EP3408284A1 - Detection of an antibody against a pathogen - Google Patents
Detection of an antibody against a pathogenInfo
- Publication number
- EP3408284A1 EP3408284A1 EP17744999.8A EP17744999A EP3408284A1 EP 3408284 A1 EP3408284 A1 EP 3408284A1 EP 17744999 A EP17744999 A EP 17744999A EP 3408284 A1 EP3408284 A1 EP 3408284A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- peptides
- peptide
- antibodies
- antibody
- phage
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C40—COMBINATORIAL TECHNOLOGY
- C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
- C40B30/00—Methods of screening libraries
- C40B30/04—Methods of screening libraries by measuring the ability to specifically bind a target molecule, e.g. antibody-antigen binding, receptor-ligand binding
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1034—Isolating an individual clone by screening libraries
- C12N15/1037—Screening libraries presented on the surface of microorganisms, e.g. phage display, E. coli display
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
Definitions
- Vertebrate immune systems have evolved sophisticated genetic mechanisms to generate T-cell receptor and antibody repertoires, which are combinatorial libraries of affinity molecules capable of distinguishing between self and non-self.
- T-cell receptor and antibody repertoires which are combinatorial libraries of affinity molecules capable of distinguishing between self and non-self.
- pathogens include viruses.
- a host's antibody response is crucial for preventing viral infection, or resolution of infection, as antibodies are produced against many epitopes on multiple virus proteins upon viral contact.
- these processes can go awry when, for example, antibodies recognizing viral peptides cross-react with human antigens and contribute to autoimmune disease.
- Antibodies bind protein antigens by a variety of mechanisms and knowledge of the processes governing these interactions is improving. For instance, it is now understood that antibody binding surfaces on natively folded proteins tend to be dominated by 'discontinuous' epitopes, which are patches of ⁇ 4 to 14 amino acid side chains fonned by two or more noncontiguous peptides brought into proximity during protein folding. If a protein is divided into its constituent peptides, antibody affinity can decrease due to the loss of contacts contributed by noncontiguous residues, and the increased entropic costs of binding a free peptide as opposed to the natively constrained peptide. On the other hand, antibodies targeting nomially inaccessible epitopes can be generated, such as those that recognize proteolytic cleavage products, misfolded proteins or protein aggregates. In
- Described herein is a proteomic technology applying a phage library that can uniformly express peptide libraries, such as the substantially complete human peptidome, or synthetic representations of a substantially complete set of viral peptides known to infect humans.
- peptide libraries such as the substantially complete human peptidome, or synthetic representations of a substantially complete set of viral peptides known to infect humans.
- T7-Pep phage library By- combining T7-Pep phage library with high-throughput DNA sequencing, the described systems and methods allow for a wide variety of high-throughput proteomic investigations, with unprecedented speed, precision, and accuracy.
- the inventors successfully established a complete set of viral peptides containing 79,407 peptide sequences derived from 788 unique viruses, encompassing over 2.01 species, 67 genera, and 29 families of viruses.
- phage libraries and methods for use including, but not limited to, methods for detecting an antibody against a virus, methods for identifying a viral cause of disease, and methods for improving vaccine design.
- One aspect provided herein relates to a method for detecting an antibody against a pathogen in a subject, the method comprising; (a) contacting a reaction sample comprising a display library with a biological sample comprising antibodies, wherein the display library comprises a plurality of peptides derived from a plurality of pathogens, and (b) detecting a peptide bound to at least one antibody, thereby detecting an antibody capable of binding the peptide.
- the plurality of pathogens is a plurality of viruses, bacteria or fungi.
- the display library is a phage display library.
- the antibodies in the reaction sample are immobilized.
- the antibodies are immobilized to a solid support adapted for binding IgM, IgA, or IgG subclasses.
- the antibodies are immobilized by contacting the display library and antibodies from the biological sample with Protein A and/or Protein G.
- the method further comprises removing unbound antibody and peptides of the display library.
- the plurality of peptides are each less than 100, 200, 300, 500, 500, 600, 700, 800, or 900 amino acids long,
- the plurality of peptides are each less than 75 amino acids long.
- each peptide of the plurality of peptides comprises a common adapter region appended to the end of the nucleic acid sequence encoding the peptide.
- the detection of the at least one peptide comprises a step of lysing the phage and amplifying the DNA.
- At least two antibodies are detected.
- at least two peptides are detected.
- the at least two antibodies are detected simultaneously.
- the at least two peptides are detected simultaneously.
- antibodies from the biological samples are immobilized.
- the display library comprises at least 2 peptides from Table 4.
- the display library comprises at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1000, at least 2000, at least 3000, at least 4000, at least 5000 peptides or more as selected in any desired combination from Table 4.
- the display library comprises all of the peptides in Table 4.
- the display library can comprise peptides from at least 1 family (e.g., human herpesvirus) or sub-family (e.g., human herpesvirus 5) of related viruses.
- the display library can comprise peptides from at least 2 families, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 peptides from at least 1 family (e.g., human herpesvirus) or sub-family (e.g., human herpesvirus 5) of viruses from Table 4, in any desired combination.
- the display library comprises peptides from each of the viral families or subfamilies in Table 4.
- Another aspect provided herein relates to a method for identifying a pathogenic component in a disease, the method comprising: (a) obtaining a biological sample from a plurality of subjects having a common disease, wherein the common disease is suspected of having a pathogenic component, (b) separately contacting each sample of a plurality of reaction samples with each biological sample under conditions that allow formation of at least one antibody-peptide complex, wherein the reaction samples each comprise a display library comprising a plurality of peptides derived from a plurality of pathogens, (c) isolating the at least one antibody-peptide complex formed in each reaction sample from unbound phage, (d) correlating at least one peptide in the at least one antibody-peptide complex in each reaction sample to the pathogen from which it is derived, and (e) identifying a pathogen that is significantly enriched in the plurality of subjects with disease compared to
- the plurality of pathogens is a plurality of viruses, bacteria or fungi
- the display library is a phage display library.
- the antibodies in the reaction sample are immobilized.
- the antibodies are immobilized to a solid support adapted for binding IgM, IgA, or IgG subclasses.
- the antibodies are immobilized by contacting the display library and antibodies from the biological sample with Protein A and/or Protein G.
- Protein A and/or Protein G are immobilized to a solid support
- the plurality of peptides are each less than 100, 200, 300, 400, 500, 600, 700, 800 or 900 amino acids long.
- the plurality of peptides are each less than 75 amino acids long.
- each peptide of the plurality of peptides comprises a common adapter region appended to the end of the nucleic acid sequence encoding the peptide.
- correlating the at least one peptide comprises a step of ly sing the phage and amplifying the DNA.
- At least two peptides are detected.
- the at least two peptides are detected simultaneously.
- the common disease comprises disease selected from the group consisting of: Kawasaki Disease, Bell's Palsy, Meniere's Disease, Type I diabetes, juvenile idiopathic arthritis, Chronic Fatigue Syndrome, Gulf War Illness, Myasthenia Gravis, and IgG4 disease.
- the method further comprises identifying the epitope to which the antibody binds.
- the method further comprises determining whether the antibody cross-reacts with an autoimmune antigen in the subject.
- Another aspect provided herein relates to a method for improving vaccine design, the method comprising: (a) obtaining a biological sample from a plurality of subjects exposed to a pathogen, (b) separately contacting each sample of a plurality of reaction samples with each biological sample under conditions that allow formation of at least one antibody-peptide complex, wherein the reaction samples each comprise a display library compri sing a plurality of peptides derived from a plurality of pathogens, (c) isolating the at least one antibody-peptide complex formed in each reaction sample from unbound phage, (d) correlating at least one peptide in the at least one antibody-peptide complex in each reaction sample to the pathogen from which it is derived, and (e) identifying an antigenic peptide that is significantly enriched in the plurality of subjects exposed to the pathogen as compared to subjects that have not been exposed to the pathogen for use in designing an improved vaccine.
- the plurality of pathogens is a plurality of viruses, bacteria or fungi.
- the display library is a phage display library.
- the antibodies in the reaction sample are immobilized.
- the antibodies are immobilized to a solid support adapted for binding IgM, IgA, or IgG subclasses.
- the antibodies are immobilized by contacting the display library and antibodies from the biological sample with Protein A and/or Protein G.
- Protein A and/or Protein G are immobilized to a solid support.
- the plurality ' of peptides are each less than 100 amino acids long.
- the plurality of peptides are each less than 75 amino acids long.
- each peptide of the plurality of peptides comprises a common adapter region appended to the end of the nucleic acid sequence encoding the peptide.
- the detection of the antigenic peptide compri ses a step of lysing the phage and amplifying the DNA.
- At least two antibodies are detected.
- the at least two antibodies are detected simultaneously.
- the display library comprises at least 2 peptides from Table 4.
- the display library comprises at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1000, at least 2000, at least 3000, at least 4000, at least 5000 peptides or more as selected in any desired combination from Table 4.
- the display library comprises all of the peptides in Table 4.
- the display library can comprise peptides from at least 1 family (e.g., human heipesvims) or sub-family (e.g., human herpesvirus 5) of related viruses.
- the display library can comprise peptides from at least 2 families, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 peptides from at least 1 family (e.g., human herpesvirus) or sub-family (e.g., human herpesvirus 5) of viruses from Table 4, in any desired combination.
- the display library comprises peptides from each of the viral families or subfamilies in Table 4.
- a phage librar ' displaying a plurality of viral peptides, wherein the plurality of viral peptides represent a set of peptides from viruses known to mfect humans.
- the phage library comprises a plurality of viral peptides from at least 3 viruses known to infect humans.
- the phage library comprises a plurality of viral peptides from at least 10 viruses known to infect humans.
- the phage library comprises a plurality of viral peptides from at least 20 viruses known to infect humans.
- the phage library comprises at least 10 peptide sequences.
- the phage library comprises at least 20 peptide sequences.
- the plurality of peptides are each less than 100 amino acids long.
- the plurality of peptides are each less than 75 amino acids long.
- each peptide of the plurality of peptides comprises a common adapter region appended to the end of the nucleic acid sequence encoding the peptide.
- the plurality of peptides are immunodominant epitopes.
- the display library comprises at least 2 peptides from Table 4.
- the display library comprises at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1000, at least 2000, at least 3000, at least 4000, at least 5000 peptides or more as selected in any desired combination from.
- Table 4 comprises all of the peptides in Table 4.
- the display library can comprise peptides from at least 1 family (e.g., human herpesvirus) or sub-family (e.g., human herpesvirus 5) of related viruses.
- the display library can comprise peptides from at least 2 families, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 peptides from at least 1 family (e.g., human herpesvirus) or sub-family (e.g., human herpesvirus 5) of viruses from. Table 4, in any desired combination.
- the display library comprises peptides from each of the viral families or subfamilies in Table 4.
- FIGs. 1A-1C show the fold enrichment of each peptide in each of two pull-downs with (FIG. I A) the same donor serum or (FIG. IB) the sera of two different donors (FIG. IC) illustration of process (from Benjamin, et l. Nature Biotechnology 29: 535-541 (2011)).
- FIG. 2 is a heatmap showing the distribution of responses to viruses across different patient samples. The percentage of peptides from a particular virus that were determined to be significantly enriched in that particular sample.
- FIGs. 3A-3D Using a library of peptides encoded by the human genome, the
- FIGs. 3A, 3B Inventors identified an epitope in multiple sclerosis patients known to cross-react with a portion of the EBV BRRF2 protein (FIGs. 3A, 3B) inset, black squares indicates the patient, columns, has a response against the peptide, row, containing the epitope).
- the Inventors also detected strong responses against this epitope, found in two peptides (BRRF2 A and BRRF2 B), in all three of samples from patients with multiple sclerosis who had previously been confirmed to have cross-reacting antibody responses (MS 2430 2, MS2430 1, and MS_5826_1).
- FIG. 3C ClustalW alignment is shown along with
- FIG. 3D MEME-generated seven-element motif.
- FIGs. 4A-4E show a general VirScan analysis of the human virome.
- the virome peptide library consists of 93,904 56 amino acid peptides tiling, with 28 amino acid overlap, across the proteomes of ail known human viruses. 200 nt DNA sequences encoding the peptides were printed on a releasable DNA microarray. The released DNA was amplified and cloned into a T7 phage display vector and packaged into virus particles displaying the encoded peptide on its surface. The libraiy is mixed with a sample containing antibodies that bind to their cognate peptide antigen on the phage surface.
- FIG. 4A Antibody profile of randomly chosen group of donors to show typical assay results. Each row is a vims, each column is a sample. The label above each chart indicates whether the donors are over 10 years of age or at most 10 years of age. The intensity of each cell indicates the number of peptides from the virus that were significantly enriched by antibodies in the sample.
- FIG. 4C Overlap between enriched peptides detected by VirScan and human B cell epitopes in IEDB from common human viruses. The regions represent the same values as in (FIG. 4B) except only epitopes corresponding to the indicated vims are considered, and only peptides from that virus that were enriched in at least two samples were considered.
- FIG. 4D Distribution of number of viruses detected in each sample. The histogram depicts the frequency of samples binned by the number of vims species detected by VirScan. The mean and median of the distribution are both approximately 1 1 virus species.
- FIG. 4E Frequently observed virus exposures. The " %' column indicates the percentage of samples that were positive for the virus by VirScan. Known HIV and HCV positive samples were excluded when performing this analysis.
- FIGs. 5A-5E show a population stratification of the human virome immune response.
- the bar graphs depict the differences in exposure to viruses between donors who are (FIG. 5A) children less than ten years of age versus adults over ten years of age, (FIG. SB) HIV positive versus HIV negative, (FIG. 5C) residing in Peru versus residing in the United States, (FIG. 5D) residing in South Africa versus residing in the United States, and (FIG. SE) residing in Thailand versus residing in the United States. Asterisks indicate false discovery rate ⁇ 0.05.
