EP3921426A1

EP3921426A1 - Obtaining plants having improved biomass digestibility

Info

Publication number: EP3921426A1
Application number: EP20702677.4A
Authority: EP
Inventors: Christine HORLOW; Marie-Hélène DURAND-TARDIF; Gregory MOUILLE; Peter Rogowsky
Original assignee: Institut National de Recherche pour lAgriculture lAlimentation et lEnvironnement
Current assignee: Institut National de Recherche pour lAgriculture lAlimentation et lEnvironnement
Priority date: 2019-02-08
Filing date: 2020-02-07
Publication date: 2021-12-15
Also published as: US11898151B2; FR3092473A1; WO2020161306A1; US20220119835A1; FR3092473B1

Abstract

Obtaining plants having improved biomass digestibility The present invention relates to a plant obtained by mutagenesis, such that the expression and/or the activity of the ESK1 protein and the expression and/or the activity of the TPS7 protein are diminished compared to a non-mutagenated plant. Said plant with biomass that has better digestibility maintains satisfactory growth. A further aim of the present invention is a method for preparing said plant, as well as the use of said plant for the production of biofuel.

Description

OBTAINING PLANTS WITH BIOMASS DIGESTIBILITY

IMPROVED

The present invention relates to the field of the production of plant biomass.

It relates more particularly to the preparation of plants which have a biomass exhibiting better digestibility (a property also referred to as degradability) and which retain satisfactory growth.

Fossil fuels such as petroleum, coal and gas are still the main source of energy in any sector. In the field of transport, oil is still largely predominant. However, these hydrocarbons are very polluting for the environment, in particular in that they release a lot of CO2 during their combustion, a carbon stock which was previously buried. In addition, deposits are becoming increasingly rare and extraction is becoming more and more expensive (https: //www.planete- energies.com/fr/medias/decryptages/les-energies-fossiles).

Biofuels could be part of the answer to the depletion of oil reserves. The first generation biofuels are made from simple sugars and oils present in plants, which are transformed into ethanol and bio-ester. Second generation biofuels (Sims et al., 2010) are produced from lignocellulosic biomass; this biomass is made up of all the cell walls of plants. The advantage of these second generation biofuels is that their production does not compete with human food. The lignocellulosic biomass used for second generation bio-fuels can be extracted from crop residues such as those from corn.

The cost of producing biofuel from this lignocellulosic biomass is still relatively high although the raw material is inexpensive. In addition, the biomass used as fodder for domestic animals does not exhibit optimal digestibility.

Within plants, certain tissues are richer than others in lignocellulosic biomass. This is the case in particular with xylem tissues, which are essentially composed of vessels which conduct raw sap and fibers. The xylem is a carbon sink; the simple sugars resulting from photosynthesis are stored there in the form of bio-polymers constituting the wall. Plant polymers are complex and linked together which makes their accessibility for digestion by animals or for their use in the chemical industry laborious and relatively polluting.

In addition, the exploitation of lignocellulosic biomass is a process which requires a first pretreatment step aimed at “breaking” the cellulose / hemicellulose / lignin matrix which forms the structure of the lignified secondary walls which consist of a complex tangle. of cellulose fibrils imbricated in a matrix of lignin and hemicellulose. This dense mesh can therefore hinder the access of digestive enzymes to polysaccharides of interest such as cellulose, a hexose polymer or hemicelluloses, such as xylan, a polymer of pentoses.

Obtaining more easily digestible plant lines with the same size and growth as their wild counterparts is therefore a topical issue (Kalluri et al., 2014). Among the strategies implemented to achieve this, there are strategies for reducing the level of lignin or modifying their chemical structure (decorations, binding to other polymers), which leads to vigor defects incompatible with their cultivation (Mottiar et al. al., 2016). Other strategies, in particular those tested and inventoried by Bhatia et al. (Bhatia et al., 2017) consist in modifying the bonds between polymers as well as modifying the decorations of hemicelluloses.

Previous work has identified frost tolerant mutants of Arabidopsis thaliana without a prior acclimatization period called eskimo 1 (eskl) (Xin et al., 1998). Plants with the mutated eskl gene were then characterized by their insensitivity to water stress (Bouchabke-Coussa et al., 2008), their dwarf phenotype (Lefebvre et al., 2011) as well as a low level of xylan acetylation. (Yuan et al., 2013).

This low acetylation of xylans observed in the eskl mutant leads to better enzymatic digestibility of the walls (Bensussan et al., 2015), which represents a valuable advantage for the transformation of plants of agronomic interest, in particular for the production of bio-fuels. or for animal feed.

However, even under optimal culture conditions, this mutant is characterized in particular by a dwarf phenotype and the plants carrying the eskl mutation ultimately produce very little biomass, which considerably limits their interest in production whether intended for food. animal or biofuel production.

In this context, additional studies focused on the identification of new lines showing good degradability of their cell wall but having a growth improved; these studies led to the identification of a double mutant (kak and eskl- 5 genes) which retains a low level of xylan acetylation but in which the dwarf phenotype is suppressed (Bensussan et al., 2015).

The inventors have now identified a new mutation which, associated with the mutation of the eskl gene, leads to a line retaining a low level of xylan acetylation and having improved biomass production (suppression of the dwarf phenotype).

More specifically, they identified the tps7 gene as a gene responsible for suppressing the dwarfism phenotype in eskl mutants. They then demonstrated that Arabidopsis thaliana plants carrying mutations in the eskl and tps7 genes exhibited improved biomass digestibility compared to wild Arabidopsis thaliana plants. In addition, they also demonstrated that the triple mutant Arabidopsis thaliana plants eskl, tps7 and kak and the triple mutant Arabidopsis thaliana plants eskl, tps7 and tps6 also exhibit better biomass digestibility compared to plants of d. "Wild Arabidopsis thaliana.

In Arabidopsis, there are 21 putative genes for trehalose biosynthesis divided into three classes according to their homology with the yeast ScTPSl and ScTPSl genes (Ramon et al., 2009). Class 1 and 2 genes encode bipartite proteins, the TPS domain (trehalose-6-phosphate synthase) and the TPP domain (trehalose-6-phosphate phosphatase). Thus trehalose-6-phosphate (T6P), a precursor of trehalose, is produced from glucose-UDP and glucose-9-phosphate, thanks to the enzyme TPS. Then T6P is then metabolized to trehalose by the enzyme TPP (Lunn et al., 2014, O'Hara et al., 2013; Vandesteene et al., 2012). The tps7 gene which codes for a trehalose-6-phosphate synthase 7 (TPS7) belongs to class 2 of the putative genes for the biosynthesis of trehalose.

Thus the present invention relates to a plant obtained by mutagenesis such as:

- the expression and / or activity of the protein designated ESK1, and

- the expression and / or activity of the protein designated TPS7,

are decreased, compared to a parent plant not mutagenized and the decrease in the expression and / or activity of the ESK1 and TPS7 proteins having been obtained by at least one mutation in each of the genes encoding the ESK1 and TPS7 proteins, and such that: the non-mutagenized ESK1 protein has at least 50% identity with the sequence SEQ ID NO: 1 and comprising the acyl esterase and transmembrane domains, and

the non-mutagenized TPS7 protein has at least 60% identity with the sequence SEQ ID NO: 2 and comprising the TPS and TPP domains. Those skilled in the art know the procedure to follow in order to obtain the best ortholog in a species of interest, and this via the “PLAZA” tool described in example 2, via the “PANTHER” tool (Mi and al., 2017), described below or via phylogenetic analyzes, such as those carried out by Paul et al., 2018.

The first step in using the "PANTHER" tool is to enter the identity of the gene (gene ID) on the TAIR website (http://www.arabidopsis.org). The second step is to select on the PANTHER site (http://www.pantherdb.org/) “gene and orthologs”, then enter the gene ID and press “search”. Among the orthologs proposed, the “least ortholog divergent” LODs must be chosen; they correspond to the best orthologs for a given protein.

The non-mutagenized ESK1 protein as defined in the present invention has at least 50% identity with the sequence SEQ ID NO: 1 and in increasing order of preference at least 55%, 60%, 65%, 70%, 75% , 80%, 85%, 90%, 95%, 97%, 98% and 99% identity.

The non-mutagenized TPS7 protein as defined in the present invention has at least 60% identity with the sequence SEQ ID NO: 2 and in increasing order of preference at least 65%, 70%, 75%, 80%, 85% , 90%, 95%, 97%, 98% and 99% identity.

The present invention is applicable to all monocotyledonous or dicotyledonous plants. Without limitation, it can be applied to cereal plants, ornamental plants, fruit trees and non-fruit trees.

The best ortholog for each of the ESK1 and TPS7 proteins in the plants of interest listed above is found via the PLAZA tool or via the PANTHER tool. The best orthologs for the ESK1 and TPS7 proteins in corn are: ZmESK1 (ZmOOOO 1 d028751) and ZmTRPS7 (Zm00001d043469).

