EP3775212A1 - Identification of muscular mirnas as molecular biomarkers and co-adjuvant for the treatment of spinal muscular atrophy - Google Patents

Identification of muscular mirnas as molecular biomarkers and co-adjuvant for the treatment of spinal muscular atrophy

Info

Publication number
EP3775212A1
EP3775212A1 EP19722955.2A EP19722955A EP3775212A1 EP 3775212 A1 EP3775212 A1 EP 3775212A1 EP 19722955 A EP19722955 A EP 19722955A EP 3775212 A1 EP3775212 A1 EP 3775212A1
Authority
EP
European Patent Office
Prior art keywords
hsa
inhibitor
microrna
sma
subject
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
EP19722955.2A
Other languages
German (de)
French (fr)
Inventor
Francesco Danilo Tiziano
Paola INFANTE
Lucia DI MARCOTULLIO
Emanuela ABIUSI
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Universita degli Studi di Roma La Sapienza
Fondazione Istituto Italiano di Tecnologia
Universita Cattolica del Sacro Cuore
Original Assignee
Universita degli Studi di Roma La Sapienza
Fondazione Istituto Italiano di Tecnologia
Universita Cattolica del Sacro Cuore
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Universita degli Studi di Roma La Sapienza, Fondazione Istituto Italiano di Tecnologia, Universita Cattolica del Sacro Cuore filed Critical Universita degli Studi di Roma La Sapienza
Publication of EP3775212A1 publication Critical patent/EP3775212A1/en
Pending legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • C12N2310/113Antisense targeting other non-coding nucleic acids, e.g. antagomirs
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • C12N2320/31Combination therapy