- FIGs. 6A-6C show data indicating that the human anti-virome response recognizes a similar spectrum of peptides among infected individuals.
- each row is a peptide tiling across the entire indicated protein and each column is a sample.
- Hie samples shown are a subset of individuals with antibodies to at least one peptide from the proteins indicated.
- the intensity of each cell corresponds to the -logio(p-value) measure of significance of enrichment for a peptide in a sample (greater values indicates stronger antibody response). Data are shown for (FIG.
- FIG. 6A Human respiratory syncytial virus Attachment Glycoprotein G (G),
- FIG. 6B Human adenovirus C penton protein (L2), and
- FIG. 6C Epstein-Barr virus nuclear antigen 1 (EBNA1). Data shown are the mean of two replicates.
- FIGs. 7A-7C Recognition of common epitopes within an immunogenic peptide from human adenovirus C penton protein (L2) across individuals. Each row is a sample. Each column denotes the first mutated position for the (FIG. 7A) single-, (FIG. 7B) double-, and (FIG. 7C) triple- alanine mutant peptide scanning through. The intensity of each cell indicates the enrichment of the mutant peptide relative to the wild-type. For double-mutants, the last position is blank. The same is true for the last two positions for triple-mutants. Data shown are the mean of two replicates.
- FIG. 8 Reproducibility threshold. Scatterplot for median and median absolute deviation of replicate 2 -logio(p-values) whose replicate 1 -logio(p-value) falls within the window whose left edge is shown on the horizontal axis.
- FIG. 9 Distribution of reproducibility threshold -logio(p-values). Histogram of the frequency of the reproducibility threshold -logio(p-values). The mean and median of the distribution are both approximately 2.3.
- FIG. 10 Correlation between virus size and number of enriched peptides. Each dot on this log-log scatterplot is a virus. The horizontal axis corresponds to the size of the virus in number of peptides. The vertical axis corresponds to the average number of peptides enriched from the virus across all samples tested. The dashed Sine is a least-squares best-fit curve for the data.
- FIGs. 11A-11B Amino acid composition of enriched peptides.
- FIG. 11 A Bar graph of the fractional abundance of each amino acid in the entire virome peptide library or peptides enriched in at least 2 samples.
- FIG. 11B Bar graph of the fractional abundance of each amino acid in peptides enriched in at least 2 samples subtracted by the abundance in the entire library.
- FIGs. 12A-12C Influenza A: hem agglutinin (UniProt IB: II8PET1, positions 1-
- FIGs. 13A-13C Respiratory syncytial virus: attachment G glycoprotein (UniProt
- FIGs. 14A-14C Enterovirus B: ge nome polyprotein (UniProt ID: Q6647 4, positions 561-616) Scanning mutagenesis identification of linear B cell epitopes in an immunogenic peptide from human viral proteins. Each row is a sample. Each column denotes the first mutated position for (FIG. 14A) single-, (FIG. 14B) double-, and (FIG. 14C) triple-alanine mutant peptides. The intensity of each cell indicates the enrichment of the mutant peptide relative to the wild-type. For double-mutants, the last position is blank. The same is true for the last two positions for triple- mutants. Data shown are the mean of two replicates.
- FIGs. 15A-15C Enterovirus B: geno me polyprotein (UniProt ID: Q6W9F9, positions 1429-1484) Scanning mutagenesis identification of linear B ceil epitopes in an immunogenic peptide from human viral proteins. Each row is a sample. Each column denotes the first mutated position for (FIG. SA) single-, (FIG. 1.5B) double-, and (FIG. 1.5C) triple-alanine mutant peptides. The intensity of each cell indicates the enrichment of the mutant peptide relative to the wild- type. For double-mutants, the last position is blank. The same is true for the last two positions for triple -mutants. Data shown are the mean of two replicates.
- FIGs. 16A-16C Rhinov irus A: genom e polyprotein (UniProt ID: Q8212 2, positions 561-616) Scanning mutagenesis identification of linear B cell epitopes in an immunogenic peptide from human viral proteins. Each row is a sample. Each column denotes the first mutated position for (FIG. 16 A) single-, (FIG. 16B) double-, and (FIG. 16C) triple-alanine mutant peptides. The intensity of each cell indicates the enrichment of the mutant peptide relative to the wild-type. For double-mutants, the last position is blank. The same is true for the last two positions for triple- mutants. Data shown are the mean of two replicates.
- FIGs. 17A-17C Epstein-Barr virus: nuclear antigen l(UniProt ID: Ql HVF7, positions 393-448) Scanning mutagenesis identification of linear B cell epitopes in an immunogenic peptide from human viral proteins. Each row is a sample. Each column denotes the first mutated position for (FIG. 17A) single-, (FIG. 17B) double-, and (FIG. 17C) tnpie-aianme mutant peptides. The intensity of each cell indicates the enrichment of the mutant peptide relative to the wild-type. For double-mutants, the last position is blank. The same is true for the last two positions for triple- mutants. Data shown are the mean of two replicates.
- FIGs. 18A-18C Adenovirus C: precapsid vertex protein (UniProt ID: P03279 , positions 533-585) Scanning mutagenesis identification of linear B cell epitopes in an immunogenic peptide from human viral proteins. Each row is a sample. Each column denotes the first mutated position for (FIG. ISA) single-, (FIG. 8B) double-, and (FIG. 18C) triple-alanine mutant peptides. The intensity of each cell indicates the enrichment of the mutant peptide relative to the wild-type. For double-mutants, the last position is blank. The same is true for the last two positions for triple- mutants. Data shown are the mean of two replicates.
- FIGs. 19A-1.9C Zero inflated generalized poisson (ZIGP) parameters regressed on input count (FIG. 19A, theta parameter; FIG. 19B, lambda parameter; FIG. 19C, pi parameter).
- ZIGP generalized poisson
- FIG. 19A theta parameter
- FIG. 19B lambda parameter
- FIG. 19C pi parameter
- Each scatter plot depicts the maximum likelihood estimates for the ZIGP parameters as a function of the input count (horizontal axis). Dashed lines are least-squares linear regressions for ⁇ and ⁇ , and least- squares exponential regression for ⁇ .
- FIG. 20 Proteome-wide detection of antibodies to Chlamydia trachomatis. Each box represents the number of peptides from a given protein (listed on the x-axis) enriched by the serum of a given donor (listed on the y-axis).
- FIG. 21 The detection of antibodies to Pneumococcal histidine triad D, Each row represents a 56 amino acid peptide tiling across the protein while each column is a serum donor.
- the values in the heatmap show the -log 10 of the pvaiue of enrichment of a given peptide by the donor seram.
- FIG. 22 The detection of antibodies to Triticum aestivum (Wheat) glutenin. Each row represents a 56 amino acid peptide tiling across the protein while each column is a serum donor. Hie values in the heatmap show the -log 10 of the pvaiue of enrichment of a given peptide by the donor serum.
- FIG. 23 The detection of antibodies to Bos taurus (Bovine) Kappa-casein .
- Each row represents a 56 amino acid peptide tiling across the protein while each column is a serum donor.
- the values in the heatmap show the -log 10 of the pvaiue of enrichment of a given peptide by the donor serum.
- FIGs. 24A-24F Longitudinal profiling of anti-viral antibodies. The panels show the number of enriched peptides from human herpesvirus 1(FIG. 24A), human herpesvirus 5 (FIG. 24B), human adenovirus C (FIG. 24C), human respiratory syncytial virus (FIG. 24D), rubella virus (FIG.
- representations of a complete set of viral peptides can be generated, such as a set of viral peptides derived from viruses known to infect humans.
- One aspect of the present technology is that unlike existing phage display techniques which rely on cDNA, programmable microarrays enable construction of a starting library that is uniformly distributed.
- the synthetic programmable microarray approach eliminates skewed initial distributions in cDNA libraries resulting from incorrect reading frame or differential gene expression obstacles, which ultimately hamper accurate detection of peptide enrichment.
- the programmable microarray approach compares favorably to traditional Sanger sequencing or microarray hybridization techniques, as high throughput phage immunoprecipitation sequencing (PhlP-Seq) allows sensitive detection for a larger number of library members and with a wider dynamic range.
- a key aspect of the present invention is extending the programmable microarray technique to include peptides from the protein sequences of viruses, including those that infect humans.
- Viruses play an important role in the pathogenesis of various human diseases and antiviral antibody responses can be very strong, essentially providing a persistent, but subtle antibody host signature for detection.
- host generated antibodies can neutralize viral particles and stop infection by interfering with virion binding to receptors, blocking uptake into cells, preventing uncoating of the genomes in endosomes, or causing aggregation of virus particles.
- enveloped viruses are lysed when antiviral antibodies and serum, complement disrupt membranes.
- non-neutralizing antibodies that bind specifically to vims particles, but do not neutralize infectivity may actually enhance infectivity due to antibodies that interact with receptors on macrophages, resulting in virus-antibody complex being brought into the ceil by endocytosis. Viral replication then proceeds, as the antibody does not block infectivity, and this pathway may allow entry into cells which normally do not bear specific virus receptors.
- host generated antibodies recognizing viral peptides can cross-react with human self-antigens, contributing to the establishment and progression of autoimmune disease. Each of these mechanisms plays a vital role in accounting for the potentiality of disease and/or dysfunction caused by viral exposure ,
- phage display libraries While the disclosure specifically recites phage display libraries, it is specifically contemplated herein that other display libraries can be used with the methods and assays described herein including, but not limited to, a yeast display library, a bacterial display library, a retroviral display library, a ribosome display library or an mRNA display library. It is within the skills of one of ordinar ' skill in the art to apply the methods and assays exemplified herein using a phage display library to the use of a different type of display library.
- the term "display library” refers to a library comprising a plurality of peptides derived from a plurality of pathogens that are displayed on the surface of a virus or cell e.g., bacteriophage, yeast, or bacteria. Methods for using such phage, yeast or bacterial display libraries are well known to those of skill in the art .
- common disease refers to a subset of subjects having the same or substantially similar diseases; that is, the subjects have the same disease "in common.”
- antibody-peptide complex refers to a complex formed when an antibody recognizes an epitope on a peptide and binds to the epitope under low or normal stringent conditions. It will be appreciated that an antibody-peptide complex can dissociate under high stringent conditions, such as low or high H, or high temperatures.
- the term "to the pathogen from w r hich it is derived” refers to a step of correlating or mapping at least one peptide in an antibody-peptide complex to a sequence in the known sequences of the viruses, thereby identifying the pathogen that comprises the peptide sequence.
- the term "enriched" indicates that peptides from a given pathogen are represented at a higher proportion in a population of subjects having a common disease or exposed to a pathogen as compared to the general population or a population lacking the common disease or pathogen exposure.
- the peptides from a given pathogen in die population of subjects having a common disease are enriched by at least 10% as compared to the general population.
- the peptides for a given pathogen are enriched by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, at least 1-fold, at least 2-fold, at least 5-fold, at least 10-fold, at least 25-fold, at least 50-fold, at least 100-fold, at least 1000-fold, or more, compared to the general population.
- oligonucleotide primers refers to nucleic acid sequences that are 5 to 100 nucleotides in length, preferably from. 17 to 45 nucleotides, although primers of different length are of use. Primers for synthesizing cDNAs are preferably 10-45 nucleotides, while primers for amplification are preferably about 17-25 nucleotides. Primers useful in the methods described herein are also designed to have a particular melting temperature (Tm) by the method of melting temperature estimation.
- Tm melting temperature
- the Tm of an amplification primer useful according to the invention is preferably between about 45 and 65°C. In other embodiments, the Tm of the amplification primer is between about 50 and 60°C.
- sample refers to a biological material which is isolated from its natural environment and contains at least one antibody
- a sample according to the methods described herein may consist of purified or isolated antibody, or it may comprise a biological sample such as a tissue sample, a biological fluid sample, or a cell sample comprising an antibody.
- a biological fluid includes, but is not limited to, blood, plasma, sputum, urine, cerebrospinal fluid, lavages, and leukophoresis samples, for example.
- the term "adapter sequence” refers to a nucleic acid sequence appended to a nucleic acid sequence encoding a phage-displayed peptide.
- the identical adaptor sequence is appended to the end of each phage-displayed peptide in the phage display library; that is, the adaptor sequence is a common sequence on each nucleic acid of the plurality of nucleic acids encoding a peptide in the phage display library.
- the adaptor sequence is of sufficient length to permit annealing of a common PCR primer.
- adaptor sequences useful with the methods described herein are preferably heterologous or artificial nucleotide sequences of at least 15, and preferably 20 to 30 nucleotides in length.
- An adaptor sequence as described herein can be, but is not necessarily random.
- compositions, methods, and respective components thereof as described herein, which are exclusive of any element not recited in that description of the embodiment.
- Pathogens Provided herein are phage display libraries that comprise a plurality of peptides derived from one or more pathogens.
- pathogen refers to an organism, including a microorganism, which causes disease in another organism, (e.g., animals and plants) by directly infecting the other organism, or by producing agents that causes disease in another organism (e.g., bacteria that produce pathogenic toxins and the like).
- pathogens include, but are not limited to bacteria, protozoa, fungi, nematodes, viroids and viruses, or any combination thereof, wherein each pathogen is capable, either by itself or in concert with another pathogen, of eliciting disease in vertebrates including but not limited to mammals, and including but not limited to humans.
- pathogen also encompasses microorganisms which may not ordinarily be pathogenic in a non- immunocompromised host.
- viral pathogens include Herpes simplex virus (HSV) l , HSV2, Epstein Barr virus (EBV), cytomegalovirus (CMV), human Herpes virus (HHV) 6, HHV7, HHV8, Varicella zoster virus (VZV), hepatitis C, hepatitis B, adenovirus.
- HSV Herpes simplex virus
- EBV Epstein Barr virus
- CMV human Herpes virus
- HHV human Herpes virus
- VZV Varicella zoster virus
- hepatitis C hepatitis B
- adenovirus Eastern Equine Encephalitis Virus
- WNE West Nile vims
- JC vims JC vims
- B V BK virus
- microorganism includes prokaryotic and eukaryotic microbial species from the Domains of Archaea, Bacteria and Eucarya, the latter including yeast and filamentous fungi, protozoa, algae, or higher Protista.
