EP3487996A1 - Serine protease variants and polynucleotides encoding same - Google Patents

Serine protease variants and polynucleotides encoding same

Info

Publication number
EP3487996A1
EP3487996A1 EP17746005.2A EP17746005A EP3487996A1 EP 3487996 A1 EP3487996 A1 EP 3487996A1 EP 17746005 A EP17746005 A EP 17746005A EP 3487996 A1 EP3487996 A1 EP 3487996A1
Authority
EP
European Patent Office
Prior art keywords
variant
seq
protease
polypeptide
starch
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
EP17746005.2A
Other languages
German (de)
French (fr)
Other versions
EP3487996B1 (en
Inventor
Keiichi Ayabe
Tomoko Matsui
Aki TOMIKI
Yuma KURAKATA
Esben P. FRIIS
Jens E. NIELSEN
Roland Alexander PACHE
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Novozymes AS
Original Assignee
Novozymes AS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Novozymes AS filed Critical Novozymes AS
Publication of EP3487996A1 publication Critical patent/EP3487996A1/en
Application granted granted Critical
Publication of EP3487996B1 publication Critical patent/EP3487996B1/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/48Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/58Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from fungi
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00Preparation of oxygen-containing organic compounds
    • C12P7/02Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/04Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
    • C12P7/06Ethanol, i.e. non-beverage
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y304/00Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
    • C12Y304/21Serine endopeptidases (3.4.21)
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02EREDUCTION OF GREENHOUSE GAS [GHG] EMISSIONS, RELATED TO ENERGY GENERATION, TRANSMISSION OR DISTRIBUTION
    • Y02E50/00Technologies for the production of fuel of non-fossil origin
    • Y02E50/10Biofuels, e.g. bio-diesel

