EP3914705A1 - Nanotransducer-based genome editing system - Google Patents

Nanotransducer-based genome editing system

Info

Publication number
EP3914705A1
EP3914705A1 EP20705789.4A EP20705789A EP3914705A1 EP 3914705 A1 EP3914705 A1 EP 3914705A1 EP 20705789 A EP20705789 A EP 20705789A EP 3914705 A1 EP3914705 A1 EP 3914705A1
Authority
EP
European Patent Office
Prior art keywords
nucleotide sequence
nanoparticle
genome editing
rna
enzyme
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP20705789.4A
Other languages
German (de)
French (fr)
Inventor
Vittoria Raffa
Elena Landi
Francesco TANTUSSI
Francesco De Angelis
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Universita di Pisa
Fondazione Istituto Italiano di Tecnologia
Original Assignee
Universita di Pisa
Fondazione Istituto Italiano di Tecnologia
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Universita di Pisa, Fondazione Istituto Italiano di Tecnologia filed Critical Universita di Pisa
Publication of EP3914705A1 publication Critical patent/EP3914705A1/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102Mutagenizing nucleic acids
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B82NANOTECHNOLOGY
    • B82YSPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
    • B82Y15/00Nanotechnology for interacting, sensing or actuating, e.g. quantum dots as markers in protein assays or molecular motors
    • BPERFORMING OPERATIONS; TRANSPORTING
    • B82NANOTECHNOLOGY
    • B82YSPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
    • B82Y5/00Nanobiotechnology or nanomedicine, e.g. protein engineering or drug delivery
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/20Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]