- microbial cells and “microbes” are used interchangeably with the term microorganism.
- Bacteria refers to a domain of prokaryotic organisms. Bacteria include at least 1 1 distinct groups as follows: (1) Gram-positive (gram+) bacteria, of which there are two major subdivisions: (i) high G+C group (Actinomycetes, Mycobacteria, Micrococcus, others) (ii) low G+C group (Bacillus, Clostridia, Lactobacillus, Staphylococci, Streptococci, Mycoplasmas); (2) Proteobacteria, e.g., Purple photosynthetic+non-photosynthetic Gram-negative bacteria (includes most "common” Gram-negative bacteria); (3) Cyanobacteria, e.g., oxygenic phototrophs: (4) Spirochetes and related species; (5) Planctomyces; (6) Bacteroides, Flavobacteria; (7) Chlamydia; (8) Green sulfur bacteria; (9) Green
- Gram-negative bacteria include cocci, nonenteric rods, and enteric rods.
- the genera of Gram-negative bacteria include, for example, Neisseria, Spirillum, Pasteurella, Brucella, Yersinia, Francisella, Haemophilus, Bordetella, Escherichia, Salmonella, Shigella, Klebsiella, Proteus, Vibrio, Pseuaomonas, Bacteroides, Aceiobacler, Aerobacler, Agrobacterium, Azotobacier, Spirilla, Serratia, Vibrio, Rhizobium, Chlamydia, Rickettsia, Treponema, and Fiisobacterium.
- Gram-positive bacteria include cocci, nonsporulating rods, and sporulatmg rods.
- Gram-positive bacteria include, for example, Actinomyces, Bacillus, Clostridium, Corynebacterium, Erysipeloihrix, Lactobacillus, Listeria, Mycobacterium, Myxococcus, Nocardia, Staphylococcus, Streptococcus, and Streptomyces .
- the methods described herein can be used io generate a phage display library comprising peptides from pathogens including, but not limited to pathogens from any of the following genera of viruses: Adenoviridae, Alfamovirus, Ailexivirus, Allolevivirus, Alphacryptovirus, Alphaherpesvirinae, Alphanodavirus , Alpharetrovieris, Alphavirus, Aphthovirus, Apscaviroid, Aquahirnavirus, Aquareovirus, Arenaviridae, Arenavirus, Arteriviridae, Arterivirus, Ascoviridae, Ascovirus, Asjarviridae, Asfivirus, Astroviridae, Astrovirus, Aureusvirus, Avenavirus, Avi adenovirus, Avibirnaviras, Avihepadnavirus, Avipoxvir s, Avsunviroia, Avsunviroidae, Baculoviridae, Badnavirus, Barnavi
- Hepatovirus Herpesviridae, Hordeivirus, Hostuviroid, Hypoviridae, Hypovieris, Ichnovirus, "lctalurid herpes-like viruses, " Idaeovirus, Ilarvirus, “Infectious laryngotrache His -like viruses, " Influenzavirus A, Influenzavirus B, Influenzavirus C, Inoviridae, Inovirus, Ipomovirus, Iridoviridae, Iridovirus, Iteravirus, "L5-like viruses, " Ixigovirus, “-like viruses, " Leishmaniavirus, Lentivirus, Leporipoxvirus, Leviviridae, Levivirus, Lipothrixviridae, Lipoihrixvirus, Luteoviridae, Luteovims, Lymphocryptovirus, Lymphocystivirus, Lyssavirus, Machlomovirus, Macluravirus, Marafivirus, “Marburg-like viruses, " "
- Parapoxvirus Parechovirus, Partitiviridae, Partitivirus, Parvoviridae, Parvovirinae, Parvovirus, Pecluvirus, Pelamoviroid, Pestivirus, "Petunia vein clearing-like viruses, " Phaeovirus, “-29 -like viruses, " "-H-like viruses, " Phlebovirus, Phycodnaviridae, Phytoreovirus, Picornaviridae, Plasmaviridae, Plasmavirus, Plectrovirus, Pneumovirinae, Pneumovirus, Podoviridae, Polerovirus, Polydnaviridae, Polyomaviridae, Polyomavirus, Pomovirus, Pospiviroid, Pospiviroidae, Potexvirus, Potyviridae, Potyvirus, Poxyiridae, Prasinovirus, Prions, Prymnesiovirus, Pseudoviridae, Pseudo
- phage display library comprising peptides derived from pathogens including, but not limited to, pathogens from any of the following genera of the domain of Bacteria (or Eubacteria): Abiotrophia, Acetiiomaculum, Acetivibrio, Acetoanaerobium, Acetobacter, Acetobacterium, Acetofllamentum, Acetogenium, Acetohalobium, Acetomicrohium, Acetonema, Acetothermus, Acholeplasma, Achromatium, A chromobacter, A cidaminobacter, Acidaminococcus, Acidimicrobium, Acidiphilium, Acidisphaera, Acidithiobacillus, Acidobacterium, Aciaocella, Acidomonas, Acidothermus, Acidovorax, Acinetobacter, Acrocarpospora.
- Actinoalloteichus Actinobacillus, Actinobacuium.
- Actinobispora Actinocorallia, Actinokineospora, Actinomadura, Actinomyces, Actinoplan.es, Actinopolymorpha.
- Actinopolyspora Actinopycnidium, Actinosporangium, A ctinosynnema, A egyptianella.
- Alishewanella Alistipes, Alkalibacterium, Alkalilimnicola, Alkaliphilus, Alkalispirilliim, Alkanindiges, Allisonella, Allochromcithim, Allojiistis, Alloiococcus, Allornorias, Allorkizobium, Alterococcus, Alteromonas, Alysiella, Arnaricoccus, Amiriobacter, Aminohacteriurn, Arninomonas, Ammonifex, Amrnoniphilus, Amoebobacter. Amorphosphorangium, Amphi bacillus.
- Ampullariella Amycolata, Amycoiatopsis, Anaeroarcus, Anaerobacter, Anaerobacidum, Anaerobiospirillum, Anaerooranca, Anaerococcus, Anaerofilum, Anaeroglobus, Anaerolinea, Anaeromiisa, Anaeromyxobacter, Anaerophaga, Anaeroplasma, Anaerorhabdus, Anaerosinus, Anaerostipes, Anaerovibrio, Anaerovorax, Anaplasma, Ancalochloris, Ancalomicrobium, Ancylobacter, Aneurinibacillus, Angiococcus, Angulomicrobium, Anoxybacillus, Anoxynatronum, Antarctobacter, Aquabacter, Aquabacterium, Aquamicrohium, Aquaspirillurn, Aquifex, Arachnia, Arcanobacterium, Arch ngium, Arcobacter, Arenib cter,
- Desulfomusa Desulfonatronovibrio, Desulfonatronum, Desulfonauticiis, Desulfonema, Desulfonispora, Desulforegula, Desulforhabdiis, Desuiforhopalus, Desulfosarcina, Desulfospira, Desiilfosporosiniis, Desidfotalea, Desiilfotignum, Desiiljbtomaciilum, Desulfovibrio, Desulfovirga, Desulfurella, Desulfurobacierium, Desidfiirornonas, Desidfuromusa, Dethiosiilfovibrio, Devosia.
- Dialister Diaphorobacter, Dichelobacter, Dichotomicrobium, Dictyoglomus, Dietzia, Diplocalyx, Dolosicocciis, Dolosigranulum, Dorea, Duganelia, Dyadobacter, Dysgonomonas, Ectothiorhodospira, Edwardsielia, EggertheUa, Ehrlichia, Eikenella, Elytrosporangium, Ernpedobacter, Enhydrobacter, Enhygrornyxa, Ensifer, Enterobacter, Enter ococcus, Enterovibrio, Entomoplasma, Eperythrozoon, Eremococcus, Erwinia, Erysipelothrix, Erythrobacter, Erythromicrobium, Erythromonas, Escherichia, Eubacterium, Ewingella, Excellospora, Exiguohacterium, Fackiamia, Faecalihacterium,
- Fiavimonas Flavobacterium, Flectobacilius, Fiexibacter, Flexistipes, Flexithrix, Fluoribacter, Formivihrio, Francisella, Frankia, Frateuria, Friedmanniella, Frigoribacterium, Fulvimarina, Fulvimonas, Fundihacter, Fusibacter, Fusobacterium, Gallibacterium, Gallicola, Gallionella, Garciella, Gardnerella, Gelidibacter, Gelria, Gemella, Gemmata, Gemmatimonas, Gemmiger, Gemmobacter, Geobacillus, Geobacter, Geodermatophilus, Georgenia, Geothrix, Geotoga, Geovibrio, Glaciecola, Globicatella, Gluconacetobacter, Gluconoacetobacter, Gluconobacter, Glycomyces, Gordoma, Gordonia, Gracilibacillus, Grahamella, Grariulicatella, Grimontia, Haemobartonella,
- Moellerella Mogibacterium, Moorella. Moraxella. Morganella, Moritella, Morococcus, Muricauda, Muricoccus, Mycetocola, Mycobacterium, Mycoplana, Mycoplasma, Myroides, Myxococcus, Nannocystis, Natroniella, Natronincoia, Natronoincola, Nautilia, Neisseria, Neochlamydia, Neorickettsia, Neptunomonas, N ester enkonia, Nevskia, Nitrobacter, Niirococcus, Nitrosococcus, Nitrosolobus, N trosomonas.
- Nitrosospira Nitrospina, Nitrospira, Nocardia, Nocardioides, Nocardiopsis, Nonomiiraea, Nonomuria, Novosphingobium, Obesumbacterium, Oceanicaulis, Oceanimonas, Oceanisphaera, Oceanithermus, Oceanobacillus, Oceanobacter, Oceano onas, Oceanospirillum, Ochrobactrum, Octadecahacter, Oenococcus, Oerskovia, Okibacterium, Oleiphilus.
- Oleispira Oligella, Oligotrophia, Olsenella, Opitutus, Orenia, Oribaculum, Orientia, Ornithinicoccus, Ornithinimicrobium, Ornithobacterium, Oscillochloris, Oscillospira, Oxalicibacterium, Oxalobacter, Oxalophagus, Oxobacter, Paenibacillus, Pandoraea, Pannonibacter, Pantoea, PapiHibacter, Parachlamyaia, Paracoccus, Paracraurococcus, Paralactobacillus, Paraliobacillus, Parascardovia, Parvularcula.
- Pasteurella Pasteuria, Paucimonas, Pectinatus, Pectobactermm, Pediococcus, Pedobacter, Pedomicrobium, Pelczaria, PeUstega, Pelobacter, Pelodictyon, Pelospora, Pelotomaculum, Peptococcus, Peptoniphilus, Pepiostreptococcus, Persephonella, Persicobacter, Petrotoga, Pfermigia, Phaeospirillum, Phascolarctobacterium, Pheriylobacterium, Phocoenobacter, Photobactervum, Photorhabdus, Phyllobacterium, Pigmentiphaga, Pilimelia, Pillotma, Pimelobacter, Pirella, Pirellula, Piscirickettsia, Planctomyces, Planktothricoides, Planktothrix, Planobispora, Planococcus, Planomicrobium, Planomono
- Prochlorococcus Prochloron, Prochlorothrix.
- Prolinoborus Promicromonospora, Propionibacter, Propionibacterium, Propionicimonas, Propicmiferax, Propionigenium, Propionimicrobium, Propionispira, Propionispora, Propionivibrio, Prosthecobacter, Prosthecochloris, Prosthecornicrobiu , Proteus, Protomonas, Providencia, Pseudaminobacter, Pseudoalteromonas, Pseudoamycolata, Pseudobiityrivibrio, P eudocaedibacter, Pseudomonas, Pseudonocardia, Pseudoramibacter, Pseudorhodohacter, Pseudospirillum, Pseudoxanthomona
- Saccharopolyspora Saccharospirillum, Saccharothrix, Sagittula, Salana, Salegentibacter, Salibacillus, Salinibacter, Salinibacterium, Salinicoccus, Salinisphaera, Salinivibrio, Salmonella, Samsonia, Sandaracinobacter, Sanguibacter, Saprospira, Sarcina, Sarcobium, Scardovia, Schineria, Schlegelella, Schwartzia, Sebalaella, Sedimentibacter, Selenihalanaerobacier, Selenomonas, Seliberia, Serpens, Serpula.
- Serpulina Serratia, Shewanella, Shigella, Shuttleworthia, Silicibacter, Simkania, Simonsiella, Sinorhizobium, Skermanella, Skermania, Slackia, Smithella, Sneathia, Sodalis, Soehngenia, Solirubrobacter, Solobacterium, Sphaerobacter, Sphaerotilus, Sphingobacterium, Sphingobiurn, Sphingomonas, Sphingopyxis, SpirUliplanes, SpiriUospora, Spirillum. Spirochaeta, Spiroplasma, Spirosoma, Sporanaerobacter.
- ViteUibacter, Vitreosalla, Voge sella Volcaniella, Vulcanithermus, Waddha, Weeksella, Weissella, Wigglesworthia, Williamsia, Wolbackia, Wolinella, Xanthobacter, Xartthomonas, Xenophilus, Xenorhahdus, Xyianimonas, Xylella, Xylophilus, Yersinia, Yokenella, Zavarzinia, Zobellia, Zoogloea, Zooshikella, Zymobacter, Zyrnornonas, and Zy ophilus.
- phage display libraries that comprise a plurality of peptides derived from a plurality of pathogens, such as bacteria, fungi, or viruses.
- the plurality of peptides will represent a substantially complete set of peptides from a group of viruses, bacteria, or fungi ⁇ e.g., ail pathogenic viruses, bacteria or fungi).
- the phage display library comprises a substantially complete set of peptides from, viruses known to infect humans (or a subgroup thereof).