Definitions

  • production of fermentation products, such as ethanol, from starch-containing material is well-known in the art.
  • the most commonly used process often referred to as a “conventional process” includes liquefying gelatinized starch at high temperature using typically a bacterial alpha-amylase, followed by simultaneous saccharification and fermentation carried out in the presence of a glucoamylase and a fermenting organism.
  • Another well-known process often referred to as a "raw starch hydrolysis"- process (RSH process) includes simultaneously saccharifying and fermenting granular starch below the initial gelatinization temperature typically in the presence of an acid fungal alpha- amylase and a glucoamylase.
  • US Patent No. 5,231 ,017-A discloses the use of an acid fungal protease during ethanol fermentation in a process comprising liquefying gelatinized starch with an alpha-amylase.
  • WO 2003/066826 discloses a raw starch hydrolysis process (RSH process) carried out on non-cooked mash in the presence of fungal glucoamylase, alpha-amylase and fungal protease.
  • WO 2007/145912 discloses a process for producing ethanol comprising contacting a slurry comprising granular starch obtained from plant material with an alpha-amylase capable of solubilizing granular starch at a pH of 3.5 to 7.0 and at a temperature below the starch gelatinization temperature for a period of 5 minutes to 24 hours; obtaining a substrate comprising greater than 20% glucose, and fermenting the substrate in the presence of a fermenting organism and starch hydrolyzing enzymes at a temperature between 10°C and 40°C for a period of 10 hours to 250 hours. Additional enzymes added during the contacting step may include protease.
  • WO 2014/037438 discloses serine proteases derived from Meripilus giganteus
  • US provisional application 62/232,903 discloses the use of the Meripilus giganteus S53 protease in the saccharification and/or fermentation step in a starch to ethanol process.
  • the present invention provides protease variants with improved properties compared to its parent.
  • the present invention relates to a protease variant comprising a modification at one or more position corresponding to positions 39, 50, 57, 60, 74, 81 , 84, 109, 1 10, 1 1 1 , 1 15, 1 17, 124, 128, 142, 145, 146, 154, 182, 183, 187, 207, 209, 210, 212, 228, 267, 271 , 272, 274, 278, 280, 294, 317, 318, 320, 321 , 322, 328, 343, 348, 362 or 363 of the polypeptide of SEQ ID NO: 3, wherein the variant has protease activity and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity to the mature polypeptide of SEQ ID NO: 3, and wherein the variant has increased thermo-stability
  • the present invention relates to protease variant comprising a modification at position corresponding to position 39, 60, 74, 81 , 84, 109, 1 15, 1 17, 142, 145, 146, 154, 182, 183, 187, 209, 210, 212, 228, 267, 272, 280, 294, 317, 318, 348 or 362 of the polypeptide of SEQ ID NO: 3, wherein the variant has protease activity and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity to the polypeptide of SEQ ID NO: 3, wherein the protease is a serine protease belonging to the S53 family and wherein the variant has increased residual activity compared to the protease of SEQ ID NO: 3 and wherein the increased thermo-stability is increased residual activity measured after incuba
  • the present invention relates to protease variant comprising a modification at position corresponding to position 50, 57, 60, 81 , 84, 109, 1 10, 1 1 1 , 124, 128, 142, 145, 146, 154, 182, 183, 207, 209, 210, 228, 267, 271 , 272, 274, 278, 280, 294, 317, 318, 320, 321 , 322, 328, 343, 362, or 363 of the polypeptide of SEQ ID NO: 3, wherein the variant has protease activity and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity to the polypeptide of SEQ ID NO: 3, wherein the protease is a serine protease belonging to the S53 family and wherein the protease is a serine protea
  • the present invention also relates to polynucleotides encoding the variants; nucleic acid constructs, vectors, and host cells comprising the polynucleotides; and methods of producing the variants.
  • the present invention relates to compositions comprising the variants of the invention.
  • the present invention also relates to a process for producing a fermentation product from starch-containing material comprising simultaneously saccharifying and fermenting starch- containing material using a carbohydrate-source generating enzymes and a fermenting organism at a temperature below the initial gelatinization temperature of said starch-containing material in the presence of a variant protease.
  • the present invention relates to a process for producing a fermentation product from starch-containing material comprising the steps of: (a) liquefying starch-containing material in the presence of an alpha-amylase; (b) saccharifying the liquefied material obtained in step (a) using a glucoamylse; (c) fermenting using a fermenting organism; wherein a variant protease of the invention is present during step b) and/or c).
  • protease activity means a proteolytic activity (EC 3.4) that catalyzes the cleavage of peptide bonds.
  • proteolytic activity EC 3.4
  • serine protease activity is determined according to the procedure described in the Examples.
  • the variants of the present invention have at least 20%, e.g., at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 100% of the protease activity of the mature polypeptide of SEQ ID NO: 2.
  • proteolytic activity means proteolytic activity (EC 3.4). There are several protease activity types such as trypsin-like proteases cleaving at the carboxyterminal side of Arg and Lys residues and chymotrypsin-like proteases cleaving at the carboxyterminal side of hydrophobic amino acid residues. Proteases of the invention are serine endopeptidases (EC 3.4.21 ) with acidic pH-optimum (pH optimum ⁇ pH 7).
  • Protease activity can be measured using any assay, in which a substrate is employed, that includes peptide bonds relevant for the specificity of the protease in question.
  • Assay-pH and assay-temperature are likewise to be adapted to the protease in question.
  • Examples of assay- pH-values are pH 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , or 12.
  • Examples of assay-temperatures are 15, 20, 25, 30, 35, 37, 40, 45, 50, 55, 60, 65, 70, 80, 90, or 95°C.
  • Examples of general protease substrates are casein, bovine serum albumin and haemoglobin.
  • protease activity was determined using assays which are described in "Materials and Methods", such as the Kinetic Suc-AAPF-pNA assay, Protazyme AK assay, Kinetic Suc-AAPX-pNA assay and o-Phthaldialdehyde (OPA).
  • Protazyme AK insoluble Protazyme AK (Azurine-Crosslinked Casein) substrate liberates a blue colour when incubated with the protease and the colour is determined as a measurement of protease activity.
  • the colourless Suc-AAPF-pNA substrate liberates yellow paranitroaniline when incubated with the protease and the yellow colour is determined as a measurement of protease activity.
  • Endo-protease/Exo-proteases Polypeptides having protease activity, or proteases, are sometimes also designated peptidases, proteinases, peptide hydrolases, or proteolytic enzymes. Proteases may be of the exo-type (exopeptidases) that hydrolyse peptides starting at either end thereof, or of the endo-type that act internally in polypeptide chains (endopeptidases).
  • S53 protease means a protease activity selected from:
  • protease For determining whether a given protease is a Serine protease, and a family S53 protease, reference is made to the above Handbook and the principles indicated therein. Such determination can be carried out for all types of proteases, be it naturally occurring or wild-type proteases; or genetically engineered or synthetic proteases.
  • allelic variant means any of two or more alternative forms of a gene occupying the same chromosomal locus. Allelic variation arises naturally through mutation, and may result in polymorphism within populations. Gene mutations can be silent (no change in the encoded polypeptide) or may encode polypeptides having altered amino acid sequences.
  • An allelic variant of a polypeptide is a polypeptide encoded by an allelic variant of a gene.
  • cDNA means a DNA molecule that can be prepared by reverse transcription from a mature, spliced, mRNA molecule obtained from a eukaryotic or prokaryotic cell. cDNA lacks intron sequences that may be present in the corresponding genomic DNA.
  • the initial, primary RNA transcript is a precursor to mRNA that is processed through a series of steps, including splicing, before appearing as mature spliced mRNA.
  • Coding sequence means a polynucleotide, which directly specifies the amino acid sequence of a variant.
  • the boundaries of the coding sequence are generally determined by an open reading frame, which begins with a start codon such as ATG,
  • control sequences means nucleic acid sequences necessary for expression of a polynucleotide encoding a variant of the present invention. Each control sequence may be native (i.e., from the same gene) or foreign (i.e., from a different gene) to the polynucleotide encoding the variant or native or foreign to each other. Such control sequences include, but are not limited to, a leader, polyadenylation sequence, propeptide sequence, promoter, signal peptide sequence, and transcription terminator.
  • control sequences include a promoter, and transcriptional and translational stop signals.
  • the control sequences may be provided with linkers for the purpose of introducing specific restriction sites facilitating ligation of the control sequences with the coding region of the polynucleotide encoding a variant.
  • expression includes any step involved in the production of a variant including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion.
  • Expression vector means a linear or circular DNA molecule that comprises a polynucleotide encoding a variant and is operably linked to control sequences that provide for its expression.
  • fragment means a polypeptide having one or more (e.g., several) amino acids absent from the amino and/or carboxyl terminus of a mature polypeptide; wherein the fragment has protease activity.
  • High stringency conditions means for probes of at least 100 nucleotides in length, prehybridization and hybridization at 42°C in 5X SSPE, 0.3% SDS, 200 micrograms/ml sheared and denatured salmon sperm DNA, and 50% formamide, following standard Southern blotting procedures for 12 to 24 hours. The carrier material is finally washed three times each for 15 minutes using 2X SSC, 0.2% SDS at 65°C.
  • host cell means any cell type that is susceptible to transformation, transfection, transduction, or the like with a nucleic acid construct or expression vector comprising a polynucleotide of the present invention.
  • host cell encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication.
  • Improved property means a characteristic associated with a variant that is improved compared to the parent. Such improved properties include, but are not limited to, increased stability under storage conditions, increased thermo-stability, and increased residual activity.
  • Isolated means a substance in a form or environment which does not occur in nature.
  • isolated substances include (1 ) any non-naturally occurring substance, (2) any substance including, but not limited to, any enzyme, variant, nucleic acid, protein, peptide or cofactor, that is at least partially removed from one or more or all of the naturally occurring constituents with which it is associated in nature; (3) any substance modified by the hand of man relative to that substance found in nature; or (4) any substance modified by increasing the amount of the substance relative to other components with which it is naturally associated (e.g., multiple copies of a gene encoding the substance; use of a stronger promoter than the promoter naturally associated with the gene encoding the substance).
  • An isolated substance may be present in a fermentation broth sample.
  • Low stringency conditions means for probes of at least 100 nucleotides in length, prehybridization and hybridization at 42°C in 5X SSPE, 0.3% SDS, 200 micrograms/ml sheared and denatured salmon sperm DNA, and 25% formamide, following standard Southern blotting procedures for 12 to 24 hours. The carrier material is finally washed three times each for 15 minutes using 2X SSC, 0.2% SDS at 50°C.
  • Mature polypeptide means a polypeptide in its final form following translation and any post-translational modifications, such as N-terminal processing, C-terminal truncation, glycosylation, phosphorylation, etc.
  • the mature polypeptide is amino acids 199 to 564 of SEQ ID NO: 2.
  • Amino acids 1 to 17 of SEQ ID NO: 2 are a signal peptide, and amino acids 18 to 198 are a propeptide.
  • the N-terminals of the mature S53 polypeptides used according to the present invention were experimentally confirmed based on EDMAN N-terminal sequencing data and Intact MS data.
  • the mature polypeptides are also included as SEQ ID NO: 3 (mature S53 protease 3 from Meripilus giganteus. It is known in the art that a host cell may produce a mixture of two of more different mature polypeptides (i.e., with a different C-terminal and/or N-terminal amino acid) expressed by the same polynucleotide.
  • Mature polypeptide coding sequence means a polynucleotide that encodes a mature polypeptide having protease activity.
  • the mature polypeptide coding sequence is nucleotides 595 to 1692 of SEQ ID NO: 1 .
  • Nucleotides 1 to 51 of SEQ ID NO: 1 encode a signal peptide, nucleotides 52 to 594 encode a propeptide.
  • Medium stringency conditions means for probes of at least 100 nucleotides in length, prehybridization and hybridization at 42°C in 5X SSPE, 0.3% SDS, 200 micrograms/ml sheared and denatured salmon sperm DNA, and 35% formamide, following standard Southern blotting procedures for 12 to 24 hours. The carrier material is finally washed three times each for 15 minutes using 2X SSC, 0.2% SDS at 55°C.
  • Medium-high stringency conditions means for probes of at least 100 nucleotides in length, prehybridization and hybridization at 42°C in 5X SSPE, 0.3% SDS, 200 micrograms/ml sheared and denatured salmon sperm DNA, and 35% formamide, following standard Southern blotting procedures for 12 to 24 hours. The carrier material is finally washed three times each for 15 minutes using 2X SSC, 0.2% SDS at 60°C.
  • Modification The term “modification(s)” is in the context of the present invention to be understood as a substitution, insertion, and/or deletion, at one or more (e.g., several) positions.
  • a substitution means replacement of the amino acid occupying a position with a different amino acid
  • a deletion means removal of the amino acid occupying a position
  • an insertion means adding an amino acid adjacent to and immediately following the amino acid occupying a position.
  • Mutant means a polynucleotide encoding a variant.
  • nucleic acid construct means a nucleic acid molecule, either single- or double-stranded, which is isolated from a naturally occurring gene or is modified to contain segments of nucleic acids in a manner that would not otherwise exist in nature or which is synthetic, which comprises one or more control sequences.
  • the one or more control sequences are heterologous (of different origin/species) to the coding sequence encoding the polypeptide of the invention.
  • operably linked means a configuration in which a control sequence is placed at an appropriate position relative to the coding sequence of a polynucleotide such that the control sequence directs expression of the coding sequence.
  • Parent or parent protease means any polypeptide with protease activity to which an alteration is made to produce the enzyme variants of the present invention.
  • Sequence identity The relatedness between two amino acid sequences or between two nucleotide sequences is described by the parameter "sequence identity”.
  • the sequence identity between two amino acid sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277), preferably version 5.0.0 or later.
  • the parameters used are gap open penalty of 10, gap extension penalty of 0.5, and the EBLOSUM62 (EMBOSS version of BLOSUM62) substitution matrix.
  • the output of Needle labeled "longest identity" (obtained using the -nobrief option) is used as the percent identity and is calculated as follows:
  • the sequence identity between two deoxyribonucleotide sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, supra) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, supra), preferably version 5.0.0 or later.
  • the parameters used are gap open penalty of 10, gap extension penalty of 0.5, and the EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix.
  • Subsequence means a polynucleotide having one or more (e.g., several) nucleotides absent from the 5' and/or 3' end of a mature polypeptide coding sequence; wherein the subsequence encodes a fragment having protease activity.
  • a subsequence contains at least 1098 nucleotides (e.g., nucleotides 595 to 1692 of SEQ ID NO: 1 ).
  • variant means a polypeptide having protease activity comprising a modification(s) at one or more (e.g., several) positions.
  • the variants of the present invention have at least 20%, e.g., at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 100% of the protease activity of the mature polypeptide of SEQ ID NO: 2, disclosed herein as SEQ ID NO: 3.
  • Very high stringency conditions means for probes of at least 100 nucleotides in length, prehybridization and hybridization at 42°C in 5X SSPE, 0.3% SDS, 200 micrograms/ml sheared and denatured salmon sperm DNA, and 50% formamide, following standard Southern blotting procedures for 12 to 24 hours. The carrier material is finally washed three times each for 15 minutes using 2X SSC, 0.2% SDS at 70°C.
  • Very low stringency conditions means for probes of at least 100 nucleotides in length, prehybridization and hybridization at 42°C in 5X SSPE, 0.3% SDS, 200 micrograms/ml sheared and denatured salmon sperm DNA, and 25% formamide, following standard Southern blotting procedures for 12 to 24 hours. The carrier material is finally washed three times each for 15 minutes using 2X SSC, 0.2% SDS at 45°C.
  • Wild-type protease means a protease expressed by a naturally occurring microorganism, such as a bacterium, yeast, or filamentous fungus found in nature.
  • the mature polypeptide comprised in SEQ ID NO: 2 is used to determine the corresponding amino acid residue in another protease.
  • the amino acid sequence of another protease is aligned with the mature polypeptide comprised in SEQ ID NO: 2 (disclosed herein as SEQ ID NO: 3), and based on the alignment, the amino acid position number corresponding to any amino acid residue in the mature polypeptide comprised in SEQ ID NO: 2 is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet.
  • Insertions For an amino acid insertion, the following nomenclature is used: Original amino acid, position, original amino acid, inserted amino acid. Accordingly the insertion of lysine after glycine at position 195 is designated “Gly195Glyl_ys” or “G195GK”. An insertion of multiple amino acids is designated [Original amino acid, position, original amino acid, inserted amino acid #1 , inserted amino acid #2; etc.]. For example, the insertion of lysine and alanine after glycine at position 195 is indicated as "Gly195Glyl_ysAla" or "G195GKA”.
  • the inserted amino acid residue(s) are numbered by the addition of lower case letters to the position number of the amino acid residue preceding the inserted amino acid residue(s).
  • the sequence would thus be:
  • variants comprising multiple modifications are separated by addition marks ("+"), e.g. , "Arg170Tyr+Gly195Glu” or “R170Y+G195E” representing a substitution of arginine and glycine at positions 170 and 195 with tyrosine and glutamic acid, respectively.
  • addition marks e.g. , "Arg170Tyr+Gly195Glu” or "R170Y+G195E” representing a substitution of arginine and glycine at positions 170 and 195 with tyrosine and glutamic acid, respectively.
  • the present invention relates to protease variants, comprising a modification(s) at one or more (e.g., several) positions corresponding to specific positions of the mature polypeptide disclosed as SEQ ID NO: 3 (a parent protease), wherein the variant has protease activity.
  • SEQ ID NO: 3 a parent protease
  • the specific position numbers may change in case the mature parent protease is different from SEQ ID NO: 3.
  • the improved properties of the variants of the invention falls in the following categories, e.g., increased stability, e.g., increased thermostability (measured as increase in thermal denaturation temperature, Td, and/or increased residual activity by the Suc- AAPF assay after incubation for 30 min at an elevated temperature in the range from 55 to 60 degrees Celsius as described in detail in the examples).
  • increased stability e.g., increased thermostability (measured as increase in thermal denaturation temperature, Td, and/or increased residual activity by the Suc- AAPF assay after incubation for 30 min at an elevated temperature in the range from 55 to 60 degrees Celsius as described in detail in the examples).
  • the present invention provides a protease variant comprising a modification at one or more position corresponding to positions 39, 50, 57, 60, 74, 81 , 84, 109, 1 10, 1 1 1 , 1 15, 1 17, 124, 128, 142, 145, 146, 154, 182, 183, 187, 207, 209, 210, 212, 228, 267, 271 , 272, 274, 278, 280, 294, 317, 318, 320, 321 , 322, 328, 343, 348, 362 or 363 of the polypeptide of SEQ ID NO: 3, wherein each modification is independently a substitution, insertion or deletion.
  • the modification is a substitution.
  • the modification is a deletion.
  • the present invention provides a protease variant comprising a modification at one or more position corresponding to positions 39, 50, 57, 60, 74, 81 , 84, 109, 1 10, 1 1 1 , 1 15, 1 17, 124, 128, 142, 145, 146, 154, 182, 183, 187, 207, 209, 210, 212, 228, 267, 271 , 272, 274, 278, 280, 294, 317, 318, 320, 321 , 322, 328, 343, 348, 362 or 363 of the polypeptide of SEQ ID NO: 3, wherein the variant has protease activity and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity to the mature polypeptide of SEQ ID NO: 3, and wherein the variant has increased thermo-stability compared to the proteas
  • the variant has sequence identity of at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, to the amino acid sequence of the mature parent protease.
  • the variant has at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, such as at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity to the polypeptide of SEQ ID NO: 3.
  • the number of substitutions in the variants of the present invention is 1 - 20, e.g., 1 -10 and 1 -5, such as 1 , 2, 3, 4, 5, 6, 7, 8, 9 or 10 substitutions.
  • the invention relates to a protease variant comprising a modification at position corresponding to positions 39, 60, 74, 81 , 84, 109, 1 15, 142, 145, 146, 154, 182, 183, 187, 209, 210, 212, 228, 267, 272, 280, 294, 317, 318, 348 or 362 of the polypeptide of SEQ ID NO: 3, wherein the variant has protease activity and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity to the polypeptide of SEQ ID NO: 3, wherein the protease is a serine protease belonging to the S53 family and wherein the variant has increased thermo-stability compared to the protease of SEQ ID NO: 3.
  • the variant comprises a modification which is a substitution at position corresponding to positions 39, 50, 57, 60, 74, 81 , 84, 109, 1 10, 1 1 1 , 1 15, 1 17, 124, 128, 142, 145, 146, 154, 182, 183, 187, 207, 209, 212, 228, 267, 271 , 272, 274, 278, 280, 294, 317, 318, 320, 321 , 322, 328, 343, 348, 362 or 363 of the polypeptide of SEQ ID NO: 3, wherein the variant has protease activity and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity to the polypeptide of SEQ ID NO: 3, wherein the protease is a serine protease belonging to the S53 family and wherein the variant has increased thermo
  • the variant comprises a modification which is a deletion at position corresponding to position 318 or 210 of the polypeptide of SEQ ID NO: 3, wherein the variant has protease activity and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity to the polypeptide of SEQ ID NO: 3, wherein the protease is a serine protease belonging to the S53 family and wherein the variant has increased thermo-stability compared to the protease of SEQ ID NO: 3.
  • the variant comprises or consists of at least one substitutions and/or deletions selected from the group consisting of: I39M, I39R, I39L, I39C, S50C, K57R, S60P, S60D, E74W , E81A, E81 E, E81 K, E81 R, I84C, D109N, D109P, D1 10N, F1 1 1 P, N1 15D, N1 15L, E1 17D, N124Q, N124L, N124W, G128A, Q142R, Q142W, N145A, N145D, N145E, N145G, N145K, N145Q, N145V, T146A, T146D, T146E, T146W, T146Y, Q154R, Q154V, Q154W, Q154Y,Q182G, Q182R, S183L, S183P, S187L, Q207R, V209L, E212E, I228R, D267N
  • the protease variant comprises a modification at position corresponding to position 39, 60, 74, 81 , 84, 109, 1 15, 1 17, 142, 145, 146, 154, 182, 183, 187, 209, 210, 212, 228, 267, 272, 280, 294, 317, 318, 348 or 362 of the polypeptide of SEQ ID NO: 3, wherein the variant has protease activity and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity to the polypeptide of SEQ ID NO: 3, wherein the protease is a serine protease belonging to the S53 family, and wherein the increased thermostability is increased residual activity measured after incubation for 30 min at an elevated temperature in the range from 55 to 60 degrees Celsius.
  • the variant comprises a modification which is a deletion at position corresponding to position 318 or 210 of the polypeptide of SEQ ID NO: 3 wherein the variant has protease activity and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity to the polypeptide of SEQ ID NO: 3, wherein the protease is a serine protease belonging to the S53 family, and wherein the increased thermo-stability is increased residual activity measured after incubation for 30 min at an elevated temperature in the range from 55 to 60 degrees Celsius.
  • the variant comprises a modification which is a substitution at position corresponding to positions 39, 60, 74 81 , 84, 109, 1 15, 142, 145, 146, 154, 182, 183, 187, 209, 212, 228, 267, 272, 280, 294, 317, 348 or 362 of the polypeptide of SEQ ID NO: 3, wherein the variant has protease activity and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity to the polypeptide of SEQ ID NO: 3, wherein the protease is a serine protease belonging to the S53 family, wherein the increased thermo-stability is increased residual activity measured after incubation for 30 min at a temperature in the range from 55 to 60 degrees Celsius.
  • the variant comprises or consists of one or more substitutions and/or deletions selected from the group consisting of: I39M, I39R, I39L, I39C, S60D, I84C N1 15D, N1 15L, E1 17D, N145G, N145Q, N145V, N145D, N145K, N145K, N145A, N145E, S183L, S183P, D280N, Q182G, Q182R, E81 R, E81 K, E81 E, E81A, I84C, Q154V, Q142W, Q142R, T146A, T146W, T146Y, T146E, T146D, I228R, D267N, S272V, S272R, E212E, S294A, T362A, E74W, S187L, P348A, D109P, S317A, S317G, S317S, S317A, S318 * and S210 * of
  • thermo-stability is increased residual activity measured after incubation for 30 min at a temperature in the range from 55 to 60 degrees Celsius. More particularly the variants have a residual activity of at least 10%, particularly at least 12%, more particularly at least 15%, measured after incubation for 30 minutes at 56°C.
  • the variant comprises at least one of the following modification or combination of modifications: Q142R + S183P;
  • the present invention relates to a variant comprising a modification at position corresponding to position 50, 57, 60, 81 , 84, 109, 1 10, 1 1 1 , 124, 128, 142, 145, 146, 154, 182, 183, 207, 209, 210, 228, 267, 271 , 272, 274, 278, 280, 294, 317, 318, 320, 321 , 322, 328, 343, 362, or 363 of the polypeptide of SEQ ID NO: 3, wherein the variant has protease activity and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity to the polypeptide of SEQ ID NO: 3, wherein the protease is a serine protease belonging to the S53 family.
  • the variant comprises a modification which is a substitution at position corresponding to positions 50, 57, 60, 81 , 84, 109, 1 10, 1 1 1 , 124, 128, 142, 145, 146, 154, 182, 183, 207, 209, 228, 267, 271 , 272, 274, 278, 280, 294, 317, 318, 320, 321 , 322, 328, 343, 362, or 363 of the polypeptide of SEQ ID NO: 3, wherein the variant has protease activity and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity to the polypeptide of SEQ ID NO: 3, wherein the protease is a serine protease belonging to the S53 family; and wherein the increase in thermo-stability is an increase in thermal denaturation temperature measured by TSA.
  • the variant comprises a modification which is a deletion at position corresponding to position 318 or 210 of the polypeptide of SEQ ID NO: 3, wherein the variant has protease activity and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity to the polypeptide of SEQ ID NO: 3, wherein the protease is a serine protease belonging to the S53 family; and wherein the increase in thermo-stability is an increase in thermal denaturation temperature measured by TSA.
  • the increased thermostability measured as Td by TSA assay is at least 59°C.
  • the variant comprises or consists of one or more substitution(s) and/or deletion(s) selected from the group consisting of S50C, K57R, S60P, E81 R, I84C, D109P, D109N, D1 10N, F1 1 1 P, N124L, N124W, N124Q, G128A, Q142R, Q142W, N145V, N145D, N145A, T146A, T146W, T146E, T146D, Q154V, Q154W, Q154,R, Q154Y, Q182G, Q182R, S183P, S183L, Q207R, V209L, I228R, D267N, V271 C, S272V, S272C, S272R, G274G, G278S, D280N, S294A, S317A, S318N, G320C, K321 G, K321A, A322S, T328C, K343
  • the variant comprises at least one of the following modifications or combination of modifications:
  • thermo-stability measured as Td by TSA assay is at least 59°C.
  • the variant comprises at least one of the following modifications or combination of modifications:
  • thermo-stability measured as Td by TSA assay is at least 61 °C.
  • the variant comprises at least one of the following modifications or combination of modifications:
  • thermo-stability measured as Td by TSA assay is at least 63°C.
  • the variant comprises at least one of the following modifications or combination of modifications:
  • thermo-stability measured as Td by TSA assay is at least 65°C.
  • the variants may further comprise one or more additional modification(s) at one or more (e.g., several) other positions. Such further modifications may preferably not change the properties of the protease variants of the present invention.
  • amino acid changes may be of a minor nature, that is conservative amino acid substitutions or insertions that do not significantly affect the folding and/or activity of the protein; small deletions, typically of 1 -30 amino acids; small amino- or carboxyl-terminal extensions, such as an amino-terminal methionine residue; a small linker peptide of up to 20-25 residues; or a small extension that facilitates purification by changing net charge or another function, such as a poly-histidine tract, an antigenic epitope or a binding domain.
  • protease variants according to the invention may only comprise one specific substitution providing the improved property according to the invention it may still have addition modifications leading to a variant protease having at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity, to the amino acid sequence of the mature parent protease, e.g., the protease of SEQ ID NO: 3.
  • additional modification should preferably not significantly change the improved properties of the variant protease.
  • conservative substitutions are within the groups of basic amino acids (arginine, lysine and histidine), acidic amino acids (glutamic acid and aspartic acid), polar amino acids (glutamine and asparagine), hydrophobic amino acids (leucine, isoleucine and valine), aromatic amino acids (phenylalanine, tryptophan and tyrosine), and small amino acids (glycine, alanine, serine, threonine and methionine).
  • Amino acid substitutions that do not generally alter specific activity are known in the art and are described, for example, by H. Neurath and R.L. Hill, 1979, In, The Proteins, Academic Press, New York.
  • Essential amino acids in a polypeptide can be identified according to procedures known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (Cunningham and Wells, 1989, Science 244: 1081 -1085). In the latter technique, single alanine mutations are introduced at every residue in the molecule, and the resultant mutant molecules are tested for protease activity to identify amino acid residues that are critical to the activity of the molecule. See also, Hilton et al., 1996, J. Biol. Chem. 271 : 4699-4708.
  • the active site of the enzyme or other biological interaction can also be determined by physical analysis of structure, as determined by such techniques as nuclear magnetic resonance, crystallography, electron diffraction, or photoaffinity labeling, in conjunction with mutation of putative contact site amino acids. See, for example, de Vos et al., 1992, Science 255: 306-312; Smith et al., 1992, J. Mol. Biol. 224: 899-904; Wlodaver ei a/., 1992, FEBS Lett. 309: 59-64.
  • the variant has improved (increased) thermo-stability compared to the parent enzyme, e.g., the polypeptide of SEQ ID NO: 3.
  • the variant has improved (increased) residual activity compared to parent enzyme, e.g., the polypeptide of SEQ ID NO: 3.
  • the variant has improved (increased) thermal melting temperature compared to parent enzyme, e.g., the polypeptide of SEQ ID NO: 3.
  • parent enzyme e.g., the polypeptide of SEQ ID NO: 3.
  • the parent protease may be (a) a polypeptide having at least 80% sequence identity to the mature polypeptide of SEQ ID NO: 2; (b) a polypeptide encoded by a polynucleotide that hybridizes under high stringency conditions with (i) the mature polypeptide coding sequence of SEQ ID NO: 1 , (ii) the cDNA sequence thereof, or (iii) the full-length complement of (i) or (ii); or (c) a polypeptide encoded by a polynucleotide having at least 80% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 1.
  • the parent has a sequence identity to the mature polypeptide of SEQ ID NO: 2 of at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%, which have protease activity.
  • the amino acid sequence of the parent differs by up to 10 amino acids, e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10, from the mature polypeptide of SEQ ID NO: 2.
  • the parent comprises or consists of the amino acid sequence of SEQ ID NO: 3. In another aspect, the parent comprises or consists of amino acids 199 to 564 of SEQ ID NO: 2.
  • the parent is encoded by a polynucleotide that hybridizes under high stringency conditions, or very high stringency conditions with (i) the mature polypeptide coding sequence of SEQ ID NO: 1 , (ii) the cDNA sequence thereof, or (iii) the full-length complement of (i) or (ii) (Sambrook et al, 1989, Molecular Cloning, A Laboratory Manual, 2d edition, Cold Spring Harbor, New York).
  • the polynucleotide of SEQ ID NO: 1 or a subsequence thereof, as well as the polypeptide of SEQ ID NO: 2 or a fragment thereof, may be used to design nucleic acid probes to identify and clone DNA encoding a parent from strains of different genera or species according to methods well known in the art.
  • probes can be used for hybridization with the genomic DNA or cDNA of a cell of interest, following standard Southern blotting procedures, in order to identify and isolate the corresponding gene therein.
  • Such probes can be considerably shorter than the entire sequence, but should be at least 15, e.g., at least 25, at least 35, or at least 70 nucleotides in length.
  • the nucleic acid probe is at least 100 nucleotides in length, e.g., at least 200 nucleotides, at least 300 nucleotides, at least 400 nucleotides, at least 500 nucleotides, at least 600 nucleotides, at least 700 nucleotides, at least 800 nucleotides, or at least 900 nucleotides in length.
  • Both DNA and RNA probes can be used.
  • the probes are typically labeled for detecting the corresponding gene (for example, with 32 P, 3 H, 35 S, biotin, or avidin). Such probes are encompassed by the present invention.
  • a genomic DNA or cDNA library prepared from such other strains may be screened for DNA that hybridizes with the probes described above and encodes a parent.
  • Genomic or other DNA from such other strains may be separated by agarose or polyacrylamide gel electrophoresis, or other separation techniques.
  • DNA from the libraries or the separated DNA may be transferred to and immobilized on nitrocellulose or other suitable carrier material.
  • the carrier material is used in a Southern blot.
  • hybridization indicates that the polynucleotide hybridizes to a labeled nucleic acid probe corresponding to (i) SEQ ID NO: 1 ; (ii) the mature polypeptide coding sequence of SEQ ID NO: 1 ; (iii) the cDNA sequence thereof; (iv) the full- length complement thereof; or (v) a subsequence thereof; under high to very high stringency conditions.
  • Molecules to which the nucleic acid probe hybridizes under these conditions can be detected using, for example, X-ray film or any other detection means known in the art.
  • the nucleic acid probe is the mature polypeptide coding sequence of SEQ ID NO: 1
  • nucleic acid probe is nucleotides 595 to 1692 of SEQ ID NO: 1 .
  • nucleic acid probe is a polynucleotide that encodes the polypeptide of SEQ ID NO: 2; the mature polypeptide thereof; or a fragment thereof.
  • nucleic acid probe is SEQ ID NO: 1 or the cDNA sequence thereof.
  • the parent is encoded by a polynucleotide having a sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 1 of at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%.
  • the polypeptide may be a hybrid polypeptide in which a region of one polypeptide is fused at the N-terminus or the C-terminus of a region of another polypeptide.
  • the parent may be a fusion polypeptide or cleavable fusion polypeptide in which another polypeptide is fused at the N-terminus or the C-terminus of the polypeptide of the present invention.
  • a fusion polypeptide is produced by fusing a polynucleotide encoding another polypeptide to a polynucleotide of the present invention.
  • Techniques for producing fusion polypeptides are known in the art, and include ligating the coding sequences encoding the polypeptides so that they are in frame and that expression of the fusion polypeptide is under control of the same promoter(s) and terminator.
  • Fusion polypeptides may also be constructed using intein technology in which fusion polypeptides are created post-translationally (Cooper et al., 1993, EMBO J. 12: 2575-2583; Dawson et al., 1994, Science 266: 776-779).
  • a fusion polypeptide can further comprise a cleavage site between the two polypeptides.
  • cleavage sites include, but are not limited to, the sites disclosed in Martin et al., 2003, J. Ind. Microbiol. Biotechnol. 3: 568-576; Svetina et al., 2000, J. Biotechnol. 76: 245-251 ; Rasmussen- Wilson et al., 1997, Appl. Environ. Microbiol.
  • the parent is a Meripilus giganteus S53 protease, e.g., the protease of SEQ ID NO: 2 or the mature polypeptide thereof, disclosed herein as SEQ ID NO: 3.
  • the variants can be prepared using any mutagenesis procedure known in the art, such as site-directed mutagenesis, synthetic gene construction, semi-synthetic gene construction, random mutagenesis, shuffling, etc.
  • Site-directed mutagenesis is a technique in which one or more (e.g., several) mutations are introduced at one or more defined sites in a polynucleotide encoding the parent.
  • Site-directed mutagenesis can be accomplished in vitro by PCR involving the use of oligonucleotide primers containing the desired mutation. Site-directed mutagenesis can also be performed in vitro by cassette mutagenesis involving the cleavage by a restriction enzyme at a site in the plasmid comprising a polynucleotide encoding the parent and subsequent ligation of an oligonucleotide containing the mutation in the polynucleotide. Usually the restriction enzyme that digests the plasmid and the oligonucleotide is the same, permitting sticky ends of the plasmid and the insert to ligate to one another. See, e.g., Scherer and Davis, 1979, Proc. Natl. Acad. Sci. USA 76: 4949-4955; and Barton et al., 1990, Nucleic Acids Res. 18: 7349-4966.
  • Site-directed mutagenesis can also be accomplished in vivo by methods known in the art. See, e.g., U.S. Patent Application Publication No. 2004/0171 154; Storici et al., 2001 , Nature Biotechnol. 19: 773-776; Kren et al., 1998, Nat. Med. 4: 285-290; and Calissano and Macino, 1996, Fungal Genet. Newslett. 43: 15-16.
  • Any site-directed mutagenesis procedure can be used in the present invention.
  • Synthetic gene construction entails in vitro synthesis of a designed polynucleotide molecule to encode a polypeptide of interest. Gene synthesis can be performed utilizing a number of techniques, such as the multiplex microchip-based technology described by Tian et al. (2004, Nature 432: 1050-1054) and similar technologies wherein oligonucleotides are synthesized and assembled upon photo-programmable microfluidic chips.
  • Single or multiple amino acid substitutions, deletions, and/or insertions can be made and tested using known methods of mutagenesis, recombination, and/or shuffling, followed by a relevant screening procedure, such as those disclosed by Reidhaar-Olson and Sauer, 1988, Science 241 : 53-57; Bowie and Sauer, 1989, Proc. Natl. Acad. Sci. USA 86: 2152-2156; WO 95/17413; or WO 95/22625.
  • Other methods that can be used include error-prone PCR, phage display (e.g., Lowman et al., 1991 , Biochemistry 30: 10832-10837; U.S. Patent No. 5,223,409; WO 92/06204) and region-directed mutagenesis (Derbyshire et al., 1986, Gene 46: 145; Ner ei a/., 1988, DNA 7: 127).
  • Mutagenesis/shuffling methods can be combined with high-throughput, automated screening methods to detect activity of cloned, mutagenized polypeptides expressed by host cells (Ness et al., 1999, Nature Biotechnology 17: 893-896). Mutagenized DNA molecules that encode active polypeptides can be recovered from the host cells and rapidly sequenced using standard methods in the art. These methods allow the rapid determination of the importance of individual amino acid residues in a polypeptide.
  • Semi-synthetic gene construction is accomplished by combining aspects of synthetic gene construction, and/or site-directed mutagenesis, and/or random mutagenesis, and/or shuffling.
  • Semi-synthetic construction is typified by a process utilizing polynucleotide fragments that are synthesized, in combination with PCR techniques. Defined regions of genes may thus be synthesized de novo, while other regions may be amplified using site-specific mutagenic primers, while yet other regions may be subjected to error-prone PCR or non-error prone PCR amplification. Polynucleotide subsequences may then be shuffled.
  • the present invention also relates to polynucleotides encoding a variant of the present invention.
  • the present invention also relates to nucleic acid constructs comprising a polynucleotide encoding a variant of the present invention operably linked to one or more control sequences that direct the expression of the coding sequence in a suitable host cell under conditions compatible with the control sequences.
  • the polynucleotide may be manipulated in a variety of ways to provide for expression of a variant. Manipulation of the polynucleotide prior to its insertion into a vector may be desirable or necessary depending on the expression vector.
  • the techniques for modifying polynucleotides utilizing recombinant DNA methods are well known in the art.
  • the control sequence may be a promoter, a polynucleotide which is recognized by a host cell for expression of the polynucleotide.
  • the promoter contains transcriptional control sequences that mediate the expression of the variant.
  • the promoter may be any polynucleotide that shows transcriptional activity in the host cell including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the host cell.
  • promoters for directing transcription of the nucleic acid constructs of the present invention in a filamentous fungal host cell are promoters obtained from the genes for Aspergillus nidulans acetamidase, Aspergillus niger neutral alpha-amylase, Aspergillus niger acid stable alpha-amylase, Aspergillus niger or Aspergillus awamori glucoamylase ⁇ glaA), Aspergillus oryzae TAKA amylase, Aspergillus oryzae alkaline protease, Aspergillus oryzae triose phosphate isomerase, Fusarium oxysporum trypsin-like protease (WO 96/00787), Fusarium venenatum amyloglucosidase (WO 00/56900), Fusarium venenatum Daria (WO 00/56900), Fusarium venenatum Quinn
  • the control sequence may also be a transcription terminator, which is recognized by a host cell to terminate transcription.
  • the terminator sequence is operably linked to the 3'-terminus of the polynucleotide encoding the variant. Any terminator that is functional in the host cell may be used.
  • Preferred terminators for filamentous fungal host cells are obtained from the genes for Aspergillus nidulans anthranilate synthase, Aspergillus niger glucoamylase, Aspergillus niger alpha-glucosidase, Aspergillus oryzae TAKA amylase, and Fusarium oxysporum trypsin-like protease.
  • control sequence may also be an mRNA stabilizer region downstream of a promoter and upstream of the coding sequence of a gene which increases expression of the gene.
  • the control sequence may also be a leader, a nontranslated region of an mRNA that is important for translation by the host cell.
  • the leader sequence is operably linked to the 5'-terminus of the polynucleotide encoding the variant. Any leader that is functional in the host cell may be used.
  • Preferred leaders for filamentous fungal host cells are obtained from the genes for Aspergillus oryzae TAKA amylase and Aspergillus nidulans triose phosphate isomerase.
  • the control sequence may also be a polyadenylation sequence, a sequence operably linked to the 3'-terminus of the variant-encoding sequence and, when transcribed, is recognized by the host cell as a signal to add polyadenosine residues to transcribed mRNA. Any polyadenylation sequence that is functional in the host cell may be used.
  • Preferred polyadenylation sequences for filamentous fungal host cells are obtained from the genes for Aspergillus nidulans anthranilate synthase, Aspergillus niger glucoamylase, Aspergillus niger alpha-glucosidase, Aspergillus oryzae TAKA amylase, and Fusarium oxysporum trypsin-like protease.
  • the control sequence may also be a signal peptide coding region that encodes a signal peptide linked to the N-terminus of a variant and directs the variant into the cell's secretory pathway.
  • the 5'-end of the coding sequence of the polynucleotide may inherently contain a signal peptide coding sequence naturally linked in translation reading frame with the segment of the coding sequence that encodes the variant.
  • the 5'-end of the coding sequence may contain a signal peptide coding sequence that is foreign to the coding sequence.
  • a foreign signal peptide coding sequence may be required where the coding sequence does not naturally contain a signal peptide coding sequence.
  • a foreign signal peptide coding sequence may simply replace the natural signal peptide coding sequence in order to enhance secretion of the variant.
  • any signal peptide coding sequence that directs the expressed variant into the secretory pathway of a host cell may be used.
  • Effective signal peptide coding sequences for filamentous fungal host cells are the signal peptide coding sequences obtained from the genes for Aspergillus niger neutral amylase, Aspergillus niger glucoamylase, Aspergillus oryzae TAKA amylase, Humicola insolens cellulase, Humicola insolens endoglucanase V, Humicola lanuginosa lipase, and Rhizomucor miehei aspartic proteinase.
  • the control sequence may also be a propeptide coding sequence that encodes a propeptide positioned at the N-terminus of a variant.
  • the resultant polypeptide is known as a proenzyme or propolypeptide (or a zymogen in some cases).
  • a propolypeptide is generally inactive and can be converted to an active polypeptide by catalytic or autocatalytic cleavage of the propeptide from the propolypeptide.
  • the propeptide coding sequence may be obtained from the genes for Myceliophthora thermophila laccase (WO 95/33836), Rhizomucor miehei aspartic proteinase.
  • the propeptide sequence is positioned next to the N-terminus of the variant and the signal peptide sequence is positioned next to the N-terminus of the propeptide sequence.
  • regulatory sequences that regulate expression of the variant relative to the growth of the host cell.
  • regulatory systems are those that cause expression of the gene to be turned on or off in response to a chemical or physical stimulus, including the presence of a regulatory compound.
  • Regulatory systems in prokaryotic systems include the lac, tac, and trp operator systems.
  • yeast the ADH2 system or GAL1 system may be used.
  • filamentous fungi the Aspergillus niger glucoamylase promoter, Aspergillus oryzae TAKA alpha-amylase promoter, and Aspergillus oryzae glucoamylase promoter may be used.
  • Other examples of regulatory sequences are those that allow for gene amplification.
  • these regulatory sequences include the dihydrofolate reductase gene that is amplified in the presence of methotrexate, and the metallothionein genes that are amplified with heavy metals.
  • the polynucleotide encoding the variant would be operably linked with the regulatory sequence.
  • the present invention also relates to recombinant expression vectors comprising a polynucleotide encoding a variant of the present invention, a promoter, and transcriptional and translational stop signals.
  • the various nucleotide and control sequences may be joined together to produce a recombinant expression vector that may include one or more convenient restriction sites to allow for insertion or substitution of the polynucleotide encoding the variant at such sites.
  • the polynucleotide may be expressed by inserting the polynucleotide or a nucleic acid construct comprising the polynucleotide into an appropriate vector for expression.
  • the coding sequence is located in the vector so that the coding sequence is operably linked with the appropriate control sequences for expression.
  • the recombinant expression vector may be any vector (e.g., a plasmid or virus) that can be conveniently subjected to recombinant DNA procedures and can bring about expression of the polynucleotide.
  • the choice of the vector will typically depend on the compatibility of the vector with the host cell into which the vector is to be introduced.
  • the vector may be a linear or closed circular plasmid.
  • the vector may be an autonomously replicating vector, i.e., a vector that exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g., a plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome.
  • the vector may contain any means for assuring self-replication.
  • the vector may be one that, when introduced into the host cell, is integrated into the genome and replicated together with the chromosome(s) into which it has been integrated.
  • a single vector or plasmid or two or more vectors or plasmids that together contain the total DNA to be introduced into the genome of the host cell, or a transposon may be used.
  • the vector preferably contains one or more selectable markers that permit easy selection of transformed, transfected, transduced, or the like cells.
  • a selectable marker is a gene the product of which provides for biocide or viral resistance, resistance to heavy metals, prototrophy to auxotrophs, and the like.
  • Selectable markers for use in a filamentous fungal host cell include, but are not limited to, amdS (acetamidase), argB (ornithine carbamoyltransferase), bar (phosphinothricin acetyltransferase), hph (hygromycin phosphotransferase), niaD (nitrate reductase), pyrG (orotidine-5'-phosphate decarboxylase), sC (sulfate adenyltransferase), and trpC (anthranilate synthase), as well as equivalents thereof.
  • amdS acetamidase
  • argB ornithine carbamoyltransferase
  • bar phosphinothricin acetyltransferase
  • hph hygromycin phosphotransferase
  • niaD nitrate reductase
  • Aspergillus nidulans or Aspergillus oryzae niaD Preferred for use in an Aspergillus cell are Aspergillus nidulans or Aspergillus oryzae niaD, niiA, amdS and pyrG genes and a Streptomyces hygroscopicus bar gene.
  • the vector preferably contains an element(s) that permits integration of the vector into the host cell's genome or autonomous replication of the vector in the cell independent of the genome.
  • the vector may rely on the polynucleotide's sequence encoding the variant or any other element of the vector for integration into the genome by homologous or non-homologous recombination.
  • the vector may contain additional polynucleotides for directing integration by homologous recombination into the genome of the host cell at a precise location(s) in the chromosome(s).
  • the integrational elements should contain a sufficient number of nucleic acids, such as 100 to 10,000 base pairs, 400 to 10,000 base pairs, and 800 to 10,000 base pairs, which have a high degree of sequence identity to the corresponding target sequence to enhance the probability of homologous recombination.
  • the integrational elements may be any sequence that is homologous with the target sequence in the genome of the host cell. Furthermore, the integrational elements may be non-encoding or encoding polynucleotides. On the other hand, the vector may be integrated into the genome of the host cell by non-homologous recombination.
  • the vector may further comprise an origin of replication enabling the vector to replicate autonomously in the host cell in question.
  • the origin of replication may be any plasmid replicator mediating autonomous replication that functions in a cell.
  • the term "origin of replication" or "plasmid replicator” means a polynucleotide that enables a plasmid or vector to replicate in vivo.
  • origins of replication useful in a filamentous fungal cell are AMA1 and ANSI
  • More than one copy of a polynucleotide of the present invention may be inserted into a host cell to increase production of a variant.
  • An increase in the copy number of the polynucleotide can be obtained by integrating at least one additional copy of the sequence into the host cell genome or by including an amplifiable selectable marker gene with the polynucleotide where cells containing amplified copies of the selectable marker gene, and thereby additional copies of the polynucleotide, can be selected for by cultivating the cells in the presence of the appropriate selectable agent.
  • the procedures used to ligate the elements described above to construct the recombinant expression vectors of the present invention are well known to one skilled in the art (see, e.g., Sambrook et al., 1989, supra). Host Cells
  • the present invention also relates to recombinant host cells, comprising a polynucleotide encoding a variant of the present invention operably linked to one or more control sequences that direct the production of a variant of the present invention.
  • the recombinant host cell comprises the polynucleotide encoding a trehalase polypeptide of the present invention, wherein the said polynucleotide is heterologous (of different origin/species) to the host cell.
  • a construct or vector comprising a polynucleotide is introduced into a host cell so that the construct or vector is maintained as a chromosomal integrant or as a self-replicating extra-chromosomal vector as described earlier.
  • the term "host cell” encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication. The choice of a host cell will to a large extent depend upon the gene encoding the variant and its source.
  • the host cell may be any cell useful in the recombinant production of a variant, e.g., a prokaryote or a eukaryote.
  • the host cell may be a fungal cell.
  • "Fungi” as used herein includes the phyla Ascomycota, Basidiomycota, Chytridiomycota, and Zygomycota as well as the Oomycota and all mitosporic fungi (as defined by Hawksworth et al., In, Ainsworth and Bisby's Dictionary of The Fungi, 8th edition, 1995, CAB International, University Press, Cambridge, UK).
  • the fungal host cell may be a yeast cell.
  • yeast as used herein includes ascosporogenous yeast (Endomycetales), basidiosporogenous yeast, and yeast belonging to the Fungi Imperfecti (Blastomycetes). Since the classification of yeast may change in the future, for the purposes of this invention, yeast shall be defined as described in Biology and Activities of Yeast (Skinner, Passmore, and Davenport, editors, Soc. App. Bacteriol. Symposium Series No. 9, 1980).
  • the yeast host cell may be a Candida, Hansenula, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces, or Yarrowia cell such as a Kluyveromyces lactis, Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbensis, Saccharomyces oviformis, or Yarrowia lipolytica cell.
  • the fungal host cell may be a filamentous fungal cell.
  • "Filamentous fungi” include all filamentous forms of the subdivision Eumycota and Oomycota (as defined by Hawksworth et al., 1995, supra).
  • the filamentous fungi are generally characterized by a mycelial wall composed of chitin, cellulose, glucan, chitosan, mannan, and other complex polysaccharides. Vegetative growth is by hyphal elongation and carbon catabolism is obligately aerobic. In contrast, vegetative growth by yeasts such as Saccharomyces cerevisiae is by budding of a unicellular thallus and carbon catabolism may be fermentative.
  • the filamentous fungal host cell may be an Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes, or Trichoderma cell.
  • the filamentous fungal host cell may be an Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Bjerkandera adusta, Ceriporiopsis aneirina, Ceriporiopsis caregiea, Ceriporiopsis gilvescens, Ceriporiopsis pannocinta, Ceriporiopsis rivulosa, Ceriporiopsis subrufa, Ceriporiopsis subvermispora, Chrysosporium inops, Chrysosporium keratinophilum, Chrysosporium lucknowense, Chrysosporium merdarium, Chrysosporium pannicola, Chrysosporium queenslandicum, Chrysosporium tropicum, Chrysosporium zona
  • Fungal cells may be transformed by a process involving protoplast formation, transformation of the protoplasts, and regeneration of the cell wall in a manner known per se. Suitable procedures for transformation of Aspergillus and Trichoderma host cells are described in EP 238023, Yelton et ai, 1984, Proc. Natl. Acad. Sci. USA 81 : 1470-1474, and Christensen et al., 1988, Bio/Technology 6: 1419-1422. Suitable methods for transforming Fusarium species are described by Malardier et ai, 1989, Gene 78: 147-156, and WO 96/00787. Yeast may be transformed using the procedures described by Becker and Guarente, In Abelson, J.N.
  • the present invention also relates to methods of producing a variant, comprising: (a) cultivating a recombinant host cell of the present invention under conditions suitable for expression of the variant; and (b) recovering the variant.
  • the host cells are cultivated in a nutrient medium suitable for production of the variant using methods known in the art.
  • the cell may be cultivated by shake flask cultivation, or small-scale or large-scale fermentation (including continuous, batch, fed-batch, or solid state fermentations) in laboratory or industrial fermentors performed in a suitable medium and under conditions allowing the variant to be expressed and/or isolated.
  • the cultivation takes place in a suitable nutrient medium comprising carbon and nitrogen sources and inorganic salts, using procedures known in the art. Suitable media are available from commercial suppliers or may be prepared according to published compositions (e.g., in catalogues of the American Type Culture Collection). If the variant is secreted into the nutrient medium, the variant can be recovered directly from the medium. If the variant is not secreted, it can be recovered from cell lysates.
  • the variant may be detected using methods known in the art that are specific for the variants. These detection methods include, but are not limited to, use of specific antibodies, formation of an enzyme product, or disappearance of an enzyme substrate. For example, an enzyme assay may be used to determine the activity of the variant.
  • the variant may be recovered using methods known in the art.
  • the variant may be recovered from the nutrient medium by conventional procedures including, but not limited to, collection, centrifugation, filtration, extraction, spray-drying, evaporation, or precipitation.
