EP3854872A1 - Phi29 dna polymerase mutant with improved thermal stability and application thereof in sequencing - Google Patents

Phi29 dna polymerase mutant with improved thermal stability and application thereof in sequencing Download PDF

Info

Publication number
EP3854872A1
EP3854872A1 EP18936847.5A EP18936847A EP3854872A1 EP 3854872 A1 EP3854872 A1 EP 3854872A1 EP 18936847 A EP18936847 A EP 18936847A EP 3854872 A1 EP3854872 A1 EP 3854872A1
Authority
EP
European Patent Office
Prior art keywords
protein
amino acid
dna polymerase
phi29
site
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
EP18936847.5A
Other languages
German (de)
French (fr)
Other versions
EP3854872A4 (en
Inventor
Zhougang ZHANG
Huanhuan LIU
Yue Zheng
Yujun ZHOU
Jun Xia
Yuliang DONG
Chongjun Xu
Wenwei Zhang
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
BGI Shenzhen Co Ltd
Original Assignee
BGI Shenzhen Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by BGI Shenzhen Co Ltd filed Critical BGI Shenzhen Co Ltd
Publication of EP3854872A1 publication Critical patent/EP3854872A1/en
Publication of EP3854872A4 publication Critical patent/EP3854872A4/en
Pending legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/12Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1241Nucleotidyltransferases (2.7.7)
    • C12N9/1252DNA-directed DNA polymerase (2.7.7.7), i.e. DNA replicase
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00Preparation of compounds containing saccharide radicals
    • C12P19/26Preparation of nitrogen-containing carbohydrates
    • C12P19/28N-glycosides
    • C12P19/30Nucleotides
    • C12P19/34Polynucleotides, e.g. nucleic acids, oligoribonucleotides
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6806Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869Methods for sequencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y207/00Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/07Nucleotidyltransferases (2.7.7)
    • C12Y207/07007DNA-directed DNA polymerase (2.7.7.7), i.e. DNA replicase
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the disclosure belongs to the field of biotechnologies, and particularly relates to a Phi29 DNA polymerase mutant with improved thermal stability and an application thereof in sequencing
  • a Phi29 DNA polymerase belonging to a family-B DNA polymerase, is a polymerase derived from Bacillus subtilis Phi29 phage.
  • the crystal structure of the Phi29 DNA polymerase shows that, in addition to conserved Palm, Thumb, Finger and Exo domain (having 3' ⁇ 5' exonuclease correction activity) of the common family-B DNA polymerase, the Phi29 DNA polymerase also has two other unique domains: TPR1 and TPR2 domains.
  • the TPR2 domain participates in formation of a narrow channel surrounding a downstream DNA strand template, and the dissociation of a double-stranded DNA is forced; at the same time, the Palm, Thumb, TPR1 and TPR2 domains form a circular structure, and tightly bind to the double-stranded DNA formed by an upstream template strand.
  • the structural characteristics of the Phi29 DNA polymerase endow it with a special high sustained synthesis ability, a stronger strand displacement function and a high fidelity.
  • RCA rolling circle amplification
  • BGI Beijing Genomics Institute
  • the DNA nanoball technology (DNB Technology) is one of core technologies of the BGI gene sequencer. After a genomic DNA is physically or enzymatically fragmented, a linker is added and it is cyclized into a single-stranded circular DNA, and then the DNA polymerase is replaced with a high-fidelity strand, for example, the Phi29 DNA polymerase or Bst DNA polymerase performs the rolling circle amplification (RCA) on the single-stranded circular DNA, and an amplified product is called as a DNA nanoball (DNB).
  • the nanoball is fixed on an arrayed silicon chip through a DNB loading technology for subsequent on-machine sequencing. Different properties of Phi29 DNA polymerase mutants have different binding abilities to a substrate DNA.
  • the amplified DNA nanoball products are also different in size, uniformity, branch structure, compactness and other characteristics, and then after the DNB is loaded on the silicon chip, the quality of sequencing is also different.
  • Properties of the Phi29 DNA polymerase also affect an amplification effect of a single-cell whole genome amplified by a Multiple Displacement Amplification (MDA) method, and the quality of single-cell sequencing is affected, for example, a Coverage, a Mapping Rate, a mutation detection accuracy and specificity, these are also very concerned parameters in application of a single-cell sequencing scientific research.
  • MDA Multiple Displacement Amplification
  • the Phi29 DNA polymerase is a medium-temperature polymerase, and may lose activity after being heated at 65°C for 10 min.
  • Some commercial Phi29 DNA polymerases on the market, due to reasons such as stability, are difficult to meet requirements of kit product development in special applications such as sequencing library amplification and single-cell whole genome amplification because of problems in aspects such as an effective signal site on a chip, an amplification preference, a coverage, and variation detection and evaluation.
  • the disclosure provides a protein.
  • the protein provided by the disclosure is a Phi29 DNA polymerase mutant, and is represented by A) or B) below:
  • the protein represented by the A) is a protein having DNA polymerase activity that is obtained by modifying amino acid residues in at least 2 or at least 3 or at least 4 or at least 5 or all of the following 6 sites in the phi29 DNA polymerase amino acid sequence: the 97-th, 123-th, 217-th, 224-th, 515-th, and 474-th sites.
  • the above modification is to modify only the 6 sites of the 97-th, 123-th, 217-th 224-th, 515-th and 474-th sites in the phi29 DNA polymerase amino acid sequence according to the above sites to be modified, and the rest amino acid residues are not changed except the 6 sites.
  • the protein represented by the A) is a protein having DNA polymerase activity that is obtained by modifying amino acid residues in all of the following 5 sites in the phi29 DNA polymerase amino acid sequence: the 97-th, 123-th, 217-th, 224-th, and 515-th sites, herein the rest amino acid residues are not changed. Specifically, it is phi29-337 in an embodiment.
  • the protein represented by the A) is a protein having DNA polymerase activity that is obtained by modifying amino acid residues in all of the following 3 sites in the phi29 DNA polymerase amino acid sequence: the 224-th, 515-th and 474-th sites, herein the rest amino acid residues are not changed. Specifically, it is phi29-464 in an embodiment.
  • the protein represented by the A) is a protein having DNA polymerase activity that is obtained by modifying amino acid residues in all of the following 3 sites in the phi29 DNA polymerase amino acid sequence: the 97-th, 123-th and 515-th sites, herein the rest amino acid residues are not changed. Specifically, it is phi29-414 in an embodiment.
  • the protein represented by the A) is a protein having DNA polymerase activity that is obtained by modifying amino acid residues in all of the following 4 sites in the phi29 DNA polymerase amino acid sequence: the 97-th, 123-th, 217-th and 515-th sites, herein the rest amino acid residues are not changed. Specifically, it is phi29-458 in an embodiment.
  • the protein represented by the A) is a protein having DNA polymerase activity that is obtained by modifying amino acid residues in the following 4 sites in the phi29 DNA polymerase amino acid sequence: the 97-th, 123-th, 224-th, and 515-th sites, herein the rest amino acid residues are not changed. Specifically, it is phi29-459 in an embodiment.
  • the protein represented by the A) is a protein having DNA polymerase activity that is obtained by modifying amino acid residues in the following 2 sites in the phi29 DNA polymerase amino acid sequence: the 224-th and 474-th sites, herein the rest amino acid residues are not changed. Specifically, it is phi29-463 in an embodiment.
  • the protein represented by the A) is a protein having DNA polymerase activity that is obtained by modifying amino acid residues in the following 2 sites in the phi29 DNA polymerase amino acid sequence: the 217-th and 224-th sites, herein the rest amino acid residues are not changed. Specifically, it is phi29-335 in an embodiment.
  • the modification is amino acid substitution.
  • amino acid substitutions in 6 sites of the 97-th, 123-th, 217-th, 224-th, 515-th and 474-th sites are respectively as follows:
  • the protein represented by the A) is a protein having DNA polymerase activity that is obtained by mutating the amino acid residue from M into K in the 97-th site, from L into H in the 123-th site, from E into P in the 515-th site, from Y into K in the 224-th site, and from G into K in the 217-th site of the phi29 DNA polymerase amino acid sequence, herein the rest amino acid residues are not changed.
  • the protein represented by the A) is a protein that is obtained by mutating the amino acid residue from Y into K in the 224-th site, from I into K in the 474-th site, and from E into P in the 515-th site of the phi29 DNA polymerase amino acid sequence.
  • the protein represented by the A) is a protein that is obtained by mutating the amino acid residue from M into T in the 97-th site, from L into H in the 123-th site, and from E into P in the 515-th site of the phi29 DNA polymerase amino acid sequence.
  • the phi29 DNA polymerase amino acid sequence is (I) or (II) or (III) below:
  • the stability of the protein is higher than that of the phi29 DNA polymerase.
  • the stability is thermal stability.
  • a nucleic acid molecule for encoding the above protein is also within a scope of protection of the disclosure.
  • An expression cassette, a recombinant vector, recombinant bacteria or a transgenic cell line containing the above nucleic acid molecule is also within a scope of protection of the disclosure.
  • nucleic acid molecule for encoding the above protein, the expression cassette containing the nucleic acid molecule, the recombinant vector containing the nucleic acid molecule, the recombinant bacteria containing the nucleic acid molecule, or the transgenic containing the nucleic acid molecule in at least one of the following 1)-10) is also within a scope of protection of the disclosure:
  • Another purpose of the disclosure is to provide a method for improving stability of a phi29 DNA polymerase.
  • the method provided by the disclosure includes the following steps: modifying at least one amino acid residue(s) in the following 6 sites of the phi29 DNA polymerase amino acid sequence: the 97-th, 123-th, 217-th, 224-th, 515-th and 474-th sites, in the modification modes above, herein the rest amino acid residues are not changed, to obtain a protein having DNA polymerase activity.
  • the stability is thermal stability.
  • the Phi29 DNA polymerase of the disclosure may exist in the form of an independently packaged DNA polymerase product, or may be packaged into a DNA amplification kit or a DNA sequencing kit.
  • the disclosure is capable of, through site-directed mutagenesis and screening technologies to obtain the mutant with the greatly improved thermal stability.
  • the amplification coverage of some mutants in single-cell whole genome amplification is greatly improved, and the accuracy and sensitivity of the mutation detection are improved, and reach a same level of QIAGEN similar products; and other mutants in the disclosure have a good effect on improving a DNB loading effect in application of RCA library amplification.
  • the recombinant vector is obtained by inserting the nucleic acid molecule into an expression vector.
  • the expression vector may specifically be a pET28a(+) vector.
  • the recombinant bacteria are bacteria obtained by introducing the recombinant vector into original bacteria.
  • the original bacteria may be Escherichia coli.
  • the E. coli may specifically be Escherichia coli BL21 (DE3).
  • the transgenic cell line may be obtained by transforming the recombinant vector into recipient cells.
  • the transgenic cell line is a non-plant propagative material.
  • the stability may specifically be thermal stability.
  • the thermal stability may specifically be thermal stability at 37°C.
  • the phi29 DNA polymerase may be (I) or (II) or (III) below:
  • pET28a(+) vector Novagen Company.
  • Escherichia coli BL21 (DE3): TIANGEN, CB105-02.
  • Storage buffer 10 mM Tris-HCI, 100 mM KCI, 1 mM DTT, 0.1 mM EDTA, 0.5% (v/v) Tween20, 0.5% (v/v) NP-40, 50% (v/v) Glycerol, and pH 7. 4@25°C.
  • Ad ssDNA in the following embodiments self-made by BGI, a single-stranded loop library of a certain size range, without a fixed sequence (a random library formed by four nucleotides A/T/C/G, and a main band length is 200-300 bp).
  • a DNA molecule shown in SEQ ID NO: 1 of a sequence listing is an encoding gene of a wild-type Phi29 DNA polymerase, and it expresses a protein shown in SEQ ID NO: 2 of the sequence listing, namely the wild-type Phi29 DNA polymerase (represented by WT).
  • a Phi29 DNA polymerase mutant is obtained by mutating at least one of the 97-th, 123-th, 217-th, 224-th, 474-th, and 515-th sites in an amino acid sequence of a wild-type Phi29 DNA polymerase. Specifically, a single-site mutation form is shown in Table 1, and a multi-site combination mutation form is shown in Table 2.
  • a DNA molecule shown in SEQ ID NO: 2 of a sequence listing is inserted between Ndel and BamHI restriction sites of a pET28a(+) vector ( Fig. 1 ), to obtain a recombinant vector WT for expressing a wild-type Phi29 DNA polymerase.
  • the recombinant vector WT is served as an original vector, each primer pair shown in Table 1 is used to introduce a site mutation, and each recombinant vector for expressing the Phi29 DNA polymerase mutant is obtained.
  • the recombinant vector WT is tested as a template, in a site-directed mutation PCR reaction system (25 ⁇ l) containing the following components: 2.5 ⁇ l 10x Pfu Reaction Buffer with Mg 2+ , 2 ⁇ l dNTP Mix (2.5 mM each), 25 ng pET28a-Phi29 plasmid, 0.5 ⁇ l Pfu DNA Polymerase, mutation primers of mutation sites (Table 1) are respectively added, and PCR amplification is performed.
  • PCR conditions are as follows: 95°C 3 min, 19 cycle for [95°C 30s, 53°C 30s, 68°C 8 min], 68°C 10 min, 4°C forever.
  • the reaction product is digested with Dpnl, it is transformed into DH5a competent cells, spread out on a kanamycin-resistant LB plate, and then it is incubated overnight in an incubator at 37°C, a monoclonal plasmid is picked out for sequencing, to verify whether a specific amino acid site is successfully mutated.
  • a difference from a recombinant vector for expressing a Phi29 DNA polymerase mutant M97H is only that: the 289-291-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "ATG” into "CAT”.
  • the mutated DNA molecule encodes the mutant M97H.
  • a difference from the mutant M97H is only that the amino acid residue in the 97-th site of the wild-type Phi29 DNA polymerase amino acid sequence is mutated from M into H.
  • a difference from a recombinant vector for expressing a Phi29 DNA polymerase mutant M97A is only that: the 289-291-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "ATG" into "GCG".
  • the mutated DNA molecule encodes the mutant M97A.
  • a difference from the mutant M97A is only that the amino acid residue in the 97-th site of the wild-type Phi29 DNA polymerase amino acid sequence is mutated from M into A.
  • a difference from a recombinant vector for expressing a Phi29 DNA polymerase mutant M97K is only that: the 289-291-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "ATG" into "AAA”.
  • the mutated DNA molecule encodes the mutant M97K.
  • a difference from the mutant M97K is only that the amino acid residue in the 97-th site of the wild-type Phi29 DNA polymerase amino acid sequence is mutated from M into K.
  • a difference from a recombinant vector for expressing a Phi29 DNA polymerase mutant L123K is only that: the 367-369-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "CTG" into "AAA”.
  • the mutated DNA molecule encodes the mutant L123K.
  • a difference from the mutant L123K is only that the amino acid residue in the 123-th site of the wild-type Phi29 DNA polymerase amino acid sequence is mutated from L into K.
  • a difference from a recombinant vector for expressing a Phi29 DNA polymerase mutant L123F is only that: the 367-369-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "CTG" into "TTT".
  • the mutated DNA molecule encodes the mutant L123F.
  • a difference from the mutant L123F is only that the amino acid residue in the 123-th site of the wild-type Phi29 DNA polymerase amino acid sequence is mutated from L into F.
  • a difference from a recombinant vector for expressing a Phi29 DNA polymerase mutant L123I is only that: the 367-369-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "CTG" into "ATT".
  • the mutated DNA molecule encodes the mutant L123I.
  • a difference from the mutant L123I is only that the amino acid residue in the 123-th site of the wild-type Phi29 DNA polymerase amino acid sequence is mutated from L into I.
  • a difference from a recombinant vector for expressing a Phi29 DNA polymerase mutant L123H is only that: the 367-369-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "CTG" into "CAT".
  • the mutated DNA molecule encodes the mutant L123H.
  • a difference from the mutant L123H is only that the amino acid residue in the 123-th site of the wild-type Phi29 DNA polymerase amino acid sequence is mutated from L into H.
  • a difference from a recombinant vector for expressing a Phi29 DNA polymerase mutant E515P is only that: the 1543-1545-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "GAA" into "CCG".
  • the mutated DNA molecule encodes the mutant E515P.
  • a difference from the mutant E515P is only that the amino acid residue in the 515-th site of the wild-type Phi29 DNA polymerase amino acid sequence is mutated from E into P.
  • a difference from a recombinant vector for expressing a Phi29 DNA polymerase mutant Y224K is only that: the 670-672-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "TAT" into "AAA”.
  • the mutated DNA molecule encodes the mutant Y224K.
  • a difference from the mutant Y224K is only that the amino acid residue in the 224-th site of the wild-type Phi29 DNA polymerase amino acid sequence is mutated from Y into K.
  • a difference from a recombinant vector for expressing a Phi29 DNA polymerase mutant G217E is only that: the 649-651 -th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "GGC" into "GAA”.
  • the mutated DNA molecule encodes the mutant G217E.
  • a difference from the mutant G217E is only that the amino acid residue in the 217-th site of the wild-type Phi29 DNA polymerase amino acid sequence is mutated from G into E.
  • a difference from a recombinant vector for expressing a Phi29 DNA polymerase mutant 1474K is only that: the 1420-1422-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "ATT" into "TTT”.
  • the mutated DNA molecule encodes the mutant I474K.
  • a difference from the mutant I474K is only that the amino acid residue in the 474-th site of the wild-type Phi29 DNA polymerase amino acid sequence is mutated from I into K.
  • the recombinant vector WT is served as an original vector, each primer pair shown in Table 1 is used to introduce a site mutation successively, to obtain each recombinant vector for expressing a Phi29 DNA polymerase mutant.
  • a specific mutation form is shown in Table 2: Table 2 Phi29 DNA polymerase mutant number Phi29 DNA polymerase mutant name phi29-337 M97K-L123H-E515P-Y224K-G217E phi29-414 M97T-L123K-E515P phi29-456 M97K-L123H-E515P Phi29-464 Y224K-I474K-E515P phi29-458 M97K-L123H-E515P-G217E phi29-459 M97K-L123H-E515P-Y224K Phi29-463 Y224K-I474K Phi29-335 Y224K-G217E
  • a difference from a recombinant vector for expressing a Phi29 DNA polymerase mutant M97K-L123H-E515P-Y224K-G217E is only that: the 289-291-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "ATG” into "AAA”, the 367-369-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "CTG” into "CAT”, the 1543-1545-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "GAA" into "CCG”, the 670-672-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "TAT” into “AAA”, the 649-651-th nucleotides of the DNA molecule shown in SEQ