- phage display libraries comprising a substantially complete set of peptides from pathogenic bacteria (or a subgroup thereof) or pathogenic fungi (or a subgroup thereof) are also contemplated herein.
- the term "subgroup" refers to a related grouping of viruses, bacteria or fungi that would benefit from simultaneous testing.
- a phage display library comprising a substantially complete set of peptides from a genus of pathogens (e.g.. a subgroup of virus, such as the Herpes genus).
- a genus of pathogens e.g.. a subgroup of virus, such as the Herpes genus.
- Such a library would permit one of skill in the art to distinguish between highly related pathogens in an antibody sample.
- the phage display library comprises less than 10,000 peptide sequences. In other embodiments, the phage display library comprises less than 9000, less than 8000, less than 7000, less than 6000, less than 5000, less than 4000, less than 3000, less than 2000, less than 1000, less than 750, less than 500, less than 250, less than 100, less than 50 or less than 25 peptide sequences. In other embodiments, the phage display library comprises at least 100, at least 200, at least 500, at least 1000, at least 5000, at least 10,000 peptide sequences or more.
- the phage display library comprises peptides derived from at least 10 protein sequences (e.g., viral protein sequences), at least 20 protein sequences, at least 30 protein sequences, at least 40 protein sequences, at least 50 protein sequences, at least 60 protein sequences, at least 70 protein sequences, at least 80 protein sequences, at least 90 protein sequences, at least 100 protein sequences, at least 200 protein sequences, at least 300 protein sequences, at least 400 protein sequences, at least 500 protein sequences, at least 600 protein sequences, at least 700 protein sequences, at least 800 protein sequences, at least 900 protein sequences, at least 1000 protein sequences, at least 2000 protein sequences, at least 3000 protein sequences, at least 4000 protein sequences, at least 5000 protein sequences
- the phage display library comprises a plurality of proteins sequence that have less than 90% shared identity; in other embodiments the plurality of protein sequences have less than 85% shared identity, less than 80% shared identity, less than 75% shared identity, less than 70% shared identity, less than 65% shared identity, less than 60% shared identity, less than 55% shared identity, less than 50% shared identity or even less.
- the phage display library comprises protein sequences from at least 3 unique pathogens or at least 5 unique pathogens (e.g., 5 unique viruses, 5 unique bacteria, or 5 unique fungi); in other embodiments the library comprises protein sequences from at least 10, at least 20, at least 50, at least 75, at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1000 unique pathogens up to and including protein sequences from all viruses, bacteria, or fungi known to cause disease in a human or other mammal.
- the library comprises protein sequences from at least 10, at least 20, at least 50, at least 75, at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1000 unique pathogens up to and including protein sequences from all viruses, bacteria, or fungi known to cause disease in a human or other mammal.
- the protein sequences of the phage display library are at least 1 amino acids long; in other embodiments the protein sequences are at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 150, at least 200, at least 250, at least 300, at least 350, at least 400, at least 450 amino acids or more in length.
- each peptide of the phage library will overlap at least one other peptide by at least 5 ammo acids. In other embodiments, each peptide of the phage library will overlap at least one other peptide by at least 10, at least 15, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 32, at least 35, at least 40 amino acids or more.
- the display library comprises at least 2 peptides from Table 4.
- the display library comprises at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1000, at least 2000, at least 3000, at least 4000, at least 5000 peptides or more as selected in any desired combination from Table 4.
- the display library comprises ail of the peptides in Table 4.
- the display library can comprise peptides from at least 1 family (e.g., human herpesvirus) or sub-family (e.g., human herpesviras 5) of related viruses.
- the display library- can comprise peptides from at least 2 families, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 1 1, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 peptides from at least 1 family (e.g., human herpesviras) or sub-family (e.g., human herpesvirus 5) of viruses from Table 4, in any desired combination.
- the display library comprises peptides from each of the viral families or subfamilies in Table 4.
- reaction sample refers to a sample that, at a minimum, comprises a phage display library, for example, the phage display library described herein.
- the reaction sample can also comprise additional buffers, salts, osmotic agents, etc. to facilitate the formation of complexes between the peptides in the phage display library when the reaction sample is contacted with a biological sample comprising an antibody.
- a "biological sample” as that term is used herein refers to a fluid or tissue sample derived from a subject that comprises or is suspected of comprising at least one antibody.
- a biological sample can be obtained from any organ or tissue in the individual to be tested, provided that the biological sample comprises, or is suspected of comprising, an antibody.
- the biological sample will comprise a blood sample, however other biological samples are contemplated herein, for example, cerebrospinal fluid.
- a biological sample is treated to remove cells or other biological particulates.
- Methods for removing cells from a blood or other biological sample are well known in the art and can include e.g., centrifugation, ultrafiltration, immune selection, or
- Antibodies can be detected from a biological sample or a sample that has been treated as described above or as known to those of skill in the art.
- biological samples include a blood sample, a urine sample, a semen sample, a lymphatic fluid sample, a cerebrospinal fluid sample, a plasma sample, a serum sample, a pus sample, an amniotic fluid sample, a bodily fluid sample, a stool sample, a biopsy sample, a needle aspiration biopsy sample, a swab sample, a mouthwash sample, a cancer sample, a tumor sample, a tissue sample, a cell sample, a synovial fluid sample, or a combination of such samples.
- a biological sample is from whole blood, plasma, cerebral spinal fluid, serum, and/or urine.
- the biological sample is cerebrospinal fluid.
- samples can be obtained from an individual with a disease or pathological condition.
- the disease or pathological condition is one that is suspected of having a common viral, bacterial or fungal origin.
- Some exemplar ⁇ - disease or pathological conditions include, but not limited to: a blood disorder, blood lipid disease, autoimmune disease, bone or joint disorder, a cardiovascular disorder, respiratory disease, endocrine disorder, immune disorder, infectious disease, muscle wasting and whole body wasting disorder, neurological disorders including neurodegenerative and/or neuropsychiatric diseases, skin disorder, kidney disease, scleroderma, stroke, hereditary hemorrhage telangiectasia, diabetes (e.g., Type I or Type II diabetes), disorders associated with diabetes (e.g.. PVD), hypertension, Gaucher's disease, Kawasaki disease.
- a blood disorder e.g., blood lipid disease, autoimmune disease, bone or joint disorder, a cardiovascular disorder, respiratory disease, endocrine disorder, immune disorder, infectious disease, muscle wasting and whole body wasting disorder
- neurological disorders including neurodegenerative and/or neuropsychiatric diseases, skin disorder, kidney disease, scleroderma, stroke, hereditary hemorrhage telangie
- gastrointestinal diseases including diseases of the colon, diseases of the spleen, appendix, gall bladder, and others
- human diseases see Mendelian Inheritance in Man: A Catalog of Human Genes and Genetic Disorders by Victor A. McKusick (12th Edition (3 volume set) June 1998, Johns Hopkins University Press, ISBN: 0801857422), the entirety of which is incorporated herein .
- samples from a normal demographicaily matched individual and/or from a non-disease sample from a patient having the disease are used in the analysis to provide controls.
- the samples can comprise a plurality of cells from individuals sharing a trait.
- the trait shared can be gender, age, pathology, predisposition to a pathology, exposure to an infectious disease (e.g., HIV), kinship, death from the same disease, treatment with the same drug, exposure to chemotherapy, exposure to radiotherapy, exposure to hormone therapy, exposure to surgery, exposure to the same environmental condition (e.g., such as carcinogens, pollutants, asbestos, TCE, perchlorate, benzene, chloroform, nicotine and the like), the same genetic alteration or group of alterations, expression of the same gene or sets of genes (e.g., samples can be from individuals sharing a common haplotype, such as a particular set of HLA alleles), and the like.
- infectious disease e.g., HIV
- kinship death from the same disease
- treatment with the same drug e.g., chemotherapy, exposure to radiotherapy, exposure to hormone therapy, exposure to surgery, exposure to the same environmental condition (e.g., such as carcinogens, pollutants, asbestos, TCE, perchlorate, benzen
- the methods and assays described herein comprise a step of contacting modified bacteriophage or the phage display library as described herein with a biological sample that comprises, or is suspected of comprising, at least one antibody. Any antiviral antibodies present in the biological sample will bind to bacteriophage(s) that display the cognate antigen.
- antibodies from the reaction sample are immobilized on a solid support to permit one to separate out the unbound phage.
- Antibody immobilization can be achieved using methods routine to those of ordinary skill in the art. Essentially any method that permits one to specifically immobilize IgM, IgA, or IgG subclasses (e.g., IgG4) can be used to immobilize antibodies from the sample, including antibodies that are complexed to one or more bacteriophage.
- Protein A, Protein G or a combination thereof is/are used to immobilize the antibody to permit removal of unbound phage. Such methods are known to those of ordinary skill in the art and as such are not described in detail herein.
- the peptide or protein used to immobilize antibodies from the reaction mixture can be attached to a solid support, such as, for example, magnetic beads (e.g., micron-sized magnetic beads), Sepharose beads, agarose beads, a nitrocellulose membrane, a nylon membrane, a column chromatography matrix, a high performance liquid chromatography (HPLC) matrix or a fast performance liquid chromatography (FPLC) matrix for purification.
- a solid support such as, for example, magnetic beads (e.g., micron-sized magnetic beads), Sepharose beads, agarose beads, a nitrocellulose membrane, a nylon membrane, a column chromatography matrix, a high performance liquid chromatography (HPLC) matrix or a fast performance liquid chromatography (FPLC) matrix for purification.
- HPLC high performance liquid chromatography
- FPLC fast performance liquid chromatography
- the reaction mixture comprising bacteriophage and antibodies can be contacted with magnetic beads coated with Protein A and/or Protein G. The Protein A and G will
- Magnetic bead means any solid support that is attracted by a magnetic field; such solid supports include, without limitation, DYNABEADSTM, BIOMAGTM Streptavidin, MPG7 Streptavidin, Streptavidin MAGNESPHERETM, Streptavidin Magnetic Particles, AFFINIT1PTM, any of the MAGATM line of magnetizable particles, BIOMAGTM Superparamagnetic Particles, or any other magnetic bead to which a molecule (e.g., an oligonucleotide primer) may be attached or immobilized.
- a molecule e.g., an oligonucleotide primer
- the peptides in the bound ph age/antibody complexes can be identified using e.g., PCR.
- the bound phage/antibody complexes can first be released from the solid support using appropriate conditions e.g., temperature, pH, etc.
- the sample is subjected to conditions that will permit lysis of the phage (e.g., heat denaturation).
- the nucleic acids from the lysed phage is subjected to an amplification reaction, such as a PCR reaction.
- the nucleic acids encoding a phage-displayed peptide comprise a common adapter sequence for PCR amplification.
- a PCR primer is designed to bind to the common adapter sequence for amplification of the DNA corresponding to a phage-displayed peptide.
- a detectable label is used in the amplification reaction to permit detection of different amplification products.
- label or “detectable label” refers to any atom or molecule which can be used to provide a detectable (preferably quantifiable) signal, and which can be operatively linked to a polynucleotide, such as a PCR primer. Labels may provide signals detectable by fluorescence, radioactivity, colorimetry, gravimetry, X-ray diffraction or absorption, magnetism, enzymatic activity, mass spectrometry, binding affinity, hybridization radiofrequency, nanocrystals and the like.
- a primer of the present invention may be labeled so that the amplification reaction product may be "detected” by "detecting" the detectable label.
- “Qualitative or quantitative” detection refers to visual or automated assessments based upon the magnitude (strength) or number of signals generated by the label.
- a labeled polynucleotide e.g., an oligonucleotide primer
- a labeled polynucleotide e.g., an oligonucleotide primer
- a labeled polynucleotide e.g., an oligonucleotide primer according to the methods of the inv ention can be labeled at the 5' end, the 3' end, or both ends, or internally.
- the label can be "direct”, e.g., a dye, or "indirect”, e.g., biotin, digoxin, alkaline phosphatase (AP), horse radish peroxidase (HRP).
- direct labels e.g., biotin, digoxin, alkaline phosphatase (AP), horse radish peroxidase (HRP).
- AP alkaline phosphatase
- HRP horse radish peroxidase
- an oligonucleotide primer is labeled with a fluorescent label.
- Suitable fluorescent labels include fluorochromes such as rhodamine and derivatives (such as Texas Red), fluorescein and derivatives (such as 5-bromomethy!
- Lucifer Yellow Lucifer Yellow
- IAEDANS 7-Me.sub.2N-coumarin-4-acetate
- 7-OH- -CH 3 - ⁇ umarin-3-acetate 7- NH.sub.2-4-CH : rCOumarin-3-acetate (AMCA)
- monobromobimane pyrene trisulfonates, such as Cascade Blue
- monobromorimethyl-ammoniobimane see for example, DeLuca
- the methods described herein can benefit from the use of labels including, e.g., fluorescent labels.
- the fluorescent label can be a label or dye that intercalates into or otherwise associates with amplified (usually double-stranded) nucleic acid molecules to give a signal.
- amplified (usually double-stranded) nucleic acid molecules to give a signal.
- One stain useful in such embodiments is SYBR Green (e.g., SYBR Green I or II, commercially available from Molecular Probes Inc., Eugene, Oreg.). Others known to those of skill in the art can also be employed in the methods described herein.
- An advantage of this approach is reduced cost relative to the use of, for example, labeled nucleotides.
- amplified product refers to polynucleotides which are copies of a portion of a particular polynucleotide sequence and/or its complementaiy sequence, which correspond in nucleotide sequence to the template polynucleotide sequence and its complementary sequence.
- An “amplified product,” can be DNA or RNA, and it may be double -stranded or single- stranded.
- the phage are lysed by heat denaturation and PCR is used to amplify the DNA region corresponding to the displayed peptide sequence.
- One of the PCR primers contains a common adaptor sequence which can be amplified in a second PCR reaction by another set of primers to prepare the DNA for ILLUMINATM high throughput sequence.