  • the variant may be purified by a variety of procedures known in the art including, but not limited to, chromatography (e.g., ion exchange, affinity, hydrophobic, chromatofocusing, and size exclusion), electrophoretic procedures (e.g., preparative isoelectric focusing), differential solubility (e.g., ammonium sulfate precipitation), SDS-PAGE, or extraction (see, e.g., Protein Purification, Janson and Ryden, editors, VCH Publishers, New York, 1989) to obtain substantially pure variants.
  • chromatography e.g., ion exchange, affinity, hydrophobic, chromatofocusing, and size exclusion
  • electrophoretic procedures e.g., preparative isoelectric focusing
  • differential solubility e.g., ammonium sulfate precipitation
  • SDS-PAGE or extraction (see, e.g., Protein Purification, Janson and Ryden, editors, VCH Publishers, New York, 1989) to obtain substantially pure
  • the variant is not recovered, but rather a host cell of the present invention expressing the variant is used as a source of the variant.
  • the present invention also relates to compositions comprising variant protease of the invention.
  • the compositions are enriched in such a protease.
  • the term "enriched" indicates that the pullulanase activity of the composition has been increased, e.g., with an enrichment factor of at least 1 .1.
  • the compositions may comprise the variant S53 protease as the major enzymatic component, e.g., a mono-component composition.
  • compositions may comprise multiple enzymatic activities, such as the variant S53 protease and one or more (e.g., several) enzymes selected from the group consisting of hydrolase, isomerase, ligase, lyase, oxidoreductase, or transferase, e.g., an alpha-galactosidase, alpha-glucosidase, aminopeptidase, alpha-amylase, beta-amylase, beta-galactosidase, beta-glucosidase, beta- xylosidase, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, chitinase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanase, esterase, glucoamylase, invertase, laccase, lip
  • the composition comprises a variant S53 protease of the invention and a carbohydrate-source generating enzyme and optionally an alpha-amylase.
  • the composition comprises a variant S53 protease and a glucoamylase.
  • the enzyme activities comprised in the composition are selected from the variant S53 protease of the invention and one or more enzymes selected from the group consisting of glucoamylase, fungal alpha-amylase.
  • the glucoamylase comprised in the composition is of fungal origin, preferably from a stain of Aspergillus, preferably A. niger, A. awamori, or A. oryzae; or a strain of Trichoderma, preferably T. reesei; or a strain of Talaromyces, preferably T. emersonii or a strain of Trametes, preferably T. cingulata, or a strain of Pycnoporus, preferable P. sanguineus, or a strain of Gloeophyllum, such as G. serpiarium or G. trabeum, or a strain of the Nigrofomes.
  • the glucoamylase is derived from Trametes, such as a strain of Trametes cingulata, such as the one shown in SEQ ID NO: 4 herein.
  • glucoamylase comprising the polypeptide of SEQ ID NO: 4 herein;
  • a glucoamylase comprising an amino acid sequence having at least 60%, at least 70%, e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the polypeptide of SEQ ID NO: 4 herein.
  • the glucoamylase is derived from Talaromyces, such as a strain of
  • Talaromyces emersonii such as the one shown in SEQ ID NO: 5 herein.
  • glucoamylase comprising the polypeptide of SEQ ID NO: 5 herein;
  • a glucoamylase comprising an amino acid sequence having at least 60%, at least 70%, e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the polypeptide of SEQ ID NO: 5 herein.
  • the glucoamylase is derived from a strain of the genus Pycnoporus, in particular a strain of Pycnoporus sanguineus described in WO 201 1/066576 (SEQ ID NOs 2, 4 or 6), such as the one shown as SEQ ID NO: 4 in WO 201 1/066576.
  • glucoamylase comprising the polypeptide of SEQ ID NO: 6 herein;
  • a glucoamylase comprising an amino acid sequence having at least 60%, at least 70%, e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at SEQ ID NO: 6 herein.
  • the glucoamylase is derived from a strain of the genus Gloeophyllum, such as a strain of Gloeophyllum sepiarium or Gloeophyllum trabeum, in particular a strain of Gloeophyllum as described in WO 201 1/068803 (SEQ ID NO: 2, 4, 6, 8, 10, 12, 14 or 16).
  • the glucoamylase is the Gloeophyllum sepiarium shown in SEQ ID NO: 2 in WO 201 1/068803 or SEQ ID NO: 7 herein.
  • the glucoamylase is derived from Gloeophyllum serpiarium, such as the one shown in SEQ ID NO: 7 herein. In an embodiment the glucoamylase is selected from the group consisting of:
  • glucoamylase comprising the polypeptide of SEQ ID NO: 7 herein;
  • a glucoamylase comprising an amino acid sequence having at least 60%, at least 70%, e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least
  • the glucoamylase is derived from Gloeophyllum trabeum such as the one shown in SEQ ID NO: 8 herein. In an embodiment the glucoamylase is selected from the group consisting of:
  • glucoamylase comprising the polypeptide of SEQ ID NO: 8 herein;
  • a glucoamylase comprising an amino acid sequence having at least 60%, at least 70%, e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the polypeptide of SEQ ID NO: 8 herein.
  • the glucoamylase is derived from a strain of the genus Nigrofomes, in particular a strain of Nigrofomes sp. disclosed in WO 2012/064351.
  • Glucoamylases may in an embodiment be added to the saccharification and/or fermentation in an amount of 0.0001 -20 AGU/g DS, preferably 0.001 -10 AGU/g DS, especially between 0.01 -5 AGU/g DS, such as 0.1 -2 AGU/g DS.
  • compositions comprising glucoamylase include AMG 200L; AMG 300 L; SANTM SUPER, SANTM EXTRA L, SPIRIZYMETM PLUS, SPIRIZYMETM FUEL, SPIRIZYMETM B4U, SPIRIZYMETM ULTRA, SPIRIZYMETM EXCEL and AMGTM E (from Novozymes MS); OPTIDEXTM 300, GC480, GC417 (from DuPont); AMIGASETM and AMIGASETM PLUS (from DSM); G-ZYMETM G900, G-ZYMETM and G990 ZR (from DuPont).
  • composition may further comprise an alpha-amylase.
  • alpha-amylase is an acid fungal alpha-amylase.
  • a fungal acid stable alpha- amylase is an alpha-amylase that has activity in the pH range of 3.0 to 7.0 and preferably in the pH range from 3.5 to 6.5, including activity at a pH of about 4.0, 4.5, 5.0, 5.5, and 6.0.
  • the acid fungal alpha-amylase is derived from the genus Aspergillus, especially a strain of A. terreus, A. niger, A. oryzae, A. awamori, or Aspergillus kawachii, or from the genus Rhizomucor, preferably a strain the Rhizomucor pusillus, or the genus Meripilus, preferably a strain of Meripilus giganteus.
  • the alpha-amylase is derived from a strain of the genus Rhizomucor, preferably a strain the Rhizomucor pusillus, such as one shown in SEQ ID NO: 3 in WO 2013/006756, such as a Rhizomucor pusillus alpha-amylase hybrid having an Aspergillus niger linker and starch-binding domain, such as the one shown in SEQ ID NO: 9 herein, or a variant thereof.
  • an alpha-amylase comprising an amino acid sequence having at least 60%, at least 70%, e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the polypeptide of SEQ ID NO: 9 herein.
  • the alpha-amylase is a variant of the alpha-amylase shown in SEQ ID NO: 9 having at least one of the following substitutions or combinations of substitutions: D165M; Y141W; Y141 R; K136F; K192R; P224A; P224R; S123H + Y141W; G20S + Y141W; A76G + Y141W; G128D + Y141W; G128D + D143N; P219C + Y141W; N142D + D143N; Y141 W + K192R; Y141W + D143N; Y141W + N383R; Y141W + P219C + A265C; Y141 W + N142D + D143N; Y141 W + K192R V410A; G128D + Y141W + D143N; Y141W + D143N + P219C; Y141W + D143N + K192R; G128D +
  • the alpha-amylase is derived from a Rhizomucor pusillus with an Aspergillus niger glucoamylase linker and starch-binding domain (SBD), preferably disclosed as SEQ ID NO: 9 herein, preferably having one or more of the following substitutions: G128D, D143N, preferably G128D+D143N (using SEQ ID NO: 9 for numbering), and wherein the alpha- amylase variant has at least 75% identity preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 91 %, more preferably at least 92%, even more preferably at least 93%, most preferably at least 94%, and even most preferably at least 95%, such as even at least 96%, at least 97%, at least 98%, at least 99%, but less than 100% identity to the polypeptide of SEQ ID NO: 9 herein.
  • SBD Rhizomucor pusillus with an Aspergillus n
  • the ratio between glucoamylase and alpha-amylase present and/or added during saccharification and/or fermentation may preferably be in the range from 500:1 to 1 :1 , such as from 250:1 to 1 :1 , such as from 100:1 to 1 : 1 , such as from 100: 2 to 100:50, such as from 100:3 to 100:70.
  • compositions may be prepared in accordance with methods known in the art and may be in the form of a liquid or a dry composition.
  • the composition may be in the form of granulate or microgranulate.
  • the variant may be stabilized in accordance with methods known in the art.
  • compositions may be prepared in accordance with methods known in the art and may be in the form of a liquid or a dry composition.
  • the compositions may be stabilized in accordance with methods known in the art.
  • the enzyme composition of the present invention may be in any form suitable for use, such as, for example, a crude fermentation broth with or without cells removed, a cell lysate with or without cellular debris, a semi-purified or purified enzyme composition, or a host cell, as a source of the enzymes.
  • the enzyme composition may be a dry powder or granulate, a non-dusting granulate, a liquid, a stabilized liquid, or a stabilized protected enzyme.
  • Liquid enzyme compositions may, for instance, be stabilized by adding stabilizers such as a sugar, a sugar alcohol or another polyol, and/or lactic acid or another organic acid according to established processes.
  • Native starch consists of microscopic granules, which are insoluble in water at room temperature. When aqueous starch slurry is heated, the granules swell and eventually burst, dispersing the starch molecules into the solution. At temperatures up to about 50°C to 75°C the swelling may be reversible. However, with higher temperatures an irreversible swelling called “gelatinization” begins. During this "gelatinization” process there is a dramatic increase in viscosity.
  • Granular starch to be processed may be a highly refined starch quality, preferably at least 90%, at least 95%, at least 97% or at least 99.5% pure or it may be a more crude starch- containing materials comprising (e.g., milled) whole grains including non-starch fractions such as germ residues and fibers.
  • the raw material such as whole grains, may be reduced in particle size, e.g., by milling, in order to open up the structure and allowing for further processing.
  • whole kernels are milled and used. Wet milling gives a good separation of germ and meal (starch granules and protein) and is often applied at locations where the starch hydrolysate is used in the production of, e.g., syrups. Both dry and wet milling is well known in the art of starch processing and may be used in a process of the invention. Methods for reducing the particle size of the starch containing material are well known to those skilled in the art.
  • the starch As the solids level is 30-40% in a typical industrial process, the starch has to be thinned or "liquefied” so that it can be suitably processed. This reduction in viscosity is primarily attained by enzymatic degradation in current commercial practice.
  • Liquefaction is carried out in the presence of an alpha-amylase, preferably a bacterial alpha-amylase and/or acid fungal alpha-amylase.
  • an alpha-amylase preferably a bacterial alpha-amylase and/or acid fungal alpha-amylase.
  • a phytase is also present during liquefaction.
  • viscosity reducing enzymes such as a xylanase and/or beta-glucanase is also present during liquefaction.
  • the long-chained starch is degraded into branched and linear shorter units (maltodextrins) by an alpha-amylase.
  • Liquefaction may be carried out as a three- step hot slurry process. The slurry is heated to between 60-95°C (e.g., 70-90°C, such as 77- 86°C, 80-85°C, 83-85°C) and an alpha-amylase is added to initiate liquefaction (thinning).
  • the slurry may in an embodiment be jet-cooked at between 95-140°C, e.g., 105-125°C, for about 1 -15 minutes, e.g., about 3-10 minutes, especially around 5 minutes.
  • the slurry is then cooled to 60-95°C and more alpha-amylase is added to obtain final hydrolysis (secondary liquefaction).
  • the jet-cooking process is carried out at pH 4.5-6.5, typically at a pH between 5 and 6.
  • the alpha-amylase may be added as a single dose, e.g., before jet cooking.
  • the liquefaction process is carried out at between 70-95°C, such as 80-90°C, such as around 85°C, for about 10 minutes to 5 hours, typically for 1 -2 hours.
  • the pH is between 4 and 7, such as between 4.5 and 5.5.
  • calcium may optionally be added (to provide 1 -60 ppm free calcium ions, such as about 40 ppm free calcium ions).
  • the liquefied starch will typically have a "dextrose equivalent" (DE) of 10-15.
  • Alpha-amylases for use in liquefaction are preferably bacterial acid stable alpha- amylases.
  • the alpha-amylase is from an Exiguobacterium sp. or a Bacillus sp. such as e.g., Bacillus stearothermophilus or Bacillus lichen iformis.
  • the alpha-amylase is from the genus Bacillus, such as a strain of Bacillus stearothermophilus, in particular a variant of a Bacillus stearothermophilus alpha- amylase, such as the one shown in SEQ ID NO: 3 in WO 99/019467 or SEQ ID NO: 10 herein.
  • the Bacillus stearothermophilus alpha-amylase has a double deletion of two amino acids in the region from position 179 to 182, more particularly a double deletion at positions 1181 + G182, R179 + G180, G180 + 1181 , R179 + 1181 , or G180 + G182, preferably 1181 + G182, and optionally a N193F substitution, (using SEQ ID NO: 10 for numbering).
  • Bacillus stearothermophilus alpha-amylase has a substitution at position S242, preferably S242Q substitution.
  • Bacillus stearothermophilus alpha-amylase has a substitution at position E188, preferably E188P substitution.
  • the alpha-amylase variant has at least 75% identity preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 91 %, more preferably at least 92%, even more preferably at least 93%, most preferably at least 94%, and even most preferably at least 95%, such as even at least 96%, at least 97%, at least 98%, at least 99%, but less than 100% identity to the polypeptide of SEQ ID NO: 10.
  • Bacillus stearothermophilus alpha- amylase and variants thereof are normally produced in truncated form.
  • the truncation may be so that the Bacillus stearothermophilus alpha-amylase shown in SEQ ID NO: 3 in WO 99/19467 or SEQ ID NO: 10 herein, or variants thereof, are truncated in the C- terminal preferably to have around 490 amino acids, such as from 482-493 amino acids.
  • Bacillus stearothermophilus variant alpha-amylase is truncated, preferably after position 484 of SEQ ID NO: 10, particularly after position 485, particularly after position 486, particularly after position 487, particularly after position 488, particularly after position 489, particularly after position 490, particularly after position 491 , particularly after position 492, more particularly after position 493.
  • Saccharification may be carried out using conditions well-known in the art with a carbohydrate-source generating enzyme, in particular a glucoamylase, or a beta-amylase and optionally a debranching enzyme, such as an isoamylase or a pullulanase.
  • a full saccharification step may last from about 24 to about 72 hours.
  • Saccharification is typically carried out at a temperature in the range of 20-75°C, e.g., 25-65°C and 40-70°C, typically around 60°C, and at a pH between about 4 and 5, normally at about pH 4.5.
  • saccharification and fermentation steps may be carried out either sequentially or simultaneously.
  • saccharification and fermentation are performed simultaneously (referred to as "SSF").
  • SSF simultaneous saccharification and fermentation
  • a pre-saccharification step for about 30 minutes to 2 hours (e.g., 30 to 90 minutes) at a temperature of 30 to 65°C, typically around 60°C which is followed by a complete saccharification during fermentation referred to as simultaneous saccharification and fermentation (SSF).
  • the pH is usually between 4.2-4.8, e.g., pH 4.5.
  • SSF simultaneous saccharification and fermentation
  • maltodextrins produced during liquefaction are converted into dextrose by adding a glucoamylase and a debranching enzyme, such as an isoamylase (U.S. Patent No. 4,335,208) or a pullulanase.
  • a glucoamylase U.S. Patent No. 4,335,208
  • the temperature is lowered to 60°C, prior to the addition of the glucoamylase and debranching enzyme.
  • the saccharification process proceeds for 24-72 hours.
  • the pH Prior to addition of the saccharifying enzymes, the pH is reduced to below 4.5, while maintaining a high temperature (above 95°C), to inactivate the liquefying alpha- amylase.
  • fermentation products may be fermented at conditions and temperatures well known to persons skilled in the art, suitable for the fermenting organism in question.
  • the fermentation product may be recovered by methods well known in the art, e.g., by distillation.
  • Examples of carbohydrate-source generating enzymes are disclosed in the "Enzymes" section below.
  • the process of the invention further comprises, prior to the conversion of a starch-containing material to sugars/dextrins the steps of:
  • the starch-containing material is milled to reduce the particle size.
  • the particle size is reduced to between 0.05-3.0 mm, preferably 0.1 -0.5 mm, or so that at least 30%, preferably at least 50%, more preferably at least 70%, even more preferably at least 90% of the starch-containing material fits through a sieve with a 0.05-3.0 mm screen, preferably 0.1 -0.5 mm screen.
  • the aqueous slurry may contain from 10-55 wt. % dry solids (DS), preferably 25-45 wt. % dry solids (DS), more preferably 30-40 wt. % dry solids (DS) of starch-containing material.
  • the conversion process degrading starch to lower molecular weight carbohydrate components such as sugars or fat replacers includes a debranching step.
  • the starch is depolymerized.
  • a depolymerization process consists of, e.g., a pre-treatment step and two or three consecutive process steps, i.e., a liquefaction process, a saccharification process, and depending on the desired end-product, an optional isomerization process.
  • the dextrose syrup may be converted into fructose.
  • the pH is increased to a value in the range of 6-8, e.g., pH 7.5, and the calcium is removed by ion exchange.
  • the dextrose syrup is then converted into high fructose syrup using, e.g., an immobilized glucose isomerase.
  • Fermentable sugars e.g., dextrins, monosaccharides, particularly glucose
  • these fermentable sugars may be further purified and/or converted to useful sugar products.
  • the sugars may be used as a fermentation feedstock in a microbial fermentation process for producing end-products, such as alcohol (e.g., ethanol, and butanol), organic acids (e.g., succinic acid, 3-HP and lactic acid), sugar alcohols (e.g., glycerol), ascorbic acid intermediates (e.g., gluconate, 2-keto-D-gluconate, 2,5-diketo-D-gluconate, and 2- keto-L-gulonic acid), amino acids (e.g., lysine), proteins (e.g., antibodies and fragment thereof).
  • alcohol e.g., ethanol, and butanol
  • organic acids e.g., succinic acid, 3-HP and lactic acid
  • sugar alcohols e.g., g
  • the fermentable sugars obtained during the liquefaction process steps are used to produce alcohol and particularly ethanol.
  • an SSF process is commonly used wherein the saccharifying enzymes and fermenting organisms (e.g., yeast) are added together and then carried out at a temperature of 30-40°C.
  • the organism used in fermentation will depend on the desired end-product. Typically, if ethanol is the desired end product yeast will be used as the fermenting organism.
  • the ethanol-producing microorganism is a yeast and specifically Saccharomyces such as strains of S. cerevisiae (U.S. Patent No. 4,316,956).
  • S. cerevisiae are commercially available and these include but are not limited to FALI (Fleischmann's Yeast), SUPERSTART (Alltech), FERMIOL (DSM Specialties), RED STAR (Lesaffre) and Angel alcohol yeast (Angel Yeast Company, China).
  • the amount of starter yeast employed in the methods is an amount effective to produce a commercially significant amount of ethanol in a suitable amount of time, (e.g., to produce at least 10% ethanol from a substrate having between 25-40% DS in less than 72 hours).
  • Yeast cells are generally supplied in amounts of about 10 4 to about 10 12 , and preferably from about 10 7 to about 10 10 viable yeast count per mL of fermentation broth. After yeast is added to the mash, it is typically subjected to fermentation for about 24-96 hours, e.g., 35-60 hours.
  • the temperature is between about 26- 34°C, typically at about 32°C, and the pH is from pH 3-6, e.g., around pH 4-5.
  • the fermentation may include, in addition to a fermenting microorganisms (e.g., yeast), nutrients, and additional enzymes, including phytases.
  • yeast e.g., yeast
  • additional enzymes including phytases.
  • fermentation end product including, e.g., glycerol, 1 ,3-propanediol, gluconate, 2-keto-D-gluconate, 2,5-diketo-D-gluconate, 2-keto-L-gulonic acid, succinic acid, lactic acid, amino acids, and derivatives thereof. More specifically when lactic acid is the desired end product, a Lactobacillus sp. (L case/ ' ) may be used; when glycerol or 1 ,3-propanediol are the desired end-products E.
  • Pantoea citrea may be used as the fermenting microorganism.
  • the above enumerated list are only examples and one skilled in the art will be aware of a number of fermenting microorganisms that may be used to obtain a desired end product.
  • Processes for producing fermentation products from un-gelatinized starch-containing material The invention relates to processes for producing fermentation products from starch-containing material without gelatinization (i.e., without cooking) of the starch-containing material (often referred to as a "raw starch hydrolysis" process).
  • the fermentation product such as ethanol, can be produced without liquefying the aqueous slurry containing the starch-containing material and water.
  • a process of the invention includes saccharifying (e.g., milled) starch- containing material, e.g., granular starch, below the initial gelatinization temperature, preferably in the presence of alpha-amylase and/or carbohydrate-source generating enzyme(s) to produce sugars that can be fermented into the fermentation product by a suitable fermenting organism.
  • the desired fermentation product e.g., ethanol
  • un- gelatinized i.e., uncooked
  • cereal grains such as corn.
  • the invention relates to processes for producing a fermentation product from starch-containing material comprising simultaneously saccharifying and fermenting starch-containing material using a carbohydrate-source generating enzymes and a fermenting organism at a temperature below the initial gelatinization temperature of said starch-containing material in the presence of a variant protease of the invention. Saccharification and fermentation may also be separate.
  • the invention relates to processes of producing fermentation products, comprising the following steps: (i) saccharifying a starch-containing material at a temperature below the initial gelatinization temperature using a carbohydrate-source generating enzyme, e.g., a glucoamylase; and
  • step (i) is carried out using at least a glucoamylase, and a variant protease of the invention.
  • the fermenting organism expresses the variant protease of the invention.
  • an alpha amylase is also added in step (i). Steps (i) and (ii) may be performed simultaneously.
  • the fermentation product e.g., ethanol
  • amylase(s) such as glucoamylase(s) and/or other carbohydrate- source generating enzymes, and/or alpha-amylase(s)
  • amylase(s) and/or other carbohydrate-source generating enzymes are(are) present during fermentation.
  • glucoamylases and other carbohydrate-source generating enzymes include raw starch hydrolyzing glucoamylases.
  • alpha-amylase(s) include acid alpha-amylases such as acid fungal alpha-amylases.
  • fermenting organisms include yeast, e.g., a strain of Saccharomyces cerevisiae.
  • initial gelatinization temperature means the lowest temperature at which starch gelatinization commences. In general, starch heated in water begins to gelatinize between about 50°C and 75°C; the exact temperature of gelatinization depends on the specific starch and can readily be determined by the skilled artisan. Thus, the initial gelatinization temperature may vary according to the plant species, to the particular variety of the plant species as well as with the growth conditions. In the context of this invention the initial gelatinization temperature of a given starch-containing material may be determined as the temperature at which birefringence is lost in 5% of the starch granules using the method described by Gorinstein and Lii, 1992, Starch/Starke 44(12): 461 -466.
  • a slurry of starch-containing material such as granular starch, having 10-55 w/w % dry solids (DS), preferably 25-45 w/w % dry solids, more preferably 30-40 w/w % dry solids of starch- containing material may be prepared.
  • the slurry may include water and/or process waters, such as stillage (backset), scrubber water, evaporator condensate or distillate, side-stripper water from distillation, or process water from other fermentation product plants. Because the process of the invention is carried out below the initial gelatinization temperature, and thus no significant viscosity increase takes place, high levels of stillage may be used if desired.
  • the aqueous slurry contains from about 1 to about 70 vol. %, preferably 15-60 vol. %, especially from about 30 to 50 vol. % water and/or process waters, such as stillage (backset), scrubber water, evaporator condensate or distillate, side-stripper water from distillation, or process water from other fermentation product plants, or combinations thereof, or the like.
  • the starch- containing material may be prepared by reducing the particle size, preferably by dry or wet milling, to 0.05 to 3.0 mm, preferably 0.1 -0.5 mm.
  • a process in this aspect of the invention is conducted at a temperature below the initial gelatinization temperature, which means that the temperature typically lies in the range between 30-75°C, preferably between 45-60°C.
  • the process carried at a temperature from 25°C to 40°C, such as from 28°C to 35°C, such as from 30°C to 34°C, preferably around 32°C.
  • the process is carried out so that the sugar level, such as glucose level, is kept at a low level, such as below 6 w/w %, such as below about 3 w/w %, such as below about 2 w/w %, such as below about 1 w/w %., such as below about 0.5 w/w %, or below 0.25 w/w %, such as below about 0.1 w/w %.
  • a low level can be accomplished by simply employing adjusted quantities of enzyme and fermenting organism.
  • the employed quantities of enzyme and fermenting organism may also be selected to maintain low concentrations of maltose in the fermentation broth.
  • the maltose level may be kept below about 0.5 w/w %, such as below about 0.2 w/w %.
  • the process of the invention may be carried out at a pH from about 3 and 7, preferably from pH 3.5 to 6, or more preferably from pH 4 to 5. In an embodiment fermentation is ongoing for 6 to 120 hours, in particular 24 to 96 hours.
  • the invention relates to processes for producing fermentation products, especially ethanol, from starch-containing material, which process includes a liquefaction step and sequentially or simultaneously performed saccharification and fermentation steps. Consequently, the invention relates to a process for producing a fermentation product from starch-containing material comprising the steps of:
  • step (a) liquefying starch-containing material in the presence of an alpha-amylase; (b) saccharifying the liquefied material obtained in step (a) using a carbohydrate- source generating enzyme;
  • a variant protease of the invention is present during step b) and/or c).
  • the fermenting organism expresses the variant protease of the invention.
  • the fermentation product such as especially ethanol, may optionally be recovered after fermentation, e.g., by distillation.
  • the fermenting organism is preferably yeast, preferably a strain of Saccharomyces cerevisiae.
  • the process of the invention further comprises, prior to step (a), the steps of:
  • x reducing the particle size of the starch-containing material, preferably by milling (e.g., using a hammer mill);
  • the particle size is smaller than a # 7 screen, e.g., a # 6 screen.
  • a # 7 screen is usually used in conventional prior art processes.
  • the aqueous slurry may contain from 10-55, e.g., 25-45 and 30-40, w/w % dry solids (DS) of starch-containing material.
  • the slurry is heated to above the gelatinization temperature and an alpha-amylase variant may be added to initiate liquefaction (thinning).
  • the slurry may in an embodiment be jet-cooked to further gelatinize the slurry before being subjected to alpha-amylase in step (a).
  • Liquefaction may in an embodiment be carried out as a three-step hot slurry process.
  • the slurry is heated to between 60-95°C, preferably between 70-90°C, such as preferably between 80-85°Cat pH 4-6, preferably 4.5-5.5, and alpha-amylase variant, optionally together with a pullulanase and/or protease, preferably metalloprotease, are added to initiate liquefaction (thinning).
  • the slurry may then be jet-cooked at a temperature between 95-140°C, preferably 100-135°C, such as 105-125°C, for about 1 -15 minutes, preferably for about 3-10 minutes, especially around about 5 minutes.
  • the slurry is cooled to 60-95°C and more alpha-amylase variant and optionally pullulanase variant and/or protease, preferably metalloprotease, is(are) added to finalize hydrolysis (secondary liquefaction).
  • the liquefaction process is usually carried out at pH 4.0-6, in particular at a pH from 4.5 to 5.5. Saccharification step (b) may be carried out using conditions well known in the art.
  • a full saccharification process may last up to from about 24 to about 72 hours, however, it is common only to do a pre-saccharification of typically 40-90 minutes at a temperature between 30-65°C, typically about 60°C, followed by complete saccharification during fermentation in a simultaneous saccharification and fermentation process (SSF process). Saccharification is typically carried out at temperatures from 20-75°C, preferably from 40-70°C, typically around 60°C, and at a pH between 4 and 5, normally at about pH 4.5.
  • SSF process simultaneous saccharification and fermentation process
  • SSF simultaneous saccharification and fermentation
  • a fermenting organism such as yeast, and enzyme(s)
  • SSF may typically be carried out at a temperature from 25°C to 40°C, such as from 28°C to 35°C, such as from 30°C to 34°C, preferably around about 32°C.
  • fermentation is ongoing for 6 to 120 hours, in particular 24 to 96 hours.
  • the carbohydrate-source generating enzyme present during saccharification may in one embodiment be a glucoamylase.
  • a glucoamylase is present and/or added in saccharification and/or fermentation, preferably simultaneous saccharification and fermentation (SSF), in a process of the invention (i.e., saccharification and fermentation of ungelatinized or gelatinized starch material).
  • SSF simultaneous saccharification and fermentation
  • the glucoamylase present and/or added in saccharification and/or fermentation is of fungal origin, preferably from a stain of Aspergillus, preferably A. niger, A. awamori, or A. oryzae; or a strain of Trichoderma, preferably T. reeser ' , or a strain of Talaromyces, preferably T. emersonii or a strain of Trametes, preferably T. cingulata, or a strain of Pycnoporus, preferably P. sanguineus, or a strain of Gloeophyllum, such as G. serpiarium or G. trabeum, or a strain of the Nigrofomes.
  • the glucoamylase is derived from Trametes, such as a strain of Trametes cingulata, such as the one shown in SEQ ID NO: 4 herein.
  • glucoamylase comprising the polypeptide of SEQ ID NO: 4 herein;
  • a glucoamylase comprising an amino acid sequence having at least 60%, at least 70%, e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the polypeptide of SEQ ID NO: 4 herein.
  • the glucoamylase is derived from Talaromyces, such as a strain of Talaromyces emersonii, such as the one shown in SEQ ID NO: 5 herein.
  • glucoamylase comprising the polypeptide of SEQ ID NO: 5 herein;
  • a glucoamylase comprising an amino acid sequence having at least 60%, at least 70%, e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the polypeptide of SEQ ID NO: 5 herein.
  • the glucoamylase is derived from a strain of the genus Pycnoporus, in particular a strain of Pycnoporus sanguineus described in WO 201 1/066576 (SEQ ID NOs 2, 4 or 6), such as the one shown as SEQ ID NO: 4 in WO 201 1/066576.
  • glucoamylase comprising the polypeptide of SEQ ID NO: 6 herein;
  • a glucoamylase comprising an amino acid sequence having at least 60%, at least 70%, e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at 6 herein.
  • the glucoamylase is derived from a strain of the genus Gloeophyllum, such as a strain of Gloeophyllum sepiarium or Gloeophyllum trabeum, in particular a strain of Gloeophyllum as described in WO 201 1/068803 (SEQ ID NO: 2, 4, 6, 8, 10, 12, 14 or 16).
  • the glucoamylase is the Gloeophyllum sepiarium shown in SEQ ID NO: 2 in WO 201 1/068803 or SEQ ID NO: 7 herein.
  • the glucoamylase is derived from Gloeophyllum serpiarium, such as the one shown in SEQ ID NO: 7 herein. In an embodiment the glucoamylase is selected from the group consisting of:
  • glucoamylase comprising the polypeptide of SEQ ID NO: 7 herein;
  • a glucoamylase comprising an amino acid sequence having at least 60%, at least 70%, e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the polypeptide of SEQ ID NO: 7 herein.
  • the glucoamylase is derived from Gloeophyllum trabeum such as the one shown in SEQ ID NO: 8 herein.
  • the glucoamylase is selected from the group consisting of:
  • glucoamylase comprising the polypeptide of SEQ ID NO: 8 herein;
  • a glucoamylase comprising an amino acid sequence having at least 60%, at least 70%, e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 91 %, at least
  • the glucoamylase is derived from a strain of the genus Nigrofomes, in particular a strain of Nigrofomes sp. disclosed in WO 2012/064351.
  • Glucoamylases may in an embodiment be added to the saccharification and/or fermentation in an amount of 0.0001 -20 AGU/g DS, preferably 0.001 -10 AGU/g DS, especially between 0.01 -5 AGU/g DS, such as 0.1 -2 AGU/g DS.
  • compositions comprising glucoamylase include AMG 200L; AMG 300 L; SANTM SUPER, SANTM EXTRA L, SPIRIZYMETM PLUS, SPIRIZYMETM FUEL, SPIRIZYMETM B4U, SPIRIZYMETM ULTRA, SPIRIZYMETM EXCEL and AMGTM E (from Novozymes MS); OPTIDEXTM 300, GC480, GC417 (from DuPont); AMIGASETM and AMIGASETM PLUS (from DSM); G-ZYMETM G900, G-ZYMETM and G990 ZR (from DuPont).
  • the glucoamylase is present and/or added in saccharification and/or fermentation in combination with an alpha-amylase. Examples of suitable alpha-amylase are described below.
  • an alpha-amylase is present and/or added in saccharification and/or fermentation in the processes of the invention.
  • the alpha-amylase is of fungal or bacterial origin.
  • the alpha-amylase is a fungal acid stable alpha-amylase.
  • a fungal acid stable alpha-amylase is an alpha-amylase that has activity in the pH range of 3.0 to 7.0 and preferably in the pH range from 3.5 to 6.5, including activity at a pH of about 4.0, 4.5, 5.0, 5.5, and 6.0.
  • the alpha-amylase present and/or added in saccharification and/or fermentation is derived from a strain of the genus Rhizomucor, preferably a strain the Rhizomucor pusillus, such as one shown in SEQ ID NO: 3 in WO 2013/006756, such as a Rhizomucor pusillus alpha-amylase hybrid having an Aspergillus niger linker and starch-binding domain, such as the one shown in SEQ ID NO: 9 herein, or a variant thereof.
  • alpha-amylase present and/or added in saccharification and/or fermentation is selected from the group consisting of:
  • an alpha-amylase comprising an amino acid sequence having at least 60%, at least 70%, e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 91 %, at least
  • the alpha-amylase is a variant of the alpha-amylase shown in SEQ ID NO: 9 having at least one of the following substitutions or combinations of substitutions: D165M; Y141W; Y141 R; K136F; K192R; P224A; P224R; S123H + Y141 W; G20S
  • the alpha-amylase is derived from a Rhizomucor pusillus with an Aspergillus niger glucoamylase linker and starch-binding domain (SBD), preferably disclosed as SEQ ID NO: 9 herein, preferably having one or more of the following substitutions: G128D, D143N, preferably G128D+D143N (using SEQ ID NO: 9 for numbering), and wherein the alpha- amylase variant present and/or added in saccharification and/or fermentation has at least 75% identity preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 91 %, more preferably at least 92%, even more preferably at least 93%, most preferably at least 94%, and even most preferably at least 95%, such as even at least 96%, at least 97%, at least 98%, at least 99%, but less than 100% identity to the polypeptid
  • SBD Rhizomucor pusillus with an Aspergillus
  • the ratio between glucoamylase and alpha-amylase present and/or added during saccharification and/or fermentation may preferably be in the range from 500:1 to 1 :1 , such as from 250:1 to 1 :1 , such as from 100:1 to 1 : 1 , such as from 100: 2 to 100:50, such as from 100:3 to 100:70.
  • any suitable starch-containing starting material may be used in a process of the present invention.
  • the starting material is generally selected based on the desired fermentation product.
  • starch-containing starting materials suitable for use in the processes of the present invention, include barley, beans, cassava, cereals, corn, milo, peas, potatoes, rice, rye, sago, sorghum, sweet potatoes, tapioca, wheat, and whole grains, or any mixture thereof.
  • the starch- containing material may also be a waxy or non-waxy type of corn and barley.
  • the starch-containing material is corn.
  • starch- containing material is wheat.
  • Fermentation product means a product produced by a method or process including fermenting using a fermenting organism. Fermentation products include alcohols (e.g., ethanol, methanol, butanol); organic acids (e.g., citric acid, acetic acid, itaconic acid, lactic acid, succinic acid, gluconic acid); ketones (e.g., acetone); amino acids (e.g., glutamic acid); gases (e.g., H2 and CO2); antibiotics (e.g., penicillin and tetracycline); enzymes; vitamins (e.g., riboflavin, B12, beta-carotene); and hormones.
  • alcohols e.g., ethanol, methanol, butanol
  • organic acids e.g., citric acid, acetic acid, itaconic acid, lactic acid, succinic acid, gluconic acid
  • ketones e.g., acetone
  • amino acids e.
  • the fermentation product is ethanol, e.g., fuel ethanol; drinking ethanol, i.e., potable neutral spirits; or industrial ethanol or products used in the consumable alcohol industry (e.g., beer and wine), dairy industry (e.g., fermented dairy products), leather industry and tobacco industry.
  • Preferred beer types comprise ales, stouts, porters, lagers, bitters, malt liquors, happoushu, high-alcohol beer, low- alcohol beer, low-calorie beer or light beer.
  • the fermentation product is ethanol.
  • fermenting organism refers to any organism, including bacterial and fungal organisms, such as yeast and filamentous fungi, suitable for producing a desired fermentation product. Suitable fermenting organisms are able to ferment, i.e., convert, fermentable sugars, such as arabinose, fructose, glucose, maltose, mannose, or xylose, directly or indirectly into the desired fermentation product.
  • fermentable sugars such as arabinose, fructose, glucose, maltose, mannose, or xylose
  • fermenting organisms include fungal organisms such as yeast.
  • yeast include strains of Saccharomyces, in particular Saccharomyces cerevisiae or Saccharomyces uvarum; strains of Pichia, in particular Pichia stipitis such as Pichia stipitis CBS 5773 or Pichia pastoris; strains of Candida, in particular Candida arabinofermentans, Candida boidinii, Candida diddensii, Candida shehatae, Candida sonorensis, Candida tropicalis, or Candida utilis.
  • Other fermenting organisms include strains of Hansenula, in particular Hansenula anomala or Hansenula polymorpha; strains of Kluyveromyces, in particular Kluyveromyces fragilis or Kluyveromyces marxianus; and strains of Schizosaccharomyces, in particular Schizosaccharomyces pombe.
  • Preferred bacterial fermenting organisms include strains of Escherichia, in particular Escherichia coli, strains of Zymomonas, in particular Zymomonas mobilis, strains of Zymobacter, in particular Zymobactor palmae, strains of Klebsiella in particular Klebsiella oxytoca, strains of Leuconostoc, in particular Leuconostoc mesenteroides, strains of Clostridium, in particular Clostridium butyricum, strains of Enterobacter, in particular Enterobacter aerogenes, and strains of Thermoanaerobacter, in particular Thermoanaerobacter BG1 L1 (Appl. Microbiol.
  • Lactobacillus are also envisioned as are strains of Corynebacterium glutamicum R, Bacillus thermoglucosidaisus, and Geobacillus thermoglucosidasius.
  • the fermenting organism is a C6 sugar fermenting organism, such as a strain of, e.g., Saccharomyces cerevisiae.
  • the fermenting organism is a C5 sugar fermenting organism, such as a strain of, e.g., Saccharomyces cerevisiae.
  • the fermenting organism is added to the fermentation medium so that the viable fermenting organism, such as yeast, count per mL of fermentation medium is in the range from 10 5 to 10 12 , preferably from 10 7 to 10 10 , especially about 5x10 7 .
  • Yeast is the preferred fermenting organism for ethanol fermentation.
  • Preferred are strains of Saccharomyces, especially strains of the species Saccharomyces cerevisiae, preferably strains which are resistant towards high levels of ethanol, i.e., up to, e.g., about 10, 12, 15 or 20 vol. % or more ethanol.
  • the C5 utilizing yeast is a Saccharomyces cerevisea strain disclosed in WO 2004/085627.
  • the fermenting organism is a C5 eukaryotic microbial cell concerned in WO 2010/074577 (Nedalco).
  • the fermenting organism is a transformed C5 eukaryotic cell capable of directly isomerize xylose to xylulose disclosed in US 2008/0014620.
  • the fermenting organism is a C5 sugar fermentating cell disclosed in WO 2009/109633.
  • yeast Commercially available yeast include LNF SA-1 , LNF BG-1 , LNF PE-2,and LNF CAT-1 (available from LNF Brazil), RED STARTM and ETHANOL REDTM yeast (available from Fermentis/Lesaffre, USA), FALI (available from Fleischmann's Yeast, USA), SUPERSTART and THERMOSACCTM fresh yeast (available from Ethanol Technology, Wl, USA), BIOFERM AFT and XR (available from NABC - North American Bioproducts Corporation, GA, USA), GERT STRAND (available from Gert Strand AB, Sweden), and FERMIOL (available from DSM Specialties).
  • the fermenting organism capable of producing a desired fermentation product from fermentable sugars is preferably grown under precise conditions at a particular growth rate.
  • the inoculated fermenting organism pass through a number of stages. Initially growth does not occur. This period is referred to as the "lag phase” and may be considered a period of adaptation.
  • the growth rate gradually increases. After a period of maximum growth the rate ceases and the fermenting organism enters "stationary phase”. After a further period of time the fermenting organism enters the "death phase" where the number of viable cells declines.
  • the fermentation conditions are determined based on, e.g., the kind of plant material, the available fermentable sugars, the fermenting organism(s) and/or the desired fermentation product.
  • One skilled in the art can easily determine suitable fermentation conditions.
  • the fermentation may be carried out at conventionally used conditions.
  • Preferred fermentation processes are anaerobic processes.
  • fermentations may be carried out at temperatures as high as 75°C, e.g., between 40-70°C, such as between 50-60°C.
  • bacteria with a significantly lower temperature optimum down to around room temperature are also known.
  • suitable fermenting organisms can be found in the "Fermenting Organisms" section above.
  • the fermentation may go on for 24 to 96 hours, in particular for 35 to 60 hours.
  • the fermentation is carried out at a temperature between 20 to 40°C, preferably 26 to 34°C, in particular around 32°C.
  • the pH is from pH 3 to 6, preferably around pH 4 to 5.
  • Fermentation is typically carried out at a pH in the range between 3 and 7, preferably from pH
  • Fermentations are typically ongoing for 6-96 hours.
  • the processes of the invention may be performed as a batch or as a continuous process. Fermentations may be conducted in an ultrafiltration system wherein the retentate is held under recirculation in the presence of solids, water, and the fermenting organism, and wherein the permeate is the desired fermentation product containing liquid. Equally contemplated are methods/processes conducted in continuous membrane reactors with ultrafiltration membranes and where the retentate is held under recirculation in presence of solids, water, and the fermenting organism(s) and where the permeate is the fermentation product containing liquid. After fermentation the fermenting organism may be separated from the fermented slurry and recycled.
  • fermentation media refers to the environment in which fermentation is carried out and comprises the fermentation substrate, that is, the carbohydrate source that is metabolized by the fermenting organism(s).
  • the fermentation medium may comprise other nutrients and growth stimulator(s) for the fermenting organism(s).
  • Nutrient and growth stimulators are widely used in the art of fermentation and include nitrogen sources, such as ammonia; vitamins and minerals, or combinations thereof.
  • the fermentation product may be separated from the fermentation medium.
  • the fermentation medium may be distilled to extract the desired fermentation product or the desired fermentation product may be extracted from the fermentation medium by micro or membrane filtration techniques. Alternatively, the fermentation product may be recovered by stripping. Methods for recovery are well known in the art.
  • a protease variant comprising a modification at one or more positions corresponding to positions 39, 50, 57, 60, 74, 81 , 84, 109, 1 10, 1 1 1 , 1 15, 1 17, 124, 128, 142, 145, 146, 154, 182, 183, 187, 207, 209, 210, 212, 228, 267, 271 , 272, 274, 278, 280, 294, 317, 318, 320, 321 , 322, 328, 343, 348, 362 or 363 of the polypeptide of SEQ ID NO: 3, wherein the variant has protease activity and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity to the mature polypeptide of SEQ ID NO: 3, and wherein the variant has increased thermo-stability compared to the proteas
  • paragraph 1 which comprises a modification which is a substitution at a position corresponding to positions 39, 50, 57, 60, 74, 81 , 84, 109, 1 10, 1 1 1 , 1 15, 1 17, 124, 128, 142, 145, 146, 154, 182, 183, 187, 207, 209, 212, 228, 267, 271 , 272, 274, 278, 280, 294, 317, 318, 320, 321 , 322, 328, 343, 348, 362 or 363 of the polypeptide of SEQ ID NO: 3, wherein the variant has protease activity and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity to the polypeptide of SEQ ID NO: 3, wherein the protease is a serine protease belonging to the
  • paragraph 1 which comprises a modification which is a deletion at a position corresponding to position 318 or 210 of the polypeptide of SEQ ID NO: 3, wherein the variant has protease activity and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity to the polypeptide of SEQ ID NO: 3, wherein the protease is a serine protease belonging to the S53 family and wherein the variant has increased thermostability compared to the protease of SEQ ID NO: 3.
  • Paragraph [5] The variant according to any of the paragraphs 1 -4, comprising a modification at a position corresponding to position 39, 60, 74, 81 , 84, 109, 1 15, 1 17, 142, 145, 146, 154, 182, 183, 187, 209, 210, 212, 228, 267, 272, 280, 294, 317, 318, 348 or 362 of the polypeptide of SEQ ID NO: 3, wherein the variant has protease activity and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity to the polypeptide of SEQ ID NO: 3, wherein the protease is a serine protease belonging to the S53 family.
  • Paragraph [6] The variant of paragraph 5, which comprises a modification which is a deletion at a position corresponding to position 318 or 210 of the polypeptide of SEQ ID NO: 3 wherein the variant has protease activity and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity to the polypeptide of SEQ ID NO: 3, wherein the protease is a serine protease belonging to the S53 family.
  • Paragraph [7] The variant of paragraph 5, which comprises a modification which is a substitution at a position corresponding to positions 39, 60, 74 81 , 84, 109, 1 15, 142, 145, 146, 154, 182, 183, 187, 209, 212, 228, 267, 272, 280, 294, 317, 348 or 362 of the polypeptide of SEQ ID NO: 3, wherein the variant has protease activity and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity to the polypeptide of SEQ ID NO: 3, wherein the protease is a serine protease belonging to the S53 family.
  • Paragraph [8] The variant of any of paragraphs 5-7, wherein the variant comprises or consists of one or more substitutions and/or deletions selected from the group consisting of I39M, I39R, I39L, I39C, S60D, I84C N1 15D, N1 15L, E1 17D, N145G, N145Q, N145V, N145D, N145K, N145K, N145A, N145E, S183L, S183P, D280N, Q182G, Q182R, E81 R, E81 K, E81 E, E81A, I84C, Q154V, Q142W, Q142R, T146A, T146W, T146Y, T146E, T146D, I228R, D267N, S272V, S272R, E212E, S294A, T362A, E74W , S187L, P348A, D109P, S317A, S317G, S317S, S3
  • thermo-stability is increased residual activity measured after incubation for 30 min at a temperature in the range from 55 to 60 degrees Celsius.
  • Paragraph [1 1 ] The variant of any of paragraphs 5-10, wherein the variant has a residual activity of at least 10%, particularly at least 12%, more particularly at least 15%, measured after incubation for 30 minutes at 56°C.
  • Paragraph [12] The variant of paragraphs 5-1 1 , wherein the variant comprises at least one of the following modification or combination of modifications:
  • the variant has residual activity of at least 30% measured after incubation for 30 minutes at 57°C.
  • I39C + Q142R +S183P I39C + Q142R +S183P; and wherein the variant has residual activity of at least 40% measured after incubation for 30 minutes at an elevated temperature of 62°C.
  • Paragraph [16] The variant according to any of the paragraphs 1 -4, comprising a modification at a position corresponding to position 50, 57, 60, 81 , 84, 109, 1 10, 1 1 1 , 124, 128, 142, 145, 146, 154, 182, 183, 207, 209, 210, 228, 267, 271 , 272, 274, 278, 280, 294, 317, 318, 320, 321 , 322, 328, 343, 362, or 363 of the polypeptide of SEQ ID NO: 3, wherein the variant has protease activity and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity to the polypeptide of SEQ ID NO: 3, wherein the protease is a serine protease belonging to the S53 family.
  • Paragraph [17] The variant of paragraph 16, which comprises a modification which is a substitution at a position corresponding to positions 50, 57, 60, 81 , 84, 109, 1 10, 1 1 1 , 124, 128, 142, 145, 146, 154, 182, 183, 207, 209, 228, 267, 271 , 272, 274, 278, 280, 294, 317, 318, 320, 321 , 322, 328, 343, 362, or 363 of the polypeptide of SEQ ID NO: 3.
  • thermo-stability measured as Td by TSA assay is at least 59°C.
  • thermo-stability measured as Td by TSA assay is at least 61 °C.
  • thermo-stability measured as Td by TSA assay is at least 63°C.
  • thermo-stability measured as Td by TSA assay is at least 65°C.
  • Paragraph [26] A nucleic acid construct comprising the polynucleotide of paragraph 25.
  • Paragraph [27] An expression vector comprising the polynucleotide of paragraph 25.
  • Paragraph [28] A recombinant host cell comprising the polynucleotide of paragraph 25.
  • Paragraph [29] A method of producing a protease variant of any of paragraphs 1 -24, comprising: cultivating the host cell of paragraph 28 under conditions suitable for expression of the variant; and optionally recovering the variant.
  • Paragraph [30] A composition comprising the variant according to any one of paragraphs 1 -24.
  • Paragraph [31] The composition of paragraph 30, further comprising a glucoamylase and optionally a fungal alpha-amylase.
  • Paragraph [32] A process for producing a fermentation product from starch-containing material comprising simultaneously saccharifying and fermenting starch-containing material using a carbohydrate-source generating enzymes and a fermenting organism at a temperature below the initial gelatinization temperature of said starch-containing material in the presence of a variant protease of any of the paragraphs 1 -24.
  • a process for producing a fermentation product from starch-containing material comprising the steps of: a) liquefying starch-containing material in the presence of an alpha- amylase; b) saccharifying the liquefied material obtained in step (a) using a glucoamylse; c) fermenting using a fermenting organism; wherein a variant protease of any of the paragraphs 1 - 24 is present during step b) and/or c).
  • Paragraph [34] The process of any of the paragraphs 32-33, wherein the fermentation product is ethanol and the fermenting organism is Saccharomyces cerevisiae.
  • Paragraph [35] The host cell of paragraph 28 expressing the variants of any of paragraphs 1 - 24, wherein the host cell is a yeast cell, particularly a Saccharomyces, such as Saccharomyces cerevisiae.
  • Paragraph [36] The process of any of the paragraphs 32-33, wherein the host cell of paragraph 35, is applied as the fermenting organism in the fermentation step and the fermentation product is ethanol.
  • Enzymes for DNA manipulations e.g. restriction endonucleases, ligases etc.
  • Enzymes for DNA manipulations e.g. restriction endonucleases, ligases etc.
  • Cove top agar 342.3 g/L Sucrose, 20 ml/L COVE salt solution, 10mM Acetamide, 10 g/L low melt agarose.
  • Cove-N plates are composed of 30 g sucrose, 20 ml Cove salt solution, 3g NaN03, and 30 g noble agar and water to 1 litre.
  • COVE salt solution are composed of 26 g KCI, 26 g MgS0 4 7H2O, 76 g KH2P0 4 and 50ml Cove trace metals and water to 1 litre.
  • Trace metal solution for COVE are composed of 0.04 g NaB 4 0 7 10H 2 O, 0.4 g CuS0 4 5H 2 0, 1.2 g FeS0 4 7H 2 0, 1.0 g MnS0 4 H2O, 0.8 g Neutral amylase II Mo0 2 2H 2 0, and 10.0 g ZnS0 4 7H 2 0 and water to 1 litre.
  • 1 ⁇ 4 YPM composed of 2.5 g yeast extract, 5 g pepton and 5 g maltose (pH 4.5) and water to 1 litre.
  • STC buffer was composed of 0.8 M sorbitol, 25 mM Tris (pH 8), and 25 mM CaCI 2 and water to l litre.
  • STPC buffer composed of 40% PEG4000 in STC buffer.
  • MLC composed of 40 g Glucose, 50 g Soybean powder, 4 g/ Citric acid (pH 5.0) and water to 1 litre.
  • E.coli DH5-alpha (Toyobo) was used for plasmid construction and amplification. Amplified plasmids were recovered with Qiagen Plasmid Kit (Qiagen). QIAquickTM Gel Extraction Kit (Qiagen) was used for the purification of PCR fragments and extraction of DNA fragment from agarose gel.
  • NN059203 was isolated by Novozymes and described in WO12160093 and is a derivative of Aspergillus niger NN049184 which was isolated from soil.
  • Transformation of Aspergillus species can be achieved using the general methods for yeast transformation.
  • the preferred procedure for the invention is described below.
  • Aspergillus niger host strain was inoculated into 100 ml YPG medium supplemented with 10 mM uridine and incubated for 16 hrs at 32°C at 80 rpm. Pellets were collected and washed with 0.6
  • Culture supernatants pre-incubated at appropriate temperatures are measured for protease activity by AAPF assay using N-Succinyl-Ala- Ala-Pro-Phe p-nitroanilide (SIGMA-ALDRICH).
  • Inserted DNAs of Aspergillus strains were recovered by direct PCR method described below or PCR on the isolated DNA by chromosomal DNA purification kit (FastDNA SPIN Kit for Soil, MP biomedicals, #6560-200) using a primer pair, insert rescue F and R.
  • the amplified DNAs were purified by agarose gel electrophoresis followed to QIAquick Gel Extraction kit (Qiagen) for sequencing analysis to check the quality of constructed libraries. Colony PCR was carried out as following:
  • MgProtlll variants Purification of the variants of Meripilus giganteus serine protease belonging to family 53 herein denoted as MgProtlll variants was carried out by two steps, desalting column and cation exchange chromatography column. Finally, the sample was buffer exchanged and concentrated in 20 mM succinate buffer pH 4.0 using a 30 kDa centrifugal concentrator (Sartorius AG).
  • Purified enzyme was diluted with 50 mM sodium acetate buffer pH 4.5 to 0.75 mg/ml and 10 ⁇ of that were mixed with 15 ⁇ I of SYPRO Orange (Invitrogen) diluted with Milli-Q water and 5 ⁇ of 30 mM bacitracin solution dissolved in 50 mM sodium acetate buffer pH 4.5. Thirty microliters of mixture solution was transfer to LightCycler 480 Multiwell Plate 96 (Roche Diagnostics) and the plate was sealed.
  • Emission wave length 580 nm The obtained fluorescence signal was normalized into a range of 0 and 1.
  • the Thermal denaturation temperature, Td was defined as the temperature where the normalized value is closest to 0.5.
  • Two PCRs were carried out for a library construction using 2 primer pairs, a forward degenerated primer and a primer having more than 15bp overlapping with an expression vector (vector F described below), and vector F primer and a reverse primer having 15bp overlapping with the degenerated primer using the expression vector as a template.
  • Vector R 25mer (SEQ ID NO: 13) TAAGTGGAGGGAAAAACACTATGCG
  • Vector F 32mer (SEQ ID NO: 14) G CTTG GAG CAACAATCTCAG AACACCAATATC
  • F1 1 1X F 27mer (SEQ ID NO: 15) ATCTCCGTCGGCGACGACNNKCAGGAT
  • the digested vector and PCR fragments were mixed with In-Fusion mix and transformed into E.coli DH5alpha. Obtained E.coli transformants were pooled and plasmids were extracted to use for Aspergillus library construction.
  • each plasmid library was transformed into A. niger host strain. Aspergillus transformants were isolated in a 96 well-MTP containing COVE-N gly agar (100ul/well), cultivate at 32°C for 1 week to have enough sporulation. 10 ⁇ /well of 0.01 % tween 20 was added to the each well, suspended with spores and the suspension was inoculated in a 96 well-MTP containing YPG and cultivated for 3 days at 30°C with shaking to have Aspergillus culture library. They were used for further library screening works.
  • Constructed Aspergillus libraries were cultivated in 96 well MTP and the culture supernatants were spotted on zein plates at appropriate temepratures. Positive variants were tested by Suc- AAPF-pna analysis and variants having higher residual activities were identified. Positive variants were cultivated in shake flasks and samples were used for further purification and characterization.
  • Inserted DNAs of Aspergillus strains were recovered by direct PCR method described below or PCR on the isolated DNA by chromosomal DNA purification kit (FastDNA SPIN Kit for Soil, MP biomedicals, #6560-200) using a primer pair, insert rescue F and R. insert rescue F (SEQ ID NO: 1 1 ) AATCTCAGAACACCAATATC
  • the amplified DNAs were purified by agarose gel electrophoresis followed to QIAquick Gel Extraction kit (Qiagen) for sequencing analysis to check the quality of constructed libraries.
  • Qiagen QIAquick Gel Extraction kit
  • Table 1 lists the positive variants identified by Suc-AAPF-pna analysis. Samples were incubated at certain temperatures for 30 minutes and their remaining activities were measured by AAPF assay. The residual activities in tables below are described as relative activity to ones incubated at 4 degree C.
  • JMgP106 E81RV209LS210 * S317A S318 * 65 55
  • Purified enzyme was diluted with 50 mM sodium acetate buffer pH 4.5 to 0.75 mg/ml and 10 ⁇ of that were mixed with 15 ⁇ I of SYPRO Orange (Invitrogen) diluted with Milli-Q water and 5 ⁇ of 30 mM bacitracin solution dissolved in 50 mM sodium acetate buffer pH 4.5. Thirty microliters of mixture solution was transfer to LightCycler 480 Multiwell Plate 96 (Roche Diagnostics) and the plate was sealed.
  • the obtained fluorescence signal was normalized into a range of 0 and 1.
  • the Td was defined as the temperature where the normalized value is closest to 0.5.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Mycology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Confectionery (AREA)