Definitions

  • the present invention generally falls within the field of genome editing.
  • the invention relates to a system based on a nano-transducer capable of modifying a genomic target sequence in a target cell, preferably a human cell.
  • nanotransducer refers to a nanoparticle capable of generating heat in a controlled way following irradiation with appropriate electromagnetic radiation.
  • engineered nuclease enzymes in particular, zinc finger nucleases (ZFN), transcription activator-like effector nucleases (TALEN), and more recently, the "Clustered Regularly Interspersed Short Palindromic Repeat (CRISPR)-CRISPR associated (Cas) (CRISPR-Cas)" system, play a significant role.
  • the CRISPR-Cas system which is based on the use of a nuclease called Cas, transcribed from the CAS (CRISPR-associated) genes, and a single- stranded RNA molecule, the so- called guide RNA (g-RNA), which associate with each other to form the ribonucleoprotein g-RNA/Cas ( Figure 1), is the most frequently applied technology.
  • the most used Cas nucleases are Cas9 from the Staphylococcus aureus bacterium and the Cpfl nuclease from Prevotella and Francisella 1.
  • Cas enzyme is a nuclease, i.e.
  • molecular scissors capable of making a double- stranded cut at a specific position in the genomic DNA molecule.
  • the g-RNA guides the Cas protein to the genomic site of interest, whereas the Cas protein is responsible for the helicase activity (i.e. the DNA double helix unwinding), so that a DNA/RNA hybrid is formed between the guide g-RNA and the genomic target DNA and a double- stranded cut is made.
  • the guide RNA is designed so that it contains a nucleotide sequence that binds to the Cas nuclease, the so-called “scaffold” sequence, and a sequence that is able to recognize and bind a specific DNA target sequence based on the complementary base pairing principle, the so-called “guide” sequence.
  • the g-RNA directs the Cas enzyme exclusively to cut the target sequence and not other regions in the genome.
  • the DNA target sequence must be immediately followed by a "Protospacer Adjacent Motif" (PAM) nucleotide sequence, which typically contains two to six base pairs.
  • PAM Protospacer Adjacent Motif
  • NHEJ non homologous end-join
  • HDR homology- directed repair
  • the Cas enzyme can allow mispairing between the g-RNA bases and the bases of a DNA sequence to a considerable extent (up to 5 bases), resulting in possible unplanned alterations at genomic regions other than the target (so-called off-target effects).
  • off-target effects In large genomes, such as the human genome, the risk that the Cas enzyme of the CRISPR-Cas system may introduce a cut into the DNA molecule at regions other than the target is highly realistic, thus leading to unwanted mutations which, depending on the genetic loci involved, can be extremely dangerous.
  • EP3199632 describes a CRISPR-Cas system whose regulation is subject to temperature variation which acts on a particular hairpin structure occurring in the guide RNA molecule, thus blocking its activation.
  • the opening of this hairpin structure following a temperature increase removes the block from the g-RNA molecule, thus allowing the CRISPR-Cas system containing it to operate.
  • Fokl nuclease Since the Fokl nuclease is active as a dimer, DNA cleavage requires the association of two Cas9-FokI monomers simultaneously linked to two adjacent target sites. The presence of two adjacent target sites is also an essential requirement for the method described in the article by Ran, F.A .et al “Double nicking by RNA-guided CRISPR Cas9 for enhanced genome editing specificity”; (2013) Cell, 154(6): 1380-92, which uses mutated Cas9 nucleases that cut only one of the two DNA strands, the so-called nickases. According to this approach, double strand cleavage is performed by two distinct Cas9 nickases capable of simultaneously binding two different adjacent target sites.
  • the object of the present invention is to provide a genome editing system in a target cell with the same degree of efficacy as the systems described in the prior art, but at the same time characterized by a significant greater selectivity of action on the target sequence of the locus of interest and a high level of safety, thus allowing its use also to be extended to the clinical-therapeutic field.
  • the genome editing system of the invention has a high safety and reliability profile as it is capable of recognizing and operating with precision and accuracy on its target sequence within the genome complexity.
  • the genome editing system comprises at least one macromolecular complex comprising (i) a nanoparticle which in a physiological environment, following exposure to appropriate electromagnetic radiation, is capable of generating an amount of heat such as to induce a temperature increase of least 10°C for at least 1 millisecond on the surface of said nanoparticle and (ii) an enzymatic complex capable of directing the nanoparticle to the genomic site of interest.
  • the term nanoparticle refers to a nanoparticle selected from a single-walled carbon nanotube (SWCNT) or a multi-walled carbon nanotube (MWCNT) capable of generating heat and a temperature increase of at least 10°C on its surface when exposed to electromagnetic radiation in the radio frequency field (20 kHz - 300 GHz), a magnetic nanoparticle capable of generating heat and a temperature increase of at least 10°C on its surface when exposed to an alternating magnetic field with a frequency of 50-800kHz, and a metallic nanoparticle capable of generating a temperature increase of at least 10°C on its surface when exposed to electromagnetic radiation with a wavelength of from 300 nm to 2 pm.
  • the metallic nanoparticle is capable of generating heat if optically irradiated with a wavelength close to the localized surface plasmon resonance.
  • the nanoparticle is a metallic nanoparticle capable of supporting a localized surface plasmon resonance, hereinafter for the sake of brevity referred to as a "plasmonic nanoparticle", capable of absorbing electromagnetic radiation at a controlled wavelength in the visible spectrum or in the near- infrared, i.e. in a wavelength range between about 300 nm and about 2 pm, preferably between 400 nm and 1800 nm, and converting it into heat.
  • the generation of heat by a plasmonic nanoparticle depends on the magnitude of the detuning or deviation factor, i.e.
  • the graph in Figure 2 illustrates the inverse relationship between the magnitude of the detuning factor and the amount of heat generated by a plasmonic nanoparticle, i.e. the amount of generated heat increases the more the laser is tuned on the SPR wavelength of the plasmonic nanoparticle.
  • the nanoparticle of the invention can have a spherical shape and a diameter preferably comprised between about 1 nm and about 100 nm, more preferably between 2 nm and 40 nm, even more preferably between 5 nm and 30 nm, most preferably between 10 nm and 20 nm.
  • the nanoparticle of the invention can have a non-spherical shape and at least one dimension preferably comprised between about 1 nm and about 100 nm, more preferably between 2 nm and 40 nm, even more preferably between 5 nm and 30 nm, most preferably between 10 nm and 20 nm.
  • dimension is intended to include each of the measures that identify and determine the size of a body, both by volume and surface, for example, including the length, the width, the height or the depth.
  • metals making up the nanoparticle are gold, silver, copper, titanium, chromium, and any compound thereof. Even more preferably, the plasmonic nanoparticle is a gold or silver nanoparticle.
  • the plasmonic nanoparticle is optionally coated with a thermosensitive acrylic polymer coating.
  • thermosensitive refers to the ability of the acrylic polymer coating to dissolve or contract following a change in temperature, preferably an increase in temperature to a value preferably comprised between 40°C and 100°C, more preferably between 40°C and 50°C.
  • thermosensitive polymer coating plays a protective role and at the same time prevents possible aggregations from occurring between the plasmonic nanoparticles in the presence of a plurality of macromolecular complexes.
  • thermosensitive acrylic polymer comprises at least one monomer selected from acrylamide (AAm), allylamide hydrochloride (AH), N-isopropylacrylamide (NIP A), bisacrylamide (BIS), and any combination thereof.
  • the plasmonic nanoparticle can optionally be linked to a single- stranded linker nucleotide sequence, preferably a sequence comprising from 10 to 20 nucleotides, preferably via a disulfide bridge chemical bond.
  • the system of the invention also comprises an enzymatic complex capable of directing the nanoparticle to the genomic target sequence.
  • the enzymatic complex is a“Clustered Regularly Interspersed Short Palindromic Repeat (CRISPR)-CRISPR associated (Cas) (CRISPR-Cas)” system comprising: a) a Cas nuclease enzyme having one or more mutations capable of abolishing the nuclease activity of said Cas enzyme (hereinafter referred to as dCas); b) a single-stranded guide RNA (g-RNA) molecule comprising from the 3' end to the 5' end: (i) a scaffold nucleotide sequence capable of binding the dCas enzyme, (ii) a guide nucleotide sequence capable of hybridizing to a complementary region of the genomic target sequence, and, optionally, (iii) a single-stranded nucleotide sequence, which for the sake of brevity will be hereinafter referred to as the c-linker, capable of complementarily hybridizing to the linker nucleo
  • CRISPR
  • the dCas nuclease enzyme used in the genome editing system of the present invention is derived from the enzymes Cas9, Casl2, Cpfl, evoCas9, and Casl3.
  • D 10A mutation and H840A mutation are mentioned by way of example but not limitation ⁇
  • the CRISPR-Cas enzyme complex can have a first or second alternative configuration.
  • a first configuration illustrated in Figure 3 (A) in the macromolecular complex of the invention the g-RNA molecule is bound to the dCas enzyme via the scaffold nucleotide sequence and the g-RNA molecule is associated with the nanoparticle by hybridization of the c-linker nucleotide sequence to the linker nucleotide sequence.
  • the g-RNA molecule is bound to the dCas enzyme via the scaffold nucleotide sequence and the dCas enzyme is associated with the nanoparticle via one or more covalent bonds.
  • these covalent bonds can be based on an NHS (N-hydroxysuccinimide) or maleimide chemistry.
  • the g-RNA molecule allows the nanoparticle as well as the dCas enzyme to be directed towards the target nucleotide sequence thanks to its ability to hybridize thereto.
  • the nanoparticle Once positioned on the DNA molecule, which is unwound by the helicase activity of the dCas enzyme, the nanoparticle acts as a nano-transducer as it is capable of generating heat in a controlled manner following irradiation with appropriate electromagnetic radiation.
  • the heat thus released by activation of the nanoparticle breaks the DNA double strand and optionally causes the thermosensitive polymer coating, when present, to dissolve. Said breakage, for example, may result in the inactivation of a specific gene (knock out) or be used for introducing an exogenous nucleotide sequence (knock in).
  • the genomic target sequence is located immediately upstream of a Protospacer Adjacent Motif (PAM) nucleotide sequence, preferably NGG (where N is a generic nucleotide and G is guanosine) (Shiraz A et al“Protospacer recognition motifs” RNA Biol. 2013 May 1; 10(5): 891-899).
  • PAM Protospacer Adjacent Motif
  • the distance between the 3’ end of the target nucleotide sequence and the 5' end of the PAM sequence is in the range of from zero to 22 nucleotides.
  • the genome editing system object of the present invention exploits the ability of the CRISPR-Cas system to target a genomic locus, but replaces the nuclease activity of the Cas enzyme with the action of the nano-transducer which, through controlled heat production, causes, directly or indirectly, breakage of the DNA double helix in the genomic target locus.
