such as antisense oligonucleotides or RNase H-based methods, RNAi, miRNA, and morpholino-based methods to give enhanced inhibition. Inasmuch as U1A0 utilize a different mechanism than these other approaches, the combined use will result in an increased inhibition of gene expression compared to the use of a single inhibitory agent alone.
Indeed, U1A0 may target the biosynthetic step in the nucleus whereas RNAi and certain antisense approaches generally target cytoplasmic stability or translatability of a pre-existing pool of mRNA.
In another aspect of the instant invention, the effector domain of the Ul adaptor can be replaced with the binding site for any one of a number of nuclear factors that regulate gene expression. For example, the binding site for polypyrimidine tract binding protein (PTB) is short and PTB is known to inhibit poly(A) sites. Thus, replacing the effector domain with a high affinity PTB
binding site would also silence expression of the target gene.
There are Ul snRNA genes that vary in sequence from the canonical Ul snRNA described hereinabove. Collectively, these Ul snRNA genes can be called the Ul variant genes. Some Ul variant genes are described in GenBank Accession Nos.
L78810, ACO25268, ACO25264 and AL592207 and in Kyriakopoulou et al. (RNA
(2006) 12:1603-11), which identified close to 200 potential Ul snRNA-like genes in the human genome. Since some of these Ul variants have a 5' end sequence different than canonical Ul snRNA, one plausible function is to recognize alternative splice signals during pre-mRNA splicing. Accordingly, the Ul domain of the U1A0 of the instant invention may be designed to hybridize with the 5' end of the Ul variant snRNA in the same way as the Ul domain was designed to hybridize with the canonical Ul snRNA as described herein. The U1A0 which hybridize to the Ul variants may then be used to modulate the expression of a gene of interest.
There are many advantages of the Ul adaptor technology to other existing silencing technologies. Certain of these advantages are as follows. First, the separates into two independent domains: (1) the annealing (i.e., targeting) activity and (2) the inhibitory activity, thereby allowing one to optimize annealing without affecting the inhibitory activity or vice versa. Second, as compared to other technologies, usage of two U1A0 to target the same gene gives additive even synergistic inhibition. Third, the U1A0 has a novel inhibitory mechanism.
Therefore, it will be compatible when used in combination with other methods.
Fourth, the U1 AO inhibits the biosynthesis of mRNA by inhibiting the critical, nearly-universal, pre-mRNA maturation step of poly(A) tail addition (also called 3' end processing).
Compositions of the instant invention comprise at least one U1 AO of the instant invention and at least one pharmaceutically acceptable carrier. The compositions may further comprise at least one other agent which inhibits the expression of the gene of interest (htt). For example, the composition may further 2 0 comprise at least one siRNA or antisense oligonucleotide directed against the gene of interest (htt).
The U1A0 of the present invention may be administered alone, as naked polynucleotides, to cells or an organism, including animals and humans. The may be administered with an agent which enhances its uptake by cells. In a particular embodiment, the U1A0 may be contained within a liposome, nanoparticle, or polymeric composition.
In another embodiment, the U1A0 may be delivered to a cell or animal, including humans, in an expression vector such as a plasmid or viral vector.
For example, a U1A0 can be expressed from a vector such as a plasmid or a virus.
Expression of such short RNAs from a plasmid or virus has become routine and can be easily adapted to express a U1A0. Expression vectors for the expression of RNA
molecules may employ a strong promoter which may be constitutive or regulated.

Such promoters are well known in the art and include, but are not limited to, RNA
polymerase II promoters, the T7 RNA polymerase promoter, and the RNA

polymerase III promoters U6 and Hl. Viral-mediated delivery includes the use of vectors based on, without limitation, retroviruses, adenoviruses, adeno-associated viruses, vaccinia virus, lentiviruses, polioviruses, and herpesviruses.
The pharmaceutical compositions of the present invention can be administered by any suitable route, for example, by injection (e.g., intravenously, intracerebroventricularly, and intramuscularly), by oral, pulmonary, nasal, rectal, or other modes of administration. The compositions can be administered for the treatment of Huntington's disease which can be treated through the downregulation of htt. The compositions may be used in vitro, in vivo, and/or ex vivo. With regard to ex vivo use, the U1A0 of the instant invention (or compositions comprising the same) may be delivered to autologous cells (optionally comprising the step of obtaining the cells from the subject) and then re-introduced into the subject. The compositions, U1 AO, and/or vectors of the instant invention may also be comprised in a kit.
The instant invention also encompasses methods of treating, inhibiting (slowing or reducing), and/or preventing Huntington's disease in a subject. In a particular embodiment, the methods comprise the administration of a therapeutically effective amount of at least one composition of the instant invention to a subject (e.g., an animal or human) in need thereof In a particular embodiment, the composition comprises at least one U1 AO of the instant invention and at least one 2 0 pharmaceutically acceptable carrier. In a particular embodiment, the U1 AO is directed to htt, particularly htt (e.g., mutant htt) that is full-length and/or truncated.
The instant methods may further comprise the administration of at least one other agent which inhibits the expression of the target htt gene. For example, the method may further comprise the administration of at least one siRNA or anti sense oligonucleotide directed against the htt gene. The methods may also comprise the administration at least one other therapeutic agent (e.g., a symptom-alleviating therapeutic agent for Huntington's disease (e.g., tetrabenazine (Xenazineg) or deutetrabenazine (Austedog)). In a particular embodiment, the therapeutic agent is conjugated to the U1A0 (e.g., directly or via a linker; e.g., at the 3' end and/or 5'end).
The therapeutic agent may be administered in separate compositions (e.g., with at least one pharmaceutically acceptable carrier) or in the same composition. The therapeutic agent may be administered simultaneously and/or consecutively with the U1A0.