Abstract

The present invention relates to protease variants, having improved properties compared to the parent protease, in particular variants of a serine protease belonging to family 53 derived from a strain of Meripilus giganteus. The variants according to the invention have in particular increased thermo-stability, e.g., increased residual activity after 30 min at a temperature in the range from 55 to 60°C and/or increased thermal denaturation temperature, compared to the parent Meripilus giganteus protease. The present invention also relates to polynucleotides encoding the variants; nucleic acid constructs, vectors, and host cells comprising the polynucleotides; and methods of using the variants.

Description

SERINE PROTEASE VARIANTS AND POLYNUCLEOTIDES ENCODING SAME
REFERENCE TO A SEQUENCE LISTING
This application contains a Sequence Listing in computer readable form, which is incorporated herein by reference.
BACKGROUND OF THE INVENTION
Production of fermentation products, such as ethanol, from starch-containing material is well-known in the art. Generally, two different kinds of processes are used. The most commonly used process, often referred to as a "conventional process", includes liquefying gelatinized starch at high temperature using typically a bacterial alpha-amylase, followed by simultaneous saccharification and fermentation carried out in the presence of a glucoamylase and a fermenting organism. Another well-known process, often referred to as a "raw starch hydrolysis"- process (RSH process) includes simultaneously saccharifying and fermenting granular starch below the initial gelatinization temperature typically in the presence of an acid fungal alpha- amylase and a glucoamylase.
US Patent No. 5,231 ,017-A discloses the use of an acid fungal protease during ethanol fermentation in a process comprising liquefying gelatinized starch with an alpha-amylase.
WO 2003/066826 discloses a raw starch hydrolysis process (RSH process) carried out on non-cooked mash in the presence of fungal glucoamylase, alpha-amylase and fungal protease.
WO 2007/145912 discloses a process for producing ethanol comprising contacting a slurry comprising granular starch obtained from plant material with an alpha-amylase capable of solubilizing granular starch at a pH of 3.5 to 7.0 and at a temperature below the starch gelatinization temperature for a period of 5 minutes to 24 hours; obtaining a substrate comprising greater than 20% glucose, and fermenting the substrate in the presence of a fermenting organism and starch hydrolyzing enzymes at a temperature between 10°C and 40°C for a period of 10 hours to 250 hours. Additional enzymes added during the contacting step may include protease.
WO 2014/037438 discloses serine proteases derived from Meripilus giganteus,
Trametes versicolor, and Dichomitus squalens and their use in animal feed.
US provisional application 62/232,903 discloses the use of the Meripilus giganteus S53 protease in the saccharification and/or fermentation step in a starch to ethanol process.
It is an object of the present invention to identify variants of the M. giganteus S53 proteases that will result in increased storage stability, in particular an increased thermo-stability of the variant protease compared to the wild type parent enzyme. The present invention provides protease variants with improved properties compared to its parent.
SUMMARY OF THE INVENTION
In a first aspect the present invention relates to a protease variant comprising a modification at one or more position corresponding to positions 39, 50, 57, 60, 74, 81 , 84, 109, 1 10, 1 1 1 , 1 15, 1 17, 124, 128, 142, 145, 146, 154, 182, 183, 187, 207, 209, 210, 212, 228, 267, 271 , 272, 274, 278, 280, 294, 317, 318, 320, 321 , 322, 328, 343, 348, 362 or 363 of the polypeptide of SEQ ID NO: 3, wherein the variant has protease activity and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity to the mature polypeptide of SEQ ID NO: 3, and wherein the variant has increased thermo-stability compared to the protease of SEQ ID NO: 3.
In a second aspect the present invention relates to protease variant comprising a modification at position corresponding to position 39, 60, 74, 81 , 84, 109, 1 15, 1 17, 142, 145, 146, 154, 182, 183, 187, 209, 210, 212, 228, 267, 272, 280, 294, 317, 318, 348 or 362 of the polypeptide of SEQ ID NO: 3, wherein the variant has protease activity and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity to the polypeptide of SEQ ID NO: 3, wherein the protease is a serine protease belonging to the S53 family and wherein the variant has increased residual activity compared to the protease of SEQ ID NO: 3 and wherein the increased thermo-stability is increased residual activity measured after incubation for 30 min at an elevated temperature in the range from 55 to 60 degrees Celsius.
In a third aspect the present invention relates to protease variant comprising a modification at position corresponding to position 50, 57, 60, 81 , 84, 109, 1 10, 1 1 1 , 124, 128, 142, 145, 146, 154, 182, 183, 207, 209, 210, 228, 267, 271 , 272, 274, 278, 280, 294, 317, 318, 320, 321 , 322, 328, 343, 362, or 363 of the polypeptide of SEQ ID NO: 3, wherein the variant has protease activity and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity to the polypeptide of SEQ ID NO: 3, wherein the protease is a serine protease belonging to the S53 family and wherein the protease is a serine protease belonging to the S53 family which has an improved property relative to the parent wherein the improved property is increased thermo-stability measured by TSA assay where Td is at least 59°C.
The present invention also relates to polynucleotides encoding the variants; nucleic acid constructs, vectors, and host cells comprising the polynucleotides; and methods of producing the variants. In a further aspect the present invention relates to compositions comprising the variants of the invention. The present invention also relates to a process for producing a fermentation product from starch-containing material comprising simultaneously saccharifying and fermenting starch- containing material using a carbohydrate-source generating enzymes and a fermenting organism at a temperature below the initial gelatinization temperature of said starch-containing material in the presence of a variant protease. In another aspect the present invention relates to a process for producing a fermentation product from starch-containing material comprising the steps of: (a) liquefying starch-containing material in the presence of an alpha-amylase; (b) saccharifying the liquefied material obtained in step (a) using a glucoamylse; (c) fermenting using a fermenting organism; wherein a variant protease of the invention is present during step b) and/or c).
DEFINITIONS
Protease: The term "protease" (also designated peptidases, proteinases, peptide hydrolases, or proteolytic enzymes) means a proteolytic activity (EC 3.4) that catalyzes the cleavage of peptide bonds. For purposes of the present invention, serine protease activity is determined according to the procedure described in the Examples. In one aspect, the variants of the present invention have at least 20%, e.g., at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 100% of the protease activity of the mature polypeptide of SEQ ID NO: 2.
Protease activity: The term "protease activity" means proteolytic activity (EC 3.4). There are several protease activity types such as trypsin-like proteases cleaving at the carboxyterminal side of Arg and Lys residues and chymotrypsin-like proteases cleaving at the carboxyterminal side of hydrophobic amino acid residues. Proteases of the invention are serine endopeptidases (EC 3.4.21 ) with acidic pH-optimum (pH optimum < pH 7).
Protease activity can be measured using any assay, in which a substrate is employed, that includes peptide bonds relevant for the specificity of the protease in question. Assay-pH and assay-temperature are likewise to be adapted to the protease in question. Examples of assay- pH-values are pH 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , or 12. Examples of assay-temperatures are 15, 20, 25, 30, 35, 37, 40, 45, 50, 55, 60, 65, 70, 80, 90, or 95°C. Examples of general protease substrates are casein, bovine serum albumin and haemoglobin. In the classical Anson and Mirsky method, denatured haemoglobin is used as substrate and after the assay incubation with the protease in question, the amount of trichloroacetic acid soluble haemoglobin is determined as a measurement of protease activity (Anson, M.L. and Mirsky, A.E., 1932, J. Gen. Physiol. 16: 59 and Anson, M.L., 1938, J. Gen. Physiol. 22: 79).
For the purpose of the present invention, protease activity was determined using assays which are described in "Materials and Methods", such as the Kinetic Suc-AAPF-pNA assay, Protazyme AK assay, Kinetic Suc-AAPX-pNA assay and o-Phthaldialdehyde (OPA). For the Protazyme AK assay, insoluble Protazyme AK (Azurine-Crosslinked Casein) substrate liberates a blue colour when incubated with the protease and the colour is determined as a measurement of protease activity. For the Suc-AAPF-pNA assay, the colourless Suc-AAPF-pNA substrate liberates yellow paranitroaniline when incubated with the protease and the yellow colour is determined as a measurement of protease activity.
Endo-protease/Exo-proteases: Polypeptides having protease activity, or proteases, are sometimes also designated peptidases, proteinases, peptide hydrolases, or proteolytic enzymes. Proteases may be of the exo-type (exopeptidases) that hydrolyse peptides starting at either end thereof, or of the endo-type that act internally in polypeptide chains (endopeptidases).
S53 protease: The term "S53 " means a protease activity selected from:
(a) proteases belonging to the EC 3.4.21 enzyme group; and/or
(b) proteases belonging to the EC 3.4.14 enzyme group; and/or
(c) Serine proteases of the peptidase family S53 that comprises two different types of peptidases: tripeptidyl aminopeptidases (exo-type) and endo-peptidases; as described in 1993, Biochem. J. 290:205-218 and in MEROPS protease database, release, 9.4 (31 January 201 1 ) (www.merops.ac.uk). The database is described in Rawlings, N.D., Barrett, A.J. and Bateman, A., 2010, "MEROPS: the peptidase database", Nucl. Acids Res. 38: D227-D233.
For determining whether a given protease is a Serine protease, and a family S53 protease, reference is made to the above Handbook and the principles indicated therein. Such determination can be carried out for all types of proteases, be it naturally occurring or wild-type proteases; or genetically engineered or synthetic proteases.
Allelic variant: The term "allelic variant" means any of two or more alternative forms of a gene occupying the same chromosomal locus. Allelic variation arises naturally through mutation, and may result in polymorphism within populations. Gene mutations can be silent (no change in the encoded polypeptide) or may encode polypeptides having altered amino acid sequences. An allelic variant of a polypeptide is a polypeptide encoded by an allelic variant of a gene.
cDNA: The term "cDNA" means a DNA molecule that can be prepared by reverse transcription from a mature, spliced, mRNA molecule obtained from a eukaryotic or prokaryotic cell. cDNA lacks intron sequences that may be present in the corresponding genomic DNA. The initial, primary RNA transcript is a precursor to mRNA that is processed through a series of steps, including splicing, before appearing as mature spliced mRNA.
Coding sequence: The term "coding sequence" means a polynucleotide, which directly specifies the amino acid sequence of a variant. The boundaries of the coding sequence are generally determined by an open reading frame, which begins with a start codon such as ATG,
GTG or TTG and ends with a stop codon such as TAA, TAG, or TGA. The coding sequence may be a genomic DNA, cDNA, synthetic DNA, or a combination thereof. Control sequences: The term "control sequences" means nucleic acid sequences necessary for expression of a polynucleotide encoding a variant of the present invention. Each control sequence may be native (i.e., from the same gene) or foreign (i.e., from a different gene) to the polynucleotide encoding the variant or native or foreign to each other. Such control sequences include, but are not limited to, a leader, polyadenylation sequence, propeptide sequence, promoter, signal peptide sequence, and transcription terminator. At a minimum, the control sequences include a promoter, and transcriptional and translational stop signals. The control sequences may be provided with linkers for the purpose of introducing specific restriction sites facilitating ligation of the control sequences with the coding region of the polynucleotide encoding a variant.
Expression: The term "expression" includes any step involved in the production of a variant including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion.
Expression vector: The term "expression vector" means a linear or circular DNA molecule that comprises a polynucleotide encoding a variant and is operably linked to control sequences that provide for its expression.
Fragment: The term "fragment" means a polypeptide having one or more (e.g., several) amino acids absent from the amino and/or carboxyl terminus of a mature polypeptide; wherein the fragment has protease activity.
High stringency conditions: The term "high stringency conditions" means for probes of at least 100 nucleotides in length, prehybridization and hybridization at 42°C in 5X SSPE, 0.3% SDS, 200 micrograms/ml sheared and denatured salmon sperm DNA, and 50% formamide, following standard Southern blotting procedures for 12 to 24 hours. The carrier material is finally washed three times each for 15 minutes using 2X SSC, 0.2% SDS at 65°C.
Host cell: The term "host cell" means any cell type that is susceptible to transformation, transfection, transduction, or the like with a nucleic acid construct or expression vector comprising a polynucleotide of the present invention. The term "host cell" encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication.
Improved property: The term "improved property" means a characteristic associated with a variant that is improved compared to the parent. Such improved properties include, but are not limited to, increased stability under storage conditions, increased thermo-stability, and increased residual activity.
Isolated: The term "isolated" means a substance in a form or environment which does not occur in nature. Non-limiting examples of isolated substances include (1 ) any non-naturally occurring substance, (2) any substance including, but not limited to, any enzyme, variant, nucleic acid, protein, peptide or cofactor, that is at least partially removed from one or more or all of the naturally occurring constituents with which it is associated in nature; (3) any substance modified by the hand of man relative to that substance found in nature; or (4) any substance modified by increasing the amount of the substance relative to other components with which it is naturally associated (e.g., multiple copies of a gene encoding the substance; use of a stronger promoter than the promoter naturally associated with the gene encoding the substance). An isolated substance may be present in a fermentation broth sample.
Low stringency conditions: The term "low stringency conditions" means for probes of at least 100 nucleotides in length, prehybridization and hybridization at 42°C in 5X SSPE, 0.3% SDS, 200 micrograms/ml sheared and denatured salmon sperm DNA, and 25% formamide, following standard Southern blotting procedures for 12 to 24 hours. The carrier material is finally washed three times each for 15 minutes using 2X SSC, 0.2% SDS at 50°C.
Mature polypeptide: The term "mature polypeptide" means a polypeptide in its final form following translation and any post-translational modifications, such as N-terminal processing, C-terminal truncation, glycosylation, phosphorylation, etc. In one aspect, the mature polypeptide is amino acids 199 to 564 of SEQ ID NO: 2. Amino acids 1 to 17 of SEQ ID NO: 2 are a signal peptide, and amino acids 18 to 198 are a propeptide. The N-terminals of the mature S53 polypeptides used according to the present invention were experimentally confirmed based on EDMAN N-terminal sequencing data and Intact MS data. The mature polypeptides are also included as SEQ ID NO: 3 (mature S53 protease 3 from Meripilus giganteus. It is known in the art that a host cell may produce a mixture of two of more different mature polypeptides (i.e., with a different C-terminal and/or N-terminal amino acid) expressed by the same polynucleotide.
Mature polypeptide coding sequence: The term "mature polypeptide coding sequence" means a polynucleotide that encodes a mature polypeptide having protease activity. In one aspect, the mature polypeptide coding sequence is nucleotides 595 to 1692 of SEQ ID NO: 1 . Nucleotides 1 to 51 of SEQ ID NO: 1 encode a signal peptide, nucleotides 52 to 594 encode a propeptide.
Medium stringency conditions: The term "medium stringency conditions" means for probes of at least 100 nucleotides in length, prehybridization and hybridization at 42°C in 5X SSPE, 0.3% SDS, 200 micrograms/ml sheared and denatured salmon sperm DNA, and 35% formamide, following standard Southern blotting procedures for 12 to 24 hours. The carrier material is finally washed three times each for 15 minutes using 2X SSC, 0.2% SDS at 55°C.
Medium-high stringency conditions: The term "medium-high stringency conditions" means for probes of at least 100 nucleotides in length, prehybridization and hybridization at 42°C in 5X SSPE, 0.3% SDS, 200 micrograms/ml sheared and denatured salmon sperm DNA, and 35% formamide, following standard Southern blotting procedures for 12 to 24 hours. The carrier material is finally washed three times each for 15 minutes using 2X SSC, 0.2% SDS at 60°C. Modification: The term "modification(s)" is in the context of the present invention to be understood as a substitution, insertion, and/or deletion, at one or more (e.g., several) positions. A substitution means replacement of the amino acid occupying a position with a different amino acid; a deletion means removal of the amino acid occupying a position; and an insertion means adding an amino acid adjacent to and immediately following the amino acid occupying a position.
Mutant: The term "mutant" means a polynucleotide encoding a variant.
Nucleic acid construct: The term "nucleic acid construct" means a nucleic acid molecule, either single- or double-stranded, which is isolated from a naturally occurring gene or is modified to contain segments of nucleic acids in a manner that would not otherwise exist in nature or which is synthetic, which comprises one or more control sequences. In one embodiment the one or more control sequences are heterologous (of different origin/species) to the coding sequence encoding the polypeptide of the invention.
Operably linked: The term "operably linked" means a configuration in which a control sequence is placed at an appropriate position relative to the coding sequence of a polynucleotide such that the control sequence directs expression of the coding sequence.
Parent or parent protease: The term "parent" or "parent protease" means any polypeptide with protease activity to which an alteration is made to produce the enzyme variants of the present invention.
Sequence identity: The relatedness between two amino acid sequences or between two nucleotide sequences is described by the parameter "sequence identity".
For purposes of the present invention, the sequence identity between two amino acid sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277), preferably version 5.0.0 or later. The parameters used are gap open penalty of 10, gap extension penalty of 0.5, and the EBLOSUM62 (EMBOSS version of BLOSUM62) substitution matrix. The output of Needle labeled "longest identity" (obtained using the -nobrief option) is used as the percent identity and is calculated as follows:
(Identical Residues x 100)/(Length of Alignment - Total Number of Gaps in Alignment) For purposes of the present invention, the sequence identity between two deoxyribonucleotide sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, supra) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, supra), preferably version 5.0.0 or later. The parameters used are gap open penalty of 10, gap extension penalty of 0.5, and the EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix. The output of Needle labeled "longest identity" (obtained using the -nobrief option) is used as the percent identity and is calculated as follows: (Identical Deoxyribonucleotides x 100)/(Length of Alignment - Total Number of Gaps in Alignment)
Subsequence: The term "subsequence" means a polynucleotide having one or more (e.g., several) nucleotides absent from the 5' and/or 3' end of a mature polypeptide coding sequence; wherein the subsequence encodes a fragment having protease activity. In one aspect, a subsequence contains at least 1098 nucleotides (e.g., nucleotides 595 to 1692 of SEQ ID NO: 1 ).
Variant: The term "variant" means a polypeptide having protease activity comprising a modification(s) at one or more (e.g., several) positions. The variants of the present invention have at least 20%, e.g., at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 100% of the protease activity of the mature polypeptide of SEQ ID NO: 2, disclosed herein as SEQ ID NO: 3.
Very high stringency conditions: The term "very high stringency conditions" means for probes of at least 100 nucleotides in length, prehybridization and hybridization at 42°C in 5X SSPE, 0.3% SDS, 200 micrograms/ml sheared and denatured salmon sperm DNA, and 50% formamide, following standard Southern blotting procedures for 12 to 24 hours. The carrier material is finally washed three times each for 15 minutes using 2X SSC, 0.2% SDS at 70°C.
Very low stringency conditions: The term "very low stringency conditions" means for probes of at least 100 nucleotides in length, prehybridization and hybridization at 42°C in 5X SSPE, 0.3% SDS, 200 micrograms/ml sheared and denatured salmon sperm DNA, and 25% formamide, following standard Southern blotting procedures for 12 to 24 hours. The carrier material is finally washed three times each for 15 minutes using 2X SSC, 0.2% SDS at 45°C.
Wild-type protease: The term "wild-type" protease means a protease expressed by a naturally occurring microorganism, such as a bacterium, yeast, or filamentous fungus found in nature.
Conventions for Designation of Variants
For purposes of the present invention, the mature polypeptide comprised in SEQ ID NO: 2 is used to determine the corresponding amino acid residue in another protease. The amino acid sequence of another protease is aligned with the mature polypeptide comprised in SEQ ID NO: 2 (disclosed herein as SEQ ID NO: 3), and based on the alignment, the amino acid position number corresponding to any amino acid residue in the mature polypeptide comprised in SEQ ID NO: 2 is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277), preferably version 5.0.0 or later. The parameters used are gap open penalty of 10, gap extension penalty of 0.5, and the EBLOSUM62 (EMBOSS version of BLOSUM62) substitution matrix. Identification of the corresponding amino acid residue in another protease than the Meripilus giganteus S53 protease can be determined by an alignment of multiple polypeptide sequences using several computer programs including, but not limited to, MUSCLE (multiple sequence comparison by log-expectation; version 3.5 or later; Edgar, 2004, Nucleic Acids Research 32: 1792-1797), MAFFT (version 6.857 or later; Katoh and Kuma, 2002, Nucleic Acids Research 30: 3059-3066; Katoh et al., 2005, Nucleic Acids Research 33: 51 1 -518; Katoh and Toh, 2007, Bioinformatics 23: 372-374; Katoh et al., 2009, Methods in Molecular Biology 537 : 39-64: Katoh and Toh, 2010, Bioinformatics 26 : 1899- 1900). and EMBOSS EMMA employing ClustalW (1.83 or later; Thompson et al., 1994, Nucleic Acids Research 22: 4673- 4680), using their respective default parameters.
When the other enzyme has diverged from the mature polypeptide of SEQ ID NO: 2 such that traditional sequence-based comparison fails to detect their relationship (Lindahl and Elofsson, 2000, J. Mol. Biol. 295: 613-615), other pairwise sequence comparison algorithms can be used. Greater sensitivity in sequence-based searching can be attained using search programs that utilize probabilistic representations of polypeptide families (profiles) to search databases. For example, the PSI-BLAST program generates profiles through an iterative database search process and is capable of detecting remote homologs (Atschul et al., 1997, Nucleic Acids Res. 25: 3389-3402). Even greater sensitivity can be achieved if the family or superfamily for the polypeptide has one or more representatives in the protein structure databases. Programs such as GenTHREADER (Jones, 1999, J. Mol. Biol. 287: 797-815; McGuffin and Jones, 2003, Bioinformatics 19: 874-881 ) utilize information from a variety of sources (PSI-BLAST, secondary structure prediction, structural alignment profiles, and solvation potentials) as input to a neural network that predicts the structural fold for a query sequence. Similarly, the method of Gough et al., 2000, J. Mol. Biol. 313: 903-919, can be used to align a sequence of unknown structure with the superfamily models present in the SCOP database. These alignments can in turn be used to generate homology models for the polypeptide, and such models can be assessed for accuracy using a variety of tools developed for that purpose.
For proteins of known structure, several tools and resources are available for retrieving and generating structural alignments. For example the SCOP superfamilies of proteins have been structurally aligned, and those alignments are accessible and downloadable. Two or more protein structures can be aligned using a variety of algorithms such as the distance alignment matrix (Holm and Sander, 1998, Proteins 33: 88-96) or combinatorial extension (Shindyalov and Bourne, 1998, Protein Engineering 1 1 : 739-747), and implementation of these algorithms can additionally be utilized to query structure databases with a structure of interest in order to discover possible structural homologs (e.g., Holm and Park, 2000, Bioinformatics 16: 566-567). In describing the variants of the present invention, the nomenclature described below is adapted for ease of reference. The accepted lUPAC single letter or three letter amino acid abbreviation is employed.
Substitutions. For an amino acid substitution, the following nomenclature is used: Original amino acid, position, substituted amino acid. Accordingly, the substitution of threonine at position 226 with alanine is designated as "Thr226Ala" or "T226A". Multiple mutations are separated by addition marks ("+"), e.g. , "Gly205Arg + Ser41 1 Phe" or "G205R + S41 1 F", representing substitutions at positions 205 and 41 1 of glycine (G) with arginine (R) and serine (S) with phenylalanine (F), respectively.
Deletions. For an amino acid deletion, the following nomenclature is used: Original amino acid, position, *. Accordingly, the deletion of glycine at position 195 is designated as "Gly195*" or "G195*". Multiple deletions are separated by addition marks ("+"), e.g., "Gly195* + Ser41 1 *" or "G195* + S41 1 *".
Insertions. For an amino acid insertion, the following nomenclature is used: Original amino acid, position, original amino acid, inserted amino acid. Accordingly the insertion of lysine after glycine at position 195 is designated "Gly195Glyl_ys" or "G195GK". An insertion of multiple amino acids is designated [Original amino acid, position, original amino acid, inserted amino acid #1 , inserted amino acid #2; etc.]. For example, the insertion of lysine and alanine after glycine at position 195 is indicated as "Gly195Glyl_ysAla" or "G195GKA".
In such cases the inserted amino acid residue(s) are numbered by the addition of lower case letters to the position number of the amino acid residue preceding the inserted amino acid residue(s). In the above example, the sequence would thus be:
Multiple modification. Variants comprising multiple modifications are separated by addition marks ("+"), e.g. , "Arg170Tyr+Gly195Glu" or "R170Y+G195E" representing a substitution of arginine and glycine at positions 170 and 195 with tyrosine and glutamic acid, respectively.
Different modifications. Where different modification can be introduced at a position, the different modifications are separated by a comma, e.g., "Arg170Tyr,Glu" represents a substitution of arginine at position 170 with tyrosine or glutamic acid. Thus, "Tyr167Gly,Ala + Arg170Gly,Ala" designates the following variants:
"Tyr167Gly+Arg170Gly", "Tyr167Gly+Arg170Ala", "Tyr167Ala+Arg170Gly", and "Tyr167Ala+Arg170Ala". DETAILED DESCRIPTION OF THE INVENTION
The present invention relates to protease variants, comprising a modification(s) at one or more (e.g., several) positions corresponding to specific positions of the mature polypeptide disclosed as SEQ ID NO: 3 (a parent protease), wherein the variant has protease activity. As explained herein the specific position numbers may change in case the mature parent protease is different from SEQ ID NO: 3. The improved properties of the variants of the invention falls in the following categories, e.g., increased stability, e.g., increased thermostability (measured as increase in thermal denaturation temperature, Td, and/or increased residual activity by the Suc- AAPF assay after incubation for 30 min at an elevated temperature in the range from 55 to 60 degrees Celsius as described in detail in the examples).
Variants
The present invention provides a protease variant comprising a modification at one or more position corresponding to positions 39, 50, 57, 60, 74, 81 , 84, 109, 1 10, 1 1 1 , 1 15, 1 17, 124, 128, 142, 145, 146, 154, 182, 183, 187, 207, 209, 210, 212, 228, 267, 271 , 272, 274, 278, 280, 294, 317, 318, 320, 321 , 322, 328, 343, 348, 362 or 363 of the polypeptide of SEQ ID NO: 3, wherein each modification is independently a substitution, insertion or deletion. In one embodiment, the modification is a substitution. In another embodiment, the modification is a deletion.
The present invention provides a protease variant comprising a modification at one or more position corresponding to positions 39, 50, 57, 60, 74, 81 , 84, 109, 1 10, 1 1 1 , 1 15, 1 17, 124, 128, 142, 145, 146, 154, 182, 183, 187, 207, 209, 210, 212, 228, 267, 271 , 272, 274, 278, 280, 294, 317, 318, 320, 321 , 322, 328, 343, 348, 362 or 363 of the polypeptide of SEQ ID NO: 3, wherein the variant has protease activity and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity to the mature polypeptide of SEQ ID NO: 3, and wherein the variant has increased thermo-stability compared to the protease of SEQ ID NO: 3.
In an embodiment, the variant has sequence identity of at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, to the amino acid sequence of the mature parent protease.
In another embodiment, the variant has at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, such as at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100%, sequence identity to the polypeptide of SEQ ID NO: 3. In one aspect, the number of substitutions in the variants of the present invention is 1 - 20, e.g., 1 -10 and 1 -5, such as 1 , 2, 3, 4, 5, 6, 7, 8, 9 or 10 substitutions.
In one specific aspect the invention relates to a protease variant comprising a modification at position corresponding to positions 39, 60, 74, 81 , 84, 109, 1 15, 142, 145, 146, 154, 182, 183, 187, 209, 210, 212, 228, 267, 272, 280, 294, 317, 318, 348 or 362 of the polypeptide of SEQ ID NO: 3, wherein the variant has protease activity and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity to the polypeptide of SEQ ID NO: 3, wherein the protease is a serine protease belonging to the S53 family and wherein the variant has increased thermo-stability compared to the protease of SEQ ID NO: 3.
More specifically the variant comprises a modification which is a substitution at position corresponding to positions 39, 50, 57, 60, 74, 81 , 84, 109, 1 10, 1 1 1 , 1 15, 1 17, 124, 128, 142, 145, 146, 154, 182, 183, 187, 207, 209, 212, 228, 267, 271 , 272, 274, 278, 280, 294, 317, 318, 320, 321 , 322, 328, 343, 348, 362 or 363 of the polypeptide of SEQ ID NO: 3, wherein the variant has protease activity and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity to the polypeptide of SEQ ID NO: 3, wherein the protease is a serine protease belonging to the S53 family and wherein the variant has increased thermo-stability compared to the protease of SEQ ID NO: 3.
More specifically the variant comprises a modification which is a deletion at position corresponding to position 318 or 210 of the polypeptide of SEQ ID NO: 3, wherein the variant has protease activity and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity to the polypeptide of SEQ ID NO: 3, wherein the protease is a serine protease belonging to the S53 family and wherein the variant has increased thermo-stability compared to the protease of SEQ ID NO: 3.
In a further specific embodiment the variant comprises or consists of at least one substitutions and/or deletions selected from the group consisting of: I39M, I39R, I39L, I39C, S50C, K57R, S60P, S60D, E74W , E81A, E81 E, E81 K, E81 R, I84C, D109N, D109P, D1 10N, F1 1 1 P, N1 15D, N1 15L, E1 17D, N124Q, N124L, N124W, G128A, Q142R, Q142W, N145A, N145D, N145E, N145G, N145K, N145Q, N145V, T146A, T146D, T146E, T146W, T146Y, Q154R, Q154V, Q154W, Q154Y,Q182G, Q182R, S183L, S183P, S187L, Q207R, V209L, E212E, I228R, D267N,V271 C, S272C, S272R, S272V, G274G, G278S, D280N, S294A, S317A, S317G, S317S, S318N, G320C, K321A, K321 G, A322S,T328C, K343C, P348A, T362A, A363C, S318* and S210* of the polypeptide of SEQ ID NO: 3, wherein the variant has protease activity and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity to the polypeptide of SEQ ID NO: 3, wherein the protease is a serine protease belonging to the S53 family and wherein the variant has increased thermo-stability compared to the protease of SEQ ID NO: 3.
In another aspect, the protease variant comprises a modification at position corresponding to position 39, 60, 74, 81 , 84, 109, 1 15, 1 17, 142, 145, 146, 154, 182, 183, 187, 209, 210, 212, 228, 267, 272, 280, 294, 317, 318, 348 or 362 of the polypeptide of SEQ ID NO: 3, wherein the variant has protease activity and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity to the polypeptide of SEQ ID NO: 3, wherein the protease is a serine protease belonging to the S53 family, and wherein the increased thermostability is increased residual activity measured after incubation for 30 min at an elevated temperature in the range from 55 to 60 degrees Celsius.
More specifically the variant comprises a modification which is a deletion at position corresponding to position 318 or 210 of the polypeptide of SEQ ID NO: 3 wherein the variant has protease activity and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity to the polypeptide of SEQ ID NO: 3, wherein the protease is a serine protease belonging to the S53 family, and wherein the increased thermo-stability is increased residual activity measured after incubation for 30 min at an elevated temperature in the range from 55 to 60 degrees Celsius.
More specifically the variant comprises a modification which is a substitution at position corresponding to positions 39, 60, 74 81 , 84, 109, 1 15, 142, 145, 146, 154, 182, 183, 187, 209, 212, 228, 267, 272, 280, 294, 317, 348 or 362 of the polypeptide of SEQ ID NO: 3, wherein the variant has protease activity and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity to the polypeptide of SEQ ID NO: 3, wherein the protease is a serine protease belonging to the S53 family, wherein the increased thermo-stability is increased residual activity measured after incubation for 30 min at a temperature in the range from 55 to 60 degrees Celsius.
In a further specific embodiment the variant comprises or consists of one or more substitutions and/or deletions selected from the group consisting of: I39M, I39R, I39L, I39C, S60D, I84C N1 15D, N1 15L, E1 17D, N145G, N145Q, N145V, N145D, N145K, N145K, N145A, N145E, S183L, S183P, D280N, Q182G, Q182R, E81 R, E81 K, E81 E, E81A, I84C, Q154V, Q142W, Q142R, T146A, T146W, T146Y, T146E, T146D, I228R, D267N, S272V, S272R, E212E, S294A, T362A, E74W, S187L, P348A, D109P, S317A, S317G, S317S, S317A, S318* and S210* of the polypeptide of SEQ ID NO: 3, wherein the variant has protease activity and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity to the polypeptide of SEQ ID NO: 3, and wherein the increased thermo-stability is increased residual activity measured after incubation for 30 min at a temperature in the range from 55 to 60 degrees Celsius.
In a further specific embodiment the variant comprises at least one of the following modifications or combination of modifications:
N1 15L;
S183P;
D280N;
N1 15D;
N1 15L + Q182G;
N1 15L + Q182R;
E81 R + S183P;
E81 K + S183P;
S183P + Q154V;
S183P + Q142W;
Q142R + S183P;
S183P + T146A;
S183P + T146W;
S183P + I228R;
S183P + D267N;
S183P + S272V;
S183P + S272R;
T146W + D280N;
T146Y + S183P;
S183P + E212E;
S183P + S294A;
S183P + T362A;
S183P + S294A;
S183P + E74W;
S183P + E81 E;
S183P + E81A;
N1 15L + S183L + S187L;
S183L + V209L + S210*;
D109P + V209L + S210*;
N1 15D + V209L + S210*;
E81 R + V209L + S210*; D109P + V209L + S210*;
N1 15D + V209L + S210*;
E81 R + V209L + S210*;
T146W + S183P + D280N;
I84C + S183P + S272C;
I39M + Q142R + S183P;
I39R + Q142R + S183P;
I39L + Q142R + S183P;
I39C + Q142R + S183P;
E1 17D + Q142R + S183P;
S60D + Q142R + S183P;
N1 15L + S183L +S187L + P348A;
D109P + S183P + V209L + S210*;
N1 15D + S183P + V209L + S210*;
E81 R + S183P + V209L +S210*;
V209L + S210* + S317A + S318*;
Q142R + N145G + T146E + S183P;
Q142R + N145Q + T146D + S183P;
Q142R + N145V + T146E + S183P ;
Q142R + N145D + T146E + S183P;
Q142R + N145K + T146E + S183P;
Q142R + N145A + T146D +S183P;
Q142R + N145E + T146E + S183P;
N1 15L + S183L + S187L + V209W + S210*;
N1 15L + S183L + S187L + V209L + S210*;
N1 15L + S183L + S187L + S317G + S318*;
N1 15L + S183L + S187L + S317S + S318*;
N1 15L +S183L + S187L + S317A + S318*;
E81 R + V209L + S210* + S317A + S318*; and wherein the increased thermo-stability is increased residual activity measured after incubation for 30 min at a temperature in the range from 55 to 60 degrees Celsius. More particularly the variants have a residual activity of at least 10%, particularly at least 12%, more particularly at least 15%, measured after incubation for 30 minutes at 56°C.
In a further specific embodiment the variant comprises at least one of the following modifications or combination of modifications:
N1 15L + Q182G; N1 15D;
Q142R +S183P;
Q142R +N145G +T146E +S183P;
Q142R +N145Q + T146D + S183P;
Q142R +N145V + T146E +S183P;
Q142R +N145D +T146E + S183P;
Q142R +N145K + T146E + S183P;
Q142R +N145A + T146D +S183P;
I39M + Q142R +S183P;
Q142R + N145E + T146E +S183P;
I39R + Q142R + S183P;
I39L + Q142R + S183P;
E1 17D + Q142R + S183P;
S60D + Q142R + S183P; and wherein the variant has residual activity of at least 30% measured after incubation for 30 min at an elevated temperature of 57 degrees Celsius.
In a further specific embodiment the variant comprises at least one of the following modifications or combination of modifications:
Q142R+ S183P;
Q142R +N145G +T146E +S183P;
Q142R +N145Q +T146D +S183P;
Q142R + N145V + T146E +S183P;
Q142R + N145D + T146E + S183P;
Q142R + N145K + T146E + S183P;
Q142R + N 145A + T146D +S183P;
I39M + Q142R + S183P;
Q142R + N145E + T146E + S183P;
I39R + Q142R + S183P;
I39L +Q142R +S183P;
E1 17D +Q142R S183P;
Q142R + S183P;
S60D + Q142R + S183P;
Q142R +S183P; and wherein the variant has residual activity of at least 70% measured after incubation for 30 min at 57 degrees Celsius.
In a further specific embodiment the variant comprises at least one of the following modification or combination of modifications: Q142R + S183P;
I39C + Q142R + S183P;
E1 17D + Q142R + S183P;
Q142R + S183P;
S60D + Q142R + S183P; and wherein the variant has residual activity of at least 40% measured after incubation for 30 min at 60 degrees Celsius.
In a further specific embodiment the variant comprises at least one of the following modification or combination of modifications:
Q142R + S183P;