Definitions

  • the present invention relates to specific inhibitors of human microRNAs, for use in the treatment of spinal muscular atrophy (SMA) and pharmaceutical compositions including them.
  • SMA spinal muscular atrophy
  • the present invention further relates to the identification of markers with high sensitivity and specificity for SMA prognosis, prognostic methods including the use of such markers and prognostic kits for detecting such markers.
  • SMA Spinal muscular atrophy
  • SMA l-lll 3 infantile forms
  • the gene responsible for all forms of SMA is localized in 5q13 and it is called SMN1 (Survival of Motor Neuron 1).
  • the SMN1 gene is absent in homozygosis in 95-97% of SMA patients.
  • SMN1 hypermorphic gene of SMN1, SMN2.
  • the two genes are highly homologous and codify for the same protein (SMN), but due to the alternative splicing of exon 7, the genes SMN2 produce mainly a protein isoform deprived of this exon which is quickly degraded.
  • SMA is characterized by progressive muscle paralysis due to the degeneration of the alpha-motor neurons of spinal cord.
  • the role of the skeletal muscle in the condition physiopathology is still controversial, although there are several experimental pieces of evidence supporting an active pathogenetic role (Braun et al., 1995; Guettier-Sigrist et al. , 2002; Chan et al., 2003; Arnold et al., 2004; Kariya et al., 2008; Walker et al., 2008; Bricceno et al., 2014).
  • SMA I or Werdning-Hoffmann disease
  • SMA II or Dubowitz disease
  • SMA III the motion acquisitions take place normally, however the patients can lose deambulation at variable age (D’Amico et al. , 2011).
  • SMN2 is the currently known main modifier of phenotypical gravity
  • the first identified biomarker was the determination of the number of copies of SMN2 (Feldkotter et al., 2002; Tiziano et al., 2007; Crawford et al., 2012): the identification of two copies of SMN2 is strongly predictive of a serious phenotype, as there is 80% of probability of a SMA I.
  • the predictive power of the identification of 3 copies of SMN2 is considerably more limited, since they are observed in about 60% of SMA II and in 50% of SMA III.
  • the finding of 4 copies of SMN2 is predictive of a lighter phenotype (Crawford et al., 2012).
  • the object of the present invention is to provide prognostic biomarkers of spinal muscular atrophy (SMA) and new compounds useful in the prevention and/or treatment of this disease.
  • SMA spinal muscular atrophy
  • the present invention is based upon the scientific experiments shown in the examples.
  • the authors have identified deregulated miRNAs in the patients affected by SMA, in particular they have identified three miRNAs (HSA-miR181a-5p, HSA-miR324- 5p and HSA-miR451a) over-expressed in the patients affected by SMA showing a correlation with the condition gravity.
  • miR181 microRNA inhibitors in particular HSA-miR181a-5p inhibitors determine an increase in the survival of the mice affected by SMA.
  • the present invention firstly relates to an inhibitor of the miR181 microRNA, in particular of HSA-miR181a-5p microRNA, for use in the prevention and/or treatment of spinal muscular atrophy (SMA), wherein said HSA-miR181a-5p microRNA has SEQ ID NO 1 and access number miRbase MIMAT0000256.
  • SMA spinal muscular atrophy
  • the present invention further relates to a pharmaceutical composition
  • a pharmaceutical composition comprising as pharmacologically active agent an inhibitor of HSA-miR181a-5p microRNA and at least a pharmaceutically acceptable carrier.
  • the present invention further relates to a Kit for the simultaneous, separate or sequential administration of an inhibitor of HSA-miR181 a-5p miR181 microRNA and one or more of the following compounds Nusinersen, HSA-miR324-5p microRNA inhibitor, HSA-miR451 a microRNA inhibitor.
  • the present invention further relates to an in vitro method for evaluating the prognosis of spinal muscular atrophy (SMA) in a subject, comprising:
  • the present invention further relates to a method for monitoring the development of spinal muscular atrophy in a subject, comprising:
  • HSA-miR181 a-5p, HSA-miR324-5p and/or HSA-miR451 a microRNAs in two or more biological samples of said subject, wherein the samples were obtained at spaced time points, and
  • the present invention further relates to a method for monitoring the effectiveness of a treatment of spinal muscular atrophy in a subject, comprising: a. determining the level of HSA-miR181 a-5p, HSA-miR324-5p and/or HSA-miR451 a icroRNAs in a biological sample of said subject obtained before the start of treatment, in particular individual and/or added up levels;
  • step (b) determining the level of microRNA in one or more biological samples of said subject obtained during or after treatment, in particular individual and/or added up levels, and c. comparing the level of individual microRNAs and/or their sum determined in the steps (a) e (b), and optionally between different samples in step (b).
  • FIG. 1 Heatmap related to the analysis of miRnoma of muscle biopsies of patients and controls.
  • the graph shows the differential expression of miRNAs deregulated in the muscle biopsies.
  • the blue strips designate the down-regulated miRNAs, whereas the yellow ones relate to the up-regulated miRNAs.
  • the heatmap shows that the analysed groups generate two distinct clusters (CTRL vs SMA).
  • Figure 2 deregulated miRNAs in the serum of SMA patients, emerging from a first validation performed through relative qRT-PCR on 10 samples SMA and 10 controls (*a£0.05).
  • FIG. 3 Correlation graphs between the expression levels of miR-181a-5p, 324- 5p and 451 a and type of SMA.
  • the boxplot shows the number of molecules/mI serum detected for miR-181a-5p (a), miR-324-5p (b) and miR-451a (c) in correlation with the type of SMA (I, II, III) ( * P£0.05).
  • FIG. 4 Predictive power of miR-181a-5p, miR-324-5p and miR-451a in discriminating SMA patients from controls.
  • the graphs show (a) the ROC curves of each miRNA analysed individually; (b) the ROC curve relative to the sum of the 3 miRNAs.
  • FIG. 5 Survival curves of the mice SMA-A7 treated with single intrathecal injection of anti-miR-181a-5p or anti-miR-324-5p.
  • the affected mice were treated on the day after birth with 0.5 nM of antagomir, of negative control or they were not subjected to treatment. From the obtained data it emerges that anti-miR-181 a-5p induces a statistically significative increase in the survival of the affected mice.
  • FIG. 6 Treatment effect with Mimic of mir-181a-5p and miR-324-5p in cells of human neuroblastoma SH-SY5Y. Both miRs are almost unmeasurable under basal conditions (scramble). The transient transfection of Mimics determines a marked increase in the levels of single miRs. However, the levels of transcripts of the SMN1 and SMN2 genes remain unchanged. Only in case of miR-324-5p a decrease in the levels of isoform SMN-del7 is noted, the biological meaning remains unknown.
  • MicroRNA are an endogenous sub-class of not codifying small RNAs constituted by single-filament ribonucleic acids, usually with a length of 21-22 nucleotides, having the capability of binding specific sequences of messenger RNA by inhibiting the subsequent translation into protein. Their presence guarantees a fine mechanism for adjusting the protein expression both under normal or pathological conditions.
  • Inhibitor of microRNA (designated in the present text even as anti miRNA) modified oligonucleotide, complementary to a specific miRNA; when miRNAs and anti-miRNAs bind, the endogenous function of the micro-RNA is abolished.
  • SMA spinal muscular atrophy, neurodegenerative recessive autosomal disease
  • SMN survival of motor neuron, essential protein for the survival and function of the spinal motor neurons
  • NGS next generation sequencing, massive parallel sequencing of molecules of DNA.
  • the present invention thus relates to inhibitors of miR181 microRNA, in particular of miR181 HSA-miR181a-5p microRNA for use in the prevention and/or treatment of spinal muscular atrophy (SMA), wherein said HSA-miR181a-5p microRNA has SEQ ID NO 1 and access number miRbase MIMAT0000256.
  • the inhibitor could be for example an antagomir, an antisense oligonucleotide or an inhibitor of RNA.
  • the molecules more commonly used as inhibitors of microRNAs, included in the object of the present invention, are represented by antisense oligonucleotides, also called antimiR, the sequence thereof is wholly or partially complementary to the sequence, (which normally includes the so-called seed sequence) of the target microRNA, and that is of the microRNA to be inhibited.
  • the sequence will be complementary at least by 90, 91 , 92, 93, 95 or 100%; it is likely that there is the inhibitory effect with at least 90% of complementarity.
  • any inhibitor of selected HSA- miR181a-5p microRNA is a specific inhibitor for HSA-miR181a-5p micro RNA having SEQ ID NO 1 and access number miRbase MIMAT0000256, and that is an inhibitor inhibiting, that is silencing, only said microRNA and which is not capable of inhibiting, that is silencing, other microRNAs expressed in the same organism.
  • the invention inhibitor will be an optionally chemically modified oligonucleotide having a sequence complementary to SEQ ID NO 1.
  • the antimiRs (and that is the oligonucleotides inhibiting microRNAs) can be modified chemically with the purpose of increasing the affinity thereof for the target microRNA (thus by increasing the annealing temperature of the inhibitor- microRNA hybrid), of increasing the half-life thereof and/or, for example, in vivo biodistribution.
  • the inhibitors of HSA-miR181a-5p, HSA-miR324-5p and HSA-miR451a microRNAs are chemically modified oligonucleotides.
  • the person skilled in the art could draw, starting from what is commonly known in the state of art, several antimiRs suitable to the implementation of the invention.
  • the modifications commonly used in the state of art include, for example, modifications to the sugar of nucleotide, modifications to the nitrogen base, modifications to the nucleic bond.
  • the assays described in the experimental portion are sufficient to evaluate the effectiveness of the inhibitors drawn based upon the above teachings and methods and programmes are available allowing to evaluate the specificity of the same; thereamong, for example, programmes are available commonly used by the person skilled in the art for evaluating the possible crosslinking and then the specificity of the antimiR, such as BLAST, Vmatch, and RNAhybrid.
  • the programme CrossLink for example, can be used for evaluating the potential interactions between microRNAs or anti-microRNAs and their target sequences.
  • suitable inhibitors of microRNAs the invention relates to, can be purchased from producers specialized for such services and inhibitors specific for said microRNAs are also available on the market.
  • inhibitors commercially available by Exiqon are the following ones: mmu-miR-181 a-5p batch#620620; mmu-miR-451a batch#183631 ; mmu-miR-324-5p batch#190693).
  • inhibitors are the oligonucleotides having sequence SEQ ID NO 4 (LNA miRNA inhibitor mmu-miR-181 a-5p- product sequence 5’- C*G*A*C*A*G*C*G*T*T*G*A*T*G*T -3’) , SEQ ID NO 5 (LNA miRNA inhibitor mmu- miR-451 a- product sequence 5’- G * T * A * A * T * G * G * T * A * A * C * G * G * T * T-3’), SEQ ID NO 6 (LNA miRNA inhibitor mmu-miR-324-5p product sequence 5’- A*T*G*C*C*C*T*A*G*G*G*G*A*T*G*C-3’).
  • the inhibitor of the present invention can be used in the prevention and/or treatment of SMA (of type l-lll).
  • SMA of type l-lll
  • HSA-miR181a- 5p microRNA inhibitor having SEQ ID NO 1 and access number miRbase MIMAT0000256 is intended for use in the prevention, treatment, reversion, cure or decrease in the process of pathogenesis correlated with SMA.
  • the therapeutic treatment according to the present invention can be implemented with a formulation suitable to any administration route, preferably systemic, still more preferably intrathecal route. Such administration could be performed by several doses or by treatment with one single dose.
  • HSA-miR181a-5p microRNA inhibitor will be administered in a therapy combined with the medicament Nusinersen and/or with an inhibitor of HSA- miR324-5p microRNA and/or with an inhibitor of HSA-miR451 a micro RNA, wherein said HSA-miR324-5p microRNA has SEQ ID NO 2 and access number miRbase MIMAT0000761 and said HSA-miR-451a micro RNA has SEQ ID NO 3 and access number miRbase MIMAT0001631.
  • kits for the simultaneous, separate or sequential administration of an inhibitor of HSA-miR181 a-5p microRNA and one or more of the following compounds Nusinersen, inhibitor of HSA-miR324-5p micro RNA, inhibitor of HSA-miR451a microRNA, is also described.
  • Such kit will be advantageously used for use in the prevention and/or treatment of spinal muscular atrophy (SMA).
  • terapéuticaally effective amount means the amount of active compound or pharmaceutical agent inducing the biological or medical response in a system of tissues, in an animal or in a human being including alleviation, prevention, treatment or delay of the onset or of the progression of the symptoms of the disease or the treated disorder.
  • composition is meant relating to even a product comprising the specific ingredients in the specific amounts, as well as any product resulting, directly or indirectly, from combinations of the ingredients specified in the specified amounts.
  • composition then further relates to a pharmaceutical composition comprising an inhibitor as above defined and at least a pharmaceutically acceptable carrier.
  • an inhibitor according to the present invention as active ingredient is mixed with a pharmaceutical carrier according to conventional techniques of pharmaceutical preparation, which carrier can have a wide variety of forms according to the preparation form wished for the administration.
  • composition will include even one or more of the following pharmacologically active agents: Nusinersen, HSA-miR324-5p microRNA inhibitor, HSA-miR451a microRNA inhibitor.
  • the compounds and preparations of the invention could be formulated for administration by any mode which results convenient for medical or veterinary purposes.
  • Tablets and capsules for oral administration could correspond to one single dose, and could include conventional excipients such as, for example, binding agents, for example maize or glucose syrup, acacia or Arabic rubber, tragacanth rubber, gelatine, sorbitol, polyvinylpyrrolidone; filling agents, for example, lactose, sugar, maize starch, calcium phosphate, sorbitol or glycine; lubricants for tablets, for example magnesium stearate, talcum, polyethyleneglycol or silica; disintegrants, for example potato starch; and pharmaceutically usable humidifying agents, for example sodium lauryl sulphate.
  • the tablets could be coated by following methods well known in the usual pharmaceutical practice.
  • Liquid preparations for oral administration could assume, for example, the form of aqueous or oily suspensions, solutions, emulsions, syrups or elixirs, or a dry product to be reconstituted with water or another suitable carrier before use.
  • Such liquid preparations could include conventional additives, including, for example, stabilizing agents of the suspension, for example sorbitol, methyl cellulose, glucose syrup, gelatine, hydroxyethyl cellulose, carboxymethyl cellulose, aluminium stearate or hydrogenated edible fats: emulsifying agents, for example lecithin, sorbitan monooleate or acacia rubber: not aqueous carriers (which can include edible oils), for example almond oil, oily esters (for example glycerin), propylene glycol, or ethyl alcohol; preservatives, for example methyl- or propyl-hydroxybenzoate or sorbic acid; and, optionally, conventional colouring and flavouring agents.
  • stabilizing agents of the suspension for example sorbitol, methyl cellulose, glucose syrup, gelatine, hydroxyethyl cellulose, carboxymethyl cellulose, aluminium stearate or hydrogenated edible fats: emulsifying agents, for example lecithin, sorb
  • compositions according to the present invention could suitably include an inhibitor as herein described or a derived or solvated salt thereof from 0.03% to 95% by weight with respect to the composition.
  • each dose could include for example 0.1 to 1000 mg of compound.
  • the invention also provides a method for use in the prevention and/or treatment of spinal muscular atrophy (SMA) comprising a step of administration to a human subject requiring it, a therapeutically effective amount of HSA-miR181a-5p microRNA inhibitor having SEQ ID NO 1 and access number miRbase MIMAT0000256 as defined in the present description and in the claims optionally in association to the other herein described active agents.
  • SMA spinal muscular atrophy
  • the invention also provides the following methods:
  • a method for evaluating the prognosis of spinal muscular atrophy (SMA) in a subject comprising:
  • a method for monitoring the development of spinal muscular atrophy in a subject comprising:
  • HSA-miR181 a-5p, HSA-miR324-5p and/or HSA-miR451 a microRNAs in two or more biological samples of said subject, wherein the samples were obtained at spaced time points, and
  • a method for monitoring the effectiveness of a treatment of spinal muscular atrophy in a subject comprising:
  • a determining the levels of HSA-miR181 a-5p, HSA-miR324-5p and/or HSA-miR451 a microRNAs in a biological sample of said subject obtained before the start of treatment; b. determining the levels of HSA-miR181 a-5p, HSA-miR324-5p and/or HSA-miR451 a microRNAs in one or more biological samples of said subject obtained during or after treatment, and