As stated hereinabove, the U1 AO of the present invention may be administered alone (as naked polynucleotides) or may be administered with an agent which enhances its uptake by cells. In a particular embodiment, the U1 AO may be contained within a delivery vehicle such as a micelle, liposome, nanoparticle, or polymeric composition. In a particular embodiment, the U1A0 is complexed with (e.g., contained within or encapsulated by) a dendrimer, particularly cationic dendrimers such as poly(amido amine) (PAMAM) dendrimers and polypropyleneimine (PPI) dendrimers (e.g., generation 2, 3, 4, or 5). In a particular embodiment, the U1A0 is complexed with PPI-G2.
1 0 In a particular embodiment, the U1 AO are targeted to a particular cell type (e.g., neurons). In a particular embodiment, the U1A0 is covalently linked (e.g., directly or via a linker) to at least one targeting moiety. The targeting moiety may be operably linked to the 5' end, the 3' end, or both ends or to internal nucleotides. In a particular embodiment, one or more targeting moieties are conjugated to one end of the U1 AO (e.g., through a single linker). In a particular embodiment, a complex comprising the U1A0 (e.g., a dendrimer, micelle, liposome, nanoparticle, or polymeric composition) is covalently linked (e.g., directly or via a linker) to at least one targeting moiety.
Generally, the linker is a chemical moiety comprising a covalent bond or a 2 0 chain of atoms that covalently attaches two compounds such as a targeting moiety to the U1A0 or complex. The linker can be linked to any synthetically feasible position of the targeting moiety and the U1 AO or complex (vehicle). In a particular embodiment, the linker connects the targeting moiety and the U1 AO or complex via an amine group and/or sulfhydryl/thiol group, particularly a sulfhydryl/thiol group.
For example, the U1A0 may be derivatized (e.g., at the 5' end) with one or more amino or thio groups. In a particular embodiment, the linker is attached at a position which avoids blocking the targeting moiety or the activity of the U1 AO.
Exemplary linkers may comprise at least one optionally substituted; saturated or unsaturated;
linear, branched or cyclic alkyl group or an optionally substituted aryl group. The linker may also be a polypeptide (e.g., from about 1 to about 20 amino acids or more, or 1 to about 5). The linker may be biodegradable (cleavable (e.g., comprises a disulfide bond)) under physiological environments or conditions. In a particular embodiment, the linker comprises polyethylene glycol (PEG) (alone or in combination with another linker). In a particular embodiment, the linker is a SPDP

(N-Succinimidyl 3-(2-pyridyldithio)-propionate) linker such as LC- SPDP
(succinimidyl 6-(3-[2-pyridyldithio]-propionamido)hexanoate) or a SMCC
(succinimidy1-4-(N-maleimidomethyl) cyclohexane-l-carboxylate) linker such as LC-SMCC(succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxy-(6-amidocaproate)). The linker may also be non-degradable (non-cleavable) and may be a covalent bond or any other chemical structure which cannot be substantially cleaved or cleaved at all under physiological environments or conditions.
Targeting moieties of the instant invention preferentially bind to the relevant tissue (e.g., nerves) or organ (e.g., brain). In a particular embodiment, the targeting 1 0 moiety specifically binds to a marker specifically (e.g., only) expressed on the target cells or a marker up-regulated on the target cells compared to other cells. In a particular embodiment, the targeting moiety is an antibody or antibody fragment immunologically specific for a surface protein on the target cells or a surface protein expressed at higher levels (or greater density) on the target cells than other cells, tissues, or organs. The antibody or antibody fragment may be a therapeutic antibody (e.g., possessing a therapeutic effect itself). In a particular embodiment, the targeting moiety is a ligand or binding fragment thereof for a cell surface receptor on the target cells. In a particular embodiment, the targeting moiety is an aptamer.
The U1 AO of the instant invention may further be conjugated to other desirable compounds. For example, the U1A0 may be further conjugated (directly or via a linker as described above) to detectable agents, therapeutics (e.g., monoclonal antibodies, peptides, proteins, inhibitory nucleic acid molecules, small molecules, chemotherapeutic agents, etc.), carrier protein, and agents which improve bioavailability, stability, and/or absorption (e.g., PEG). The additional compounds may be attached to any synthetically feasible position of the U1A0 (or conjugate (e.g., to the Ul Adaptor (e.g., either end) or the targeting moiety).
Alternatively, the targeting moiety and the U1 AO are each individually attached to additional compound (e.g., carrier protein) (as such the additional compound can be considered to serve as the linker between the U1 AO and the targeting moiety). In a particular embodiment, the U1A0 is conjugated to a targeting moiety (e.g., neuron targeting moiety) at one end and, optionally, a therapeutic agent on the other.
Preferentially, the attachment of the additional compounds does not significantly affect the activity of the U1 AO or the targeting moiety. Detectable agents may be any compound or protein which may be assayed for directly or indirectly, particularly directly.