- Unique barcoded oligonucleotides in the second PCR reaction are used to amplify different samples and pool them together in one sequencing run to e.g., reduce cost and/or permit simultaneous detection of multiple phage-displayed peptides.
- the detection of a phage-displayed peptide comprises high throughput detection of a plurality of peptides simultaneously, or near simultaneously.
- the high-throughput systems use methods similar to DNA. sequencing techniques.
- DNA sequencing techniques are known in the art, including fiuorescence-based sequencmg methodologies (See, e.g., Birren et al., Genome Analysis: Analyzing DNA, 1 , Cold Spring Harbor, N.Y.).
- automated sequencing techniques understood in the art are utilized.
- the high-throughput systems described herein use methods that provide parallel sequencing of partitioned amplicons (e.g., WO2006084132).
- DNA sequencing is achieved by parallel oligonucleotide extension (See, e.g.. U.S. Pat. No. 5,750,341 , and U.S. Pat. No. 6,306,597). Additional examples of sequencing techniques include the Church polony technology (Mitra et al., 2003, Analytical Biochemistry 320, 55-65;
- NGS Next-generation sequencing
- Non- amplification approaches also known as single-molecule sequencing, are exemplified by the HELISCOPETM platform commercialized by HELICOS BIOSYSTEMSTM, and emerging platforms commercialized by VISIGENTM, OXFORD NANOPORE TECHNOLOGIES LTD., and PACIFIC BI OSCIENCESTM, respectively .
- template DNA is fragmented, end-repaired, ligated to adaptors, and clonally amplified in-situ by capturing single template molecules with beads bearing oligonucleotides complementary to the adaptors.
- Each bead bearing a single template type is compartmentalized into a water-in-oil microvesicle, and the template is clonaily amplified using a technique referred to as emulsion PCR.
- the emulsion is disrupted after amplification and beads are deposited into individual wells of a picotitre plate functioning as a flow cell during the sequencing reactions. Ordered, iterative introduction of each of the four dNTP reagents occurs in the flow cell in the presence of sequencing enzymes and
- luminescent reporter such as Iuciferase.
- an appropriate dNTP is added to the 3' end of the sequencing primer, the resulting production of ATP causes a burst of luminescence within the well, which is recorded using a CCD camera. It is possible to achieve read lengths greater than or equal to 400 bases, and 10 D sequence reads can be achieved, resulting in up to 500 million base pairs (Mb) of sequence.
- sequencing data are produced in the form of shorter-length reads.
- single -stranded fragmented DNA is end-repaired to generate 5'-phosphoryiated blunt ends, followed by Klenow-mediated addition of a single A base to the 3' end of the fragments.
- A- addition facilitates addition of T-overhang adaptor oligonucleotides, which are subsequently used to capture the template-adaptor molecules on the surface of a flow cell that is studded with
- oligonucleotide anchors The anchor is used as a PCR primer, but because of the length of the template and its proximity to other nearby anchor oligonucleotides, extension by PCR results in the "arching over" of the molecule to hybridize with an adjacent anchor oligonucleotide to form a bridge structure on the surface of the flow cell. These loops of DNA are denatured and cleaved. Forward strands are then sequenced with reversible dye terminators. The sequence of incorporated nucleotides is determined by detection of post-incorporation fluorescence, with each fluor and block removed prior to the next cycle of dNTP addition. Sequence read length ranges from 36 nucleotides to over 50 nucleotides, with overall output exceeding 1 billion nucleotide pairs per analytical run.
- interrogation probes have 16 possible combinations of the two bases at the 3' end of each probe, and one of four fluors at the 5' end. Fluor color, and thus identity of each probe, corresponds to specified color-space coding schemes. Multiple rounds (usually 7) of probe annealing, ligation, and ffuor detection are followed by denaturation, and then a second round of sequencing using a primer that is offset by one base relative to the initial primer. In this manner, the template sequence can be computationally re-constructed, and template bases are interrogated twice, resulting in increased accuracy. Sequence read length averages 35 nucleotides, and overall output exceeds 4 billion bases per sequencing run,
- nanopore sequencing is employed (see, e.g., Astier et al., J.
- nanopore sequencing has to do with what occurs when a nanopore is immersed in a conducting fluid and a potential (voltage) is applied across it. Under these conditions a slight electric current due to conduction of ions through the nanopore can be observed, and the amount of current is exceedingly sensitive to the size of the nanopore. As each base of a nucleic acid passes through the nanopore, this causes a change in the m agnitude of the current through the nanopore that is distinct for each of the four bases, thereby allowing the sequence of the DNA molecule to be determined.
- HELISCOPETM by HELICOS BIOSCIENCESTM is employed (Voelkerding et al, Clinical Chem., 55. 641-658, 2009: MacLean et al., Nature Rev.
- Template DNA is fragmented and polyadenylated at the 3' end, with die final adenosine bearing a fluorescent label. Denatured polyadenylated template fragments are iigated to poly(dT)
- oligonucleotides on the surface of a flow cell.
- Initial physical locations of captured template molecules are recorded by a CCD camera, and then label is cleaved and washed away. Sequencing is achieved by addition of polymerase and serial addition of fluorescently-labeled dNTP reagents.
- the Ion Torrent technology is a method of DNA sequencing based on the detection of hydrogen ions that are released during the polymerization of DNA (see, e.g.. Science 327(5970): 1190 (2010); U.S. Pat. Appl. Pub. Nos. 20090026082, 20090127589, 20100301398, 20100197507, 20100188073, and 20100137143).
- a microwell contains a template DNA strand to be sequenced.
- Beneath the layer of rnicrowelis is a hypersensitive I SFET ion sensor. All layers are contained within a CMOS semiconductor chip, similar to that used in the electronics industry.
- a hydrogen ion is released, which triggers a hypersensitive ion sensor.
- a hydrogen ion is released, which triggers a hypersensitive ion sensor.
- multiple dNTP molecules will be incorporated in a single cycle. This leads to a corresponding number of released hydrogens and a proportionally higher electronic signal.
- This technology differs from other sequencing technologies in that no modified nucleotides or optics are used.
- the per base accuracy of the Ion Torrent sequencer is .about.99.6% for 50 base reads, with -100 Mb generated per run. The read-length is 100 base pairs.
- the accuracy for homopolymer repeats of 5 repeats in length is -98%.
- Tins sequencing process typically includes providing a daughter strand produced by a template-directed synthesis.
- the daughter strand generally includes a plurality of subunits coupled in a sequence corresponding to a contiguous nucleotide sequence of ail or a portion of a target nucleic acid in which the individual subunits comprise a tether, at least one probe or nucleobase residue, and at least one selectively cleavable bond.
- the selectively cleavable bond(s) is/are cleaved to yield an XPANDOMERTM of a length longer than the plurality of the subunits of the daughter strand.
- the XPANDOMERTM typically includes the tethers and reporter elements for parsing genetic information in a sequence corresponding to the contiguous nucleotide sequence of all or a portion of the target nucleic acid. Reporter elements of the XPANDOMERTM are then detected. Additional details relating to XPANDOMERTM-based approaches are described in, for example, U.S. Pat. Pub No. 20090035777, entitled "HIGH THROUGHPUT NUCLEIC ACID SEQUENCING BY EXPANSION," filed Jun. 19, 2008, which is incorporated herein in its entirety.
- Other emerging single molecule sequencing methods include real-time sequencing by synthesis using a VISIGENTM platform (Voelkerding et al., Clinical Chem., 55: 641 -58, 2009: U.S. Pat. No. 7,329,492: U.S. patent application Ser. No. 11/671,956: U.S. patent application Ser. No. 11/781, 166) in which immobilized, primed DNA template is subjected to strand extension using a fluorescently-modified polymerase and florescent acceptor molecules, resulting in detectible fluorescence resonance energy transfer (FRET) upon nucleotide addition.
- FRET fluorescence resonance energy transfer
- U.S. Pat. No. 7,476,503 utilizes reaction wells 50-100 nm in diameter and encompassing a reaction volume of approximately 20 zeptoliters ( 10 "/J L). Sequencing reactions are performed using immobilized template, modified phi29 DNA polymerase, and high local concentrations of fluorescently labeled dNTPs. High local concentrations and continuous reaction conditions allow incorporation events to be captured in real time by fluor signal detection using laser excitation, an optical waveguide, and a CCD camera.
- the single molecule real time (SMRT) DNA sequencing methods using zero-mode waveguides (ZMWs) developed by Pacific Biosciences, or similar methods are employed.
- ZMWs zero-mode waveguides
- DNA sequencing is performed on SMRT chips, each containing thousands of zero-mode waveguides (ZMWs).
- a ZMW is a hole, tens of nanometers in diameter, fabricated in a 100 nm metal film deposited on a silicon dioxide substrate.
- Each ZMW becomes a nanophotonic visualization chamber providing a detection volume of just 20 zeptoliters (10 "2i L). At this volume, the activity of a single molecule can he detected amongst a background of thousands of labeled nucleotides.
- the ZMW provides a window for watching DNA polymerase as it performs sequencing by synthesis.
- a single DNA polymerase molecule is attached to the bottom surface such that it permanently resides within the detection volume.
- Phospholinked nucleotides each type labeled with a different colored fluorophore, are then introduced into the reaction solution at high concentrations which promote enzyme speed, accuracy, and processivity. Due to the small size of the ZMW, even at these high, biologically relevant concentrations, the detection volume is occupied by nucleotides only a small fraction of the time. In addition, visits to the detection volume are fast, lasting only a few microseconds, due to the very small distance that diffusion has to cany the nucleotides. The result is a very low background.
- Processes and systems for such real time sequencing that can be adapted for use with the methods described herein include, for example, U.S. Pat. No. 7,405,281, U.S. Pat. No. 7,315,019, U.S. Pat. No. 7,313,308, U.S. Pat. No, 7,302,146, U.S. Pat. No. 7,170,050, U.S. Pat, Pub. Nos.
- the data produced comprises sequence data from multiple barcoded DNAs.
- the data can be deconvoluted to assign sequences to the source subjects, samples, organisms, etc.
- the sequences are mapped, in some embodiments, to a reference DNA sequence (e.g., a chromosome) and genotypes are assigned to the source subjects, samples, organisms, etc., e.g., by modeling, e.g., by a Hidden Markov Model.
- Some embodiments provide a processor, data storage, data transfer, and software comprising instructions to assign genotypes.
- Some embodiments of the technology provided herein further comprise functionalities for collecting, storing, and/or analyzing data.
- some embodiments comprise the use of a processor, a memory, and/or a database for, e.g., storing and executing instructions, analyzing data, performing calculations using the data, transforming the data, and storing the data.
- the processor is configured to calculate a function of data derived from the sequences and/or genotypes determined.
- the processor performs instructions in software configured for medical or clinical results reporting and in some embodiments the processor performs instructions in software to support non-clinical results reporting.
- the detection of a phage-dispiayed peptide comprises PCR with barcoded oligonucleotides.
- barcode refers to a unique oligonucleotide sequence that allows a corresponding nucleic acid base and/or nucleic acid sequence to be identified.
- the nucleic acid base and/or nucleic acid sequence is located at a specific position on a larger polynucleotide sequence (e.g., a polynucleotide covalently attached to a bead).
- barcodes can each have a length within a range of from 4 to 36 nucleotides, or from.
- barcodes are members of a minimally cross-hybridizing set. That is, the nucleotide sequence of each member of such a set is sufficiently different from that of every other member of the set that no member can form a stable duplex with the complement of any other member under stringent hybridization conditions. In one aspect, the nucleotide sequence of each member of a minimally cross-hybridizing set differs from those of every other member by at least two nucleotides.
- the described technology allows for detection of such past (e.g., resolved or unresolved infections) or ongoing infection by detecting host antibody response to a patiiogen such as a virus, bacteria, or fungi.
- a comprehensive peptide phage library can capture virtually all host generated antibodies, the simultaneous detection of the complete antiviral antibody responses as an indicator of virus infection against virtually all known viruses capable of infecting humans.
- antibody response persist for long periods of time, this approach further allows for detection of prior exposure, where an infection has been contained.
- this technology further provides a mechanism to identify viral correlates or causes of disease.
- Many diseases suspected have a viral cause, but without positive identification of a responsible pathogen. Examples include Kawasaki Disease, Bell ' s Palsy, Meniere's Disease, Type I Diabetes and Juvenile Idiopathic Arthritis.
- viral correlates of onset or severity have been suggested, but a pathogenic origin cannot be identified due to the lack of system -wide screening techniques for viral exposure, and researchers must rely on piecemeal detection schemes in order to narrow down possible disease-causing agents.
- the described systems and methods provide not only a systematic approach to compare antiviral responses in patient and control sera to identify viral correlates of disease, but across virtually all viruses known to infect humans, allowing for a much improved route for identifying responsible pathogens.
- the detection of antiviral antibody responses in subjects further allows identification of critical antigen peptide epitopes.
- the high-throughput nature of the described technology also allows rapid and wide-scale detection of such signatures across various subjects, thereby providing means for mapping of antiviral antibody epitopes across populations, which is not possible with existing technology.
- this information further allow s identification of potential cross-reactivity with human antigens, a key source of autoimmune disease generation.
- a critical aspect of establishing programmable microarrays to include viral peptides is generation of an appropriate oligonucleotide sequence set for library generation.
- wide-scale, parallel detection of viral antigens is particularly challenging, given their highly adaptive evolutionary nature and comparatively small antigenic signature compared to a library of human peptides, as one example.
- the Inventors have improved algorithms for designing oligonucleotide sequences from parental protein sequences using randomized codons to minimize redundancy, and in order to increase the ability to align short reads to unique members of the library.
- the programmable microarray approach described herein further including the antibody-focused adaptions, algorithms to design oligonucleotide sequences with reduced redundancy, and/or short read alignments, all lend themselves for wide extension of the programmable microarray technology to detection of other pathogens (e.g., bacteria or fungi), as well as adaption into other display systems (e.g., ribosome display, arrayed peptide, or yeast display).