  • step (b) comparing the levels of HSA-miR181 a-5p, HSA-miR324-5p and HSA-miR451a microRNAs determined in steps (a) and (b), and optionally between different samples in step (b), for example 1 , 3, 6, 12, 24, 36 or 48 months earlier.
  • biological samples useful in anyone of the methods of the invention include plasma, serum, urine, muscle biopsies, skin biopsies, cerebrospinal liquid.
  • microRNAs are extracted and purified from any biological sample.
  • anyone of the above-described methods can further include the step of reducing or eliminating the degradation of microRNAs.
  • control level as used herein, comprises predetermined standards (for example, a value published in a reference) and levels determined experimentally in samples analysed and processed by control subjects (for example healthy subjects of equal age, patients treated with placebo, etc.).
  • a Kit is also herein described for use in the prognosis of spinal muscular atrophy in a subject comprising reagents for the determination of levels of HSA-miR324-5p micro RNA and/or of HSA-miR451a micro RNA in a biological sample and optionally one or more control samples, that is samples wherein the levels of microRNAs are known.
  • the reagents for the measurement of the levels for determining the levels of the microRNAs are known to the person skilled in the art and exemplified in the examples.
  • the high-throughput analysis of miRnoma of the patients affected by SMA was performed on 7 muscle biopsies (3 SMA I, 2 SMA II and 2 SMA III), and 7 controls obtained by the Division of Child Neuropsichiatry of the Neurological Institute“Carlo Besta” in Milan.
  • the samples were selected based upon the biopsy site selected (quadriceps femoris) and the execution of sampling at the first stages of the disease to avoid the excessive presence of fibrotic tissue.
  • the controls were selected among morphologically normal samples, obtained from healthy subjects of the same range of age.
  • the total RNA was extracted from muscle biopsies by the use of TRIzol® Reagent (Life Techologies) in a ratio of 1 ml/100 mg of sample, according to the producer’s protocol.
  • the extracted RNA was re-suspended in water RNase-free and quantified by reading at spectrophotometer NanoDrop 1000 (Thermo Scientific).
  • the total RNA was at first quantified and qualified by Byoanalyzer (Agilent) with the purpose of evaluating quality and integrity thereof, defined through the number of integrities of RNA (RIN).
  • the fraction of small RNAs, containing the miRNAs, was selected through cutting from not-denaturing 6% polyacrylamide gel.
  • the extraction of miRNAs from serum was performed by using miRCURYTM RNA Isolation Kit - Biofluids (EXIQON). With the purpose of avoiding the presence of blood cells in the serum, the sample was centrifuged at 3.000rpm for 5 minutes before proceeding with extraction. The miRNAs were extracted from an initial volume of serum of 200mI for each sample. In the final extraction step, a digestion with DNase RNase-free for 15 minutes at room temperature was performed in order to remove the residues of cell-free DNA.
  • the retrotranscription of miRNAs extracted from serum was performed with Universal cDNA synthesis kit II (EXIQON), according to the producer’s instructions.
  • the reaction of retrotranscription was performed under different conditions.
  • 4mI of RNA were retrotranscripted thereto 4mI 5x Reaction Buffer, 2mI Enzyme mix, 1 mI Synthetic RNA spike in (UniSp6) and 9mI H20 nuclease-free, in a final volume of 20mI, were added.
  • 2mI Enzyme mix 1 mI Synthetic RNA spike in (UniSp6)
  • 9mI H20 nuclease-free in a final volume of 20mI
  • miRNA quantification in serum through absolute qRT-PCR assoluta 2mI of RNA were retrotranscripted thereto 2mI 5x Reaction Buffer, 1 mI Enzyme mix and 5mI H20 nuclease-free, in a final volume of 10mI, were added.
  • the obtained cDNA was brought to a 100x concentration of the final dilution with H20 nuclease-free for the subsequent reactions of relative qRT-PCR, or at a 25x concentration of the final dilution in TE pH8 (10mM Tris-HCL, 1 mM EDTA) for the subsequent reactions of absolute qRT-PCR.
  • the libraries were sequenced on Genome Analyze I lx (lllumina), according to the producer’s directions.
  • the obtained reads (having length of 31 bases, in single-end) were at first filtrated by quality, by using FASTX-toolkit, and then subjected to trimming (by means of Trim galore) for removing the adapter. Only the reads longer than 15 bases were preserved for the subsequent analysis.
  • the filtered reads were aligned to the sequences of the precursor miRNAs noted in the miRBase (www.mirbase.org) database. For the alignment Bowtie algorithm was used, by allowing a maximum of two mismatches.
  • the identification and quantification of mature miRNAs were performed by using exclusively the reads perfectly aligned to the sequence of each mature miRNA.
  • the reads not aligned in miRBase were subsequently filtered, by removing potential molecules of tRNA, rRNA or other products noted in Rfam, ncRNA and NONCODE databases.
  • the remaining reads were grouped together with the identification of possible miRNAs still not noted, performed by miRDeep (v2).
  • miRDeep the evaluation of the differential expression of the miRNAs identified between SMA samples and controls was performed through the software edgeR (v2.4.1).
  • the so-identified miRNAs were considered expressed in differential way between patients and controls exclusively for values of FDR (False Discovery Rate) ⁇ 0.05.
  • primer reverse included the sequence of the universal primer used in the commercial kit Universal cDNA synthesis kit II (EXIQON), followed by a queue of T15 and by 4 nucleotides complementary to the last 4 of the end 3’ of the sequence of the mature miRNA.
  • primer forward had a variable length and included the sequence of mature miRNA (www.mirbase.org), followed by a queue of A15 and by 3 nucleotides complementary to the last 3 of the end 3’ of the universal primer R.
  • PCR In order to transform into double-filament DNA the fragment containing the sequence of mature miRNA, one single cycle of PCR was performed.
  • the reaction of PCR was performed in a final volume of 12.5mI including: 0.1 mI GC-Platinum Taq DNA Polymerase (5u/mI), 1.25mI 10x Reaction Buffer, 1 mI 25mM MgCI2, 0.25mI 10mM dNTPs, 1 mI primer exst_F 10mM, 1 mI primer exst_R 10mM e 7.9mI H20 nuclease-free.
  • the cycle of PCR was: 30” - 94°C, 30” - 54°C, 30” - 72°C.
  • the product obtained from the previous reaction was cloned in the vector pDrive (Qiagen).
  • the pDrive was at first linearized with EcoRV (Roche) by incubating at 37°C for 1 hour 10pg of the vector with 10 U of enzyme, 2.5mI 10x SuRE/Cut Buffer B and 2dH20 in a final volume of 25mI.
  • the digested vector was subsequently purified by precipitation with sodium acetate 3M (C2H3Na02) pH 5.2.
  • the digested vector was made T-overhang by amplification in presence of only dTTPs, with the purpose of favouring the pairing thereof with the A- overhang existing in the inserts.
  • Such reaction was performed in a final volume of 12.5mI with 0.2mI GC-Platinum Taq DNA Polymerase (5u/pl), 1.25mI 10x Reaction Buffer, 0.75mI 25mM MgCI2, 0.25mI 10mM dTTPs, 300ng of the linearized vector pDrive and 2dH20 at volume. The reaction was incubated for 20 minutes at 72°C.
  • the ligation was performed in a final volume of 20mI with 5mI 4x AnzaTM T4 DNA Ligase Master Mix (Invitrogen), 1 mI vector pDrive EcoRV T-overhang [50ng/pl], 10ng of the insert. The reaction was incubated at room temperature for 30 minutes.
  • Competent bacteria EZ were transformed with the vector pDrive including the fragment of interest according to the method of the heat shock: 30 minutes in ice, 50 seconds at 42°C and 2 minutes in ice. Then 250mI of SOC medium (2% tryptone, 0.5% 10mM NaCI, 2.5mM KCI, 10mM MgCI2, 10mM MgS04, 20mM Glu) were added; the bacteria were incubated for 1.5 hours at 37°C under stirring at 300 rpm. Subsequently, they were plated on petri including LB-AGAR with ampicillin 100pg/ml, X-Gal 80pg/ml, IPTG 50mM and incubated O/N at 37°C.
  • SOC medium 2% tryptone, 0.5% 10mM NaCI, 2.5mM KCI, 10mM MgCI2, 10mM MgS04, 20mM Glu
  • the cycle of PCR was: 5’ - 95°C; 1’ - 95°C, 1’ - 56°C, 1’ - 72°C (for 30 cycles); 5’ - 72°C.
  • the size of the obtained amplified ones was evaluated by electrophoresis on agarose gel: only the colonies producing products of PCR> of -200 bp were sequenced.
  • the sequence of each cloned miRNA was checked by means of sequencing of Sanger.
  • the product of PCR (5mI) was purified with 1 mI ExoSAP-IT® PCR Product Cleanup (Affymetrix) for 15 minutes at 37°C, thereafter ExoSAP was inactivated at 80°C for 15 minutes.
  • the fragment of DNA of interest was sequenced by using BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems), according to the producer’s directions, in a final volume of 10mI.
  • the sequence reactions were purified with BigDye® XTerminatorTM Purification Kit (Applied Biosystems), according to the producer’s protocol.
  • the sequencing was performed by capillary electrophoresis on automatic sequencer ABI-Prism 3130 (Applied Biosystem).
  • the plasmid DNA was extracted with E.Z.N.A Plasmid DNA Mini Kit I Spin Protocol (OMEGA Biotek) according to the producer’s protocol.
  • the concentration of the extracted DNA was quantified by spectrophotometer MultiskanTM Go (Thermo Scientific) and its integrity was verified through electrophoretic run on agarose gel. The correctness of the insert sequence was again verified.
  • the extracted plasmid DNA was diluted at a final concentration of 3ng/pl by means of serial dilutions for the construction of the standard curves.
  • each antagomir was diluted 1 : 1 in Cerebro Spinal Fluid (CSF) artificial 2x (238 mM NaCI, 52.4 mM NaHC03, 5 mM KCI, 2 mM NaH2P04, 2.6 mM MgCI2, 20 mM glucose).
  • CSF Cerebro Spinal Fluid
  • the injection at intra-cerebro-ventricular P2 of the affected mice with 0.5 nM of each antagomir (in a final volume of 1 mI) was performed. The phenotypical effect of the treatment was evaluated exclusively through survival.
  • the AQ (Absolute Quantification) files obtained from relative qRT-PCRs were converted into RQ (Relative Quantification) files by means of RQ Manager 1.2 and subsequently analysed with Real Time StatMiner® v4.1. For the identification and subsequent removal from the analysis of the outliers the Grubbs’ test was applied. Spike-In UniSp6 was used as normalizer in the relative qRT-PCRs. The comparison of the levels of different miRNAs between patients and controls was performed by using the not-parametric test Wilcoxon and only the miRNAs with FDR (False Discovery Rate) ⁇ 0.05 were considered significant. The statistical analysis of the data obtained from absolute qRT-PCR was performed by the software Statgraphics Centurion XV (StatPoint Inc.).
  • sensitivity and specificity of the determination of the levels of miRNAs in the patients with respect to the controls were determined by means of ROC (Receiver Operator Characteristic) curves.
  • ROC Receiveiver Operator Characteristic
  • the object of the present invention can be synthetized in two fundamental points: 1) the identification of 3 miRNA produced by the skeletal muscle, deregulated in the SMA patients, as biomarkers for the condition.
  • a method of absolute qPCR was developed allowing to determine the levels of miRNAs in serum (expressed as number of molecules/mI of serum); 2) the therapeutic application of the modulation of such miRNA under neurodegenerative conditions such as, apart from SMA, amyotrophic lateral sclerosis (SLA).
  • SLA amyotrophic lateral sclerosis
  • miRNAs some play a key role in the muscle physiology; some of them were previously identified as biomarkers for other neuro-muscle conditions (miR-1 , miR-133a/b and miR-206). Moreover, our data show that the miRNAs involved in processes of atrophy/denervation are deregulated even in SMA and their modulation could be a valid therapeutic target to slow-down the disease progression.
  • Step 1 we tested the expression levels of the 99 deregulated miRNAs emerged from the analysis of the muscle biopsies on samples of serum of 10 SMA patients and 10 controls by means of relative qRT-PCR with commercial assays (Exiqon, miRCURY LNA). Commercial tests were available for 76/99 miR deregulated in the muscle biopsies.
  • the relative quantification was performed by using a spike-in, Unisp6, as calibrator.
  • Step 2 For a value of alfa £0.05, 21 miRNAs were significantly over-expressed and 3 under-expressed in serum of the SMA patients with respect to the controls, thus resulting potential biomarkers (Figure 2)
  • Step 2 For the 24 miRs detected in Step 1 and for the 23 miRs therefor commercial assays were not available, we developed an in-house system for absolute qRT-PCR. By using such assays, we analysed the expression levels of 47/99 miRs identified from the analysis of miRnoma on 91 samples of serum (51 of patients affected by different forms of SMA and 40 of control healthy subjects, Figure 2).
  • miRNAs Most part of analysed miRNAs could not be dosed or were not expressed differentially between patients and controls; 3 miRNAs (miR324-5p, miR181a-5p e miR-451a) resulted to be promising biomarkers for SMA, as significantly over-expressed in samples of serum of the patients. Particularly interesting, some studies demonstrated the involvement of miR-181 a-5p and of miR- 451 a in controlling the myogenic differentiation processes (Naguibneva et al. , 2006 and Dmitriev et al., 2013). Afterwards, we evaluated the applicability of the above-mentioned miRNAs as biomarkers for SMA, by analysing possible correlations between the serum levels and some clinical parameters.
  • the predictive power of the quantification of (single or combined) miRNAs in distinguishing the patients from the controls was evaluated. To this purpose, we constructed ROC curves.
  • miRNA Most predictive miRNA is miR- 181 a-5p: by fixing the cut-off at 70.5 molecules/mI, the determination of miRNA has a diagnostic sensitivity of 75% and a specificity of 61 % (Figure 4a); the sum of the 3 miRNAs increases sensitivity and specificity: in particular, by fixing the cut-off at 380 molecules/mI, sensitivity and specificity reach 80 and 74%, respectively ( Figure 4b).
  • Figure 4a the sum of the 3 miRNAs increases sensitivity and specificity: in particular, by fixing the cut-off at 380 molecules/mI, sensitivity and specificity reach 80 and 74%, respectively.
  • each antagomir into 5 mice SMNA7 and a control antagomir- scramble into other 5.
  • P2 postnatal life
  • the inventors have identified deregulated miRNAs in SMA patients with respect to the controls.
  • the primary objective of the study was to identify the biomarkers for the condition: 1) the modulation thereof was independent from the products of the SMN2 genes and 2) which derived from a tissue (the skeletal muscle) which has a central role in the pathogenetic mechanism of the condition.
  • the skeletal muscle either it is active, as retrograde signal on the spinal motor neuron, or passive, after denervation and triggering of the atrophy processes
  • the rational behind the selection of this approach was to identify deregulated miRNAs on tissues deriving from patients.
  • the deregulated miRNAs in the skeletal muscle were identified by analysis of miRNoma of muscle biopsies and they were subsequently quantified in more than 90 samples of serum of patients and controls. Out of 99 deregulated miRNAs in the skeletal muscle of the patients, only 3 could be dosed and/or deregulated in serum of the patients. It is to be noted that typical myomiRs, such as miR-1 , miR-133 and miR- 2016, over-expressed in the serum of patients affected by DMD (Cacchiarelli et ai, 2011) or miR usually released into circulation during processes of cellular death, are not deregulated in SMA sera.
  • HSA-miR181 a-5p, HSA-miR324-5p and HSA-miR451 a are over-expressed in the patients and allow to differentiate patients and controls with a sensitivity of 80% and a specificity of 74% (p ⁇ 0.0001).
  • HSA-miR324-5p and HSA- miR451a are also correlated with the phenotypical gravity, since they have significantly higher levels in the less serious forms of SMA.
  • HSA-miR181a-5p can be considered a therapeutic approach for SMA, in combination with other treatments, but it can be effective even in other neurodegenerative diseases such as SLA, which has several features in common with SMA. It would be further interesting to evaluate the application thereof under other neurodegenerative conditions of SNC, such as Alzheimer and Parkinson disease.
  • the analysed samples are particularly precious and rare as deriving from muscle biopsies performed with diagnostic purpose several years ago: it has to be taken into account that, considering the bioavailability of a highly sensitive and specific genetic test, the muscle biopsy is a by now obsolete procedure in the diagnostic process of SMA, apart from being ethically not acceptable.
  • the miRNAs deregulated in the serum of the patients with respect to the controls could be identified directly.
  • This approach differently from the published studies not only in the field of SMA but even of other conditions, allowed to detect 3 deregulated miRNAs, but above all to give a therapeutic apart from prognostic/pathogenic meaning to the invention.
  • the finding of greatest translational impact of the study is the definition of the therapeutic role of modulation of HSA-miR-181 a-5p.
  • SEQ ID NO 1 AACAUUCAACGCUGUCGGUGAGU HSA-miR181 a-5p micro RNA has SEQ ID NO 1 and access number miRbase MIMAT0000256;
  • SEQ ID NO 3 AAACCG U U ACC AU U ACUG AG U U HSA-miR-451 a micro RNA has SEQ ID NO 3 and access number miRbase MIMAT0001631 ; SEQ ID NO 4 (LNA miRNA inhibitor mmu-miR-181 a-5p product sequence 5’-