  • the genome editing system according to the invention is capable of generating heat in a localized genomic site of a cell, in a nanoscopic volume of liquid, for example a volume of about 10 4 nm 3 , for a very short period of time, so as to cause an absolutely negligible temperature increase in the target cell in order to avoid damage to the latter.
  • the system of the invention comprises a thermophilic restriction endonuclease which can be activated with the heat generated by the nano-transducer.
  • thermophilic means the ability of the restriction enzyme to have greater activity at a temperature above 37°C, preferably at a temperature of 50°C or above.
  • thermophilic restriction endonuclease is active at a temperature of 50°C or above, more preferably at a temperature in the range of from 55°C to 70°C, and at the same time has very low residual activity at 37°C.
  • Thermophilic restriction endonucleases are known and described in the state of the art, therefore the selection and use thereof are within the skills of those of ordinary skill in the art.
  • Taql, ApeKI, BsiHKAI, BstAPI, BstBI, Mwol, PI-PspI, PspGI, Smll, Tfil, TspRI, and Tthl 1 II are mentioned by way of example but not limitation.
  • thermophilic restriction endonuclease can be co administered with the genome editing nano-transducer ( Figure 4A) or covalently linked to the nano-transducer ( Figure 4B).
  • thermophilic restriction endonuclease is coated with a thermosensitive polymer coating as previously described.
  • the enzyme is released following the dissolution or contraction of the thermosensitive polymer coating caused by the heat generated by irradiation of the nano-transducer, as shown in Figure 4B.
  • the thermosensitive polymer coating can preferably comprise one or more Mg 2+ magnesium ions. These ions, released following the thermal dissolution of said coating, can act as enzymatic cofactors by promoting the DNA molecule cutting activity of the restriction endonuclease.
  • the guide nucleotide sequence of the g-RNA molecule is capable of hybridizing to a complementary region of the genomic target sequence which is in proximity to a restriction site of the thermophilic endonuclease on the target sequence.
  • the distance between the 5’ end of the complementary region of the genomic target sequence and the 3’ end of the restriction site or, alternatively, the distance between the 3’ end of the complementary region of the genomic target sequence and the 5’ end of the restriction site is less than or equal to 500 nucleotides, more preferably less than or equal to 100 nucleotides. This ensures that the restriction endonuclease will operate by cutting the DNA molecule exactly at the restriction site near the target sequence targeted by the nano-transducer system of the invention.
  • the above-described configuration of the genome editing system of the invention allows the off-targets (sites that are recognized by the guide RNA because they are similar to the target sequence) to be recognized, where the DNA molecule cannot be cut because the restriction enzyme does not find a restriction site in close proximity, distinguishing them from the on-target (target site recognized by the guide RNA that has a restriction site nearby, and therefore two conditions that must occur simultaneously as an AND logic gate), where the cut takes place because the restriction enzyme finds its binding site that is required for the binding and cutting of the DNA molecule.
  • the genome editing system comprises a first and a second macromolecular complex capable of forming a dimer, as defined in the appended claim 1.
  • the g-RNA of the first macromolecular complex comprises a first guide nucleotide sequence capable of hybridizing to a first complementary region of the genomic target sequence
  • the g-RNA of the second macromolecular complex comprises a second guide nucleotide sequence capable of hybridizing to a second complementary region of the genomic target sequence.
  • the 3’ end of the first complementary region is in close proximity to the 5' end of the second complementary region on the genomic target sequence, the distance between said ends being preferably in the range between zero and 500 nucleotides, more preferably in the range between zero and 200 nucleotides, still more preferably in the range between zero and 100 nucleotides.
  • the first and second guide sequences direct the sequence- specific binding of the first and second macromolecular complexes to the respective first and second complementary sequences in the genomic target sequence, thereby bringing the plasmonic nanoparticles of said first and second complexes close to each other.
  • This mechanism allows the off-targets (sites recognized by a single guide RNA) to be distinguished from the on-target (site recognized by both of the guide RNAs). It is therefore necessary that two conditions occur simultaneously as an AND logic gate.
  • the metallic nanoparticle of the first and second macromolecular complexes is capable of supporting a localized surface plasmon resonance capable of generating a temperature increase of at least 80°C on its surface when the dimer formed by the first macromolecular complex and the second macromolecular complex is exposed to electromagnetic radiation that is resonant with the dimer, at a wavelength in the range between 300 nm and 2 pm.
  • the controlled wavelength is comprised between 300 nm and 2 pm, more preferably between 400 nm and 1800 nm, even more preferably between 450 nm and 1500 nm, very preferably between 500 nm and 900 nm, most preferably between 700 nm and 880 nm.
  • the nanoparticles When two plasmonic nanoparticles are close to each other, the nanoparticles couple together and the behaviour of the dimer prevails over that of the monomer, with consequent shifting of the surface plasmon resonance of the complex to greater wavelengths, therefore towards the red frequencies. Therefore, as shown in Figure 5, following irradiation with a controlled wavelength electromagnetic radiation, preferably in the visible spectrum or in the near- infrared, the heat generated by the plasmonic nanoparticles close to each other initially causes a temperature increase of at least 10°C on the surface of said nanoparticles, as well as dissolution of the respective thermosensitive polymer coatings, if any.
  • a controlled wavelength electromagnetic radiation preferably in the visible spectrum or in the near- infrared
  • the plasmonic nanoparticles to come closer together and a greater coupling thereof, with the formation of a two-particle aggregate (dimer) which has new physical-chemical-optical properties compared to the single component particle.
  • the absorbance peak of the dimer is more evident than the absorbance peak of the single component particle, with consequent further heat emission and temperature increase of at least 80°C on the surface of the dimer, but of less than 10°C at a distance of 10 nm from the surface of the nanoparticle itself ( Figure 7).
  • the heat emission resulting from the formation of the dimer is such as to cause the DNA double strand to break at the contact area between said nanoparticles.
  • the optical behaviour of the dimer is not equal to the sum of the behaviours of the two monomers.
  • the irradiation of the nano-transducer is such as to optimize the absorbance of the dimer and only partially that of the monomer.
  • a laser that is not resonant with the monomer but is resonant with the dimer does not produce a sufficient amount of heat to break a DNA molecule, thereby preventing the risk of unwanted cuts at off-target sites to which the nano-transducer may have been bound in the monomeric form, led there by the guide RNA that can even bind off-target sites, although with less efficiency than the on-target site. Therefore, only a laser resonant with the dimer but not resonant with the monomer causes a sufficient amount of heat to break the DNA molecule when the first and second macromolecular complexes of the genome editing system of the invention bind to said molecule in the dimeric form.
  • the radiation is resonant with the main absorbance peak of the dimer, this causes a very high increase in temperature in a very small volume and for a very short time. In terms of energy produced, it is almost zero and under normal conditions is dissipated in the aqueous medium. Only if the dimer of the two nanoparticles is tightly bound to the DNA by the gRNA/dCas of the first and the second macromolecular complex, respectively, the very close proximity of said dimer to the DNA can cause an amount of heat production suitable for local fusion of the DNA. There is no effect if such contact and interaction in the near field does not occur.
  • the nanoparticles of the first and second macromolecular complexes of the genome editing system are coated with a thermosensitive polymer coating.
  • the presence of said coating makes the genome editing system particularly suitable for biomedical use since it prevents two nanoparticles from being at a sufficient distance to dimerize in a liquid environment where they move freely with Brownian motions.
  • the following events must occur concurrently: i) binding of the first macromolecular complex to the DNA; ii) binding of the second macromolecular complex to the DNA; iii) a distance between the two macromolecular complexes of less than 500 base pairs for dimerization to occur, iv) switching on of a laser in resonance with the absorbance peak of the dimeric form, but not of the monomeric one.
  • a genome editing system comprising at least one macromolecular complex that comprises a nanoparticle selected from a carbon nanotube, a magnetic nanoparticle and a metallic nanoparticle having the characteristics as previously described, associated with one or two expression vectors, and a thermophilic restriction enzyme, also falls within the scope of the present invention.
  • a further object of the present invention is a genome editing system comprising a first macromolecular complex and a second macromolecular complex, said first macromolecular complex and said second macromolecular complex each comprising a metallic nanoparticle capable of supporting a localized surface plasmon resonance, associated with an expression vector.
  • the nucleotide sequences encoding a catalytically inactive Cas nuclease enzyme (dCas) and a single-stranded guide RNA (g-RNA) molecule, as defined above, are inserted in a single expression vector or in two different vectors.
  • dCas catalytically inactive Cas nuclease enzyme
  • g-RNA single-stranded guide RNA
  • the at least one macromolecular complex comprises a nanoparticle as defined above, associated with one or two expression vectors comprising, in addition to the nucleotide sequences encoding the dCas enzyme and the g-RNA, a nucleotide sequence encoding a thermophilic restriction enzyme.
  • the association between the nanoparticle and the expression vector can be mediated by electrostatic interactions.
  • Expression vectors commonly used in the state of the art are suitable for use in the genome editing system of the invention.
  • nucleotide sequences of the expression vector encoding the dCas enzyme and the g-RNA are suitable for expression, for example, in a host cell since they are operably linked to one or more regulatory sequences. This allows, following the transcription of the sequence encoding the g-RNA molecule and the transcription/translation of the sequence encoding the dCas enzyme, said g-RNA molecule and said dCas to associate with the plasmonic nanoparticle to form a macromolecular complex having the first configuration as illustrated above.
  • nucleotide sequence encoding the g-RNA molecule can be operably linked to a promoter that is recognized by eukaryotic RNA polymerase III, preferably a U6 or T7 promoter.
  • the nano-transducer genome editing systems object of the invention therefore have the advantage of carrying out a targeted and selective action, since the cutting function of the Cas enzyme is replaced by the activity of a plasmonic nanoparticle which acts as a nano-transducer, generating heat.