The plant according to the invention may be a dicotyledon such as Arabidopsis thaliana, poplar (Populus trichocarpa) or grapevine (Vais vinifera). Preferably, the plant according to the invention is a monocotyledon such as wheat, corn (Zea mays), sorghum (Sorghum bicolor) or rice (Oryza sativa), even more preferably corn.

The protein designated ESK1, also called TBL29, whose expression and / or activity is reduced in the plant according to the invention is defined with reference to the ESK1 protein of Arabidopsis thaliana of SEQ ID NO: 1; in fact, depending on the plant species considered, a person skilled in the art is able to identify the ortholog of the protein designated ESK1 which has: - an acyl-esterase domain, necessary for their enzymatic activity (Anantharaman et al., 2010 and Gille et al., 2012), comprising the conserved motif GDSL of sequence SEQ ID NO: 4 and the conserved motif of sequence SEQ ID NO: 5, located at positions corresponding respectively to positions 214-217 and 462-465 of the sequence SEQ ID NO: 1, when said ESK1 protein is aligned with said sequence SEQ ID NO: 1, and

- an Ntb transmembrane domain, allowing anchoring to the internal membrane of the Golgi apparatus, the probable site of xylan acetylation (Gille et al., 2012 and Yuan et al., 2013). The presence of the transmembrane domain is identified using the TMHMM bioinformatics tool, which is software for predicting the structure of membrane proteins.

The conserved GDSL motif signifies the linking of the amino acids glycine, aspartate, serine and leucine.

The term “conserved domain or motif” is understood to mean a chain of amino acids found identically in the orthologous proteins.

According to a particular embodiment of the invention, the ESK1 protein can be further defined by 3 additional conserved patterns of sequences:

SEQ ID NO: 6 located at positions corresponding to positions 211-224 of the sequence SEQ ID NO: 1, when said ESK1 protein is aligned with said sequence SEQ ID NO: 1 and which comprises the conserved motif GDSL, of sequence SEQ ID NO: 4,

RKD located at positions corresponding to positions 433-435 of the sequence SEQ ID NO: 1, when said ESK1 protein is aligned with said sequence SEQ ID NO: 1, and SEQ ID NO: 7 located at positions corresponding to positions 461- 470 of the sequence SEQ ID NO: 1, when said ESK1 protein is aligned with said sequence SEQ ID NO: 1 and which comprises the conserved motif of sequence SEQ ID NO: 5.

The conserved motif RKD stands for the chain of the amino acids arginine, lysine and aspartate.

By way of example, the ESK1 proteins come from Arabidopsis thaliana of sequence SEQ ID NO: 1 (ESK1 / TBL29), from Zea mays (ZmESKl, called Zm00001d028751) of sequence SEQ ID NO: 8, from Oryza sativa ( called 0s03g0291800) of sequence SEQ ID NO: 9, of Populus trichocarpa (called POTR_0010s 19490) of sequence SEQ ID NO: 10 or of Sorghum bicolor (called Sb01g038450.1) of sequence SEQ ID NO: 11.

According to one embodiment of the present invention, the plant according to the invention is a dicotyledon and said ESK1 protein has at least 65% identity with SEQ ID NO: 1 and in increasing order of preference at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% and 99% identity with SEQ ID NO: 1 and comprises the units conserved GDSL sequences, of sequence SEQ ID NO: 4 and SEQ ID NO: 5 located at positions corresponding respectively to positions 214-217 and 462-465 of the sequence SEQ ID NO: 1, when said ESK1 protein is aligned with said sequence SEQ ID NO: 1.

According to another embodiment of the present invention, the plant according to the invention is a monocotyledon and said ESK1 protein has at least 50% identity with SEQ ID NO: 1 and in increasing order of preference at least 55%, 60 %, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98% and 99% identity with SEQ ID NO: 1 and includes the conserved domains of GDSL sequences, sequence SEQ ID NO: 4 and SEQ ID NO: 5 located at positions corresponding respectively to positions 214-217 and 462-465 of the sequence SEQ ID NO: 1, and may also comprise at least one of the conserved domains of SEQ ID sequences NO: 6, RKD and SEQ ID NO: 7 located at positions corresponding respectively to positions 211-224, 433-435 and 461-470 of the sequence SEQ ID NO: 1, when said ESK1 protein is aligned with said sequence SEQ ID NO: 1.

The protein designated TPS7, the expression and / or activity of which is reduced in the plant according to the invention, is defined with reference to the TPS7 protein of Arabidopsis thaliana of SEQ ID NO: 2; in fact, depending on the plant species considered, those skilled in the art are able to identify the ortholog of the protein designated TPS7 as follows which has: a TPS domain (Yang et al., 2012), comprising the conserved motif of sequence SEQ ID NO: 12 and the conserved motif of sequence SEQ ID NO: 13, located at positions corresponding respectively to positions 203-207 and 226-236 of the sequence SEQ ID NO: 2, when said TPS7 protein is aligned with said sequence SEQ ID NO: 2, and a TPP domain (Yang et al., 2012), comprising the conserved units of sequence SEQ ID NO: 14, 15 and 16, located at positions corresponding respectively to positions 649-654, 777 -787 and 807-815 of the sequence SEQ ID NO: 2, when said TPS7 protein is aligned with said sequence SEQ ID NO: 2.

For example, the TPS7 proteins are derived from Arabidopsis thaliana of sequence SEQ ID NO: 2 (AtTPS7), from Zea mays (Zmtrps7, called Zm00001d043469) of sequence SEQ ID NO: 17, from Oryza sativa (called 0s01g0749400 ) of sequence SEQ ID NO: 18, of Vitis vinifera (called VIT_12s0028g01670) of sequence SEQ ID NO: 19, of Populus trichocarpa (called POPTR_0011G70900) of sequence SEQ ID NO: 20, or of Sorghum bicolor (called SB03G034640) of sequence SEQ ID NO: 21. According to one embodiment of the present invention, the plant according to the invention is a dicotyledon and said TPS7 protein has at least 70% identity with SEQ ID NO: 2 and in increasing order of preference at least 75%, 80% , 85%, 90%, 95%, 97%, 98% and 99% identity with SEQ ID NO: 2 and comprises the conserved motifs of sequences SEQ ID NO: 12 and SEQ ID NO: 13 located at corresponding positions respectively at positions 203-207 and 226-236 of the sequence SEQ ID NO: 2, when said TPS7 protein is aligned with said sequence SEQ ID NO: 2.

According to another embodiment of the present invention, the plant according to the invention is a monocotyledon and said TPS7 protein has at least 60% identity with SEQ ID NO: 2 and in increasing order of preference at least 65%, 70 %, 75%, 80%, 85%, 90%, 95%, 97%, 98% and 99% identity with SEQ ID NO: 2 and comprises the conserved motifs of sequences SEQ ID NO: 12 and SEQ ID NO : 13 located at positions corresponding respectively to positions 203-207 and 226-236 of the sequence SEQ ID NO: 2, and may also comprise at least one of the conserved motifs of sequences SEQ ID NO: 14, 15 and 16 located at positions corresponding respectively to positions 649-654, 777-787 and 807-815 of the sequence SEQ ID NO: 2, when said TPS7 protein is aligned with said sequence SEQ ID NO: 2.

According to a first particular embodiment, the plant according to the invention such that the expression and / or the activity of the proteins ESK1 and TPS7 are reduced is also such that the expression and / or the activity of the designated protein. KAK are reduced, compared to a parent plant not mutagenized, the decrease in the expression and / or activity of the KAK protein having been obtained by at least one mutation in the gene encoding the KAK protein, and such that the non-mutagenized KAK protein has at least 60% identity with the sequence SEQ ID NO: 3 and comprising armadillo repeats and a HECT domain.

The non-mutagenized KAK protein as defined in the present invention has at least 60% identity with the sequence SEQ ID NO: 3 and in order of increasing preference at least 65%, 70%, 75%, 80%, 85% , 90%, 95%, 97%, 98% and 99% identity.

The best ortholog for the KAK protein in the plants of interest listed above is found via the PLAZA tool or via the PANTHER tool. The best ortholog for the KAK protein in maize is ZmKAK1.

The KAK protein whose expression and / or activity is reduced in the plant according to the invention is defined with reference to the KAK protein ïA rabidopsis thaliana of SEQ ID NO: 3; in fact, depending on the plant species considered, those skilled in the art are able to identify the ortholog of the protein designated KAK as follows which has:

- armadillo repeats in N¾, defined as a target protein binding domain, which will be sent to the proteasome (Sharma et al., 2016) comprising the conserved motifs of sequences SEQ ID NO: 22 and 23, located at corresponding positions at positions 291-309 and 311-341 of the sequence SEQ ID NO: 3, when said KAK protein is aligned with said sequence SEQ ID NO: 3, and

- an HECT domain in COOH, binding ubiquitin units which will subsequently be linked to the targets for addressing to the proteasome (El Refy et al., 2003), comprising the conserved motif of sequence SEQ ID NO: 24, located at positions corresponding to position 1845-1867 of the sequence SEQ ID NO: 3, when said KAK protein is aligned with said sequence SEQ ID NO: 3.

