EP3555268A1 - Methods for producing fatty alcohols and derivatives thereof in yeast - Google Patents
Methods for producing fatty alcohols and derivatives thereof in yeastInfo
- Publication number
- EP3555268A1 EP3555268A1 EP17825464.5A EP17825464A EP3555268A1 EP 3555268 A1 EP3555268 A1 EP 3555268A1 EP 17825464 A EP17825464 A EP 17825464A EP 3555268 A1 EP3555268 A1 EP 3555268A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- homology
- seq
- desaturase
- pex10
- far
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
- C12N15/815—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts for yeasts other than Saccharomyces
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/52—Genes encoding for enzymes or proenzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0008—Oxidoreductases (1.) acting on the aldehyde or oxo group of donors (1.2)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0071—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
- C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y114/00—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14)
- C12Y114/19—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14) with oxidation of a pair of donors resulting in the reduction of molecular oxygen to two molecules of water (1.14.19)
- C12Y114/19001—Stearoyl-CoA 9-desaturase (1.14.19.1), i.e. DELTA9-desaturase
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P20/00—Technologies relating to chemical industry
- Y02P20/50—Improvements relating to the production of bulk chemicals
- Y02P20/582—Recycling of unreacted starting or intermediate materials
Definitions
- the present invention relates to oleaginous yeast cells for the production of fatty alcohols and derivatives thereof, in particular desaturated fatty alcohols, desaturated fatty acyl acetates and desaturated fatty aldehydes. Also provided are methods for obtaining such compounds, which are useful in pheromone compositions.
- Fatty alcohols are a group of chemicals with broad applications. Fatty alcohols are usually straight primary alcohols that vary in chain length (C 6 -C 26 ) and can bear saturated or unsaturated carbon bonds. Depending on the above mentioned
- fatty alcohols can be used as fuel, detergents and surfactants, cosmetics, insect pest management and many more. Since the advent of DDT more than 50 years ago, broad-spectrum neurotoxic insecticides have provided the principal means for the control of economically important insects in agriculture and public health programs. Whereas the use of synthetic insecticides initially resulted in spectacular increases in crop yields and the suppression of some important human and animal disease vectors, the development of insecticide resistance in insect pest populations and the environmental damage caused by insecticides have become widely recognised as serious drawbacks to their use.
- insecticides are 1 ) their direct toxicity to non-target organisms (including humans); 2) their persistence in the biosphere where they can accumulate and cause untoward developmental and reproductive effects in higher organisms; 3) significant point-source pollution associated with their manufacture and distribution; 4) their worldwide dispersal.
- Pheromones can be used as pest control instead of pesticides.
- (Z)19-14:OAc for example has been found to disrupt mating efficiency of fall armyworm with 86% efficiency when applied alone, i.e. without other pheromone components.
- the commercial use of pheromones to control insect pests by mating disruption has several advantages over conventional insecticides.
- Pheromones are: 1 ) non-toxic and environmentally benign; 2) specific to one target species and do not adversely affect non-target beneficial insects, making them extremely well suited for use in integrated pest management programs; and 3) much less likely (and have never been shown) to produce resistance in the target insect.
- current approaches for the commercial production of pheromones employ traditional synthetic chemical routes.
- pheromones require very high purity to elicit an insect's response, these syntheses are expensive and difficult, and generate large amounts of organic wastes that require treatment. Thus the major hurdle standing in the way of using sex pheromones remains the production cost. As a result, a very small part of global agricultural land employs pheromones (estimated to less than 0.05%). Pheromone production from a cell factory is expected to significantly lower the production costs of pheromones. Fatty alcohols are usually produced chemically based on petrochemical or natural feedstocks. Some approaches have been made to produce fatty alcohols in microorganisms such as Escherichia coli and yeast using renewable feedstock such as e.g. glucose.
- oleaginous yeast which are specialised in accumulating and consuming lipid-derived compounds.
- oleaginous yeast most advanced research has been conducted on the yeast Yarrowia lipolytica.
- Fatty alcohols can be produced in microorganisms by the heterologous expression of the enzyme fatty acyl reductase which reduces the natively produced fatty acyl-CoA esters to fatty alcohols.
- fatty acyl-CoA esters are used for membrane lipid production or stored in lipid bodies. Some microorganisms are able to degrade fatty alcohols.
- Y. lipolytica degrades fatty acid derived chemicals via beta- oxidation, which takes place in the peroxisomes, or via omega-oxidation pathway, occurring at the endoplasmic reticulum.
- the present disclosure provides methods and host strains which increase fatty alcohol production by decreasing the activity of competing lipid biosynthesis pathway and by decreasing fatty alcohol degradation. These methods and host strains are particularly suitable for production of desaturated fatty alcohols and their derivatives (e.g., fatty acyl acetates), such as Lepidoptera pheromones.
- Fatty acyl-CoA esters with different carbon chain length are synthesised by the fatty acyl-CoA synthetase complex (FAS1 and 2) from acetyl-CoA and malonyl-CoA and serve as substrates for storage and membrane lipids.
- the initial reaction towards lipids is the transfer of fatty acyl-CoAs to glycerol-3-phosphate, catalyzed by glycerol-3- phosphate 1 -O-acyltransferase (GPAT) and resulting in formation of lysophosphatidic acid.
- GPAT glycerol-3-phosphate 1 -O-acyltransferase
- the overexpression of GPAT in Y. lipolytica has been shown to increase lipid accumulation.
- the oleaginous yeast Y. lipolytica is known to be able to utilize hydrophobic
- Fatty alcohols are thought to be oxidised into fatty aldehydes by fatty alcohol dehydrogenases present in both ER and peroxisomes and fatty alcohol oxidases (FAO) present in peroxisomes.
- Fatty alcohol dehydrogenases present in both ER and peroxisomes
- FEO fatty alcohol oxidases
- the fatty aldehydes are further oxidised to fatty acids by fatty aldehyde
- HFD dehydrogenases
- Y. lipolytica's Adhl p, Adh3p and Faol p have been suggested to play a role in degradation of exogenous fatty alcohols, while fatty alcohols resulting from alkane degradation have been suggested to be oxidised by Adh1 p-Adh7p, Fadhp and Faol p (Iwama, 2015).
- Y. lipolytica encodes four fatty aldehyde dehydrogenases, Hfd1 p to Hfd4p, which have been shown to be essential for growth on n-alkanes
- the PEX70 gene encodes peroxisome biogenesis factor Peroxin 10. Deletion of PEX10 in Y. lipolytica results in the absence of peroxisomes and in defect in n-decane assimilation (Sumita et al, 2002).
- the present invention describes the downregulation of GPAT, Hfd1 , Hfd4, Fao1 and/or Pex10 expression as a strategy to redirect the flux of fatty acyl-CoA ester precursors from storage and membrane lipid synthesis to fatty alcohol production.
- an oleaginous yeast cell capable of producing a desaturated fatty alcohol, said cell:
- Hfd1 SEQ ID NO: 4
- Hfd4 SEQ ID NO: 6
- Pex10 SEQ ID NO: 8
- Fao1 SEQ ID NO: 22
- GPAT SEQ ID NO: 10
- at least 65% homology such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology
- Also provided is a method of producing a fatty alcohol in an oleaginous yeast cell comprising the steps of providing a yeast cell and incubating said yeast cell in a medium, wherein the yeast cell:
- ii) expresses at least one heterologous fatty acyl-CoA reductase, capable of converting at least part of said desaturated fatty acyl-CoA to a desaturated fatty alcohol, thereby producing said desaturated fatty alcohol; and iii) has reduced activity of at least one of Hfd1 (SEQ ID NO: 4), Hfd4 (SEQ ID NO: 6), Pex10 (SEQ ID NO: 8), Fao1 (SEQ ID NO: 22) and GPAT (SEQ ID NO: 10) or reduced activity of at least one protein having at least 60% homology to one of Hfd1 (SEQ ID NO: 4), Hfd4 (SEQ ID NO: 6), Pex10 (SEQ ID NO: 8), Fao1 (SEQ ID NO: 22) and GPAT (SEQ ID NO: 10), such as at least 65% homology, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least
- nucleic acid construct for modifying a yeast cell comprising:
- fatty acyl-CoA capable of introducing at least one double bond in a fatty acyl-CoA; and ii) a second polynucleotide encoding at least one heterologous fatty acyl-CoA reductase (FAR), capable of converting at least part of said desaturated fatty acyl-CoA to a desaturated fatty alcohol; and
- FAR heterologous fatty acyl-CoA reductase
- kits of parts comprising:
- yeast cell as defined herein and instructions for use; and/or b) a nucleic acid construct as defined herein, wherein said construct is for modifying a yeast cell, and
- yeast cell optionally the yeast cell to be modified.
- a desaturated fatty alcohol a desaturated fatty acyl acetate or a desaturated fatty aldehyde obtainable by the methods disclosed herein.
- Figure 1 pathway towards Z9-C14:OAc.
- ⁇ 9 FAD - Z9-fatty acyl desaturase
- FAR - fatty acyl-CoA reductase AcT - acetyl-CoA transferase.
- Figure 2 map of BB1963 (LEU2 selection marker cassette).
- Leu2 term. Leu2 terminator.
- Figure 3 map of BB1360 (pex70 and Iip2 terminator).
- ECS Easy Cloning Site.
- pex10 term. pex10 terminator.
- Figure 4 map of expression cassette of Dmd9 and HarFAR.
- pex20 term pex20 terminator.
- Tefl prom. Tefintron promoter.
- Figure 5 expression cassette of Atf 1 .
- Atf 1 YL codon opt Atf 1 codon optimised for Yarrowia lipolytica
- Figure 6 production of fatty alcohols in various Y. lipolytica strains; beyond the genotype indicated on the X axis, the strains also all express the Amyelois transitella ⁇ 1 1 desaturase and the Heliothis subflexa reductase (Hs_FAR). Sat.: saturated fatty alcohols (15:0 ⁇ and 16:01-1). Desat.: desaturated fatty alcohols ((Z)9-16:OH and (Z)1 1 - 16:01-1). Detailed description of the invention
- Biopesticide the term 'biopesticide' is a contraction of 'biological pesticide' and refers to several types of pest management intervention: through predatory, parasitic, or chemical relationships.
- biopesticides have been defined as "a form of pesticide based on micro-organisms or natural products".
- they are defined by the EPA as "including naturally occurring substances that control pests (biochemical pesticides), microorganisms that control pests (microbial pesticides), and pesticidal substances produced by plants containing added genetic material (plant-incorporated protectants) or PIPs".
- the present disclosure relates more particularly to biopesticides comprising natural products or naturally occurring substances.
- Fatty acid refers to a carboxylic acid having a long aliphatic chain, i.e. an aliphatic chain between 4 and 28 carbon atoms, such as 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27 or 28 carbon atoms. Most naturally occurring fatty acids are unbranched. They can be saturated, or desaturated.
- Fatty acyl acetate the term will herein be used interchangeably with "fatty acetate” and refers to an acetate having a fatty carbon chain, i.e. an aliphatic chain between 4 and 28 carbon atoms, such as 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27 or 28 carbon atoms. Fatty acyl acetates can be saturated or desaturated.
- Fatty acyl-CoA the term will herein be used interchangeably with "fatty acyl-CoA ester”, and refers to compounds of general formula R-CO-SCoA, where R is a fatty carbon chain.
- Fatty acyl-CoAs can be saturated or desaturated, depending on whether the fatty acid which it is derived from is saturated or desaturated.
- Fatty alcohol refers herein to an alcohol derived from a fatty acyl-CoA, having a carbon chain length of 4 to 28 carbon atoms, such as 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27 or 28 carbon atoms. Fatty alcohols can be saturated or desaturated.
- Fatty aldehyde refers herein to an aldehyde derived from a fatty acyl-CoA, having a carbon chain length of 4 to 28 carbon atoms, such as 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27 or 28 carbon atoms.
- Fatty aldehydes can be saturated or desaturated.
- Heterologous when referring to a polypeptide, such as a protein or an enzyme, or to a polynucleotide, shall herein be construed to refer to a polypeptide or a polynucleotide which is not naturally present in a wild type cell.
- heterologous ⁇ 9 desaturase when applied to Yarrowia lipolytica refers to a ⁇ 9 desaturase which is not naturally present in a wild type Y. lipolytica cell, e.g. a ⁇ 9 desaturase derived from Drosophila melanogaster.
- Native when referring to a polypeptide, such as a protein or an enzyme, or to a polynucleotide, shall herein be construed to refer to a polypeptide or a polynucleotide which is naturally present in a wild type cell.
- Pest as used herein, the term 'pest' shall refer to an organism, in particular an animal, detrimental to humans or human concerns, in particular in the context of agriculture or livestock production.
- a pest is any living organism which is invasive or prolific, detrimental, troublesome, noxious, destructive, a nuisance to either plants or animals, human or human concerns, livestock, human structures, wild ecosystems etc. The term often overlaps with the related terms vermin, weed, plant and animal parasites and pathogens. It is possible for an organism to be a pest in one setting but beneficial, domesticated or acceptable in another.
- Pheromones are naturally occurring compounds designated by an unbranched aliphatic chain (between 9 and 18 carbons) ending in an alcohol, aldehyde or acetate functional group and containing up to 3 double bonds in the aliphatic backbone.
- Pheromone compositions may be produced chemically or biochemically, for example as described herein.
- Pheromones may thus comprise desaturated fatty alcohols, fatty aldehydes or fatty acyl acetates, such as can be obtained by the methods and cells described herein.
- Reduced activity may herein refer to a total or a partial loss of activity of a given peptide, such as a protein or an enzyme.
- peptides are encoded by essential genes, which cannot be deleted. In these cases, activity of the peptide can be reduced by methods known in the art, such as down-regulation of transcription or translation, or inhibition of the peptide. In other cases, the peptide is encoded by a non-essential gene, and the activity may be reduced or it may be completely lost, e.g. as a consequence of a deletion of the gene encoding the peptide.
- Saturated refers to a compound which is devoid of double or triple carbon-carbon bonds.
- the present disclosure relates to an oleaginous yeast cell useful for the production of Lepidoptera pheromones.
- the inventors have found that down-regulation of one or more of HFD1, HFD4, PEX10, FA01 and GPAT in an oleaginous yeast cell, in particular in a Y. lipolytica cell, combined with heterologous expression of at least one heterologous desaturase and at least one heterologous fatty acyl-CoA reductase, results in the production of desaturated fatty alcohols useful for example for formulating pheromone compositions for pest management.
- the cell may be further engineered to also allow production of fatty alcohol derivatives such as aldehydes and acetates, in particular desaturated fatty alcohol derivatives such as desaturated aldehydes and desaturated acetates, which are also useful for such pheromone compositions.
- fatty alcohol derivatives such as aldehydes and acetates
- desaturated fatty alcohol derivatives such as desaturated aldehydes and desaturated acetates
- an oleaginous yeast cell which is capable of producing a desaturated fatty alcohol, said cell:
- Hfd1 SEQ ID NO: 4
- Hfd4 SEQ ID NO: 6
- Pex10 SEQ ID NO: 8
- Fao1 SEQ ID NO: 22
- GPAT SEQ ID NO: 10
- at least 65% homology such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least
- Also provided is a method of producing a fatty alcohol in an oleaginous yeast cell comprising the steps of providing a yeast cell and incubating said yeast cell in a medium, wherein the yeast cell:
- ii) expresses at least one heterologous fatty acyl-CoA reductase, capable of converting at least part of said desaturated fatty acyl-CoA to a desaturated fatty alcohol, thereby producing said desaturated fatty alcohol; and iii) has reduced activity of at least one of Hfd1 (SEQ ID NO: 4), Hfd4 (SEQ ID NO: 6), Pex10 (SEQ ID NO: 8), Fao1 (SEQ ID NO: 22) and GPAT (SEQ ID NO: 10) or reduced activity of at least one protein having at least 60% homology to one of Hfd1 (SEQ ID NO: 4), Hfd4 (SEQ ID NO: 6), Pex10 (SEQ ID NO: 8), Fao1 (SEQ ID NO: 22) and GPAT (SEQ ID NO: 10), such as at least 65% homology, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least
- the method the steps of providing a yeast cell and incubating said yeast cell in a medium, wherein the yeast cell:
- ii) expresses at least one heterologous fatty acyl-CoA reductase, capable of converting at least part of said desaturated fatty acyl-CoA to a desaturated fatty alcohol;
- iii) has a mutation resulting in reduced activity of Pex10 (SEQ ID NO: 8) and a mutation resulting in reduced activity of at least one of Hfd1 (SEQ ID NO: 4), Hfd4 (SEQ ID NO: 6), Fao1 (SEQ ID NO: 22) and GPAT (SEQ ID NO: 10) or having a mutation resulting in reduced activity of at least one protein having at least 60% homology to Pex10 (SEQ ID NO: 8) and a mutation resulting in reduced activity of at least one of Hfd1 (SEQ ID NO: 4), Hfd4 (SEQ ID NO: 6), Fao1 (SEQ ID NO: 22) and GPAT (SEQ ID NO: 10), such as at least 65% homology, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology,
- nucleic acid construct for modifying a yeast cell comprising:
- fatty acyl-CoA capable of introducing at least one double bond in a fatty acyl-CoA; and ii) a second polynucleotide encoding at least one heterologous fatty acyl-CoA reductase (FAR), capable of converting at least part of said desaturated fatty acyl-CoA to a desaturated fatty alcohol; and
- FAR heterologous fatty acyl-CoA reductase
- Hfd1 SEQ ID NO: 4
- Hfd4 SEQ ID NO: 6
- Pex10 SEQ ID NO: 8
- SEQ ID NO: 22 and GPAT (SEQ ID NO: 10) or of at least one protein having at least 60% homology to one of Hfd1 (SEQ ID NO: 4), Hfd4 (SEQ ID NO: 6), Pex10 (SEQ ID NO: 8), Fao1 (SEQ ID NO: 22) and GPAT (SEQ ID NO: 10),
- first polynucleotide and/or the second polynucleotide and/or the additional polynucleotides are under the control of a promoter.
- kits of parts comprising a yeast cell as described herein and instructions for use; and/or a nucleic acid construct as described herein, wherein said construct is for modifying a yeast cell, and optionally a yeast cell to be modified.
- a desaturated fatty alcohol, a desaturated fatty acyl acetate or a desaturated fatty aldehyde obtainable by the methods described herein. Also provided is the use of a desaturated fatty alcohol, a desaturated fatty acyl acetate or a desaturated fatty aldehyde obtainable by the present methods.
- the terms 'fatty acyl-CoA desaturase', 'desaturase', 'fatty acyl desaturase' and 'FAD' will be used interchangeably.
- the term refers to an enzyme capable of introducing at least one double bond in E/Z confirmations in an acyl-CoA having a chain length of 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 carbon atoms.
- the double bond may be introduced in any position.
- a desaturase introducing a double bond in position 3 is termed ⁇ 3 desaturase.
- a desaturase introducing a double bond in position 5 is termed ⁇ 5 desaturase.
- a desaturase introducing a double bond in position 6 is termed ⁇ 6 desaturase.
- a desaturase introducing a double bond in position 7 is termed ⁇ 7 desaturase.
- a desaturase introducing a double bond in position 8 is termed ⁇ 8 desaturase.
- a desaturase introducing a double bond in position 9 is termed ⁇ 9 desaturase.
- a desaturase introducing a double bond in position 10 is termed ⁇ 10 desaturase.
- a desaturase introducing a double bond in position 1 1 is termed ⁇ 1 1 desaturase.
- a desaturase introducing a double bond in position 12 is termed ⁇ 12 desaturase.
- a desaturase introducing a double bond in position 13 is termed ⁇ 13 desaturase.
- a desaturase introducing a double bond in position 14 is termed ⁇ 14 desaturase.
- a desaturase introducing a double bond in position 15 is termed ⁇ 15 desaturase.
- a desaturase introducing a double bond in position 16 is termed ⁇ 16 desaturase.
- a desaturase introducing a double bond in position 17 is termed ⁇ 17 desaturase.
- a desaturase introducing a double bond in position 18 is termed ⁇ 18 desaturase.
- a desaturase introducing a double bond in position 19 is termed ⁇ 19 desaturase.
- a desaturase introducing a double bond in position 20 is termed ⁇ 20 desaturase.
- Reductases reduce acyl-CoAs into alcohols of the corresponding chain length.
- the cell is capable of expressing at least one heterologous ⁇ 5 desaturase. In another embodiment, the cell is capable of expressing at least one heterologous ⁇ 6 desaturase. In another embodiment, the cell is capable of expressing at least one heterologous ⁇ 7 desaturase. In another embodiment, the cell is capable of expressing at least one heterologous ⁇ 8 desaturase. In another embodiment, the cell is capable of expressing at least one heterologous ⁇ 9 desaturase. In another
- the cell is capable of expressing at least one heterologous ⁇ 10 desaturase. In another embodiment, the cell is capable of expressing at least one heterologous ⁇ 1 1 desaturase. In another embodiment, the cell is capable of expressing at least one heterologous ⁇ 12 desaturase. In another embodiment, the cell is capable of expressing at least one heterologous ⁇ 13 desaturase. In another embodiment, the cell is capable of expressing at least one heterologous ⁇ 14 desaturase. In another embodiment, the cell is capable of expressing at least one heterologous ⁇ 15 desaturase. In another embodiment, the cell is capable of expressing at least one heterologous ⁇ 16 desaturase.
- the cell is capable of expressing at least one heterologous ⁇ 17 desaturase. In another embodiment, the cell is capable of expressing at least one heterologous ⁇ 18 desaturase. In another embodiment, the cell is capable of expressing at least one heterologous ⁇ 19 desaturase. In another embodiment, the cell is capable of expressing at least one heterologous ⁇ 20 desaturase.
- the skilled person will know, depending on which desaturated fatty alcohol is desired, which kind of desaturase to use.