  • the mutated DNA molecule encodes the mutant M97K-L123H-E515P-Y224K-G217E.
  • a difference from the mutant M97K-L123H-E515P-Y224K-G217E is only that the amino acid residue in the 97-th site of the wild-type Phi29 DNA polymerase amino acid sequence is mutated from M into K, and the 123-th site is mutated from L into H, the 515-th site is mutated from E into P, the 224-th site is mutated from Y into K, and the 217-th site is mutated from G into E.
  • a difference from a recombinant vector for expressing a Phi29 DNA polymerase mutant M97T-L123K-E515P is only that the 289-291-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "ATG” into “ACC”, the 367-369-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "CTG” into "AAA”, the 1543-1545-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "GAA" into "CCG".
  • the mutated DNA molecule encodes the mutant M97T-L123K-E515P.
  • a difference from the mutant M97T-L123K-E515P is only that the amino acid residue in the 97-th site of the wild-type Phi29 DNA polymerase amino acid sequence is mutated from M into T, and the 123-th site is mutated from L into K, and the 515-th site is mutated from E into P.
  • a difference from a recombinant vector for expressing a Phi29 DNA polymerase mutant M97K-L123H-E515P is only that: the 289-291-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "ATG” into "AAA”, the 367-369-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "CTG” into "CAT”, the 1543-1545-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "GAA" into "CCG".
  • the mutated DNA molecule encodes the mutant M97T-L123H-E515P.
  • a difference from the mutant M97K-L123H-E515P is only that the amino acid residue in the 97-th site of the wild-type Phi29 DNA polymerase amino acid sequence is mutated from M into T, and the 123-th site is mutated from L into H, and the 515-th site is mutated from E to P.
  • a difference from a recombinant vector for expressing a Phi29 DNA polymerase mutant Y224K-I474K-E515P is only that: the 670-672-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "TAT” into "AAA”, the 1420-1422-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "ATT" into "TTT”, the 1543-1545-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "GAA" into "CCG".
  • the mutated DNA molecule encodes the mutant Y224K-I474K-E515P.
  • a difference from the mutant Y224K-I474K-E515P is only that the amino acid residue in the 224-th site of the wild-type Phi29 DNA polymerase amino acid sequence is mutated from Y into K, and the 474-th site is mutated from I into K, and the 515-th site is mutated from E into P.
  • a difference from a recombinant vector for expressing a Phi29 DNA polymerase mutant M97K-L123H-E515P-G217E is only that: the 289-291 -th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "ATG” into "AAA”, the 367-369-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "CTG” into "CAT”, the 1543-1545-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "GAA" into "CCG”, and the 649-651-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "GGC” to "GAA".
  • the mutated DNA molecule encodes the mutant M97K-L123H-E515P-G217E.
  • a difference from the mutant M97K-L123H-E515P-G217E is only that the amino acid residue in the 97-th site of the wild-type Phi29 DNA polymerase amino acid sequence is mutated from M into K, the amino acid residue in the 123-th site is mutated from L into H, and the 515-th site is mutated from E into P, and the 217-th site is mutated from G into E.
  • a difference from a recombinant vector for expressing a Phi29 DNA polymerase mutant M97K-L123H-E515P-Y224K is only that: the 289-291-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "ATG” into "AAA”, the 367-369-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "CTG” into "CAT”, the 1543-1545-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "GAA" into “CCG”, and the 670-672-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "TAT" into “AAA”.
  • the mutated DNA molecule encodes the mutant M97K-L123H-E515P-G217E.
  • a difference from the mutant M97K-L123H-E515P-G217E is only that the amino acid residue in the 97-th site of the wild-type Phi29 DNA polymerase amino acid sequence is mutated from M into K, the amino acid residue in the 123-th site is mutated from L into H, and the 515-th site is mutated from E into P, and the 224-th site is mutated from Y into K.
  • a difference from a recombinant vector for expressing a Phi29 DNA polymerase mutant Y224K-I474K is only that: the 670-672-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "TAT” into "AAA”, the 1420-1422-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "ATT" into "TTT”.
  • the mutated DNA molecule encodes the mutant Y224K-I474K.
  • mutant Y224K-I474K Compared with the wild-type Phi29 DNA polymerase, a difference from the mutant Y224K-I474K is only that the amino acid residue in the 224-th site of the wild-type Phi29 DNA polymerase amino acid sequence is mutated from Y into K, and the amino acid residue in the 474-th site is mutated from I into K.
  • the recombinant vector WT and each recombinant vector for expressing the Phi29 DNA polymerase mutant constructed in step I are respectively introduced into Escherichia coli BL21 (DE3), to obtain recombinant bacteria for expressing the wild-type Phi29 DNA polymerase and each recombinant bacterium for expressing the Phi29 DNA polymerase mutant.
  • the recombinant bacteria for expressing the wild-type Phi29 DNA polymerase and each recombinant bacterium for expressing the Phi29 DNA polymerase mutant obtained in step II are taken, and sequentially induced and purified, to obtain the wild-type Phi29 DNA polymerase fused with an HiS 6 tag at an N-terminal and each Phi29 DNA polymerase mutant fused with an HiS 6 tag at an N-terminal.
  • the wild-type Phi29 DNA polymerase fused with the HiS 6 tag at the N-terminal and each Phi29 DNA polymerase mutant fused with the HiS 6 tag at the N-terminal are successively named as a wild-type Phi29 DNA polymerase with the HiS 6 tag, a Phi29 DNA polymerase mutant M97H with the HiS 6 tag, a Phi29 DNA polymerase mutant M97A with the HiS 6 tag, a Phi29 DNA polymerase mutant M97K with the HiS 6 tag, a Phi29 DNA polymerase mutant L123K with the HiS 6 tag, a Phi29 DNA polymerase mutant L123F with the HiS 6 tag, a Phi29 DNA polymerase mutant L123I with the HiS 6 tag, a Phi29 DNA polymerase mutant L123H with the HiS 6 tag, a Phi29 DNA polymerase mutant E515P with the HiS 6 tag, a Phi29 DNA polymerase mutant E515G with the HiS 6 tag
  • the recombinant bacteria are seeded into 3 ml of a liquid LB medium containing Kana resistance, and cultured overnight.
  • IPTG with a final concentration of 0.5 mM is added to a system, and shake-cultured at 16°C and 220 rpm for 12 h.
  • step (3) After the step (3) is completed, it is centrifuged at 4°C and 8000 rpm for 5 min, and bacteria are collected.
  • Dialysis buffer 23.75 mM Tris-HCI (pH7.4@ 25°C), 237.5 mM KCI, 2.375 mM DTT, 0.2375 mM EDTA, 5% (v/v) Glycerol.
  • the wild-type Phi29 DNA polymerase solution with the HiS 6 tag and the Phi29 DNA polymerase mutant solution with the HiS 6 tag prepared in Embodiment 1 are taken as enzyme solution to be tested.
  • Enzyme activity of enzyme solution to be tested ⁇ DNBx5000 ⁇ 37.38.
  • ⁇ DNB is a difference value between concentration average values of the reaction products in the systems after the reactions of the test group and the negative control group are terminated, 5000 is a dilution factor, and 37.38 is a slope of a functional relationship between the enzyme activity and the ⁇ DNB.
  • Enzyme activity results of some enzyme solution to be tested are shown in Table 3.
  • Table 3 Polymerase Control group average value
  • Experimental group average value ⁇ DNB (ng/ ⁇ l) Enzyme activity of prepared enzyme solution (U/ ⁇ l) WT 0.46 0.96 0. 51 67.6 E515P 0.37 0. 73 0. 37 49.3 L123K 0.4 0. 77 0. 37 50.1 M97A 0.4 0.75 0.36 48 G217E 0.42 0.97 0.55 73.8 Y224K 0. 38 0.8 0.42 56.1 1474K 0.48 1.06 0.57 15.4
  • the target protein solution (the wild-type Phi29 DNA polymerase solution with the His 6 tag and the Phi29 DNA polymerase mutant solution with the His 6 tag) prepared in Embodiment 1 is taken, and divided into two parts, and they are respectively treated as follows:
  • U1 is the activity of the unheated enzyme solution
  • U2 is the activity of the heated enzyme solution
  • a difference from the 37°C 10 min experiment is only that the 10 min in the 37°C metal bath is replaced with the 10 min in a refrigerator at -20°C.
  • the specific enzyme activity and the enzyme activity loss ratio of each mutant are shown in Table 4. Compared with the wild type (WT), the enzyme activity loss ratios of the mutants in examples are all improved to a certain extent; and a numeral value of the enzyme activity loss ratio is larger, the enzyme is more unstable, and the thermal stability is worse.
  • NC is a background value, and a blank is because there is no data calculation processing.
  • a multiple PCR mode is used to amplify a multiple housekeeping gene in an MDA product.
  • a specific operating process is as follows: a NA12878 reference genome sample (Coriell Institute) is added to 200 ⁇ l of a PCR tube, a total volume is 4 ⁇ l, and if it is not enough, PBS is added to supplement to 4 ⁇ l. 3 ⁇ l of Buffer D2 (QIAGEN REPLI-g Single Cell Kit) is added to the PCR tube, a pipette tip should be attached to a tube wall, and is not inserted under a liquid surface, and centrifuging is performed without shaking. After being centrifuged, it is put on a PCR instrument at 65°C for 10 min.
  • the pipette tip should be attached to the tube wall, and is not inserted below the liquid surface, the centrifuging is performed without shaking. After being centrifuged, it is put on the PCR instrument at 30°C for 8 h and 65°C for 3 min. After a reaction is finished, the shaking and centrifuging are performed, and a concentration is measured with Qubit BR. After the concentration is measured, a multiple housekeeping gene PCR detection is performed. 50-200 ng of a DNA is taken, a negative control (N) and a positive control (P) should be set, the negative is water, the positive is a NA12878 reference genome without amplification, and an experimental group is set with 3 different samples.
  • N negative control
  • P positive control
  • Table 5 Multiple PCR primers and procedures are shown in Table 5 below: Table 5: Multiple PCR primer and PCR reaction system Primer name Primer sequence 18-F GGCATCGCTTAGACTCTATGTG 18-R CTGCCCTTGGCCTAACTAACCT 12-F GTTCCTCAAGTAGCTCCACGAG 12-R CGTTAGACTCTGGATCTGGCGT 16-F CCAGCCAGTTCATGCGTCGGTG 16-R CCTGACAACTCGCAAGTAGCAC 17-F GCTCAATGGGGTACTTCAGGT 17-R GTGGACTTACGTAAAAGGCCC 19-F TGCTCTGTATGTGAAGATGCCA 19R TTCCAGGTAAATCCAGCCCAGG 3-F CAGCCAGTCGGCATCATCCAAC 3-R GAAAGCCGGATTGCGGTAACAT 8-F GGATAGCTCTGCCAGGGGAGAG 8-R TCGTCGCAGTAGAAATACGGCT 22-F AGATGTCAGGCACGTAGCTCAG 22-R GGCACGTTGG
  • PCR procedure 95°C 5 min, 35 cycles x[94°C 30 s, 60°C 50 s, 72°C 1 min], 72°C 5 min, 12°C holder.
  • Results are shown in Fig. 2 , compared with the wild-type WT, the amplification coverage of the phi29-337, phi29-456, phi29-458, phi29-36, and phi29-414 is greatly improved, and 8 housekeeping gene products may at least be amplified for 6 or more.
  • concentrations of the amplified products the phi29-337, phi29-456, phi29-458, phi29-36, and phi29-414 are higher than the wild-type WT and a phi29 commercial product from Enzymatics Company.
  • the representation of the mutants Phi29-337, Phi29-456, Phi29-335, and Phi29-414 are comparable to that of the wild-type WT and the QIAGEN kit in mapping rate and coverage, but the representation of the wild-type WT is the worst in terms of duplication rate parameters, the mutants listed in the table are all slightly better than the wild type, herein the representation of the 337 mutant is best, and is comparable to the QIAGEN (REPLI-g Single Cell Kit) kit.
  • the representation of the 337 mutant is best, and slightly better than the QIAGEN kit, the wild-type WT and the 456, 335, 414 mutants are worse than the QIAGEN kit; and in aspects of parameters indel_Precision, indel_Sensitivity and indel_F-measure, the representation of the 337 mutant is also the best, and data is better than the QIAGEN kit.
  • the embodiment selects several mutants with improved thermal stability, and performs an on-machine test in a BGISEQ-500 sequencer, application effects of the different mutants in DNA sequencing are detected with reference to a standard of the BGISEQ-500 sequencer.
  • Reagents used in the whole test are a complete set of a PE50V2.0 kit produced by the BGI, an E. coil Ad153 standard library produced by the BGI and a Qubit ssDNA Assay reagent produced by Invitrogen.
  • the reagents used below are all included in the PE50V2.0 kit except the library and QubitssDNA Assay, and a PE50V2.0 reagent tank written below only refers to reagents used in the on-machine test.
  • DNB preparation buffer a standard library, DNB polymerase mixed solution and DNB polymerase mixed solution II are taken out from a refrigerator at -20°C and melted on an ice box, after being completely dissolved, they are placed on a vortex shaker, shaken and continuously mixed uniformly for 5 s, and transiently centrifuged in a handheld centrifuge for 3 s, then it is placed on the ice box for later use.
  • Molecular-grade water and DNB stop buffer are taken out from a refrigerator at 4°C, and placed on the ice box for later use.
  • 20 ⁇ l of the DNB preparation buffer and 6 ng of the ssDNA E.
  • coli standard substance library are successively added, and supplemented to 40 ⁇ l with Nuclease Free Water.
  • the eight-connected tube is placed in the vortex shaker and continuously mixed uniformly for 5 s, and transiently centrifuged for 3 s in the handheld centrifuge.
  • the above eight-connected tube is placed in the PCR instrument, and reaction conditions are set or checked: 95°C 1 min, 65°C 1 min, 40°C 1 min, and 4°C for maintaining (a hot lid temperature is set to 103°C). After a reaction is completed, the PCR eight-connected tube is taken, and placed on the ice box.
  • the eight-connected tube After a lid temperature of the eight-connected tube drops to a room temperature, it is placed in the handheld centrifuge and transiently centrifuged for 3 s, and immediately placed on the ice box.
  • Each of the following components is successively added into the eight-connected tube: 40 ⁇ l of reaction solution in the eight-connected tube after denaturation, 40 ⁇ l of the DNB polymerase mixed solution, and 4 ⁇ l of the DNB polymerase mixed solution II.
  • the eight-connected tube is placed in the vortex shaker and continuously mixed uniformly for 5 s, and transiently centrifuged for 3 s in the handheld centrifuge. It is immediately placed in the PCR instrument or a water bath kettle to start a reaction.
  • Reaction conditions are set or checked: 30°C 20min, and 4°C for maintaining (a hot lid does not need to be installed). While the above RCA reaction is completed, the eight-connected tube is taken and placed on the ice box, and 20 ⁇ l of the DNB stop buffer is immediately added. A pipette with a 100 ⁇ l wide-mouth pipette tip is used to slowly blow and mix uniformly for 5-8 times (one-suction and one-blow are counted as 1 time). After being mixed uniformly, it is stored at 4°C for later use. A Qubit ssDNA Assay Kit and a Qubit Fluorometer instrument are used to measure a concentration of the above DNB preparation product. While the concentration is 8ng/ ⁇ l-40ng/ ⁇ l, it is judged to be qualified, and it is reserved for a subsequent experiment.
  • the DNB After the DNB is prepared, the DNB needs to be loaded on a chip, namely DNB loading.
  • a sample loading reagent plate V2.1 is taken and placed at a room temperature for melting, shaken and mixed uniformly. After being transiently centrifuged, it is placed on the ice box for later use.
  • DNB loading buffer II is taken, and shaken uniformly. After being transiently centrifuged, it is placed on the ice box for later use.
  • the chip and the sample loading reagent plate V2.1 are placed on BGIDL-50.
  • 35 ⁇ l of the DNB loading buffer II is taken and added to a PCR tube containing 100 ⁇ l of the DNB, and a wide-mouth sucker is used to gently mix uniformly for 15 times.
  • Example load 2.0 Example load 2.0
  • an on-machine sequencing test is performed on the BGISEQ-500 sequencer, one chip and one BGISEQ-500RS high-throughput sequencing reagent tank (PE50V2.0) are used.
  • a sequencing reagent tank II, dNTPs mixed solution (V3.0) and dNTPs mixed solution II (V2.0) are firstly thawed and melted, and placed in a refrigerator or ice box at 4°C for later use; a sequencing enzyme is shaken and mixed uniformly, and placed on the ice box for later use.
  • 5 well reagent is prepared, namely 1 ml of a pipette is used to pipette 1150 ⁇ l of the DNA polymerase mixed solution for adding to a No. 5 well and pipette 1150 ⁇ l of the dNTPs mixed solution (V3.0) for adding to the No. 5 well, and the pipette is used to blow and mix uniformly for 10-15 times.
  • a No. 6 well reagent is prepared, namely 1 ml of the pipette is used to pipette 890 ⁇ l of the DNA polymerase mixed solution for adding to a No. 6 well and pipette 890 ⁇ l of the dNTPs mixed solution II (V2.0) for adding to the No.
  • a No. 14 well reagent is prepared, namely 5 ml of a pipette is used to pipette all No. 14 well reagents, 2.8 ml of the No. 14 well reagent is taken and mixed uniformly with 400 ⁇ l of the phi29 polymerase mutant, and added to a No. 14 well.
  • the prepared reagent tanks are assembled.
  • the on-machine test is performed, namely the sequencer is started and washing is performed, the reagent tank is put into a designated position of the sequencer, and actual preloading is performed in an operating order.
  • the chip prepared in the above step (2) is installed, and related sequencing information is written, namely the sequencing is started.
  • the chip, the reagent tanks and a washing instrument are taken out.
  • One cycle is tested in the embodiment.
  • ESR Effective Spots Rates
  • Bic basecall information content
  • fit crosstalk fit score
  • a crosstalk situation after correction, the intensity distribution of each base is more concentrated, a fit value thereof is higher
  • SNR Signal to Noise Ratio
  • Fig. 3 Results are shown in Fig. 3 (Fig. A is comparison of BIC, FIT, ESR parameters of each mutant; Fig. B is comparison of SNR parameters of each mutant; and Fig. C is comparison of RHO parameters of each mutant), it may be seen that synthesized with the analysis of the above various parameter indexes, the best of the tested mutants is 464, and the second is 463.
  • the mutants with the good effects may be further screened through performing saturation mutations on the amino acids in the mutation sites of the disclosure; or on the basis of the mutants of the disclosure, and other amino acids except the amino acid sites contained in the disclosure are mutated, to obtain a similar effect.
  • the disclosure may also be applied in the technical fields including food detection, virus detection, RNA detection, single-cell sequencing and the like, and it may also be used to develop third and fourth generation sequencer technologies.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Provided are a Phi29 DNA polymerase mutant with improved thermal stability and an use thereof in sequencing. The phi29 DNA polymerase mutant is represented by A) or B) below: the DNA polymerase mutant represented by the A) is a protein having DNA polymerase activity that is obtained by modifying at least one amino acid residue(s) in the following six sites in a phi29 DNA polymerase amino acid sequence: the 97-th, 123-th, 217-th, 224-th, 515-th, and 474-th sites; the DNA polymerase mutant represented by the B) is a protein having DNA polymerase activity that is derived from the A) by adding a tag sequence to a terminal of the amino acid sequence of the protein represented by the A).