The presence of the armadillo repeats and the HECT domain is identified using the bioinformatic tool “Protein Sequence Analysis and Classification” of InterPro 68.0 (EMBL-EBI), found using the website https://www.ebi.ac. uk / interpro /.

According to a particular embodiment of the invention, the KAK protein can be further defined by 2 additional conserved patterns of sequences:

SEQ ID NO: 25 located at positions corresponding to positions 1466-1490 of the sequence SEQ ID NO: 3, when said KAK protein is aligned with said sequence SEQ ID NO: 3, and

SEQ ID NO: 26 located at positions corresponding to positions 1496-1521 of the sequence SEQ ID NO: 3, when said KAK protein is aligned with said sequence SEQ ID NO: 3.

By way of example, the KAK proteins are obtained from Arabidopsis thaliana of sequence SEQ ID NO: 3 (AtKAK), from Zea mays (ZmUPL3, also called ZmKAKl and Zm00001d004139) of sequence SEQ ID NO: 27, from Vitis vinifera ( named VIT_03s0038g02340) of sequence SEQ ID NO: 28, of Populus trichocarpa (called POPTR_0009s 13670) of sequence SEQ ID NO: 29, or of Sorghum bicolor (named Sb06g003290.1) of sequence SEQ ID NO: 30.

According to one embodiment of the present invention, the plant according to the invention is a dicotyledon and said KAK protein has at least 70% identity with SEQ ID NO: 3 and in increasing order of preference at least 75%, 80% , 85%, 90%, 95%, 97%, 98% and 99% identity with SEQ ID NO: 3 and includes the conserved motifs of SEQ ID sequences NO: 22, 23 and 24 located at positions corresponding respectively to positions 291-309, 311-341 and 1845-1867 of the sequence SEQ ID NO: 3, when said KAK protein is aligned with said sequence SEQ ID NO: 3.

According to another embodiment of the present invention, the plant according to the invention is a monocotyledon and said KAK protein has at least 60% identity with SEQ ID NO: 3 and in increasing order of preference at least 65%, 70 %, 75%, 80%, 85%, 90%, 95%, 97%, 98% and 99% identity with SEQ ID NO: 3 and comprises the conserved motifs of sequences SEQ ID NO: 22, 23 and 24 located at positions corresponding respectively to positions 291-309, 311-341 and 1845-1867 of the sequence SEQ ID NO: 3, and may also comprise at least one of the conserved motifs of sequences SEQ ID NO: 25 and 26 located at positions corresponding respectively to positions 1466-1490 and 1496-1521 of the sequence SEQ ID NO: 3, when said KAK protein is aligned with said sequence SEQ ID NO: 3.

According to a second particular embodiment, the plant according to the invention such that the expression and / or activity of the ESK1 and TPS7 proteins are reduced is also such that the expression and / or activity of the designated protein. TPS6 are reduced, compared to a parent plant not mutagenized, the decrease in the expression and / or activity of the TPS 6 protein having been obtained by at least one mutation in the gene encoding the TPS6 protein, and such that the non-mutagenized TPS6 protein has at least 60% identity with the sequence SEQ ID NO: 65 and preferably comprising the TPS and TPP domains.

The non-mutagenized TPS6 protein as defined in the present invention has at least 60% identity with the sequence SEQ ID NO: 65 and in order of increasing preference at least 65%, 70%, 75%, 80%, 85% , 90%, 95%, 97%, 98% and 99% identity.

The best ortholog for the TPS6 protein in the plants of interest listed above is found via the PLAZA tool or via the PANTHER tool. The best ortholog for the TPS6 protein in corn is Zm00001d028267.

The TPS6 protein, the expression and / or activity of which is reduced in the plant according to the invention is defined with reference to the TPS6 protein of Arabidopsis thaliana of SEQ ID NO: 65; in fact, depending on the plant species considered, a person skilled in the art is able to identify the ortholog of the protein designated TPS6 as follows which has:

a TPS domain (Yang et al., 2012), comprising the conserved motif of sequence SEQ ID NO: 12 and the conserved motif of sequence SEQ ID NO: 13, located at positions corresponding respectively to positions 213-217 and 235-246 of the sequence SEQ ID NO: 65, when said TPS6 protein is aligned with said sequence SEQ ID NO: 65, and a TPP domain (Yang et al., 2012), comprising the conserved motifs of sequence SEQ ID NO: 14, 15 and 16, located at positions corresponding respectively to positions 666-671, 794-804 and 824-832 of the sequence SEQ ID NO: 65, when said TPS6 protein is aligned with said sequence SEQ ID NO: 65.

By way of example, the TPS6 proteins are obtained from Arabidopsis thaliana of sequence SEQ ID NO: 65 (called AtTPS6 or AT1G68020), from Zea mays (Zm00001d028267, also called GRMZM2G099860) of sequence SEQ ID NO: 66, from Vitis vinifera (called VIT_00011634001) of sequence SEQ ID NO: 68, of Populus trichocarpa (called POPTR_010G104500v3) of sequence SEQ ID NO: 69, or of Sorghum bicolor (called SORBI_3001G450800) of sequence SEQ ID NO: 67.

According to one embodiment of the present invention, the plant according to the invention is a dicotyledon and said TPS6 protein has at least 70% identity with SEQ ID NO: 65 and in increasing order of preference at least 75%, 80% , 85%, 90%, 95%, 97%, 98% and 99% identity with SEQ ID NO: 65 and comprises the conserved motif of sequence SEQ ID NO: 12 and the conserved motif of sequence SEQ ID NO: 13 , located at positions corresponding respectively to positions 213-217 and 235-246 of the sequence SEQ ID NO: 65 when said TPS6 protein is aligned with said sequence SEQ ID NO: 65.

According to another embodiment of the present invention, the plant according to the invention is a monocotyledon and said TPS6 protein has at least 60% identity with SEQ ID NO: 65 and in increasing order of preference at least 65%, 70 %, 75%, 80%, 85%, 90%, 95%, 97%, 98% and 99% identity with SEQ ID NO: 65 and comprises the conserved motif of sequence SEQ ID NO: 12 and the conserved motif of sequence SEQ ID NO: 13, located at positions corresponding respectively to positions 213-217 and 235-246 of the sequence SEQ ID NO: 65 when said TPS6 protein is aligned with said sequence SEQ ID NO: 65 and may also comprise the conserved motifs of sequence SEQ ID NO: 14, 15 and 16, located at positions corresponding respectively to positions 666-671, 794-804 and 824-832 of the sequence SEQ ID NO: 65, when said TPS6 protein is aligned with said sequence SEQ ID NO: 65.

Unless otherwise specified, the alignment between two peptide sequences and the calculation of the identity percentages are carried out over the entire length of the peptide sequences using the “needle” computer program (Needleman et al., 1970) using the default parameters: "Matrix": EBLOSUM62, "Gap penalty": 10.0 and "Extend penalty": 0.5.

The decrease in the expression and / or activity in a plant of the proteins ESK1, TPS7 and optionally KAK or TPS6 as defined above, can be obtained in various ways detailed below.

The term "decrease in the expression of a protein in a plant obtained by mutagenesis" refers to the decrease in the amount of protein produced by the plant obtained by mutagenesis in comparison with an unmutagenized parent plant and in which the expression of said protein is not reduced.

Methods used to measure decreased expression of a protein in a plant include, for example, the western blot technique.

The term "decrease in the activity of a protein in a plant obtained by mutagenesis" refers to the decrease in the activity of the protein produced by the plant obtained by mutagenesis in comparison with an unmutagenized parent plant and in which the 'activity of said protein is not reduced.

Methods used to measure the decrease in the activity of a protein in a plant include, for example, measurement of enzyme activity, by assaying sugars, by infrared, by mass spectrometry or by visual tests.

In the present case, the decrease in the expression of each of the proteins ESK1, TPS7, KAK and TPS6 is measured by western blot and is compared respectively with the expression of the proteins ESK1, TPS7, KAK and TPS6 of a non-mutagenized plant. .

In the present case, the decrease in the activity of ESK1 is measured by an acetate or infrared assay or by MS Maldi-TOL and is compared with the ESK1 protein of a non-mutagenized plant.

In the present case, the decrease in the activity of TPS7 is measured by a sugar assay or by mass spectrometry and is compared to the TPS7 protein from an unmutagenized plant.

In the present case, the decrease in KAK activity is measured by a visual test by observing the hyperbranched trichomes and is compared to the KAK protein of an unmutagenized plant.

In the present case, the decrease in the activity of TPS6 is measured by an assay of sugars or by mass spectrometry and is compared to the TPS6 protein of a non-mutagenized plant. The plant material (protoplasts, calli, cuttings, seeds, etc.) obtained from the plants according to the invention also forms part of the subject of the present invention. The invention also encompasses the products obtained from the plants according to the invention, in particular fodder, wood, leaves, stems, roots, etc.