- a ⁇ 1 1 desaturase having at least 60% homology to the ⁇ 1 1 desaturase from Amyelois transitella as set forth in SEQ ID NO: 2 a ⁇ 1 1 desaturase having at least 60% homology to the ⁇ 1 1 desaturase from Choristoneura rosaceana as set forth in SEQ ID NO: 19 or a ⁇ 1 1 desaturase having at least 60% homology to the ⁇ 1 1 desaturase from Choristoneura parallela as set forth in SEQ ID NO: 20 may be used.
- a ⁇ 9 desaturase having at least 60% homology to the ⁇ 9 desaturase from Drosophila melanogaster as set forth in SEQ ID NO: 18 may be used.
- the gene encoding the heterologous desaturase may be codon-optimised for any purpose for the given host cell, e.g. Yarrowia lipolytica, as is known in the art.
- the nucleic acid encoding the heterologous desaturase is as set forth in SEQ ID NO: 63 or a homologue thereof having at least 60% homology thereto, , such as at least 61 % homology, such as at least 62% homology, such as at least 63% homology, such as at least 64% homology, such as at least 65% homology, such as at least 66% homology, such as at least 67% homology, such as at least 68% homology, such as at least 69% homology, such as at least 70% homology, such as at least 71 % homology, such as at least 72%, such as at least 73%, such as at least 74%, such as at least 75%, such as at least 76%, such as at least 77%, such as at least 78%, such as at least 79%, such as at least 80%, such as at least 81 %, such as at least 82%, such as at least 83%, such as at least 84%, such as at least 85%, such as at least
- the at least one heterologous desaturase is a ⁇ 1 1 desaturase having at least 60% homology to the ⁇ 1 1 desaturase from Amyelois transitella as set forth in SEQ ID NO: 2, such as at least 61 % homology, such as at least 62% homology, such as at least 63% homology, such as at least 64% homology, such as at least 65% homology, such as at least 66% homology, such as at least 67% homology, such as at least 68% homology, such as at least 69% homology, such as at least 70% homology, such as at least 71 % homology, such as at least 72%, such as at least 73%, such as at least 74%, such as at least 75%, such as at least 76%, such as at least 77%, such as at least 78%, such as at least 79%, such as at least 80%, such as at least 81 %, such as at least 82%, such as at least 83%, such as at least 84%
- the at least one heterologous desaturase is encoded by a nucleic acid having at least 60% homology to the nucleic acid encoding the ⁇ 1 1 desaturase from Amyelois transitella as set forth in SEQ ID NO: 1 , such as at least 61 % homology, such as at least 62% homology, such as at least 63% homology, such as at least 64% homology, such as at least 65% homology, such as at least 66% homology, such as at least 67% homology, such as at least 68% homology, such as at least 69% homology, such as at least 70% homology, such as at least 71 % homology, such as at least 72%, such as at least 73%, such as at least 74%, such as at least 75%, such as at least 76%, such as at least 77%, such as at least 78%, such as at least 79%, such as at least 80%, such as at least 81 %, such as at least 82%, such as at least 83%,
- the at least one heterologous desaturase is encoded by a nucleic acid having at least 60% homology to the nucleic acid encoding the ⁇ 1 1 desaturase from Amyelois transitella as set forth in SEQ ID NO: 64, such as at least 61 % homology, such as at least 62% homology, such as at least 63% homology, such as at least 64% homology, such as at least 65% homology, such as at least 66% homology, such as at least 67% homology, such as at least 68% homology, such as at least 69% homology, such as at least 70% homology, such as at least 71 % homology, such as at least 72%, such as at least 73%, such as at least 74%, such as at least 75%, such as at least 76%, such as at least 77%, such as at least 78%, such as at least 79%, such as at least 80%, such as at least 81 %, such as at least 82%, such as at least 83%, such
- the at least one heterologous desaturase is a ⁇ 9 desaturase having at least 60% homology to the ⁇ 9 desaturase having at least 60% homology to the ⁇ 9 desaturase from Drosophila melanogaster as set forth in SEQ ID NO: 18, such as at least 61 % homology, such as at least 62% homology, such as at least 63% homology, such as at least 64% homology, such as at least 65% homology, such as at least 66% homology, such as at least 67% homology, such as at least 68% homology, such as at least 69% homology, such as at least 70% homology, such as at least 71 % homology, such as at least 72%, such as at least 73%, such as at least 74%, such as at least 75%, such as at least 76%, such as at least 77%, such as at least 78%, such as at least 79%, such as at least 80%, such as at least 81 %, such as at least 82%,
- the at least one heterologous desaturase is encoded by a nucleic acid having at least 60% homology to the nucleic acid encoding the ⁇ 9 desaturase from Drosophila melanogaster as set forth in SEQ ID NO: 17, such as at least 61 % homology, such as at least 62% homology, such as at least 63% homology, such as at least 64% homology, such as at least 65% homology, such as at least 66% homology, such as at least 67% homology, such as at least 68% homology, such as at least 69% homology, such as at least 70% homology, such as at least 71 % homology, such as at least 72%, such as at least 73%, such as at least 74%, such as at least 75%, such as at least 76%, such as at least 77%, such as at least 78%, such as at least 79%, such as at least 80%, such as at least 81 %, such as at least 82%, such as at least 83%,
- the at least one heterologous desaturase is encoded by a nucleic acid having at least 60% homology to the nucleic acid encoding the ⁇ 9 desaturase from Drosophila melanogaster as set forth in SEQ ID NO: 63, such as at least 61 % homology, such as at least 62% homology, such as at least 63% homology, such as at least 64% homology, such as at least 65% homology, such as at least 66% homology, such as at least 67% homology, such as at least 68% homology, such as at least 69% homology, such as at least 70% homology, such as at least 71 % homology, such as at least 72%, such as at least 73%, such as at least 74%, such as at least 75%, such as at least 76%, such as at least 77%, such as at least 78%, such as at least 79%, such as at least 80%, such as at least 81 %, such as at least 82%, such as at least 8
- the heterologous desaturase may preferably be derived from an insect, for example from the order of Lepidoptera.
- the heterologous desaturase is derived from Amyelois transitella.
- the heterologous desaturase is derived from Helicoverpa assulta.
- the heterologous desaturase is derived from Helicoverpa armigera.
- the heterologous desaturase is derived from Choristoneura rosaceana.
- the heterologous desaturase is derived from Choristoneura parallela.
- a heterologous desaturase may be expressed from a nucleic acid introduced in the cell, e.g. on a vector such as a plasmid, or by genomic integration.
- the nucleic acid may be codon-optimised for any purpose as is known in the art for the specific yeast cell used.
- the yeast cell to be modified may express a native desaturase, which may have a negative impact on the production of desaturated fatty alcohol and/or desaturated fatty acyl acetate. Accordingly, if the yeast cell to be modified expresses such a native desaturase, the cell may be modified so that activity of the native desaturase is reduced or absent.
- the gene encoding the native desaturase may be deleted or partly deleted in order to ensure that the native desaturase is not expressed.
- the gene may be mutated so that the native desaturase is expressed but lacks activity, e.g. by mutation of the catalytical site of the enzyme.
- translation of mRNA to an active protein may be prevented by methods such as silencing RNA or siRNA.
- the yeast cell may be incubated in a medium comprising an inhibitor which inhibits activity of the native desaturase.
- a compound inhibiting transcription of the gene encoding the native desaturase may also be provided so that transcription is inactivated when said compound is present.
- Inactivation of the native desaturase may thus be permanent or long-term, i.e. the modified yeast cell does not exhibit activity of the native desaturase in stable conditions, or it may be transient, i.e. the modified yeast cell may exhibit activity of the native desaturase for periods of time, but this activity can be suppressed for other periods of time.
- Alcohol-forming fatty acyl-CoA reductase (EC 1.2. 1.84)
- heterologous FAR refers to a FAR which is not naturally expressed by the yeast cell.
- the fatty acyl-CoA is reduced to a fatty aldehyde, before the fatty aldehyde is further reduced into a fatty alcohol in a second step.
- the fatty acyl-CoA may be a desaturated fatty acyl-CoA.
- the FARs capable of catalyzing such reaction are alcohol-forming fatty acyl-CoA reductases with an EC number 1 .2.1 .84.
- the yeast cell of the present disclosure expresses at least one heterologous desaturase capable of introducing at least one double bond in a fatty acyl-CoA as described above, and at least one heterologous fatty acyl-CoA reductase capable of converting at least part of said desaturated fatty acyl-CoA to a desaturated fatty alcohol, and has moreover reduced activity of at least one of Hfd1 (SEQ ID NO: 4), Hfd4 (SEQ ID NO: 6), Pex10 (SEQ ID NO: 8), Fao1 (SEQ ID NO: 22) and GPAT (SEQ ID NO: 10) or having reduced activity of at least one protein having at least 60% homology to one of Hfd1 (SEQ ID NO: 4), Hfd4 (SEQ ID NO: 6), Pex10 (SEQ ID NO: 8), Fao1 (SEQ ID NO: 22) and GPAT (SEQ ID NO: 10), such as at least 65% homology, such as at least 70% homo
- the yeast cell expresses at least one heterologous desaturase, at least one heterologous fatty acyl-CoA reductase and has reduced activity of Pex10 and at least one of Hfd1 , Hfd4, GPAT and Fao1 or a homologue thereof.
- the at least one heterologous FAR is derived from an organism belonging to the Lepidoptera order.
- a heterologous fatty acyl-CoA reductase may be expressed from a nucleic acid introduced in the cell, e.g. on a vector such as a plasmid, or by genomic integration.
- the nucleic acid may be codon-optimised for any purpose as is known in the art for the specific yeast cell used.
- the at least one heterologous FAR is capable of converting a ⁇ 3 fatty acyl-CoA into a ⁇ 3 fatty alcohol. In another embodiment, the at least one heterologous FAR is capable of converting a ⁇ 5 fatty acyl-CoA into a ⁇ 5 fatty alcohol. In another embodiment, the at least one heterologous FAR is capable of converting a ⁇ 6 fatty acyl-CoA into a ⁇ 6 fatty alcohol. In another embodiment, the at least one heterologous FAR is capable of converting a ⁇ 7 fatty acyl-CoA into a ⁇ 7 fatty alcohol.
- the at least one heterologous FAR is capable of converting a ⁇ 8 fatty acyl-CoA into a ⁇ 8 fatty alcohol. In another embodiment, the at least one heterologous FAR is capable of converting a ⁇ 9 fatty acyl-CoA into a ⁇ 9 fatty alcohol. In another embodiment, the at least one heterologous FAR is capable of converting a ⁇ 10 fatty acyl-CoA into a A ⁇ 0 fatty alcohol. In another embodiment, the at least one heterologous FAR is capable of converting a ⁇ 1 1 fatty acyl-CoA into a ⁇ 1 1 fatty alcohol.
- the at least one heterologous FAR is capable of converting a ⁇ 12 fatty acyl-CoA into a ⁇ 12 fatty alcohol. In another embodiment, the at least one heterologous FAR is capable of converting a ⁇ 13 fatty acyl-CoA into a ⁇ 13 fatty alcohol. In another embodiment, the at least one heterologous FAR is capable of converting a ⁇ 14 fatty acyl-CoA into a ⁇ 14 fatty alcohol. In another embodiment, the at least one heterologous FAR is capable of converting a ⁇ 15 fatty acyl-CoA into a ⁇ 15 fatty alcohol.
- the at least one heterologous FAR is capable of converting a ⁇ 16 fatty acyl-CoA into a ⁇ 16 fatty alcohol. In another embodiment, the at least one heterologous FAR is capable of converting a ⁇ 17 fatty acyl-CoA into a ⁇ 17 fatty alcohol. In another embodiment, the at least one heterologous FAR is capable of converting a ⁇ 18 fatty acyl-CoA into a ⁇ 18 fatty alcohol. In another embodiment, the at least one heterologous FAR is capable of converting a ⁇ 19 fatty acyl-CoA into a ⁇ 19 fatty alcohol.
- the at least one heterologous FAR is capable of converting a ⁇ 20 fatty acyl-CoA into a ⁇ 20 fatty alcohol. In another embodiment, the at least one heterologous FAR is capable of converting a ⁇ 21 fatty acyl-CoA into a ⁇ 21 fatty alcohol. In another embodiment, the at least one heterologous FAR is capable of converting a ⁇ 22 fatty acyl-CoA into a ⁇ 22 fatty alcohol.
- the FAR is selected from a FAR having at least 80% homology to the FAR derived from Helicoverpa armigera, as set forth in SEQ ID NO: 14, a FAR having at least 80% homology to the FAR from Helicoverpa assulta as set forth in SEQ ID NO: 16, a FAR having at least 80% homology to the FAR from Heliothis subflexa as set forth in SEQ ID NO: 12 and a FAR having at least 80% homology to the FAR from Bicyclus anynana as set forth in SEQ ID NO: 24.
- the FAR is selected from a FAR having at least 80% homology to the FAR derived from Helicoverpa armigera and a FAR having at least 80% homology to the FAR from Heliothis subflexa as set forth in SEQ ID NO: 12.
- the FAR is Har FAR (SEQ ID NO: 14, FAR from Helicoverpa armigera) or a variant thereof having at least 75% homology to Har FAR, such as at least 76%, such as at least 77%, such as at least 78%, such as at least 79%, such as at least 80%, such as at least 81 %, such as at least 82%, such as at least 83%, such as at least 84%, such as at least 85%, such as at least 86%, such as at least 87%, such as at least 88%, such as at least 89%, such as at least 90%, such as at least 91 %, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% homology to Har FAR (SEQ ID NO: 14).
- the FAR is Has_FAR (SEQ ID NO: 16, FAR from Helicoverpa assulta) or a variant thereof having at least 75% homology to Has_FAR, such as at least 76%, such as at least 77%, such as at least 78%, such as at least 79%, such as at least 80%, such as at least 81 %, such as at least 82%, such as at least 83%, such as at least 84%, such as at least 85%, such as at least 86%, such as at least 87%, such as at least 88%, such as at least 89%, such as at least 90%, such as at least 91 %, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% homology to Has_FAR (SEQ ID NO: 16).
- the FAR is Hs_FAR (SEQ ID NO: 12, FAR from Heliothis subflexa) or a variant thereof having at least 75% homology to Hs_FAR, such as at least 76%, such as at least 77%, such as at least 78%, such as at least 79%, such as at least 80%, such as at least 81 %, such as at least 82%, such as at least 83%, such as at least 84%, such as at least 85%, such as at least 86%, such as at least 87%, such as at least 88%, such as at least 89%, such as at least 90%, such as at least 91 %, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% homology to Hs_FAR (SEQ ID NO: 12).
- the FAR is Ban FAR (SEQ ID NO: 24, FAR from Bicyclus anynana) or a variant thereof having at least 75% homology to Ban FAR, such as at least 76%, such as at least 77%, such as at least 78%, such as at least 79%, such as at least 80%, such as at least 81 %, such as at least 82%, such as at least 83%, such as at least 84%, such as at least 85%, such as at least 86%, such as at least 87%, such as at least 88%, such as at least 89%, such as at least 90%, such as at least 91 %, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% homology to Ban FAR (SEQ ID NO: 24).
- expression of the desaturase and/or of the FAR can be induced, for example if the genes encoding these enzymes are under the control of inducible promoters, as is known in the art.
- the yeast cell is incubated under suitable conditions, such as in an appropriate medium and at an appropriate temperature as is known to a person of skill in the art.
- Suitable media supporting yeast growth include, but are not limited to: undefined, complete media such as YEPD (or YPD, Yeast Extract Peptone Dextrose); defined, complete medium such as SC (Synthetic Complete); defined, drop-out medium such as SD (Synthetic Dextrose) lacking one or more elements such as an amino acid or an inducer; or mineral medium, consisting of salts, vitamins and a carbon source, and others.
- YEPD or YPD, Yeast Extract Peptone Dextrose
- SC Synthetic Complete
- drop-out medium such as SD (Synthetic Dextrose) lacking one or more elements such as an amino acid or an inducer
- mineral medium consisting of salts, vitamins and a carbon source, and others.
- reduced activity may refer to a partial or a total loss activity. Reduced activity may be achieved by methods known in the art, e.g. by mutation or deletion of the gene encoding the peptide displaying said activity, by repression of transcription using a repressible promoter, by inhibition of the activity or by silencing at the translational level.
- PEX10 (YALI0C01023g, SEQ ID NO: 7) encodes the peroxisome biogenesis factor 10 (SEQ ID NO: 8). It is involved in import of peroxisomal matrix proteins and localizes to the peroxisomal membrane.
- the oleaginous yeast cell of the present disclosure expresses at least one heterologous desaturase capable of introducing at least one double bond in a fatty acyl-CoA as described above, at least one heterologous fatty acyl-CoA reductase, capable of converting at least part of said desaturated fatty acyl-CoA to a desaturated fatty alcohol as described above, and has reduced activity of Pex10 or of a protein having at least 60% homology to Pex10 (SEQ ID NO: 8), such as at least 65% homology, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such
- Reduced or total loss of activity of Pex10 or of a protein having at least 60% homology thereto can be obtained by methods known in the art.
- reduced activity is total loss of activity.
- the gene encoding Pex10 or the protein having at least 60% homology thereto can be knocked out, or deleted, or its transcription can be prevented as is known in the art, for example by introducing a repressible promoter upstream of the gene resulting in total inactivation of transcription in the presence of a repressing compound.
- the gene encoding Pex10 or a protein having at least 60% homology thereto is deleted.
- the gene is PEX10 (SEQ ID NO: 7) and the oleaginous yeast cell is Yarrowia lipolytica.
- the yeast cell expresses:
- - at least one heterologous desaturase selected from the group consisting of a ⁇ 1 1 desaturase having at least 60% homology to the ⁇ 1 1 desaturase from Amyelois transitella as set forth in SEQ ID NO: 2, a ⁇ 9 desaturase having at least 60% homology to the ⁇ 9 desaturase from Drosophila melanogaster as set forth in SEQ ID NO: 18, a ⁇ 1 1 desaturase having at least 60% homology to the ⁇ 1 1 desaturase from Choristoneura rosaceana as set forth in SEQ ID NO: 19 and a ⁇ 1 1 desaturase having at least 60% homology to the ⁇ 1 1 desaturase from Choristoneura parallela as set forth in SEQ ID NO: 20; and
- the FAR is selected from a FAR having at least 80% homology to the FAR derived from Helicoverpa armigera as set forth in SEQ ID NO: 14 and a FAR having at least 80% homology to the FAR from Heliothis subflexa as set forth in SEQ ID NO: 12; and
- the yeast cell has reduced activity or total loss of activity of Pex10 or of a protein having at least 65% homology thereto, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such as at least 90% homology, such as at least 91 % homology, such as at least 92% homology, such as at least 93% homology, such as at least 94% homology, such as at least 95% homology, such as at least 96% homology, such as at least 97% homology, such as at least 98% homology, such as at least 99% homology to Pex10 (SEQ ID NO: 8).
- the yeast cell expresses:
- homology such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such as at least 90% homology, such as at least 91 % homology, such as at least 92% homology, such as at least 93% homology, such as at least 94% homology, such as at least 95% homology, such as at least 96% homology, such as at least 97% homology, such as at least 98% homology, such as at least 99% homology to Pex10 (SEQ ID NO: 8).
- yeast cell expresses:
- the yeast cell has reduced activity or total loss of activity of Pex10 or of a protein having at least 65% homology thereto, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such as at least 90% homology, such as at least 91 % homology, such as at least 92% homology, such as at least 93% homology, such as at least 94% homology, such as at least 95% homology, such as at least 96% homology, such as at least 97% homology, such as at least 98% homology, such as at least 99% homology to Pex10 (SEQ ID NO: 8).
- the yeast cell expresses:
- yeast cell expresses:
- homology such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such as at least 90% homology, such as at least 91 % homology, such as at least 92% homology, such as at least 93% homology, such as at least 94% homology, such as at least 95% homology, such as at least 96% homology, such as at least 97% homology, such as at least 98% homology, such as at least 99% homology to Pex10 (SEQ ID NO: 8).
- yeast cell expresses:
- heterologous desaturase having at least 60% homology to the ⁇ 1 1 desaturase from Amyelois transitella as set forth in SEQ ID NO: 2; and - at least one heterologous fatty acyl-CoA reductase having at least 80%
- the yeast cell has reduced activity or total loss of activity of Pex10 or of a protein having at least 65% homology thereto, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such as at least 90% homology, such as at least 91 % homology, such as at least 92% homology, such as at least 93% homology, such as at least 94% homology, such as at least 95% homology, such as at least 96% homology, such as at least 97% homology, such as at least 98% homology, such as at least 99% homology to Pex10 (SEQ ID NO: 8).
- the yeast cell expresses:
- - has reduced activity or total loss of activity of Pex10 or of a protein having at least 65% homology thereto, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such as at least 90% homology, such as at least 91 % homology, such as at least 92% homology, such as at least 93% homology, such as at least 94% homology, such as at least 95% homology, such as at least 96% homology, such as at least 97% homology, such as at least 98% homology, such as at least 99% homology to Pex10 (SEQ ID NO: 8).
- yeast cell expresses:
- homology such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such as at least 90% homology, such as at least 91 % homology, such as at least 92% homology, such as at least 93% homology, such as at least 94% homology, such as at least 95% homology, such as at least 96% homology, such as at least 97% homology, such as at least 98% homology, such as at least 99% homology to Pex10 (SEQ ID NO: 8).
- yeast cell expresses:
- - has reduced activity or total loss of activity of Pex10 or of a protein having at least 65% homology thereto, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such as at least 90% homology, such as at least 91 % homology, such as at least 92% homology, such as at least 93% homology, such as at least 94% homology, such as at least 95% homology, such as at least 96% homology, such as at least 97% homology, such as at least 98% homology, such as at least 99% homology to Pex10 (SEQ ID NO: 8).
- the yeast cell is a Yarrowia cell, such as a Yarrowia lipolytica cell.
- HFD1 (YALI0F23793g, SEQ ID NO: 3) encodes a fatty aldehyde dehydrogenase (SEQ ID NO: 4). It catalyses the oxidation of fatty aldehydes to fatty acids.