  • the heat generated by the single nanoparticle of the genome editing system of the invention is not sufficient in itself to cut the DNA molecule, but requires the activation of a thermophilic restriction enzyme, or alternatively, a process of dimerization of the plasmonic nanoparticles of a first and a second macromolecular complex.
  • the aforementioned condition is fundamental to ensure the activation of the genome editing system of the invention only when it is linked to the target genomic site (on-target), thus avoiding dangerous off-target cutting events.
  • the activation of the nanotransducer nanoparticle is bound by the occurrence of a certain number of conditions, each under appropriate control. More precisely, the present inventors employed a synthetic biology approach, implementing 3-input AND logic gates. According to Boolean algebra, programming the AND logic gate means establishing a number of binary inputs that produce a single binary output according to the following logical table: the output is true if all the inputs are simultaneously true; the output is false if at least one of the inputs is false.
  • the response of a real biological circuit is sub- optimal and the OFF state is never equal to the value 0 (i.e. the circuit generates a significant output signal even in the OFF state, called background noise).
  • the DNA molecule is cut if the latter has been linked by the g-RNA and if the nuclease is activated; if chimeric Cas enzymes or nickase pairs are used, the DNA molecule is cut if two distinct target sites are recognized.
  • the system of the invention is based on 3-input AND logic gates.
  • DNA cutting occurs only when the following three conditions occur: (i) recognition and binding of the target nucleotide sequence by the g-RNA/dCas macromolecular complex, (ii) activation of the electromagnetic radiation source, for example a laser, for irradiation of the plasmonic nanoparticle with a controlled wavelength, and (iii) recognition of the respective restriction site by the thermophilic endonuclease. Consequently, the frequency of off-target events is significantly reduced, more precisely by a factor of 0.1 x N x 10 N/2 , where N is the number of nucleotides that make up the endonuclease restriction site.
  • the system of the invention represents a 3 -input AND logic gate since the DNA molecule is cut depending on the occurrence of the following events: (i) recognition and binding of the target nucleotide sequence by the first and second macromolecular complexes, (ii) activation of the electromagnetic radiation source, for example a laser, for irradiation of the plasmonic nanoparticle with a controlled wavelength, and (iii) dimerization of the plasmonic nanoparticles of said first and second macromolecular complexes.
  • the electromagnetic radiation source for example a laser
  • the background noise of the system advantageously decreases exponentially, making the frequency of off-target events negligible.
  • An in vitro method of genome editing in a target cell is also an object of the present invention.
  • the method of the invention comprises transforming or transfecting the target cell with a system of the present invention as defined above, and exposing the transformed or transfected cell to a controlled wavelength electromagnetic radiation in the visible spectrum or in the near-infrared, suitable to excite the plasmonic resonance of the nanoparticle and generate an amount of heat such as to induce a temperature increase of at least 10°C.
  • Chemical or physical methods such as for example addition to the culture medium, electroporation, micro-injection and lipofection, can be used for transforming or transfecting the target cell with the system of the invention.
  • the selection of the most appropriate method to be used within the scope of the present invention falls well within the skills of those of ordinary skill in the art.
  • the method of the invention can further comprise placing the transformed or transfected cell under suitable culture conditions to induce expression of the dCas enzyme and the g-RNA molecule.
  • suitable culture conditions and times depend on the target cell and may be related, for example, to the composition of the culture medium, the pH, the relative humidity, the gaseous component of O2 and CO2, as well as the temperature.
  • the visible spectrum or near-infrared electromagnetic radiation used in the method of the invention which can be emitted, for example, by a laser device, has a controlled wavelength comprised between 300 nm and 2 pm, more preferably between 400 nm and 1800 nm, even more preferably between 450 nm and 1500 nm, very preferably between 500 nm and 900 nm, most preferably between 700 nm and 880 nm.
  • the electromagnetic radiation used has a wavelength between 500 and 900 nm
  • the radiation used has a wavelength between 700 nm and 880 nm.
  • the electromagnetic radiation can be a continuous or pulsed radiation, and the irradiation time can be from 1 nano-second to 60 minutes, preferably from 1 second to 30 minutes.
  • irradiation of the target cell, which is transformed or transfected with the genome editing nano-transducer of the invention, with a controlled wavelength electromagnetic radiation results in activation of the plasmonic nanoparticle as a localized heat source thanks to the excitation of the localized plasmon resonance of the nanoparticle and the generation of an amount of heat such as to directly or indirectly cut the DNA molecule, for example by means of a thermophilic endonuclease or a method of dimerization of the plasmonic nanoparticles.
  • the method of the invention advantageously allows a time control function, i.e. the irradiation time, to be integrated with a spatial control function, i.e. the direction of irradiation towards selected target cells.
  • the target cell of the method of the invention is a eukaryotic cell, preferably a mammalian cell, more preferably a human cell, and even more preferably a diseased human cell.
  • the ability to operate on the genome of a target cell in an extremely targeted and selective manner makes the system of the invention particularly suitable for use in clinical-therapeutic applications, in particular applications selectively targeted to diseased cells, but also applications in the biotechnological field, in particular applications for the development of non-human genetically modified organisms for applications in basic research, food processing industry, pharmaceutical industry and development of materials and biofuels.
  • a further object of the present invention is the system of the invention for use as a medicament.
  • the therapeutic use is for the treatment of a disease selected from melanoma, solid tumours and leukemias.
  • EXAMPLE 1 Thermophilic restriction endonuclease-based system
  • NP gold nanoparticles
  • NHS N-hydroxysuccinimide
  • Lyophilized dCas9 protein EnGen® Spy dCas9 (SNAP-tag®) (BM0652T, New England Bioloabs) conjugated to the gold nanoparticle via covalent bonds that are formed between the primary amines exposed on the protein and the NHS groups present on the surface of the nanoparticle was used.
  • g-RNA guide RNA molecule
  • two oligonucleotides were designed, which correspond to the selected target sequence and to the Cas9-recognized constant sequence, having the following sequences, respectively:
  • the above-described genome editing system was used simultaneously with the Tsprl restriction endonuclease, which recognizes a restriction site having the sequence ⁇ NNCASTGNN j and has catalytic activity at 65°C, with 10% residual activity at 37°C.
  • the g-RNA molecules were assessed for their ability to guide the system of the invention towards the target nucleotide sequence located at a distance of 30 base pairs (bp) from the cleavage site of the Tsprl restriction enzyme.
  • the linearized plasmid was irradiated by using a continuous -light laser with an intensity of 100 W/cm 2 and a wavelength of 532 nm.
  • the nanoparticles functionalized with the dCas9 enzyme produced heat, causing a localized increase in temperature above 50°C, thereby inducing activation of the Tsprl enzyme in a limited way at the restriction site adjacent to the target sequence.
  • the sequence-specific cleavage of the DNA double strand catalysed by the restriction endonuclease was made possible by the proximity between the Tsprl enzyme restriction site and the binding site of the CRISPR-Cas system and by the activation of the enzyme by means of the heat produced by the heat generated as a result of the irradiation of the nano transducer.
  • the plasmid was subjected to electrophoresis and the fragmentation of the plasmid was assessed.
  • thermophilic endonuclease according to the invention was used to make a targeted cut on a 460 base pair long fragment of the tyrosinase (Tyr) coding gene.
  • the sequence of the fragment used is as follows:
  • nucleotide sequence SEQ ID NO. 4 the underlined nucleotide bases correspond to the PAM sequence, the upper-case nucleotide bases correspond to the DNA sequence used to design the guide, and the bold and double-underlined nucleotide bases correspond to the Tsprl restriction site.
  • the schematic representation of the cutting point is shown in Figure 8, at the top. The point where the DNA molecule was cut is indicated by an arrow. The cutting effectiveness and specificity of the genome editing system of the invention was assessed by agarose gel electrophoresis, the results of which are illustrated in Figure 8, at the bottom.
  • Lane 1 ladder; lane 2: irradiated sample; lane 3: non-irradiated sample.
  • the presence of two bands at the expected height (312 and 148 bp) in the irradiated sample indicates the breakage of the DNA fragment at the specific site, whereas the non-irradiated sample exhibits a single band.
  • the present inventors used, as the nanoparticles, 10x40 nm gold nanorods (NRs) surface-functionalized with COOH groups and with a resonance frequency of 780 nm.
  • NRs gold nanorods
  • 01igo2 GCGATTTAGGTGACACTATAGGGCACGGGCAGCTTGCCGG
  • the Oligo 1 and Oligo 2 oligonucleotide sequences are complementary to two adjacent sequences, respectively, in the gene encoding for the GFP protein (one complementary sequence on the sense strand and the other complementary sequence on the antisense strand). Both of the Oligo 1 and Oligo 2 oligonucleotides are functionalized at the 5’ end with a - NH2 group which was used to bind the gold nanoparticles using the EDC ( 1 -Ethyl- 3- (3- dimethylaminopropyl)carbodiimide) chemistry.
  • EDC 1 -Ethyl- 3- (3- dimethylaminopropyl)carbodiimide
  • the gold nanoparticles were incubated for 10 minutes in 4% EDC to activate the carboxylic groups.
  • Each oligonucleotide was added in a molar amount of 500: 1 in relation to the number of nanoparticles and incubated for 2 hours at room temperature under stirring.
  • the oligonucleotide-functionalized nanoparticles were separated from the unreacted free oligonucleotides by centrifugation at 20,000g.
  • the concentration of oligonucleotides bound to the nanoparticles was determined by Nanodrop and confirmed by electrophoresis.
  • the oligonucleotide-linked plasmonic nanoparticles were complexed with the dCas9 enzyme (BM0652T, New England Bioloabs), and the first and second macromolecular complexes thus obtained were analysed in vitro on linearized pEGFPC2 plasmids containing the GFP coding sequence.
  • the first and second macromolecular complexes of the invention were assessed for their ability to cut or break the DNA double strand of the GFP coding gene at a point close to the regions complementary to the sequences of the two oligonucleotides functionalized on the nanoparticles, respectively.
  • the linearized plasmid was irradiated with a pulsed-light laser at an intensity of 100 W/cm 2 and a wavelength of about 808 nm.
  • the binding of the first and second macromolecular complexes to the respective target sequences that are close to the DNA induces the nanoparticle of the first complex and the nanoparticle of the second complex to couple together.