The plants according to the invention are such that they have improved digestibility. Plants in which the expression and / or activity of the ESK1 and TPS7 proteins are reduced exhibit biomass production intermediate between that of the eskl mutant and the wild type. Plants in which the expression and / or activity of the ESK1, TPS7 and KAK proteins are reduced and those for which the expression and / or activity of the ESK1, TPS7 and TPS6 proteins are reduced exhibit an intermediate or equivalent biomass. to that of a wild plant.

The calculation of the amount of biomass is done by measuring the dry weight per kg of fresh weight from ten plants.

The digestibility is evaluated by digestion of the parietal compounds with the enzymatic cocktail known as “Onozuka cellulase” as described in Bensussan et al., 2015. The digestibility protocol then corresponds to an in vitro test aimed at estimating the contents of insoluble fibers after hydrolysis. acid.

The invention also relates to a process for preparing a plant with improved digestibility according to the invention in which the expression and / or activity of the protein designated ESK1, and the expression and / or activity of the protein designated TPS7, are reduced, said method comprising the steps of mutagenesis of the genes encoding the proteins designated ESK1 and TPS7.

According to a first particular embodiment, this method allows the preparation of a plant such that the expression and / or the activity of the protein designated KAK are also reduced (in addition to those of ESK1 and TPS7) and comprises a additional step of mutagenesis of the gene encoding the protein designated KAK.

According to a second particular embodiment, this method allows the preparation of a plant such that the expression and / or the activity of the protein designated TPS6 are also reduced (in addition to those of ESK1 and TPS7) and comprises a additional step of mutagenesis of the gene encoding the protein designated TPS 6.

The decrease in the expression and / or activity of each of the ESK1, TPS7, KAK and TPS6 proteins is obtained by mutagenesis of the genes encoding their respective proteins. For example, a mutation within the coding sequence of a gene can induce, depending on the nature of the mutation, the expression of an inactive protein, or of a protein with altered activity. A knock-out type mutation in which the reading frame presents a premature stop codon can also induce a decrease in the expression of this protein.

The mutants can be obtained by deletion, insertion and / or substitution of one or more nucleotides, for example by deletion of all or part of the coding sequence of the gene encoding the protein or of its promoter or by the insertion of a exogenous sequence within the coding sequence of the gene encoding the protein or of its promoter.

Mutagenesis can be carried out by inducing random mutations, for example using physical or chemical agents such as EMS (Ethyl Methane Sulfonate) or random insertion mutagenesis, followed by selection of mutants with the targeted mutations. High throughput mutagenesis methods followed by selection of mutants are well known. For example, mention may be made of the TILLING method (Targeting Induced Local Lesions IN Genomes) which is described in particular in by McCallum et al., 2000, Colbert et al., 2001 Henikoff et al. , 2003 and Till et al., 2003). The TILLING technique has continued to develop on different cultivated species as evidenced by numerous publications such as, for example, Taheri et al., 2017.

Alternatively, mutagenesis can be carried out by methods using nucleases (TALEN, CRISPR / Cas9, etc.), described in Shan et al., 2013, Leng et al., 2013, Svitashev et al., 2015 and Char et al., 2017.

For certain plants such as maize, the mutants can be insertion lines, for example chosen from the collection of lines called mutator ULMu; the search for maize lines which possess transposon insertion into the orthologous genes of interest can be performed using the website https://maizegdb.org/data_center/stock.

The genotyping of the lines is carried out according to the authors' recommendations (McCarty et al., 2013).

In the absence of insertion of transposable elements or TILLING mutants in the selected genes, the strategy of mutagenesis by CRISPR / Cas9 is carried out.

Finally, the inhibition of the expression of the target protein can be obtained by an RNA interference technique (RNAi), by expression of an antisense RNA or alternatively by aptamers. The present invention relates to a process for increasing the growth of a plant carrying the eskl mutation, characterized in that it comprises a step of genetic modification of said plant to decrease the expression and / or activity of the protein. designated TPS 7.

Preferably, this method also comprises a step of genetic modification of said plant to decrease the expression and / or activity of the protein designated KAK or a step of genetic modification of said plant to decrease the expression and / or the activity of the protein designated TPS6.

The invention also relates to the use of a plant according to the invention for the production of biofuel.

The invention further relates to the use of a plant according to the invention for animal nutrition.

Figure 1: Physical map of the candidate genes selected for the beemlAXC line. Beem stands for “biomass enhancement under eskimo 1 mutation”. These are mutagenized eskl mutant lines, the dwarf character of which is attenuated. Position of SNP variants from bioinformatics analysis.

Figure 2: Phenotype of the mutants eskl, beemlAXC (eskl mutant line suppressed or not suppressed for dwarfism after chemical mutagenesis) and wild type. (A) Representative plants of each genotype cultivated under standard conditions: wild type Col-0, suppressed beemlAXC, beemlAXC eskimo- \ kc segregating in the mutagenized unsuppressed population and eskX (B) Representation of segregation of the beemlAXC line. The white squares show the plants which exhibit the beem phenotype (C) Comparison of plant height between the parental mutant eskX and the suppressed mutant beemlAXC.

Figure 3: A Comparison of the surface area of rosettes between different lines. The letter symbolizes the class to which each line belongs, a class determined by a multiple comparison test (Tuckey). The line in the middle of each box represents the median, the diamond indicates the average, the ends of each box is ¹ and the 3 ^rd quartile of the series, the standard deviation is shown by the vertical bars, extreme individuals are indicated by a black dot. B Number of the allelism test.

Figure 4: Graphic representation of plasmid L1657.

Figure 5: Phylogenetic tree produced with protein sequences of class 2 TPS genes anchored with the protein of the TPSX gene. The values indicate the length of the branches. Figure 6: Arabidopsis plants at the floral induction and flowering stage.

A- Top from left to right: 2 plants of the mutant eskl, followed by 2 plants of the double mutant tpsôeskl, 2 plants of the double mutant tps7eskl, 2 plants of the double mutant tps8eskl, 2 plants of the double mutant tps9eskl and 2 plants of the double mutant tpslOeskl. At the bottom are 2 wild type plants (ColO).

B- From left to right: 2 wild type plants (ColO), 2 plants of the single mutants tps6, 2 plants of the double mutants tps6tps7 and 2 plants of the single mutants tps7.

C- Flowering plants. From left to right, the wild type ColO plant, followed by the triple mutant tps6tps7eskl, the double mutant tpsôeskl, the double mutant tps7eskl and the single mutant eskl.

D- View of the rosettes of whole plants shown in C.

FIG. 7: Position of the CrispR targets on the genomic sequences of the ZmOOOO1 d022582 (ESK3) and Zm00001d028751 (ESK6) genes.

Figure 8: Morphological characterization of corn plants. Left: Observation of the size of mutant plants esk3.1, eskô.l and esk3.1esk6.1 in relation to the size of the wild plant (WT) at the flowering stage and the photo from right to right shows a defect foliar visible from the 4 ^th sheet. B: Appearance of ligulate leaves over time. C: Measurement of the height of the plants at the flowering stage. The letters a and b according to Tukey's test indicate that the plants belong to two significantly different groups. D: Distribution of genotypes according to the length and width of the 8 ^th sheet.

Figure 9: Result of the amylase treatment carried out on the samples. Two technical repetitions per sample were carried out, the results are compared with those obtained from laboratory standards (gray dots = repeat 1, white dots = repeat 2, black dots = standards).

Figure 10: Oligoxylans obtained after xylanase treatment and MALDI TOF identification. The different oligoxylans are distributed according to their m / z (horizontal axis) and their proportion on the vertical axis. The genotypes are represented by the pictograms, 3 biological repeats per genotype with the exception of the esk3.2esk6.2 lots (2 biological repeats).

Figure 11: Evaluation of the in vitro digestibility of dry matter (INDMD) and wall residue (INCWRD) and lignin content (klason) of the walls. A: above, averages of the digestibility of the dry matter according to the genotypes (3 biological repeats x 2 technical repeats per genotype); at the bottom, the digestibility of wall residues as a function of genotypes (3 biological repeats per genotype x 3 technical repeats). Tukey's test shows that the genotypes are divided into two significantly distinct groups (a and b). B: table of values of lignin content of wall residues according to genotypes. (3 biological repeats x 2 technical repeats per genotype) C: distribution of genotypes according to the digestibility of wall residues and the amount of lignin. Figure 12: Cross sections of corn internodes after FASGA staining. Low-lignified tissue is colored blue and lignified tissue is pink. Below, magnification of the perivascular regions of the wild plant and of the mutant eskô.l which have very blue and large cells around the vessels compared to those of the wild plant.

Figure 13: Measurements of the areas of sections of internode sections under the cob and quantification of the different tissues observed after FASGA staining. The stars indicate that the differences are significant (n = 57).