- the inventors found that reduced activity of Hfd1 resulted in increased titre of desaturated fatty alcohols in oleaginous yeast cells such as Y. lipolytica.
- the yeast cell also has reduced or total loss of activity of Pex10 or of a protein having at least 60% homology to Pex10 (SEQ ID NO: 8), as described above.
- the oleaginous yeast cell of the present disclosure expresses at least one heterologous desaturase capable of introducing at least one double bond in a fatty acyl-CoA as described above, at least one heterologous fatty acyl-CoA reductase, capable of converting at least part of said desaturated fatty acyl-CoA to a desaturated fatty alcohol as described above, and has reduced activity of Hfd1 or of a protein having at least 60% homology to HfcM (SEQ ID NO: 4), such as at least 65% homology, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology
- the yeast cell also has reduced or total loss of activity of Pex10 or of a protein having at least 60% homology to Pex10 (SEQ ID NO: 8), as described above.
- Reduced activity of Hfdl or of a protein having at least 60% homology thereto can be obtained by methods known in the art.
- reduced activity is total loss of activity.
- the gene encoding Hfd1 or the protein having at least 60% homology thereto can be knocked out, or deleted, or its transcription can be prevented as is known in the art, for example by introducing a repressible promoter upstream of the gene resulting in total inactivation of transcription in the presence of a repressing compound.
- the gene encoding Hfdl or a protein having at least 60% homology thereto is deleted.
- the gene is HFD1 (SEQ ID NO: 3) and the oleaginous yeast cell is Yarrowia lipolytica.
- the yeast cell expresses:
- the at least one heterologous desaturase selected from the group consisting of a ⁇ 1 1 desaturase having at least 60% homology to the ⁇ 1 1 desaturase from Amyelois transitella as set forth in SEQ ID NO: 2, a ⁇ 9 desaturase having at least 60% homology to the ⁇ 9 desaturase from Drosophila melanogaster as set forth in SEQ ID NO: 18, a ⁇ 1 1 desaturase having at least 60% homology to the ⁇ 1 1 desaturase from Choristoneura rosaceana as set forth in SEQ ID NO: 19 and a ⁇ 1 1 desaturase having at least 60% homology to the ⁇ 1 1 desaturase from Choristoneura parallela as set forth in SEQ ID NO: 20; preferably the at least one heterologous desaturase is a ⁇ 1 1 desaturase having at least 60% homology to the ⁇ 1 1 desaturase from Amyelois transitella as set forth in SEQ ID NO: 2 or a
- the FAR is selected from a FAR having at least 80% homology to the FAR derived from Helicoverpa armigera as set forth in SEQ ID NO: 14 and a FAR having at least 80% homology to the FAR from Heliothis subflexa as set forth in SEQ ID NO: 12; and
- the yeast cell has reduced activity or total loss of activity of Hfd1 or of a protein having at least 65% homology thereto, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such as at least 90% homology, such as at least 91 % homology, such as at least 92% homology, such as at least 93% homology, such as at least 94% homology, such as at least 95% homology, such as at least 96% homology, such as at least 97% homology, such as at least 98% homology, such as at least 99% homology to HfcM (SEQ ID NO: 4).
- the yeast cell has reduced or total loss of
- Hfd1 has reduced activity or total loss of activity of Hfd1 or of a protein having at least 65% homology thereto, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such as at least 90% homology, such as at least 91 % homology, such as at least 92% homology, such as at least 93% homology, such as at least 94% homology, such as at least 95% homology, such as at least 96% homology, such as at least 97% homology, such as at least 98% homology, such as at least 99% homology to HfcM (SEQ ID NO: 4).
- HfcM SEQ ID NO
- the yeast cell also has reduced or total loss of activity of Pex10 or of a protein having at least 60% homology to Pex10 (SEQ ID NO: 8), as described above.
- yeast cell expresses:
- heterologous desaturase having at least 60% homology to the ⁇ 9 desaturase from Drosophila melanogaster as set forth in SEQ ID NO: 18; and - at least one heterologous fatty acyl-CoA reductase having at least 80%
- Hfd1 has reduced activity or total loss of activity of Hfd1 or of a protein having at least 65% homology thereto, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such as at least 90% homology, such as at least 91 % homology, such as at least 92% homology, such as at least 93% homology, such as at least 94% homology, such as at least 95% homology, such as at least 96% homology, such as at least 97% homology, such as at least 98% homology, such as at least 99% homology to HfcM (SEQ ID NO: 4).
- HfcM SEQ ID NO
- the yeast cell also has reduced or total loss of activity of Pex10 or of a protein having at least 60% homology to Pex10 (SEQ ID NO: 8), as described above.
- yeast cell expresses:
- Hfd1 has reduced activity or total loss of activity of Hfd1 or of a protein having at least 65% homology thereto, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such as at least 90% homology, such as at least 91 % homology, such as at least 92% homology, such as at least 93% homology, such as at least 94% homology, such as at least 95% homology, such as at least 96% homology, such as at least 97% homology, such as at least 98% homology, such as at least 99% homology to HfcM (SEQ ID NO: 4).
- HfcM SEQ ID NO
- the yeast cell also has reduced or total loss of activity of Pex10 or of a protein having at least 60% homology to Pex10 (SEQ ID NO: 8), as described above.
- the yeast cell expresses: - at least one heterologous desaturase having at least 60% homology to the ⁇ 9 desaturase from Drosophila melanogaster as set forth in SEQ ID NO: 18; and
- Hfd1 has reduced activity or total loss of activity of Hfd1 or of a protein having at least 65% homology thereto, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such as at least 90% homology, such as at least 91 % homology, such as at least 92% homology, such as at least 93% homology, such as at least 94% homology, such as at least 95% homology, such as at least 96% homology, such as at least 97% homology, such as at least 98% homology, such as at least 99% homology to HfcM (SEQ ID NO: 4).
- HfcM SEQ ID NO
- the yeast cell also has reduced or total loss of activity of Pex10 or of a protein having at least 60% homology to Pex10 (SEQ ID NO: 8), as described above.
- yeast cell expresses:
- Hfd1 has reduced activity or total loss of activity of Hfd1 or of a protein having at least 65% homology thereto, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such as at least 90% homology, such as at least 91 % homology, such as at least 92% homology, such as at least 93% homology, such as at least 94% homology, such as at least 95% homology, such as at least 96% homology, such as at least 97% homology, such as at least 98% homology, such as at least 99% homology to HfcM (SEQ ID NO: 4).
- HfcM SEQ ID NO
- the yeast cell also has reduced or total loss of activity of Pex10 or of a protein having at least 60% homology to Pex10 (SEQ ID NO: 8), as described above.
- yeast cell expresses:
- Hfd1 has reduced activity or total loss of activity of Hfd1 or of a protein having at least 65% homology thereto, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such as at least 90% homology, such as at least 91 % homology, such as at least 92% homology, such as at least 93% homology, such as at least 94% homology, such as at least 95% homology, such as at least 96% homology, such as at least 97% homology, such as at least 98% homology, such as at least 99% homology to HfcM (SEQ ID NO: 4).
- HfcM SEQ ID NO
- the yeast cell also has reduced or total loss of activity of Pex10 or of a protein having at least 60% homology to Pex10 (SEQ ID NO: 8), as described above.
- yeast cell expresses:
- the yeast cell has reduced activity or total loss of activity of Hfd1 or of a protein having at least 65% homology thereto, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such as at least 90% homology, such as at least 91 % homology, such as at least 92% homology, such as at least 93% homology, such as at least 94% homology, such as at least 95% homology, such as at least 96% homology, such as at least 97% homology, such as at least 98% homology, such as at least 99% homology to HfcM (SEQ ID NO: 4).
- the yeast cell also has reduced or total homo
- yeast cell expresses:
- Hfd1 has reduced activity or total loss of activity of Hfd1 or of a protein having at least 65% homology thereto, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such as at least 90% homology, such as at least 91 % homology, such as at least 92% homology, such as at least 93% homology, such as at least 94% homology, such as at least 95% homology, such as at least 96% homology, such as at least 97% homology, such as at least 98% homology, such as at least 99% homology to HfcM (SEQ ID NO: 4).
- HfcM SEQ ID NO
- the yeast cell also has reduced or total loss of activity of Pex10 or of a protein having at least 60% homology to Pex10 (SEQ ID NO: 8), as described above.
- Fatty aldehyde dehydrogenase Hfd4 Fatty aldehyde dehydrogenase Hfd4
- HFD4 (YALI0B01298g, SEQ ID NO: 5 encodes a fatty aldehyde dehydrogenase (SEQ ID NO: 6). It catalyses the oxidation of fatty aldehydes to fatty acids.
- the yeast cell also has reduced or total loss of activity of Pex10 or of a protein having at least 60% homology to Pex10 (SEQ ID NO: 8), as described above.
- the oleaginous yeast cell of the present disclosure expresses at least one heterologous desaturase capable of introducing at least one double bond in a fatty acyl-CoA as described above, at least one heterologous fatty acyl-CoA reductase, capable of converting at least part of said desaturated fatty acyl-CoA to a desaturated fatty alcohol as described above, and has reduced activity of Hfd4 or of a protein having at least 60% homology to Hfd4 (SEQ ID NO: 6), such as at least 65% homology, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology
- Reduced activity of Hfd4or of a protein having at least 60% homology thereto can be obtained by methods known in the art.
- reduced activity is total loss of activity.
- the gene encoding Hfd4 or the protein having at least 60% homology thereto can be knocked out, or deleted, or its transcription can be prevented as is known in the art, for example by introducing a repressible promoter upstream of the gene resulting in total inactivation of transcription in the presence of a repressing compound.
- the gene encoding Hfd4or a protein having at least 60% homology thereto is deleted.
- the gene is HFD4 (SEQ ID NO: 5) and the oleaginous yeast cell is Yarrowia lipolytica.
- the yeast cell expresses:
- the at least one heterologous desaturase selected from the group consisting of a ⁇ 1 1 desaturase having at least 60% homology to the ⁇ 1 1 desaturase from Amyelois transitella as set forth in SEQ ID NO: 2, a ⁇ 9 desaturase having at least 60% homology to the ⁇ 9 desaturase from Drosophila melanogaster as set forth in SEQ ID NO: 18, a ⁇ 1 1 desaturase having at least 60% homology to the ⁇ 1 1 desaturase from Choristoneura rosaceana as set forth in SEQ ID NO: 19 and a ⁇ 1 1 desaturase having at least 60% homology to the ⁇ 1 1 desaturase from Choristoneura parallela as set forth in SEQ ID NO: 20; preferably the at least one heterologous desaturase is a ⁇ 1 1 desaturase having at least 60% homology to the ⁇ 1 1 desaturase from Amyelois transitella as set forth in SEQ ID NO: 2 or a
- the FAR is selected from a FAR having at least 80% homology to the FAR derived from Helicoverpa armigera as set forth in SEQ ID NO: 14 and a FAR having at least 80% homology to the FAR from Heliothis subflexa as set forth in SEQ ID NO: 12; and
- the yeast cell has reduced activity or total loss of activity of Hfd4 or of a protein having at least 65% homology thereto, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such as at least 90% homology, such as at least 91 % homology, such as at least 92% homology, such as at least 93% homology, such as at least 94% homology, such as at least 95% homology, such as at least 96% homology, such as at least 97% homology, such as at least 98% homology, such as at least 99% homology to Hfd4 (SEQ ID NO: 6).
- the yeast cell also has reduced or total homo
- the yeast cell expresses:
- 65% homology thereto such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such as at least 90% homology, such as at least 91 % homology, such as at least 92% homology, such as at least 93% homology, such as at least 94% homology, such as at least 95% homology, such as at least 96% homology, such as at least 97% homology, such as at least 98% homology, such as at least 99% homology to Hfd4 (SEQ ID NO: 6).
- the yeast cell also has reduced or total loss of activity of Pex10 or of a protein having at least 60% homology to Pex10 (SEQ ID NO: 8), as described above.
- yeast cell expresses:
- the yeast cell also has reduced or total loss of activity of Pex10 or of a protein having at least 60% homology to Pex10 (SEQ ID NO: 8), as described above.
- yeast cell expresses:
- the yeast cell has reduced activity or total loss of activity of Hfd4 or of a protein having at least 65% homology thereto, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such as at least 90% homology, such as at least 91 % homology, such as at least 92% homology, such as at least 93% homology, such as at least 94% homology, such as at least 95% homology, such as at least 96% homology, such as at least 97% homology, such as at least 98% homology, such as at least 99% homology to Hfd4 (SEQ ID NO: 6).
- the yeast cell also has reduced or total homo
- Hfd4 has reduced activity or total loss of activity of Hfd4 or of a protein having at least 65% homology thereto, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such as at least 90% homology, such as at least 91 % homology, such as at least 92% homology, such as at least 93% homology, such as at least 94% homology, such as at least 95% homology, such as at least 96% homology, such as at least 97% homology, such as at least 98% homology, such as at least 99% homology to Hfd4 (SEQ ID NO: 6).
- the yeast cell also has reduced or total loss of activity of Pex10 or of a protein having at least 60% homology to Pex10 (SEQ ID NO: 8), as described above.
- yeast cell expresses:
- Hfd4 has reduced activity or total loss of activity of Hfd4 or of a protein having at least 65% homology thereto, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such as at least 90% homology, such as at least 91 % homology, such as at least 92% homology, such as at least 93% homology, such as at least 94% homology, such as at least 95% homology, such as at least 96% homology, such as at least 97% homology, such as at least 98% homology, such as at least 99% homology to Hfd4 (SEQ ID NO: 6).
- the yeast cell also has reduced or total loss of activity of Pex10 or of a protein having at least 60% homology to Pex10 (SEQ ID NO: 8), as described above.
- yeast cell expresses:
- Hfd4 has reduced activity or total loss of activity of Hfd4 or of a protein having at least 65% homology thereto, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such as at least 90% homology, such as at least 91 % homology, such as at least 92% homology, such as at least 93% homology, such as at least 94% homology, such as at least 95% homology, such as at least 96% homology, such as at least 97% homology, such as at least 98% homology, such as at least 99% homology to Hfd4 (SEQ ID NO: 6).
- the yeast cell also has reduced or total loss of activity of Pex10 or of a protein having at least 60% homology to Pex10 (SEQ ID NO: 8), as described above.
- the yeast cell expresses: - at least one heterologous desaturase having at least 60% homology to the ⁇ 1 1 desaturase from Amyelois transitella as set forth in SEQ ID NO: 2; and
- 65% homology thereto such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such as at least 90% homology, such as at least 91 % homology, such as at least 92% homology, such as at least 93% homology, such as at least 94% homology, such as at least 95% homology, such as at least 96% homology, such as at least 97% homology, such as at least 98% homology, such as at least 99% homology to Hfd4 (SEQ ID NO: 6).
- the yeast cell also has reduced or total loss of activity of Pex10 or of a protein having at least 60% homology to Pex10 (SEQ ID NO: 8), as described above.
- yeast cell expresses:
- the yeast cell has reduced activity or total loss of activity of Hfd4 or of a protein having at least 65% homology thereto, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such as at least 90% homology, such as at least 91 % homology, such as at least 92% homology, such as at least 93% homology, such as at least 94% homology, such as at least 95% homology, such as at least 96% homology, such as at least 97% homology, such as at least 98% homology, such as at least 99% homology to Hfd4 (SEQ ID NO: 6).
- the yeast cell also has reduced or total homo
- the yeast cell is a Yarrowia cell, such as a Yarrowia lipolytica cell.
- FA01 (YALI0B14014g, SEQ ID NO: 21 ) encodes a fatty alcohol oxidase (SEQ ID NO: 22). Its deletion results in increased accumulation of ⁇ -hydroxy fatty acids.
- the yeast cell also has reduced or total loss of activity of Pex10 or of a protein having at least 60% homology to Pex10 (SEQ ID NO: 8), as described above.
- the oleaginous yeast cell of the present disclosure expresses at least one heterologous desaturase capable of introducing at least one double bond in a fatty acyl-CoA as described above, at least one heterologous fatty acyl-CoA reductase, capable of converting at least part of said desaturated fatty acyl-CoA to a desaturated fatty alcohol as described above, and has reduced activity of Fao1 or of a protein having at least 60% homology to Fao1 (SEQ ID NO: 22), such as at least 65% homology, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such
- Reduced activity of Fao1 or of a protein having at least 60% homology thereto can be obtained by methods known in the art.
- reduced activity is total loss of activity.
- the gene encoding Fao1 or the protein having at least 60% homology thereto can be knocked out, or deleted, or its transcription can be prevented as is known in the art, for example by introducing a repressible promoter upstream of the gene resulting in total inactivation of transcription in the presence of a repressing compound.
- the gene encoding Fao1 or a protein having at least 60% homology thereto is deleted.
- the gene is Fao1 (SEQ ID NO: 21 ) and the oleaginous yeast cell is Yarrowia lipolytica.
- the yeast cell expresses:
- the at least one heterologous desaturase selected from the group consisting of a ⁇ 1 1 desaturase having at least 60% homology to the ⁇ 1 1 desaturase from Amyelois transitella as set forth in SEQ ID NO: 2, a ⁇ 9 desaturase having at least 60% homology to the ⁇ 9 desaturase from Drosophila melanogaster as set forth in SEQ ID NO: 18, a ⁇ 1 1 desaturase having at least 60% homology to the ⁇ 1 1 desaturase from Choristoneura rosaceana as set forth in SEQ ID NO: 19 and a ⁇ 1 1 desaturase having at least 60% homology to the ⁇ 1 1 desaturase from Choristoneura parallela as set forth in SEQ ID NO: 20; preferably the at least one heterologous desaturase is a ⁇ 1 1 desaturase having at least 60% homology to the ⁇ 1 1 desaturase from Amyelois transitella as set forth in SEQ ID NO: 2 or a
- the FAR is selected from a FAR having at least 80% homology to the FAR derived from Helicoverpa armigera as set forth in SEQ ID NO: 14 and a FAR having at least 80% homology to the FAR from Heliothis subflexa as set forth in SEQ ID NO: 12; and
- Fao1 has reduced activity or total loss of activity of Fao1 or of a protein having at least 65% homology thereto, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such as at least 90% homology, such as at least 91 % homology, such as at least 92% homology, such as at least 93% homology, such as at least 94% homology, such as at least 95% homology, such as at least 96% homology, such as at least 97% homology, such as at least 98% homology, such as at least 99% homology to Fao1 (SEQ ID NO: 22).
- the yeast cell also has reduced or total loss of activity of Pex10 or of a protein having at least 60% homology to Pex10 (SEQ ID NO: 8), as described above.
- the yeast cell expresses:
- the yeast cell has reduced activity or total loss of activity of Fao1 or of a protein having at least 65% homology thereto, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such as at least 90% homology, such as at least 91 % homology, such as at least 92% homology, such as at least 93% homology, such as at least 94% homology, such as at least 95% homology, such as at least 96% homology, such as at least 97% homology, such as at least 98% homology, such as at least 99% homology to Fao1 (SEQ ID NO: 22).
- the yeast cell also has reduced or total loss of
- Fao1 has reduced activity or total loss of activity of Fao1 or of a protein having at least 65% homology thereto, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such as at least 90% homology, such as at least 91 % homology, such as at least 92% homology, such as at least 93% homology, such as at least 94% homology, such as at least 95% homology, such as at least 96% homology, such as at least 97% homology, such as at least 98% homology, such as at least 99% homology to Fao1 (SEQ ID NO: 22).
- the yeast cell also has reduced or total loss of activity of Pex10 or of a protein having at least 60% homology to Pex10 (SEQ ID NO: 8), as described above.
- yeast cell expresses:
- - has reduced activity or total loss of activity of Fao1 or of a protein having at least 65% homology thereto, such as at least 70% homology, such as at least
- homology such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such as at least 90% homology, such as at least 91 % homology, such as at least 92% homology, such as at least 93% homology, such as at least 94% homology, such as at least 95% homology, such as at least 96% homology, such as at least 97% homology, such as at least 98% homology, such as at least 99% homology to Fao1 (SEQ ID NO: 22).
- the yeast cell also has reduced or total loss of activity of Pex10 or of a protein having at least 60% homology to Pex10 (SEQ ID NO: 8), as described above.
- the yeast cell expresses:
- Fao1 has reduced activity or total loss of activity of Fao1 or of a protein having at least 65% homology thereto, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such as at least 90% homology, such as at least 91 % homology, such as at least 92% homology, such as at least 93% homology, such as at least 94% homology, such as at least 95% homology, such as at least 96% homology, such as at least 97% homology, such as at least 98% homology, such as at least 99% homology to Fao1 (SEQ ID NO: 22).
- the yeast cell also has reduced or total loss of activity of Pex10 or of a protein having at least 60% homology to Pex10 (SEQ ID NO: 8), as described above.
- the yeast cell expresses:
- heterologous desaturase having at least 60% homology to the ⁇ 1 1 desaturase from Amyelois transitella as set forth in SEQ ID NO: 2; and - at least one heterologous fatty acyl-CoA reductase having at least 80%
- Fao1 has reduced activity or total loss of activity of Fao1 or of a protein having at least 65% homology thereto, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such as at least 90% homology, such as at least 91 % homology, such as at least 92% homology, such as at least 93% homology, such as at least 94% homology, such as at least 95% homology, such as at least 96% homology, such as at least 97% homology, such as at least 98% homology, such as at least 99% homology to Fao1 (SEQ ID NO: 22).
- the yeast cell also has reduced or total loss of activity of Pex10 or of a protein having at least 60% homology to Pex10 (SEQ ID NO: 8), as described above.
- the yeast cell expresses:
- Fao1 has reduced activity or total loss of activity of Fao1 or of a protein having at least 65% homology thereto, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such as at least 90% homology, such as at least 91 % homology, such as at least 92% homology, such as at least 93% homology, such as at least 94% homology, such as at least 95% homology, such as at least 96% homology, such as at least 97% homology, such as at least 98% homology, such as at least 99% homology to Fao1 (SEQ ID NO: a protein having at least 65% homology thereto, such as
- the yeast cell also has reduced or total loss of activity of Pex10 or of a protein having at least 60% homology to Pex10 (SEQ ID NO: 8), as described above.