Detectable agents include, for example, chemiluminescent, bioluminescent, and/or fluorescent compounds or proteins, imaging agent, contrast agent, radionuclides, paramagnetic or superparamagnetic ions, isotopes (e.g., radioisotopes (e.g., (tritium) and "C) or stable isotopes (e.g., 2H (deuterium), nc, 13C, 170 and 180), optical agents, and fluorescence agents.
Carrier proteins include, without limitation, serum albumin (e.g., bovine, human), ovalbumin, and keyhole limpet hemocyanin (KLH). In a particular embodiment, the carrier protein is human serum albumin. Carrier proteins (as well as other proteins or peptides) may be conjugated to the U1A0 (or conjugate) at any synthetically feasible position. For example, linkers (e.g., LC-SPDP) may be attached to free amino groups found on lysines of the carrier protein and then the U1A0 and targeting moieties may be conjugated to the linkers. Any unreacted linkers may be inactivated by blocking with cysteine.
The U1A0 of the instant invention may be conjugated (e.g., directly or via a linker) to a compound (e.g., antibodies, peptides, proteins, nucleic acid molecules, small molecules, etc.) which targets the U1A0 to a desired cell type and/or promotes cellular uptake of the U1A0 (e.g., a cell penetrating moiety). The targeting moiety may be operably linked to the 5' end, the 3' end, or both ends or to internal nucleotides. In a particular embodiment, the targeting moiety and/or cell penetrating moiety are conjugated to the 5' end and/or 3' end. In a particular embodiment, the targeting moiety and/or cell penetrating moiety is conjugated to the 5' end.
In a particular embodiment, the U1A0 is conjugated to both a targeting moiety and a cell penetrating moiety. As used herein, the term "cell penetrating agent" or "cell penetrating moiety" refers to compounds or functional groups which mediate transfer of a compound from an extracellular space to within a cell. In a particular embodiment, the U1A0 is conjugated to an aptamer. The aptamer may be targeted to a surface compound or protein (e.g., receptor) of a desired cell type (e.g., the surface compound or protein may be preferentially or exclusively expressed on the surface of the cell type to be targeted). In a particular embodiment, the aptamer is a cell penetrating aptamer (e.g., Cl or Otter (see, e.g., Burke, D.H. (2012) Mol.
Ther., 20:
251-253)). In a particular embodiment, the U1 AO is conjugated to a cell penetrating peptide (e.g., Tat peptides (e.g., YGRKKKRRQRRRPPQ; SEQ ID NO: 6 (optionally acetylated on N-terminus)), Penetratin (e.g., RQIKIWFQNRRMKWKKGG; SEQ ID
NO: 7), short amphipathic peptides (e.g., from the Pep- and MPG-families), oligoarginine (e.g., 4-12 consecutive arginine), oligolysine (e.g., 4-12 consecutive lysine)). In a particular embodiment, the U1A0 is conjugated to a small molecule such as biotin (as part of targeting antibodies) or a non-polar fluorescent group (e.g., a cyanine such as Cy3 or Cy5) or to other cell penetrating agents.
In a particular embodiment, at least one of the 3' end and 5' end of the U1A0 comprises a free-SH group.
The U1A0 (including the vehicles comprising the same) described herein will generally be administered to a patient as a pharmaceutical preparation. The terms "patient" and "subject", as used herein, include humans and animals. These Ul adaptors may be employed therapeutically, under the guidance of a physician.
The compositions comprising the U1A0 of the instant invention may be conveniently formulated for administration with any pharmaceutically acceptable carrier(s). For example, the U1 AO may be formulated with an acceptable medium such as water, buffered saline, ethanol, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol and the like), dimethyl sulfoxide (DMSO), oils, detergents, suspending agents or suitable mixtures thereof The concentration of the U1A0 in the chosen medium may be varied and the medium may be chosen based on the desired route of administration of the pharmaceutical preparation. Except insofar as any conventional media or agent is incompatible with the U1 AO to be 2 0 administered, its use in the pharmaceutical preparation is contemplated.
The dose and dosage regimen of U1 AO according to the invention that are suitable for administration to a particular patient may be determined by a physician considering the patient's age, sex, weight, general medical condition, and the specific condition for which the U1 AO is being administered and the severity thereof The physician may also take into account the route of administration, the pharmaceutical carrier, and the UlAO's biological activity.
Selection of a suitable pharmaceutical preparation will also depend upon the mode of administration chosen. For example, the U1A0 of the invention may be administered by direct injection to a desired site (e.g., brain). In this instance, a pharmaceutical preparation comprises the U1A0 dispersed in a medium that is compatible with the site of injection. U1 AO of the instant invention may be administered by any method. For example, the U1A0 of the instant invention can be administered, without limitation parenterally, subcutaneously, orally, topically, pulmonarily, rectally, vaginally, intravenously, intracerebroventricularly, intracrani ally, intraperitoneally, intrathecally, intracerebrally, epidurally, intramuscularly, intradermally, or intracarotidly. In a particular embodiment, the method of administration is by direct injection (e.g., into the brain) or intracerebroventricularly. Pharmaceutical preparations for injection are known in the art. If injection is selected as a method for administering the U1 AO, steps should be taken to ensure that sufficient amounts of the molecules or cells reach their target cells to exert a biological effect.
Pharmaceutical compositions containing a U1 AO of the present invention as the active ingredient in intimate admixture with a pharmaceutically acceptable carrier can be prepared according to conventional pharmaceutical compounding techniques.
The carrier may take a wide variety of forms depending on the form of preparation desired for administration, e.g., intravenous, oral, direct injection, intracranial, intracerebroventricular, and intravitreal.
A pharmaceutical preparation of the invention may be formulated in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form, as used herein, refers to a physically discrete unit of the pharmaceutical preparation appropriate for the patient undergoing treatment. Each dosage should contain a quantity of active ingredient calculated to produce the desired effect in association with the selected pharmaceutical carrier. Procedures for determining the appropriate 2 0 dosage unit are well known to those skilled in the art.
Dosage units may be proportionately increased or decreased based on the weight of the patient. Appropriate concentrations for alleviation of a particular pathological condition may be determined by dosage concentration curve calculations, as known in the art.
In accordance with the present invention, the appropriate dosage unit for the administration of U1 AO may be determined by evaluating the toxicity of the molecules or cells in animal models. Various concentrations of U1 AO in pharmaceutical preparations may be administered to mice, and the minimal and maximal dosages may be determined based on the beneficial results and side effects observed as a result of the treatment. Appropriate dosage unit may also be determined by assessing the efficacy of the U1 AO treatment in combination with other standard drugs. The dosage units of U1A0 may be determined individually or in combination with each treatment according to the effect detected.

The pharmaceutical preparation comprising the U1A0 may be administered at appropriate intervals, for example, at least twice a day or more until the pathological symptoms are reduced or alleviated, after which the dosage may be reduced to a maintenance level. The appropriate interval in a particular case would normally depend on the condition of the patient.
Definitions The singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.
1 0 "Nucleic acid" or a "nucleic acid molecule" as used herein refers to any DNA
or RNA molecule, either single or double stranded and, if single stranded, the molecule of its complementary sequence in either linear or circular form. In discussing nucleic acid molecules, a sequence or structure of a particular nucleic acid molecule may be described herein according to the normal convention of providing the sequence in the 5' to 3' direction. With reference to nucleic acids of the invention, the term "isolated nucleic acid" is sometimes used. This term, when applied to DNA, refers to a DNA molecule that is separated from sequences with which it is immediately contiguous in the naturally occurring genome of the organism in which it originated. For example, an "isolated nucleic acid" may comprise a DNA
molecule 2 0 inserted into a vector, such as a plasmid or virus vector, or integrated into the genomic DNA of a prokaryotic or eukaryotic cell or host organism.
When applied to RNA, the term "isolated nucleic acid" may refer to an RNA
molecule encoded by an isolated DNA molecule as defined above. Alternatively, the term may refer to an RNA molecule that has been sufficiently separated from other nucleic acids with which it would be associated in its natural state (i.e., in cells or tissues). An isolated nucleic acid (either DNA or RNA) may further represent a molecule produced directly by biological or synthetic means and separated from other components present during its production.
A "vector" is a genetic element, such as a plasmid, cosmid, bacmid, phage or virus, to which another genetic sequence or element (either DNA or RNA) may be attached. The vector may be a replicon so as to bring about the replication of the attached sequence or element.
An "expression operon" refers to a nucleic acid segment that may possess transcriptional and translational control sequences, such as promoters, enhancers, translational start signals (e.g., ATG or AUG codons), polyadenylation signals, terminators, and the like, and which facilitate the expression of a nucleic acid or a polypeptide coding sequence in a host cell or organism. An "expression vector"
is a vector which facilitates the expression of a nucleic acid or a polypeptide coding sequence in a host cell or organism.
The term "oligonucleotide," as used herein, refers to nucleic acid sequences, primers, and probes of the present invention, and is defined as a nucleic acid molecule comprised of two or more ribo or deoxyribonucleotides, preferably more than three.
The exact size of the oligonucleotide will depend on various factors and on the particular application and use of the oligonucleotide.
The phrase "small, interfering RNA (siRNA)" refers to a short (typically less than 30 nucleotides long, more typically between about 21 to about 25 nucleotides in length) double stranded RNA molecule. Typically, the siRNA modulates the expression of a gene to which the siRNA is targeted. The term "short hairpin RNA"
or "shRNA" refers to an siRNA precursor that is a single RNA molecule folded into a hairpin structure comprising an siRNA and a single stranded loop portion of at least one, typically 1-10, nucleotide.
The term "RNA interference" or "RNAi" refers generally to a sequence-specific or selective process by which a target molecule (e.g., a target gene, protein or RNA) is downregulated via a double-stranded RNA. The double-stranded RNA
structures that typically drive RNAi activity are siRNAs, shRNAs, microRNAs, and other double-stranded structures that can be processed to yield a small RNA
species that inhibits expression of a target transcript by RNA interference.
The term "antisense" refers to an oligonucleotide having a sequence that hybridizes to a target sequence in an RNA by Watson-Crick base pairing, to form an RNA:oligonucleotide heteroduplex with the target sequence, typically with an mRNA. The antisense oligonucleotide may have exact sequence complementarity to the target sequence or near complementarity. These antisense oligonucleotides may block or inhibit translation of the mRNA, and/or modify the processing of an mRNA
to produce a splice variant of the mRNA. Antisense oligonucleotides are typically between about 5 to about 100 nucleotides in length, more typically, between about 7 and about 50 nucleotides in length, and even more typically between about 10 nucleotides and about 30 nucleotides in length.