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The present invention relates to specific inhibitors for human microRNAs, for use in the treatment of spinal muscular atrophy (SMA) and pharmaceutical compositions including them. The present invention further relates to the identification of markers with high sensitivity and specificity for the prognosis of a spinal muscular atrophy (SMA), prognostic methods comprising the use of such markers and prognostic kits for detecting such markers.

Description

"IDENTIFICATION OF MUSCULAR miRNA AS BIOMARKERS AND CO-ADIUVANT TREATMENT FOR SPINAL MUSCULAR ATROPHY"
DESCRIPTION
The present invention relates to specific inhibitors of human microRNAs, for use in the treatment of spinal muscular atrophy (SMA) and pharmaceutical compositions including them. The present invention further relates to the identification of markers with high sensitivity and specificity for SMA prognosis, prognostic methods including the use of such markers and prognostic kits for detecting such markers.
STATE OF PRIOR ART
Spinal muscular atrophy (SMA) is a genetically determined, autosomal recessive transmission rare condition, characterized by progressive muscular paralysis due to loss in spinal motor neurons. Based upon the clinical gravity (at time of onset and at time of maximum motion acquisition) SMA is classified in 3 infantile forms (SMA l-lll). The gene responsible for all forms of SMA is localized in 5q13 and it is called SMN1 (Survival of Motor Neuron 1). The SMN1 gene is absent in homozygosis in 95-97% of SMA patients.
In the same region there is a hypermorphic gene of SMN1, SMN2. The two genes are highly homologous and codify for the same protein (SMN), but due to the alternative splicing of exon 7, the genes SMN2 produce mainly a protein isoform deprived of this exon which is quickly degraded.
SMA is characterized by progressive muscle paralysis due to the degeneration of the alpha-motor neurons of spinal cord. The role of the skeletal muscle in the condition physiopathology is still controversial, although there are several experimental pieces of evidence supporting an active pathogenetic role (Braun et al., 1995; Guettier-Sigrist et al. , 2002; Chan et al., 2003; Arnold et al., 2004; Kariya et al., 2008; Walker et al., 2008; Bricceno et al., 2014). Based upon the time of onset and the time of maximum motion acquisition, generally 3 forms of SMA are identified with onset in infantile age: SMA I, or Werdning-Hoffmann disease, starts within 6 months of age, the affected children do not acquire the seated position; SMA II or Dubowitz disease starts <18 months, the patients do not acquire autonomous deambulation; the onset of SMA III is >18 months, the motion acquisitions take place normally, however the patients can lose deambulation at variable age (D’Amico et al. , 2011).
Most part of the therapeutic approaches during experiments have as objective the increase in the levels of SMN protein produced by SMN2 genes. Thereamong, Nusinersen (Spinraza®, Biogen) has been recently registered by EMA e FDA, and it is based on antisense oligonucleotides (ASO) which reduce the alternative splicing of exon 7.
The long-term effects of the treatment are not yet known, considering the follow up still limited in time. However, what currently appears clearly is that the treatment with Nusinersen allows a net clinical improvement of the patients, but not the total reversion of the phenotype (Finkel et al., 2017; Mercuri et al., 2018). The possible reasons of the not complete therapeutic success can be several: 1) the treatment could not allow to reach therapeutic levels of SMN in the central nerve system; 2) the only rescue of SMN at central level could not be sufficient to recover totally the phenotype, since the skeletal muscle and the other peripheral tissues are not reached by the drug; 3) a so-called therapeutic window could exist, outside thereof the treatment allows to obtain limited effects. To support this last hypothesis there are data of the Nurture study performed by Biogen (EudraCT Number: 2014-002098-12), not yet published; the ad interim analysis results were illustrated during the last congress of the World Muscle Society, in 2017 (Hwu et al., 2017). In this study, the children with assumed SMA I, identified by prenatal screening or as subsequent pregnancies of families with a preceding child affected by SMA I, were treated in pre-symptomatic phase. What appears quite evidently is that the earlier the treatment is started, the better the expected therapeutic outcome is. It is to be noted that even in pre-clinical models of SMA, the administration of ASO improves, but it does not reverse the phenotype (Passini et al., 2011).
Parallelly to the identification of effective therapeutic approaches, a portion of the scientific community dedicated to the identification of both prognostic and predictive biomarkers for SMA. As SMN2 is the currently known main modifier of phenotypical gravity, the first identified biomarker was the determination of the number of copies of SMN2 (Feldkotter et al., 2002; Tiziano et al., 2007; Crawford et al., 2012): the identification of two copies of SMN2 is strongly predictive of a serious phenotype, as there is 80% of probability of a SMA I. The predictive power of the identification of 3 copies of SMN2 is considerably more limited, since they are observed in about 60% of SMA II and in 50% of SMA III. The finding of 4 copies of SMN2 is predictive of a lighter phenotype (Crawford et al., 2012).
The determination of the levels of products of SMN2 (transcripts and/or protein) in samples of peripheral blood of patients and controls was one of the most explored potential biomarkers for SMA: whereas the protein levels do not correlate with the phenotypical gravity (Kobayashi et al., 2011 ; Kobayashi et al., 2012; Tiziano et al., 2013), the levels of transcripts SMN2-f\ are the biomarker which predicts at best the gravity of SMA (Tiziano et al., 2010a; Tiziano et al., 2010b; Tiziano et al., 2013; patent N.: RM2008A000270).
As far as the identification of biomarkers independent from the products of genes SMN2 is concerned, in one single published study (Kobayashi et al., 2013) sera of controls and patients affected by forms of different gravity were analysed: they were identified by immunoassay 12 analytes significantly correlated with the motion function of the patients. However, such analytes were not subsequently validated in interventional clinical studies.
The object of the present invention is to provide prognostic biomarkers of spinal muscular atrophy (SMA) and new compounds useful in the prevention and/or treatment of this disease.
SUMMARY OF THE INVENTION
The present invention is based upon the scientific experiments shown in the examples. The authors have identified deregulated miRNAs in the patients affected by SMA, in particular they have identified three miRNAs (HSA-miR181a-5p, HSA-miR324- 5p and HSA-miR451a) over-expressed in the patients affected by SMA showing a correlation with the condition gravity. Moreover, they have found that miR181 microRNA inhibitors, in particular HSA-miR181a-5p inhibitors determine an increase in the survival of the mice affected by SMA. The present invention firstly relates to an inhibitor of the miR181 microRNA, in particular of HSA-miR181a-5p microRNA, for use in the prevention and/or treatment of spinal muscular atrophy (SMA), wherein said HSA-miR181a-5p microRNA has SEQ ID NO 1 and access number miRbase MIMAT0000256.
The present invention further relates to a pharmaceutical composition comprising as pharmacologically active agent an inhibitor of HSA-miR181a-5p microRNA and at least a pharmaceutically acceptable carrier.
The present invention further relates to a Kit for the simultaneous, separate or sequential administration of an inhibitor of HSA-miR181 a-5p miR181 microRNA and one or more of the following compounds Nusinersen, HSA-miR324-5p microRNA inhibitor, HSA-miR451 a microRNA inhibitor.
The present invention further relates to an in vitro method for evaluating the prognosis of spinal muscular atrophy (SMA) in a subject, comprising:
a. determining the level of HSA-miR181 a-5p, HSA-miR324-5p and/or HSA-miR451 a microRNAs in a biological sample of said subject;
b. comparing the level of said micro RNAs in the sample of said subject with the control levels and optionally
c. (i) identifying the subject as affected by the spinal muscular atrophy when the levels of microRNAs in the subject sample have increased with respect to the control ones or (ii) identifying the subject as not affected by spinal muscular atrophy when the levels of microRNAs in the subject sample have not increased.
The present invention further relates to a method for monitoring the development of spinal muscular atrophy in a subject, comprising:
a. determining the level of HSA-miR181 a-5p, HSA-miR324-5p and/or HSA-miR451 a microRNAs in two or more biological samples of said subject, wherein the samples were obtained at spaced time points, and
b. comparing the microRNA levels between the biological samples obtained previously and those obtained subsequently.
The present invention further relates to a method for monitoring the effectiveness of a treatment of spinal muscular atrophy in a subject, comprising: a. determining the level of HSA-miR181 a-5p, HSA-miR324-5p and/or HSA-miR451 a icroRNAs in a biological sample of said subject obtained before the start of treatment, in particular individual and/or added up levels;
b. determining the level of microRNA in one or more biological samples of said subject obtained during or after treatment, in particular individual and/or added up levels, and c. comparing the level of individual microRNAs and/or their sum determined in the steps (a) e (b), and optionally between different samples in step (b).
DETAILED DESCRIPTION OF THE FIGURES
Figure 1 : Heatmap related to the analysis of miRnoma of muscle biopsies of patients and controls. The graph shows the differential expression of miRNAs deregulated in the muscle biopsies. The blue strips designate the down-regulated miRNAs, whereas the yellow ones relate to the up-regulated miRNAs. The heatmap shows that the analysed groups generate two distinct clusters (CTRL vs SMA).
Figure 2: deregulated miRNAs in the serum of SMA patients, emerging from a first validation performed through relative qRT-PCR on 10 samples SMA and 10 controls (*a£0.05).
Figure 3: Correlation graphs between the expression levels of miR-181a-5p, 324- 5p and 451 a and type of SMA. The boxplot shows the number of molecules/mI serum detected for miR-181a-5p (a), miR-324-5p (b) and miR-451a (c) in correlation with the type of SMA (I, II, III) (*P£0.05).
Figure 4: Predictive power of miR-181a-5p, miR-324-5p and miR-451a in discriminating SMA patients from controls. The graphs show (a) the ROC curves of each miRNA analysed individually; (b) the ROC curve relative to the sum of the 3 miRNAs.
Figure 5: Survival curves of the mice SMA-A7 treated with single intrathecal injection of anti-miR-181a-5p or anti-miR-324-5p. The affected mice were treated on the day after birth with 0.5 nM of antagomir, of negative control or they were not subjected to treatment. From the obtained data it emerges that anti-miR-181 a-5p induces a statistically significative increase in the survival of the affected mice.
Figure 6: Treatment effect with Mimic of mir-181a-5p and miR-324-5p in cells of human neuroblastoma SH-SY5Y. Both miRs are almost unmeasurable under basal conditions (scramble). The transient transfection of Mimics determines a marked increase in the levels of single miRs. However, the levels of transcripts of the SMN1 and SMN2 genes remain unchanged. Only in case of miR-324-5p a decrease in the levels of isoform SMN-del7 is noted, the biological meaning remains unknown.
GLOSSARY
MicroRNA (miRNA or miR): are an endogenous sub-class of not codifying small RNAs constituted by single-filament ribonucleic acids, usually with a length of 21-22 nucleotides, having the capability of binding specific sequences of messenger RNA by inhibiting the subsequent translation into protein. Their presence guarantees a fine mechanism for adjusting the protein expression both under normal or pathological conditions.
Inhibitor of microRNA: (designated in the present text even as anti miRNA) modified oligonucleotide, complementary to a specific miRNA; when miRNAs and anti-miRNAs bind, the endogenous function of the micro-RNA is abolished.
SMA: spinal muscular atrophy, neurodegenerative recessive autosomal disease
SMN: survival of motor neuron, essential protein for the survival and function of the spinal motor neurons
NGS: next generation sequencing, massive parallel sequencing of molecules of DNA.
DESCRIZIONE DETTAGLIATA OF THE INVENTION
The present invention thus relates to inhibitors of miR181 microRNA, in particular of miR181 HSA-miR181a-5p microRNA for use in the prevention and/or treatment of spinal muscular atrophy (SMA), wherein said HSA-miR181a-5p microRNA has SEQ ID NO 1 and access number miRbase MIMAT0000256.
The inhibitor could be for example an antagomir, an antisense oligonucleotide or an inhibitor of RNA. The molecules more commonly used as inhibitors of microRNAs, included in the object of the present invention, are represented by antisense oligonucleotides, also called antimiR, the sequence thereof is wholly or partially complementary to the sequence, (which normally includes the so-called seed sequence) of the target microRNA, and that is of the microRNA to be inhibited. The sequence will be complementary at least by 90, 91 , 92, 93, 95 or 100%; it is likely that there is the inhibitory effect with at least 90% of complementarity.