Landscapes

  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Immobilizing And Processing Of Enzymes And Microorganisms (AREA)

Abstract

A non-naturally occurring or engineered genome editing system targeting a genomic target sequence in a target cell is described herein. The system of the invention comprises a macromolecular complex characterised in that it comprises a metallic nanoparticle capable of supporting a localized surface plasmon resonance, an inactive Cas nuclease enzyme, and a single-stranded guide RNA (g-RNA) molecule comprising a guide nucleotide sequence capable of hybridizing to a complementary region of the genomic target sequence. Irradiation of the target cell, which is transformed or transfected with the genome editing system of the invention, with a controlled wavelength electromagnetic radiation results in activation of the plasmonic nanoparticle as a localized heat source thanks to the excitation of the localized plasmon resonance of the nanoparticle and the generation of an amount of heat such as to cut the DNA molecule.

Description

Nanotransducer-based genome editing system
The present invention generally falls within the field of genome editing.
More specifically, the invention relates to a system based on a nano-transducer capable of modifying a genomic target sequence in a target cell, preferably a human cell.
The term nanotransducer refers to a nanoparticle capable of generating heat in a controlled way following irradiation with appropriate electromagnetic radiation. Among the biotechnological tools that have revolutionized genetic engineering in the 21st century for genome editing, engineered nuclease enzymes, in particular, zinc finger nucleases (ZFN), transcription activator-like effector nucleases (TALEN), and more recently, the "Clustered Regularly Interspersed Short Palindromic Repeat (CRISPR)-CRISPR associated (Cas) (CRISPR-Cas)" system, play a significant role.
The CRISPR-Cas system, which is based on the use of a nuclease called Cas, transcribed from the CAS (CRISPR-associated) genes, and a single- stranded RNA molecule, the so- called guide RNA (g-RNA), which associate with each other to form the ribonucleoprotein g-RNA/Cas (Figure 1), is the most frequently applied technology. The most used Cas nucleases are Cas9 from the Staphylococcus aureus bacterium and the Cpfl nuclease from Prevotella and Francisella 1. Cas enzyme is a nuclease, i.e. "molecular scissors" capable of making a double- stranded cut at a specific position in the genomic DNA molecule. Typically, the g-RNA guides the Cas protein to the genomic site of interest, whereas the Cas protein is responsible for the helicase activity (i.e. the DNA double helix unwinding), so that a DNA/RNA hybrid is formed between the guide g-RNA and the genomic target DNA and a double- stranded cut is made. Generally, the guide RNA is designed so that it contains a nucleotide sequence that binds to the Cas nuclease, the so-called "scaffold" sequence, and a sequence that is able to recognize and bind a specific DNA target sequence based on the complementary base pairing principle, the so-called "guide" sequence. This means, at least in principle, that the g-RNA directs the Cas enzyme exclusively to cut the target sequence and not other regions in the genome. To successfully bind the Cas enzyme, the DNA target sequence must be immediately followed by a "Protospacer Adjacent Motif" (PAM) nucleotide sequence, which typically contains two to six base pairs.
The repair of a DNA double-strand cut is generally mediated by endogenous mechanisms. Among these, the "non homologous end-join" (NHEJ) repair mechanism is the most common. This mechanism is inherently prone to errors and can introduce mutations (base insertions or deletions) into the cleavage site, thus causing loss of function of the gene. Generally, in genome editing experiments, the NHEJ mechanism is used in order to obtain the so-called gene knock-out, that is the modification of a specific gene resulting in its inactivation. In some cases, however, an alternative DNA repair path called "homology- directed repair" (HDR) can intervene to repair the cut and any mutated gene by using the non-mutated homologous chromosome or an exogenous DNA as the template. This mechanism is typically used to obtain the so-called gene knock-in, i.e. the integration of a desired nucleotide sequence into a specific genomic locus.
However, in the traditional CRISPR-Cas systems, the Cas enzyme can allow mispairing between the g-RNA bases and the bases of a DNA sequence to a considerable extent (up to 5 bases), resulting in possible unplanned alterations at genomic regions other than the target (so-called off-target effects). In large genomes, such as the human genome, the risk that the Cas enzyme of the CRISPR-Cas system may introduce a cut into the DNA molecule at regions other than the target is highly realistic, thus leading to unwanted mutations which, depending on the genetic loci involved, can be extremely dangerous.
In order to limit the frequency of the off-target events of the CRISPR-Cas system, several solutions have recently been attempted, which are mainly based on the regulation of the duration of the activity times of the Cas enzyme. In particular, experimental approaches have been developed in which Cas expression occurs in a transient (Ortinski, PI. et al·,“Integrase- Deficient Lentiviral Vector as an All-in-One Platform for Highly Efficient CRISPR/Cas9- Mediated Gene Editing”; (2017) Mol. Ther. Methods Clin. Dev., 5: 153-164), self-limiting (Chen, Y. et al·,“A Self-restricted CRISPR System to Reduce Off-target Effects”; (2016) Mol. Ther., 24 (9): 1508-10) or inducible manner, for example by chemical or blue light activation (Nihongaki, Y.; Kawano, F.; Nakajima, T.; Sato, M., Photoactivatable CRISPR- Cas9 for optogenetic genome editing. Nature biotechnology 2015, 33 (7), 755-60).
For example, EP3199632 describes a CRISPR-Cas system whose regulation is subject to temperature variation which acts on a particular hairpin structure occurring in the guide RNA molecule, thus blocking its activation. The opening of this hairpin structure following a temperature increase removes the block from the g-RNA molecule, thus allowing the CRISPR-Cas system containing it to operate.
However, although the previously illustrated approaches give the possibility of temporally controlling the activity of the Cas enzyme by limiting the exposure time of the DNA, in particular the genomic DNA, to this nuclease and consequently limiting its specific activity, these strategies have no internal control ability as regards the fidelity of recognition of the target sequence by the CRISPR-Cas system.
In order to improve this recognition, a few technological solutions have been proposed, which substantially comprise the use of Cas9 nuclease variants characterized by an increased specificity of recognition of the DNA sequence targeted by the system or by a decreased binding probability in the absence of an exact match between the guide sequence of the g- RNA and the target nucleotide sequence (mismatch).
Alternatively, approaches based on the generation and use of chimeric enzymes have been implemented to increase the specificity of DNA cutting by the Cas nuclease. However, these approaches have the disadvantage of having mechanisms of action that are complex and cannot be temporally or spatially "activated”. The scientific article by Guilinger, J.P. el al “Fusion of catalytically inactive Cas9 to Fokl nuclease improves the specificity of genome modification”; (2014) Nat. Biotechnol., 32(6): 577-582, for example, illustrates the generation of a fusion protein between a catalytically inactive Cas9 nuclease and a Fokl nuclease. Since the Fokl nuclease is active as a dimer, DNA cleavage requires the association of two Cas9-FokI monomers simultaneously linked to two adjacent target sites. The presence of two adjacent target sites is also an essential requirement for the method described in the article by Ran, F.A .et al “Double nicking by RNA-guided CRISPR Cas9 for enhanced genome editing specificity”; (2013) Cell, 154(6): 1380-92, which uses mutated Cas9 nucleases that cut only one of the two DNA strands, the so-called nickases. According to this approach, double strand cleavage is performed by two distinct Cas9 nickases capable of simultaneously binding two different adjacent target sites.
In the light of the foregoing, despite the numerous experimental efforts made in order to increase precision and control the activation of the CRISPR-Cas technology as an instrument for accurate identification and correction of genetic alterations, this method is still associated with a high frequency of off-target events. The introduction of unwanted mutations at the genomic level represents a consequence with potentially devastating effects, especially when these mutations concern gene regions involved in fundamental cellular processes. Therefore, although having a significant therapeutic potential, the CRISPR/Cas systems of the prior art are not yet considered mature enough to allow their application for genome editing in the clinical field.
Therefore, the object of the present invention is to provide a genome editing system in a target cell with the same degree of efficacy as the systems described in the prior art, but at the same time characterized by a significant greater selectivity of action on the target sequence of the locus of interest and a high level of safety, thus allowing its use also to be extended to the clinical-therapeutic field.
These and other objects are achieved by the genome editing systems as defined in claims 1 to 11 and by the methods of genome editing in a target cell as defined in claims 12 to 15.
Therapeutic applications of the system of the invention also fall within the scope of the present invention.
Preferred embodiments of the invention form the object of the remaining dependent and independent claims. The appended independent and dependent claims form an integral part of the present specification.
As will be apparent from the following detailed description, the genome editing system of the invention has a high safety and reliability profile as it is capable of recognizing and operating with precision and accuracy on its target sequence within the genome complexity.
The genome editing system according to the invention comprises at least one macromolecular complex comprising (i) a nanoparticle which in a physiological environment, following exposure to appropriate electromagnetic radiation, is capable of generating an amount of heat such as to induce a temperature increase of least 10°C for at least 1 millisecond on the surface of said nanoparticle and (ii) an enzymatic complex capable of directing the nanoparticle to the genomic site of interest.
Within the scope of the present invention, the term nanoparticle refers to a nanoparticle selected from a single-walled carbon nanotube (SWCNT) or a multi-walled carbon nanotube (MWCNT) capable of generating heat and a temperature increase of at least 10°C on its surface when exposed to electromagnetic radiation in the radio frequency field (20 kHz - 300 GHz), a magnetic nanoparticle capable of generating heat and a temperature increase of at least 10°C on its surface when exposed to an alternating magnetic field with a frequency of 50-800kHz, and a metallic nanoparticle capable of generating a temperature increase of at least 10°C on its surface when exposed to electromagnetic radiation with a wavelength of from 300 nm to 2 pm. In particular, the metallic nanoparticle is capable of generating heat if optically irradiated with a wavelength close to the localized surface plasmon resonance.
According to a preferred embodiment of the invention, the nanoparticle is a metallic nanoparticle capable of supporting a localized surface plasmon resonance, hereinafter for the sake of brevity referred to as a "plasmonic nanoparticle", capable of absorbing electromagnetic radiation at a controlled wavelength in the visible spectrum or in the near- infrared, i.e. in a wavelength range between about 300 nm and about 2 pm, preferably between 400 nm and 1800 nm, and converting it into heat. As is known in the art, the generation of heat by a plasmonic nanoparticle depends on the magnitude of the detuning or deviation factor, i.e. the difference between the wavelength of the light source used for irradiation and the resonance frequency of the surface plasmons of said nanoparticle (SPR). The graph in Figure 2 illustrates the inverse relationship between the magnitude of the detuning factor and the amount of heat generated by a plasmonic nanoparticle, i.e. the amount of generated heat increases the more the laser is tuned on the SPR wavelength of the plasmonic nanoparticle.
The nanoparticle of the invention can have a spherical shape and a diameter preferably comprised between about 1 nm and about 100 nm, more preferably between 2 nm and 40 nm, even more preferably between 5 nm and 30 nm, most preferably between 10 nm and 20 nm. Alternatively, the nanoparticle of the invention can have a non-spherical shape and at least one dimension preferably comprised between about 1 nm and about 100 nm, more preferably between 2 nm and 40 nm, even more preferably between 5 nm and 30 nm, most preferably between 10 nm and 20 nm.
In the context of the present description, the term "dimension" is intended to include each of the measures that identify and determine the size of a body, both by volume and surface, for example, including the length, the width, the height or the depth.
Particularly preferred examples of metals making up the nanoparticle are gold, silver, copper, titanium, chromium, and any compound thereof. Even more preferably, the plasmonic nanoparticle is a gold or silver nanoparticle.
According to the invention, the plasmonic nanoparticle is optionally coated with a thermosensitive acrylic polymer coating. Within the scope of the present invention, the term "thermosensitive” refers to the ability of the acrylic polymer coating to dissolve or contract following a change in temperature, preferably an increase in temperature to a value preferably comprised between 40°C and 100°C, more preferably between 40°C and 50°C.
Within the scope of the present invention, the thermosensitive polymer coating plays a protective role and at the same time prevents possible aggregations from occurring between the plasmonic nanoparticles in the presence of a plurality of macromolecular complexes. In a preferred embodiment, the thermosensitive acrylic polymer comprises at least one monomer selected from acrylamide (AAm), allylamide hydrochloride (AH), N-isopropylacrylamide (NIP A), bisacrylamide (BIS), and any combination thereof.
In the genome editing system of the invention, the plasmonic nanoparticle can optionally be linked to a single- stranded linker nucleotide sequence, preferably a sequence comprising from 10 to 20 nucleotides, preferably via a disulfide bridge chemical bond.
As previously indicated, the system of the invention also comprises an enzymatic complex capable of directing the nanoparticle to the genomic target sequence.
In a preferred embodiment, the enzymatic complex is a“Clustered Regularly Interspersed Short Palindromic Repeat (CRISPR)-CRISPR associated (Cas) (CRISPR-Cas)” system comprising: a) a Cas nuclease enzyme having one or more mutations capable of abolishing the nuclease activity of said Cas enzyme (hereinafter referred to as dCas); b) a single-stranded guide RNA (g-RNA) molecule comprising from the 3' end to the 5' end: (i) a scaffold nucleotide sequence capable of binding the dCas enzyme, (ii) a guide nucleotide sequence capable of hybridizing to a complementary region of the genomic target sequence, and, optionally, (iii) a single-stranded nucleotide sequence, which for the sake of brevity will be hereinafter referred to as the c-linker, capable of complementarily hybridizing to the linker nucleotide sequence linked to the nanoparticle.
Preferably, the dCas nuclease enzyme used in the genome editing system of the present invention is derived from the enzymes Cas9, Casl2, Cpfl, evoCas9, and Casl3.
Among the dCas9 enzyme mutations that cause inactivation of the nuclease, but not of the helicase activity, D 10A mutation and H840A mutation are mentioned by way of example but not limitation·
According to the invention, the CRISPR-Cas enzyme complex can have a first or second alternative configuration. According to a first configuration illustrated in Figure 3 (A), in the macromolecular complex of the invention the g-RNA molecule is bound to the dCas enzyme via the scaffold nucleotide sequence and the g-RNA molecule is associated with the nanoparticle by hybridization of the c-linker nucleotide sequence to the linker nucleotide sequence.