- yeast cell expresses:
- the yeast cell has reduced activity or total loss of activity of Fao1 or of a protein having at least 65% homology thereto, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such as at least 90% homology, such as at least 91 % homology, such as at least 92% homology, such as at least 93% homology, such as at least 94% homology, such as at least 95% homology, such as at least 96% homology, such as at least 97% homology, such as at least 98% homology, such as at least 99% homology to Fao1 (SEQ ID NO: 22).
- the yeast cell also has reduced or total loss of
- yeast cell expresses:
- heterologous desaturase having at least 60% homology to the ⁇ 9 desaturase from Drosophila melanogaster as set forth in SEQ ID NO: 18; and - at least one heterologous fatty acyl-CoA reductase having at least 80% homology to the FAR from Bicyclus anynana as set forth in SEQ ID NO: 24; and
- Fao1 has reduced activity or total loss of activity of Fao1 or of a protein having at least 65% homology thereto, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such as at least 90% homology, such as at least 91 % homology, such as at least 92% homology, such as at least 93% homology, such as at least 94% homology, such as at least 95% homology, such as at least 96% homology, such as at least 97% homology, such as at least 98% homology, such as at least 99% homology to Fao1 (SEQ ID NO: 22).
- the yeast cell also has reduced or total loss of activity of Pex10 or of a protein having at least 60% homology to Pex10 (SEQ ID NO: 8), as described above.
- the yeast cell is a Yarrowia cell, such as a Yarrowia Iipolytica cell.
- GPAT In Yarrowia Iipolytica, GPAT (YALI0C00209g, SEQ ID NO: 9) encodes a glycerol-3- phosphate acyltransf erase (SEQ ID NO: 10). GPAT catalyzes the first reaction towards glycerolipids biosynthesis. The gene is essential in Yarrowia Iipolytica.
- the yeast cell also has reduced or total loss of activity of Pex10 or of a protein having at least 60% homology to Pex10 (SEQ ID NO: 8), as described above.
- the oleaginous yeast cell of the present disclosure expresses at least one heterologous desaturase capable of introducing at least one double bond in a fatty acyl-CoA as described above, at least one heterologous fatty acyl-CoA reductase, capable of converting at least part of said desaturated fatty acyl-CoA to a desaturated fatty alcohol as described above, and has reduced activity of Fao1 or of a protein having at least 60% homology to GPAT (SEQ ID NO: 10), such as at least 65% homology, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such
- Reduced activity of GPAT or of a protein having at least 60% homology thereto can be obtained by methods known in the art.
- reduced activity is partial loss of activity.
- the gene encoding GPAT or the protein having at least 60% homology thereto can be mutated or its transcription can be reduced as is known in the art, for example by introducing a repressible promoter upstream of the gene resulting in partial inactivation of transcription in the presence of a repressing compound. If the yeast cell is Yarrowia lipolytica, GPAT activity is reduced without deleting the gene.
- the yeast cell expresses:
- the at least one heterologous desaturase selected from the group consisting of a ⁇ 1 1 desaturase having at least 60% homology to the ⁇ 1 1 desaturase from Amyelois transitella as set forth in SEQ ID NO: 2, a ⁇ 9 desaturase having at least 60% homology to the ⁇ 9 desaturase from Drosophila melanogaster as set forth in SEQ ID NO: 18, a ⁇ 1 1 desaturase having at least 60% homology to the ⁇ 1 1 desaturase from Choristoneura rosaceana as set forth in SEQ ID NO: 19 and a ⁇ 1 1 desaturase having at least 60% homology to the ⁇ 1 1 desaturase from Choristoneura parallela as set forth in SEQ ID NO: 20; preferably the at least one heterologous desaturase is a ⁇ 1 1 desaturase having at least 60% homology to the ⁇ 1 1 desaturase from Amyelois transitella as set forth in SEQ ID NO: 2 or a
- GPAT has reduced activity or total loss of activity of GPAT or of a protein having at least 65% homology thereto, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such as at least 90% homology, such as at least 91 % homology, such as at least 92% homology, such as at least 93% homology, such as at least 94% homology, such as at least 95% homology, such as at least 96% homology, such as at least 97% homology, such as at least 98% homology, such as at least 99% homology to GPAT (SEQ ID NO: 10).
- the yeast cell also has reduced or total loss of activity of Pex10 or of a protein having at least 60% homology to Pex10 (SEQ ID NO: 8), as described above.
- the yeast cell expresses:
- - has reduced activity or total loss of activity of GPAT or of a protein having at least 65% homology thereto, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such as at least 90% homology, such as at least 91 % homology, such as at least 92% homology, such as at least 93% homology, such as at least 94% homology, such as at least 95% homology, such as at least 96% homology, such as at least 97% homology, such as at least 98% homology, such as at least 99% homology to GPAT (SEQ ID NO: 10).
- the yeast cell also has reduced or total loss of activity of Pex10 or of a protein having at least 60% homology to Pex10 (SEQ ID NO: 8), as described above.
- yeast cell expresses:
- the yeast cell has reduced activity or total loss of activity of GPAT or of a protein having at least 65% homology thereto, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such as at least 90% homology, such as at least 91 % homology, such as at least 92% homology, such as at least 93% homology, such as at least 94% homology, such as at least 95% homology, such as at least 96% homology, such as at least 97% homology, such as at least 98% homology, such as at least 99% homology to GPAT (SEQ ID NO: 10).
- the yeast cell also has reduced or total loss of
- - has reduced activity or total loss of activity of GPAT or of a protein having at least 65% homology thereto, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such as at least 90% homology, such as at least 91 % homology, such as at least 92% homology, such as at least 93% homology, such as at least 94% homology, such as at least 95% homology, such as at least 96% homology, such as at least 97% homology, such as at least 98% homology, such as at least 99% homology to GPAT (SEQ ID NO: 10).
- the yeast cell also has reduced or total loss of activity of Pex10 or of a protein having at least 60% homology to Pex10 (SEQ ID NO: 8), as described above.
- yeast cell expresses:
- - has reduced activity or total loss of activity of GPAT or of a protein having at least 65% homology thereto, such as at least 70% homology, such as at least
- homology such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such as at least 90% homology, such as at least 91 % homology, such as at least 92% homology, such as at least 93% homology, such as at least 94% homology, such as at least 95% homology, such as at least 96% homology, such as at least 97% homology, such as at least 98% homology, such as at least 99% homology to GPAT (SEQ ID NO: 10).
- the yeast cell also has reduced or total loss of activity of Pex10 or of a protein having at least 60% homology to Pex10 (SEQ ID NO: 8), as described above.
- the yeast cell expresses:
- - has reduced activity or total loss of activity of GPAT or of a protein having at least 65% homology thereto, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such as at least 90% homology, such as at least 91 % homology, such as at least 92% homology, such as at least 93% homology, such as at least 94% homology, such as at least 95% homology, such as at least 96% homology, such as at least 97% homology, such as at least 98% homology, such as at least 99% homology to GPAT (SEQ ID NO: 10).
- the yeast cell also has reduced or total loss of activity of Pex10 or of a protein having at least 60% homology to Pex10 (SEQ ID NO: 8), as described above.
- the yeast cell expresses:
- heterologous desaturase having at least 60% homology to the ⁇ 9 desaturase from Drosophila melanogaster as set forth in SEQ ID NO: 18; and - at least one heterologous fatty acyl-CoA reductase having at least 80%
- - has reduced activity or total loss of activity of GPAT or of a protein having at least 65% homology thereto, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such as at least 90% homology, such as at least 91 % homology, such as at least 92% homology, such as at least 93% homology, such as at least 94% homology, such as at least 95% homology, such as at least 96% homology, such as at least 97% homology, such as at least 98% homology, such as at least 99% homology to GPAT (SEQ ID NO: 10).
- the yeast cell also has reduced or total loss of activity of Pex10 or of a protein having at least 60% homology to Pex10 (SEQ ID NO: 8), as described above.
- the yeast cell expresses:
- the yeast cell also has reduced or total loss of activity of Pex10 or of a protein having at least 60% homology to Pex10 (SEQ ID NO: 8), as described above.
- yeast cell expresses:
- - has reduced activity or total loss of activity of GPAT or of a protein having at least 65% homology thereto, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such as at least 90% homology, such as at least 91 % homology, such as at least 92% homology, such as at least 93% homology, such as at least 94% homology, such as at least 95% homology, such as at least 96% homology, such as at least 97% homology, such as at least 98% homology, such as at least 99% homology to GPAT (SEQ ID NO: 10).
- the yeast cell also has reduced or total loss of activity of Pex10 or of a protein having at least 60% homology to Pex10 (SEQ ID NO: 8), as described above.
- the yeast cell is a Yarrowia cell, such as a Yarrowia lipolytica cell. Reduction of activity of two or more of HfcM , Hfd4, Pex10, Fao1 and GPAT
- the yeast cell has reduced or total loss of activity of Pex10 or of a protein having at least 60% homology to Pex10 (SEQ ID NO: 8), as described above, and of one or more of Hfd1 , Hfd4, Fao1 and GPAT, or homologues thereof having at least 65% homology thereto, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such as at least 90% homology, such as at least 91 % homology, such as at least 92% homology, such as at least 93% homology, such as at least 94% homo
- the yeast cell has reduced activity of two or more of Hfd1 , Hfd4, Pex10, Fao1 and GPAT, or homologues thereof having at least 65% homology thereto, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such as at least 90% homology, such as at least 91 % homology, such as at least 92% homology, such as at least 93% homology, such as at least 94% homology, such as at least 95% homology, such as at least 96% homology, such as at least 97% homology, such as at least 98% homology, such as at least 99% homology to
- the yeast cell expresses at least one heterologous desaturase as described above and at least one fatty acyl-CoA reductase as described above, and has reduced activity of Hfd1 and Hfd4 or homologues thereof having at least 65% homology thereto, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such as at least 90% homology, such as at least 91 % homology, such as at least 92% homology, such as at least 93% homology, such as at least 94% homology, such as at least 95% homology, such as at least 96% homology, such as at least 97% homology,
- the yeast cell expresses at least one heterologous desaturase as described above and at least one fatty acyl-CoA reductase as described above, and has reduced activity of Hfd1 and Pex10 or homologues thereof having at least 65% homology thereto, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such as at least 90% homology, such as at least 91 % homology, such as at least 92% homology, such as at least 93% homology, such as at least 94% homology, such as at least 95% homology, such as at least 96% homology, such as at least 97% homology, such
- the yeast cell expresses at least one heterologous desaturase as described above and at least one fatty acyl-CoA reductase as described above, and has reduced activity of Hfd1 and Fao1 or homologues thereof having at least 65% homology thereto, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such as at least 90% homology, such as at least 91 % homology, such as at least 92% homology, such as at least 93% homology, such as at least 94% homology, such as at least 95% homology, such as at least 96% homology, such as at least 97% homology, such
- the yeast cell expresses at least one heterologous desaturase as described above and at least one fatty acyl-CoA reductase as described above, and has reduced activity of Hfd1 and GPAT or homologues thereof having at least 65% homology thereto, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such as at least 90% homology, such as at least 91 % homology, such as at least 92% homology, such as at least 93% homology, such as at least 94% homology, such as at least 95% homology, such as at least 96% homology, such as at least 97% homology, such
- the yeast cell expresses at least one heterologous desaturase as described above and at least one fatty acyl-CoA reductase as described above, and has reduced activity of Hfd4 and Pex10 or homologues thereof having at least 65% homology thereto, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such as at least 90% homology, such as at least 91 % homology, such as at least 92% homology, such as at least 93% homology, such as at least 94% homology, such as at least 95% homology, such as at least 96% homology, such as at least 97% homology, such
- the yeast cell expresses at least one heterologous desaturase as described above and at least one fatty acyl-CoA reductase as described above, and has reduced activity of Hfd4 and Fao1 or homologues thereof having at least 65% homology thereto, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such as at least 90% homology, such as at least 91 % homology, such as at least 92% homology, such as at least 93% homology, such as at least 94% homology, such as at least 95% homology, such as at least 96% homology, such as at least 97% homology, such
- the yeast cell expresses at least one heterologous desaturase as described above and at least one fatty acyl-CoA reductase as described above, and has reduced activity of Hfd4 and GPAT or homologues thereof having at least 65% homology thereto, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such as at least 90% homology, such as at least 91 % homology, such as at least 92% homology, such as at least 93% homology, such as at least 94% homology, such as at least 95% homology, such as at least 96% homology, such as at least 97% homology, such
- the yeast cell expresses at least one heterologous desaturase as described above and at least one fatty acyl-CoA reductase as described above, and has reduced activity of Pex10 and Fao1 or homologues thereof having at least 65% homology thereto, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such as at least 90% homology, such as at least 91 % homology, such as at least 92% homology, such as at least 93% homology, such as at least 94% homology, such as at least 95% homology, such as at least 96% homology, such as at least 97% homology, such as
- the yeast cell expresses at least one heterologous desaturase as described above and at least one fatty acyl-CoA reductase as described above, and has reduced activity of Pex10 and GPAT or homologues thereof having at least 65% homology thereto, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such as at least 90% homology, such as at least 91 % homology, such as at least 92% homology, such as at least 93% homology, such as at least 94% homology, such as at least 95% homology, such as at least 96% homology, such as at least 97% homology, such as
- the yeast cell expresses at least one heterologous desaturase as described above and at least one fatty acyl-CoA reductase as described above, and has reduced activity of Fao1 and GPAT or homologues thereof having at least 65% homology thereto, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such as at least 90% homology, such as at least 91 % homology, such as at least 92% homology, such as at least 93% homology, such as at least 94% homology, such as at least 95% homology, such as at least 96% homology, such as at least 97% homology, such as
- the yeast cell has reduced activity of three or more of Hfd1 , Hfd4, Pex10, Fao1 and GPAT, or homologues thereof having at least 65% homology thereto, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such as at least 90% homology, such as at least 91 % homology, such as at least 92% homology, such as at least 93% homology, such as at least 94% homology, such as at least 95% homology, such as at least 96% homology, such as at least 97% homology, such as at least 98% homology, such as at least 99% homology to Hfc
- the yeast cell expresses at least one heterologous desaturase as described above and at least one fatty acyl-CoA reductase as described above, and has reduced activity of Hfd1 , Hfd4 and Pex10 or homologues thereof having at least 65% homology thereto.
- the yeast cell expresses at least one heterologous desaturase as described above and at least one fatty acyl-CoA reductase as described above, and has reduced activity of Hfd1 , Hfd4 and Fao1 or homologues thereof having at least 65% homology thereto.
- the yeast cell expresses at least one heterologous desaturase as described above and at least one fatty acyl-CoA reductase as described above, and has reduced activity of Hfd1 , Hfd4 and GPAT or homologues thereof having at least 65% homology thereto.
- the yeast cell expresses at least one heterologous desaturase as described above and at least one fatty acyl-CoA reductase as described above, and has reduced activity of Hfd1 , Pex10 and Fao1 or homologues thereof having at least 65% homology thereto.
- the yeast cell expresses at least one heterologous desaturase as described above and at least one fatty acyl-CoA reductase as described above, and has reduced activity of Hfd1 , Pex10 and GPAT or homologues thereof having at least 65% homology thereto.
- the yeast cell expresses at least one heterologous desaturase as described above and at least one fatty acyl-CoA reductase as described above, and has reduced activity of Hfd1 , Fao1 and GPAT or homologues thereof having at least 65% homology thereto.
- the yeast cell expresses at least one heterologous desaturase as described above and at least one fatty acyl-CoA reductase as described above, and has reduced activity of Hfd4, Pex10 and Fao1 or homologues thereof having at least 65% homology thereto.
- the yeast cell expresses at least one heterologous desaturase as described above and at least one fatty acyl-CoA reductase as described above, and has reduced activity of Hfd4, Pex10 and GPAT or homologues thereof having at least 65% homology thereto.
- the yeast cell expresses at least one heterologous desaturase as described above and at least one fatty acyl-CoA reductase as described above, and has reduced activity of Hfd4, Fao1 and GPAT or homologues thereof having at least 65% homology thereto.
- the yeast cell expresses at least one heterologous desaturase as described above and at least one fatty acyl-CoA reductase as described above, and has reduced activity of Pex10, Fao1 and GPAT or homologues thereof having at least 65% homology thereto.
- the yeast cell has reduced activity of four or more of Hfd1 , Hfd4, Pex10, Fao1 and GPAT, or homologues thereof having at least 65% homology thereto, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such as at least 90% homology, such as at least 91 % homology, such as at least 92% homology, such as at least 93% homology, such as at least 94% homology, such as at least 95% homology, such as at least 96% homology, such as at least 97% homology, such as at least 98% homology, such as at least 99% homology to Hfd
- the yeast cell expresses at least one heterologous desaturase as described above and at least one fatty acyl-CoA reductase as described above, and has reduced activity of Hfd1 , Hfd4, Pex10 and Fao1 or homologues thereof having at least 65% homology thereto.
- the yeast cell expresses at least one heterologous desaturase as described above and at least one fatty acyl-CoA reductase as described above, and has reduced activity of Hfd1 , Hfd4, Pex10 and GPAT or homologues thereof having at least 65% homology thereto.
- the yeast cell expresses at least one heterologous desaturase as described above and at least one fatty acyl-CoA reductase as described above, and has reduced activity of Hfd1 , Pex10, Fao1 and GPAT or homologues thereof having at least 65% homology thereto.
- the yeast cell expresses at least one heterologous desaturase as described above and at least one fatty acyl-CoA reductase as described above, and has reduced activity of Hfd1 , Hfd4, Fao1 and GPAT or homologues thereof having at least 65% homology thereto.
- the yeast cell expresses at least one heterologous desaturase as described above and at least one fatty acyl-CoA reductase as described above, and has reduced activity of Hfd4, Pex10, Fao1 and GPAT or homologues thereof having at least 65% homology thereto.
- the yeast cell has reduced activity of all of Hfd1 , Hfd4, Pex10, Fao1 and GPAT, or homologues thereof having at least 65% homology thereto, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such as at least 90% homology, such as at least 91 % homology, such as at least 92% homology, such as at least 93% homology, such as at least 94% homology, such as at least 95% homology, such as at least 96% homology, such as at least 97% homology, such as at least 98% homology, such as at least 99% homology to Hfd1 as
- acetyltransferase refers to enzymes of EC number 2.3.1 .84 and can also be termed “alcohol-O-acetyltransferase” or "AcT”. It acts on aliphatic alcohols, and catalyses the reaction:
- Acetyl-CoA + an alcohol ⁇ > CoA + an acetyl ester.
- the yeast cell of the present disclosure may express or overexpress an
- the acetyltransferase may be a native acetyltransferase which the cell to be modified is already capable of expressing, or it may be a heterologous acetyltransferase. If the yeast cell expresses a native acetyltransferase, the yeast cell is preferably modified so that expression of the native acetyltransferase is increased.
- a heterologous acetyltransferase may be expressed from a nucleic acid introduced in the cell, e.g. on a vector such as a plasmid, or by genomic integration.
- the nucleic acid may be codon-optimised for any purpose as is known in the art for the specific yeast cell used.
- a nucleic acid encoding a heterologous acetyltransferase may be introduced in the cell, either in a genomic location or on a vector, to enable expression of the acetyltransferase.
- the acetyltransferase is expressed at a high level, e.g. by introducing multiple copies of the nucleic acid encoding the acetyltransferase, or by taking advantage of a constitutive promoter with a high expression level, or of an inducible promoter which upon induction leads to high expression levels.
- overexpress thus refers to the overexpression of an acetyltransferase in a yeast cell when compared to a yeast cell which has not been modified to overexpress the acetyltransferase, i.e. the parent strain.
- the acetyltransferase is the AcT of SEQ ID NO: 62 (Atf1 , the S.
- At least 75% homology to Sc_Atf 1 such as at least 76%, such as at least 77%, such as at least 78%, such as at least 79%, such as at least 80%, such as at least 81 %, such as at least 82%, such as at least 83%, such as at least 84%, such as at least 85%, such as at least 86%, such as at least 87%, such as at least 88%, such as at least 89%, such as at least 90%, such as at least 91 %, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% homology to SEQ ID NO: 62.
- the conversion of at least part of the desaturated fatty alcohols to desaturated fatty acyl acetates is done chemically, as is known to the skilled person.
- acetyl chloride can be added to the fatty alcohol and the mixture incubated at room temperature after mixing.
- yeast cells of the present disclosure can be used for the production of compounds which are naturally comprised within pheromones, in particular Lepidoptera
- Such compounds are typically not naturally produced by oleaginous yeast cells.
- the pheromone compounds comprise desaturated and saturated fatty alcohols, desaturated and saturated fatty acyl acetates, and desaturated and saturated fatty aldehydes.
- the compounds produced by the cells and methods of the present disclosure are desaturated.
- the compounds obtainable by the present methods using the present cells may be naturally occurring pheromone compounds of a number of Lepidoptera species.
- the larvae of many lepidopteran species are major pests in agriculture. Some of the major pests include Tortricidae, Noctuidae, and Pyralidae.
- the larvae of the Noctuidae genus Spodoptera (armyworms), Helicoverpa (corn earworm), or Pieris brassicae can cause extensive damage to certain crops.
- Helicoverpa zea larvae cotton bollworms or tomato fruitworms
- the compounds obtainable by the present methods using the present cells may be naturally occurring pheromone compounds of the Tortricidae, Noctuidae, and Pyralidae genera.
- the compounds are naturally occurring in Spodoptera or Helicoverpa.
- the compounds are naturally occurring in Tuta absoluta (tomato moth), Lobesia botrana (grapevine moth),
- the yeast cells of the present disclosure can be used for the production of desaturated fatty alcohols.
- Such compounds are naturally comprised within pheromones, in particular Lepidoptera pheromones, as detailed above.