I39C + Q142R +S183P; and wherein the variant has residual activity of at least 40% measured after incubation for 30 minutes at 62°C.
The present invention relates to a variant comprising a modification at position corresponding to position 50, 57, 60, 81 , 84, 109, 1 10, 1 1 1 , 124, 128, 142, 145, 146, 154, 182, 183, 207, 209, 210, 228, 267, 271 , 272, 274, 278, 280, 294, 317, 318, 320, 321 , 322, 328, 343, 362, or 363 of the polypeptide of SEQ ID NO: 3, wherein the variant has protease activity and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity to the polypeptide of SEQ ID NO: 3, wherein the protease is a serine protease belonging to the S53 family.
More specifically the variant comprises a modification which is a substitution at position corresponding to positions 50, 57, 60, 81 , 84, 109, 1 10, 1 1 1 , 124, 128, 142, 145, 146, 154, 182, 183, 207, 209, 228, 267, 271 , 272, 274, 278, 280, 294, 317, 318, 320, 321 , 322, 328, 343, 362, or 363 of the polypeptide of SEQ ID NO: 3, wherein the variant has protease activity and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity to the polypeptide of SEQ ID NO: 3, wherein the protease is a serine protease belonging to the S53 family; and wherein the increase in thermo-stability is an increase in thermal denaturation temperature measured by TSA. In particular, the increased thermo-stability measured as Td by TSA assay is at least 59°C.
More specifically the variant comprises a modification which is a deletion at position corresponding to position 318 or 210 of the polypeptide of SEQ ID NO: 3, wherein the variant has protease activity and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity to the polypeptide of SEQ ID NO: 3, wherein the protease is a serine protease belonging to the S53 family; and wherein the increase in thermo-stability is an increase in thermal denaturation temperature measured by TSA. In particular, the increased thermostability measured as Td by TSA assay is at least 59°C.
In a further specific embodiment the variant comprises or consists of one or more substitution(s) and/or deletion(s) selected from the group consisting of S50C, K57R, S60P, E81 R, I84C, D109P, D109N, D1 10N, F1 1 1 P, N124L, N124W, N124Q, G128A, Q142R, Q142W, N145V, N145D, N145A, T146A, T146W, T146E, T146D, Q154V, Q154W, Q154,R, Q154Y, Q182G, Q182R, S183P, S183L, Q207R, V209L, I228R, D267N, V271 C, S272V, S272C, S272R, G274G, G278S, D280N, S294A, S317A, S318N, G320C, K321 G, K321A, A322S, T328C, K343C, T362A, A363C, S318* and S210* of the polypeptide of SEQ ID NO: 3, wherein the variant has protease activity and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity to the polypeptide of SEQ ID NO: 3 and wherein the increased thermo-stability measured as Td by TSA assay is at least 59°C
In a further specific embodiment, the variant comprises at least one of the following modifications or combination of modifications:
S183P;
D280N;
K57R +S183P;
D109P +S183P+ V209L +S210*;
E81 R+ S183P +V209L +S210*;
E81 R +V209L +S210*;
Q154V +S183P;
Q142W +S183P;
Q142R +S183P;
T146A +S183P;
T146W +S183P;
S183P +I228R;
S183P +D267N;
S183P +S272V;
E81 R +V209L +S210* +S317A +S318*;
S183P +T328C +K343C;
S183P +G320C+ A363C;
T146W +D280N;
T146W +S183L D+280N;
T146W;
T146W +S183P +D280N;
T146Y +S183P; S183P +Q207R;
S50C +S183P +V271C;
I84C +S183P+ S272C;
Q142W +T146W +S183P;
Q142W+T146W+S183P+ D280N;
S183P +S294A;
S183P +K321G;
S183P +T362A;
Q182G;
Q142W+T146W+Q182R;
S272V;
S272R;
S60P;
D109N +D110N;
F111P;
G128A;
G278S;
S318N +K321A+A322S;
E81R+ T146W;
E81R+Q142R+S183P;
E81R+Q142W +S183P
S183P +G274G;
E81R;
N124L +Q142R +S183P;
N124W+Q142R+S183P;
N124Q +Q142R +S183P;
Q142R + N145V + T146E +S183P;
Q142R +N145D +T146E + S183P;
Q142R + N145A +T146D +S183P; and wherein the increased thermo-stability measured as Td by TSA assay is at least 59°C.
In a further specific embodiment, the variant comprises at least one of the following modifications or combination of modifications:
D280N;
D109P + S183P + V209L + S210*;
E81R + S183P + V209L + S210*;
E81R + V209L+S210*;
Q154V + S183P; Q142W +S183P;
Q142R + S183P;
T146A + S183P;
T146W + S183P;
S183P + D267N;
S183P + S272V;
E81 R + V209L + S210*+ S317A +S318*;
T146W + D280N;
T146W + S183L +D280N;
T146W;
T146W + S183P +D280N;
T146Y + S183P;
S183P + Q207R;
S50C + S183P + V271 C;
I84C + S183P + S272C;
Q142W + T146W + S183P;
Q142W + T146W + S183P + D280N;
S183P + S294A;
Q142W + T146W + Q182R;
S272V;
S272R;
S60P;
E81 R + T146W;
E81 R + Q142R + S183P;
E81 R + Q142W + S183P;
S183P + G274G;
E81 R;
N124L + Q142R + S183P;
N124W + Q142R + S183P;
N124Q + Q142R + S183P;
Q142R + N145V + T146E + S183P;
Q142R + N145D + T146E +S183P;
Q142R + N145A + T146D + S183P; and wherein the increased thermo-stability measured as Td by TSA assay is at least 61 °C.
In a further specific embodiment, the variant comprises at least one of the following modifications or combination of modifications:
E81 R + S183P+ V209L +S210*; Q142R + S183P;
T146W + D280N;
T146W +S183L + D280N;
T146W + S183P+ D280N;
S50C + S183P + V271 C;
I84C + S183P + S272C;
Q142W + T146W + S183P+ D280N;
S272V;
E81 R +T146W;
E81 R + Q142R + S183P;
N124L + Q142R +S183P;
N124W + Q142R +S183P;
N124Q + Q142R + S183P;
Q142R + N145V + T146E + S183P;
Q142R + N 145D + T146E + S183P;
Q142R + N145A + T146D + S183P; and wherein the increased thermo-stability measured as Td by TSA assay is at least 63°C.
In a further specific embodiment, the variant comprises at least one of the following modifications or combination of modifications:
Q142R + S183P;
S50C + S183P + V271 C;
E81 R + Q142R + S183P;
N124L + Q142R + S183P;
N124Q + Q142R + S183P;
Q142R + N145V + T146E + S183P;
Q142R + N145D + T146E + S183P; or
Q142R + N145A + T146D + S183P; and wherein the increased thermo-stability measured as Td by TSA assay is at least 65°C.
The variants may further comprise one or more additional modification(s) at one or more (e.g., several) other positions. Such further modifications may preferably not change the properties of the protease variants of the present invention.
The amino acid changes may be of a minor nature, that is conservative amino acid substitutions or insertions that do not significantly affect the folding and/or activity of the protein; small deletions, typically of 1 -30 amino acids; small amino- or carboxyl-terminal extensions, such as an amino-terminal methionine residue; a small linker peptide of up to 20-25 residues; or a small extension that facilitates purification by changing net charge or another function, such as a poly-histidine tract, an antigenic epitope or a binding domain. Therefore even though the protease variants according to the invention may only comprise one specific substitution providing the improved property according to the invention it may still have addition modifications leading to a variant protease having at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity, to the amino acid sequence of the mature parent protease, e.g., the protease of SEQ ID NO: 3. These additional modification should preferably not significantly change the improved properties of the variant protease.
Examples of conservative substitutions are within the groups of basic amino acids (arginine, lysine and histidine), acidic amino acids (glutamic acid and aspartic acid), polar amino acids (glutamine and asparagine), hydrophobic amino acids (leucine, isoleucine and valine), aromatic amino acids (phenylalanine, tryptophan and tyrosine), and small amino acids (glycine, alanine, serine, threonine and methionine). Amino acid substitutions that do not generally alter specific activity are known in the art and are described, for example, by H. Neurath and R.L. Hill, 1979, In, The Proteins, Academic Press, New York. Common substitutions are Ala/Ser, Val/lle, Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/lle, LeuA al, Ala/Glu, and Asp/Gly.
Essential amino acids in a polypeptide can be identified according to procedures known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (Cunningham and Wells, 1989, Science 244: 1081 -1085). In the latter technique, single alanine mutations are introduced at every residue in the molecule, and the resultant mutant molecules are tested for protease activity to identify amino acid residues that are critical to the activity of the molecule. See also, Hilton et al., 1996, J. Biol. Chem. 271 : 4699-4708. The active site of the enzyme or other biological interaction can also be determined by physical analysis of structure, as determined by such techniques as nuclear magnetic resonance, crystallography, electron diffraction, or photoaffinity labeling, in conjunction with mutation of putative contact site amino acids. See, for example, de Vos et al., 1992, Science 255: 306-312; Smith et al., 1992, J. Mol. Biol. 224: 899-904; Wlodaver ei a/., 1992, FEBS Lett. 309: 59-64.
In an embodiment, the variant has improved (increased) thermo-stability compared to the parent enzyme, e.g., the polypeptide of SEQ ID NO: 3.
In an embodiment, the variant has improved (increased) residual activity compared to parent enzyme, e.g., the polypeptide of SEQ ID NO: 3.
In an embodiment, the variant has improved (increased) thermal melting temperature compared to parent enzyme, e.g., the polypeptide of SEQ ID NO: 3. Parent proteases
The parent protease may be (a) a polypeptide having at least 80% sequence identity to the mature polypeptide of SEQ ID NO: 2; (b) a polypeptide encoded by a polynucleotide that hybridizes under high stringency conditions with (i) the mature polypeptide coding sequence of SEQ ID NO: 1 , (ii) the cDNA sequence thereof, or (iii) the full-length complement of (i) or (ii); or (c) a polypeptide encoded by a polynucleotide having at least 80% sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 1.
In an aspect, the parent has a sequence identity to the mature polypeptide of SEQ ID NO: 2 of at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%, which have protease activity. In one aspect, the amino acid sequence of the parent differs by up to 10 amino acids, e.g., 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10, from the mature polypeptide of SEQ ID NO: 2.
In another aspect, the parent comprises or consists of the amino acid sequence of SEQ ID NO: 3. In another aspect, the parent comprises or consists of amino acids 199 to 564 of SEQ ID NO: 2.
In another aspect, the parent is encoded by a polynucleotide that hybridizes under high stringency conditions, or very high stringency conditions with (i) the mature polypeptide coding sequence of SEQ ID NO: 1 , (ii) the cDNA sequence thereof, or (iii) the full-length complement of (i) or (ii) (Sambrook et al, 1989, Molecular Cloning, A Laboratory Manual, 2d edition, Cold Spring Harbor, New York).
The polynucleotide of SEQ ID NO: 1 or a subsequence thereof, as well as the polypeptide of SEQ ID NO: 2 or a fragment thereof, may be used to design nucleic acid probes to identify and clone DNA encoding a parent from strains of different genera or species according to methods well known in the art. In particular, such probes can be used for hybridization with the genomic DNA or cDNA of a cell of interest, following standard Southern blotting procedures, in order to identify and isolate the corresponding gene therein. Such probes can be considerably shorter than the entire sequence, but should be at least 15, e.g., at least 25, at least 35, or at least 70 nucleotides in length. Preferably, the nucleic acid probe is at least 100 nucleotides in length, e.g., at least 200 nucleotides, at least 300 nucleotides, at least 400 nucleotides, at least 500 nucleotides, at least 600 nucleotides, at least 700 nucleotides, at least 800 nucleotides, or at least 900 nucleotides in length. Both DNA and RNA probes can be used. The probes are typically labeled for detecting the corresponding gene (for example, with 32P, 3H, 35S, biotin, or avidin). Such probes are encompassed by the present invention.
A genomic DNA or cDNA library prepared from such other strains may be screened for DNA that hybridizes with the probes described above and encodes a parent. Genomic or other DNA from such other strains may be separated by agarose or polyacrylamide gel electrophoresis, or other separation techniques. DNA from the libraries or the separated DNA may be transferred to and immobilized on nitrocellulose or other suitable carrier material. In order to identify a clone or DNA that hybridizes with SEQ ID NO: 1 or a subsequence thereof, the carrier material is used in a Southern blot.
For purposes of the present invention, hybridization indicates that the polynucleotide hybridizes to a labeled nucleic acid probe corresponding to (i) SEQ ID NO: 1 ; (ii) the mature polypeptide coding sequence of SEQ ID NO: 1 ; (iii) the cDNA sequence thereof; (iv) the full- length complement thereof; or (v) a subsequence thereof; under high to very high stringency conditions. Molecules to which the nucleic acid probe hybridizes under these conditions can be detected using, for example, X-ray film or any other detection means known in the art.
In one aspect, the nucleic acid probe is the mature polypeptide coding sequence of SEQ
ID NO: 1. In another aspect, the nucleic acid probe is nucleotides 595 to 1692 of SEQ ID NO: 1 . In another aspect, the nucleic acid probe is a polynucleotide that encodes the polypeptide of SEQ ID NO: 2; the mature polypeptide thereof; or a fragment thereof. In another aspect, the nucleic acid probe is SEQ ID NO: 1 or the cDNA sequence thereof.
In another embodiment, the parent is encoded by a polynucleotide having a sequence identity to the mature polypeptide coding sequence of SEQ ID NO: 1 of at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%.
The polypeptide may be a hybrid polypeptide in which a region of one polypeptide is fused at the N-terminus or the C-terminus of a region of another polypeptide.
The parent may be a fusion polypeptide or cleavable fusion polypeptide in which another polypeptide is fused at the N-terminus or the C-terminus of the polypeptide of the present invention. A fusion polypeptide is produced by fusing a polynucleotide encoding another polypeptide to a polynucleotide of the present invention. Techniques for producing fusion polypeptides are known in the art, and include ligating the coding sequences encoding the polypeptides so that they are in frame and that expression of the fusion polypeptide is under control of the same promoter(s) and terminator. Fusion polypeptides may also be constructed using intein technology in which fusion polypeptides are created post-translationally (Cooper et al., 1993, EMBO J. 12: 2575-2583; Dawson et al., 1994, Science 266: 776-779).
A fusion polypeptide can further comprise a cleavage site between the two polypeptides.
Upon secretion of the fusion protein, the site is cleaved releasing the two polypeptides. Examples of cleavage sites include, but are not limited to, the sites disclosed in Martin et al., 2003, J. Ind. Microbiol. Biotechnol. 3: 568-576; Svetina et al., 2000, J. Biotechnol. 76: 245-251 ; Rasmussen- Wilson et al., 1997, Appl. Environ. Microbiol. 63: 3488-3493; Ward et al., 1995, Biotechnology 13: 498-503; and Contreras et al., 1991 , Biotechnology 9: 378-381 ; Eaton et al., 1986, Biochemistry 25: 505-512; Collins-Racie et al., 1995, Biotechnology 13: 982-987; Carter et al., 1989, Proteins: Structure, Function, and Genetics 6: 240-248; and Stevens, 2003, Drug Discovery World 4: 35-48.
In another aspect, the parent is a Meripilus giganteus S53 protease, e.g., the protease of SEQ ID NO: 2 or the mature polypeptide thereof, disclosed herein as SEQ ID NO: 3.
Preparation of Variants
The variants can be prepared using any mutagenesis procedure known in the art, such as site-directed mutagenesis, synthetic gene construction, semi-synthetic gene construction, random mutagenesis, shuffling, etc.
Site-directed mutagenesis is a technique in which one or more (e.g., several) mutations are introduced at one or more defined sites in a polynucleotide encoding the parent.
Site-directed mutagenesis can be accomplished in vitro by PCR involving the use of oligonucleotide primers containing the desired mutation. Site-directed mutagenesis can also be performed in vitro by cassette mutagenesis involving the cleavage by a restriction enzyme at a site in the plasmid comprising a polynucleotide encoding the parent and subsequent ligation of an oligonucleotide containing the mutation in the polynucleotide. Usually the restriction enzyme that digests the plasmid and the oligonucleotide is the same, permitting sticky ends of the plasmid and the insert to ligate to one another. See, e.g., Scherer and Davis, 1979, Proc. Natl. Acad. Sci. USA 76: 4949-4955; and Barton et al., 1990, Nucleic Acids Res. 18: 7349-4966.
Site-directed mutagenesis can also be accomplished in vivo by methods known in the art. See, e.g., U.S. Patent Application Publication No. 2004/0171 154; Storici et al., 2001 , Nature Biotechnol. 19: 773-776; Kren et al., 1998, Nat. Med. 4: 285-290; and Calissano and Macino, 1996, Fungal Genet. Newslett. 43: 15-16.
Any site-directed mutagenesis procedure can be used in the present invention. There are many commercial kits available that can be used to prepare variants.
Synthetic gene construction entails in vitro synthesis of a designed polynucleotide molecule to encode a polypeptide of interest. Gene synthesis can be performed utilizing a number of techniques, such as the multiplex microchip-based technology described by Tian et al. (2004, Nature 432: 1050-1054) and similar technologies wherein oligonucleotides are synthesized and assembled upon photo-programmable microfluidic chips.
Single or multiple amino acid substitutions, deletions, and/or insertions can be made and tested using known methods of mutagenesis, recombination, and/or shuffling, followed by a relevant screening procedure, such as those disclosed by Reidhaar-Olson and Sauer, 1988, Science 241 : 53-57; Bowie and Sauer, 1989, Proc. Natl. Acad. Sci. USA 86: 2152-2156; WO 95/17413; or WO 95/22625. Other methods that can be used include error-prone PCR, phage display (e.g., Lowman et al., 1991 , Biochemistry 30: 10832-10837; U.S. Patent No. 5,223,409; WO 92/06204) and region-directed mutagenesis (Derbyshire et al., 1986, Gene 46: 145; Ner ei a/., 1988, DNA 7: 127).
Mutagenesis/shuffling methods can be combined with high-throughput, automated screening methods to detect activity of cloned, mutagenized polypeptides expressed by host cells (Ness et al., 1999, Nature Biotechnology 17: 893-896). Mutagenized DNA molecules that encode active polypeptides can be recovered from the host cells and rapidly sequenced using standard methods in the art. These methods allow the rapid determination of the importance of individual amino acid residues in a polypeptide.
Semi-synthetic gene construction is accomplished by combining aspects of synthetic gene construction, and/or site-directed mutagenesis, and/or random mutagenesis, and/or shuffling. Semi-synthetic construction is typified by a process utilizing polynucleotide fragments that are synthesized, in combination with PCR techniques. Defined regions of genes may thus be synthesized de novo, while other regions may be amplified using site-specific mutagenic primers, while yet other regions may be subjected to error-prone PCR or non-error prone PCR amplification. Polynucleotide subsequences may then be shuffled.
Polynucleotides
The present invention also relates to polynucleotides encoding a variant of the present invention.
Nucleic Acid Constructs
The present invention also relates to nucleic acid constructs comprising a polynucleotide encoding a variant of the present invention operably linked to one or more control sequences that direct the expression of the coding sequence in a suitable host cell under conditions compatible with the control sequences.
The polynucleotide may be manipulated in a variety of ways to provide for expression of a variant. Manipulation of the polynucleotide prior to its insertion into a vector may be desirable or necessary depending on the expression vector. The techniques for modifying polynucleotides utilizing recombinant DNA methods are well known in the art.
The control sequence may be a promoter, a polynucleotide which is recognized by a host cell for expression of the polynucleotide. The promoter contains transcriptional control sequences that mediate the expression of the variant. The promoter may be any polynucleotide that shows transcriptional activity in the host cell including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the host cell.
Examples of suitable promoters for directing transcription of the nucleic acid constructs of the present invention in a filamentous fungal host cell are promoters obtained from the genes for Aspergillus nidulans acetamidase, Aspergillus niger neutral alpha-amylase, Aspergillus niger acid stable alpha-amylase, Aspergillus niger or Aspergillus awamori glucoamylase {glaA), Aspergillus oryzae TAKA amylase, Aspergillus oryzae alkaline protease, Aspergillus oryzae triose phosphate isomerase, Fusarium oxysporum trypsin-like protease (WO 96/00787), Fusarium venenatum amyloglucosidase (WO 00/56900), Fusarium venenatum Daria (WO 00/56900), Fusarium venenatum Quinn (WO 00/56900), Rhizomucor miehei lipase, Rhizomucor miehei aspartic proteinase, Trichoderma reesei beta-glucosidase, Trichoderma reesei cellobiohydrolase I, Trichoderma reesei cellobiohydrolase II, Trichoderma reesei endoglucanase I, Trichoderma reesei endoglucanase II, Trichoderma reesei endoglucanase III, Trichoderma reesei endoglucanase IV, Trichoderma reesei endoglucanase V, Trichoderma reesei xylanase I, Trichoderma reesei xylanase II, Trichoderma reesei beta-xylosidase, as well as the NA2-tpi promoter (a modified promoter from an Aspergillus neutral alpha-amylase gene in which the untranslated leader has been replaced by an untranslated leader from an Aspergillus triose phosphate isomerase gene; non-limiting examples include modified promoters from an Aspergillus niger neutral alpha-amylase gene in which the untranslated leader has been replaced by an untranslated leader from an Aspergillus nidulans or Aspergillus oryzae triose phosphate isomerase gene); and mutant, truncated, and hybrid promoters thereof.
The control sequence may also be a transcription terminator, which is recognized by a host cell to terminate transcription. The terminator sequence is operably linked to the 3'-terminus of the polynucleotide encoding the variant. Any terminator that is functional in the host cell may be used.
Preferred terminators for filamentous fungal host cells are obtained from the genes for Aspergillus nidulans anthranilate synthase, Aspergillus niger glucoamylase, Aspergillus niger alpha-glucosidase, Aspergillus oryzae TAKA amylase, and Fusarium oxysporum trypsin-like protease.
The control sequence may also be an mRNA stabilizer region downstream of a promoter and upstream of the coding sequence of a gene which increases expression of the gene.
The control sequence may also be a leader, a nontranslated region of an mRNA that is important for translation by the host cell. The leader sequence is operably linked to the 5'-terminus of the polynucleotide encoding the variant. Any leader that is functional in the host cell may be used.
Preferred leaders for filamentous fungal host cells are obtained from the genes for Aspergillus oryzae TAKA amylase and Aspergillus nidulans triose phosphate isomerase.
The control sequence may also be a polyadenylation sequence, a sequence operably linked to the 3'-terminus of the variant-encoding sequence and, when transcribed, is recognized by the host cell as a signal to add polyadenosine residues to transcribed mRNA. Any polyadenylation sequence that is functional in the host cell may be used. Preferred polyadenylation sequences for filamentous fungal host cells are obtained from the genes for Aspergillus nidulans anthranilate synthase, Aspergillus niger glucoamylase, Aspergillus niger alpha-glucosidase, Aspergillus oryzae TAKA amylase, and Fusarium oxysporum trypsin-like protease.
The control sequence may also be a signal peptide coding region that encodes a signal peptide linked to the N-terminus of a variant and directs the variant into the cell's secretory pathway. The 5'-end of the coding sequence of the polynucleotide may inherently contain a signal peptide coding sequence naturally linked in translation reading frame with the segment of the coding sequence that encodes the variant. Alternatively, the 5'-end of the coding sequence may contain a signal peptide coding sequence that is foreign to the coding sequence. A foreign signal peptide coding sequence may be required where the coding sequence does not naturally contain a signal peptide coding sequence. Alternatively, a foreign signal peptide coding sequence may simply replace the natural signal peptide coding sequence in order to enhance secretion of the variant. However, any signal peptide coding sequence that directs the expressed variant into the secretory pathway of a host cell may be used.
Effective signal peptide coding sequences for filamentous fungal host cells are the signal peptide coding sequences obtained from the genes for Aspergillus niger neutral amylase, Aspergillus niger glucoamylase, Aspergillus oryzae TAKA amylase, Humicola insolens cellulase, Humicola insolens endoglucanase V, Humicola lanuginosa lipase, and Rhizomucor miehei aspartic proteinase.
The control sequence may also be a propeptide coding sequence that encodes a propeptide positioned at the N-terminus of a variant. The resultant polypeptide is known as a proenzyme or propolypeptide (or a zymogen in some cases). A propolypeptide is generally inactive and can be converted to an active polypeptide by catalytic or autocatalytic cleavage of the propeptide from the propolypeptide. The propeptide coding sequence may be obtained from the genes for Myceliophthora thermophila laccase (WO 95/33836), Rhizomucor miehei aspartic proteinase.
Where both signal peptide and propeptide sequences are present, the propeptide sequence is positioned next to the N-terminus of the variant and the signal peptide sequence is positioned next to the N-terminus of the propeptide sequence.
It may also be desirable to add regulatory sequences that regulate expression of the variant relative to the growth of the host cell. Examples of regulatory systems are those that cause expression of the gene to be turned on or off in response to a chemical or physical stimulus, including the presence of a regulatory compound. Regulatory systems in prokaryotic systems include the lac, tac, and trp operator systems. In yeast, the ADH2 system or GAL1 system may be used. In filamentous fungi, the Aspergillus niger glucoamylase promoter, Aspergillus oryzae TAKA alpha-amylase promoter, and Aspergillus oryzae glucoamylase promoter may be used. Other examples of regulatory sequences are those that allow for gene amplification. In eukaryotic systems, these regulatory sequences include the dihydrofolate reductase gene that is amplified in the presence of methotrexate, and the metallothionein genes that are amplified with heavy metals. In these cases, the polynucleotide encoding the variant would be operably linked with the regulatory sequence.
Expression Vectors
The present invention also relates to recombinant expression vectors comprising a polynucleotide encoding a variant of the present invention, a promoter, and transcriptional and translational stop signals. The various nucleotide and control sequences may be joined together to produce a recombinant expression vector that may include one or more convenient restriction sites to allow for insertion or substitution of the polynucleotide encoding the variant at such sites. Alternatively, the polynucleotide may be expressed by inserting the polynucleotide or a nucleic acid construct comprising the polynucleotide into an appropriate vector for expression. In creating the expression vector, the coding sequence is located in the vector so that the coding sequence is operably linked with the appropriate control sequences for expression.
The recombinant expression vector may be any vector (e.g., a plasmid or virus) that can be conveniently subjected to recombinant DNA procedures and can bring about expression of the polynucleotide. The choice of the vector will typically depend on the compatibility of the vector with the host cell into which the vector is to be introduced. The vector may be a linear or closed circular plasmid.
The vector may be an autonomously replicating vector, i.e., a vector that exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g., a plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome. The vector may contain any means for assuring self-replication. Alternatively, the vector may be one that, when introduced into the host cell, is integrated into the genome and replicated together with the chromosome(s) into which it has been integrated. Furthermore, a single vector or plasmid or two or more vectors or plasmids that together contain the total DNA to be introduced into the genome of the host cell, or a transposon, may be used.
The vector preferably contains one or more selectable markers that permit easy selection of transformed, transfected, transduced, or the like cells. A selectable marker is a gene the product of which provides for biocide or viral resistance, resistance to heavy metals, prototrophy to auxotrophs, and the like.
Selectable markers for use in a filamentous fungal host cell include, but are not limited to, amdS (acetamidase), argB (ornithine carbamoyltransferase), bar (phosphinothricin acetyltransferase), hph (hygromycin phosphotransferase), niaD (nitrate reductase), pyrG (orotidine-5'-phosphate decarboxylase), sC (sulfate adenyltransferase), and trpC (anthranilate synthase), as well as equivalents thereof. Preferred for use in an Aspergillus cell are Aspergillus nidulans or Aspergillus oryzae niaD, niiA, amdS and pyrG genes and a Streptomyces hygroscopicus bar gene.
The vector preferably contains an element(s) that permits integration of the vector into the host cell's genome or autonomous replication of the vector in the cell independent of the genome.
For integration into the host cell genome, the vector may rely on the polynucleotide's sequence encoding the variant or any other element of the vector for integration into the genome by homologous or non-homologous recombination. Alternatively, the vector may contain additional polynucleotides for directing integration by homologous recombination into the genome of the host cell at a precise location(s) in the chromosome(s). To increase the likelihood of integration at a precise location, the integrational elements should contain a sufficient number of nucleic acids, such as 100 to 10,000 base pairs, 400 to 10,000 base pairs, and 800 to 10,000 base pairs, which have a high degree of sequence identity to the corresponding target sequence to enhance the probability of homologous recombination. The integrational elements may be any sequence that is homologous with the target sequence in the genome of the host cell. Furthermore, the integrational elements may be non-encoding or encoding polynucleotides. On the other hand, the vector may be integrated into the genome of the host cell by non-homologous recombination.
For autonomous replication, the vector may further comprise an origin of replication enabling the vector to replicate autonomously in the host cell in question. The origin of replication may be any plasmid replicator mediating autonomous replication that functions in a cell. The term "origin of replication" or "plasmid replicator" means a polynucleotide that enables a plasmid or vector to replicate in vivo.
Examples of origins of replication useful in a filamentous fungal cell are AMA1 and ANSI
(Gems et al., 1991 , Gene 98: 61 -67; Cullen et ai, 1987, Nucleic Acids Res. 15: 9163-9175; WO 00/24883). Isolation of the AMA1 gene and construction of plasmids or vectors comprising the gene can be accomplished according to the methods disclosed in WO 00/24883.
More than one copy of a polynucleotide of the present invention may be inserted into a host cell to increase production of a variant. An increase in the copy number of the polynucleotide can be obtained by integrating at least one additional copy of the sequence into the host cell genome or by including an amplifiable selectable marker gene with the polynucleotide where cells containing amplified copies of the selectable marker gene, and thereby additional copies of the polynucleotide, can be selected for by cultivating the cells in the presence of the appropriate selectable agent. The procedures used to ligate the elements described above to construct the recombinant expression vectors of the present invention are well known to one skilled in the art (see, e.g., Sambrook et al., 1989, supra). Host Cells
The present invention also relates to recombinant host cells, comprising a polynucleotide encoding a variant of the present invention operably linked to one or more control sequences that direct the production of a variant of the present invention. In a particular embodiment, the recombinant host cell comprises the polynucleotide encoding a trehalase polypeptide of the present invention, wherein the said polynucleotide is heterologous (of different origin/species) to the host cell. A construct or vector comprising a polynucleotide is introduced into a host cell so that the construct or vector is maintained as a chromosomal integrant or as a self-replicating extra-chromosomal vector as described earlier. The term "host cell" encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication. The choice of a host cell will to a large extent depend upon the gene encoding the variant and its source.
The host cell may be any cell useful in the recombinant production of a variant, e.g., a prokaryote or a eukaryote.
The host cell may be a fungal cell. "Fungi" as used herein includes the phyla Ascomycota, Basidiomycota, Chytridiomycota, and Zygomycota as well as the Oomycota and all mitosporic fungi (as defined by Hawksworth et al., In, Ainsworth and Bisby's Dictionary of The Fungi, 8th edition, 1995, CAB International, University Press, Cambridge, UK).
The fungal host cell may be a yeast cell. "Yeast" as used herein includes ascosporogenous yeast (Endomycetales), basidiosporogenous yeast, and yeast belonging to the Fungi Imperfecti (Blastomycetes). Since the classification of yeast may change in the future, for the purposes of this invention, yeast shall be defined as described in Biology and Activities of Yeast (Skinner, Passmore, and Davenport, editors, Soc. App. Bacteriol. Symposium Series No. 9, 1980).
The yeast host cell may be a Candida, Hansenula, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces, or Yarrowia cell such as a Kluyveromyces lactis, Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbensis, Saccharomyces oviformis, or Yarrowia lipolytica cell.
The fungal host cell may be a filamentous fungal cell. "Filamentous fungi" include all filamentous forms of the subdivision Eumycota and Oomycota (as defined by Hawksworth et al., 1995, supra). The filamentous fungi are generally characterized by a mycelial wall composed of chitin, cellulose, glucan, chitosan, mannan, and other complex polysaccharides. Vegetative growth is by hyphal elongation and carbon catabolism is obligately aerobic. In contrast, vegetative growth by yeasts such as Saccharomyces cerevisiae is by budding of a unicellular thallus and carbon catabolism may be fermentative.
The filamentous fungal host cell may be an Acremonium, Aspergillus, Aureobasidium, Bjerkandera, Ceriporiopsis, Chrysosporium, Coprinus, Coriolus, Cryptococcus, Filibasidium, Fusarium, Humicola, Magnaporthe, Mucor, Myceliophthora, Neocallimastix, Neurospora, Paecilomyces, Penicillium, Phanerochaete, Phlebia, Piromyces, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolypocladium, Trametes, or Trichoderma cell.
For example, the filamentous fungal host cell may be an Aspergillus awamori, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus japonicus, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Bjerkandera adusta, Ceriporiopsis aneirina, Ceriporiopsis caregiea, Ceriporiopsis gilvescens, Ceriporiopsis pannocinta, Ceriporiopsis rivulosa, Ceriporiopsis subrufa, Ceriporiopsis subvermispora, Chrysosporium inops, Chrysosporium keratinophilum, Chrysosporium lucknowense, Chrysosporium merdarium, Chrysosporium pannicola, Chrysosporium queenslandicum, Chrysosporium tropicum, Chrysosporium zonatum, Coprinus cinereus, Coriolus hirsutus, Fusarium bactridioides, Fusarium cerealis, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium oxysporum, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sporotrichioides, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides, Fusarium venenatum, Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium purpurogenum, Phanerochaete chrysosporium, Phlebia radiata, Pleurotus eryngii, Thielavia terrestris, Trametes villosa, Trametes versicolor, Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei, or Trichoderma viride cell.
Fungal cells may be transformed by a process involving protoplast formation, transformation of the protoplasts, and regeneration of the cell wall in a manner known per se. Suitable procedures for transformation of Aspergillus and Trichoderma host cells are described in EP 238023, Yelton et ai, 1984, Proc. Natl. Acad. Sci. USA 81 : 1470-1474, and Christensen et al., 1988, Bio/Technology 6: 1419-1422. Suitable methods for transforming Fusarium species are described by Malardier et ai, 1989, Gene 78: 147-156, and WO 96/00787. Yeast may be transformed using the procedures described by Becker and Guarente, In Abelson, J.N. and Simon, M.I., editors, Guide to Yeast Genetics and Molecular Biology, Methods in Enzymology, Volume 194, pp 182-187, Academic Press, Inc., New York; Ito et al., 1983, J. Bacteriol. 153: 163; and Hinnen et ai, 1978, Proc. Natl. Acad. Sci. USA 75: 1920. Methods of Production
The present invention also relates to methods of producing a variant, comprising: (a) cultivating a recombinant host cell of the present invention under conditions suitable for expression of the variant; and (b) recovering the variant.
The host cells are cultivated in a nutrient medium suitable for production of the variant using methods known in the art. For example, the cell may be cultivated by shake flask cultivation, or small-scale or large-scale fermentation (including continuous, batch, fed-batch, or solid state fermentations) in laboratory or industrial fermentors performed in a suitable medium and under conditions allowing the variant to be expressed and/or isolated. The cultivation takes place in a suitable nutrient medium comprising carbon and nitrogen sources and inorganic salts, using procedures known in the art. Suitable media are available from commercial suppliers or may be prepared according to published compositions (e.g., in catalogues of the American Type Culture Collection). If the variant is secreted into the nutrient medium, the variant can be recovered directly from the medium. If the variant is not secreted, it can be recovered from cell lysates.
The variant may be detected using methods known in the art that are specific for the variants. These detection methods include, but are not limited to, use of specific antibodies, formation of an enzyme product, or disappearance of an enzyme substrate. For example, an enzyme assay may be used to determine the activity of the variant.
The variant may be recovered using methods known in the art. For example, the variant may be recovered from the nutrient medium by conventional procedures including, but not limited to, collection, centrifugation, filtration, extraction, spray-drying, evaporation, or precipitation.
The variant may be purified by a variety of procedures known in the art including, but not limited to, chromatography (e.g., ion exchange, affinity, hydrophobic, chromatofocusing, and size exclusion), electrophoretic procedures (e.g., preparative isoelectric focusing), differential solubility (e.g., ammonium sulfate precipitation), SDS-PAGE, or extraction (see, e.g., Protein Purification, Janson and Ryden, editors, VCH Publishers, New York, 1989) to obtain substantially pure variants.
In an alternative aspect, the variant is not recovered, but rather a host cell of the present invention expressing the variant is used as a source of the variant.
Enzyme Compositions