Preferably, to the purposes of the present invention, any inhibitor of selected HSA- miR181a-5p microRNA, is a specific inhibitor for HSA-miR181a-5p micro RNA having SEQ ID NO 1 and access number miRbase MIMAT0000256, and that is an inhibitor inhibiting, that is silencing, only said microRNA and which is not capable of inhibiting, that is silencing, other microRNAs expressed in the same organism.
In an embodiment, then, the invention inhibitor will be an optionally chemically modified oligonucleotide having a sequence complementary to SEQ ID NO 1.
It is known, in the state of art that the antimiRs (and that is the oligonucleotides inhibiting microRNAs) can be modified chemically with the purpose of increasing the affinity thereof for the target microRNA (thus by increasing the annealing temperature of the inhibitor- microRNA hybrid), of increasing the half-life thereof and/or, for example, in vivo biodistribution.
According to an embodiment of the invention, then, the inhibitors of HSA-miR181a-5p, HSA-miR324-5p and HSA-miR451a microRNAs are chemically modified oligonucleotides. The person skilled in the art could draw, starting from what is commonly known in the state of art, several antimiRs suitable to the implementation of the invention. The modifications commonly used in the state of art include, for example, modifications to the sugar of nucleotide, modifications to the nitrogen base, modifications to the nucleic bond.
The assays described in the experimental portion are sufficient to evaluate the effectiveness of the inhibitors drawn based upon the above teachings and methods and programmes are available allowing to evaluate the specificity of the same; thereamong, for example, programmes are available commonly used by the person skilled in the art for evaluating the possible crosslinking and then the specificity of the antimiR, such as BLAST, Vmatch, and RNAhybrid. The programme CrossLink, for example, can be used for evaluating the potential interactions between microRNAs or anti-microRNAs and their target sequences. Moreover, suitable inhibitors of microRNAs, the invention relates to, can be purchased from producers specialized for such services and inhibitors specific for said microRNAs are also available on the market. Examples of inhibitors commercially available by Exiqon are the following ones: mmu-miR-181 a-5p batch#620620; mmu-miR-451a batch#183631 ; mmu-miR-324-5p batch#190693).
Examples of inhibitors are the oligonucleotides having sequence SEQ ID NO 4 (LNA miRNA inhibitor mmu-miR-181 a-5p- product sequence 5’- C*G*A*C*A*G*C*G*T*T*G*A*A*T*G*T -3’) , SEQ ID NO 5 (LNA miRNA inhibitor mmu- miR-451 a- product sequence 5’- G*T*A*A*T*G*G*T*A*A*C*G*G*T*T-3’), SEQ ID NO 6 (LNA miRNA inhibitor mmu-miR-324-5p product sequence 5’- A*T*G*C*C*C*T*A*G*G*G*G*A*T*G*C-3’).
As said above, the inhibitor of the present invention can be used in the prevention and/or treatment of SMA (of type l-lll). According to the present invention HSA-miR181a- 5p microRNA inhibitor having SEQ ID NO 1 and access number miRbase MIMAT0000256, is intended for use in the prevention, treatment, reversion, cure or decrease in the process of pathogenesis correlated with SMA. The therapeutic treatment according to the present invention can be implemented with a formulation suitable to any administration route, preferably systemic, still more preferably intrathecal route. Such administration could be performed by several doses or by treatment with one single dose. According to an embodiment HSA-miR181a-5p microRNA inhibitor will be administered in a therapy combined with the medicament Nusinersen and/or with an inhibitor of HSA- miR324-5p microRNA and/or with an inhibitor of HSA-miR451 a micro RNA, wherein said HSA-miR324-5p microRNA has SEQ ID NO 2 and access number miRbase MIMAT0000761 and said HSA-miR-451a micro RNA has SEQ ID NO 3 and access number miRbase MIMAT0001631. Herein a kit for the simultaneous, separate or sequential administration of an inhibitor of HSA-miR181 a-5p microRNA and one or more of the following compounds Nusinersen, inhibitor of HSA-miR324-5p micro RNA, inhibitor of HSA-miR451a microRNA, is also described. Such kit will be advantageously used for use in the prevention and/or treatment of spinal muscular atrophy (SMA).
The term "therapeutically effective amount", as used herein, means the amount of active compound or pharmaceutical agent inducing the biological or medical response in a system of tissues, in an animal or in a human being including alleviation, prevention, treatment or delay of the onset or of the progression of the symptoms of the disease or the treated disorder.
As used herein, the term "composition" is meant relating to even a product comprising the specific ingredients in the specific amounts, as well as any product resulting, directly or indirectly, from combinations of the ingredients specified in the specified amounts. The invention then further relates to a pharmaceutical composition comprising an inhibitor as above defined and at least a pharmaceutically acceptable carrier.
For preparing the pharmaceutical compositions of this invention, an inhibitor according to the present invention as active ingredient is mixed with a pharmaceutical carrier according to conventional techniques of pharmaceutical preparation, which carrier can have a wide variety of forms according to the preparation form wished for the administration.
According to an embodiment the composition will include even one or more of the following pharmacologically active agents: Nusinersen, HSA-miR324-5p microRNA inhibitor, HSA-miR451a microRNA inhibitor.
More generally, the compounds and preparations of the invention could be formulated for administration by any mode which results convenient for medical or veterinary purposes.
Tablets and capsules for oral administration could correspond to one single dose, and could include conventional excipients such as, for example, binding agents, for example maize or glucose syrup, acacia or Arabic rubber, tragacanth rubber, gelatine, sorbitol, polyvinylpyrrolidone; filling agents, for example, lactose, sugar, maize starch, calcium phosphate, sorbitol or glycine; lubricants for tablets, for example magnesium stearate, talcum, polyethyleneglycol or silica; disintegrants, for example potato starch; and pharmaceutically usable humidifying agents, for example sodium lauryl sulphate. The tablets could be coated by following methods well known in the usual pharmaceutical practice.
Liquid preparations for oral administration could assume, for example, the form of aqueous or oily suspensions, solutions, emulsions, syrups or elixirs, or a dry product to be reconstituted with water or another suitable carrier before use. Such liquid preparations could include conventional additives, including, for example, stabilizing agents of the suspension, for example sorbitol, methyl cellulose, glucose syrup, gelatine, hydroxyethyl cellulose, carboxymethyl cellulose, aluminium stearate or hydrogenated edible fats: emulsifying agents, for example lecithin, sorbitan monooleate or acacia rubber: not aqueous carriers (which can include edible oils), for example almond oil, oily esters (for example glycerin), propylene glycol, or ethyl alcohol; preservatives, for example methyl- or propyl-hydroxybenzoate or sorbic acid; and, optionally, conventional colouring and flavouring agents.
The compositions according to the present invention could suitably include an inhibitor as herein described or a derived or solvated salt thereof from 0.03% to 95% by weight with respect to the composition. When presented in form of unitary dose, each dose could include for example 0.1 to 1000 mg of compound.
The invention also provides a method for use in the prevention and/or treatment of spinal muscular atrophy (SMA) comprising a step of administration to a human subject requiring it, a therapeutically effective amount of HSA-miR181a-5p microRNA inhibitor having SEQ ID NO 1 and access number miRbase MIMAT0000256 as defined in the present description and in the claims optionally in association to the other herein described active agents.
The invention also provides the following methods:
A method for evaluating the prognosis of spinal muscular atrophy (SMA) in a subject, comprising:
a. determining the levels of HSA-miR181 a-5p, HSA-miR324-5p and/or HSA-miR451 a microRNAs in a biological sample of said subject;
b. comparing the levels of said microRNAs in the sample of said subject with the levels of a control and optionally
c. (i) identifying the subject as affected by the spinal muscular atrophy when the levels of microRNAs in the subject sample have increased with respect to the control ones or (ii) identifying the subject as not affected by spinal muscular atrophy when the microRNA levels in the subject sample have not increased.
A method for monitoring the development of spinal muscular atrophy in a subject, comprising:
a. determining the levels of HSA-miR181 a-5p, HSA-miR324-5p and/or HSA-miR451 a microRNAs in two or more biological samples of said subject, wherein the samples were obtained at spaced time points, and
b. comparing the microRNA levels between the biological samples obtained previously and those obtained subsequently.
A method for monitoring the effectiveness of a treatment of spinal muscular atrophy in a subject, comprising:
a. determining the levels of HSA-miR181 a-5p, HSA-miR324-5p and/or HSA-miR451 a microRNAs in a biological sample of said subject obtained before the start of treatment; b. determining the levels of HSA-miR181 a-5p, HSA-miR324-5p and/or HSA-miR451 a microRNAs in one or more biological samples of said subject obtained during or after treatment, and
c. comparing the levels of HSA-miR181 a-5p, HSA-miR324-5p and HSA-miR451a microRNAs determined in steps (a) and (b), and optionally between different samples in step (b), for example 1 , 3, 6, 12, 24, 36 or 48 months earlier.
Not limiting examples of biological samples useful in anyone of the methods of the invention include plasma, serum, urine, muscle biopsies, skin biopsies, cerebrospinal liquid.
Not limiting examples of procedures for determining the level of microRNAs useful in anyone of the invention methods include hybridisation, RT-PCR and sequencing. Examples of procedures useful for measuring the microRNA level in the biological samples include hybridisation with selective probes (for example, the use of Northern blotting, flow cytometry based upon microspheres, oligonucleotide microchip [microarray] or assays of hybridisation in solution as commercial kits. In an embodiment, before step (a) in anyone of the previous methods, the microRNAs are extracted and purified from any biological sample. Anyone of the above-described methods can further include the step of reducing or eliminating the degradation of microRNAs.
The term "individual" or "subject" as used herein, relates to animals in general, preferably to human beings. The term “control level” as used herein comprises predetermined standards (for example, a value published in a reference) and levels determined experimentally in samples analysed and processed by control subjects (for example healthy subjects of equal age, patients treated with placebo, etc.).
A Kit is also herein described for use in the prognosis of spinal muscular atrophy in a subject comprising reagents for the determination of levels of HSA-miR324-5p micro RNA and/or of HSA-miR451a micro RNA in a biological sample and optionally one or more control samples, that is samples wherein the levels of microRNAs are known. The reagents for the measurement of the levels for determining the levels of the microRNAs are known to the person skilled in the art and exemplified in the examples.
The following examples are provided to ease the comprehension of the invention, and they are not intended and have not to be interpreted in any way as limiting the invention described in the herebelow following claims.
EXAMPLES
MATERIALS AND METHODS
1. Analysed samples
The high-throughput analysis of miRnoma of the patients affected by SMA was performed on 7 muscle biopsies (3 SMA I, 2 SMA II and 2 SMA III), and 7 controls obtained by the Division of Child Neuropsichiatry of the Neurological Institute“Carlo Besta” in Milan. In order to reduce the experimental variability, the samples were selected based upon the biopsy site selected (quadriceps femoris) and the execution of sampling at the first stages of the disease to avoid the excessive presence of fibrotic tissue. The controls were selected among morphologically normal samples, obtained from healthy subjects of the same range of age. The subsequent validation of miRNAs results differentially expressed by miRNoma analysis was performed on samples of serum obtained from the following institutes: Division of Child Neuropsychiatry - Neurological Institute “Carlo Besta” (Milan); U.O. Neuromuscular-Neuroimmunology Diseases - Neurological Institute“Carlo Besta” (Milan); Section of Child Neuropsychiatry - “Universita Cattolica del Sacro CuoreTPoliclinico Agostino Gemelli” (Rome); Department of Molecular Medicine -“Ospedale Pediatrico Bambino Gesu” (Rome). In total, 51 SMA patients (4 SMA I, 20 SMA II e 27 SMA III) were recruited and 40 controls. The controls were obtained as samples anonymized by the Analysis Laboratory of the Foundation of Policlinico Gemelli and of Ospedale Pediatrico Bambino Gesu, in Rome.
2. Extraction of RNA from tissue and of miRNA from serum