Description

    Technical Field
  • The disclosure belongs to the field of biotechnologies, and particularly relates to a Phi29 DNA polymerase mutant with improved thermal stability and an application thereof in sequencing
  • Background
  • A Phi29 DNA polymerase, belonging to a family-B DNA polymerase, is a polymerase derived from Bacillus subtilis Phi29 phage. The crystal structure of the Phi29 DNA polymerase shows that, in addition to conserved Palm, Thumb, Finger and Exo domain (having 3'→5' exonuclease correction activity) of the common family-B DNA polymerase, the Phi29 DNA polymerase also has two other unique domains: TPR1 and TPR2 domains. The TPR2 domain participates in formation of a narrow channel surrounding a downstream DNA strand template, and the dissociation of a double-stranded DNA is forced; at the same time, the Palm, Thumb, TPR1 and TPR2 domains form a circular structure, and tightly bind to the double-stranded DNA formed by an upstream template strand. The structural characteristics of the Phi29 DNA polymerase endow it with a special high sustained synthesis ability, a stronger strand displacement function and a high fidelity. It is often used in applications such as constant temperature amplification such as rolling circle amplification (RCA) of a trace circular DNA or multiple-strand displacement amplification of a genome, for example, a DNA Nanoball Technology of a Beijing Genomics Institute (BGI) gene sequencer and a single-cell whole-gene sequencing technology.
  • The DNA nanoball technology (DNB Technology) is one of core technologies of the BGI gene sequencer. After a genomic DNA is physically or enzymatically fragmented, a linker is added and it is cyclized into a single-stranded circular DNA, and then the DNA polymerase is replaced with a high-fidelity strand, for example, the Phi29 DNA polymerase or Bst DNA polymerase performs the rolling circle amplification (RCA) on the single-stranded circular DNA, and an amplified product is called as a DNA nanoball (DNB). The nanoball is fixed on an arrayed silicon chip through a DNB loading technology for subsequent on-machine sequencing. Different properties of Phi29 DNA polymerase mutants have different binding abilities to a substrate DNA. The amplified DNA nanoball products are also different in size, uniformity, branch structure, compactness and other characteristics, and then after the DNB is loaded on the silicon chip, the quality of sequencing is also different. Properties of the Phi29 DNA polymerase also affect an amplification effect of a single-cell whole genome amplified by a Multiple Displacement Amplification (MDA) method, and the quality of single-cell sequencing is affected, for example, a Coverage, a Mapping Rate, a mutation detection accuracy and specificity, these are also very concerned parameters in application of a single-cell sequencing scientific research.
  • The Phi29 DNA polymerase is a medium-temperature polymerase, and may lose activity after being heated at 65°C for 10 min. Some commercial Phi29 DNA polymerases on the market, due to reasons such as stability, are difficult to meet requirements of kit product development in special applications such as sequencing library amplification and single-cell whole genome amplification because of problems in aspects such as an effective signal site on a chip, an amplification preference, a coverage, and variation detection and evaluation.
  • Summary
  • The disclosure provides a protein.
  • The protein provided by the disclosure is a Phi29 DNA polymerase mutant, and is represented by A) or B) below:
    • the protein represented by the A) is a protein having DNA polymerase activity that is obtained by modifying at least one amino acid residue in the following 6 sites in a phi29 DNA polymerase amino acid sequence: the 97-th, 123-th, 217-th, 224-th, 515-th, and 474-th sites, herein the rest amino acid residues are not changed; and
    • the protein represented by the B) is a protein having DNA polymerase activity that is derived from the A) by adding a tag sequence to a terminal of the amino acid sequence of the protein represented by the A).
  • In the above protein, the protein represented by the A) is a protein having DNA polymerase activity that is obtained by modifying amino acid residues in at least 2 or at least 3 or at least 4 or at least 5 or all of the following 6 sites in the phi29 DNA polymerase amino acid sequence: the 97-th, 123-th, 217-th, 224-th, 515-th, and 474-th sites.
  • The above modification is to modify only the 6 sites of the 97-th, 123-th, 217-th 224-th, 515-th and 474-th sites in the phi29 DNA polymerase amino acid sequence according to the above sites to be modified, and the rest amino acid residues are not changed except the 6 sites.
  • In the above protein, the protein represented by the A) is a protein having DNA polymerase activity that is obtained by modifying amino acid residues in all of the following 5 sites in the phi29 DNA polymerase amino acid sequence: the 97-th, 123-th, 217-th, 224-th, and 515-th sites, herein the rest amino acid residues are not changed. Specifically, it is phi29-337 in an embodiment.
  • In the above protein, the protein represented by the A) is a protein having DNA polymerase activity that is obtained by modifying amino acid residues in all of the following 3 sites in the phi29 DNA polymerase amino acid sequence: the 224-th, 515-th and 474-th sites, herein the rest amino acid residues are not changed. Specifically, it is phi29-464 in an embodiment.
  • In the above protein, the protein represented by the A) is a protein having DNA polymerase activity that is obtained by modifying amino acid residues in all of the following 3 sites in the phi29 DNA polymerase amino acid sequence: the 97-th, 123-th and 515-th sites, herein the rest amino acid residues are not changed. Specifically, it is phi29-414 in an embodiment.
  • In the above protein, the protein represented by the A) is a protein having DNA polymerase activity that is obtained by modifying amino acid residues in all of the following 4 sites in the phi29 DNA polymerase amino acid sequence: the 97-th, 123-th, 217-th and 515-th sites, herein the rest amino acid residues are not changed. Specifically, it is phi29-458 in an embodiment.
  • In the above protein, the protein represented by the A) is a protein having DNA polymerase activity that is obtained by modifying amino acid residues in the following 4 sites in the phi29 DNA polymerase amino acid sequence: the 97-th, 123-th, 224-th, and 515-th sites, herein the rest amino acid residues are not changed. Specifically, it is phi29-459 in an embodiment.
  • In the above protein, the protein represented by the A) is a protein having DNA polymerase activity that is obtained by modifying amino acid residues in the following 2 sites in the phi29 DNA polymerase amino acid sequence: the 224-th and 474-th sites, herein the rest amino acid residues are not changed. Specifically, it is phi29-463 in an embodiment.
  • In the above protein, the protein represented by the A) is a protein having DNA polymerase activity that is obtained by modifying amino acid residues in the following 2 sites in the phi29 DNA polymerase amino acid sequence: the 217-th and 224-th sites, herein the rest amino acid residues are not changed. Specifically, it is phi29-335 in an embodiment.
  • In the above protein, the modification is amino acid substitution.
  • In the above protein, the amino acid substitutions in 6 sites of the 97-th, 123-th, 217-th, 224-th, 515-th and 474-th sites are respectively as follows:
    • a methionine in the 97-th site is substituted with an alanine or a histidine or a lysine or a threonine;
    • a leucine in the 123-th site is substituted with a lysine or a phenylalanine or an isoleucine or a histidine;
    • a glycine in the 217-th site is substituted with a glutamic acid;
    • a tyrosine in the 224-th site is substituted with a lysine;
    • an isoleucine in the 474-th site is substituted with a lysine; and
    • a glutamic acid in the 515-th site is substituted with a proline or a glycine.
  • In the above protein, the protein represented by the A) is a protein having DNA polymerase activity that is obtained by mutating the amino acid residue from M into K in the 97-th site, from L into H in the 123-th site, from E into P in the 515-th site, from Y into K in the 224-th site, and from G into K in the 217-th site of the phi29 DNA polymerase amino acid sequence, herein the rest amino acid residues are not changed.
  • In the above protein, the protein represented by the A) is a protein that is obtained by mutating the amino acid residue from Y into K in the 224-th site, from I into K in the 474-th site, and from E into P in the 515-th site of the phi29 DNA polymerase amino acid sequence.
  • In the above protein, the protein represented by the A) is a protein that is obtained by mutating the amino acid residue from M into T in the 97-th site, from L into H in the 123-th site, and from E into P in the 515-th site of the phi29 DNA polymerase amino acid sequence.
  • In the above protein, the phi29 DNA polymerase amino acid sequence is (I) or (II) or (III) below:
    1. (I) a protein shown in SEQ ID NO: 2 of a sequence listing;
    2. (II) a protein having more than 90% identity with the protein shown in SEQ ID NO: 2 of the sequence listing and derived from a Bacillus subtilis protein; and
    3. (III) a protein having more than 95% identity with the protein shown in SEQ ID NO: 2 of the sequence listing and derived from a Bacillus subtilis protein.
  • In the above protein, the stability of the protein is higher than that of the phi29 DNA polymerase.
  • In the above protein, the stability is thermal stability.
  • A nucleic acid molecule for encoding the above protein is also within a scope of protection of the disclosure.
  • An expression cassette, a recombinant vector, recombinant bacteria or a transgenic cell line containing the above nucleic acid molecule is also within a scope of protection of the disclosure.
  • Use of the above protein in at least one of the following 1)-11) is also within a scope of protection of the disclosure:
    1. 1) as a DNA polymerase;
    2. 2) catalyzing DNA replication and/or catalyzing DNA amplification;
    3. 3) catalyzing rolling circle amplification and/or catalyzing multiple-strand displacement amplification;
    4. 4) performing DNA sequencing or RNA sequencing or whole genome sequencing;
    5. 5) constructing a RCA library;
    6. 6) detecting a genome amplification coverage;
    7. 7) preparing a kit for catalyzing the DNA replication and/or catalyzing the DNA amplification;
    8. 8) preparing a product for catalyzing the rolling circle amplification and/or catalyzing the multiple-strand displacement amplification;
    9. 9) preparing a product for performing the DNA sequencing or the RNA sequencing or the whole genome sequencing;
    10. 10) preparing a product for constructing the RCA library; and
    11. 11) preparing a product for detecting the genome amplification coverage.
  • Use of the nucleic acid molecule for encoding the above protein, the expression cassette containing the nucleic acid molecule, the recombinant vector containing the nucleic acid molecule, the recombinant bacteria containing the nucleic acid molecule, or the transgenic containing the nucleic acid molecule in at least one of the following 1)-10) is also within a scope of protection of the disclosure:
    1. 1) catalyzing DNA replication and/or catalyzing DNA amplification;
    2. 2) catalyzing rolling circle amplification and/or catalyzing multiple-strand displacement amplification;
    3. 3) performing DNA sequencing or RNA sequencing or whole genome sequencing;
    4. 4) constructing a RCA library;
    5. 5) detecting a genome amplification coverage;
    6. 6) preparing a product for catalyzing the DNA replication and/or catalyzing the DNA amplification;
    7. 7) preparing a product for catalyzing the rolling circle amplification and/or catalyzing the multiple-strand displacement amplification;
    8. 8) preparing a product for performing the DNA sequencing or the RNA sequencing or the whole genome sequencing;
    9. 9) preparing a product for constructing the RCA library; and
    10. 10) preparing a product for detecting the genome amplification coverage.
  • Another purpose of the disclosure is to provide a method for improving stability of a phi29 DNA polymerase.
  • The method provided by the disclosure includes the following steps: modifying at least one amino acid residue(s) in the following 6 sites of the phi29 DNA polymerase amino acid sequence: the 97-th, 123-th, 217-th, 224-th, 515-th and 474-th sites, in the modification modes above, herein the rest amino acid residues are not changed, to obtain a protein having DNA polymerase activity.
  • In the above method, the stability is thermal stability.
  • The Phi29 DNA polymerase of the disclosure may exist in the form of an independently packaged DNA polymerase product, or may be packaged into a DNA amplification kit or a DNA sequencing kit. The disclosure is capable of, through site-directed mutagenesis and screening technologies to obtain the mutant with the greatly improved thermal stability. Herein the amplification coverage of some mutants in single-cell whole genome amplification is greatly improved, and the accuracy and sensitivity of the mutation detection are improved, and reach a same level of QIAGEN similar products; and other mutants in the disclosure have a good effect on improving a DNB loading effect in application of RCA library amplification.
  • The recombinant vector is obtained by inserting the nucleic acid molecule into an expression vector.
  • The expression vector may specifically be a pET28a(+) vector.
  • The recombinant bacteria are bacteria obtained by introducing the recombinant vector into original bacteria.
  • The original bacteria may be Escherichia coli.
  • The E. coli may specifically be Escherichia coli BL21 (DE3).
  • The transgenic cell line may be obtained by transforming the recombinant vector into recipient cells. The transgenic cell line is a non-plant propagative material.
  • The stability may specifically be thermal stability. The thermal stability may specifically be thermal stability at 37°C.
  • The phi29 DNA polymerase may be (I) or (II) or (III) below:
    1. (I) a protein shown in SEQ ID NO: 2 of a sequence listing;
    2. (II) a protein having more than 90% identity with the protein shown in SEQ ID NO: 2 of the sequence listing and derived from a Bacillus subtilis protein; and
    3. (III) a protein having more than 95% identity with the protein shown in SEQ ID NO: 2 of the sequence listing and derived from a Bacillus subtilis protein.
    Brief Description of the Drawings
    • Fig. 1 is a construction schematic diagram of a Phi29 gene expression vector.
    • Fig. 2 is a coverage of a housekeeping gene in a MDA product detected by multiple PCR.
    • Fig. 3 is data analysis of an on-machine test of RCA library construction.
    Detailed Description of the Embodiments