The term "substantially pure" refers to a preparation comprising at least 50-60% by weight of a given material (e.g., nucleic acid, oligonucleotide, protein, etc.).
More preferably, the preparation comprises at least 75% by weight, and most preferably 90- 95% by weight of the given compound. Purity is measured by methods appropriate for the given compound (e.g. chromatographic methods, agarose or polyacrylamide gel electrophoresis, HPLC analysis, and the like).
The term "isolated" may refer to a compound or complex that has been sufficiently separated from other compounds with which it would naturally be associated. "Isolated" is not meant to exclude artificial or synthetic mixtures with other compounds or materials, or the presence of impurities that do not interfere with fundamental activity or ensuing assays, and that may be present, for example, due to incomplete purification, or the addition of stabilizers.
The term "gene" refers to a nucleic acid comprising an open reading frame encoding a polypeptide, including both exon and (optionally) intron sequences.
The nucleic acid may also optionally include non coding sequences such as promoter or enhancer sequences. The term "intron" refers to a DNA sequence present in a given gene that is not translated into protein and is generally found between exons.
As used herein, the term "aptamer" refers to a nucleic acid that specifically binds to a target, such as a protein, through interactions other than Watson-Crick base 2 0 pairing. In a particular embodiment, the aptamer specifically binds to one or more targets (e.g., a protein or protein complex) to the general exclusion of other molecules in a sample. The aptamer may be a nucleic acid such as an RNA, a DNA, a modified nucleic acid, or a mixture thereof The aptamer may also be a nucleic acid in a linear or circular form and may be single stranded or double stranded. The aptamer may comprise oligonucleotides that are at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40 or more nucleotides in length.
Aptamers may comprise sequences that are up to 40, up to 60, up to 80, up to 100, up to 150, up to 200 or more nucleotides in length. Aptamers may be from about 5 to about 150 nucleotides, from about 10 to about 100 nucleotides, or from about 20 to about nucleotides in length. While aptamers are discussed herein as nucleic acid molecules (e.g., oligonucleotides) aptamers, aptamer equivalents may also be used in place of the nucleic acid aptamers, such as peptide aptamers.
The phrase "operably linked", as used herein, may refer to a nucleic acid sequence placed into a functional relationship with another nucleic acid sequence.

Examples of nucleic acid sequences that may be operably linked include, without limitation, promoters, transcription terminators, enhancers or activators and heterologous genes which when transcribed and, if appropriate to, translated will produce a functional product such as a protein, ribozyme or RNA molecule.
"Pharmaceutically acceptable" indicates approval by a regulatory agency of the Federal government or a state government. "Pharmaceutically acceptable"
agents may be listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans.
A "carrier" refers to, for example, a diluent, preservative, solubilizer, 1 0 emulsifier, adjuvant, excipient, auxilliary agent or vehicle with which an active agent of the present invention is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like.
Water or aqueous saline solutions and aqueous dextrose and glycerol solutions may be employed as carriers. Suitable pharmaceutical carriers are described, for example, in "Remington's Pharmaceutical Sciences" by E.W. Martin.
An "antibody" or "antibody molecule" is any immunoglobulin, including antibodies and fragments thereof (e.g., immunologically specific fragments), that binds to a specific antigen. As used herein, antibody or antibody molecule contemplates intact immunoglobulin molecules, immunologically active portions of an immunoglobulin molecule, and fusions of immunologically active portions of an immunoglobulin molecule. The term includes polyclonal, monoclonal, chimeric, single domain (Dab) and bispecific antibodies. As used herein, antibody or antibody molecule contemplates recombinantly generated intact immunoglobulin molecules and immunologically active portions of an immunoglobulin molecule such as, without limitation: Fab, Fab', F(al302, F(v), scFv, scFv2, and scFv-Fc.
With respect to antibodies, the term "immunologically specific" refers to antibodies that bind to one or more epitopes of a protein or compound of interest, but which do not substantially recognize and bind other molecules in a sample containing a mixed population of antigenic biological molecules.
The term "treat" refers to the ability of the compound to relieve, alleviate, and/or slow the progression of the patient's disease. In other words, the term "treat"
refers to inhibiting and/or reversing the progression of a disease.

The following example describes illustrative methods of practicing the instant invention and is not intended to limit the scope of the invention in any way.
EXAMPLE
HD9197 cells (Coriel Institute GM09197; 21/181 CAG repeats, fibroblast 6 year old male) were transfected with a panel of Ul adaptor oligonucleotides (U1A0s) and siRNAs (see below) directed against full length human huntingtin (HTT) using LipofectamineTM RNAiMAX transfection reagent (Invitrogen, Carlsbad, CA). The percent change of human HTT mRNA normalized to hypoxanthine phosphoribosyltransferase 1 (HPRT1) was determined. As seen in Figure 2, human HTT-full length mRNA-2 (hHTT-FL-2) U1A0 had the highest silencing activity which was significantly greater than the silencing observed with any siRNA.
Notably, further experiments also showed that hHTT-FL-1 U1A0 can silence to <
30%. Similar results were obtained with DU145 (human prostate cancer cell line) and Mia PaCa2 cells (human pancreatic cancer cell line). With regard to the truncated version of HTT (also referred to as the alternatively spliced or intron 1 truncated form), hHTT-TR-1 U1A0 was determined to have the greatest silencing activity.
The U1A0s and siRNA used for the experiments described herein are:
U1A0s:
hHTT-fl-li: UCCUGCUGAUGACAUGUGGGGCCAGGUAAGUAU (SEQ ID NO:
8), wherein each nucleotide is 2'-0-methyl;
hHTT-fl-21: CAGAAAAGGUUCACGUCCACGCCAGGUAAGUAU (SEQ ID NO:
9), wherein each nucleotide is 2'-0-methyl;
hHTT-fl-31: CAACCACCUCAAGCACAGACGCCAGGUAAGUAU (SEQ IDNO:
10), wherein each nucleotide is 2'-0-methyl;
hHTT-fl-41: UUCGUAAACAAGUCAGCAGCGCCAGGUAAGUAU (SEQ ID NO:

11), wherein each nucleotide is 2'-0-methyl;
hHTT-fl-51: GCCUCACAGUCUCUCCCACCGCCAGGUAAGUAU (SEQ ID NO:

12), wherein each nucleotide is 2'-0-methyl;
hHTT-fl-61: GUGACUAUCAGGAGAAAGGAGCCAGGUAAGUAU (SEQ ID NO:

13), wherein each nucleotide is 2'-0-methyl;
hHTT-FL-2: mC+AmGmAmA+AmAmGmG+TmUmCmA+CmGmUmC+CmAmC
mGmCmCmAmGmGmUmAmAmGmUmAmU (SEQ ID NO: 14), wherein m = 2'-0-methyl and + = Locked Nucleic Acid;

hHTT-TR-1: mA+GmGmGmU+TmAmCmC+GmCmCmA+TmCmCmC+CmGmC
mGmCmCmAmGmGmUmAmAmGmUmAmU (SEQ ID NO: 15), wherein m = 2'-0-methyl and + = Locked Nucleic Acid;
hHTT-TR-2: mGmC+GmAmGmA+GmGmAmC+AmAmGmG+GmAmAmG+AmC
mGmCmCmAmGmGmUmAmAmGmUmAmU (SEQ ID NO: 16), wherein m = 2'-0-methyl and + = Locked Nucleic Acid;
NC-a (ctrl): mAAmCmGmGmUmUmAmGmGmCmAmCmCmTmCmUmUmGmA
mGmCmCmAmGmGmUmAmAmGmUmAmU (SEQ ID NO: 17), wherein m = 2'-0-methyl;
mHTT-FL-A: mUmGmC+AmGmCmC+AmCmCmA+CmCmUmC+AmAmAmC+A
mGmCmC+AmGmG+TmA+AmGmU+AmU (SEQ ID NO: 18), wherein m = 2'-0-methyl and + = Locked Nucleic Acid; and mHTT-TR-A: mA+GmUmUmC+TmCmUmU+CmAmCmA+AmCmAmG+TmCmA
mGmCmC+AmGmG+TmA+AmGmU+AmU (SEQ ID NO: 19), wherein m = 2'-0-methyl and + = Locked Nucleic Acid;
siRNA:
hHTT-siRNA-1 (both strands presented; r = RNA):
5'-rGrGrA rUrArG rUrArG rArCrA rGrCrA rArUrA rArCrU rCrGG T-3' (SEQ ID NO: 20) 5'-rArCrC rGrArG rUrUrA rUrUrG rCrUrG rUrCrU rArCrU rArUrC rCrGrU-3' (SEQ ID NO: 21);
hHTT-siRNA-2 (both strands presented; r = RNA):
5'-rArGrA rArCrU rUrUrC rArGrC rUrArC rCrArA rGrArA rArGA C-3' (SEQ ID NO: 22) 5'-rGrUrC rUrUrU rCrUrU rGrGrU rArGrC rUrGrA rArArG rUrUrC rUrUrU-3' (SEQ ID NO: 23); and hHTT-siRNA-3 (both strands presented; r = RNA):
5'-rArCrA rGrCrU rCrCrA rGrCrC rArGrG rUrCrA rGrCrG rCrCG T-3' (SEQ ID NO: 24) 5'-rArCrGr GrCrG rCrTrG rArCrC rTrGrG rCrTrG rGrArG rCrTrG rTrTrG-3' (SEQ ID NO: 25).