- the present oleaginous yeast cell expresses at least one heterologous desaturase capable of introducing at least one double bond in a fatty acyl-CoA; and at least one heterologous fatty acyl-CoA reductase, capable of converting at least part of said desaturated fatty acyl-CoA to a desaturated fatty alcohol; and has reduced activity of at least one of Hfd1 (SEQ ID NO: 4), Hfd4 (SEQ ID NO: 6), Pex10 (SEQ ID NO: 8), Fao1 (SEQ ID NO: 22) and GPAT (SEQ ID NO: 10) or reduced activity of at least one protein having at least 60% homology to one of Hfd1 (SEQ ID NO: 4), Hfd4 (SEQ ID NO: 6), Pex10 (SEQ ID NO: 8), Fao1 (SEQ ID NO: 22) and GPAT (SEQ ID NO: 10), such as at least 65% homology, such as at least 70% homology, such
- the yeast cell also has reduced or total loss of activity of Pex10 or of a protein having at least 60% homology to Pex10 (SEQ ID NO: 8), as described above. Accordingly, herein is provided a method for producing a desaturated fatty alcohol in an oleaginous yeast cell, said method comprising the steps of providing a yeast cell and incubating said yeast cell in a medium, wherein the yeast cell:
- ii) expresses at least one heterologous fatty acyl-CoA reductase, capable of converting at least part of said desaturated fatty acyl-CoA to a desaturated fatty alcohol, thereby producing said desaturated fatty alcohol; and iii) has reduced activity of at least one of Hfd1 (SEQ ID NO: 4), Hfd4 (SEQ ID NO: 6), Pex10 (SEQ ID NO: 8), Fao1 (SEQ ID NO: 22) and GPAT (SEQ ID NO: 10) or reduced activity of at least one protein having at least 60% homology to one of Hfd1 (SEQ ID NO: 4), Hfd4 (SEQ ID NO: 6), Pex10 (SEQ ID NO: 8), Fao1 (SEQ ID NO: 22) and GPAT (SEQ ID NO: 10), such as at least 65% homology, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least
- the yeast cell has reduced or total loss of activity of at least Pex10 or a protein having at least 60% homology to Pex10 (SEQ ID NO: 8) and at least one of Hfd1 , Hfd4, Fao1 or GPAT), as described above.
- yeast cell The yeast cell, the desaturase, the fatty acyl-CoA reductase, Hfd1 , Hfd4, Pex10, Fao1 and GPAT or homologues thereof may be as defined herein elsewhere.
- the fatty alcohols produced by such methods may be saturated or desaturated.
- desaturated fatty alcohols are most desirable, and it is an object of the present disclosure to provide methods for obtaining desaturated fatty alcohols and derivatives thereof with a high titre.
- the yeast cell of the present disclosure may thus be used for the production of a range of desaturated fatty alcohols, such as:
- ( ⁇ )- ⁇ 5 desaturated fatty alcohols having a carbon chain length of 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 ;
- the fatty alcohol has a chain length of 8. In another embodiment, the fatty alcohol has a chain length of 9. In another embodiment, the fatty alcohol has a chain length of 10. In another embodiment, the fatty alcohol has a chain length of 1 1 . In another embodiment, the fatty alcohol has a chain length of 12. In another
- the fatty alcohol has a chain length of 13. In another embodiment, the fatty alcohol has a chain length of 14. In another embodiment, the fatty alcohol has a chain length of 15. In another embodiment, the fatty alcohol has a chain length of 16. In another embodiment, the fatty alcohol has a chain length of 17. In another
- the fatty alcohol has a chain length of 18. In another embodiment, the fatty alcohol has a chain length of 19. In another embodiment, the fatty alcohol has a chain length of 20. In another embodiment, the fatty alcohol has a chain length of 21 . In another embodiment, the fatty alcohol has a chain length of 22.
- the yeast cell disclosed herein may thus express a heterologous ⁇ 9 desaturase and a fatty acyl-CoA reductase, and be used to produce fatty alcohols harbouring a desaturation in Zconformation at position 9, for example having a carbon chain length of 14 ((Z)9-14:OH).
- This fatty alcohol is a precursor of (Z)9-C14:OAc, which is an important component of pheromones derived from various species, for example the fall armyworm Spodoptera frugiperda.
- the yeast cell expresses a heterologous ⁇ 1 1 desaturase and a fatty acyl-CoA reductase, and can be used to produce fatty alcohols harbouring a desaturation in Zconformation at position 9.
- (Z)1 1 -C14:OH may be produced, i.e. a fatty alcohol having a carbon chain length of 14 harbouring a desaturation in Zconformation at position 9.
- This fatty alcohol is a precursor of (Z)1 1 - C14:OAc, which is an important component of pheromones derived from various species, for example the European corn borer Ostrinia nubilalis and the red-banded leafroller Argyrotaenia velutinana.
- the yeast cell disclosed herein may thus express a heterologous ⁇ 1 1 desaturase, a fatty acyl-CoA reductase, and acetyltransferase and be used to produce fatty alcohol acetates harbouring a desaturation in Z conformation at position 1 1 , for example having a carbon chain length of 16 ((Z)1 1 -16:01-1).
- This fatty alcohol can be oxidized into (2)1 1 -16:Ald, which is an important component of pheromones derived from various species, for example the cotton bollworm Helicoverpa armigera.
- the yeast cell expresses a heterologous ⁇ 1 1 desaturase and a fatty acyl-CoA reductase, and can be used to produce fatty alcohols harbouring a desaturation in E conformation at position 9.
- (£)1 1 -C14:OH may be produced, i.e. a fatty alcohol having a carbon chain length of 14 harbouring a desaturation in Econformation at position 9.
- This fatty alcohol is a precursor of (£)1 1 - C14:OAc, which is an important component of pheromones derived from various species, for example the lightbrown apple moth Epiphyas postvittana.
- the desaturated fatty alcohols produced by the present yeast cell may also be desaturated in more than one position.
- the desaturated fatty alcohols may be desaturated in at least two positions, such as at least three positions, such as four positions.
- (£)7, (Z)9 desaturated fatty alcohols may be produced having a carbon chain length of 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22.
- (£)3, (Z)8, (Z)1 1 desaturated fatty alcohols may be produced having a carbon chain length of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22, for example 14.
- (Z)9, (£) 1 1 , (£) 13 desaturated fatty alcohols may be produced having a carbon chain length of 14, 15, 16, 17, 18, 19, 20, 21 or 22.
- the thus produced desaturated fatty alcohols may be further modified as is known in the art, for example by carbon chain shortening.
- (£)7, (Z)9 desaturated fatty alcohols may be produced having a carbon chain length of 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22.
- (£)3, (Z)8, (Z)1 1 desaturated fatty alcohols may be produced having a carbon chain length of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22.
- (Z)9, (£)1 1 , (£)13 desaturated fatty alcohols may be produced having a carbon chain length of 14, 15, 16, 17, 18, 19, 20, 21 or 22.
- Fatty acyl acetates in particular desaturated fatty acyl acetates, are also naturally comprised within pheromones, in particular pheromones produced by species belonging to the Lepidoptera order.
- the yeast cells and methods of the present disclosure can also be used to obtain such fatty acyl acetates.
- acetyltransferase This can be done by introducing a gene encoding an acetyltransferase, as detailed above, or it can be done by chemicals methods, as is known to the skilled person.
- acetyl chloride can be added to the fatty alcohol and the mixture incubated at room temperature after mixing.
- the yeast cell of the present disclosure may optionally express or overexpress an acetyltransferase capable of converting at least part of the desaturated fatty alcohols produced by the cell in desaturated fatty acyl acetates, and may thus be used for the production of a range of desaturated fatty acetates having a carbon chain length of 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22, such as:
- ( ⁇ )- ⁇ 5 desaturated fatty acetates having a carbon chain length of 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22;
- ( ⁇ )- ⁇ 9 desaturated fatty acetates having a carbon chain length of 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22;
- the fatty acyl acetate has a chain length of 8. In another embodiment, the fatty acyl acetate has a chain length of 9. In another embodiment, the fatty acyl acetate has a chain length of 10. In another embodiment, the fatty acyl acetate has a chain length of 1 1 . In another embodiment, the fatty acyl acetate has a chain length of 12. In another embodiment, the fatty acyl acetate has a chain length of 13. In another embodiment, the fatty acyl acetate has a chain length of 14. In another embodiment, the fatty acyl acetate has a chain length of 15. In another embodiment, the fatty acyl acetate has a chain length of 16.
- the fatty acyl acetate has a chain length of 17. In another embodiment, the fatty acyl acetate has a chain length of 18. In another embodiment, the fatty acyl acetate has a chain length of 19. In another embodiment, the fatty acyl acetate has a chain length of 20. In another embodiment, the fatty acyl acetate has a chain length of 21 . In another embodiment, the fatty acyl acetate has a chain length of 22.
- the yeast cell expresses a heterologous ⁇ 9 desaturase, a heterologous FAR and an acetyltransferase, and has reduced activity of at least one of Hfd1 (SEQ ID NO: 4), Hfd4 (SEQ ID NO: 6), Pex10 (SEQ ID NO: 8), Fao1 (SEQ ID NO: 22) and GPAT (SEQ ID NO: 10) or reduced activity of at least one protein having at least 60% homology to one of Hfd1 (SEQ ID NO: 4), Hfd4 (SEQ ID NO: 6), Pex10 (SEQ ID NO: 8), Fao1 (SEQ ID NO: 22) and GPAT (SEQ ID NO: 10), and can be used to obtain (Z)9-C14:OAc, i.e.
- the yeast cell has reduced or total loss of activity of at least Pex10 or a protein having at least 60% homology to Pex10 (SEQ ID NO: 8 and at least one of Hfd1 , Hfd4, Fao1 or GPAT), as described above.
- the yeast cell expresses a heterologous ⁇ 1 1 desaturase, a heterologous FAR and an acetyltransferase, and has reduced activity of at least one of Hfd1 (SEQ ID NO: 4), Hfd4 (SEQ ID NO: 6), Pex10 (SEQ ID NO: 8), Fao1 (SEQ ID NO: 22) and GPAT (SEQ ID NO: 10) or reduced activity of at least one protein having at least 60% homology to one of Hfd1 (SEQ ID NO: 4), Hfd4 (SEQ ID NO: 6), Pex10 (SEQ ID NO: 8), Fao1 (SEQ ID NO: 22) and GPAT (SEQ ID NO: 10), and can be used to produce (Z)1 1 -C14:OAc, i.e.
- This fatty acyl acetate is an important component of pheromones derived from various species, for example the European corn borer Ostrinia nubilalis and the red-banded leafroller Argyrotaenia velutinana.
- the yeast cell has reduced or total loss of activity of at least Pex10 or a protein having at least 60% homology to Pex10 (SEQ ID NO: 8 and at least one of Hfd1 , Hfd4, Fao1 or GPAT), as described above.
- the yeast cell expresses a heterologous ⁇ 1 1 desaturase, a heterologous FAR, and has reduced activity of at least one of Hfd1 (SEQ ID NO: 4),
- Hfd4 (SEQ ID NO: 6), Pex10 (SEQ ID NO: 8), Fao1 (SEQ ID NO: 22) and GPAT (SEQ ID NO: 10) or reduced activity of at least one protein having at least 60% homology to one of Hfd1 (SEQ ID NO: 4), Hfd4 (SEQ ID NO: 6), Pex10 (SEQ ID NO: 8), Fao1 (SEQ ID NO: 22) and GPAT (SEQ ID NO: 10), and can be used to obtain (2)1 1 -C16:OH.
- This fatty alcohol can be oxidized into (2)1 1 -C16:Ald, which is an important component of pheromones derived from various species, for example the cotton bollworm
- the yeast cell has reduced or total loss of activity of at least Pex10 or a protein having at least 60% homology to Pex10 (SEQ ID NO: 8 and at least one of Hfd1 , Hfd4, Fao1 or GPAT), as described above.
- the yeast cell expresses a heterologous ⁇ 1 1 desaturase, a heterologous FAR and an acetyltransferase, and has reduced activity of at least one of Hfd1 (SEQ ID NO: 4), Hfd4 (SEQ ID NO: 6), Pex10 (SEQ ID NO: 8), Fao1 (SEQ ID NO: 22) and GPAT (SEQ ID NO: 10) or reduced activity of at least one protein having at least 60% homology to one of Hfd1 (SEQ ID NO: 4), Hfd4 (SEQ ID NO: 6), Pex10 (SEQ ID NO: 8), Fao1 (SEQ ID NO: 22) and GPAT (SEQ ID NO: 10), and can be used to produce (£)1 1 -C14:OAc, i.e.
- the yeast cell has reduced or total loss of activity of at least Pex10 or a protein having at least 60% homology to Pex10 (SEQ ID NO: 8 and at least one of Hfd1 , Hfd4, Fao1 or GPAT), as described above.
- the yeast cell expresses a heterologous ⁇ 10 desaturase, a heterologous FAR and an acetyltransferase, and has reduced activity of at least one of Hfd1 (SEQ ID NO: 4), Hfd4 (SEQ ID NO: 6), Pex10 (SEQ ID NO: 8), Fao1 (SEQ ID NO: 22) and GPAT (SEQ ID NO: 10) or reduced activity of at least one protein having at least 60% homology to one of Hfd1 (SEQ ID NO: 4), Hfd4 (SEQ ID NO: 6), Pex10 (SEQ ID NO: 8), Fao1 (SEQ ID NO: 22) and GPAT (SEQ ID NO: 10), and can be used to produce (2)10-C14:OAc, i.e.
- the yeast cell has reduced or total loss of activity of at least Pex10 or a protein having at least 60% homology to Pex10 (SEQ ID NO: 8 and at least one of Hfd1 , Hfd4, Fao1 or GPAT), as described above.
- the desaturated fatty acetates produced by the present yeast cell may also be desaturated in more than one position.
- the desaturated fatty acetates may be desaturated in at least two positions, such as at least three positions, such as four positions.
- (£)7, (Z)9 desaturated fatty acetates may be produced having a carbon chain length of 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22.
- (£)3, (Z)8, (Z)1 1 desaturated fatty acetates may be produced having a carbon chain length of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22.
- (Z)9, (£)1 1 , (£)13 desaturated fatty acetates may be produced having a carbon chain length of 14, 15, 16, 17, 18, 19, 20, 21 or 22.
- the thus produced desaturated fatty acetates may be further modified as is known in the art, for example by carbon chain shortening.
- (£)7, (Z)9 desaturated fatty acetates may be produced having a carbon chain length of 12 starting from fatty acetates having a carbon chain length of 14, (£)3, (Z)8, (Z)1 1 desaturated fatty acetates may be produced having a carbon chain length of 12 starting from fatty acetates having a carbon chain length of 14, and (Z)9, (£)1 1 , (£)13 desaturated fatty acetates may be produced having a carbon chain length of 12 starting from fatty acetates having a carbon chain length of 14.
- the yeast cell expresses a heterologous ⁇ 9 desaturase, a ⁇ 1 1 desaturase, a heterologous FAR and an acetyltransferase, and has reduced activity of at least one of Hfd1 (SEQ ID NO: 4), Hfd4 (SEQ ID NO: 6), Pex10 (SEQ ID NO: 8), Fao1 (SEQ ID NO: 22) and GPAT (SEQ ID NO: 10) or reduced activity of at least one protein having at least 60% homology to one of Hfd1 (SEQ ID NO: 4), Hfd4 (SEQ ID NO: 6), Pex10 (SEQ ID NO: 8), Fao1 (SEQ ID NO: 22) and GPAT (SEQ ID NO: 10), and can be used to produce (£)9, (2)1 1 -C 14:0 Ac, i.e.
- the yeast cell has reduced or total loss of activity of at least Pex10 or a protein having at least 60% homology to Pex10 (SEQ ID NO: 8 and at least one of Hfd1 , Hfd4, Fao1 or GPAT), as described above.
- the present disclosure provides methods for producing desaturated fatty alcohols and desaturated fatty acyl acetates, it may be of interest to further convert said fatty alcohols to the corresponding aldehydes.
- the method may further comprise the step of converting at least part of the fatty alcohols to fatty aldehydes, thereby producing fatty aldehydes. This can be achieved by chemical methods or by further engineering of the yeast cell.
- the step of converting at least part of the fatty alcohols to the corresponding aldehydes is a step of chemical conversion.
- the chemical conversion is based on the oxidation of fatty alcohols to the corresponding aldehydes. Methods for performing this conversion are known in the art. Preferred methods are environmentally friendly and minimize the amount of hazardous waste.
- the method comprises a Copper(l)/ABNO-catalysed aerobic alcohol oxidation reaction (Steves & Stahl, 2013).
- the chemical conversion may be metal free, avoiding toxic heavy metal based reagents such as manganese oxides, chromium oxides (Jones ox. PDC, PCC) or ruthenium compounds (TPAP, Ley-Griffith ox.).
- the conversion does not involve reactions with activated dimethyl sulfoxide such as the Swern oxidation or the Pfitzner-Moffat type. Such reactions may involve the stereotypic formation of traces of intensively smelling organic sulfur compounds such as dimethyl sulfide which can be difficult to remove from the target product.
- the method comprises a Dess-Martin reaction (Yadav et al., 2004, Meyer et al., 1994).
- the chemical conversion comprises the oxidation with sodium hypochlorite under aqueous/organic two phase conditions (Okada et al., 2014; Tamura et al., 2012; Li et al., 2009).
- the chemical oxidation can be performed with 1 - chlorobenzotriazole in a medium of methylene chloride containing 25% pyridine (Ferrell and Yao, 1972).
- the oxidation of a fatty alcohol to the corresponding fatty aldehyde can be performed enzymatically by alcohol dehydrogenases.
- alcohol dehydrogenases The skilled person will know how to carry out enzymatic oxidation.
- enzymatic oxidation can be carried out by contacting purified enzymes, cell extracts or whole cells, with the fatty alcohol.
- the fatty alcohols obtainable by the cells and methods described herein can be further converted in fatty aldehydes by introducing a gene encoding an aldehyde-forming fatty acyl-CoA reductase EC 1 .2.1 .50 (FAR').
- FAR' aldehyde-forming fatty acyl-CoA reductase
- the enzymes capable of catalyzing this conversion can catalyse a reduction reaction, where the fatty acyl-CoA is reduced to a fatty aldehyde.
- Such enzymes are aldehyde-forming fatty acyl-CoA reductases, herein also referred to as FAR' or “aldehyde-forming FAR' ", with an EC number 1 .2.1 .50. They catalyse the following reaction:
- Fatty acyl-CoA + NADPH fatty aldehyde + NADP+ + coenzyme A.
- expression of the aldehyde-forming FAR' can be induced, for example if the genes encoding this enzyme is under the control of inducible promoters, as is known in the art.
- the yeast cell is incubated under suitable conditions, such as in an appropriate medium and at an appropriate temperature as is known to a person of skill in the art.
- suitable media supporting yeast growth are known in the art and include, but are not limited to: undefined, complete media such as YEPD (or YPD, Yeast Extract Peptone Dextrose), defined, complete medium such as SC (Synthetic
- drop-out medium such as SD (Synthetic Dextrose) lacking one or more elements such as an amino acid or an inducer.
- ( ⁇ )- ⁇ 7 desaturated fatty aldehydes having a carbon chain length of 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22;
- the fatty acyl aldehyde has a chain length of 8. In another embodiment, the fatty acyl aldehyde has a chain length of 9. In another embodiment, the fatty acyl aldehyde has a chain length of 10. In another embodiment, the fatty acyl aldehyde has a chain length of 1 1 . In another embodiment, the fatty acyl aldehyde has a chain length of 12. In another embodiment, the fatty acyl aldehyde has a chain length of 13. In another embodiment, the fatty acyl aldehyde has a chain length of 14. In another embodiment, the fatty acyl aldehyde has a chain length of 15.
- the fatty acyl aldehyde has a chain length of 16. In another embodiment, the fatty acyl aldehyde has a chain length of 17. In another embodiment, the fatty acyl aldehyde has a chain length of 18. In another embodiment, the fatty acyl aldehyde has a chain length of 19. In another embodiment, the fatty acyl aldehyde has a chain length of 20. In another embodiment, the fatty acyl aldehyde has a chain length of 21 . In another embodiment, the fatty acyl aldehyde has a chain length of 22.
- the desaturated fatty aldehydes produced by the present yeast cell may also be desaturated in more than one position.
- the desaturated fatty aldehydes may be desaturated in at least two positions, such as at least three positions, such as four positions.
- (£)7, (Z)9 desaturated fatty aldehydes may be produced having a carbon chain length of 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22, such as 14.
- (£)3, (Z)8, (Z)1 1 desaturated fatty aldehydes may be produced having a carbon chain length of 14.
- (Z)9, (£)1 1 , (£)13 desaturated fatty aldehydes may be produced having a carbon chain length of 14, 15, 16, 17, 18, 19, 20, 21 or 22, such as 14.
- the thus produced desaturated fatty aldehydes may be further modified as is known in the art, for example by carbon chain shortening.
- (£)7, (Z)9 desaturated fatty aldehydes may be produced having a carbon chain length of 12 starting from fatty aldehydes having a carbon chain length of 14, (£)3, (Z)8, (2)1 1 desaturated fatty aldehydes may be produced having a carbon chain length of 12 starting from fatty aldehydes having a carbon chain length of 14, and (Z)9, (£)1 1 , (£)13 desaturated fatty aldehydes may be produced having a carbon chain length of 12 starting from fatty aldehydes having a carbon chain length of 14.
- the yeast cell In order for the yeast cell to produce desaturated fatty alcohols and desaturated fatty acyl acetates as described herein, the yeast cell needs fatty acyl-CoAs as a susbtrate.
- the fatty acyl-CoA has a carbon chain length of 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22.
- the fatty acyl-CoA has a carbon chain length of 8.
- the fatty acyl-CoA has a carbon chain length of 9.
- the fatty acyl-CoA has a carbon chain length of 10.