  • The following embodiments are convenient for understanding the disclosure better, but do not limit the disclosure. Unless otherwise specified, experimental methods in the following embodiments are all conventional methods. Unless otherwise specified, test materials used in the following embodiments are all purchased from conventional biochemical reagent stores. Quantitative tests in the following embodiments are all set to three times of repeated experiments, and results are averaged. For each solution or buffer in the following embodiments, unless otherwise specified, solvents are all water.
  • pET28a(+) vector: Novagen Company.
  • Escherichia coli BL21 (DE3): TIANGEN, CB105-02.
  • Storage buffer: 10 mM Tris-HCI, 100 mM KCI, 1 mM DTT, 0.1 mM EDTA, 0.5% (v/v) Tween20, 0.5% (v/v) NP-40, 50% (v/v) Glycerol, and pH 7. 4@25°C.
  • 141 RCA Primer in the following embodiments: TCCTAAGACCGCTTGGCCTCCGACT.
  • 141 Ad ssDNA in the following embodiments: self-made by BGI, a single-stranded loop library of a certain size range, without a fixed sequence (a random library formed by four nucleotides A/T/C/G, and a main band length is 200-300 bp).
  • In the following embodiments, a DNA molecule shown in SEQ ID NO: 1 of a sequence listing is an encoding gene of a wild-type Phi29 DNA polymerase, and it expresses a protein shown in SEQ ID NO: 2 of the sequence listing, namely the wild-type Phi29 DNA polymerase (represented by WT).
  • Embodiment 1: Preparation of Phi29 DNA polymerase mutant
  • A Phi29 DNA polymerase mutant is obtained by mutating at least one of the 97-th, 123-th, 217-th, 224-th, 474-th, and 515-th sites in an amino acid sequence of a wild-type Phi29 DNA polymerase. Specifically, a single-site mutation form is shown in Table 1, and a multi-site combination mutation form is shown in Table 2.
  • I. Construction of a recombinant vector for expressing Phi29 DNA polymerase mutant 1. Recombinant vector for expressing Phi29 DNA polymerase single-site mutant
  • A DNA molecule shown in SEQ ID NO: 2 of a sequence listing is inserted between Ndel and BamHI restriction sites of a pET28a(+) vector (Fig. 1), to obtain a recombinant vector WT for expressing a wild-type Phi29 DNA polymerase.
  • The recombinant vector WT is served as an original vector, each primer pair shown in Table 1 is used to introduce a site mutation, and each recombinant vector for expressing the Phi29 DNA polymerase mutant is obtained.
  • The above method of introducing the site mutation by using each primer pair shown in Table 1 is as follows.
  • The recombinant vector WT is tested as a template, in a site-directed mutation PCR reaction system (25 µl) containing the following components: 2.5 µl 10x Pfu Reaction Buffer with Mg2+, 2 µl dNTP Mix (2.5 mM each), 25 ng pET28a-Phi29 plasmid, 0.5 µl Pfu DNA Polymerase, mutation primers of mutation sites (Table 1) are respectively added, and PCR amplification is performed.
  • PCR conditions are as follows: 95°C 3 min, 19 cycle for [95°C 30s, 53°C 30s, 68°C 8 min], 68°C 10 min, 4°C forever. After the reaction product is digested with Dpnl, it is transformed into DH5a competent cells, spread out on a kanamycin-resistant LB plate, and then it is incubated overnight in an incubator at 37°C, a monoclonal plasmid is picked out for sequencing, to verify whether a specific amino acid site is successfully mutated. Table 1: Single-site mutation primers
    Phi29 DNA polymerase mutant Forward primer Reverse primer
    M97H
    Figure imgb0001
    Figure imgb0002
    M97A
    Figure imgb0003
    Figure imgb0004
    M97K
    Figure imgb0005
    Figure imgb0006
    L123K
    Figure imgb0007
    Figure imgb0008
    L123F
    Figure imgb0009
    Figure imgb0010
    L123I
    Figure imgb0011
    Figure imgb0012
    L123H
    Figure imgb0013
    Figure imgb0014
    E515P
    Figure imgb0015
    Figure imgb0016
    Phi29-192 (Y224K)
    Figure imgb0017
    Figure imgb0018
    Phi29-103 (G217E)
    Figure imgb0019
    Figure imgb0020
    phi29-85 (I474K)
    Figure imgb0021
    Figure imgb0022
  • Compared with the recombinant vector WT, a difference from a recombinant vector for expressing a Phi29 DNA polymerase mutant M97H is only that: the 289-291-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "ATG" into "CAT". The mutated DNA molecule encodes the mutant M97H. Compared with the wild-type Phi29 DNA polymerase, a difference from the mutant M97H is only that the amino acid residue in the 97-th site of the wild-type Phi29 DNA polymerase amino acid sequence is mutated from M into H.
  • Compared with the recombinant vector WT, a difference from a recombinant vector for expressing a Phi29 DNA polymerase mutant M97A is only that: the 289-291-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "ATG" into "GCG". The mutated DNA molecule encodes the mutant M97A. Compared with the wild-type Phi29 DNA polymerase, a difference from the mutant M97A is only that the amino acid residue in the 97-th site of the wild-type Phi29 DNA polymerase amino acid sequence is mutated from M into A.
  • Compared with the recombinant vector WT, a difference from a recombinant vector for expressing a Phi29 DNA polymerase mutant M97K is only that: the 289-291-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "ATG" into "AAA". The mutated DNA molecule encodes the mutant M97K. Compared with the wild-type Phi29 DNA polymerase, a difference from the mutant M97K is only that the amino acid residue in the 97-th site of the wild-type Phi29 DNA polymerase amino acid sequence is mutated from M into K.
  • Compared with the recombinant vector WT, a difference from a recombinant vector for expressing a Phi29 DNA polymerase mutant L123K is only that: the 367-369-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "CTG" into "AAA". The mutated DNA molecule encodes the mutant L123K. Compared with the wild-type Phi29 DNA polymerase, a difference from the mutant L123K is only that the amino acid residue in the 123-th site of the wild-type Phi29 DNA polymerase amino acid sequence is mutated from L into K.
  • Compared with the recombinant vector WT, a difference from a recombinant vector for expressing a Phi29 DNA polymerase mutant L123F is only that: the 367-369-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "CTG" into "TTT". The mutated DNA molecule encodes the mutant L123F. Compared with the wild-type Phi29 DNA polymerase, a difference from the mutant L123F is only that the amino acid residue in the 123-th site of the wild-type Phi29 DNA polymerase amino acid sequence is mutated from L into F.
  • Compared with the recombinant vector WT, a difference from a recombinant vector for expressing a Phi29 DNA polymerase mutant L123I is only that: the 367-369-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "CTG" into "ATT". The mutated DNA molecule encodes the mutant L123I. Compared with the wild-type Phi29 DNA polymerase, a difference from the mutant L123I is only that the amino acid residue in the 123-th site of the wild-type Phi29 DNA polymerase amino acid sequence is mutated from L into I.
  • Compared with the recombinant vector WT, a difference from a recombinant vector for expressing a Phi29 DNA polymerase mutant L123H is only that: the 367-369-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "CTG" into "CAT". The mutated DNA molecule encodes the mutant L123H. Compared with the wild-type Phi29 DNA polymerase, a difference from the mutant L123H is only that the amino acid residue in the 123-th site of the wild-type Phi29 DNA polymerase amino acid sequence is mutated from L into H.
  • Compared with the recombinant vector WT, a difference from a recombinant vector for expressing a Phi29 DNA polymerase mutant E515P is only that: the 1543-1545-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "GAA" into "CCG". The mutated DNA molecule encodes the mutant E515P. Compared with the wild-type Phi29 DNA polymerase, a difference from the mutant E515P is only that the amino acid residue in the 515-th site of the wild-type Phi29 DNA polymerase amino acid sequence is mutated from E into P.
  • Compared with the recombinant vector WT, a difference from a recombinant vector for expressing a Phi29 DNA polymerase mutant Y224K is only that: the 670-672-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "TAT" into "AAA". The mutated DNA molecule encodes the mutant Y224K. Compared with the wild-type Phi29 DNA polymerase, a difference from the mutant Y224K is only that the amino acid residue in the 224-th site of the wild-type Phi29 DNA polymerase amino acid sequence is mutated from Y into K.
  • Compared with the recombinant vector WT, a difference from a recombinant vector for expressing a Phi29 DNA polymerase mutant G217E is only that: the 649-651 -th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "GGC" into "GAA". The mutated DNA molecule encodes the mutant G217E. Compared with the wild-type Phi29 DNA polymerase, a difference from the mutant G217E is only that the amino acid residue in the 217-th site of the wild-type Phi29 DNA polymerase amino acid sequence is mutated from G into E.
  • Compared with the recombinant vector WT, a difference from a recombinant vector for expressing a Phi29 DNA polymerase mutant 1474K is only that: the 1420-1422-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "ATT" into "TTT". The mutated DNA molecule encodes the mutant I474K. Compared with the wild-type Phi29 DNA polymerase, a difference from the mutant I474K is only that the amino acid residue in the 474-th site of the wild-type Phi29 DNA polymerase amino acid sequence is mutated from I into K.
  • 2. Construction of recombinant vector for expressing Phi29 DNA polymerase multi-site mutant
  • The recombinant vector WT is served as an original vector, each primer pair shown in Table 1 is used to introduce a site mutation successively, to obtain each recombinant vector for expressing a Phi29 DNA polymerase mutant. A specific mutation form is shown in Table 2: Table 2
    Phi29 DNA polymerase mutant number Phi29 DNA polymerase mutant name
    phi29-337 M97K-L123H-E515P-Y224K-G217E
    phi29-414 M97T-L123K-E515P
    phi29-456 M97K-L123H-E515P
    Phi29-464 Y224K-I474K-E515P
    phi29-458 M97K-L123H-E515P-G217E
    phi29-459 M97K-L123H-E515P-Y224K
    Phi29-463 Y224K-I474K
    Phi29-335 Y224K-G217E
  • Compared with the recombinant vector WT, a difference from a recombinant vector for expressing a Phi29 DNA polymerase mutant M97K-L123H-E515P-Y224K-G217E is only that: the 289-291-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "ATG" into "AAA", the 367-369-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "CTG" into "CAT", the 1543-1545-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "GAA" into "CCG", the 670-672-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "TAT" into "AAA", the 649-651-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "GGC" into "GAA". The mutated DNA molecule encodes the mutant M97K-L123H-E515P-Y224K-G217E. Compared with the wild-type Phi29 DNA polymerase, a difference from the mutant M97K-L123H-E515P-Y224K-G217E is only that the amino acid residue in the 97-th site of the wild-type Phi29 DNA polymerase amino acid sequence is mutated from M into K, and the 123-th site is mutated from L into H, the 515-th site is mutated from E into P, the 224-th site is mutated from Y into K, and the 217-th site is mutated from G into E.
  • Compared with the recombinant vector WT, a difference from a recombinant vector for expressing a Phi29 DNA polymerase mutant M97T-L123K-E515P is only that the 289-291-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "ATG" into "ACC", the 367-369-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "CTG" into "AAA", the 1543-1545-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "GAA" into "CCG". The mutated DNA molecule encodes the mutant M97T-L123K-E515P. Compared with the wild-type Phi29 DNA polymerase, a difference from the mutant M97T-L123K-E515P is only that the amino acid residue in the 97-th site of the wild-type Phi29 DNA polymerase amino acid sequence is mutated from M into T, and the 123-th site is mutated from L into K, and the 515-th site is mutated from E into P.
  • Compared with the recombinant vector WT, a difference from a recombinant vector for expressing a Phi29 DNA polymerase mutant M97K-L123H-E515P is only that: the 289-291-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "ATG" into "AAA", the 367-369-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "CTG" into "CAT", the 1543-1545-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "GAA" into "CCG". The mutated DNA molecule encodes the mutant M97T-L123H-E515P. Compared with the wild-type Phi29 DNA polymerase, a difference from the mutant M97K-L123H-E515P is only that the amino acid residue in the 97-th site of the wild-type Phi29 DNA polymerase amino acid sequence is mutated from M into T, and the 123-th site is mutated from L into H, and the 515-th site is mutated from E to P.
  • Compared with the recombinant vector WT, a difference from a recombinant vector for expressing a Phi29 DNA polymerase mutant Y224K-I474K-E515P is only that: the 670-672-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "TAT" into "AAA", the 1420-1422-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "ATT" into "TTT", the 1543-1545-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "GAA" into "CCG". The mutated DNA molecule encodes the mutant Y224K-I474K-E515P. Compared with the wild-type Phi29 DNA polymerase, a difference from the mutant Y224K-I474K-E515P is only that the amino acid residue in the 224-th site of the wild-type Phi29 DNA polymerase amino acid sequence is mutated from Y into K, and the 474-th site is mutated from I into K, and the 515-th site is mutated from E into P.
  • Compared with the recombinant vector WT, a difference from a recombinant vector for expressing a Phi29 DNA polymerase mutant M97K-L123H-E515P-G217E is only that: the 289-291 -th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "ATG" into "AAA", the 367-369-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "CTG" into "CAT", the 1543-1545-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "GAA" into "CCG", and the 649-651-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "GGC" to "GAA". The mutated DNA molecule encodes the mutant M97K-L123H-E515P-G217E. Compared with the wild-type Phi29 DNA polymerase, a difference from the mutant M97K-L123H-E515P-G217E is only that the amino acid residue in the 97-th site of the wild-type Phi29 DNA polymerase amino acid sequence is mutated from M into K, the amino acid residue in the 123-th site is mutated from L into H, and the 515-th site is mutated from E into P, and the 217-th site is mutated from G into E.
  • Compared with the recombinant vector WT, a difference from a recombinant vector for expressing a Phi29 DNA polymerase mutant M97K-L123H-E515P-Y224K is only that: the 289-291-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "ATG" into "AAA", the 367-369-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "CTG" into "CAT", the 1543-1545-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "GAA" into "CCG", and the 670-672-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "TAT" into "AAA". The mutated DNA molecule encodes the mutant M97K-L123H-E515P-G217E. Compared with the wild-type Phi29 DNA polymerase, a difference from the mutant M97K-L123H-E515P-G217E is only that the amino acid residue in the 97-th site of the wild-type Phi29 DNA polymerase amino acid sequence is mutated from M into K, the amino acid residue in the 123-th site is mutated from L into H, and the 515-th site is mutated from E into P, and the 224-th site is mutated from Y into K.