The total RNA was extracted from muscle biopsies by the use of TRIzol® Reagent (Life Techologies) in a ratio of 1 ml/100 mg of sample, according to the producer’s protocol. The extracted RNA was re-suspended in water RNase-free and quantified by reading at spectrophotometer NanoDrop 1000 (Thermo Scientific). For the extraction of the small RNAs, the total RNA was at first quantified and qualified by Byoanalyzer (Agilent) with the purpose of evaluating quality and integrity thereof, defined through the number of integrities of RNA (RIN). The fraction of small RNAs, containing the miRNAs, was selected through cutting from not-denaturing 6% polyacrylamide gel.
The extraction of miRNAs from serum was performed by using miRCURY™ RNA Isolation Kit - Biofluids (EXIQON). With the purpose of avoiding the presence of blood cells in the serum, the sample was centrifuged at 3.000rpm for 5 minutes before proceeding with extraction. The miRNAs were extracted from an initial volume of serum of 200mI for each sample. In the final extraction step, a digestion with DNase RNase-free for 15 minutes at room temperature was performed in order to remove the residues of cell-free DNA.
3. Retrotranscription
The retrotranscription of miRNAs extracted from serum was performed with Universal cDNA synthesis kit II (EXIQON), according to the producer’s instructions.
Depending upon the use of the obtained cDNA, the reaction of retrotranscription was performed under different conditions. For miRNA quantification in serum through relative qRT-PCR 4mI of RNA were retrotranscripted thereto 4mI 5x Reaction Buffer, 2mI Enzyme mix, 1 mI Synthetic RNA spike in (UniSp6) and 9mI H20 nuclease-free, in a final volume of 20mI, were added. For miRNA quantification in serum through absolute qRT-PCR assoluta 2mI of RNA were retrotranscripted thereto 2mI 5x Reaction Buffer, 1 mI Enzyme mix and 5mI H20 nuclease-free, in a final volume of 10mI, were added. The obtained cDNA was brought to a 100x concentration of the final dilution with H20 nuclease-free for the subsequent reactions of relative qRT-PCR, or at a 25x concentration of the final dilution in TE pH8 (10mM Tris-HCL, 1 mM EDTA) for the subsequent reactions of absolute qRT-PCR.
4. miRNA sequencing
4.1 Preparation of miRNA libraries
For the preparation of miRNA libraries TruSeq Small RNA Sample Preparation (lllumina) kit was used, according to the producer’s instructions. The quality of the libraries was evaluated through run on High Sensitivity DNA Chip on the instrument 2100 Byoanalyzer (Agilent). The libraries’ quantification was performed through fluorimetric method on the instrument Q bit (Thermo Scientific) and through qRT-PCR (Kapa-Biosystems).
The libraries were sequenced on Genome Analyze I lx (lllumina), according to the producer’s directions.
4.2 Bioinformatic analysis of the sequencing data
After conversion into FastQ of the files . bcl obtained from sequencing, the obtained reads (having length of 31 bases, in single-end) were at first filtrated by quality, by using FASTX-toolkit, and then subjected to trimming (by means of Trim galore) for removing the adapter. Only the reads longer than 15 bases were preserved for the subsequent analysis. The filtered reads were aligned to the sequences of the precursor miRNAs noted in the miRBase (www.mirbase.org) database. For the alignment Bowtie algorithm was used, by allowing a maximum of two mismatches. The identification and quantification of mature miRNAs were performed by using exclusively the reads perfectly aligned to the sequence of each mature miRNA. The reads not aligned in miRBase were subsequently filtered, by removing potential molecules of tRNA, rRNA or other products noted in Rfam, ncRNA and NONCODE databases. The remaining reads were grouped together with the identification of possible miRNAs still not noted, performed by miRDeep (v2). At last, the evaluation of the differential expression of the miRNAs identified between SMA samples and controls was performed through the software edgeR (v2.4.1). The so-identified miRNAs were considered expressed in differential way between patients and controls exclusively for values of FDR (False Discovery Rate) < 0.05.
5. Construction of external standards
In order to determine in absolute number, the molecules of each miRNA existing in the samples of serum, an in-house quantification system was developed, based upon the use of specific standard curves in qRT-PCR (Tiziano et al., 2010).
For each miRNA 2 partially complementary primers, F and R, were drawn. The primer reverse (exst_R), with a length of 36 nucleotides, included the sequence of the universal primer used in the commercial kit Universal cDNA synthesis kit II (EXIQON), followed by a queue of T15 and by 4 nucleotides complementary to the last 4 of the end 3’ of the sequence of the mature miRNA. The primer forward (exst_F) had a variable length and included the sequence of mature miRNA (www.mirbase.org), followed by a queue of A15 and by 3 nucleotides complementary to the last 3 of the end 3’ of the universal primer R. In order to transform into double-filament DNA the fragment containing the sequence of mature miRNA, one single cycle of PCR was performed. The reaction of PCR was performed in a final volume of 12.5mI including: 0.1 mI GC-Platinum Taq DNA Polymerase (5u/mI), 1.25mI 10x Reaction Buffer, 1 mI 25mM MgCI2, 0.25mI 10mM dNTPs, 1 mI primer exst_F 10mM, 1 mI primer exst_R 10mM e 7.9mI H20 nuclease-free.
The cycle of PCR was: 30” - 94°C, 30” - 54°C, 30” - 72°C.
5.1 Cloning
The product obtained from the previous reaction was cloned in the vector pDrive (Qiagen).
The pDrive was at first linearized with EcoRV (Roche) by incubating at 37°C for 1 hour 10pg of the vector with 10 U of enzyme, 2.5mI 10x SuRE/Cut Buffer B and 2dH20 in a final volume of 25mI.
The digested vector was subsequently purified by precipitation with sodium acetate 3M (C2H3Na02) pH 5.2. The digested vector was made T-overhang by amplification in presence of only dTTPs, with the purpose of favouring the pairing thereof with the A- overhang existing in the inserts. Such reaction was performed in a final volume of 12.5mI with 0.2mI GC-Platinum Taq DNA Polymerase (5u/pl), 1.25mI 10x Reaction Buffer, 0.75mI 25mM MgCI2, 0.25mI 10mM dTTPs, 300ng of the linearized vector pDrive and 2dH20 at volume. The reaction was incubated for 20 minutes at 72°C.
Subsequently, the ligation was performed in a final volume of 20mI with 5mI 4x AnzaTM T4 DNA Ligase Master Mix (Invitrogen), 1 mI vector pDrive EcoRV T-overhang [50ng/pl], 10ng of the insert. The reaction was incubated at room temperature for 30 minutes.
5.2 Bacterial transformation and selection of the colonies
Competent bacteria EZ were transformed with the vector pDrive including the fragment of interest according to the method of the heat shock: 30 minutes in ice, 50 seconds at 42°C and 2 minutes in ice. Then 250mI of SOC medium (2% tryptone, 0.5% 10mM NaCI, 2.5mM KCI, 10mM MgCI2, 10mM MgS04, 20mM Glu) were added; the bacteria were incubated for 1.5 hours at 37°C under stirring at 300 rpm. Subsequently, they were plated on petri including LB-AGAR with ampicillin 100pg/ml, X-Gal 80pg/ml, IPTG 50mM and incubated O/N at 37°C.
For the selection of the positive colonies (including the insert) blue screening was used. The white colonies were collected, re-suspended in 10mI TE pH8 and incubated for 5 minutes at 95°C; the positive colonies were identified by means of PCR-colony by using the primers of the vector T7 (5’-GT AAT ACG ACT CACT AT AG-3’) and SP6 (5’- CATTTAGGTGACACTATAG-3’). The reaction was performed in a final volume of 12.5mI with 6.25mI 2x GoTaq® Hot Start Colorless Master Mix (Promega), 5 nM of primers T7 and SP6, 2mI of DNA.
The cycle of PCR was: 5’ - 95°C; 1’ - 95°C, 1’ - 56°C, 1’ - 72°C (for 30 cycles); 5’ - 72°C. The size of the obtained amplified ones was evaluated by electrophoresis on agarose gel: only the colonies producing products of PCR> of -200 bp were sequenced.
5.3 Sequencing
The sequence of each cloned miRNA was checked by means of sequencing of Sanger. The product of PCR (5mI) was purified with 1 mI ExoSAP-IT® PCR Product Cleanup (Affymetrix) for 15 minutes at 37°C, thereafter ExoSAP was inactivated at 80°C for 15 minutes. The fragment of DNA of interest was sequenced by using BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems), according to the producer’s directions, in a final volume of 10mI. The sequence reactions were purified with BigDye® XTerminatorTM Purification Kit (Applied Biosystems), according to the producer’s protocol. The sequencing was performed by capillary electrophoresis on automatic sequencer ABI-Prism 3130 (Applied Biosystem).
Once confirmed the presence of the insert and its correct sequence, the corresponding bacterial colony was collected again and incubated in LB medium O/N at 37°C under stirring.
5.4 Extraction of plasmid DNA
The plasmid DNA was extracted with E.Z.N.A Plasmid DNA Mini Kit I Spin Protocol (OMEGA Biotek) according to the producer’s protocol. The concentration of the extracted DNA was quantified by spectrophotometer MultiskanTM Go (Thermo Scientific) and its integrity was verified through electrophoretic run on agarose gel. The correctness of the insert sequence was again verified. The extracted plasmid DNA was diluted at a final concentration of 3ng/pl by means of serial dilutions for the construction of the standard curves. The number of molecules/ng of DNA was determined starting from the molecular weight and from the number of Avogadro (see Tiziano et al., 2010 of the detailed description of the method); the standard curves extended in a concentration range of 102- 107 molecules of miRNA. The optimum standard curves were selected based upon the slope (~-3.33) and upon the correlation coefficient (R2=0.99-1), used as a measurement of the experimental reproducibility, obtained by the amplification in qPCR.
6. qRT-PCR
In order to identify the deregulated miRs in the serum samples of SMA patients, firstly an approach of relative qRT-PCR was used, by using the 96-well Pick-&-Mix miRNA PCR Panel (EXIQON). The panel included primers lyophilized at LNA™, specific for the miRNAs of interest, and a Spike-In (UniSp6) used as inner calibrator. The reactions of PCR were prepared and amplified according to the producer’s directions.
For the analysis of the miRs therefor commercial assays EXIQON were not available and for the step for validating the miRs identified by relative approach, the absolute qRT- PCR was used. The reaction was performed in a final volume of 12.5mI with: 6.25mI SYBR® Green PCR Master Mix (Applied Biosystems), 2.5 nM of each primer, 4mI cDNA diluted 1 :25.
In each reaction the universal R primer (see above) and a forward primer specific for each miRNA, according to the sequence published in miRBase (www.mirbase.org) (Table 7), were used. In order to increase the melting temperature of the primers up to ~60°C, calculated with the algorithm OligoAnalyzer 3.1 (Integrated DNA Technologies), at the end 5’ stretches of tetranucleotides (GACT) were added, which did not form secondary structures or hairpin which could reduce the amplification effectiveness. qRT- PCR was performed in the instrument ViiA 7™ Real-Time PCR System (Applied Biosystems). Each sample was amplified in triplicate and each experiment was repeated at least three times.
7. Intrathecal injections
The commercial antagomir were purchased by EXIQON and resuspended in water. Before the intra-cerebro-ventricular injection, each antagomir was diluted 1 : 1 in Cerebro Spinal Fluid (CSF) artificial 2x (238 mM NaCI, 52.4 mM NaHC03, 5 mM KCI, 2 mM NaH2P04, 2.6 mM MgCI2, 20 mM glucose). After determining the genotype at P1 (on the day of birth), the injection at intra-cerebro-ventricular P2 of the affected mice with 0.5 nM of each antagomir (in a final volume of 1 mI) was performed. The phenotypical effect of the treatment was evaluated exclusively through survival.
8. Statistical analysis
The AQ (Absolute Quantification) files obtained from relative qRT-PCRs were converted into RQ (Relative Quantification) files by means of RQ Manager 1.2 and subsequently analysed with Real Time StatMiner® v4.1. For the identification and subsequent removal from the analysis of the outliers the Grubbs’ test was applied. Spike-In UniSp6 was used as normalizer in the relative qRT-PCRs. The comparison of the levels of different miRNAs between patients and controls was performed by using the not-parametric test Wilcoxon and only the miRNAs with FDR (False Discovery Rate) < 0.05 were considered significant. The statistical analysis of the data obtained from absolute qRT-PCR was performed by the software Statgraphics Centurion XV (StatPoint Inc.). The comparison of the levels of different miRNAs between patients and controls, or between the different forms of SMA, was performed by using the not- para metric test Mann-Withney U-test. The continuous variables were compared by means of linear correlations. The gravity of the phenotype was correlated with the different molecular (levels of miRNAs, levels of transcripts SMN2, number of genes SMN2) and clinical (Hammersmith Functional Motor Scale-Expanded/Extended, Six minutes walking test, North Star Ambulatory Assessment) parameters by means of multi-varied analysis. For all tests, levels of P£0.05 were considered significant.
At last, sensitivity and specificity of the determination of the levels of miRNAs in the patients with respect to the controls were determined by means of ROC (Receiver Operator Characteristic) curves. The cut-off value of the single miRNAs or of the sum of the three was identified based upon the higher values of sensitivity and specificity. RESULTS