EXAMPLE 1 Demonstration of the tps7 mutation as a suppressor of dwarfism in arabidopsis thaliana and characterization of the double mutant plants eskl and tps7 in arabidopsis thaliana

Materials and methods

1. Obtaining "beems" by mutagenesis of the mutant eskimol

After chemical mutagenesis by EMS (3%), homozygous eskl-5 mutant seeds of Arabidopsis thaliana, 4500 M1 plants were cultivated, then groups of 7 M1 plants were made. 200 M2 seeds per group were then sown and groups which exhibited 4 to 5 M2 plants having greater growth than that of the mutant esk1 were isolated. These plants, called “beem” for “Biomass Enhancement under Eskimol Mutation”, were backcrossed with the eskl -5 mutant and self-fertilized to again observe the suppression of the dwarf phenotype in M3. Thus 12 lines containing suppressors of the dwarfism of the At eskl mutant were isolated. Crosses between beem suppressors and observations of segregation of phenotypes in F1 and F2 indicate that the mutations affect different genes except beem308A and beem396B which are allelic. DNA extracted from pool of 100 beem F2 plants and genome sequencing to a depth of 100X was performed for 5 beems (563B, 396B, 241C, 142A, 648B).

The eskl -5 mutant is genotyped with the pair of primers ESK1-5 # R2 and ESK1-5 # L1 for the wild-type allele and the pair of primers LBSalk2 and ESK1-5 # R2 for the mutated allele. The tps7-1 mutant comes from the SALK135044 line and is genotyped with the primers LBSalk2 and RP-Salkl35044 for the mutant allele and RP-Salkl35044 and LP-Salkl35044 for the wild-type allele.

The tps7-2 mutant comes from the SALK116341c line and is genotyped with the primers RP-Salkl 16341 and LBSalk2 for the mutant allele and with the primers RP-Salkl 16341 and LP-Salkl l341 for the wild-type allele.

The tpsl-3 mutant is the line GABI341E02. The mutant allele is determined by PCR with the primers Gabi08409 and RP-GK341E02 for the mutated allele and with the primers RP-GK341E02 and LP-GK341E02 for the wild-type allele.

The tpsl-A mutant is genotyped by PCR with the primers TS7 # U1 and TPS7 # L1 and the sequencing determines the presence of the SNP (G in A) relative to the reference sequence.

The sequences of the PCR products are obtained by the Sanger method and the sequences are aligned with the reference wild-type gene to determine the presence of the SNP.

The sequences of the T-DNA primers are: LBSalk2, Gabi08409, Lbl.3.

Table 1: Primers used for PCR

2. Bioinformatic analysis

A bioinformatic analysis was carried out by aligning the sequences (“reads”) of the genome of 5 beem mutants (563 B, 396B, 241 C, 142A, 648B) on the reference genome using the software CLC Genomics Workbench 7.5.2 ( Qiagen), knowing that the beem mutants were not allelic to each other. Sequence alignment

The “trimming” function provided by the CLC Genomics Workbench software was used. A trimming by quality and length of sequence was first done, with the following parameters:

Quality cutoff score = 0.05 (Phred value equivalent to a quality score of 40: the probability of incorrectly calling a base is 1 in 10,000).

trim. ambiguous nucleotides = 0 (no ambiguous nucleotides are allowed)

trim. length = reads with a length of less than 80 bp are discarded.

The “reads” were mapped on the VArabidopsis reference genome (T AIR 10.0) according to the default parameters. However, the parameters of fraction length (value of the alignment which must correspond to the reference sequence before being put in the list of mapped variants) and the similarity fraction (minimum percentage of identity between the "read" and the reference sequence) are 0.9 and 0.05 respectively.

SNP detection

The “basic variant detection” function was used with the following parameters: minimum coverage = 6; minimum count = 2; and minimum allele frequency = 80%. A list of SNPs for each beem line was obtained. Then, the list of possible candidates was chosen according to the following parameters (Abe et al., 2012; Hartwig et al. 2012): a) SNP / INDEL (insertion or deletion in a biological sequence) exclusive and unique for the beem241 line. C, b) The SNP / INDEL must be located in a coding region to have effects on the amino acid sequences, c) The SNP / INDEL has an allelic frequency between 80-100%.

Validation of candidate SNPs

480 plants of the F2 progeny of the backcross: beemlAXC x esk 1 -5 as well as 24 plants of the parental line eskl -5 and 10 wild Col-0 plants were sown in the greenhouse, in order to evaluate the recessivity of the beemlAXC mutation for the selected morphological characters. Suppressed plants look similar to that of a wild plant, while unsupported plants show small rosettes, dark green leaves and plant height that is shorter than that of wild plants.

DNA from suppressed "beem" plants was individually extracted. All the plants were genotyped by PCR in order to verify their homozygosity for the eskl mutation. Then primers were defined on the candidate genes for which the EMS mutations have an effect on the amino acid sequence (Table 2).

Table 2: Primers used. Primer sequences for the exclusive and independent candidate genes responsible for the suppression of the dwarf phenotype of the beemlAXC line.

The amplification products are sequenced by the company Beckman Coulter Genomics (24 suppressed "beem" plants, 7 sister plants with the eskimo-like phenotype and one eskl plant). Analysis of wild-type or mutant alleles indicates whether or not there is a correlation with the phenotype of plants observed using CLC Genomics Workbench 7.5.2 software (Qiagen).

Results

1. Identification of the beemlAXC mutation

Approximately 2000 SNP / INDEL were obtained for each beem line, but only those which are exclusive for the beemlAXC line and which meet the established selection criteria (allele frequency 80% - 100%, SNP / INDEL located on exons) were retained. Thus for the beemlAXC line, 19 SNP / INDEL were obtained with a coverage of 76% for all the chromosomes. But only nine candidate genes distributed over the chromosomes 1, 4 and 5 are unique and appear with an allelic frequency ranging from 80 to 100%. They are located in the coding regions of genes (Figure 1 and Table 3).

A cluster of mutations on the top of chromosome 1 is found.

Table 3: Candidate genes distributed on chromosomes 1, 4 and 5 found during bioinformatics analysis. Chr. Chromosome, Ref. Reference nucleotide, Mut. Mutant nucleotide, Couv. Cover, Freq. Frequency. (*) Unknown Protein, (SNV) Single Nucleotide Variant, (D) Deletion, (I) Insertion, (G) Guanine, (A) Adenine, (T) Thymine.

Most mutations on chromosome 1 show changes from G by A. On chromosomes 4 and 5, the variants correspond to deletions and insertions rarely found by EMS chemical mutagenesis. CVP2 and TPS7 are the unique variants which show a frequency of 100% with 60 and 63 sequences respectively.

M2 beemlAXC plants were backcrossed five times with their eskl parent. The resulting F2 population showed segregation for the rosette size of 138 beem plants: 342 non-suppressed plants (Chi2 test positive for the expected segregation 1: 3-p-value = 0.05778) (Figure. 2). This result confirms that the mutation responsible for the suppressed phenotype is recessive. The DNA of the 138 suppressed plants was individually extracted to verify by PCR that all the plants are eskl homozygous, then the sequencing of the candidate genes around the detected SNP was carried out. The deletion causes the change of a serine to proline at codon 814 of the coding sequence (CDS) of TPS7 potentially leading to the translation of the complete TPS domain (Trehalose Phosphate Synthase) and of the modified TPP domain (Trehalose Phosphate Phosphatase) of the protein .

2) _ Complementation tests with T-DNA insertion mutants in the TPS7 gene

The tps7-1, tps7-2, tps7-3 mutants were crossed with the eskl-5 mutant in order to select in F2 the double mutants tps7-l eskl-5, tps7-2eskl-5 and tps7-3eskl-5 using the primers identified in Table 1.

To carry out the complementation test, these double mutants were crossed with the mutant beemlAXC and the surface of the rosettes of the F1 progenies (beem241C tps7 eskl) was measured after 4 weeks of growth. The surface of the rosettes of the F1 progenies (beem241C tp7s eskl) observed is similar to that of beemlAXC. The results of the complementation tests shown in Figure. 3 therefore tell us that beemlAXC is tpsl.

It is also observed that the tps7 eskl-5 double mutants have an intermediate phenotype between that of the wild plant and that of the eskl -5 mutant, as is observed in the beemlAXC mutant, the size of the rosettes being larger than that of the eskl mutant. -5.

3) _ Biomass production

To assess biomass production, plants were grown on the Phenoscope automated phenotyping machine (Tisne et al. 2013), under controlled and reproducible conditions. The dry matter weight of rosettes 44 days old and dehydrated for 48 hours was measured.

The results of this measurement are available in Table 4.

It can be seen that the simple tps7 mutants exhibit a significantly higher biomass (23 to 32%) than the wild in irrigated condition as in water deficit condition.

The tps7 eskl-5 double mutants exhibit a higher biomass than that of the eskl -5 mutant in irrigated condition.