- pathogens e.g., bacteria or fungi
- other display systems e.g., ribosome display, arrayed peptide, or yeast display.
- the combination of advantages described herein prov ide a wide-ranging, systematic approach for using host antibody response as a means to identify past and present pathogen exposure.
- the proteomic technology described herein applies a phage library that can uniformly express peptide librari es, such as synthetic representations of a complete set of viral peptides known to infect humans.
- peptide librari es such as synthetic representations of a complete set of viral peptides known to infect humans.
- the Inventors demonstrate viral peptides enriched by donor serum are highly reproducible and sera from different donors, on the other hand, recognize distinct profiles of peptides presumably commensurate with their previous unique histories of viral exposure.
- the Inventors identified a known epitope in the EBV BRRF2 protein that is cross-reactive with autoimmune antigens in patients with multiple sclerosis.
- the described systems and methods can therefore be applied to determine common antiviral antibody responses in people immunized against viruses in order to improve vaccine design.
- the present invention may be as defined in any one of the following numbered paragraphs.
- a method for detecting an antibody against a pathogen in a subject comprising:
- each peptide of the plurality of peptides comprises a common adapter region appended to the end of the nucleic acid sequence encoding the peptide.
- a method for identifying a pathogen associated with a disease comprising
- reaction samples each comprise a display library comprising a plurality of peptides derived from a pluralit 7 of pathogens
- each peptide of the plurality of peptides comprises a common adapter region appended to the end of the nucleic acid sequence encoding the peptide.
- the common disease comprises disease selected from the group consisting of: Kawasaki Disease, Bell's Palsy, Meniere's Disease, Type I diabetes, juvenile idiopathic arthritis, Chronic Fatigue Syndrome, Gulf War Illness, Myasthenia Gravis, and IgG4 disease.
- a method for improving vaccine design comprising:
- reaction samples each comprise a display library comprising a plurality of peptides derived from a plurality of pathogens
- each peptide of the plurality of peptides comprises a common adapter region appended to the end of the nucleic acid sequence encoding the peptide.
- a phage library displaying a plurality of viral peptides, wherein the plurality' of viral peptides represent a set of peptides from viruses known to infect humans.
- phage library of paragraph 45 wherein the phage library comprises a plurality of viral peptides from at least 3 viruses known to infect humans.
- each peptide of the plurality of peptides comprises a common adapter region appended to the end of the nucleic acid sequence encoding the peptide.
- FIG. 1 C The general process is illustrated in FIG. 1 C. Peptide sequences are back-translated into DNA sequences with randomized codon usage to minimize sequence redundancy in order to facilitate unique identification using short DNA reads. The DNA sequences were also edited using synonymous mutations to remove rare codons and restriction sites used for downstream cloning. Finally, a common '"adapter' region was appended to the ends of each DNA sequence to allow PGR amplification of the library. The final set of defined DNA sequences were synthesized as
- oligonucleotides on a programmable DNA microarray PGR amplified, and cloned into a
- T7-Select 10-3b display system using standard molecular biology techniques.
- the T7-Select 10-3b system produces peptides encoded by DNA as fusions to the exterior coat proteins of T7 bacteriophage particles.
- Each bacteriophage particle contains DNA encoding a peptide fused to the C-terminus of the T7 gene 10 protein.
- the exterior of the bacteriophage particle is surrounded by 415 copies of the gene 10 protein; on average, 5-15 of these copies will contain the C- terminal peptide fusion.
- Example 2 Immobilization steps
- Any antiviral antibodies in the sample will bind to bacteriophage that display the cognate antigen.
- phage are lysed by heat denaturation and PCR is applied to amplify the
- This PCR primer contains a common adapter sequence which can be amplified in a second PCR reaction by another set of primers to prepare the DNA for Illumina high throughput sequencing.
- Unique barcoded oligonucleotides in the second PCR reaction amplify different samples and pool them together in one sequencing ran for cost reduction.
- a set of custom Python scripts are applied to count the frequency of each peptide in each barcoded sample, and custom statistical analysis is applied to identify which peptides are significantly enriched by the selection. One can then determine which peptide epitopes are being recognized by antibodies in those samples.
- a pattern of strong enrichment of peptide epitopes from a single vims indicates the sample donor is or was infected with that viras.
- the Inventors observed that the vast majority of donors have strong responses against common viruses such as Rhinovims (common cold), while fewer patients have strong responses against rarer viruses such as Human erythrovims V9 or Simian adenovims (Fig. 2).
- VirScan a novel technology that leverages recent advances in programmable DNA microarray technology to create a synthetic representation of the human virome ( Figure 1C). Immunoprecipitation and massively parallel DNA sequencing were used to
- VirScan is thus able to characterize the full spectrum of viral peptide epitopes targeted by an individual's B cell response.
- tins platform identifies antiviral responses with very high sensitivity and specificity. Characterization of 569 serum samples revealed known and novel differences in viral exposure between populations of differing age, HIV status, and geographic location.
- the inventors employed VirScan to identify the specific B cell epitope determinants targeted and found remarkable similarity in epitope recognition across indi viduals and populations.
- VirScan utilizes the Phage Immunoprecipitation sequencing (PhlP-seq) technology as previously described (8). Briefly , the inventors used a programmable DNA microarray to synthesize 93,904 200-mer oligonucleotides, encoding 56-residue peptide tiles, with 28 residue overlaps, that together span the reference protein sequences (collapsed to 90% identity) of all virases annotated to have human tropism in the UniProt database (9). This library includes peptides from 206 species of vims and over 1 ,000 different strains. The libraiy was cloned into a T7 bacteriophage display vector for screening.
- FIG. 4a shows the antibody profiles of a set of human viruses in sera from a typical group of individuals in a heat map format that illustrates the number of enriched peptides from each virus.
- Hie inventors frequently detected antibodies to multiple peptides from common human viruses, such as Epstein-Barr virus (EBV), Cytomegalovirus (CMV), and rhinovirus.
- EBV Epstein-Barr virus
- CMV Cytomegalovirus
- rhinovirus As expected, more peptides were observed to be enriched from viruses with larger proteomes, such as EBV and CMV, likely because there are more epitopes available for recognition.
- a computational method was developed to identify the set of viruses to which an individual has been exposed, based on the number of enriched peptides identified per virus. Briefly, the inventors set a threshold number of significant non-overlapping peptide enrichments for each virus. The inventors empirically determined that a threshold of three non-overlapping enriched peptides gave the best performance for detecting Herpes simplex virus 1 compared to a commercial serologic test, described below (Table 1).
- Virscan is highly sensitive and specific. Sensitivity is the percentage of samples positive for the virus as determined by VirScan out of all n known positives. Specificity is the percentage of samples negative for the vims by VirScan out of all n known negatives. Hepatitis C virus 93% (26) 97% * (31)
- Herpes simplex virus 1 97% (38) 100% (6)
- Herpes simplex virus 2 90% (20) 100% (24)
- the inventors adjusted the threshold to account for the size of the viral proteome (FIG. 10). Next, the number of enriched peptides from each virus was tallied.
- Antibodies generated against a specific virus can cross-react with similar peptides from a related virus. This would lead to false positives because an antibody targeted to an epitope from one virus to which a donor was exposed would also enrich a homologous peptide from a related vims to which the donor may not have been exposed.
- the inventors adopted a maximum parsimony approach to infer the fewest number of vims exposures that could elicit the observed spectrum of antiviral peptide antibodies. For groups of enriched peptides that share a 7 amino acid subsequence and may be recognized by a single specific antibody, the inventors only count it as one epitope for the vims which has the greatest number of oilier enriched peptides. If this adjusted peptide count is greater than the threshold for that vims, the sample is considered positive for the vims.
- HCV immunodeficiency vims
- HCV Hepatitis C virus
- VirScan achieves very high sensitivities and specificities of -95% or higher (Table 1 ).
- the viral genotype was also known for the HCV samples. Despite the very high sequence similarity among HCV genotypes (12), which poses a problem for all antibody-based detection methods, VirScan correctly reported the HCV genotype in 72% of the samples. The inventors also compared VirScan to a commercially available serology test that is type specific for the highly related Herpes simplex viruses 1 and 2 (HSV1 and HSV2).
- VirScan is extremely specific and sensitive (Table 1 ). These results demonstrate that VirScan performs well in distinguishing between closely related viruses. The data also demonstrate that VirScan can detect antibodies to viruses that range in size from small (HIV and HCV) to very large (HSV1 and HSV2) with high sensitivity and specificity.
- Table 2 Prevalence of ail viruses detected in donors residing in the United States. Known HIV-positive and HCV -positive samples were excluded from this analysis.
- the most frequently detected viruses are generally those known to commonly infect humans (FIG. 4E).
- the inventors occasionally detected what appear to be false positives that may be due to antibodies that cross react with non-viral peptides.
- 'SESDSD' antibodies against a peptide from the C4L gene that shares an eight amino acid sequence
- Clumping Factor B protein from Staphylococcus aureus
- the inventors frequently detected antibodies to rhinovirus and respirator ⁇ ' syncytial vims, which are normally found only in the respiratory tract, indicating that VirScan using blood samples is still able to detect viruses that do not cause viremia.
- Antibodies to influenza, which is normally cleared, and poliovirus were also detected, which in modern times most people generate antibodies through vaccination. Since the original antigen is no longer present, the inventors are likely detecting antibodies secreted by long-lived memory B cells (14).
- the frequency at which influenza (58.4%) and poliovirus (37.3%) was detected is lower than expected given that the majority of the population has been exposed to or vaccinated against these viruses. This may be due to reduced sensitivity because of a gradual narrowing and decrease of the long-lived B cell response in the absence of persistent antigen.
- the frequency of detecting varicella zoster virus (chicken pox) antibodies is also lower than expected (24.4%), even though the frequency of detecting other latent herpesviruses, such as Epstein-Barr virus (88.1%) and cytomegalovirus (49.8%), is similar to the prevalence reported in epidemiological studies (15-17).
- this may reflect differences in how frequently these viruses shed antigens that stimulate B cell responses or a more limited humoral response that relies on epitopes that cannot be detected in a 56 residue peptide. It might be possible to increase the sensitivity of detection of these viral antibodies by stimulating memory B cells in vitro to probe the history of infection more deeply.
- HIV positive samples When comparing results from HIV positive to HIV negative samples, the inventors found more of the HIV positive samples to also be seropositive for additional viruses, including HSV2, CMV, and Kaposi's sarcoma-associated herpesvirus (KSHV) (false discovery rate g ⁇ 0.05, FIG. 5B), These results are consistent with prior studies indicating higher risk of these co-infections in HIV positive patients (19-21). Without wishing to be bound by theory, the patients with HIV may engage in activities that put them at higher risk for exposure to these viruses. Alternatively, these viruses may increase the risk of HIV infection.
- viruses including HSV2, CMV, and Kaposi's sarcoma-associated herpesvirus
- Adenovirus C seropositivity was found at similar frequencies in all regions, but Adenovirus D seropositivity was generally higher outside the United States, while Adenovirus B seropositivity was higher in Pern and South Africa, but lower in Thailand.
- Influenza B seropositivity was more common in the United States compared to other countries, especially Thailand.
- the incidence of Influenza B is much lower than Influenza A but the standard flu vaccination contains both Influenza A and B strains, so the elevated frequency of indi viduals with seroreactivity may be due to higher rates of flu vaccination in the United States.
- Other viruses such as Rhinoviras and Epstein-Barr virus, were detected at very- similar frequencies in all the geographic regions.
- the inventors After analyzing responses on the whole virus level, the inventors focused their attention on the specific peptides targeted by these antibodies. They detected antibodies to a total of 3,041 unique peptides in at least 2 samples, and 5,314 in at least 1 sample. Because of the presence of many related peptides in the library and the Immune Epitope Database (IEDB), for the following analysis the inventors consider a peptide "unique” only if it does not contain a continuous 7-residue subsequence (the estimated size of a linear B cell epitope) in common with any other peptide in the database.
- IEDB Immune Epitope Database
- the VirScan database nearly doubles the 1,715 unique human B cell epitopes from human viruses in the IEDB (22).
- the epitopes identified in our unbiased analysis demonstrate a significant overlap with those contained in the IEDB (p ⁇ 10 '30 . FIG. 4B).
- the amount of overlap is even greater for epitopes from viruses that commonly cause infection (FIG. 4D). It may- have been possible to detect even more immunogenic peptides in common with the IEDB if more samples from, individuals infected with rare viruses were tested .
- the inventors next analyzed the amino acid composition of recurrently enriched peptides.
- Enriched peptides tend to have more proline and charged amino acids and fewer hydrophobic amino acids, which is consistent with a previous analysis of B cell epitopes in the IEDB (FIGs. 1 lA-1 IB) (23). This trend likely reflects enrichment for amino acids that are surface exposed or can fonn stronger interactions with antibodies.
- the triple -mutants abolished antibody binding to a greater extent, and the enrichment patterns were similar among single-, double- and triple -mutants of the same peptide (FIG. 7, FIGs. 12-18).
- a 9 to 15 amino acid region was critical for antibody recognition in >90% of samples (FIG. 7, FIGs. 12-14).
- One other peptide had a region of similar size that was critical in about half of the samples (FIG. 15).
- a single region was important for antibody recognition in the majority of the samples, but the extents of the critical region varied slightly for different samples and occasionally there are donors that recognize a completely separate epitope (FIG. 16).
- the remaining two peptides contained a single triple mutant that abolished binding in the majority of samples, but the critical region also extended further to different extents depending on the sample (FIGs. 17-18).
- a single G36A mutation disrupted binding in almost half of the samples whereas none of the double- or triple-alanine mutants that also included the adjacent positions (L35, G37) affected binding (FIG. 18).
- G36 plays a role in helping the peptide adopt an antigenic conformation and multiple -mutants containing the adjacent Leu or Gly residues rescue this ability.