The object of the present invention can be synthetized in two fundamental points: 1) the identification of 3 miRNA produced by the skeletal muscle, deregulated in the SMA patients, as biomarkers for the condition. To this purpose a method of absolute qPCR was developed allowing to determine the levels of miRNAs in serum (expressed as number of molecules/mI of serum); 2) the therapeutic application of the modulation of such miRNA under neurodegenerative conditions such as, apart from SMA, amyotrophic lateral sclerosis (SLA).
With the purpose of identifying miRNAs expressed in differential way between patients and controls, with possible application as biomarkers in SMA, in the first step of our study we performed the differential analysis of the expression levels of miRNAs in samples of skeletal muscle of the SMA patients with respect to the adequately selected controls. To this purpose we performed an analysis of miRnoma by means of sequencing techniques of new generation (NGS) both on culture of myoblasts and myotubes of 5 SMA patients and 5 controls, and on muscle biopsies of 7 SMA patients and 7 controls. The selection of the double approach, in vivo and in vitro, has several reasons: 1) the in vitro model allowed to analyse a homogeneous population of cells, independently from the denervation, re-innervation and atrophy processes which usually take place in the SMA muscle and consequently to identify miRNA, the deregulation thereof could have pathogenetic importance; 2) the use of the in vivo model has a greater impact in the identification of new miRNA biomarkers, since it better reflects the pathophysiological process which takes place in the patients during the course of condition. The comparative analysis of the SMA samples versus the controls demonstrated that the two groups clusterize separately. In the cultures of SMA myoblasts and myotubes, we identified 22 and 19 miRNAs, respectively, expressed in differential way (alfa £0.05), by suggesting the existence of a primitive muscle defect, independent from the denervative process. Nighty-nine miRNAs resulted to be deregulated in the muscle biopsies of patients (alfa <0.05) (Fig. 1): thereamong, 5 miRNAs were shared with myoblasts and myotubes. Three miRNAs (miR-1 , miR-133a and miR208b) showed an opposite regulation in the muscle cultures with respect to biopsies: such discrepancy is probably due to the different level of maturity of the muscle fibrocells in the in vitro model and/or to the lack in innervation. Among the deregulated miRNAs, some play a key role in the muscle physiology; some of them were previously identified as biomarkers for other neuro-muscle conditions (miR-1 , miR-133a/b and miR-206). Moreover, our data show that the miRNAs involved in processes of atrophy/denervation are deregulated even in SMA and their modulation could be a valid therapeutic target to slow-down the disease progression.
The 99 deregulated miRNAs in the muscle biopsies were validated as potential biomarkers for SMA. We used an approach developed in two steps: Step 1 : we tested the expression levels of the 99 deregulated miRNAs emerged from the analysis of the muscle biopsies on samples of serum of 10 SMA patients and 10 controls by means of relative qRT-PCR with commercial assays (Exiqon, miRCURY LNA). Commercial tests were available for 76/99 miR deregulated in the muscle biopsies. The relative quantification was performed by using a spike-in, Unisp6, as calibrator. For a value of alfa £0.05, 21 miRNAs were significantly over-expressed and 3 under-expressed in serum of the SMA patients with respect to the controls, thus resulting potential biomarkers (Figure 2) Step 2: For the 24 miRs detected in Step 1 and for the 23 miRs therefor commercial assays were not available, we developed an in-house system for absolute qRT-PCR. By using such assays, we analysed the expression levels of 47/99 miRs identified from the analysis of miRnoma on 91 samples of serum (51 of patients affected by different forms of SMA and 40 of control healthy subjects, Figure 2). Most part of analysed miRNAs could not be dosed or were not expressed differentially between patients and controls; 3 miRNAs (miR324-5p, miR181a-5p e miR-451a) resulted to be promising biomarkers for SMA, as significantly over-expressed in samples of serum of the patients. Particularly interesting, some studies demonstrated the involvement of miR-181 a-5p and of miR- 451 a in controlling the myogenic differentiation processes (Naguibneva et al. , 2006 and Dmitriev et al., 2013). Afterwards, we evaluated the applicability of the above-mentioned miRNAs as biomarkers for SMA, by analysing possible correlations between the serum levels and some clinical parameters. The first and simplest analysed correlation is the one between the levels of single miRNAs and the gravity of the phenotype (form of SMA): the levels of miR-181a-5p do not correlate with the condition gravity, whereas the miR- 324-5p is under-expressed in SMA I with respect to SMA II (P=0.03) and III (P=0.04). Analogously, miR-451 a is under-expressed in SMA I with respect to SMA III (P=0.03), but not to SMA II (Figure 3). Afterwards, the predictive power of the quantification of (single or combined) miRNAs in distinguishing the patients from the controls was evaluated. To this purpose, we constructed ROC curves. Most predictive miRNA is miR- 181 a-5p: by fixing the cut-off at 70.5 molecules/mI, the determination of miRNA has a diagnostic sensitivity of 75% and a specificity of 61 % (Figure 4a); the sum of the 3 miRNAs increases sensitivity and specificity: in particular, by fixing the cut-off at 380 molecules/mI, sensitivity and specificity reach 80 and 74%, respectively (Figure 4b). At last, we evaluated the potential therapeutic role of the miRNAs under examination by means of intrathecal injections in SMA murine models (mice SMNA7). Since our date show that the selected miRNAs are secreted actively by the skeletal muscle in the blood circulation, we assumed they could act as pro-apoptotic or survival signal on other tissue districts, in particular on the spinal motor neurons. With the purpose of testing this assumption, we injected each antagomir into 5 mice SMNA7 and a control antagomir- scramble into other 5. We performed one single injection of 5 nM of each antagomiR after two days of postnatal life (P2) and evaluated the survival of mice in which each antagomir was injected with respect to those in which the negative control was injected or not treated. Differently from the other two antagomirs, the treatment with antimiR- 181 a-5p induced a significant increase in the mice survival (p=0,004, figure 5 and not shown data). Anti-miR-324-5p induced a significant ponderal increase in the treated mice (not shown data). The action mechanism of antagomiRs is not known and it will be subjected to a dedicated study. The first assumption we tested is if the increase in the survival of SMA mice could be due to the possible modulation of the expression of SMN genes by miR-181a. To this purpose we transfected cells of neuroblastoma SH-SY5Y with mimic-181 a. As it appears clear from the data in figure 6, although there is a very consistent increase in the levels of miR-181 a, the levels of SMN remain substantially unchanged. Therefore, the action mechanism of miR is independent from SMN.
DISCUSSION
The inventors have identified deregulated miRNAs in SMA patients with respect to the controls. The primary objective of the study was to identify the biomarkers for the condition: 1) the modulation thereof was independent from the products of the SMN2 genes and 2) which derived from a tissue (the skeletal muscle) which has a central role in the pathogenetic mechanism of the condition. Considering the involvement of the skeletal muscle (either it is active, as retrograde signal on the spinal motor neuron, or passive, after denervation and triggering of the atrophy processes) in SMA, the rational behind the selection of this approach was to identify deregulated miRNAs on tissues deriving from patients. The deregulated miRNAs in the skeletal muscle were identified by analysis of miRNoma of muscle biopsies and they were subsequently quantified in more than 90 samples of serum of patients and controls. Out of 99 deregulated miRNAs in the skeletal muscle of the patients, only 3 could be dosed and/or deregulated in serum of the patients. It is to be noted that typical myomiRs, such as miR-1 , miR-133 and miR- 2016, over-expressed in the serum of patients affected by DMD (Cacchiarelli et ai, 2011) or miR usually released into circulation during processes of cellular death, are not deregulated in SMA sera. These data show that 1) the 3 miRNAs are secreted actively in plasma, probably in exosomal vescicles; 2) the skeletal muscle of SMA patients does not release miRNA passively, differently from other neuromuscular conditions, wherein there could be leakage of sarcolemma.
The three identified miRNAs (HSA-miR181 a-5p, HSA-miR324-5p and HSA-miR451 a) are over-expressed in the patients and allow to differentiate patients and controls with a sensitivity of 80% and a specificity of 74% (p<0.0001). HSA-miR324-5p and HSA- miR451a are also correlated with the phenotypical gravity, since they have significantly higher levels in the less serious forms of SMA.
In the assumption of a remote communication system between the skeletal muscle and the spinal motor neurons, mediated by HSA-miR181a-5p, HSA-miR324-5p and HSA- miR451a, the effect of the intrathecal injection of each antagomir into a serious murine model of SMA was evaluated. The anti-miR-181a-5p induces a significant increase in the survival of the affected mice. These data demonstrate, for the first time, that the in vivo modulation of the levels of a miRNA under a neurodegenerative condition can constitute a therapeutic approach, independently from the correction of the base genetic defect. Therefore, the modulation of HSA-miR181a-5p can be considered a therapeutic approach for SMA, in combination with other treatments, but it can be effective even in other neurodegenerative diseases such as SLA, which has several features in common with SMA. It would be further interesting to evaluate the application thereof under other neurodegenerative conditions of SNC, such as Alzheimer and Parkinson disease.
The use of methods based upon the absolute qRT-PCR for the quantification of the levels of miRNA in the serum allowed to reduce the bias of the experimental variability. Since the expression levels of miRNAs generally are very low, the relative methods insert several possible biases. This observation could explain the poor reproducibility of published data of miRNA profiling. Although up to now some deregulated miRNAs in SMA have been described, the present invention offers some advantages with respect to what is known: 1) differently from what shown in literature, the data were obtained starting from biological material of human origin (samples of skeletal muscle) and not from cellular cultures or from tissues of pre-clinical models. Moreover, the use of the skeletal muscle allowed to analyse a tissue surely involved in the pathogenetic mechanisms of SMA. The analysed samples are particularly precious and rare as deriving from muscle biopsies performed with diagnostic purpose several years ago: it has to be taken into account that, considering the bioavailability of a highly sensitive and specific genetic test, the muscle biopsy is a by now obsolete procedure in the diagnostic process of SMA, apart from being ethically not acceptable.
In the drawing of the experimental protocol, the miRNAs deregulated in the serum of the patients with respect to the controls could be identified directly. However, one preferred to identify miRNAs correlated to the physiopathology of SMA and to proceed then with the analysis biased on samples of serum of the miRNAs deregulated in the skeletal muscle. This approach, differently from the published studies not only in the field of SMA but even of other conditions, allowed to detect 3 deregulated miRNAs, but above all to give a therapeutic apart from prognostic/pathogenic meaning to the invention. The finding of greatest translational impact of the study is the definition of the therapeutic role of modulation of HSA-miR-181 a-5p. Considering few pieces of data of scientific literature available about the function of this miRNA, it is probable that it acts in pro-apoptotic way and that its inhibition could increase the neuronal survival (Moon et al. , 2013). Differently to what shown in literature, the data show that HSA-miR-181a-5p could derive from the skeletal muscle and not only be produced locally in SNC. Moreover, the co administration of anti-HSA-miR-181 a-5p could potentiate the therapeutic effect of Nusinersen or of other drugs which modulate the levels of SMN. At last, the anti-HSA- miR-181 a-5p could be useful under other neurodegenerative conditions, above all in SLA which shares several pathogenetic aspects with SMA.
DESCRIPTION OF THE SEQUENCES
SEQ ID NO 1 AACAUUCAACGCUGUCGGUGAGU HSA-miR181 a-5p micro RNA has SEQ ID NO 1 and access number miRbase MIMAT0000256;
SEQ ID NO 2 CGCAUCCCCUAGGGCAUUGGUGU HSA-miR324-5p micro RNA access number miRbase MIMAT0000761 ;
SEQ ID NO 3 AAACCG U U ACC AU U ACUG AG U U HSA-miR-451 a micro RNA has SEQ ID NO 3 and access number miRbase MIMAT0001631 ; SEQ ID NO 4 (LNA miRNA inhibitor mmu-miR-181 a-5p product sequence 5’-
C*G*A*C*A*G*C*G*T*T*G*A*A*T*G*T-3’)3’;
SEQ ID NO 5 (LNA miRNA inhibitor mmu-miR-451 a- product sequence 5’-
G*T*A*A*T*G*G*T*A*A*C*G*G*T*T -3’) ;
SEQ ID NO 6 (LNA miRNA inhibitor mmu-miR-324-5p product sequence 5’-
A*T*G*C*C*C*T*A*G*G*G*G*A*T*G*C-3’)