Table 4: Biomass (dry matter) of the rosettes of A. 44 day old thaliana taken from the Phenoscope. The number of individuals measured in each condition for each genotype is indicated in column N.

EXAMPLE 2: Demonstration of the selective effect of the tps7 mutation as a suppressor of dwarfism in arabidopsis thaliana and characterization of the triple mutant plants eskl, tps7 and tps6 in arabidopsis thaliana

The tpseskl double mutants were obtained from lines carrying mutations in each of the class 2 genes (Table 5 and Figure 5).

Table 5: List of class 2 TPS genes with their identifier (ID), the mutant lines obtained at the Stock Center and the oligonucleotides used to identify the mutant homozygous plants. The T-DNA oligonucleotides are those recommended on the site http://signal.salk.edU/tdnaprimers.2.html

After selection of the homozygous mutant tps plants, they were crossed with the mutant eskl. The F1 plants were then sown to search for double mutants. Thus the double mutants: tps5eskl, tpsôeskl, tps8eskl, tps9eskl, tpslOeskl Tpslleskl have been selected in F2. Only the tps7eskl mutant exhibits rosettes which are larger in size than that of the eskl mutant as well as compared to those of the other mutants (FIG. 6A).

When selecting the single tps6 mutants (one of the close homologs of the TPS7 gene and d & TPS5 (figure 6B) show a rosette size similar to that of the tps7 mutant. The selection of the double mutant tps6tps7 was therefore undertaken and a slightly larger surface area. rosettes were noted.

The expression profiles of class 2 TPS genes according to Ramon et al, 2009 and the very strong homology between the protein sequences of the TPS5, TPS6 and TPS7 genes represented on the phylogenetic tree (figure 5), led to research the triple mutants tps6tps7 eskl (Figures 6C and 6D). While the double mutant tpsôeskl does not suppress rosette dwarfism, it is suppressed with the triple combination and the surface area of the rosettes even seems to be increased with a greater number of secondary inflorescences. This result suggests that there is an interaction between the proteins TPS6 and TPS7 capable in the context of the eskl mutation of suppressing the effects of "stress" which block the growth of plants.

EXAMPLE 3: Determination in corn of the ortholog of the AlESK I gene.

Material and methods

The search in corn for orthologs to the AlESK I gene (gene ID AT3G55990) was carried out on the Plaza v.4 platform (Van Bel et al., 2017).

CrispR cas9 targeting is done with oligo A which targets Zm00001d022582 and is found at the end of the first of the exons. Oligo B mainly targets Zm00001d028751 (23/23) but also Zm00001d022582 (17/23; 3 'end preserved). It is located in the exonl of a total of 3 exons and is located upstream of the conserved region.

Oligo A = ESK3-CR85 in Zm00001d022582: ACAGGTCGCACCCGGCAACCTGG Oligo B = ESK6-CR24 in Zm00001d028751: GCAGACGTGCGACCTGTACCGGG Below are the primers used to target the Zm00001d1d0286751 genes (as well as the Zm00001d1d0286751 and PCRs used to target the Zm00001d1d0286 and PCR primers (as well as the Zm00001d1d0286) and PCR used to target the genes Zm00001 and the Zm00001d0286. sequencing (Table 6).

Table 6 Obtaining and selecting mutants

The immature corn embryos of the A188 line were transformed via Agrobacterium tumefaciens by the plasmid L1657-ESK carrying between the left and right limits of the T-DNA, the CAS9 gene under the control of the Ubiquitin promoter, the oligos A and B and the BAR gene. The transformants obtained after the regeneration of the calli were cultured and crossed with the line A 188 used as maternal or paternal parent.

In the greenhouse (16 day photoperiod), 12 F1 plants from each cross were grown. The presence or absence of the BAR and CAS9 genes is determined by the presence or absence of products of the PCR carried out on the DNA of the F1 plants with the primers of Table 6 above. The presence of heterozygous mutations in the target genes is verified by sequencing the PCR products and by the use of software (Dehairs, J. et al. CRISP-ID: decoding of indels mediated by CRISPR by Sanger sequencing Sci. Rep. 6, 28973; doi: 10.1038 / srep28973 (2016)). Plants negative for the BAR and CAS9 PCR products but heterozygous for the genes of interest were backcrossed on A 188 plants and self-pollinated. The F2 plants are then cultivated in the greenhouse, among them, the homozygous mutant plants and the anizygous sister plants are selected by PCR and by Sanger PCR sequencing and again self-pollinated to produce a sufficient number of grains allow the following analyzes.

The F3 mutant plants (n = 12) of each genotype and the wild-type plants are cultivated in the greenhouse up to the silage stage. Morphological characteristics like plant size, length and width of the 8th leaf are measured at the time of flowering and during plant development. The number of ligulate leaves is reported over time.

At the silage stage, the whole plants with the ear are cut, then batches of plants of the same genotype are roughly crushed, bagged and weighed before being dehydrated by passing 96 hours in an oven at 50 ° C. The dry matter content is calculated by the difference in mass before and after drying. The samples are then finely ground using a hammer mill (1 mm grid) to a homogeneous powder.

Three batches of 3 plants of the same genotype constitute 3 biological repeats and two technical repetitions per analysis are carried out at least.

Biochemical analyzes

Biochemical analyzes are carried out on the powders after validation and calibration of the weighings. Prior to the extraction of cell wall residues (CWR) through passages water / ethanol (Soxhlet), an amylase treatment is carried out on the dry matter powders. 2 g of dry matter are taken up in 20 ml of distilled water to which are added 400 μl of the amylase solution (HTL Ankom). Tubes are incubated at 100 ° C for 15 min with shaking in the middle of the incubation. Then the tubes are dipped in ice to cool them. A 15 min centrifugation at 18G is carried out, the supernatants are removed by aspiration and the pellets are rinsed twice with distilled water (20 ml) and centrifuged. The pellets are then frozen at -80 ° C. and then lyophilized for 30 h. The weight loss is estimated by weighing with 2 technical repetitions per sample. The value is validated if less than 5% error between the repetitions and the values of the standards (Ronaldinio Z18DIgPE106 are compliant) (figure 9).

The digestibility of the dry matter in vitro (IVDMD) and the digestibility of cell wall residues (IVCWRD) were estimated according to a modified protocol derived from Aufrère and Michalet-Doreau (1983). 30 mg of dry matter are pretreated in an acid solution (0.1N HCL) at 40 ° C. for 24 h, then a 2 M NaOH solution is added to terminate the reaction. The sample is then incubated in a cellulase solution (Cellulase Onozuka RIO 8 mg.ml-1, 0.1M NaAc pH 4.95, 0.4% Na2CO3) at 50 ° C for 72 h. After centrifugation, the pellet is washed with water and frozen before lyophilization. Weight loss is expressed as a percentage of the initial weight (30 mg). The lignin content in the cell wall (KL.CWR) is estimated by the Klason method according to Dence (1992) (2 technical repetitions per sample, a third is carried out if the results give more than 5% error).

The determination of the acetylation of xylan is carried out on a few micrograms of dry matter digested in a solution of endo-1,4-P-Xylanasc (E-XYRU6, Megazyme) in 50 mM sodium acetate buffer previously desalted. The samples are then analyzed and identified by MALDI-TOF mass spectrometry.

The preparation of the histological sections and the statistical analyzes were carried out according to the protocols described in the publication (Legland et al., 2017).

Statistical processing

Statistical analyzes of the data are carried out in Excel or with RStudio software.

Results

By bioinformatic analysis using the PLAZA v.4 software, two candidate genes Zm00001d028751 and Zm00001d022582 were selected as being the best candidate orthologs to the AtESK1 gene (AT1G55990) in Arabidopsis. He appeared It is interesting to carry out the double genetic targeting directly by the CrispR cas9 strategy to quickly validate whether these candidates were the right ones, given the very strong homology with the other orthologous genes belonging to the TBL29 family.

In Figure 7 are shown the oligo A which targets the gene ZmOOOOl d022582 (ESK3) and is at the end of the first exon, and the oligo B which mainly targets ZmOOOOl d028751 (ESK6) (23/23) but also ZmOOOOl d022582 (17/23; 3 'end retained). It is located in the exonl out of a total of 3 exons.

The maize transformants obtained by T-DNA transformation were analyzed by sequencing and thus several allelic mutants were obtained (Table 7). By backcrossing with the wild line, it was possible in the segregating progenies to select single allelic mutants esk3 and esk6 but also double allelic mutants esk3esk6.

Table 7: Description of the mutations obtained in each gene studied

Morphological and biochemical characterizations focused on two of the 4 allelic mutants of the ZmOOOOl <1028751 gene. This is the eskô.l mutant whose mutation creates a STOP codon resulting in a truncated protein of 192 amino acids out of the total 555, and the esk6.2 mutant whose mutation causes a change in reading phase from amino acid 192 to 308 ^th thus leading to a truncated protein of 247 amino acids.