Figure 3 provides a Western blot of Human DU145 cells transfected 48 hours (LipofectamineTM 2000) with various anti-hHTT-FL Ul AOs and siRNAs (see below).
Cells were lysed directly into laemmli buffer and then analyzed by Western blot after electrophoresis on a 6-20% gradient gel. The best anti-hHTT-FL Ul AOs (hHTT-FL-1 and hHTT-FL-2) were used here and show silencing activity at the protein level.
The anti-HTT-FL siRNA also showed silencing activity. Notably, using less U1A0 gave less silencing (compare lane 9 with lane 7).
YAC128 are mice containing the entire human HTT gene (300,000 bp) having 128 CAG repeats. To determine the effectiveness of the U1A0, either 1 or 20 of hHTT-FL-2 U1 AO or saline was unilaterally intracerebroventricular (ICV) injected into YAC128 mice. After 48 hours, mice were sacrificed with perfusion. Total RNA
from left forebrains was extracted by a Trizol-based method and was analyzed by RT-qPCR and normalized to eukaryotic translation initiation factor 4A3 (Eif4a3).
As seen in Figure 4A, a 20 tg unilaterally-ICV-injected dose of the hHTT-FL-2 silences with a 62% reduction of the hHTT-F1 mRNA in YAC128 brain as compared to saline treated mice. The specificity of silencing is confirmed by the fact that neither the hHTT-Tr mRNA isoform (Fig. 4B) nor the Eif4a3 housekeeping gene underwent an observable change in expression.
Total RNA (4 tg /lane) from forebrains of YAC128 mice were analyzed by 32P Northern blot (8% PAGE) (Figure 5). Specifically, the blot was probed with a 33nt 32P-anti-hHTT-FL-2 oligonucleotide complementary to hHTT-FL-2 U1A0 in order to measure U1 AO levels. The lanes marked "Standards" are the uninjected U1A0 and their inclusion allows for a rigorous quantitation. As seen in Figure 5, the U1A0 in the brain tissue is neither degraded nor shortened. Shortening of the injected U1 AO, even by just a few nucleotides, would result in a noticeable change in migration relative to the standards.
An RNAScopeg analysis, a type of in situ hybridization (ISH) technology, was used to detect hHTT-FL transcripts at single cell resolution. Briefly, the RNAScopeg method involves fixing the hemibrain in 4% paraformaldehyde for 48 hours, transferring to PBS, and processing through tissue processor for paraffin embedding. The formalin-fixed paraffin-embedded (FFPE) brains were cut at 5 microns thick through the sagittal plane and striatal sections followed by in situ hybridization using an RNAScopeg probe specific to hHTT-FL mRNA. As seen in Figure 6, the hHTT-FL-2 U1 AO-treated mice (right) have fewer dots and a reduced intensity as compared to saline treated mice (left), thereby demonstrating silencing of hHTT-FL.
To further demonstrate the stability of hHTT-FL-2 U1 AO, 20 tg of hHTT-FL-2 U1 AO or saline was unilaterally intracerebroventricular (ICV) injected into YAC128 mice. After 2, 4, or 7 days, mice were sacrificed with perfusion. Total RNA from left forebrains was extracted by a Trizol-based method and was analyzed by RT-qPCR and normalized to eukaryotic translation initiation factor 4A3 (Eif4a3).
As seen in Figure 7A, a 2011g unilaterally-ICV-injected dose of the hHTT-FL-2 U1 AO reduces hHTT-F1 mRNA in YAC128 brain constantly over time. Figure 7B
provides a Northern blot analysis probed with a 33nt32P-anti-hHTT-FL-2 oligonucleotide complementary to hHTT-FL-2 U1 AO in order to measure U1 AO
levels. As seen in Figure 7B, the U1 AO in the brain tissue is neither degraded nor shortened over time.
The ability to silence hHTT-Tr has also been demonstrated. 20 tg of hHTT-1 5 TR-1 U1A0, hHTT-TR-2 U1A0, or saline was unilaterally ICV injected into YAC128 mice. After 48 hours, mice were sacrificed with perfusion. Total RNA
from forebrains was extracted by a Trizol-based method and was analyzed by RT-qPCR and normalized to eukaryotic translation initiation factor 4A3 (Eif4a3).
As seen in Figure 8A, hHTT-TR-1 U1A0 did not effectively silence hHTT-TR whereas the hHTT-TR-2 U1A0 significantly silences hHTT-TR by about 79%. The effect was specific as no silencing was observed for the hHTT-FL mRNA in either the saline-treated or hHTT-TR-treated mice (Fig. 8B).
Anti-mouse HTT Ul AOs were also synthesized and shown to silence mHTT
in cultured cells. The best anti-mouse HTT Ul AOs were mHTT-TR-a (targeting mHTT-TR mRNA transcript) and mHTT-FL-a (targeting mHTT-FL mRNA
transcript). These Ul AOs were then tested in the Q175 mouse model. Q175 mice are a knock-in mice where, for heterozygotes, one of the HTT alleles has 175 CAG
repeat. To determine the effectiveness of the U1A0, saline, 20 of mHTT-TR-A
U1 AO, or 40 tg of non-specific control adaptor (NC-A) U1 AO was unilaterally ICV
injected into Q175 mice. The NC-A U1A0 is a non-specific control U1A0 designed to not silence any mouse gene. After 48 hours, mice were sacrificed with perfusion.
Total RNA from left forebrains was extracted by a Trizol-based method and was analyzed by RT-qPCR and normalized to eukaryotic translation initiation factor (Eif4a3). As seen in Figure 9A, a 20 tg unilaterally-ICV-injected dose of the mHTT-TR-A U1A0 silences with a 75% reduction of the mHTT-TR mRNA in Q175 brain as compared to control treated mice. The specificity of silencing is confirmed by the fact that neither the mHTT-FL mRNA isoform (Fig. 9B) nor the Eif4a3 housekeeping gene underwent a significant change in expression.
An RNAScopeg analysis was also performed to detect mHTT-TR transcripts at single cell resolution. Briefly, the RNAScopeg method involves fixing the hemibrain in 4% paraformaldehyde for 48 hours, transferring to PBS, and processing through tissue processor for paraffin embedding. The formalin-fixed paraffin-embedded (FFPE) brains were cut at 5 microns thick through the sagittal plane and striatal sections followed by in situ hybridization using an RNAScopeg probe specific to mHTT-TR mRNA. As seen in Figure 10, the mHTT-TR-A U1 AO-treated mice (right) have fewer dots and a reduced intensity as compared to saline treated mice (left), thereby demonstrating silencing of mHTT-TR.
To further demonstrate the stability of mHTT-TR-A U1 AO, 20 tg of mHTT-1 5 TR-A U1 AO or saline was unilaterally intracerebroventricular (ICV) injected into Q175 mice. After 21 days, mice were sacrificed with perfusion. Total RNA from left forebrains was extracted by a Trizol-based method and was analyzed by RT-qPCR
and normalized to eukaryotic translation initiation factor 4A3 (Eif4a3). As seen in Figure 11A, a 20 tg unilaterally-ICV-injected dose of the mHTT-TR-A U1 AO
reduces mHTT-TR mRNA in Q175 mouse brain even after 21 days. The specificity of silencing is confirmed by the fact that neither the mHTT-FL mRNA isoform (Fig.
11B) nor the Eif4a3 housekeeping gene underwent a significant change in expression.
To determine the effectiveness of the mHTT-FL U1A0, saline, 40 tg of mHTT-FL-A U1 AO, or 40 tg of non-specific control adaptor (NC-A) U1 AO was unilaterally ICV injected into Q175 mice. The NC-A U1A0 is a non-specific control U1A0 designed to not silence any mouse gene. After 48 hours, mice were sacrificed with perfusion. Total RNA from left forebrains was extracted by a Trizol-based method and was analyzed by RT-qPCR and normalized to eukaryotic translation initiation factor 4A3 (Eif4a3). As seen in Figure 12A, a 40 unilaterally-ICV-injected dose of the mHTT-FL-A U1A0 silences with a 69% reduction of the mHTT-FL mRNA in Q175 brain as compared to control treated mice. The specificity of silencing is confirmed by the fact that neither the mHTT-TR mRNA isoform (Fig.

12B) nor the Eif4a3 housekeeping gene underwent a significant change in expression.