Alternatively, according to a second configuration illustrated in Figure 3 (B), the g-RNA molecule is bound to the dCas enzyme via the scaffold nucleotide sequence and the dCas enzyme is associated with the nanoparticle via one or more covalent bonds. By way of example, these covalent bonds can be based on an NHS (N-hydroxysuccinimide) or maleimide chemistry.
In both the first and the second configuration of the CRISPR-Cas system of the invention as previously illustrated, the g-RNA molecule allows the nanoparticle as well as the dCas enzyme to be directed towards the target nucleotide sequence thanks to its ability to hybridize thereto. Once positioned on the DNA molecule, which is unwound by the helicase activity of the dCas enzyme, the nanoparticle acts as a nano-transducer as it is capable of generating heat in a controlled manner following irradiation with appropriate electromagnetic radiation. The heat thus released by activation of the nanoparticle breaks the DNA double strand and optionally causes the thermosensitive polymer coating, when present, to dissolve. Said breakage, for example, may result in the inactivation of a specific gene (knock out) or be used for introducing an exogenous nucleotide sequence (knock in).
Generally, the genomic target sequence is located immediately upstream of a Protospacer Adjacent Motif (PAM) nucleotide sequence, preferably NGG (where N is a generic nucleotide and G is guanosine) (Shiraz A et al“Protospacer recognition motifs” RNA Biol. 2013 May 1; 10(5): 891-899). Typically, the distance between the 3’ end of the target nucleotide sequence and the 5' end of the PAM sequence is in the range of from zero to 22 nucleotides.
The genome editing system object of the present invention exploits the ability of the CRISPR-Cas system to target a genomic locus, but replaces the nuclease activity of the Cas enzyme with the action of the nano-transducer which, through controlled heat production, causes, directly or indirectly, breakage of the DNA double helix in the genomic target locus. Advantageously, the genome editing system according to the invention is capable of generating heat in a localized genomic site of a cell, in a nanoscopic volume of liquid, for example a volume of about 104 nm3, for a very short period of time, so as to cause an absolutely negligible temperature increase in the target cell in order to avoid damage to the latter. According to an embodiment illustrated in Figures 4A and 4B, the system of the invention comprises a thermophilic restriction endonuclease which can be activated with the heat generated by the nano-transducer.
In the context of the present invention, the term "thermophilic" means the ability of the restriction enzyme to have greater activity at a temperature above 37°C, preferably at a temperature of 50°C or above.
Preferably, in the genome editing system according to the invention, the thermophilic restriction endonuclease is active at a temperature of 50°C or above, more preferably at a temperature in the range of from 55°C to 70°C, and at the same time has very low residual activity at 37°C.
This allows, in the presence of the heat generated by the nanoparticle after controlled irradiation, the restriction endonuclease to be functionally active and to cut the DNA molecule (Figure 4).
Thermophilic restriction endonucleases are known and described in the state of the art, therefore the selection and use thereof are within the skills of those of ordinary skill in the art. Taql, ApeKI, BsiHKAI, BstAPI, BstBI, Mwol, PI-PspI, PspGI, Smll, Tfil, TspRI, and Tthl 1 II are mentioned by way of example but not limitation.
For the purposes of the following invention, the thermophilic restriction endonuclease can be co administered with the genome editing nano-transducer (Figure 4A) or covalently linked to the nano-transducer (Figure 4B).
According to a preferred embodiment, the thermophilic restriction endonuclease is coated with a thermosensitive polymer coating as previously described. In the latter case, the enzyme is released following the dissolution or contraction of the thermosensitive polymer coating caused by the heat generated by irradiation of the nano-transducer, as shown in Figure 4B. The thermosensitive polymer coating can preferably comprise one or more Mg2+ magnesium ions. These ions, released following the thermal dissolution of said coating, can act as enzymatic cofactors by promoting the DNA molecule cutting activity of the restriction endonuclease.
In this embodiment, the guide nucleotide sequence of the g-RNA molecule is capable of hybridizing to a complementary region of the genomic target sequence which is in proximity to a restriction site of the thermophilic endonuclease on the target sequence. Preferably, the distance between the 5’ end of the complementary region of the genomic target sequence and the 3’ end of the restriction site or, alternatively, the distance between the 3’ end of the complementary region of the genomic target sequence and the 5’ end of the restriction site is less than or equal to 500 nucleotides, more preferably less than or equal to 100 nucleotides. This ensures that the restriction endonuclease will operate by cutting the DNA molecule exactly at the restriction site near the target sequence targeted by the nano-transducer system of the invention. More specifically, the above-described configuration of the genome editing system of the invention allows the off-targets (sites that are recognized by the guide RNA because they are similar to the target sequence) to be recognized, where the DNA molecule cannot be cut because the restriction enzyme does not find a restriction site in close proximity, distinguishing them from the on-target (target site recognized by the guide RNA that has a restriction site nearby, and therefore two conditions that must occur simultaneously as an AND logic gate), where the cut takes place because the restriction enzyme finds its binding site that is required for the binding and cutting of the DNA molecule.
In another embodiment shown in Figure 5, the genome editing system according to the invention comprises a first and a second macromolecular complex capable of forming a dimer, as defined in the appended claim 1. In this embodiment, the g-RNA of the first macromolecular complex comprises a first guide nucleotide sequence capable of hybridizing to a first complementary region of the genomic target sequence, and the g-RNA of the second macromolecular complex comprises a second guide nucleotide sequence capable of hybridizing to a second complementary region of the genomic target sequence. According to this embodiment, the 3’ end of the first complementary region is in close proximity to the 5' end of the second complementary region on the genomic target sequence, the distance between said ends being preferably in the range between zero and 500 nucleotides, more preferably in the range between zero and 200 nucleotides, still more preferably in the range between zero and 100 nucleotides.
Accordingly, in this embodiment, the first and second guide sequences direct the sequence- specific binding of the first and second macromolecular complexes to the respective first and second complementary sequences in the genomic target sequence, thereby bringing the plasmonic nanoparticles of said first and second complexes close to each other. This mechanism allows the off-targets (sites recognized by a single guide RNA) to be distinguished from the on-target (site recognized by both of the guide RNAs). It is therefore necessary that two conditions occur simultaneously as an AND logic gate.
According to the invention, the metallic nanoparticle of the first and second macromolecular complexes is capable of supporting a localized surface plasmon resonance capable of generating a temperature increase of at least 80°C on its surface when the dimer formed by the first macromolecular complex and the second macromolecular complex is exposed to electromagnetic radiation that is resonant with the dimer, at a wavelength in the range between 300 nm and 2 pm.
Preferably, the controlled wavelength is comprised between 300 nm and 2 pm, more preferably between 400 nm and 1800 nm, even more preferably between 450 nm and 1500 nm, very preferably between 500 nm and 900 nm, most preferably between 700 nm and 880 nm.
When two plasmonic nanoparticles are close to each other, the nanoparticles couple together and the behaviour of the dimer prevails over that of the monomer, with consequent shifting of the surface plasmon resonance of the complex to greater wavelengths, therefore towards the red frequencies. Therefore, as shown in Figure 5, following irradiation with a controlled wavelength electromagnetic radiation, preferably in the visible spectrum or in the near- infrared, the heat generated by the plasmonic nanoparticles close to each other initially causes a temperature increase of at least 10°C on the surface of said nanoparticles, as well as dissolution of the respective thermosensitive polymer coatings, if any. This causes the plasmonic nanoparticles to come closer together and a greater coupling thereof, with the formation of a two-particle aggregate (dimer) which has new physical-chemical-optical properties compared to the single component particle. As shown in Figure 6, the absorbance peak of the dimer is more evident than the absorbance peak of the single component particle, with consequent further heat emission and temperature increase of at least 80°C on the surface of the dimer, but of less than 10°C at a distance of 10 nm from the surface of the nanoparticle itself (Figure 7). The heat emission resulting from the formation of the dimer is such as to cause the DNA double strand to break at the contact area between said nanoparticles.
As shown in Figure 6, the optical behaviour of the dimer is not equal to the sum of the behaviours of the two monomers. The graph in Figure 6 shows the absorbance profile for the monomer (curve a) and the dimer at different distances (gaps) between its two component particles (curves b - 1). This different behaviour is particularly evident in curve (1) corresponding to the actual dimer (gap = 0, the nanoparticles touch each other), in which the different values of the absorbance peaks at 900-930 nm of the dimer and the monomer highlight their different optical behaviour.
Unlike the state of the art in which the use of nanoparticles for generating heat for the release of a dmg or for cell ablation is based on the use of the single nanoparticle and on maximizing its absorbance peak, in the embodiment of the invention as previously described, the irradiation of the nano-transducer is such as to optimize the absorbance of the dimer and only partially that of the monomer. Advantageously, a laser that is not resonant with the monomer but is resonant with the dimer does not produce a sufficient amount of heat to break a DNA molecule, thereby preventing the risk of unwanted cuts at off-target sites to which the nano-transducer may have been bound in the monomeric form, led there by the guide RNA that can even bind off-target sites, although with less efficiency than the on-target site. Therefore, only a laser resonant with the dimer but not resonant with the monomer causes a sufficient amount of heat to break the DNA molecule when the first and second macromolecular complexes of the genome editing system of the invention bind to said molecule in the dimeric form.
According to the present invention, if the radiation is resonant with the main absorbance peak of the dimer, this causes a very high increase in temperature in a very small volume and for a very short time. In terms of energy produced, it is almost zero and under normal conditions is dissipated in the aqueous medium. Only if the dimer of the two nanoparticles is tightly bound to the DNA by the gRNA/dCas of the first and the second macromolecular complex, respectively, the very close proximity of said dimer to the DNA can cause an amount of heat production suitable for local fusion of the DNA. There is no effect if such contact and interaction in the near field does not occur. In fact, as shown in Figure 7, a strong increase in temperature is observed (line a) at the surface of the dimer (and therefore near the genomic target), whereas a substantial absence of temperature rise is observed in the surrounding environment (line b). This means that only the DNA in close contact with the dimer is susceptible to breakage, safeguarding any other genomic locus and/or the cell as a whole from unwanted effects.
In a preferred embodiment, the nanoparticles of the first and second macromolecular complexes of the genome editing system are coated with a thermosensitive polymer coating. According to the invention, the presence of said coating makes the genome editing system particularly suitable for biomedical use since it prevents two nanoparticles from being at a sufficient distance to dimerize in a liquid environment where they move freely with Brownian motions.
In the light of the foregoing, in order for the DNA molecule to be cut and the genome editing event to occur by means of the system according to the invention comprising a first and a second macromolecular complex, the following events must occur concurrently: i) binding of the first macromolecular complex to the DNA; ii) binding of the second macromolecular complex to the DNA; iii) a distance between the two macromolecular complexes of less than 500 base pairs for dimerization to occur, iv) switching on of a laser in resonance with the absorbance peak of the dimeric form, but not of the monomeric one.
A genome editing system comprising at least one macromolecular complex that comprises a nanoparticle selected from a carbon nanotube, a magnetic nanoparticle and a metallic nanoparticle having the characteristics as previously described, associated with one or two expression vectors, and a thermophilic restriction enzyme, also falls within the scope of the present invention.
A further object of the present invention is a genome editing system comprising a first macromolecular complex and a second macromolecular complex, said first macromolecular complex and said second macromolecular complex each comprising a metallic nanoparticle capable of supporting a localized surface plasmon resonance, associated with an expression vector.
According to the invention, in both the previously described genome editing system configurations, i.e. the dimer configuration and/or the configuration comprising a thermophilic restriction enzyme, the nucleotide sequences encoding a catalytically inactive Cas nuclease enzyme (dCas) and a single-stranded guide RNA (g-RNA) molecule, as defined above, are inserted in a single expression vector or in two different vectors.
In a further configuration of the genome editing system that works with the thermophilic endonuclease, the at least one macromolecular complex comprises a nanoparticle as defined above, associated with one or two expression vectors comprising, in addition to the nucleotide sequences encoding the dCas enzyme and the g-RNA, a nucleotide sequence encoding a thermophilic restriction enzyme.
According to the invention, the association between the nanoparticle and the expression vector can be mediated by electrostatic interactions.
Expression vectors commonly used in the state of the art are suitable for use in the genome editing system of the invention.
Within the scope of the present invention, the nucleotide sequences of the expression vector encoding the dCas enzyme and the g-RNA are suitable for expression, for example, in a host cell since they are operably linked to one or more regulatory sequences. This allows, following the transcription of the sequence encoding the g-RNA molecule and the transcription/translation of the sequence encoding the dCas enzyme, said g-RNA molecule and said dCas to associate with the plasmonic nanoparticle to form a macromolecular complex having the first configuration as illustrated above.
Regulatory sequences suitable for use in gene expression are known and described in the state of the art, therefore the selection and use thereof are well within the skills of those of ordinary skill in the art. Promoters, for example inducible promoters, as well as enhancers, internal ribosome entry sites and/or transcription termination signals are mentioned by way of non-limiting example. For example, the nucleotide sequence encoding the g-RNA molecule can be operably linked to a promoter that is recognized by eukaryotic RNA polymerase III, preferably a U6 or T7 promoter.