For the gene ZmOOOOl <1022582, only two allelic mutants were obtained, these are the mutants esk3.1 and esk3.2 whose mutations create a change in reading phase from amino acid 158 and to proteins truncated in size 223 and 225 amino acids respectively on the predicted 529 amino acids. The double mutants esk3.1 eskô.l and esk3.2esk6.2 were also studied in this study.

The culture of all the mutant and wild plants has shown that the plants carrying the esk6 mutation have a size reduced by 27% compared to that of the wild plants (Figures 8A and 8C). The length and width of the longest sheet are also impacted with a decrease in areas of 20 and 27% respectively (Figure 8D). A growth retardation of about 3 weeks is also observed in all the plants carrying the esk6 mutation (FIG. 8B). In contrast, plants carrying the esk3 mutation are not different from wild plants (Figures 8A and 8C). The esk3esk6 double mutants are also dwarf, indicating a strong penetrance of the mutation (Figures 8A and 8C). As esk6 single mutants, borders, and the double mutants leaf ends esk3esk6 Yellowing or dry from the 4 ^th sheet. At the silage stage determined after observing the ripening of the grains located in the middle of the ear (pasty, glassy, milky stage), the lots of plants of the same genotype (3 lots) were harvested and the percentages of dry matter indicate that the plants were taken at the same stage of maturity with values varying between 30 and 37% depending on the lots (Table

8) -

Table 8: Percentage of dry matter of whole plants harvested at the silage stage.

Analysis of the oligoxylans shows that only the allelic mutants eskô.l and esk6.2 have a decrease in Xyl6 Ac2, Xyl6 Ac3, Xyl6 Ac4 and a very large increase in Xyl4 (Glc4Me) Ac (figure 10). On the other hand, the single allelic mutants esk3 and the double mutants esk3esk6 have oligoxylans which are little different from those of wild plants.

From these results, it can be concluded that the Zm00001d028751 (ESK6) gene is the ortholog of the AtlG55990 gene and has a function of Xylan O-Acetyl transferase.

The dwarfism observed in all plants carrying the esk6 mutation, single or double mutant, shows the penetrance of the mutation. Based on these results, the ZmOOOOl <3022582 (ESK3) gene has no function involved in the acetylation of xylans.

Improvement of biomass digestibility by the esk6 mutation. All plants carrying the esk6 mutation (single and double mutants) have a better dry matter digestibility (INDMD) of 2 to 4% depending on the genotypes compared to wild plants. Plants carrying the single esk3 mutation are poorly digestible compared to wild plants (from -2 to -4%) and significantly less digestible compared to esk6 mutants and esk3esk6 double mutants (from -5 to -8%) (figure 11A).

The analysis of the results of the digestibility of the parietal residues (INCWRD) also show the same results with clearly an improvement of the digestibility of the biomass in the plants carrying the esk6 mutation as indicated by the statistical test of Tukey in figure 11A. . This digestibility is improved by 3 to 4 points depending on the genotypes.

The content, composition and structure of lignins are unchanged in mutants.

To find out whether the improvement in the digestibility of the biomass of the mutants is linked to a lower content of lignin, this was quantified by the Klason method on wall residues. The contents vary extremely little from 13.8 to 14.9% (FIG. 11B). The distribution of genotypes according to TIVCWRD and Klason lignin content shows two distinct groups of plants. The first group consists of all mutants carrying the esk6 mutation (single and double mutants) and the second of single esk3 mutants and wild plants (FIG. 11C). This result tells us that at equivalent lignin content, the mutant plants esk6 and esk3esk6 are much more digestible.

To find out, if this digestibility is linked to a change in the composition and structure of the lignins, a thioacidolysis was carried out on the single mutants esk6 and the double mutants esk3esk6.

The results (not shown here) indicate that there is no change in the composition and structure of the lignins of the mutants compared to the wild control.

The esk6 mutation affects the size of the internodes and the production of a less lignified bone marrow parenchyma.

In Figure 12A are shown sections of internodes of corn stems after staining with Fasga. It can be observed that plants carrying the esk6 mutation have reduced internode areas compared to those of wild and mutant esk3 plants. In addition, a more pronounced blue staining of the marrow in the mutants esk6 and esk3esk6 indicates to us that the cells of the medullary parenchyma are less lignified than those of the wild and mutant plants esk3 which have a pink parenchyma and therefore more lignified. The blue staining of the perivascular cells of the mutant esk6 (FIG. 12B) indicate that they are not very lignified and they appear to be larger in size compared to those of the wild type. These observations are confirmed by the statistical treatment of the internode sections (n = 57) (figure 13). It shows that the esk6 and esk3esk6 mutants have a significant reduction in the internode area. Also, the latter have significantly less lignified tissue and a higher proportion of non-lignified tissue. However, statistical analysis does not reveal a significant difference in the thickness of the bark and the surface of the vascular vessels.

Given the results obtained in biochemistry on lignin contents, this suggests a different spatial distribution of lignins within tissues.

Conclusion

The Zm00001d028751 gene is the ortholog of the AT1G55990 gene in arabidopsis. It leads to the same developmental defect, namely plant dwarfism, and is accompanied by better digestibility of the biomass resulting from a decrease in the acetylation of xylans. The mutant's vascular vessels are not collapsed as is the case in the Ateskl mutant of arabidospis. In addition, the observations of several hundred histological sections of corn internodes from plants cultivated under conditions of water stress have never made it possible to observe the collapse of the xylem vessels but the same distribution pattern of the tissues observed in the mutant. esk6.

EXAMPLE 4 Characterization of the double mutant plants eskl and tps7 in maize

1. Search for in silico orthologs in maize using Arabidopsis thaliana plants

On the website https://bioinformatics.psb.ugent.be/plaza/versions/plaza_v4_monocots/, in the search engine, enter the name of the ES Kl gene in Arabidospsis thaliana, namely AT3G55990,

in the "Toolbox, explorer" section, select the "the orthologs using the Integrative Orthology Viewer" tab,

select for the species "Zea Mays" the ortholog corresponding to the "Best-Hits- and-Inparalogs (BHI) family", in this case Zm00001d028751,

in the "Toolbox, view" section, select the "sequences" tab.

The nucleotide and protein sequences of Zm00001d028751 are then accessible.

For the TPS 7 gene, the operation is repeated with the name of the TPS 7 gene in Arabidospsis thaliana, namely AT1G06410 and the ortholog is found in maize, under the reference Zm00001d043469. 1.1. Verification of the presence of the patterns preserved in the corn orthologs

A protein alignment is made between the sequence of Arabidopsis thaliana and that of

Zea Mays, using https://www.ebi.ac.uk/Tools/psa/emboss_needle/.

The presence of the GDSL motif, present in the acyl esterase domain of the ESK1 protein, is confirmed directly from this sequence alignment.

The presence of a transmembrane domain is identified via the TMHMM bioinformatics tool, accessible from the website http://www.cbs.dtu.dk/services/TMHMM/

1.2. Obtaining corn mutants

There are 2 orthologous genes for the ES K1 gene (AT3G55990) in maize: Zm00001d022582 and Zm00001d028751.

Genetic transformations of immature A188 corn embryos are carried out with the plasmid L1657-ESK (Figure 4) carrying between the borders of the T-DNA the gene encoding the CAS9 protein under the control of the Ubiquitin promoter as well as the target sequences of the genes of interest. For the Zm00001d022582 and Zm00001d028751 genes, the target sequences are respectively CAGGTCGCACCCGGCAACC and

CAGACGTGCGACCTGTACC.

There are 3 orthologous genes for the TPS7 gene (AT1G06410) in maize: ZM03G31920 (ZmTprs7), ZM03G31900 (ZmTprsS6) and ZM08G34940 (ZmTPrsl5) in maize. For the ZM03G31900 gene, there are insertions of mutator transposons such as mul069747 in UFMu-08325 and mul077018 in UFMu-08873 and for the ZM08G34940 gene, there is only an insertion of a transposable element in the exonic part: it is mul057945 in line UFMu-07357. For the ZM03G31920 gene which is the closest ortholog to AtTPS7, there is no transposable element in the gene. A CRISPR / Cas9 mutagenesis strategy is then necessary.

2. Materials and Methods

Double mutants eskl tps7 as well as single mutants and savages are reared in greenhouse or dedicated platform. All informative morphometric and phenological characteristics such as date of appearance of the third ligulate leaf, date of flowering, height of plants, width and length of the longest leaf are measured.

The plants are collected at the silage stage and at the mature grain stage. The water content of the stems and leaves is evaluated by weighing before and after drying in an oven at 50 ° C. for 4 days. The dry biomass is crushed into a fine powder with an IKA M20 cutter mill.

The biomass of the different lines is characterized as follows:

1 / Digestibility by enzymatic hydrolyses (Virlouvet et al., In preparation).

3 technical repetitions per sample are performed.