An RNAScopeg analysis was also performed to detect mHTT-FL transcripts at single cell resolution. Briefly, the RNAScopeg method involves fixing the hemibrain in 4% paraformaldehyde for 48 hours, transferring to PBS, and processing through tissue processor for paraffin embedding. The formalin-fixed paraffin-embedded (FFPE) brains were cut at 5 microns thick through the sagittal plane and striatal sections followed by in situ hybridization using an RNAScopeg probe specific to mHTT-FL mRNA. As seen in Figure 13, the mHTT-FL-A U1A0-treated mice (right) have fewer dots and a reduced intensity as compared to saline treated mice (left), thereby demonstrating silencing of mHTT-FL.
Biodistribution studies for hHTT-FL-2 U1A0 were also performed. Briefly, to assess biodistribution in brain regions at the single cell level, a series of experiments was performed with a Cy3-fluorescently labelled hHTT-FL-2 U1A0 (Cy3-hHTT-FL-2 U1A0). 5 ig of Cy3-hHTT-FL-2 U1A0 was unilaterally ICV-inj ected into 6-8 month old YAC128 mice. At 1, 7, and 28 days post-injection, mice were sacrificed with perfusion (with saline) to remove blood and extracellular U1A0.
Brain samples were subsequently studied by confocal microscopy. Notably, higher doses of Cy3-hHTT-FL-2 U1 AO were not used because the Cy3 fluorescent group itself proved toxic. Indeed, the injection of 1.5 and 4 of free Cy3, which is the stoichiometric equivalent of 30 tg and 80 tg Cy3-hHTT-FL-2 U1A0, respectively, was determined to be highly toxic to YAC128 mice. The use of 5 tg of Cy3-hHTT-FL-2 U1A0 resulted in no overt toxic effects in YAC128 mice.
The biodistribution assays showed that after Cy3-hHTT-FL-2 U1 AO was ICV-injected into the left ventricle, Cy3-hHTT-FL-2 U1A0 rapidly (within 1 day) and significantly distributed across both left and right hemibrains, resulting in symmetric distribution of Cy3-hHTT-FL-2 U1 AO in both the left and right side of the brain by days 7 and 28. These results show that Cy3-hHTT-FL-2 U1A0 quickly migrates from the left-ventricle injection site into other brain regions (e.g., striatum, cortex, hippocampus, cerebellum), including right hemibrain regions that are farthest from the injection site. Cy3-hHTT-FL-2 U1 AO also had widespread uptake by most neurons (e.g., cortical neurons) and cell types. Additionally, Cy3-hHTT-FL-2 was clearly visible in the nucleus and perinucleus. Lastly, fluorescent intensity was only slightly diminished at the 28 day time point as compared to the 1 and 7 day time points, thereby demonstrating the stability of Cy3-hHTT-FL-2 U1 AO over time.

Further experiments were performed to demonstrate 50% to 80% sustained reduction of the mHTT-F1 transcript from one to four months. In parallel experiments, conditions were identified that achieved 50% to 80% sustained reduction of the mHTT-Tr transcript from one to four months.
First, Q175 mice underwent a single unilateral ICV dose with the mHTT-FL-a U1A0 at four different concentrations - 10, 20, 40, and 80 i.tg (mice n = 9 per dose) -giving 36 mice in total. A cohort of three mice from each concentration was euthanized after 1, 2, and 4 months where mice underwent perfusion with lx PBS
and then sacrificed. Hemibrains were collected and processed for analysis by RT-qPCR
and Northern blot. All Ul Adaptor treated mice were compared to untreated Q175 mice. Silencing of the mHTT-F1 transcript was assessed by RT-qPCR which were then compared to untreated mice set to 100%. RT-qPCR to detect mHTT-Tr transcript included Dnase treatment necessary to remove intron #1 DNA that would have interfered with mHTT-Tr transcript Ct values.
As seen in Figures 15A, 15B, and 15C, the mHTT-F1 transcript was specifically reduced at 1, 2, and 4 months, respectively, after treatment.
Figure 15D
shows that control-treated Q175 mice treated with a single unilateral ICV dose of control NC-a U1 AO at the highest concentration of 80 i.tg had no reduction in the mHTT-F1 transcript or the mHTT-Tr transcript.
Second, Q175 mice underwent a single unilateral ICV dose with the mHTT-Tr-a U1 AO at four different concentrations - 10, 20, 40, and 80 i.tg (mice n = 9 per dose) - giving 36 mice in total. A cohort of three mice from each concentration was euthanized after 1, 2, and 4 months where mice underwent perfusion with lx PBS
and then sacrificed. Hemibrains were collected and processed for analysis by RT-qPCR
and Northern blot. All Ul Adaptor treated mice were compared to untreated Q175 mice. Silencing of the mHTT-Tr transcript was assessed by RT-qPCR which were then compared to untreated mice set to 100%. RT-qPCR to detect mHTT-Tr transcript included Dnase treatment necessary to remove intron #1 DNA that would have interfered with mHTT-Tr transcript Ct values.
As seen in Figures 16A, 16B, and 16C, the mHTT-Tr transcript was specifically reduced at 1, 2, and 4 months, respectively, after treatment.
Silencing of the mHTT-Tr transcript by mHTT-Tr-a U1 AO was deemed specific because: 1) no significant changes in the mHTT-F1 transcript were observed and 2) the NC-a non-specific control U1A0 showed no silencing at the highest dose (80 g) at the 1, 2 and 4 month durations. Likewise, silencing of the mHTT-F1 transcript by mHTT-Fl-a U1A0 was deemed specific because: 1) no significant changes in the mHTT-Tr transcript were observed and 2) the NC-a non-specific control U1A0 showed no silencing at the highest dose (80 g) at the 1, 2 and 4 month durations.
Pharmacokinetics (PK) studies were also performed. A PK profile was achieved by 32P-Northern blot analysis over a four point dose response combined with a 3-point time-course duration of the same mice listed above. An aliquot of the same RNA used to perform RT-qPCR was used for Northern blotting. In brief, RNA
1 0 samples from Ul Adaptor-treated mice along with standards and a 32P
tracer were separated on an 8% denaturing urea-PAGE gel followed by transfer to a Northern blot membrane. The membrane was then probed with the cognate 32P-probe, washed and exposed to X-ray film. The cognate probes were a 32P-labelled oligonucleotide called 32P-anti-mHTT-FL-a that is antisense to the mHTT-Fl-a U1 AO or a 32P-labelled oligonucleotide called 32P-anti-mHTT-Tr-a that is antisense to the mHTT-Tr-a or a 32P-labelled oligonucleotide called 32P-anti-NC-a that is antisense to the NC-a U1 AO. After several exposures to X-ray film, the Northern blots were quantified by phosphoimager analysis on a TyphoonTm system. Results are provided in Figure 17.
The histopathology of the U1A0 was also studied. Briefly, YAC128 mice were ICV injected with saline (n = 3) or 50 [tg of hHTI-FL-2 Ul Adaptor Oligo in saline (n = 5). Two mice were used as untreated controls. The mice were all males and ranged in age from 3-5 months. Mice were treated for 7 days. Two hematoxylin and eosin (H&E) stained slides from brain, kidney and liver tissue from each mouse was examined for histopathology analysis. Microscopic examination of the above slides does not reveal specific histopathologic changes of toxicity related to ICV-50 g Ul Adaptor Oligo. Microscopic examination of the H&E slides did not reveal specific histopathologic changes of toxicity related to IC V-50 [tg Ul Adaptor Oligo.
While certain of the preferred embodiments of the present invention have been described and specifically exemplified above, it is not intended that the invention be limited to such embodiments. Various modifications may be made thereto without departing from the scope and spirit of the present invention, as set forth in the following claims.