- the inventors occasionally saw other examples of mutations that resulted in patterns of disrupted binding with no simple explanation, illustrating the complexity of antibody-antigen interaction.
- VirScan a technology for identifying viral exposure and B cell epitopes across the entire known human virome in a single, multiplex reaction using less than a drop of blood.
- VirScan uses DNA microarray synthesis and bacteriophage display to create a uniform, synthetic representation of peptide epitopes comprising the human virome. Immunoprecipitation and high-throughput DNA sequencing reveals the peptides recognized by antibodies in the sample.
- VirScan is easily automated in 96-well format to enable high throughput sample processing, Barcoding of samples during PCR enables pooled analysis which can dramatically reduce the per- sampie cost.
- the VirScan approach has se veral advantages for studying the effect of viruses on the host immune system. By detecting antibody responses, it can identify' infectious agents that have been cleared after an effective host response .
- Current serological methods of antiviral antibody detection typically employ the selection of a single optimized antigen in order to achieve high accuracy. In contrast, VirScan's unique approach does not require such optimization in order to obtain similar performance.
- VirScan achieves high sensitivity by assaying each virus's complete proteome to detect any antibodies directed to epitopes that can be captured in a 56-residue fragment and high specificity by computationally eliminating cross-reactive antibodies.
- This unbiased approach identities exposure to less well -studied viruses for which optimal serological antigens are not known and can be rapidly extended to include new viruses as they are discovered (24).
- VirScan While sensitive and selective, VirScan also has a few limitations. First, it cannot detect epitopes that require post-translationai modifications. Secondly, it cannot detect epitopes that involve discontinuous sequences on protein fragments greater than 56 residues.
- VirScan is likely to be less specific compared with certain nucleic acid tests that discern highly related virus strains. However, VirScan demonstrates excellent serological discrimination among similar virus species, such as HSV l and HSV2 and can even distinguish the genotype of HCV 72% of the time. The inventors envision VirScan will become an important tool for first-pass unbiased serologic screening applications.
- VirScan is a sensitive and specific assay for detecting exposure to viruses across the human virome. Because it can be performed in high- throughput and requires minimal sample and cost, VirScan enables rapid and cost-effective screening of large numbers of samples to identify population-level differences in vims exposure across the human virome.
- the inventors analyzed over 106 million antibody-viral peptide interactions, in the first comprehensive study of pan-vims serology in a large, diverse population. In doing so we 87 different viral species were detected in 2 or more individuals. This is likely to be an underestimate of the histor - of viral infection as temporally distant infections may have significantly lower levels of circulating antibodies that are more difficult to detect.
- cytomegalovirus antibodies were found in significantly higher frequencies in Pern, Thailand, and South Africa whereas Kaposi's sarcoma-associated herpesvirus and HSVl antibodies were detected more frequently in Peru and South Africa, but not Thailand ⁇ 15, 26-30).
- the inventors also uncovered previously undocumented serological differences, such as an increased rate of antibodies against Adenovirus B and respirator ⁇ ' syncytial vims in HIV positive individuals compared to HIV negative individuals. These differences can provide insight into how HIV co-infection alters the balance between host immunity and resident viruses, as well as help to identify pathogens that can increase susceptibility to HIV and other heterologous infections.
- HTV infection can reduce the immune system's ability to control reactivation of normally dormant resident viruses or to prevent opportunistic infections from taking hold and triggering a strong adaptive immune response.
- VirScan can also be applied to identify viral exposures that correlate with disease or other phenotypes in virome-wide association studies. [000194] These result identify a large number of novel B cell epitopes, cumulatively nearly doubling the number of all previously identified viral epitopes. Knowledge of these epitopes and the extent of their recognition can have important implications beyond the identifi cation of potential neutralizing antibody targets or improving B cell epitope prediction algorithms.
- these epitopes can be used to improve vaccine design by piggybacking on existing immune responses. Fusing a previously detected and globally recognized B cell epitope to an antigen can increase a vaccine's efficacy among a broad population by improving antigen presentation and aiding affinity maturation.
- B cells recognizing the epitope can act as antigen presenting cells to re-present epitopes on MHC class I and II (31 ). Antibodies secreted by these B cells can also participate in immune complexes with the antigen, which are critical for follicular dendritic cells to prime class switching and affinity maturation of B cells recognizing other epitopes on the same antigen ⁇ 32).
- the inventors have utilized these data to identify globally immunodominant and commonly recognized "public" epitopes that can be used for this purpose. For most species of viruses, a single peptide is recognized in over 70% to 97% of samples positive for that species (Table 3).
- Table 3 Certain peptides are commonly targeted by the antibody response. The inventors determined the peptide from each species of virus that was most frequently targeted in donors that were exposed to that virus. In each row, the frequency is the percentage of samples positive for the species of virus that had antibodies targeting the peptide sequence shown. The parent protein of the peptide is also listed.
- the in ventors identified a set of two peptides that together are recognized by >95% of all screened samples and a set of five peptides that together are recognized in >99% of screened samples. They also found that the B cell response to viral epitopes is highly similar between individuals across many viral proteins. Without wishing to be bound by theory, one possible model for this striking similarity is that these regions possess properties favorable for antigenicity, such as accessibility. Another model is that the same or highly similar B cell receptor sequences that recognize these epitopes are commonly generated. Identical T cell receptor sequences ("public" cionotypes) have been found in multiple individuals and are thought to be the result of biases during the recombination process that favor certain amino acid sequences (33).
- V(D)J recombination of the immunoglobulin heavy and light chain loci is also heavily biased (34).
- Highly similar or even identical complementarity determining region 3 (CDR3) sequences have been observed in dengue virus specific antibodies from different individuals (35).
- CDR3 sequences may subtly alter antibody-antigen interaction, leading to the slight variations obsen/ed in the extent of critical epitope regions. It is possible that, rather than being an exception for dengue specific antibodies, this represents a general phenomenon: inherent biases in V(D)J recombination generate the same or similar antibodies in multiple individuals that recognize highly similar epitopes.
- VirScan is a powerful new technology that enables human virome- wide exploration - at the epitope level - of immune responses in large numbers of individuals.
- the inventors have demonstrated its effectiveness for determining viral exposure and characterizing viral B cell epitopes in high throughput and at high resolution.
- These studies have revealed interesting general properties of the human immune system, both at the individual and population scale.
- VirScan is an important tool in uncovering the effect of host-virome interactions on human health and disease and can easily be expanded to include other human pathogens such as bacteria, fungi and protozoa.
- CAGGgaagagctcgaa to the 3' end to form the 200 nt oligonucleotide sequences.
- the inventors For the scanning mutagenesis library, the inventors first took the sequences of the peptides to be mutagenized. For each peptide, they made ail single-, double-, and triple-mutants sequences scanning through the whole peptide. Non-alanine amino acids were mutated to alanine and alanines were mutated to glycine. The inventors reverse translated these peptide sequences into DNA codons, making synonymous mutations when necessary to avoid restriction sites used in subsequent cloning steps (EcoRJ and Xhol). The inventors also made synonymous mutations to ensure that the 50 nt at the 5' end of peptide sequence is unique to allow unambiguous mapping of the sequencing results.
- the inventors added the adapter sequence "aGGAATTCCGCTGCGT” to the 5' end and “CAGGgaagagctcgaa” to the 3' end to form the 200 nt oligonucleotide sequences.
- T7-PRA caagcagaagACTCGAGCTCTTCCCTG
- Phage immunoprecipitation and sequencing The inventors performed phage immunoprecipitation and sequencing using a slightly modified version of previously published PhlP- Seq protocols (8, 10). First, the inventors blocked each well of a 96 deep-well plate with 1 mL of 3% BSA in TBST overnight on a rotator at 4°C.
- the inventors added sera or plasma containing approximately 2 ⁇ g of IgG (quantified using a Human IgG ELISA Quantitation Set (BethyS Laboratories)) and 1 mL of the bacteriophage library diluted to approximately 2, ⁇ lif fold representation (2x 10 10 pfu for a library of 10 3 clones) in phage extraction buffer (20 mM Tris-HCl, pH 8.0, 100 mM NaCl, 6 mM MgSO ⁇ . Two technical replicates were performed for each sample. The antibodies were permitted to bind the phage overnight on a rotator at 4°C.
- the inventors prepared the DNA for multiplexed ILLUMINATM sequencing using a slightly modified version of a previously published protocol (36). Two rounds of PCR amplification were performed on the lysed phage material using hot start Q5 polymerase according to the manufacturer suggested protocol (NEB). The first round of PCR used the primers IS7_HsORF5_2 (ACACTCTTTCCCTACACGACTCCAGTCAGGTGTGATGCTC) and IS8_HsORF3_2
- the inventors determined the DNA concentration of each sample by qPCR and pooled equimolar am ounts of all samples for gel extraction. Following gel extraction, the pooled DNA was sequenced by the Harvard Medical School Biopolymers Facility using a 50 bp read cycle on an lliumina HiSeq 2000 or 2500. The inventors pooled up to 192 samples for sequencing on each lane and generally obtained approximately 100 - 200 million reads per lane (500,000 to 1,000,000 reads per sample).
- the inventors determined the threshold for reproducibility between technical replicates based on a previously published method (10). Briefly, the inventors made scatter plots of the log 10 of the -log 10 (p-values) and used a sliding window- of width 0.005 from 0 to 2 across the axis of one replicate. For all the clones that fell within each window, the inventors calculated the median and median absolute deviation of the log 10 of the -log 10 (p-values) in the other replicate and plotted it against the window location (FIG. 8). The inventors called the threshold for reproducibility the first window in which the median was greater than the median absolute dev iation.
- the inventors To call vims exposures, the inventors grouped peptides according to the virus the peptide is derived from . All peptides were grouped from individual viral strains for which there were complete proteomes. The sample was counted as positive for a species if it was positive for any strain from that species. For viral strains which had partial proteomes, the inventors grouped them with other strains from the same species to form a complete set and bioinformatically eliminated homologous peptides. A threshold number of hits per virus was set based on the size of the virus. It was found that there is approximately a power-law relationship between size of the vims and the average number of hits per sample (FIG. 10).
- the inventors To bioinformatically remove cross-reactive antibodies, the inventors first sorted the viruses by total number of hits in descending order. The inventors then iterated through each virus in this order. For each vims, the inventors iterated through each peptide hit. If the hit shared a subsequence of at least 7 aa with any hit previously observed in any of the virases from that sample, that hit was considered to be from a cross-reactive antibody and would be ignored for that virus. Otherwise, the hit is considered to be specific and the score for that vims is incremented by one. In this way, the inventors summed only the peptide hits that do not share any linear epitopes. The inventors compared the final score for each virus to the threshold for that virus to determine whether the sample is positive for exposure to that virus
- Fisher's exact test was first used to calculate a -value for the significance of association of virus exposure with one population versus another. Then, the inventors constructed a null-distribution of Fisher's exact p-vaiues by randomly permuting the sample labels 1000 times and re-calculating the Fisher's exact p-value for each virus. Using this null-distribution, the false discovery rate was calculated by dividing the number of permutation p-values more extreme than the one observed by the total number of permutations.
- JEDB epitope overlap analysis The inventors downloaded data for all continuous human B cell epitopes from IEDB and filtered out all non-viral epitopes (22). To avoid redundancy in these 4,549 viral epitopes, the inventors grouped together epitopes that share a 7 aa subsequence, yielding 1 ,877 non-redundant epitope groups. Of these groups, 1 ,715 contain a member epitope that is also a subsequence of a peptide in the VirScan library. This represents the total number of epitopes that could be detected by VirScan.
- the inventors To determine the number of epitopes detected, the inventors tallied the number of epitope groups with at least one member that is contained in a peptide that was enriched in one or two samples. Finally, to determine the number of non-redundant new epitopes detected, the inventors grouped non-IEDB epitopes containing peptides that share a 7 residues subsequence and counted the number of these non-redundant peptide groups.
- Scanning mutagenesis data analysis First, the inventors estimated the fractional abundance of each peptide by dividing the numbe of reads for that peptide by the total number of reads for the sample. Then, the inventors divided the fractional abundance of each peptide after immunoprecipitation by the fractional abundance before immunoprecipitation to get the enrichment. To calculate relative enrichment, the inventors divided enrichment of the mutated peptide by enrichment of the wild-type peptide.
- the inventors averaged enrichment of the wild-type peptide enrichment with enrichment of single-mutant peptides in the middle two quartiles to get a better estimate of the wild-type peptide enrichment.
- Table 4 Provided herein in Table 4 are exemplary peptides from a plurality of viruses and viral families that can bind antibodies generated by a subject in response to the virus. That is, the peptides described in Table 4 act as epitopes for antibodies present in a biological sample, permitting the detection and/or identification of antibodies generated against a particular vims or plurality of vi rases.
- the exemplary peptides in Table 4 represent high confidence peptides containing epitopes that were found. There are -5000 peptides, representing approximately 2000 epitopes with many variants of related peptides for viruses in a given family.
- a display library can comprise at least 2 peptides from Table 4, in any desired combination.
- the display library can comprise at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1000, at least 2000, at least 3000, at least 4000, at least 5000 peptides or more as selected from Table 4, in any desired combination.
- the display library comprises all of the peptides in Table 4.
- the display library can comprise peptides from at least 1 family (e.g., human herpesvirus) or sub-family (e.g., human herpesvirus 5) of related viruses.
- the display library can be a "human herpesvirus" display library that would yield information regarding the virus or plurality of viruses a subject has been exposed to that are within the herpesvirus family. Such embodiments are particularly useful for determining the sub-type of a particular herpesvirus that a subject has been exposed to.
- the display library can comprise peptides from e.g., a single subtype of virus, such as the human herpesvirus serotype 5. This approach is particularly useful when a high sensitivity test is required since multiple epitopes for a given subtype of vims can be reflected in a relatively small sample.
- a single peptide can be derived from each family of virases from e.g., Table 4.