30 mg of dry matter are incubated for 24 hours at 40 ° C. in the presence of 0.1N HCL then 90 ml of 2M sodium hydroxide are added. After having passed the mixture by vortexing, 2 ml of cellulolysis solution (NaAc 0.1M pH 4.95, Sodium azide 0.4%, Cellulase ONOZUKA RIO 8mg.ml- 1) are added. The whole is placed under stirring at 50 ° C. for 72 h. The tubes are centrifuged for 15 min at 4000 RPM 8 ° C, the supernatants are removed and 4 ml of water are added to wash the pellets. After taking up the pellets using a vortex, a new centrifugation is carried out for 10 min. A new rinsing with water and centrifugation are carried out and the supernatant is then discarded. The pellets are frozen at -80 ° C. before lyophilization for a minimum of 48 hours. The dry pellets are then weighed. Weight loss is calculated as a percentage.

2 / The acetate level according to the recommendations of the Megazyme K-Acetic acid kit from 25 mg of wall residue obtained by the Soxhlet method.

3 / The sugar content of 10 mg of non-cellulosic wall residue obtained after treatment with 2.5M triflluoroacetic acid (TFA). The analysis is carried out by HPLC compared to the reference sugars (D (+) - Fucose, D (+) - Arabinose, D (+) - Glucose, D (+) - Galactose, D (+) - Mannose, D (+) - D (+) - Xylose, L-Rhamnose, D (-) - Fructose.

The determination of trehalose-6 phosphate and trehalose are carried out by chemical analysis.

4 / Cytological observations of the xylem vessels (internode under the ear) and of the roots are carried out by light microscopy.

Lignin levels by the lignin Klason method from 150 mg of wall residue according to the protocol described by Méchin et al., 2014.

At the silage stage, the acquisition of Infra-red spectra with Fourier transform (FTIR) obtained from xylem tissues on a 50 mhi section of internodes under a spike allows the detection of xylan acetylation (Lefebre et al. ., 2011).

Histological stains with Fasga of the internodes under the spike make it possible to visualize the lignified and non-lignified tissues, the shape of the vessels as well as their density (Legland et al, 2017).

EXAMPLE 5 Characterization of the triple mutant plants eskl, tps7 and KAK in maize

1. Search for in silico orthologs in corn using Arabidopsis thaliana plants

The search for the ortholog of the KAK gene in maize is carried out as described in Example 2 with the name of the KAK gene in Arabidospsis thaliana, namely AT4G38600 and the ortholog is found in maize, under the reference Zm00001d004139.

There are 2 orthologous genes for the KAK gene (AT4G38600) in maize: ZmOOOO 1 d004139 (ZmKak \) and ZmOOOOldO 14920 (Zm Kaki).

Homozygous mutant plants in the Zm Kaki gene were obtained by insertion of a mutator transposon: mul057066 into the UFMu-07383 line. As regards the ZmKakl gene, a CRISPR / Cas9 mutagenesis strategy is more suitable.

2. Materials and Methods The eskl tps7 double mutants are crossed with the eskl kak double mutants. The progeny of F1 plants (homozygous esk, heterozygous tps7, heterozygous kak) are bred to produce F2 progeny by selfing. Of the F2 plants, 1/16 of the plants are triple mutants esk tps7 kak. The selection of plants is done by genotyping by PCR with the primers used to select the single mutants.

The same studies as those described in Example 2 are carried out.

BIBLIOGRAPHY

Abe et al., Nature Biotechnology, 2012, 30, pages 174-178;

Anantharaman et al., Biology Direct, 2010, 5: 1, pages 1-8;

Bhatia et al., Plant Biotechnol Journal, 2017, 15: 1071-1092;

Bensussan et al., Plant Physiology, 2015, DOI: 10.1104 / pp.15.00122;

Char et al., Plant Biotechnol J., 2017, 15, 257-268;

Colbert et al., Plant Physiology, 2001, 126, pages 480-484;

El Refy et al., Mol Gen Genomics, 2003, 270, pages 403-414;

Feng et al., Cell Res., 2013, 23, pages 1229-1232;

Gille et al., Plant Science, 2012, 3, pages 1-7;

Hartwig et al., Plant Physiology, 2012, pages 591-600;

Henikoff et al., Annual Review of Plant Biology, 2003, 54, pages 15.1-15.27;

Kalluri et al., Plant Biotechnol Journal, 2014, 12 (9), pages 1207-1216;

Lefebvre et al., PLoS ONE, 2011, 6: 2, pages 1-13;

Legland et al., Plant Methods, 2017, 13:84;

Lunn et al., Plant Journal, 2014, 79, 544-567;

McCallum et al., Plant Physiology, 2000, 123: 2, pages 439-442;

McCarty et al., Plant Transposable Elements, 2013, 157-166;

Méchin et al., J. Agric. Food Chem., 2014, 62: 5102-5107;

Mi et al., Nucleic Acids Research, 2017, 45, pages D183-D189;

Mottiar et al., Curr Opin Biotechnol, 2016, 37: 190-200;

O’Hara et al., Molecular Plant, 2013, 6, pages 261-274;

Paul et al., Plant Physiology, 2018, 177, pages 12-23;

Ramon et al., Plant, Cell and environment, 2009, 32 pages 1015-1032;

Shan et al., Nat. Biotechnol, 2013, 31, pages 686-688;

Sharma et al., Frontiers in plant science, 2016, 6, pages 1-15;

Sims et al., Bioresour Technol, 2010, 101, 1570-1580;

Svitashev et al., Plant. Physiol., 2015, 169, 931-945;

Taheri et al., Mol Breeding., 2017, 169, 931-945;

Till et al., Genome research, 2003, 13, DOI: 10.1007 / sl 1032-017-0643-7;

Tisne et al., Plant Journal, 2013, 74, pages 534-544; Van Bel et al. (2017) PLAZA 4.0: an integrative resource for functional, evolutionary and comparative plant genomics Nucleic Acids Res;

Vandesteene et al., Plant Physiology, 2012, 160, 884-896;

Virlouet L et al. Front Plant Sci. 2019; 10: 488. doi: 10.3389 / fpls.2019.00488

Xin et al., PNAS, 1998, 95, pages 7799-7804;

Yang et al., Plant Biotechnology journal, 2012, pages 1-11;

Yuan et al., 2013, Plant & Cell Physiology, pages 1-14.

Claims

1. Plant obtained by mutagenesis such as:

the expression and / or activity of the protein designated ESK1, and

the expression and / or activity of the protein designated TPS7,

are decreased, compared to a parent plant not mutagenized and the decrease in the expression and / or activity of the ESK1 and TPS7 proteins having been obtained by at least one mutation in each of the genes encoding the ESK1 and TPS7 proteins, and such that:

the non-mutagenized ESK1 protein has at least 50% identity with the sequence SEQ ID NO: 1 and comprising the acyl esterase and transmembrane domains, and

the non-mutagenized TPS7 protein has at least 60% identity with the sequence SEQ ID NO: 2 and comprising the TPS and TPP domains.

2. Plant according to claim 1, characterized in that it is such that the expression and / or activity of the protein designated KAK are reduced, compared with a non-mutagenized parent plant, the decrease in expression and / or the activity of the KAK protein having been obtained by at least one mutation in the gene encoding the KAK protein, and such that the non-mutagenized KAK protein has at least 60% identity with the sequence SEQ ID NO: 3 and comprising the armadillo repeats as well as a HECT domain.

3. Plant according to claim 1, characterized in that it is such that the expression and / or the activity of the protein designated TPS6 are reduced, compared with a non-mutagenized parent plant, the decrease in expression and / or the activity of the TPS6 protein having been obtained by at least one mutation in the gene encoding the TPS6 protein, and such that the non-mutagenized TPS6 protein has at least 60% identity with the sequence SEQ ID NO: 65 and includes the TPS and TPP domains.

4. Process for preparing a plant with improved digestibility according to claim

1, characterized in that it comprises the steps of mutagenesis of the genes encoding the proteins designated ESK1 and TPS7.

5. A method according to claim 4 for preparing a plant according to claim

2, characterized in that it comprises an additional step of mutagenesis of the gene encoding the protein designated KAK.

6. A method according to claim 4 for preparing a plant according to claim 2, characterized in that it comprises an additional step of mutagenesis of the gene encoding the protein designated TPS 6.

7. A method for increasing the growth of a plant carrying the eskl mutation, characterized in that it comprises a step of genetically modifying said plant to decrease the expression and / or the activity of the protein designated TPS7.

8. Method for increasing the growth of a plant carrying the eskl mutation according to claim 7, characterized in that it comprises an additional step of genetic modification of said plant to decrease the expression and / or activity of the protein. designated KAK.

9. A method for increasing the growth of a plant carrying the eskl mutation according to claim 7, characterized in that it comprises an additional step of genetic modification of said plant to decrease the expression and / or activity of the protein. designated TPS 6.

10. Use of a plant according to any one of claims 1 to 3, for the production of biofuel.

11. Use of a plant according to any one of claims 1 to 3, for animal nutrition.