Several publications and patent documents are cited in the foregoing specification in order to more fully describe the state of the art to which this invention pertains. The disclosure of each of these citations is incorporated by reference herein.

Claims (31)

WHAT IS CLAIMED IS:

1. A Ul adaptor oligonucleotide for inhibiting the expression of the huntingtin gene, wherein said Ul adaptor oligonucleotide is a nucleic acid molecule comprising an annealing domain operably linked to at least one effector domain, wherein said annealing domain hybridizes to the pre-mRNA of said huntingtin gene, and wherein said effector domain hybridizes to the Ul snRNA of Ul snRNP.

2. The Ul adaptor oligonucleotide of claim 1, wherein said annealing domain is about 10 to about 30 nucleotides in length.

3. The Ul adaptor oligonucleotide of claim 1, wherein said effector domain is about 8 to about 20 nucleotides in length.

1 5 4. The Ul adaptor oligonucleotide of claim 1, wherein said effector domain and annealing domain are linked by a bond or a linker domain of about 1 to about nucleotides.

5. The Ul adaptor oligonucleotide of claim 1, wherein said effector domain comprises 2 0 the sequence 5'-CAGGUAAGUA-3' (SEQ ID NO: 1), 5'-CAGGUAAGUAU-3' (SEQ ID NO: 4), or 5'-GCCAGGUAAGUAU-3' (SEQ ID NO: 5).

6. The Ul adaptor oligonucleotide of claim 1, further comprising at least one targeting moiety and/or cell penetrating moiety, wherein said targeting moiety and/or cell 2 5 penetrating moiety is operably linked to said Ul adaptor oligonucleotide.

7. The Ul adaptor oligonucleotide of claim 1, wherein said Ul adaptor oligonucleotide comprises at least one nucleotide analog.

3 0 8. The Ul adaptor oligonucleotide of claim 1, wherein said Ul adaptor oligonucleotide comprises 2'-0-methyl nucleotides, 2'-0-methyloxyethoxy nucleotides, 2'-halo (e.g., 2'-fluoro), and/or locked nucleic acids.

9. The Ul adaptor oligonucleotide of claim 1, wherein Ul adaptor oligonucleotide comprises phosphorothioates.

10. The Ul adaptor oligonucleotide of claim 1, wherein said annealing domain hybridizes with a target sequence in the 3' terminal exon of the huntingtin gene.

11. The Ul adaptor oligonucleotide of claim 1, wherein the effector domain is operably linked to the 3' end of the annealing domain, the 5' end of the annealing domain, or both the 5' and 3' end of the annealing domain.

12. The Ul adaptor oligonucleotide of claim 1, wherein said annealing domain comprises a stretch of at least seven deoxyribonucleotides.

13. The Ul adaptor oligonucleotide of claim 1, wherein said Ul snRNA is a Ul 1 5 variant snRNA.

14. The Ul adaptor oligonucleotide of claim 6, wherein said Ul adaptor oligonucleotide and said targeting moiety and/or cell penetrating moiety are conjugated via a linker.

15. The Ul adaptor oligonucleotide of claim 14, wherein said linker is cleavable.

16. The Ul adaptor oligonucleotide of claim 6, wherein said targeting moiety and/or cell penetrating moiety is operably linked to the 3' end, the 5' end, or both the 5' and 2 5 3' end of the Ul adaptor oligonucleotide.

17. The Ul adaptor oligonucleotide of claim 16, wherein said targeting moiety and/or cell penetrating moiety is operably linked to the 5' end of the Ul adaptor oligonucleotide.

18. The Ul adaptor oligonucleotide of claim 1, wherein said Ul adaptor oligonucleotide is operably linked to a first targeting moiety at the 3' end and a second targeting moiety at the 5' end.

19. The Ul adaptor oligonucleotide of claim 6, wherein said targeting moiety is an antibody or fragment thereof.

20. The Ul adaptor oligonucleotide of claim 1, wherein the Ul adaptor oligonucleotide inhibits the expression of the full-length and/or truncated huntingtin mRNA.

21. The Ul adaptor oligonucleotide of claim 1, wherein the Ul adaptor oligonucleotide comprises a sequence selected from the group consisting of SEQ
ID
NO: 8, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 9, SEQ ID NO: 39, SEQ ID
NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID
NO: 15, and SEQ ID NO: 16.

22. The Ul adaptor oligonucleotide of claim 1, wherein the Ul adaptor 1 5 oligonucleotide comprises a sequence selected from the group consisting of SEQ ID
NO: 8, SEQ ID NO: 9, and SEQ ID NO: 15.

23. The Ul adaptor oligonucleotide of claim 1, wherein the annealing domain hybridizes with a sequence selected from the group consisting of SEQ ID NOs:
26-36.

24. The Ul adaptor oligonucleotide of claim 1, wherein the annealing domain hybridizes with a sequence selected from the group consisting of SEQ ID NO:
26, SEQ ID NO: 29, and SEQ ID NO: 35.

2 5 25. A composition comprising at least one Ul adaptor oligonucleotide of any one of claims 1-24 and at least one pharmaceutically acceptable carrier.

26. The composition of claim 25, wherein said composition further comprises at least one siRNA or antisense oligonucleotide directed against said huntingtin gene.

27. A method of inhibiting the expression of the huntingtin gene comprising delivering to a cell at least one Ul adaptor oligonucleotide of any one of claims 1-24.

28. The method of claim 27, wherein at least two of said Ul adaptor oligonucleotides are delivered and wherein the annealing domains of said Ul adaptor oligonucleotides hybridize with different target sequences in said huntingtin gene.

29. A method of treating Huntington's disease in a subject in need thereof, said method comprising administering at least one Ul adaptor oligonucleotide of any one of claims 1-24 to said subject.

30. The method of claim 29, wherein at least two of said Ul adaptor oligonucleotides 1 0 are administered and wherein the annealing domains of said Ul adaptor oligonucleotides hybridize with different target sequences in said huntingtin gene.

31. The method of claim 29, further comprising the administration of at least one siRNA or antisense oligonucleotide directed against said huntingtin gene.