- the fatty acyl -CoA has a carbon chain length of 1 1 .
- the fatty acyl -CoA has a carbon chain length of 12. In another embodiment, the fatty acyl ⁇ CoA has a carbon chain length of 13. In another embodiment, the fatty acyl ⁇ CoA has a carbon chain length of 14. In another embodiment, the fatty acyl ⁇ CoA has a carbon chain length of 15. In another embodiment, the fatty acyl ⁇ CoA has a carbon chain length of 16. In another embodiment, the fatty acyl ⁇ CoA has a carbon chain length of 17. In another embodiment, the fatty acyl ⁇ CoA has a carbon chain length of 18. In another embodiment, the fatty acyl ⁇ CoA has a carbon chain length of 19.
- the fatty acyl ⁇ CoA has a carbon chain length of 20. In another embodiment, the fatty acyl ⁇ CoA has a carbon chain length of 21 . In another embodiment, the fatty acyl ⁇ CoA has a carbon chain length of 22. In some embodiments a mixture of fatty acyl-CoAs having different carbon chain lengths is provided.
- Such fatty acyl-CoAs can either be provided in the medium in which the yeast cell is incubated, or the yeast cell may be naturally able to produce such fatty acyl-CoA, or the yeast cell may be engineered in order to produce or to increase production of such fatty acyl-CoAs.
- the yeast cell is not naturally capable of producing a fatty acyl- CoA having a carbon chain length of 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22, or a mixture thereof.
- the yeast cell may in this case be engineered as is known in the art, for example by the introduction of a heterologous thioesterase.
- a nucleic acid encoding a thioesterase is introduced in the yeast cell, on a vector or by genomic integration.
- the thioesterase gene may be under the control of an inducible promoter, or under the control of a constitutive promoter.
- the nucleic acid encoding a thioesterase may be codon-optimised for any purpose for the yeast cell, as is known in the art.
- the nucleic acid may be codon-optimised for any purpose for a Yarrowia cell, such as a Yarrowia lipolytica cell.
- the thioesterase is derived from an organism selected from Cuphea palustris, Cuphea hookeriana, Cinnamomum camphora, or from Escherichia coli.
- the present disclosure provides a yeast cell which has been modified to produce a desaturated fatty alcohol, and optionally a desaturated fatty acyl acetate.
- Desaturated fatty alcohols and desaturated fatty acyl acetates are components of pheromones, in particular of moth pheromones.
- the yeast cell disclosed herein thus provides a platform for environment-friendly moth pheromone production.
- the cell has been modified at the genomic level, e.g. by gene editing in the genome.
- the cell may also be modified by insertion of at least one nucleic acid construct such as at least one vector.
- the vector may be designed as is known to the skilled person to either enable integration of nucleic acid sequences in the genome, or to enable expression of a polypeptide encoded by a nucleic acid sequence comprised in the vector without genome integration.
- yeast or fungi of genera including, but not limited to, Blakeslea, Candida, Cryptococcus, Cunninghamella, Lipomyces, Mortierella, Mucor, Phycomyces, Pythium, Rhodosporidium, Rhodotorula, Trichosporon, and Yarrowia are employed.
- organisms of species that include, but are not limited to, Blakeslea trispora, Candida pulcherrima, C. revêti, C. tropicalis, Cryptococcus curvatus, Cunninghamella echinulata, C. elegans, C. japonica, Lipomyces starkeyi, L. lipoferus, Mortierella alpina, M. isabellina, M. ramanniana, M. vinacea, Mucor circinelloides, Phycomyces blakesleanus, Pythium irregulare,
- Rhodosporidium toruloides Rhodotorula glutinis, R. gracilis, R. graminis, R.
- the oleaginous yeast cell is a Yarrowia lipolytica cell.
- the yeast cell to be modified which will also be referred to as the host cell, may express native enzymes which are of the same class than the enzymes which are necessary for the production of desaturated fatty alcohols and desaturated fatty acyl acetates.
- native enzymes may have a negative impact on the titre of desaturated fatty alcohols and/or desaturated fatty acyl acetates which can be obtained; the native enzymes may thus be inactivated by methods known in the art, such as gene editing.
- the genes encoding the native enzymes having a negative impact on the titre may be deleted or mutated so as to lead to total or partial loss of activity of the native enzyme.
- the yeast cell of the present disclosure express at least one heterologous desaturase capable of introducing at least one double bond in a fatty acyl-CoA having a carbon chain length of 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 as described herein, at least one heterologous fatty acyl-CoA reductase capable of converting at least part of said desaturated fatty acyl-CoA to a desaturated fatty alcohol as described herein, and optionally an acetyltransferase capable of converting at least part of said desaturated fatty alcohol to a desaturated fatty acyl acetate, and has reduced activity of at least one of Hfd1 (SEQ ID NO: 4), Hfd4 (SEQ ID NO: 6), Pex10 (SEQ ID NO: 8), Fao1 (SEQ ID NO: 22) and GPAT (SEQ ID NO: 10) or reduced activity of at least one protein having at least 60% homology to one of Hfd1
- the yeast cell also expresses an acetyltransferase. In some embodiments, the yeast cell also expresses a thioesterase. In specific embodiments, the yeast cell has reduced or total loss of activity of at least Pex10 or a protein having at least 60% homology to Pex10 (SEQ ID NO: 8 and at least one of Hfd1 , Hfd4, Fao1 or GPAT), as described above.
- the yeast cell in one embodiment, the yeast cell:
- i) expresses at least one heterologous desaturase capable of introducing at least one double bond in a fatty acyl-CoA, and is thereby capable of converting at least part of said fatty acyl-CoA to a desaturated fatty acyl- CoA;
- ii) expresses at least one heterologous fatty acyl-CoA reductase, capable of converting at least part of said desaturated fatty acyl-CoA to a desaturated fatty alcohol, thereby producing said desaturated fatty alcohol, and iii) has reduced activity of at least one of Hfd1 (SEQ ID NO: 4), Hfd4 (SEQ ID NO: 6), Pex10 (SEQ ID NO: 8), Fao1 (SEQ ID NO: 22) and GPAT (SEQ ID NO: 10), or reduced activity of at least one protein having at least 60% homology to one of Hfd1 (SEQ ID NO: 4), Hfd4 (SEQ ID NO: 6), Pex10 (SEQ ID NO: 8), Fao1 (SEQ ID NO: 22) and GPAT (SEQ ID NO: 10), such as at least 65% homology, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least
- the yeast cell has reduced or total loss of activity of at least Pex10 or a protein having at least 60% homology to Pex10 (SEQ ID NO: 8 and at least one of Hfd1 , Hfd4, Fao1 or GPAT), as described above.
- the yeast cell in one embodiment, the yeast cell:
- ii) expresses at least one heterologous fatty acyl-CoA reductase; and iii) has reduced activity of at least one of Hfd1 (SEQ ID NO: 4), Hfd4 (SEQ ID NO: 6), Pex10 (SEQ ID NO: 8), Fao1 (SEQ ID NO: 22) and GPAT (SEQ ID NO: 10), or reduced activity of at least one protein having at least 60% homology to one of Hfd1 (SEQ ID NO: 4), Hfd4 (SEQ ID NO: 6), Pex10 (SEQ ID NO: 8), Fao1 (SEQ ID NO: 22) and GPAT (SEQ ID NO: 10).
- the yeast cell has reduced or total loss of activity of at least Pex10 or a protein having at least 60% homology to Pex10 (SEQ ID NO: 8 and at least one of Hfd1 , Hfd4, Fao1 or GPAT), as described above.
- the FAR has at least 80% homology to the FAR from
- the FAR has at least 80% homology to the FAR from Helicoverpa assulta as set forth in SEQ ID NO: 16. In other embodiments, the FAR has at least 80% homology to the FAR from Heliothis subflexa as set forth in SEQ ID NO: 12. In other embodiments, the FAR has at least 80% homology to the FAR from Bicyclus anynana as set forth in SEQ ID NO: 24.
- the yeast cell has reduced or total loss of activity of at least Pex10 or a protein having at least 60% homology to Pex10 (SEQ ID NO: 8 and at least one of Hfd1 , Hfd4, Fao1 or GPAT), as described above.
- yeast cell in another embodiment, the yeast cell:
- ii) expresses at least one heterologous fatty acyl-CoA reductase; and iii) has reduced activity of at least one of Hfd1 (SEQ ID NO: 4), Hfd4 (SEQ ID NO: 6), Pex10 (SEQ ID NO: 8), Fao1 (SEQ ID NO: 22) and GPAT (SEQ ID NO: 10), or reduced activity of at least one protein having at least 60% homology to one of Hfd1 (SEQ ID NO: 4), Hfd4 (SEQ ID NO: 6), Pex10 (SEQ ID NO: 8), Fao1 (SEQ ID NO: 22) and GPAT (SEQ ID NO: 10).
- the yeast cell has reduced or total loss of activity of at least Pex10 or a protein having at least 60% homology to Pex10 (SEQ ID NO: 8 and at least one of Hfd1 , Hfd4, Fao1 or GPAT), as described above.
- the FAR has at least 80% homology to the FAR from
- the FAR has at least 80% homology to the FAR from Helicoverpa assulta as set forth in SEQ ID NO: 16. In other embodiments, the FAR has at least 80% homology to the FAR from Heliothis subflexa as set forth in SEQ ID NO: 12. In other embodiments, the FAR has at least 80% homology to the FAR from Bicyclus anynana as set forth in SEQ ID NO: 24.
- the yeast cell has reduced or total loss of activity of at least Pex10 or a protein having at least 60% homology to Pex10 (SEQ ID NO: 8 and at least one of Hfd1 , Hfd4, Fao1 or GPAT), as described above.
- yeast cell in another embodiment, the yeast cell:
- ii) expresses at least one heterologous fatty acyl-CoA reductase; and iii) has reduced activity of at least one of Hfd1 (SEQ ID NO: 4), Hfd4 (SEQ ID NO: 6), Pex10 (SEQ ID NO: 8), Fao1 (SEQ ID NO: 22) and GPAT (SEQ ID NO: 10), or reduced activity of at least one protein having at least 60% homology to one of Hfd1 (SEQ ID NO: 4), Hfd4 (SEQ ID NO: 6), Pex10 (SEQ ID NO: 8), Fao1 (SEQ ID NO: 22) and GPAT (SEQ ID NO: 10).
- the yeast cell has reduced or total loss of activity of at least Pex10 or a protein having at least 60% homology to Pex10 (SEQ ID NO: 8 and at least one of Hfd1 , Hfd4, Fao1 or GPAT), as described above.
- the FAR has at least 80% homology to the FAR from
- the FAR has at least 80% homology to the FAR from Helicoverpa assulta as set forth in SEQ ID NO: 16. In other embodiments, the FAR has at least 80% homology to the FAR from Heliothis subflexa as set forth in SEQ ID NO: 12. In other embodiments, the FAR has at least 80% homology to the FAR from Bicyclus anynana as set forth in SEQ ID NO: 24.
- the yeast cell has reduced or total loss of activity of at least Pex10 or a protein having at least 60% homology to Pex10 (SEQ ID NO: 8 and at least one of Hfd1 , Hfd4, Fao1 or GPAT), as described above.
- yeast cell in another embodiment, the yeast cell:
- ii) expresses at least one heterologous fatty acyl-CoA reductase; and iii) has reduced activity of at least one of Hfd1 (SEQ ID NO: 4), Hfd4 (SEQ ID NO: 6), Pex10 (SEQ ID NO: 8), Fao1 (SEQ ID NO: 22) and GPAT (SEQ ID NO: 10), or reduced activity of at least one protein having at least 60% homology to one of Hfd1 (SEQ ID NO: 4), Hfd4 (SEQ ID NO: 6), Pex10 (SEQ ID NO: 8), Fao1 (SEQ ID NO: 22) and GPAT (SEQ ID NO: 10).
- the yeast cell has reduced or total loss of activity of at least Pex10 or a protein having at least 60% homology to Pex10 (SEQ ID NO: 8 and at least one of Hfd1 , Hfd4, Fao1 or GPAT), as described above.
- the FAR has at least 80% homology to the FAR from
- the FAR has at least 80% homology to the FAR from Helicoverpa assulta as set forth in SEQ ID NO: 16. In other embodiments, the FAR has at least 80% homology to the FAR from Heliothis subflexa as set forth in SEQ ID NO: 12. In other embodiments, the FAR has at least 80% homology to the FAR from Bicyclus anynana as set forth in SEQ ID NO: 24.
- the yeast cell has reduced or total loss of activity of at least Pex10 or a protein having at least 60% homology to Pex10 (SEQ ID NO: 8 and at least one of Hfd1 , Hfd4, Fao1 or GPAT), as described above.
- yeast cell in another embodiment, the yeast cell:
- ii) expresses at least one heterologous fatty acyl-CoA reductase; and iii) has reduced activity of at least one of Hfd1 (SEQ ID NO: 4), Hfd4 (SEQ ID NO: 6), Pex10 (SEQ ID NO: 8), Fao1 (SEQ ID NO: 22) and GPAT (SEQ ID NO: 10), or reduced activity of at least one protein having at least 60% homology to one of Hfd1 (SEQ ID NO: 4), Hfd4 (SEQ ID NO: 6), Pex10 (SEQ ID NO: 8), Fao1 (SEQ ID NO: 22) and GPAT (SEQ ID NO: 10).
- the yeast cell has reduced or total loss of activity of at least Pex10 or a protein having at least 60% homology to Pex10 (SEQ ID NO: 8 and at least one of Hfd1 , Hfd4, Fao1 or GPAT), as described above.
- the FAR has at least 80% homology to the FAR from
- the FAR has at least 80% homology to the FAR from Helicoverpa assulta as set forth in SEQ ID NO: 16. In other embodiments, the FAR has at least 80% homology to the FAR from Heliothis subflexa as set forth in SEQ ID NO: 12. In other embodiments, the FAR has at least 80% homology to the FAR from Bicyclus anynana as set forth in SEQ ID NO: 24.
- the yeast cell has reduced or total loss of activity of at least Pex10 or a protein having at least 60% homology to Pex10 (SEQ ID NO: 8 and at least one of Hfd1 , Hfd4, Fao1 or GPAT), as described above.
- the yeast cell expresses at least one heterologous ⁇ 9 desaturase capable of introducing at least one double bond in a fatty acyl-CoA;
- Hfd1 expresses at least one heterologous fatty acyl-CoA reductase; and has reduced activity of at least one of Hfd1 (SEQ ID NO: 4), Hfd4 (SEQ ID NO: 6), Pex10 (SEQ ID NO: 8), Fao1 (SEQ ID NO: 22) and GPAT (SEQ ID NO: 10), or reduced activity of at least one protein having at least 60% homology to one of Hfd1 (SEQ ID NO: 4), Hfd4 (SEQ ID NO: 6), Pex10 (SEQ ID NO: 8), Fao1 (SEQ ID NO: 22) and GPAT (SEQ ID NO: 10).
- the yeast cell has reduced or total loss of activity of at least Pex10 or a protein having at least 60% homology to Pex10 (SEQ ID NO: 8 and at least one of Hfd1 , Hfd4, Fao1 or GPAT), as described above.
- the FAR has at least 80% homology to the FAR from
- the FAR has at least 80% homology to the FAR from Helicoverpa assulta as set forth in SEQ ID NO: 16. In other embodiments, the FAR has at least 80% homology to the FAR from Heliothis subflexa as set forth in SEQ ID NO: 12. In other embodiments, the FAR has at least 80% homology to the FAR from Bicyclus anynana as set forth in SEQ ID NO: 24.
- the yeast cell has reduced or total loss of activity of at least Pex10 or a protein having at least 60% homology to Pex10 (SEQ ID NO: 8 and at least one of Hfd1 , Hfd4, Fao1 or GPAT), as described above.
- the ⁇ 9 desaturase has at least 60% homology to the ⁇ 9 desaturase from Drosophila melanogaster as set forth in SEQ ID NO: 18.
- the yeast cell has reduced or total loss of activity of at least Pex10 or a protein having at least 60% homology to Pex10 (SEQ ID NO: 8 and at least one of Hfd1 , Hfd4, Fao1 or GPAT), as described above.
- yeast cell in another embodiment, the yeast cell:
- Hfd1 expresses at least one heterologous fatty acyl-CoA reductase; and has reduced activity of at least one of Hfd1 (SEQ ID NO: 4), Hfd4 (SEQ ID NO: 6), Pex10 (SEQ ID NO: 8), Fao1 (SEQ ID NO: 22) and GPAT (SEQ ID NO: 4), Hfd4 (SEQ ID NO: 6), Pex10 (SEQ ID NO: 8), Fao1 (SEQ ID NO: 22) and GPAT (SEQ ID NO: 4), Hfd4 (SEQ ID NO: 6), Pex10 (SEQ ID NO: 8), Fao1 (SEQ ID NO: 22) and GPAT (SEQ ID NO: 4), Hfd4 (SEQ ID NO: 6), Pex10 (SEQ ID NO: 8), Fao1 (SEQ ID NO: 22) and GPAT (SEQ ID NO: 4), Hfd4 (SEQ ID NO: 6), Pex10 (SEQ ID NO: 8
- Hfd1 SEQ ID NO: 4
- Hfd4 SEQ ID NO: 6
- Pex10 SEQ ID NO: 8
- Fao1 SEQ ID NO: 22
- GPAT SEQ ID NO: 10
- the yeast cell has reduced or total loss of activity of at least Pex10 or a protein having at least 60% homology to Pex10 (SEQ ID NO: 8 and at least one of Hfd1 , Hfd4, Fao1 or GPAT), as described above.
- the FAR has at least 80% homology to the FAR from
- the FAR has at least 80% homology to the FAR from Helicoverpa assulta as set forth in SEQ ID NO: 16. In other embodiments, the FAR has at least 80% homology to the FAR from Heliothis subflexa as set forth in SEQ ID NO: 12. In other embodiments, the FAR has at least 80% homology to the FAR from Bicyclus anynana as set forth in SEQ ID NO: 24.
- the yeast cell has reduced or total loss of activity of at least Pex10 or a protein having at least 60% homology to Pex10 (SEQ ID NO: 8 and at least one of Hfd1 , Hfd4, Fao1 or GPAT), as described above.
- yeast cell in another embodiment, the yeast cell:
- ⁇ ) expresses at least one heterologous fatty acyl-CoA reductase; and iii) has reduced activity of at least one of Hfd1 (SEQ ID NO: 4), Hfd4 (SEQ ID NO:
- the yeast cell has reduced or total loss of activity of at least Pex10 or a protein having at least 60% homology to Pex10 (SEQ ID NO: 8 and at least one of Hfd1 , Hfd4, Fao1 or GPAT), as described above.
- the FAR has at least 80% homology to the FAR from
- the FAR has at least 80% homology to the FAR from Helicoverpa assulta as set forth in SEQ ID NO: 16. In other embodiments, the FAR has at least 80% homology to the FAR from Heliothis subflexa as set forth in SEQ ID NO: 12. In other embodiments, the FAR has at least 80% homology to the FAR from Bicyclus anynana as set forth in SEQ ID NO: 24.
- the yeast cell has reduced or total loss of activity of at least Pex10 or a protein having at least 60% homology to Pex10 (SEQ ID NO: 8 and at least one of Hfd1 , Hfd4, Fao1 or GPAT), as described above.
- the desaturase has at least 60% homology to the ⁇ 1 1 desaturase from Amyelois transitella as set forth in SEQ ID NO: 2. In another particular embodiment, the desaturase has at least 60% homology to the ⁇ 1 1 desaturase from Choristoneura rosaceana as set forth in SEQ ID NO: 19. In another particular embodiment, the desaturase has at least 60% homology to the ⁇ 1 1 desaturase from Choristoneura parallela as set forth in SEQ ID NO: 20.
- the yeast cell has reduced or total loss of activity of at least Pex10 or a protein having at least 60% homology to Pex10 (SEQ ID NO: 8 and at least one of Hfd1 , Hfd4, Fao1 or GPAT), as described above.
- yeast cell in another embodiment, the yeast cell:
- ⁇ ) expresses at least one heterologous fatty acyl-CoA reductase; and iii) has reduced activity of at least one of Hfd1 (SEQ ID NO: 4), Hfd4 (SEQ ID NO:
- the yeast cell has reduced or total loss of activity of at least Pex10 or a protein having at least 60% homology to Pex10 (SEQ ID NO: 8 and at least one of Hfd1 , Hfd4, Fao1 or GPAT), as described above.
- the FAR has at least 80% homology to the FAR from
- the FAR has at least 80% homology to the FAR from Helicoverpa assulta as set forth in SEQ ID NO: 16. In other embodiments, the FAR has at least 80% homology to the FAR from Heliothis subflexa as set forth in SEQ ID NO: 12. In other embodiments, the FAR has at least 80% homology to the FAR from Bicyclus anynana as set forth in SEQ ID NO: 24.
- the yeast cell has reduced or total loss of activity of at least Pex10 or a protein having at least 60% homology to Pex10 (SEQ ID NO: 8 and at least one of Hfd1 , Hfd4, Fao1 or GPAT), as described above.
- yeast cell in another embodiment, the yeast cell:
- ⁇ ) expresses at least one heterologous fatty acyl-CoA reductase; and iii) has reduced activity of at least one of Hfd1 (SEQ ID NO: 4), Hfd4 (SEQ ID NO:
- the yeast cell has reduced or total loss of activity of at least Pex10 or a protein having at least 60% homology to Pex10 (SEQ ID NO: 8 and at least one of Hfd1 , Hfd4, Fao1 or GPAT), as described above.
- the FAR has at least 80% homology to the FAR from
- the FAR has at least 80% homology to the FAR from Helicoverpa assulta as set forth in SEQ ID NO: 16. In other embodiments, the FAR has at least 80% homology to the FAR from Heliothis subflexa as set forth in SEQ ID NO: 12. In other embodiments, the FAR has at least 80% homology to the FAR from Bicyclus anynana as set forth in SEQ ID NO: 24.