  • Compared with the recombinant vector WT, a difference from a recombinant vector for expressing a Phi29 DNA polymerase mutant Y224K-I474K is only that: the 670-672-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "TAT" into "AAA", the 1420-1422-th nucleotides of the DNA molecule shown in SEQ ID NO: 1 of the sequence listing are mutated from "ATT" into "TTT". The mutated DNA molecule encodes the mutant Y224K-I474K. Compared with the wild-type Phi29 DNA polymerase, a difference from the mutant Y224K-I474K is only that the amino acid residue in the 224-th site of the wild-type Phi29 DNA polymerase amino acid sequence is mutated from Y into K, and the amino acid residue in the 474-th site is mutated from I into K.
  • II. Construction of recombinant bacteria for expressing Phi29 DNA polymerase mutant
  • The recombinant vector WT and each recombinant vector for expressing the Phi29 DNA polymerase mutant constructed in step I are respectively introduced into Escherichia coli BL21 (DE3), to obtain recombinant bacteria for expressing the wild-type Phi29 DNA polymerase and each recombinant bacterium for expressing the Phi29 DNA polymerase mutant.
  • III. Induced expression of recombinant bacteria
  • The recombinant bacteria for expressing the wild-type Phi29 DNA polymerase and each recombinant bacterium for expressing the Phi29 DNA polymerase mutant obtained in step II are taken, and sequentially induced and purified, to obtain the wild-type Phi29 DNA polymerase fused with an HiS6 tag at an N-terminal and each Phi29 DNA polymerase mutant fused with an HiS6 tag at an N-terminal.
  • The wild-type Phi29 DNA polymerase fused with the HiS6 tag at the N-terminal and each Phi29 DNA polymerase mutant fused with the HiS6 tag at the N-terminal are successively named as a wild-type Phi29 DNA polymerase with the HiS6 tag, a Phi29 DNA polymerase mutant M97H with the HiS6 tag, a Phi29 DNA polymerase mutant M97A with the HiS6 tag, a Phi29 DNA polymerase mutant M97K with the HiS6 tag, a Phi29 DNA polymerase mutant L123K with the HiS6 tag, a Phi29 DNA polymerase mutant L123F with the HiS6 tag, a Phi29 DNA polymerase mutant L123I with the HiS6 tag, a Phi29 DNA polymerase mutant L123H with the HiS6 tag, a Phi29 DNA polymerase mutant E515P with the HiS6 tag, a Phi29 DNA polymerase mutant E515G with the HiS6 tag, a Phi29 DNA polymerase mutant Y224K with the HiS6 tag, a Phi29 DNA polymerase mutant G217E with the HiS6 tag, a Phi29 DNA polymerase mutant I474K with the HiS6 tag, a Phi29 DNA polymerase mutant M97K-L123H-E515P-Y224K-G217E with the His6 tag, a Phi29 DNA polymerase mutant M97T-L123K-E515P with the His6 tag, a Phi29 DNA polymerase mutant Y224K-I474K-E515P with the HiS6 tag, a Phi29 DNA polymerase mutant M97K-L123H-E515P-G217E with the HiS6 tag, a Phi29 DNA polymerase mutant M97K-L123H-E515P-Y224K with the HiS6 tag, a Phi29 DNA polymerase mutant Y224K-I474K with the HiS6 tag, and a Phi29 DNA polymerase mutant Y224K-G217E with the His6 tag.
  • 1. Specific steps of induction are as follows: (1) Live bacteria
  • The recombinant bacteria are seeded into 3 ml of a liquid LB medium containing Kana resistance, and cultured overnight.
  • (2) Transfer
  • After the step (1) is completed, the above bacterial solution is transferred to 2 ml of the liquid LB medium containing the Kana resistance according to a 1/100 volume, and shake-cultured at 37°C and 220 rpm until OD600nm = 0.6 (in a practical application, OD600nm = 0.4-0.8 is acceptable).
  • (3) Induction
  • After the step (2) is completed, IPTG with a final concentration of 0.5 mM is added to a system, and shake-cultured at 16°C and 220 rpm for 12 h.
  • (4) Bacteria collection
  • After the step (3) is completed, it is centrifuged at 4°C and 8000 rpm for 5 min, and bacteria are collected.
  • 2. An AKTA Pure purification system of GE Company is used for purification, and specific steps are as follows:
    1. (1) The bacteria obtained in the step 1 are taken, shaken and uniformly mixed with resuspension buffer (20 mM Tris-HCI, 500 mM NaCl, 20 mM Imidazole, 5% Glycerol, and pH 7.9 @25°C), it is ultrasonically crushed on ice, and then centrifuged at 4°C and 12000 rpm for 30 min, and supernatant is collected.
    2. (2) The supernatant obtained in the step (1) is taken, and a nickel column affinity chromatography (HisTrap FF 5 ml pre-packed column) is used for purification. Specific steps are as follows: firstly it is equilibrated with 10 column volumes of Buffer A; then a sample is loaded; then it is rinsed with 20 column volumes of the Buffer A; then it is eluted with 15 column volumes of eluent and post-column solution with a target protein is collected (the eluent is formed by Buffer A and Buffer B, and in an elution process, a volume fraction of the Buffer B is linearly increased from 0% to 100%, and correspondingly a volume fraction of the Buffer A is linearly decreased 100% to 0%).
      • Buffer A: 20 mM Tris-HCI, 500 mM NaCl, 20 mM Imidazole, 5% (v/v) Glycerol; pH 7.9@ 25°C.
      • Buffer B: 20 mM Tris-HCI, 500 mM NaCl, 500 mM Imidazole, 5% (v/v) Glycerol; pH7.9@ 25°C.
    3. (3) The post-column solution obtained in the step (2) is taken, and a strong anion column chromatography (HiTrap Q HP 5 ml pre-packed column) is used for purification. Specific steps are as follows: firstly it is equilibrated with 10 column volumes of mixed buffer formed by Buffer A with a volume fraction of 59% and Buffer B with a volume fraction of 41%; then a sample is loaded; and after a protein peak appears, flow-through solution is collected (collection is performed after a UV detection value raises to 20 mAu, and the collection is stopped after the UV detection value drops to 50 mAu).
      • Buffer A: 20 mM Tris-HCI, 150 mM NaCl, 5% (v/v) Glycerol, pH7.5@ 25°C.
      • Buffer B: 20 mM Tris-HCI, 1 M NaCl, 5% (v/v) Glycerol, pH7.5@ 25°C.
    4. (4) The flow-through solution obtained in the step (3) is taken, and a cation exchange chromatography (HiTrap SP HP pre-packed column) is used for purification, to obtain protein sample solution of which a purity is greater than 95%. Specific steps are as follows: firstly it is equilibrated with 10 column volumes of Buffer A; then a sample is loaded; then it is rinsed with 15 column volumes of the Buffer A; then it is eluted with 10 column volumes of eluent (the eluent is formed by Buffer A and Buffer B, and in an elution process, a volume fraction of the Buffer B is linearly increased from 0% to 50%, and correspondingly a volume fraction of the Buffer A is linearly decreased 100% to 50%) and post-column solution with a target protein is collected (collection is performed after a UV detection value raises to 50 mAu, and the collection is stopped after the UV detection value drops to 100 mAu).
      • Buffer A: 20 mM Tris-HCI, 150 mM NaCl, 5% (v/v) Glycerol, pH7.5@ 25°C.
      • Buffer B: 20 mM Tris-HCI, 1 M NaCl, 5% (v/v) Glycerol, pH7.5@ 25°C.
    5. (5) The target protein collected in the step (4) is taken and transferred to a dialysis bag, after dialysis in dialysis buffer overnight, protein solution in the dialysis bag is collected, and other reagents are added, to obtain target protein solution with a protein concentration of 1 mg/ml. The concentrations of other components in the target protein solution are as follows: 10 mM Tris-HCI (pH7.4@ 25°C), 100 mM KCI, 1 mM DTT, 0.1 mM EDTA, 0.5%(v/v)NP-40, 0.5% (v/v) Tween20, 50% (v/v) Glycerol.
  • Dialysis buffer: 23.75 mM Tris-HCI (pH7.4@ 25°C), 237.5 mM KCI, 2.375 mM DTT, 0.2375 mM EDTA, 5% (v/v) Glycerol.
  • Embodiment 2: Polymerization activity test of wild-type Phi29 DNA polymerase and mutant
  • The wild-type Phi29 DNA polymerase solution with the HiS6 tag and the Phi29 DNA polymerase mutant solution with the HiS6 tag prepared in Embodiment 1 are taken as enzyme solution to be tested.
    1. 1. Each enzyme solution to be tested is diluted to 5000 times in a gradient by using storage buffer, adequately and uniformly mixed in a vortex shaker, and it is standing on ice for 5 min, to obtain each solution to be tested.
      A pre-reaction system is uniformly mixed in a PCR tube, and placed in a PCR instrument, the following procedures are performed: 95°C 1 min, 65°C 1 min, 40°C 1 min, and a hot lid temperature is set to 102°C.
      Pre-reaction system (80.8 µl): 50 mM Tris-HCI (pH7.5), 4 mM DTT, 10 mM (NH4)2SO4, 10 mM MgCl2, 50 nM dNTP Mixture, 2 pM 141RCA Primer and 18 ng single-stranded circular DNA template 141 Ad ssDNA.
    2. 2. After the step 1 is completed, the PCR tube is taken out and placed on ice while the temperature reaches 4°C. 1 µl of each solution to be tested is respectively added in a test group, and 1 µl of the storage buffer is added in a negative control group. Then, the vortex shaker is used to shake and mix uniformly, it is placed in the PCR instrument after being transitorily centrifuged for 5 s in a centrifuge, and the following procedures are performed: 30°C 60 min, and a hot lid temperature is set to 65°C.
    3. 3. After the step 2 is completed, 5 µL of 0.5 M EDTA solution is added to stop a reaction, and it is shaken and mixed uniformly.
    4. 4. A Qubit ssDNA Assay Kit (Q10212, INVITROGEN) is used and operated according to instructions. A Qubit fluorometer3.0 is used to detect a concentration of DNB (DNA Nano ball) in a reaction product.
  • Enzyme activity of enzyme solution to be tested=ΔDNBx5000÷37.38.
  • Note: ΔDNB is a difference value between concentration average values of the reaction products in the systems after the reactions of the test group and the negative control group are terminated, 5000 is a dilution factor, and 37.38 is a slope of a functional relationship between the enzyme activity and the ΔDNB.
  • Enzyme activity results of some enzyme solution to be tested are shown in Table 3. Table 3
    Polymerase Control group average value Experimental group average value ΔDNB (ng/µl) Enzyme activity of prepared enzyme solution (U/µl)
    WT 0.46 0.96 0. 51 67.6
    E515P 0.37 0. 73 0. 37 49.3
    L123K 0.4 0. 77 0. 37 50.1
    M97A 0.4 0.75 0.36 48
    G217E 0.42 0.97 0.55 73.8
    Y224K 0. 38 0.8 0.42 56.1
    1474K 0.48 1.06 0.57 15.4
  • Embodiment 3: Thermal stability test of wild-type Phi29 DNA polymerase and mutant 37°C 10 min experiment:
  • The target protein solution (the wild-type Phi29 DNA polymerase solution with the His6 tag and the Phi29 DNA polymerase mutant solution with the His6 tag) prepared in Embodiment 1 is taken, and divided into two parts, and they are respectively treated as follows:
    • First part: it is placed in a metal bath preheated to 37°C for 10 min, and centrifuged at 4°C and 13000 rpm for 1 min, and supernatant is collected; and then, the supernatant is taken, and diluted to 1000 times of a volume with the storage buffer, and the vortex shaker is used to adequately mix uniformly, and then it is standing on ice for 5 min, to obtain solution 1 to be tested.
    • Second part: it is diluted to 5000 times of a volume with the storage buffer, and adequately mixed uniformly with the vortex shaker, and then it is standing on ice for 5 min, to obtain solution 2 to be tested.
  • It is performed according to the steps 1 to 4 of Embodiment 2.
  • Unheated enzyme activity (U1)=ΔDNB×5000÷37.38; ΔDNB is a difference value between concentration average values of reaction products in the systems after the reactions of the test group (second part) and the negative control group are terminated;
    Heated enzyme activity (U2)=ΔDNB×1000÷37.38; ΔDNB is a difference value between concentration average values of reaction products in the systems after the reactions of the test group (first part) and the negative control group are terminated;
    5000 and 1000 are dilution factors respectively, and 37.38 is a slope of a functional relationship between the enzyme activity and the ΔDNB;
    an enzyme activity loss ratio is calculated according to the activities of the unheated and heated enzyme solution, Enzyme activity loss ratio % = U 1 U 2 ÷ U 1 × 100 % ;
    Figure imgb0023
  • U1 is the activity of the unheated enzyme solution, and U2 is the activity of the heated enzyme solution.
  • -20°C experiment: a difference from the 37°C 10 min experiment is only that the 10 min in the 37°C metal bath is replaced with the 10 min in a refrigerator at -20°C.
  • The specific enzyme activity and the enzyme activity loss ratio of each mutant are shown in Table 4. Compared with the wild type (WT), the enzyme activity loss ratios of the mutants in examples are all improved to a certain extent; and a numeral value of the enzyme activity loss ratio is larger, the enzyme is more unstable, and the thermal stability is worse. Table 4
    Mutation site Heat treatment condition Average value (ng/µl) ΔDNB (ng/µl) Diluted enzyme solution activity (U) Originalenzyme solution activity (U/µl) Specific enzyme activity (U/ ug) Enzyme activity loss ratio Note
    Enzyme concentration (mg/ ml) Original enzyme solution dilution factor
    Phi29-WT -20°C 1.12 0.74 0.02 59.2 74 98.60 % 0.8 3000
    37 °C
    (Wild type) 10min 0.68 0.3 0.008 0.8 100
    NC 0.38
    Phi29-Enzymatics (Commercial enzyme of Enzymatics Company)
    -20 °C 1.04 0.57 0.015 76.7 63.9 85.40 % 1.2 5000
    37 °C
    10min 0.55 0.08 0.002 11.2 5000
    NC 0.46
    Phi29-337 (M97K-L123H-E515P-Y224K-G217E) -20 °C 1.87 1.41 0.038 18.8 104.6 7.80% 0.18 500
    37 °C
    15min 1.76 1.3 0.035 17.4 500
    NC 0.46
    Phi29-414 -20 °C 1.13 0.734 0.020 19.6 67.7 12.26 % 0.29 1000
    37 °C
    (M97T-L123K-E515P) 10min 1.04 0.644 0.017 17.2 1000
    NC 0.396
    Phi29-456 -20 °C 1.14 0.697 0.018 36.9 60.2 35.19 % 0.613 2000
    37 °C
    (M97K-L123H-E515P) 10min 2.25 1.807 0.048 23.9 500
    NC 0.443
    Phi29-464 -20 °C 2.05 1.633 0.027 53.72 57.15 63.67 % 0.94 2000
    (Y224K-I474K-E515P) 37 °C
    10min 2.79 2.373 0.039 19.51 500
    NC 0.417
    Phi29-36 -20 °C 1.46 1.04 0.017 51.5 51.5 70.20 1 3000
    %
    (E515P) 37 °C
    10min 1.35 0.93 0.015 15.3 1000
    NC 0.42
    Phi29-458 -20 °C 0.936 0.583 0.016 31.2 31.2 70.97 % 1 2000
    (M97K-L123H-E515P-G217E) 37 °C
    10min 1.03 0.677 0.018 9.1 500
    NC 0.353
    Phi29-459 -20 °C 0.825 0.472 0.013 25.3 25.3 72.35 % 1 2000
    (M97K-L123H -E515P-Y224K) 37 °C
    10min 0.875 0.522 0.014 7.0 500
    NC 0.353
    Phi29-463 -20 °C 1.81 1.347 0.04 36.04 72.07 80.91 % 0.5 1000
    (Y224K-I474K) 37 °C
    10min 1.32 0.857 0.02 6.88 300
    NC 0.463
    Phi29-103 -20 °C 0.97 0.55 0.015 73.8 70.3 85.20 % 1.05 5000
    (G217E) 37 °C
    10min 0.5 0.08 0.002 10.9 5000
    NC 0.42
    Phi29-335 -20 °C 1.94 1.51 0.041 81 85.3 86.70 0.95 2000
    %
    (Y224K-G217E) 37 °C
    10min 1.23 0.8 0.022 10.8 500
    NC 0.43
    Phi29-192 -20 °C 1.43 1.05 0.028 56.1 56.1 87.30 % 1 2000
    (Y224K) 37 °C
    10min 1.71 1.33 0.036 7.1 200
    NC 0.38
    0.220
    Phi29-85 -20 °C 0.682 5 0.027 29.5 36.9 88.66 % 0.8 5000
    37 °C 0.586
    (I474K) 10min 5 0.125 0.039 3.3 1000
    0.461
    NC 5
  • In the above table, NC is a background value, and a blank is because there is no data calculation processing.
  • Embodiment 4: Genomic amplification coverage detection
  • In order to detect a coverage to which a sample is extended before on-machine sequencing, a multiple PCR mode is used to amplify a multiple housekeeping gene in an MDA product.