- This type of display library can be useful as a crude screen to determ ine the family of virases to which the subject has been exposed.
- the display library can comprise peptides from at least 2 families, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 peptides from at least I family (e.g., human herpesvirus) or sub-family (e.g., human herpesvirus 5) of viruses from Table 4 (e.g., at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 viral families or subtypes), in any desired combination.
- the display library comprises peptides from each
- the display library comprises all of the peptides listed in Table 4.
- This embodiment provides an assay of high sensitivity since it is representative of a variety of epitopes from each vims and also efficiency as it can be a high throughput means to detect the subject's exposure to a very large number of viruses in a variety of families.
- Example 8 Application of the platform to non-viral antigens
- the platform has been expanded to the detection of antibodies against a variety of non-viral pathogens and antigens of interest. Specifically, a library was generated that tiles across the complete proteomes of 6 bacterial species in 56 amino acid fragments with 28 amino acid overlap. Immunoprecipitation of this library with patient serum provides genome-wide mapping of antibacterial antibodies.
- FIG. 20 shows the Chlamydia trachomatis proteins enriched by antibodies from 12 human donors. This experiment revealed known and novel antigenic proteins and demonstrated that this platform can be applied to detect anti-bacterial antibodies on a genome-wide scale.
- the technology is further applied to characterize the antibody response against 571 protein antigens of interest in parallel, including common allergens, antigens from bacteria, and antigens from other pathogens. It was possible to detect and map the antibody responses to these various classes of antigens as shown for Pneumococcal histidine triad protein D (FIG. 21), Triticum aestivum (Wheat) glutenin (FIG. 22), and Bos taurus (Bovine) Kappa-casein (FIG. 23). These results demonstrate thai our technology can be used to profile a broad range of non-viral antibody responses simultaneously.
- Example 9 Detection of vaccine-induced antibodies and the measurement of antibody levels over time
- the VirScan platform was used to longitudinally profile the anti-viral antibodies in a cohort of children from the time of birth to around the age of three.
- the inventors were able to measure the persistence of maternal antibodies, time the first exposure to various viruses, and detect vaccine -induced antibodies to Measles and Rubella (FIG. 24).
- the numbers expressing quantities of ingredients, properties such as concentration, reaction conditions, and so forth, used to describe and claim certain embodiments of the invention are to be understood as being modified in some instances by the term " 'about.' 1 Accordingly, in some embodiments, the numerical parameters set forth in the written description and attached claims are approximations that can vary depending upon the desired properties sought to be obtained by a particular embodiment. In some embodiments, the numerical parameters should be construed in light of the number of reported Significant digits and by applying ordinary rounding techniques. Notwithstanding that the numerical ranges and parameters setting forth the broad scope of some embodiments of the in v ention are approximations, the numerical values set forth in the specific examples are reported as precisely as practicable. The numerical values presented in some embodiments of the invention may contain certain errors necessarily resulting from the standard deviation found in their respective testing measurements.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Wood Science & Technology (AREA)
- Biophysics (AREA)
- Crystallography & Structural Chemistry (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Virology (AREA)
- Microbiology (AREA)
- Medicinal Chemistry (AREA)
- Immunology (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Botany (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Gastroenterology & Hepatology (AREA)
- Peptides Or Proteins (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Description
Claims
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201662288011P | 2016-01-28 | 2016-01-28 | |
| PCT/US2017/015411 WO2017132550A1 (en) | 2016-01-28 | 2017-01-27 | Detection of an antibody against a pathogen |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| EP3408284A1 true EP3408284A1 (en) | 2018-12-05 |
| EP3408284A4 EP3408284A4 (en) | 2019-08-14 |
Family
ID=59398939
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP17744999.8A Withdrawn EP3408284A4 (en) | 2016-01-28 | 2017-01-27 | DETECTION OF ANTIBODY DIRECTED AGAINST A PATHOGENIC AGENT |
Country Status (3)
| Country | Link |
|---|---|
| US (2) | US20190055545A1 (en) |
| EP (1) | EP3408284A4 (en) |
| WO (1) | WO2017132550A1 (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113046328A (en) * | 2021-04-13 | 2021-06-29 | 吉林大学 | Cryptobacterium pyogenes bacteriophage and medical application thereof |
| CN114230642A (en) * | 2021-10-28 | 2022-03-25 | 扬州大学 | Polypeptide for distinguishing H7N9 subtype avian influenza virus infection from immune animals and detection method |
Families Citing this family (16)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016179099A1 (en) | 2015-05-04 | 2016-11-10 | Epivax, Inc. | Modified h7 hemagluttinin glycoprotein of the influenza a/shanghai/2/2013 h7 sequence |
| WO2019074940A1 (en) * | 2017-10-09 | 2019-04-18 | Healthtell Inc. | Integrated platform for target and specificity information-derived binding partner selection |
| US11773143B2 (en) * | 2017-10-13 | 2023-10-03 | Trellis Bioscience, Llc | Conformational epitopes in respiratory syncytial virus G protein central conserved region |
| EP3833677A4 (en) | 2018-08-08 | 2022-04-27 | Trellis Bioscience, Inc. | IMPROVED PASSIVE AND ACTIVE VACCINES AGAINST RSV |
| WO2020180700A1 (en) * | 2019-03-01 | 2020-09-10 | Fred Hutchinson Cancer Research Center | Protein residue mapping using a combination of deep mutational scanning and phage display high throughput sequencing |
| WO2020243485A1 (en) * | 2019-05-29 | 2020-12-03 | Massachusetts Institute Of Technology | Hiv-1 specific immunogen compositions and methods of use |
| CN114761576B (en) * | 2019-10-11 | 2025-02-18 | 美国政府(由卫生和人类服务部的部长所代表) | Viral exposure signature for early detection of hepatocellular carcinoma |
| WO2021152586A1 (en) | 2020-01-30 | 2021-08-05 | Yeda Research And Development Co. Ltd. | Methods of analyzing microbiome, immunoglobulin profile and physiological state |
| WO2021214766A1 (en) * | 2020-04-21 | 2021-10-28 | Yeda Research And Development Co. Ltd. | Methods of diagnosing viral infections and vaccines thereto |
| US20240027453A1 (en) * | 2020-07-28 | 2024-01-25 | The Trustees Of Princeton University | Method for detection and quantitative monitoring of infections with herpesviruses |
| US11403316B2 (en) | 2020-11-23 | 2022-08-02 | Peptilogics, Inc. | Generating enhanced graphical user interfaces for presentation of anti-infective design spaces for selecting drug candidates |
| WO2022140655A1 (en) * | 2020-12-23 | 2022-06-30 | The Trustees Of Columbia University In The City Of New York | Single-molecule electronic multiplex nanopore immunoassays for biomarker detection |
| EP4378951A4 (en) * | 2021-07-26 | 2025-10-15 | Beijing Wantai Biological Pharmacy Co Ltd | Epitope polypeptide with general affinity for human rhinovirus, antibodies and uses thereof |
| CN115093466B (en) * | 2022-06-06 | 2024-11-15 | 哈尔滨医科大学 | A polypeptide inhibitor of group B coxsackievirus and its preparation method and application |
| US20260104424A1 (en) * | 2022-08-06 | 2026-04-16 | The Johns Hopkins University | Methods, systems and kits for identifying bioactive compounds and therapeutic methods and compositions |
| EP4679092A1 (en) * | 2024-07-08 | 2026-01-14 | Charité - Universitätsmedizin Berlin | Biomarkers for herpes-simplex virus autoimmunity |
Family Cites Families (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5492807A (en) | 1993-11-19 | 1996-02-20 | Santi; Daniel V. | Method of obtaining diagnostic reagents, assays and therapeutics based on clinical manifestations of a disease |
| WO1999033969A1 (en) | 1997-12-31 | 1999-07-08 | Pincus Seth H | A method of isolating a peptide which immunologically mimics microbial carbohydrates including group b streptococcal carbohydrates and the use thereof in a vaccine |
| US7033748B2 (en) | 1999-08-06 | 2006-04-25 | Ivigene Corporation | Identification of microbial polynucleotides expressed during infection of a host |
| US7803913B2 (en) * | 2002-05-06 | 2010-09-28 | The United States Of America As Represented By The Department Of Health And Human Services | Identification of novel broadly cross-reactive neutralizing human monoclonal antibodies using sequential antigen panning of phage display libraries |
| BR112012016305A2 (en) * | 2009-12-31 | 2017-05-02 | Stc Unm | "Plasmids and methods for peptide display and affinity selection in rna bacteriophage virus-like particles" |
| US20130149336A1 (en) | 2011-10-27 | 2013-06-13 | Brian L. Hjelle | Methods for Screening Viral Like Particles and Identifying Neutralizing Epitopes and Related Vaccines, Constructs, and Libraries |
| EP3083700B1 (en) * | 2013-12-17 | 2023-10-11 | The Brigham and Women's Hospital, Inc. | Detection of an antibody against a pathogen |
-
2017
- 2017-01-27 US US16/073,716 patent/US20190055545A1/en not_active Abandoned
- 2017-01-27 WO PCT/US2017/015411 patent/WO2017132550A1/en not_active Ceased
- 2017-01-27 EP EP17744999.8A patent/EP3408284A4/en not_active Withdrawn
-
2022
- 2022-01-25 US US17/583,947 patent/US12601088B2/en active Active
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113046328A (en) * | 2021-04-13 | 2021-06-29 | 吉林大学 | Cryptobacterium pyogenes bacteriophage and medical application thereof |
| CN113046328B (en) * | 2021-04-13 | 2023-07-25 | 吉林大学 | A Cryptobacterium pyogenes Phage and Its Medical Application |
| CN114230642A (en) * | 2021-10-28 | 2022-03-25 | 扬州大学 | Polypeptide for distinguishing H7N9 subtype avian influenza virus infection from immune animals and detection method |
Also Published As
| Publication number | Publication date |
|---|---|
| US12601088B2 (en) | 2026-04-14 |
| WO2017132550A1 (en) | 2017-08-03 |
| EP3408284A4 (en) | 2019-08-14 |
| US20190055545A1 (en) | 2019-02-21 |
| US20220251541A1 (en) | 2022-08-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US12601088B2 (en) | Detection of an antibody against a pathogen | |
| US11821110B2 (en) | Detection of an antibody against a pathogen | |
| Barzon et al. | Next-generation sequencing technologies in diagnostic virology | |
| Liu et al. | Sensitive and rapid diagnosis of respiratory virus coinfection using a microfluidic chip‐powered CRISPR/Cas12a system | |
| Sindhuja et al. | A review on PCR and POC-PCR-a boon in the diagnosis of COVID-19 | |
| Klenner et al. | Comparing viral metagenomic extraction methods | |
| Stellrecht et al. | Effect of genomic drift of influenza PCR tests | |
| Davis et al. | Hepatitis E virus: whole genome sequencing as a new tool for understanding HEV epidemiology and phenotypes | |
| Quan et al. | Rapid sequence-based diagnosis of viral infection | |
| Lu et al. | Quantitative real-time PCR assays for detection and type-specific identification of the endemic species C human adenoviruses | |
| Warneford-Thomson et al. | A LAMP sequencing approach for high-throughput co-detection of SARS-CoV-2 and influenza virus in human saliva | |
| Alsaleh et al. | A retrospective performance evaluation of an adenovirus real‐time PCR assay | |
| Kwon et al. | A point‐of‐care diagnostic system to influenza viruses using chip‐based ultra‐fast PCR | |
| WO2022182837A1 (en) | Devices and methods for rapid nucleic acid preparation and detection | |
| Kabir | Molecular methods for detection of pathogenic viruses of respiratory tract—A review | |
| Mora et al. | A one-pot RT-LAMP diagnostic assay for SARS-CoV-2 from saliva samples | |
| Uhteg et al. | Coronavirus detection in the clinical microbiology laboratory: Are we ready for identifying and diagnosing a novel virus? | |
| US8216810B2 (en) | Multiplex systems, methods, and kits for detecting and identifying nucleic acids | |
| Tao et al. | Broad-range virus detection and discovery using microfluidic PCR coupled with high-throughput sequencing | |
| Lee et al. | M‐specific reverse transcription loop‐mediated isothermal amplification for detection of pandemic (H1N1) 2009 virus | |
| Chaqroun et al. | Optimized protocol for direct extraction of SARS-CoV-2 RNA from raw wastewater samples (ANRS 0160) | |
| Meneguzzi | Development and Application of a Probe-Based Viral Target Enrichment and Long-Read Sequencing Workflow for Enhanced Characterization and Surveillance of Swine Viral Pathogens | |
| Lee et al. | Development of a Multiplex One-step RT-qPCR Diagnostic Test for SARS-CoV-2 Using a Portable Biomeme Thermocycler | |
| Lopera et al. | Development and evaluation of next-generation sequencing standards for virome research | |
| Kean et al. | A snapshot of the UK blood donor plasma virome: a retrospective cross-sectional cohort study |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE |
|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE |
|
| 17P | Request for examination filed |
Effective date: 20180828 |
|
| AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR |
|
| AX | Request for extension of the european patent |
Extension state: BA ME |
|
| RIN1 | Information on inventor provided before grant (corrected) |
Inventor name: KULA, TOMASZ Inventor name: XU, GEORGE Inventor name: ELLEDGE, STEPHEN J. Inventor name: LARMAN, HARRY B. |
|
| DAV | Request for validation of the european patent (deleted) | ||
| DAX | Request for extension of the european patent (deleted) | ||
| A4 | Supplementary search report drawn up and despatched |
Effective date: 20190712 |
|
| RIC1 | Information provided on ipc code assigned before grant |
Ipc: C12N 15/10 20060101ALI20190708BHEP Ipc: C07K 14/415 20060101AFI20190708BHEP |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: EXAMINATION IS IN PROGRESS |
|
| 17Q | First examination report despatched |
Effective date: 20201120 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION HAS BEEN WITHDRAWN |
|
| 18W | Application withdrawn |
Effective date: 20240717 |