The present invention also relates to compositions comprising variant protease of the invention. Preferably, the compositions are enriched in such a protease. The term "enriched" indicates that the pullulanase activity of the composition has been increased, e.g., with an enrichment factor of at least 1 .1. The compositions may comprise the variant S53 protease as the major enzymatic component, e.g., a mono-component composition. Alternatively, the compositions may comprise multiple enzymatic activities, such as the variant S53 protease and one or more (e.g., several) enzymes selected from the group consisting of hydrolase, isomerase, ligase, lyase, oxidoreductase, or transferase, e.g., an alpha-galactosidase, alpha-glucosidase, aminopeptidase, alpha-amylase, beta-amylase, beta-galactosidase, beta-glucosidase, beta- xylosidase, carbohydrase, carboxypeptidase, catalase, cellobiohydrolase, cellulase, chitinase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, endoglucanase, esterase, glucoamylase, invertase, laccase, lipase, mannosidase, mutanase, oxidase, pectinolytic enzyme, peroxidase, phytase, polyphenoloxidase, protease, ribonuclease, transglutaminase, or xylanase. In one embodiment the composition comprises a variant S53 protease of the invention and a carbohydrate-source generating enzyme and optionally an alpha-amylase. In one particular embodiment the composition comprises a variant S53 protease and a glucoamylase. Preferably the enzyme activities comprised in the composition are selected from the variant S53 protease of the invention and one or more enzymes selected from the group consisting of glucoamylase, fungal alpha-amylase.
In an embodiment the glucoamylase comprised in the composition is of fungal origin, preferably from a stain of Aspergillus, preferably A. niger, A. awamori, or A. oryzae; or a strain of Trichoderma, preferably T. reesei; or a strain of Talaromyces, preferably T. emersonii or a strain of Trametes, preferably T. cingulata, or a strain of Pycnoporus, preferable P. sanguineus, or a strain of Gloeophyllum, such as G. serpiarium or G. trabeum, or a strain of the Nigrofomes.
In an embodiment the glucoamylase is derived from Trametes, such as a strain of Trametes cingulata, such as the one shown in SEQ ID NO: 4 herein.
In an embodiment the glucoamylase is selected from the group consisting of:
(i) a glucoamylase comprising the polypeptide of SEQ ID NO: 4 herein;
(ii) a glucoamylase comprising an amino acid sequence having at least 60%, at least 70%, e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the polypeptide of SEQ ID NO: 4 herein.
In an embodiment the glucoamylase is derived from Talaromyces, such as a strain of
Talaromyces emersonii, such as the one shown in SEQ ID NO: 5 herein.
In an embodiment the glucoamylase is selected from the group consisting of:
(i) a glucoamylase comprising the polypeptide of SEQ ID NO: 5 herein;
(ii) a glucoamylase comprising an amino acid sequence having at least 60%, at least 70%, e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the polypeptide of SEQ ID NO: 5 herein.
In an embodiment the glucoamylase is derived from a strain of the genus Pycnoporus, in particular a strain of Pycnoporus sanguineus described in WO 201 1/066576 (SEQ ID NOs 2, 4 or 6), such as the one shown as SEQ ID NO: 4 in WO 201 1/066576.
In an embodiment the glucoamylase is selected from the group consisting of:
(i) a glucoamylase comprising the polypeptide of SEQ ID NO: 6 herein;
(ii) a glucoamylase comprising an amino acid sequence having at least 60%, at least 70%, e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at SEQ ID NO: 6 herein.
In an embodiment the glucoamylase is derived from a strain of the genus Gloeophyllum, such as a strain of Gloeophyllum sepiarium or Gloeophyllum trabeum, in particular a strain of Gloeophyllum as described in WO 201 1/068803 (SEQ ID NO: 2, 4, 6, 8, 10, 12, 14 or 16). In a preferred embodiment the glucoamylase is the Gloeophyllum sepiarium shown in SEQ ID NO: 2 in WO 201 1/068803 or SEQ ID NO: 7 herein.
In an embodiment the glucoamylase is derived from Gloeophyllum serpiarium, such as the one shown in SEQ ID NO: 7 herein. In an embodiment the glucoamylase is selected from the group consisting of:
(i) a glucoamylase comprising the polypeptide of SEQ ID NO: 7 herein;
(ii) a glucoamylase comprising an amino acid sequence having at least 60%, at least 70%, e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least
93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the polypeptide of SEQ ID NO: 7 herein.
In another embodiment the glucoamylase is derived from Gloeophyllum trabeum such as the one shown in SEQ ID NO: 8 herein. In an embodiment the glucoamylase is selected from the group consisting of:
(i) a glucoamylase comprising the polypeptide of SEQ ID NO: 8 herein;
(ii) a glucoamylase comprising an amino acid sequence having at least 60%, at least 70%, e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the polypeptide of SEQ ID NO: 8 herein.
In an embodiment the glucoamylase is derived from a strain of the genus Nigrofomes, in particular a strain of Nigrofomes sp. disclosed in WO 2012/064351.
Glucoamylases may in an embodiment be added to the saccharification and/or fermentation in an amount of 0.0001 -20 AGU/g DS, preferably 0.001 -10 AGU/g DS, especially between 0.01 -5 AGU/g DS, such as 0.1 -2 AGU/g DS. Commercially available compositions comprising glucoamylase include AMG 200L; AMG 300 L; SAN™ SUPER, SAN™ EXTRA L, SPIRIZYME™ PLUS, SPIRIZYME™ FUEL, SPIRIZYME™ B4U, SPIRIZYME™ ULTRA, SPIRIZYME™ EXCEL and AMG™ E (from Novozymes MS); OPTIDEX™ 300, GC480, GC417 (from DuPont); AMIGASE™ and AMIGASE™ PLUS (from DSM); G-ZYME™ G900, G-ZYME™ and G990 ZR (from DuPont).
In addition to a glucoamylase the composition may further comprise an alpha-amylase. Particularly the alpha-amylase is an acid fungal alpha-amylase. A fungal acid stable alpha- amylase is an alpha-amylase that has activity in the pH range of 3.0 to 7.0 and preferably in the pH range from 3.5 to 6.5, including activity at a pH of about 4.0, 4.5, 5.0, 5.5, and 6.0.
Preferably the acid fungal alpha-amylase is derived from the genus Aspergillus, especially a strain of A. terreus, A. niger, A. oryzae, A. awamori, or Aspergillus kawachii, or from the genus Rhizomucor, preferably a strain the Rhizomucor pusillus, or the genus Meripilus, preferably a strain of Meripilus giganteus.
In a preferred embodiment the alpha-amylase is derived from a strain of the genus Rhizomucor, preferably a strain the Rhizomucor pusillus, such as one shown in SEQ ID NO: 3 in WO 2013/006756, such as a Rhizomucor pusillus alpha-amylase hybrid having an Aspergillus niger linker and starch-binding domain, such as the one shown in SEQ ID NO: 9 herein, or a variant thereof.
In an embodiment the alpha-amylase is selected from the group consisting of:
(i) an alpha-amylase comprising the polypeptide of SEQ ID NO: 9 herein;
(ii) an alpha-amylase comprising an amino acid sequence having at least 60%, at least 70%, e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the polypeptide of SEQ ID NO: 9 herein.
In a preferred embodiment the alpha-amylase is a variant of the alpha-amylase shown in SEQ ID NO: 9 having at least one of the following substitutions or combinations of substitutions: D165M; Y141W; Y141 R; K136F; K192R; P224A; P224R; S123H + Y141W; G20S + Y141W; A76G + Y141W; G128D + Y141W; G128D + D143N; P219C + Y141W; N142D + D143N; Y141 W + K192R; Y141W + D143N; Y141W + N383R; Y141W + P219C + A265C; Y141 W + N142D + D143N; Y141 W + K192R V410A; G128D + Y141W + D143N; Y141W + D143N + P219C; Y141W + D143N + K192R; G128D + D143N + K192R; Y141W + D143N + K192R + P219C; G128D + Y141 W + D143N + K192R; or G128D + Y141 W + D143N + K192R + P219C (using SEQ ID NO: 9 for numbering).
In an embodiment the alpha-amylase is derived from a Rhizomucor pusillus with an Aspergillus niger glucoamylase linker and starch-binding domain (SBD), preferably disclosed as SEQ ID NO: 9 herein, preferably having one or more of the following substitutions: G128D, D143N, preferably G128D+D143N (using SEQ ID NO: 9 for numbering), and wherein the alpha- amylase variant has at least 75% identity preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 91 %, more preferably at least 92%, even more preferably at least 93%, most preferably at least 94%, and even most preferably at least 95%, such as even at least 96%, at least 97%, at least 98%, at least 99%, but less than 100% identity to the polypeptide of SEQ ID NO: 9 herein.
In a preferred embodiment the ratio between glucoamylase and alpha-amylase present and/or added during saccharification and/or fermentation may preferably be in the range from 500:1 to 1 :1 , such as from 250:1 to 1 :1 , such as from 100:1 to 1 : 1 , such as from 100: 2 to 100:50, such as from 100:3 to 100:70.
The compositions may be prepared in accordance with methods known in the art and may be in the form of a liquid or a dry composition. For instance, the composition may be in the form of granulate or microgranulate. The variant may be stabilized in accordance with methods known in the art.
The compositions may be prepared in accordance with methods known in the art and may be in the form of a liquid or a dry composition. The compositions may be stabilized in accordance with methods known in the art.
The enzyme composition of the present invention may be in any form suitable for use, such as, for example, a crude fermentation broth with or without cells removed, a cell lysate with or without cellular debris, a semi-purified or purified enzyme composition, or a host cell, as a source of the enzymes.
The enzyme composition may be a dry powder or granulate, a non-dusting granulate, a liquid, a stabilized liquid, or a stabilized protected enzyme. Liquid enzyme compositions may, for instance, be stabilized by adding stabilizers such as a sugar, a sugar alcohol or another polyol, and/or lactic acid or another organic acid according to established processes.
Use of the variant proteases of the invention
Starch Processing
Native starch consists of microscopic granules, which are insoluble in water at room temperature. When aqueous starch slurry is heated, the granules swell and eventually burst, dispersing the starch molecules into the solution. At temperatures up to about 50°C to 75°C the swelling may be reversible. However, with higher temperatures an irreversible swelling called "gelatinization" begins. During this "gelatinization" process there is a dramatic increase in viscosity. Granular starch to be processed may be a highly refined starch quality, preferably at least 90%, at least 95%, at least 97% or at least 99.5% pure or it may be a more crude starch- containing materials comprising (e.g., milled) whole grains including non-starch fractions such as germ residues and fibers. The raw material, such as whole grains, may be reduced in particle size, e.g., by milling, in order to open up the structure and allowing for further processing. In dry milling whole kernels are milled and used. Wet milling gives a good separation of germ and meal (starch granules and protein) and is often applied at locations where the starch hydrolysate is used in the production of, e.g., syrups. Both dry and wet milling is well known in the art of starch processing and may be used in a process of the invention. Methods for reducing the particle size of the starch containing material are well known to those skilled in the art.
As the solids level is 30-40% in a typical industrial process, the starch has to be thinned or "liquefied" so that it can be suitably processed. This reduction in viscosity is primarily attained by enzymatic degradation in current commercial practice.
Liquefaction is carried out in the presence of an alpha-amylase, preferably a bacterial alpha-amylase and/or acid fungal alpha-amylase. In an embodiment, a phytase is also present during liquefaction. In an embodiment, viscosity reducing enzymes such as a xylanase and/or beta-glucanase is also present during liquefaction.
During liquefaction, the long-chained starch is degraded into branched and linear shorter units (maltodextrins) by an alpha-amylase. Liquefaction may be carried out as a three- step hot slurry process. The slurry is heated to between 60-95°C (e.g., 70-90°C, such as 77- 86°C, 80-85°C, 83-85°C) and an alpha-amylase is added to initiate liquefaction (thinning).
The slurry may in an embodiment be jet-cooked at between 95-140°C, e.g., 105-125°C, for about 1 -15 minutes, e.g., about 3-10 minutes, especially around 5 minutes. The slurry is then cooled to 60-95°C and more alpha-amylase is added to obtain final hydrolysis (secondary liquefaction). The jet-cooking process is carried out at pH 4.5-6.5, typically at a pH between 5 and 6. The alpha-amylase may be added as a single dose, e.g., before jet cooking.
The liquefaction process is carried out at between 70-95°C, such as 80-90°C, such as around 85°C, for about 10 minutes to 5 hours, typically for 1 -2 hours. The pH is between 4 and 7, such as between 4.5 and 5.5. In order to ensure optimal enzyme stability under these conditions, calcium may optionally be added (to provide 1 -60 ppm free calcium ions, such as about 40 ppm free calcium ions). After such treatment, the liquefied starch will typically have a "dextrose equivalent" (DE) of 10-15.
Generally liquefaction and liquefaction conditions are well known in the art.
Alpha-amylases for use in liquefaction are preferably bacterial acid stable alpha- amylases. Particularly the alpha-amylase is from an Exiguobacterium sp. or a Bacillus sp. such as e.g., Bacillus stearothermophilus or Bacillus lichen iformis.
In an embodiment the alpha-amylase is from the genus Bacillus, such as a strain of Bacillus stearothermophilus, in particular a variant of a Bacillus stearothermophilus alpha- amylase, such as the one shown in SEQ ID NO: 3 in WO 99/019467 or SEQ ID NO: 10 herein.
In an embodiment the Bacillus stearothermophilus alpha-amylase has a double deletion of two amino acids in the region from position 179 to 182, more particularly a double deletion at positions 1181 + G182, R179 + G180, G180 + 1181 , R179 + 1181 , or G180 + G182, preferably 1181 + G182, and optionally a N193F substitution, (using SEQ ID NO: 10 for numbering).
In an embodiment the Bacillus stearothermophilus alpha-amylase has a substitution at position S242, preferably S242Q substitution.
In an embodiment the Bacillus stearothermophilus alpha-amylase has a substitution at position E188, preferably E188P substitution.
In an embodiment the alpha-amylase is selected from the group of Bacillus stearothermophilus alpha-amylase variants with the following mutations:
- I 181 *+G182*+N193F+E129V+K177L+R179E;
- 1181 * +G182*+N 193F+V59A+Q89R+E129V+K177L+R179E+H208Y+K220P+N224L
+Q254S;
- I 181 *+G182*+N 193F +V59A Q89R+ E129V+ K177L+ R179E+ Q254S+ M284V; and
- I 181 *+G182*+N 193F+E129V+K177L+R179E+K220P+N224L+S242Q+Q254S (using SEQ ID NO: 10 for numbering).
In an embodiment the alpha-amylase variant has at least 75% identity preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 91 %, more preferably at least 92%, even more preferably at least 93%, most preferably at least 94%, and even most preferably at least 95%, such as even at least 96%, at least 97%, at least 98%, at least 99%, but less than 100% identity to the polypeptide of SEQ ID NO: 10.
It should be understood that when referring to Bacillus stearothermophilus alpha- amylase and variants thereof they are normally produced in truncated form. In particular, the truncation may be so that the Bacillus stearothermophilus alpha-amylase shown in SEQ ID NO: 3 in WO 99/19467 or SEQ ID NO: 10 herein, or variants thereof, are truncated in the C- terminal preferably to have around 490 amino acids, such as from 482-493 amino acids. Preferably the Bacillus stearothermophilus variant alpha-amylase is truncated, preferably after position 484 of SEQ ID NO: 10, particularly after position 485, particularly after position 486, particularly after position 487, particularly after position 488, particularly after position 489, particularly after position 490, particularly after position 491 , particularly after position 492, more particularly after position 493.
Saccharification may be carried out using conditions well-known in the art with a carbohydrate-source generating enzyme, in particular a glucoamylase, or a beta-amylase and optionally a debranching enzyme, such as an isoamylase or a pullulanase. For instance, a full saccharification step may last from about 24 to about 72 hours. However, it is common to do a pre-saccharification of typically 40-90 minutes at a temperature between 30-65°C, typically about 60°C, followed by complete saccharification during fermentation in a simultaneous saccharification and fermentation (SSF) process. Saccharification is typically carried out at a temperature in the range of 20-75°C, e.g., 25-65°C and 40-70°C, typically around 60°C, and at a pH between about 4 and 5, normally at about pH 4.5.
The saccharification and fermentation steps may be carried out either sequentially or simultaneously. In an embodiment, saccharification and fermentation are performed simultaneously (referred to as "SSF"). However, it is common to perform a pre-saccharification step for about 30 minutes to 2 hours (e.g., 30 to 90 minutes) at a temperature of 30 to 65°C, typically around 60°C which is followed by a complete saccharification during fermentation referred to as simultaneous saccharification and fermentation (SSF). The pH is usually between 4.2-4.8, e.g., pH 4.5. In a simultaneous saccharification and fermentation (SSF) process, there is no holding stage for saccharification, rather, the yeast and enzymes are added together.
In a typical saccharification process, maltodextrins produced during liquefaction are converted into dextrose by adding a glucoamylase and a debranching enzyme, such as an isoamylase (U.S. Patent No. 4,335,208) or a pullulanase. The temperature is lowered to 60°C, prior to the addition of the glucoamylase and debranching enzyme. The saccharification process proceeds for 24-72 hours. Prior to addition of the saccharifying enzymes, the pH is reduced to below 4.5, while maintaining a high temperature (above 95°C), to inactivate the liquefying alpha- amylase. This process reduces the formation of short oligosaccharide called "panose precursors," which cannot be hydrolyzed properly by the debranching enzyme. Normally, about 0.2-0.5% of the saccharification product is the branched trisaccharide panose (Glc pa1 -6Glc pa1 -4Glc), which cannot be degraded by a pullulanase. If active amylase from the liquefaction remains present during saccharification (i.e., no denaturing), the amount of panose can be as high as 1 -2%, which is highly undesirable since it lowers the saccharification yield significantly.
Other fermentation products may be fermented at conditions and temperatures well known to persons skilled in the art, suitable for the fermenting organism in question.
The fermentation product may be recovered by methods well known in the art, e.g., by distillation. Examples of carbohydrate-source generating enzymes are disclosed in the "Enzymes" section below.
In a particular embodiment, the process of the invention further comprises, prior to the conversion of a starch-containing material to sugars/dextrins the steps of:
(x) reducing the particle size of the starch-containing material; and
(y) forming a slurry comprising the starch-containing material and water.
In an embodiment, the starch-containing material is milled to reduce the particle size. In an embodiment the particle size is reduced to between 0.05-3.0 mm, preferably 0.1 -0.5 mm, or so that at least 30%, preferably at least 50%, more preferably at least 70%, even more preferably at least 90% of the starch-containing material fits through a sieve with a 0.05-3.0 mm screen, preferably 0.1 -0.5 mm screen. The aqueous slurry may contain from 10-55 wt. % dry solids (DS), preferably 25-45 wt. % dry solids (DS), more preferably 30-40 wt. % dry solids (DS) of starch-containing material.
Conventional starch-conversion processes, such as liquefaction and saccharification processes are described, e.g., in U.S. Patent No. 3,912,590, EP 252730 and EP 063909, which are incorporated herein by reference.
In an embodiment, the conversion process degrading starch to lower molecular weight carbohydrate components such as sugars or fat replacers includes a debranching step.
In the case of converting starch into a sugar, the starch is depolymerized. Such a depolymerization process consists of, e.g., a pre-treatment step and two or three consecutive process steps, i.e., a liquefaction process, a saccharification process, and depending on the desired end-product, an optional isomerization process.
When the desired final sugar product is, e.g., high fructose syrup the dextrose syrup may be converted into fructose. After the saccharification process, the pH is increased to a value in the range of 6-8, e.g., pH 7.5, and the calcium is removed by ion exchange. The dextrose syrup is then converted into high fructose syrup using, e.g., an immobilized glucose isomerase. Production of Fermentation Products
Fermentable sugars (e.g., dextrins, monosaccharides, particularly glucose) are produced from enzymatic saccharification. These fermentable sugars may be further purified and/or converted to useful sugar products. In addition, the sugars may be used as a fermentation feedstock in a microbial fermentation process for producing end-products, such as alcohol (e.g., ethanol, and butanol), organic acids (e.g., succinic acid, 3-HP and lactic acid), sugar alcohols (e.g., glycerol), ascorbic acid intermediates (e.g., gluconate, 2-keto-D-gluconate, 2,5-diketo-D-gluconate, and 2- keto-L-gulonic acid), amino acids (e.g., lysine), proteins (e.g., antibodies and fragment thereof).
In an embodiment, the fermentable sugars obtained during the liquefaction process steps are used to produce alcohol and particularly ethanol. In ethanol production, an SSF process is commonly used wherein the saccharifying enzymes and fermenting organisms (e.g., yeast) are added together and then carried out at a temperature of 30-40°C.
The organism used in fermentation will depend on the desired end-product. Typically, if ethanol is the desired end product yeast will be used as the fermenting organism. In some preferred embodiments, the ethanol-producing microorganism is a yeast and specifically Saccharomyces such as strains of S. cerevisiae (U.S. Patent No. 4,316,956). A variety of S. cerevisiae are commercially available and these include but are not limited to FALI (Fleischmann's Yeast), SUPERSTART (Alltech), FERMIOL (DSM Specialties), RED STAR (Lesaffre) and Angel alcohol yeast (Angel Yeast Company, China). The amount of starter yeast employed in the methods is an amount effective to produce a commercially significant amount of ethanol in a suitable amount of time, (e.g., to produce at least 10% ethanol from a substrate having between 25-40% DS in less than 72 hours). Yeast cells are generally supplied in amounts of about 104 to about 1012, and preferably from about 107 to about 1010 viable yeast count per mL of fermentation broth. After yeast is added to the mash, it is typically subjected to fermentation for about 24-96 hours, e.g., 35-60 hours. The temperature is between about 26- 34°C, typically at about 32°C, and the pH is from pH 3-6, e.g., around pH 4-5.
The fermentation may include, in addition to a fermenting microorganisms (e.g., yeast), nutrients, and additional enzymes, including phytases. The use of yeast in fermentation is well known in the art.
In further embodiments, use of appropriate fermenting microorganisms, as is known in the art, can result in fermentation end product including, e.g., glycerol, 1 ,3-propanediol, gluconate, 2-keto-D-gluconate, 2,5-diketo-D-gluconate, 2-keto-L-gulonic acid, succinic acid, lactic acid, amino acids, and derivatives thereof. More specifically when lactic acid is the desired end product, a Lactobacillus sp. (L case/') may be used; when glycerol or 1 ,3-propanediol are the desired end-products E. coli may be used; and when 2-keto-D-gluconate, 2,5-diketo-D- gluconate, and 2-keto-L-gulonic acid are the desired end products, Pantoea citrea may be used as the fermenting microorganism. The above enumerated list are only examples and one skilled in the art will be aware of a number of fermenting microorganisms that may be used to obtain a desired end product.
Processes for producing fermentation products from un-gelatinized starch-containing material The invention relates to processes for producing fermentation products from starch-containing material without gelatinization (i.e., without cooking) of the starch-containing material (often referred to as a "raw starch hydrolysis" process). The fermentation product, such as ethanol, can be produced without liquefying the aqueous slurry containing the starch-containing material and water. In one embodiment a process of the invention includes saccharifying (e.g., milled) starch- containing material, e.g., granular starch, below the initial gelatinization temperature, preferably in the presence of alpha-amylase and/or carbohydrate-source generating enzyme(s) to produce sugars that can be fermented into the fermentation product by a suitable fermenting organism. In this embodiment the desired fermentation product, e.g., ethanol, is produced from un- gelatinized (i.e., uncooked), preferably milled, cereal grains, such as corn.
Accordingly, in one aspect the invention relates to processes for producing a fermentation product from starch-containing material comprising simultaneously saccharifying and fermenting starch-containing material using a carbohydrate-source generating enzymes and a fermenting organism at a temperature below the initial gelatinization temperature of said starch-containing material in the presence of a variant protease of the invention. Saccharification and fermentation may also be separate. Thus in another aspect the invention relates to processes of producing fermentation products, comprising the following steps: (i) saccharifying a starch-containing material at a temperature below the initial gelatinization temperature using a carbohydrate-source generating enzyme, e.g., a glucoamylase; and
(ii) fermenting using a fermentation organism;
wherein step (i) is carried out using at least a glucoamylase, and a variant protease of the invention.
In one embodiment the fermenting organism expresses the variant protease of the invention. In one embodiment, an alpha amylase is also added in step (i). Steps (i) and (ii) may be performed simultaneously.
The fermentation product, e.g., ethanol, may optionally be recovered afterfermentation, e.g., by distillation. Typically amylase(s), such as glucoamylase(s) and/or other carbohydrate- source generating enzymes, and/or alpha-amylase(s), is(are) present during fermentation. Examples of glucoamylases and other carbohydrate-source generating enzymes include raw starch hydrolyzing glucoamylases. Examples of alpha-amylase(s) include acid alpha-amylases such as acid fungal alpha-amylases. Examples of fermenting organisms include yeast, e.g., a strain of Saccharomyces cerevisiae. The term "initial gelatinization temperature" means the lowest temperature at which starch gelatinization commences. In general, starch heated in water begins to gelatinize between about 50°C and 75°C; the exact temperature of gelatinization depends on the specific starch and can readily be determined by the skilled artisan. Thus, the initial gelatinization temperature may vary according to the plant species, to the particular variety of the plant species as well as with the growth conditions. In the context of this invention the initial gelatinization temperature of a given starch-containing material may be determined as the temperature at which birefringence is lost in 5% of the starch granules using the method described by Gorinstein and Lii, 1992, Starch/Starke 44(12): 461 -466. Before initiating the process a slurry of starch-containing material, such as granular starch, having 10-55 w/w % dry solids (DS), preferably 25-45 w/w % dry solids, more preferably 30-40 w/w % dry solids of starch- containing material may be prepared. The slurry may include water and/or process waters, such as stillage (backset), scrubber water, evaporator condensate or distillate, side-stripper water from distillation, or process water from other fermentation product plants. Because the process of the invention is carried out below the initial gelatinization temperature, and thus no significant viscosity increase takes place, high levels of stillage may be used if desired. In an embodiment the aqueous slurry contains from about 1 to about 70 vol. %, preferably 15-60 vol. %, especially from about 30 to 50 vol. % water and/or process waters, such as stillage (backset), scrubber water, evaporator condensate or distillate, side-stripper water from distillation, or process water from other fermentation product plants, or combinations thereof, or the like. The starch- containing material may be prepared by reducing the particle size, preferably by dry or wet milling, to 0.05 to 3.0 mm, preferably 0.1 -0.5 mm. After being subjected to a process of the invention at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or preferably at least 99% of the dry solids in the starch-containing material are converted into a soluble starch hydrolyzate. A process in this aspect of the invention is conducted at a temperature below the initial gelatinization temperature, which means that the temperature typically lies in the range between 30-75°C, preferably between 45-60°C. In a preferred embodiment the process carried at a temperature from 25°C to 40°C, such as from 28°C to 35°C, such as from 30°C to 34°C, preferably around 32°C. In an embodiment the process is carried out so that the sugar level, such as glucose level, is kept at a low level, such as below 6 w/w %, such as below about 3 w/w %, such as below about 2 w/w %, such as below about 1 w/w %., such as below about 0.5 w/w %, or below 0.25 w/w %, such as below about 0.1 w/w %. Such low levels of sugar can be accomplished by simply employing adjusted quantities of enzyme and fermenting organism. A skilled person in the art can easily determine which doses/quantities of enzyme and fermenting organism to use. The employed quantities of enzyme and fermenting organism may also be selected to maintain low concentrations of maltose in the fermentation broth. For instance, the maltose level may be kept below about 0.5 w/w %, such as below about 0.2 w/w %. The process of the invention may be carried out at a pH from about 3 and 7, preferably from pH 3.5 to 6, or more preferably from pH 4 to 5. In an embodiment fermentation is ongoing for 6 to 120 hours, in particular 24 to 96 hours.
Processes for producing fermentation products from gelatinized starch-containing material
In this aspect, the invention relates to processes for producing fermentation products, especially ethanol, from starch-containing material, which process includes a liquefaction step and sequentially or simultaneously performed saccharification and fermentation steps. Consequently, the invention relates to a process for producing a fermentation product from starch-containing material comprising the steps of:
(a) liquefying starch-containing material in the presence of an alpha-amylase; (b) saccharifying the liquefied material obtained in step (a) using a carbohydrate- source generating enzyme;
(c) fermenting using a fermenting organism;
wherein a variant protease of the invention is present during step b) and/or c). In one embodiment, the fermenting organism expresses the variant protease of the invention. The fermentation product, such as especially ethanol, may optionally be recovered after fermentation, e.g., by distillation. The fermenting organism is preferably yeast, preferably a strain of Saccharomyces cerevisiae. In a particular embodiment, the process of the invention further comprises, prior to step (a), the steps of:
x) reducing the particle size of the starch-containing material, preferably by milling (e.g., using a hammer mill);
y) forming a slurry comprising the starch-containing material and water.
In an embodiment, the particle size is smaller than a # 7 screen, e.g., a # 6 screen. A # 7 screen is usually used in conventional prior art processes. The aqueous slurry may contain from 10-55, e.g., 25-45 and 30-40, w/w % dry solids (DS) of starch-containing material. The slurry is heated to above the gelatinization temperature and an alpha-amylase variant may be added to initiate liquefaction (thinning). The slurry may in an embodiment be jet-cooked to further gelatinize the slurry before being subjected to alpha-amylase in step (a). Liquefaction may in an embodiment be carried out as a three-step hot slurry process. The slurry is heated to between 60-95°C, preferably between 70-90°C, such as preferably between 80-85°Cat pH 4-6, preferably 4.5-5.5, and alpha-amylase variant, optionally together with a pullulanase and/or protease, preferably metalloprotease, are added to initiate liquefaction (thinning). In an embodiment the slurry may then be jet-cooked at a temperature between 95-140°C, preferably 100-135°C, such as 105-125°C, for about 1 -15 minutes, preferably for about 3-10 minutes, especially around about 5 minutes. The slurry is cooled to 60-95°C and more alpha-amylase variant and optionally pullulanase variant and/or protease, preferably metalloprotease, is(are) added to finalize hydrolysis (secondary liquefaction). The liquefaction process is usually carried out at pH 4.0-6, in particular at a pH from 4.5 to 5.5. Saccharification step (b) may be carried out using conditions well known in the art. For instance, a full saccharification process may last up to from about 24 to about 72 hours, however, it is common only to do a pre-saccharification of typically 40-90 minutes at a temperature between 30-65°C, typically about 60°C, followed by complete saccharification during fermentation in a simultaneous saccharification and fermentation process (SSF process). Saccharification is typically carried out at temperatures from 20-75°C, preferably from 40-70°C, typically around 60°C, and at a pH between 4 and 5, normally at about pH 4.5. The most widely used process to produce a fermentation product, especially ethanol, is a simultaneous saccharification and fermentation (SSF) process, in which there is no holding stage for the saccharification, meaning that a fermenting organism, such as yeast, and enzyme(s), may be added together. SSF may typically be carried out at a temperature from 25°C to 40°C, such as from 28°C to 35°C, such as from 30°C to 34°C, preferably around about 32°C. In an embodiment fermentation is ongoing for 6 to 120 hours, in particular 24 to 96 hours.
Glucoamylase Present And/Or Added In Saccharification And/Or Fermentation The carbohydrate-source generating enzyme present during saccharification may in one embodiment be a glucoamylase. A glucoamylase is present and/or added in saccharification and/or fermentation, preferably simultaneous saccharification and fermentation (SSF), in a process of the invention (i.e., saccharification and fermentation of ungelatinized or gelatinized starch material).
In an embodiment the glucoamylase present and/or added in saccharification and/or fermentation is of fungal origin, preferably from a stain of Aspergillus, preferably A. niger, A. awamori, or A. oryzae; or a strain of Trichoderma, preferably T. reeser', or a strain of Talaromyces, preferably T. emersonii or a strain of Trametes, preferably T. cingulata, or a strain of Pycnoporus, preferably P. sanguineus, or a strain of Gloeophyllum, such as G. serpiarium or G. trabeum, or a strain of the Nigrofomes.
In an embodiment the glucoamylase is derived from Trametes, such as a strain of Trametes cingulata, such as the one shown in SEQ ID NO: 4 herein.
In an embodiment the glucoamylase is selected from the group consisting of:
(i) a glucoamylase comprising the polypeptide of SEQ ID NO: 4 herein;
(ii) a glucoamylase comprising an amino acid sequence having at least 60%, at least 70%, e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the polypeptide of SEQ ID NO: 4 herein.
In an embodiment the glucoamylase is derived from Talaromyces, such as a strain of Talaromyces emersonii, such as the one shown in SEQ ID NO: 5 herein.
In an embodiment the glucoamylase is selected from the group consisting of:
(i) a glucoamylase comprising the polypeptide of SEQ ID NO: 5 herein;
(ii) a glucoamylase comprising an amino acid sequence having at least 60%, at least 70%, e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the polypeptide of SEQ ID NO: 5 herein.
In an embodiment the glucoamylase is derived from a strain of the genus Pycnoporus, in particular a strain of Pycnoporus sanguineus described in WO 201 1/066576 (SEQ ID NOs 2, 4 or 6), such as the one shown as SEQ ID NO: 4 in WO 201 1/066576.
In an embodiment the glucoamylase is selected from the group consisting of:
(i) a glucoamylase comprising the polypeptide of SEQ ID NO: 6 herein; (ii) a glucoamylase comprising an amino acid sequence having at least 60%, at least 70%, e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at 6 herein. In an embodiment the glucoamylase is derived from a strain of the genus Gloeophyllum, such as a strain of Gloeophyllum sepiarium or Gloeophyllum trabeum, in particular a strain of Gloeophyllum as described in WO 201 1/068803 (SEQ ID NO: 2, 4, 6, 8, 10, 12, 14 or 16). In a preferred embodiment the glucoamylase is the Gloeophyllum sepiarium shown in SEQ ID NO: 2 in WO 201 1/068803 or SEQ ID NO: 7 herein.
In an embodiment the glucoamylase is derived from Gloeophyllum serpiarium, such as the one shown in SEQ ID NO: 7 herein. In an embodiment the glucoamylase is selected from the group consisting of:
(i) a glucoamylase comprising the polypeptide of SEQ ID NO: 7 herein;
(ii) a glucoamylase comprising an amino acid sequence having at least 60%, at least 70%, e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the polypeptide of SEQ ID NO: 7 herein. In another embodiment the glucoamylase is derived from Gloeophyllum trabeum such as the one shown in SEQ ID NO: 8 herein. In an embodiment the glucoamylase is selected from the group consisting of:
(i) a glucoamylase comprising the polypeptide of SEQ ID NO: 8 herein;
(ii) a glucoamylase comprising an amino acid sequence having at least 60%, at least 70%, e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 91 %, at least
92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the polypeptide of SEQ ID NO: 8 herein.
In an embodiment the glucoamylase is derived from a strain of the genus Nigrofomes, in particular a strain of Nigrofomes sp. disclosed in WO 2012/064351.
Glucoamylases may in an embodiment be added to the saccharification and/or fermentation in an amount of 0.0001 -20 AGU/g DS, preferably 0.001 -10 AGU/g DS, especially between 0.01 -5 AGU/g DS, such as 0.1 -2 AGU/g DS.
Commercially available compositions comprising glucoamylase include AMG 200L; AMG 300 L; SAN™ SUPER, SAN™ EXTRA L, SPIRIZYME™ PLUS, SPIRIZYME™ FUEL, SPIRIZYME™ B4U, SPIRIZYME™ ULTRA, SPIRIZYME™ EXCEL and AMG™ E (from Novozymes MS); OPTIDEX™ 300, GC480, GC417 (from DuPont); AMIGASE™ and AMIGASE™ PLUS (from DSM); G-ZYME™ G900, G-ZYME™ and G990 ZR (from DuPont). According to a preferred embodiment of the invention the glucoamylase is present and/or added in saccharification and/or fermentation in combination with an alpha-amylase. Examples of suitable alpha-amylase are described below.
Alpha-Amylase Present and/or Added In Saccharification And/Or Fermentation
In an embodiment an alpha-amylase is present and/or added in saccharification and/or fermentation in the processes of the invention. In a preferred embodiment the alpha-amylase is of fungal or bacterial origin. In a preferred embodiment the alpha-amylase is a fungal acid stable alpha-amylase. A fungal acid stable alpha-amylase is an alpha-amylase that has activity in the pH range of 3.0 to 7.0 and preferably in the pH range from 3.5 to 6.5, including activity at a pH of about 4.0, 4.5, 5.0, 5.5, and 6.0.
In a preferred embodiment the alpha-amylase present and/or added in saccharification and/or fermentation is derived from a strain of the genus Rhizomucor, preferably a strain the Rhizomucor pusillus, such as one shown in SEQ ID NO: 3 in WO 2013/006756, such as a Rhizomucor pusillus alpha-amylase hybrid having an Aspergillus niger linker and starch-binding domain, such as the one shown in SEQ ID NO: 9 herein, or a variant thereof.