  • A specific operating process is as follows: a NA12878 reference genome sample (Coriell Institute) is added to 200 µl of a PCR tube, a total volume is 4 µl, and if it is not enough, PBS is added to supplement to 4 µl. 3 µl of Buffer D2 (QIAGEN REPLI-g Single Cell Kit) is added to the PCR tube, a pipette tip should be attached to a tube wall, and is not inserted under a liquid surface, and centrifuging is performed without shaking. After being centrifuged, it is put on a PCR instrument at 65°C for 10 min. After it is finished, it is placed on ice, 3 µl of neutralization buffer (QIAGEN REPLI-g Single Cell Kit) is added to the PCR tube, the pipette tip should be attached to the tube wall, and is not inserted under the liquid surface, the centrifuging is performed without shaking. 39 µl of MDA reaction buffer (10x phi29 Reaction Buffer 5 µl, 25 mM dNTP 2µl, 1 mM N8Primer 2µl, 100x BSA 0.5 1-11, 10% F68 0.05µl, and H2O 29.75 µl) is added to the PCR tube, 1 µl of phi29-337, phi29-456, phi29-458, phi29-36, phi29-335, phi29-414, and phi29-464 prepared in Embodiment 1 and 1 µl of the Phi29 DNA polymerase carried by the QIAGEN REPLI-g Single Cell Kit are respectively added. The pipette tip should be attached to the tube wall, and is not inserted below the liquid surface, the centrifuging is performed without shaking. After being centrifuged, it is put on the PCR instrument at 30°C for 8 h and 65°C for 3 min. After a reaction is finished, the shaking and centrifuging are performed, and a concentration is measured with Qubit BR. After the concentration is measured, a multiple housekeeping gene PCR detection is performed. 50-200 ng of a DNA is taken, a negative control (N) and a positive control (P) should be set, the negative is water, the positive is a NA12878 reference genome without amplification, and an experimental group is set with 3 different samples. Multiple PCR primers and procedures are shown in Table 5 below: Table 5: Multiple PCR primer and PCR reaction system
    Primer name Primer sequence
    18-F GGCATCGCTTAGACTCTATGTG
    18-R CTGCCCTTGGCCTAACTAACCT
    12-F GTTCCTCAAGTAGCTCCACGAG
    12-R CGTTAGACTCTGGATCTGGCGT
    16-F CCAGCCAGTTCATGCGTCGGTG
    16-R CCTGACAACTCGCAAGTAGCAC
    17-F GCTCAATGGGGTACTTCAGGT
    17-R GTGGACTTACGTAAAAGGCCC
    19-F TGCTCTGTATGTGAAGATGCCA
    19R TTCCAGGTAAATCCAGCCCAGG
    3-F CAGCCAGTCGGCATCATCCAAC
    3-R GAAAGCCGGATTGCGGTAACAT
    8-F GGATAGCTCTGCCAGGGGAGAG
    8-R TCGTCGCAGTAGAAATACGGCT
    22-F AGATGTCAGGCACGTAGCTCAG
    22-R GGCACGTTGGCGTTTACGATGA
    Reaction component Volume
    10x PCR Buffer 3 µl
    dNTP (2.5mM) 3.2 µl
    Primer Mix 3 µl
    DNA (50ng/µl) 1 µl
    100x BSA (NEB) 0.2 µl
    rTaq (5U/µl) 0.4 µl
    ddH20 19.2 µl
    Total 30 µl
  • PCR procedure: 95°C 5 min, 35 cycles x[94°C 30 s, 60°C 50 s, 72°C 1 min], 72°C 5 min, 12°C holder.
  • Results are shown in Fig. 2, compared with the wild-type WT, the amplification coverage of the phi29-337, phi29-456, phi29-458, phi29-36, and phi29-414 is greatly improved, and 8 housekeeping gene products may at least be amplified for 6 or more. For the concentrations of the amplified products, the phi29-337, phi29-456, phi29-458, phi29-36, and phi29-414 are higher than the wild-type WT and a phi29 commercial product from Enzymatics Company.
  • Embodiment 5: Application effect of wild-type Phi29 DNA polymerase and Phi29 DNA polymerase mutant in single-cell whole genome sequencing
  • In order to test effects of a wild-type Phi29 DNA polymerase and a mutant in single-cell genome sequencing, library construction is performed respectively on products of a NA12878 trace gDNA (200pg) amplified by the wild-type Phi29 DNA polymerase and the Phi29 DNA polymerase mutant prepared in Embodiment 1, after that, high-depth sequencing is performed; at the same time, the same NA12878 trace gDNA (200pg) amplified by a commercial Qiagen single-cell amplification kit is used for control.
  • Analysis and mutation detection analysis are performed on sequencing data, a NA12878 standard mutation data set is used to evaluate, and a difference between each mutant and the Qiagen kit is compared. Specific data analysis results are shown in Table 6 and Table 7.
  • It may be seen that the representation of the mutants Phi29-337, Phi29-456, Phi29-335, and Phi29-414 are comparable to that of the wild-type WT and the QIAGEN kit in mapping rate and coverage, but the representation of the wild-type WT is the worst in terms of duplication rate parameters, the mutants listed in the table are all slightly better than the wild type, herein the representation of the 337 mutant is best, and is comparable to the QIAGEN (REPLI-g Single Cell Kit) kit. At the same time, in aspects of mutation detection evaluation parameters snp_Precision, snp_Sensitivity, and snp_F-measure, the representation of the 337 mutant is best, and slightly better than the QIAGEN kit, the wild-type WT and the 456, 335, 414 mutants are worse than the QIAGEN kit; and in aspects of parameters indel_Precision, indel_Sensitivity and indel_F-measure, the representation of the 337 mutant is also the best, and data is better than the QIAGEN kit. Table 6: Sequencing data analysis of wild-type Phi29 and mutant in single-cell sequencing
    Mutant number QIAGEN Phi29-WT Phi29-36 Phi29-335 Phi29-337
    ReadLength 100 100 100 100 100
    Read_raw 1.12E+09 7.96E+08 1.07E+09 1.01 E+09 1.08E+09
    Q30_clean 88.67% 87.09% 86% 87.67% 87.07%
    Depth_clean 28.48 19.96 28.95 25.56 28.47
    Mapping rate 99.93% 99.85% 99.95% 99.91% 99.93%
    Duplicate rate 3.71% 5.07% 4.56% 4.85% 3.87%
    Coverage 98.01 % 97.20% 94.52% 97.16% 98.33%
    Genome depth CV 1.01 2.21 1.36 1.7 1
    GC depth CV 0.35 0.34 0.35 0.33 0.36
    snp_Precision 0.9222 0.8993 0.9004 0.8747 0.9383
    snp_Sensitivity 0.92 0.8621 0.8199 0.8466 0.9349
    snp_F-measure 0.9211 0.8803 0.8582 0.8604 0.9366
    indel_Precision 0.3466 0.1229 0.072 0.1405 0.7437
    indel_Sensitivity 0.7249 0.5759 0.5076 0.5925 0.7819
    indel_F-measure 0.469 0.2025 0.126 0.2271 0.7623
    Table 7: Sequencing data analysis of wild-type Phi29 and mutant in single-cell sequencing
    Mutant number Phi29-414 Phi29-456 Phi29-458
    ReadLength 100 100 100
    Read_raw 1.14E+09 1.28E+09 1.25E+09
    Q30_clean 87.90% 88.54% 88.02%
    Depth_clean 28.98 32.99 32.74
    Mapping rate 99.91% 99.91% 99.96%
    Duplicate rate 4.67% 4.51% 4.31%
    Coverage 97.03% 97.60% 95.79%
    Genome depth CV 1.09 1.01 1.06
    GC depth CV 0.35 0.35 0.36
    snp_Precision 0.9183 0.9379 0.9335
    snp_Sensitivity 0.8898 0.9165 0.8707
    snp_F-measure 0.9038 0.9271 0.901
    indel_Precision 0.1318 0.1327 0.075
    indel_Sensitivity 0.6275 0.6667 0.5502
    indel_F-measure 0.2179 0.2214 0.132
    (Note: QIAGEN is a control of a commercial REPLI-g Single Cell Kit)
  • Embodiment 6: Detection of RCA library construction on-machine testing effect
  • Synthesized with the thermal stability results in Table 4, the embodiment selects several mutants with improved thermal stability, and performs an on-machine test in a BGISEQ-500 sequencer, application effects of the different mutants in DNA sequencing are detected with reference to a standard of the BGISEQ-500 sequencer. Reagents used in the whole test are a complete set of a PE50V2.0 kit produced by the BGI, an E. coil Ad153 standard library produced by the BGI and a Qubit ssDNA Assay reagent produced by Invitrogen. The reagents used below are all included in the PE50V2.0 kit except the library and QubitssDNA Assay, and a PE50V2.0 reagent tank written below only refers to reagents used in the on-machine test.
  • 1. DNB preparation
  • DNB preparation buffer, a standard library, DNB polymerase mixed solution and DNB polymerase mixed solution II are taken out from a refrigerator at -20°C and melted on an ice box, after being completely dissolved, they are placed on a vortex shaker, shaken and continuously mixed uniformly for 5 s, and transiently centrifuged in a handheld centrifuge for 3 s, then it is placed on the ice box for later use. Molecular-grade water and DNB stop buffer are taken out from a refrigerator at 4°C, and placed on the ice box for later use. In a labeled eight-connected tube, 20 µl of the DNB preparation buffer and 6 ng of the ssDNA (E. coli standard substance library) are successively added, and supplemented to 40 µl with Nuclease Free Water. The eight-connected tube is placed in the vortex shaker and continuously mixed uniformly for 5 s, and transiently centrifuged for 3 s in the handheld centrifuge. The above eight-connected tube is placed in the PCR instrument, and reaction conditions are set or checked: 95°C 1 min, 65°C 1 min, 40°C 1 min, and 4°C for maintaining (a hot lid temperature is set to 103°C). After a reaction is completed, the PCR eight-connected tube is taken, and placed on the ice box. After a lid temperature of the eight-connected tube drops to a room temperature, it is placed in the handheld centrifuge and transiently centrifuged for 3 s, and immediately placed on the ice box. Each of the following components is successively added into the eight-connected tube: 40 µl of reaction solution in the eight-connected tube after denaturation, 40 µl of the DNB polymerase mixed solution, and 4 µl of the DNB polymerase mixed solution II. The eight-connected tube is placed in the vortex shaker and continuously mixed uniformly for 5 s, and transiently centrifuged for 3 s in the handheld centrifuge. It is immediately placed in the PCR instrument or a water bath kettle to start a reaction. Reaction conditions are set or checked: 30°C 20min, and 4°C for maintaining (a hot lid does not need to be installed). While the above RCA reaction is completed, the eight-connected tube is taken and placed on the ice box, and 20 µl of the DNB stop buffer is immediately added. A pipette with a 100 µl wide-mouth pipette tip is used to slowly blow and mix uniformly for 5-8 times (one-suction and one-blow are counted as 1 time). After being mixed uniformly, it is stored at 4°C for later use. A Qubit ssDNA Assay Kit and a Qubit Fluorometer instrument are used to measure a concentration of the above DNB preparation product. While the concentration is 8ng/µl-40ng/µl, it is judged to be qualified, and it is reserved for a subsequent experiment.
  • 2. DNB loading
  • After the DNB is prepared, the DNB needs to be loaded on a chip, namely DNB loading.
  • A sample loading reagent plate V2.1 is taken and placed at a room temperature for melting, shaken and mixed uniformly. After being transiently centrifuged, it is placed on the ice box for later use. DNB loading buffer II is taken, and shaken uniformly. After being transiently centrifuged, it is placed on the ice box for later use. Firstly, the chip and the sample loading reagent plate V2.1 are placed on BGIDL-50. Secondly, 35 µl of the DNB loading buffer II is taken and added to a PCR tube containing 100 µl of the DNB, and a wide-mouth sucker is used to gently mix uniformly for 15 times. Then, the above mixed solution is placed in a designated DNB placement area of a loading system, a DNB loading program (Sample load 2.0) is selected, and loading is started. Finally, after the loading is completed, it is incubated at the room temperature for 30 min, and then stored at 2-8°C for later use.
  • 3. On-machine test
  • For the wild-type phi29 polymerase or mutant to be tested, an on-machine sequencing test is performed on the BGISEQ-500 sequencer, one chip and one BGISEQ-500RS high-throughput sequencing reagent tank (PE50V2.0) are used. Before the on-machine test, a sequencing reagent tank II, dNTPs mixed solution (V3.0) and dNTPs mixed solution II (V2.0) are firstly thawed and melted, and placed in a refrigerator or ice box at 4°C for later use; a sequencing enzyme is shaken and mixed uniformly, and placed on the ice box for later use. Firstly, a No. 5 well reagent is prepared, namely 1 ml of a pipette is used to pipette 1150 µl of the DNA polymerase mixed solution for adding to a No. 5 well and pipette 1150 µl of the dNTPs mixed solution (V3.0) for adding to the No. 5 well, and the pipette is used to blow and mix uniformly for 10-15 times. Secondly, a No. 6 well reagent is prepared, namely 1 ml of the pipette is used to pipette 890 µl of the DNA polymerase mixed solution for adding to a No. 6 well and pipette 890 µl of the dNTPs mixed solution II (V2.0) for adding to the No. 6 well, and the pipette is used to blow and mix uniformly for 10-15 times. Then, a No. 14 well reagent is prepared, namely 5 ml of a pipette is used to pipette all No. 14 well reagents, 2.8 ml of the No. 14 well reagent is taken and mixed uniformly with 400 µl of the phi29 polymerase mutant, and added to a No. 14 well. The prepared reagent tanks are assembled. Finally, the on-machine test is performed, namely the sequencer is started and washing is performed, the reagent tank is put into a designated position of the sequencer, and actual preloading is performed in an operating order. After the preloading is finished, the chip prepared in the above step (2) is installed, and related sequencing information is written, namely the sequencing is started. After the end, the chip, the reagent tanks and a washing instrument are taken out. One cycle is tested in the embodiment.
  • 4. Data analysis
  • After the sequencing is finished, an analysis report is downloaded, a previously specified standard is compared, and the performance of the phi29 DNA polymerase mutant is judged.
  • Each of comparison parameters is explained as follows: Effective Spots Rates (ESR), and basecall information content (Bic) may be used as a DNB ratio of basecalling; fit (crosstalk fit score) reflects a crosstalk situation, after correction, the intensity distribution of each base is more concentrated, a fit value thereof is higher; a Signal to Noise Ratio (SNR) takes the calculation of a single DNB SNR as an example, base A (max intensity) is served as a signal, CGT is a background, and a variance of the CGT intensity is a noise; Rho Intensity (RHO) is an intensity value of corrected intensity removing normalization, and it is intuitively interpreted as an intensity value of the original intensity of dye after correction.
  • Results are shown in Fig. 3 (Fig. A is comparison of BIC, FIT, ESR parameters of each mutant; Fig. B is comparison of SNR parameters of each mutant; and Fig. C is comparison of RHO parameters of each mutant), it may be seen that synthesized with the analysis of the above various parameter indexes, the best of the tested mutants is 464, and the second is 463.
  • Industrial application
  • On the basis of the disclosure, the mutants with the good effects may be further screened through performing saturation mutations on the amino acids in the mutation sites of the disclosure; or on the basis of the mutants of the disclosure, and other amino acids except the amino acid sites contained in the disclosure are mutated, to obtain a similar effect. The disclosure may also be applied in the technical fields including food detection, virus detection, RNA detection, single-cell sequencing and the like, and it may also be used to develop third and fourth generation sequencer technologies.
    Figure imgb0024
    Figure imgb0025
    Figure imgb0026
    Figure imgb0027