- the yeast cell has reduced or total loss of activity of at least Pex10 or a protein having at least 60% homology to Pex10 (SEQ ID NO: 8 and at least one of Hfd1 , Hfd4, Fao1 or GPAT), as described above.
- yeast cell in another embodiment, the yeast cell:
- ii) expresses at least one heterologous fatty acyl-CoA reductase; and iii) has reduced activity of at least one of Hfd1 (SEQ ID NO: 4), Hfd4 (SEQ ID NO: 6), Pex10 (SEQ ID NO: 8), Fao1 (SEQ ID NO: 22) and GPAT (SEQ ID NO: 10), or reduced activity of at least one protein having at least 60% homology to one of Hfd1 (SEQ ID NO: 4), Hfd4 (SEQ ID NO: 6), Pex10 (SEQ ID NO: 8), Fao1 (SEQ ID NO: 22) and GPAT (SEQ ID NO: 10).
- the yeast cell has reduced or total loss of activity of at least Pex10 or a protein having at least 60% homology to Pex10 (SEQ ID NO: 8 and at least one of Hfd1 , Hfd4, Fao1 or GPAT), as described above.
- the FAR has at least 80% homology to the FAR from
- the FAR has at least 80% homology to the FAR from Helicoverpa assulta as set forth in SEQ ID NO: 16. In other embodiments, the FAR has at least 80% homology to the FAR from Heliothis subflexa as set forth in SEQ ID NO: 12. In other embodiments, the FAR has at least 80% homology to the FAR from Bicyclus anynana as set forth in SEQ ID NO: 24.
- the yeast cell has reduced or total loss of activity of at least Pex10 or a protein having at least 60% homology to Pex10 (SEQ ID NO: 8 and at least one of Hfd1 , Hfd4, Fao1 or GPAT), as described above.
- Nucleic acids SEQ ID NO: 8 and at least one of Hfd1 , Hfd4, Fao1 or GPAT
- nucleic acid encoding an activity' shall refer to a nucleic acid molecule capable of encoding a peptide, a protein or a fragment thereof having said activity.
- nucleic acid molecules may be open reading frames or genes or fragments thereof.
- the nucleic acid construct may also be a group of nucleic acid molecules, which together may encode several peptides, proteins or fragments thereof having an activity of interest.
- the term 'activity of interest' refers to one of the following activities: a desaturase as described herein, a fatty acyl-CoA reductase, an aldehyde-forming fatty acyl-CoA reductase, a thioesterase and/or an acetyltransferase activity.
- a desaturase as described herein a fatty acyl-CoA reductase
- an aldehyde-forming fatty acyl-CoA reductase a thioesterase and/or an acetyltransferase activity.
- the nature of the one or more activity of interest will depend on the nature of the desired product one wishes to obtain with the present methods.
- each of the nucleic acids encoding each of the present activities may be comprised within the genome of the yeast cell or within a vector comprised within yeast cell.
- each of the nucleic acids encoding each of the present activities may be present in the genome of said yeast cell, either because the nucleic acid encodes a native protein, or because it has been integrated therein by genome engineering or genome editing or by crossing yeast cells of different mating types. Methods for integrating a nucleic acid are well known in the art.
- the activity of interest is encoded by introduction of a heterologous nucleic acid in the yeast cell.
- the heterologous nucleic acid encoding said activity may be codon-optimised for any purpose, or may comprise features that can help improve the activity.
- the heterologous nucleic acid may be modified so as to encode a modified protein.
- modifications include, but are not limited to, the introduction of localisation signals, gain-of-function or loss-of-function mutations, fusion of the protein to a marker or a tag such as fluorescent tag, insertion of an inducible promoter, introduction of modifications conferring increased stability and/or half-life.
- Cloning methods may involve the design and construction of a plasmid in an organism such as Escherichia coli.
- the plasmid may be an integrative or a non- integrative vector.
- Cloning-free methods comprise homologous recombination-based methods such as ad aptamer- mediated PCR or gap repair. Such methods often result in integration of the heterologous nucleic acid in the genome of the yeast cell.
- the nucleic acids encoding the activities of interest may be present in high copy number.
- yeast cells of the present disclosure can be used for the production of a desaturated fatty alcohol and optionally derivatives thereof, such as a desaturated fatty acyl acetate and/or a desaturated fatty aldehyde. Accordingly, also provided herein is a method of producing a fatty alcohol in an oleaginous yeast cell, said method
- yeast cell comprising the steps of providing a yeast cell and incubating said yeast cell in a medium, wherein the yeast cell:
- ii) expresses at least one heterologous fatty acyl-CoA reductase, capable of converting at least part of said desaturated fatty acyl-CoA to a desaturated fatty alcohol, thereby producing said desaturated fatty alcohol; and iii) has reduced activity of at least one of Hfd1 (SEQ ID NO: 4), Hfd4 (SEQ ID NO: 6), Pex10 (SEQ ID NO: 8), Fao1 (SEQ ID NO: 22) and GPAT (SEQ ID NO: 10), or having reduced activity of at least one protein having at least 60% homology to one of Hfd1 (SEQ ID NO: 4), Hfd4 (SEQ ID NO: 6), Pex10
- SEQ ID NO: 8 Fao1 (SEQ ID NO: 22) and GPAT (SEQ ID NO: 10), such as at least 65% homology, such as at least 70% homology, such as at least 75% homology, such as at least 80% homology, such as at least 81 % homology, such as at least 82% homology, such as at least 83% homology, such as at least 84% homology, such as at least 85% homology, such as at least 86% homology, such as at least 87% homology, such as at least 88% homology, such as at least 89% homology, such as at least 90% homology, such as at least 91 % homology, such as at least 92% homology, such as at least 93% homology, such as at least 94% homology, such as at least 95% homology, such as at least 96% homology, such as at least 97% homology, such as at least 98% homology, such as at least 99% homology to one of Hfd1 (SEQ ID NO: 4), H
- the yeast cell has reduced or total loss of activity of at least Pex10 or a protein having at least 60% homology to Pex10 (SEQ ID NO: 8 and at least one of Hfd1 , Hfd4, Fao1 or GPAT), as described above.
- the yeast cell is capable of producing fatty alcohols with a total titre of at least 1 mg/L, such as at least 5 mg/L, such as at least 10 mg/L, such as at least 25 mg/L, such as at least 50 mg/L, such as at least 100 mg/L, such as at least 250 mg/L, such as at least 500 mg/L, such as at least 1 g/L, such as at least 2 g/L, such as at least 3 g/L, such as at least 4 g/L, such as at least 5 g/L, such as at least 6 g/L, such as at least 7 g/L, such as at least 8 g/L, such as at least 9 g/L, such as at least 10 g/L, wherein the total titre is the sum of the titre of desaturated fatty alcohols and the titre of saturated fatty alcohols.
- the total titre is the sum of the titre of desaturated fatty alcohols and the titre of saturated fatty alcohols.
- the yeast cell is capable of producing desaturated fatty alcohols with a titre of at least 1 mg/L, such as at least 5 mg/L, such as at least 10 mg/L, such as at least 25 mg/L, such as at least 50 mg/L, such as at least 100 mg/L, such as at least 250 mg/L, such as at least 500 mg/L, such as at least 1 g/L, such as at least 2 g/L, such as at least 3 g/L, such as at least 4 g/L, such as at least 5 g/L, such as at least 6 g/L, such as at least 7 g/L, such as at least 8 g/L, such as at least 9 g/L, such as at least 10 g/L.
- a titre of at least 1 mg/L such as at least 5 mg/L, such as at least 10 mg/L, such as at least 25 mg/L, such as at least 50 mg/L, such as at least 100 mg/L, such as at least 250 mg/L
- the present methods enable production of fatty alcohols, wherein the desaturated fatty alcohols produced by the cell represent at least 20% of the total fatty alcohols produced by the cell, such as at least 30%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90% of the total fatty alcohols produced by the cell.
- the cell is capable of producing (ZJ1 1 -C16:OH with a titre of at least 0.5 mg/L, such as at least 1 mg/L, such as at least 5 mg/L, such as at least 10 mg/L, such as at least 25 mg/L, such as at least 50 mg/L, such as at least 100 mg/L, such as at least 250 mg/L, such as at least 500 mg/L, such as at least 1 g/L, such as at least 2 g/L, such as at least 3 g/L, such as at least 4 g/L, such as at least 5 g/L, such as at least 6 g/L, such as at least 7 g/L, such as at least 8 g/L, such as at least 9 g/L, such as at least 10 g/L (Zj1 1 -C16:OH.
- a titre of at least 0.5 mg/L such as at least 1 mg/L, such as at least 5 mg/L, such as at least 10 mg/L, such
- the (ZJ1 1 -C16:OH produced by the cell represents at least 20% of the total fatty alcohols produced by the cell, such as at least 30%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90% of the total fatty alcohols produced by the cell.
- the (ZJ1 1 -C16:OH produced by the cell represents at least 20% of the total desaturated fatty alcohols produced by the cell, such as at least 30%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90% of the total desaturated fatty alcohols produced by the cell.
- the fatty alcohol is a fatty alcohol which is naturally found in pheromones produced by species of the Lepidoptera order.
- the yeast cell may be as described herein.
- the yeast cell is a Yarrowia cell, such as a Yarrowia lipolytica cell.
- the present methods may comprise a further step of recovering the desaturated fatty alcohol and/or the desaturated fatty acyl acetate and/or desaturated fatty aldehyde produced by the present yeast cells.
- the method comprises a step of recovering the desaturated fatty alcohols.
- the method comprises a step of recovering the desaturated fatty alcohols having a carbon chain length of 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22.
- the method comprises a step of recovering the fatty acyl acetates having a carbon chain length of 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22.
- the method comprises a step of recovering the fatty acyl acetates having a carbon chain length of 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22.
- Methods for recovering the products obtained by the present invention are known in the art and may comprise an extraction with a hydrophobic solvent such as decane, hexane or a vegetable oil.
- a hydrophobic solvent such as decane, hexane or a vegetable oil.
- the recovered products may be modified further, for example desaturated fatty alcohols may be converted to the corresponding desaturated fatty aldehydes as described herein above.
- the recovered products i.e. the desaturated fatty alcohols and/or desaturated fatty acyl acetates, may also be formulated into a pheromone composition.
- the composition may further comprise one or more additional compounds such as a liquid or solid carrier or substrate.
- Fatty aldehydes obtained from said desaturated fatty alcohols may also be comprised in such compositions.
- kits of parts for performing the present methods.
- the kit of parts may comprise an oleaginous yeast cell "ready to use” as described herein.
- the yeast cell is a Yarrowia cell, such as a Yarrowia lipolytica cell.
- the kit of parts comprises a nucleic acid construct encoding the activities of interest to be introduced in the yeast cell.
- the kit of parts may comprise a nucleic acid construct for reducing activity of at least one of Hfd1 (SEQ ID NO: 4), Hfd4 (SEQ ID NO: 6), Pex10 (SEQ ID NO: 8), Fao1 (SEQ ID NO: 22) and GPAT (SEQ ID NO: 10) or of at least one protein having at least 60% homology to one of Hfd1 (SEQ ID NO: 4), Hfd4 (SEQ ID NO: 6), Pex10 (SEQ ID NO: 8), Fao1 (SEQ ID NO: 22) and GPAT (SEQ ID NO: 10).
- the nucleic acid construct may be provided as a plurality of nucleic acid constructs, such as a plurality of vectors, wherein each vector encodes one or several of the desired activities, or wherein each vector allows reduction of the activity of one or more of Hfd1 , Hfd4, Pex10, Fao1 and GPAT.
- each vector encodes one or several of the desired activities, or wherein each vector allows reduction of the activity of one or more of Hfd1 , Hfd4, Pex10, Fao1 and GPAT.
- the yeast cell has reduced or total loss of activity of at least Pex10 or a protein having at least 60% homology to Pex10 (SEQ ID NO: 8 and at least one of Hfd1 , Hfd4, Fao1 or GPAT), as described above.
- the kit of parts may optionally comprise the yeast cell to be modified.
- the yeast cell to be modified already has reduced activity of at least one of Hfd1 (SEQ ID NO: 4), Hfd4 (SEQ ID NO: 6), Pex10 (SEQ ID NO: 8), Fao1 (SEQ ID NO: 22) and GPAT (SEQ ID NO: 10) or of at least one protein having at least 60% homology to one of Hfd1 (SEQ ID NO: 4), Hfd4 (SEQ ID NO: 6), Pex10 (SEQ ID NO: 8), Fao1 (SEQ ID NO: 22) and GPAT (SEQ ID NO: 10).
- the yeast cell has reduced or total loss of activity of at least Pex10 or a protein having at least 60% homology to Pex10 (SEQ ID NO: 8 and at least one of Hfd1 , Hfd4, Fao1 or GPAT), as described above.
- the kit of parts comprises all of the above.
- the present disclosure thus provides compounds, in particular desaturated fatty alcohols and fatty acyl acetates, as well as derivatives thereof, and their use.
- the compounds obtainable using the present cells and methods are useful as components of pheromone compositions.
- Such pheromone compositions may be useful for integrated pest management. They can be used as is known in the art for e.g. mating disruption.
- the desaturated fatty alcohols and desaturated fatty acyl acetates obtainable by the present methods or using the present yeast cells may be formulated in a pheromone composition.
- Such pheromone compositions may be used as integrated pest management products, which can be used in a method of monitoring the presence of pest or in a method of disrupting the mating of pest.
- Pheromone compositions as disclosed herein may be used as biopesticides. Such compositions can be sprayed or dispensed on a culture, in a field or in an orchard. They can also, as is known in the art, be soaked e.g. onto a rubber septa, or mixed with other components. This can result in mating disruption, thereby preventing pest reproduction, or it can be used in combination with a trapping device to entrap the pests.
- compositions can be used are: cotton bollworm (Helicoverpa armigera), striped stemborer (Chilo suppressalis), diamond back moth (Plutella xylostella), cabbage moth (Mamestra brassicae), large cabbage-heart caterpillar (Crocidolomia binotalis), European corn stalk borer (Sesamia nonagrioides), currant clearwing (Synanthedon tipuliformis) and artichoke plume moth (Platyptilia carduidactylal). Accordingly, use of the present compositions on a culture can lead to increased crop yield, with
- the relative amounts of fatty alcohols and fatty acyl acetates in the present pheromone compositions may vary depending on the nature of the crop and/or of the pest to be controlled; geographical variations may also exist. Determining the optimal relative amounts may thus require routine optimisation.
- the pheromone compositions may also comprise fatty aldehydes. Examples of compositions used as repellents can be found in Kehat & Bisblum, 1993, for H. armigera, in Alfaro et al., 2009, for C. suppressalis , in Eizaguirre et al., 2002, for S. nonagrioides; in Wu et al., 2012, for P.
- the pheromone composition may further comprise one or more additional compounds such as a liquid or solid carrier or substrate.
- suitable carriers or substrate include vegetable oils, refined mineral oils or fractions thereof, rubbers, plastics, silica, diatomaceous earth, wax matrix and cellulose powder.
- the pheromone composition may be formulated as is known in the art. For example, it may be in the form of a solution, a gel, a powder. The pheromone composition may be formulated so that it can be easily dispensed, as is known in the art.
- PR-10656 (EpiVecYL _rev) atcatgtaaUtagttatgtcacgcttacattc 30
- PR-10702 (Apexl 0YL_up _fw) cattgtaactagtcctggaggg 31
- PR-1 1047 (NatMxSynYL-end aataacttcg U atagcatacattatacg aag ttatcg a 36 rev new) gcgtcccaaaacc
- PR-1 1 1 10 E.coli atcgcgtgcattcgcggccgcatttaaatcc 37 backboneUSER _fw
- PR-1 1 138 (Hphsyn jw) agcaatgggUaaaaagcctgaactcaccgc 39
- PR-1 1 139 (Hphsyn _rev) attacatgaUtattcctttgccctcggacg 40
- PR-1 1694 (GPAT_up_USER CGTGCGAUgcatctaggagctccattcagc 41 _fw)
- PR-1 1695 GPAT down CACGCGAUggacgagcagaccacg 42 _USER_rev
- PR-13494 (Nat-Tcyc-loxPJw) agggtacUactttggatgatactgc 43
- PR-13549 (loxP-PrTeflntron ataacttcg U ataatg tatgctatacg aagttatag ag a 44
- PR-14269 (UraYLJw) atgccctcctacgaggcccg 45
- PR-15426 (Ahfd1_up _fw) CGTGCGAUataagaaaaaacag 47
- PR-15427 (Ahfd1_up _rev) AGCTGTTCUactaaccctacttcctc 48
- PR-16463 (Afao1 YL_up _fw) CGTGCGAUTGGGGGAGGATTGCGAT 55
- PR-16696 (GPAT_up _rev) agctgttcUTACCGCACTTCCGGAACATC 59
- PR-14396 aagcgttgcacgUaagcactatcctctgctgcgcg 104
- PR-14397 agtggccUccgagcgtcgacaagcatac 105
- PR-14398 cacgcg a Ugttag aagcaattgg ag aag 106
- Table 2 DNA fragments obtained by PCR using the indicated template and primers.
- Hygromycin PR-1 1 138 PR-1 1 139 Hygromycin resistance gene (Hphsyn _fw) (Hphsyn rev) resistance gene
- nourseothricin (Nat-Tcyc- (NatMxSynYL- resistance loxPJw) end rev new)
- BB1 145 Genomic region PR-10704 PR-10705 Genomic DNA downstream of Yarrowia pex10 lipolytica GB20
- BioBrick BB1 135 was treated with the nicking endonuclease Nb.Bsml (New England Biolabs) according to the manufactures instructions and purified using
- Nucleospin® Gel and PCR Clean-up kit (Macherey-Nagel) prior to use.
- the DNA fragments were assembled by USER-cloning via the following protocol: 1 -1 .3 ⁇ of each BioBrick (listed in Table 3), 0.5 ⁇ CutSmart® (New England BioLabs), and 0.5 ⁇ USER enzyme (New England Biolabs) were mixed and incubated at 37 ⁇ ⁇ for 25 min and at 25 ⁇ for 25 min.
- the reaction was transformed into chemically competent E. coli DHalpha cells and the cells were plated on Lysogeny Broth (LB) agar plates with 100 mg/L ampicillin. The plates were incubated overnight at 37°C and the resulting colonies were screened by colony PCR.
- the plasmids were purified from overnight E. coli cultures and the correct cloning was confirmed by sequencing.
- the constructed vectors are listed in Table 3.
- the parent plasmids pCfB4778, pCfB5219 and pCfB4781 were digested as described in Jensen et al., 2014 before assembly by USER-cloning.
- the DNA fragments were assembled by USER-cloning via the following protocol: 1 -1 .3 ⁇ of each BioBrick (listed in Table 8), 0.5 ⁇ CutSmart® (New England BioLabs), and 0.5 ⁇ USER enzyme (New England Biolabs) were mixed and incubated at 37°C for 25 min and at 25 ⁇ for 25 min.
- the reaction was transformed into chemically competent E. coli DHalpha cells and the cells were plated on Lysogeny Broth (LB) agar plates with 100 mg/L ampicillin.
- LB Lysogeny Broth
- the constructed strains are listed in Tables 4 and 5.
- the expression plasmids Prior to transformation into Y. Iipolytica, the expression plasmids were linearised with Notl. The linearised plasmid BioBricks were transformed into V. Iipolytica GB 20 (Angerer, 2014) using a lithium- acetate-based protocol (Chen, 1997). After transformation the cells were recovered in 500 ⁇ YPD medium for 2 hours at 30 'C. Positive transformants were selected on synthetic complete (SC) medium (Sigma-Aldrich) lacking either uracil or leucine or on YPD medium containing hygromycin (50 mg/L) or nourseothricin (250 mg/L). The integration of the knockout constructs into the Y. lipolytica genome was confirmed by colony PCR.
- Strain ST6527 expresses Atrdl 1 and HarFAR from an intergenic region on
- chromosome C The gene expression cassettes are the same as in to pCfB5929.
- HFD4 YALI0B01298g
- HFD1 YALI0F23793g
- nucleotides -1 130 to - 100 upstream of the coding sequence of GP/47 ⁇ YALI0C00209g
- a premature Stop-codon and frame-shift were introduced into open reading frames of PEX10 (YALI0C01023g) and FA01 (YALI0B14014g) resulting in non-functional genes.
- Strain ST7394 expresses Dmd9, HarFAR and Atf 1 as described in pCfB6969 and pCfB7600 from intergenic regions on chromosomes C and D (figure 4).
- the open-reading frame of genes HFD4, HFD2, HFD3 and HFD1 as well as
- the oven temperature was set to 80 'C for 1 min, then increased at a rate of l O 'C /min to 210 ⁇ , followed by a hold at 210°C for 15 min, and then increased at a rate of 10 C/min to 230 ⁇ C followed by a hold at 230 ⁇ for 20 min.
- Compounds were identified by comparison of retention times and mass spectra with those of reference compounds available in laboratory collection. Compounds were quantified by the Total Ion Current (TIC) recorded. Data were analyzed by the Agilent ChemStation software and iWork Numbers. The concentrations of fatty alcohols were calculated based on internal standard (Table 4).
- the injector was configured in splitless mode at 250 'C, the oven temperature was set to 80 ⁇ C for 1 min, then increased at a rate of 10 °C /min to 210 ⁇ C, followed by a hold at 210 °C for 10 min, and then increased at a rate of 10 C/min to 230 °C followed by a hold at 230 'C for 5 min.
- the MS was operated in electron impact mode (70eV), scanning between m/z 30 and 350. Compounds were identified by comparison of retention times and mass spectra with those of reference compounds. Compounds were quantified by the Total Ion Current (TIC) recorded. Data were analyzed by the BrukerMSWorkstation software. The concentrations of fatty alcohols were calculated based on internal standards ( Figure 6).