In an embodiment the alpha-amylase present and/or added in saccharification and/or fermentation is selected from the group consisting of:
(i) an alpha-amylase comprising the polypeptide of SEQ ID NO: 9 herein;
(ii) an alpha-amylase comprising an amino acid sequence having at least 60%, at least 70%, e.g., at least 75%, at least 80%, at least 85%, at least 90%, at least 91 %, at least
92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to the polypeptide of SEQ ID NO: 9 herein.
In a preferred embodiment the alpha-amylase is a variant of the alpha-amylase shown in SEQ ID NO: 9 having at least one of the following substitutions or combinations of substitutions: D165M; Y141W; Y141 R; K136F; K192R; P224A; P224R; S123H + Y141 W; G20S
+ Y141W; A76G + Y141W; G128D + Y141W; G128D + D143N; P219C + Y141W; N142D +
D143N; Y141 W + K192R; Y141W + D143N; Y141W + N383R; Y141W + P219C + A265C;
Y141 W + N142D + D143N; Y141 W + K192R V410A; G128D + Y141W + D143N; Y141W +
D143N + P219C; Y141W + D143N + K192R; G128D + D143N + K192R; Y141W + D143N + K192R + P219C; G128D + Y141 W + D143N + K192R; or G128D + Y141 W + D143N + K192R
+ P219C (using SEQ ID NO: 9 for numbering). In an embodiment the alpha-amylase is derived from a Rhizomucor pusillus with an Aspergillus niger glucoamylase linker and starch-binding domain (SBD), preferably disclosed as SEQ ID NO: 9 herein, preferably having one or more of the following substitutions: G128D, D143N, preferably G128D+D143N (using SEQ ID NO: 9 for numbering), and wherein the alpha- amylase variant present and/or added in saccharification and/or fermentation has at least 75% identity preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 91 %, more preferably at least 92%, even more preferably at least 93%, most preferably at least 94%, and even most preferably at least 95%, such as even at least 96%, at least 97%, at least 98%, at least 99%, but less than 100% identity to the polypeptide of SEQ ID NO: 9 herein.
In a preferred embodiment the ratio between glucoamylase and alpha-amylase present and/or added during saccharification and/or fermentation may preferably be in the range from 500:1 to 1 :1 , such as from 250:1 to 1 :1 , such as from 100:1 to 1 : 1 , such as from 100: 2 to 100:50, such as from 100:3 to 100:70.
Starch-Containing Materials
Any suitable starch-containing starting material may be used in a process of the present invention. The starting material is generally selected based on the desired fermentation product. Examples of starch-containing starting materials, suitable for use in the processes of the present invention, include barley, beans, cassava, cereals, corn, milo, peas, potatoes, rice, rye, sago, sorghum, sweet potatoes, tapioca, wheat, and whole grains, or any mixture thereof. The starch- containing material may also be a waxy or non-waxy type of corn and barley. In a preferred embodiment the starch-containing material is corn. In a preferred embodiment the starch- containing material is wheat.
Fermentation Products
The term "fermentation product" means a product produced by a method or process including fermenting using a fermenting organism. Fermentation products include alcohols (e.g., ethanol, methanol, butanol); organic acids (e.g., citric acid, acetic acid, itaconic acid, lactic acid, succinic acid, gluconic acid); ketones (e.g., acetone); amino acids (e.g., glutamic acid); gases (e.g., H2 and CO2); antibiotics (e.g., penicillin and tetracycline); enzymes; vitamins (e.g., riboflavin, B12, beta-carotene); and hormones. In a preferred embodiment the fermentation product is ethanol, e.g., fuel ethanol; drinking ethanol, i.e., potable neutral spirits; or industrial ethanol or products used in the consumable alcohol industry (e.g., beer and wine), dairy industry (e.g., fermented dairy products), leather industry and tobacco industry. Preferred beer types comprise ales, stouts, porters, lagers, bitters, malt liquors, happoushu, high-alcohol beer, low- alcohol beer, low-calorie beer or light beer. In an preferred embodiment the fermentation product is ethanol.
Fermenting Organisms
The term "fermenting organism" refers to any organism, including bacterial and fungal organisms, such as yeast and filamentous fungi, suitable for producing a desired fermentation product. Suitable fermenting organisms are able to ferment, i.e., convert, fermentable sugars, such as arabinose, fructose, glucose, maltose, mannose, or xylose, directly or indirectly into the desired fermentation product.
Examples of fermenting organisms include fungal organisms such as yeast. Preferred yeast include strains of Saccharomyces, in particular Saccharomyces cerevisiae or Saccharomyces uvarum; strains of Pichia, in particular Pichia stipitis such as Pichia stipitis CBS 5773 or Pichia pastoris; strains of Candida, in particular Candida arabinofermentans, Candida boidinii, Candida diddensii, Candida shehatae, Candida sonorensis, Candida tropicalis, or Candida utilis. Other fermenting organisms include strains of Hansenula, in particular Hansenula anomala or Hansenula polymorpha; strains of Kluyveromyces, in particular Kluyveromyces fragilis or Kluyveromyces marxianus; and strains of Schizosaccharomyces, in particular Schizosaccharomyces pombe.
Preferred bacterial fermenting organisms include strains of Escherichia, in particular Escherichia coli, strains of Zymomonas, in particular Zymomonas mobilis, strains of Zymobacter, in particular Zymobactor palmae, strains of Klebsiella in particular Klebsiella oxytoca, strains of Leuconostoc, in particular Leuconostoc mesenteroides, strains of Clostridium, in particular Clostridium butyricum, strains of Enterobacter, in particular Enterobacter aerogenes, and strains of Thermoanaerobacter, in particular Thermoanaerobacter BG1 L1 (Appl. Microbiol. Biotech. 77: 61 -86), Thermoanarobacter ethanolicus, Thermoanaerobacter mathranii, or Thermoanaerobacter thermosaccharolyticum. Strains of Lactobacillus are also envisioned as are strains of Corynebacterium glutamicum R, Bacillus thermoglucosidaisus, and Geobacillus thermoglucosidasius.
In an embodiment, the fermenting organism is a C6 sugar fermenting organism, such as a strain of, e.g., Saccharomyces cerevisiae.
In an embodiment, the fermenting organism is a C5 sugar fermenting organism, such as a strain of, e.g., Saccharomyces cerevisiae.
In one embodiment, the fermenting organism is added to the fermentation medium so that the viable fermenting organism, such as yeast, count per mL of fermentation medium is in the range from 105 to 1012, preferably from 107 to 1010, especially about 5x107.
Yeast is the preferred fermenting organism for ethanol fermentation. Preferred are strains of Saccharomyces, especially strains of the species Saccharomyces cerevisiae, preferably strains which are resistant towards high levels of ethanol, i.e., up to, e.g., about 10, 12, 15 or 20 vol. % or more ethanol.
In an embodiment, the C5 utilizing yeast is a Saccharomyces cerevisea strain disclosed in WO 2004/085627.
In an embodiment, the fermenting organism is a C5 eukaryotic microbial cell concerned in WO 2010/074577 (Nedalco).
In an embodiment, the fermenting organism is a transformed C5 eukaryotic cell capable of directly isomerize xylose to xylulose disclosed in US 2008/0014620.
In an embodiment, the fermenting organism is a C5 sugar fermentating cell disclosed in WO 2009/109633.
Commercially available yeast include LNF SA-1 , LNF BG-1 , LNF PE-2,and LNF CAT-1 (available from LNF Brazil), RED STAR™ and ETHANOL RED™ yeast (available from Fermentis/Lesaffre, USA), FALI (available from Fleischmann's Yeast, USA), SUPERSTART and THERMOSACC™ fresh yeast (available from Ethanol Technology, Wl, USA), BIOFERM AFT and XR (available from NABC - North American Bioproducts Corporation, GA, USA), GERT STRAND (available from Gert Strand AB, Sweden), and FERMIOL (available from DSM Specialties).
The fermenting organism capable of producing a desired fermentation product from fermentable sugars is preferably grown under precise conditions at a particular growth rate. When the fermenting organism is introduced into/added to the fermentation medium the inoculated fermenting organism pass through a number of stages. Initially growth does not occur. This period is referred to as the "lag phase" and may be considered a period of adaptation. During the next phase referred to as the "exponential phase" the growth rate gradually increases. After a period of maximum growth the rate ceases and the fermenting organism enters "stationary phase". After a further period of time the fermenting organism enters the "death phase" where the number of viable cells declines.
Fermentation
The fermentation conditions are determined based on, e.g., the kind of plant material, the available fermentable sugars, the fermenting organism(s) and/or the desired fermentation product. One skilled in the art can easily determine suitable fermentation conditions. The fermentation may be carried out at conventionally used conditions. Preferred fermentation processes are anaerobic processes.
For example, fermentations may be carried out at temperatures as high as 75°C, e.g., between 40-70°C, such as between 50-60°C. However, bacteria with a significantly lower temperature optimum down to around room temperature (around 20°C) are also known. Examples of suitable fermenting organisms can be found in the "Fermenting Organisms" section above. For ethanol production using yeast, the fermentation may go on for 24 to 96 hours, in particular for 35 to 60 hours. In an embodiment the fermentation is carried out at a temperature between 20 to 40°C, preferably 26 to 34°C, in particular around 32°C. In an embodiment the pH is from pH 3 to 6, preferably around pH 4 to 5.
Other fermentation products may be fermented at temperatures known to the skilled person in the art to be suitable for the fermenting organism in question.
Fermentation is typically carried out at a pH in the range between 3 and 7, preferably from pH
3.5 to 6, such as around pH 5. Fermentations are typically ongoing for 6-96 hours.
The processes of the invention may be performed as a batch or as a continuous process. Fermentations may be conducted in an ultrafiltration system wherein the retentate is held under recirculation in the presence of solids, water, and the fermenting organism, and wherein the permeate is the desired fermentation product containing liquid. Equally contemplated are methods/processes conducted in continuous membrane reactors with ultrafiltration membranes and where the retentate is held under recirculation in presence of solids, water, and the fermenting organism(s) and where the permeate is the fermentation product containing liquid. After fermentation the fermenting organism may be separated from the fermented slurry and recycled.
Fermentation Medium
The phrase "fermentation media" or "fermentation medium" refers to the environment in which fermentation is carried out and comprises the fermentation substrate, that is, the carbohydrate source that is metabolized by the fermenting organism(s).
The fermentation medium may comprise other nutrients and growth stimulator(s) for the fermenting organism(s). Nutrient and growth stimulators are widely used in the art of fermentation and include nitrogen sources, such as ammonia; vitamins and minerals, or combinations thereof.
Recovery
Subsequent to fermentation, the fermentation product may be separated from the fermentation medium. The fermentation medium may be distilled to extract the desired fermentation product or the desired fermentation product may be extracted from the fermentation medium by micro or membrane filtration techniques. Alternatively, the fermentation product may be recovered by stripping. Methods for recovery are well known in the art.
The present invention is further described in the following numbered paragraphs.
Paragraph [1 ] A protease variant comprising a modification at one or more positions corresponding to positions 39, 50, 57, 60, 74, 81 , 84, 109, 1 10, 1 1 1 , 1 15, 1 17, 124, 128, 142, 145, 146, 154, 182, 183, 187, 207, 209, 210, 212, 228, 267, 271 , 272, 274, 278, 280, 294, 317, 318, 320, 321 , 322, 328, 343, 348, 362 or 363 of the polypeptide of SEQ ID NO: 3, wherein the variant has protease activity and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity to the mature polypeptide of SEQ ID NO: 3, and wherein the variant has increased thermo-stability compared to the protease of SEQ ID NO: 3.
Paragraph [2] The variant of paragraph 1 , which comprises a modification which is a substitution at a position corresponding to positions 39, 50, 57, 60, 74, 81 , 84, 109, 1 10, 1 1 1 , 1 15, 1 17, 124, 128, 142, 145, 146, 154, 182, 183, 187, 207, 209, 212, 228, 267, 271 , 272, 274, 278, 280, 294, 317, 318, 320, 321 , 322, 328, 343, 348, 362 or 363 of the polypeptide of SEQ ID NO: 3, wherein the variant has protease activity and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity to the polypeptide of SEQ ID NO: 3, wherein the protease is a serine protease belonging to the S53 family and wherein the variant has increased thermostability compared to the protease of SEQ ID NO: 3.
Paragraph [3] The variant of paragraph 1 , which comprises a modification which is a deletion at a position corresponding to position 318 or 210 of the polypeptide of SEQ ID NO: 3, wherein the variant has protease activity and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity to the polypeptide of SEQ ID NO: 3, wherein the protease is a serine protease belonging to the S53 family and wherein the variant has increased thermostability compared to the protease of SEQ ID NO: 3.
Paragraph [4] The variant of any of the preceding paragraphs, wherein the variant comprises or consists of at least one substitution and/or deletion selected from the group consisting of I39M, I39R, I39L, I39C, S50C, K57R, S60P, S60D, E74W , E81A, E81 E, E81 K, E81 R, I84C, D109N, D109P, D1 10N, F1 1 1 P, N1 15D, N1 15L, E1 17D, N124Q, N124L, N124W,G128A, Q142R, Q142W, N145A, N145D, N145E, N145G, N145K, N145Q, N145V, T146A, T146D, T146E, T146W, T146Y, Q154R, Q154V, Q154W, Q154Y,Q182G, Q182R, S183L, S183P, S187L, Q207R, V209L, E212E, I228R, D267N, V271 C, S272C, S272R, S272V, G274G, G278S, D280N, S294A, S317A, S317G, S317S, S318N, G320C, K321A, K321 G, A322S,T328C, K343C, P348A, T362A, A363C, S318* and S210* of the polypeptide of SEQ ID NO: 3, wherein the variant has protease activity and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity to the polypeptide of SEQ ID NO: 3, wherein the protease is a serine protease belonging to the S53 family and wherein the variant has increased thermostability compared to the protease of SEQ ID NO: 3.
Paragraph [5] The variant according to any of the paragraphs 1 -4, comprising a modification at a position corresponding to position 39, 60, 74, 81 , 84, 109, 1 15, 1 17, 142, 145, 146, 154, 182, 183, 187, 209, 210, 212, 228, 267, 272, 280, 294, 317, 318, 348 or 362 of the polypeptide of SEQ ID NO: 3, wherein the variant has protease activity and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity to the polypeptide of SEQ ID NO: 3, wherein the protease is a serine protease belonging to the S53 family.
Paragraph [6] The variant of paragraph 5, which comprises a modification which is a deletion at a position corresponding to position 318 or 210 of the polypeptide of SEQ ID NO: 3 wherein the variant has protease activity and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity to the polypeptide of SEQ ID NO: 3, wherein the protease is a serine protease belonging to the S53 family.
Paragraph [7] The variant of paragraph 5, which comprises a modification which is a substitution at a position corresponding to positions 39, 60, 74 81 , 84, 109, 1 15, 142, 145, 146, 154, 182, 183, 187, 209, 212, 228, 267, 272, 280, 294, 317, 348 or 362 of the polypeptide of SEQ ID NO: 3, wherein the variant has protease activity and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity to the polypeptide of SEQ ID NO: 3, wherein the protease is a serine protease belonging to the S53 family.
Paragraph [8] The variant of any of paragraphs 5-7, wherein the variant comprises or consists of one or more substitutions and/or deletions selected from the group consisting of I39M, I39R, I39L, I39C, S60D, I84C N1 15D, N1 15L, E1 17D, N145G, N145Q, N145V, N145D, N145K, N145K, N145A, N145E, S183L, S183P, D280N, Q182G, Q182R, E81 R, E81 K, E81 E, E81A, I84C, Q154V, Q142W, Q142R, T146A, T146W, T146Y, T146E, T146D, I228R, D267N, S272V, S272R, E212E, S294A, T362A, E74W , S187L, P348A, D109P, S317A, S317G, S317S, S317A, S318* and S210* of the polypeptide of SEQ ID NO: 3, wherein the variant has protease activity and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity to the polypeptide of SEQ ID NO: 3, and wherein the increased thermo-stability is increased residual activity measured after incubation for 30 min at a temperature in the range from 55 to 60 degrees Celsius.
Paragraph [9] The variant of any of paragraphs 5-8, wherein the variant comprises at least one of the following modifications or combination of modifications:
N1 15L;
S183P;
D280N;
N1 15D;
N1 15L + Q182G;
N1 15L + Q182R;
E81 R + S183P;
E81 K + S183P;
S183P + Q154V;
S183P + Q142W;
Q142R + S183P;
S183P + T146A;
S183P + T146W;
S183P + I228R;
S183P + D267N;
S183P + S272V;
S183P + S272R;
T146W + D280N;
T146Y + S183P;
S183P + E212E;
S183P + S294A;
S183P + T362A;
S183P + S294A;
S183P + E74W;
S183P + E81 E;
S183P + E81A;
N1 15L + S183L + S187L;
S183L + V209L + S210*;
D109P + V209L + S210*;
N1 15D + V209L + S210*;
E81 R + V209L + S210*;
D109P + V209L + S210*; N1 15D + V209L + S210*;
E81 R + V209L + S210*;
T146W + S183P + D280N;
I84C + S183P + S272C;
I39M + Q142R + S183P;
I39R + Q142R + S183P;
I39L + Q142R + S183P;
I39C + Q142R + S183P;
E1 17D + Q142R + S183P;
S60D + Q142R + S183P;
N1 15L + S183L +S187L + P348A;
D109P + S183P + V209L + S210*;
N1 15D + S183P + V209L + S210*;
E81 R + S183P + V209L +S210*;
V209L + S210* + S317A + S318*;
Q142R + N145G + T146E + S183P;
Q142R + N145Q + T146D + S183P;
Q142R + N145V + T146E + S183P;
Q142R + N145D + T146E + S183P;
Q142R + N145K + T146E + S183P;
Q142R + N145A + T146D +S183P;
Q142R + N145E + T146E + S183P;
N1 15L + S183L + S187L + V209W + S210*;
N1 15L + S183L + S187L + V209L + S210*;
N1 15L + S183L + S187L + S317G + S318*;
N1 15L + S183L + S187L + S317S + S318*;
N1 15L +S183L + S187L + S317A + S318*;
E81 R + V209L + S210* + S317A + S318*. Paragraph [10] The variant of any of paragraphs 5-9, wherein the increased thermo-stability is increased residual activity measured after incubation for 30 min at a temperature in the range from 55 to 60 degrees Celsius.
Paragraph [1 1 ] The variant of any of paragraphs 5-10, wherein the variant has a residual activity of at least 10%, particularly at least 12%, more particularly at least 15%, measured after incubation for 30 minutes at 56°C. Paragraph [12] The variant of paragraphs 5-1 1 , wherein the variant comprises at least one of the following modification or combination of modifications:
N1 15L + Q182G;
N1 15D;
Q142R +S183P;
Q142R +N145G +T146E +S183P;
Q142R +N145Q + T146D + S183P;
Q142R +N145V + T146E +S183P;
Q142R +N145D +T146E + S183P;
Q142R +N145K + T146E + S183P;
Q142R +N145A + T146D +S183P;
I39M + Q142R +S183P;
Q142R + N145E + T146E +S183P;
I39R + Q142R + S183P;
I39L + Q142R + S183P;
E1 17D + Q142R + S183P;
S60D + Q142R + S183P;
and wherein the variant has residual activity of at least 30% measured after incubation for 30 minutes at 57°C.
Paragraph [13] The variant of paragraphs 5-12, wherein the variant comprises at least one of the following modifications or combination of modifications:
Q142R + S183P;
Q142R + N145G + T146E + S183P;
Q142R + N145Q + T146D + S183P;
Q142R + N145V + T146E +S183P;
Q142R + N145D + T146E + S183P;
Q142R + N145K + T146E + S183P;
Q142R + N 145A + T146D +S183P;
I39M + Q142R + S183P;
Q142R + N145E + T146E + S183P;
I39R + Q142R + S183P;
I39L +Q142R +S183P;
E1 17D +Q142R S183P;
Q142R + S183P;
S60D + Q142R + S183P; Q142R +S183P; and wherein the variant has residual activity of at least 70% measured after incubation for 30 minutes at 57°C.
Paragraph [14] The variant of paragraphs 5-13, wherein the variant comprises at least one of the following modifications or combination of modifications:
Q142R + S183P;
I39C + Q142R + S183P;
E1 17D + Q142R + S183P;
Q142R + S183P;
S60D + Q142R + S183P; and wherein the variant has residual activity of at least 40% measured after incubation for 30 minutes at 60°C.
Paragraph [15] The variant of paragraphs 5-14, wherein the variant comprises at least one of the following modifications or combination of modifications: Q142R + S183P;
I39C + Q142R +S183P; and wherein the variant has residual activity of at least 40% measured after incubation for 30 minutes at an elevated temperature of 62°C.
Paragraph [16] The variant according to any of the paragraphs 1 -4, comprising a modification at a position corresponding to position 50, 57, 60, 81 , 84, 109, 1 10, 1 1 1 , 124, 128, 142, 145, 146, 154, 182, 183, 207, 209, 210, 228, 267, 271 , 272, 274, 278, 280, 294, 317, 318, 320, 321 , 322, 328, 343, 362, or 363 of the polypeptide of SEQ ID NO: 3, wherein the variant has protease activity and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity to the polypeptide of SEQ ID NO: 3, wherein the protease is a serine protease belonging to the S53 family.
Paragraph [17] The variant of paragraph 16, which comprises a modification which is a substitution at a position corresponding to positions 50, 57, 60, 81 , 84, 109, 1 10, 1 1 1 , 124, 128, 142, 145, 146, 154, 182, 183, 207, 209, 228, 267, 271 , 272, 274, 278, 280, 294, 317, 318, 320, 321 , 322, 328, 343, 362, or 363 of the polypeptide of SEQ ID NO: 3.
Paragraph [18] The variant of paragraph 16, which comprises a modification which is a deletion at a position corresponding to position 318 or 210 of the polypeptide of SEQ ID NO: 3.
Paragraph [19] The variant of paragraphs 16-18, wherein the variant comprises or consists of one or more substitutions and/or deletions selected from the group consisting of S50C, K57R, S60P, E81 R, I84C, D109P, D109N, D1 10N, F1 1 1 P, N124L, N124W, N124Q, G128A, Q142R, Q142W, N145V, N145D, N145A, T146A, T146W, T146E, T146D, Q154V, Q154W, Q154,R, Q154Y, Q182G, Q182R, S183P, S183L, Q207R, V209L, I228R, D267N, V271 C, S272V, S272C, S272R, G274G, G278S, D280N, S294A, S317A, S318N, G320C, K321 G, K321A, A322S, T328C, K343C, T362A, A363C, S318* and S210* of the polypeptide of SEQ ID NO: 3, wherein the variant has protease activity and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity to the polypeptide of SEQ ID NO: 3.
Paragraph [20] The variant of any of paragraphs 16-19, wherein the variant comprises at least one of the following modifications or combination of modifications:
S183P;
D280N;
K57R +S183P;
D109P +S183P+ V209L +S210*;
E81 R+ S183P +V209L +S210*;
E81 R +V209L +S210*;
Q154V +S183P;
Q142W +S183P;
Q142R +S183P;
T146A +S183P;
T146W +S183P;
S183P +I228R;
S183P +D267N;
S183P +S272V;
E81 R +V209L +S210* +S317A +S318*;
S183P +T328C +K343C;
S183P +G320C+ A363C;
T146W +D280N;
T146W +S183L D+280N;
T146W;
T146W +S183P +D280N;
T146Y +S183P;
S183P +Q207R;
S50C +S183P +V271 C;
I84C +S183P+ S272C;
Q142W +T146W +S183P; Q142W +T146W +S183P+ D280N;
S183P +S294A;
S183P +K321G;
S183P +T362A;
Q182G;
Q142W +T146W +Q182R;
S272V;
S272R;
S60P;
D109N +D110N;
F111P;
G128A;
G278S;
S318N +K321A+A322S;
E81R+T146W;
E81R +Q142R +S183P;
E81R+Q142W +S183P
S183P +G274G;
E81R;
N124L +Q142R +S183P;
N124W +Q142R+S183P;
N124Q +Q142R +S183P;
Q142R + N145V + T146E +S183P;
Q142R +N145D +T146E + S183P;
Q142R + N145A +T146D +S183P; and wherein the increased thermo-stability measured as Td by TSA assay is at least 59°C.
Paragraph [21] The variant of any of paragraphs 16-20, wherein the variant comprises at least one of the following modifications or combination of modifications: D280N;
D109P + S183P + V209L + S210*;
E81R + S183P + V209L + S210*;
E81R + V209L+S210*;
Q154V + S183P;
Q142W+S183P;
Q142R + S183P; T146A + S183P;
T146W + S183P;
S183P + D267N;
S183P + S272V;
E81 R + V209L + S210*+ S317A +S318*;
T146W + D280N;
T146W + S183L +D280N;
T146W;
T146W + S183P +D280N;
T146Y + S183P;
S183P + Q207R;
S50C + S183P + V271 C;
I84C + S183P + S272C;
Q142W + T146W + S183P;
Q142W + T146W + S183P + D280N;
S183P + S294A;
Q142W + T146W + Q182R;
S272V;
S272R;
S60P;
E81 R + T146W;
E81 R + Q142R + S183P;
E81 R + Q142W + S183P;
S183P + G274G;
E81 R;
N124L + Q142R + S183P;
N124W + Q142R + S183P;
N124Q + Q142R + S183P;
Q142R + N145V + T146E + S183P;
Q142R + N145D + T146E + S183P;
Q142R + N145A + T146D + S183P; and wherein the increased thermo-stability measured as Td by TSA assay is at least 61 °C.
Paragraph [22] The variant of any of paragraphs 16-21 , wherein the variant comprises at least one of the following modifications or combination of modifications:
E81 R + S183P+ V209L +S210*; Q142R + S183P;
T146W + D280N;
T146W +S183L + D280N;
T146W + S183P+ D280N;
S50C + S183P + V271 C;
I84C + S183P + S272C;
Q142W + T146W + S183P+ D280N;
S272V;
E81 R +T146W;
E81 R + Q142R + S183P;
N124L + Q142R +S183P;
N124W + Q142R +S183P;
N124Q + Q142R + S183P;
Q142R + N145V + T146E + S183P;
Q142R + N145D + T146E + S183P;
Q142R + N145A + T146D + S183P; and wherein the increased thermo-stability measured as Td by TSA assay is at least 63°C.
Paragraph [23] The variant of any of paragraphs 16-22, wherein the variant comprises at least one of the following modifications or combination of modifications:
Q142R + S183P;
S50C + S183P + V271 C;
E81 R + Q142R + S183P;
N124L + Q142R + S183P;
N124Q + Q142R + S183P;
Q142R + N145V + T146E + S183P;
Q142R + N145D + T146E + S183P; or
Q142R + N145A + T146D + S183P; and wherein the increased thermo-stability measured as Td by TSA assay is at least 65°C.
Paragraph [24] The variant according to any one of the preceding paragraphs, wherein said variant comprises a substitution at 1 , 2, 3, 4, 5, 6, 7, 8, 9, or 10 positions.
Paragraph [25] A polynucleotide encoding the variant of any of paragraphs 1 -24.
Paragraph [26] A nucleic acid construct comprising the polynucleotide of paragraph 25. Paragraph [27] An expression vector comprising the polynucleotide of paragraph 25. Paragraph [28] A recombinant host cell comprising the polynucleotide of paragraph 25.
Paragraph [29] A method of producing a protease variant of any of paragraphs 1 -24, comprising: cultivating the host cell of paragraph 28 under conditions suitable for expression of the variant; and optionally recovering the variant. Paragraph [30] A composition comprising the variant according to any one of paragraphs 1 -24.
Paragraph [31] The composition of paragraph 30, further comprising a glucoamylase and optionally a fungal alpha-amylase.
Paragraph [32] A process for producing a fermentation product from starch-containing material comprising simultaneously saccharifying and fermenting starch-containing material using a carbohydrate-source generating enzymes and a fermenting organism at a temperature below the initial gelatinization temperature of said starch-containing material in the presence of a variant protease of any of the paragraphs 1 -24.
Paragraph [33] A process for producing a fermentation product from starch-containing material comprising the steps of: a) liquefying starch-containing material in the presence of an alpha- amylase; b) saccharifying the liquefied material obtained in step (a) using a glucoamylse; c) fermenting using a fermenting organism; wherein a variant protease of any of the paragraphs 1 - 24 is present during step b) and/or c).
Paragraph [34] The process of any of the paragraphs 32-33, wherein the fermentation product is ethanol and the fermenting organism is Saccharomyces cerevisiae. Paragraph [35] The host cell of paragraph 28 expressing the variants of any of paragraphs 1 - 24, wherein the host cell is a yeast cell, particularly a Saccharomyces, such as Saccharomyces cerevisiae.
Paragraph [36] The process of any of the paragraphs 32-33, wherein the host cell of paragraph 35, is applied as the fermenting organism in the fermentation step and the fermentation product is ethanol.
The present invention is further described by the following examples.
EXAMPLES
Enzymes
Enzymes for DNA manipulations (e.g. restriction endonucleases, ligases etc.) were obtained from New England Biolabs, Inc. and were used according to the manufacturer's instructions. Media and reagents
The following media and reagents were used unless otherwise specified:
Chemicals used for buffers and substrates were commercial products of analytical grade. Cove: 342.3 g/L Sucrose, 20 ml/L COVE salt solution, "l OmM Acetamide, 30 g/L noble agar.
Cove top agar: 342.3 g/L Sucrose, 20 ml/L COVE salt solution, 10mM Acetamide, 10 g/L low melt agarose. Cove-N plates are composed of 30 g sucrose, 20 ml Cove salt solution, 3g NaN03, and 30 g noble agar and water to 1 litre. COVE salt solution are composed of 26 g KCI, 26 g MgS04 7H2O, 76 g KH2P04 and 50ml Cove trace metals and water to 1 litre. Trace metal solution for COVE are composed of 0.04 g NaB407 10H2O, 0.4 g CuS04 5H20, 1.2 g FeS047H20, 1.0 g MnS04 H2O, 0.8 g Neutral amylase II Mo022H20, and 10.0 g ZnS04 7H20 and water to 1 litre. ¼ YPM composed of 2.5 g yeast extract, 5 g pepton and 5 g maltose (pH 4.5) and water to 1 litre. STC buffer was composed of 0.8 M sorbitol, 25 mM Tris (pH 8), and 25 mM CaCI2 and water to l litre. STPC buffer composed of 40% PEG4000 in STC buffer. MLC composed of 40 g Glucose, 50 g Soybean powder, 4 g/ Citric acid (pH 5.0) and water to 1 litre.
Purchased material (E.coli, plasmid and kits)
E.coli DH5-alpha (Toyobo) was used for plasmid construction and amplification. Amplified plasmids were recovered with Qiagen Plasmid Kit (Qiagen). QIAquickTM Gel Extraction Kit (Qiagen) was used for the purification of PCR fragments and extraction of DNA fragment from agarose gel.
Strains
The expression host strain Aspergillus niger described is a derivative of NN059203. NN059203 was isolated by Novozymes and described in WO12160093 and is a derivative of Aspergillus niger NN049184 which was isolated from soil.
Transformation of Aspergillus
Transformation of Aspergillus species can be achieved using the general methods for yeast transformation. The preferred procedure for the invention is described below. The
Aspergillus niger host strain was inoculated into 100 ml YPG medium supplemented with 10 mM uridine and incubated for 16 hrs at 32°C at 80 rpm. Pellets were collected and washed with 0.6
M KCI, and resuspended in 20 ml 0.6 M KCI containing a commercial glucanase product
(GLUCANEX™, Novozymes A/S, Bagsvaerd, Denmark) at a final concentration of 20 mg per ml. The suspension was incubated at 32°C with shaking (80 rpm) until protoplasts were formed, and then washed twice with STC buffer. The protoplasts were counted with a hematometer and resuspended and adjusted in an 8:2:0.1 solution of STC:STPC:DMSO to a final concentration of 2.5x107 protoplasts/ml. Approximately 4pg of plasmid DNA was added to 100 pi of the protoplast suspension, mixed gently, and incubated on ice for 30 minutes. One ml of SPTC was added and the protoplast suspension was incubated for 20 minutes at 37°C. After the addition of 10 ml of 50°C Cove top agarose, the reaction was poured onto Cove agar plates and the plates were incubated at 32°C for 5 days.
PCR amplification
PrimeSTAR® HS (Premix) 10 μΙ
Template DNA (50-100 ng/ pi) 1 μΙ
Forward primer (100pM) 1 μΙ
Reverse primer (100 pM) 1 μΙ
Distilled water to 20 μΙ
PCR conditions
1 . 94°C 2 min
2. 94°C 10 sec
3. 57°C 5 sec
4. 72°C 20 sec
Repeat 2-4, 30 cycl
5. 72°C 30 sec
MTP cultivation for enzyme production
Spores of Aspergillus libraries were inoculated in 0.5-1 ml of 1/4YPM media in 96 deep well plate and cultivated at 30°C for 2-3 days at 600rpm.
Enzyme assay
Zein plate assay
Culture supernatants were applied on 0.05-0.1 % of zein (Sigma) plate (20mM sodium acetate buffer, pH4.5) and incubated at appropriate temperatures (30-60 degree C).
Suc-AAPF-pna analysis
Culture supernatants pre-incubated at appropriate temperatures (50 to 60 degree C and 4 degree C as a control) are measured for protease activity by AAPF assay using N-Succinyl-Ala- Ala-Pro-Phe p-nitroanilide (SIGMA-ALDRICH).
Assay:
1 ) Add 25μΙ samples to wells of 384 microtiterplate (MTP)
2) Add 25μΙ pNA substrate working soln. to 384 MTP 3) Read 405nm (zero point)
4) Incubate 37°C, 60min (if the color is not developed well, continue incubation)
5) Read 405nm (zero point) DNA isolation from Aspergillus clones
Inserted DNAs of Aspergillus strains were recovered by direct PCR method described below or PCR on the isolated DNA by chromosomal DNA purification kit (FastDNA SPIN Kit for Soil, MP biomedicals, #6560-200) using a primer pair, insert rescue F and R.
insert rescue F (SEQ ID NO: 1 1 ) AATCTCAGAACACCAATATC
insert rescue R (SEQ ID NO: 12) AACACTATGCGTTATCGTAC
The amplified DNAs were purified by agarose gel electrophoresis followed to QIAquick Gel Extraction kit (Qiagen) for sequencing analysis to check the quality of constructed libraries. Colony PCR was carried out as following:
Conidias from strains were transferred to a 1.5 ml tube and 500μΙ of TE-buffer was added and mixed briefly.
It was diluted 10-20 times in water and one μΙ of the dilution was used as template for PCR. Purification
Purification of the variants of Meripilus giganteus serine protease belonging to family 53 herein denoted as MgProtlll variants was carried out by two steps, desalting column and cation exchange chromatography column. Finally, the sample was buffer exchanged and concentrated in 20 mM succinate buffer pH 4.0 using a 30 kDa centrifugal concentrator (Sartorius AG).
TSA (Thermal Shift Assay)
Purified enzyme was diluted with 50 mM sodium acetate buffer pH 4.5 to 0.75 mg/ml and 10 μΙ of that were mixed with 15 μ I of SYPRO Orange (Invitrogen) diluted with Milli-Q water and 5 μΙ of 30 mM bacitracin solution dissolved in 50 mM sodium acetate buffer pH 4.5. Thirty microliters of mixture solution was transfer to LightCycler 480 Multiwell Plate 96 (Roche Diagnostics) and the plate was sealed.
Equipment parameters of TSA:
Apparatus: LightCycler 480 Real-Time PCR System (Roche Applied Science)
Scan rate: 0.02°C/sec
Scan range: 37 - 96°C
Integration time: 1.0 sec
Excitation wave length 465 nm
Emission wave length 580 nm The obtained fluorescence signal was normalized into a range of 0 and 1. The Thermal denaturation temperature, Td, was defined as the temperature where the normalized value is closest to 0.5. EXAMPLE 1 : Library construction
Plasmid library construction using ln-fusion cloning (Clontech)
An expression vector, pFLP-MgProlll disclosed in WO1260093 Figure 5, which contains the target protease gene (shown as SEQ 1 ) instead of glucoamylase gene and amd S marker gene instead of pyr G marker gene, was digested with appropriate restriction enzymes (Xhol BsiW1 for pFRT-GIAMG) to cut out the protease gene.
Two PCRs were carried out for a library construction using 2 primer pairs, a forward degenerated primer and a primer having more than 15bp overlapping with an expression vector (vector F described below), and vector F primer and a reverse primer having 15bp overlapping with the degenerated primer using the expression vector as a template.
Vector R 25mer (SEQ ID NO: 13) TAAGTGGAGGGAAAAACACTATGCG
Vector F 32mer (SEQ ID NO: 14) G CTTG GAG CAACAATCTCAG AACACCAATATC
One of the examples of primers for a library is shown below:
F1 1 1X F 27mer (SEQ ID NO: 15) ATCTCCGTCGGCGACGACNNKCAGGAT
F1 1 1 X R 20mer (SEQ ID NO: 16) GTCGCCGACGGAGATGAACG
The digested vector and PCR fragments were mixed with In-Fusion mix and transformed into E.coli DH5alpha. Obtained E.coli transformants were pooled and plasmids were extracted to use for Aspergillus library construction.
Aspergillus transformation to construct a library in Aspergillus
One μg of each plasmid library was transformed into A. niger host strain. Aspergillus transformants were isolated in a 96 well-MTP containing COVE-N gly agar (100ul/well), cultivate at 32°C for 1 week to have enough sporulation. 10ΟμΙ/well of 0.01 % tween 20 was added to the each well, suspended with spores and the suspension was inoculated in a 96 well-MTP containing YPG and cultivated for 3 days at 30°C with shaking to have Aspergillus culture library. They were used for further library screening works.
Library screening
Constructed Aspergillus libraries were cultivated in 96 well MTP and the culture supernatants were spotted on zein plates at appropriate temepratures. Positive variants were tested by Suc- AAPF-pna analysis and variants having higher residual activities were identified. Positive variants were cultivated in shake flasks and samples were used for further purification and characterization.
DNA isolation from Aspergillus clones
Inserted DNAs of Aspergillus strains were recovered by direct PCR method described below or PCR on the isolated DNA by chromosomal DNA purification kit (FastDNA SPIN Kit for Soil, MP biomedicals, #6560-200) using a primer pair, insert rescue F and R. insert rescue F (SEQ ID NO: 1 1 ) AATCTCAGAACACCAATATC
insert rescue R (SEQ ID NO: 12) AACACTATGCGTTATCGTAC
The amplified DNAs were purified by agarose gel electrophoresis followed to QIAquick Gel Extraction kit (Qiagen) for sequencing analysis to check the quality of constructed libraries. RESULTS
Table 1 lists the positive variants identified by Suc-AAPF-pna analysis. Samples were incubated at certain temperatures for 30 minutes and their remaining activities were measured by AAPF assay. The residual activities in tables below are described as relative activity to ones incubated at 4 degree C.
JMgP066 N115LS183LS187LS317AS318* 47 33
JMgP075 S183L V209LS210* 49 41
JMgP ID 55°C, 30min 56°C, 30min
JMgP009 S183P 39.4 19
Iib19-4 S183P E74W 32.1 13.7 lib22-2 S183P E81A 46.1 23.5
JMgP083 E81RS183P 70.9 53.5
JMgP084 E81KS183P 73.5 55.6
Iib22-11 S183P E81E 36.8 15.3
JMgP ID 55°C, 30min 56°C, 30min
JMgP009 S183P 46.8 24.7
JMgP094 S183P Q154V 67.4 49.4
JMgP095 S183P Q142W 66.1 50.6
JMgP096 Q142RS183P 99 100
JMgP097 S183PT146A 65.8 47.4
JMgP098 S183PT146W 83.8 78.1
JMgP099 S183P I228R 67 49.5
JMgPIOO S183P D267N 81.9 76.6
JMgP101 S183P S272V 81.8 77.5
JMgP103 S183P S272R 88.6 83.2
JMgP120 T146YS183P 64 52
JMgP ID 55°C, 30min 56°C, 30min
JMgP009 S183P 48 27
JMgP030 D280N 62 49
JMgP087 D109PS183PV209LS210* 63 49
JMgP089 E81RS183PV209LS210* 69 62
JMgP091 D109P V209LS210* 47 28
JMgP092 N115D V209LS210* 54 36
JMgP093 E81RV209LS210* 56 42
JMgP104 V209LS210* S317A S318* 58 45
JMgP106 E81RV209LS210* S317A S318* 65 55
JMgP115 T146W D280N 60 50
JMgP118 T146WS183P D280N 73 29
JMgP120 T146YS183P 81 37
JMgP134 S183P S294A 85 58
JMgP137 S183PT362A 53 32
JMgP140 S183P S294A 73 56 55°C, 30min 56°C, 30min
JMgP009 S183P 50 29
JMgP088 N115DS183PV209LS210* 41 34
JMgP096 Q142RS183P 73 71
JMgP123 S183P E212E 48 32
JMgP127 I84C S183P S272C 71 67
57°C, 30min 58°C, 30min
JMgP096 Q142RS183P 78 76
JMgP229 Q142R N145G T146E S183P 86 87
JMgP230 Q142R N145Q T146D S183P 92 92
JMgP231 Q142R N145V T146E S183P 92 91
JMgP232 Q142R N145D T146E S183P 89 90
JMgP233 Q142R N145K T146E S183P 92 94
JMgP234 Q142R N145AT146D S183P 84 82
JMgP236 I39M Q142RS183P 88 92
JMgP235 Q142R N145E T146E S183P 90 87
JMgP237 I39RQ142RS183P 82 82
JMgP238 I39LQ142RS183P 91 98
60°C, 30min 62°C, 30min
JMgP096 Q142RS183P 84 45
JMgP245 I39CQ142RS183P 125 105
57°C, 30min 60°C, 30min
JMgP252 E117DQ142RS183P 90 61
JMgP096 Q142RS183P 88 43
57°C, 30min 60°C, 30min
Iib81-1 S60DQ142RS183P 96 99
JMgP096 Q142RS183P 96 60
EXAMPLE 2: Purification and Thermal shift assay (TSA) analysis
Purification Purification of MgProtlll variants was carried out by two steps, desalting column and cation exchange chromatography column. Finally, the sample was buffer exchanged and concentrated in 20 mM succinate buffer pH 4.0 using a 30 kDa centrifugal concentrator (Sartorius AG). TSA
Purified enzyme was diluted with 50 mM sodium acetate buffer pH 4.5 to 0.75 mg/ml and 10 μΙ of that were mixed with 15 μ I of SYPRO Orange (Invitrogen) diluted with Milli-Q water and 5 μΙ of 30 mM bacitracin solution dissolved in 50 mM sodium acetate buffer pH 4.5. Thirty microliters of mixture solution was transfer to LightCycler 480 Multiwell Plate 96 (Roche Diagnostics) and the plate was sealed.
Equipment parameters of TSA:
Apparatus: LightCycler 480 Real-Time PCR System (Roche Applied Science)
Scan rate: 0.02°C/sec
Scan range: 37 - 96°C
Integration time: 1.0 sec
Excitation wave length 465 nm
Emission wave length 580 nm
The obtained fluorescence signal was normalized into a range of 0 and 1. The Td was defined as the temperature where the normalized value is closest to 0.5.
Result: The TSA data are listed in TABLE 2.