Claims

1. An inhibitor of miR181 micro RNA for use in the prevention and/or treatment of spinal muscular atrophy (SMA).
2. The inhibitor of HSA-miR181a-5p miR181 micro RNA for use in the prevention and/or treatment of spinal muscular atrophy (SMA), wherein said HSA-miR181a-5p microRNA has SEQ ID NO 1 and access number miRbase MIMAT0000256.
3. The inhibitor for use according to claim 1 or 2 wherein said inhibitor is selected from the group consisting of an antagomir, an antisense oligonucleotide capable of penetrating the cells, an antisense oligonucleotide having a sequence complementary to that of HSA-miR181a-5p microRNA and able to abolish its function.
4. The inhibitor for use according to claim 3 wherein said oligonucleotide is a chemically modified oligonucleotide.
5. The inhibitor for use according to claim 4 wherein said oligonucleotide comprises one or more chemical modifications selected in the group: one or more modified nucleotide bonds, one or more modified or substituted pentose sugar molecules, one or more modified nitrogenous bases, bond to a carrier molecule.
6. The inhibitor for use according to any one of claims 1 to 5, wherein said inhibitor comprises or consists of a nucleotide sequence selected in the SEQ group ID NO: 4, SEQ ID NO:5 and/or SEQ ID NO:6.
7. The inhibitor for use according to any one of claims 1 to 6 in association with the Nusinersen medicament.
8. The inhibitor for use according to any one of claims 1 to 7 in association with an inhibitor of HSA-miR324-5p microRNA and/or of HSA-miR451 a microRNA, wherein said HSA-miR324-5p microRNA has SEQ ID NO 2 and access number miRbase MIMAT0000761 and said HSA-miR-451 a microRNA has SEQ ID NO 3 and access number miRbase MIMAT0001631.
9. The inhibitor for use according to any one of claims 1 to 8 wherein said SMA is of type I, II or III.
10. A pharmaceutical composition comprising as pharmacologically active agent an inhibitor of HSA-miR181a-5p microRNA according to anyone of claims 1 to 9 and at least a pharmaceutically acceptable carrier.
1 1. The pharmaceutical composition according to claim 10 further comprising one or more of the following pharmacologically active agents: Nusinersen, HSA-miR324-5p microRNA inhibitor, HSA-miR451a microRNA inhibitor.
12. The pharmaceutical composition according to claim 10 or 11 for use in the prevention and/or treatment of spinal muscular atrophy (SMA).
13. The pharmaceutical composition for use according to claim 12 by intrathecal administration.
14. The pharmaceutical composition for use according to any one of claims 10 to 13 wherein said inhibitor comprises or consists of a nucleotide sequence selected in the SEQ group ID NO:4, SEQ ID NO: 5 and/or SEQ ID NO:6.
15. A kit for the simultaneous, separate or sequential administration of an inhibitor of HSA-miR181 a-5p microRNA according to anyone of claims 1 to 9 and one or more of the following compounds Nusinersen, HSA-miR324-5p microRNA inhibitor, HSA- miR451a microRNA inhibitor, in particular for use in the prevention and/or treatment of spinal muscular atrophy (SMA).
16. An in vitro method for evaluating the prognosis of patients affected by spinal muscular atrophy (SMA) in a subject, comprising:
a. determining the level of HSA-miR181a-5p, HSA-miR324-5p and/or HSA-miR451a microRNAs in a biological sample of said subject;
b. comparing the level of said microRNAs in the sample of said subject with the control levels, and optionally
c. (i) identifying the subject as affected by the spinal muscular atrophy when the microRNA level in the subject sample is greater than the control or (ii) identifying the subject as not affected by spinal muscular atrophy when the microRNA level in the subject sample has not increased compared to the control.
17. An in vitro method for monitoring the development of spinal muscular atrophy in a subject, comprising:
a. determining the level of HSA-miR181a-5p, HSA-miR324-5p and/or HSA-miR451a microRNAs in two or more biological samples of said subject, wherein the samples were obtained at spaced time points, and
b. comparing the microRNA levels between the biological samples obtained previously and those obtained subsequently.
18. An in vitro method for monitoring the effectiveness of a treatment of spinal muscular atrophy in a subject, comprising:
a. determining the level of HSA-miR181a-5p, HSA-miR324-5p and/or HSA-miR451a microRNAs in a biological sample of said subject obtained before the start of treatment; b. determining the level of HSA-miR181a-5p, HSA-miR324-5p and/or HSA-miR451a microRNAs in one or more biological samples said subject obtained during or after treatment, and
c. comparing the level of HSA-miR181a-5p, HSA-miR324-5p and/or HSA-miR451a microRNAs determined in steps (a) e (b), and optionally between different samples in step (b).
19. The method according to claim 18, further comprising a step (d) (i) wherein the treatment determination is effective if the level of microRNAs decreased during or after treatment or (ii) the treatment determination is not effective if the level of microRNAs did not decrease during or after treatment.
20. The method according to anyone of claims 16 to 19 wherein the biological sample of said subject is selected from serum, plasma, urine, saliva, muscle biopsy, cephalic- rachidian liquid.
21. The method according to claim 16 wherein the control level is determined in a biological sample obtained from a patient not affected by spinal muscular atrophy or is a predetermined standard.
22. The method according to anyone of claims 16 to 21 wherein the levels of HSA- miR181a-5p, HSA-miR324-5p and HSA-miR451a micro RNAs are determined in said biological sample, in particular wherein said levels are determined individually and/or added up.
23. The method according to anyone of claims 16 to 22 wherein the microRNA level is determined by using a method selected from the group consisting of hybridization, RT- PCR and sequencing.
24. The method according to anyone of claims 16 to 23 wherein before the step (a), microRNA is purified from the biological sample.
25. A use of a kit for the prognosis of a spinal muscular atrophy in a subject comprising reagents for the determination of HSA-miR324-5p microRNA levels in a biological sample and optionally one or more control samples.
26. Kit for the prognosis of a spinal muscular atrophy in a subject comprising reagents for the determination of the levels of HSA-miR324-5p RNA, HSA-miR324-5p and/or of HSA-miR451a microRNAs in a biological sample and optionally one or more control samples.
EP19722955.2A 2018-04-10 2019-04-05 Identification of muscular mirnas as molecular biomarkers and co-adjuvant for the treatment of spinal muscular atrophy Pending EP3775212A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
IT102018000004359A IT201800004359A1 (en) 2018-04-10 2018-04-10 IDENTIFICATION OF MUSCLE miRNAs AS BIOMARCATORS AND CO-ADJUVANT TREATMENT FOR SPINAL MUSCULAR ATROPHY
PCT/IB2019/052820 WO2019197954A1 (en) 2018-04-10 2019-04-05 IDENTIFICATION OF MUSCULAR miRNAS AS MOLECULAR BIOMARKERS AND CO-ADJUVANT FOR THE TREATMENT OF SPINAL MUSCULAR ATROPHY

Publications (1)

Publication Number Publication Date
EP3775212A1 true EP3775212A1 (en) 2021-02-17

Family

ID=62875111

Family Applications (1)

Application Number Title Priority Date Filing Date
EP19722955.2A Pending EP3775212A1 (en) 2018-04-10 2019-04-05 Identification of muscular mirnas as molecular biomarkers and co-adjuvant for the treatment of spinal muscular atrophy

Country Status (3)

Country Link
EP (1) EP3775212A1 (en)
IT (1) IT201800004359A1 (en)
WO (1) WO2019197954A1 (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
PT3999643T (en) 2019-07-19 2023-12-11 Biogen Ma Inc Methods of treating or preventing spinal muscular atrophy
CN116656781B (en) * 2023-07-07 2024-04-26 中国药科大学 Fluorescent probe for detecting antisense oligonucleotide drug and detection method

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9458458B2 (en) * 2013-11-11 2016-10-04 Emory University Manipulating microRNA for the management of neurological diseases or conditions and compositions related thereto

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9458458B2 (en) * 2013-11-11 2016-10-04 Emory University Manipulating microRNA for the management of neurological diseases or conditions and compositions related thereto

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
LIU ZHEN-RU ET AL: "Over-expression of miR-451a can enhance the sensitivity of breast cancer cells to tamoxifen by regulating 14-3-3[zeta], estrogen receptor [alpha], and autophagy", LIFE SCIENCE, PERGAMON PRESS, OXFORD, GB, vol. 149, 17 February 2016 (2016-02-17), pages 104 - 113, XP029445192, ISSN: 0024-3205, DOI: 10.1016/J.LFS.2016.02.059 *
See also references of WO2019197954A1 *

Also Published As

Publication number Publication date
WO2019197954A1 (en) 2019-10-17
IT201800004359A1 (en) 2019-10-10

Similar Documents

Publication Publication Date Title
US12077803B2 (en) MicroRNAs as biomarkers for endometriosis
JP6021893B2 (en) Methods of using miRNA from body fluids for early detection and monitoring of mild cognitive impairment (MCI) and Alzheimer&#39;s disease (AD)
EP2733219B1 (en) Diagnostic miRNA markers for Alzheimer
CN111961725B (en) Kit or device for detecting pancreatic cancer and detection method
US20110160285A1 (en) Identification of mirna profiles that are diagnostic of hypertrophic cardiomyopathy
EP3122905B1 (en) Circulating micrornas as biomarkers for endometriosis
WO2016186987A1 (en) Biomarker micrornas and method for determining tumor burden
WO2014114802A1 (en) Non-invasive prenatal genetic diagnostic methods
JP2010510769A (en) Methods and compositions for diagnosis of esophageal cancer and prognosis and improvement of patient survival
CN102884206B (en) Means and methods for determining risk of cardiovascular disease
EP3775212A1 (en) Identification of muscular mirnas as molecular biomarkers and co-adjuvant for the treatment of spinal muscular atrophy
US20170240958A1 (en) Biomarker of mycobacteriosis or mycobacterial infection
US20230220483A1 (en) Biomarkers for predicting a patient&#39;s response to bcg therapy, methods and uses based thereon
CN114107461A (en) Circular RNA marker and application thereof in diagnosis and prediction of recurrent abortion pathological pregnancy
Popov et al. Comparative Expression Analysis of mi R‒619‒5 p in Serum and PBMC s as a Promising Candidate Biomarker for Autism Spectrum Disorder
KR20240113002A (en) Markers for diagnosing inflammatory genital diseases in dogs
KR20240150715A (en) miR-6880-5p in cancer cell derived exosomes as biomarker for prostate cancer diagnosis
WO2020234072A1 (en) Pcos diagnosis
HK40049419A (en) Circulating micrornas as biomarkers for endometriosis
HK40011172A (en) Micrornas as biomarkers for endometriosis
HK40011172B (en) Micrornas as biomarkers for endometriosis

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: UNKNOWN

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20201103

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

AX Request for extension of the european patent

Extension state: BA ME

DAV Request for validation of the european patent (deleted)
DAX Request for extension of the european patent (deleted)
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: EXAMINATION IS IN PROGRESS

17Q First examination report despatched

Effective date: 20240729