Claims (22)

  1. A protein, represented by A) or B) below:
    the protein represented by the A) is a protein having DNA polymerase activity that is obtained by modifying at least one amino acid residue(s) in the following 6 sites in a phi29 DNA polymerase amino acid sequence: the 97-th, 123-th, 217-th, 224-th, 515-th, and 474-th sites, wherein the rest amino acid residues are not changed; and
    the protein represented by the B) is a protein having DNA polymerase activity that is derived from the A) by adding a tag sequence to a terminal of the amino acid sequence of the protein represented by the A).
  2. The protein according to claim 1, wherein:
    the protein represented by the A) is a protein having DNA polymerase activity that is obtained by modifying amino acid residues in at least 2 or at least 3 or at least 4 or at least 5 or all of the following 6 sites in the phi29 DNA polymerase amino acid sequence: the 97-th, 123-th, 217-th, 224-th, 515-th, and 474-th sites, wherein the rest amino acid residues are not changed.
  3. The protein according to claim 1 or 2, wherein:
    the protein represented by the A) is a protein having DNA polymerase activity that is obtained by modifying amino acid residues in all of the following 5 sites in the phi29 DNA polymerase amino acid sequence: the 97-th, 123-th, 217-th, 224-th, and 515-th sites, wherein the rest amino acid residues are not changed.
  4. The protein according to claim 1 or 2, wherein:
    the protein represented by the A) is a protein having DNA polymerase activity that is obtained by modifying amino acid residues in all of the following 3 sites in the phi29 DNA polymerase amino acid sequence: the 224-th, 515-th and 474-th sites, wherein the rest amino acid residues are not changed.
  5. The protein according to claim 1 or 2, wherein:
    the protein represented by the A) is a protein having DNA polymerase activity that is obtained by modifying amino acid residues in all of the following 4 sites in the phi29 DNA polymerase amino acid sequence: the 97-th, 123-th, 217-th and 515-th sites, wherein the rest amino acid residues are not changed.
  6. The protein according to claim 1 or 2, wherein:
    the protein represented by the A) is a protein having DNA polymerase activity that is obtained by modifying amino acid residues in the following 4 sites in the phi29 DNA polymerase amino acid sequence: the 97-th, 123-th, 224-th, and 515-th sites, wherein the rest amino acid residues are not changed.
  7. The protein according to claim 1 or 2, wherein:
    the protein represented by the A) is a protein having DNA polymerase activity that is obtained by modifying amino acid residues in the following 2 sites in the phi29 DNA polymerase amino acid sequence: the 224-th and 474-th sites, wherein the rest amino acid residues are not changed.
  8. The protein according to claim 1 or 2, wherein:
    the protein represented by the A) is a protein having DNA polymerase activity that is obtained by modifying amino acid residues in the following 2 sites in the phi29 DNA polymerase amino acid sequence: the 217-th and 224-th sites, wherein the rest amino acid residues are not changed.
  9. The protein according to any one of claims 1-8, wherein the modification is amino acid substitution.
  10. The protein according to claim 9, wherein:
    the amino acid substitutions in 6 sites of the 97-th, 123-th, 217-th, 224-th, 515-th and 474-th sites are respectively as follows:
    a methionine in the 97-th site is substituted with an alanine or a histidine or a lysine or a threonine;
    a leucine in the 123-th site is substituted with a lysine or a phenylalanine or an isoleucine or a histidine;
    a glycine in the 217-th site is substituted with a glutamic acid;
    a tyrosine in the 224-th site is substituted with a lysine;
    an isoleucine in the 474-th site is substituted with a lysine; and
    a glutamic acid in the 515-th site is substituted with a proline or a glycine.
  11. The protein according to claim 10, wherein:
    the protein represented by the A) is a protein having DNA polymerase activity that is obtained by mutating the amino acid residue from M into K in the 97-th site, from L into H in the 123-th site, from E into P in the 515-th site, from Y into K in the 224-th site, and from G into K in the 217-th site of the phi29 DNA polymerase amino acid sequence, wherein the rest amino acid residues are not changed.
  12. The protein according to claim 10, wherein:
    the protein represented by the A) is a protein that is obtained by mutating the amino acid residue from Y into K in the 224-th site, from I into K in the 474-th site, and from E into P in the 515-th site of the phi29 DNA polymerase amino acid sequence.
  13. The protein according to claim 10, wherein:
    the protein represented by the A) is a protein that is obtained by mutating the amino acid residue from M into T in the 97-th site, from L into H in the 123-th site, and from E into P in the 515-th site of the phi29 DNA polymerase amino acid sequence.
  14. The protein according to any one of claims 1-13, wherein: the phi29 DNA polymerase amino acid sequence is any one of the followings:
    (I) a protein shown in SEQ ID NO: 2 of a sequence listing;
    (II) a protein having more than 90% identity with the protein shown in SEQ ID NO: 2 of the sequence listing and derived from a Bacillus subtilis protein; and
    (III) a protein having more than 95% identity with the protein shown in SEQ ID NO: 2 of the sequence listing and derived from a Bacillus subtilis protein.
  15. The protein according to any one of claims 1-14, wherein: the stability of the protein is higher than that of the phi29 DNA polymerase.
  16. The protein according to claim 15, wherein: the stability is thermal stability.
  17. A nucleic acid molecule for encoding the protein according to any one of claims 1-16.
  18. An expression cassette, a recombinant vector, recombinant bacteria or a transgenic cell line comprising the nucleic acid molecule according to claim 17.
  19. Use of the protein according to any one of claims 1-16 in at least one of the following 1)-11):
    1) as a DNA polymerase;
    2) catalyzing DNA replication and/or catalyzing DNA amplification;
    3) catalyzing rolling circle amplification and/or catalyzing multiple-strand displacement amplification;
    4) performing DNA sequencing or RNA sequencing or whole genome sequencing;
    5) constructing a RCA library;
    6) detecting a genome amplification coverage;
    7) preparing a kit for catalyzing the DNA replication and/or catalyzing the DNA amplification;
    8) preparing a product for catalyzing the rolling circle amplification and/or catalyzing the multiple-strand displacement amplification;
    9) preparing a product for performing the DNA sequencing or the RNA sequencing or the whole genome sequencing;
    10) preparing a product for constructing the RCA library; and
    11) preparing a product for detecting the genome amplification coverage.
  20. Use of the nucleic acid molecule for encoding the protein according to any one of claims 1-16, the expression cassette comprising the nucleic acid molecule, the recombinant vector comprising the nucleic acid molecule, the recombinant bacteria comprising the nucleic acid molecule, or the transgenic cell comprising the nucleic acid molecule in at least one of the following 1)-10):
    1) catalyzing DNA replication and/or catalyzing DNA amplification;
    2) catalyzing rolling circle amplification and/or catalyzing multiple-strand displacement amplification;
    3) performing DNA sequencing or RNA sequencing or whole genome sequencing;
    4) constructing a RCA library;
    5) detecting a genome amplification coverage;
    6) preparing a product for catalyzing the DNA replication and/or catalyzing the DNA amplification;
    7) preparing a product for catalyzing the rolling circle amplification and/or catalyzing the multiple-strand displacement amplification;
    8) preparing a product for performing the DNA sequencing or the RNA sequencing or the whole genome sequencing;
    9) preparing a product for constructing the RCA library; and
    10) preparing a product for detecting the genome amplification coverage.
  21. A method for improving stability of a phi29 DNA polymerase, comprising the following steps: modifying at least one amino acid residue(s) in the following 6 sites of the phi29 DNA polymerase amino acid sequence: the 97-th, 123-th, 217-th, 224-th, 515-th and 474-th sites, in the modification modes according to any one of claims 1-17, wherein the rest amino acid residues are not changed, to obtain a protein having DNA polymerase activity.
  22. The method according to claim 22, wherein: the stability is thermal stability.
EP18936847.5A 2018-10-11 2018-10-11 Phi29 dna polymerase mutant with improved thermal stability and application thereof in sequencing Pending EP3854872A4 (en)