- Example 4 Production of fatty alcohols in controlled fermentations
- the fermentation medium (6 L) was supplemented with 750 ml nutrient-rich feed (which was composed of 16.2 g/L yeast extract, 108.6 g/L yeast nitrogen base, 6.2 g/L lysine, 0.2 mg/L thiamine, 0.02 g/L biotin, and 326 g/L glycerol), followed by a pulse of glycerol to a concentration of 50 g/L in the reactor at 32h. From 36 hours glycerol was fed continuously keeping a steady glycerol concentration of 20- 30 g/L.. The fermentation lasted a total of 48 hours. The fatty alcohol concentrations at the end of the fermentation are given in Table 6.
- Strains ST6527, ST6360 and ST7394 were cultivated in minimal medium as described in Example 3.
- the medium for strain ST7394 was additionally supplemented with 1 g/L methyl myristate.
- the platform yeast strain By expressing different desaturases and fatty alcohol reductases, the platform yeast strain could be used to produce different desaturared fatty alcohols (Table 7).
- a gene encoding a fatty-acyl-CoA desaturase and a gene encoding a fatty-acyl-CoA reductase are expressed in a Y. Iipolytica cell with deletions in PEX10, HFD1, HFD4 and FA01 genes, and with reduced expression of GPAT. The resulting cell, when cultivated in fermentation medium, produces desaturated fatty alcohols. These fatty alcohols are recovered from the broth and chemically oxidised into the corresponding fatty aldehydes.
- a gene, encoding a fatty-acyl-CoA desaturase, a gene encoding a fatty-acyl-CoA reductase, are expressed in a Y.
- the resulting cell when cultivated in fermentation medium, produces desaturated fatty alcohol acetates.
- ⁇ 1 1 desaturase Reductase from Acetyltransferase Atf 1 Z1 1 - from Choristoneura Helicoverpa from S. cerevisiae tetradecen-1 -yl rosaceana armigera acetate
- SEQ ID NO: 1 S. cerew ' s/ae-codon-optimised nucleotide sequence of A. transitella ⁇ 1 1 -desaturase; mRNA-coding sequence.
- SEQ ID NO: 2 Amino acid sequence of A. transitella delta- 1 1 -desaturase (translation)
- SEQ ID NO: 3 Nucleotide sequence of Y. lipolytica fatty aldehyde dehydrogenase hfdl (YALI0F23793g)
- SEQ ID NO: 4 Amino acid sequence of V. lipolytica fatty aldehyde dehydrogenase HFD1
- SEQ ID NO: 5 Nucleotide sequence of Y. lipolytica fatty aldehyde dehydrogenase hfd4 (YALI0B01298g)
- SEQ ID NO: 7 Nucleotide sequence of Y. lipolytica peroxisome biogenesis factor pex10 (YALI0C01023g) PEX10
- SEQ ID NO: 8 Amino acid sequence of Y. lipolytica peroxisome biogenesis factor PEX10
- SEQ ID NO: 9 Nucleotide sequence of Y. lipolytica glycerol-3-phosphate o- acyltransf erase gpat (YALI0C00209g)
- SEQ ID NO: 10 Amino acid sequence of Y. lipolytica glycerol-3-phosphate o- acyltransf erase GPAT
- SEQ ID NO: 1 1 - S. cerew ' s/ae-codon-optimised nucleotide sequence of H. subflexa fatty acyl reductase; mRNA-coding sequence.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
Description
Claims
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| DE17825464.5T DE17825464T1 (en) | 2016-12-16 | 2017-12-15 | METHOD FOR PRODUCING FATTY ALCOHOLS AND DERIVATIVES THEREOF IN YEAST |
| EP21175652.3A EP3916087A1 (en) | 2016-12-16 | 2017-12-15 | Methods for producing fatty alcohols and derivatives thereof in yeast |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP16204769 | 2016-12-16 | ||
| PCT/EP2017/083021 WO2018109163A1 (en) | 2016-12-16 | 2017-12-15 | Methods for producing fatty alcohols and derivatives thereof in yeast |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP21175652.3A Division EP3916087A1 (en) | 2016-12-16 | 2017-12-15 | Methods for producing fatty alcohols and derivatives thereof in yeast |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| EP3555268A1 true EP3555268A1 (en) | 2019-10-23 |
| EP3555268B1 EP3555268B1 (en) | 2021-05-26 |
Family
ID=57609699
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP21175652.3A Withdrawn EP3916087A1 (en) | 2016-12-16 | 2017-12-15 | Methods for producing fatty alcohols and derivatives thereof in yeast |
| EP17825464.5A Active EP3555268B1 (en) | 2016-12-16 | 2017-12-15 | Methods for producing fatty alcohols and derivatives thereof in yeast |
Family Applications Before (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP21175652.3A Withdrawn EP3916087A1 (en) | 2016-12-16 | 2017-12-15 | Methods for producing fatty alcohols and derivatives thereof in yeast |
Country Status (9)
| Country | Link |
|---|---|
| US (1) | US11345922B2 (en) |
| EP (2) | EP3916087A1 (en) |
| CN (1) | CN110300799B (en) |
| BR (1) | BR112019012266B1 (en) |
| DE (1) | DE17825464T1 (en) |
| DK (1) | DK3555268T3 (en) |
| ES (1) | ES2888232T3 (en) |
| HU (1) | HUE055982T2 (en) |
| WO (1) | WO2018109163A1 (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2022238404A1 (en) | 2021-05-10 | 2022-11-17 | Biophero Aps | Improved methods and cells for increasing enzyme activity and production of insect pheromones |
| WO2023275361A1 (en) | 2021-07-02 | 2023-01-05 | Biophero Aps | Methods and yeast cells for production of desaturated compounds |
| WO2023275374A1 (en) | 2021-07-02 | 2023-01-05 | Biophero Aps | Methods and yeast cells for production of desaturated compounds |
Families Citing this family (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108697072A (en) | 2015-11-18 | 2018-10-23 | 普罗维维股份有限公司 | Microorganism for generating insect pheromone and related compound |
| WO2018213554A1 (en) | 2017-05-17 | 2018-11-22 | Provivi, Inc. | Microorganisms for the production of insect pheromones and related compounds |
| US20230332096A1 (en) | 2019-02-19 | 2023-10-19 | Biophero Aps | Methods and cell factories for producing insect pheromones |
| US20230332195A1 (en) * | 2019-10-10 | 2023-10-19 | River Stone Biotech Aps | Genetically modified host cells producing benzylisoquinoline alkaloids |
| AU2020370542A1 (en) | 2019-10-22 | 2022-04-28 | FMC Agricultural Solutions A/S | Improved methods for production, recovery and secretion of hydrophobic compounds in a fermentation |
| WO2021119548A1 (en) * | 2019-12-11 | 2021-06-17 | Provivi, Inc. | Biosynthesis of insect pheromones and precursors thereof |
| CA3161539A1 (en) * | 2019-12-20 | 2021-06-24 | Irina BORODINA | Yeast cells and methods for production of e8,e10-dodecadienyl coenzyme a, codlemone and derivatives thereof |
| CN114807240B (en) * | 2021-01-21 | 2024-02-06 | 深圳市第二人民医院(深圳市转化医学研究院) | Template molecule connected with aptamer and kit thereof |
| WO2023012151A1 (en) | 2021-08-06 | 2023-02-09 | Biophero Aps | Method for producing fatty aldehydes and derivatives thereof |
| US20230242944A1 (en) * | 2022-01-31 | 2023-08-03 | Isca Technologies, Inc. | Methods for production of diatraea saccharalis pheromone precursors |
| US20230242945A1 (en) * | 2022-01-31 | 2023-08-03 | Isca Technologies, Inc. | Methods for production of amyelois transitella pheromone precursor |
Family Cites Families (14)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5876994A (en) | 1995-11-16 | 1999-03-02 | Cornell Research Foundation, Inc. | Pheromone desaturases |
| US6593299B1 (en) | 1999-04-21 | 2003-07-15 | University Of Florida Research Foundation, Inc. | Compositions and methods for controlling pests |
| DE10208812A1 (en) | 2002-03-01 | 2003-09-11 | Basf Plant Science Gmbh | Process for the production of unsaturated fatty acids |
| ES2204328B1 (en) | 2002-10-04 | 2005-09-01 | Consejo Sup. De Invest. Cientificas | PROCEDURE FOR THE PRODUCTION OF POLINSATURATED FATTY ACIDS WITH LEAVES BY INCORPORATION OF OLEFINIC OR ACETYLENE SUBSTRATES. |
| US20090117253A1 (en) | 2007-10-03 | 2009-05-07 | E. I. Du Pont De Nemours And Company | Peroxisome biogenesis factor protein (pex) disruptions for altering polyunsaturated fatty acids and total lipid content in oleaginous eukaryotic organisms |
| PL2655612T3 (en) | 2010-12-23 | 2017-12-29 | Shell Internationale Research Maatschappij B.V. | Gene disruptants producing fatty acyl-coa derivatives |
| WO2012087958A2 (en) | 2010-12-23 | 2012-06-28 | Codexis, Inc. | Yeast promoters |
| US20140357727A1 (en) | 2011-12-20 | 2014-12-04 | Codexis, Inc. | Fatty alcohol forming acyl reductase (far) variants and methods of use |
| CN102795997A (en) | 2012-08-21 | 2012-11-28 | 昆明博鸿生物科技有限公司 | Synthetic method of diamondback moth sex pheromone compound |
| WO2015013674A2 (en) | 2013-07-25 | 2015-01-29 | The Regents Of The University Of California | A yeast cell modified to overproduce fatty acid and fatty acid-derived compounds |
| WO2015057155A1 (en) | 2013-10-18 | 2015-04-23 | Biopetrolia Ab | Engineering of hydrocarbon metabolism in yeast |
| WO2015171057A1 (en) | 2014-05-06 | 2015-11-12 | Per Hofvander | Production of insect pheromone precursors in plants |
| ES2789823T3 (en) | 2015-06-26 | 2020-10-26 | Univ Danmarks Tekniske | Method of production of moth pheromones in yeast |
| CN108697072A (en) * | 2015-11-18 | 2018-10-23 | 普罗维维股份有限公司 | Microorganism for generating insect pheromone and related compound |
-
2017
- 2017-12-15 WO PCT/EP2017/083021 patent/WO2018109163A1/en not_active Ceased
- 2017-12-15 DK DK17825464.5T patent/DK3555268T3/en active
- 2017-12-15 ES ES17825464T patent/ES2888232T3/en active Active
- 2017-12-15 DE DE17825464.5T patent/DE17825464T1/en active Pending
- 2017-12-15 US US16/470,024 patent/US11345922B2/en active Active
- 2017-12-15 EP EP21175652.3A patent/EP3916087A1/en not_active Withdrawn
- 2017-12-15 BR BR112019012266-4A patent/BR112019012266B1/en active IP Right Grant
- 2017-12-15 HU HUE17825464A patent/HUE055982T2/en unknown
- 2017-12-15 EP EP17825464.5A patent/EP3555268B1/en active Active
- 2017-12-15 CN CN201780086423.1A patent/CN110300799B/en active Active
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2022238404A1 (en) | 2021-05-10 | 2022-11-17 | Biophero Aps | Improved methods and cells for increasing enzyme activity and production of insect pheromones |
| WO2023275361A1 (en) | 2021-07-02 | 2023-01-05 | Biophero Aps | Methods and yeast cells for production of desaturated compounds |
| WO2023275374A1 (en) | 2021-07-02 | 2023-01-05 | Biophero Aps | Methods and yeast cells for production of desaturated compounds |
Also Published As
| Publication number | Publication date |
|---|---|
| BR112019012266B1 (en) | 2022-08-30 |
| CN110300799B (en) | 2024-01-19 |
| DK3555268T3 (en) | 2021-08-30 |
| ES2888232T3 (en) | 2022-01-03 |
| BR112019012266A2 (en) | 2020-01-28 |
| WO2018109163A1 (en) | 2018-06-21 |
| EP3916087A1 (en) | 2021-12-01 |
| DE17825464T1 (en) | 2019-12-19 |
| EP3555268B1 (en) | 2021-05-26 |
| HUE055982T2 (en) | 2022-01-28 |
| CN110300799A (en) | 2019-10-01 |
| US11345922B2 (en) | 2022-05-31 |
| US20190330646A1 (en) | 2019-10-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11345922B2 (en) | Methods for producing fatty alcohols and derivatives thereof in yeast | |
| US20230135852A1 (en) | Production of desaturated fatty alcohols and desaturated fatty acyl acetates in yeast | |
| US20240076329A1 (en) | Method for production of moth pheromones in yeast | |
| US20230332096A1 (en) | Methods and cell factories for producing insect pheromones | |
| US20240327874A1 (en) | Yeast cells and methods for production of E8,E10-dodecadienyl coenzyme A, codlemone and derivatives thereof | |
| US20240279693A1 (en) | Methods and yeast cells for production of desaturated compounds | |
| US20250320528A1 (en) | Improved methods and cells for increasing enzyme activity and production of insect pheromones | |
| US20240287555A1 (en) | Methods and yeast cells for production of desaturated compounds | |
| Borodina et al. | DTU DTU Library |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: UNKNOWN |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE |
|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE |
|
| 17P | Request for examination filed |
Effective date: 20190621 |
|
| AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR |
|
| AX | Request for extension of the european patent |
Extension state: BA ME |
|
| REG | Reference to a national code |
Ref country code: DE Ref country code: DE Ref legal event code: R210 Ref document number: 602017039400 Country of ref document: DE |
|
| REG | Reference to a national code |
Ref country code: DE Representative=s name: 2K PATENT- UND RECHTSANWAELTE PARTNERSCHAFT MB, DE Ref country code: DE Ref legal event code: R082 Ref document number: 602017039400 Country of ref document: DE Representative=s name: 2K PATENT- UND RECHTSANWAELTE PARTNERSCHAFT MB, DE Ref country code: DE Ref legal event code: R082 Country of ref document: DE |
|
| DAV | Request for validation of the european patent (deleted) | ||
| DAX | Request for extension of the european patent (deleted) | ||
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: EXAMINATION IS IN PROGRESS |
|
| 17Q | First examination report despatched |
Effective date: 20200525 |
|
| GRAP | Despatch of communication of intention to grant a patent |
Free format text: ORIGINAL CODE: EPIDOSNIGR1 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: GRANT OF PATENT IS INTENDED |
|
| INTG | Intention to grant announced |
Effective date: 20201211 |
|
| GRAS | Grant fee paid |
Free format text: ORIGINAL CODE: EPIDOSNIGR3 |
|
| GRAA | (expected) grant |
Free format text: ORIGINAL CODE: 0009210 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE PATENT HAS BEEN GRANTED |
|
| REG | Reference to a national code |
Ref country code: DE Ref legal event code: R081 Ref document number: 602017039400 Country of ref document: DE Owner name: DANMARKS TEKNISKE UNIVERSITET, DK Free format text: FORMER OWNER: DANMARKS TEKNISKE UNIVERSITET, KGS. LYNGBY, DK Ref country code: DE Ref legal event code: R082 Country of ref document: DE Ref country code: DE Ref legal event code: R082 Ref document number: 602017039400 Country of ref document: DE Representative=s name: 2K PATENT- UND RECHTSANWAELTE PARTNERSCHAFT MB, DE Ref country code: DE Ref legal event code: R081 Ref document number: 602017039400 Country of ref document: DE Owner name: FMC AGRICULTURAL SOLUTIONS A/S, DK Free format text: FORMER OWNER: DANMARKS TEKNISKE UNIVERSITET, KGS. LYNGBY, DK |
|
| AK | Designated contracting states |
Kind code of ref document: B1 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR |
|
| REG | Reference to a national code |
Ref country code: GB Ref legal event code: FG4D |
|
| REG | Reference to a national code |
Ref country code: CH Ref legal event code: EP |
|
| REG | Reference to a national code |
Ref country code: AT Ref legal event code: REF Ref document number: 1396258 Country of ref document: AT Kind code of ref document: T Effective date: 20210615 |
|
| REG | Reference to a national code |
Ref country code: DE Ref legal event code: R096 Ref document number: 602017039400 Country of ref document: DE |
|
| REG | Reference to a national code |
Ref country code: IE Ref legal event code: FG4D |
|
| REG | Reference to a national code |
Ref country code: NL Ref legal event code: FP |
|
| REG | Reference to a national code |
Ref country code: DK Ref legal event code: T3 Effective date: 20210827 |
|
| REG | Reference to a national code |
Ref country code: LT Ref legal event code: MG9D |
|
| REG | Reference to a national code |
Ref country code: AT Ref legal event code: MK05 Ref document number: 1396258 Country of ref document: AT Kind code of ref document: T Effective date: 20210526 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: LT Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20210526 Ref country code: FI Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20210526 Ref country code: HR Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20210526 Ref country code: AT Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20210526 Ref country code: BG Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20210826 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: RS Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20210526 Ref country code: SE Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20210526 Ref country code: LV Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20210526 Ref country code: PT Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20210927 Ref country code: PL Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20210526 Ref country code: NO Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20210826 Ref country code: IS Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20210926 Ref country code: GR Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20210827 |
|
| REG | Reference to a national code |
Ref country code: ES Ref legal event code: FG2A Ref document number: 2888232 Country of ref document: ES Kind code of ref document: T3 Effective date: 20220103 |
|
| REG | Reference to a national code |
Ref country code: HU Ref legal event code: AG4A Ref document number: E055982 Country of ref document: HU |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: RO Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20210526 Ref country code: CZ Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20210526 Ref country code: EE Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20210526 Ref country code: SK Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20210526 Ref country code: SM Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20210526 |
|
| REG | Reference to a national code |
Ref country code: DE Ref legal event code: R097 Ref document number: 602017039400 Country of ref document: DE |
|
| PLBE | No opposition filed within time limit |
Free format text: ORIGINAL CODE: 0009261 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: NO OPPOSITION FILED WITHIN TIME LIMIT |
|
| RAP4 | Party data changed (patent owner data changed or rights of a patent transferred) |
Owner name: DANMARKS TEKNISKE UNIVERSITET |
|
| 26N | No opposition filed |
Effective date: 20220301 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: IS Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20210926 Ref country code: AL Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20210526 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: MC Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20210526 |
|
| REG | Reference to a national code |
Ref country code: CH Ref legal event code: PL |
|
| REG | Reference to a national code |
Ref country code: HU Ref legal event code: HC9C Owner name: DANMARKS TEKNISKE UNIVERSITET, DK |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: LU Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES Effective date: 20211215 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: LI Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES Effective date: 20211231 Ref country code: CH Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES Effective date: 20211231 |
|
| P01 | Opt-out of the competence of the unified patent court (upc) registered |
Effective date: 20230331 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: CY Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20210526 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: MK Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20210526 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: MT Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20210526 |
|
| REG | Reference to a national code |
Ref country code: GB Ref legal event code: 732E Free format text: REGISTERED BETWEEN 20250515 AND 20250521 |
|
| REG | Reference to a national code |
Ref country code: BE Ref legal event code: PD Owner name: FMC AGRICULTURAL SOLUTIONS A/S; DK Free format text: DETAILS ASSIGNMENT: CHANGE OF OWNER(S), ASSIGNMENT; FORMER OWNER NAME: HENNIN CAROLINE Effective date: 20250506 |
|
| REG | Reference to a national code |
Ref country code: DE Ref legal event code: R081 Ref document number: 602017039400 Country of ref document: DE Owner name: FMC AGRICULTURAL SOLUTIONS A/S, DK Free format text: FORMER OWNER: DANMARKS TEKNISKE UNIVERSITET, LYNGBY, DK Ref country code: DE Ref legal event code: R082 Ref document number: 602017039400 Country of ref document: DE Representative=s name: 2K PATENT- UND RECHTSANWAELTE PARTNERSCHAFT MB, DE |
|
| REG | Reference to a national code |
Ref country code: NL Ref legal event code: PD Owner name: FMC AGRICULTURAL SOLUTIONS A/S; DK Free format text: DETAILS ASSIGNMENT: CHANGE OF OWNER(S), ASSIGNMENT; FORMER OWNER NAME: DANMARKS TEKNISKE UNIVERSITET Effective date: 20250718 Ref country code: HU Ref legal event code: FH1C Free format text: FORMER REPRESENTATIVE(S): DR. KOCSOMBA NELLI UEGYVEDI IRODA, HU Representative=s name: DR. KOCSOMBA NELLI UEGYVEDI IRODA, HU Ref country code: HU Ref legal event code: GB9C Owner name: FMC AGRICULTURAL SOLUTION A/S, DK Free format text: FORMER OWNER(S): DANMARKS TEKNISKE UNIVERSITET, DK |
|
| REG | Reference to a national code |
Ref country code: ES Ref legal event code: PC2A Owner name: FMC AGRICULTURAL SOLUTIONS A/S Effective date: 20251112 |
|
| PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: TR Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20210526 |
|
| PGFP | Annual fee paid to national office [announced via postgrant information from national office to epo] |
Ref country code: GB Payment date: 20251229 Year of fee payment: 9 |
|
| PGFP | Annual fee paid to national office [announced via postgrant information from national office to epo] |
Ref country code: IT Payment date: 20251219 Year of fee payment: 9 Ref country code: DK Payment date: 20251226 Year of fee payment: 9 |
|
| PGFP | Annual fee paid to national office [announced via postgrant information from national office to epo] |
Ref country code: HU Payment date: 20251124 Year of fee payment: 9 Ref country code: NL Payment date: 20251226 Year of fee payment: 9 Ref country code: FR Payment date: 20251226 Year of fee payment: 9 |
|
| PGFP | Annual fee paid to national office [announced via postgrant information from national office to epo] |
Ref country code: BE Payment date: 20251229 Year of fee payment: 9 |
|
| PGFP | Annual fee paid to national office [announced via postgrant information from national office to epo] |
Ref country code: IE Payment date: 20251229 Year of fee payment: 9 |
|
| PGFP | Annual fee paid to national office [announced via postgrant information from national office to epo] |
Ref country code: ES Payment date: 20260102 Year of fee payment: 9 |
|
| PGFP | Annual fee paid to national office [announced via postgrant information from national office to epo] |
Ref country code: DE Payment date: 20251229 Year of fee payment: 9 |