Compared to the prior art, the nano-transducer genome editing systems object of the invention therefore have the advantage of carrying out a targeted and selective action, since the cutting function of the Cas enzyme is replaced by the activity of a plasmonic nanoparticle which acts as a nano-transducer, generating heat. Advantageously, the heat generated by the single nanoparticle of the genome editing system of the invention is not sufficient in itself to cut the DNA molecule, but requires the activation of a thermophilic restriction enzyme, or alternatively, a process of dimerization of the plasmonic nanoparticles of a first and a second macromolecular complex. The aforementioned condition is fundamental to ensure the activation of the genome editing system of the invention only when it is linked to the target genomic site (on-target), thus avoiding dangerous off-target cutting events.
In fact, the activation of the nanotransducer nanoparticle is bound by the occurrence of a certain number of conditions, each under appropriate control. More precisely, the present inventors employed a synthetic biology approach, implementing 3-input AND logic gates. According to Boolean algebra, programming the AND logic gate means establishing a number of binary inputs that produce a single binary output according to the following logical table: the output is true if all the inputs are simultaneously true; the output is false if at least one of the inputs is false. Typically, the response of a real biological circuit is sub- optimal and the OFF state is never equal to the value 0 (i.e. the circuit generates a significant output signal even in the OFF state, called background noise). Therefore, in principle, biological circuits that output a genome editing event have a certain off-target frequency. However, adding more inputs to a logic gate leads to an increase in the number of possible states (2n, where n is the number of inputs). In this context, the traditional CRISPR/Cas system of the prior art can be considered as a 1 -input logic gate since genome editing occurs if the target DNA sequence is recognized and linked by the guide RNA. Instead, the use of inducible or chimeric Cas nucleases, or nickase pairs, implements 2-input AND logic gates. More specifically, in the presence of an inducible Cas enzyme, the DNA molecule is cut if the latter has been linked by the g-RNA and if the nuclease is activated; if chimeric Cas enzymes or nickase pairs are used, the DNA molecule is cut if two distinct target sites are recognized. Instead, the system of the invention is based on 3-input AND logic gates.
In particular, according to the embodiment in Figure 4, DNA cutting occurs only when the following three conditions occur: (i) recognition and binding of the target nucleotide sequence by the g-RNA/dCas macromolecular complex, (ii) activation of the electromagnetic radiation source, for example a laser, for irradiation of the plasmonic nanoparticle with a controlled wavelength, and (iii) recognition of the respective restriction site by the thermophilic endonuclease. Consequently, the frequency of off-target events is significantly reduced, more precisely by a factor of 0.1 x N x 10 N/2, where N is the number of nucleotides that make up the endonuclease restriction site.
Also in the embodiment of Figure 5, the system of the invention represents a 3 -input AND logic gate since the DNA molecule is cut depending on the occurrence of the following events: (i) recognition and binding of the target nucleotide sequence by the first and second macromolecular complexes, (ii) activation of the electromagnetic radiation source, for example a laser, for irradiation of the plasmonic nanoparticle with a controlled wavelength, and (iii) dimerization of the plasmonic nanoparticles of said first and second macromolecular complexes.
In this condition, the frequency of off-target events is theoretically reduced by a factor of 1/n2 (1/n being the off-target frequency related to the recognition of a single target site).
As a consequence of the increase in the number of inputs, and therefore in the number of possible states, the background noise of the system advantageously decreases exponentially, making the frequency of off-target events negligible.
An in vitro method of genome editing in a target cell, as defined in the appended claim 12, is also an object of the present invention. The method of the invention comprises transforming or transfecting the target cell with a system of the present invention as defined above, and exposing the transformed or transfected cell to a controlled wavelength electromagnetic radiation in the visible spectrum or in the near-infrared, suitable to excite the plasmonic resonance of the nanoparticle and generate an amount of heat such as to induce a temperature increase of at least 10°C.
Chemical or physical methods, such as for example addition to the culture medium, electroporation, micro-injection and lipofection, can be used for transforming or transfecting the target cell with the system of the invention. The selection of the most appropriate method to be used within the scope of the present invention falls well within the skills of those of ordinary skill in the art.
When the macromolecular complex comprises the plasmonic nanoparticle associated with the expression vector, the method of the invention can further comprise placing the transformed or transfected cell under suitable culture conditions to induce expression of the dCas enzyme and the g-RNA molecule. Typically, suitable culture conditions and times depend on the target cell and may be related, for example, to the composition of the culture medium, the pH, the relative humidity, the gaseous component of O2 and CO2, as well as the temperature.
Preferably, the visible spectrum or near-infrared electromagnetic radiation used in the method of the invention, which can be emitted, for example, by a laser device, has a controlled wavelength comprised between 300 nm and 2 pm, more preferably between 400 nm and 1800 nm, even more preferably between 450 nm and 1500 nm, very preferably between 500 nm and 900 nm, most preferably between 700 nm and 880 nm. In particular for biotechnological applications, such as development of recombinant dmgs, creation of model organisms, production of non-human genetically modified organisms for basic research studies and for food processing industry, biofuels production, generation of synthetic materials, the electromagnetic radiation used has a wavelength between 500 and 900 nm, whereas for clinical-therapeutic applications such as, for example, gene therapy, the radiation used has a wavelength between 700 nm and 880 nm.
According to the method of the invention, the electromagnetic radiation can be a continuous or pulsed radiation, and the irradiation time can be from 1 nano-second to 60 minutes, preferably from 1 second to 30 minutes. As previously illustrated, irradiation of the target cell, which is transformed or transfected with the genome editing nano-transducer of the invention, with a controlled wavelength electromagnetic radiation results in activation of the plasmonic nanoparticle as a localized heat source thanks to the excitation of the localized plasmon resonance of the nanoparticle and the generation of an amount of heat such as to directly or indirectly cut the DNA molecule, for example by means of a thermophilic endonuclease or a method of dimerization of the plasmonic nanoparticles. In this way, the method of the invention advantageously allows a time control function, i.e. the irradiation time, to be integrated with a spatial control function, i.e. the direction of irradiation towards selected target cells.
According to a more preferred embodiment, the target cell of the method of the invention is a eukaryotic cell, preferably a mammalian cell, more preferably a human cell, and even more preferably a diseased human cell.
As previously described, the ability to operate on the genome of a target cell in an extremely targeted and selective manner makes the system of the invention particularly suitable for use in clinical-therapeutic applications, in particular applications selectively targeted to diseased cells, but also applications in the biotechnological field, in particular applications for the development of non-human genetically modified organisms for applications in basic research, food processing industry, pharmaceutical industry and development of materials and biofuels.
Therefore, a further object of the present invention is the system of the invention for use as a medicament. Preferably, but not by way of limitation, the therapeutic use is for the treatment of a disease selected from melanoma, solid tumours and leukemias.
The experimental section that follows is provided for illustration purposes only and does not limit the scope of the invention as defined in the appended claims.
EXAMPLE 1: Thermophilic restriction endonuclease-based system For the construction of the system described in this example, the present inventors used 30- nm diameter gold nanoparticles (NP) having a resonance frequency of 526 nm and surface- functionalized with N-hydroxysuccinimide (NHS) ester groups.
Lyophilized dCas9 protein EnGen® Spy dCas9 (SNAP-tag®) (BM0652T, New England Bioloabs) conjugated to the gold nanoparticle via covalent bonds that are formed between the primary amines exposed on the protein and the NHS groups present on the surface of the nanoparticle was used.
For the in vitro synthesis of the guide RNA molecule (g-RNA), two oligonucleotides were designed, which correspond to the selected target sequence and to the Cas9-recognized constant sequence, having the following sequences, respectively:
GCGATTTAGGTGACACTATATTCAAGTCCGCCATGCCCGAGTTTTAGAGCTAG AAATAGCAAG (SEQ ID NO. l);
AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTT T A ACTTGCT ATTT CT AGCT CT A A A AC (SEQ ID NO.2).
The above-described genome editing system was used simultaneously with the Tsprl restriction endonuclease, which recognizes a restriction site having the sequence † NNCASTGNN j and has catalytic activity at 65°C, with 10% residual activity at 37°C.
The efficiency and specificity of the genome editing system of the invention, including the Tsprl enzyme, were assessed in vitro by using linearized pEGFPC2 plasmids containing the GFP coding sequence.
In particular, the g-RNA molecules were assessed for their ability to guide the system of the invention towards the target nucleotide sequence located at a distance of 30 base pairs (bp) from the cleavage site of the Tsprl restriction enzyme.
The linearized plasmid was irradiated by using a continuous -light laser with an intensity of 100 W/cm2 and a wavelength of 532 nm. Following irradiation, the nanoparticles functionalized with the dCas9 enzyme produced heat, causing a localized increase in temperature above 50°C, thereby inducing activation of the Tsprl enzyme in a limited way at the restriction site adjacent to the target sequence. The sequence- specific cleavage of the DNA double strand catalysed by the restriction endonuclease was made possible by the proximity between the Tsprl enzyme restriction site and the binding site of the CRISPR-Cas system and by the activation of the enzyme by means of the heat produced by the heat generated as a result of the irradiation of the nano transducer.
To demonstrate that GFP had been cleaved by the enzyme, the plasmid was subjected to electrophoresis and the fragmentation of the plasmid was assessed.
In another experiment carried out by the present inventors, the genome editing system comprising a thermophilic endonuclease according to the invention was used to make a targeted cut on a 460 base pair long fragment of the tyrosinase (Tyr) coding gene. The sequence of the fragment used is as follows:
5’gtgaagcctctcactctcctcgactcttcatcatcatgtctctccatctcctcctcttcttcttcctccagctcttcagctcgtctctcca gcagttcccccgagtctgcacctCCCCAGAAGTCCTCCAGTCCaaacgctgctgtccagtctggcccggcgac ggctccgtgtgcggcgtccagtcaggtcgagggttctgtcaggacgtcctggtgtccgaccttcccaacgggccgcagtatcctca ctcaggagtggacgatcgagagcgatggcctttagtgttttacaaccaaacctggeaglgegccggaaactacatggggtttgatt gcggcgaatgcaagttcggcttcttcggtgccaactgcgcagagagacgcgagtctgtgcgcagaaatatattccagctgtccact accgagaggcagaggttcatctcgtacctaaatctgg 3’ (SEQ ID NO.4).
In nucleotide sequence SEQ ID NO. 4, the underlined nucleotide bases correspond to the PAM sequence, the upper-case nucleotide bases correspond to the DNA sequence used to design the guide, and the bold and double-underlined nucleotide bases correspond to the Tsprl restriction site. The schematic representation of the cutting point is shown in Figure 8, at the top. The point where the DNA molecule was cut is indicated by an arrow. The cutting effectiveness and specificity of the genome editing system of the invention was assessed by agarose gel electrophoresis, the results of which are illustrated in Figure 8, at the bottom. Lane 1: ladder; lane 2: irradiated sample; lane 3: non-irradiated sample. The presence of two bands at the expected height (312 and 148 bp) in the irradiated sample indicates the breakage of the DNA fragment at the specific site, whereas the non-irradiated sample exhibits a single band.
EXAMPLE 2: Dimer-based system
For this experimental model, the present inventors used, as the nanoparticles, 10x40 nm gold nanorods (NRs) surface-functionalized with COOH groups and with a resonance frequency of 780 nm.
For the preparation of the g-RNA molecules, two oligonucleotides having the following sequences were designed:
Oligol:
GCGATTTAGGTGACACTATATTCAAGTCCGCCATGCCCGAGTTTTAGAGCTAG AAATAGCAAG (SEQ ID NO. l).
01igo2: GCGATTTAGGTGACACTATAGGGCACGGGCAGCTTGCCGG
GTTTTAGAGCTAGAAATAGCAAG (SEQ ID NO.3).
For both, the oligo for the constant portion is:
AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTT T A ACTTGCT ATTT CT AGCT CT A A A AC (SEQ ID NO.2).
The Oligo 1 and Oligo 2 oligonucleotide sequences are complementary to two adjacent sequences, respectively, in the gene encoding for the GFP protein (one complementary sequence on the sense strand and the other complementary sequence on the antisense strand). Both of the Oligo 1 and Oligo 2 oligonucleotides are functionalized at the 5’ end with a - NH2 group which was used to bind the gold nanoparticles using the EDC ( 1 -Ethyl- 3- (3- dimethylaminopropyl)carbodiimide) chemistry.
Briefly, the gold nanoparticles were incubated for 10 minutes in 4% EDC to activate the carboxylic groups. Each oligonucleotide was added in a molar amount of 500: 1 in relation to the number of nanoparticles and incubated for 2 hours at room temperature under stirring. The oligonucleotide-functionalized nanoparticles were separated from the unreacted free oligonucleotides by centrifugation at 20,000g. The concentration of oligonucleotides bound to the nanoparticles was determined by Nanodrop and confirmed by electrophoresis. Subsequently, the oligonucleotide-linked plasmonic nanoparticles were complexed with the dCas9 enzyme (BM0652T, New England Bioloabs), and the first and second macromolecular complexes thus obtained were analysed in vitro on linearized pEGFPC2 plasmids containing the GFP coding sequence. In particular, the first and second macromolecular complexes of the invention were assessed for their ability to cut or break the DNA double strand of the GFP coding gene at a point close to the regions complementary to the sequences of the two oligonucleotides functionalized on the nanoparticles, respectively.
The linearized plasmid was irradiated with a pulsed-light laser at an intensity of 100 W/cm2 and a wavelength of about 808 nm.
The binding of the first and second macromolecular complexes to the respective target sequences that are close to the DNA induces the nanoparticle of the first complex and the nanoparticle of the second complex to couple together.
When two plasmonic structures come into close contact, their electromagnetic fields couple together, and the resonant wavelength peak of two interacting particles is shifted towards the red compared to that of the individual nanoparticles (Figure 6). The resonance frequency shift caused by the coupling of the two nanoparticles on the GFP coding gene brings the resonance frequency much closer to the radiation frequency (808 nm). This causes an increase in the excitation efficiency with a consequent increase in the local temperature (Figure 7) and subsequent breakage of the double strand at the point of the GFP gene where the two nanoparticles are in contact with each other.