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/CN2018/109777 WO2020073266A1 (en) 2018-10-11 2018-10-11 Phi29 dna polymerase mutant with improved thermal stability and application thereof in sequencing

Publications (2)

Publication Number Publication Date
EP3854872A1 true EP3854872A1 (en) 2021-07-28
EP3854872A4 EP3854872A4 (en) 2022-06-22

Family

ID=70163745

Family Applications (1)

Application Number Title Priority Date Filing Date
EP18936847.5A Pending EP3854872A4 (en) 2018-10-11 2018-10-11 Phi29 dna polymerase mutant with improved thermal stability and application thereof in sequencing

Country Status (5)

Country Link
US (1) US20210355459A1 (en)
EP (1) EP3854872A4 (en)
JP (1) JP7256280B2 (en)
CN (2) CN112805372B (en)
WO (1) WO2020073266A1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2025008523A1 (en) 2023-07-05 2025-01-09 Navinci Diagnostics Ab Stabilisation of phi29 polymerase
WO2025036438A1 (en) 2023-08-15 2025-02-20 上海金斯康生物科技有限公司 Prediction for influence of mutation on protease activity

Families Citing this family (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111363795A (en) * 2018-12-26 2020-07-03 清华大学 A method for single-cell whole-genome sequencing
CA3140244A1 (en) * 2019-05-17 2020-11-26 4basebio Sl Phi29 dna polymerase mutants with improved primer recognition
WO2021248757A1 (en) * 2020-06-10 2021-12-16 深圳华大生命科学研究院 Stable phi29 dna polymerase having high enzyme activity, and encoding gene and application thereof
CN113684194B (en) * 2021-08-31 2023-06-13 湖南大地同年生物科技有限公司 Mutant motor protein, application thereof and kit
CN119895036A (en) * 2022-12-21 2025-04-25 深圳华大生命科学研究院 DNA polymerase and application thereof
CN116083393B (en) * 2023-02-14 2025-09-23 南方科技大学 A DNA assembly molecular machine and its application
CN116574710A (en) * 2023-04-23 2023-08-11 天津中合基因科技有限公司 DNA polymerase with strand displacement function and application thereof
CN117264981A (en) * 2023-11-09 2023-12-22 杭州云心质力生物科技有限公司 Production method of Phi29DNA polymerase for rolling circle amplification reaction
CN118222536B (en) * 2024-04-12 2026-01-02 湖南艾科瑞生物工程有限公司 phi29 DNA polymerase mutant, its preparation method and application
WO2025222397A1 (en) * 2024-04-24 2025-10-30 深圳华大生命科学研究院 Dna polymerase and use thereof
CN119082075B (en) * 2024-09-12 2025-06-27 湖南艾科瑞生物工程有限公司 Phy29 DNA polymerase mutant with improved performance and preparation method and application thereof

Family Cites Families (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100291638A1 (en) * 2005-10-06 2010-11-18 Thomas William Schoenfeld Thermostable dna polymerases and methods of use
US8420366B2 (en) * 2008-03-31 2013-04-16 Pacific Biosciences Of California, Inc. Generation of modified polymerases for improved accuracy in single molecule sequencing
US8999676B2 (en) * 2008-03-31 2015-04-07 Pacific Biosciences Of California, Inc. Recombinant polymerases for improved single molecule sequencing
EP2942404B1 (en) * 2008-03-31 2016-11-23 Pacific Biosciences of California, Inc. Generation of modified polymerases for improved accuracy in single molecule sequencing
WO2011040971A2 (en) * 2009-09-30 2011-04-07 Pacific Biosciences Of California, Inc. Generation of modified polymerases for improved accuracy in single molecule sequencing
US8906660B2 (en) * 2012-02-01 2014-12-09 Pacific Biosciences Of California, Inc. Recombinant polymerases with increased phototolerance
US20140094374A1 (en) * 2012-10-01 2014-04-03 Pacific Biosciences Of California, Inc. Recombinant Polymerases with Increased Readlength and Stability for Single-Molecule Sequencing
US9422535B2 (en) * 2013-04-25 2016-08-23 Thermo Fisher Scientific Baltics Uab phi29 DNA polymerase mutants having increased thermostability and processivity
GB201502810D0 (en) * 2015-02-19 2015-04-08 Oxford Nanopore Tech Ltd Method
US10280411B2 (en) * 2015-10-27 2019-05-07 Pacific Biosciences of California, In.c Methods, systems, and reagents for direct RNA sequencing
CN106367407A (en) * 2016-08-09 2017-02-01 吴江近岸蛋白质科技有限公司 Preparation method and application of phi29 DNA polymerase
WO2018195850A1 (en) * 2017-04-27 2018-11-01 深圳华大智造科技有限公司 Phi29 dna polymerase mutant with increased thermostability
US11104889B2 (en) * 2017-07-28 2021-08-31 Mgi Tech Co., Ltd. Phi29 DNA polymerase mutant having increased thermal stability and use thereof

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2025008523A1 (en) 2023-07-05 2025-01-09 Navinci Diagnostics Ab Stabilisation of phi29 polymerase
WO2025036438A1 (en) 2023-08-15 2025-02-20 上海金斯康生物科技有限公司 Prediction for influence of mutation on protease activity

Also Published As

Publication number Publication date
CN112805372A (en) 2021-05-14
JP7256280B2 (en) 2023-04-11
US20210355459A1 (en) 2021-11-18
EP3854872A4 (en) 2022-06-22
JP2022508776A (en) 2022-01-19
WO2020073266A1 (en) 2020-04-16
CN117467642A (en) 2024-01-30
CN112805372B (en) 2023-10-31

Similar Documents

Publication Publication Date Title
EP3854872A1 (en) Phi29 dna polymerase mutant with improved thermal stability and application thereof in sequencing
Altamirano et al. Directed evolution of new catalytic activity using the α/β-barrel scaffold
CN110719955B (en) Phi29 DNA polymerase mutant with improved thermostability and application thereof
CN112639089B (en) Recombinant KOD polymerase
US7488816B2 (en) Methods for obtaining thermostable enzymes, DNA polymerase I variants from Thermus aquaticus having new catalytic activities, methods for obtaining the same, and applications of the same
CN110914415A (en) Engineered ligase variants
CN109937252B (en) Recombinant DNA polymerase
Wong et al. Coupled motions in the SH2 and kinase domains of Csk control Src phosphorylation
CN118792276A (en) T7 RNA polymerase mutant and its preparation method and application
JP6980383B2 (en) Amadriase with improved dehydrogenase activity
CN113637085B (en) Fusion DNA polymerase mutants and their applications in isothermal amplification
TW202115249A (en) Polymerizing enzymes for sequencing reactions
CN119082075B (en) Phy29 DNA polymerase mutant with improved performance and preparation method and application thereof
CN118185902B (en) Bst DNA polymerase mutant with enhanced thermal stability and preparation method and application thereof
CN118853626A (en) Phii29 DNA polymerase mutant and its preparation method and application
WO2012043601A1 (en) Amadoriase variant
CN119685285B (en) Taq DNA polymerase mutant with improved thermal stability and anti-inhibition ability, preparation method and application thereof
Jia et al. MutS-mediated rapid and cost-effective error correction in in vitro DNA synthesis
WO2025137876A1 (en) Isolated polypeptide, preparation method, and use
CN118931868B (en) Recombinant DNA polymerase, preparation method, kit and application in probe-based qPCR amplification
CN120813687A (en) DNA polymerase and application thereof
Trapp et al. Regulatory landscapes and structural choreography of transcription initiation in spirochetes
HK40129071A (en) A dual-restricted region nanopore protein complex and its application
CN120265762A (en) Polypeptide with DNA polymerase activity and its application
WO2024138762A1 (en) Recombinant protein and use thereof

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20210422

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

RIC1 Information provided on ipc code assigned before grant

Ipc: C12N 15/63 20060101ALI20211115BHEP

Ipc: C12N 15/52 20060101ALI20211115BHEP

Ipc: C12N 9/12 20060101AFI20211115BHEP

DAV Request for validation of the european patent (deleted)
DAX Request for extension of the european patent (deleted)
A4 Supplementary search report drawn up and despatched

Effective date: 20220519

RIC1 Information provided on ipc code assigned before grant

Ipc: C12N 15/63 20060101ALI20220513BHEP

Ipc: C12N 15/52 20060101ALI20220513BHEP

Ipc: C12N 9/12 20060101AFI20220513BHEP

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: EXAMINATION IS IN PROGRESS

17Q First examination report despatched

Effective date: 20250327