Claims

1 . A protease variant comprising a modification at one or more positions corresponding to positions 39, 50, 57, 60, 74, 81 , 84, 109, 1 10, 1 1 1 , 1 15, 1 17, 124, 128, 142, 145, 146, 154, 182, 183, 187, 207, 209, 210, 212, 228, 267, 271 , 272, 274, 278, 280, 294, 317, 318, 320, 321 , 322, 328, 343, 348, 362 or 363 of the polypeptide of SEQ ID NO: 3, wherein the variant has protease activity and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity to the mature polypeptide of SEQ ID NO: 3, and wherein the variant has increased thermo-stability compared to the protease of SEQ ID NO: 3.
2. The variant of claim 1 , wherein the variant comprises or consists of at least one substitution and/or deletion selected from the group consisting of I39M, I39R, I39L, I39C, S50C, K57R, S60P, S60D, E74W , E81A, E81 E, E81 K, E81 R, I84C, D109N, D109P, D1 10N, F1 1 1 P, N1 15D, N1 15L, E1 17D, N124Q, N124L, N124W,G128A, Q142R, Q142W, N145A, N145D, N145E, N145G, N145K, N145Q, N145V, T146A, T146D, T146E, T146W, T146Y, Q154R, Q154V, Q154W, Q154Y,Q182G, Q182R, S183L, S183P, S187L, Q207R, V209L, E212E, I228R, D267N, V271 C, S272C, S272R, S272V, G274G, G278S, D280N, S294A, S317A, S317G, S317S, S318N, G320C, K321A, K321 G, A322S,T328C, K343C, P348A, T362A, A363C, S318* and S210* of the polypeptide of SEQ ID NO: 3, wherein the variant has protease activity and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity to the polypeptide of SEQ ID NO: 3, wherein the protease is a serine protease belonging to the S53 family and wherein the variant has increased thermo-stability compared to the protease of SEQ ID NO: 3.
3. The variant according to any of the claims 1 -2, comprising a modification at a position corresponding to position 39, 60, 74, 81 , 84, 109, 1 15, 1 17, 142, 145, 146, 154, 182, 183, 187, 209, 210, 212, 228, 267, 272, 280, 294, 317, 318, 348 or 362 of the polypeptide of SEQ ID NO:
3, wherein the variant has protease activity and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity to the polypeptide of SEQ ID NO: 3, wherein the protease is a serine protease belonging to the S53 family.
4. The variant of claim 3, wherein the variant comprises or consists of one or more substitutions and/or deletions selected from the group consisting of I39M, I39R, I39L, I39C,
S60D, I84C N1 15D, N1 15L, E1 17D, N145G, N145Q, N145V, N145D, N145K, N145K, N145A, N145E, S183L, S183P, D280N, Q182G, Q182R, E81 R, E81 K, E81 E, E81A, I84C, Q154V, Q142W, Q142R, ΤΊ 46Α, T146W, ΤΊ46Υ, ΤΊ 46Ε, T146D, I228R, D267N, S272V, S272R, E212E, S294A, T362A, E74W , S187L, P348A, D109P, S317A, S317G, S317S, S317A, S318* and S210* of the polypeptide of SEQ ID NO: 3, wherein the variant has protease activity and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity to the polypeptide of SEQ ID NO: 3, and wherein the increased thermo-stability is increased residual activity measured after incubation for 30 min at a temperature in the range from 55 to 60 degrees Celsius.
5. The variant of any of claims 3-4, wherein the variant comprises at least one of the following modifications or combination of modifications:
N1 15L;
S183P;
D280N;
N1 15D;
N1 15L + Q182G;
N1 15L + Q182R;
E81 R + S183P;
E81 K + S183P;
S183P + Q154V;
S183P + Q142W;
Q142R + S183P;
S183P + T146A;
S183P + T146W;
S183P + I228R;
S183P + D267N;
S183P + S272V;
S183P + S272R;
T146W + D280N;
T146Y + S183P;
S183P + E212E;
S183P + S294A;
S183P + T362A;
S183P + S294A;
S183P + E74W;
S183P + E81 E; S183P + E81A;
N1 15L + S183L + S187L;
S183L + V209L + S210*;
D109P + V209L + S210*;
N1 15D + V209L + S210*;
E81 R + V209L + S210*;
D109P + V209L + S210*;
N1 15D + V209L + S210*;
E81 R + V209L + S210*;
T146W + S183P + D280N;
I84C + S183P + S272C;
I39M + Q142R + S183P;
I39R + Q142R + S183P;
I39L + Q142R + S183P;
I39C + Q142R + S183P;
E1 17D + Q142R + S183P;
S60D + Q142R + S183P;
N1 15L + S183L +S187L + P348A;
D109P + S183P + V209L + S210*;
N1 15D + S183P + V209L + S210*;
E81 R + S183P + V209L +S210*;
V209L + S210* + S317A + S318*;
Q142R + N145G + T146E + S183P;
Q142R + N145Q + T146D + S183P;
Q142R + N145V + T146E + S183P;
Q142R + N145D + T146E + S183P;
Q142R + N145K + T146E + S183P;
Q142R + N145A + T146D +S183P;
Q142R + N145E + T146E + S183P;
N1 15L + S183L + S187L + V209W + S210*;
N1 15L + S183L + S187L + V209L + S210*;
N1 15L + S183L + S187L + S317G + S318*;
N1 15L + S183L + S187L + S317S + S318*;
N1 15L +S183L + S187L + S317A + S318*;
E81 R + V209L + S210* + S317A + S318*.
The variant of any of claims 3-5, wherein the increased thermo-stability is increased residual activity measured after incubation for 30 min at a temperature in the range from 55 to 60 degrees Celsius.
7. The variant of any of claims 3-6, wherein the variant has a residual activity of at least 10%, particularly at least 12%, more particularly at least 15%, measured after incubation for 30 minutes at 56°C.
8. The variant according to any of the claims 1 -2, comprising a modification at a position corresponding to position 50, 57, 60, 81 , 84, 109, 1 10, 1 1 1 , 124, 128, 142, 145, 146, 154, 182, 183, 207, 209, 210, 228, 267, 271 , 272, 274, 278, 280, 294, 317, 318, 320, 321 , 322, 328, 343, 362, or 363 of the polypeptide of SEQ ID NO: 3, wherein the variant has protease activity and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity to the polypeptide of SEQ ID NO: 3, wherein the protease is a serine protease belonging to the S53 family.
9. The variant claim 8, wherein the variant comprises or consists of one or more substitutions and/or deletions selected from the group consisting of S50C, K57R, S60P, E81 R, I84C, D109P, D109N, D1 10N, F1 1 1 P, N124L, N124W, N124Q, G128A, Q142R, Q142W, N145V, N145D, N145A, T146A, T146W, T146E, T146D, Q154V, Q154W, Q154,R, Q154Y, Q182G, Q182R, S183P, S183L, Q207R, V209L, I228R, D267N, V271 C, S272V, S272C, S272R, G274G, G278S, D280N, S294A, S317A, S318N, G320C, K321 G, K321A, A322S, T328C, K343C, T362A, A363C, S318* and S210* of the polypeptide of SEQ ID NO: 3, wherein the variant has protease activity and wherein the variant has at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity to the polypeptide of SEQ ID NO: 3.
10. The variant of any of claims 8-9, wherein the variant comprises at least one of the following modifications or combination of modifications:
S183P;
D280N;
K57R +S183P;
D109P +S183P+ V209L +S210*;
E81 R+ S183P +V209L +S210*;
E81 R +V209L +S210*;
Q154V +S183P;
Q142W +S183P; Q142R +S183P;
T146A +S183P;
T146W +S183P;
S183P +I228R;
S183P +D267N;
S183P +S272V;
E81R +V209L +S210* +S317A +S318*
S183P +T328C +K343C;
S183P +G320C+ A363C;
T146W+D280N;
T146W +S183L D+280N;
T146W;
T146W +S183P +D280N;
T146Y +S183P;
S183P +Q207R;
S50C +S183P +V271C;
I84C +S183P+ S272C;
Q142W +T146W +S183P;
Q142W +T146W +S183P+ D280N;
S183P +S294A;
S183P +K321G;
S183P +T362A;
Q182G;
Q142W +T146W +Q182R;
S272V;
S272R;
S60P;
D109N +D110N;
F111P;
G128A;
G278S;
S318N +K321A +A322S;
E81R+ T146W;
E81R+Q142R+S183P;
E81R+Q142W +S183P
S183P +G274G;
E81 R; N124L +Q142R +S183P;
N124W +Q142R +S183P;
N124Q +Q142R +S183P;
Q142R + N145V + T146E +S183P;
Q142R +N145D +T146E + S183P;
Q142R + N145A +T146D +S183P; and wherein the increased thermo-stability measured as Td by TSA assay is at least 59°C.
1 1 . An polynucleotide encoding the variant of any of claims 1 -10.
12. A nucleic acid construct comprising the polynucleotide of claim 1 1.
13. An expression vector comprising the polynucleotide of claim 1 1 .
14. A recombinant host cell comprising the polynucleotide of claim 1 1 .
15. A method of producing a protease variant of any of claims 1 -10, comprising: cultivating the host cell of claim 14 under conditions suitable for expression of the variant; and optionally recovering the variant.
16. A composition comprising the variant according to any one of claims 1 -10.
17. The composition of claim 16, further comprising a glucoamylase and optionally a fungal alpha-amylase.
18. A process for producing a fermentation product from starch-containing material comprising simultaneously saccharifying and fermenting starch-containing material using a carbohydrate-source generating enzymes and a fermenting organism at a temperature below the initial gelatinization temperature of said starch-containing material in the presence of a variant protease of any of the claims 1 -10.
19. A process for producing a fermentation product from starch-containing material comprising the steps of: a) liquefying starch-containing material in the presence of an alpha- amylase; b) saccharifying the liquefied material obtained in step (a) using a glucoamylse; c) fermenting using a fermenting organism; wherein a variant protease of any of the claims 1 -10 is present during step b) and/or c).
20. The process of any of the claims 18-19, wherein the fermentation product is ethanol and the fermenting organism is Saccharomyces cerevisiae.
21 . The host cell of claim 14 expressing the variants of any of claims 1 -10, wherein the host cell is a yeast cell, particularly a Saccharomyces, such as Saccharomyces cerevisiae.
22. The process of any of the claims 18-19, wherein the host cell of claim 21 , is applied as the fermenting organism in the fermentation step and the fermentation product is ethanol.
EP17746005.2A 2016-07-21 2017-07-14 Serine protease variants and polynucleotides encoding same Active EP3487996B1 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
EP16180497 2016-07-21
EP16195078 2016-10-21
PCT/EP2017/067883 WO2018015304A1 (en) 2016-07-21 2017-07-14 Serine protease variants and polynucleotides encoding same

Publications (2)

Publication Number Publication Date
EP3487996A1 true EP3487996A1 (en) 2019-05-29
EP3487996B1 EP3487996B1 (en) 2024-04-10

Family

ID=59501396

Family Applications (1)

Application Number Title Priority Date Filing Date
EP17746005.2A Active EP3487996B1 (en) 2016-07-21 2017-07-14 Serine protease variants and polynucleotides encoding same

Country Status (9)

Country Link
US (3) US10927361B2 (en)
EP (1) EP3487996B1 (en)
CN (1) CN109642225A (en)
CA (1) CA3028875A1 (en)
DK (1) DK3487996T5 (en)
ES (1) ES2981748T3 (en)
FI (1) FI3487996T3 (en)
MX (1) MX2019000805A (en)
WO (1) WO2018015304A1 (en)

Families Citing this family (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018015304A1 (en) * 2016-07-21 2018-01-25 Novozymes A/S Serine protease variants and polynucleotides encoding same
EP3487995B1 (en) 2016-07-21 2021-05-26 Novozymes A/S Serine protease variants and polynucleotides encoding same
CN113490740A (en) * 2019-03-18 2021-10-08 诺维信公司 Polypeptides having pullulanase activity suitable for use in liquefaction
KR102316445B1 (en) * 2019-11-29 2021-10-26 씨제이제일제당 주식회사 A novel serine protease variant
CN112574978B (en) * 2021-01-19 2021-08-17 青岛尚德生物技术有限公司 Protease mutant capable of improving alcohol-soluble protein degradation capacity and coding gene and application thereof
KR102613549B1 (en) 2021-03-12 2023-12-13 씨제이제일제당 주식회사 A novel serine protease variant
US20250311734A1 (en) 2022-05-14 2025-10-09 Novozymes A/S Compositions and Methods for Preventing, Treating, Suppressing and/or Eliminatting Phytopathogenic Infestations and Infections
EP4638725A1 (en) 2022-12-19 2025-10-29 Novozymes A/S Carbohydrate esterase family 3 (ce3) polypeptides having acetyl xylan esterase activity and polynucleotides encoding same
EP4638768A2 (en) 2022-12-19 2025-10-29 Novozymes A/S Processes for producing fermentation products using fiber-degrading enzymes with engineered yeast
EP4638724A1 (en) 2022-12-19 2025-10-29 Novozymes A/S Carbohydrate esterase family 1 (ce1) polypeptides having ferulic acid esterase and/or acetyl xylan esterase activity and polynucleotides encoding same
JP2025541374A (en) 2022-12-19 2025-12-18 ノボザイムス アクティーゼルスカブ Compositions Comprising Arabinofuranosidase and Xylanase and Their Use for Increasing Solubilization of Hemicellulosic Fibers - Patent application
CN120380158A (en) 2022-12-19 2025-07-25 诺维信公司 Method for reducing the viscosity of a slurry at the back end of a fermentation product production process
AU2024303961A1 (en) 2023-06-13 2025-12-11 Novozymes A/S Processes for producing fermentation products using engineered yeast expressing a beta-xylosidase
WO2025128568A1 (en) 2023-12-11 2025-06-19 Novozymes A/S Composition and use thereof for increasing hemicellulosic fiber solubilization
WO2026008449A2 (en) 2024-07-04 2026-01-08 Novozymes A/S A process for producing a fermentation product and a concentrated protein co-product

Family Cites Families (38)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3912590A (en) 1973-01-03 1975-10-14 Novo Industri As Procedure for liquefying starch
US4316956A (en) 1980-02-06 1982-02-23 Novo Industri A/S Fermentation process
US4335208A (en) 1980-03-11 1982-06-15 Novo Industri A/S Saccharification of starch hydrolysates
JPS57174089A (en) 1981-04-20 1982-10-26 Novo Industri As Chain dividing enzyme product
DK122686D0 (en) 1986-03-17 1986-03-17 Novo Industri As PREPARATION OF PROTEINS
EP0252730B1 (en) 1986-07-09 1992-09-16 Novo Nordisk A/S Alpha-amylase mixtures for starch liquefaction
US5223409A (en) 1988-09-02 1993-06-29 Protein Engineering Corp. Directed evolution of novel binding proteins
JP3016587B2 (en) 1989-12-04 2000-03-06 ザ・リサーチ・ファンデーション・オブ・ステート・ユニバーシティ・オブ・ニューヨーク Combination of non-steroidal anti-inflammatory drug and tetracycline
IL99552A0 (en) 1990-09-28 1992-08-18 Ixsys Inc Compositions containing procaryotic cells,a kit for the preparation of vectors useful for the coexpression of two or more dna sequences and methods for the use thereof
US5231017A (en) 1991-05-17 1993-07-27 Solvay Enzymes, Inc. Process for producing ethanol
DE4343591A1 (en) 1993-12-21 1995-06-22 Evotec Biosystems Gmbh Process for the evolutionary design and synthesis of functional polymers based on shape elements and shape codes
US5605793A (en) 1994-02-17 1997-02-25 Affymax Technologies N.V. Methods for in vitro recombination
JP3649338B2 (en) 1994-06-03 2005-05-18 ノボザイムス バイオテック,インコーポレイティド Purified Myserioftra laccase and nucleic acid encoding it
ATE294871T1 (en) 1994-06-30 2005-05-15 Novozymes Biotech Inc NON-TOXIC, NON-TOXIGEN, NON-PATHOGENIC FUSARIUM EXPRESSION SYSTEM AND PROMOTORS AND TERMINATORS FOR USE THEREIN
AU9434398A (en) 1997-10-13 1999-05-03 Novo Nordisk A/S Alpha-amylase mutants
AU6188599A (en) 1998-10-26 2000-05-15 Novozymes A/S Constructing and screening a dna library of interest in filamentous fungal cells
CN1940067A (en) 1999-03-22 2007-04-04 诺沃奇梅兹有限公司 Promoters for expressing genes in a fungal cell
US7314712B2 (en) 2001-07-27 2008-01-01 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Systems for in vivo site-directed mutagenesis using oligonucleotides
ATE418616T2 (en) 2002-01-23 2009-01-15 Royal Nedalco B V FERMENTATION OF PENTOSE SUGAR
JP2005523689A (en) 2002-02-08 2005-08-11 ジェネンコー・インターナショナル・インク Method for producing ethanol from a carbon substrate
WO2004085627A1 (en) 2003-03-26 2004-10-07 Forskarpatent I Syd Ab New saccharomyces cerevisiae strains utilizing xylose
US7968318B2 (en) 2006-06-06 2011-06-28 Genencor International, Inc. Process for conversion of granular starch to ethanol
JP5625199B2 (en) 2008-03-07 2014-11-19 ディーエスエム アイピー アセッツ ビー.ブイ. Pentose sugar fermentation cell
ES2594438T3 (en) 2008-08-20 2016-12-20 Novozymes A/S Processes to produce fermentation products
CA2746818A1 (en) 2008-12-24 2010-07-01 C5 Yeast Company B.V. Xylose isomerase genes and their use in fermentation of pentose sugars
ES2534098T3 (en) 2009-11-30 2015-04-17 Novozymes A/S Polypeptides having glucoamylase activity and polynucleotides encoding them
CN104169417B (en) 2009-12-01 2020-05-08 诺维信公司 Polypeptide with glucoamylase activity and its encoding polynucleotide
US9040280B2 (en) 2009-12-11 2015-05-26 Novozymes A/S Protease variants
CN103189715B (en) 2010-11-05 2015-12-02 松下知识产权经营株式会社 Stereoscopic image processing device and stereoscopic image processing method
WO2012064351A1 (en) 2010-11-08 2012-05-18 Novozymes A/S Polypeptides having glucoamylase activity and polynucleotides encoding same
EP2527448A1 (en) 2011-05-23 2012-11-28 Novozymes A/S Simultaneous site-specific integrations of multiple gene-copies in filamentous fungi
CA2840962C (en) 2011-07-06 2021-04-13 Novozymes A/S Alpha amylase variants and polynucleotides encoding same
AU2013311668B2 (en) * 2012-09-05 2019-02-28 Novozymes A/S Polypeptides having protease activity
CA2918685C (en) * 2013-08-30 2024-01-02 Novozymes A/S Enzyme composition and uses thereof
WO2015197871A1 (en) 2014-06-27 2015-12-30 Dsm Ip Assets B.V. A method for improving the nutritional value of animal feed
US10724054B2 (en) 2015-09-25 2020-07-28 Novozymes A/S Use of serine proteases for improving ethanol yield
EP3487995B1 (en) * 2016-07-21 2021-05-26 Novozymes A/S Serine protease variants and polynucleotides encoding same
WO2018015304A1 (en) * 2016-07-21 2018-01-25 Novozymes A/S Serine protease variants and polynucleotides encoding same

Also Published As

Publication number Publication date
US20220090041A1 (en) 2022-03-24
EP3487996B1 (en) 2024-04-10
DK3487996T5 (en) 2024-09-02
FI3487996T3 (en) 2024-07-10
CN109642225A (en) 2019-04-16
US12291730B2 (en) 2025-05-06
US20210139876A1 (en) 2021-05-13
ES2981748T3 (en) 2024-10-10
US10927361B2 (en) 2021-02-23
CA3028875A1 (en) 2018-01-25
DK3487996T3 (en) 2024-05-21
US11447763B2 (en) 2022-09-20
MX2019000805A (en) 2019-06-20
US20190352629A1 (en) 2019-11-21
WO2018015304A1 (en) 2018-01-25

Similar Documents

Publication Publication Date Title
US12291730B2 (en) Serine protease variants and polynucleotides encoding same
US11203790B2 (en) Glucoamylase variants and polynucleotides encoding same
EP3487995B1 (en) Serine protease variants and polynucleotides encoding same
US10724054B2 (en) Use of serine proteases for improving ethanol yield
CN103930543B (en) Glucoamylase variants and polynucleotides encoding them
CA2961448C (en) Glucoamylase variants and polynucleotides encoding same
US11279921B2 (en) Glucoamylase variants and polynucleotides encoding same
US20200165591A1 (en) Combined use of at least one endo-protease and at least one exo-protease in an ssf process for improving ethanol yield
CA3057896C (en) Glucoamylase variants and polynucleotides encoding same

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: UNKNOWN

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20190221

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

AX Request for extension of the european patent

Extension state: BA ME

DAV Request for validation of the european patent (deleted)
DAX Request for extension of the european patent (deleted)
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: EXAMINATION IS IN PROGRESS

17Q First examination report despatched

Effective date: 20200617

GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: GRANT OF PATENT IS INTENDED

INTG Intention to grant announced

Effective date: 20231102

GRAS Grant fee paid

Free format text: ORIGINAL CODE: EPIDOSNIGR3

GRAA (expected) grant

Free format text: ORIGINAL CODE: 0009210

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE PATENT HAS BEEN GRANTED

AK Designated contracting states

Kind code of ref document: B1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

REG Reference to a national code

Ref country code: GB

Ref legal event code: FG4D

REG Reference to a national code

Ref country code: CH

Ref legal event code: EP

REG Reference to a national code

Ref country code: DE

Ref legal event code: R096

Ref document number: 602017080851

Country of ref document: DE

P01 Opt-out of the competence of the unified patent court (upc) registered

Effective date: 20240403

REG Reference to a national code

Ref country code: IE

Ref legal event code: FG4D

REG Reference to a national code

Ref country code: DK

Ref legal event code: T3

Effective date: 20240516

REG Reference to a national code

Ref country code: FI

Ref legal event code: FGE

REG Reference to a national code

Ref country code: NL

Ref legal event code: FP

REG Reference to a national code

Ref country code: LT

Ref legal event code: MG9D

REG Reference to a national code

Ref country code: DK

Ref legal event code: T5

Effective date: 20240830

REG Reference to a national code

Ref country code: AT

Ref legal event code: MK05

Ref document number: 1674949

Country of ref document: AT

Kind code of ref document: T

Effective date: 20240410

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: IS

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20240810

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: BG

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20240410

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: HR

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20240410

REG Reference to a national code

Ref country code: ES

Ref legal event code: FG2A

Ref document number: 2981748

Country of ref document: ES

Kind code of ref document: T3

Effective date: 20241010

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: GR

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20240711

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: PT

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20240812

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: AT

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20240410

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: PL

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20240410

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: LV

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20240410

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: PT

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20240812

Ref country code: PL

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20240410

Ref country code: NO

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20240710

Ref country code: LV

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20240410

Ref country code: IS

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20240810

Ref country code: HR

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20240410

Ref country code: GR

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20240711

Ref country code: BG

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20240410

Ref country code: AT

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20240410

Ref country code: RS

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20240710

REG Reference to a national code

Ref country code: DE

Ref legal event code: R097

Ref document number: 602017080851

Country of ref document: DE

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: EE

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20240410

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: CZ

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20240410

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: SK

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20240410

Ref country code: RO

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20240410

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: SM

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20240410

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: SM

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20240410

Ref country code: SK

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20240410

Ref country code: RO

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20240410

Ref country code: EE

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20240410

Ref country code: CZ

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20240410

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: IT

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20240410

Ref country code: MC

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20240410

PLBE No opposition filed within time limit

Free format text: ORIGINAL CODE: 0009261

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: NO OPPOSITION FILED WITHIN TIME LIMIT

REG Reference to a national code

Ref country code: CH

Ref legal event code: PL

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: LU

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20240714

26N No opposition filed

Effective date: 20250113

GBPC Gb: european patent ceased through non-payment of renewal fee

Effective date: 20240714

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: LU

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20240714

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: SI

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20240410

Ref country code: CH

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20240731

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: GB

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20240714

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: NL

Payment date: 20250627

Year of fee payment: 9

Ref country code: BE

Payment date: 20250626

Year of fee payment: 9

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: FR

Payment date: 20250623

Year of fee payment: 9

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: IE

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20240714

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: SE

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20240410

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: FI

Payment date: 20250715

Year of fee payment: 9

Ref country code: ES

Payment date: 20250807

Year of fee payment: 9

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: DE

Payment date: 20250618

Year of fee payment: 9

Ref country code: DK

Payment date: 20250714

Year of fee payment: 9

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: CY

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT; INVALID AB INITIO

Effective date: 20170714

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: HU

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT; INVALID AB INITIO

Effective date: 20170714