Claims

1. A non-naturally occurring or engineered genome editing system targeting a genomic target sequence in a target cell, the system comprising a first macromolecular complex and a second macromolecular complex capable of forming a dimer, said first macromolecular complex and said second macromolecular complex each comprising:
1) a metallic nanoparticle capable of supporting a localized surface plasmon resonance capable of generating a temperature increase of at least 80°C on the surface of said nanoparticle when the dimer formed by said first macromolecular complex and said second macromolecular complex is exposed to electromagnetic radiation that is resonant with said dimer, at a wavelength in the range between 300 nm and 2 pm;
wherein said nanoparticle is optionally covalently linked to a single- stranded linker nucleotide sequence;
2) a DNA-binding enzymatic complex capable of directing said nanoparticle towards the genomic target sequence, said enzymatic complex being a“Clustered Regularly Interspersed Short Palindromic Repeat (CRISPR)-CRISPR associated (Cas) (CRISPR-Cas)” system comprising:
a) a Cas nuclease enzyme comprising one or more mutations capable of abolishing the nuclease activity of said Cas enzyme (dCas);
b) a single- stranded guide RNA (g-RNA) molecule comprising from the 3' end to the 5' end: (I) a scaffold nucleotide sequence capable of binding the dCas enzyme; (P) a guide nucleotide sequence capable of hybridizing to a complementary region of the genomic target sequence; and, optionally, (PI) a single- stranded c-linker nucleotide sequence capable of complementarily hybridizing to the linker nucleotide sequence optionally linked to the metallic nanoparticle;
wherein the g-RNA of the first macromolecular complex comprises a first guide nucleotide sequence capable of hybridizing to a first complementary region of the genomic target sequence, and the g-RNA of the second macromolecular complex comprises a second guide nucleotide sequence capable of hybridizing to a second complementary region of the genomic target sequence, wherein the 3' end of said first complementary region is in close proximity to the 5' end of said second complementary region on the genomic target sequence; and
wherein in said first macromolecular complex and in said second macromolecular complex the g-RNA molecule is bound to the dCas enzyme via the scaffold nucleotide sequence and wherein the g-RNA molecule is associated with the nanoparticle by hybridization of the c- linker nucleotide sequence to the linker nucleotide sequence, or alternatively,
wherein in said first macromolecular complex and in said second macromolecular complex the g-RNA molecule is bound to the dCas enzyme via the scaffold nucleotide sequence and the dCas enzyme is associated with the metallic nanoparticle via one or more covalent bonds.
2. A non-naturally occurring or engineered genome editing system targeting a genomic target sequence in a target cell, the system comprising a first macromolecular complex and a second macromolecular complex capable of forming a dimer, said first macromolecular complex and said second macromolecular complex each comprising:
1) a metallic nanoparticle capable of supporting a localized surface plasmon resonance capable of generating a temperature increase of at least 80°C on the surface of said nanoparticle when the dimer formed by said first macromolecular complex and said second macromolecular complex is exposed to electromagnetic radiation that is resonant with said dimer, at a wavelength in the range between 300 nm and 2 pm;
wherein said nanoparticle is optionally covalently linked to a single- stranded linker nucleotide sequence;
2) at least one expression vector comprising:
a) a nucleotide sequence encoding a Cas nuclease enzyme comprising one or more mutations capable of abolishing the nuclease activity of said Cas enzyme (dCas), said coding nucleotide sequence being operably linked to one or more regulatory sequences located on the vector; and b) a nucleotide sequence encoding a single-stranded guide RNA (g-RNA) operably linked to one or more regulatory sequences located on the vector, wherein said g-RNA comprises from the 3' end to the 5' end: (I) a scaffold nucleotide sequence capable of binding the dCas enzyme; (P) a guide nucleotide sequence capable of hybridizing to a complementary region of the genomic target sequence; and, optionally, (PI) a single- stranded c-linker nucleotide sequence capable of complementarily hybridizing to the linker nucleotide sequence optionally linked to the nanoparticle;
wherein the g-RNA of the first macromolecular complex comprises a first guide nucleotide sequence capable of hybridizing to a first complementary region of the genomic target sequence, and the g-RNA of the second macromolecular complex comprises a second guide nucleotide sequence capable of hybridizing to a second complementary region of the genomic target sequence, wherein the 3' end of said first complementary region is in close proximity to the 5' end of said second complementary region on the genomic target sequence.
3. A non-naturally occurring or engineered genome editing system targeting a genomic target sequence in a target cell, the system comprising at least one macromolecular complex comprising:
1) a nanoparticle selected from the group consisting of: (i) single-walled carbon nanotubes (SWCNT) or multi-walled carbon nanotubes (MWCNT) capable of generating a temperature increase of at least 10°C on their surface when exposed to electromagnetic radiation with a frequency of from 20 kHz to 300 GHz; (ii) magnetic nanoparticles capable of generating a temperature increase of at least 10°C on their surface when exposed to an alternating magnetic field with a frequency of 50 to 800kHz; and (iii) metallic nanoparticles capable of generating a temperature increase of at least 10°C on their surface when exposed to electromagnetic radiation with a wavelength of from 300 nm to 2 pm;
wherein said nanoparticle is optionally covalently linked to a single-stranded linker nucleotide sequence;
2) a DNA-binding enzymatic complex capable of directing said nanoparticle towards the genomic target sequence, the enzymatic complex being a“Clustered Regularly Interspersed Short Palindromic Repeat (CRISPR)-CRISPR associated (Cas) (CRISPR-Cas)” system comprising:
a) a Cas nuclease enzyme comprising one or more mutations capable of abolishing the nuclease activity of said Cas enzyme (dCas);
b) a single- stranded guide RNA (g-RNA) molecule comprising from the 3' end to the 5' end: (I) a scaffold nucleotide sequence capable of binding the dCas enzyme; (P) a guide nucleotide sequence capable of hybridizing to a complementary region of the genomic target sequence; and, optionally, (PI) a single- stranded c-linker nucleotide sequence capable of complementarily hybridizing to the linker nucleotide sequence optionally linked to the metallic nanoparticle;
wherein the g-RNA molecule is bound to the dCas enzyme via the scaffold nucleotide sequence and wherein the g-RNA molecule is associated with the nanoparticle by hybridization of the c-linker nucleotide sequence to the linker nucleotide sequence, or alternatively, wherein the g-RNA molecule is bound to the dCas enzyme via the scaffold nucleotide sequence and the dCas enzyme is associated with the metallic nanoparticle via one or more covalent bonds; and
3) a thermophilic restriction endonuclease, wherein the 5’ end of the complementary region of the guide nucleotide sequence of the g-RNA molecule is in close proximity to the 3' end of a restriction site of said restriction endonuclease on the genomic target sequence or the 3’ end of said complementary region is in close proximity to the 5’ end of said restriction site on the genomic target sequence.
4. A non-naturally occurring or engineered genome editing system targeting a genomic target sequence in a target cell, the system comprising at least one macromolecular complex comprising:
1) a nanoparticle selected from the group consisting of: (i) single-walled carbon nanotubes (SWCNT) or multi-walled carbon nanotubes (MWCNT) capable of generating a temperature increase of at least 10°C on their surface when exposed to electromagnetic radiation with a frequency of from 20 kHz to 300 GHz; (ii) magnetic nanoparticles capable of generating a temperature increase of at least 10°C on their surface when exposed to an alternating magnetic field with a frequency of 50 to 800kHz; and (iii) metallic nanoparticles capable of generating a temperature increase of at least 10°C on their surface when exposed to electromagnetic radiation with a wavelength of from 300 nm to 2 pm;
wherein said nanoparticle is optionally covalently linked to a single-stranded linker nucleotide sequence;
2) at least one expression vector comprising:
a) a nucleotide sequence encoding a Cas nuclease enzyme comprising one or more mutations capable of abolishing the nuclease activity of said Cas enzyme (dCas), said nucleotide sequence being operably linked to one or more regulatory sequences located on the vector; and
b) a nucleotide sequence encoding a single-stranded guide RNA (g-RNA) operably linked to one or more regulatory sequences located on the vector, wherein said g-RNA comprises from the 3' end to the 5' end: (I) a scaffold nucleotide sequence capable of binding the dCas enzyme; (P) a guide nucleotide sequence capable of hybridizing to a complementary region of the genomic target sequence; and, optionally, (PI) a single- stranded c-linker nucleotide sequence capable of complementarily hybridizing to the linker nucleotide sequence optionally linked to the nanoparticle; and 3) a thermophilic restriction endonuclease, wherein the 5’ end of the complementary region of the guide nucleotide sequence of the g-RNA molecule is in close proximity to the 3' end of a restriction site of said restriction endonuclease on the genomic target sequence or the 3’ end of said complementary region is in close proximity to the 5’ end of said restriction site on the genomic target sequence.
5. The genome editing system according to any one of claims 1 to 4, wherein the nanoparticle is a metallic nanoparticle capable of supporting a localized surface plasmon resonance.
6. The genome editing system according to any one of claims 1 to 5, wherein the metal making up the metallic nanoparticle is selected from the group consisting of gold, silver, copper, titanium, chromium, and any compound thereof.
7. The genome editing system according to any one of claims 1 to 6, wherein the nanoparticle has a diameter comprised between 2 nm and 40 nm, or wherein the nanoparticle has at least one dimension comprised between 2 nm and 40 nm.
8. The genome editing system according to any one of claims 1 to 7, wherein the nanoparticle is coated with a thermosensitive polymer coating.
9. The genome editing system according to claim 8, wherein the polymer coating of the nanoparticle is sensitive to a temperature comprised between 40°C and 100°C.
10. The genome editing system according to any one of claims 3 to 9, wherein the thermophilic restriction endonuclease is capable of endonuclease activity at a temperature above 37°C, preferably at a temperature of 50°C or above.
11. The genome editing system according to any one of claims 3 to 10, wherein the thermophilic restriction endonuclease is selected from the group consisting of Taql, ApeKI, BsiHKAI, BstAPI, BstBI, Mwol, PI-PspI, PspGI, Smll, Tfil, TspRI, and Tthll lL
12. An in vitro genome editing method, said method comprising the steps of: - transforming the target cell with a genome editing system according to any one of claims 1 to 11, and
- exposing the transformed cell to electromagnetic radiation with a controlled wavelength in the visible spectmm or in the near-infrared, which is capable of exciting the plasmon resonance of the metallic nanoparticle and generating an amount of heat capable of inducing a temperature increase of at least 10°C.
13. The method according to claim 12, wherein the controlled wavelength is comprised between 300 nm and 2 pm, preferably between 500 nm and 880 nm.
14. The method according to claim 12 or 13, wherein the electromagnetic radiation is a continuous or pulsed radiation.
15. The method according to any one of claims 12 to 14, wherein the target cell is a eukaryotic cell, preferably a human cell.
16. The genome editing system according to any one of claims 1 to 15, for use as a medicament.
17. The genome editing system according to claim 16, for use in the therapeutic treatment of a disease selected from the group consisting of melanoma, leukemia, and solid tumours.
18. The use of the genome editing system according to any one of claims 1 to 11 for use in the manufacture of non-human genetically modified organisms.
19. The use of the genome editing system according to claim 18, for use in basic research, food processing industry, pharmaceutical industry and biofuels production.
EP20705789.4A 2019-01-21 2020-01-21 Nanotransducer-based genome editing system Withdrawn EP3914705A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
IT201900000861 2019-01-21
PCT/IB2020/050432 WO2020152573A1 (en) 2019-01-21 2020-01-21 Nanotransducer-based genome editing system

Publications (1)

Publication Number Publication Date
EP3914705A1 true EP3914705A1 (en) 2021-12-01

Family

ID=66476709

Family Applications (1)

Application Number Title Priority Date Filing Date
EP20705789.4A Withdrawn EP3914705A1 (en) 2019-01-21 2020-01-21 Nanotransducer-based genome editing system

Country Status (2)

Country Link
EP (1) EP3914705A1 (en)
WO (1) WO2020152573A1 (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112255215B (en) * 2020-09-16 2021-08-17 清华大学 Surface-enhanced Raman method of modified dimer for detecting and analyzing the life activity state of living cells
EP4377472A2 (en) * 2021-07-26 2024-06-05 Imperial College Innovations Limited Nanozyme-catalysed detection of nucleic acids
IT202300017598A1 (en) 2023-08-25 2025-02-25 Univ Pisa New CRISPR/Cas-enabled gold nanoparticles, their compositions and uses

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014124322A1 (en) * 2013-02-08 2014-08-14 University Of Louisville Research Foundation, Inc. Nanoparticles for drug delivery
EP3353309A4 (en) * 2015-09-25 2019-04-10 Tarveda Therapeutics, Inc. COMPOSITIONS AND METHODS FOR GENOMIC EDITION
EP3199632A1 (en) * 2016-01-26 2017-08-02 ACIB GmbH Temperature-inducible crispr/cas system

Also Published As

Publication number Publication date
WO2020152573A1 (en) 2020-07-30
WO2020152573A8 (en) 2021-10-21

Similar Documents

Publication Publication Date Title
Fu et al. Exploring the trans-cleavage activity of CRISPR/Cas12a on gold nanoparticles for stable and sensitive biosensing
Chandrasekaran et al. Exceptional nuclease resistance of paranemic crossover (PX) DNA and crossover-dependent biostability of DNA motifs
Cai et al. Orthogonal chemical activation of enzyme-inducible CRISPR/Cas9 for cell-selective genome editing
Tay et al. Nature-inspired DNA nanosensor for real-time in situ detection of mRNA in living cells
Yehl et al. Catalytic deoxyribozyme-modified nanoparticles for RNAi-independent gene regulation
Cai et al. Multitarget reaction programmable automatic diagnosis and treatment logic device
Liu et al. DNAzyme based nanomachine for in situ detection of MicroRNA in living cells
Lee et al. Synthetically modified guide RNA and donor DNA are a versatile platform for CRISPR-Cas9 engineering
Rouge et al. Ribozyme–spherical nucleic acids
Lone et al. CRISPR/Cas9 system: a bacterial tailor for genomic engineering
Peng et al. A genome-editing nanomachine constructed with a clustered regularly interspaced short palindromic repeats system and activated by near-infrared illumination
Tao et al. Development of a DNAzyme walker for the detection of APE1 in living cancer cells
Li et al. Precision spherical nucleic acids enable sensitive FEN1 imaging and controllable drug delivery for cancer-specific therapy
EP3914705A1 (en) Nanotransducer-based genome editing system
Rouge et al. Spherical nucleic acids as a divergent platform for synthesizing RNA–nanoparticle conjugates through enzymatic ligation
Allemailem et al. Recent updates of the CRISPR/Cas9 genome editing system: Novel approaches to regulate its spatiotemporal control by genetic and physicochemical strategies
Hu et al. Label-free CRISPR/Cas9 assay for site-specific nucleic acid detection
Sun et al. Recent advances in DNAzymes for bioimaging, biosensing and cancer therapy
US20230008217A1 (en) Ligation-based gene editing using crispr nickase
Singh et al. Stimuli responsive, programmable DNA nanodevices for biomedical applications
Yu et al. DNA nanotechnology for multimodal synergistic theranostics
US12104150B2 (en) Near-infrared photothermally activated CRISPR/CAS9 genome editing machine
Tang et al. Single‐nucleotide editing: From principle, optimization to application
Matsumoto et al. The history of genome editing: advances from the interface of chemistry & biology
Liu et al. Reversible acylation of RNA enables activatable biosensing

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: UNKNOWN

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20210818

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

DAV Request for validation of the european patent (deleted)
DAX Request for extension of the european patent (deleted)
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: EXAMINATION IS IN PROGRESS

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN WITHDRAWN

17Q First examination report despatched

Effective date: 20260115

18W Application withdrawn

Effective date: 20260123